CN110818779B - Group B epidemic encephalitis fHbp-V2 recombinant protein and preparation method thereof, vaccine composition and application - Google Patents

Abstract

The invention provides a B-group epidemic encephalitis fHbp-V2 recombinant protein, a preparation method thereof, a vaccine composition and application thereof, wherein antigen protein genes of the vaccine are from Chinese epidemic B-group epidemic encephalitis strains, and an antigen protein immune mouse can induce and generate a binding antibody reaction with the average titer of 102600 and a bactericidal antibody reaction aiming at the B-group epidemic encephalitis strains of fHbp-V2 and fHbp-V3 and can be used for preventing infection caused by the B-group epidemic encephalitis strains of fHbp-V2 and fHbp-V3 genes.

Description

Group B epidemic encephalitis fHbp-V2 recombinant protein and preparation method thereof, vaccine composition and application

Technical Field

The invention belongs to the field of vaccines, and particularly relates to a group B epidemic cerebrospinal meningitis fHbp-V2 recombinant protein, an amino acid sequence of the recombinant protein, a gene for encoding the recombinant protein, a vaccine composition containing the recombinant protein, a preparation method of the recombinant protein, and application of the recombinant protein in preparation of a vaccine for preventing cerebrospinal meningitis or bacteremia diseases.

Background

Epidemic cerebrospinal meningitis (epidemic cerebrospinal meningitis for short) belongs to the second infectious disease prescribed in China, is an infectious disease which is caused by gram-negative Neisseria and is transmitted through a respiratory tract with acute cerebrospinal meningitis and septicemia as main symptoms, infants and teenagers are main groups with diseases, Neisseria meningitidis usually does not cause diseases, and can be planted in the nasopharynx part of a human body in an asymptomatic mode, and cerebrospinal meningitis and bacteremia can be caused in some cases. The incidence rate of epidemic cerebrospinal meningitis in China is reduced to below 0.01/10 ten thousand, and the Chinese legal infectious disease data in 2018 issued by the Chinese disease control and prevention control center shows that the incidence rate of epidemic cerebrospinal meningitis in China is 0.0075/10 ten thousand, and the mortality rate is 8-15%.

According to the nature of its capsular polysaccharide, epidemic encephalitis can be divided into 13 serogroups, of which A, B, C, W and Y serogroups are the major epidemic groups, and more than 95% of cases of epidemic encephalitis are caused by infection with these serogroups. Among them A, C, W, Y group epidemic encephalitis corresponding capsular polysaccharide vaccine and polysaccharide conjugate vaccine are already on the market, and are used for preventing the infection of the four epidemic encephalitis serogroups. And the B-group epidemic encephalitis is low in immunogenicity because the capsular polysaccharide is an analogue of sialyl acyl protein of human cells, and cannot be used for researching the B-group epidemic encephalitis vaccine.

The fHbp is lipoprotein which is positioned on the outer membrane of the epidemic encephalitis and can be combined with the H factor, the H factor has an important function in a complement system, and the fHbp can escape from the killing effect of an immune system on the epidemic encephalitis strain in a mode of being combined with the H factor and is an important group B epidemic encephalitis vaccine antigen. Based on the protein sequence of fHbp, fHbp is divided into 3 variant groups V1, V2, and V3, with the homology of fHbp antigen within each variant group being 91.6-99%, and the homology of fHbp antigen between different variant groups being at least 62.8%. According to the research data of the Chinese disease control center on the B-group epidemic encephalitis, the fHbp genes of the B-group epidemic encephalitis strains in China and European and American areas are different, the fHbp gene of the European and American epidemic strains is mainly V1 and accounts for 70% of the epidemic strains, and the fHbp gene of the Chinese epidemic B-group epidemic encephalitis strain is mainly V2.

