TWI363802B - Method for rapidly identifying bacteria and kit thereof - Google Patents

Description

1363802 IX. Description of the Invention: [Technical Field] The present invention relates to a method for identifying bacteria; in particular, the present invention relates to a method for identifying bacteria using a specific probe. [Prior Art]

The conventional microbial identification method is based on biochemical analysis. For example, methods for identifying food hygiene microorganisms include selective amplification of microorganisms of interest 'subsequently separated by different selective media, and a suspected colony on a selective agar plate is tested by a set of biochemical reactions to confirm kind. For example, 'lauric tryptone broth (LST) and EC broth are used to selectively amplify E. coli (Eic/zerzc/na α/ζ) in food samples, followed by Levron ( Suspected Escherichia coli was isolated on Levine's E. sinensis (L-EMB) agar medium (Hitchins, AD, 1995, ρρ· 4.01-4.29 In Bacteriological analytical manual, 8th ed. AOAC International, Gaithersburg, MD, USA). These suspicious colonies (center dark, with or without metallic luster) were confirmed by the following tests: Gram stain test, 〇 (〇) generation test, Voge-Poskauer (Voges-Poskauer) VP) and methyl red reaction compound formation test, citrate utilization test and gas production test of LST culture solution. This complete validation process may last for 4 days (Hitchins, A. D. et al., 1995). In addition to lengthy procedures and high costs, biochemical tests are difficult for a food microbiology laboratory to maintain a large set of media for confirming the test. It is estimated that the identification of baci Hus cereus, Escherichia coli (five scijericya, single branch fine 97654-940727.doc -6 - 8 Listeria monocytogenes, Pseudomonas aeruginosa aerwgz'woja ), suspicious colonies of Salmonella (heart/speaking/like), Staphylococcus aureus OMrew·?) and Vibrio parahaemolyticus (Κζ·ό/*ζ·σ /jara/mewo/yhcMi) require at least 50 mediums (Andrews, "W·Η· et al., 1995, ρρ· 5.01-5.20· In Bacteriological analytical manual, 8th ed. AOAC International, Gaithersburg, MD, USA; Bennette, RW and GA Lancette. 1995. pp. 12.01- 12.05. In Bacteriological analytical manual, 8th ed. AOAC International, Gaithersburg, MD, USA; Elliot, EL et al, 1995. pp. 9.01-9.27. In Bacteriological analytical manual, 8th ed. AOAC International, Gaithersburg, MD, USA; Hitchins, AD, et al., 1995; pp. 4.01 - 4.29. In Bacteriological analytical manual, 8th ed. AOAC International, Gaithersburg, MD, USA; Hitchins, AD 1995. pp. 10.01-10.13. In Bacteriological analytic Al manual, 8th ed. AOAC International, Gaithersburg, MD, USA; Rhodehamel, E. J, and SM Harmon. 1995. pp. 14.01 -14.08. In Bacteriological analytical manual, 8th ed. AOAC International, Gaithersburg, MD, USA; Covert, TC 1992. pp. 9-31-932. In RE Greenberg, LS Clesceri and AD Eaton (ed.). Standard methods for the examination of water and wastewater, 18th ed. American Public Health Association, Washington, DC) ° Many studies have reported using the polymerase chain reaction (PCR) to identify 97354-940727.doc 1363802

々 (or detect) various food microorganisms (Ferretti, R. et al., 2001. Appl.

Environ. Microbiol. 67: 977-978; Lee, C. Υ· et al., 1995. Appl. Environ. Microbiol. 61 : 1311-1317) » For PCR, different types of bacteria are often required to identify different types of bacteria and thermal cycling conditions. Therefore, a series of separate PCRs need to be performed in parallel or sequentially to identify different microorganisms. For a limited variety of microorganisms, multipiex pcr may be an effective method (Brasher, C. W. et al., 1998. Curr. Microbiol. 37: 101-107; Gilbert, C. et al., 2003. Mol. Cell . Probes 17 : 135-138). However, as the use of primers increases, so does the sensitivity, and the chance of false products formed by two unrelated primers increases. 23S rDNA has been used to develop a nucleotide array to identify bacteria in positive blood cultures (Anthony, R. M. et al., 2000. J. Clin. Microbiol. 38: 781-788). Cross-hybridization can be observed between many species due to the high homology of the gene in different bacteria. By using a variable region of 18s rDNA, a human (Wu, Ζ·荨人, 2003. Appl. Environ. Microbiol. 69: 5389-5397) developed 33 oligonucleotide probes by means of a seam Slot hybridization to detect a variety of airborne fungi. However, it has been found that many species hybridize to probes designed for a single species.

Volokhov et al. (Volokhov, D. et al., 2003. J. Clin. Microbiol. 4 1 · 4071 -4080) use a complex array of oligonucleotides to distinguish jejunum and Campylobacter (Cam, Campylobacter coli) Co/z·), Curvularia lunata (C/ari) and Campylobacter pupa (c, the oligonucleotide array contained according to 5 genes, 97354-940727.doc 1363802

Acinetobacter baumannii 1 baumannii) Acinetobacter aceti 5 calcoaceticus) Hemolysis immobilized rod _ (j ckeiohcier 1 haemolyticus) Acinetobacter rutae / wo force? ζ·) 1 Alcaligenes faecalis 1 Xylose oxidized region 〇4/ca%e«as 2 xylosoxidans) Aeromonas 1 Hydrophila) Aeromonas sinensis ·?οΖ?η·α) Bacillus amyloliquefaciens 1 10 11 5 1 1 1 2

