TWI280247B - Surface protein of Neisseria bacterium - Google Patents

Abstract

The present invention provides a monoclonal antibody binding to Neisseria bacteria and its target antigen Ag473, which include the sequences of its polynucleotide and its amino acid, wherein the Neisseria bacteria can be Neisseria meningitidis or Neisseria gonorrhoeae; and wherein Ag473 can be made into a vaccine or a diagnostic or therapeutic reagent.

Description

1280247 IX. Description of the invention: [Technical field of the invention] The present invention relates to a Neisseria surface antigen, in particular to a surface antigen of Ag473 and a specific antibody thereof, which has the effects as a vaccine component, a diagnostic or therapeutic agent. . [Previous technique #?] According to 'Neisseria meningitidis (NM) as a Gram-negative bacterium with a laughing membrane. According to the chemical composition and antigenicity of capsular polysaccharide, it can be divided into 13 serogroups (ser〇type), in which serogroups A, B, C, Y and W-135 are human pathogens, which can cause fatal meningitis. And sepsis, which is the main factor causing mortality in the second world's national bureaucracy (Griffiss et al., 1984); among them, A, B, and C are prone to prevalence, and group A is mainly prevalent in the Sahara desert region of Africa and China; And North America is based on the B group (Verheul et Microbiol Rev 57:34-49, 1993); Taiwan's epidemic cerebrospinal meningitis has only B and W135 years, the first in 2001 Cases of type a, c and gamma were found. Although there are not many cases caused by Neisseria meningitidis in industrialized countries, in the era when transportation is developed and tourism is booming, the epidemic or regional brain ridge may be caused by Neisseria meningitidis infection. Membrane inflammation is still a global health problem that needs to be addressed (Pdt〇la, H. Dmgs 55:347-366, 1998). 'Because of the epidemic cerebrospinal meningitis is similar to influenza and has a short incubation period (about 2 to 10 days, usually 3 to 4 days). It is often a case of sputum. It is often caused by a delay in the timing of administration, causing nerve damage in patients. Even death, so once the 0909-A21076TWF1 (N2); kai 1280247 cases, often lead to public panic, and even medical disputes and other social issues. Like most bacterial infectious diseases, timely use of antibiotics can kill Neisseria meningitidis to achieve therapeutic and epidemic effects. However, excessive use of antibiotics can accelerate the development of resistant bacteria. Different drug-resistant NM strains have been found to have 'including penicillin (Ben et al, J Formos Med Assoc 100: 696-8, 2001), tetracycline (Dillon et al, Sex Transm Dis 28: 521). - 526, 2001), rifampin (Abadi et al, Antimicrob Agents Chemother 40: 646-651, 1996) and chloramphenicol (Galimand et al, 1998). Taiwan also had a case of meningitis in 2001 caused by Neisseria meningitidis against Benicillin (Ben et al., 2001). As the development of a new generation of antibiotics becomes more and more difficult, the development of effective vaccines for infectious diseases such as epidemic cerebrospinal meningitis is the fundamental epidemic prevention. Based on this consideration, the World Health Organization (WH0) listed the development of a more effective N. meningitidis vaccine as one of the important public health policies in the 1980s (Verheul et al.. 1993) Neisseria meningitidis The surface antigens are capsular polysaccharide (CPS), outer membrane protein, lunar polysaccharide (LPS, endotoxin) and piius, and these antigens have the possibility of becoming a vaccine. Since capsular polysaccharide is the outermost part of the bacterium and is directly related to the pathogenicity of the bacterium (Verheuletal, 1993), it has become the primary candidate for the epidemic. The vaccine development history of Neisseria gonorrhoeae has been more than 8 years. The first generation of vaccines was launched in the 1960s, but it is only effective for A, C, γ and Wl35. Because its composition is capsular polysaccharide, The immune response is weak and there is no memory cell production. Although it provides short-term epidemic prevention ability for young children and adults, it has no protective ability for high-risk groups (Pelt〇la, 1998). Because 0909-A21076TWF1(N2); kai 6 1280247 B group fc of the film polysaccharide is (2-8) Team B (N_acetyl) (IV) ^ polysialic acid), r, St (sialic acid) ^ #^ Glycoproteins on certain cell membranes of humans (eg, NCAM on nerve cells) (PQn et al., (d)), because of the immunotolerance, the polysaccharides of group b are slightly weaker than humans. And may cause autoimmune reactions' so the outer membrane protein has become the main choice in the development of group B vaccines. There are five main outer membrane proteins of Neisseria faecalis: the first protein is also called PorA, the first and the first is called pGfB, the fourth is 卩qing, and the fifth is opacity. protein. Clinical human test results show that the immune response elicited by the outer membrane protein vaccine is mainly directed to P〇rA (R〇senqvist d, 1995;

