TWI251025B - An isolated gene encoding a unique hemolysin of Klebsiella pneumoniae and its uses in the detection of infections caused by Klebsiella pneumoniae isolates - Google Patents

Abstract

This invention provides an isolated gene, khe, which codes for an extracellular hemolysin of K. pneumoniae and which has been determined to have a nucleotide sequence as shown in SEQ. ID. NO:1, based on which methods and tools for the detection of the presence of K. pneumoniae in a subject suspected to have an infection caused by K. pneumoniae are developed.

Description

1251025 发明, invention description: [Technical Field of Invention] 3 FIELD OF THE INVENTION The present invention relates to an isolated gene, that is, it is isolated from K. 5, and encodes a unique Krebs Pneumococcal hemolysin, and the use of this gene for the development of a rapid, sensitive and reliable device for detecting infections caused by Klebsiella pneumoniae. 10 [:^ ^tr 】 Background of the invention (description of related art) Klebsiella (members of the ruler are the cause of nosocomial infections in adults and outbreaks of diseases in the neonatal population in hospitals (Darfeuille-Michaud, A., et Al. July 1992, Infect. Immun., 60: 15 44-55; Guarino, A., et al. (1989), Pediatr. Res. 25: 5W-5M). Most clinically important in this group The sex is Klebsiella pneumoniae ([· pneumoniae) {Podschun, R. and U, Ullmann. From C7//?· M/croMo/. i^v., "·· 5S9-(10)3), Can cause bacteremia, meningitis, pneumonia 20 and pyogenic liver abscess (Z)ar/ewz7/e-Michaud, A., et al. July 1992, Infect. Immun., 60: 44-55·, Goldman, JM and JK Kowalec (1978), JAMA} 240: 2660; Kreger, BE, et al. (1980), Am, J. Med, 68: 332-343, Seeto, RK and DC Rockey (1996), Medicine, 75: 99-113). 1251025 Klebsiella pneumoniae (10) is a source of opportunistic infections that cause urinary tract infections associated with sepsis and nosocomial pneumonia, and is from patients with gram-negative bacteremia The second most common microorganism isolated after E. coli (£^c/?er/c/2/a e<9//) (Farmer JJ, III, Kelly MT. R/accoe· In Balows A et al., Eds. Manual of clinical microbioloby, 5th ed. Washington, DC: American Society for Microbiology, 1991, pp. 60-383; Jarvis WR et al. (1985), Infect Control (Thorofare)} 6 : 68-74·, Kreger BE et al. 10 "卯0 into dm at .· 332-3W). In recent years, 50% to 80% of cases of suppurative liver abscess in Taiwan have been associated with infection with Klebsiella pneumoniae (Lee, T\Y., et al. (1994), Abdom Imaging, 19 : 47-52·, Yang, C. C., et al. (1993), Am. J. Gasterol., 88: /9/7-/9/5). More importantly, many Taiwanese patients who develop Klebsiella pneumoniae-induced 15 cases of suppurative liver abscess will also experience metastatic endophthalmitis (Chang, F. Y). ·, W α/· 1988? J. Formos. Med. Assoc. 87: 282-287; Cheng, DL, et al., (1990), J. Formos, Med. Assoc, 89: 571-576·, Cheng, DLy et al (1991), Arch. Intern. Med. 151: 1557-1559; Chiu, 20 CT, et al. (1988), J. Clin. Gastroenterol, 10: 524-527) 〇 Many different factors It has been proposed as a possible determinant of toxicity for Klebsiella pneumoniae. The production of the capsular polysaccharide imparts anti-bactericidal properties and antiphagocytic properties to the organism (milk P· ei α/. (7P90 into 1251025)

Med M/croZ>/<9/, 7.. 79 (5-202). Colonization at the epithelial and urethral epithelium of the human beer channel is thought to be initiated by the pilus protein or non-:fimbrial protein adhesin (Z)0r /ez^7/e-Mz*c/2azM i with α/·[7992 into 5 Infect Immun, 60: 44-55·, Duguid, JP (1959), J Gen M/cro6/o/, 27·· 2 77-2S (5). The components involved in intestinal adhesion are also important Qinzizi (Oelschlaeger, Τ\Α· ei αί· (J997), Infect Immun (55··. Aerobactin production and utilization will also be enhanced Toxicity (# seems to /, Z. et al. (1986), Infect Immun 54: 10 (503-60S), and a toxic complex secreted by Klebsiella pneumoniae has been shown to be lethal to mice (price rD.C. "9§7 into / /7/αί 55·· 彳S) 〇 , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , The infection is related to et al. (1989), Pediatr Res 25: 514-518; Klipstein, FA, et al. 15 (1983), Infect Immun 42: 838-841·, Koo FCW, et al. (1986),

Curr Microbiol 13: 23-27,. Species identification of Klebsiella pneumoniae by conventional methods often takes 3 to 4 days. The need for a reliable and rapid assay for the specific detection of Klebsiella pneumoniae is clinically and epidemiologically important. Hemolysin is functionally defined by its ability to dissolve red blood cells, and for various pathogenic microorganisms it is usually associated with toxicity, V. et al. (1991), Crit Rev Microbiol 18: . Although Klebsiella pneumoniae is considered to be non-lytic 1251025 bloody, especially for human red blood cells, in 1985, Albesa et al. reported a clinical isolate with hemolysis ability on rabbit red blood cells (Albesa, I. et al. (1985), Can Microbiol 31: 297-300, reported that it has been shown that purified Klebsiella pneumoniae hemolysin 5 [klebsolysin] is in sheep, Mice exhibit hemolytic effects on human red blood cells and have characteristics similar to other thiol-activated lysins (1989), J Αρρ

Bacteriol 67: 263-266; Barberis, LI et al. (1986), Can Microbiol 32: 884-888) o 10 However, there is no separation and characterization of genes encoding hemolysin derived from Klebsiella pneumoniae. Identification report. In addition, the role of klebsolysin in the pathogenesis of Klebsiella pneumoniae infection has not been fully evaluated. It would be highly desirable to have an isolated gene encoding one gram of Klebsiella pneumoniae [klebsolysin], 15 which allows assessment of the hemolysis of clinical isolates of Klebsiella pneumoniae. In US 6,225,453 to Hiroshi Ueuama et al., a probe useful for detecting and identifying Klebsiella pneumoniae has been disclosed. Specifically, DN A of a bacterium derived from Klebsiella pneumoniae was extracted, followed by restriction enzyme digestion, and then randomly incorporated into the vector 20 pGEM-3Z. Five probes specific to Klebsiella pneumoniae were screened out from the selected strains obtained therefrom, that is, the probes contained Klebsiella pneumoniae which were shown to be contained in nature. DNA within the DNA has a specific reactivity of the DN A fragment. This patent does not mention the isolation and characterization of a gene encoding the hemolysin of Klebsiella pneumoniae and the use of the gene 1251025 as a molecular marker for Klebsiella pneumoniae. In US 5,994,066 and US 6,001,564 issued to Michel G. Bergeron et al., a method has been disclosed for comprehensive detection of bacteria present in biological samples and for specific detection of presence in urine or E. coli (jE^c/zer/c/z/a co/z·), Klebsiella pneumoniae, Enterococcus faecalis (·EWerococci/s /~(^/以) in any other biological sample , Pseudomonas aeruginosa, Proiews mirabilis, Staphylococcus saprophyticus, Pneumococcus pneumoniae, 10 strains of Moraxe//caiarr/za/b Haemophilus influenzae, the method comprising: denaturation of the bacterial DNA into a single-strand form and fixing it on a support or leaving it in a solution; contacting the single-stranded genetic material with a group selected from the group consisting of Labeled probes in the group: i) fragments of the chromosomal DNA of the above bacteria, and ii) synthetic nucleotides, the 15 sequences of which are derived from fragments of the chromosomal DNA or sequences obtainable from the database , all (i and ii) probes can be specifically heterozygous To their chromosomal DNA, or, if it is a universal primer, hybridize to any bacterial chromosomal DNA. However, the disclosure of these patents does not mention the use of primer 20 which is specific for the gene encoding hemolysin derived from Klebsiella pneumoniae. On the other hand, Lu J. J. et al. designed a universal PCR (Jowma/o/C/M) that is part of the 16S rDNA gene capable of amplifying eubacteria (including Klebsiella pneumoniae). /ea/ M/croho/o illusion (8).· 2076-2(10)0, 2000). According to the PCR technique reported in this paper, the source 1251025 is derived from Escherichia coli, Klebsiella pneumoniae, Serratia marcescens (heart rm plus) and Enterobacter cloacae (pentavalent c/oacae). The scoop PCR products have the same good m-digestion pattern, but have different patterns when they are shouldered with a job or a price. Although this combination of universal PCR, which limits enzyme 5 analysis, is claimed to be useful for detecting and identifying bacterial plaques in clinical specimens, it is clear that such a tool can be used to detect and identify Klebsiella (4) Whether the members are fast, sensitive and trustworthy.

