TWI324608B - Genes and polypeptides relating to human colorectal cancers - Google Patents

Description

V. INSTRUCTIONS OF THE INVENTION (1) Technical Field of the Invention The present invention relates to the field of biological sciences a ^ ^ molybdenum secret, ^ η „ bamboo, especially the field of cancer research. The present invention relates to a new The 拗 i i i 丨 丨 丨 丨 丨 丨 丨 丨 丨 丨 丨 丨 丨 丨 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及 涉及Gene # arguing cell proliferative diseases, and as a target molecule for the development of drugs against this disease. % [Prior Art] Near:: Rectal cancer is the main cause of cancer death in Wang World. Although recently in diagnosis and treatment On the entry of the cattle extract > J) r ^ Η _ „ ', the technical substudy 6 of the late cancer patients is predicted to reveal that cancer formation involves changes in tumor 1 and/or oncogenes, which are further understood in detail. The data of the base state of normal and malignant cells can be obtained by the CDNA microarray technology, and the soil performance of malignant cells and normal cells is compared (Okabe et al., Cancer Res 61: 2129_37 (2〇〇1); Ltahara et al., Cancer Res 61: 3544-9 (20 0 1 ); Lin et al., Oncogene 21: 4120-8 (2002); Hasegawa et al. 'Cancer Res 62: 70 1 2-7 (2002) ). This approach allows to reveal cancer cells, complex properties, and help understand the mechanisms of cancer formation. The identification of tumor-free genes that are not officially helps individual cancers to be more detailed and precise and develop new therapeutic goals (Bienz and Clevers, Cell 103:311-20 (20 00)). In order to understand the mechanism of the tumor from a genomic point of view and find the target molecule for diagnosis and development of a new drug, the present invention uses an II 1 S 1 SS ! I 1 1 ! 1 IIS ρ i S iii 1 I 1 i 2125-5994-PF ( N2); Chiumeow.ptd's _ 1J24608 cdna microarray with 23040 genes analyzed the performance of tumor cells (Okabe et al., Cancer Res 61: 2 1 29-37 (2001);

Kitahara et al., Cancer Res 61: 3544_9 (2〇〇1); Lin et al., Oncogene 21: 4120-8 (2002); Hasegawa et al., Cancer Res 62: 7012-7 (2002)). Studies of cancer formation mechanisms have helped confirm the molecular targets of anti-tumor agents. For example, farnesyl transferase inhibitors (FTIs) were originally developed.

Inhibition of Ras-related growth message transmission pathways, whose activation is dependent on post-translational farnesylation's effective treatment of Ras-associated tumors in animal models (He et al., Cell 99: 335-45 (1999)) . Human clinical trials using a combination of anticancer and anti-HER2 monoclonal antibody, trastuzumab, have been used to combat the pre-oncogene receptor HER2/neu; and have improved clinical response and overall survival in breast cancer patients (Lin et al. , Cancer Res 6 1:6345-9 (200 1 )). A tyrosine kinase inhibitor, STI-571, which selectively deactivates bcr-abl fusion protein has been developed to treat chronic myeloid leukemia,

Activation of bcr-abl tyrosine kinase plays a key role in transforming white blood cells. Such agents are designed to inhibit the oncogenic activity of specific gene products (Fujita et al., Cancer Res 6 1:77 22-6 (2001)). Therefore, gene products that are normally up-regulated in cancer cells can serve as potential targets for the development of new anti-cancer agents. CD8+ cytotoxic T lymphocytes (CTLs) have been shown to recognize I-type molecules derived from MHC groups.

2125 - 5994-PF(N2); 〇iiumeow.ptd Page 7 1324608 V. Inventions (3) Tumor-associated antigens (TAAs) and epitopes in lysed tumor cells (ep it Ope ) peptide. Since the first example of TAAs was discovered, the MAGE family, many other TAAs have been discovered using immunological methods (Boon, Int J Cancer 54: 177-80 (1993); Boon and van der Bruggen, J Exp Med 183: 725 -9 (1996); van der Bruggen et a 1., Science 254: 1643-7 (1991); Brichard et al 1., J Exp Med 178: 489-95 (1993); Kawakami et a 1., J Exp Med 180 : 347-52 (1994)). Some of the TAAs found are in the clinical phase as targets for Φ immunotherapy. The TAAs currently found contain MAGE (van der Bruggen et al., Science 254: 1643-7 (1991)) 'gplOO (Kawakami et al., J Exp Med 180: 347-52 (1994)) 'SART (Shichijo et al J Exp Med 1 87: 277-88 (1 998 )) and NY-ESO-1 (Chen et al., Proc Natl Acad Sci USA 94: 1914-8 (1997)). On the other hand, gene products that have been shown to be overexpressed in tumor cells have been shown to be useful targets for causing cellular overreaction. Such gene products include p53 (Umano et al., Brit J Cancer 84: 1 052-7 (2001)), HER2/neu (Tanaka et al., Brit J Cancer 84: 94-9 (2001)), CEA ( Nukaya et al., Int J Cancer 80: 92-7 (1 999 )) and so on. Although there has been considerable progress in the basic and clinical research on ΤΑ As (Rosenbeg et al., Nature Med 4: 321-7 (1998); Mukher ji et al., Proc Natl Acad Sci USA 92: 80 78-82 ( 1 995 ); Hu et al., Cancer Res 56: 2479-83

2125-5994-PF(N2); Chiumeow.ptd Page 8 1324608 V. INSTRUCTIONS (4) (1 996 )) 'The candidate TAAs used to treat adenocarcinoma (including colorectal cancer) are only a few. TA As is commonly expressed in cancer cells, and its limited expression to cancer cells makes it a potential candidate for immunotherapy. Moreover, the identification of new TAAs to cause effective and specific anti-tumor immune responses has also been expected to accelerate the use of peptide vaccine technology in different cancers (B〇〇n and

Can der Bruggen, J Exp Med 1 83: 725-9 (1 996)'· van der Bruggen et al·, Science 254: 1643-7 (1991); Brichard et al., j Exp Med 178: 489-95 ( 1993); Kawakami et al., J Exp Med 180: 347-52 (1994); Shichijo et al., J Exp Med 187: 277-88 (1998);

Chen et al., Proc Natl Acad Sci USA 94: 1914-8 (1 997); Harris, J Natl Cancer Inst 88: 1 442-5 (1 996); Butterfield et al., Cancer Res 59: 3134-42 ( 1999); Vissers et al., Cancer Res 59: 5554-9 (1999); van der Burg et al., J Immunol 156: 3308-14 (1996); Tanaka et al., Cancer Res 57: 4465_8

(1 997); Fujie et al, Int J Cancer 80: 169-72 (1 999); Kikuchi et al., Int J Cancer 8i: 459_66 (1999); Oiso et al., Int J Cancer 81: 387- 94 (1999)). Peripheral mononuclear blood cells (PBMCs) from specific health donors have been repeatedly demonstrated to produce significant amounts of IFN-' in response to this peptide, but siCr analysis under HLA-A24 or -A0201 restriction conditions Very little cytotoxicity against tumor cells (Kawan〇et ai.

2125-5994-PF(N2); Chiumeow.ptd Page 9 1324608 V. Description of invention (5)

Cance Res 60: 3550-8 (2000); Nishizaka et al., Cancer Res 60: 4830-7 (2000); Tamura et al., Jpn J Cancer Res 92: 762-7 (2001)). However, both HLA-A24 and HLA-A0201 are common HLA dual genes in sputum, and are also among Caucasians (Date et al., Tissue Antigens 47: 93-101 (1996); Kondo et al., J Immunol 155: 4307-12 (1995); Kubo et al., J Immunol 152: 3913-24 (1994); Imanishi et al,, Proceeding of the eleventh International H i ctocompatibi1ity Workshop and Conference Oxford University Press, Oxford, 1065 (1992) ); Williams et al., Tissue Antigen 49: 129 (1997)). Therefore, antigenic peptides of cancers with these HLAs may be particularly useful for treating cancers of Japanese and Caucasians. In addition, it is known that initiating low-affinity CTLs in living organisms usually results in the use of high concentrations of peptides, resulting in high amounts of specific peptide/MHC complexes on antigen presenting cells (APCs), thus being effective These CTLs are activated (Alexander-Mi1ler et al., Proc Natl Acad Sci USA 93: 4102-7 (1996)). SUMMARY OF THE INVENTION One object of the present invention is to provide a novel protein and a gene thereof which are involved in the proliferation mechanism of colorectal cancer cells, and a method for preparing and using the protein or gene for diagnosis and treatment of colorectal cancer. To reveal the formation of the stomach and colorectal cancer and to identify and treat this tumor

2125-5994-PF(N2); aiiumeow.ptd Page 10 1324608 V. Inventive Note (6) The novel diagnostic marker and/or drug target, the inventors of the present invention analyzed a cDNA microarray with 230j0 genes. The performance of tumor cells. From a pharmaceutical point of view, the inhibition of carcinogenic signals is easier to perform than the activation of tumor suppression mechanisms. Therefore, the present inventors searched for genes which are abundantly expressed in the formation of colorectal cancer. Among the transcripts often expressed in large numbers in colorectal cancer, the gene RNF43 (Ring finger_ pr〇tein 43) classified on the chromosome 17pter-pl3.1 has been confirmed. In addition, the yeast two-hybrid screening assay showed that the RNF43 protein is associated with N0TCH2 or STRIN. N0TCH2 is a large-scale transmembrane receptor protein that is part of an evolutionarily conserved intracellular signaling mechanism. N0TCH2 is a protein member of the Notch signaling pathway and is implicated in the formation of kidney spheroids and in the development of the heart and small blood vessels of the eye (McCright et al.,

Development 1 28: 49 1 -502 (200 1 )). Three Three Delta/Serrate/Lag-2 (DSL) proteins: Deltal, Jaggaedl and Jaggaed2 have been identified as functional ligands for N0TCH2 (Shimizu et al., Mol Cell Biol 20: 691 3-22 (2000)). The signal caused by the binding of the ligand to the message delivery pathway achieves intracellular conduction via entry into the nucleus involved in receptor protein breakdown and intracellular portions of NOTCH. (See Ar t avan i s -Tsakοnas e t a 1., Annu Re v Ce 11 B i ο 1 7 : 427-52 (1999); Weinmaster, Curr Opin Genet Dev 10: 363-9 (20 0 0 )). Moreover, by transfection of specific S-oligonucleotides or small interfering RNAs corresponding to them

2125-5994-PF(N2) ;Qiiumeow.ptd Page 11 丄j厶

The decrease in necrotine η m inhibited the growth of colorectal cancer cells. As mentioned in the previous volume, =? The drug is not only toxic to cancer cells, but also to normal cells. The drug may not be harmful to other organs, because the normal performance of ΒΑΟ#二ΒΑΟ is limited to the fetus, more precisely the fetus. 11 . Kidney, therefore it may be of great importance in the treatment of cancer. The present invention therefore provides a purified novel gene, RNF43, which is a diagnostic marker candidate gene for cancer and a development of a new anticancer agent. . In addition, the present invention provides a multi-peptide encoded by this gene, as well as a method of its production and use. More specifically, the present invention provides the following: The present invention provides a novel human polypeptide, RNF43, or a functional equivalent thereof, which promotes cell proliferation and is overexpressed in cell proliferative diseases such as colorectal cancer . In a preferred embodiment, the RNF43 polypeptide comprises a protein deduced to be a 783 amino acid, which is encoded by the open reading region of SEQ ID NO: 1. The RNF43 polypeptide preferably comprises an amino acid sequence as listed in SEQ ID NO: 2 and contains a Ring finger motif at 272-312 yards. 〇 RNF43 multi-peptide display and circular finger protein (RING finger protein) homolog DKFZp566H073. 1 has 38% homology (GenBank Accession Number: T08729). The invention also provides a purified protein 'encoded by at least a portion of the RNF43 polynucleotide sequence, or at least 30% of the polynucleotide sequence, more preferably at least 40% complementary to the sequence identifier number 1. The invention provides a Novel human peptide, RNF43, its performance

2125-5994-PF(N2); Chiumeow.ptd Page 12 1324608 V. INSTRUCTIONS (8) The amount is significantly higher in most colorectal cancers than in non-cancerous mucosa. In addition to colorectal cancer, RNF43 is also widely expressed in lung cancer, gastric cancer and liver cancer. The purified RNF43 gene contains a peptide sequence as shown in SEQ ID NO: 1. In particular, the R4543 cDNA contains 5345 nucleotides containing an open reading region of 2352 nucleotides (SEQ ID NO: 1). The invention further comprises a polynucleotide which hybridizes to at least 30%, more preferably at least 40% of the polynucleotide sequence of SEQ ID NO: 1, and which encodes the RNF43 protein or a functional equivalent thereof. Examples of such polynucleotides are the degenerate and dual mutations of SEQ ID NO: 1.

Here, a purified gene is a polynucleic acid having a structure that is not identical to any natural polynucleotide or a fragment of any natural genomic polynucleic acid that spans three different groups. This name includes, for example, (a) —

DNA, which has a sequence of a portion of a genomic DNA molecule naturally produced in an organism; (b) - a polynucleotide that is incorporated into a vector or a genomic DNA of a prokaryotic or eukaryotic organism. Natural or genomic DNA is different; (c) a separate molecule such as a cDNA, a genomic fragment, a polymerase chain reaction (PCR) product or a restriction fragment; and (d) a recombinant nucleus : g: an acid sequence 'a line of a hybrid gene' such as a gene encoding a fusion peptide. In summary, the present invention provides a purified polynucleotide having a multi-peptide described herein or a fragment encoding the multi-peptide. Preferably, the purified polynucleotide comprises a nucleotide sequence which is at least 60% identical to the nucleotide sequence of SEQ ID NO: 1. More preferably, the purified nucleic acid molecule and sequence

1324608 V. INSTRUCTIONS (9) The nucleotide sequence of column identification number 1 is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99% or more of the same degree. As for the purified polynucleic acid which is longer than the reference sequence, such as the sequence identification number 1 ', the full length of the reference sequence is used as a basis for comparison. When the length of the purified polynucleotide is less than the reference sequence, such as shorter than the sequence number of 1, the length of the reference sequence is used as a basis for comparison (excluding any length required to calculate homology).

The invention also provides a method of producing a protein by transfecting or transforming a host cell with a polynucleotide sequence encoding a RNF 4 3 protein and expressing the polynucleotide sequence. Further, the present invention provides a vector comprising a nucleotide sequence encoding a RNF43 protein and a host cell comprising a polynucleotide encoding a RNF43 protein. This vector and host cells are useful for the production of RNF4 3 protein. Antibodies that recognize the RNF43 protein are also provided by the present invention. Among them, an anti-intentional multi-nucleotide (e.g., anti-j) NA), a catalytic RNA (ribozyme), and a siRNA (small interfering RNA) of the RNF43 gene are also provided.

The present invention further provides a method for diagnosing a cell proliferative disease, comprising confirming the amount of expression of the gene in a biological section sample, comparing the expression of the gene with the normal sample, and defining a high sigh in the sample? The amount of gene expression is a cell proliferative disease, such as cancer. The disease diagnosed by the gamma (4) gene expression is a cancer of the large intestine, lung, stomach, and liver. Further, the present invention provides a method of screening for a compound for treating a cell proliferative disease. This method involves contacting the RNF43 multi-peptide with a test compound and selecting a test compound that binds to the RNF43 multi-peptide.

1324608 V. INSTRUCTION DESCRIPTION (10) The present invention further provides a method for screening a compound for treating a cell proliferative disease. The method comprises contacting a RNF43 polypeptide with a test compound and selectively inhibiting the expression or biological activity of the RNF43 polypeptide. Test compound. Further, the present invention provides a method for screening a compound for treating a cell proliferative disease, which comprises contacting RNF43 with NOTCH2 or STRIN in the presence of a test compound, and selecting a test compound which inhibits binding of RNF43 to NOTCH2 or STRIN. .

The present invention also provides a pharmaceutical composition for treating a cell proliferative disease such as cancer. The pharmaceutical composition may be, for example, an anticancer agent. This pharmaceutical combination f I is described as at least a part of a portion of the reverse s_oligonucleotide or siRNA of the cleavage polymorphic acid sequence indicated by SEQ ID NO: 1. A suitable antisense S-oligonucleotide has the nucleotide sequence shown in SEQ ID NO: The antisense S'' oligonucleotide containing the nucleotide sequence shown in SEQ ID NO: 10 is suitable for cancers such as the large intestine, lung, stomach and liver. A suitable siRNA has a set of nucleotides selected from sequence identifiers 19 and 2,

Nucleotides of 21 and 22. The naked-cut isiRNA having nucleotides selected from sequence numbers 19 and 20, 21 and 22 is applicable to cancers such as the large intestine, lung, stomach and liver. The pharmaceutical grade may also contain a compound of the invention screened for screening for compounds for the treatment of cell proliferative disorders. Preferably, the pharmaceutical composition acts to inhibit the growth of cancer cells. This pharmaceutical composition can be used in mammals comprising humans and livestock animals. The invention further provides a method of treating a cell proliferative disorder using the pharmaceutical composition provided herein.

2125-5994-PF(N2); Chiumeow.ptd Page 15 V. INSTRUCTION DESCRIPTION (11) In addition, the present invention provides a method for treating or preventing cancer, comprising the use of a 2' The use of RNF43 multi-peptide results in an anti-tumor immune response. The invention also provides a method of anti-tumor immune response comprising the use of RNF43 multi-peptide and a pharmaceutical composition comprising RNF43 multi-peptide to treat or prevent cancer cancer. The present invention and the following embodiments are preferred embodiments and are not intended to limit the invention or other embodiments of the invention. [Embodiment] The words "at least one", "a", "an" and "the" are used unless otherwise specified. The scope of the present invention encompasses a novel human gene, RNF43, which is significantly more abundant in colorectal cancer than non-cancerous tissue. RNF43 c])NA has 5345 nucleotides' of which there is an open reading region of 2352 nucleotides, as indicated by SEQ ID NO: 1. This open reading region has a protein that is presumed to be 1 83 amino acid. RNF43 is associated with N0TCH2 and STRIN. N0TCH2 is a large transmembrane receptor protein that is part of an evolutionarily conserved intracellular signaling mechanism. NOTCH 2 is a protein member of the Notch signal' and is noted to be involved in the formation of the kidney spheroid and the development of the heart and small blood vessels in the eye. In addition, 'Three Three Delta/Serrate/Lag-2 (DSL) proteins: Deltal, Jaggaedl and Jaggaed2 have been identified as functional ligands for N0TCH2. STRIN encodes a putative protein that is identical to the mouse 丁1^{7. The function of 5 ft. 11^ or 1'1^{ still needs to be defined. Usually, the foreign appearance in the cell causes the cells to grow, but

2125-5994-PF(N2); Chiunieow pt (j Page 16 1324608 V. INSTRUCTIONS (12) 'Reverse S-oligonucleotide or small interfering RNA (siRNA) inhibits its expression leading to significant cancer cell Growth inhibition. These findings suggest that RNF43 causes carcinogenic activity in cancer cells, and inhibiting the activity of these proteins should be an effective method for treating cancer.

The scope of the present invention encompasses a novel human gene gene RNF43 comprising a polynucleotide sequence of the sequence number 1 and its degradation and mutations 'only encoding the RNF43 protein' including the sequence number 2 or its function An equivalent amino acid sequence. Examples of the polynucleic acid which is functionally equivalent to RNF43 include 'a homologous protein of other organisms corresponding to the human RNF43 protein, and a mutation of the human RNF43 protein. In the present invention, the term "functionally equivalent" means that the indicated multi-peptide has an activity of promoting cell proliferation like RNF43 protein and causes cancer cells to have carcinogenic activity. Whether or not the indicated multi-peptide has cell proliferative activity can be improved by introducing a DNA encoding the indicated multi-peptide into a cell which exhibits the multi-peptide and detecting cell proliferation or forming a population activity. Such cells comprise 'for example' for RNF43' NIH3T3 cells, SW480 cells and COS7 cells. Alternatively, whether or not the indicated multi-peptide is functionally equivalent to RNF43 can be judged by its ability to bind to N0TCH2 or STRIN.

Methods for preparing functionally equivalent multi-peptides with a protein are well known to those skilled in the art and include methods for introducing mutations into proteins. For example, the skilled artisan prepares a multi-peptide that is functionally equivalent to the human RNF43 protein by introducing site-directed mutagenesis in the amino acid sequence of the protein (Hashimoto-Gotoh et al., Gene 152:271-5 (1995); Zoller and Smith,

2125-5994-PF(N2); Chiun, e〇w.ptd Page 17 1324608 V. Description of invention (13)

Methods Enzymol 100: 468-500 (1983); Kramer et al., Nucleic Acids Res. 12:9441-9456 (1984);

Kramer and Fritz, Methods Enzymol 154: 350-67 (1987) ; Kunkel, Proc Natl Acad Sci USA 82: 488-92 (1985); Kunkel, Methods Enzymol 85: 2763-6

(1988)). Amino acid mutations can also be found in nature. The multi-peptide of the present invention comprises a protein having a human RNF43 protein amino acid sequence in which one or more amino acid mutations are produced and the resulting mutant peptide is functionally equivalent to the human RNF4 3 protein. The amount of the mutated amino acid in such a mutant is usually 10 or less', preferably 6 amino acids or less, more preferably 3 amino acids or less. A mutant or modified protein, a protein having one or more amino acids modified, deleted, inserted, and/or added to modify a particular amino acid sequence is known to have an original biological activity (Mark et al) Proc Natl Acad Sci USA 81: 5662-6 (1984); Zoller and Smith, Nucleic Acids Res 10:6487-500 (1982);

Dalbadie-McFarland et al., Proc Natl Acad Sci USA 79:6409-13 (1982)).

The amino acid to be changed is preferably changed to a different one, but an amino acid-like branching property (referred to as c〇nservative amin〇 acid substitution) is exemplified by the hydrophobicity of the amide. Amino acids (Α, I, L, M, F, P, W, γ, ν), hydrophilic amino acids (R, D, N' t E' Q' G' H' K, S, τ) And a brancher having the following workgroups or characteristics: an aliphatic branch (G, A, V, L, I, Ρ), a hydroxy group

1324608 V. INSTRUCTIONS (14) --- Branches of the base (S, T, Y), a branch containing a sulfur atom (c M) with a bond of a thiol and an amino group (D, N, E, Q ), a base-containing partition I (R, K, Η), and a branch containing an aromatic group (H, f γ, ϊ, w). Values Note that the letters in parentheses above are the codes for amino acids. π Addition of one or more amino acids to the human RNF43 protein, an example of which is a fusion protein containing the human RNF43 protein. The scope of the invention encompasses the fusion of human RNF43 protein with other multi-peptides or proteins. The fusion protein can be produced by methods well known to those skilled in the art, for example, DNA encoding the human RNF43 protein of the present invention is ligated to DNA having other polymorphic traits, and the fusion DNA is introduced into a performance vector and expressed overnight. There are no restrictions on the polypeptide or protein fused to the protein of the present invention.多 Multi-peptides known to be fused to the protein of the present invention include, for example, FLAG (Hopp et al., Biotechnology 6: 1204-10 (1 988)), 6xHis, i containing 6 His (histamine) 〇xHis, Influenza agglutinin (HA), human c-myC fragment, VSP-GP fragment, pl8 HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment 'lck tag, 〇:-tubulin Fragments, B-tags, protein C fragments and their analogs. Examples of proteins which can be fused to the protein of the present invention include GST (glutathione-S-transferase), influenza agglutinin (HA), immunoglobulin conserved region (immun〇gl〇bulirl constant region), galactosidase (泠-galactosidase) ), MBP (maltose-binding protein) and its analogs.

1324608 V. INSTRUCTIONS (15) The fusion protein can be prepared by commercially available DNA encoding the polydatin or protein discussed above and the DNA encoding the multi-peptide of the present invention and expressing the fusion DNA. σ Another method for isolating functionally equivalent multi-peptides is known in the art as a method of using heterozygous technology (Sambrook et al.