Mdagresetal., 1998). Since the major outer membrane proteins have differences between strains, such vaccines are only effective against strains of the same strain (Fischer et D., 1999). Although the Netherlands has developed a vaccine containing six PorA subtypes, the Shanglin epidemic field has so far provided effective protection against different H. sinensis strains. • Since the major outer membrane proteins are very prone to antigenic variation, if other outer membrane proteins with high conservation between the lines can be found, although the performance is higher than the number of >, if these 次 combine these secondary protein combinations into cocktails , will be able to become, a broad-spectrum plague. Before the genome of N. meningitidis was completely decoded, such membrane proteins have been shown to be effective vaccine components with p64k (U.S. Patent No. 5286484) and heme receptor (hem〇gi〇bin recept〇r, US patent).

No. 6121037), NspA (U.S. Patent No. 6,287,574 Bl), NhhA (U.S. Patent No. 6,607,729 B2), and NMASP (U.S. Patent No. 6,693,186, Β2). After genome decoding (TetteUn et al, 2〇〇〇; pizza et ^, such as 〇〇), with the performance of 5 recombinant protein, there have been NadA (Comanducci et al, 2002), 0909-A21076TWF1 (N2); Kai 78702 GNAl870 (Masignani et al, 2003), GNA33, GNA992, GNA1162, GNA1220, GNA1946, GNA2001 and GNA2132 (Pizza et al, 2000) were found to have surface potential for vaccine potential, including GNA1870, GNA33, GNA1162 GNA1946 and GNA2132 are lipoproteins. In addition to NspA, the above-mentioned proteins with vaccine potential are mainly discovered by biochemical or genetic sequences. NspA is a surface antigen found by a monoclonal antibody against the surface protein of Neisseria meningitidis. SUMMARY OF THE INVENTION The present invention comprises a monoclonal antibody 4-7-3 prepared by using a whole strain of Neisseria meningitidis as an immunogen, and an identified target antigen Ag473 thereof. This antigen has a molecular weight of approximately 1 (M5 kDa), a newly discovered and functionally unknown lipoprotein that is ubiquitous on the surface of Neisseria, including Neisseria meningitidis and Neisseria gonorrhoeae. Five Ag473 variants, sequence identification number:; [, 3, 5, 7, 9 as their nucleic acid sequence, sequence identification number: 2, 4, 6, 8, 10 are deduced amino acid sequences (Annex 1) Among them, the sequence identification numbers: 1 to 8 are sequences obtained by Neisseria meningitidis. The main difference between the variants is that the number of 21 test bases (gaagctgtaactgaagccaaa) in the nucleic acid sequence is different. The amino acid sequence is EAVTEAK. Sequence identification numbers: 9 and 10 are sequences obtained from Neisseria gonorrhoeae, wherein the sequence identification number: 9 is 95% identical to the sequence identification number: i (DNA), and the sequence identification number: 1〇 and sequence identification number: 2 (protein) is 90.4%. The present invention expresses Ag473 protein by recombinant DNA technology, and prepares antiserum, and the obtained antiserum can not only bind to live N. meningitidis, but also 0909-A21076TWF1(N2);kai 1280247 has bactericidal power Ag473 has the potential to become a vaccine composition and therapeutic target. The present invention uses the antibodies 4-7-3 and C〇l〇ny_PCR to detect the expression of Ag473 in the above two Neisserias by protein and gene level, respectively. The present invention also provides a new method for diagnosing Neisseria. In the present invention, the monoclonal antibody of the B group strain Nm22209 isolated from Taiwan is used as an antigen to prepare a monoclonal antibody as A tool for searching for vaccine components. In order to maintain the integrity of the whole bacteria, the bacteria after heat treatment are directly injected into the vaccine. (1) Preparation and characterization of monoclonal antibody 4-7-3: after heat treatment

