TW200525031A - Method for producing virus-like particles of Infectious Bursal Disease viruses by E. coli and its application in subunit vaccine - Google Patents

Abstract

The present invention relates to a method to express VP2 proteins of the Infectious Bursal Disease viruses (IBDV) by E. coli host. The virus-like particle (VLP) can be successfully assembled by VP2 so as to be applied in the development of subunit vaccine.

Description

200525031 V. Description of the invention (1) "Technical field to which the invention belongs" The present invention relates to a method for producing Chinese virion particles in E. coli, which includes mature VP2 (mVP2) encoding trachea structural protein or its truncated λ The expression vector t of the bursal virus, the obtained expression vector sophobia is constructed in the prudent virion-like embodiment of the Fahrenheit bursal virus, which is based on the use of the expression vector PC ci_item TOP 0R. In another aspect of the present invention, which is said to be capable of GST ^ dGEX 6P 1 H 'in vivo implementation, p-GEX 6PM plastids with N-terminally fused GST were used to prepare fusion proteins. In addition, in a specific implementation aspect, the use of a female furnace aunt from u, do not praise the moon. Hugh? You use the E. coli strain BL21 (DE3) CodonPlus-RP as the expression host to produce mVp2 virus-like particles. In another aspect, the present invention relates to Fahrenheit virus virion-like particles produced by E. coli, which is composed of * IBDV2VP2 protein, and the size of the virion-like particles is 15 to 30 · nm. In yet another aspect, the present invention provides a vaccine ' for preventing chicken Fahrenheit virus infection, which comprises vp2-like virus particles prepared according to the method of the present invention.

The present invention also relates to a fusion protein of the mature VP2 protein or fragment thereof of Fahrenheit virus, which is a polypeptide or protein that is connected to the n-terminus or C-terminus of the mature VP2 protein or its fragment for protein purification or incremental expression. In a specific embodiment of the present invention, the fusion protein is a C-terminus of a mature VP2 protein or a fragment thereof, which is a polypeptide fragment containing 6 histidines, such as mvp2 (R). In another embodiment of the present invention, the fusion protein is a fusion protein that fuses a GST protein at the N-terminus of a mature VP2 protein or a fragment thereof.

200525031 V. Description of the invention (2) Named GST-mVP2. [Previous technology] Infectious bursal disease virus (IBDV) is a double-stranded RNA virus belonging to the family Birnaviridae, which causes infectious diseases that infect chickens (Kibenge et al., J. Gen. Virol. 69: 1757-1775, 1 9 8 8), the main pathological effect is to destroy the b lymphocytes of chicken Fahrenheit sac, causing chickens to be immune deficient, and susceptible to death by other viral or bacterial infections, causing high chicken mortality. And the economic losses of chicken farmers (Dobos et al., J. Virol. 32: 593-605, 1979). Because I BDV is highly stable in nature and highly contagious, although the spread of IBDV is controlled through isolation of diseased birds or environmental disinfection, the effect is not significant. Therefore, the early prevention and treatment of I BDV was vaccinating the hens. The mothers passed the antibodies indirectly to the next generation, so that young chickens could be protected from IBDV by migrating antibodies within 4-5 weeks of age. infection. However, the effectiveness of this migrating antibody is difficult to predict. The prevention and treatment of IBDV in Mugang is mainly through inoculation of attenuated vaccines or live or dead IBDV vaccines to produce migration infections, but such vaccines are not effective against mutant virulent chickens. J Gen. Vir. 69: 631-640, 1988). L > Inactivated vaccines and attenuated vaccines have been successively developed, but generally not 200525031 V. Description of the invention (3) Exhibiting a subunit vaccine produced by vp2 structural protein that exhibits protective and antigenic properties to the host to immunize chickens only. In the relevant national patent application of the applicant of this case (Application No. · 9 1 1 1 99 93), the baculovirus / insect cell expression system has been used to show the rVP2H structural protein containing 6 histidines, which can Assembled to form virus-like particles VLP and can be purified by metal ion affinity chromatography, and the special structure formed can induce a neutralizing immune response and protect chickens from IBDV infection (the full disclosure of which is incorporated herein As a reference). IBDV's host protective antigen VP2 protein is expressed in different expression systems, and the immune responses triggered by it are different. From the previous Vp2 protein polymer to the known virus-like particles, it is not difficult to find the Vp 2 protein. The configuration has a lot to do with the immune response it produces, and the concept of VLp has reached a mature stage. It is very safe to use VLP as a subunit vaccine. It is also a good strategy for in vivo (in vivo) ) 'S immune system to stimulate the host to produce strong humoral and cellular immune responses (Kunding et al.

