TWI359869B - Process for producing poly-unsaturated fatty acids - Google Patents

Description

1359869 IX. Description of the Invention: [Technical Field] The present invention provides a method for producing a new fatty acid in an oleaginous yeast, comprising: (丨) by selecting a D5-desaturase (D5-desaturase) , D6-desaturase (D6-deSatUrase), D12-desaturase (D-desaturase), D15-desaturase (D15-desaturase) and the enzyme gene of ephronase (e1 ongase) are introduced into yeast. Producing 'oil-producing yeasts; and (2) cultivating yeast in a medium containing a high content of carbon sources. « The present invention also provides the residue remaining after pressing the oleaginous yeast by the method of the present invention. The invention further provides fatty acids produced by the methods of the invention. The present invention further provides a fatty acid composition produced by the method of the present invention. [Prior Art]

D6-desaturase production of gamma linoleic acid (GLA) is described in U.S. Patent No. 5,552,306. U.S. Patent No. 5,376,541 is disclosed in U.S. Patent No. 5,376. The production of docosahexaenoic acid by dinoflagellates is described in U.S. Patent No. 5,407,957. The D6-palmitoyl_acyl carrier protein desaturase is described in PCT Publication No. WO 96/13591 and U.S. Patent No. 5,614,400. The selection of borage D6-desaturase is described in the pct publication w〇 96/21022. The selection of the D9-desaturase is described in the following published patent applications: pCT Bulletin w〇91/13972, Ep〇55〇162A1 'EP0 561 569 A2, EP0644 263A2, and EP0 736 598A1, and US Patent No. 5, 057, 419. The selection of D12-desaturase from various organisms is described in pCT Publication No. 94/11516 and U.S. Patent No. 5,443,974. The selection of 5 1359869 from various organisms D15-desaturase is described in PCT Bulletin 3/11245. By reference: all the announcements mentioned herein and the US patents or applications are fully combined. One of the limitations of using the parent-to-metabolic pathway to produce high value-added oils or fats is the lack of mono- or complex enzymes required for the final product of the carbon source filament. The production of oil by gene introduction of essential enzymes into wild-type transgenic plants that do not produce oil is a well-known technique. The attempt to achieve the same results in transgenic yeast has not been successful.

SUMMARY OF THE INVENTION The discovery of a cheap carbon source capable of growth using an oleaginous yeast strain, such as glucose, allows us to develop an unsaturated fatty acid that can express a foreign gene involved in fatty acid biosynthesis. The present invention provides a program for producing a new fatty acid in an oleaginous yeast, comprising: (1) by encoding a D5-desaturase, a D6-desaturase, a D12- An enzyme gene of a d12-desaturase, a D15-desaturase, and an elongase is introduced into a yeast to produce an oil-producing yeast; and (2) a cultured yeast is contained in a high concentration The medium containing the carbon source. Foreign genes (such as those from the D5-desaturase, D6-desaturase, D12-desaturase, D15-desaturase, and growth-chain enzymes) may be derived from other oil-producing yeasts Wild plants are selected or modified, or not found in oleaginous yeast at all. The term "oil-producing yeast" as used in the present invention refers to the following but not limited to the yeast:

Candida sp., Candida curvata D, Candida curvata R, Candida diddensiae,

Cryptococcus (tern col us) albidus var. albidus, Cryptococcus laurentu, Endomycopsis vernal is, Hansenula ciferri, Hansenula saturnus, Lipomyces lipofer, Lipomyces starkeyi, Lipomyces 6 1359869 tetrasporus, Rhodosporidium toruloides, Rhodotorula glutinis (gracilis), Rhodotorula gramims, Rhodo torula muci Laginosa, Tn chosporon cu tancum, Tnchosporon pullulans, Trigonopsis variables, Yarrowia lipolytica, and Yarrowia paralipolytica. In the winter invention method, the suitable oil-producing yeast is yaj 〇ifrj.a.

As suggested by these examples, the oleaginous yeast used in the present invention can exhibit foreign gene enzymes such as D5-depletion and enzymes 'D6-desaturase, D12-desaturase, D15-desaturase and growth carbon. Chain enzyme. Suitable enzymes for the production of oleaginous yeast are D6_desaturase and D12_* saturase. In a preferred embodiment of the invention, the sequence of the D6-desaturase is detailed in Figure 2. Introduction of D12-desaturase to oleaginous yeast increases downstream metabolite production (eg, linoleic acid, a-linolenic acid, and 71-linolenic acid)»D12 - The desaturase gene may be derived from oleaginous yeast or other organisms. In the process of the invention, the carbon source in the culture medium includes, but is not limited to, a six carbon sugar such as glucose, fructose, galactose, mannose or the like. One of the suitable six carbon sugars is glucose. In order to test the oil production of the oleaginous yeast, several strains were tested on several media. The strains tested were ATCC 8662, ATCC 20226, ATCC 48436 and polf (from LGMC, INRA-CNRS, CBAI, INAP-G, Thiverval Grignon, France). As a result, it was found that in a nutrient-rich medium such as YPD, z growth was determined but less oil was produced (results not shown here). K can produce large amounts of fat in a medium that limits nitrogen sources. Among all the culture media, the medium limiting the nitrogen source, for example, the yeast in 1/5 〇 YPD grew best. The ynb medium or the high salt medium recommended by Papanikolaou and Aggelis in 2002 was found to be unsuitable for fatty acid production (results not shown here). 7 1359869 Therefore, we conclude that a small fraction of YP (1/2~1/1〇〇〇) and high levels of glucose in the medium is sufficient to cause K to produce fat and at the same time the cost is low. Thus, the 'high content carbon source' in the process of the present invention is defined to be at least three times higher than the nitrogen source concentration. The results of fatty acid production from the above experiments are summarized in Table _. Table 1. Growth of yeast, production of oleic acid and linoleic acid in different media. — Growth fatty acid production oleic acid conversion to linoleic acid efficiency YL medium ++ ++ +++ YPD ++++ + + diluted YPD +++ ++++ ++ YNB wood + + 9η 9/10 YPD Add 1/10 YL +++ ++ ++ *YNB is a medium that utilizes the yeast nitrogen base as a nitrogen source.