Nm22209 was immunized by intraperitoneal injection, and Nm22209 whole bacteria were subjected to enzyme immunoassay (ELISA) to determine the antibody response to Nm22209. The spleen cells were fused with myeloma cell Sp2/0-Agl4 to obtain fusion tumor cells. The cell line secreting Nm22209-specific antibody was screened by whole-bacterial immunoassay. The binding of these cell culture media to human neuroblasts IMR-32 was analyzed by enzyme immunoassay. 'Winter 7_3 (IgG3) and Nm22209 There is a combination but no reaction with IMR-32. Further analysis of the binding reaction of 4_7_3 cell culture medium with other strains showed that 4-7-3 had binding ability to all tested strains, indicating that 4-7-3 antigens are ubiquitous on the surface of different strains of Neisseria meningitidis. . In order to clearly prove that the binding of 4-7-3 to the whole bacteria is mainly for a single antigen, one strain of each serogroup is selected for Western blot analysis (as shown in Figure 1), and the result is only 1 A reaction band appears at the position of 〇_15]^1^. The bactericidal test of Nm222〇8 strain was carried out with purified antibody and human complement, and about 6 g of antibody can achieve bactericidal effect of 5%. The above knot 0909-A21076TWF1 (N2); kai 1280247 It is proved that the antigen recognized by 4-7_3 is located on the surface of the cell. (B), 4-7-3 antigen identification · 2D electrophoresis analysis of Nm22209 total protein '4-7-3 for immunodetection to determine the antigen position (as shown in Figure 2), from silver staining In the film, the relative position of the protein was separated and analyzed by mass spectrometry. The result showed that the protein might be a hypothetical protein NMB14*68 of the N. meningitidis MC58 strain. The DOLOP (Madan Babu and Sankaran 2〇〇2) analysis showed that this hypothetical protein was a lipoprotein. Although the genome of group A Z2491 has the same DNA sequence (AL162756), this DNA is annotated as a part of a 979 amino acid protein. Previous studies have shown that the promoter of N. meningitidis in Escherichia coli (5·co/〇 can be expressed in 7awaya et al., 1999), in order to clarify whether this hypothetical protein is Ag473, according to the genome sequence of MC58 Polymerase chain reaction (pCR) primer, the DNA leading to this antigen and the upstream 329-bp of the gene of Nm22209 are amplified by the colony-polymerase chain reaction and cloned into pGEM_T Easy vector and sent to the large intestine. Bacillus HB101 is expressed. On the other hand, a Nm22209 mutant strain [Nm22209::Ag473(Gm)] was inserted into the gene, and the recombinant protein expressed by E. coli was recognized by antibody 4-7-3, while Nm222〇9:: Ag473 (Gm) was There are no protein bands that react with 4_7_3 (as shown in Figure 3). The above results confirmed that Ag473 is NMB1468, a newly discovered meningitis Neisseria rouge protein. (B), Ag473 gene sequence: sequence analysis of the above polymerase chain reaction product, found that the coding region (sequence identification number: 1) more than the MC58 sequence (sequence number: 3) 2i- a repeat of bp; resulting in a protein containing two repeats of Glu_Ala_Val_Thr_Glu_Ala_Ly's amino acid sequence 0909-A21076TWF1 (N2); kai 10 1280247 f 歹U (SEQ ID NO: 2, 昼 line portion). The Western blot method also shows that the size of Ag473 captured by different strains is slightly different (as shown in the figure), and the result metaphor Ag473 may have different variants. In order to understand the variant of Ag473: class, the Ag473 gene of the above strain was amplified by the polymerization enzyme chain reaction and cloned into pGEM-T Easy plastid for sequence analysis, and four sequences were found (SEQ ID NO: 1, 3,5,7), which contains a 21-bp repeat (the portion of the squall line) is different, the smallest gene and MC58 have the same sequence (SEQ ID NO: 3), and only one 21_bp 'the most has 4 21- The bp repeat sequence (SEQ ID NO: 7), the dominant proteins are 107, 114, 121 and 128 amino acids, respectively (see sequence identification numbers: 2, 4, 6, 8 and Figure 8). In order to determine whether the number of repeats contained in the AgW