Proc. Natl. Acad. Sci. USA 93: 9716-9723, 1996; Sedlik et al., Proc. Natl. Acad. Sci. USA. 94: 7503-7508, 1997). Previous techniques used yeast (Macreadie et al., Vaccine 8: 549-552, 1990) and E. coli (Az ad et al., Virology 1 49: 1 90-1 98, 1991) to express the VP2 protein, but were unsuccessful Inducing chickens to produce neutralizing antibodies. The results of many previous IBDV studies have shown that the V P 2 protein expressed by the coliform expression system does not trigger a good immune response.

IEH

Page 6 200525031

Fruit 'and there is a certain degree of difficulty. Azad et al. Have discussed and compared the physicochemical and immune aspects of VP2 expressed by E. coli and yeast. 'The fewer fusion proteins they found at the N-terminus of the vp2 protein expressed by E. coli, the more soluble protein will With the increase, if there is no fusion protein, although there is a lot of soluble protein, the yield is very small. The vp2 protein without the fusion of foreign proteins is easily degraded and the yield is very small. In terms of immunity, E. coli produces insoluble inclusion bodies that do not have the correct configuration and cannot interact with single-source antibodies that recognize the correct configuration of VP2. Soluble vp2 protein can be compared with the single-group that recognizes the correct configuration of VP2. The source antibody has a strong effect but fails to elicit virus-neutralizing antibodies, which has a lot to do with the configuration of the expressed protein (previously, Azad et al., 1991). This again seems to indicate that the VP2 protein was not completely folded correctly in E. coli and did not form the correct protein configuration. Therefore, from the perspective of VLP, if the VP2 protein appears to form virus-like particles in E. coli, it may be able to elicit virus-neutralizing antibodies in protecting chickens. This inference has been obtained by our previous research. Confirmation (Cai Qianniu 'Master's Thesis, Institute of Agricultural Biotechnology, National ZTE University, 2002). Furthermore, E. coli has fast growth and protein expression, simple culture method, and does not require much cost. It is a very good expression system at the level of producing vaccines, and can be used to explore the structure of virus-like particles produced by different expression systems. The difference in the shape and immune response can further understand the entire process of the real virus from infecting the host to the formation of infectious virus particles, and it is also helpful to the research and development of the IBDV vaccine. Studies of mature VP2 protein forming virus-like particles in E. coli have not been reported. Therefore, the present invention relates to the

Page 7 200525031

= The structural protein VP2 gene or a fragment thereof is constructed in a expression vector, and E. coli is used to express the full-length and C-terminal or N-terminal, truncated Vp2 protein, and is found through testing under different conditions. The recombinant VP2 protein and its fusion protein prepared by the performance of the host system can self-assemble to form virus-like particles, and can induce virus-neutralizing antibodies in chickens, thus completing the present invention. [Summary of the Invention] Infectious chicken bursal disease (infecti〇us bursai disease;

(I BD) broke out in Gambaor County, Delaware, USA in 1957. This disease is also known as Gumboro disease. Cosgrove ’s report in 1962 stated that ‘the disease was negative through bacteriological tests, and antibiotic administration was also ineffective, so the initial diagnosis was caused by the virus (cosmos,

Avian Dis · 6: 385-389 ‘196”). After the disease occurred in the United States, it has been reported in Europe, Africa, Asia and other places. Lu, Xie, and others had performed chicken clear antibody tests on chicken farms in Taiwan from 1980 to 1983, and found that about 90% of the chickens were positive. It can be seen that the disease has spread to chicken farms (Lu et al., J. Chinese Soc. Vet. Sci. 9: 61-66, 1983).