Amyloliquefaciens) Bacillus circulans said (10)c/rcw/a/w) 2 Bacillus coagulans CSaczV/MS coflgMAms) 2 Bacillus licheniformis 2 BaciHus 丨icheniformis 2 Bacillus licheniformis aczY/MS wyco/iifes) 2 Bacillus megaterium 1 Bacillus licheniformis 1 Bacillus licheniformis 1 psychrophilus) Bacillus brevis pflc/Z/M·? pw/m'/ws) 2 Sphere Bacillus C^czY/w·? ip/zam'cw·?) 3 Bacillus stearothermophilus <3^ζ7/μ·5 1 stearothermophilus) Bacillus subtilis • swfti/"·?) 2 Bacillus thuringiensis Bacillus (5acz7 heart 4 thuringiensis) Burkholde Ha 1 cepacia Citrobacter freundii (CzYro6ac^er freundii) Differential bacterium (CzYrc^flcier 1 2 2 2 2 2 2 3 2 4 diversus) E. sinensis (_Ec/viw<i^e/A3 as rcfo) 2 Enterobacteriaceae acige aerogewes 1 Enterobacter aeruginosa 5 5 1 2 1 2 2 97354-940727.doc -20- 1363802

Agglomerans) Enterobacter cloacae c/oacfle) Escherichia b丨attae 3 Escherichia 5 fergusonii Escherichia 1 hermannii Escherichia 1 Hermannii Escherichia vidneHs) 3 Enterococcus sp.) 2 Gregulicatella adiacens {Granulicatella adiacens) Acid-producing Klebsiella (Klebsiella pneumoniae C^eiizW/α 1 pneumoniae) Listeria 3, Listeria monocytogenes 4 Listeria II, Listeria, 2 Listeria, 2 Listeria, 7 MicrococcMS sp. Monocytogenes (corpse / (10) (10) like 1 shigelloides) Proteus mirabilis 1 Common Proteobacteria (iVoiew · Pseudomonas 3 alcaligenes) Pseudomonas fluorescens 3 Mendoza Pseudomonas 2 mendocina) Pseudomonas aeruginosa (household from 2 pseudoalcaligenes) Pseudomonas putida (Psewcfomowas _ρΜίζ·ύ?α) 2 Pseudomonas pseudomonas stutzeri 1 Shigella Shigella Fushishi Shiga Shigella sojae, Aeromonas maltophilia 2 2 4 4 3 5 1 3 2 1 1 1 3 4 3 4 2 2 2 7 2 2 1 1 1 1 3 3 2 2 2 1 2 3 2 2 4 2 3 9 9 8 97354-940727.doc -21 - {Stenotrophomonas maltophilia) Ear Staphylococcus auricularis) Staphylococcus aureus caseolyticus) Staphylococcus aureus (51 tons?/2 less/ococcw·? cohnii) Staphylococcus aureus ("Stop/^/ococcM·? delphini" Staphylococcus epidermidis Epidermidis) Staphylococcus hominis Staphylococcus hominis (SVap/^ococcws intermedius, Staphylococcus aureus/ewiws) Staphylococcus saprophyticus) Staphylococcus aureus (5*t sc/mW) Staphylococcus simulans Staphylococcus simulans (Stop/^/ococcws xylosus) Staphylococcus aureus (6ϊα_ρ/ζ少/〇COCCMi warneri) Streptococcus agalactiae OSVre/^ococciw agalactiae) Streptococcus pyogenes GSVeptococcws Angiossus) O. coli OSYreptococcw·? Zjov&) Streptococcus mutans (*Sire/^ococcz« constellatus) Streptococcus mutans OSYre/^ococcM·? egwkws) E. coli (*Sire/?iocOCCW) i equisimilis) Staphylococcus aureus OSVre/^ococews m/treatment) Streptococcus mutans (•SVre/^ococcws mwtow) Streptococcus mutans 〇Sire_piococcw«s oroi/z··?) 97354-940727.doc -22- 1363802

Streptococcus pneumoniae 1 2 3 Streptococcus pyogenes (iSVreptococfMi pyogeMi) 1 1 Streptococcus mutans OSVrepiococcws 1 1 Streptococcus sanguis (<Sirintocoecw sflTigwz.wb) 1 1 Streptococcus mutans (51吟piococcM·? 1 Resolve Vibrio a ginolyticus 1 2 3 Vibrio campbellii 1 1 % strip, Vibrio carchariae 1 1 Vibrio cholerae ηοη-01 (e/20/erae non- Ol) 12 12 Vibrio damsela 1 1 River bacterium (WWoy/wWa/i·?) 1 1 Fructus sinensis ζ_) 1 2 3 Vibrio hoUisae 1 1 2 Vibrio harveyi (TzTjWo Z/an^yz') 1 3 4 Vibrio metschnikovif 1 1 Vibrio michaete (WiWo 1 1 minimal bacterium (wfm/cus) 1 2 3 black, beautiful orphan ( Vibrio nigrapulchritudo) 1 1 Vibrio orientalis 1 1 Vibrio orientalis (factory plus magic 1 1 2 Vibrio ^lendidus 1 1 Vibrio tubiashii 1 1 Vibrio vulnificus (factory) Visiting coffee vw/myicws) 2 29 31 Yersinia enterocolitica (rerWm'a enterocolitica) Total 1 1 555 a reference strain from The National Type Culture Collection (ATCC, Manassa, VA, USA) or the Taiwan Center for Conservation and Conservation of Biological Resources (BCRC, Hsinchu, Taiwan) obtained 0 6 non-reference strains isolated from food, environmental and clinical samples. c includes thirty-five Serotypes. Preparation of DNA. Boiler method as described by Vaneechoutte et al. (Vaneechoutte, M. et al. '1995. J. Clin. Microbiol. 33: 11-15) 97354-940727.doc -23- 1363802 Extraction. Briefly, a single colony of a simple culture was suspended in 50 μl of sterile water and then heated in a 100 ° C heater for 15 minutes. After centrifugation in a microcentrifuge (5,000 g centrifugation for 3 minutes), The supernatant containing the bacterial DNA was stored at -20 ° C until use.