Molecular Cloning 2nd ed. 9.47-9.58, Cold Spring Harbor Lab. Press (1989)). Those skilled in the art can easily isolate DNA with high homology to all or part of the DNA sequence of human RNF43 protein (eg, SEQ ID NO: 1), and purify the human RNF43 protein from the isolated DNA with the same functionality. Peptide β The multi-peptide of the present invention comprises a DNA codon that is heterozygous for all or part of the DNA sequence of the human RNF43 protein and is equivalent to the human RNF43 protein. This multi-win includes a complemented homolog of a human protein (e.g., a multi-peptide encoded by a monkey, rat, rabbit or bovine gene). The use of fetal lung or fetal kidney tissue is preferred when isolating a cdnA that is highly homologous to the DNA encoding the human RNF43 protein from the animal. The heterozygous conditions for isolating a DNA encoded by a multi-peptide encoding functionally equivalent to the human RNF43 protein can be roughly selected by those skilled in the art. For example, 'hybridization can be carried out as follows, using Rapid-hyb buffer (Amei: Sham LIFE SCIENCE) at 68. (: For 30 minutes or more, the front sigma is ready to be added - the labeled probe is heated to 68 °C for 1 hour or f for a long time. The rinsing step can be performed under a low stringent condition, for example. The low f-square f means, for example, 42 °c, 2X SSC, 〇·SDS, or 佳佳地疋5〇C 2X SSC, 〇. 1% SDS. More preferably, it is highly strict.

2125-5994-PF(N2) ;Chiumeow.ptd Page 20 1324608 V. Description of invention (16) ^Part ^, grid element means, for example, 2X ssc ^ / = ^ at room temperature for 20 minutes, then 37 °c with lx ssc, 〇 · 1% SDS rinse eight people, 2 〇々 clock, and 5 (r2 under 1X ssc, 〇 1% SDs rinse 2 times, 2 knives clock, however, several factors, such as Temperature and salt concentration can affect the heterozygous degree. Those who are familiar with this field can choose the appropriate factors and achieve the required stringency. 0 Gene proliferation methods such as PCR can be used instead of hybridization to isolate a functionally equivalent human RNF43 protein. The DNA encoded by the peptide, which is a primer based on the DNA of the protein (SEQ ID NO: n. The above-mentioned DNA purified by hybridization or gene proliferation technology encodes a function equivalent to human RNF43. The multi-peptide of the protein usually has high homology with the amino acid sequence of the human RNF43 protein. "High homology" generally means that the homology of 4% or more is preferably 6% or higher, more preferably It is 8〇% or more, or even better, 95% or higher. The angular origin of a multi-peptide can be obtained by, for example, Wilbur and Lipm. An, Proc Natl Acad Sci USA 80: 726-30 (1983) calculated in the algorithm. The multipeptide of the invention may have different amino acid sequences, molecular weight, isoelectric point, with or without sugar chains Or the form 'depends on the cell or host used for the production of the protein or the purification method. However, as long as it is functionally equivalent to the human RNF43 protein of the present invention, it is within the scope of the present invention. Recombinant proteins or natural proteins, which are well known to those skilled in the art, can be prepared by inserting a DNA having the polypeptide encoded by the present invention (e.g., DN A comprising the nucleotide sequence of SEQ ID NO: 1) into a recombinant protein. Appropriate performance vector, introduce this vector into the appropriate

1324608 V. INSTRUCTIONS (17) Host cells, extracting their extracts, and purifying the peptides by chromatography, for example, ion exchange chromatography, reversed phase chromatography, gel filtration, or affinity chromatography It uses a column in which antibodies against the proteins of the invention are immobilized, or more than one combination of the above columns is used. When the multi-peptide of the present invention is in the form of a glutathione-S-transf eras fusion protein or a recombinant protein having a plurality of histidine acids in a host cell (for example, 'animal cells or E. The recombinant protein expressed in coli) can be purified using a glutathione c〇iumn or nickel c〇lumn or the multi-peptide of the present invention to have c-myc When a plurality of histidine acids or FLAG-tagged proteins are expressed, each can be detected and purified using an antibody against C-myC, histidine, or FLAG. After purification of the fusion protein, if necessary, it can also be via coagulation ( Thrombin) or fact〇r-Xa cut out the desired multi-peptide. The native protein can be isolated by methods well known to those skilled in the art, for example, using an affinity camp; and the antibody to the RNF43 protein is linked to the tissue of the RNF43 protein ir· it & μ L Or the cell extract may be a multi-strain antibody or a monoclonal antibody. Divided into two parts of the multi-peptide of the multi-peptide of the invention. This portion has at least 7 amino acids, preferably H = a specific amino acid sequence, and contains an amino acid or more. Partially polydecanoic acid or more, more preferably 9 invented multi-peptide antibody, screening - ^ ^, ❹ 'preparation for the object, and screening for the invention more than:; Combination

1324608 V. DESCRIPTION OF THE INVENTION (18) A part of the multi-peptide of the present invention can be synthesized by a method of synthesizing a peptide, or by a suitable enzyme, and can be used. For example, a solid phase invention can be used. The multi-nucleotide tannic acid of the present invention can be used for the peptide in vivo or in a test tube, or can be used for the benefit of the present invention as described above. The gene therapy of the disease caused by the gene of the gene encoded by the yin yue yue yue yue yue. The multi-core of the invention can be used as long as the 仃 路 路 路 日 日 日 日 _ _ _ _ _ _ 、 、 Encoding the multi-peptide of the present invention, including mRNA, MA cDNA, genomic cis, chimeric synthetic polynuclear ridge acid: J=W_!nthesized poiynucleotides) 4Sk^glycate 3 - having a specific nucleotide sequence of ma and its degenerate sequence, As long as the DNA produced therefrom encodes a multi-peptide of the present invention, the polynucleotide of the present invention can be prepared by methods well known in the art, for example, the polynucleotide of the present invention can be prepared as follows: from the performance of the present invention, ''Field preparation Cj) NA database, and use the partial sequence of the dna of the present invention (such as 'sequence identification number υ as a probe for hybridization. An example of preparing a cDna database is, using Sambrook et al., Molecule Cloning, Cold Spring Harbor Laboratory Press (1 989) the method described; or a commercially available cDNA library can also be used. The cDNA library can also be prepared by extracting cells expressing the multi-peptide of the invention from the DNA of the invention (eg, sequence recognition) No. 1) based on the synthetic nucleus nucleotide 'this oligonucleotide is used as a primer, PCr is propagated and the cDNA encoding the multi-peptide of the present invention is amplified. Further, the cDNA obtained by sequencing, Λ(:Ι)ΝΑ The translation area can be

2125-5994-PF(N2); Qiiumeow.ptd Page 23 1324608 V. Description of the Invention (19) It is roughly determined that the amino acid sequence of the multipeptide of the present invention can be easily obtained by "additional use of the obtained cDNA or Part of it serves as a probe screening genomic DNA database to isolate genomic DNA. More specifically, it can be prepared from a cell, tissue or organ exhibiting the multi-peptide of the present invention (e.g., fetal lung or fetal kidney to obtain a sessile (7)). A method known to be useful for purifying mRNA is, for example, that all rna can be guanidine ultracentrifugation 'Chirgwin et al.,

Biochemistry 18: 5294-9 (1979)) or AGPC method (Chomczynski a n d S a c c h i, A n a 1 B i o c h e m 1 6 2 : 1 5 6 - 9 (1 9 8 7 )). Further, mRNA can be purified from all RNA using mRNA Purification Kit (Pharmacia) and the like, or directly purified by QuickPrep mRNA Purification Kit (Pharmacia). The obtained mRNA was used as a reverse transcriptase for the synthesis of cDNA. Synthesis of CDNA A commercially available reagent set such as AMV Reverse Transcriptase First-strand cDNA Synthesis Kit (Seikagaku Kogyo) can be used. Alternatively, cDNA can be synthesized and propagated by the 5'-RACE method (Frohman et al., Proc Natl Acad Sci USA 85: 8998-9002 (1988); Belyavsky et al., Nucleic Acids Res 17: 2919-32 (1989)). This method uses a primer, as well as the 5'-Ampli FINDER RACE Kit (Clontech) and polymerase chain reaction (PCR). The desired DNA fragment is linked to a vector DNA from the above PCR product. This recombinant vector was used to transfect a host such as £ c〇h·, and the recombinant vector was prepared from selected colonies. The nucleotide sequence of the desired DNA can be used

2125-5994-PF(N2); Chiumeow.ptd Page 24 1324608 V. INSTRUCTIONS (20) Methods such as dideoxynucleotide chain termination ^ W: °

The nucleotide sequence of the polynuclear choate of the present invention can be designed to have a higher expression rate by considering the use rate of the codon in the host used (Grantham et al., Nucleic Acids Res 9: 43-74 (1981) )). The sequence of the polynucleotide of the present invention can be modified using a commercially available reagent set or a conventional method. For example, the sequence may limit enzymatic digestion, insertion of a synthetic oligonucleotide or a suitable polynucleotide fragment 'incorporating a linker, or inserting a start codon (ATG) and/or a stop codon (TAA, TGA or TAG). Particularly, the polynucleotide of the present invention comprises a DNA having the nucleotide sequence of SEQ ID NO: 1. Further, the present invention provides a polynucleotide which hybridizes under stringent conditions to a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 1 and has a multi-peptide which is equivalent to the present invention as described above. Biological function of the RNF43 protein. Those skilled in the art should be able to choose the stringency conditions for hybridization. For example, low stringency conditions can be used. It is preferred to use high stringency conditions. This condition is the same as described above. The hybrid DNA described above is preferably a "Μ or a genomic DNA". The present invention also provides a vector peptide. The vector of the present invention is suitable for use in DNA, and is maintained in a host cell using the multi-peptide of the present invention in the gene when using I Λ ?"As a sink

It comprises an insert of the present invention which will multiply a polynucleic acid of the present invention, in particular, to express the multi-peptide of the present invention, or to be therapeutic. The main cell and the vector are proliferated in _£

Page 25 1324608 V. INSTRUCTIONS (21) Mass production (eg, JM109, DH5a, HB101 or XLlBlue), this vector should have an "ori" to be proliferated in £ and a marker gene to select for transfection ϋ co" (eg, a primary anti-drug gene selected from the group consisting of ampicillin, tetracycline, kanamycin, chloramphenicol, or the like). For example, Ml 3 series vectors, pUC series vectors, PBR322, pBluescript, pCR-Script, and the like can be used. In addition, pGEM-T, pDIRECT and pT7 can also be used for secondary transfer and extraction of cDNA and the above vectors. Expression vectors are particularly useful when a vector is used to prepare the proteins of the invention. For example, a performance vector to be expressed in i: should have the above characteristics to proliferate in ϋ co". When using five, such as JM1 0 9, DH5 α:, ΗΒ101, or XL1 Blue as host cells, the vector should have a promoter, such as the lacZ promoter (Ward et al., Nature 341: 544-6 (1989) FASEB J 6: 2422-7 (1 9 9 2 )), araB promoter (Better et al., Science 240: 1041-3 (1988)) or Τ '7 promoter or the like, which is effective Express the required genes in five. With this concept, pGEX-5X-l (Pharmacia), "QIAexpress system" (Qiagen), pEGFP and pET (here, BL21 which expresses T7 RNA polymerase is a preferred host), for example, can be used instead of the above vector . Alternatively, the vector may have a single sequence for secretion of the peptide. An example of a single sequence that directs the multi-peptide to be secreted around the cytoplasm is the pelB single sequence (Lei et al., J Bacteriol 1 69: 4379 (1 987)). Means for introducing a vector into a target host cell include, for example, a calcium chi or ide method and electroporation.

2125-5994-PF(N2); Chiumeow.ptd Page 26 1324608 V. Description of Invention (22) Electroplating method. In addition to i:, the multi-peptide of the present invention can also be used as a derivative

Milk expression vectors (eg, pcDNA3 (Invi trogen) and pEGF-BOS (Nucleic Acids Res 18(17): 5322 (1990)), pEF, pCDM8) 'Bamboo from insect cell expression vectors (eg iiBac_t〇_BAC baculovirus) Expression system" (GIBCO BRL), pBacPAK8), a plant-derived expression vector (eg, pMH1, pMH2), an expression vector for derivatized animal viruses (eg, pHSV, pMV, pAdexLcw), derived from a retroviral viral expression vector (eg pZIpneo), derived from reversal; preparation of vector for the consideration of yeast (such as "Pichia Expression Kit" (Invitrogen), pNVll, SP-Q01), and expression vector derived from Bacillus subtilis (eg, ppl6〇8, pKTH50) . In order for the vector to be expressed in animal cells such as CHO, COS, or NIH3T3 cells, the vector should have a promoter required for expression in such cells, eg, the SV40 promoter (Mulligan et al., Nature 277: 1 08 (1979) )), MMLV-LTR promoter, EF1 a promoter (Mizushima et al., Nucleic Acids Res 1 8: 532 2 (1 990)), CMV promoter

And such 'preferably' has a marker gene for selection of transfected cells (e. g. ' a drug resistance gene selected by a drug (e.g., ne〇mycin, G418). Vectors known to have such properties include, for example, pMAM, PDR2, pBK-RSV, pBK-CMV, pOPRSV, and p〇P13. Further, a method of stably expressing a gene in a cell while simultaneously proliferating the number of the gene can be used. For example, a vector comprising a DHFR complementary gene (such as CH0 I) can be introduced into CH0 cells deleted by the nucleic acid synthesis pathway and used to proliferate

2125-5994-PF(N2) ;Chiumeow.ptd Page 27 1324608

Aminomethyl folate (methotrexate, MTX). In addition, in the case of the transient expression of a gene, a vector having a "4" replication origin (replication origin 0f SV40, pcD, etc.) can be transformed into a COS cell having the SV40 T antigen expression gene in the chromosome. .

The multi-peptide of the present invention obtained as described above can be isolated from the host cell or from the outside (e.g., culture medium) and purified into a substantially pure homologous peptide. The term "substantially pure" is used in the multi-peptide to mean that the multi-peptide is essentially separated from other biomacromolecules. The substantially pure multipeptide is at least 75% pure (e.g., at least 80, 85, 95, or 993⁄4) in terms of dry weight. Purity can be measured by any suitable standard method, such as column chromatography, polyacrylic acid gel electrophoresis or HPLC analysis. The separation and purification of the multipeptide is not limited to any particular method. In fact, any standard method suitable for use can be used. For example, column chromatography, filtration, ultrafiltration, salt precipitation, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectric focusing, dialysis, and recrystallization can be selected and Combine to separate and purify the multi-peptide.

Examples of chromatography include, for example, affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, absorption chromatography, and the like (Strategies for Protein Purification and Characterization: A Laboratory Course Manual Ed.

Daniel R. Marshak et al., Cold Spring Harbor

Laboratory Press (1996)). These chromatography can be carried out by liquid chromatography such as HPLC and FPLC. Accordingly, the present invention provides highly purified multi-peptides prepared as described above.

1324608 V. INSTRUCTION DESCRIPTION (24) The use of an enzyme before or after purification of the present invention includes, but is not limited to, chymotrypsin, (protein kinase). The antibody provided by the present invention may be any of the peptides of the present invention. The type of anti-classified antibodies per plant and multiple strains. Months can be selectively modified or partially deleted to purify a suitable protein-modifying enzyme. Useful proteins are modified by trypsin, chymotrypsin lysylendopept i dase, protein activin, glucosidase, and the like. An antibody that binds to the multi-peptide of the present invention. The present invention uses, for example, a single or multiple strains of antibodies, and comprises an antiserum obtained from a de-immunized animal (such as a rabbit), a human, a human antibody, and a human recombinantly prepared as an antigen to obtain an antibody. The peptide can be derived from any animal, but is preferably from a mammal such as a human, mouse or rat, more preferably a human. A multi-peptide derived from human can be obtained from the present di- or amino acid sequence. According to the present invention, the multipeptide which is a deimmunized antigen may be a complete protein or a partial peptide of the protein. The partial peptide may comprise, for example, an amine (N) terminal or a carboxyl (C) terminal fragment of the inventive multipeptide. Alternatively, any multi-peptide comprising an amino acid sequence can be used to prepare an antibody to the multi-peptide of the present invention: 3 RNF43; SEQ ID NO: 42, 59 or 70. Herein, an antibody is defined as a protein which is reacted with the intact native peptide or a fragment thereof. The gene encoding the polypeptide of the present invention or a fragment thereof can be inserted into a known expression vector' and then used to transform a host cell. The desired multipeptide or its

2125-5994-PF(N2); Chiumeow.ptd Page 29 丄324608 V. INSTRUCTIONS (25) Fragments can be recovered from host cells or externally by any standard method and used as an antigen. Alternatively, intact cells expressing the multi-peptide or a lysate thereof or a chemically synthesized multi-peptide can be used as an antigen. Any mammal can be immunized with this antigen, but it is preferred to consider the suitability of the parental cells for cell fusion. Generally used are the scorpion, the rabbit, or the primate. The scorpion animals include, for example, mice, large rolls, and hamsters. Rabbit-shaped animals include, for example, rabbits. Primates include, for example, the Catarrhini monkey (old world monkey) such as iiacaca fascicularis, which is a monkey, a scorpion, and a black scorpion.

Methods of immunizing animals with antigens are well known in the art. Intraperitoneal or subcutaneous injection of the antigen is the standard method for immunizing animals. More specifically, the antigen can be diluted and suspended in a suitable dose of physiological phosphate buffer (pBS) or the like. If desired, an antigen suspension can be combined with a suitable standard of adjuvant, such as Freund's complete adjuvant, to form an emulsion for use in mammals. Preferably, there are several uses of antigen mixed with a suitable amount of Freund's complete adjuvant every 4 to 12 days. A suitable medium can also be used for immunization. After immunization as described above, it is tested by standard methods whether the antibody required for the card is increased.

The antibody against the multi-peptide of the present invention can be collected from the blood of an immunized animal in which the desired antibody in the serum is increased, and the serum is separated from the blood solution by a conventional method. A plurality of antibodies include serum containing a plurality of antibodies, and a portion containing a plurality of antibodies which may be isolated from the gold. The immunoglobulin can be prepared from a serum fraction that recognizes only the polypeptide of the present invention, for example, an affinity column coupled to the polypeptide of the present invention, and further an egg

1324608 V. INSTRUCTIONS (26) --- White A or Protein G column purification of this part. In the preparation of monoclonal antibodies, immunocyte cells are collected from the above-mentioned animals immunized with antigen and high in human serum, for cell fusion. a Immunocyte in cell fusion is preferably taken from the spleen. Other preferred parental cells fused to the above-described immunogenic cells are, e.g., mammalian osteoblasts, more preferably bone marrow cancer cells that can be screened by drugs. The above immunocytic cells and bone marrow cancer cells can be incorporated by known methods, such as the method of Milstein et al. (Galfre and Milstein, ° Methods Enzymol 73: 3-46 (1981)). Hybridomas obtained by cell fusion can be screened by culturing in a standard culture medium, such as HAT medium (culture medium containing 隹hypoxanthine, aminopterin, and thymidine). The cell culture is usually carried out in the HAT medium for several days to several weeks to kill all other cells (unfused cells) other than the desired fusion tumor. Standard limiting dilutions are then performed to screen and transfer to the fusion of the desired antibody. In addition to the above methods of immunizing antigen-non-human animals to prepare fusion tumors, 'human lymphocytes, such as those infected with Epstein-Barr virus, can be immunized in a test tube with a multi-peptide, a cell expressing a peptide or a lysate thereof. . The immunized lymphocytes are then fused with bone marrow cancer cells derived from humans that can divide indefinitely, such as U266, to produce a fusion tumor of the human antibody required for the production of the above-mentioned multi-peptides (Unexamined Published Japanese Patent Application No. ( JP-A) Sho 63-17688).

1324608 V. INSTRUCTIONS (27) The resulting fusion tumor is then transplanted into the abdominal cavity of a mouse and ascites is extracted. The resulting monoclonal antibody can be purified by, for example, ammonium sulfate precipitation, protein A or protein G column, DEAE ion exchange chromatography, or an affinity column coupled to the multipeptide of the present invention. The antibody of the present invention can be used not only for purifying and detecting the multi-peptide of the present invention but also as a synergist or antagonist of the multi-peptide of the present invention. In addition, this antibody can be used for antibody treatment of diseases associated with the multipeptides of the present invention. When the obtained antibody is used in the human body (antibody treatment), a human antibody or a humanized antibody is preferred to reduce the immune response. For example, a gene-transforming animal having a human antibody gene can be immunized with an antigen selected from the multi-peptide or a cell expressing the multi-peptide or a lysate thereof. The antibody-producing cells are then collected from the animal and allowed to form a fusion tumor with myeloma cells, and a human antibody against the multi-peptide is prepared (see W0 92-03918, W093-2227, W094-02602, W094-25585, W096-33735, and WO96-34096). Alternatively, an antibody-producing immune cell, such as an immunological lymphocyte, can be immobilized via a consensus oncogene and used to prepare a monoclonal antibody. The resulting monoclonal antibodies can also be obtained using genetic engineering techniques (see, e.g., 'Borrebaeck and Larrick, Therapeutic Monoclonal Antibodies, published in the United Kingdom, MacMillan Publishers LTD (1 990)) » for example. The d-code encoding an antibody can be transferred from an immune cell (e.g., a fusion tumor or an immunized lymphocyte producing the antibody), inserted into a suitable vector, and introduced into a host cell to prepare a recombinant antibody. The invention also provides the above

1324608 V. Description of the invention (28) Preparation of recombinant antibodies. Furthermore, the antibody of the present invention may be a fragment of an antibody or a modified antibody as long as it binds to one or more of the multi-peptides of the present invention. For example, the antibody fragment can be a Fab, F(ab,) 2 'Fv or Fv (scFv) single strand, wherein the Fv fragments from the Η and L chains are linked by a suitable linker (Huston et al., Proc Natl) Acad Sci USA 85: 5879-83 (1988)). More specifically (eg, an antibody fragment may be an antibody treated with an enzyme such as papain or pepsiη) or a gene encoding the antibody fragment may be constructed and inserted into an expression vector. 'and behave in a suitable host cell (see, eg, Co et al., J Immunol 152: 2968-76 (1994); Better and Horwitz, Methods Enzymol 178: 476-96 (1989); Pluckthun and Skerra, Methods Enzymol 178: 497-515 (1989);

Lamoyi, Methods Enzymol 121: 652-63 (1986); Rousseaux et a 1. , Methods Enzymol 1 21: 663-9 (1986); Bird and Walker, Trends Biotechnol 9: 132-7 (1991)). An antibody can be modified by attaching a different molecule, such as polyethylene glycol (PEG). The present invention provides such modified antibodies. This modified antibody can be obtained by chemical modification. Such modification techniques are well known in the art. Alternatively, the antibody of the present invention may be a chimeric antibody consisting of a variable region of a non-human antibody and a conserved region of a human antibody, or a humanized antibody comprising a complementary region of a non-human antibody (complementarity)

2125-5994-PF(N2); Chiumeow.ptd Page 33 1324608 V. Description of invention (29) determining region, CDR), the framework work region (FR) of human antibodies and a conservation region. Such antibodies can be prepared by known techniques. The antibody obtained above can be purified to homogeneity. For example, the isolation and purification of antibodies can be based on techniques for isolation and purification of general proteins. For example, 'antibodies can be isolated by appropriate selection and combination of different chromatograms, such as, but not limited to, affinity layer, filtration, ultrafiltration, salt precipitation, dialysis, SDS-polypropylene gel electrophoresis, isoelectric focusing, and other methods ( Antibodies: A Laboratory Manual, Ed Harlow and David Lane, Cold Spring Harbor Laboratory (1 988 )). Protein A column and protein G column can be used as an affinity column. Examples of protein A columns are, for example, Hyper D, P0R0S and Sepharose F.F. (Pharmacia). Examples of chromatography, in addition to affinity, include, for example, ion exchange chromatography, hydrophobic chromatography, colloidal filtration, reverse phase chromatography, adsorption chromatography, etc. (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press (1996)). The chromatography step can be carried out by liquid chromatography such as HPLC and FPLC. For example, the activity of the antibody of the present invention linked to an antigen can be measured by measuring light absorbance, enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), and radioimmunoassay (RIA). , and / or immunofluorescence and other methods of measurement. In the ELISA, the antibody of the present invention is immobilized on an assay plate.

