TWI339217B - - Google Patents

Description

1339217 V. Description of invention (1)

TECHNICAL FIELD OF THE INVENTION The present invention relates to a method for producing a P. bursii virus (181^)-like virion using Escherichia coli, which comprises a structural protein-encoding VP2 (mVP2) encoding an infectious chicken Fahlovirus virus or a The truncated fragment gene is constructed in a expression vector, and the resulting expression vector is transformed into an E. coli host to produce a virion-like particle of Fahrenheit virus. In a specific embodiment of the present invention, the gene is utilized. Escherichia coli expression vector PCRRT7CT-, TOPO. In another embodiment of the present invention, a pGEX 6P-1 plastid which is fused with GST at the n-terminus is used to prepare a fusion protein. Further, in the present invention, In the sample, the E. coli strain bl2 1 (DE3 ) CodonPlus-RP is used as a performance host to produce mVP2 & virions. In another aspect, the present invention relates to a bursal virus-like virus particle produced by Escherichia coli. It is composed of *IBDV2VP2 protein, and the particle size of the virion is 丨5 to 3〇·nm. The invention provides a disease field for controlling chicken bursal disease. It comprises a plaque-like granule prepared according to the method of the invention. ηAbout Fahrenheit virus formation, the fusion of the 2 protein or a fragment thereof is carried out at the end or c-terminus of the mature m protein or its fragment to the egg: A purified or incrementally expressed polypeptide or protein. In the second aspect of the invention: the terminally-bound η-like protein, the fusion protein is ligated to the mature νρ2 protein or has a succulent _/ Λϊό Amino acid guest day + μ ^ Recognize ηπ makeup peptide fragment, such as mVP2H. Chengqi V; 2 protein? In another specific embodiment, the fusion protein is in the mature VP2 protein or its fragment Fusion protein protein