Amplification of the ITS region and determination of nucleic acid sequences. The ITS region of the bacteria was amplified by PCR. Bacterial specificity universal primer 2F (5,-TTG TAC ACA CCG CCC GTC-3·, sequence identification number 21) and 6R (5'-GGG TTY CCC CRT TCR GAA ΑΤ-3· 'Y system C or T, R system A or G, sequence identification number 22) is used to amplify a DNA fragment containing an ITS region. The 51-terminus of the primer 2F is located at 1390 of the 16S rDNA, the 5th of the primer 6R, and the end of the primer is located at the 111 position downstream of the 23S rDNA (number of E. coli). PCR is performed with 5 microliters (1 to 5 Ng) of template DNA. The total reaction volume for performing PCR was 50 μl, which included 10 mM Tris-HCl (pH 8.3) ' 50 mM KC1 ' 1.5 mM MgCl 2 ' 0.8 mM deoxyribonucleic acid triphosphate (0.2 mM each), 1 μΜ 2F primer, 2 μΜ 6R primer and 1 DNA polymerase, and covered with 50 μl of mineral oil. PCR

The program consisted of the following __ description: 8 cycles of denaturation (94 ° C, 2 minutes), annealing (55 ° C, 1 minute) and extension (72 ° C, 1 minute), followed by 30 cycles of denaturation ( 94 ° C, 1 minute), annealing (60 ° C, 1 minute) and extension (72 ° C, 1 minute), the final extension step was carried out at 72 ° C for 3 minutes. For the preparation of the digoxigenin-labeled PCR product, the 5·-end of the reverse primer 6R (MDBio®, Taipei, Taiwan) was labeled with digoxin and digoxin-11 - dUTP (Roche®, Mannheim, Germany) ) was added to the PCR reaction mixture (final concentration was 10 μΜ). The DNA extracted from the yellow bacillus BCRC 12271 was used as a positive control. OmniGen Thermal Cycler (Hybaid® Co., Ltd., Middlesex, UK) 97354-940727.doc • 24·

1363802 is used to implement PCR.

For the strains that produced a single PCR product as shown in Figure 1, yellow Bacillus subtilis BCRC 12271, Salmonella typhimurium serotype BCRC 11490, and Pseudomonas aeruginosa ATCC 27853, directly from the 377 type sequencing system (Applied Biosystems®, Taipei, The amplicon was bidirectionally sequenced on Taiwan, and the BigDyeTM Terminator Cycle Sequencing kit (version 3.1, Applied Biosystems) was used for sequencing. For strains producing multiple PCR products (E. coli BCRC 15486, Listeria monocytogenes BCRC 14486, Salmonella serotype A paratyphoid BCRC 12949 and Vibrio parahaemolyticus BCRC 10806), under UV light The smallest fragment was cut from the stained agarose gel. DNA from the gel (approximately 300 mg per strain) was extracted and sequenced using a Gel-MTM gel extraction kit (Viogene®, Taipei, Taiwan). The size of the PCR product is between about 400 bp (Bacillus cereus) and 950 bp (Yellow bacillus).

The ITS region of one of the seven target microorganisms can also be amplified from the colonies grown on the selective medium by PCR. The selective medium used was as follows: mannitol-egg-polymyxin (MYP) agar medium for Bacillus licheniformis (Rhodehamel, EJ and S. M. Harmon. 1995.), for E. coli Eosin blue (L-EMB) agar medium (Hitchins, AD et al., 1995.), a gasified lithium phenylethanol cephalosporate oxime (LPM) agar medium for Listeria monocytogenes and Oxford Medium (OXA) (Hitchins, AD 1995.), Barium Sulfite (BS) agar medium for Salmonella, Xylose-Imino-deoxycholate (XLD) agar medium, and Hematoxylin and Eosin (HE) agar Medium 97354-940727.doc -25- 1363802 (Andrews, W. H_ et al., 1995.), Baird-Parker agar (BPA) medium for Staphylococcus aureus (Bennette, RW and GA) Lancette. 1995.), thiosulfate-citrate-biliary-sugar (TCBS) medium for Vibrio parahaemolyticus (Elliot, EL et al., 1995.) and modified M-PA for Pseudomonas aeruginosa Agar medium (Covert, TC 1992.).

Probe design. A strain-specific oligonucleotide probe that can be used for seven food microorganisms is designed based on the ITS region sequence. Sequence alignments were performed between the ITS region sequences obtained in this study and the existing ITS region sequences in GenBank. The PrettyBox instructions of the Wisconsin Genetics Computer Group (GCG) packaging software (10.3 '' Accelrys, Inc., San Diego, CA, USA) were used to create alignments of multiple ITS region sequences. After screening GenBank for homology with other bacteria and performing a preliminary hybridization test, 20 probes (MDBio®, Taipei, Taiwan) including two positive controls (designed according to the sequence of the ITS region of the yellow bacillus) were synthesized. Further evaluation. The probe is shown in Table 2