1324608 V. INSTRUCTION DESCRIPTION (30) One of the inventions of a multi-peptide is added to an assay disk, and a sample containing the desired antibody, such as a culture suspension of the antibody-producing cells or a purified antibody, is added. Next, an anti-Zhao is added, and the secondary antibody recognizes the primary antibody and has an enzyme label, such as alkaline phosphatase, and the plate is allowed to stand. Next, after the rinsing, a substrate such as p-nitrophenyl phosphate is added to the analysis tray t, and its light absorbance is measured to estimate the antigen binding activity of the sample. A fragment of the above multi-peptide, such as a c-terminal or N-terminal fragment, can be used as an antigen to estimate the antigen-binding activity of the antibody. BIAcore (Pharmacia) can be used to estimate the activity of the antibodies of the invention.

The above method detects or measures the immunocomplex formed by the multi-peptide of the present invention and the antibody of the present invention by exposing the antibody of the present invention to a sample containing the putative peptide of the present invention. Since the detection or measurement method of the multi-peptide of the present invention can specifically detect or measure a multi-peptide, the method is suitable for experiments using different multi-peptides,

The invention also provides a polynucleic acid, which hybridizes to a polynucleotide encoding a human RNF43 protein (SEQ ID NO: 丨) or its complementary strand, and comprises at least fifteen. The polynucleotide of the present invention is preferably a polynucleotide which specifically hybridizes to the DNA encoding the polypeptide of the present invention. The term "specific hybridization" as used herein refers to the lower incidence of cross-hybridization with DNA having a protein under normal hybridization conditions, preferably under stringent hybridization conditions. Such nucleus includes probes, primers, nuclear faint acids, and nuclear ridge acid derivatives (eg, anti-initiative nucleotides and rib〇zymes) that hybridize to DNA encoding the multi-peptide of the present invention or Its complementary strands form a specific hybrid. In addition, this class

1324608 V. INSTRUCTIONS (31) Polynucleotides can be used to prepare DNA wafers. The present invention comprises a reverse oligonucleotide ligated to any position of the nucleotide sequence of SEQ ID NO: 1. Preferably, the anti-infectious oligonucleotide is at least 15 consecutive nucleotides in the sequence identification number 1 nucleotide antibody sequence. Preferably, the above-described anti-oligonucleotide, which comprises a start codon at least 15 contiguous nucleotides above, is preferred. More specifically, such a reverse oligonucleotide for RNF43 comprises a nucleotide sequence comprising SEQ ID NO: 10.

Derivatives or modifications of the anti-oligonucleotide can be used as anti-oligonucleophilic acids. Such modifications include a low phosphonic acid alkyl ester modification such as methyl-phosphonate-type or ethyl-phosphonate-type, thio-lin Phosphorothioate modification and phosphoroamidate modification. The term "anti-intelligent oleic acid" is used herein to mean not only those having a nuclear acid that is completely complementary to a particular region of a DNA or mRNA, but also those having one or more mismatched nucleotides, as long as the DNA is present. Or the mRNA and the reverse oligonucleotide can be specifically hybridized to the nucleotide sequence of SEQ ID NO: 1.

Such a polynucleic acid is contained in the above "at least 15 contiguous nucleotide regions", at least 70% or more homologous, preferably with or higher homology, more preferably The ground has a homology of 90% or higher, and even more preferably has a homology of 95% or higher. The algorithms described herein can be used to confirm homology. Such polynucleotides are useful as isolation or detection of DNA encoding a multi-peptide of the invention, as exemplified in the Examples below, or as a primer for proliferation. The anti-intentional oligonucleotide derivative of the present invention is multi-successful by coding with the present invention

2125-5994-PF(N2); Chiumeow.ptd Page 36 1324608 V. Inventive Note (32) - '-------, DNA or heart... combines to produce the present invention ^ This DNhiURNA Transcription or transfer, promoting the inhibition of the performance of the multi-peptide of the present invention, thereby inhibiting the function of the multi-peptide. The anti-intelligent nucleus #acid derivative of the present invention is made into a topical mixture by mixing with a matrix which is inactive for this organism.

Wet compresses the drug. Tincture A At the same time, if necessary, the above derivatives can be formulated into tablets, powders, granules, capsules, and microlipid capsules by adding excipients such as isotonic agents, stabilizers, preservatives, analgesics, and the like. , injections, solvents, nasal drops and cold drying agents. These can be formulated by the following general methods. The above-mentioned counter-nuclear nucleotide derivative can be used directly at the site where the patient is ill, or by injection into a blood vessel to reach a diseased site. An antisense-mounting medium can also be used to increase persistence and membrane penetration. Examples are microlipids, poly-L-lysine, lipids, cholesterol, lipofectin, or derivatives thereof. The dose of the anti-intelligence oligonucleotide derivative of the present invention can be adjusted depending on the condition of the patient. For example, a dose of 0.1 to 1 mg/kg, preferably a dose of οι to 50 mg/kg, can be used. The present invention also encompasses a small interfering RNA (siRNA) comprising a sequence of one of the nucleotide sequences of the SEQ ID NO: 1 and a combination of a nucleic acid strand and a counter-nucleic acid strand. More specifically, such siRNA for inhibiting the expression of RNF43 includes a nucleotide sequence comprising a nucleotide sequence of sequence number 19, 20, 21, or 22.

2125-5994-PF(N2); Chiumeow.ptd Page 37 1324608 V. INSTRUCTIONS (33) The term "siRNA" refers to a double-stranded RNA molecule that transcribes this target mRNA. The introduction of si RNA into cells using standard techniques involves the use of DNA as a template to transcribe RNA. The above siRNA comprises a cisplatin sequence encoding a polynucleotide of human RNF43 protein (SEQ ID NO: 1) and an antisense nucleic acid sequence. This siRNA is constructed such that a single transcript (double stranded RNA) has both a compliant and complementary reverse sequence of the target gene, such as a U-shaped hairpin. This method is used to alter the gene expression of a cell, meaning , re-adjust the amount of RNF43 expression, as a result of malignant transformation of cells. Binding of siRNA to the RNF43 transcript in the target cells results in a decrease in protein production of this cell. This oligonucleotide is at least 10 nucleotides in length and can be as long as the length of the natural transcript. Preferably, the oligonucleotide is 19-25 nucleotides in length. Most preferably, the oligonucleotide is shorter than 75, 50, 25 nucleotides long. An example of an RNF43 siRNA oligonucleotide that inhibits the expression of a mammalian cell comprises an oligonucleotide containing SEQ ID NO: 74-7. These sequences are each the sequence of the following s i R N A sequences. SEQ ID NO: 74, SEQ ID NO: 19, 20 (RNF43); and SEQ ID NO: 75, SEQ ID NO: 21, 22 (RNF43) The nucleotide sequence of siRNAs can be designed from a siRNA designed computer software from the Ambion website ( Http://www. ambion.com/techlib/misc/ siRNA_finder, html ). The nucleotide sequence of the siRNA is selected from the computer software by the following steps: Selection of the position of the siRNA target:

2125*5994-PF(N2); Chiumeow.ptd Page 38 1324608 V. INSTRUCTIONS (34) 1. The aa dinucleotide sequence is screened down from the AUG start codon of the target transcript. Record the position of 19 nuclear carboxylic acids next to AA and 3' as potential siRNA targets. Tuschl et al. suggested avoiding the design of regions corresponding to 5, and 3' non-translated regions (UTRs) and close to the start codon (75 test) Si RNA), as these regions may have more regulatory protein binding regions. UTR-binding proteins and/or translational initiation complexes may interfere with the binding of siRNA endonuclease complexes. 2. Compare the potential target position to the human genome database and remove any target sequences that are significantly homologous to other coding sequences. The search for homology can be performed using BLAST, which can be found on the NCBI server: www.ncbi.nlm.nih.gov/BLAST/. 3. Select the qualified target sequence and synthesize it. On Ambion, it is preferred that a plurality of target sequences along the length of the evaluated DN A can be selected. The anti-intelligence oligonucleotide or si RNA of the present invention inhibits the expression of the multi-peptide of the present invention, thereby effectively inhibiting the biological activity of the multi-peptide of the present invention. The same performance inhibitor, comprising the anti-intentional oligonucleotide or siRNA of the present invention, is useful for inhibiting the biological activity of the multi-sex of the present invention. Therefore, a composition comprising the anti-intelligic oligonucleotide or siRNA of the present invention is useful for treating a cell proliferative disease such as cancer. Further, the present invention provides a method for diagnosing a cell proliferative disease using the expression amount of the multipeptide of the present invention as a diagnostic marker. The diagnostic method comprises the steps of: (a) detecting the expression amount of the gene of the present invention in a biological slice sample; (b) making an increase in the expression amount of the gene and a cell proliferative disease such as cancer. system.

1324608 V. Description of invention (35) Sighing? The amount of expression of a gene in a particular section can be estimated from the quantification of mRNA or protein corresponding to the side-cut gene. Methods for quantifying mRNA are well known in the art. For example, the amount of mRNA expression corresponding to the gene can be measured by northern blot or RT-PCR. Since the complete nucleotide acid sequence of the Betfair gene is shown in SEQ ID NO: 1, any probe or primer that is familiar to the field can be designed to quantify the N/A gene. The amount of Μ/β gene expression can also be analyzed by analyzing the activity or amount of the protein encoded by the gene. A method for determining the amount of RNF4 3 protein is as follows. For example, immunoassays are useful for measuring proteins in biological materials. Any biological material can be used to determine its amount of protein or its activity. For example, a blood sample is analyzed with a serum marker to estimate this protein. Alternatively, a suitable method can be used to determine the activity of a protein encoded by a strong gene. It is estimated that the expression of the (4) gene in one sample (test sample) is compared with the normal sample. When this comparison shows that the target gene is presenting more than the normal sample, the subject is judged to have a cell proliferative disorder. The amount of gene expression in the normal sample and the sample taken from the subject can be measured at the same time. The normal range of or the amount of performance can be determined by statistical methods based on the gene expression of the control group collected in advance. The result obtained from a subject sample is compared with the above normal range; when the result is not within the normal range, the subject is determined to have a cell proliferative disease. In the present invention, the diagnosed cell-producing disease is preferably cancer. More preferably, when the amount of expression of the exogenous gene is estimated, the disease to be diagnosed is colorectal cancer, stomach cancer or lung cancer. In the present invention, a diagnostic agent for diagnosing a cell proliferative disease such as cancer, including colorectal cancer, stomach cancer, and lung cancer is also provided. Diagnosis of the present invention

1324608 V. INSTRUCTIONS (36) The breaker contains a compound whose disc is too close. Preferably, the acid or polypeptide is used as the acid, and the core which is heterozygous for the polynucleic acid of the present invention corresponds to the antibody of the polypeptide of the present invention. Further, the present invention provides a screening test for the use of the compound of the present invention for the treatment of a cell proliferative disorder. An embodiment of the method comprises the steps of: (a) subjecting a test compound to a multi-peptide of the invention: (8) measuring the binding activity of the test compound to the multi-peptide of the invention, and (C) selecting one The compound 'which binds to the multi-peptide of the invention. The multi-peptide of the present invention screened may be a recombinant polypeptide or natural protein, or a partial multi-peptide thereof. Any test compound, for example, cell extract, cell culture suspension, product of microbial fermentation, marine organism extract, plant extract, purified or natural protein, peptide, non-peptide compound, synthetic micromolecular compound and Natural compounds can be used. The multi-peptide of the present invention which is contacted with the test compound may be, for example, a purified polypeptide, a soluble protein, a form that binds to a vector, or a fusion protein fused to other multi-peptides. Many methods well known in the art can be used in the method of using the multi-peptide screening protein of the present invention, such as in combination with the multi-peptide of the present invention. Such screening can be performed by 'e' immunoprecipitation, more specifically, as described below. The gene encoding the multi-peptide of the present invention is expressed in an animal cell by inserting the gene into a expression vector such as pSV2neo, pcDNA I and pCD8. The promoter used for this expression can be any commonly used promoter, including 'SV40 early promoter (Rigby in Williamson (ed.), genetic engineering, vo1. 3. Academic)

2125-5994*PF(N2); Qiiuiiieow.ptd Page 41 1324608 V. Description of invention (37)

Press, London, 83-1 41 (1 982)), EF-1 α promoter Kim et al., Gene 91·· 21 7-23 (1 990)), CAG promoter (Niwa et al., Tnen 1) 08: 1 93-200 (1 991 )), RSV LTR promoter (Cullen, Methods in Enzymology 152: 684-704 (1987)), Sra promoter (Takebe et al., Mol Cell Biol 8: 466 (1 988) )) 'CMV immediate early promoter (Seed and Aruffo, Proc Natl Acad Sci USA 84: 3365-9 (1987)) 'SV40 late promoter (Gheysen and Fiers, J Mol Appl gene t 1: 385-94 (1 982 )) 'Adenovirus late promoter (Kaufman et al., Mol Cell Biol 9: 946 (1989)), HSV TK promoter and the like. The step of introducing a gene into an animal expressing a foreign gene can be carried out according to any method, for example, electroporation method (Chupor al., Nucleic Acids Res 15·1 3 1 1 -26 (1 987)), calcium phosphate. Method (calcium phosphate method > Chen and Okayama, Mol Cell Biol 7: 2745-52 (1987)), DEAE glucomannan method (Lopata et al., Nucleic Acids Res 12: 5707-17 (1984); Sussman and Milman , Mol Cell Biol 4: 1642-3 (1985)) '

Lipofectin method (Derijard, B Cell 7: 1 025-37 (1 994), · Lamb et al., Naturegenetics 5: 22-30 (1993): Rabindran et al., Science 259: 230-4 (1993)), etc. Wait. The multi-peptide of the present invention can be expressed in the form of a fusion protein comprising an epitope of a monoclonal antibody which is determined by the introduction of a specific monoclonal antibody antigen which is confirmed to be located in the N- of the multi-peptide of the present invention. C-end. be usable

1324608 V. INSTRUCTIONS (38) A commercially available epitope-antibody system (Exper i menta 1 Medicine 1 3: 85-90 (1 995)). A vector capable of expressing a fusion protein having, for example, /9-galactosidase (/51318 (:1; 051 (1356), maltose binding protein, face-acidic acid-S-trans 4 匕 enzyme ( Glutathione S-transferase, green fluorescent protein (GFP), etc., which utilize a plurality of replication sites, are commercially available. The present invention also encompasses a fusion protein which is introduced from only a few to 12 Prepared by small epitopes of amino acids to avoid altering the peptides of the present invention. Antigenic epitopes such as histtag, inf luenza aggregate HA, human c-myc, FLAG, sachet Stomatitis virus glycoprotein, (VSV-GP), T7 gene 1.0 protein (T7~tag), human vesicular virus glycoprotein (HSV-tag), E-tag (-single phage antigen epitope), etc. 'And the monoclonal antibodies recognizing them can be used to identify the anti-antibody system 13: 85-90 (1995). The immunoprecipitate is formed by using this multi-peptide to use the anti-localization antibody, an immunization When the IgG antibody is ligated, if it is a fusion protein of the present invention, one is immunized. This immune complexation The antibody of the conjugated peptide can be precipitated using the protein A, the multi-peptide, the immune complex, the silver, the sputum, and the cell lysate, including the multi-peptide of the present invention, and It has a multi-peptide and an antibody. Immunoprecipitation can also be carried out by immunizing the antibody without using the above anti-antigen. The antibody is a mouse (4) (4) K protein G-lipose condensed with an antigen (such as GST) fusions can be used to fight against the present day

2125-5994-PF(N2); Chiumeow.ptd Page 43 1324608 V. Description of the invention (39) The formation of an antibody using a substance that specifically binds to this epitope, such as a glutathione-agarose gel Glue 4B. Immunoprecipitation can be performed as described in the literature (Harlow and Lane, Antibodies, 511-52, Cold Spring Harbor Laboratory publications, New York (1988)). SDS-PAGE is commonly used to analyze immunoprecipitated proteins, and the linked proteins can be analyzed by molecular weight of the protein using a gel of appropriate concentration. Since the protein bound to the multi-peptide of the present invention is not easily detected by the general staining method, Coomassie staining or silver staining (Siiver staining), the detection sensitivity of the protein can be determined by the culture medium containing the radioisotope 35S-methionine or S_cystein. The cells are cultured, the proteins in the cells are labeled, and the protein is detected and improved. The target protein can be directly purified from SDS-polyacrylamide gel, and the sequence can be confirmed when the molecular weight of a protein is revealed. As a method of screening a protein which binds to the polypeptide of the present invention, for example, West-Western blotting analysis (Skolnik et al., Cell 65: 83 '90 (1991)) can be used. In particular, a protein that binds to the multi-peptide of the present invention can be obtained by preparing a cDN A database. This cDNA library can be obtained from cells, tissues, organs (with RNF4; 3 binders, eg, fetal lung, fetal kidney tissue) Or a cultured cell which is expected to exhibit a protein which binds to the compound of the present invention, which is expressed on a lb-agar gel using a sputum carrier (such as ZAP) to immobilize the expressed protein on a filter paper. The purified and labeled multipeptide of the present invention is reacted with the above filter paper, and colonies expressing the protein which binds to the multipeptide of the present invention are detected via the label. The multi-peptide of the present invention can be labeled as follows: using organisms; egg white 1324608 V., invention instructions (40), or using antibodies that specifically recognize the multi-peptide of the present invention, or a peptide that is fused to the multi-peptide of the present invention or Peptide (such as GST). Radioisotopes or fluorescent methods can also be used. Or in another embodiment of the screening method of the present invention, a two-hybrid system using cells ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER Two-Hybrid Assay Kit" , "MATCHMAKER one-Hybrid system"(Clontech);"HybriZAP Two-Hybrid Vector

System" (Strata gene); see "Dalton and Treisfflan,

Cell 68: 597-612 (1992) ", "Fields and Sternglanz, Trends Genet 10: 286-92 (1994)"). In a double hybrid system, the multipeptide of the invention is fused to the SRF_binding region or the GAL4-binding region and expressed in yeast cells. A cDNA library is prepared from cells expected to exhibit a protein that binds to the multipeptide of the present invention, which is expressed in fusion with the VP1 6 or GAL 4 transcriptional activation region. Introducing the c/NA database into the above-mentioned yeast cells and separating them from the positive transgenic plants, and the cDNA derived from this database (when expressed in a protein cell that binds to the multi-peptide of the present invention) A reporter gene is reported to enable a positive transgenic strain to be detected. ^ - This is obtained by "the protein encoded by the protein is encoded by J. (7) " and the protein is expressed. The field is introduced as a reporter gene except HI. In addition to the S3 gene, the Ade2 gene, the lacZ gene, the CAT gene luciferase, the (luci f erase) gene, etc. ... the protein which binds to the multi-peptide of the present invention can also be sieved using affinity and force chromatography. Page 45 2125-5994*PF(N2); Chiumeow.ptd 1324608 V. INSTRUCTION DESCRIPTION (41) Inspection. For example, the multi-segment of the present invention can be immobilized on a medium of affinity chromatography. The test compound of the multipeptide-binding protein of the present invention is added to the column. Here, a test compound may be, for example, a cell extract, a cell lysate, etc. After the test compound is added, the column is washed. 'The protein bound to the multi-peptide of the invention can be prepared When the test compound is a protein, the amino acid sequence of the obtained protein is analyzed, and an oligo DNA is synthesized according to the sequence, and the cDNA library is screened by using the oligo DNA as a probe to obtain the dnA of the protein. A biosensor using surface plasmon resonance can be used for the detection or quantification of the linked compounds in the present invention. When such a biosensor is used, the polypeptide of the present invention is tested The reaction of the compound can be observed immediately by surface plasmon resonance signal, which uses a small amount of multi-peptide and does not need to be labeled (for example, BiAcore, Pharmacia). Therefore, the combination between the multi-peptide of the present invention and the test compound can be used. A biosensor, such as BIAc〇re, is evaluated. When the immobilized multi-peptide of the present invention is exposed to a synthetic chemical compound, a natural substance, or a random phage display peptide library, its screening and immobilization & Methods for binding molecules with multiple peptides, and screening methods using high-throughput quantitative academic combinations (Wrighton et al., Science 273: 458-64 (1 996); Verdme, Nature 384: 1 1 -1 3 (1 996)· Hogan, Nature 384: 1 7_9 (1 996 )), to isolate proteins and compounds (including synergists and antagonists) in combination with the present invention are well known in the art. Alternatively, the screening method of the present invention may comprise the following steps:

2125-5994-PF(N2); Qiiumeow.ptd 丄324608

V. Description of the invention (42)

(3) A candidate compound and a vector-containing vector containing the RNF43 and the domain 'RNF43 and the reporter gene line are present, the cells are in contact with the control group of the transcription control region of the reporter gene. b) measuring the activity of the reporter gene; and • the amount of performance (c) compared to a control group, selecting a compound that reduces the reporter. earth

The desired primary cells are well known in the art. ::: Report: The structure can be prepared from a transcriptional control region using a marker gene. : The transcriptional control region of the standard δ gene is well known in the art, a report ::: preparation. When a marker gene (4) = system & is not yet defined, a nucleotide sequence containing the nucleoside-binding gene of the transcriptional control region is derived from the base. Separation of the Tuen Mun Group 注 注 : : : : : : : : : : : : : : : : : , , , , , , , , , , , , , , , , , , , , , , , , The screening method is based on the activity of the multi-peptide combination of the present invention, and can be added to a ^ ^ / 喆 喆 + + ^ A, by adding, deleting and

The range of compounds. In another embodiment, the present invention provides a screening target drug agent for treating a cell proliferative disease with a potential target & the colorectal cancer =, the occurrence and development of the liver cancer can be control. Therefore, as a therapeutic cell proliferation

2125-5994-PF(N2); Chiurae〇w.ptd

1324608 V. INSTRUCTIONS (43) Candidate agents for potential disease targets can be identified by screening. The screening is based on the performance and activity of RNF43. In accordance with the present invention, the screening may comprise the following steps: a) contacting a candidate compound with a cell that exhibits RNF43; and b) selecting a compound that reduces the amount of RNF43 expression compared to the absence of the candidate compound. Field-expressing cells of RNF43 include, for example, cell lines established from colorectal cancer, lung cancer, cancer or liver cancer, and such cells can be used for the screening of the present invention described above. The amount of performance can be assessed by methods well known in the art. In the screening method, a compound which reduces the amount of RNF43 expression can be selected as a candidate agent. In another embodiment of the method for screening a cell proliferative disorder of the present invention, the method utilizes the biological activity of the multipeptide of the present invention as an indicator. Since the RNF43 protein of the present invention has an activity of promoting cell proliferation, the activity of promoting or inhibiting a protein of the present invention can be screened by using the biological activity as an index. The screening method comprises the steps of: (a) contacting a test compound with a multi-peptide of the invention: (b) detecting the biological activity of the multi-peptide in step (a) and comparing (c) A compound that inhibits the biological activity of the multi-peptide is selected as compared to the biological activity of the multi-peptide without the test compound. Any multi-peptide can be used for screening as long as it has the biological activity of the RNF43 protein. Such biological activities include the cellular proliferative activity of the human RNF43 protein and the activity of binding of RNF43 to NOTCH2 or STRIN. For example, a human RNF43 protein and a multi-peptide that is functionally equivalent to this protein can be used. Such multi-peptides can be expressed endogenously or exogenously.