gene is only the above four types, the 141 strain was subjected to a polymerase chain reaction using the both ends of the repeat region as a primer, and the obtained product was a polyacrylamide gel. The electrophoresis analysis showed that only the above four repeat sequences appeared (shown in Fig. 4A), and the primer used in the polymerase chain reaction was indicated by the arrow in the Ag473-2 sequence of Figure 7 and the sequence identification number: 1. The Ag473 is divided into three segments, and the main difference in the proteins dominated by the four dual genes is the number of repeats contained in the II segment. (4A) Figure Μ refers to the mixing of alleles l-4, and 1-4 represent the number of repeats, respectively. (IV) Analysis of immunological characteristics of recombinant Ag473 (rAg473): In order to prove that Ag473 can be used as a component of Neisseria meningitidis vaccine, the DNA sequence of the dominant Ag473 protein is increased by Nm22209 and then cloned into the pET21 series vector and sent to the large intestine. Bacillus sp. BL21 (DE3) showed that the protein was purified by a Ni2+-affinity column. The performance and purity of rAg473 were detected by silver staining and Western blotting respectively. Western blotting and enzyme immunoassay were used to determine the antiserum against recombinant Ag473 (rAg473) 0909-A21076TWF1(N2); kai 1280247 anti-blood, "analyzed by enzyme immunoassay for the whole g of N. lyratum 8 Wei, the surface of the heterozygous rAg473 can identify the heart: the type of N. sphaeroides (as shown in Figure 5A®) and with the live 4_7,,,. (as shown in Figure 5B) 'The Nm22209 It is an immune strain used to prepare antibodies; Mutant refers to =2G9::Ag473(Gm); NM1 and _ are clinical isolates; 诵 and M5 are purchased by the American Center for Diseases (ATCC), respectively. Serogroups a, B and 〇 =, strain 'so that rAg473 can trigger the immune response against the whole bacteria, and second has the potential to become a vaccine. The initial animal in vitro (four) reliance results show that sputum serum has a bactericidal effect on Nm22208. 5) Performance of Ag473 in other strains: In order to further understand whether the antigen of AgW property is Neisseria@special-antigen, the present invention initially detects whether other bacteria carry the gene by colony-polymerase chain reaction. Wang Mibei analyzed nearly 20 strains of bacteria, including奈奈氏氏, There are Neisseria gonorrhoeae, dried Neisser _』·_, N. sphaeroides ^ shoulder surface and Lactose Netheria (TVWac^zmz.ca), the result is only this The four strains of Neisseria have a polymerase chain reaction product, in which Neisseria gonorrhoeae, Neisseria gonorrhoeae and N. lactis are similar in size to the Ag473 gene fragment. Currently, Neisseria gonorrhoeae has been carried out. The sequence of the polymerase chain reaction product with the dried Neisseria, the sequence of the Neisseria gonorrhoeae product sequence (SEQ ID NO: 9) and the dissociated gonorrhea genome sequence (identity) Up to 99% (as shown in Figure 6), and the nucleic acid sequence with sequence number: 1 (Ag473-2) is also as high as 95% (as shown in Figure 7); the dominant protein and Ag473-2 have 90.4 % is the same (as shown in Figure 8), so it is named Ag473-Ng. Western blotting of 0909-A21076TWF1(N2) with antibody 4·7_3; kai 12 1280247 by dot analysis confirmed that Ag473_Ng is in gonorrhea Sear's limb - an expressed protein (as shown in Figure 9) 'M is a pre-colored protein marker. This result shows that Ag473 not only has As a vaccine for meningitis, it can also be applied to the prevention of gonorrhea. Based on the above results, the Ag473 of the present invention refers to a protein which reacts with the antibody 4_7_3. Therefore, the present invention provides a protein recognized by the antibody 4_7_3. The protein sequence of (Ag473) includes the silk gt sequence of the sequence identification numbers: 2, 4, 6, 8 and ι〇, whereby a product such as an epidemic squaring reagent or a therapeutic reagent can be prepared. Further, the present invention provides a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 1, 3, 5, 7 and 9, whereby a vaccine combination or a diagnostic reagent or a therapeutic reagent can be prepared. The above is only the preferred embodiment of the present invention, and the scope of the present invention is not limited thereto; therefore, the simple equivalent changes and modifications made by the content of the invention and the contents of the invention are described. All should remain within the scope of the invention patent. 