Table 2: Oligonucleotide probes used in the present invention Microbial probe code a Probe sequence σ-3·) Sequence identification number GenBank Accession number Bacillus bacillus BC2 AAAGTTTCCGTGTTTCGTT 1 AF267900 NCTC9620 BC4 TTGTTCAG CTGTTCATCAATATAAGTT 2 AF267900 Escherichia coli BCRC EC5 TCCGTGTTTCG ACGGCAAATTTGAAGAGG 3 AY684796b 15486 EC7 TTTTAACTACAT CTGTAGTGATTAAATAAAA 4 AY684796b Monocyte proliferation Lis LM2 AATACTTCAGA CTTCTCAGTATGTTTGTTCT 5 U44063 Phytophthora ATCC 49594 LM4 TCTCAGTATG ACTTCTCAGTATGTTTGTT 6 U44063 97354-940727.doc -26- 1363802 CTTCTC LM6 CATAGATAATTTATTATTT ATGACACAAGT 7 U44063 Monocytogenes Lis Patent coli BCRC LM5 TGGATGTATCATCGCTGAT ACGGAAAATCA 8 AY6847911 14846 Pseudomonas aeruginosa ATCC 27853 PA2 ATTGTTGGTGTGCTGCGTG ATCC 9 AY6847921 PA6 GAAGTAAGACTGAATGAT CTCTTTCACTGG 10 AY6847921 serotypes of Salmonella paratyphi BCRC SAL CTCAAAACTGACTTACGAG TCACGTTTG 11 AY6847931 12949 SAL3 TTAATATCTCAAAACTGAC TTACGAGTCAC 12 AY6847931 Salmonella serotype typhimurium BCRC 11490 SAL6 AAATTGAAACAC AGAACA ACGAAAG 13 AY6847941 SAL7 GAGTGTACCTGAAAGGGT TCACTGCG 14 AY6847941 aureus D46 SA4 ATAAAAGAAAACGTTTAG CAGACAATGAGT 15 U11773 aureus H11 SA5 CGTTTCCTGTAGGATGGAA ACATAGATTAA 16 U11784 Vibrio parahaemolyticus BCRC 10806 VP4 GTTTGTCTTTAAGACAAAC ACCAAAATAAC 17 AY6847951 VP6 ATTGATAGTTCACAAGCGC AAGCTTGTAGC 18 AY6847951 flavum BCRC 12271 PClc GCTGTATGACATCGTGAAT AGGGCATT 19 AY6847971 PC2c TTCTGACTTAAGATGTCGG AAGCGTTT 20 AY6847971

The a oligonucleotide probes are arranged on the array as shown in FIG. The bITS sequence was determined in this example. The e probes PC 1 and PC2 were used as positive controls. Production of oligonucleotide arrays. The array (5 x 8 mm) is produced at a time of 20. Trace dye solution (30% (v/v) glycerol, 40% (v/v) dimethyl sulfoxide, 1 mM ethylenediaminetetraacetic acid (EDTA, disodium salt), 0.15% (w/v) Bromophenol blue and 10 mM Tris-HCl, pH 7.5) Dilute the probe 1:1 (final concentration 5 μΜ) » Aspirate the probe solution into the well of a round bottom microtiter plate and then use an automated array machine (Wittech®, Taipei, Taiwan) The probe solution was spotted onto a positively charged nylon membrane (R〇che8) using a hard needle (500 micro 97154-940727.doc • 27·1363802 meters). The array 3 has 40 points, of which 8 points are used for the target bacteria, 2 for the positive control (the probe is designed according to the ITS region of the yellow bacillus), and 4 for the negative control (only the dye). In addition, the 5th _ end with digoxin (MDBi〇8) marked 6 Han introduced to the left hand of the membrane and the bottommost row - u points; this " points as the basis for positioning the parent probe ( figure 2). After all probes were applied, the nylon membrane was allowed to dry in air and the nylon membrane was exposed to a short wave uv (StrataHnker 1800, Stratagen®, La Jolla, CA) for 30 seconds. The nylon membrane was washed twice at room temperature to wash away the unbound oligonucleotide, and the washing solution was 〇5χ ssc (Bu SSC is 〇·ΐ5 M Naa plus 15% sodium citrate) 〇ι% ten Sodium dialkyl sulfate (SDS). The array was air dried and stored at room temperature for storage. Hybridization method. Unless otherwise indicated, hybridization procedures were performed at room temperature in a hybridization chamber (shake speed of 60 rpm). In addition to the wash buffer, most of the reagents used for hybridization use the reagents included in the DIG Nucleic Acid Detection kit (Roche®, catalog number 丨丨75〇4丨). Each array was hybridized in each well of a 24-well cell culture plate. Array in 1 ml of hybridization solution (5 χ ssc, 1% (w/v) blocker, 〇1% Ν_N-Iaurylsarcosine and 〇〇2% SDS) _ at 5〇〇c Prehybridization for 2 hours. The digoxigenin-labeled PCR product was heated in a boiling water bath for 5 minutes and then immediately cooled in an ice bath. One microliter of the denatured pcR product of the test organism and 10 microliters of the denatured PCR product of the positive control (amplified from yellow bacillus) were diluted with 5 ml of the mixed parent liquid and added to each well. Hybridize at 5 〇 for 9 〇 minutes. After removing the unhybridized PCR product, the array was washed in a milliliter of maleic acid (0.1 mM maleic acid, 〇·15 M Naa, pH 7 5). 4 97354-940727.doc -28- The reaction was blocked for 1 hour each time for 5 minutes, followed by a 1 ml blocking solution (1% (w/v) blocker diluted in maleic acid buffer). Then, the blocking solution was removed, and 5 ml of an alkaline phosphatase-conjugated goat anti-digoxigenin antibody (diluted 1:2500 in a blocking solution) was added to each well to carry out an i-hour antigen-antibody reaction. . After removing the unbound antibody, the array was washed 4 times for 5 minutes in a 丨ml wash solution (containing male 3% (v/v) Tween 2〇 maleic acid buffer).