The individual compression of the cotton gene to the oleaginous yeast may not be sufficient to extract the high value-added oil produced by the process of the invention. Therefore, the residue remaining after pressing the yeast containing some high value-added oil is industrially useful and may be used in feed, medicine, make-up or healthy food. Accordingly, the present invention also provides the residue remaining after pressing the oleaginous yeast obtained by the method of the present invention. The invention further provides fatty acids produced by the methods of the invention. In particular, the following groups include 7-linolenic acid (GLA), α-linolenic acid (ALA), dihomm〇-r-linolenic acid (dihommo-r-linolenic) Acid, DGLA), arachidonic acid (AA), eicosapentaenoic acid (EPA), adrenic acid, decosahexanoid acid (DHA) and Pino acid (pin〇ienic acid) fat 8 1359869 acid. The method of the present invention produces a more suitable fatty acid which is GLA, ALA or pinotonic acid. An additional oil selected from the group consisting of rice bran oil, sesame oil, fish oil, borage oil, evening primrose oil and blackcurrant seed oil can be added to the composition of the present invention as an additional benefit. [Examples] Example 1: Selection of D6-desaturase oleaginous yeast Ζ was found to produce LA but not under the metabolic pathway shown in Figure i

Travel fatty acids, such as GLA. The oleaginous yeast is found to lack the D6_desaturase, an essential enzyme for the conversion of linoleic acid (LA) to GLA by the negative stomach. Therefore, we managed to generate gene-transferred Z to produce gla by introducing recombinant plastids containing D6-desaturase CDNA sequences in γ " and /ca. The steps of the selection are detailed below: Gene synthesis of the dragon Delta 6 and Delta 12 desaturase 1. The double D6-desaturase cDNA sequence is present in the gene bank plus the desaturase cDNA sequence is shown in Figure 2. The primer sighs 4卩60 mer as a unit. Between the two units, the 2Q test pair is the space that is not overlapped.

3. Mix all the primers, the first row of the domain row _ aerospace. The first polymerase chain reaction product is used as a template to perform a second silk synthase chain reaction: a single step to polymerize the gene and a complete plastid derived from a large number of oligodeoxyribonucleotides. 4. Select the lean and sequencing polymerase chain reaction product and screen out the correct addition-desaturase and desaturase genes for further study. 9 1359869 The above steps are summarized as follows:

Example 2: Recombinant expression vectors PINA1311-D6 and pINA1311-D12 Table 2. Primer pairs of recombinant vectors. Introduction to the name of the primer Ϊ-S-D6F 5,- AATGGCTGCTGCTCCCAGTGTG -3, Delta*~6 forward primer D6R 5'- TTACTGCGCCTTACCCATCTTG -3, Delta-6 reverse primer D12F 5,- MTGGCACCTCCCAACACTATC -3' Delta-12 positive To the primer D12F 5,- TTACTTCTTGAAMAGACCAC -3' Delta-12 reverse primer 1. PINA1311-D6 vector recombinant PINA1311 vector (from LGMC, INRA-CNRS, CBAI, INAP-G, Thiverval Grignon, France, the carrier system details Said in Nicaud, Jean-Marc, FEMS Yeast research, 2:371-379, 2002) Hydrolysis with restriction enzyme pmii in ι〇〇μι Reaction buffer: IX NEBuffer I, 1 mM magnesium chloride, 20 yg pINC131 U Prall, 2 U test acidase (SAP) '37 °C '16 hours' using the acacia extract kit (vi〇gene) to obtain PINA1311. 10 1359869

The Delta -6 desaturase gene uses D6F and D6R as primers to proliferate pCR in 5 μμΐ of reaction buffer: 20 mM THS-HC1 (ρΗ 8.8 at 25. 〇, 1〇_ sulphuric acid, 1 〇 secret gasification _, 0.1% Triton Χ-100, 〇.丄mg/ml bovine albumin, 2 硫酸 硫酸 sulfate, 〇 4 primer pair, G.2 mM deoxynucleotide tri-acid, 2 5 u pfu Xinjiang polymerase (10) Fermentas), 55 ° C 30 sec - 68 ° C 2. 5 min - 68 ° C 7 min 95 ° C 5 min - 95 X 30 sec - 40 C t 30 cycles of purified Delta-6 PCR product (Acacia extract kit) 5, phosphorylation 5, in the reaction buffer of 1 :: IX Τ4 激梅 buffer, 1 _ adenine nucleoside tristearic acid, 4 〇 ^ i polymerase chain reaction product, 12. 5 U T4 kinase '37. (:, 16 hours. _ County gel extraction kit purification. In the conjugation reaction, the ratio of PINA1311: Delta-6 is 1:9 in 1〇μι of the ligation reaction buffer: 4G mM Tris-HQ, 1〇姗 Magnesium chloride, 1G _ dithiothreitol, 〇 5 mM adenine nucleoside tri-hybrid, 5% PEG4_, 3 u T4 ligase, 22 〇c, 3 〇 minutes. Take 5 μΐ of the junction product and with 1QQ Μΐ is suitable for cell mixing, the experimental steps of transformation are: 3 minutes ice bath - 45 seconds 42 X thermal shock ~ 3G minutes ice water bath. Cultured in 2 () ml (four) (including 25 / zg / ml Kangxiu) acacia medium The colony polymerase chain reaction was performed using D6R and i3ii_SF as primer pairs. The correct colonies were identified by sequencing. 2. PINA1311-D12 vector recombinant PINA1311 vector (from LGMC, INRA-CNRS, CBAI, INAP-G, Thiverval