SUMMARY OF THE INVENTION 10 SUMMARY OF THE INVENTION Thus, in a first aspect, the present invention provides an isolated gene, that is, a moxibustion heart, which encodes one of the extracellular dissolved A proteins of Klebsiella pneumoniae, and which has been determined to have one For example, the nucleotide sequence shown in Sequence Identification Number: 1.

The expression of this gene results in the production of a polypeptide having 162 amino acids. The polypeptide has been determined to have hemolytic activity and has an amino acid sequence as shown in SEQ ID NO: 2. Thus, those skilled in the art can use the immunological methods well known in the art, such as fusion tumor technology, to produce antibodies, particularly monoclonal antibodies specific for the polypeptide. The antibodies thus obtained can be used in the production of test kits which can be used to detect infections caused by Klebsiella pneumoniae isolates. In a second aspect, the invention provides a method for detecting the presence of Klebsiella pneumoniae in an individual suspected of having an infection caused by K. pneumoniae comprising the steps of: A biological sample is obtained from the individual; and 10 1251025 is detected to detect the presence of the K gene in the sample from the e gene for the presence of Klebsiella pneumoniae. In a third aspect, the present invention provides a primer set for detecting the presence of Klebsiella pneumoniae in an individual suspected of having an infection caused by K. pneumoniae, comprising a forward primer having a nucleic acid sequence selected from the sequence of sequence identification number: 3 and sequence identification number: 5, and having a sequence identification number: 4 and sequence identification number: 6 The reverse primer of the nucleotide sequence of the sequence. The above and other objects, features, and advantages of the present invention will become apparent from the Detailed Description of Description The nucleotide sequence of the E gene and the deduced amino acid sequence of Klebsiella pneumoniae. The nucleotides are numbered with the first letter of the 15 Met codon of the initiator as +1, and the amino acid residues are numbered from the starter Met as +1. A Shine-Dalgarno sequence with a hypothesis about the location of a ribosome is underlined. The stop codon is represented by an asterisk, and a palindromic sequence (palindr〇rnic seqUence) is represented by a convergent arrow; 2〇 Figure 2 shows the parental plastid and recombinant plastid Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the recombinant protein in the overnight culture of transformed E. coli, the first line of which is the low molecular weight protein standard (Amersham Pharmacia) Biotech); line 2 is pUC18; line 3 is pUC19; line 4 is pCHlOO; and line 5, 1251025 is the position of the pCHlOl(R) gene product, indicated by an arrow. The numbers on the left side of line 1 represent the size criteria expressed in kilodaltons (kDa);

Figure 3 shows Southern blots of genomic DNA from 5 and other Klebsiella species from different isolates of K. pneumoniae. The genomic DNA of these bacterial strains was digested with i/MdIII and probed with a 0.8-kb DNA fragment containing the unavoidable gene. Lines 1 to 10: isolates of Klebsiella pneumoniae CMC_1 (line 1), isolate 86008 (line 2 10), isolate 86016 (line 3), isolate 86024 (line 4), Isolate 86037 (line 5), isolate 86053 (line 6), isolate 86060 (line 7), isolate 87012 (line 8), isolate 87021 (line 9), and isolate 87024 (the first) Line 10); Line 11: Klebsiella pneumoniae (U. oxyioca); Line 12: Klebsiella genus ([; 13th line: native gram 1 5 Rybago (Κ ierr/ Gwa); Line 14: Klebsiformis Kluyveromyces ([

And line 15: AT. The number on the left side of line 1 represents the size of the λ DNA size expressed as base pairs // Figure 4 shows the extraction from Klebsiella pneumoniae and non-Krebs PCR analysis of DNAs of 20 genus bacteria using a 16S rRNA gene universal primer (column) and a P3-P4 primer pair (column B) of the present invention, wherein: a 100-bp stepped molecular size marker; Line: Klebsiella pneumoniae ATCC 33495 and 3 clinical isolates; lines 5-8: Klebsiella pneumoniae (U.O. γίοΜ) ATCC 13182 and 3 clinical isolates; Line 9: Phytosanitary R. brevis 12 1251025 (You./(10)i/eo/α) ATCC 33531; line 10: Klebsiella pneumoniae (U.S. ierrige) ATCC 33257; Line 11: Ni, πνζ·like m ATCC 33558; Line 12: E. coli ATCC 25922; Line 13: Streptococcus pyogenes ATCC 14289; Line 14: 5 strains of the gut intestines (five c/(9aC(2e) clinical isolates; and line 15: Serratia marcescens / clinical isolates;

Figure 5 shows the PCR product amplified from DNAs extracted from the patient's blood culture. A specific PCR analysis of Klebsiella pneumoniae detected the presence of this bacterium in 4 samples (lines 1-4). The remaining 8 have been infected with 10 grams of bacterium, especially (paths 5-6) and non-Klebsiella (ie E. coli (lines 7-10), Enterobacter cloacae (Line 11) and Serratia marcescens (line 12)] Samples isolated from them and those samples from which no bacterial pathogens were isolated (lines 13-16) will not be associated with the P3-P4 primer. The reaction was generated. Column "M": 100-bp stepped molecule 15 size marker.

L Embodiment 3 Detailed Description of the Preferred Embodiments Detailed Description of the Invention We have occasionally observed that clinical isolates 20 of Klebsiella pneumoniae (especially low-passage clinical isolates) are caused Hemolysis. To explore the hemolysis properties of Klebsiella pneumoniae, we have selected and sequenced the hemolysin-encoding gene from Klebsiella pneumoniae. When expressed in E. coli, a unique peptide of approximately 20 kDa was identified. Nucleotide sequence analysis predicted a single open-entry architecture (ORF) with 486 base pairs (bps) 13 1251025, which encodes a 162 amino group with an estimated ten pi value of 6.77. The peptide of acid. Numerous sequence homology was not identified at the nucleotide or amino acid level with any of the reported sequences. Furthermore, DNA heterozygous under severe conditions for several bacteria, 5 contains Klebsiella oxysporum (U.. sand (7) (10)), and K. burgdorferi (K. serrata ([ And Klebsiella nidus (I orm7/n.770/J; ... illusion, no cross-reactivity can be seen. These data show that we have selected a unique gene, which is tested Among the Klebsiella pneumoniae isolates, it is highly conserved. 10 Because the other genes are not detected in the Klebsiella and non-Klebsiella strains tested. Nucleotide sequence, which is promising as an assay tool for Klebsiella pneumoniae isolates. We therefore further evaluated this wI as a marker for identifying Klebsiella pneumoniae isolates. Application of the molecular marker. - According to the present invention - a polynucleotide derived from Klebsiella pneumoniae ("clear" is basically provided by the following: () For the sequence identification number: 1 core _ st sequence; , (8) - nuclear sinus acid sequence 'the system is the order Identification number: Nuclear moss acid sequence of i: 0 complement one; or (a) a core

Ganzi sequence, J, which hybridizes under high stringency conditions to the nucleotide sequence of (1) or (9). 4 is the polynucleotide encoding one of the W genes of K. pneumoniae - a polypeptide having a hemolytic activity and consisting of a sequence of amino acid derived from sequence identification 14 1251025 . This polypeptide is considered to be a species of specific Klebsiella pneumoniae-specific hemolysin and thus can be used as an indicator in the determination of the presence of Klebsiella pneumoniae. Based on the nucleotide sequence of the moxibustion heart gene, an oligo-nuclear acid that can hybridize with at least 5 13 nucleotides of the moxibustion gene can be designed using conventional methods well known in the art of biotechnology. As a probe or primer for detecting the expression of the heart gene.