0909-A21076TWF1(N2); kai 13 1280247 [Simplified description of the drawings] Fig. 1 is a view showing the reaction of the antibody 4-7-3 with different total proteins of N. meningitidis by the western blot method of the present invention. 2A and 2B are the Western blotting method of the present invention for two-dimensional electrophoresis analysis of Nm22209 total protein (2A) silver-stained film and (2B) with 4-7-3 as a probe. Figure 3 shows the performance of Ag473 in E. coli five co" (Ag473) and Nm22209:: Ag473 (Gm) by the Western blot method of the present invention. (A) and (b) are antibodies 4-7-3 and anti-PorA as primary antibodies, respectively. Figure 4 is a fragment of the Ag473 gene of Neisseria meningitidis analyzed by the present invention. Figure 4B is a schematic representation of four Ag473 genes and dominant proteins of the invention. Figures 5A and 5B show the binding ability of the whole bacteria-enzyme immunoassay (5A) of the present invention and glory activated cell scanning analysis (FACS) (5B) mouse anti-Ag473 recombinant protein serum to a strain of N. meningitidis. Figure 6 is a Biast search result of the present invention. The nucleic acid sequence of the polymerase chain reaction product of Neisseria gonorrhoeae is compared to the database of the unfinished Neisseria faecalis genome. Figure 7 is a comparison of nucleic acid sequences between Ag473_2 (sequence identification number: ^ and Ag473_Ng (SEQ ID NO: 9) of the present invention. The difference is indicated by the bottom line. The two 21-bps repeated in A material is _2 Italicized. Figure 8 is a sequence comparison of typical amino compounds of different gene variants of Ag473 of the present invention. Ag473_Ng is a sequence derived from Neisseria gonorrhoeae g. Figure 9 is a 4_7_3 monoclonal antibody against meninges of the present invention. Neisseria gonorrhoeae total protein and Neisseria gonorrhoeae were detected by Western blotting method. 〇9〇9-A2l〇76TWF1(N2);kai 14 1280247 [Main component symbol description] None 0 0909-A21076TWF1(N2) ;kai 1280247 Sequence Listing [Serial Number] <120>Executive Disease Control Agency<140> TW093110881 <141> 2004-04-19 <160> 10 <170> PatentIn Version 7·0 <210> 1 <211> 342 <212> DNA <213> Neisseria meningitidis <400> 1 60 120 180 240 300 342 <21〇> 2 <211> 114 <212> PRT <213> Neisseria Meningitidis <400〉 2 Met Lys Lys Leu Leu lie Ala Ala Met Met Ala atgaaaaaat gccaaacagg gcttctgccg gctgcggctg actgaagcca gcgactcagg tattgattgc aggttaagga ccgagtctgc atgcaaaggc aagaagctgt aagcggcaga cgcaatgatg agcggttcaa cgcttctgcc aagtgccgag aactgaagca caaaatgaaa gcggctgcct gccgttgagt gtcgaagaag gaagctgtaa gctaaagata gatgccgcca tggcagcttg ccgatgttaa cgaaagacca ctgaagccaa ctttgaacaa aa ttcgcaagaa agacactgcg agtcaaagat agaagctgta agctgccgac 0909-A21076TWF2 (N2); kai 16 1280247 1 5 10 Ala Ala Leu Ala Ala Cys Ser Gin Glu Ala Lys 15 20 Gin Glu Val Lys Glu Ala Val Gin Ala Val Glu 25 30 Ser Asp Val Lys Asp Thr Ala Ala Ser Ala Ala 35 40 Glu Ser Ala Ala Ser Ala Val Glu Glu Ala Lys 45 50 55 Asp Gin Val Lys Asp Ala Ala Ala Asp Ala Lys 60 65 Ala Ser Ala Glu Glu Ala Val Thr Glu Ala Lys 70 75 Glu Ala Val Thr Glu Ala Lys Glu Ala Val Thr 80 85 Glu Ala Ala Lys Asp Thr Leu Asn Lys Ala Ala 90 95 Asp Ala Thr Gin Glu Ala Ala Asp Lys Met Lys 100 105 110 Asp Ala Ala Lys <210> 3 <211〉 3 21 < 212 > DNA < 213 > Neisseria meningitidis < 400 > 3 ttcgcaagaa agacactgcg agtcaaagat agaagctgta agcggcagac 60 120 180 240 300 atgaaaaaat tattgattgc cgcaatgatg gcggctgcct tggcagcttg gccaaacagg aggttaagga agcggttcaa gccgttgagt ccgatgttaa gcttctgccg ccgagtctgc cgcttctgcc gtcgaagaag cgaaagacca gctgcggctg atgcaaaggc aagtgccgag gaagctgtaa ctgaagccaa actgaagcag ctaaagatac tttgaacaaa Gctgccgacg cgactcagga aaaatgaaag atgccgccaa a 0909-A21076TWF2(N2);kai 17 321 1280247