Page 4: 339217 V. Description of invention (2) Named GST-mVP2. [Prior Art] Infectious bur sal disease virus (IBDV) is a double-stranded RNA virus belonging to the Birnaviridae family, which causes infectious diseases infecting young chickens (Kibenge et al.'j Gen. Virol. 69:1757-1775, 1988), the main pathological effect is to destroy the b lymphocytes of the chicken Fahrenheit, causing the chicken's immune deficiency, and is easily infected by other viruses or fine sputum, resulting in high mortality and raising of the chicken. The economic loss of the chicken industry (Dobos et al. 'J, vir〇i. 32:593-605, 1979). Due to the high stability and strong infectivity of I BDV in nature, although the transmission of 丨BDV is controlled by isolating sick birds or performing environmental disinfection, the effect is not good. Therefore, early prevention and treatment of IBDV is to vaccinate hens, and indirectly pass the antibodies to the next generation by the mother, so that the chickens can avoid IBDV infection by moving antibodies within 4-5 weeks after birth. However, the effectiveness of this transitional antibody is difficult to predict. The prevention and treatment of IBDV is mainly through the inoculation of attenuated strains of vaccines, or the use of live or deadly IBDV vaccines to produce transitional antibodies to protect chicks from I BDV infection, but such vaccines are resistant to mutations. The virulent strain is ineffective (Becht et al., J. Gen. Vir〇 1. 69:631_64〇, 1988). Later, although inactivated vaccines and attenuated vaccines were developed one after another, the general inactivated vaccines and attenuated vaccines have difficulties in preparation, and there is a risk of recovery, which is also quite expensive in terms of manufacturing costs. Therefore, there is a great need for 1339217. V. INSTRUCTIONS (3) A subunit vaccine produced by a vp2 structural protein having a protective friend antigenicity is displayed to immunize a chicken. In the relevant national patent application of the applicant (application number: 9 Π 1 9 9 9 3), the baculovirus/insect cell expression system has been used to express the rVP2H structural protein containing 6 histidines, which is capable of self It is assembled to form virion-like VLPs and can be purified by metal ion affinity chromatography, and the specific structure formed can induce neutralization of immune response and protect chickens from I BDV infection (the full disclosure is incorporated herein) As a reference). The host protective antigen VP2 protein of IBDV exhibits different immune responses in different expression systems. From the previous Vp 2 protein polymer to the now known virus-like particles, it is not difficult to find VP2 protein. The configuration has a great relationship with the immune response it produces, and the concept of VLp has reached a stage of maturity. It is very safe to use VLP as a subunit vaccine. It is also a good strategy to benefit in vivo (丨nvi The immune system of vo) stimulates the host to produce strong humoral and intracellular immune responses (hum 〇ra 1 andce 1 1 u 1 arimmuneres ρ ο nses ) (K unding et al. 'Proc. Natl. Acad. Sci. USA 93:9716-9723, 1996; Sedlik et al., Pr〇c. Natl. Acad. Sci. USA. 94:7503-7508, 1997) 〇 Previous techniques used yeast (Macreadie et al., Vaccine 8: 549- 552 '1990) and E. coli (Azad et al, Virology 149: 190-198, 1991) to express VP2 protein, but did not successfully induce chickens to produce neutralizing antibodies. The results of many previous I BDV studies show that the VP2 protein expressed by the E. coli expression system failed to elicit a very good immunological induction. 339217 V. Inventions (4) and there are certain difficulties. Azad et al. The physicochemical and immunological aspects of Vfi2 expressed by Escherichia coli and yeast have been investigated and compared. 'The fewer fusion proteins found on the N-terminus of VP2 protein expressed in E. coli', the soluble protein will increase, if there is no fusion. Protein, although soluble in many proteins, has very little yield. The VP2 protein, which is not fused with foreign proteins, is easily degraded and yields are small. In terms of immunity, the inclusion body of E. coli does not have a correct configuration and cannot interact with a single-source antibody that recognizes the correct configuration of VP2; soluble VP2 protein can recognize the correct configuration of VP2. Single-source antibodies have a strong role' but do not trigger virus-neutralizing antibodies, which is strongly related to the conformation of the expressed protein (the aforementioned 'Azad et al., ι991) β, which seems to indicate that VP2 protein is in Escherichia coli. It was not completely folded correctly and did not form the correct protein configuration. Therefore, from the point of view of VLP, if the VP2 protein can form virus-like particles in E. coli, it may trigger virus-neutralizing antibodies in the protection of chickens. This inference has been confirmed by our previous studies ( Cai Qianyu's master's thesis of the National Institute of Agricultural Biotechnology, National Chung Hsing University, (·2002). Furthermore, E. coli grows and protein is fast and the culture method is simple 'no need for too much cost, at the level of production vaccine A good performance system, and can explore the differences in the configuration and immune response of virus-like particles produced by different performance systems, and can further understand the whole virus from the 丨_ infected host to the formation of infectious virus particles. The process is more conducive to the research and development of IBDV vaccine. The study of the formation of virus-like particles in E. coli by mature VP2 protein has not been reported. Therefore, the present invention relates to the infectious chicken Fahrenheit virus.

Page 7 1339217 V. Description of the invention (5) The structural protein VP2 gene or a fragment thereof is constructed in a expression vector, and the full-length and C-terminal or N-terminal VP2 protein is expressed by E. coli and found by different conditions. The recombinant VP2 protein and its fusion protein produced by the Escherichia coli host system can be self-assembled to form a virus-like particle by the method according to the present invention, and a virus-neutralizing antibody can be induced in a chicken, thereby completing the present invention. [Inventive content] * Infecti〇us bursal disease (I BD) broke out in Ganpaul County, Delaware, USA in 1957. This disease is also known as Gumboro disease. ). In Cosgrove's report in 1962, it was found that the disease was negative by bacteriological examination and that the administration of antibiotics was not effective, so the initial diagnosis was caused by a virus (c〇sgr〇ve,

Avian Dis· 6: 385-389 ’ 196$). After the disease occurred in the United States, this case has appeared in Europe, Africa, and Asia. Lu, Xie et al. conducted a serum antibody test of chickens in chicken farms in Taiwan from 1890 to 1983. It was found that about 90% of the chickens were positive, which shows that the disease has spread throughout the chicken farms. (Lu et al., J. Chinese Soc. Vet. Sci. 9: 61-66, 1983). IBDV is a member of the Bi rnaviridae family. Same belong

The virus of Birnaviridae family also has IPNV (infectious necrosis virus) infected with fish, TV (Tel 1ina virus) infected with double shellfish, Oster virus infected with snail, and dxv (Drosophila X virus) infected with fruit. IBDV is an unenclosed, 92

Page 8 1339217 V. INSTRUCTIONS (6) A right-handed icosahedral avian virus with a capsomer and a T=13d particle size of about 60 to 65 nm. Its monolayer outer sheath structure consists of 780 VP2 on the outside and 6 VP3 proteins on the inside, and a small amount of non-structural proteins VP4 and VP1 on the inside (Bottcher et al., J.