As an example, we have designed four primers that can be used in the method of the present invention for detecting Klebsiella pneumoniae, including: 1 〇 first primer pair: forward primer 1 5, -aaCgacctgattgcattcgccactg-3 , (sequence identification number: 3) reverse primer 1 5, -ggtcagtccagtcgagCatCg-3, (sequence identification number: 4) second primer pair:

Forward introduction 2 5,-aataacacCgagCaggaggttcgtctg-35 (SEQ ID NO: 5) 15 Reverse primer 2 5,-gataaaCCaCaggCgcatagtgCg-3, (sequence identification number: 6) It is expected that the forward primer 1 can be associated with the opposite Paired with the primer 2, and the forward leader 2 can be paired with the backward leader. According to the present invention, the expression of the excision gene can be detected by analysis of an mRNA transcript derived from the exogenous gene or a protein transduced by the gene. Detection of proteins translated from the mRNA transcripts of the excision gene can be carried out by conventional methodologies well known in the art of biotechnology. For example, an antibody having a specificity for a polypeptide of SEQ ID NO: 2, which can be produced according to the usual method for the production of monoclonal antibodies in the art and used by 15 1251025 in a Klebsiella pneumoniae isolate Exist. The present invention provides a coffee gene of Klebsiella pneumoniae. In particular, Example 1 of 2 describes the confirmation, separation and special (4) determination of K. pneumoniae strain. Southern miscellaneous analysis using this gene revealed that the coffee gene is singular in Klebsiella pneumoniae and is specific to the bacterium (see the coding region of the 仏 gene of the small (10) strain of the example The sequence and the portion of the flanking region are described in the sequence identification number: 1 (see Figure 1).

As used herein, the term "heart|cause" encompasses a Klebsiella pneumoniae gene that hybridizes to a CMU strain under stringent conditions, or has at least 13 of its length. A fragment of the base pair _. "Tramatic conditions, where the joy of (4) will provide a heterozygous situation with about 10% or less of base pair mismatches.

As noted above, since the m is conserved within the C. pneumoniae strain and is specific to the strain, the gene and the mRNAS and polypeptide encoded by the gene, Both the detection and quantification of K. pneumoniae strains are excellent targets. For example, the detection or quantification of Klebsiella pneumoniae can be achieved by using a polymerase chain reaction (PCR) of the primer (which will amplify at least a portion of the 20 cardiac gene), by heterozygous to the cardiac gene A DNA or RNA probe or mRNA fluorescent detection system, or an immunoassay that specifically binds to a heart peptide by using one. Preferably, the detection of the presence of the gene is carried out by using at least one of the following methods to detect the presence of the mRNA of the moxibustion heart gene located in a biological sample, and the heterozygous, cyclic probe reaction (CyCHng) Reacti〇n), polymerase chain reaction (PCR), nested PCR, reverse transcriptase polymerase chain reaction (RT-PCR), multiplex PCR polymerase chain reaction _ single strand structure polymorphism, ligase chain reaction (LCR a 5-primary amplification reaction (NASBA) and a transcription-regulated amplification reaction (TMA) to limit fragment length polymorphic nucleic acid sequences. In a preferred embodiment of the invention, the detection of the gene is detected by using PCR to detect the presence of the gene in the biological sample. In a more preferred embodiment of the invention, the detection of the presence of the e gene is carried out by the following steps: 0) extraction of total genomic DNA from a distant biological sample; (b) obtaining from step (a) The extracted genomic DNA is subjected to a polymerase chain reaction (PCR) treatment using at least one primer pair having a forward primer and a reverse primer, each primer having a 15-nucleic acid sequence which is heterozygous to have one The nucleotide acid sequence corresponds to at least 13 contiguous nucleotides of the gene having the sequence number: 1; and (CH is a measure of whether a nucleotide having the same nucleotide sequence as or complementary to the acupuncture heart gene) The PCR product of one part of the sequence has been generated from the PCR treatment of step (8), and the presence of the PCR product is characterized by the presence of Klebsiella pneumoniae. The PCR detection method provided by the rabbit can allow rapid Ground and sensitive for clinical detection of Klebsiella pneumoniae. ', 车乂佳地' The biological sample is selected from the group consisting of: 1251025 / night feces and urine. In the present invention a better specific In one embodiment, the biological sample is blood. In a preferred embodiment of the invention, the X to V primer pairs used in step (b) comprise: a first primer having a nucleotide sequence歹Η π is selected from the sequence identification number: 3 and the serial number described in the sequence identification number: 5, to - Chu 1 21 brother I? I, which has a nucleotide sequence selected from the sequence identification number: 4 And the sequence described in the sequence identification number: 6. In a more specific example of the present invention, the pair of primers used in the step (b) includes a one having a sequence corresponding to the sequence identification number: 3 a first primer of the S. cerevisiae S 夂 sequence, and a second primer having a nucleotide sequence corresponding to SEQ ID NO: 4. In another preferred embodiment of the present invention, used in the step (b) The sub-pair of the sub-together comprises: - having - a _ primer corresponding to the sequence of nuclear identification number of 5: and a nucleotide sequence having a sequence corresponding to sequence identification 15: 6 Second introduction. Ben Maoming also provides a method for detecting a suspected one with Cray A primer set for the presence of Klebsiella pneumoniae in an infected individual caused by P. pneumoniae, comprising: - a first primer having a -nucleic acid sequence selected from the sequence identification number: 3 and the sequence 20 column described in the sequence identification number, and a second primer having a nuclear wicking sequence selected from the sequence identification number: 4 and the sequence identified in the sequence identification number: 6. The present invention also Providing a test kit for detecting the presence of Klebsiella pneumoniae in an individual suspected of having an infection caused by K. pneumoniae, comprising a first primer and a A pair of primers of the second bow 1 18 1251025, each primer having a nucleotide acid sequence will be heterozygous to at least 13 contiguous nucleotides of the centroid gene having a nuclear % S under sequence corresponding to the sequence identification number: 丨. In a preferred embodiment of the present invention, the test kit comprises a pair of primers consisting of the following five columns: a first primer having a nucleotide sequence selected from the sequence identification number: 3 and the sequence Identification number: the sequence described in 5; and a second primer having a nucleotide sequence selected from the sequences identified in Sequence Identification Number: 4 and Sequence Identification Number: 6.

In a more preferred embodiment of the present invention, the test kit comprises a pair of primers consisting of the following 10 columns: a first primer having a nucleoside & L sequence corresponding to the sequence identification number: 3, and A second primer having a nucleotide sequence corresponding to sequence identification number: 4.

In another preferred embodiment of the present invention, the test kit comprises a pair of primers consisting of: a first primer having a 15 nucleotide sequence corresponding to sequence identification number: 5, and one having A second primer corresponding to the sequence identification of the nuclear oxalate sequence of .6. In addition to the above, those skilled in the art will appreciate that various applications falling within the scope of the present invention include the use of any form of evaluation analysis. 20 To perform PCR analysis, the DNA line was obtained from a sample suspected of containing Klebsiella pneumoniae. Further, mRNA can be obtained from this sample and used to prepare cDNA, which can be used as a template in PCR. Methods for extracting total cellular DNA and RNA from cells and methods for preparing cDNA are well known. However, PCR does not require highly purified 19 1251025 DNA' and the DNA released by boiling the cells can be used directly without any purification. A PCR primer is a nucleic acid molecule having a selected sequence whereby the molecule can be hybridized to one of the genes. Typically, 5 must be used with at least 2 primers (each primer will be heterozygous to each of the 々Ae genes), but more than one pair of primer pairs can be used, if more than one portion is desired to be amplified The words of the gene. The primers should have at least 13 base pairs in length, preferably 2〇-3〇 base pairs, and have a content greater than 4%. The specificity of these primers should be determined by Southern blot analysis. Second, DNA is amplified by PCR, and PCR methods, equipment, and reagents are well known and commercially available. Finally, the amplified DNA is detected or quantified. This can be achieved by the four-night method known in the art. For example, the reaction mixture can be electrophoretically analyzed on an agarose gel, and the presence or absence of amplified DNA of the expected size can be confirmed by staining the gel. Alternatively, a labeled nucleic acid molecule (-pin) that is hybridized to the amplified DNA can be used to allow for the detection or quantification of the amplified (10). Alternatively or additionally, the primers can be labeled, or the nucleotide acid used during PCR can be labeled, and the label incorporated into the amplified DNA can be detected and quantified. Detection of Klebsiella pneumoniae can also be achieved by obtaining DN A or RN a from a sample suspected of containing Klebsiella pneumoniae. This can be achieved in the same manner as described above for PCR analysis. The 20 1251025 is either attached to the probe. The probe is a conjugated molecule having a selected sequence 'by which the molecule will hybridize to the orchard or the mRNA encoded by the cardiac. The probe is allowed to hybridize to the DNA or RNA obtained from the sample. To detect the gene or her, the probe is labeled. The probe should be as large as possible while maintaining specificity. The present invention further encompasses nucleic acid molecules which are used as probes and primers in these techniques. These nucleic acid molecules have a selected sequence whereby