2B-group epidemic encephalitis vaccine products are on the market in European and American areas, one vaccine comprises two fHbp antigen proteins, namely fHbp-V1.45 and fHbp-V3.55, the other vaccine also comprises fHbp-V1.1 protein, and the three fHbp proteins are not found in the Chinese B-group epidemic encephalitis strain, so that the fHbp antigen protein for screening the Chinese epidemic B-group epidemic encephalitis strain plays an important role in developing the vaccine according with the Chinese B-group epidemic situation.

Disclosure of Invention

The invention provides a group B epidemic cerebrospinal meningitis fHbp-V2 recombinant protein which has an amino acid sequence shown as seq ID No. 1.

The invention provides a group B epidemic encephalitis fHbp-V2 gene sequence which encodes the group B epidemic encephalitis fHbp-V2 recombinant protein as claimed in claim 1.

Preferably, the nucleotide sequence of the group B epidemic cerebrospinal meningitis fHbp-V2 gene sequence is shown as seq ID No. 2.

Preferably, the nucleotide sequence of the group B epidemic cerebrospinal meningitis fHbp-V2 gene is synthesized after codon optimization according to the codon preference of Escherichia coli, and is shown as seq ID No. 3.

The invention provides a vaccine composition which is characterized by comprising the group B epidemic cerebrospinal meningitis fHbp-V2 recombinant protein and aluminum hydroxide serving as an adjuvant, a complete Freund adjuvant or an incomplete Freund adjuvant.

Preferably, the content of the recombinant protein of the group B epidemic cerebrospinal meningitis fHbp-V2 is 200 ug/ml.

Preferably, the content of the aluminum hydroxide adjuvant is 1 mg/ml.

The invention provides application of the group B epidemic cerebrospinal meningitis fHbp-V2 recombinant protein antigen in preparation of a vaccine for preventing cerebrospinal meningitis or bacteremia diseases.

The invention provides a preparation method of the group B epidemic cerebrospinal meningitis fHbp-V2 recombinant protein, which comprises the following steps:

obtaining a gene sequence: the nucleotide sequence of fHbp-V2 gene shown in seqID No.2 is obtained from fHbp gene sub-variant V2.18 strain of group B epidemic cerebrospinal meningitis preserved in Chinese disease control center by PCR gene amplification method, wherein PCR primers used for amplification are respectively: an upstream primer: TGACCTGCCTCATTGATGC, downstream primer: GCCGTCCGAACACGATAATTTACCG, respectively;

codon optimization: carrying out codon preference optimization synthesis on the nucleotide sequence of the fHbp gene shown as seq ID NO.2 by using lasergene software to obtain the nucleotide sequence shown as seq ID NO. 3;

constructing a prokaryotic expression plasmid:

carrying out double enzyme digestion on the codon-optimized fHbp-V2 gene and a prokaryotic pET28a expression vector by using Nco l and EcoR I restriction endonucleases, recovering gene fragments, then connecting the gene fragments by using T4 DNA ligase, converting a connecting product into a DH5a competent cell, culturing and identifying;

constructing an expression strain:

successfully constructed clone transformed BL21(DE3) expression competent cells are induced, cultured and induced to express, and SDS-PAGE protein electrophoresis is used for identifying the expression of mycoprotein; screening strains with high expression quantity;

expression and purification of fHbp-V2 recombinant protein:

and culturing, collecting, crushing and purifying the strain with high expression level to obtain the fHbp-V2 recombinant protein.

The fHbp-V2 recombinant protein antigen gene sequence related by the invention is derived from a strain of a B-group epidemic encephalitis in China, the fHbp gene of the strain belongs to a sub-Variant type V2.18(Variant 2.18 from the Chinese disease prevention and control center), the antigen gene is subjected to codon optimization synthesis according to the codon preference of escherichia coli and then cloned to a prokaryotic expression vector pET28a, the B-group epidemic encephalitis fHbp-V2 recombinant protein antigen is obtained after expression and purification, and immune serum of the obtained fHbp-V2 antigen can generate a bactericidal antibody aiming at the B-group epidemic encephalitis strain of fHbp-V2 and fHbp-V3, and the effect is obvious.