<210> 4 <211> 107 <212> PRT <213> Neisseria meningitidis <400> 4

Met Lys Lys Leu Leu lie Ala Ala Met Met Ala 15 10

Ala Ala Leu Ala Ala Cys Ser Gin Glu Ala Lys 15 20

Gin Glu Val Lys Glu Ala Val Gin Ala Val Glu 25 30

Ser Asp Val Lys Asp Thr Ala Ala Ser Ala Ala 35 40

Glu Ser Ala Ala Ser Ala Val Glu Glu Ala Lys 45 50 55

Asp Gin Val Lys Asp Ala Ala Ala Asp Ala Lys 60 65

Ala Ser Ala Glu Glu Ala Val Thr Glu Ala Lys 7 0 75

Glu Ala Val Thr Glu Ala Ala Lys Asp Thr Leu 80 85

Asn Lys Ala Ala Asp Ala Thr Gin Glu Ala Ala 90 95

Asp Lys Met Lys Asp Ala Ala Lys 100 105 <21〇> 5 <211> 363 <212> DNA <213> Neisseria meningitidis <4〇〇> 5 60 atgaaaaaat tattgattgc cgcaatgatg gcggctgcct tggcagcttg ttcgcaagaa gccaaacagg aggttaagga agcggttcaa gccgttgagt ccgatgttaa agacactgcg 0909-A21076TWF2 (N2); kai 18 120 180 1280247 gcttctgccg ccgagtctgc cgcttctgcc gtcgaagaag cgaaagacca agtcaaagat gctgcggctg atgcaaaggc aagtgccgag gaagctgtaa ctgaagccaa agaagctgta actgaagcca aagaagctgt aactgaagcc aaagaagctg taactgaagc agctaaagat actttgaaca aagctgccgac gcgactcagg aagcggcaga caaaatgaaa gatgccgcc aaa < 210 > 6 < 211 > 121

<212> PRT <213> Neisseria meningitidis <4〇0> 6

Met Lys Lys Leu Leu lie Ala Ala Met Met Ala 1 5 10

Ala Ala Leu Ala Ala Cys Ser Gin Glu Ala Lys 15 20

Gin Glu Val Lys Glu Ala Val Gin Ala Val Glu 25 30

Ser Asp Val Lys Asp Thr Ala Ala Ser Ala Ala 35 40

Glu Ser Ala Ala Ser Ala Val Glu Glu Ala Lys 45 50 55

Asp Gin Val Lys Asp Ala Ala Ala Asp Ala Lys 60 65

Ala Ser Ala Glu Glu Ala Val Thr Glu Ala Lys 7 0 75

Glu Ala Val Thr Glu Ala Lys Glu Ala Val Thr 80 85

Glu Ala Lys Glu Ala Val Thr Glu Ala Ala Lys 90 95

Asp Thr Leu Asn Lys Ala Ala Asp Ala Thr Gin 100 105 110

Glu Ala Ala Asp Lys Met Lys Asp Ala Ala Lys 120 240 300 360 363 115 0909-A21076TWF2(N2);kai 1280247

<21〇〉7 <211> 384 <212> DNA <213>Neisseria meningitidis <4〇〇> 7 60 120 180 240 300 360 384 atgaaaaaat tattgattgc cgcaatgatg gcggctgcct tggcagcttg ttcgcaagaa gccaaacagg aggttaagga agcggttcaa gccgttgagt ccgatgttaa agacactgcg gcttctgccg ccgagtctgc cgcttctgcc gtcgaagaag cgaaagacca agtcaaagat gctgcggctg atgcaaaggc aagtgccgag gaagctgtaa ctgaagccaa agaagctgta actgaagcca aagaagctgt aactgaagcc aaagaagctg taactgaagc caaagaagct gtaactgaag cagctaaaga tactttgaac aaagctgccg acgcgactca ggaagcggca gacaaaatgaa agatgccgc caaa