IBDV belongs to the Birnaviridae family. The viruses belonging to the family Birnaviri da e still include ip NV (infectious necrosis virus) that infects fish, TV (Tellina virus) that infects bivalves, OV (Oster virus) that infects oysters, and dxv (Drosophila X virus) that infects fruit flies. ). IBDV is an unenveloped, with 92

Page 8 200525031

V. Description of the invention (6) Right-symmetric icosahedral avian virus with a grain size (capsomer) of about 60 to 65 nm and a T = 13d. Its monolayer outer sheath structure is composed of 780 VP2 on the outer side and 600 VP3 proteins on the inner side, and a small amount of non-structural proteins VP4 and VP1 on the inner side (Bottcher et al., J.

Virol. 71 (1): 325-330, 1997). The IBDV gene contains two dsRNA fragments, ab

Segment A is approximately 3.2 kb in length and has two open reading regions (〇rf). The smaller 0RF will translate a 16-21 kDa protein product, VP5. Another larger ORF will translate a polyprotein (plyprotein) of about 11 kDa protein product 'VPX-VP4-VP3. The small strand is Segment B, which is about 2.9 kb in length, which translates to a protein product of about 90 kDa, VP1. VP1 is confirmed as an RNA-dependent RNA polymerase of IBDV (Morgan et al., Virology · 163 · · 240-242., 1 988), and it will form a VP1-VP3 complex with VP3 and play an important role in the replication process of the virus Role (Maraver et al., J. Viroi 77: 2459-68, 2003). VP2 is the most in the whole virus composition, its content is as high as 51%, it is the main structural protein of IBDV and the main host protective antigen. VP2 expression in mammalian cells was found to cause degradation of rRNA and inhibition of protein synthesis, and it was found in experiments that expressed be 1-2 that when Be 1-2 was expressed, the phenomenon that VP2 caused protein synthesis inhibition would disappear, and VP2 is thought to induce planned cell death (Arias et al., J. Virol. 71: 80 14-80 18, 1 997). The assembly process of VP2 in the shell is regulated by multiple proteins. It is known that during the process of assembly into a virus, IBDV's VPX (also known as pVP2, formerly

Page 9 200525031 V. Description of the invention (7) Flooding VP2) will be truncated by serine protein VP4 to become mature VP2 protein (Jagadish et al. J. Virol 62: 1 084-1 087, 1 988; Chevalier et al. (J. Virol. 76: 2384-2392, 2002; and Costa et al., J. Virol. 76: 2393-2402, 2002). VP4 has a total of 5 identified positions on the VPX. From the results of Cryo-EM, it was found that IBDV is an icosahedral structure with T = 13 (Bottcher— # ,, J. Virol. 71: 325-330, 1 997), and its main structural protein, VP2, is formed separately. Dodecahedron structure with T = 1 (Caston et al., J. Virol. 75: 1 081 5-10828, 2001). VP3 is the second most abundant protein in the virus particle, and its C-terminus has a region with a positive charge of up to 40%, which may be the region bound to the viral nucleic acid. The N-terminus of VP3 has now been demonstrated to have the ability to bind single-stranded RNA (Kochan et al., Arch Virol. 1 48: 723-744, 2003). When using the two-hybrid system to understand the interaction between IBDV proteins, it was also found that VP3 would have a heterologous interaction with VP1. Therefore, some people believe that VP3 will interact with VP1 and replicate with IBDV. And assembly (Tacken et al., J. Gen. Virol. 81 · _ 209-2 1 8, 2000). VP4 was first thought to cleave polyproteins when expressing the entire segment A in E. coli (Azad et al., Virology. 161: 145-152, 1 987) The aVPX-VP4-VP3 polyprotein will be cleaved by the VP4 of the polyprotein to νρχ, VP4 and VP3 with the activity of in cis and in trans, and mature in the entire virus particle. In the process, the VPX is further cut into mature VP2, which is mVP2 (mentioned above, cheval ier et al., 2002).