Gngnon, a gift from France, detailed in this vector system by Nicaud, Jean Marc, research, 2:37 379, 2002), using restriction enzymes, hydrolysis, ιχ I, i chlorination, 20 μ PINC131, 20 U Pmll 2 u 瑕 鳞 鳞 鳞 ( (SAp), 37 1359869 C, 16 hours, using the acacia extract kit (Viogene) to obtain piNA1311. -12 desaturase was proliferated by pCR using D12F and D12R as primers, in 5 〇w reaction buffer: 20 _ Tris-HC1 (pH 8 8 at 25 χ), 1 〇遽 sulfuric acid, mM potassium hydride, 〇. i % Triton χ_1〇〇, 〇"mg/ml bovine serum albumin, 2 〇 _ sulfuric acid,

0.4 primer pair, 0.2 mM deoxyribonucleic acid, 2 5 u pfu leg polymerase (he I

Fermentas)>

' 95〇C 5 minutes 4 95Χ 30 seconds—55°C 30 seconds—68T 2. 5 minutes—68T 7 minutes. - 4〇C t__J 30 cycles of purified Delta-12 PCR product (cabbage extraction kit), phosphoric acid 5, the end in 1 〇〇 of the reaction buffer: IX Τ 4 kinase buffer, 1 adenine nucleoside triphosphate, 4 〇 from the 丨 polymerase chain reaction product, 12. 5 U Τ 4 激 腾 ' 37 Τ , 16 hours. Acacia gum extraction sleeve: purified. In the conjugation reaction, ΡΙΝΑ1311: Delta-12 ratio is 丨:9, in 10 μl of ligation reaction buffer: 40 mM Tris-Ηα, 10 secret magnesium, 10 secret dithiothreitol, _福. 5 Fu adenine nucleoside triphosphate, 5% PEG4000, 3 U T4 DNA ligase, 22 T, 30 knives. Take 5 μΐ of the conjugated product and mix it with 1 μ μ of competent cells. The experimental steps for the transformation are: . 30 minutes ice bath - 45 seconds 42. (: Thermal shock - 3 minutes ice bath. Cultured in the diaphragm LBKm (containing 25 yg / mi Kangmycin) acacia medium. The next day using D12R, 1311-SF as a primer pair to perform colony polymerase chain lock Reaction. The correct colonies were identified by the 131 1-sf and 1311-SR primer pairs. Example 3: Transformation of κ using the expression vectors PINA1311-D6 and piNAi3ii-Di2

Hpolytica.

Upolytica's review of 12 ammonium sulphate sodium sulphate BD mother acid sauerkraut a. material VN / yeast glu, spread bran aj culture j icGl a · 06 I1 ^.s % % base L 2 2 single step transformation Buffer __ PEG 50% 2M LiOAc 2M dithiothreitol single-stranded deoxyribonucleic acid (10 ~ 12K) Transformation step 1. Provoke some yeast (p〇lf) colonies. Dissolve in one milliliter of secondary water and shake for a few seconds. 2. Check the density of the cells under a microscope and adjust the cell density to 1~5 X 1〇7 / ml. 3. Each YPD medium was cultured in the same amount as ΙΟΟμΙ (Bu 5χ1〇6/culture medium at 28 °C for 20-24 hours. 4. Hydrolyzed pINA1311D6 and pINA1311D12 with restriction enzyme Notl. The final concentration was 〇. 2 Pg / μΐ 5. Scrap the cells from the medium with a toothpick and dissolve in one milliliter of secondary water. Calculate the cell density. 6. Spin about 5 x 107 cells (3 〇〇〇 g, 5 minutes). Discard. The supernatant is mixed with buffer:

90 uL 5 uL 5 uL 2.5 uL 5 uL PEG 50 %

LiOAc (2 Μ) dithiothreitol (2 Μ) single-stranded deoxyribonucleic acid (1〇Κ) restriction enzyme hydrolysis (linearized) carrier 13 1359869 7. Complete by shaking and mixing at 39 °C Water bath for one hour. 8. Culture on YNBD plus CG agar. Incubate at 28 °C or 30 °C. 9. A single set of vector transformation colonies will appear from the second to the third day. Its efficiency is about 1 〇 3-4 / microbial carrier. Example 4: Activity analysis of fat production and D6-desaturase The D6-desaturase was produced by the transformation of the carrier Pinal311-D6 into X polf to obtain the transformed J J/po/ytfca.

Cultivation and analysis of polf's PINA1311D6 and pINA1311D12 transformed strains 1. Randomly provoked transformants of PINA1311D6 and pINA1311D12. Cultivate and analyze twice. 2. A single colony of p〖NA1311D6 and pINA1311D12 transformed strains of p〇if was cultured at room temperature in a 5 mm ml flask containing 10 ml of YPD. Shake 2 rpm overnight. 3. Incubate 5 X 1〇7~1 X 1〇8 cells in 5 μl of modified γρ]) medium at room temperature (1/50 YP plus D in 250 ml triangular flask). Shake 2 rpm for 48 hours. 4_ knife analysis method. The enamel was extracted according to the experimental procedure of F〇lch et al., J Biol Chem, 226: 497-509, 1957. Lipid methylation was performed according to Morrison et al., J Lipid Res, 5: 600-608, 1964 or Metcalfe et al., Anal Chem, 38: 514-515, 1966. Gas chromatography (GG) analysis was carried out according to the following experiments: _ gas chromatography with a scorpion capillary and a quartz quartz capillary tube for the amount of cinnamic acid. The temperature of the injection and side is 23 °C. The fatty acid methyl ester was detected using a comparison of the standard and the highest point of the indwelling time of the sample. The results are summarized in the table below: $2. Culture and analysis of the pINA1311D6 transformed strain of polf.