2125-5994-PF(N2) ;Chiumeow.ptd Page 48 1324608

Any test compound, such as cell extracts, cell culture suspensions, products of microbial fermentation, marine organism extracts, plant extracts, purified or natural proteins, peptides, non-peptide compounds, synthetic micromolecular compounds and natural Compounds can be used. The compound isolated by screening is a candidate antagonist of the multipeptide of the present invention. The term "antagonist" refers to a molecule which inhibits the function of the multipeptide of the present invention by binding. In addition, the compound isolated by this screening is a candidate for the interaction of the peptide with the molecule (including DNA and protein) in vivo. 0 When the present invention is used to detect the cell cycle of the cell, the screening of the candidate cell proliferation, the biological treatment of the large intestine, and the acquisition and deletion method to obtain the biological activity detected by the method of the present embodiment is cell proliferation. At this time, it is possible to prepare cells expressing the multi-peptide of the present invention, culture the cells under a test compound, measure the rate of cell proliferation, measure the two types, and measure the population-forming activity as described in the examples. The isolated compound is tested to inhibit the multi-peptide bioactive drug of the present invention, which can be used for diseases associated with the multipeptide of the present invention, such as diseases, including cancer. More specifically, when the protein property of RNF43 is used as an index, the compound isolated by this screening is a drug candidate for treating lung, stomach, or liver cancer. , a, a compound, wherein a part of the structure is active by the above-described screening method in combination with the multi-peptide of the present invention, and/or substitution conversion, both of which comprise a range of compounds from the present invention: . Another method of screening for the treatment of a cell proliferative disease, the method uses the ability of RNF43 to combine with N0TCH2 or STRIN 1324608 V. Inventive Note (45) Force. The MF43 protein of the present invention has been shown to be associated with N0TCH2 and STRIN. This finding suggests that the RNF43 protein of the present invention exerts its cell proliferation function by binding to molecules such as N0TCH2 and STRIN. Therefore, inhibition of binding of RNF43 to NOTCH2 or STRIN is thought to result in inhibition of cell proliferation, and a compound which inhibits this binding can be used as a drug for treating a cell proliferative disease such as cancer. Preferably, the cell proliferative disorder treated by the compound obtained by the screening method of the present invention is the large intestine, lung, stomach, or liver cancer. This screening method comprises the steps of: (a) contacting the multipeptide of the present invention with NOTCH2 or STRIN in the presence of a test compound; (b) detecting the binding between the multipeptide and N0TCH2 or STRIN And (c) selecting a test compound that inhibits the binding activity between the multi-peptide and NOTCH2 or STRIN. The RNF43 multipeptide of the present invention for screening, and N0TCH2 or STRIN may be a recombinant polypeptide or a naturally derived protein, or a partial peptide thereof, as long as it still has the ability to bind to each other. The MF43 multipeptide, N0TCH2 or STRIN used for screening may be, for example, a purified polypeptide, a soluble protein, a form bound to a medium or a fusion protein fused to other proteins. Any test compound, such as cell extracts, cell culture suspensions, products of microbial fermentation, marine organism extracts, plant extracts, purified or natural proteins, peptides, non-peptide compounds, synthetic micromolecular compounds and natural Compounds can be used. In screening methods for inhibiting the binding of RNF43 protein to N0TCH2 or STRIN, many methods well known in the art can be used. Such screening

2125-5994-PF(N2); Chiumeow.ptd Page 50 1324608 V. Description of the Invention (46) The assay system can be performed in a test tube, for example, an acellular system. More specifically, first, one of the 1 liver 34 protein ' or N0TCH 2 or STRIN is immobilized on a support, and the other protein is added together with a sample to be tested. Next, the mixture is allowed to stand, washed and detected and/or measured for another protein immobilized on the above support. Examples of the support which can be used for the immobilized protein include insoluble polysaccharides such as agarose, cellulose, and dextran; and synthetic resins such as polyacrylamide and polyphenylene. Ethylene (p〇iyStyrene) and Shi Xi; preferably, commercially available microbeads and analytical discs (e.g., porous discs, biosensing wafers, etc.) made of the above materials can also be used. When microbeads are used, they can be filled into a column. Fixing a protein to a support can be carried out according to conventional methods such as chemical bonding and physical absorption. Alternatively, a protein can be immobilized on a support via an antibody that specifically recognizes the protein. Alternatively, immobilization of the protein on a support can be achieved by a combination of biotin and avidin. The binding between proteins is carried out in a buffer such as, but not limited to, phosphate buffer and Tris buffer, as long as the buffer does not inhibit binding between proteins. In the present invention, a biosensor using surface plasmon resonance can be used for detection or quantification of linked proteins. When such a biosensor is used, the reaction between the proteins can be immediately observed via a surface plasmon resonance signal using a small amount of multi-peptide without labeling (e.g., 'BIAcore, Pharmacia). Therefore, this payment

Page 51 2125-5994-PF(N2); Chiumeow.ptd 1324608 V. INSTRUCTION DESCRIPTION (47) The binding between the MF43 protein and N0TCH2 or STRIN can be assessed using a biosensing benefit such as BIAcore. Alternatively, one of the RNF43 polypeptide, or one of N0TCH2 or STRIN, can be labeled' and the label on the linked protein can be used to detect or measure the ligated protein. Specifically, 'after pre-labeling one of the above proteins, the labeled protein is contacted with another protein in the presence of the test compound, and then after rinsing, the link is detected or measured by this mark. protein. Labeling substances 35S, 1251, 1311) phosphatase) peroxidase), such as radioisotopes (eg, 3H, 14C, 32p, 33p, 1 enzyme (such as phytochemical (alkaline sylvestre root peroxidase (horseradish cold-galactose enzyme ( 9-gong 313 (: 1:081 (1 & 86), β-glucosidase), fluorescent substances (eg, fluorescein isothiosyanete (FITC), rhodamine), and Biotin/avidin, etc., can be used to label a protein in the method. When the protein is labeled with a radioisotope, the detection or measurement can be carried out via a liquid flash. Alternatively, the protein labeled with an enzyme can be added. The ligand of this nutrient is detected or measured by measuring its enzyme change, such as using an absorpt iometer to measure the color generation. Further, when using a fluorescent substance as a label, the linked protein can be detected by the light meter. In addition, the combination of RNF43 peptide and N0TCH2 or STRIN can also be detected or measured using antibodies against RNF43 peptide and N0TCH2 or STRIN. For example, more RNF43 immobilized on a support. Of a peptide tested

2125*5994-PF(N2); Chiumeow.ptd Page 52 1324608 V. INSTRUCTIONS (48) After contact with N0TCH2 or STRIN, the mixture is allowed to stand and rinsed, and detected by antibodies against N0TCH2 or STRIN or measuring. Alternatively, N0TCH2 or STRIN can be immobilized on a support while an antibody against RNF43 is used. When an antibody is used in the screening, the antibody is preferably a label having one of the above-mentioned labeling substances, and is detected or measured based on the label. Alternatively, an antibody against RNF43 polypeptide, N0TCH2 or STRIN can be used as a primary antibody and then detected by a labeled secondary antibody. In addition, the antibody bound to the protein in the screening of the present invention can be detected or measured by a protein G or protein A column.

In another embodiment of the screening of the present invention, a two-hybrid system ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER Two-Hybrid Assay Kit", "MATCHMAKER one can be used. -Hybrid system"(Clontech);"HybriZAP Two-Hybrid Vector System" (Strata Gene); Reference 11 Dalton and Treisman, Cell 68: 597-612 (1992), Fields and Sternglanz, Trends Genet 10: 286-92 ( 1994) "). _ In the double hybrid system, the RNF43 multipeptide of the present invention is combined with SRF-

The region or GAL4-binding region fuses and behaves in yeast cells. The N0TCH2 4STRIN, which binds to the RNF43 polypeptide of the present invention, is fused to the scale 6 or GU4 transcriptional activation region and expressed in yeast cells in the presence of a test compound. When the test compound does not inhibit the two-node β between the RNF43 polypeptide and N〇TCH2 or STRINi, the binding of the two activates a reporter gene, allowing the positive transfectant to be detected. ,

V. Description of the invention (49) For a reporter gene, in addition to the HIS3 gene, for example, the gene, the la^Z gene, the CAT gene, and the luciferase gene can be used. The sifting compound is a candidate agent that inhibits the binding between the RNF43 polypeptide and the N0TCH2, and can be used to treat an RNF43 phase, such as a cell proliferative disease such as cancer. Or more specifically, the large intestine is straight, "lung cancer, stomach cancer or liver cancer. In addition, a compound whose part inhibits the binding between RNF43 polypeptide and N0TCH24STRIN can be transformed by addition, deletion and/or substitution. They all contain a range of compounds obtained by the screening methods of the present invention.

a compound isolated by the method of the present invention as a medicament for human sputum, [, it is a mammal, such as a mouse, a rat, a guinea pig, a rabbit, a cat, a two sheep, a pig, a cow, a monkey, a chimpanzee, When a cell is added to a disease such as cancer, the isolated compound can be used as it is or directly in a pharmaceutical form using a known pharmaceutical method. For example, depending on the dosage, the agent is administered orally, such as a sugar-coated tablet, capsules and microcapsules; or a parenteral form, such as a two-injection solution or a suspension of water or other pharmaceutically acceptable liquid. Example a, the compound may be mixed with a pharmaceutically acceptable carrier or base, especially sterilized water, physiological saline, vegetable oil, emulsifier, suspending agent, boundary=active agent, stabilizer, fragrance, bismuth agent, The delivery agent, the antiseptic agent, the bonding agent, and the like, form a generally acceptable unit dosage form. The active ingredients contained in these formulations are within the range available. Examples of additives which can be mixed with the tablets and capsules are, for example, adhesives such as tragacanth gum and arabic gum; excipients such as crystalline cellulose (crystalline)

1324608 V. Description of invention (50) cellulose); swelling agent such as corn; house powder, gelatin and alginic acid; lubricants, such as stearic acid; sweeteners such as sucrose, lactose or saccharin; Seasonings such as mint, Gaul theria adenothrix oil and floor peaches. When the unit dosage form is a capsule, a liquid medium, such as an oil, may be further included in the above ingredients. The sterile composition for injection can be prepared according to a general pharmaceutical preparation method using, for example, distilled water for injection.

Physiological saline, glucose, and other osmotic liquids, including adjuvants such as D-sorbitol, (D-mannnose), (D-mannitol), and sodium chloride, can be used as aqueous solutions for injection. These can be used with suitable cosolvents such as alcohol 'especially ethanol, p〇lyalc〇h〇is such as propylene glycol and polyethylene glycol 'nonionic surfactants such as p〇iyS〇rbate go (tm) and HCO-50 » Sesame or soy oil can be used as an oleaginous liquid and can be used with benzyl benzoate benzyl aU〇h〇1 help

Solvent) and can be formulated with buffers, such as phosphate buffer and sodium acetate buffer - analgesics, such as procaine hydrochloride; stabilizers, such as stupid; (benzyi alc〇h〇1), 纷(phen〇1), and primary resistance. Prepared. The injection can be filled into a suitable preparation, and can be used in patients, such as intra-arterial, intravenous, transbronchial, intramuscular or oral cavity, for use in the present invention. The compound is administered intraperitoneally, percutaneously, and nasally. Dosage and formula used

1324608 V. INSTRUCTIONS (51) -- The formula varies according to the patient's weight, age and mode of use; however, those skilled in the art can (4) judge. If the compound can be used by Xie (4), the DNA can be inserted into a vector for gene therapy, and the dosage and manner of using the carrier for the two treatments vary depending on the weight, age and mode of use of the patient, however, familiar with this The artist can easily judge. Children, such as the two cumin symptoms will be somewhat different, combined with the multi-peptide of the present invention /, when used by an adult (body weight 6 〇 kg) for oral use, is O. ^ ii ^ g to 100 ng per day, The best is about 5 〇 (4) per day, and more preferably about .mg to 2〇mg. When administered parenterally to an adult (body weight 6 〇 kg) in the form of injection, although the patient's personal status, target organs, symptoms and usage patterns may be somewhat different, in general, the intravenous dose is 〇〇1叩 to 3 per day. 〇 mg, preferably 疋 1 mg to 2 mg per day, more preferably about 〇丄 mg to 10 mg per day. In addition, when used in other animals, the dose can be converted to a weight of 6 〇 kg. Further, the present invention provides a method for treating or preventing a cell proliferative disease such as cancer, which is an antibody against a multi-peptide of the present invention. According to this method, a pharmaceutically effective amount of an antibody against the multi-peptide of the present invention is used. Since the expression level of RNF43 protein in cancer cells is increased, and inhibition of RNF43 protein expression reduces cell proliferation activity, this antibody and RNF43 protein are considered to treat or prevent cell proliferative diseases. Thus, an antibody against a multi-peptide of the present invention is used in a sufficient dose to reduce the activity of the multi-peptide of the present invention. This dosage range is about 250 mg/kg per day. The dosage range for adults is generally from about 5 mg to 17.5 g per day, preferably daily.

2125-5994-PF(N2); Chiumeow.ptd Page 56 1324608 V. Description of the invention (52) Approximately 5 mg to 10 g' and more preferably about 1 mg to 3 g per day. Alternatively, an antibody that specifically recognizes a cel 1 surf ace marker can be used as a tool for delivering a drug. For example, an antibody linked to a cytoplasmic agent can be used in an amount sufficient to harm a tumor cell. The invention also relates to a method of eliciting an anti-tumor immune response comprising the steps of using an RNF43 protein, an immunologically active fragment thereof or a polynucleotide encoding the protein or fragment. This rNF43 protein or a fragment thereof having immunological activity is an effective vaccine against cell proliferative diseases. In some cases, the protein or fragment may be associated with a T cell receptor (TCR) or an antigen presenting cell (APC, such as a sputum cell, a dendritic cell (DC) or a B-cell). The form of performance is used. Since DC has a strong antigenic performance, the use of DC is the best of all APCs. In the present invention, a vaccine against cell proliferative diseases refers to a substance which, when implanted in an animal, has a function of causing an antitumor immune response. According to the present invention, the multi-span of the amino acid sequence comprising the sequence identification number 4 2, 5 9 or 70 is considered to be an epitope-restricted epitope of HLA-A24 or HLA-A*020 1 , It may have the function of eliciting an effective and specific immune response against large colon, lung, stomach or liver cancer cells expressing RNF43. Accordingly, the present invention also encompasses a method of eliciting an anti-tumor immune response function using a multi-peptide comprising the amino acid sequence of SEQ ID NO: 42, 59 or 70. In general, the function of an anti-tumor immune response involves the following immune response: initiation of cytotoxic lymphocytes to

2125-5994-PF(N2) ;Chiuir,eow.ptd Page 57 1324608

Anti-tumor, activates antibodies that recognize tumors, and initiates production of anti-tumor cytokine. Therefore, when a specific protein causes any of the above-mentioned immune responses after implantation into an animal, the protein is confirmed to have a function of causing an anti-tumor immune response. Induction of anti-tumor immunity via a protein can be detected by observing the response of the in vivo immune system in the tube. For example, the method of detecting the initiation of c y t 〇 t ο X i c T lymphocytes is well known. A foreign substance entering an organism will be revealed by the antigen...

(APCs) are presented to tau cells and b cells. The tau cells respond to the antigen expressed by APC in the form of antigen specificity, and differentiate into cytotoxic T cells (cytotoxic T lymphocytes; CTLs) and proliferate (the so-called tau cell activation process) due to stimulation of the antigen. Therefore, a CTL caused by a specific multi-peptide can be judged by APC displaying the multi-peptide to T cells and detecting the CTL. Further, Apc has the ability to activate CD4+ τ cells, CD8+ sputum cells, phage, erythrocytes (eosinophi ls), and cells. Anti-tumor immunity due to CD4+ T cells and CD8+ T cells

It is important that the anti-tumor immune response caused by this multi-peptide is evaluated by the degree of activation of these cells. Methods for assessing CTL initiation using dendritic cells (DCs) as APCs are well known in the art. The DC system shows APC#' which has the strongest CTL activation effect in APC. In this method, the multi-score is first contacted with DC' then the DC is in contact with the cell. After contact with DC, 'detecting T cells with cytotoxic effects on the target cells, showing

1324608 V. INSTRUCTIONS (54) Measuring the number of J9 is too active to initiate cytotoxic T cells. The activity of CTL against tumors can be detected as follows, for example, using lysates of Cr-labeled tumor cells as index. Alternatively, 3 Η -thymidine nucleoside or lactate dehydrogenase (LDH, lactose dehydrogenase) release may be used as an indicator of tumor cell destruction. In addition to DC, peripheral mononuclear blood cells (PBMCs) can also be used as APCs. The initiation of CTL has been shown to be potentiated by culturing PBMC in an environment containing GM-CSF and IL-4. Similarly, CTL has been shown to be potentiated by culturing pbmc in an environment containing keyh〇le liBjpet hemocyanin (KLH) and IL-7. It was confirmed by these methods that the tested multi-peptide system which controls the C τ L-priming activity has DC activation efficacy and post-CTL activation activity. Therefore, multi-peptides that initiate CTL against tumor cells are suitable for use as anti-tumor vaccines. Furthermore, Apc having the ability to initiate CTL against tumor cells by contact with this multi-peptide is suitable as an anti-tumor vaccine. In addition, CTLs that exhibit this multi-peptide and have cytotoxic ability via Apc can also be used as anti-tumor vaccines. Such anti-tumor immunotherapy methods using Apc and CTL are so-called cellular immunotherapy. In general, when multi-peptide is used for cellular immunotherapy, it is known to combine several peptides with different sisters, &ττ * #d, anchor & 裎tm and make them η with DC When using a protein fragment, it is advantageous to use several fragments. Antibody 3 is more than:: cited;: swollen U can be observed in anti-tumor animals, causing resistance to this multi-winning ": body test === some antibody inhibition, this multi-win can be determined to have "start; 2 = Page 59 2125-5994-PF (N2); Chiumeow.ptd 1324608 V. Description of the invention (55) Ability to react. The anti-tumor immune response is initiated by the use of the vaccine of the invention, and initiation of the anti-tumor immune response allows for the treatment or prevention of a cell proliferative disorder, η cancer, lung cancer, gastric cancer or liver cancer. Treatment of cancer or prevention (4) Health includes any of the following steps, such as inhibiting the growth of cancer cells, repelling cancer, and inhibiting the onset of cancer. Reduces mortality in cancer patients, tumor markers in the fluid, and alleviates cancer complications. It is included in the treatment or prevention of cancer. This type of second or second syndrome = "疋 is of statistical importance. Example #, when controlled with and without a vaccine (a vaccine, anti-cell proliferative disease treatment or prevention heart = Slgniflcance level ^% or lower. For example, you can use Student, s t-test, Mann_Whit anova for statistical analysis. est ^ The above immunologically active protein or the combination of the drug coded with this protein. One adjuvant refers to a compound 1 and this has the: protein together (before and after) when used Examples of medicines include, but are not limited to, cholera toxins and exo-J: the vaccine of the present invention may suitably be pharmaceutically-acceptable. Examples of such media are: steaming water, physiological salt, and phosphoric acid. In addition, the above vaccine may include a stable bite, a surfactant, a surfactant, etc. The vaccine may systemically or partially administer the h vaccine as a single-time or several times. = 朦C or CTL as a vaccine of the present invention, which can be treated or prevented as follows, for example, via an in vitro method. More precisely, collection and acceptance

1324608 V. INSTRUCTIONS (56) PBMCs of a subject to be treated or prevented are contacted with the above-mentioned multi-peptide in vitro, and the cells can be used on the subject after APC or CTL is initiated. APC can also be initiated by introducing a vector encoding this multi-peptide into PBMC in vitro. APC or CTL initiated in vitro can be transferred prior to use. Cell-immunotherapy can be performed more efficiently by transferring and culturing cells that have high activity against harmful target cells. Further, APCs and CTLs isolated in this manner can be used for cellular immunotherapy, not only for the subject providing the cells, but also for another body having a similar tumor. The present invention further provides a therapeutic or prophylactic cell proliferative disorder

Pharmaceutical composition comprising a pharmaceutically effective amount of a multi-peptide of the invention. This pharmaceutical composition can be used to develop an anti-tumor immune response. The normal performance of rNF43 occurs only in the fetus, more precisely in the fetal lungs and kidneys. Therefore, inhibiting the lake gene does not affect other organs. Therefore, RNF43 peptide is also suitable for the treatment of cell proliferative diseases, especially colorectal cancer and lung. In addition, since the RNF43 contains a sequence identification number 42, the .r ^ ^ column of the peptide fragments are each confirmed to cause an anti-RNF43 ίίif+i sequence identification number 42, 59 and 70 amino acid sequence "peptide 疋 is preferably available Diseases in the characters of a pharmaceutical group (special s, 丨 "The treatment or prevention of cell growth in the eye of the eye"

Invention </ RTI> </ RTI> </ RTI> </ RTI> </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> </ RTI> <RTIgt; For example, the Img of this multi-fruit seven sugar ug can be repeated with 虿疋. Example Tumor immune response 使用 Use four times a week to cause resistance

Page 61 1324608 V. INSTRUCTIONS (57) '-*' The following examples are merely illustrative of the present invention and are intended to facilitate the manufacture and use of the present invention. These examples do not limit the scope of the invention. Unless otherwise stated, all technical and scientific terms used herein are the same as those familiar to those skilled in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. Any patents, patent applications, and publications cited herein are hereby incorporated by reference. The present invention is described in detail by the following examples, but is not limited to the examples. 1. Materials and methods (1) Patients and tissue sections All gastric cancer and colorectal cancer tissues, and corresponding non-cancer tissues, are obtained by consent. Surgical section of the patient who opened the knife. (2) Genomic DNA microarray This study used the internal genome cdNA microarray containing 23040 genes to extract the complete RNA extract from the microanatomical tissue after treatment with DNase I, with Ampliscribe T7 Transcription Kit (Epicentre Technologies) J# and labeled with Cy-dye (Amersham) during reverse transcription (non-cancer tissue RNA:

Cy 5 ; tumor RNA : Cy3). Hybridization, washing and detection were performed as described above (Ono et al., Gene Res. 60: 50 07-1 1 (2000)), and Cy points of each target point were measured with Array Vision software (Amersham Pharmacia). Fluorescence intensity of 5 and Cy 3. After subtracting the background signal, take each

2125-5994-PF(N2); Chiumeow.ptd Page 62 1324608 V. INSTRUCTIONS (58) The average of the two results of the points. Next, all camp light intensities on each slide were lifted to adjust the average Cy5 and Cy3 intensities of the 52 housekeeping genes. Genes with cy5 and Cy3 intensities below 25,0 0 fluorescent units were excluded from further studies, while those with a Cy3/Cy5 signal ratio greater than 2.0 were studied. (3) Cell line Human fetal kidney 293 (HEK293) was obtained from TaKaRa°C0S7 cells, NIH3T3 cells, human cervical cancer cell line HeLa, human gastric cancer cell lines MKN-1 and MKN-28, human liver cancer cell line Alexander and human Colorectal cancer cell lines LoVo, HCT116, DLD-1 and SW480 are obtained from the American Type Culture Collection (ATCC,

Rockville, MD). Human liver cancer cell line SNU475 and human colorectal cancer cell line, SNUC4 and SNUC5, etc., were obtained from Bank of Korea Cell Bank. All cells were grown in a single layer in appropriate cultures: C0S7, NIH3T3, HEK293 and Alexander using Dulbecco's modified Eagle's; MKN-1, MKN-28, SNU475, SNUC4, DLD-1 and SNUC5 using RPMI1640; HCT116 use McCoy's 5A medium ; SW48 0 uses Leibovitz's L-15; LoVo uses HAM's F-12; HeLa uses Eagle's mini mum essential medium (Life Technologies, Grand Island, NY) ° All cultures are supplemented with 10% fetal bovine serum and 1% antibiotic /antimycotic solution (Sigma). A human gastric cancer cell line St-4 was supplied by Dr. Tsuruo of Cancer Institure, Japan. The St-4 cell line was in RPMI 1 640 containing 10% fetal bovine serum and 1% antibacterial/antimycotic solution (Sigma).