The fHbp-V2 recombinant protein antigen can induce cross bactericidal antibody reaction aiming at the group B epidemic encephalitis fHbp-V3 strain, and can be used for preventing infection of the group B epidemic encephalitis fHbp-V2 strain and the group B epidemic encephalitis fHbp-V3 strain.

The invention has the advantages that the antigen gene of the fHbp-V2 recombinant protein obtained by screening is from epidemic B-group epidemic encephalitis strain in China, and can be used for preventing the epidemic of the epidemic B-group epidemic encephalitis strain in China.

Drawings

FIG. 1: a DNA electrophoresis diagram of the fHbp-V2 gene sequence by double enzyme digestion;

FIG. 2: a DNA electrophoresis picture of pET28a carrier double enzyme digestion;

FIG. 3: an SDS-PAGE picture of the expression condition of the prokaryotic expression protein strain of the fHbp-V2 gene;

FIG. 4: an SDS-PAGE profile of the purified fHbp-V2 recombinant protein;

FIG. 5: the binding antibody response induced by the immune serum of the recombinant protein fHbp-V2;

FIG. 6: the FHbp-V2 recombinant protein immune serum induces a bactericidal antibody response;

Detailed Description

In order that those skilled in the art will better understand the technical solutions of the present invention, the present invention will be further described in detail with reference to the following detailed description.

Experimental methods without specific conditions noted in the examples of this patent generally follow conventional conditions, such as molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).

Example 1 construction of a prokaryotic expression plasmid for fHbp-V2

1.1. Obtaining a Gene sequence

The nucleotide sequence of fHbp-V2 gene shown in seq ID No.2 is obtained from the sub-variant V2.18 strain of fHbp gene of group B epidemic cerebrospinal meningitis preserved in Chinese disease control center by a conventional PCR gene amplification mode, and PCR primers used for amplification are respectively: an upstream primer: TGACCTGCCTCATTGATGC, downstream primer: GCCGTCCGAACACGATAATTTACCG, PCR the condition is pre-denaturation at 95 deg.C for 5 min; denaturation at 95 ℃ for 30 s; annealing at 60 ℃ for 30 s; extension at 72 ℃ for 60 s; 30 cycles; extending for 5min at 72 ℃;

1.2 codon optimization:

for better expression of target protein, the signal peptide nucleotide sequence of fHbp gene shown in seq ID No.2 is removed and the nucleotide sequence described in seq ID No.3 is obtained by using lasergene software to perform codon preference optimization synthesis of Escherichia coli;

double digestion of the fHbp-V2 Gene and pET28a vector

Carrying out double enzyme digestion treatment on the fHbp-V2 gene optimally synthesized and connected to the PMD-19T carrier by using Nco I and EcoR I restriction enzymes, carrying out overnight enzyme digestion at 37 ℃, wherein the electrophoresis result of the enzyme-digested DNA is shown in figure 1;

the prokaryotic expression vector pET28a was digested simultaneously with restriction enzymes Nco I and EcoR I and digested overnight at 37 ℃ as shown in FIG. 2.

1.4. Recovery and ligation of the cleaved fragments

The fHbp-V2 gene and pET28a gene fragments which are subjected to restriction enzyme digestion overnight by Nco I and EcoR I restriction enzymes are firstly subjected to gel recovery, the recovered gene fragments are connected by T4 DNA ligase, and the connecting system is as follows:

components	Volume (μ L)
		ddH20	3
10×buffer	2
		T4 ligase	1
pET28a vector gene	4
		fHbp-V2 gene	10

1.5. Transformation and PCR identification of ligation products

The ligation product is used for transforming DH5 alpha competent cells, then the cells are spread on LB solid culture medium containing kanamycin resistance and cultured overnight at 37 ℃, grown colonies are picked for PCR identification, and the identification primer is a universal primer of a pET28a vector, and the sequence of the primer is as follows:

an upstream primer: 5'-TAATACGACTCACTATAGGG-3'

A downstream primer: 5'-GCTAGTTATTGCTCAGCGG-3'

The action system of PCR is as follows:

PCR reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s; annealing at 58 ℃ for 30 s; extension at 72 ℃ for 60 s; 30 cycles; extending for 5min at 72 ℃; the reaction was terminated at 4 ℃. PCR identification of correct colonies was carried out by sequencing identification.