Virol. 71(1): 325-330, 1997). The genome of IBDV contains two sRNA fragments of Αβ, and the large fragment is called Segment A. The length is about 3. 2 kb 'with two open reading regions (〇rf), and the smaller ORF will translate a 16~ 21 kDa protein product, VP5. Another larger ORF will translate a polyprotein of the protein product 'VPX-VP4-VP3' of approximately 1 〇 kDa. The small fragment was a protein product of approximately 90 kDa size, VP1, for a segment B ' length of approximately 2.9 kb'. VP1 was confirmed to be an RNA-dependent RNA polymerase of IBDV (M〇rgan et al., Virology. 163: 240-242 '1988) and would form a VP1 - VP3 complex with VP3 and play an important role in the replication of the virus. Role (Maraver et al., J. Virol. 77: 2459-68, 2003). The most common component of the virus is VP 2, which is as high as 51%. It is the main structural protein of IBDV and also the main host protective antigen. The expression of VP2 in mammalian cells was found to cause degradation of rRNA and inhibition of protein synthesis, and it was found in the experiment showing a total of 1-2 that when Beb 2 was expressed, the inhibition of protein synthesis by | VP2 disappeared. It is thought that VP2 induces planned cell death (Arias et al., J. Virol. 7 Bu. 8014-8018, 1 997). The assembly process of VP2 in the shell is regulated by polyproteins. It is now known that in the process of assembling into a virus, VPX of IBDV (also known as Pvp2, former 1339217 V, invention description (7) VP2) will be protected by serine. Protein VP4 is cut into mature VP2 protein (Jagadi sh et al. J. Virol, 62: 1084-1087, 1988; Chevalier et al. J. Virol. 76: 2384-2392, 2002; and Costa et al., J. Virol 76:2393-2402, 2002) =VP4 There are 5 identified locations on the VPX. From the results of Cry〇-EM, it was found that IBDV is a T=13 icosahedral structure (Bottcher et al., 丫11~〇1.71:325-3 30,1 997 ) 'in its sole structural protein VP2 This is the formation of a dodecahedral structure with T = 1 (Cast on et al., J. Virol. 75: 10815-10828, 2001). VP3 is a protein that is second only to VP2 in viral particles, and has a region with a positive charge of up to 40% at the C-terminus, possibly a region that binds to viral nucleic acids. The N-terminus of VP3 has now been shown to have the ability to bind to single-stranded RNA (Kochan et al., Arch Virol. 1 48:723-744, 2003). When using the two-hybrid system to understand the interaction between the proteins of IBDV, it is also found that VP3 has heterologous interaction with VP1, so some people think that VP3 will interact with VP1 and replicate with IBDV. And assembly related (Tacken et al., J. Gen. Virol. 81 · 209-2 18, 2000). VP4 was first thought to cleave polyproteins when expressing whole segment A in E. coli (Azad et al., Virology. 161:145-152, 1987) °VPX-VP4-VP3 polyprotein will be cis4 and VP4 The activity of in trans cleaves the entire polyprotein into VPX, VP4 and VP3, and further VPX is cleaved into mature VP2, mVP2 (previously, Chevalier et al., 2002) during the maturation of the entire viral particle.