1324608 V. INSTRUCTIONS (59) Growth in a single layer. T2 cells (HLA-A*020 1 ) and EHM (HLA-A3/3), and human B-type lymphoblastoid cells (B-lymphoblastoid) were given by Prof. Shiku (Univ. Mie). HT29 (colorectal cancer cell line; HLA-A2 4/01). WiDR (colorectal cancer cell line; HLA-A24/01) and HCT116 (colorectal cancer cell line; HLA-A02/01), DLD-1 (colorectal cancer cell line; HLA-A24/01), SNU475 (liver cancer) The cell line; HLA-A*020 1 ) was also purchased from ATCC. TISI cells (HLA-A24/24) were given by Takara Shuzo Co, Ltd. (Otsu, Japan).

(4) RNA preparation and RT-PCR Total RNA (total RNA) was obtained by Qiagen RNeasy kit (Qiagen) or Trizol reagent (Life Technologies) according to the procedure provided by the manufacturer. 10 mg of complete RNA was reverse transcribed into single-stranded cDNA with poly dT丨2_18 primer (Amersham Pharmacia Biotech) and Superscript II reverse transcriptase (Life Technologies). Each single strand of cDNA was diluted for subsequent PCR proliferation using standard RT-PCR experiments, 20 v 1 PCR buffer (TaKaRa). The proliferation line was performed under the following conditions: metamorphism at 94 °C for 4 minutes followed by a start of 20 (for GAPDH), 30 (for RNF43) in the gene amplification PCR system 9 700 (Perkin-Elmer, Foster City, CA) °C, 30 seconds, 56 t:, 30 seconds, and 72 °C, 45 second cycle. The primer sequence is: GAPDH: forward: 5'-ACAACAGCCTCAAGATCATCAG (SEQ ID NO: 3) and reverse: 5'-GGTCCACCACTGACACGTTG (SEQ ID NO: 4); RNF43 Forward: 5'-CAGGCTTTGGACGCACAGGACTGGTAC-3' (SEQ ID NO: 5 ),

2125-5994-PF(N2); Chiumeow.ptd Page 64 1324608 V. Description of the invention (60) Reverse: 5'-CTTTGTGATCATCCTGGCTTCGGTGCT-3' (sequence identification number 6). (5) Northern blot analysis Human multiple tissue dots (Clontech, Palo Alto, CA) were hybridized with RNF43 32P-labeled PCR product. Pre-hybridization preparation, hybridization, and washing steps are performed as recommended by the manufacturer. The resulting dots were radiographed at a temperature of -80 ° C for 24 to 72 hours. (7) Construction of plastids expressing FLJ2031 5 The complete coding region of RNF43 was amplified by RT-PCR using a gene-specific primer. The primers for RNF43 are: 5'-TGCAGATCTGCAGCTGGTAGCATGAGTGGTG-3, (SEQ ID NO: 7) and 5'-GAGGAGCTGTGTGAACAGGCTGTGTGAGATGT-3' (SEQ ID NO: 8). Insert the PCR product into the appropriate cloning site of pcDNA3.1 (Invitrogen) or pcDNA3·lmyc/His (Invitrogen) vector ° (8) Immunoblotting (Immunoblotting)

Cells transfected with pcDNA3.lmyc/His-RNF43 or pcDNA3.lmyc/His-LacZ were washed twice with PBS and placed in lysis buffer (1 50 mM NaCl, 1% Triton X-100, 50 mM Tris-HCl pH 7.4, ImM DTT, and IX full protease inhibitor cocktail (B〇ehringer). After homogenization, the cells were centrifuged at 10,00 Oxg for 30 minutes, and the protein concentration of the suspension was normalized by the Bradford test (Bio-Rad). Proteins were separated by 10% SDS-PAGE and immunoblotted with mouse anti-iyC (SANTA CRUZ) antibody. As a goat anti-mouse igG (Amersham) linked to HRP

2125-5994-PF(N2); Chiumeow.ptd Page 65 1324608 V. INSTRUCTIONS (61) Secondary antibodies to the E C L 4 detection system (A m e r s h a m). (9) Immunohistochemical staining Cells transfected with pcDNA3.1myc/His-RNF43 or pcDNA3.lmyc/His-LacZ were immobilized in PBS containing 4% paraformaldehyde for 15 minutes, followed by placing室温 at room temperature. 1% Tri ton Xl 00 PBS 2. 5 minutes to make it permeable. The cells were immersed in PBS containing 2% BSA for 24 hours at 4 °C to block non-specific hybridization. The mouse anti-myc monoclonal antibody (Sigma) diluted 1:100 was used as a primary antibody, and the reaction was observed with Rhodamine-conjugated anti-mouse secondary antibody (Leinco and ICN). The 4',6'-dioxa-2'-benzoquinone dihydrochloride (DAPI) was stained with nuclei. Fluorescence images were acquired with an ECLIPSE E800 microscope. (10) Cellony Formation assay Cells expressing the plastids of each gene or controlling the plastid transfection are placed in an appropriate concentration of dendritic 61161^〇^11 for 1 to 21 days. The cells were immobilized with 100% sterol and stained with Giemsa solution. All experiments were repeated twice. (11) Establish cells overexpressing RNF43 and transfect NIH3T3, C0S7 and LoVo cells with pcDNA3.lmyc/His-RNF43, pcDNA3.lmyc/His-LacZ or control plastids, and store the cells in culture medium containing appropriate concentrations of geneticins. . Two weeks after transfection, the surviving colonies were selected and the performance of each gene was examined by semi-quantitative RT-PCR. (12) To examine the effect of oligonucleic acid on the cell growth. Transfect the cells in l〇-cm culture m (2X105 cells/dish) with RNF43 plastid or synthetic S-oligonucleotide, using LIPOFECTIN reagent.

2125-5994-PF(N2); Chiumeow.ptd Page 66 1324608 V. Description of invention (62) (GIBCO BRL). The cells are then cultured for 6 to 12 days with a medium containing the appropriate concentration of geneticins. The cells were then fixed with 1% methanol and stained with Giemsa solution. The sequence of the S-oligonucleotide is as follows: RNF43-S1, 5'-TGGTAGCATGAGTGGT-3' (SEQ ID NO: 9); and RNF43-AS1, 5'-ACCACTCATGCTACCA-3' (SEQ ID NO: 10). (13) 3-(4,5-Dimethylindole-2-yl)-2,5-diphenyltetrazine bromide (MTT) analysis of cells with a density of 5×10 5 cells/100 mm culture dish Three groups of methods were transfected with S-oligonucleic acid, which was designed to inhibit rnF43 expression. After 72 hours of transfection, the culture medium was replaced with 5〇〇yg/mi 〇f MTT (3-(4,5-dimercaptopurin-2-yl)-2,5-diphenyltetrazine Desertification. () Sigma) fresh medium and will be at 37. C was cultured for four hours. Next, 1 ml of 0.01 N HC1/10% SDS was added to dissolve the cells, and the absorbance of the lysate at a wavelength of 570 ηιη (reference value 630 nm) was measured by an ELISA reader. Cell viability was compared to control cells by absorbance. (14) Construction of psiHlBX3. 0 Since the H1RNA gene was confirmed to be transcribed by RNA polymerase III, it produced a short transcript of the urinary bite at the 3' end, and a genomic fragment containing the H1RNA gene of its promoter was PCR-proliferated. The primers used are: [5'-TGGTAGCCAAGTGCAGGTTATA-3' (sequence identification number 11) and 5'-CCAAAGGGTTTCTGCAGTTTCA-3, (sequence identification number 12)]

2125-5994-PF(N2); Chiumeow.ptd Page 67 1324608 V. Description of the invention (63) Disk DNA as a model. The product was purified and the pCR2.0 plastid vector was implanted in a TA5 transplant kit (Invitrogen) according to the manufacturer's protocol. The BamHI and Xhol fragments containing the H1RNA gene were purified and inserted into the 1 257 to 56 nucleotide positions in the pcDNA3.1 (+) plastid to proliferate the plastid by PCR: 5' -TGCGGATCCAGAGCAGATTGTACTGAGAGT-3' ( Sequence ID 13) and 5'-CTCTATCTCGAGTGAGGCGGAAAGAACCA-3' (SEQ ID NO: 14) were subsequently digested with BamHI and Xhol. The ligated DNA was used as a PCR model, and the primers were: 5'~ TTTAAGCTTGAAGACCATTTTTGGAAAAAAAAAAAAAAAAAAAAAAC-3, (SEQ ID NO: 15) and 5'-TTTAAGCTTGAAGACATGGGAAAGAGTGGTCTCA-3, (SEQ ID NO: 16). The resulting product was digested with Hindlll and self-ligated to yield a psiHlBX3.0 mass. As a control group, psiHIBX-EGFP was prepared by implanting the following double-stranded oligonucleotides in the Bbsl spot of the psiHIBX vector: 5'_CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTT 03' (SEQ ID NO: 17) and 5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTT C-3' (sequence Identification number 18). (15) Examination of the silencing effect of RNF43-siRNA A performance system of RNF4 3-si RNA was prepared by implanting a double-stranded oligonucleotide into a psiHlBX3.0 vector. Oligonucleotide system as RNF43 siRNAs: 5*-TCCCGTCACCGGATCCAACTCAGTTCAAGAGACTGAGTTGGATCCGG TGAC-3' (SEQ ID NO: 19) and

2125-5994-PF(N2); Chiumeow.ptd Page 68 1324608 V. INSTRUCTIONS (64) 5,-AAAAGTCACCGGATCCAACTCAGTCTCGTGAACTGAGTTGGATCCGG TGAC-3' (SEQ ID NO: 20) is siRNA16-4; 5*-TCCCGCTATTGCACAGAACGCAGTTCAAGAGACTGCGTTCTGTGCAA TAGC-3' (SEQ ID NO: 21) and 5,-AAAAGCTATTGCACAGAACGCAGTCTCTTGAACTGCGTTCTGTGCAA TAGC-3' (SEQ ID NO: 22) are siRNA1 834; 5,-TCCCCAGAAAGCTGTTATCAGAGTTCAAGAGACTCTGATAACAGCTT TCTG-3' (SEQ ID NO: 23) and 5*-AAAACAGAAAGCTGTTATCAGAGTCTCTTGAACTCTGATAACAGCTT TCTG-3' (sequence Identification number 24) is siRNA1; 5,-TCCCTGAGCCACCTCCAATCCACTTCAAGAGAGTGGATTGGAGGTGG CTCA-3' (SEQ ID NO: 25) and -AAAATGAGCCACCTCCAATCCACTCTCTTGAAGTGGATTGGAGGTGG CTCA-3' (SEQ ID NO: 26) is siRNA14; 5'-TCCCCTGCACGGACATCAGCCTATTCAAGAGATAGGCTGATGTCCGT GCAG-3' (SEQ ID NO:27 And 5, -AAAACTGCACGGACATCAGCCTATCTCTTGAATAGGCTGATGTCCGT GCAG-3' (SEQ ID NO: 28) is siRNA15. Transfect psiHlBX-RNF43 or psiHIBX-mock plastids into SNUC4 or St-4 cells using FuGENE6 reagent (Roche) as recommended by the manufacturer. The complete RNA line was extracted from cells 48 hours after transfection. (16) Construction of the recombinant amino terminus and carboxy terminus of RNF43 protein The amino- and carboxy-terminal regions of RNF4 3 were proliferated by RT-PCR, and the primers used were: amine-based end regions:

2125-5994-PF(N2); Chiumeow.ptd Page 69 1324608 V. INSTRUCTIONS (65) 5'-GAAGATCTGCAGCGGTGGAGTCTGAAAG-3' (SEQ ID NO: 29) and 5'-GGAATTCGGACTGGGAAAATGAATCTCCCTC-3, (SEQ ID NO: 30) And the carboxy terminal region: 5'-GGAGATCTCCTGATCAGCAAGTCACC-3, (SEQ ID NO: 31) and 5'-GGAATTCCACAGCCTGTTCACACAGCTCCTC-3' (SEQ ID NO: 32). The resulting product was digested and implanted into the pET-43.1a(+) vector (Novagen). This plasmid was transfected into anti-BL21i/^ (DE3) pLysS cells (StrataGene). Adding 0.2 mM IPTG and incubating at 25 °C for 16 hours, extracting recombinant RNF43 protein from cells. (17) Yeast two-hybrid experiment Yeast two-hybrid analysis using MATCHMAKER GAL4 double hybrid system 3 (Cion tech )get on. The entire coding sequence of the M/edge was inserted into the Eco^\-BamH I spot of the pAS 2-1 vector as a bait for screening the Cion tech cDNA library (Cion tech). To determine the response in yeast, PAS2-RNF43 was used as a bait vector, pACT2-NOTCH2 and pACT2-STRIN as a prey vector. (21) Statistical analysis The data obtained were used for variation (AN0VA) and Scheffe's F test. (22) Preparation of 9-mer and 10-mer peptides of RNF43 that bind to HLA-A24 or HLA-A*020 1 molecule via binding prediction software (http://bimas.dcrt.nih.gov/cgi- Bin/molbio/ken_parker_comboform) Estimated. These are synthesized by Mimotopes, SanDiego, LA, standard solid state synthesis

2125-5994-PF(N2); Chiumeow.ptd Page 70 1324608 V. Inventive Note (66) The peptide was purified and purified by reverse phase HPLC. The purity was (&gt;9%), and the peptide was confirmed by HPLC analysis and mass spectrometry. The peptide was dissolved in dimercaptopurine (DMSO) at a concentration of 2 〇 mg/ml and stored at -80 t. (23) Intracellular CTL initiation Mononuclear leukocyte-derived dendritic cells (D C ) were used as antigen-presenting cells (APCs) to cause CTL responses to HLA-expressed peptides. The dc line is produced outside the tube (Nukaya et al., Int J Cancer 80: 92-7 (1 999); Tsai et al., J Immunol 1 58: 1 7 96-802 (1 997)). In particular, peripheral blood mononuclear cells (PBMCs) are isolated from healthy donors with HLA-A*0201 or HLA-A24, using Ficol 1-Plaque (Pharmacia) solution 'from PBMC A plastic tissue culture flask (Beckon Dicki nson) absorbs mononuclear white blood cells and separates them. The mononuclear leukocytes were cultured for seven days using heat-inactivated serum containing 2% heat deactivation.

Autologous serum, AS), 1000 U/ml GM-CSF (supplied by Kirin Brewery Company) and 1 000 u/ml IL-4 (Genzyme) AIM-V medium (Invitrogen) to obtain a DC fraction. A 20 eg/ml candidate peptide was pulsed into this DC-rich cell in 4 hours at 20 °C in AIM-V containing 3 #g/ml 02-microglobulin (microglobuiin). These peptide-pulsed antigen-expressing cells were then irradiated (5 5 0 rads) and mixed with autologously transplanted CD8+ T cells at 1:20, and positively selected with Dynabeads®-450 CD8 (Dynal) and Detachabead (Dynal). The culture was performed as follows: 48-well plate (Corning), each well containing 1. 5 χ 104 peptide pulsed antigen-expressing cells, 3xl05 CD8+ T cells and 10

1324608 V. INSTRUCTIONS (67) ng/Dil IL-7 (Genzyme) in 0. 5 ml of 8% containing 2% AS. Three days later, IL-2 (CHIRON) was added to reach a final concentration of 2 IU/ml. On days 7 and 14, the cells were stimulated to exhibit tau cells by autologous transplantation of the peptide pulse antigen. On day 21, lymphocytes were collected and tested for cytotoxic activity against ISI or Τ2 cells of the peptide pulse. (24) CTL expands the cultured lymphocytes, and has a significant cell ginnin activity on the peptide 7 or s, and then expands in cell culture, using a method similar to that of i. Et al., n Engl J Med 333:1038-1044, 1995; Riddel et al., Nature Med. 2: 2 1 6-223,1 996 ). Resuspend 5 xl〇4 lymphocytes in the middle AIM-V, which contains 5% AS and 25 χ 1〇6 irradiated (33 rads) PBMC, 5 X 106 irradiated (8000 rads) EHM cells, and 40 ng/ml anti-CD3 monoclonal antibody (Pharmingen) . One day later, add 12〇 iu/mi 11-2. Add 5%" and 30 111/111111^-2 fresh on days 5, 8, and 11. (25) Construct a CTL cell population to obtain CTL cell populations using some cells with cytotoxic activity. Dilute the cell suspension To 96-hole round chassis (Nalge Nunc

International), 0.3 per hole! , and 3 cTLs/lymphocytes. These cells were ehm with 7 x 104 cells/well of allogeneic PBMC'lxlO4 cells/well in 5% AS, 30 ng/ml anti-CD3 antibody and 125 U/ml IL-2 AIM-V (150 After incubation in /zl/well), ten days later, 50 V 1 /well of IL-2 was added to reach a final concentration of 125 U/ml. CTL fine

2125-5994-PF(M2); Chiumeow.ptd Page 72 1324608 V. INSTRUCTIONS (68) Cytotoxic activity was tested on day 14 and the CTL cell population was expanded in the manner described above. (2 6 ) Analysis of cytotoxic activity The target cells were labeled with 1 〇〇 #Ci of Na251Cr04 (Perkin Elmer Life Sciences) for 1 hour in a CO 2 incubator at 37 °C. When the peptide pulse is used, the target cell line is spiked with 20/zg/ml before labeling with Na25! Cr04, at 37. (: Incubate for 16 hours. Rinse the target cells and mix with the affected cells in a round bottom microtiter plate to reach the final trough volume of 2 m 1 . Centrifuge the titration plate (4 min, 800 x g) To increase cell-to-cell contact and simmer in a CO 2 incubator at 37 ° C. Four hours later, 0.1 μm of the suspension was collected from each well and measured with a gamma counter. Radioactivity. When assessing cytotoxic activity against endogenously expressed cells of RNF43, it was measured in 3〇 excess of unlabeled κ562 cells to reduce non-specific dissolution caused by any NK-1 ike effectors. Antigen-specificity was confirmed by cold-labeled inhibition analysis using unlabeled, peptide-pulsed (2〇#g/ml, 16 hrs, 37 °c) TISI or T2 cells to compete for 5i (:r-labeling) Identification of HT29 or SNU475 cells. MHC restriction is measured by blocking ass ay test, measuring anti-HLA-class I (W6/32) antibody and anti-HLA-class II antibody, anti-CD4 antibody and anti-CD8 antibody ( DAK0) inhibition of cytotoxic activity. The percentage of specific cytotoxic activity is The following formula calculates the release of η Cr_: {(received sample release number - spontaneous release number) / (highest release number - spontaneous release number)} X 100. Spontaneous release number is determined by the target cells cultured in the absence of cells 'The highest number of releases is from the target cell.

1324608 V. INSTRUCTIONS (69) 1 N HC1 culture was obtained. All data were repeated twice and the standard error of the mean was less than 10% of the mean. 2. Results (21) Confirmation of the gene FLJ203 15 , which is usually overexpressed in human colorectal cancer with a cDNA microarray containing 23040 genes, and the performance of 11 colorectal cancer tissues and the corresponding non-cancer large intestinal mucosa Organizational comparison. Based on this analysis, the performance of several genes in cancer and non-cancer tissues that are often overexpressed in cancer tissues is compared. Among them, a gene with internal number B44 6 9 and EST (FLJ2031 5), in a single gene (UniGene) cluster

Hs.18457 (http://www.ncbi.nlm.nih.gov/UniGene/) corresponds to excessive expression in cancer tissues, which has an overexpression of 1.44 to 11.22 times compared with non-cancer (the first) La map). Six of the 18 gastric cancer cases, 12 of the 20 HCC examples, and 11 of the 22 adenocarcinoma examples showed the phenotype/muscle excess. To confirm the results of the microarray, the performance of these transcripts was further quantified by RT-PCR in more colorectal cancer samples, confirming that 15 of 18 tumors had an increase in FLJ20315 (Fig. lb). . (22) The performance and structure of RNF43 is further homologous to the FLJ20315 sequence using the BLAST software of the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST/) Studies, the same ESTs include XM_0 970 6 3, BF817142 and a gene bank accession number NT-01 0651, in

2125-5994-PF(N2); Chiumeow.ptd Page 74 1324608 V. Description of the invention (70) Genomic sequence on the 17ptef~pl3·1 chromosome. Further homologous study # to a 5345 nucleotide, with a nucleotide sequence of 2352 nucleotides (SEQ ID NO: 1) open reading region encoding a protein of 78 3 amino acids (SEQ ID NO: 2 (Gene Bank Accession No. 〇8 1 837). This gene is called RNF43 (ring finger protein 43). The first ATG is consistent with the translation initiation sequence in eukaryotic cells (AGCATGC) The sequence and an upstream stop codon are surrounded. Comparing the cDNA with the genomic sequence revealed that the gene has 11 exons. The northern blot analysis using the PCR product of RNF43 as a probe was not used in human adult multiple tissues. Any streaks were detected (no data was shown). However, a 5.2 kb transcript was extracted in fetal lungs and kidneys (Fig. 2a). Single-module construction research tool (s丨mp丄e

The Modular Architecture Research Tool (SMART, http://smart.embl-heidelberg.de) was used for protein morphology studies and it was found that this protein was predicted to have a loop finger structure (codons 272-312) (Fig. 2). (23) Intracellular localization of the myc-tagged RNF43 protein To study the intracellular localization of the RNF43 protein, a plastid expressing the myc-tagged RNF43 protein (PDNAmyc/His-RNF43) was transiently transfected into the COS7 cells. Western blot analysis using this cell extract and anti-myc antibody showed a 85·5-KDa streak corresponding to this marker protein (Fig. 3a). Subsequent immunohistochemical staining showed that this protein was mainly present in the nucleus (Fig. 3b). The RNF43 protein also showed a similar intracellular location in SW480 human colorectal cancer cells. (24) Effect of RNF43 on cell growth

2125-5994-PF(N2); Chiumeow.ptd Page 75 1324608

V. INSTRUCTIONS (71) NIH3T3 cells were transfected with plastids expressing RNF43 (pcDNA-RNF43) for community formation analysis. The pcDNA-RNIMS transfected cells clearly produced more cell populations than the control group (Fig. 4a). The efficacy of RNF43 in increasing community formation activity was also shown in S W 4 8 0 cells, where endogenous r n F 4 3 exhibited very low θ (data not shown). In order to further investigate this growth promotion, a stable expression of RNF43 in COS7 cells (C0S7-RNF43) was established (Fig. 4b). In the culture medium containing 10% FBS, the growth rate of COS7-RNF43 cells was significantly faster than that of COS7-mock cells (Fig. 4c).

(25) Inhibition of growth inhibition of colorectal cancer cells by anti-intentional S-raised nucleotides designed to reduce the expression of RNF 43. To test whether inhibition of RNF4 3 expression causes growth retardation and/or death of colorectal cancer cells, five groups were synthesized. The antisense s_oligonucleotide' corresponding to RNF43 was controlled and transfected into LoVo colorectal cancer cells, which had high RNF43 expression in the 11 colorectal cancer cell lines tested. After 12 hours of transfection, RNF43-AS1 significantly inhibited the expression of RNF43 in five antisense s-oligonucleotides compared to the control S-oligonucleotide (RNF43-S1) (Fig. 5a).