Example 2 establishment of prokaryotic expression Strain of fHbp-V2

BL21(DE3) competent cells are transformed by fHbp-V2 prokaryotic expression plasmids with correct sequencing, the cells are coated on LB solid culture medium containing kanamycin resistance, colonies are picked to a test tube containing 5ml of liquid LB culture medium, the cells are cultured on a shaking table with the rotation speed of 180rpm at 37 ℃ until the 0D value of the bacterial liquid reaches 0.2-0.4, 5 mu L of IPTG (isopropyl-beta-D-thiogalactoside) is added for induction expression, the cells are collected at 12000rpm after the induction expression is carried out for 3h, and the expression of mycoprotein is identified by running SDS-PAGE protein electrophoresis after the cells are resuspended by PBS solution. FIG. 3 shows the expression of the protein prokaryotic expression strain fHbp-V2.

Example 3 expression and purification of fHbp-V2 recombinant protein

Expression of fHbp-V2 recombinant protein

1) And inoculating 50 mu L of fHbp-V2 prokaryotic expression bacterial liquid with high expression quantity to a test tube containing 10mL of liquid LB culture medium, culturing overnight on a shaking table with the rotation speed of 180rpm at 37 ℃, and inoculating to a culture bottle containing 2L of liquid LB culture medium for culturing the next morning.

2) And culturing until the 0D value of the bacterial liquid reaches 0.2-0.4, adding 2mL of IPTG (isopropyl-beta-thiogalactoside) for induction expression, and performing expression on a shaking table at 16 ℃ and the rotating speed of 180rpm for 20 hours.

3) The bacterial suspension was centrifuged at 8000rpm for 30min, and the cells were collected and resuspended in 200mL of 30mM/L Tris solution at pH7.5 to form a cell suspension.

4) And crushing the thalli by using a high-pressure homogenizer under the conditions of pressure of 600bar, flow rate of 38.00HZ and crushing time of 10 min.

5) And centrifuging the crushed solution at 10000rpm, collecting supernatant and purifying the target protein.

Purification of the recombinant protein fHbp-V2

Sepharose DEAE was used as a purification packing, the equilibration buffer was 30mM/L Tris buffer at pH7.5, and the eluent was 30mM/L Tris solution at pH7.5 and 0.5M/L NaCl. FIG. 4 shows the purified recombinant protein of fHbp-V2.

Example 4 determination of the concentration of fHbp-V2 recombinant protein

1) Preparation of a standard sample: adding 0, 0.2, 0.4, 0.6, 0.8 and 1.0ml of standard protein solution (with concentration of 100 μ g/ml) into 6 large test tubes, and adding water to 1.0 ml;

2) diluting a sample to be detected to 1.0ml according to a proper dilution;

3) each tube was charged with 5ml of sodium tartrate and 50 ml of copper sulfate: 1, quickly mixing the mixed solution on a vortex mixer, and reacting for 10 minutes at room temperature;

4) 0.5 ml of a 1: 1 mixture of Folin phenol reagent and water was added tube by tube, mixed immediately and developed for 30 minutes at room temperature.

5) The absorbance value of 650nm of the solution in each tube was determined using the first tube without protein solution as a blank. And drawing a standard curve by taking the amount of the protein as an abscissa and the absorbance value as an ordinate. And (4) according to the absorbance value of the detected sample, checking the corresponding protein mass on the standard curve, thereby calculating the protein concentration of the sample solution.