This was followed by washing with 1 ml of assay buffer (0.1 M Tris-HCl, 0.15 M NaCl, pH 9.5) for 5 minutes. Finally, alkaline phosphatase substrate (nitrogen blue tetrazolium chloride/5_bromo-4·gas_3_°5丨哚 phosphoric acid mother liquor diluted 1:50 in assay buffer) was added to each well. 'Yes 37ΐ reaction (15 minutes to 1 hour after the start of the shaking reaction, the color development is clearly visible. Definition of positive reaction, sensitivity and specificity. When a strain and all probes and positive control probes designed for this species When (ρι&ρ2) was hybridized, the strain was identified as one of the seven target microorganisms (except Salmonella). For Salmonella, if it hybridized with two of the four probes (SAL, SAL3, SAL6, and SAL7) The test microorganism is a Salmonella strain. The sensitivity is defined as the number of strains of the positive hybridization reaction (true positive) divided by the total number of strains tested. The specificity is defined as the number of strains that are negative for the non-target microorganism (true negative). Divided by the total number of strains of the non-target species tested. If a strain hybridizes to a probe designed for a strain 'but the strain shows atypical colonies on the selective isolation target microorganism agar medium, the strain is considered to be Not belonging to the target strain. Nucleotide sequence accession number. Escherichia coli BCRC 15486, Listeria monocytogenes BCRC 14846, Pseudomonas aeruginosa ATCC 27853, 97354-940727.doc 1363802 Salmonella serotype A paratyphoid BCRC The ITS sequences of 12949, Salmonella serovar Typhimurium BCRC 11490, Vibrio parahaemolyticus BCRC 10806 and Yellow Bacillus BCRC 12271 were submitted to GenBank. The accession numbers are listed in Table 2: Table 3: Different bacteria and oligonucleotides immobilized on the array Glycoside probe hybridization results at a glance 48 2 4 3 3 9 4

Number of test strains: - Bacillus licheniformis 26 Bacillus licheniformis 2 Bacillus thuringiensis 4 Other bacteria (1 523 Escherichia coli, Escherichia coli, Shigella flexneri, Shigella flexneri Other bacteria*1 Pseudomonas aeruginosa 3 29 Other bacteria 0 526 Staphylococcus aureus 38 Staphylococcus aureus 2 Staphylococcus aureus 1 Staphylococcus epidermidis 2 Staphylococcus aureus 3 Other bacteria "1 509 Vibrio parahaemolyticus 43 Vibrio albicans 3 Vibrio harveyi 2 Vibrio harveyi 1 Vibrio mimicus 1 97354-940727.doc Probe code and selective agar hybridization results 3 Colony morphology on medium b

BC2 BC4 + + + + D + C + + T EC5 EC7 + + + + Ae + + A + + A + + A PA2 PA6 + + SA4 SA5 + + - + T - + - + - + VP4 VP6 + + + + A + + T + + A + + T 1363802

Other bacteria £) 505 Mononuclear cell proliferation Lis 40 Phytophthora innocuous Listeria 2 Harmful Listeria 2 Listeria elegans 1 Listeria elegans 1 Listeria monocytogenes 2 Wisteria Lis Phytophthora 4 Listeria 2 Other bacteria 6 501 Salmonella 23 Salmonella 9 Salmonella 8 Salmonella 11 Other bacteria 504 LM2 LM4 LM5 LM6

SAL SAL3 SAL6 SAL7

The T 3 probe sequence is shown in Table 2. *^ Typical colonies and morphology: Bacillus cerevisiae grown on MYP agar medium is pink with surrounding areas; the E. coli line growing on L-EMB agar medium is dark, with or without metallic luster; Listeria monocytogenes on LPM agar medium is bright blue or white; colonies of Listeria monocytogenes grown on OXA have a black halo; grown on modified M-PA agar medium Pseudomonas aeruginosa is flat, with a light outer edge and a brown to black green center; Salmonella brown, gray or black colonies grown on BS agar medium, with or without metallic luster, grown on HE agar medium Salmonella is blue-green to blue with or without a black center. Salmonella grown on XLD agar is pink with or without a black center. Staphylococcus aureus grown on BPA medium is gray or dark black, often with Light-colored edges; vibrio parahaemolyticus green or blue-green 97354-940727.doc -31 - 1363802 colonies grown on TCBS agar medium. e typical colonies. d Other bacteria listed in Table 1. e atypical colonies. Table 4: Efficacy of oligonucleotide arrays for identifying seven food and water hygienic microorganisms. Microbiological test for the number of strains with positive number of strains Sensitivity (%) Specificity (%) Target bacteria Non-target bacteria Target bacteria Non-target bacteria wax Bacillus 26 529 26 6 100 98.9 Escherichia coli 48 507 48 0 100 100 Listeria monocytogenes 40 515 40 2 100 99.6 Pseudomonas aeruginosa 29 526 29 0 100 100 Salmonella 51 504 51 0 100 100 Golden yellow grapes Cocci 40 515 38 0 95 100 Vibrio parahaemolyticus 43 512 43 3 100 99.4 Hybridization of Bacillus licheniformis with an oligonucleotide array. The 26 strains of Bacillus licheniformis tested were hybridized to probes BC2 and BC4 (Table 3). Two strains of Bacillus licheniformis and four strains of Bacillus thuringiensis were cross-hybridized to the two probes and produced a false positive reaction. Bacillus licheniformis and Bacillus thuringiensis produce a typical colony similar to Bacillus licheniformis on MYP agar medium (blushing pink, producing lethicinase) (Rhodehamel, E. J. and S. M. Harmon. 1995). However, 523 other bacteria (including 18 strains of Bacillus) did not cause cross-hybridization (Table 3). The sensitivity and specificity of the oligonucleotide arrays used to identify Bacillus licheniformis were 100% (26/26) and 98.9% (523/529), respectively (Table 4). Hybridization of E. coli with an oligonucleotide array. All 48 E. coli strains (including 3 serotypes 0157: H7) were crossed to the design of this strain.