The isomolecule will hybridize to the W gene or to the mRNA encoded by the coffee gene. A suitable probe or primer may have a sequence of the coffee gene described in the sequence listing number: 1 or a fragment of the sequence. These nucleic acid molecules may also contain anti-information RNA molecules and ribozymes, although methods for synthesizing these nucleic acid molecules are also well known in the art. 15 These probes or primers can be labeled to allow detection of Klebsiella pneumonia

Bacillus. Suitable labels and methods for attaching or incorporating them into nucleic acid molecules are well known. Suitable labels include radioactive labels (eg, 32P), chemical fluorescent labels, fluorescent labels [eg, fluorescein, rhodamine], particulate markers [eg, gold 20 Gold colloids], colorimetric markers (c〇i〇rimetric labeis) (eg, dyes), enzymes, and biotin. As noted above, labeled nucleotides can also be used in PCR to produce a labeled amplified DNA. Preferably, the nucleotides are identified by a method familiar to those skilled in the art to have a label (e.g., 32p) that emits 211251025 activity. Klebsiella pneumoniae can also be detected in an immunoassay using antibodies that specifically bind to -capeptide. A W-peptide can be used by methods known in the art for the production of antibodies useful in such immunoassays. The "gene or fragment thereof" can be used to generate a heart peptide. The peptide can also be prepared by a solid phase synthesis method. Single-chain antibodies or other engineered antibodies or antibody fragments comprising an antibody binding site can also be used.

For immunoassay, a sample of 10 suspected to contain Klebsiella pneumoniae is contacted with the antibody under the conditions used, whereby the antibody binds to a peptide (if present). Standard immunoassay patterns can be used. An antibody that binds to a moxibustion peptide can be labeled to allow detection of a moxibustion peptide, or a binding to a labeled portion of the antibody (eg, a secondary antibody to a first antibody or protein A) ) can be used. Suitable labels and methods for attaching them 15 to antibodies and other proteins and compounds are

Be familiar with. Suitable labels include radioactive labels (eg, 2 ^ I), fluorescent labels [eg, fluorescein (rhodamine), rhodamine], chemical fluorescent labels, granular labels [eg , gold colloids], colorimetric labels (eg, 20 doses), enzymes, and biotin. In a further embodiment, the invention provides a primer for detecting Klebsiella pneumoniae in a sample using a nuclear sinus acid amplification technique, which is included in the sequence listing with sequence identification number: 1 Nuclear swearing acid sequence. The primer of the present invention may be used as a degenerate primer for 22 1251025, which is a nuclear sinus acid sequence which is described by a sequence rhyme number 3 to 6 in the sequence listing - Or a combination of many possible combinations. It is contemplated by the present invention that the nucleic acids described herein can be used in any of a number of nucleic acid detection techniques, including but not limited to, polymerase 5 chain reaction, isothermal amplification (isothermai DNA) Amplificati〇n) and so on. Similarly, a nucleic acid described in the sequence identification number: 丨 can be used as a probe for detecting or capturing a nucleic acid that is hybridized to the nucleic acid of the sequence identification number i. It is contemplated by the present invention that the nucleic acids described herein can be used in any of a number of nucleic acid detection techniques, including but not limited to: polymerase chain reaction, isothermal DNA amplification, liquid phase miscellaneous Hquid hybridization and so on. Similarly, the nucleic acid described in the sequence identification number: i can be used as a probe for detecting Klebsiella pneumoniae. Clinical samples that can be used in the methods of the present invention include phlegm, pharynx 15 throat scraping, blood, urine, cerebrospinal fluid, skin, biopsy, saliva, synovial fluid, bronchial irrigation Bronchial lavage or other tissue or fluid sample from humans or other animals. Many of the methods described above use hybridization of nucleic acids. Hybrid conditions and guidance for selecting high severity and low severity conditions are well known in the art.

20 of that. For example, Sambrook et al., Molecular Cloning. A Μα;?(10)/ (2W /9S9). Suitable heterozygous conditions can be readily determined and optimized using conventional techniques in the art. The present invention will be described in more detail with reference to the following examples, which are to be construed as limited only. EXAMPLES Example 1: Selection of Λ/μ gene from Klebsiella pneumoniae Experimental method 5 Bacterial strains and plastids used in bacteria include: Klebsiella pneumoniae (U.S. (10) he) CMC-1 , 50 strains of Klebsiella pneumoniae, Klebsiella producing acid (夂·

, Phytophthora serrata (A. sylvestris / a / ^ co / a), Aeromonas hydrophila, Proteus vulgaris, 10 Pseudomonas aerivghwa), typhoid fever Salmonella typhimurium, epidermidis epiis, Staphylococcus aureus, Shigella sojae, Streptococcus pyogenes, Vibrio cholerae c/70/erae, Vibrio parahaemolyticus 15 and Vibrio vulnificus (Γ/0Γ/·ο, these all

The Department is isolated from the blood or feces of patients with a hospital attached to the National Cheng Kung University; and Klebsiella pneumoniae fX. /err/gwa) and Klebsiformis acid (especially Obtained from the Institute of Culture and Development of Hsinchu City, Taiwan Province of the Republic of China. Clinical isolates, Klebsiella xylostella 20 and Klebsiella nidus (Ni (10) (yi / ea) and Escherichia coli 〇E. eWz·) is grown in Luria-Bertani (LB) medium at 37 ° C (heart moxibustion J. et al. y Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, 1989. Dayang Deyang (E. 24 1251025

Coli) JA221 (Beggs JD. Nature 1978, 275: 104-109) ^ JM109 (Yanisch - Perron C et al., Gene 1985, 33: 103-119) and ΧΙΛΒ [Stratagene, La Jolla, CA, ί/.ϋ ) is used as a transformation hosts. Klebsiella pneumoniae and recombinant E. coli cell lines by using blood agar dishes (trypticase soy agar containing 5% rabbit red blood cells [BBL, Cockeysville, MD, U.S_A·] ) and evaluate the hemolysis phenotype. Ampicillin (50 pg/ml) was added when appropriate for screening. When necessary, the medium was added with isopropyl 10 - yS -D-. Isopropyl--D-thiogalactopyranoside (IPTG) to a final concentration of 1 mM. The plastid pBR322 (5ο/ζ·νπ F a/·, Gwe 7 eve 77, 2.. was used in the selection experiment; plastid pUC18 and pUC19 α/., Gewe

7 Yang 2 / 9: 259-2 Yang) was used in the secondary-selection experiment. The plastid pET21b 15 (Novagen, Madison, WI, U.S.A.) was used in a protein over expression experiment. Construction and screening of genomic libraries All DNA manipulation systems are performed using standard procedures. J. et al., Molecular cloning: a laboratory manual, 2nd ed. Cold 20 Spring Harbor, New York: Cold Spring Harbor Laboratory iVew, 7 ). The genomic DNA library of Klebsiella pneumoniae CMC-1 was constructed as described by Chang et al. (Ck sigh MC W a/·, J Gm M/croZnW 7993, HP: 32/5-3223). This gene pool was used to transform E. coli (five. co/z·) JA22 and the transformation system was screened on a blood agar dish by 25 1251025. After 48 hours of incubation at 37 ° C, colonies with a clear zone around them were isolated. DNA sequencing and analysis