Page 10 V. Description of the invention (8), considered to be free of virus replication (Mundt et al., J. Virol. 71: Off, VP5 is a non-structural protein of IBDV but related to virus release 5647-5 651 ' 1 997). In vitro experiments suggest that vp5 is associated with pathogenicity and the death of infected cells (Ya0 et al., VirOlOgy. 285 · 50-58, 2001). It is often used to control viral diseases in birds. Using active and passive immunization, passive immunization uses a form-shifting antibody to fight viral infections, but the optimal time frame cannot be predicted. Instead, the use of vaccines (especially non-activated vaccines) for active adaptive immunity is a more effective way to control disease and is the current main method (Sharma 'Adv · Vet · Sci · Comp · Med · 41: 48 卜 4 94, 1 99 9). The main prevention method of IBDV is to use an attenuated inactivated virus as an antigen to trigger an immune response. Because the use of inactivated viruses has the potential to cause viral toxicity recovery, virus-like particles (VLPs), which closely resemble real viruses and are not infectious, have been developed as subunit vaccines. In the development of the IBDV subunit vaccine, E. coli and yeast were still the earliest used to express Vp2 as a vaccine candidate. As a result, it was found that the yield of E. coli was not only low, but also had no immune effect. 'And yeast showed the same results (Aza (j et al.') Vaccine 9: 7 1 5-722, 1991; and Vakhari, Annual Review of Biotechnology, Vol. 3: 151-168, 1 997), until 2002 It has only been confirmed that the VP2 protein expressed by E. coli not only assembles itself to form VLPs, but also has some protective effects (the aforementioned, Cai Qianniu, 2002). The more widely studied is the use of the baculovirus expression system to express the VP2 protein The results show that for 200525031 V. Description of the invention (9) Eliciting neutralizing antibodies and protecting young chickens against I BDV infection have a very good effect (Vakharia et al., J. Gen. Virol. 74: 1201-1206, 1993; Pitcovski et al., Avian Dis. 40: 753-761, 1996; Wang et al., Biotechnol. Bioeng. 67: 104-111, 2000; Shen Bingcheng, National Institute of Agricultural Biotechnology, Zhongxing University, Thesis, 2 002). For nucleic acid vaccines, The VP2 gene is constructed in turkey herpesviruses to immunize chickens with viral vectors, and has very good results (Tsukamoto et al., J. Viorl. 76: 5637-5645, 2002). Assembly into virus-like particles is not All the gene products of the virus are needed. For the study of VLP, in addition to infectious pure strains, other expression systems can be used. The difference in the expression system will also lead to the diversity of the capsid assembly (Johnson et al.) , Curr. 0pin. Struct.

Biol. 10: 229-235 ' 2000). The N-terminus of the FMV coat protein was cut, and the molecular switches that affected the assembly of VLPs with T = 3 were found to have more charged amino acids in the 30th to 50th positions. A region of residues. The study in SeMV also found that its N-terminal ARM (argine rich motif) is the region that mainly affects the formation of τ = 3 VLP and finds the region assembled into τ = 1 and psuedo T = 2 (Lokesh et al., 卩 11'〇1 〇 It 292: 21 1 -223 '2002). VLPs formed by VP1 of human polyoma virus jc virus can send plastids with -Gal into cos-7 cells and allow Cos-7 cells to transfer X- The decomposition of Gal into blue products (Goldmann et al., J. viroi 73: 4465-4469, 1999) shows the potential of VLPs to develop into gene therapy vectors. Use the known χ-ray results ’to find an exposed area in the CPV that does not affect assembly after removal

200525031 V. Description of the invention (10) (loop 2), if it is replaced by a sex hormone with a length of 12 amino acids, it will not only affect the formation of VLP, but can also be recognized by the monoclonal antibody of this hormone (Hurtado et al. , 1996). Furthermore, VLP-immunized mice formed by replacing polivovirus epitope C3: B with 10op 2 were found to induce neutralizing antibodies with a potency greater than 1,000 (Rueda et al., Virology 263: 89-99,1 999). It has been shown that the development of multivalent vaccines using VLPs is feasible. The E. coli expression system is currently the most widely used expression system for the expression and production of foreign proteins. Combining extensive knowledge in genetics and physiology, plus the application of biotechnology, according to E. coli is a simple organism. It not only has a fast growth rate, but also can express proteins in large quantities and quickly. Now, this performance system is the best choice, and people already know the function of the E. coli genome, so it is helpful for us to insert the target gene into the vector, and the vector carries the protein gene that can use natural or chemical substances to regulate the gene. The promoter of expression allows E. coli to efficiently use nutrients to produce the target protein under optimal conditions. The resistance gene on the vector can avoid contamination by other bacteria, and it can increase the screening pressure and stabilize the protein performance. It is more convenient to study protein structure and function. However, using E. coli to display biologically active proteins still faces many challenges, such as the number of plastids, maintenance of plastids, promoters, mRNA stability, correct folding of proteins, degradation of proteins, and secretion of proteins. Post-translational modifications (Weichert et al., Current Opinion in Biotechnology 7: 494-499, 1995; Makrides, Microbiol · rev. 60: 512-538, 1996; Baneyx, Current 200525031 V. Description of the invention (11)