Page 10 1339217 V. INSTRUCTIONS (8) VP5 is a non-structural protein of IBDV and is considered to be unrelated to viral replication 'but related to viral release (Mundt et al., J. Virol. 71: 5647-5651, 1997). ). In vitro experiments suggest that VP 5 is associated with pathogenicity and death from infected cells (Ya et al., Virology. 285: 50-58, 2001). Active and passive immunization is often used to control viral diseases in birds. Passive immunization uses metastatic antibodies to fight viral infections, but it is impossible to predict optimal timeliness. Rather, the use of vaccines (especially inactivated vaccines) for active adaptive immunity is the main method of effective disease control (Sharma 'Adv. Vet. Sci. Comp. Med. 41: 48 494, 1999) The main preventive method of IBDV is also to use an attenuated inactivated virus as an antigen to elicit an immune response. Since the use of non-activated viruses has the potential to cause viral toxicity recovery, virus-like particles (VLPs) that resemble real viruses and are not infectious are a developmental direction for sub-unit vaccines. In the development of the subunit vaccine of I BDV, E. coli and yeast were used to express VP2 as a candidate for vaccine. The results showed that the yield of E. coli was not low, and there was no Immune effects, while yeast shows the same result (AZaci et al. 'Vaccine. 9: 715-722, 1991; and Vakhari, Biotechnology

The annual review, vol. 3:15, 168, 1 997, was not confirmed until 2002. The VP2 protein expressed by E. coli not only self-assembles to form VLPs but also has partial protective effects (described above, Cai Qianniu, 2002). The more widely studied is the use of baculovirus expression systems to express VP2 protein, the results are shown for

Page 11 1339217 V. INSTRUCTIONS (9) Inducing neutralizing antibodies and making chicks resistant to infection with IBDV (Vakharia et al., J. Gen' Virol, 74: 1201-1206, 1993; Pitcovski et al. 'Avian Dis. 40: 753-761, 1996; Wang et al. 'Biotechnol. Bioeng. 67: 104-111, 2000; Shen Bingcheng, 'Master's thesis, Institute of Agricultural Biotechnology, National Chung Hsing University, 2 002 ). In the case of nucleic acid vaccines, the chickens were vaccinated with the VP 2 gene in the turkey herpes virus as a viral vector, and there were also very good results (Tsukamoto et al., J. Viorl. 76: 5637-5645, 2002). Assembled into virions that do not require all of the gene products of the virus. For VLP studies, in addition to using infectious strains, other expression systems can be utilized, and differences in expression systems can also lead to caps id. The diversity of assembly (Johnson et al., Curr. Op.in. Struct,

Biol. 10: 229-235, 2000). The N-terminus of the FMV coat protein was cut to find the molecular switch that affects the assembly of T=3. The switch has more charged amino acids at the 30th to 50th residues. Area. The SeMV study also found that the N-terminal ARM (argine rich motif) is the region that mainly affects the formation of T = 3 VLP and finds the region assembled into T = 1 and psuedo T = 2 (Lokesh et al., \^1~〇) 1〇莒7 292:21 1 -223,2002 ). The VLP formed by VP1 of human polyomavirus JC virus can transport plastids with 々-Gal into Cos-7 cells and allow Cos-7 cells to decompose X-Gal into blue products. (Goldmann et al, J. Virol. 73: 4465-4469, 1999), showing the potential of VLPs to develop into gene therapy vectors. Using known X-ray results, find an area in the CPV that is exposed but does not affect assembly after removal.

Page 12 1339217 V. INSTRUCTIONS (10) . (loop 2), if replaced by a sex hormone with 2 amino acids, not only does it affect the formation of VLP, but also can be recognized by the anti-strain monoclonal antibody. (Hurtado et al., 1996). Further, the VLP-immunized mice formed by replacing the polivovirus epitope C3:B with its l〇op 2 were found to be able to induce a neutralizing anti-barrel with a force price greater than 1〇〇〇 (Rueda et al., virology 263:89-99 '1999). It has been shown that the development of multivalent vaccines using VLPs is feasible. The E. coli expression system is currently the most widely used expression system for the expression and production of foreign proteins. "Combined with extensive genetic and physiological knowledge 1 plus the application of biotechnology, E. coli is a simple organism. 'It's not only a fast growth rate, but also a large and fast protein expression. Under such advantages, this performance system is the best choice, and people have a good understanding of the function of the E. coli genome, so it is beneficial to us. The target gene is inserted into the vector, and the promoter has a promoter capable of regulating the expression of the protein gene by using natural or chemical substances, so that Escherichia coli can effectively utilize the nutrient to produce the target protein under the optimal conditions, and the carrier is resistant. The gene can avoid other bacteria contamination, increase the screening pressure, and stabilize the protein performance, which is more convenient in studying the structure and function of the protein. However, the use of E. coli to express biologically active proteins still faces many challenges, such as plastid replication, plastid maintenance, promoter, mRNA stability, proper protein folding, protein degradation, protein secretion, Post-translational modification, etc. (Weichert et al., Current 〇pini() I1 in Biotechnology 7:494-499 >1 9 95 *. Makrides > Microbiol, rev. 60 : 5 1 2-538 ^ 1 9 96 ; Baneyx ^ Current 1339217 V. Description of invention (π)