The k-free sequencing was performed by an automated DNA analyzer (ABI 377; 5 Applied Biosystems, Inc., Foster City, CA, U.S.A.). Sequence analysis was performed using the PC/GENE suite of software (Intelligenetics). The nucleotide sequence and its deduced amino acid sequence are obtained by using the BLAST e-mail network 10 feeding device located at the National Centre for Biotechnology and Information (Taiwan, Republic of China) (BLAST E- Mail network server) was analyzed. SOS-PAGE analysis of E. coli <:〇//·) cells was collected by centrifugation from a 200-ml overnight culture and re-floated in assay buffer (0.85% NaCl, 10 mM Tris, ρΗ7·5), and carry out 3 consecutive French pressure cell sites

15 (French pressure cell treatments, 14,000 lb / in 2, at 4 ° C

under). The protein concentration of the resulting lysate was determined using a bicinchoninic acid protein assay kit (Pierce Biochemicals, Rockford, IL, U.S.A.). The protein was then isolated by SDS-PAGE on a 8% polyacrylamide gel using the method used (Laemmli UK. Nature 1970, 227: 680-685) 20 and using Coomassie Blue Gel Code Reagent ( Coomassie Blue GelCode reagent, Pierce) is stained for viewing. Southern hybridization chromosomal DNA with endonuclease restriction enzyme 26 1251025

(restriction endonuclease) //Mdn was digested and separated by agarose gel electrophoresis and transferred to Zeta-probe GT membrane (Bio-Rad Laboratories, Hercules, CA, U.S.A.). A DNA fragment excised from plastid pCH100 was identified by [5P]dCTP (> 3,000 Ci/mmol; Amersham Pharmacia Biotech) by using 5 Prime-a, Gene Labeling System (Promega, Madison, WI5 USA) , Piscataway, NJ, USΑ·) is used as a probe. The film was hybridized at 60 ° C for 16 hours, exposed to an X-ray film at -70 ° C for 2 days, and developed with Kodak developer and 10 fixative as recommended by the manufacturer. Results According to the present invention, 50 clinical isolates of Klebsiella pneumoniae exhibited hemolytic activity when cultured on rabbit blood agar, and clear hemolysis zones were selected and exposed by exposure to air or refrigeration. Enhanced. For the selection of 15 determinants related to the hemolytic phenotype of Klebsiella pneumoniae,

The genomic reservoir of a strong hemolytic strain CMC-1 was constructed in Escherichia coli (f.cW/) JA221. The transformed E. coli cells were screened on a blood agar culture dish to select a hemolytic pure strain. The average insert size was 6 kb, and about 1 out of 1000 colonies exhibited weak hemolytic properties. 20 This frequency suggests that the gene is present in the genome of P. jejuni in a single copy. Three hemolytic colonies were obtained, and the plastids pKH1, pKH2, and pKH3 formed were significantly repetitive according to the restriction endonuclease map. The plastid pKH1 was selected for further analysis, and the results of the sub-selection showed that a 〇.8-kb DNA fragment was able to exert hemolytic activity on 27 1251025 E. coli (five eo//) JA221. When this fragment was re-implanted into pUC18 and pUC19 (pCH100 and pCH101, respectively), this diplast encoded active hemolysin in E. coli co//) JA221, suggesting that the promoter of t/ze together with This gene is implanted and is functional in the 5 strains of the large intestine.

Nucleotide sequence of Kite gene

The nucleotide sequence of the ruler k and its flanking regions have been confirmed on both strands (see Figure 1). This sequence shows an open reading architecture (ORF) consisting of 486 bps and encoding a polypeptide of 162 amino acids, and has a position 6 bp upstream of the 10 predicted start codon ATG. The possible ribosome binding site GGAG is located in the pre-GZ) a/.,

Acids Res·, 7982/ /0·· 297/-299(5). A palindrome that may be a stop codon is located at a 24 bp downstream of the transcription termination codon. We have not attempted to find a promoter region located upstream of the predicted transcription start site. The G+C content of the coding region was 60.4%, and the G+C content at the third position of the codon was higher (71.5%). The molecular mass and pi values predicted by the moxibustion heart were 18,739 and 6.77, respectively. A GenBank search revealed no significant homology to any of the reported sequences at the nucleotide or amino acid level. Nucleotide sequence registration number The nucleotide sequence of the hemolysin gene selected from Klebsiella pneumoniae CMC-1 has been assigned GenBank Accession No. AF293352. Performance of recombinant khe (rkhe) in Daphnia bacillus 28 1251025 To test whether it can be directly observed in a polyacrylamide gel, 'reviewed with pCH100, pCH101 or pUC18 by SDS-PAGE

Ammonium sulfate-precipitated lysate of E. coli JA221 cells. Figure 2 shows that E. coli harboring PCH100 or PCH101 produces a protein of about 5 2〇-kE>a which is not produced by cells bearing piJC18. The size of this recombinant protein is greater than that expected for the product of the gene, probably due to the abnormal movement of the recombinant protein on SDS-PAGE. In E. coli JA221 and PET expression systems, the protein accumulates like an inclusion body. Attempts to achieve a higher amount of soluble proteins with hemolytic activity from those obtained from strain JA221 (pCHl〇〇) grown without IPTG were unsuccessful. Conservation of khe gene between clinical isolates of Klebsiella pneumoniae

Because the clinical isolates of Klebsiella pneumoniae on the large eve will exhibit hemolysis phenotype after being cultured on 15 blood agar plates containing rabbit red blood cells, the applicant may check that the moxibustion heart gene may be conserved. Sex. The genomic DNA of 20 Klebsiella pneumoniae strains from 20 patients was digested with wn, and then mixed with a 0.8-kb HI DNA fragment containing the entire 486 bp moxibustion gene. The results of Southern dot blot hybridization analysis under severe conditions 20 showed that all Klebsiella pneumoniae isolates contained sequences that could be hybridized to the probe. Three types of milk Win staining patterns were observed in this strain, while for other Klebsiella species (including Klebsiella oxytosus, Klebsiella oxysporum, Klebs No positive signal was observed on chromosome 29 1251025 of bacteria and Klebsiella nidus. In addition, for other bacterial strains [such as Aeromonas hydrophila, common Proteus (Edo (7) (10) vw / gar), Pseudomonas aeruginosa, Salmonella typhimurium (Sa / m6 ^ e / / typhimurium), epidermis Staphylococcus epidermidis, Staphylococcus aureus, Shigella sonnei, Streptococcus pyogenes (iS7r^p/(9cc^cw*s, Vibrio cholerae (mrz_<) 9 c/zo/erae), Vibrio parahaemolyticus (mr/o, traumatic arc)

No hybridization was observed in the chromosomal DNA 10 of the bacteria (mr/o vzz/m/ifcz^) and Escherichia coli (£\ co//·). The results of Southern blot analysis of DNA from 10 Klebsiella pneumoniae strains and DNA from other Klebsiella species for probe reaction of the 々/26 gene are shown in Figure 3. . Example 2: PCR analysis for the identification of Klebsiella pneumoniae 15 - PCR analysis was developed for evaluation of the /: heart gene as a gram