Six days after transfection, 'survival cells transfected with RNF 4 3 - A S1 were significantly less than cells transfected with RNF43-S1' suggesting that inhibition of RNF43 expression reduced cell growth and/or survival (Fig. 5b) . Consistent results were obtained for each of the three experiments. (2) Construction of RNF43 si RNAs and their effects on colorectal cancer cell growth In mammalian cells, small interfering RNA (siRNA) has 20 or 21-mer double-stranded RNA (dsRNA) with 19 complementary Nucleotide and 3' end complementation

2125-5994-PF(N2); Chiumeow.ptd

1324608 V. The thymine or uracil dimer of (72) has been shown to have gene-specific silencing effects, but does not cause changes in overall gene expression. Therefore, plastids expressing different RNF43-siRNAs were established to examine their effects on RNF43 expression. In different RNF43-siRNAs,

Mouth 3 1111 to -1?1^16-4 and? 5 11116乂-1? Reviews 1 8 34 Significantly inhibited RNF43 expression in 5〇04 cells (Fig. 6A). To test whether inhibition of RNF43 would inhibit colorectal cancer cell growth, SNUC4 cells were transfected with psiHlBX-RNF16-4, psiHlBX-RNF1 834 or mock vector. Consistent with the data of the antisense S-oligonucleotide, the cell viability of transfection with psiHIBX-RNF16-4 or p s i Η1B X - M F18 3 4 was less than that of the control group (Fig. 6, Fig. 6C). (27) Flag-tagged RNF43 protein in foreign flag-labeled RNF43 protein transfected in C0S7 cell culture medium. Search for RNF43 amino acid using a single-module construction research tool (SMART, http://smart.embl-heidelberg.de) The results of the protein morphology of the sequence are predicted to be a single peptide and a ring finger domain, followed by examination of the secretion of the RNF43 protein. which performed

Flag tag RNF43 (pFLAG-RNF43) or Myc tag RNF43 (pcDNA3.

The plastid or mock plastid of Myc/His-RNF43) was transfected into c〇S7 cells, and the cells were cultured in a culture medium containing 0.5% fetal bovine serum for 48 hours. Western blot analysis with anti-Flag antibody or anti-Myc antibody. Flag-labeled RNF43 or Myc-tagged protein was detected in the culture medium of pFLAG-RNF43 or pcDNA3·1-Myc/His-RNF43 transfected cells, but in the mock vector The cells were not detected in the culture medium (Figs. 7A and 7B). 1324608 V. INSTRUCTIONS (73) (28) Effect of culture medium of cells transfected with pFLAG-RNF43 on NIH3T3 cells The expression of exogenous RNF43 was confirmed to promote the growth of NIH3T3 cells, and whether the secreted Flag-tagged RNF43 can also promote NIH3T3 Cell growth. The NIH3T3 cells were cultured in a culture medium in which the culture medium was not changed, mock-transfected cells, or adjusted pFlag-RNF43-transfected cells. As predicted, cells transfected with pFlag-RNF43 or pcDNA3.l-Myc/His-RNF43 had higher growth rates in the conditioned medium than in untreated or mock-transfected cell cultures (8A) And 8B map). These data show that RNF43 may achieve growth-promoting effects through autocrine methods. (29) Preparation of recombinant amino- and carboxy-terminal RNF43 proteins To produce a specific anti-RNF43 antibody, a Nus-labeled RNF43 protein was constructed to express plastids (Fig. 9A). This plastid was transformed into BL21trxB(DE3)pLysS cells to produce a recombinant protein in the bacterial extract. The predicted size was determined by SDS-PAGE (Fig. 9B and 9C). (30) Confirmation of the reactive protein of RNF43 by a two-hybrid screening system To clarify the mechanism of canceration of RNF43, a protein that reacts with RNF43 is searched by a two-hybrid screening system. In positive colonies, NOTCH2 or STRIN are simultaneously transformed into yeast cells (Fig. 10B), or pAS2. 1-RNF43 and pACT2-STRIN simultaneously transformed yeast cells (Fig. 11B) at pAS2.l-RNF4 3 and pACT2-NOTCH2. Reacts with RNF43. The regions that react with NOTCH2 and STRIN are shown in Figures 10A and 11A, respectively. (31) Prediction of HLA-A24-binding peptides derived from RNF43 Screening of the amino acid sequence of RNF43 for the search for 9 or 10 amino acid lengths

1324608 V. INSTRUCTIONS (74) HLA-A24-bound peptides, using a combination of predictive software (http://bimas.dcrt.nih.gov/cgi-bin/molbio/ken_parker_comboform). Table 1 shows the predicted peptides in the order of binding affinity (SEQ ID NO: 33-52). Twenty peptides were selected and described below. Table 1 predicts HUW\24 inclusion boat of RNF43 (http://bimas.dct.nih.gDv/cgi-bin/mQlbio/kEn_parkEr_comboform) Starting feS (9 fiber 亲 亲 1 1 start Μ (10 dirty Binding Affinity RNF43-331 SYQEPGRRL 360 RNF43-449 SYCTERSGYL 200 RNF43-350 HYHLPAAYL 200 RNF43-350 HYHLPMYLL 200 RNF43-639 LFNLQKSSL 30 RNF43-718 CY3NSQPVWL 200 RNF43-24 GFGRTGLVL 20 RNF43-2Q9 IFVIIU\SVL 36 RNF43-247 RYQASCRQA 15 RNF43-313 VFNITEGDSF 15 RNF43-397 RAPGEQQRL 14 RNF43-496 TFCSSLSSDF 12 RNF43-114 RAPRPCLSL 12 RNF43-B1 KLMQSHPLYL 12 RNF43-368 RPPRPGPFL 12 RNF43-54 KMDPTGKLNL 9 RMF4345 KAVIRVIPL 12 RNF43-683 HYTPSVAYPW 8 RNF43-721 NSQPVWLCL 10 RNF43 -282 GQELRVISCL 4 In this table, the starting position is the N-terminal amino acid of RNF43. (3 2 ) The CTL system for predicting peptide stimulation of T cells against these RNF43-derived peptides is based on the Materials and Methods. Prepared by the method described above. The obtained CTL having detectable cytotoxic activity was expanded, and a CTL cell line was established. The cytotoxic activity of the CTL strain induced by the 9-mer peptide (SEQ ID NO: 33-42) is shown in the table. 2 Shows.

2125 - 5994-PF( N2); Qi i umeow. p td Page 79 1324608 V. Description of the invention (75) Table 2 CTL cell line cytotoxin 1 (9-mer 3 start-up with tearing) Affinity cell hybrid X20 x2 CTL桷Pep(+) Pepf-) Pepi+l Pep(-) ^NF43-331 SYQEPGRRL 360.0 2% 1% 0% 0% 1 RNF43-350 HYHLPAAYL 200.0 26% 17% 5% 4% RNF43-639 LFNLQKSSL 30.0 42% 33% 7% 5% RNF43-24 GFGRTGLVL 20.0 8% 9% 1% 2% RNF43-247 RYQASCRQA 15.0 71% 82% 28% 16% RNF43-397 RAPGEQQRL 14.4 41% 32% 15% 15% RNF43-114 RAPRPCLSL 12.0 23% 26% 6% 9% RNF43-36B RPPRPGPFL 12.0 1% 0% 0% 0% RNF43-45 KAVIRVIPL 12.0 Μ E RNF43-721 NSQPVWLCL 10.0 68% 0% 26% I 0 % 13 ME: CTLs stimulated by RNF43-350 (HYHLPAAYL) (SEQ ID NO: 34), RNF43-639 (LFNLQKSSL) (SEQ ID NO: 35) and RNF43-721 (NSQPVWLCL) (SEQ ID NO: 42) were not established. The strain showed higher cytotoxic activity. From these CTLs, a CTL transfer line with RNF43-639 and 13 CTL transfer lines with RNF43-721 were established. The CTL stimulated with RNF43-72 1 showed potential cytotoxic activity against the peptide pulse, but no cytotoxic activity against the target without the peptide pulse (Fig. 12). The results of examining the CTL cytotoxic activity stimulated with the 10-mer peptide (SEQ ID NO: 43_52) are shown in Table 3.

Page 80 2125-5994-PF (N2); Chi coffee eow.ptd 1324608 V. Description of invention (76)

Table 3 CTL fine-grain Ki 〇 历 ) 起始 雠 ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ x 20 x 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 1% □ % 0% RNF43-350 HYHLPAAYLL 200.0 NE RNF43-718 CYSNSQPVWL 200.0 NE RNF43-209 IFVilL^SVL 36.0 Unsynthesized RNF43-313 N/FNITEGDSF 15.0 Unsynthesized RNF4349S TFCSSLSSDF 12.0 8% 9% 0% 0% RNF43-81 KLMQSHPLYL 12.0 10% 5% 2% -3% RNF43-54 KMDPTGKLNL 9.6 5% 2% 0% -1% RNF43-683 HYTPSVAYPW 8.4 0% 0% 0% -1% RNF43-282 GQELRVISCL 8.4 Μ E NE: Not established The CTL strain stimulated by RNF43-81 (KLMQSHPLYL) (SEQ ID NO: 49) or RNF43-54 (KMDPTGKLNL) (SEQ ID NO: 50) showed moderate cytotoxic activity against the peptide pulse, but did not win. The target of the peptide pulse is not cytotoxic. (33) Establishment of a CTL transfer line The CTL transfer line was established from the above CTL strain using a limiting dilution method. Thirteen 13 CTL transgenic lines against RNF43-721 and one CTL transfer line against RNF43-63 9 were established (see Table 2). Figure 13 shows the cytotoxic activity of the RNF43-721 CTL transfer line. Each CTL transgenic line has very potent cytotoxic activity against the peptide pulse and has no cytotoxic activity against the target without the peptide pulse. (34) Cytotoxic activity targeting RNF43 in the colorectal cancer cell line The ability to recognize CTL-transgenic lines for predicting peptide construction and to kill tumor cells expressing RNF43 internally was examined. Figure 14 shows the construction of RNF43-721

Page 81 2125-5994-PF(N2); Chiumeow.ptd 1324608 V. INSTRUCTIONS (77) Results of the constructed CTL transgenic strain 45. CTL transgenic strain 45 has potent cytotoxic activity against HT29 and WiDR, HT29 Both WiDR and RDR represent RNF43 and HLA-A24. On the other hand, CTL transgenic strain 45 has no cytotoxic activity against HCT116 (expressing RNF43 but not HLA-A24) or TISI (expressing HLA-A24 but not RNF43). In addition, CTL transgenic strain 45 had no cytotoxic activity against TISI and SNU-C4 (expressing RNF43 and a small amount of HLA-A24) with irrelevant peptide pulses (results not shown). (35) Characteristics of constructed CTLs The specificity of the RNF43-721 CTL transfectants was confirmed by cold-label inhibition analysis. The HT29 cells labeled with 51 Cr were used as a thermal marker here, while the TISI cells pulsed with RNF43-72 1 peptide without the 51Cr label were cold-labeled.

When RSF4 3 - 7 2 1 peptide-pulsed T IS I cells were added to the assay in different ratios, specific cytolysis of Η T 2 9 cells was significantly inhibited (Fig. 15). The result is a specific solubility of 20%/Τ ratio. To understand the properties of the CTL-transgenic lines constructed with the RNF43 peptide, anti-HLA-Class I, HLA-Class II, CD3, CD4 and CD8 antibodies were used and tested for their ability to inhibit the cytotoxic activity of CTL-transfected cells. The cytotoxic activity of CTL transgenic lines on Wi DR cells was significantly inhibited by anti-HLA-Class I, CD3 and CD8 antibodies (Fig. 16). This result indicates that the CTL transfer line recognizes the RNF43-derived peptide via HLA-Class I, CD3 and CD8. (36) Homologous analysis of RNF4 3-721 peptide The CTL transgenic line constructed with RNF43-721 has very strong cytotoxic activity. This result indicates that the R N F 4 3 - 7 2 1 sequence may be homologous to other peptides derived from other molecules known to sensitize the human immune system. In order to row

2125-5994-PF(N2); Chiumeow.ptd Page 82 1324608

V. INSTRUCTIONS (78) In addition to this possibility, the homology of RNF43-721 was analyzed by BLAST (http://www.ncbi.nlm.nih.gov/blast/blast.cgi), and the results showed that there was no BLAST. Any sequence that exactly matches RNF43-721 (Table 4). Table 4 Homology analysis of RNF43-721 wins (http://www.ncbi.nlm.aov/blasl/blast.cgn same (9/9) 0 same (8/9) 0 phase sec 7 0 identical 6/9) 2 This result indicates that the RNF43-721 sequence is unique, and the CTL transfer system constructed with RNF43-721 has a small chance of causing an immune response to other molecules. (37) Modification of RNF43-721 to improve antigenicity Epit〇pe shows the effect. In order to improve the peptide display effect, the amino acid of the RNF43-721 peptide anchor site is modified. This modification is expected to improve the affinity of this peptide for HLA Class I molecules. Table 5 shows that RNF43-721 (SEQ ID NO: 53 and 54) with 2 amino acids in the modification position has a better affinity for 1}1^ with 3" I molecules. Table 5 shows the modification of natural RNF43-721. J| too predictive binding ability sequence

NSQPVWLCL

NFQPVWLCL score 10.08 50.40 row ratio, 10 504.00

NYQPVWLCL* The 9-mer peptide (38) restricted by HLA-A24 predicts candidate peptides derived from RNF43. Table 6 shows candidate peptides (Nos. 49 and 55-73) ranked by binding affinity.

1324608 V. INSTRUCTIONS (79) Table 6 RNF43: Pre-epithelial epitopes wins □ (ΗΙΛ-ΑΤ^ΟΙ) 9 gathers fe 10 gathers away from the table and touches the feet J Ί scores compiled starting fun feet J score 1 60 KLNLTLEGV 274.3 11 81 KLMQSHPLYL 1521.5 2 8 QLAALWPWL 199.7 12 357 /LLGPSRSAV 1183.7 3 82 LMQSHPLYL 144.2 13 202 LMTWGTIFV 469.6 4 358 LLGPSRSAV 118.2 14 290 CLHEFHRNCV 285.1 5 11 ALWPWLLMA 94.8 15 500 SLSSDFDPLV 264.2 6 15 WLLMATLQA 84.5 16 8 QLAAIWPWLL 160.2 7 200 WILMTWGT 40.1 17 11 ALWPWLLMAT 142.2 8 171 KLMEFWKN 34.5 18 7 LQLAALWPWL 127.3 9 62 NLTLEG\^A 27.3 19 726 WLCLTPRQPL 98.2 10 156 GLTWPWLI 23.9 20 302 WLHQHRTCPL 982 A total of 20 peptides were selected and tested as follows. (3 9 ) Stimulation of sputum cells using candidate peptides Lymphocytes were cultured with candidate peptides derived from RNF43 as described in Materials and Methods. The lymphocytes with cytotoxic activity were expanded and CTL cell lines were established. The cytotoxic activity of the CTL cell line initiated with the 9-mer peptide (SEQ ID NO: 55-64) is shown in Table 7. Table 7 CTL fine cell 黯 mHLA-A*0201 9 earn) Start teS seam ^? ϋ Binding affinity cell tide x20 x2 Pep(+) Pepf-1 Pep(+) Pep(-) RNF43-60 KLNLTLEGV 274.3 -2.1 0.2 -1.6 0.0 RNF43-8 QLAALWPWL 199.7 3.5 0.0 0.0 1.0 RNF43-82 LMQSHPLYL 144.2 1.7 1.2 0.0 -0.4 RNF43-358 LLGPSRSAV 118.2 -0.4 -0.7 0.0 -0.8 RNF43-11 ALWPWLLMA 94.8 9D.2 Χβ. 454 1.3 RNF43-15 WLLMATLQA 84.5 -D.2 0.0 -0.4 -09 RNF43-200 WILMTWGT 40.1 Unsynthesized RNF43-171 KLMEFWKN 34.5 2.6 0.0 1.1 -0.5 RNF43-62 NLTLEGVFA 27.3 Not reduced minus RNF43-156 GLTWPWLI 23.9 -0.4 0.7 -0.5 I -0.3 NE: CTL cell line initiated by MF43-11-9 (ALWPWLLMA) (SEQ ID NO: 59) was not established compared with the target not pulsed with peptide.

2125-5994-PF(N2); Chiumeow.ptd Page 84 1324608 V. INSTRUCTIONS (80) Pulsed cells have high cytotoxic activity. From these CTLs, four CTL transgenic cells were established with RNF43-11-9. The CTL strain stimulated with RNF43-11-9 has high cytotoxic activity against cells labeled with peptides, but has no cytotoxic activity against the target that is not pulsed with peptide (Figure 17A). The cytotoxic activity of the CTL strains initiated by the peptides (SEQ ID NO: 49 and 65-73) is shown in Table 8. Table 8 CTL Fine ^ ^ 黯 黯 ΗΙΛ Α 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 152 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 020 18_0 27.6 6.3 6.3 RNF43-357 YLLGPSRSAV 11B3.7 18.2 15.4 3.7 3.0 RNF43-202 LMTWGTIFV 469.6 Unnamed RNF43-290 CLHEFHRNCV 285.1 9.6 9.7 2.7 3.7 RNF43-500 SLSSDPLV 264.2 N = RNF43-8 qlaaiwpwll 160.2 6.7 9.0 1.1 1.3 RNF43-11 ALWPWLLMAT 142.2 91.5 27.1 40.5 4.3 RIMF43-7 LQLAflLWPWL 127.3 N RNF43-726 WLCLTPRQPL 98.2 ME RNF43-302 WLHQHRTCPL 98.2 7.4 6.1 I 1.5 I 2.2 ΝΕ: CTL strain was not established with RNF43-11-10 (ALWPWLLMAT) (SEQ ID NO: 70) The stimulated CTL strain has high cytotoxic activity against cells labeled with peptides, but has no cytotoxic activity against the target that is not pulsed with the peptide (Fig. 1 7). (40) Establishment of CTL transfer line The CTL transfer line was cultured from the above CTL strain using a limiting dilution method. Four CTL transfer lines for RNF43-11-9 were established (see Table 7). The cytotoxic activity of the RNF43 peptide-derived CTL-transgenic line is shown in Figures 18 and 18Β. Each CTL transgenic line has a height for cells that are labeled with a peptide

2125-5994-PF(N2); Chiumeow.ptd Page 85 1324608 V. INSTRUCTIONS (81) Cytotoxic activity, but not cytotoxic activity against the pulse treated with peptide. (41) Cytotoxin activity against colorectal cancer cell lines expressing RNF43 in vivo The CTL transformation line established by the above predicted peptide was tested for its ability to recognize and kill tumor cells which internally express RNF43. Figures 19A and 19B show the results of establishing a complete CTL transfer line for the RNF43-derived peptide. The CTL-transgenic line has high cytotoxic activity against DLD-1 expressing RNF43 and HLA-A*0 20 1 but not cytotoxic activity against HT29 which exhibits RNF43 but does not exhibit HLA-A*020 1 . (42) Specificity of CTL transgenic lines A cold target inhibition assay was performed to confirm the specificity of the RTF43-5-11 (9-mer) CTL transgene. HCT116 labeled with Na/Cr 04 was used as a thermal label, while T2 pulsed with the RNF43-11-9 peptide without the 51Cr label was used as a cold label. When a different ratio of RNF4 3-11-9 peptide pulse T2 was added, the specific cytolysis of HCT-116 cells was significantly inhibited. Industrial Applicability Compared with non-cancer mucosa tissues, the expression of the novel human gene rNF43 is markedly enhanced in colorectal cancer cells. Therefore, these genes can be used as diagnostic markers for cancer, and the proteins encoded thereby can be used for the diagnosis of cancer. The present invention also shows that the expression of the novel protein RNF4 3 promotes cell growth.

2125-5994-PF(N2); Chiumeow, ptd

Page 86 丄 324608

Long, and cell growth is made up of anti-sense oligonucleotides or small interfering RNAs corresponding to the milk-forming genes. These findings suggest that RNF43 protein stimulates oncogenic activity. Therefore, these new oncogenic proteins are suitable targets for the development of anticancer drugs. For example, an agent that exhibits resistance to RNF43 or an agent that prevents its activity can be used as an anticancer agent for the treatment of colorectal cancer. Examples of such agents include anti-initiative nucleotides and small interfering RNAs, and antibodies recognizing RNF43. Furthermore, the present invention demonstrates that RNF43 reacts with NOTCH2 or STRIN. RNF43 cell proliferative activity is predicted to be controlled by its association with N〇TCH2. Therefore, an agent which inhibits the formation of a complex between RNF43 and NOTCH2 or STRIN can also be used for the treatment and prevention of cancer, particularly colorectal cancer, lung cancer, gastric cancer and liver cancer. The present invention has been described in detail, and described in the specific embodiments of the invention, and various modifications and changes may be made without departing from the spirit and scope of the invention.

2125-5994-PF(N2); Chiumeow.ptd Page 87 1324608 Schematic description of the graph The first and fifth graphs show the performance of colorectal cancer. Figure 1 a shows the relative performance ratio (cancer/non-cancer) in the case of a primary colorectal cancer in the case of a cDNA microarray analysis of the melon/7 disaster 5 (the cancer is performed in the large intestine by cutting off the filter) One of the cases of rectal cancer was overexpressed (Cy3: Cy5 intensity ratio, &gt; 2, 0) (〇丫3 and 0丫5 signals were all greater than 25,000). Figure 11) shows the results of analysis of /z/i-like/5 performance using semi-quantitative RT-PCR using 18 colorectal cancer cases (τ is tumor tissue; n is normal tissue). The performance is here as an internal control group. Figure 2a is a photograph showing the results of a northern blot analysis of lakes in different human fetal tissues. Figure 2b shows the predicted RNF43 protein structure. Figures 3a and 3b show photographs of intracellular locations of myc-tagged RNF43 protein. Figure 3a is a photograph showing the results of Western blot analysis of the myc-tagged RNF4 3 protein using the extraction of C0S7 cells transfected with pcDNA3.1-myc/Hi S-RNF43 or control plastid (mock). Things. Figure 3b shows photographs of the above transfected cells stained with mouse anti-my c antibody and FITC-linked secondary antibody. The nuclei were stained with DAP I for comparison. Figures 4a through 4c show the effect on cell growth. Figure 4a is a photograph showing the results of a population formation analysis in a NIH3T3 cell. Figure 4b is a photograph showing the expression of Xiao Yu in the model (C0S7-pcDNA) and COS7-RNF43 cells formed by transfection of COS7 cells with pcDNA-RNF43. Figure 4c shows the results of cell growth between COS7-RNF43 cells and mock cells that are relatively stable in the presence of a foreign ship (4). Figures 5a and 5b show the design of the antisense S-oligonucleotide designed to inhibit the shoulder (4)

2125-5994-PF(N2); Chiumeow.ptd Page 88 1324608 Schematic description of growth inhibition efficacy. Figure 5a is a photograph showing the expression of RNF43 in LoVo cells after 12 hours of treatment with control (RNF4 3-S1) or antisense S-oligonucleotide (RNF43-AS1). Semi-quantitative RT-PCR) analysis. Figure 5b shows cell viability of LoVo cells treated with control or antisense s-oligonucleotides as measured by MTT assay. The MTT analysis was repeated three times. Figures 6A to 6C show the growth inhibitory effects of RNF43-siRNAs. Figure 6A is a photograph showing the effect of RNF43-siRNAs on the performance of RNF43. Figure 6B is a photograph showing the results of Gibbs staining of cells that survived control of siRNA or RNF43-siRNAs. Figure 6C shows the results of MTT analysis of cells transfected with plastids by control of plastids or RNF43-siRNAs, and the significant difference was determined by Fisher's most effective difference test (p &lt; 0.05) ° 7A And 7B shows the expression of the labeled RNF43 protein. Section 7A is a photograph showing the results of Western blot analysis of the Flag-labeled RNF43 protein in a culture solution of COS7 cells transfected with pFLAG-5CMV-RNF43 (lane 2) or mock vector (lane 1). Figure 7B is a photograph showing the western ink of Myc-labeled RNF43 protein secreted into the culture medium by the C0S7 cells transfected with pcDNA3. :l-Myc/His-RNF43 (second barrier) or mock vector (column 1). Point analysis results. Figures 8A and 8B show the growth promoting effects of the culture medium containing the Myc marker or the Flag-tagged RNF43 protein. Figure 8A is a photograph showing the culture medium of C0S7 cells transfected with the control vector (1), pcDNA3.; l-Myc/His-RNF43 (3) or PFLAG-5CMV-RNF43 (4) training

1324608 Schematic description of the morphology of the raised NIH3T3 cells. Fig. 8B shows the number of NIH3T3 cells cultured in the culture solution of the eighth human figure. The data of each group is the average quality of three replicate experiments; the significant difference between the known rs, ± SE. * and the control group is (ρ &lt; 0. 0 5 ) 〇 The 9th to 9th C map shows the end of RNF43 (Ν1) and C-terminal (C1) recombinant protein ° Figure 9 shows the structure of the recombinant protein {^1?43_" and _匚1. Figure 9 shows a photo of 'NusTLtagged RNF43-N1 protein in five _ 〇?&quot; The performance in 'has (2nd block) or does not have (1st block) 0.2 Mm of IPTG. The 9C figure is a photograph showing the performance of NusTM_tagged RNF43-C1 protein in ϋ co&quot; has (2nd block) Or does not have IPTG (column 1) lmM. 10A and 10B show the reaction between rNF43 and NOTCH2 in the yeast two-hybrid system. Figure 10A shows the predicted structure and reaction region of N0TCH2 (a) is the prediction of NOTCH2 protein The full length structure, and (b) is the predicted reaction zone (ECD, extracellular region; TM, transmembrane domain; ICD, intracellular region). Figure 10B is a photograph showing the test by a two-hybrid system Reaction between RNF43 and N0TCH2. 11A and 11B show the test by yeast two-hybrid system Reaction between RNF43 and STRI N. Figure 11A shows the predicted structure and reaction region of N0TCH2 (a) is the predicted full-length structure of the STRI N protein, and (b) is the predicted reaction zone (RING 'bad region). Figure 11B is a photograph showing the reaction between RNF43 and STRIN tested by the two-hybrid system. Figure 12 shows the peptide specific cytotoxin of the CTL strain developed by RNF43-721. RNF 4 3 - 7 2 1 pulse

2125-5994-PF(N2); Qiiumeow.ptd Page 90 1324608 Schematic description of the highly cytotoxic activity of the standard cells (TISI) of the (quadrilateral line), which, in the same but not pulsed with RNF43-721' No significant cytotoxic activity was detected in the cells (TISI) of the (quadrilateral line). The CTL strain was shown to have a peptide specific cytotoxin. Figure 13 shows the serotype-specific cytotoxin of the CTL strain developed by RNF43-721. The cytotoxic activity of the 13 RNF43-721 CTL communities on peptide-pulsed targets (TISI) was tested as described in Materials and Methods. The established RNF43-721 CTL cell population has very potent cytotoxic activity against the peptide-labeled (TIS I) cells, while there is no significant cytotoxic activity against the target (T ISI ) cells that are not pulsed with peptides.