The proportion of fats and oils (%) LA (linolenic acid, ci8: 2w6) in three 48.13 46.80 47.66 45.30 48.96 47.44 17.93 18.87 19.84 22.25 19.67 20.21 1359869

Proportion of acid glyceride (%) GLA (γ-linoleic acid, C18:3w6) Proportion (%) in triglyceride 1.71 1.77 0.29 0.24 0.26 0.29 D6 conversion rate (%) 8.69 8.57 1.44 1.07 1.30 1.44 Oleic acid Proportion in triglycerides (%) ratio of linoleic acid plus tau-linoleic acid in triglycerides (%) ratio of oleic acid plus linoleic acid plus 7 linoleic acid in triglycerides (%) 48.13 46.80 47.66 45.30 48.96 47.44 19.64 20.64 20.12 22.50 19.93 20.50 67. 77 67.44 67. 79 67. 79 68. 89 67. 94 D12 conversion rate (%) 28.98 30.60 29.69 33.18 28.93 30.18 Average conversion rate (%) Standard error 30.26 1.57 Table 4. Culture and analysis of the pINA1311D6 transition strain of polf. Sample No. D6-1 D6-2 D6 -3 D6-4 D6-5 D6-6 0A (oleic acid, C18: lw9) in triglyceride ratio (%) LA (linolenic acid, C18: 2w6 In the proportion of triglyceride (%) GLA (γ-linolenic acid, C18: 3w6) in the proportion of triglyceride (%) 46. 64 45. 62 47. 04 45. 01 47. 55 46. 63 18.89 19.82 20.47 22.54 21.11 21.09 1.78 1.82 0.27 0.23 0.28 0.27 D6 conversion rate (%) 8.63 8.43 1.30 0.99 1.29 1.25 ratio of oleic acid in triglyceride (%) linoleic acid plus T linoleic acid in triglyceride Medium ratio (%) oleic acid plus linoleic acid plus 7 linoleic acid in triglyceride ratio (%) 46. 64 45. 62 47. 04 45. 01 47. 55 46. 63 20.67 21.64 20.74 22.77 21.38 21.36 67. 31 67. 27 67. 77 67. 78 68. 93 67. 98 D12 conversion rate (%) 30.71 32.18 30.60 33.59 31.02 31.42 Average conversion rate (%) Standard error 31.59 1.14 Table V. Cultivation and analysis of polf's pINA1311D12 transformation Strain. Sample No. D12- 1 D12-2 D12 -3D12 -4D12- 5D12 -6 0A (oleic acid, C18: lw9) in triglyceride ratio (%) LA (linolenic acid, C18: 2w6) in three Proportion (%) of acid glycerides 41.95 42.66 42.43 39.77 42.48 41.63 27.33 25.45 25.58 29.13 27.37 26.89 15 1359869

Sample No. D12- 1 D12-2 D12 -3D12 -4D12- 5D12 -6 0A (oleic acid, C18: lw9) in triglyceride ratio (%) LA (linolenic acid, C18: 2w6) in three Proportion of acid glyceride (%) 44.42 43.91 45.15 42.93 43.87 43.51 25.25 24.68 23.55 25.62 25.39 24.89 D6 conversion rate (%) No oleic acid was detected in triglyceride (%) linoleic acid plus r-linolenic acid in Proportion of triglyceride (%) Ratio of oleic acid plus linoleic acid plus linoleic acid in triglyceride (%) ' 44.42 43.91 45.15 42.93 43.87 43.51 25.25 24.68 23.55 25.62 25.39 24.89 69.67 68.58 68.70 68.55 69.26 68.40 D12 conversion rate (%) 36.25 35.98 34.28 37.37 36.66 36.39 Average conversion rate (%) Standard error 36.15 1.04 The results show that in the diluted YPD medium, 大量 produces a large amount of fat. D6 conversion rate (%) No ratio of oleic acid in triglyceride was detected (%) Linoleic acid plus T linoleic acid in triglyceride ratio 〇〇 oleic acid plus linoleic acid plus 7* Proportion (%) of linoleic acid in triglycerides 41.95 42.66 42.43 39.77 42.48 41.63 27.33 25.45 25.58 29.13 27.37 26.89 69.28 68.10 68.01 68.89 69.85 68.52 D12 slew rate (%) Average slew rate (%) Standard error 39.45 37.36 37.61 42.28 39.18 39.25 39.19 1.76 Table 6. Culture and analysis of the PINA1311D12 transition strain of polf. After the calculation, the extracted yeast has a net weight of about 30 to 40% as fat, and 65 to 75% of the yeast is triglyceride. The activity of the D6-desaturase was measured by conversion of la to GLA. Compared with the control group, the D6-1 and D6-2 transformed strains showed significant activity (about 8 to 9% of LA was converted to GLA), whereas the control group had only 1. 0% to 1.5% of activity. There is variability in the D6 transition strain. The host strain polf (results not shown here) and the D12 transition strain showed no activity to detect D6-desaturase.