The use of one of the identifications of K. pneumoniae. A specific primer derived from a gene encoding Klebsiella pneumoniae was designed to supply a 222 bp fragment for amplification of a gene located within the gene and specific for Klebsiella pneumoniae. 20 Materials and Methods A total of 282 strains, i.e., 12 control strains and 270 clinical isolates including 23 different species were used in this study (see Table 1). The strain was obtained from: Department of Clinical Pathology, Chi Mei Basic Medical Center; Department of Microbiology, National Cheng Kung University Hospital, Tainan; Tai Po; Dr. Po-Ren Hsueh, National Taiwan University School of Medicine 30 1251025, Taipei; and Institute of Culture and Development, Hsinchu, Taiwan, Republic of China. The bacteria were cultured in TSB (Tryptic Soy Broth) or LB (Luria-Bertani Broth) overnight at 37 °C. The genomic DNA was extracted from the culture of each strain using a boiling method (Za J J w a/., C7z-/7. 5 her 2(10)3S·· 2076-20SO). Table 1: Number of specific species strains tested for P3-P4 primers designed for K. pneumoniae identification. Number of strains with Me showed Aeromonas aeruginosa (heart cav/flfe) 1 0 ^ Aeromonas hydrophila (known as Jrop/u7fl) 10 0 Aeromonas aeruginosa (L. 3 Enterobacter agglomerans (five "/eroiackr 6 0 Enterobacter cloacae (£. c/mcm) 20 0 E. coli ATCC 25922 and 20 clinical isolates 21 0 Klebsiella oxytosus (A: · ATCC 13182 and 21 0 20 clinical isolates) Klebsiella plant (foot. ATCC 3353 1) 1 0 Krebs Klebsiella pneumoniae (iL p/iew/iiow/ae ATCC 91 91 33495 and 90 clinical isolates J. berghei ([ATCC 33257] 1 0 (K. trevisanii ATCC 33 55 8) 1 0 Proteus mirabilis ( TVokws 10 0 Proteus vulgaris (75. vw/gar/·^ 10 0 Pseudomonas aeruginosa (Tsewi/o/woww ATCC 10 0 27 853 and 9 clinical isolates) Salmonella enteritidis (Sa/mo(10)//α(10) in r/ W/s group B) 5 0 Salmonella enteritidis (5\C group) 3 0 Salmonella enteritidis (5\βηίβΓ/Ύζϋ group D) 5 0 Salmonella enteritidis 5\ Ε群) 2 0 Serratia marcescens 10 0 Staphylococcus aureus ίπ/rews ATCC 14 0 25923, 29213, 27664, CCRC 12989 and 10 bed isolates Staphylococcus epidermidis epz·heart rw/mountain· Heart) 1 0 Pneumococcus pneumoniae 12 0 Streptococcus pyogenes (3⁄4. ATCC 14289 and 10 11 0 clinical isolates) Vibrio cholerae (F/ftr/o 1 0 Vibrio parahaemolyticus paraAaemo/yi/cwW 7 0 trauma Vibrio fK 5 0 31 1251025 Table 2. Oligonucleotide primer primer sequence selected for PCR (5'-3') Size of PCR product (bp) _ PI aacgacctgattgcattcgccactg Hemolysin 663, P2 ggtcagtccagtcgagcatcg P3 ggtcagtccagtcgagcatcg Hemolysin 222 P4 gataaaccacaggcgcatagtgcg U1 ccagcagccgcggtaatacg 16S rRNA 996 U2 atcgg(c/t)taccttgttacgacttc

As shown in Table 2, two pairs of primer pairs, ie, the primer PhP2 (5'-aacgacctgattgcattcgccactg-3' [SEQ ID NO: 3] and 5'-ggtcagtccagtcgagcatcg-3' [SEQ ID NO: 4], and the primer 5 P3 -P4 (5'-aataacaccgagcaggaggttcgtctg-3' [sequence identification number:

5] and 5'-gataaaccacaggcgcatagtgcg-3' [SEQ ID NO: 6], based on the sequence of the khe gene of CMC-1 from Klebsiella pneumoniae (B) (GenBank accession no. AF293352) And was designed. An additional primer pair with a broad 10 specificity for a conserved 16S rRNA sequence present in bacteria, ie U1-U2 (5'-ccagcagccgcggtaatacg-3' [SEQ ID NO: 7] and 5'-atcgg ( c/t) taccttgttacgacttc-3' [SEQ ID NO: 8]), used as an amplification control (Lw, JJ et al., Clin. Microbiol. 2000, 38: 2076-2(10)0). For PCR amplification, prepare a bacterial lysate containing the following reaction mixture: 10 μΐ; PCR buffer solution (10 mM Tris-HCl, pH 8.8, at 25 ° C, 1.5 mM MgCl 2 , 50 mM KC1 and 0.1% Triton Xl 00); - 1 μΜ concentration of each PCR primer; a concentration of 0.1 mM each of deoxynucleoside triphosphate (PROTECH Technologies, Inc., Taipei, Taiwan) and 2 units of 20 DyNAzyme TMII DNA Polymerase (HNNZYMES OY, Espoo, 32 1251025

Finland), this is formulated in a total volume of 50 μΐ. After an initial denaturation reaction at 5 minutes at 96 ° C, the reaction mixture was subjected to 25 thermal cycles (denaturation reaction at 96 ° C for 30 seconds, annealing at 60 ° C for 30 seconds, and at 72 ° The extension reaction was carried out at ° C for 1 minute), followed by incubation at 72 5 ° C for 7 minutes. 5 μΐ of PCR product utilizes 〇.5χ

Tris-borate-EDTA running buffer (ΤΒΕ; 45 mM Tris-borate, 1 mM EDTA) was electrophoresed on a 2% agar gel, and a 1 〇〇-bp DNA ladder marker (PROtech Technology) was included. The inside is labeled as a molecular size. A 1 〇 reagent control group consisting of all PCR components but without template dnA was included in each PCR operation. All experiments were repeated. Results 15 20

In the initial PCR analysis using primers for P1-P2, a major staining band of 663 tons of p-amplification product was observed in all Klebsiella pneumoniae, and several non-specific amplification products appeared in other Types of Klebsiella (data not shown). However, in the use of the primer pair p3_p4 pcR

In the analysis, the specificity of Klebsiella pneumoniae was shown in the amplification products of all strains (see Table υ. From Klebsiella Klebsiella, other Klebsiella species, and non-Cray The PCR amplification products of the B. burgdorfer isolate are clearly shown in Figure 4. Among the tested strains, all of the tested strains produced 996-bp amplifications that were still enriched by extensive specific primers. (See panel 4, panel a), but only the Klebsiella pneumoniae strain is produced - additional PCR amplifications are generated via the extensive specific primer P3_P4 (see Figure 4, panel B). K. pneumoniae was further confirmed to be a PCR-identified saline suspension of 33 1251025 CMC-1 in 1 〇 dilution and was used as a template for PCR amplification. The dilutions of these cells were also plated at 5%. On the blood agar, sputum was used to compare colony-forming ability plus PCR sensitivity. The results showed that 30 CFU of bacterial cells were used in each reaction tube, 5 using the P3-P4 primer set in this study. A 222-bp fragment of the khe gene was amplified.

When performing a two-step nested PCR [where the first PCR (25 cycles) uses the primer pair P P2 to generate a 663-bp product, and a second PCR (25 cycles to 2) The first product of μΐ was used as a 10 template) to generate a 222-bp product by using a primer for Ρ3-Ρ4, and a sensitivity of 10 times or more was observed, which was as low as in each reaction tube. A strong signal of 222 bp was observed under 3 CFU bacterial cells (data not shown).

To confirm that the PCR-based analysis is likely to be useful as a test, clinical blood samples are evaluated by culture and PCR. BACTEC blood culture bottles (Becton Dickinson Microbiology Systems, Cockeysville, Md.) inoculated with 3-10 ml of blood from patients at Chi Mei Fund Medical Center were inserted into BACTEC NR9240 instrument (Becton Dickinson Microbiology Systems) at 37° C is cultivated. Samples from 20 positive blood cultures were examined by Gram stain and were separately cultured in agarose containing 5% sheep blood and EMB (Eosin-Methylene Blue). On the dish, and then analyzed using the commercial identification system MicroScan WalkAwayTM-96 (Dade Behring, Frankfurt, Germany), for the confirmation of the PCR analysis of the knot 34 1251025

fruit. For PCR amplification, DNAs were extracted from 12 positive blood cultures characterized by Gram-negative and 4 negative blood using GenomicPrep cell and tissue DNA isolation kits (Amersham Pharmacia Biotech, Asia pacific Ltd., Taiwan). 5 parts of the whole portion of 0.5 ml of the culture. The conditions for PCR amplification are performed as described above. These experiments were performed in a blind test in which participants did not know if they were conducting an experimental or control group trial. 12 positive blood cultures [containing 4 E. coli strains, one Enterobacter cloacae c/oacae) strain, 2 strains of K. oxysporum (U. oxyhca), and 4 Klebsiella 10 bacilli The strain and one Serratia marcescens strain were isolated and identified using conventional methods. PCR products from blood cultures of these positive and negative strains were consistent with results obtained from other conventional assays. As shown in Figure 5, the positive PCR results of the moxibustion gene with a 222-bp fragment were confirmed to be from four blood culture samples consisting of Klebsiella pneumoniae, and the negative results were confirmed to be From Klebsiella oxysporum ([the other 8 blood cultures with other non-Klebsiella pathogens. This analysis confirms the amplification of this 222-bp fragment for blood samples as well as routine clinical microorganisms The identification 20 of Klebsiella pneumoniae in the laboratory is sensitive and specific. Although the invention has been described as being most suitable and preferred embodiments, it will be appreciated that The invention is not limited to the disclosed embodiments, but is intended to cover various modifications and equivalents thereof. Simple description