97354-940727.doc -32- (D 1363802 needle EC5 and EC7 (Table 3). Total is divided into Escherichia coli, Shigella baumannii, Shigella flexneri and Shigella sojae The 14 strains were cross-hybridized into the probe milk and the broth. However, the 'four hybrids and the hybrid strain could not use the lactose on the TM agar medium. Therefore, only SARS (four) falling (colorless) was produced on the medium. The sensitivity (48/48) and specificity (5〇7/5〇7) of the E. coli oligonucleotide array were (10)% (Table 4).

Hybridization of Listeria monocytogenes with an oligo(4) array. All 40 strains of Listeria monocytogenes (4) were crossed to the four probes (LM2, LM4, LMS and LM6) designed to identify the species (Table 3). Listeria monocytogenes and Grignard's Listeria g were not hybridized to any of the four probes, 'L. striata, Listeria, and Listeria. Hybridization was performed on 2 of the 4 probes. Of the 4 strains of Listeria monocytogenes tested, 2 of them hybridized to the probe and produced a false positive reaction; however, the remaining 2 strains of Listeria monocytogenes only hybridized to the probes LM5 and LM6 ( Table 3) above. Listeria monocytogenes showed typical colonies on LpM and OXA agar media, and the colonies were bright blue and had black halos. The sensitivity and specificity of the nucleotide arrays used to identify Listeria monocytogenes were 1% (4〇/4〇) and 99.6% (513/515), respectively (Table 4). Hybridization of Pseudomonas aeruginosa with an oligonucleotide array. All 29 strains of Pseudomonas aeruginosa were identified on the probes PA2 and pA6 (Table 3) for the identification of this strain. 526 other bacteria including 6 strains (13 strains of Pseudomonas strains) were not hybridized to the probes PA2 and PA6. The sensitivity (29/29) and specificity (526/526) of the oligonucleotide array used to identify Pseudomonas aeruginosa were 1〇〇. /. (Table 4). 97354-940727.doc -33- 1363802 Hybridization of J. elegans with an oligonucleotide array. Four probes (SAL, SAL3, SAL6mAL7) were designed to identify Salmonella g (Table 2). The η strain of Salmonella strain was hybridized to 4 probes (Table 3). Of the remaining 28 strains of Salmonella, 9 of them hybridized to 3 probes (SAL, SAL3, and SAL6); 8 of them hybridized to the probes SAL and SAL3, and the U strain hybridized to the probe. And on SAL7 (Table 3). According to the definition of positive Salmonella reaction, all 51 strains (35 serotypes) of Salmonella tested by the hybridization test were positive. Sensitivity 1/51) and specificity (504/5 04) for the identification of Salmonella nucleotide arrays were 1% (Table 4). S. aureus was hybridized with an oligonucleotide array, and two probes (SA4 and SA5) were used to carry out the determination of S. aureus (Table 2). Of the 40 strains of S. aureus tested, 38 were simultaneously hybridized to two probes (Table 3). Two strains only hybridized to probe SA5 but not to SA4; therefore, the two strains were false negative by the hybrid test. Staphylococcus aureus (1 strain), Staphylococcus epidermidis (2 strains), and Staphylococcus aureus (3 strains) were crossed and hybridized to one of the two probes (SA5) (Table 3). The sensitivity and specificity of the oligonucleotide arrays used to identify S. aureus were 95% (38/40) and 1 〇〇〇/, respectively. (515/515) (Table 4). Hybridization of Vibrio parahaemolyticus with an oligonucleotide array. All 43 strains of Vibrio parahaemolyticus were hybridized to probes VP4 and VP6 (Table 3) designed to identify the species. 3 strains of Algae oxysporum were simultaneously hybridized to the two probes VP4 and VP6, but the strain of Vibrio alginolyticus was able to utilize sucrose (Elliot, EL et al., 1995; Farmer, JJ III et al. 2003), and atypical colonies (yellow colonies) were produced on TCBS agar medium. Three strains of Vibrio harveyi were also crossed and crossed to 97354-940727.doc -34· on both probes VP4 and VP6. Of the three strains of Vibrio harveyi, two strains were unable to utilize sucrose and produced typical green colonies on TCBS agar, while the third strain was able to utilize sucrose (Table 3). In addition, a minimal vibrio that does not utilize sucrose hybridizes to probes VP4 and VP6. Therefore, three Vibrio species (two strains of Vibrio harveyi and one strain of Vibrio mimicus) were identified as Vibrio parahaemolyticus. The sensitivity and specificity of the oligonucleotide arrays used to identify Vibrio parahaemolyticus were ι〇〇% (43/43) and 99.4% (509/512), respectively (Table 4). Hybridization of various microorganisms with oligonucleotide arrays. The array can be used to simultaneously identify several different target microorganisms that are separately grown on their respective selective media. As shown in Figure 2, two strains (Listeria monocytogenes and Vibrio parahaemolyticus), four strains (Bacillus cereus, Escherichia coli, mononuclear, 'Field cell proliferation Lister' Phytophthora and Staphylococcus aureus) or pCR products of 6 strains (C. sphaeroides, Escherichia coli, Pseudomonas aeruginosa, Listeria monocytogenes, Vibrio parahaemolyticus and Staphylococcus aureus), It can hybridize simultaneously to their respective probes on the array. The microorganisms grown on the selective agar medium are hybridized to the oligonucleotide array. Ten strains of each of the seven target microorganisms were subcultured on their respective selective media commonly used for their isolation. Regardless of whether the test strain was grown on non-selective media or on selective media, 'hybridization results showed no difference (data not shown) {> While embodiments of the invention have been illustrated and described, techniques of the art Personnel can still make various changes and improvements to them. The present invention is not intended to be limited to the scope of the invention, and all modifications may be made without departing from the spirit and scope of the invention. 97354-940727.doc 1363802 [Simplified illustration] Figure 1 Amplification of the bacterial ITS region and separation of the PCR product by 2% agarose gel electrophoresis. Μ Μ : 1 〇 0 oligonucleotide gradient molecules (100 bp ladder); 1: yellow bacillus BCRC 12271 ; 2 : Salmonella serotype thyroid paratyphoid BCRC 12949 ; 3 : Salmonella serotype typhoid BCRC 11490; 4 : E. coli BCRC 1 5486 ; 5 : Listeria monocytogenes BCRC 14846 ; 6 : Bacillus licheniformis BCRC 10250 ; 7 : Staphylococcus aureus BCRC 15299 ; 8 : Pseudomonas aeruginosa ATCC 27853 ; Vibrio hemolyticus BCRC 10806. Figure 2. Hybridization of a target to a non-target microorganism and an oligonucleotide array. The positions of the oligonucleotide probes are shown in the upper left array, and the sequences of the probes are shown in Table 2. Test strains are shown at the bottom of each array. PM: position mark (5·-end is labeled with digoxin-labeled lead 6R). PC1 and PC2: Positive control probes designed from the ITS region of the yellow bacillus. NC: Negative control (only traced dye). 97354-940727.doc • 36 1363802 <110>National Success University <120> Method and kit for rapid identification of bacteria <130>none<140> 094111409 <141> 2005-04-13 <160> 22 <170> Patentln version 3.2 <210> 1 <211> 27 <212> DNA <213>Labor<220><223>Probe<400> 1 aaagtttccg tgtttcgttt tgttcag