Opinion in Biotechnology 10: 411-421, 1 999 ). The expression of the plastid often dominates the performance of the protein. 'In order to maintain the presence of the plastid, the screening pressure of the antibiotic, the use of the gene to regulate the temperament of the temperament in the light of the planned death (Baneyx, 1 999) _ is to build the gene It is then available on the chromosome of the bacteria (Olson et al., Pro|ein expr. purif. 14·16〇_166 '1998). The ideal promoter is a large amount of & when it is to induce protein expression. Lac, tac and Τ7 are commonly used promoters, and IPTG can also be used to induce protein expression, but all three have a leaky phenomenon. In order to avoid the influence on the growth of Escherichia coli in the presence of toxic proteins, BL21(DE3)pLysS and BL21(DE3) strains have been used as expression constructs to improve the expression of toxic proteins (C 1 emens et al. B i ο T echnique · 1 9 : 1 4 7 - 1 4 9,1 9 9 5 ). Proteins are low in E. coli. In addition to the toxicity of the foreign protein expressed to the cell, another factor is the use of the code. There are many codes such as AGG for arginine, AUA for CGA's-leucine with AGA' leucine, and CCC for lysine, which are often found in eukaryotes but are rare in E. coli (Kane, Current).

Opinion in Biotechnology 6:494-500, 1995), the argil gene that can be translated into tRNAAre is constructed into a plastid as a helper plastid (heiper p 1 asm id) and then expresses a protein with more AGG and AGA codes. As a result, an increase in the amount of expression was found (Schenk et al., BioTechniques 19: 196-200, 1995). In addition, e. c〇li 812 (:〇(1〇叩1115(0£3)-尺11) when expressing other strains can be used to express [11) (: "The predecessor can not only be used A large number of performances, and the re-re nature of its inclusions can retain its activity (Lai ne et al, J. Virol

Page 14 1339217 V. Description of invention (12)

Methods. 1 03:67-74, 2002 ). Large amounts of protein often accumulate as inactive inclusion bodies in an incorrectly folded manner. To enhance soluble, correctly folded, and biologically active proteins, induce or co-express chaperone, reduce expression temperature, and fuse proteins. It is a viable method. Fusion of MBP is considered to be a more efficient expression of soluble protein fusions than GST and TRX. It is also considered to have the ability to have chaperone proteins (Kapust et al. ' Protein Science 8::1 668-1 674, 1 999 ). The most talked about E. coli expression system is that there is no complete post-translational modification, but it is now possible to transfer the pgi gene cluster (gene cluster) that was originally N-linkeci glycosylated on C. jejuni to E. coli. It also has the function of ^-end linkage (Wacker et al. 'Scienc 298:1790-1793, 20 02 ). 'The expression system of E. coli is not only used on the structural proteins of phage, such as MaSon-Pfizer monkey virus ( The structural protein of MpMV; a type D retrovirus) is expressed in the form of inclusion bodies by E. coli (K1 ikova et al., 995). The outer sheath protein of tobacco mosaic virus (TMV) is expressed by E. coli. Assembled into pseudoviral particles (Hwang et al, P: oc. Natl. Acad. Sci. USA. 91: 9067-9071, 1994) This is the same performance as fo disease virus (FMDV) The situation of 7 〇s empty virus particles formed in the system is the same as in humans, J. Virol. 65: 6572-6580, 1991). This system is easy to perform mutation and labeling of protein genes, and can be expressed and analyzed in a short time. It is also convenient to store. It requires less cost in culture and production, and is easy to access for purification. The protein greatly reduces the cost of purification on 1339217 V. The invention (13) -- plays an important role in the function and structure of the protein. Based on the above advantages, this is the main purpose of multi-invention of the use of E. coli to express VP2 protein of 丨BDy to develop the subunit vaccine of Fahrenheit virus. The invention is further illustrated by the following examples which are not to be construed as limiting. The entire contents of all of the references (including the cited documents, the published patents, the published applications, and the commonly assigned patent application) are hereby incorporated by reference. [Embodiment] Example 1 shows an I BDV-like virion in an Escherichia coli host. The present assay system uses a 70-T0P0R (Invi trogen) plastid having both performance and T/A cloning as a expression vector. The previously constructed Topo-1167 plastids were treated with Nhe I and EcoR I, run TAE gel electrophoresis, and then purified by colloid. Topo plastids can be driven by the T7 promoter. In addition, pGEX 6Ρ-1 (Amersham Bioscience), which is a Ν-end fusion GST gene, is shown to be driven by the tac promoter. The enzyme cleavage sites are ECoRI and Notl. In the preparation of gene fragments, in order to construct VPX, VPX AC46, mVP2, mVP2H, mVP2H ΔΝ10 and GST-mVP2 which express IBDV, pBluescrip-VP2 was constructed by Li Longhu Teacher's Laboratory of ZTE University. Native strain P3009) As a template, the primers such as IBDVANP4 (CGAGTGGCTA^CgT^ACAAACCTGACA) > VP2-N30F (ACG£TAGgTTgATTGTTCCGTTCATACGG) and GSTVP2F (GCGAATTCinSACAAACCTGACAG) are 5'-end primers, respectively, with 1 536 (GCGAATTmiGGCGAGAGTTAG) ' 1398