Figure 1 shows the nucleotide sequence of the Klebsiella pneumoniae moxibustion gene and the deduced amino acid sequence. The nucleotides are numbered with the first letter of the initiator Met codon as +1, and the amino acid 5 residues are numbered from the starter Met as +1. A Shine-Dalgarno sequence with a hypothesis about the location of a ribosome is underlined. The terminating secret code is represented by an asterisk, and a palindromic sequence is represented by a convergent arrow;

Figure 2 shows sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- for the expression of recombinant proteins in overnight cultures of 10 E. coli transformed with parental and recombinant plastids. PAGE) analysis, where line 1 is the low molecular weight protein standard (Amersham Pharmacia Biotech); line 2 is pUC18; line 3 is pUC19; line 4 is pCHlOO; and line 5 is pCHlOl. The location of the gene product is indicated by an arrow. The numbers on the left side of line 15 represent the size criteria expressed in kilodaltons (kDa); Figure 3 shows the different isolates from Klebsiella pneumoniae and other Klebsiella species. (Southern blots of genomic DNA of the species. The genomic DNA 20 of these bacterial strains was digested and probed with a 0.8-kb DNA fragment containing the Me gene. Lines 1 to 10 : Klebsiella pneumoniae isolate CMC-1 (line 1), isolate 86008 (line 2), isolate 86016 (line 3), isolate 86024 (line 4), isolate 86037 ( Line 5), isolate 86053 (line 6), isolate 86060 (line 7 36 1251025), isolate 87012 (line 8), isolate 87021 (line 9), and isolate 87024 (line 10) ); Line 11: Klebsiella producing acid (foot); Line 12: Klebsiella phytophthora (foot 〆 (four) price ο / α); Line 13: Klebsiella native (fire · (10) ^ buckle feet); line 14: Klebsiformis acid (U. 5 ormV / n · (10) (yi / ea); and line 15: [•. in the first Figures are representative of the left posterior to represent the group of i / Mdll- digested; I DNA size standards;

Figure 4 shows DNAs extracted from Klebsiella pneumoniae and non-Klebsiella bacteria, using the 16S rRNA gene universal primer (column A) and the P3-P4 primer pair of the present invention (column B) PCR analysis, in which: 100-bp step size molecular marker; lines 1-4 · Klebsiella pneumoniae ATCC 33495 and 3 clinical isolates; lines 5-8: acid-producing Krebs Bacteria (Nym oxyMca) ATCC 13 182 and 3 clinical isolates; Line 9: Klebsiella burgdorferi (see 〆(10)i/co/a) ATCC 3353 1 ; Line 10: Klebsiella pneumoniae (A :. 15 ierr/gwa) ATCC 33257; Line 11: You· ATCC 33558;

Line I2: E. coli ATCC 2W22; Line I3: Streptococcus pyogenes ATCC 14289; Line 14: Fall: Enterobacteriaceae rokcier c/(10) cae) clinical isolate; and line 15 · Slim, less a clinical isolate of marcace-like; and 2 〇 Figure 5 shows the PCR product amplified from the blood culture extracted from the patient. A specific PCR analysis for Klebsiella pneumoniae detected the presence of this bacterium in 4 samples (lines 1-4). The remaining 8 have K. oxysporum (U.S. oxyhca) (lines 5-6) and non-Klebsiella pathogens [ie E. coli (lines 7-10), sulcus Bacillus (the third line) and the sticky 37 1251025 Serratia marcescens (heart line 12)] samples isolated from them and those samples from which no bacterial pathogens were isolated (lines 13-16) will not The P3-P4 primer pair reacts. "M" column: 100_bp step molecular size mark. 5 [The main component representative symbol table of the drawing] (none)

38 1251025 Sequence Listing <110〉Chung, Yin-Ching Zhang, Zheng-Chung <120〉 A code for a unique Klebsiella pneumoniae (AVefe/Ws(10) hemolysin isolated gene And its application in detecting infection caused by Klebsiella pneumoniae isolates <130> NP-17021 <160> 8 <170> Microsoft Word 2000

<303> Chuang, YC, et al. (2002), Microb. Pathog. 33 (1), 1-6 <210> 1 <211> 809 <212> DNA <213> Krebs Klebsiella pneumoniae <223> encodes the gene for Klebsiella pneumoniae hemolysin<400> 1 gatcgctaaa accgtcctgc ccgatttaat cgcaacacgc atgaccctgg gtatgctata 60 tctgaagtgt ctcattttcg ggagaaaacg atg aaa cga cct gat tgc att cgc 114

Met Lys Arg Pro Asp Cys lie Arg 1 5 cac tgg cgc gaa ctg gaa ggg ccc gac gat gcc act tat ccc gac age 162

His Trp Arg Glu Leu Glu Gly Pro Asp Asp Ala Thr Tyr Pro Asp Ser 10 15 20 ccg gag cgt ttt teg att ggc geg ccg ctg ggg cgc ggt tta cgt etc 210

Pro Glu Arg Phe Ser He Gly Ala Pro Leu Gly Arg Gly Leu Arg Leu 39 1251025 25 30 35 40 aac egg ttg ggg ate cac cac gag ega ctg ccg ccc ggg egg ege acc 258

Asn Arg Leu Gly He His His Glu Arg Leu Pro Pro Gly Arg Arg Thr 45 50 55 teg tac ccg cac geg gag age gat gag gaa gag ttc ate tac gtg ctg 306

Ser Tyr Pro His Ala Glu Ser Asp Glu Glu Glu Phe lie Tyr Val Leu 60 65 70 gag ggc tat ccg gaa gtg tgg ata aag ggc tat etc tgg aag ctg gag 354

Glu Gly Tyr Pro Glu Val Trp lie Asn Gly Tyr Leu Trp Lys Leu Glu 75 80 85 ccg ggg gac age gtg ggt ttt ccc geg ggt acc ggt ate tgc cac act 402

Pro Gly Asp Ser Val Gly Phe Pro Ala Gly Thr Gly lie Cys his Thr 90 95 100 ttt etc aat aac acc gag cag gag gtt cgt ctg ctg gtg gtg ggc gag 450

Phe Leu Asn Asn Thr Glu Gin Glu Val Arg Leu Leu Val Val Gly Glu 105 110 115 120 gee aac aag aaa tac aac ege ate tat tat ccg etc aat cca ggc tat 498

Ala Asn Lys Lys Tyr Asn Arg He Tyr Tyr Pro Leu Asn Pro Gly Tyr 125 130 135 gee geg aeg ege cag gat cgt tgg gtt gac cat ccg ccg caa ttc ttc 546

Ala Ala Thr Arg Gin Asp Arg Trp Val Asp His Pro Pro Gin Phe Phe 140 145 150 ggt cca cac gac ggc aag aag egg aaa aag taatctaccc ggggaagggg 596

Gly Pro his Asp Gly Lys Pro Arg Lys Lys 40 1251025 155 60 cgaagcgcgg cgcactatgc gcctgtggtt tatctttgtg ctatagtagc gccccttttt 656 acccggatgc ttatttattc ggccattgat gcctgaatca acgtcacctg ttttccctgc 716 tcaccgcttc tccatcgcgc cgatgctcga ctggactgac cgacactccg gctacttcct 776 gcggctcgtg tcgcgcgata cgctgctgtatac 809 < 210 > 2 < 211 > 162 <212>Amino acid <213><220><223> Deduced amino acid sequence <4〇〇> 2