<211> 30 <212> DNA <213> Labor <220><223> Probe <400> 2 ctgttcatca alataagttt ccgtgtttcg <210> 3 <211> 30 <212> DNA <213>Labor<220><223>Probe<400> 3 acggcaaatt tgaagaggtt ttaactacat

<210> 4 <211> 30 <212>DNA <213>Labor<220><223> probe <400> 4 ctgtagtgat taaataaaaa atacttcaga <210> 5 <211> 30 <212&gt ; DNA <2I3> Labor <220><223> Probe <400> 5 cttctcagta tgtttgttct tctcagtatg

<210> 6 <211> 25 <212> DNA 97354-940727.doc 1363802 <213>manual<220><223>Probe<400> 6 acttctcagt atgtttgttc ttctc <210> 7 <;211> 30 <212> DNA <213> Labor <220><223> Probe <400> 7 catagataat ttattattta tgacacaagt <210> 8 <211> 30 <212> DNA <213> Artificial

<220><223> Probe <400> 8 tggatgtatc atcgctgata cggaaaatca <210> 9 <211> 23 <212> DNA <213> Labor <220><223> Probe <400> 9 attgttggtg tgctgcgtga tcc <210> 10 <2Π> 30 <212> DNA <213> Labor <220><223> Probe <400> 10 gaagtaagac tgaatgatct ctttcactgg <210> 11 <;211> 28 <212> DNA <213> Labor <220><223> Probe <400> 11 ctcaaaactg acttacgagt cacgtttg <210> 12 <211> 30 <212> DNA <213> Labor <220> 97354_940727.doc 1363802 <223>Probe<400> 12 ttaatatctc aaaactgact tacgagtcac <210> 13 <211> 25 <212> DNA <213> Labor <220> 223 > Probe <400> 13 aaattgaaac acagaacaac gaaag <210> 14 <211> 26 <212> DNA <213> Labor <220>

<223> Probe <400> 14 gagtgtacct gaaagggttc actgcg <210> 15 <211> 30 <212> DNA <213> Labor <220><223> Probe <400> 15 ataaaagaaa Acgtttagca gacaatgagt <210> 16 <211> 30 <212> DNA <213> Labor <220><223> Probe <400> 16 cgtttcctgt aggatggaaa catagatlaa <210> 17 <211> 30 <212> DNA <213> Labor <220><223> Probe <400> 17 gtttgtcttt aagacaaaca ccaaaataac <210> 18 <211> 30 <212> DNA <213>Labor<220><223> Probe <400> 18 97354-940727.doc 1363802 attgatagtt cacaagcgca agcttgtagc <210> 19 <211> 27 <212> DNA <213> Labor <220><223> Probe <400> 19 gctgtatgac atcgtgaata gggcatt <210> 20 <211> 27 <212> DNA <213> Labor <220><223> Probe <400> 20 ttctgactta agatgtcgga agcgttt

<210> 21 <211> 18 <212> DNA <213> Labor <220><223> Introduction <400> 21 ttgtacacac cgcccgtc <210> 22 <211> 20 <212> DNA <213> Labor <220><223> Initiative <220><221> Variation <222> (1)..(20) <223> y is c or t <220><;221>Variation<222> (1)..(20) <223> r is a or g <400> 22 gggttycccc rttcrgaaat 97354-940727.doc