Opinion in Biotechnology 1 ·· 411__421, 1 999). (Previously, Baneyx, 1999 on chromosomes (Olson et al., Pro | plastids often dominate protein performance, in order to maintain the presence of plastids in the anti-Scholen pressure, the use of genes to regulate the abundance of aposomes during the day and day Death good is a dye-infecting method in which expres- sion of genes is delivered to bacteria in expr · purif · 14: 16〇1 166, 1998) are all feasible methods. The ideal promoter is to be expressed in large quantities only when protein expression is to be induced If. Uc, tac & T7 are commonly used promoters, they can also be used 丨! ^ (; To: induce protein expression ', but these three have leakage (1 eaky) phenomenon. To avoid, toxin protein is expressed When it affects the growth of E. coli, the use of BL21 (DE3) pLysS and Bl21 (DE3) strains as expression cells has become a method to improve the expression of toxic proteins (Clemens et al., BioTechnique 19: 147-149, 1995). Low protein expression in E. coli. In addition to the presence of foreign proteins that are toxic to cells, another factor is the use of codes. There are many codes such as ARG and AGA for arginine, and CGA for leucine. Leucine aua and proline ccc often appear Eukaryotic but rare in E. coli (Kane, Current;

Opinion in Biotechnology 6: 494-500, 1995), constructing the argU gene that can translate tRNAArg into plastids as helper plasmids and then expressing proteins with more AGG and AGA codes. The results can be found The amount of performance has increased (3〇: 116111 ^ et al., 81〇 丁 6 (^ 1 ^ 41163 19: 196-200, 1 995). In addition, the use of £ .coli BL2buc can be used to translate other rare passwords. 〇d〇nplus (DE3) —When RIL expresses strains to express HbcAg precursors, not only can it be expressed in large quantities, but its renaturation can still retain its activity (Laine et al., J. Virol

Page 14 200525031

V. Description of the invention (12)

Methods · 1 03: 67-74, 2002). A large number of protein expressions often accumulate improperly into inclusion bodies that are not nasally active. To increase the solubility, correct folding, and biological activity of proteins, induce or co-express chaperone, reduce expression temperature, and fusion proteins. Is the feasible method. Fusion MBP is considered to be more effective in expressing soluble protein fusion proteins than GST and TRX, and it is also considered to have the ability of a chaperone protein (Kapust et al., Protein Science 8. · 668-1674, 1999). The E. coli expression system is most affected by human speech because it does not have complete post-translational modifications, but now it is possible to transfer the Pgi gene cluster (gene cluster that was originally N-linked on C. jejuni) to E. coli. It also has the function of ^^-terminal linkage vinegarization (Wacker et al., Scienc 298: 1790-1793, 2002). The expression system of E. coli is not only used on phage structural proteins, such as Mason-Pfizer monkey virus ( MPMV; a type D retrovirus) structural proteins are expressed by E. coli as inclusion bodies (Klikovaetal, 1 995). Tobacco mosaic virus (TMV) sheath proteins are assembled into E. coli Pseudoviral particles (Hwang et al.,

Proc. Natl. Acad. Sci. USA 91: 9067-9071, 1994) This is the case of 70s empty virus particles formed in the same expression system as foot and mouth disease virus (FMDV). Same (Lewis et al., J. Virol 65: 6572-6580, 1991). This system is easy to perform mutation and truncation of protein genes, and can be expressed and analyzed in a short time. It is also very convenient to save; it requires less cost in culture and production. It is easy to access labeled proteins for purification. Which greatly reduces purification