Claims (1)

1359869 Application No.: 094Π4555 The patent application is not underlined! • A method for producing linoleic acid (GLA) in the oil-producing yeast producing linoleic acid, comprising: (1) by SEQ ID NO: a gene-transformed yeast encoding a D6-desaturase (j) 6-desaturase to produce an oleaginous yeast; wherein the expression of the D6_desaturase gene is regulated by the hp4d promoter; and (2) cultivating the production The oil yeast is contained in a high-content carbon source medium containing a carbon source content of at least three times the concentration of the nitrogen source. 2. The method of claim 1, wherein the oleaginous yeast strain is selected from the group consisting of Candida sp., Candida curvata D, Candida curvata R, Candida diddensiae, Cryptococcus (t err i col us) albidus var, Albidus, Cryptococcus laurentii, Endomycopsis vernal is' Hansenula ciferri 'Hansenula saturnus'Lipomyces lipofer, Lipomyces starkeyi, Lipomyces tetrasporus, Rhodosporidium toruloides, Rhodotorula glutinis (gracilis), Rhodotorula graminis, Rhodotorula mucilaginosa 'Trichosporon cutancum, Trichosporon pullulans, Trigonopsis variables, Yarrowia lipolytica And Yarrowia paralipolytica. 3. According to the method of claim 2, wherein the oleaginous yeast is Yarrowia lipolytica. 4. The method of claim 1, wherein the carbon source is a hexasaccharide or a disaccharide. 5. According to the method of claim 4, wherein the hexasaccharide is glucose and the disaccharide is sucrose. 4. 4 1359869 XI, Figure 1 Schema D9-desaturase 18:0-► stearic acid D12-desaturase n-6 EFAs D15·desaturase 18:ln-9 ► Linoleic Acid 18:2n-6 oleic acid Gamma-Linolenic Acid (G LA) D6-desaturase 18:3n-6 Dihommo-Gamma Linolenic Acid (DGLA) ♦ 20:3n-6 Growth of carbon chain enzyme D5-desaturase Arachidonic Acid 20:4n-6 (AA)ψ Adrenic Acid 22:4n-6ψ 22:5n-6 Growth of carbon chain enzyme D4-desaturase n-3 EFAs 18:3n-3 Alpha-linolenic Acid (ALA) ψ 18:4n-3▼ 20:4n-3 ” Eicosapen- 20:5n-3 taenoic Acid (EPA) 22:5n- 3 Decosa- 22:6n-3 hexanoic Acid (DHA) 1359869 Figure 2 1 ATGGCTGCTG CTCCCAGTGT GAGGACGTTT ACTCGGGCCG AGGTTTTGAA TACCGACGAC GAGGGTCACA CTCCTGCAAA TGAGCCCGGC TCCAAAACTT 51 TGCCGAGGCT CTGAATGAGG GCAAGAAGGA TGCCGAGGCA CCCTTCTTGA ACGGCTCCGA GACTTACTCC CGTTCTTCCT ACGGCTCCGT GGGAAGAACT 101 TGATCATCGA CAACAAGGTG TACGATGTCC GCGAGTTCGT CCCTGATCAT ACTAGTAGCT GTTGTTCCAC ATGCTACAGG CGCTCAAGCA GGGACTAGTA 151 CC.CGGTGGAA GTGTGATTCT CACGCACGTT GGCAAGGACG GCACTGACGT GGGCCACCTT CACACTAAGA GTGCGTGCAA CCGTTCCTGC CGTGACTGCA 201 CTTTGACACT TTTCACCCCG AGGCTGCTTG GGAGACTCTT GCCAACTTTT GAAACTGTGA AAAGTGGGGC TCCGACGAAC CCTCTGAGAA CGGTTGAAAA 251 ACGTTGGTGA TATTGACGAG AGCGACCGCG ATATCAAGAA TGATGACTTT TGCAACCACT ATAACTGCTC TCGCTGGCGC TATAGTTCTT ACTACTGAAA 301 GCGGCCGAGG TCCGCAAGCT GCGTACCTTG TTCCAGTCTC TTGGTTACTA CGCCGGCTCC AGGCGTTCGA CGCATGGAAC AAGGTCAGAG AACCAATGAT 351 CGATTCTTCC AAGGCATACT ACGCCTTCAA GGTCTCGTTC AACCTCTGCA GCTAAGAAGG TTCCGTATGA TGCGGAAGTT CCAGAGCAAG TTGGAGACGT 401 TCTGGGGTTT GTCGACGGTC ATTGTGGCCA AGTGGGGCCA GACCTCGACC AGACCCCAAA CAGCTGCCAG TAACACCGG T TCACCCCGGT CTGGAGCTGG 451 CTCGCCAACG TGCTCTCGGC TGCGCTTTTG GGTCTGTTCT