Claims (1)

13.63802, the scope of patent application: the annual smelting (more) original 篦 0941 L--~ Chinese [S] · Wai. Touch Patent Application 1 (February 101) A probe hybridization sample in which an intergenic spacer region of bacteria 16S and 23S rDNA is isolated, the probe being selected from the group consisting of BC2 (SEQ ID NO: 1) , BC4 (sequence identification number 2), EC5 (sequence identification number 3), EC7 (sequence identification number 4), LM2 (sequence identification number 5), LM4 (sequence identification number 6), LM6 (sequence identification number 7), LM5 (Sequence Identification No. 8), PA2 (Sequence Identification Number 9), PA6 (Sequence Identification Number 1〇), SAL (Sequence Identification Number 11), SAL3 (Sequence Identification Number 12), SAL6 (Sequence Identification Number 13), SAL7 ( Sequence identification number 14), SA4 (sequence identification number 15), SA5 (sequence identification number 16), VP4 (sequence identification number 17), VP6 (sequence identification number 18), and their fully complementary sequences. 2) The method of claim 1, wherein: if the intergenic region is associated with BC2, BC4 or its fully complementary sequence, the parent is a Bacillus cereus; The spacer and EC5, EC7 or its fully complementary sequence heterozygous' will be identified as Escherichia coli; if the intergenic spacer is associated with LM2, LM4, LM6, LM5 or its fully complementary sequence , the sage is identified as Listeria monocytogenes; if the intergenic region hybridizes to PA2, PA6 or its fully complementary sequence, the bacterium is identified as Pseudomonas aeruginosa (Pseud〇) m(10)Μ aeruginosa); 97354-1010224 1363802 If the intergenic region hybridizes to SAL, SAL3, SAL6 and SAL7 for any two or its fully complementary sequences, the scorpion is identified as Salmonella spp.; The region is crossed with SA4, SA5 or its fully complementary sequence, and the bacterium is identified as Staphyl〇c〇ccus aureus; and if the intergenic region hybridizes to VP4, VP6 or its fully complementary sequence, The bacterium is identified as vibri〇 parahaemolyticus ° 3 _ as in the method of claim 1, wherein the sample is food or water. 4. The method of claim 1, wherein the gene spacer for separating the bacterial 16S and 23S rDNA in the sample is amplified by polymerase chain reaction prior to hybridization. 5. 8. 9. The method of claim 4, wherein the gene spacer for separating the bacteria i6s and 23S rDNA in the sample is amplified by a bacterial specific universal primer. The method of item 5, wherein the bacterial specific universal primer comprises 2F=sub (sequence number 2) and 6R (sequence identification number 22). Method for θ length term 6 'where the amplified gene spacer comprises BC2 BC4, EC5, EC7, LM2 'LM4, LM6, LM5, PA2, PA6, SAL, SAL3, SAL6, sal7, from 4, from 5 Hybridization with a probe of VP6 or its fully complementary sequence. For example, the method of claim 1, wherein the (etc.) probe is coated on a substrate. Ί 'where 4 hybrids are made by using -microarray into line 97354-1010224 13.63802. 10. The method of claim 1, further comprising a positive control step comprising the step of separating the genetic spacers of Xanthobacter flavus 16S and 23S rDNA from pci (SEQ ID NO: 19) and PC2 ( Sequence identification number 2〇) allows at least one probe to hybridize. 11. A kit for identifying bacteria in a sample, the kit comprising at least one probe selected from the group consisting of BC2 (SEQ ID NO: 1), BC4 (SEQ ID NO: 2) , EC5 (sequence identification number 3), EC7 (sequence identification number 4), LM2 (sequence identification number 5), LM4 (sequence identification number 6), lM6 (sequence identification number 7), LM5 (sequence identification number 8), PA2 (sequence identification number 9), PA6 (sequence identification number 10), SAL (sequence identification number 丨1), SAL3 (sequence identification number 12), SAL6 (sequence identification number 13), SAL7 (sequence identification number 14), S A4 (Sequence Identification Number 15), S A5 (Sequence Identification Number 16), VP4 (Sequence Identification Number 17), VP6 (Sequence Identification Number 18), and their fully complementary sequences. 12 _ The set of claim 11, wherein the sample is food or water. 13. The kit of claim 11, further comprising reagents for obtaining a genetic spacer for separating the 16S and 23S rDNA of the bacteria. 14. The kit of claim 13 wherein the reagents are for polymerase bond reaction. 15. The set of claim 14 further comprising a bacterial specific universal primer. 16. The kit of claim 15, wherein the bacterial specific universal primer comprises a 97354-1010224 13.63502 2F primer (SEQ ID NO: 21) and a 6R primer (SEQ ID NO: 22). 17. The kit of claim 16, wherein the probes comprise BC2, BC4, EC5, EC7, LM2, LM4, LM6, LM5, PA2, PA6, SAL, SAL3, SAL6, SAL7, SA4, SA5, VP4 and VP6 or its fully complementary sequence. 18. The kit of claim 11, further comprising a reagent for hybridization. 19. A kit according to claim, wherein the probe is applied to a substrate. 20. The kit of claim 18, further comprising reagents for the use of a microarray of hybrids. 21. The kit of claim 11, further comprising a genetic spacer for separating the yellow bacillus 16S and 23S rDNA and at least one of PC1 (SEQ ID NO: 19) and PC2 (SEQ ID NO: 20). 97354-1010224