Example 5 animal immunization

The method is characterized in that an aluminum hydroxide adjuvant is used as an antigen adjuvant, the final concentration of fHbp-V2 antigen is 200ug/ml of protein, the concentration of the aluminum adjuvant is 1mg/ml, a Balb/C mouse is immunized after fHbp-V2 recombinant protein is adsorbed, the adsorption condition is that magnetic stirring is carried out at 300rpm for 1h, the immunization dose is 20 ug/mouse/time, the immunization mode is intraperitoneal immunization, three needles are immunized, the immunization interval is 3 weeks, 10 mice in each group are collected, and serum is separated for antibody detection 2 weeks after the last immunization. In further research, Freund's adjuvant is selected as an adjuvant of an antigen, the first needle is complete Freund's adjuvant, the second needle is incomplete Freund's adjuvant (the Freund's adjuvant and the incomplete Freund's adjuvant are purchased from commercial channels), the adjuvant and a protein solution are mixed in equal volume, and then emulsification is carried out to form an emulsion drop immune animal which is not scattered in water, and the protein concentration is 200 ug/ml. Selecting two immunization modes of muscle immunization and abdominal cavity immunization, wherein the immunization dose is 20 mu g/mouse/time, three immunization needles are used, the immunization interval is 3 weeks, 10 mice in each group are used, and blood is collected 2 weeks after the last immunization to separate serum for antibody detection.

ELISA detection of binding antibody reaction

Coating purified fHbp-V2 antigen with the concentration of 10ug/mL on a 96-well polystyrene flat plate overnight at 37 ℃, coating 100 mu L of each well, discarding supernatant, washing three times by PBST, patting the solution dry, then sealing by 5% skim milk solution, sealing 200 mu L of each well at 37 ℃ for 2h, discarding the solution, washing three times by PBST, patting the solution dry, then adding mouse serum solution diluted by sealing solution, reacting at 37 ℃ for 1h and 100 mu L of each well, discarding the solution, washing three times by PBST, patting the dry, then adding goat anti-mouse secondary antibody solution with HRP label diluted by sealing solution, reacting at 37 ℃ for 1h and 100 mu L of each well, washing three times by PBST, patting the dry, then adding TMB chromogenic substrate solution, reacting at 100 mu L of each well for 5min, then adding 50 mu L of stop solution to terminate the reaction, detecting the photometric value of 0D450, and judging the antibody binding reaction titer of the serum. FIG. 5 shows that the mean titer of antibodies induced by the immune serum of the recombinant protein fHbp-V2 is 102600.

7. Sterilization antibody detection

1) Complement and serum sample inactivation: the complement was inactivated by the reference serum, the test serum and a small amount of complement at 56 ℃ for 30 min.

2) Preparation of target bacteria suspension concentration (final concentration 4000 CFU/ml):

typical colonies selected for overnight culture were inoculated onto Columbia blood medium plates for 4-6h (streaking). Scraping and takingMixing thallus Porphyrae with DPBS buffer solution, measuring absorbance (0D value) at 600nm to about 0.35, diluting with DPBS buffer solution to obtain bacterial suspension with 0D value of 4000CFU/ml, (diluting process) calculating buffer solution volume (OD 10-0.1) according to the detected 0D value, namely adding 0D value 0.35 bacterial suspension 100ul into 3.4ml DPBS buffer solution, mixing to obtain 0.35 bacterial suspension 1/10, sequentially diluting 10 times to 1 x 10^-4Then, the dilution is further diluted by 3-4 times, the dilution degree of 3 or 4 times is determined according to the experimental result, and the final number of colonies which are stable at each 12.5ul is 50-60 CFU. )

3) Controlling the concentration of bacteria: and mixing the diluted target bacteria solution with the inactivated young rabbit complement in the same volume, taking 25ul of mixed solution (or directly taking 12.5ul of diluted bacterial suspension) to drip on a Columbia blood culture medium plate for overnight culture, and then counting bacteria, wherein the colony number grown on the plate is 50-60CFU, which is the optimal target bacteria concentration.

4) Sample detection: and (3) using a 96-well cell culture plate, adding 25ul of DPBS buffer solution into each well, adding 25ul of serum to be detected into each well for dilution by multiple times, then adding 12.5ul of uninhibited young rabbit complement and 12.5ul of bacterial suspension, and simultaneously setting a positive control, a complement control well and an inactivated complement control well. Mix well on shaker for 5min, incubate at 37 ℃ with 5% CO2 for 1.5 h.