Page 16 1339217 V. Description of the invention (14) (GCGAATTlCTAlTGCAGGTGGGAA), 1323NH CGCGAATTCfCTAjGTGATGGTGATGGTGATGTGCTCCTGCAATCTTCAG), 1 323 (GCGAATTClCniTGOTCCTGCAATCTTCAG) and Notl 323 (ATAAGAATGCGGCCG [CmTGCTCCTGC) are 3' end primers, and Ex-taq (TaKaRa) with corrective ability When the polymerase is subjected to PCR (polymerase chain reaction), the condition is · · · upper cover (1丄d) temperature 1 05 ° C, 94 ° C for 3 minutes, 94 ° C for 1 minute and 30 seconds to melt, 56.5 ° C After 45 seconds of bonding, 72 ° C for 2 minutes, the above 30 cycles of amplification reaction, 72 ° C for 5 minutes, finally 25 ° C, to obtain a large number of amplified gene fragments, and then processed by restriction enzymes after colloid purification . The purified vector was ligated with the gene fragment and transformed into Escherichia coli BL21 (DE3) CodonPlus-RP, and the length of the resulting recombinant mVP2 protein and its fragment and its fusion protein are shown in Fig. 2. VP4 shares five recognized positions on VPX, where VPX Λ46 is the protein at the catalytic position of the fourth VP4 at the C-terminus in the specific region of VPX. The plastid pCRR T7CT-T0P0R driven by the T7 promoter to drive the VPX Δ46 gene was sent to the BL21(DE3) CodonPlus-RP expression strain, and then cultured at 37 ° C in each batch of 500 ml to OD6 00 = 0.5. Induction with IPTG of mM. ImM for 4 hours. After being purified by ultra-high speed centrifugation such as 0-40% ammonium sulfate, 25% sucrose solution cushion and 20-40% cesium chloride, particles with a size of about 5 nm can be observed under TEM (Fig. 3A). ). The mVP2 protein is now considered to be a mature IBDV VP2 protein (described above, Chevalier et al., 2002). The performance conditions and crude purification steps of mVP2 protein in this experiment are the same as VPX Λ46, after collecting 0-60% ammonium sulfate precipitation product.