Page 15 200525031 V. Expenses of the invention description (13) 'play an important role in the function and structure of the protein. The above advantages, which is also the present invention using the m protein of the present invention to develop the present invention of the main stem cell list of the Fahrenheit virus subunit vaccine, the following examples show that Λ should not be used as limit. This: The entire text of all references cited in the application (including the three published patents, published applications, and common patent applications) are incorporated herein by reference.实施 [Embodiment] Example 1 Expression of IBDV virus-like particles with E. coli host. This experiment uses T7CT-TOPOR (Invitrogen) plastid as the expression vector, which has both expression and T / A cloning. The Topo-1167 plastids were treated with Nhe I and EcoR I and tae gel electrophoresis was performed, followed by colloidal purification. Topo plastids can drive gene expression by an oral promoter. In addition, pGEX 6P-1 (Amersham Bioscience) with N-terminally fused GST is also used. The gene of this plastid is driven by the tac promoter, and the enzyme cut is £ (: 〇 [{1 and " 1; 1. In terms of gene fragment preparation, in order to build 181, which can be used to express Nakamura, VPX AC46, mVP2, mVP2H, mVP2H ΔΝ10, and GST-mVP2, then

The pBluescrip — VP2 (from Taiwanese strain P 3009) constructed in the Department of Veterinary Medicine of Xing University is used as a template, with IBDV A NP4 J (CGAGTGGCTAGCgT ^ ACAAACCTGACA), VP2-N30F (ACGCTA £ gXTgATTGTTCCGTTCATACGG) and GSTVP2F (GCGAATTCCiTGG1) The isotope primers are 5'-end primers, with 1 536 (GCGAATTmiGGCGAGAGTTAG), 1398

Page 16 200525031_ V. Description of the invention (14)

(GCGAATTrrAlTGCAGGTGGGAA), 1 323NH (GCGAAjnT [CTA | GTGATGGTGATGGTGATGTGCTCCTGCAATCTTCAG), 1 323 (GCGAATTClCTAlTGCTCCTGCAATCTTCAG), and Notl323 (ATAAGAATGCGGCCG [CTHTGCTCCTGC), etc. are 3'-cloned, Ta-cloned and Ta-cloned. Polymerase chain reaction), the conditions are: cover (1 id) temperature 1 05 ° C, 94 ° C for 3 minutes, 94 ° C for 1 minute and 30 seconds melting, 56. 5 ° C for 45 seconds for adhesion, 72 ° C for 2 minutes The above-mentioned 30-cycle amplification reaction was performed at 72 ° C for 5 minutes and finally at 25 ° C to obtain a large number of amplified gene fragments, which were then obtained by colloidal purification after restriction enzyme treatment. The purified vector was ligated with the gene fragment, transformed into E. coli BL21 (DE3) CodonPlus-RP, and the length of the resulting recombinant mVP2 protein and its fragment and its fusion protein are shown in FIG. 2. VP4 has a total of five recognized positions on VPX, of which VPX Λ46 is the protein at the C-terminal fourth VP4 catalytic site in a specific region of VPX. The pCRR T7CT-T0P0R expressed by the VPX Λ46 gene driven by the T7 promoter was sent to the BL21 (DE3) CodonPlus-RP expression strain, and the working volume was 500 ml per batch and cultured at 37 ° C to OD600 = 0.5 and then 0. 1 mM IPTG was induced for 4 hours. After 0-40% ammonium sulphate, 25% sucrose solution cushion and 20-40% cesium gasified ultra-high speed centrifugal purification, the presence of particles with a size of about 15 nm can be observed under TEM (Figure 3A) . The mVP2 protein is now considered a mature IBDV VP2 protein (previously,

Cheval ier et al., 2002). In this experiment, the performance conditions and crude purification steps of mVP2 protein are the same as VPX Δ46. After collecting 0-60% ammonium sulfate precipitation product