Figure 14 shows the cytotoxic activity of RNF43-721 CTL Clone 45 on HT29, WiDR and HCT116. RNF43-721 CTL Clone recognizes and dissolves tumor cells that express RNF43 in an HLA-restricted manner. HT29, WiDR and HCT116 both endogenously express RNF43, and RNF43-72 1 CTL Clone 45 plays an effector cell. TISI is used as a target for not expressing RNF43. RNF43-721 CTL Clone 45 showed high cytotoxic activity in HT29 (filled triangles) and WiDR (filled squares) showing RNF43 and HLA-A24. On the other hand, rNF43-721 CTL Clone 45 was not significantly present in HCT116 (open triangle) showing only RNF43 but not HLA-A24, and TISI (open square) showing only HLA-A24 but not RNF43. Cytotoxic activity. In addition, RNF43-721 CTL Clone 45 is in the unrelated peptide pulse TISI (solid square) and SNU-C4 (closed circle)

2125-5994-PF(N2); Chiumeow.ptd Page 91 1324608 Schematic description of the medium (expressing RNF43 and a small amount of HLA-A24) with no cytotoxic activity. Figure 15 shows the results of the c〇ld target inhibition assay. RNF43 -72 1 CTL Clone specifically recognizes RNF 43-721 in a HLA-A24 restricted manner. HT29 labeled with Na25〗Cr 〇4 was prepared as a thermal label, and rNF43-721 peptide pulse tisi (peptide +) was used as a cold label (inhibitor). Set Ε/τ to 20. The cytotoxic activity against HT2 9 was inhibited after the addition of T s s (solid square) with the same peptide pulse, while 丨 s I (open square) with no peptide pulse was added, and almost no inhibition occurred.

Figure 16 shows the results of the blocking analysis (bi〇cking assay), showing

Effect of antibodies against HLA-Class I, HLA-Class II, CD3, CD4 and CD8 on cytotoxic activity of RNF43-721 CTL strain eRNF43-72 1 CU strain showed HLA-Class I, CD3 and CD8 restricted cytotoxic activity . In order to examine the characteristics of CTL strains developed with RNF43 peptide, antibodies against HLA-Class I, HLA-Class II, CD3, CD4 and CD8 were used to test them.

Inhibitory effect on cytotoxic activity. The horizontal axis shows the percentage inhibition of cytotoxic activity. When antibodies against class I, CD3, and CD8 were used, the cytotoxic activity of the CTL strain against W i D R was significantly reduced. This result indicates that CTL Cl0ne recognizes RNF43-derived peptides in a manner dependent on !!!^ Class丨, CD3 and CD8. Figures 17A and 17B show peptide specific cytotoxins of CTL strains stimulated by RNF43-H-9 (A) or RNF43-11-10 (B). These CTL strains exhibit high cytotoxic activity against cells labeled with RNF43-11-9 or RNF43-11-10 (T2), but for the same but not the peptide of the peptide.

A brief description of the schema - no cytotoxic activity was detected in cells (T2). Figures 18A and 18B show peptide specific cytotoxins of CTL strains stimulated by RNF43-11-9 (A) or RNF43-11-10 (B). The cytotoxic activity of four 1?叩43-11-9(:1^ strains or 7 1?? 43-11-1() strains against the peptide-labeled cells (T2) is described in Materials and Methods The established RNF43-11-9 and RNF43-11-10 CTL cell populations have very potent cytotoxic activity against peptide-labeled cells (T2), while targeting cells that are not pulsed with peptides (T2). No significant cytotoxic activity.

Figures 19 and 19 show the cytotoxic activity of RNF43-5 CTL strain 90 and RNF43-17 CTL strain 25 on ΗΤ29 and DLD-1. RNF43_5 cn strain 9〇 and RNF43-1 7 CTL strain 25 recognize and dissolve tumor cells expressing RNF43 in a hla-restricted manner. Both HT29 and DLD-1 endogenously express RNF43, while RNF43-5 CTL strain 90 and RNF43-17 CTL strain 25 act as an effect〇r cell. T2 is used as a target that does not express RNF43. RNF43-5 CTL strain 90 and RNF43-17 CTL strain 25 showed high cytotoxic activity in DLD-1 expressing RNF43 and HLA-A*020 1 . On the other hand, RNF43_5 CTL strain 9〇 and RNF43-1 7 CTL strain 25 had no significant cytotoxic activity in HT29 which only expressed RNF43 but did not express HLA-A*0201. Figure 20 shows the results of the c〇id target inhibition assay. The RNF43-11-9 CTL strain specifically recognizes RNF 43-11-9 in a HLA-A2 restricted manner. HCT116 labeled with Na251Cr 04 was prepared as a thermal label, while the peptide pulse T2 (peptide +) was used as a cold label (inhibitor). Set the Ε/Τ ratio to 2〇. The cytotoxic activity against HCT11 6 was inhibited after the addition of η with the same peptide pulse.

The 1324608 pattern is a simple description, and the addition of T2 without a peptide pulse has almost no inhibition.

2125-5994-PF(N2); Chiumeow.ptd Page 94 1324608 2/32

Met Ser Gly Gly His Gin Leu Gin Leu Ala Ala Leu Trp Pro 15 10 tgg ctg ctg atg get acc ctg cag gca ggc ttt gga cgc aca gga ctg 578

Trp Leu Leu Met Ala Thr Leu Gin Ala Gly Phe Gly Arg Thr Gly Leu 15 20 25 30 gta ctg gca gca geg gtg gag tet gaa aga tea gca gaa cag aaa get 626

Val Leu Ala Ala Ala Val Glu Ser Glu Arg Ser Ala Glu Gin Lys Ala 35 40 45 att ate aga gtg ate ccc ttg aaa atg gac ccc aca gga aaa ctg aat 674 lie lie Arg Val lie Pro Leu Lys Met Asp Pro Thr Gly Lys Leu Asn 50 55 60 etc act ttg gaa ggt gtg ttt get ggt gtt get gaa ata act cca gca 722

Leu Thr Leu Glu Gly Val Phe Ala Gly Val Ala Glu lie Thr Pro Ala 65 70 75 gaa gga aaa tta atg cag tcc cac ccg ctg tac ctg tgc aat gcc agt 770

Glu Gly Lys Leu Met Gin Ser His Pro Leu Tyr Leu Cys Asn Ala Ser 80 85 90 gat gac gac aat ctg gag cct gga ttc ate age ate gtc aag ctg gag 818

Asp Asp Asp Asn Leu Glu Pro Gly Phe lie Ser lie Val Lys Leu Glu 95 100 105 110 agt cct ega egg gcc ccc ege ccc tgc ctg tea ctg get age aag get 866

Ser Pro Arg Arg Ala Pro Arg Pro Cys Leu Ser Leu Ala Ser Lys Ala 115 120 125 egg atg geg ggt gag ega gga gcc agt get gtc etc ttt gac ate act 914

Arg Met Ala Gly Glu Arg Gly Ala Ser Ala Val Leu Phe Asp lie Thr 130 135 140 gag gat ega get get gag cag ctg cag cag ccg ctg ggg ctg acc 962

Glu Asp Arg Ala Ala Ala Glu Gin Leu Gin Gin Pro Leu Gly Leu Thr 145 150 155 tgg cca gtg gtg ttg ate tgg ggt aat gac get gag aag ctg atg gag 1010

Trp Pro Val Val Leu lie Trp Gly Asn Asp Ala Glu Lys Leu Met Glu 160 165 170 ttt gtg tac aag aac caa aag gcc cat gtg agg att gag ctg aag gag 1058

Phe Val Tyr Lys Asn Gin Lys Ala His Val Arg lie Glu Leu Lys Glu 175 180 185 190 1324608 3/32 ccc ccg gcc tgg cca gat tat gat gtg tgg ate eta atg aca gtg gtg 1106

Pro Pro Ala Trp Pro Asp Tyr Asp Val Trp lie Leu Met Thr Val Val 195 200 205 ggc acc ate ttt gtg ate ate ctg get teg gtg ctg ege ate egg tgc 1154

Gly Thr lie Phe Val lie lie Leu Ala Ser Val Leu Arg He Arg Cys 210 215 220 ege ccc ege cac age agg ccg gat ccg ett cag cag aga aca gcc tgg 1202

Arg Pro Arg His Ser Arg Pro Asp Pro Leu Gin Gin Arg Thr Ala Trp 225 230 235 gcc ate age cag ctg gcc acc agg agg tac cag gcc age tgc agg cag 1250

Ala He Ser Gin Leu Ala Thr Arg Arg Tyr Gin Ala Ser Cys Arg Gin 240 245 250 gcc egg ggt gag tgg cca gac tea ggg age age tgc age tea gcc cct 1298

Ala Arg Gly Glu Trp Pro Asp Ser Gly Ser Ser Cys Ser Ser Ala Pro 255 260 265 270 gtg tgt gee ate tgt ctg. gag gag ttc tet gag ggg cag gag eta egg 1346

Val Cys Ala lie Cys Leu Glu Glu Phe Ser Glu Gly Gin Glu Leu Arg 275 280 285 gtc att tee tgc etc cat gag ttc cat cgt aac tgt gtg gac ccc tgg 1394

Val lie Ser Cys Leu His Glu Phe His Arg Asn Cys Val Asp Pro Trp 290 295 300 tta cat cag cat egg act tgc ccc etc tgc gtg ttc aac ate aca gag 1442

Leu His Gin His Arg Thr Cys Pro Leu Cys Val Phe Asn lie Thr Glu 305 310 315 gga gat tea ttt tee cag tee ctg gga ccc tet ega tet tac caa gaa 1490

Gly Asp Ser Phe Ser Gin Ser Leu Gly Pro Ser Arg Ser Tyr Gin Glu 320 325 330 cca ggt ega aga etc cac etc att ege cag cat ccc ggc cat gcc cac 1538

Pro Gly Arg Arg Leu His Leu lie Arg Gin His Pro Gly His Ala His 335 340 345 350 tac cac etc cct get gcc tac ctg ttg ggc cct tee egg agt gca gtg 1586

Tyr His Leu Pro Ala Ala Tyr Leu Leu Gly Pro Ser Arg Ser Ala Val 355 360 365 get egg ccc cca egg cct ggt ccc ttc ctg cca tee cag gag cca ggc 1634

Ala Arg Pro Pro Arg Pro Gly Pro Phe Leu Pro Ser Gin Glu Pro Gly 370 375 380 1324608 4/32 atg ggc cct egg cat cac ege ttc ccc aga get gca cat ccc egg get 1682

Met Gly Pro Arg His His Arg Phe Pro Arg Ala Ala His Pro Arg Ala 385 390 395 cca gga gag cag cag ege ctg gca gga gee cag cac ccc tat gca caa 1730

Pro Gly Glu Gin Gin Arg Leu Ala Gly Ala Gin His Pro Tyr Ala Gin 400 405 410 ggc tgg gga atg age cac etc caa tee acc tea cag cac cct get get 1778

Gly Trp Giy Met Ser His Leu Gin Ser Thr Ser Gin His Pro Ala Ala 415 420 425 430 tgc cca gtg ccc eta ege egg gee agg ccc cct gac age agt gga tet 1826

Cys Pro Val Pro Leu Arg Arg Ala Arg Pro Pro Asp Ser Ser Gly Ser 435 440 445 gga gaa age tat tgc aca gaa ege agt ggg tac ctg gca gat ggg cca 1874

Gly Glu Ser Tyr Cys Thr Glu Arg Ser Gly Tyr Leu Ala Asp Gly Pro 450 455 460 gee agt gac tee age tea ggg ccc tgt cat ggc tet tee agt gac tet 1922

Ala Ser Asp Ser Ser Ser Gly Pro Cys His Gly Ser Ser Ser Asp Ser 465 470 475 gtg gtc aac tgc aeg gac ate age eta cag ggg gtc cat ggc age agt 1970

Val Val Asn Cys Thr Asp lie Ser Leu Gin Gly Val His Gly Ser Ser 480 485 490 tet act ttc tgc age tee eta age agt gac ttt gac ccc eta gtg tac 2018

Ser Thr Phe Cys Ser Ser Leu Ser Ser Asp Phe Asp Pro Leu Val Tyr 495 500 505 510 tgc age cct aaa ggg gat ccc cag ega gtg gac atg cag cct agt gtg 2066

Cys Ser Pro Lys Gly Asp Pro Gin Arg Val Asp Met Gin Pro Ser Val 515 520 525 acc tet egg cct cgt tee ttg gac teg gtg gtg ccc aca ggg gaa acc 2114

Thr Ser Arg Pro Arg Ser Leu Asp Ser Val Val Pro Thr Gly Glu Thr 530 535 540 cag gtt tee age cat gtc cac tac cac ege cac egg cac cac cac tac 2162

Gin Val Ser Ser His Val His Tyr His Arg His Arg His His His Tyr 545 550 555 aaa aag egg ttc cag tgg cat ggc agg aag cct ggc cca gaa acc gga 2210

Lys Lys Arg Phe Gin Trp His Gly Arg Lys Pro Gly Pro Glu Thr Gly 1324608 5/32 560 565 570 gtc ccc cag tcc agg cct cct att cct egg aca cag ccc cag cca gag Val Pro Gin Ser Arg Pro Pro lie Pro Arg Thr Gin Pro Gin Pro Glu 575 580 585 590 cca cct tet cct gat cag caa gtc acc gga tec aac tea gca gee cct Pro Pro Ser Pro Asp Gin Gin Val Thr Gly Ser Asn Ser Ala Ala Pro 595 600 605 teg ggg egg etc tet aac Cca cag tgc ccc agg gee etc cct gag cca Ser Gly Arg Leu Ser Asn Pro Gin Cys Pro Arg Ala Leu Pro Glu Pro 610 615 620 gee cct ggc cca gtt gac gee tec age ate tgc ccc agt acc age agt Ala Pro Gly Pro Val Asp Ala Ser Ser lie Cys Pro Ser Thr Ser Ser 625 630 635 ctg ttc aac ttg caa aaa tec age etc tet gee ega cac cca cag agg Leu Phe Asn Leu Gin Lys Ser Ser Leu Ser Ala Arg His Pro Gin Arg 640 645 650 aaa Agg egg ggg ggt ccc tec gag ccc acc cct ggc tet egg ccc cag Lys Arg Arg Gly Gly Pro Ser Glu Pro Thr Pro Gly Ser Arg Pro Gin 655 660 665 670 gat gca act gtg cac cca get tgc cag att ttt ccc cat tac acc Ccc Asp Ala Thr Val His Pro Ala Cys Gin lie Phe Pro His Tyr Thr Pro 675 680 685 agt gtg gca tat cct tgg tec cca gag gca cac ccc ttg ate tgt gga Ser Val Ala Tyr Pro Trp Ser Pro Glu Ala His Pro Leu lie Cys Gly 690 695 700 2258 2306 2354 2402 2450 2498 2546 2594 cct cca ggc ctg gac aag agg ctg eta cca gaa acc cca ggc ccc tgt Pro Pro Gly Leu Asp Lys Arg Leu Leu Pro Glu Thr Pro Gly Pro Cys 705 710 715 tac tea aat Tea cag cca gtg tgg ttg tgc ctg act cct ege cag ccc Tyr Ser Asn Ser Gin Pro Val Trp Leu Cys Leu Thr Pro Arg Gin Pro 720 725 730 ctg gaa cca cat cca cct ggg gag ggg cct tet gaa tgg agt tet gac Leu Glu Pro His Pro Pro Gly Glu Gly Pro Ser Glu Trp Ser Ser Asp 735 740 745 750 2642 2690 2738 acc gca gag ggc agg cca tgc cct tat ccg cac tgc cag gtg ctg teg 2786 1324608 6/32

Thr Ala Glu Gly Arg Pro Cys Pro Tyr Pro His Cys Gin Val Leu Ser 755 760 765 gcc cag cct ggc tea gag gag gaa etc gag gag ctg tgt gaa cag get 2834

Ala Gin Pro Gly Ser Glu Glu Glu Leu Glu Glu Leu Cys Glu Gin Ala 770 775 780 gtg tga gatgttcagg cctagctcca accaagagtg tgctccagat gtgtttgggc 2890

Val cctacctggc acagagtcct gctcctggga aaggaaagga ccacagcaaa caccattctt 2950 tttgccgtac ttcctagaag cactggaaga ggactggtga tggtggaggg tgagagggtg 3010 ccgtttcctg ctccagctcc agaccttgtc tgcagaaaac atctgcagtg cagcaaatcc 3070 atgtccagcc aggcaaccag ctgctgcctg tggcgtgtgt gggctggatc ccttgaaggc 3130 tgagtttttg agggcagaaa getagetatg ggtagccagg tgttacaaag gtgctgctcc 3190 ttctccaacc cctacttggt ttccctcacc ccaagcctca tgttcatacc agccagtggg 3250 ttcagcagaa cgcatgacac cttatcacct ccctccttgg gtgagctctg aacaccagct 3310 ttggcccctc cacagtaagg ctgctacatc aggggcaacc ctggctctat cattttcctt 3370 ttttgccaaa aggaccagta gcataggtga gccctgagca ctaaaaggag gggtccctga 3430 agctttccca ctatagtgtg gagttctgtc cctgaggtgg gtacagcagc cttggttcct 3490 ctgggggttg agaataagaa tagtggggag ggaaaaactc ctccttgaag atttcctgtc 3550 tcagagtccc agagaggtag aaaggaggaa tttctgctgg actttatctg ggcagaggaa 3610 ggatggaatg aaggtagaaa aggeagaatt acagctgagc ggggacaaca aagagttctt 3670 ctctgggaaa agttttgtct tagagcaagg atggaaaatg gggacaacaa aggaaaagca 3730 aa gtgtgacc cttgggtttg gacagcccag aggcccagct ccccagtata agccatacag 3790 gccagggacc cacaggagag tggattagag cacaagtctg gcctcactga gtggacaaga 3850 gctgatgggc ctcatcaggg tgacattcac cccagggcag cctgaccact cttggcccct 3910 caggcattat cccatttgga atgtgaatgt ggtggcaaag tgggcagagg accccacctg 3970 1324608 7/32 ggaacctttt tccctcagtt agtggggaga ctagcaccta ggtacccaca tgggtattta tatctgaacc agacagacgc ttgaatcagg cactatgtta agaaatatat ttatttgcta atatatttat ccacaaacag gcactatgtt aagaaatata tttatttgct aatatattta tccacaaatg tggtctggtc ttgtggtttt gttctgtcgt gactgtcact cagggtaaca acgtcatctc tttctacatc aagagaagta aattatttat gttatcagag gctaggctcc gattcatgaa aggatagggt agagtagagg gcttggcaat aagaactggt ttgtaagccc ctaaaagtgt ggcttagtga gatcagggaa ggagaaagca tgactggatt cttactgtgc ttcagtcatt attattatac tgttcacttc acacattatc atacttcagt gactcagacc ttgggcaaat actctgtgcc tcgctttttc agtccataaa atgggcctac ttaatagttg ttgcaggact tacatgagat aatagagtgt agaaaatatg ttccaaagtg gaaagtttta ttcatgtgat agaaaacatc caaacctgtc acagagccca t ctgaacaca gcatgggacc gccaacaaga agaaagcccg cccggaagca gctcaatcag gaggctgggc tggaatgaca gcgcagcggg gcctgaaact atttatatcc caaagctcct ctcagataaa cacaaatgac tgcgttctgc ctgcactcgg gctattgcga ggacagagag ctggtgctcc attggcgtga agtctccagg gccagaaggg gcctttgtcg cttcctcaca aggcacaagt tccccttctg cttccccgag aaaggtttgg taggggtggt ggtttagtgc ctatagaaca aggcatttcg cttcctagac ggtgaaatga aagggaaaaa aaggacacct aatctcctac aaatggtctt tagtaaagga accgtgtcta agcgctaaga actgcgcaaa gtataaatta tcagccggaa cgagcaaaca gacggagttt taaaagataa atacgcattt ttttccgccg tagctcccag gccagcattc ctgtgggaag caagtggaaa ccctatagcg ctctcgcagt taggaaggag gggtggggct gtcgctggat ttcttctcgg tctctgcaga gacaatccag agggagacag tggattcact gcccccaatg cttctaaaac ggggagacaa aacaaaaaaa aacaaacttc cgggttacca tcggggaaca ggaccgacgc ccagggccac cagccccctc gtgcc 4030 4090 4150 4210 4270 4330 4390 4450 4510 4570 4630 4690 4750 4810 4870 4930 4990 5050 5110 5170 5230 5290 5345 1324608 8 / 32 &lt;210〉 2 &lt;211> 783 &lt;212> PRT &lt;213&gt; Homo sapi Ens &lt;400&gt; 2