Met Lys Arg Pro Asp Cys lie Arg His Trp Arg Glu Leu Glu Gly Pro 15 10 15

Asp Asp Ala Thr Tyr Pro Asp Ser Pro Glu Arg Phe Ser lie Gly Ala 20 25 30

Pro Leu Gly Arg Gly Leu Arg Leu Asn Arg Leu Gly He His His Glu 35 40 45

Arg Leu Pro Pro Gly Arg Arg Thr Ser Tyr Pro His Ala Glu Ser Asp 50 55 60

Glu Glu Glu Phe He Tyr Val Leu Glu Gly Tyr Pro Glu Val Trp lie 65 70 75 80

Asn Gly Tyr Leu Trp Lys Leu Glu Pro Gly Asp Ser Val Gly Phe Pro 41 1251025 85 90 95

Ala Gly Thr Gly lie Cys his Thr Phe Leu Asn Asn Thr Glu Gin Glu 100 105 110

Val Arg Leu Leu Val Val Gly Glu Ala Asn Lys Lys Tyr Asn Arg lie 115 120 125

Tyr Tyr Pro Leu Asn Pro Gly Tyr Ala Ala Thr Arg Gin Asp Arg Trp 130 135 140

Val Asp His Pro Pro Gin Phe Phe Gly Pro his Asp Gly Lys Pro Arg 145 150 155 160

Lys Lys <21〇> 3 <211> 25 <212> DNA <213>Artificial sequence<220><223> Amplification primer for 1^^<400> 3 25 aacgacctga ttgcattcgc Cactg <21〇> 4 <211> 21 <212> DNA <213> artificial sequence 42 21 <220> 1251025 <223> Amplification primer for 6 <400> 4 ggtcagtcca gtcgagcatc g <210> 5 <211> 27 <212> DNA <213>Artificial sequence <220><223> Amplification primer for 1^^<400> 5 27 aataacaccg agcaggaggt tcgtctg < 210> 6 <211> 24 <212> DNA <213>Artificial sequence<220><223> Amplification primer for 1^^<400> 6 gataaaccac aggcgcatag tgcg <210> 7 43 24 1251025 <211> 20 <212> DNA <213>Artificial sequence <220><223> Amplification primer for 16S rRNA<400> 7 20 ccagcagccg cggtaatacg

<210> 8 <211> 23 <212> DNA <213> Artificial sequence <220><223> Amplification primer for 16S rRNA (c/t) <400> 8 23

Atcggytacc ttgttacgac ttc 44

Claims (1)

X. Patent application scope: Patent application No. 091138185 Application for revision of patent scope Revision date: December 1994 1. Once isolated polynucleotides, they basically consist of the following: (i) One is sequence identification Nucleotide sequence of 1; or (ii) a nucleotide sequence which is one of the sequence identification number: 1 complement; or (iii) a nucleotide sequence 歹 ij, which is in high stringency conditions The nucleotide sequence will be heterozygous to (i) or (ii). 2·························································· Encoded by the polynucleotide of the first paragraph of the patent. 4. A method for detecting in vitro whether a body is infected with Klebsiella pneumoniae (iC), comprising the steps of: (a) taking one from a suspected infection with Klebsiella pneumoniae An individual biological sample is used to detect the presence or absence of a Me gene, and the Me gene is detected to be characterized by the presence of Klebsiella pneumoniae. 5. The method of claim 4, wherein The 炀e gene consists essentially of: (i) a nucleotide sequence of sequence identification number: 1; or (ii) a nucleotide sequence which is one of the sequence identification numbers: 1 Or (iii) a nucleotide sequence which hybridizes under high stringency conditions to the 1251025 nucleotide sequence of (i) or (ii). 6. The method of claim 4, wherein the biological sample The system is selected from the group consisting of blood, feces and urine. 7. The method of claim 4, wherein the biological sample is blood 5 liquid. Method of detecting the Me gene by measuring the creature by debt The presence of the mRNA transcript of the Me gene in the sample is carried out. 9. The method of claim 8, wherein the detection of the presence of the mRNA 10 transcript of the Me gene is 'created by using at least one of the following methods: hybrid, cyclic probe reaction , polymerase chain reaction (PCR), 'nested PCR, reverse transcriptase polymerase chain reaction (RT-PCR), multiplex PCR polymerase chain reaction - single strand structure polymorphism, ligase chain reaction (LCR), Restriction fragment length polymorphic nucleic acid sequence-based amplification reaction (NASBA) 15 and transcription-regulated amplification reaction (TMA). 10. The method of claim 4, wherein the detection of the Me gene is carried out by using RT-PCR. 11. The method of claim 4, wherein the detection of the presence of the Me gene is performed by the following steps: 20 (a) extracting total genomic DNA from the biological sample; (b) obtaining from The extracted genomic DNA of step (a) is subjected to a polymerase chain reaction (PCR) treatment using at least one primer pair having a forward primer and a reverse primer, each primer having a nucleotide sequence which is heterozygous to Having a nucleotide sequence corresponding to sequence identification number: 1 of 2 1251025 of at least 13 contiguous nucleotides of the moxibustion/ze gene; and (c) detecting whether a nucleotide sequence is identical or complementary to the The PCR product of a portion of the nucleotide sequence of the Me gene has been generated from the PCR treatment of step (b), the presence of which is characterized by the presence of Klebsiella pneumoniae. 12. The method of claim 11, wherein the at least one primer pair used in step (b) comprises: a first primer having a nucleotide sequence selected from the sequence identification number: 3 And a sequence described in Sequence Identification Number: 5; and a second primer having a nucleotide sequence selected from the sequence 10: ID: 4 and Sequence ID: 6. 13. The method of claim 11, wherein the at least one primer pair used in step (b) comprises: a first primer having a nucleotide sequence corresponding to the sequence identification number -.3, And a second primer having a nucleotide sequence corresponding to the sequence identification number: 4. 15 14. The method of claim 11, wherein the method is used in step (b) The at least one primer pair comprises: a first primer having a nucleotide sequence corresponding to sequence identification number: 5, and a second primer having a nucleotide sequence corresponding to sequence identification number: 6. 15. A DNA sequence having a nucleotide acid sequence selected from the sequence identified by Sequence Identification Number: 3 to Sequence Number: 6. 16. An introductory group for in vitro detection of whether a body is infected with Klebsiella pneumoniae (Ny, comprising: a first primer having a nucleotide sequence selected from the sequence identification number: 3 and the sequence described in Sequence Identification Number: 5; and a second primer having a nucleotide sequence 3 1251025 selected from the sequence identified by Sequence Identification Number: 4 and Sequence Identification Number: 6. The primer group of claim 16 wherein the first primer has a nuclear sinus acid sequence as described in SEQ ID NO: 3. 18. The primer group of claim 16 of the patent application, wherein the first The primer has a nucleotide sequence as described in 5 Sequence Identification No.: 5. 19. The primer set of claim 16 wherein the second primer has a nuclear acid as described in Sequence Identification Number: 4. sequence. 20. The primer set of claim 16 wherein the second primer has a nucleotide sequence as described in SEQ ID NO: 6. 10 21. A test kit for detecting in vitro whether a body is infected with Klebsiella pneumoniae (N/metto om'ae), comprising at least one for a nucleotide sequence corresponding to one A pair of primers designed according to the sequence identification number: 1 for the e gene, the at least one primer pair comprising: a first primer having a nucleotide sequence selected from the sequence identification number: 3 and the sequence identification number: The sequence described in 5 15; and a second primer having a nucleotide sequence selected from the sequence identification number: 4 and the sequence identification number. 22. The test kit of claim 21, comprising a pair of primers consisting of: a first primer having a nucleotide sequence corresponding to sequence identification number: 3, and a one having a corresponding Sequence identification number: the second primer of the nucleoside 20 acid sequence of 4. twenty three. The test kit of claim 21, comprising a pair of primers consisting of: a first primer having a nucleotide sequence corresponding to sequence identification number: 5, and a one having a sequence corresponding to sequence identification Number: The second primer of the nucleotide sequence of 6. 4