Page 17 200525031 V. Description of the invention (15) Purification by ultrahigh-speed centrifugation with equal density of gaseous cesium. Observation of the purified mVP2 under TEM reveals a VLP with a size of 30nm (Fig. 3B). IPTG was cultured at 37 ° C to OD6002 · 0.5 to induce expression for 4 hours, and IMAC was used to purify the protein with a strategy of pH change. The protein extracted from ρΗ4.0 was observed by TEM. The formation of VLPs with a size of 20 nm and 10 nm was observed (Figure 4). From the results of the ιηνΡ2ΗΔΝ10 protein, it can be seen that the truncation of 10 amino acids at the N-terminus of mVP2 does not affect the assembly of VLP, nor does it Increasing the performance of soluble proteins or easily degrading, compared with the results of Azad et al., Which found that shortening the N-terminus would increase the performance of soluble proteins but was easily degraded (Azad et al., 1991). This is different. For purification, a fusion His-tag fusion protein mVP2H was prepared at the c-terminus of the protein, which can be purified by changing the pH value using immobilized metal affinity chromatography (IMAC). The resulting fusion protein mVP2H is in TEM A donut-shaped VLP (d0Ughnut 1 1 ke) with a size of 20nm can be observed below (Figure 3C), which is similar to the size of mVP2H expressed by the baculovirus expression system. A fusion MT protein was also constructed. GST-mVP2 at the N-terminus of mvP2 is expected to increase the amount of expression. From the observation of FIG. 3DtTEM, the fusion protein mVp2 expressed by E. coli can be assembled into virus-like particles with a particle size of about 16 nm. Example 2 Chicken immune test This example is mainly to use the mVP2H expressed by E. coli E. 200525031 in the previous embodiment 丨 (16) col i to test chickens for immunity, to inspect the assembly of VLPs The antigenicity, immunogenicity, and ability to produce neutralizing antibodies of the mVP2H protein further evaluate the applicability of the VP2 virion particles expressed by E. coli of the present invention in the preparation of subunit vaccines. The mVP2H protein purified by IMAC was concentrated through a 100 KDa concentrated membrane, and the buffer solution was replaced with PBS. 20 micrograms of protein was taken and mixed with an equal volume of Freund's complete adjuvant (CF A), and the method was intramuscularly injected. Three-week-old chicks (4) and PBS group (3). Four weeks after immunization, vvIBDV with a virus power of 10-4 was used for challenge. Five days after challenge, chickens were immunized with mVP2H protein. There were no deaths and no signs of infection, while the PBS group died within 3 days. All chickens were sacrificed and their Fahrenheit sacs were taken, ground with liquid nitrogen and dissolved in PBS. Western blot was used to detect virus infection. In any two of them (# Γ and # 2), no signal of VP2 protein was detected (the results are shown in Figure 5). To understand the ability of chicks to produce antibodies after immunization, blood was drawn every other week after vaccination with mVP2H VLP, and the antigen-capturing EL ISA (AC-ELISA) was used to detect the IgG potency of anti-rVP2H in the serum of immunized chickens. The purified rVP2H protein was diluted on an ELISA plate (EIA / RIA stirp plate, Costar) with ELISA coating buffer, and the protein was coated in each microwell to a concentration of 0.1 μg / well, 100 μl /groove. After overnight adsorption at 4 ° C, 5% skim milk was added and blocking reaction was performed at 4 ° C for 4 hours. Remove skim milk, add twice diluted serum and react at 4 ° C for 4 hours. Wash with PBS-T buffer 6 times before adding.

Page 19 200525031 V. Description of the invention (17) 5000-fold diluted secondary antibody HRP-conjugated goat anti-chicken 'was reacted at 4 ° C for 4 hours, and finally washed 6 times with PBS-T. Add 100 μl of OPD solution (Sigma) to each well for 7 to 15 minutes at room temperature. Then stop the reaction with 50 μl of 3M HC1 and measure the absorption at 490 nm. The background group is uncoated rVP2H. The interpretation is the value minus the background value, if it is greater than 0 · 1, it is judged as positive. The results are shown in the table below. Table · Serum potency (GMT) of each week after immunization __ELIS A antibody potency (average 値 ^ 〇, week number (after vaccine injection) 0 1 2 3 4 mVP2H 75 ± 50 300 ± 115 32000 ± 22170 51200 ± 0 12800士 0 __PBS 75 ± 50 100 ± 0 200 士 0 200 ± 0 200 土 0 ▲ The results show that the average power value in the third week after mVp2iI injection can be as high as 5 1 200 or more. Combined with the above results, the present invention has In E. coli, IBDV-1 exhibited mVP2 protein assembled into virus-like particles. It is very important for chickens with this protein configuration to produce virus-neutralizing antibodies (said, Cai,). The immune test also confirms the present invention :) mVP2 VLP can induce highly neutralizing antibodies, provide good edge protection, and is therefore of great industrial utility value. Therefore, the present invention is based on the creation of the laws of nature, which can achieve

Page 21 200525031 Schematic illustration Figure 1: Amino acid sequence of VPX of IBM P3009 virus strain. Wherein AA represents the (T / A_X-A! A) motif that VP2 is known to be catalyzed by VP4 during the maturation process (Chevalier et al., J · viroi · 76: 2384-2392, 20 02), that is, VP4 The cut part. Figure 2: Schematic diagram of the length of each truncated VPX and VP2 protein. _ Indicates the fusion of His-tag containing 6 histidines. m represents a fusion of 29 kDa GST. mVP2 refers to the mature VP2 protein with a total length of 441 amino acids. Figure 3 shows the results of observation of the proteins VPX Λ46, mVP2 and mVP2H expressed by E. coli under a transmission electron microscope (TEM). The purified protein was negatively stained with 0.2% uranium acetate (UA) and observed. Under TEM, VPX Δ46 (A) with a particle size of about 15 nm, mVP2 (B) at 30 nm, mVP2H (C) at 20 nm, and GST-mVP2 (D) at about 16 nm were observed. Virus particles. Fig. 4 shows the results of mVP2H ΔN10 observation under the electric display TEM. It was observed after the purified protein was negatively stained with 0.2% uranium acetate (UA). Under T E M, virus-like particles having a particle size of approximately 20 nm and 10 nm were observed, respectively. Figure 5: The Western blot method was used to analyze the chicken Fahrenheit sac after challenge, and it was checked for the presence of VP 2 protein. The columns from left to right are molecular weight markers (M), # 1 and # 2 (1 and 2) with mVP2H as antigen, injection of PBS (P) without dragging the antigen, and administration by insects. Cells express rVP2H protein (C). The primary antibody used in this experiment was the multiple antibody a-VP2 CNC, while the secondary antibody was AP-Co-Goat anti-rabbit antibody.

linn p. 22

Claims (1)

200525031 Application Patent Scope 1, a method for producing Escherichia coli Fahrenheit virus (ibdv) & virions (VLP), which comprises mature VP2 (fflVP2) encoding the structural protein of infectious chicken Fahrenheit virus The gene of the truncated fragment or the truncated fragment is constructed in a expression vector, and the obtained expression vector is transformed into an E. coli host for expression, thereby producing a virus-like particle of Fahrenheit virus. 2. The method according to item (1) of the scope of patent application, wherein the expression vector is pCRRT7CT-T0P0R. 3. The method according to item 1 of the scope of patent application, which uses pGEX 6P-1 plastids that can be fused with GST at the end to prepare a fusion protein. 4. The method according to item 1 of the scope of patent application, wherein the host of the E. coli is a pure strain BL21 (DE3) CodonPlus-RP. 5. A Fahrenheit virus-like virion produced by E. coli, which is composed of the mature VP2 protein of IBDV or a truncated fragment thereof, and the assembled virus-like particles have a particle size of 15 to 30 nm. 6. A fusion protein of the mature VP2 protein or fragment thereof of Fahrenheit virus, which is a polypeptide or protein that is n-terminus or c-terminus of the mature VP2 protein or fragment thereof to facilitate protein purification or incremental expression. 7. The fusion protein according to item 6 of the scope of the patent application, wherein the fusion protein is a c-terminus of a mature VP2 protein or a fragment thereof with a polypeptide fragment containing 6 histidines. 8. The fusion protein according to item 7 of the scope of patent application, wherein the fusion protein is mVP2H. 9. The fusion protein according to item 6 of the patent application, wherein the fusion protein is a fusion of a GST protein at the N-terminus of a mature VP2 protein or a fragment thereof. Page 23 200525031 6. Scope of patent application Synthetic protein. 10. The fusion protein according to item 9 of the application, wherein the fusion protein is GST-mVP2. 11. A vaccine for preventing chicken Fahrenheit virus infection, comprising a Fahrenheit virus-like virus particle according to item 5 of the scope of the patent application. 12. A vaccine for preventing chicken Fahrenheit virus infection, which comprises a fusion protein according to item 6 of the scope of patent application.