Page 17 1339217 V. Description of the invention (15) Purification by gasification and absolute density ultra-high speed centrifugation, the results of the purified mVP2 observed under TEM can be found to be 30 nm VLP (Fig. 3B) °mVP2HAN10 protein is O. lmM IPTG was cultured at 37 ° C until OD600 = 〇. 5 to induce performance for 4 hours, and IMAC was used to purify the protein with a strategy of changing p Η value. The observation of ΤΕΜ from the protein extracted by ρΗ4.0 can observe the formation of VLP at 20 nm and 10 nm (Fig. 4). From the results of mVP2HAN10 protein, it can be seen that the cutting of 1 amino acid at the N-terminus of mVP2 does not affect the assembly of VLP, nor does it increase the performance of soluble protein or easily degrade. Compare Azad et al. The results of studies in which N-terminal shortening increases the performance of soluble proteins but are susceptible to degradation (described above, Azad et al., 1991) are not identical. To facilitate the purification of the mVP2 protein, a fusion protein mVP2H having a His-tag fusion at the c-terminus of the protein was prepared, which can be purified by immobilized metal affinity chromatography (IMAC) to change the pH. The resulting fusion protein mVP2H was observed to have a 2〇nm-sized dopnut-like VLP (Fig. 3C) under TEM, which is similar to the mVP2H size expressed by the baculovirus expression system. GST-mVP2 fused to the GST protein at the mVp2 terminus was also constructed to increase the amount of expression. The results of Fig. 3 〇 iTEM show that the fusion protein GST_mVp2 expressed by Escherichia coli can be assembled into virions having a particle size of about 16 n m. , Example 2 chicken immunoassay

Page 18 1.339217 V. INSTRUCTIONS (16) The mVP2H expressed by co 1 i is used to conduct an immunoassay on chickens to examine the antigenicity and immunogenicity of the mVP2H protein assembled into VLPs. The ability to produce neutralizing antibodies was further evaluated for the applicability of the VP2-like virions represented by E. coli in the preparation of subunit vaccines. The IMAC-purified mVP2H protein was concentrated by a 100 KDa concentrated membrane, and the buffer was replaced with PBS, 20 μg of protein was taken and mixed with an equal volume of Freund's complete adjuvant (CFA), and intramuscularly inoculated into three. Young chickens of age (4) and PBS (3). Four weeks after immunization, vivIBDV with a viral power of 10-4 was challenged. After 5 days of challenge, the immunized chickens inoculated with mVP2H protein showed no death and no signs of infection, while the PBS group died within 3 days. All the chickens were sacrificed and their Fahrenheit food was taken and ground with liquid nitrogen and dissolved in PBS to detect virus infection by Western blotting. In the analysis of two of them (# 1 · and #2 ), no signal of VP2 protein was detected (the results are shown in Figure 5). In order to understand the ability of the chicks to produce antibodies after immunization, sputum was taken every other week after inoculation of mVP 2 Η VLP, and the antigen-capture EL ISA (AC-ELISA) was used to detect the IgG valency of anti-rVP2H in the serum. The purified rVP2H protein was first diluted on an ELISA plate (EIA/RIA stirp plate, Costar) with an ELISA coating buffer, and the protein was coated in each microwell to a concentration of 0.1 μg/well. 〇〇 〇〇 microliter / slot. After absorbing at 4 ° C overnight, 5% skim milk was added to 4. (: Blocking reaction was carried out for 4 hours. Skim milk was removed, and twice diluted serum was added to 4. (: After 4 hours of reaction, it was washed 6 times with PBS-T buffer and then added.