Met Ser Gly Gly His Gin Leu Gin Leu Ala Ala Leu Trp Pro Trp Leu 15 10 15

Leu Met Ala Thr Leu Gin Ala Gly Phe Gly Arg Thr Gly Leu Val Leu 20 25 30

Ala Ala Ala Val Glu Ser Glu Arg Ser Ala Glu Gin Lys Ala lie lie 35 40 45 ,

Arg Val lie Pro Leu Lys Met Asp Pro Thr Gly Lys Leu Asn Leu Thr 50 55 60

Leu Glu Gly Val Phe Ala Gly Val Ala Glu lie Thr Pro Ala Glu Gly 65 70 75 80

Lys Leu Met Gin Ser His Pro Leu Tyr Leu Cys Asn Ala Ser Asp Asp 85 90 95

Asp Asn Leu Glu Pro Gly Phe lie Ser lie Val Lys Leu Glu Ser Pro 100 105 110

Arg Arg Ala Pro Arg Pro Cys Leu Ser Leu Ala Ser Lys Ala Arg Met 115 120 125

Ala Gly Glu Arg Gly Ala Ser Ala Val Leu Phe Asp lie Thr Glu Asp 130 135 140

Arg Ala Ala Ala Glu Gin Leu 145 150

Gin Gin Pro Leu Gly Leu Thr Trp Pro 155 160 1324608 9/32

Val Val Leu lie Trp Gly Asn Asp Ala Glu Lys Leu Met Glu Phe Val 165 170 175

Tyr Lys Asn Gin Lys Ala His Val Arg lie Glu Leu Lys Glu Pro Pro 180 185 190

Ala Trp Pro Asp Tyr Asp Val Trp lie Leu Met Thr Val Val Gly Thr 195 200 205 lie Phe Val lie lie Leu Ala Ser Val Leu Arg lie Arg Cys Arg Pro 210 215 220

Arg His Ser Arg Pro Asp Pro Leu Gin Gin Arg Thr Ala Trp Ala lie 225 230 235 240

Ser Gin Leu Ala Thr Arg Arg Tyr Gin Ala Ser Cys Arg Gin Ala Arg 245 250 255

Gly Glu Trp Pro Asp Ser Gly Ser Ser Cys Ser Ser Ala Pro Val Cys 260 265 270

Ala He Cys Leu Glu Glu Phe Ser Glu Gly Gin Glu Leu Arg Val lie 275 280 285

Ser Cys Leu His Glu Phe His Arg Asn Cys Val Asp Pro Trp Leu His 290 295 300

Gin His Arg Thr Cys Pro Leu Cys Val Phe Asn lie Thr Glu Gly Asp 305 310 315 320

Ser Phe Ser Gin Ser Leu Gly Pro Ser Arg Ser Tyr Gin Glu Pro Gly 325 330 335

Arg Arg Leu His Leu lie Arg Gin His Pro Gly His Ala His Tyr His 340 345 350 1324608 10/32

Leu Pro Ala Ala Tyr Leu Leu Gly Pro Ser Arg Ser Ala Val Ala Arg 355 360 365

Pro Pro Arg Pro Gly Pro Phe Leu Pro Ser Gin Glu Pro Gly Met Gly 370 375 380

Pro Arg His His Arg Phe Pro Arg Ala Ala His Pro Arg Ala Pro Gly 385 390 395 400

Glu Gin Gin Arg Leu Ala Gly Ala Gin His Pro Tyr .Ala Gin Gly Trp 405 410 415

Gly Met Ser His Leu Gin Ser Thr Ser Gin His Pro Ala Ala Cys Pro 420 425 430

Val Pro Leu Arg Arg Ala Arg Pro Pro Asp Ser Ser Gly Ser Gly Glu 435 440 445

Ser Tyr Cys Thr Glu Arg Ser Gly Tyr Leu Ala Asp Gly Pro Ala Ser 450 455 460

Asp Ser Ser Ser Gly Pro Cys His Gly Ser Ser Ser Asp Ser Val Val 465 470 475 480

Asn Cys Thr Asp He Ser Leu Gin Gly Val His Gly Ser Ser Ser Thr 485 490 495

Phe Cys Ser Ser Leu Ser Ser Asp Phe Asp Pro Leu Val Tyr Cys Ser 500 505 510

Pro Lys Gly Asp Pro Gin Arg Val Asp Met Gin Pro Ser Val Thr Ser 515 520 525

Arg Pro Arg Ser Leu Asp Ser Val Val Pro Thr Gly Glu Thr Gin Val 530 535 540 1324608 11/32

Ser Ser His Val His Tyr His Arg His Arg His His His Tyr Lys Lys 545 550 555 560

Arg Phe Gin Trp His Gly Arg Lys Pro Gly Pro Glu Thr Gly Val Pro 565 570 575

Gin Ser Arg Pro Pro lie Pro Arg Thr Gin Pro Gin Pro Glu Pro Pro 580 585 590

Ser Pro Asp Gin Gin Val Thr Gly Ser Asn Ser Ala Ala Pro Ser Gly 595 600 605

Arg Leu Ser Asn Pro Gin Cys Pro Arg Ala Leu Pro Glu Pro Ala Pro 610 615 620

Gly Pro Val Asp Ala Ser Ser He Cys Pro Ser Thr Ser Ser Leu Phe 625 630 635 640

Asn Leu Gin Lys Ser Ser Leu Ser Ala Arg His Pro Gin Arg Lys Arg 645 650 655

Arg Gly Gly Pro Ser Glu Pro Thr Pro Gly Ser Arg Pro Gin Asp Ala 660 665 670

Thr Val His Pro Ala Cys Gin lie Phe Pro His Tyr Thr Pro Ser Val 675 680 685

Ala Tyr Pro Trp Ser Pro Glu Ala His Pro Leu lie Cys Gly Pro Pro 690 695 700

Gly Leu Asp Lys Arg Leu Leu Pro Glu Thr Pro Gly Pro Cys Tyr Ser 705 710 715 720

Asn Ser Gin Pro Val Trp Leu Cys Leu Thr Pro Arg Gin Pro Leu Glu 1324608 12/32 725 730 735

Pro His Pro Pro Gly Glu Gly Pro Ser Glu Trp Ser Ser Asp Thr Ala 740 745 750

Glu Gly Arg Pro Cys Pro Tyr Pro His Cys Gin Val Leu Ser Ala Gin 755 760 765

Pro Gly Ser Glu Glu Glu Leu Glu Glu Leu Cys Glu Gin Ala Val 770 775 780 &lt;210&gt; 3 &lt;211&gt; 22 &lt;212> DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized primer Sequence &lt;400&gt; 3 acaacagcct caagatcatc ag &lt;210&gt; 4 &lt;211> 20 -&lt;212> DNA &lt;213&gt; Artificial &lt;220&lt;223&gt; an artificially synthesized primer sequence &lt;400&gt; 4 ggtccaccac tgacacgttg &lt;210> 5 &lt;211> 27 <212> DNA &lt;213> Artificial &lt;220> &lt;223&gt; an artificially synthesized primer sequence 1324608 13/32 &lt;400&gt; 5 caggctttgg acgcacagga ctggtac 27 &lt;210〉 6 &lt;211> 27 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized primer sequence &lt;400&gt; 6 ctttgtgatc atcctggctt cggtgct 27 &lt;210&gt; 7 &lt;211&gt; 31 &lt;212&gt ; DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized primer sequence &lt;400&gt; 7 tgcagatctg cagctggtag catgagtggt g 31 &lt;210> 8 &lt;211> 32 &lt;212&gt; DNA <213> Artificial &lt;220> &lt;223&gt; an artificially synthesized primer sequence &lt;400&gt; 8 gaggagctgt gtgaacaggc tgtgtgagat gt 32 &lt;210> 9 &lt;211> 16 &lt;212> DNA &lt;213〉 Artificial &lt;220> &lt;223&gt; an artificially synthesized S-oligonucleotide 1324608 14/32 &lt;400&gt; 9 tggtagcatg agtggt 16 &lt;210> 10 &lt;211> 16 &lt;212> DNA <213> Artificial &lt;220> &lt;223&gt; an artificially synthesized S-oligonucleotide &lt;400&gt; 10 accactcatg ctacca 16 &lt;210> 11 &lt;211> 22 &lt;212> DNA &lt;213&gt; Artificial &lt;220&lt;223&gt; an artificially synthesized primer sequence &lt;400&gt; 11 tggtagccaa gtgcaggtta ta 22 &lt;210> 12 &lt;211> 22 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized primer sequence &lt;400> 12 ccaaagggtt tctgcagttt ca 22 &lt;210&gt; 13 &lt;211> 30 &lt;212> DNA <213> Artificial &lt;220> 1324608 15/32 &lt;223> an artificially synthesized primer sequenc e &lt;400&gt; 13 tgcggatcca gagcagattg tactgagagt &lt;210> 14 &lt;211> 29 &lt;212> DNA &lt;213&gt; Artificial &lt;220> &lt;223> an artificially synthesized primer sequence &lt;400> 14 ctctatctcg agtgaggcgg aaagaacca &lt;210> 15 &lt;211&gt; 47 <212> DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized primer sequence &lt;400&gt; 15 tttaagcttg aagaccattt ttggaaaaaa aaaaaaaaaa aaaaaac &lt;210> 16 &lt;211 〉 34 &lt;212> DNA &lt;213〉 Artificial &lt;220> &lt;223> an artificially synthesized primer sequence <400> 16 tttaagcttg aagacatggg aaagagtggt ctca &lt;210> 17 &lt;211> 51 <212> DNA <213> Artificial 30 29 47 34 &lt;220> &lt;220>1324608 16/32 &lt;223&gt; an artificially synthesized oligonucleotide sequence &lt;400&gt; 17 caccgaagca gcacgacttc ttcttcaaga gagaagaagt cgtgctgctt c 51 &lt;210> 18 &lt;211> 51 &lt; 212> DNA &lt;213〉 Artificial &lt;220&gt;&lt;223&gt; an ar Tificially synthesized oligonucleotide sequence &lt;400&gt; 18 aaaagaagca gcacgacttc ttctctcttg aagaagaagt cgtgctgctt c 51 &lt;210> 19 &lt;211> 51 &lt;212> DNA &lt;213&gt; Artificial &lt;220&lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400&gt; 19 tcccgtcacc ggatccaact cagttcaaga gactgagttg gatccggtga c 51 <210> 20 &lt;211> 51 <212> DNA &lt;213> Artificial <220> &lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400&gt; 20 aaaagtcacc ggatccaact Cagtctcttg aactgagttg gatccggtga c 51 <210> 21 &lt;211&gt; 51 &lt;212> DNA <213> Artificial &lt;220&gt;&lt;220&gt;1324608 17/32 &lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400&gt; Tcccgctatt gcacagaacg cagttcaaga gactgcgttc tgtgcaatag c 51 &lt;210> 22 &lt;211&gt; 51 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400&gt; 22 aaaagctatt gcacagaacg cagtctcttg aactgcgttc Tg Tgcaatag c 51 &lt;210&gt; 23 &lt;211> 51 &lt;212> DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400&gt; 23 tccccagaaa gctgttatca gagttcaaga gactctgata acagctttct g 51 &lt;;210&gt; 24 &lt;211> 51 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400&gt; 24 aaaacagaaa gctgttatca gagtctcttg aactctgata acagctttct g 51

&lt;210&gt; 25 &lt;211&gt; 51 &lt;212&gt; DNA 1324608 18/32 &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400&gt; 25 51 tccctgagcc acctccaatc cacttcaaga gagtggattg gaggtggctc a &lt;210> 26 &lt;211> 51 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400&gt; 26 51 aaaatgagcc acctccaatc cactctcttg aagtggattg gaggtggctc a &lt;210> 27 &lt;211> 51 <212> DNA &lt;213> Artificial &lt;220> &lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400&gt; 27 51 tcccctgcac ggacatcagc ctattcaaga gataggctga tgtccgtgca g &lt;210&gt; 28 &lt;211&gt; 51 &lt;212> DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized oligonucleotide for siRNA &lt;400> 28 aaaactgcac ggacatcagc ctatctcttg aataggctga tgtccgtgca g &lt;210> 29 &lt;211> 28 51 1324608 19/ 32 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artifici Allally synthesized primer sequence &lt;400&gt; 29 gaagatctgc agcggtggag tctgaaag 28 &lt;2i0&gt; 30 &lt;211> 31 &lt;212> DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized primer sequence &lt;400&gt; 30 ggaattcgga ctgggaaaat gaatctccct c 31 &lt;210> 31 &lt;211> 26 &lt;212> DNA &lt;213&gt; Artificial &lt;220&lt;223&gt; an artificially synthesized primer sequence <400> 31 ggagatctcc tgatcagcaa gtcacc 26 &lt;210 〉 32 &lt;211> 31 <212> DNA &lt;213> Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized primer sequence &lt;400&gt; 32 ggaattccac agcctgttca cacagctcct c 31 <210> 33 1324608 20/32 &lt;211 〉 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 33

Ser Tyr Gin Glu Pro Gly Arg Arg Leu <210> 34 &lt;211> 9 &lt;212&gt; PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

His Tyr His Leu Pro Ala Ala Tyr Leu 1 5 &lt;210&gt; 35 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial <220> &lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

Leu Phe Asn Leu Gin Lys Ser Ser Leu 1 5 &lt;210> 36 &lt;211> 9 <212> PRT &lt;213> Artificial &lt;220> 1324608 21/32 &lt;223&gt; an artificially kissing peptide sequence &lt;400 〉 36

Gly Phe Gly Arg Thr Gly Leu Val Leu 1 5 &lt;210> 37 &lt;211> 9 &lt;212&gt; PRT &lt;213&gt; Artificial &lt;220&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

Arg Tyr Gin Ala Ser Cys Arg Gin Ala 1 5 &lt;210> 38 &lt;211> 9 <212> PRT &lt;213> Artificial ' &lt;220> &lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 38

Arg Ala Pro Gly Glu Gin Gin Arg Leu <210> 39 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400> 39

Arg Ala Pro Arg Pro Cys Leu Ser Leu 1324608 22/32 1 5 &lt;210&gt; 40 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 40

Arg Pro Pro Arg Pro Gly Pro Phe Leu 1 5 &lt;210&gt; 41 &lt;211> 9 &lt;212&gt; PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

Lys Ala Val lie Arg Val lie Pro Leu 1 5 &lt;210&gt; 42 &lt;211> 9 &lt;212&gt; PRT <213> Artificial &lt;220> &lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

Asn Ser Gin Pro Val Trp Leu Cys Leu &lt;210&gt; 43 &lt;211&gt; 10 1324608 23/32 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 43

Ser Tyr Cys Thr Glu Arg Ser Gly Tyr Leu 1 5 10 &lt;210&gt; 44 &lt;211> 10 &lt;212> PRT &lt; 213 &gt; Artificial &lt;220 &lt; 223 &gt; 223 > an artificially kissing peptide sequence &lt;400&gt; 44

His Tyr His Leu Pro Ala Ala Tyr Leu Leu 15 10 &lt;210&gt; 45 <211> 10 &lt;212> PRT <213> Artificial &lt;220> &lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 45

Cys Tyr Ser Asn Ser Gin Pro Val Trp Leu 1 5 10 &lt;210> 46 &lt;211> 10 &lt;212> PRT <213> Artificial &lt;220> &lt;223&gt; an artificially kissing peptide sequence 1324608 24/32 &lt;;400&gt; 46 lie Phe Val lie He Leu Ala Ser Val Leu 1 5 10 &lt;210&gt; 47 <211> 10 &lt;212> PRT &lt;213&gt; Artificial &lt;220> &lt;223&gt; an artificially kissing peptide sequence &lt;;400&gt; 47

Val Phe Asn He Thr Glu Gly Asp Ser Phe 1 5 10 &lt;210> 48 &lt;211> 10 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 48

Thr Phe Cys Ser Ser Leu Ser Ser Asp Phe 1 5 10 &lt;210&gt; 49 &lt;211> 10 &lt;212> PRT &lt;213&gt; Artificial &lt;220&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 49

Lys Leu Met Gin Ser His Pro Leu Tyr Leu 1 5 10 1324608 25/32 &lt;210> 50 &lt;211> 10 &lt;212&gt; PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence <400> 50 .

Lys Met Asp Pro Thr Gly Lys Leu Asn Leu 15 10 &lt;210> 51 <211> 10 <212> PRT &lt;213> Artificial &lt;220> &lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

His Tyr Thr Pro Ser Val Ala Tyr Pro Trp 1 5 10

&lt;210> 52 &lt;211> 10 <212> PRT &lt;213> Artificial <220> &lt;223&gt; an artificially kissing peptide sequence &lt;400> 52

Gly Gin Glu Leu Arg Val lie Ser Cys Leu 1 5 10

<210> 53 <211> 9 &lt;212> PRT 1324608 26/32 &lt;213> Artificial &lt;220> &lt;223> an artificially kissing peptide sequence &lt;400&gt; 53

Asn Phe Gin Pro Val Trp Leu Cys Leu 1 5 &lt;210&gt; 54 &lt;211&gt; 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

Asn Tyr Gin Pro Val Trp Leu Cys Leu 1 5 &lt;210> 55 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 55

Lys Leu Asn Leu Thr Leu Glu Gly Val 1 5 &lt;210&gt; 56 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence 1324608 27/32 &lt;400&gt; 56

Gin Leu Ala Ala Leu Trp Pro Trp Leu 1 5 &lt;210&gt; 57 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

Leu Met Gin Ser His Pro Leu Tyr Leu 1 5 &lt;210> 58 <211> 9 &lt;212> PRT &lt;213> Artificial &lt;220> &lt;223&gt; an artificially kissing peptide sequence &lt;400> 58

Leu Leu Gly Pro Ser Arg Ser Ala Val 1 5 &lt;210> 59 <211> 9 &lt;212> PRT &lt;213> Artificial &lt;220> &lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 59

Ala Leu Trp Pro Trp Leu Leu Met Ala 1 5 1324608 28/32 &lt;210> 60 &lt;211> 9 &lt;212&gt; PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt; 400> 60

Trp Leu Leu Met Ala Thr Leu Gin Ala 1 5 &lt;210> 61 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

Trp lie Leu Met Thr Val Val Gly Thr 1 5 &lt;210&gt; 62 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

Lys Leu Met Glu Phe Val Tyr Lys Asn 1 5 &lt;210> 63 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;220>1324608 29/32 &lt;223&gt; an artificially synthesized Peptide sequence &lt;400&gt; 63

Asn Leu Thr Leu Glu Gly Val Phe Ala 1 5 &lt;210&gt; 64 &lt;211> 9 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt;

Gly Leu Thr Trp Pro Val Val Leu He 1 5 &lt;210> 65 &lt;211> 10 &lt;212> PRT <213> Artificial &lt;220> &lt;223&gt; an artificially kissing peptide sequence &lt;400> 65

Tyr Leu Leu Gly Pro Ser Arg Ser Ala Val 1 5 10 &lt;210> 66 &lt;211> 10 &lt;212> PRT &lt;213&gt; Artificial &lt;220 &lt; 223 &gt; 223 &gt; an artificially kissing peptide sequence &lt;400&gt; 66 1324608 30/32

Leu Met Thr Val Val Gly Thr lie Phe Val 1 5 10 &lt;210> 67 &lt;211> 10 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synchronized peptide sequence &lt;400&gt; 67

Cys Leu His Glu Phe His Arg Asn Cys Val 1 5 10 &lt;210> 68 &lt;211> 10 &lt;212&gt; PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synchronized peptide sequence &lt;400&gt; 68

Ser Leu Ser Ser Asp Phe Asp Pro Leu Val 1 5 10 &lt;210> 69 &lt;211> 10 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 69

Gin Leu Ala Ala lie Trp Pro Trp Leu Leu 1 5 10 1324608 31/32 &lt;210> 70 &lt;211> 10 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;400〉 70

Ala Leu Trp Pro Trp Leu Leu Met Ala Thr 1 5 10 &lt;210> 71 <211> 10 <212> PRT <213> Artificial &lt;220> &lt;223&gt; an artificially kissing peptide sequence &lt;400&gt; 71

Leu Gin Leu Ala Ala Leu Trp Pro Trp Leu 1 5 10 &lt;210〉 72 &lt;211> 10 &lt;212> PRT &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synchronized peptide sequence &lt;400&gt; 72

Trp Leu Cys Leu Thr Pro Arg Gin Pro Leu 1 5 10 &lt;210> 73 &lt;211> 10 &lt;212&gt; PRT <213> Artificial 1324608 32/32 &lt;220&gt;&lt;223&gt; an artificially kissing peptide sequence &lt;;400&gt; 73

Trp Leu His Gin His Arg Thr Cys Pro Leu 1 5 10 &lt;210> 74 &lt;211> 20 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized target sequence for siRNA &lt;400&gt; 74 20 gtcaccggat ccaactcagt &lt;210> 75 &lt;211> 20 &lt;212> DNA &lt;213&gt; Artificial &lt;220&gt;&lt;223&gt; an artificially synthesized target sequence for siRNA &lt;400&gt; 75 gctattgcac agaacgcagt 20

Claims (1)

1324608 i VI. Application for patent scope) "Year + Month" a 1. An isolated and purified multi-peptide 'selected from the following populations: (a) - a multi-peptide consisting of the amino acid sequence of SEQ ID NO: 2; (b) - a multi-peptide, It is composed of the amino acid sequence of SEQ ID NO: 2, in which ten or less amino acids are added, and has an organism equivalent to a protein consisting of the sequence identification number 2 amino acid sequence. And (c) a multi-peptide consisting of amino acid sequences selected from the following populations: sequence identifiers 42, 59, and 70. 2. An isolated and purified polynucleotide encoding the multi-peptide as described in claim 1 of the scope of the patent application. 3. A vector comprising the polynucleotide of claim 2 in the scope of the patent application. 4. A host cell comprising a polynucleic acid as described in claim 2, or a carrier as described in claim 3, wherein the preparation is as in the scope of the patent application. In the method of multi-segment, the method comprises the following steps: _ (a) cultivating the host cell as described in claim 4 (b) causing the host cell to express the multi-peptide; and (c) collecting The multi-peptide that is expressed. γ 6. A reverse-polynucleotide consisting of the nucleoside sequence of SEQ ID NO: 1. 7. A small interfering RNA whose preferred strands are selected from the following populations: The nucleotide sequences of SEQ ID NO: 74 and 75 are the target sequences. 1324608 _^ 92132870--f Month day ___ VI. Patent application scope 8. A method for diagnosing colorectal cancer, the method comprising the following steps: (a) detecting a coding sequence in a large intestine rectal tissue sample The expression amount of the gene of the acid sequence of the identification number 2; (b) The increase in the expression amount of the gene is linked to the colorectal cancer. 9. The method of claim 8, wherein the amount of expression is detected by any of the following groups: (a) detecting mRNA of the amino acid sequence of coding sequence number 2; (b) detecting a protein consisting of the sequence identification number 2 amino acid sequence. 10. A composition for treating colorectal cancer, the composition comprising a pharmaceutically effective amount of a reverse polynucleotide as an active ingredient, the antisense polyglycolic acid being a nucleotide of SEQ ID NO: The sequence consists of a pharmaceutically acceptable carrier. 11. A composition for treating colorectal cancer, the composition comprising - a pharmaceutically effective amount of a small interfering RNA consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO: 74 and 75, Target sequence, column 0 1 2. Use of a reverse polynucleotide - for the preparation of a medicament for the treatment of colorectal cancer, wherein the antisense polynucleotide consists of the sequence identification number J 〇 nucleotide sequence ^ A 13. The use of small interfering RNA for the preparation of a medicament for the treatment of colorectal cancer, wherein the small interfering RNA is composed of nucleotide sequences selected from the following groups: sequence identification numbers 74 and 75; , is the sequence of the target. 1324608 Case No. 92132870 Month a Amendment VI. Patent application scope 14. A use of a multi-peptide for the preparation of a medicament for the treatment of colorectal cancer, wherein the multi-peptide is selected from the following groups: sequence identification number 42 The amino acid sequences of 59 and 70 are composed. An antigen-presenting cell produced by contacting a dendritic cell with a multi-peptide consisting of amino acid sequences selected from the following populations: SEQ ID NOs: 42, 59, and 70; . A pharmaceutical composition for treating colorectal cancer, the pharmaceutical composition comprising a pharmaceutically effective amount of a multi-peptide as an active ingredient, the multi-peptide selected from the following groups: sequence identification number 42, 59 And the amino acid sequence of 70, and a pharmaceutically acceptable carrier. 2125-5994-PF3(N2).ptc Page 3 2010.03.01.097