GGCAGCAGTG GAGCGGTTGC ACGAGAGCCG ACGCGAAAAC CCAGACAAGA CCGTCGTCAC 501 CGGATGGTTG GCTCACGACT TTTTGCATCA CCAGGTCTTC CAGGACCGTT GCCTACCAAC CGAGTGCTGA AAAACGTAGT GGTCCAGAAG GTCCTGGCAA 551 TCTGGGGTGA TCTTTTCGGC GCCTTCTTGG GAGGTGTCTG CCAGGGCTTC 2 1359869 AGACCCCACT AGAAAAGCCG CGGAAGAACC CTCCACAGAC GGTCCCGAAG 601 TCGTCCTCGT GGTGGAAGGA CAAGCACAAC ACTCACCACG CCGCCCCCAA AGCAGGAGCA CCACCTTCCT GTTCGTGTTG TGAGTGGTGC GGCGGGGGTT 651 CGTCCACGGC GAGGATCCCG ACATTGACAC CCACCCTCTG TTGACCTGGA GCAGGTGCCG CTCCTAGGGC TGTAACTGTG GGTGGGAGAC AACTGGACCT 701 GTGAGCATGC GTTGGAGATG TTCTCGGATG TCCCAGATGA GGAGCTGACC CACTCGTACG CAACCTCTAC AAGAGCCTAC AGGGTCTACT CCTCGACTGG 751 CGCATGTGGT CGCGTTTCAT GGTCCTGAAC CAGACCTGGT TTTACTTCCC GCGTACACCA GCGCAAAGTA CCAGGACTTG GTCTGGACCA AAATGAAGGG 801 CATTCTCTCG TTTGCCCGTC TCTCCTGGTG CCTCCAGTCC ATTCTCTTTG GTAAGAGAGC AAACGGGCAG AGAGGACCAC GGAGGTCAGG TAAGAGAAAC 851 TGCTGCCTAA CGGTCAGGCC CACAAGCCCT CGGGCGCGCG TGTGCCCATC ACGACGGATT GCCAGTCCGG GTGTTCGGGA GCCCGCGCGC ACACGGGTAG 901 TCGTTGGTCG AGCAGCTGTC GCTTGCGATG CACTGGACCT GGTACCTCGC AGCAACCAGC TCGTCGACAG CGAACGCTAC GTGACCTGGA CCATGGAGCG 951 CACCATGTTC CTGTTCATCA AGGATCCCGT CAACATGCTG GTGTACTTTT GTGGTACAAG GACAAGTAGT TCCTAGGGCA GTTGTACGAC CACATGAAAA 1001 TGGTGTCGCA GGCGGTGTGC GGAAAC TTGT TGGCGATCGT GTTCTCGCTC ACCACAGCGT CCGCCACACG CCTTTGAACA ACCGCTAGCA CAAGAGCGAG 1051 AACCACAACG GTATGCCTGT GATCTCGAAG GAGGAGGCGG TCGATATGGA TTGGTGTTGC CATACGGACA CTAGAGCTTC CTCCTCCGCC AGCTATACCT 1101 TTTCTTCACG AAGCAGATCA TCACGGGTCG TGATGTCCAC CCGGGTCTAT m 1359869 FIG 3 1 ATGGCACCTC CCAACACTAT CGATGCCGGT TTGACCCAGC GTCATATCAG TACCGTGGAG GGTTGTGATA GCTACGGCCA AACTGGGTCG CAGTATAGTC 51 CACCTCGGCC CCAAACTCGG CCAAGCCTGC CTTCGAGCGC AACTACCAGC GTGGAGCCGG GGTTTGAGCC GGTTCGGACG GAAGCTCGCG TTGATGGTCG 101 TCCCCGAGTT CACCATCAAG GAGATCCGAG AGTGCATCCC TGCCCACTGC AGGGGCTCAA GTGGTAGTTC CTCTAGGCTC TCACGTAGGG ACGGGTGACG 151 TTTGAGCGCT CCGGTCTCCG TGGTCTCTGC CACGTTGCCA TCGATCTGAC AAACTCGCGA GGCCAGAGGC ACCAGAGACG GTGCAACGGT AGCTAGACTG 201 TTGGGCGTCG CTCTTGTTCC TGGCTGCGAC CCAGATCGAC AAGTTTGAGA AACCCGCAGC GAGAACAAGG ACCGACGCTG GGTCTAGCTG TTCAAACTCT 251 ATCCCTTGAT CCGCTATTTG GCCTGGCCTG TTTACTGGAT CATGCAGGGT TAGGGAACTA GGCGATAAAC CGGACCGGAC AAATGACCTA GTACGTCCCA 301 ATTGTCTGCA CCGGTGTCTG GGTGCTGGCT CACGAGTGTG GTCATCAGTC TAACAGACGT GGCCACAGAC CCACGACCGA GTGCTCACAC CAGTAGTCAG 351 CTTCTCGACC TCCAAGACCC TCAACAACAC AGTTGGTTGG ATCTTGCACT GAAGAGCTGG AGGTTCTGGG AGTTGTTGTG TCAACCAACC TAGAACGTGA 401 CGATGCTCTT GGTCCCCTAC CACTCCTGGA GAATCTCGCA CTCGAAGCAC GCTACGAGAA CCAGGGGATG GTGAGGACCT CTTAGAGCGT GAGCTTCGTG 451 CACAAGGCCA CTGGCCATAT GACCAAGG AC CAGGTCTTTG TGCCCAAGAC GTGTTCCGGT GACCGGTATA CTGGTTCCTG GTCCAGA?\AC ACGGGTTCTG 501 CCGCTCCCAG GTTGGCTTGC CTCCCAAGGA GAACGCTGCT GCTGCCGTTC GGCGAGGGTC CAACCGAACG GAGGGTTCCT CTTGCGACGA CGACGGCAAG m 4 1359869 551 AGGAGGAGGA CATGTCCGTG CACCTGGATG AGGAGGCTCC CATTGTGACT TCCTCCTCCT GTACAGGCAC GTGGACCTAC TCCTCCGAGG GTAACACTGA 601 TTGTTCTGGA TGGTGATCCA GTTCTTGTTC GGATGGCCCG CGTACCTGAT AACAAGACCT ACCACTAGGT CAAGAACAAG CCTACCGGGC GCATGGACTA 651 TATGAACGCC TCTGGCCAAG ACTACGGCCG CTGGACCTCG CACTTCCACA ATACTTGCGG AGACCGGTTC TGATGCCGGC GACCTGGAGC GTGAAGGTGT 701 