5) The incubated 96-well plate was placed on a shaker, and a developing medium containing TTC (about 45 ℃) was added thereto while shaking, 50ul was added to each well, and the plate was left at room temperature for 5min until agar was completely solidified, and incubated overnight at 37 ℃ with 5% CO 2.

6) Each batch of experiments required three bacterial growth controls,

antibody control: young rabbit complement, bacterial liquid, inactivated positive antibody control and diluent

Complement control: complement of young rabbit, bacterial liquid and diluent

Inactivated complement control: inactivated young rabbit complement, bacterial liquid and diluent

7) Judging the result: the number of colonies growing on a Columbia blood plate (complement control hole) is taken as the original number of target bacteria, the number of the holes to be detected of the bacteria growth control hole similar to the bacteria growth hole is recorded as +++, (10% -45%) of thalli death is recorded as ++++, (50% -75%) of thalli death is recorded as ++, (75% -100%) of thalli death is recorded as + 100% of thalli death is recorded, and the maximum serum dilution capable of killing more than 50% of thalli is the bactericidal antibody titer of the serum to be detected. (bactericidal antibody titer first well starting at 1: 4) the strains selected for bactericidal experiments were 211009(fHbp-V3.94, from the chinese center for disease prevention and control) and 441304(fHbp-V2.16, from the chinese center for disease prevention and control), and fig. 6 shows that the bactericidal antibody reaction induced by the intraperitoneal immunization of fHbp-V2 protein induced by aluminum hydroxide as adjuvant, the mean titer of the bactericidal antibodies induced against 211009(fHbp-V3.94) strain was 26.4, and the mean titer of the bactericidal antibodies induced against 441304(fHbp-V2.16) strain was 23.6.

The fHbp-V2 recombinant protein immunization is carried out by using Freund's adjuvant and a muscle immunization mode and an abdominal cavity immunization mode, the bactericidal antibody result of immune serum is shown in Table I, from the bactericidal antibody result, the bactericidal antibody reaction generated by the muscle immunization mode is better than that generated by the abdominal cavity immunization mode, the geometric mean titer of the bactericidal antibody generated by mouse serum for 211009(fHbp-V3.94) strain is 56, and the geometric mean titer of the bactericidal antibody generated by 441304(fHbp-V2.16) strain is 134.4.

Table 1: FHbp-V2 antigen different immunization mode induced bactericidal antibody reaction

Sequence listing

<120> group B epidemic cerebrospinal meningitis fHbp-V2 recombinant protein, preparation method thereof, vaccine composition and application

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 250

<212> PRT

<213> Neisseria meningitidis (Neisseria meningitidis)

<400> 1

Met Gly Gly Val Ala Ala Asp Ile Gly Ala Gly Leu Ala Asp Ala Leu

1 5 10 15

Thr Ala Pro Leu Asp His Lys Asp Lys Ser Leu Gln Ser Leu Thr Leu

20 25 30

Asp Gln Ser Val Arg Lys Asn Glu Lys Leu Lys Leu Ala Ala Gln Gly

35 40 45

Ala Glu Lys Thr Tyr Gly Asn Gly Asp Ser Leu Asn Thr Gly Lys Leu

50 55 60

Lys Asn Asp Lys Ile Ser Arg Phe Asp Phe Ile Arg Gln Ile Glu Val

65 70 75 80

Asp Gly Arg Leu Ile Thr Leu Glu Ser Gly Glu Phe Gln Ile Tyr Lys

85 90 95

Gln Asp His Ser Ala Val Val Ala Leu Gln Ile Glu Lys Ile Asn Asn

100 105 110

Pro Asp Lys Ile Asp Ser Leu Ile Asn Gln Arg Ser Phe Leu Val Ser

115 120 125

Gly Leu Gly Gly Glu His Thr Ala Phe Asn Gln Leu Pro Asp Gly Lys

130 135 140

Ala Glu Tyr His Gly Lys Ala Phe Ser Ser Asp Asp Ala Gly Gly Lys

145 150 155 160

Leu Thr Tyr Thr Ile Asp Phe Ala Ala Lys Gln Gly His Gly Lys Ile

165 170 175

Glu His Leu Lys Thr Pro Glu Gln Asn Val Glu Leu Ala Ala Ala Glu

180 185 190

Leu Lys Ala Asp Glu Lys Ser His Ala Val Ile Leu Gly Asp Thr Arg

195 200 205

Tyr Gly Ser Glu Glu Lys Gly Thr Tyr His Leu Ala Leu Phe Gly Asp

210 215 220

Arg Ala Gln Glu Ile Ala Gly Ser Ala Thr Val Lys Ile Arg Glu Lys

225 230 235 240

Val His Glu Ile Gly Ile Ala Gly Lys Gln

245 250

<210> 2

<211> 822

<212> DNA

<213> Neisseria meningitidis (Neisseria meningitidis)

<400> 2

gtgaaccgaa ctgccttctg ctgcctttct ttgaccgccg ccctgattct gaccgcctgc 60

agcagcggag gcggcggtgt cgccgccgac atcggcgcgg ggcttgccga tgcactaacc 120

gcaccgctcg accataaaga caaaagtttg cagtctttga cgctggatca gtccgtcagg 180

aaaaacgaga aactgaagct ggcggcacaa ggtgcggaaa aaacttatgg aaacggcgac 240

agcctcaata caggcaaatt gaagaacgac aaaatcagcc gcttcgactt tatccgtcaa 300

atcgaagtgg acgggcggct cattaccttg gagagcggag agttccaaat atacaaacag 360

gaccactccg ccgtcgttgc cctacagatt gaaaaaatca acaaccccga caaaatcgac 420

agcctgataa accaacgctc cttccttgtc agcggtttgg gcggagaaca taccgccttc 480

aaccaactgc ctgacggcaa agccgagtat cacggcaaag cattcagctc cgacgatgct 540

ggcggaaaac tgacctatac catagatttc gccgccaaac agggacacgg caaaatcgaa 600

cacctgaaaa cacccgagca aaatgtcgag cttgccgccg ccgaactcaa agcagatgaa 660

aaatcacacg ccgtcatttt gggcgacacg cgctacggca gcgaagaaaa aggcacttac 720

cacctcgccc ttttcggcga ccgcgcccaa gaaatcgccg gctcggcaac cgtgaagata 780

agggaaaagg ttcacgaaat cggcatcgcc ggcaaacagt ag 822

<210> 3

<211> 753

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgggcggcg ttgcggcgga cattggtgcc ggcctggcgg atgccctgac cgcgccatta 60

gatcataaag ataagagctt acagagcctg acgctggatc agagcgtgcg taaaaatgaa 120

aaactgaagc tggcggcgca gggtgcggaa aaaacctatg gcaatggcga cagcctgaat 180

acgggcaagc tgaagaacga taagattagc cgttttgact ttatccgtca gatcgaggtg 240

gacggtcgtc tgattaccct ggaaagcggc gagtttcaaa tctataaaca ggaccatagc 300

gcggtggtgg cgttacagat tgaaaagatc aacaatccgg acaagattga tagcctgatt 360

aaccagcgca gctttctggt gagcggttta ggtggcgagc ataccgcgtt taatcaactg 420

ccagatggca aggccgagta tcatggcaaa gcgtttagca gcgatgatgc gggtggcaaa 480

ctgacgtata ccattgattt cgccgcgaaa cagggccacg gcaaaattga acacctgaaa 540

accccggaac agaatgtgga gttagccgcc gccgaactga aagccgatga gaaaagtcat 600

gcggttatcc tgggtgatac ccgttatggc agcgaagaga aaggcacgta tcatttagcg 660

ttatttggcg atcgtgcgca ggaaattgcc ggtagtgcga ccgttaaaat ccgtgagaaa 720

gtgcatgaaa tcggtattgc gggcaaacag taa 753

Claims (10)

1. An application of a B-group epidemic encephalitis fHbp-V2 recombinant protein antigen of an amino acid sequence shown as seq ID No.1 in preparation of a vaccine for preventing infection of B-group epidemic encephalitis fHbp-V2 and fHbp-V3 strains.

2. A vaccine composition is characterized by comprising a group B epidemic encephalitis fHbp-V2 recombinant protein and aluminum hydroxide serving as an adjuvant, a complete Freund adjuvant or an incomplete Freund adjuvant, wherein the content of the group B epidemic encephalitis fHbp-V2 recombinant protein is 200ug/ml, and the amino acid sequence of the group B epidemic encephalitis fHbp-V2 recombinant protein is seq ID No. 1.

3. The vaccine composition of claim 2, wherein the aluminum hydroxide adjuvant is present in an amount of 1 mg/ml.

4. The vaccine composition of claim 2, wherein the group B epidemic encephalitis fHbp-V2 recombinant protein gene sequence is shown in seq ID No. 3.

5. Use of the vaccine composition according to claim 2 for the preparation of a vaccine for the prevention of cerebrospinal meningitis or bacteremia disorders.

6. The vaccine composition of claim 2, prepared by the steps of:

and (3) using an aluminum hydroxide adjuvant as an antigen adjuvant, wherein the final concentration of the fHbp-V2 recombinant protein is 200ug/ml, the concentration of the aluminum adjuvant is 1mg/ml, and the fHbp-V2 recombinant protein is adsorbed under the condition of magnetic stirring at 300rpm for 1 h.

7. The vaccine composition of claim 2, prepared by the steps of:

freund's adjuvant is used as an adjuvant of antigen, the adjuvant and fHbp-V2 recombinant protein solution are mixed in equal volume, and then emulsification is carried out to form emulsion drops which are not dispersed in water, and the concentration of fHbp-V2 recombinant protein is 200 ug/ml.

8. Use of the vaccine composition according to claim 5 for the preparation of a vaccine for the prevention of cerebrospinal meningitis or bacteremia disorders, wherein the immunization is performed by muscle immunization.

9. The vaccine composition of claim 7, wherein the Freund's adjuvant is complete Freund's adjuvant and/or incomplete Freund's adjuvant.

10. The method of claim 1, wherein the method of preparing a group B epidemic encephalitis fHbp-V2 recombinant protein comprises the steps of:

obtaining a gene sequence: the nucleotide sequence of fHbp-V2 gene shown in seq ID No.2 is obtained from the fHbp gene subtype V2.18 strain of the group B epidemic cerebrospinal meningitis preserved in the Chinese disease control center by a PCR gene amplification method, wherein PCR primers for amplification are respectively: an upstream primer: TGACCTGCCTCATTGATGC, downstream primer: GCCGTCCGAACACGATAATTTACCG, respectively;

codon optimization: carrying out codon preference optimization synthesis on the nucleotide sequence of the fHbp-V2 gene shown in seq ID No.2 by using lasergene software to obtain the nucleotide sequence shown in seq ID No. 3;

constructing a prokaryotic expression plasmid:

carrying out double enzyme digestion on the codon-optimized fHbp-V2 gene and a prokaryotic pET28a expression vector by restriction enzymes Nco I and EcoRI, recovering gene fragments, then connecting the gene fragments by using T4 DNA ligase, converting a connecting product into a DH5 alpha competent cell, culturing and identifying;

constructing an expression strain:

successfully constructed clone transformed BL21 expression competent cells are induced, cultured and induced to express, and the expression of mycoprotein is identified by SDS-PAGE protein electrophoresis; screening strains with high expression quantity;

expression and purification of fHbp-V2 recombinant protein:

and culturing, collecting, crushing and purifying the strain with high expression level to obtain the fHbp-V2 recombinant protein.

Images