<210> 8 <211> 128 <212> PRT <213> Neisseria meningitidis <400>

Met Lys Lys Leu Leu lie Ala Ala Met Met Ala 1 5 10 Ala Ala Leu Ala Ala Cys Ser Gin Glu Ala Lys 15 20 Gin Glu Val Lys Glu Ala Val Gin Ala Val Glu 25 30 Ser Asp Val Lys Asp Thr Ala Ala Ser Ala Ala 35 40 Glu Ser Ala Ala Ser Ala Val Glu Glu Ala Lys 45 5 〇55 Asp Gin Val Lys Asp Ala Ala Ala Asp Ala Lys 60 65 〇9〇9-A21〇76TWF2(N2);kai 20 1280247

Ala Ser Ala Glu Glu Ala Val Thr Glu Ala Lys 70 75 Glu Ala Val Thr Glu Ala Lys Glu Ala Val Thr 80 85 Glu Ala Lys Glu Ala Val Thr Glu Ala Lys Glu 90 95 Ala Val Thr Glu Ala Ala Lys Asp Thr Leu Asn 100 105 110 Lys Ala Ala Asp Ala Thr Gin Glu Ala Ala Asp 115 120 Lys Met Lys Asp Ala Ala Lys 125 <210> 9 <211> 342

≪ 212 > DNA < 213 > Neisseria gonorrhoeae < 4〇〇 > 9 atgaaaaaat tattgattgc cgcaatgatg gccaaacagg aggttaaaga agcggcccaa gcttctgccg ccgagtctgc cgcttctgcc gctgcggctg atgcaaaggc aagtgccgag gccgaaacca aagaagcggt aagcgaagcg gcggctcagg aagcggcaga caaaatgaaa gcggctgcct tggcagcttg gccgttgagt ccgatgttaa gtcgaagaag cgaaaggcca gaagctgtaa ctgaagccaa gctaaagaca ctttgaacaa gatgccgcca aa ttcgcaagaa Agacactgcg agtcaaagat agacgcggca agccgccgac 60 120 180 240 300 342 <210> 10 <211> 114

<212> PRT <213> Neisseria gonorrhoeae <400> 10 Met Lys Lys Leu Leu lie Ala Ala Met Met Ala 0909-A21076TWF2(N2); kai 21 1280247 1 5 10

Ala Ala Leu Ala Ala Cys Ser Gin Glu Ala 15 20

Gin Glu Val Lys Glu Ala Ala Gin Ala Val 25 3 0

Ser Asp Val Lys Asp Thr Ala Ala Ser Ala 3 5 40

Glu Ser Ala Ala Ser Ala Val Glu Glu Ala 45 50 55

Gly Gin Val Lys Asp Ala Ala Ala Asp Ala 60 65

Ala Ser Ala Glu Glu Ala Val Thr Glu Ala 7 0 75

Asp Ala Ala Ala Glu Thr Lys Glu Ala Val 80 85

Glu Ala Ala Lys Asp Thr Leu Asn Lys Ala 90 95

Asp Ala Ala Gin Glu Ala Ala Asp Lys Met 100 105 110

Asp Ala Ala Lys 〇909-A21〇76TWF2(N2);kai

Lys Glu Ala Lys Lys Lys Ser Ala Lys 22

Claims (1)

1280247 X. Patent application scope: l An isolated protein, an immunological reaction consisting of a sequence of Neisseria-resistant bacteria caused by Sequence Discriminating Fiber 2. Clearly: the amino acid described in 6 or 8 2. As described in the scope of the patent application, in the case of i, the isolated protein sequence described by the member may be a vaccine. 3. If the scope of the patent application is the first, the sequence is a protein with the step === 4. For example, the reagent for reading the patent scope. Quality, the isolated protein described by the staff 5. - Species: tiller:, step is a therapeutic agent. The protein sequence encoded by the anti-Nexus gene is transcribed. The nucleic acid sequence of the sequence is identified by the sequence identification number: 5 or 7 of the nucleic acid of (4), 7. If the vaccine is applied. Wherein the sequence is the isolated nucleic acid as described in Item 1. 8. If the application is a diagnostic reagent. Wherein, the isolated nucleic acid described in the item is a therapeutic agent. 23 1280247 VII. Designated representative map: (1) The representative representative of the case is: (1). (2) A brief description of the symbol of the representative figure·· No 0. 8. If there is a chemical formula in this case, please disclose the chemical formula that best shows the characteristics of the invention: None 0 0909-A21076TWF1(N2);kai 4