Page 19 1339217 JL, invention description (17) The second antibody HRP-conjugated goat anti-chicken diluted 5000 times was reacted at 4 °C for 4 hours, and finally washed 6 times. 100 μl of OPD solution (Sigma) was added to each well for 7 minutes at room temperature, and the reaction was stopped with 50 μl of 3 M HCl, and the absorbance at 490 nm was measured. The background group is not coated rVP2H. The interpretation is the value minus the background value. If it is greater than 0.1, it is judged as positive. The results are shown in the table below. Table. Serum price (GMT) for each week after immunization ° _ ELIS A antibody strength (average 値: ts. D.), number of weeks (after vaccination) 0 1 2 3 4 m VP2H 75 ± 50 300 ± 115 32000 ±22170 51200士0 12800士0 PBS 75±50 100±0 200士0 200士0 200士0 The results show that the average price of the third week after injection of m V p 2 Η can be as high as 51200 or more. Based on the above results, the present invention has been shown to express I BDV in E. coli to form a virion-like mVp2 protein, and having such a protein configuration is very important for inducing virus-neutralizing antibodies in chickens (described above, Cai, 2 〇2); From the chicken immunization test of the above Example 2, it was also confirmed that the mVP2 VLP of the present invention can induce a highly neutralizing antibody and provide a good chicken-protecting effect, which is extremely industrially useful. Therefore, the present invention utilizes a high degree of natural law creation, which can achieve 1339217. V. Inventive Description (18) The intended purpose of the present invention. The present invention is an unprecedented design and has a very practical effect. Feng has already met the requirements for the high degree of creation of invention patents. 提起 Filed an invention application in accordance with the law, and please give a patent as soon as possible. 1339217 Brief description of the sputum Figure 1: The amino acid sequence of VPX for the IBDV P3009 strain. Wherein AA represents the (T/A-X-A i A) motif known to be catalyzed by VP4 during the maturation process (Chevalier et al., J. Virol. 76: 2384-2392, 2002), i.e., the site of VP4. Figure 2: Schematic representation of the length of each of the VPX and VP2 proteins. The His-tag containing 6 histidines was fused. HS represents a GST that fuses 29kDa. mVP2 refers to the mature VP2 protein with a total length of 441 amino acids. Figure 3 shows the results of observation of the proteins νρχ Λ46, mVP2 and mVP2H expressed by E. coli under a transmission electron microscope (TEM). The purified protein was negatively stained with 0. 2% uranyl acetate (u A) and observed as α. Under TEM, VPX Λ46 (A) with a particle size of about 15 nm was observed, which was 30 nm. mVP2 (B), 20 nm mVP2H (C) and about 16 nm GST-mVP2 (D) virions. Figure 4: Lists the results of observation of mVP21l A N 10 under electro-optic TEM. The protein was observed after negative staining of the purified protein with 〇·2% uranyl acetate (UA). At T EM, virus-like particles with particle sizes of approximately 20 nm and 10 nm, respectively, were observed. Figure 5: The Western blotting method was used to analyze the chicken bursae after challenge and to check whether VP2 protein was present. The left to right column is the molecular weight marker protein (marker, M), the mVP2H as the antigen #1 and #2 (1 and 2), the non-hit antigen and only the PBS (P) and administered by the insect. Cellular expression of rVP2 prion protein (C) The first antibody used in this experiment was the multi-antibody a-VP2 CNC, and the second antibody was a ΑΡ-conjugated goat anti-rabbit antibody.

Claims (1)

丄州217 9 Announcement! 77 years >丨月; 〇曰Revised replacement page' - a method for producing bursal disease virus (IBDV) virion particles (VLP) in Escherichia coli (£·co/i), which includes: (1) The gene encoding the structural protein mature VP2 (mVP2) of the infectious chicken Fructus sinensis virus or the N-terminus of the fragment of 10 amino acids is constructed to contain the T7 promoter-driven gene expression and T/A colonization (cloning) In the performance vector: (2) transforming the expression vector obtained in step (1) into an E. coli host to express and recombine the protein and assemble it into virions; and (3) passing the cell lysate through 0-60% sulfur Ammonium precipitation and chlorination are carried out by ultra-high speed centrifugation to obtain virion particles of Fahrenheit virus. 2. According to the method of claim 1, wherein the performance carrier used in the step (1) is pCR®T7CT-T0P0®. 3. The method of claim 1, wherein the E. coli host is a pure strain BL21 (DE3) CodonPlus-RP. 4. The method of claim 1, wherein the step (3) further comprises purifying by immobilized metal affinity chromatography (IMAC). 5. A bursal-like virus-like virion prepared by the method of claim 1 of the patent application, which is obtained by cutting the mature VP2 protein of IBDV or its Ν-end by cutting and cutting 10 amino acids. The fragments are composed of virions having a particle size of 15 to 30 ηηι ° 6. According to the fifth paragraph of the patent application, the Fahrenheit virus-like granules 23 1339217 _ 'Revision and replacement on November 30, 1999 A page comprising a polypeptide fragment containing 6 histidines at the N-terminus or C-terminus of the mature VP2 protein or its N-terminus to facilitate protein purification. 7. A Fructus pseudovirus-like virus particle according to item 5 of the patent application, which is linked to the GST protein at the N-terminus of the mature VP2 protein or the N-terminus thereof. A vaccine for controlling infection of chicken bursal disease virus, which comprises a bursal disease virus-like particle according to item 5 of the patent application. twenty four