CGTACTCGCC CATCTTTGAG CCCCGCAACT TTTTCGACAT TATTATCTCG GCATGAGCGG GTAGAAACTC GGGGCGTTGA AAAAGCTGTA ATAATAGAGC 751 GACCTCGGTG TGTTGGCTGC CCTCGGTGCC CTGATCTATG CCTCCATGCA CTGGAGCCAC ACAACCGACG GGAGCCACGG GACTAGATAC GGAGGTACGT 801 GTTGTCGCTC TTGACCGTCA CCAAGTACTA TATTGTCCCC TACCTCTJTG CAACAGCGAG AACTGGCAGT GGTTCATGAT AT / VACAGGGG ATGGAGAAAC 851 TCAACTTTTG GTTGGTCCTG ATCACCTTCT TGCAGCACAC CGATCCCAAG AGTTGAAAAC CAACCAGGAC TAGTGGAAGA ACGTCGTGTG GCTAGGGTTC 901 CTGCCCCATT ACCGCGAGGG TGCCTGGAAT TTCCAGCGTG GAGCTCTTTG GACGGGGT7VA TGGCGCTCCC ACGGACCTTA AAGGTCGCAC CTCGAGAAAC 951 CACCGTTGAC CGCTCGTTTG GCAAGTTCTT GGACCATATG TTCCACGGCA GTGGCAACTG GCGAGCAAAC CGTTC AAGAA CCTGGTATAC AAGGTGCCGT 1001 TTGTCCACAC CCATGTGGCC CATCACTTGT TCTCGCAAAT GCCGTTCTAC AACAGGTGTG GGTACACCGG GTAGTGAACA AGAGCGTTTA CGGCAAGATG 1051 CATGCTGAGG AAGCTACCTA TCATCTCAAG AAACTGCTGG GAGAGTACTA GTACGACTCC TTCGATGGAT AGTAGAGTTC TTTGACGACC CTCTCATGAT 1101 TGTGTACGAC CCATCCCCGA TCGTCGTTGC GGTCTGGAGG TCGTTCCGTG ACACATGCTG GGTAGGGGCT AGCAGCAACG CCAGACCTCC AGCAAGGCAC 1359869 1151 AGTGCCGATT CGTGGAGGAT CAGGGAGACG TGGTCTTTTT CAAGAAGTAA TCACGGCTAA GCACCTCCTA GTCCCTCTGC ACCAGAAAAA GTTCTTCATT 1359869 FIG. 4 Delta 6 D6F1: 55- atggctgctgctcccagtgtgaggacgtttactcgggccgaggttttgaatgccgaggct-35 D6F2: 55 - tgccgaggcacccttcttgatgatcatcgacaacaaggtgtacgatgtccgcgagttcgt-3 D6F3:? 5gtgtgattctcacgcacgttggcaaggacggcactgacgtctttgacacttttcaccccg-35 D6F4: 55 - gccaacttttacgttggtgatattgacgagagcgaccgcgatatcaagaatgatgacttt-39 D6F5: 55 - gcgtaccttgttccagtctcttggttactacgattcttccaaggcatactacgccttcaa-35 D6F6: 5'- tctggggtttgtcgacggtcattgtggccaagtggggccagacctcgaccctcgccaacg-3 'D6F7: 5'- ggtctgttctggcagcagtgcggatggttggctcacgactttttgcatcaccaggtcttc- 3 'D6F8: 55 - tcttttcggcgccttcttgggaggtgtctgccagggcttctcgtcctcgtggtggaagga-39 D6F9: 59 - ccgcccccaacgtccacggcgaggatcccgacattgacacccaccctctgttgacctgga-35 D6F10: 59 - ttctcggatgtcccagatgaggagctgacccgcatgtggtcgcgtttcatggtcctgaac-35 D6F11: 55- cattctctcgtttgcccgtctctcctggtgcctccagtccattctctttgtgctgcctaa-3, D6F12: 5' - cgggcgcgcgtgtgcccatctcgttggtcgagcagctgtcgcttgcgatgcactggacct-3, D6F13: 55 - ctgttcatcaaggatcccgtcaacatgctggtgtactttttggtgtcgcaggcggtgtgc-35 D6F14: 5 ? - gttctcgctcaaccaca acggtatgcctgtgatctcgaaggaggaggcggtcgatatgga-35 D6F15: 55 - tcacgggtcgtgatgtccacccgggtctatttgccaactggttcacgggtggattgaact-35 D6F16: 59 - ttcccttcgatgcctcgccacaacttttcaaagatccagcctgctgtcgagaccctgtgc-39 D6F17:? 55 - ccacaccaccggtatgatcgagggaactgcagaggtctttagccgtctgaacgaggtctc-3 D6R1: 55- tcaagaagggtgcctcggcatccttcttgccctcattcagagcctcggcattcaaaacct-3, D6R2: 55 - aacgtgcgtgagaatcacacttccaccgggatgatcagggacgaactcgcggacatcgta-35 D6R3: 55 - tcaccaacgtaaaagttggcaagagtctcccaagcagcctcggggtgaaaagtgtcaaag-39 D6R4: 55 - gagactggaacaaggtacgcagcttgcggacctcggccgcaaagtcatcattcttgatat-35 7 1359869 D6R5: 55 - gaccgtcgacaaaccccagatgcagaggttgaacgagaccttgaaggcgtagtatgcctt-35 D6R6: 55 - cactgctgccagaacagacccaaaagcgcagccgagagcacgttggcgagggtcgaggtc-35 D6R7: 55 - ccaagaaggcgccgaaaagatcaccccagaaacggtcctggaagacctggtgatgcaaaa-35 D6R8 ·· 5 '- gccgtggacgttgggggcggcgtggtgagtgttgtgcttgtccttccaccacgaggacga-3' D6R9: 55 - tcatctgggacatccgagaacatctccaacgcatgctcactccaggtcaacagagggtgg-35 D6R10: 55- gacgggcaaacgagagaatggggaagtaaaaccaggtctggttcaggaccatgaaacgcg-3, D6R11: 5 ' · gatgggcacacgcgcgcccgagggcttgtgggcctgaccgttaggcagcacaaagagaat-3 'D6R12: 55- acgggatccttgatgaacaggaacatggtggcgaggtaccaggtccagtgcatcgcaagc-35 D6R13: 55 - cgttgtggttgagcgagaacacgatcgccaacaagtttccgcacaccgcctgcgacacca-35 D6R14: 55 - gtggacatcacgacccgtgatgatctgcttcgtgaagaaatccatatcgaccgcctcctc-31 D6R15: 55 - tggcgaggcatcgaagggaacaagtggtgctcgatctgatagttcaatccacccgtgaac-3 D6R16:? 5' - cgatcataccggtggtgtggtatcggacattgtactttttgcacagggtctcgacagcag-3 'D6R17: 5 ttactgcgccttacccatcttggaggcagccttggagacctcgttcagacggct-3' 1,359,869 FIG. 5 Delta D12F1: 5 - atggcacctcccaacactatcgatgccggtttgacccagcgtcatatcagcacctcggcc-3, D12F2:? 59 - cttcgagcgcaactaccagctccccgagttcaccatcaaggagatccgagagtgcatccc-33 D12F3:? 5 - ccggtctccgtggtctctgccacgttgccatcgatctgacttgggcgtcgctcttgttcc-35 D12F4: 5 '- aagtttgagaatcccttgatccgctatttggcctggcctgtttactggatcatgcagggt-3, D12F5: 5ggtgctggctcacgagtgtggtcatcagtccttctcgacctccaagaccctcaacaacac-35 D12F6: 5cgatgctcttggtcccctaccactcctggagaatctcgcactcgaagcaccacaaggcca-3 'D12F7: 5, - caggtctttgtgcccaagacccgctcccaggttggcttgcctcccaaggagaacgctgct-3, D12F8: 5' - catgtccgtgcacctggatgaggaggctcccattgtgactttgttctggatggtgatcca-3 'D12F9: 5' - cgtacctgattatgaacgcctctggccaagactacggccgctggacctcgcacttccaca_3 'D12F10: 55 - ccccgcaactttttcgacattattatctcggacctcggtgtgttggctgccctcggtgcc-35 D12F11: 59 - gttgtcgctcttgaccgtcaccaagtactatattgtcccctacctctttgtcaacttttg-35 ? D12F12: 59 - tgcagcacaccgatcccaagctgccccattaccgcgagggtgcctggaatttccagcgtg-3 D12F13: 59 - cgctcgtttggcaagttcttggaccatatgttccacggcattgtccacacccatgtggcc-35 D12F14: 59 - gccgttctaccatgctgaggaagctacctatcatctcaagaaactgctgggagagtacta-3 D12F15: 55 - tcgtcgttgcggtctggaggtcgttccgtgagtgccgattcgtggaggatcagggagacg-39 D12R1; 5, - gctggtagttgcgctcgaaggcaggcttggccgagtttggggccgaggtgctgatatgac-3, D12R2:? 55 - gcagagaccacggagaccggagcgctcaaagcagtgggcagggatgcactctcggatctc-35 D12R3: 55 - atcaagggattctcaaacttgtcgatctgggtcgcagccaggaacaagagcgacgcccaa-35 D12R4: 5 '- cacactcgtgagccagcacccagacaccggtgcagacaataccctgcatgatccagtaaa-3' D12R5: 55 - gtaggggaccaagagcatcgagtgcaagatccaaccaactgtgttgttgagggtcttgga-39 D12R6: 55- gtcttgggcacaaagacctggtccttggtcatatggccagtggccttgtggtgcttcgag-3, 9 1359869 D12R7: 55 - catccaggtgcacggacatgtcctcctcctgaacggcagcagcagcgttctccttgggag-35 D12R8: 55 - ggcgttcataatcaggtacgcgggccatccgaacaagaactggatcaccatccagaacaa-35 D12R9: 55- atgtcgaaaaagttgcggggctcaaagatgggcgagtacgtgtggaagtgcgaggtcca-35 D12R10: 55 - tgacggtcaagagcgacaactgcatggaggcatagatcagggcaccgagggcagccaaca-35 D12R11: 55- cttgggatcggtgtgctgcaagaaggtgatcaggaccaaccaaaagttgacaaagaggta-35 D12R12: 55 - aagaacttgccaaacgagcggtcaacggtgcaaagagctccacgctggaaattccaggca-35 D12R13: 55 - cctcagcatggtagaacggcatttgcgagaacaagtgatgggccacatgggtgtggacaa-3 ' D12R14:55 - cctccagaccgcaacgacgatcggggatgggtcgtacacatagtactctcccagcagttt-35 D12R15:55 - ttacttcttgaaaaagaccacgtctccctgatcctccacg-35 Rsi' 10 1359869 Ura3d1 Php4d 7^.\ά PINA1311D Hnnil] ΠρΙίΛ fi λ'/./ii i.-i〇fianlU i 15:·;-1 /ία//ϊ 11 ( i9r)H j } ΊΙ ' : r : Kpil Liptt ί: i'i T 7pta Kan R 1359869 · Fig. 7 Php4d Ura3d1 Dplta 1? V 7 pINA1311Dl 6380 bp Liptt T 7 Κλπ P I: