TW200411067A - An isolated gene encoding a unique haemolysin of klebsiella pneumoniae and its uses in the detection of infections caused by klebsiella pneumoniae isolates - Google Patents

Abstract

This invention provides an isolated gene, khe, which codes for an extracellular haemolysin of K. pneumoniae and which has been determined to have a nucleotide sequence as shown in SEQ. ID. NO:1, based on which methods and tools for the detection of the presence of K. pneumoniae in a subject suspected to have an infection caused by K. pneumoniae are developed.

Description

200411067 发明, Description of the invention: [Invention of the technical field of the genus genus 3 Field of the invention The present invention relates to an isolated gene, that is, it is isolated from Klebsiella pneumoniae, and its code is a unique Klebsiella pneumoniae (foot-like) hemolysin, and there is information about the gene used in debt testing by Klebsiella pneumoniae (human

(Me) The development of fast, sensitive, and reliable devices for infections caused by Me). 10 [Prior Art] Background of the Invention (Description of Related Techniques) Members of the genus Klebsiella (foot / e ^ k // a) are the cause of nosocomial infections in adults and disease outbreaks in the neonatal population in hospitals (Darfeuille- Michaud, A ·, et al · July 1992, Infect · Immun ·, 60: 15 44-55; Guarino, A., et al · (1989), Pediatr · Res. 25:

574-57S). The most clinically important in this group is A. pneumoniae {Podschuny R. and U · Ullmann. (7PP5 human ΜζΥγοΗο /. 77. ·, which can cause bacteremia ( bacteremia), meningitis, pneumonia 20 and pyogenic liver abscess (Dar / ewz7 / e-Michaud, A., et al. July 1992, Infect. Immun., 60: 44 -55 \ Goldman, J. M. and J. K. Kowalec (1978), JAMA, 240: 2660, Kreger, BE, et al. (1980), Am. J. Med., 68: 332-343. Seeto, RK and D. Rockey (1996), Medicine, 75: 99-113) o 200411067 Klebsiella pneumoniae is an opportunistic source of infection that causes urinary tract infections accompanied by sepsis and nosocomial infections Pneumonia, and the second most common microorganism isolated from E. coli (five sc / zer / c / nh) from patients with Gram-negative bacteremia (Farmer JJ , III, Kelly MT ·

In Balows A et aL, Eds. Manual of clinical microbioloby, 5th ed. Washington, D. C .: American Society for Microbiology, 1991, pp. 60-383; Jarvis WR et al. (1985), Infect Control (Thorofare) , 6: 68-74 ·, Kreger BE et al · 10 (7 卯 team dm Yang _ ·. In recent years, 50% to 80% of cases of purulent liver abscess in Taiwan are related to Klebsiella pneumoniae Infection is linked (Zee, 7 " · Γ · to a / · / magkg, 79: 47-52;

Yang, C.C., et al. (1993), Am. J. GasteroL, 88: 7977-7W5). More importantly, many Taiwanese patients who develop Klebsiella pneumoniae-induced 15 purulent liver abscesses also experience metastatic endophthalmitis (Chang, FY, ei) that can cause blindness. α / · 1988, J. Formos. Med. Assoc. 87: 282-287; Cheng, DL, et al · (1990), J, Formos. Med. Assoc ·) 89: 571-576 ·, Cheng, D · L ·, et al · (1991), Arch, Intern · Med. 151: 1557-1559 ·, Chiu, 20 CT} et al. (1988), J. Clin. Gastroenterol, 10: 524-527) ° Many Different factors have been proposed as possible determinants of the toxicity of Klebsiella pneumoniae. The production of encapsulating polysaccharides imparts anti-bactericidal properties and antiphagocytic properties to the organism (antiphagocytic with α /. (7 日夕 0 入 200411067)

Med M / crMz · 〇 /, 7: 79 (5-202). Colonization in the human airway epithelium and urethral epithelium is thought to be initiated by pilus protein or non-fimbrial protein adhesin (1992) (1992) ), 5 Infect Immun, 60: 44-55; Duguid, JP (1959), J Gen MicrM Qin /, 27: 27 / -2 < ^). The components involved in the intestinal tract are also important Qinzizi (Oelschlaeger, T.A. et al. (1997), Infect Immun 65 ... The production and use of aerobactin also enhances toxicity X. et aL (1986), Infect Immun 54: 10 6034-like), and a toxic complex secreted by Klebsiella pneumoniae has been shown to be fatal to mice. From DC (79 < §7 into i > 2 / eci 55 ·· 44-45) 〇 In addition, several toxins detected in Klebsiella pneumoniae are related to infections caused by the bacteria (GwaW⑽, d., Et al. ( 1989), Pediatr Res 25: 514-518; Klipstein, FA, et aL 15 (1983), Infect Immun 42: 838-841 ·, Koo FCW, et al. (1986),

Curr Microbiol 13: 23-27. The identification of Klebsiella pneumoniae species by conventional methods often takes 3 to 4 days. The need for a reliable and rapid assay for the specific detection of Klebsiella pneumoniae is clinically and epidemiologically important. Hemolysin is functionally defined by its ability to dissolve red blood cells, and for various pathogenic microorganisms, it is usually associated with toxicity (Braun, V. et al. (1991), Crit Rev Microbiol 18: 775- / 5S). Although Klebsiella pneumoniae has been considered non-lytic 200411067 for many years, especially for human red blood cells, in 1985, Albesa et al. Reported clinical isolates with hemolytic capacity on rabbit red blood cells (Albesa, I. et al. (1985), Can Microbiol 31: 297-300. Reports from the latter soil have indeed shown that purified Klebsiella pneumoniae hemolysin 5 [klebsolysin] in Sheep, mouse and human red blood cells show up

Hemolytic effect is exhibited, and has characteristics similar to other thiol-activated lysins (XiJin J Bacteriol 67: 263-266 ·, Barberis, LI et al. (1986), Can Microbiol 32: 884-888. 10 However, there have been no reports of the isolation and characterization of genes encoding hemolysin derived from Klebsiella pneumoniae. In addition, the role of klebsolysin in the pathogenesis of Klebsiella pneumoniae infection has not been fully evaluated. It would be highly desirable to obtain an isolated gene encoding a Klebsiella pneumoniae hemolysin [klebsolysin], 15 which allows the evaluation of the hemolytic effect of clinical isolates of Klebsiella pneumoniae.

In US 6,225,453 issued to Hiroshi Ueuama et al., Probes have been disclosed which can be used to detect and identify Klebsiella pneumoniae. In particular, the DNA derived from Klebsiella pneumoniae bacteria was extracted and then completely digested with the restriction enzyme hdlll, and then randomly colonized into the vector 20 pGEM-3Z. Five probes specific for Klebsiella pneumoniae were selected from the thus-obtained selection strains, that is, the probes contained the probes which were shown to be contained in natural Klebsiella pneumoniae. A DNA fragment with specific reactivity within the DNA. This patent does not mention the isolation and characterization of a gene encoding the hemolysin of Klebsiella pneumoniae and the use of the gene 200411067 as a molecular marker for Klebsiella pneumoniae.

In US 5,994,066 and US 6,001,564 issued to Michel G. Bergeron et al., A method has been disclosed for the comprehensive detection of bacteria present in biological samples and for the specific detection of urine or Any 5 E. coli co / z in other biological samples), Klebsiella pneumoniae, Enterococcus faecalis (pentavalent / ^ ~ 仏), Pseudomonas aeruginosa, Mirabilis), rot ί Staphylococcus saprophyticus, Streptococcus pneumoniae, Moraxella catarrhalis instrument (Haemophilus ζ · π // ζ ^ λ2ZM), the method includes: : Denaturing bacterial DNA into a single strand and holding it on a support or leaving it in a solution; contacting the single strand of genetic material with a labeled probe selected from the group : I) fragments of chromosomal DNA of the above bacteria, and ii) synthetic oligonucleotides whose 15 sequences are derived from fragments of these chromosomal DNA or sequences available from databases, all (i and ii) Probes can specifically hybridize Their chromosomal DNA, or, if a universal primer, the hybrid to any one of the bacterial chromosome DNA. However, the disclosures of these patents do not mention the use of primers 20 specific to genes encoding hemolysin derived from Klebsiella pneumoniae. On the other hand, Lu JJ et al. Designed a universal 1PCR (Journal of Clinical Microbiology. 38 · 207 (5) that can amplify a part of the 16S rDNA gene of Eubacteria (including Klebsiella pneumoniae). -2⑽2 卯 0). According to the PCR technology reported in this article, the source

200411067 "E. coli, P. pneumoniae, Serratia marcescens (see heart heart fairy see) and Enterobacter cloacae (five ... strains, the PCR product has the same digestion pattern as ΙΠ, but when she I or fine BI—Different types when digested. Although this universal pCR combined to limit enzyme t. 5 analysis is claimed to be used to detect and identify bacteria in clinical specimens | ± pathogens, it is clear that such a tool, when Whether it is used for primary testing with members of Klebsiella yttrium genus Klebsiella is fast, sensitive, and reliable. [Summary] Spring 10 Summary of the Invention Therefore, in a first aspect, the present invention provides a The isolated gene, also known as moxibustion heart, encodes extracellular hemolysin, one of Klebsiella pneumoniae, and it has been determined to have the nuclear loop sequence shown in the sequence identification number: 丨. The performance of 15 resulted in the production of 15 of a polypeptide having 162 amino acids. The polypeptide has been determined to have hemolytic activity and has an amino acid sequence as shown in sequence identification number: 2. Therefore, those skilled in the art can Make Use the immunological methods (such as fusion tumor technology) well-known in the art to make * Φ antibodies, especially the monoclonal antibodies specific for the polypeptide. The antibodies obtained can be used in the production of A test kit for detecting an infection caused by Klebsiella pneumoniae isolates.-In a second aspect, the present invention provides a method for detecting a suspected disease-a Klebsiella pneumoniae A method for the presence of Klebsiella pneumoniae in an infected body caused by Bacillus, comprising the steps of: obtaining a biological sample from the individual; and 10 200411067 testing the coat of the moxibustion gene in the sample. The detected manifestation of the heart moxibustion gene is characterized by the presence of Klebsiella pneumoniae. In a third aspect, the present invention provides-for detecting a suspected disease caused by Klebsiella pneumoniae. The set of primers for the presence of Klebsiella pneumoniae 5 in the infected individual, including—the forward direction of the nuclear sequence with a sequence selected from sequence identification number: 3 and sequence identification number: 5 Primer And-has-reverse primers selected from the nucleotide sequences of the sequence identification number: 4 and the sequence identification number: 6. The above and other objects, features, and advantages of the present invention are described in detail below with reference to 10 It will become obvious after comparing with the preferred specific example and the accompanying drawings, where: The drawings are briefly explained. Figure 1 shows the nucleotide sequence of the Klebsiella pneumoniae heart-free gene and the deduced amino group. The nucleotide sequence is numbered with the first letter of the initiator 15 Met codon as +1, and the amino acid residues are sequenced from the initiator Met as +1 Numbered. A Shine-Dalgarno sequence with a hypothetical binding site for ribosomes is underlined. The stop codon is indicated by an asterisk, and a palindromic sequence is indicated by convergent arrows. 20; Figure 2 shows dodecyl sulfate-polyacrylamide gel electrophoresis of the expression of recombinant proteins in an overnight culture of E. coli transformed with parental and recombinant plastids ( (SDS-PAGE) Analysis, where line 1 is the low molecular weight protein standard (Amersham Pharmacia Biotech); line 2 is pUC18; line 3 is pUC19; line 4 is pCHlOO; and line 5 200411067 is pCHlOl. The location of the / ze gene product is indicated by an arrow. The numbers on the left side of line 1 represent size standards in kilodaltons (kDa); Figure 3 shows different isolates from Klebsiella pneumoniae and 5 and other Klebsiella Southern blots of the genomic DNA of the genus (especially species). The genomic DNA of these bacterial strains was digested by / ί7ΜΙΙΙ and was extracted from a gene containing 0.8-kb Ac / -like mHI DNA fragments. For probe detection. Lines 1 to 10: CMC-1 isolate (line 1), isolate 86008 (line 2 10), isolate 86016 (line 3), isolate Strain 86028 (line 4), isolate 86037 (line 5), isolate 86053 (line 6), isolate 86060 (line 7), isolate 87012 (line 8), isolate 87021 (line 9 Line) and isolate 87024 (line 10); line 11: Klebsiella acidigenes (Russian-like ⑺); line 12: Klebsiella phytica ([ρ / βπίζ'α / α ); Line 13: 15 Klebsiella erythropolis ([ierr 蝓 wa); Line 14: Klebsiella guanis ([; and Line 15: You ·. Located in The numbers on the left side of line 1 represent the ugly kdl-digested and DNA size standards expressed in base pairs; Figure 4 shows DNAs extracted from Klebsiella pneumoniae and non-Klebsiella 20 bacteria PCR analysis using 16S rRNA gene universal primers (column A) and the P3-P4 primer pair (column B) of the present invention, where line M: 100-bP ladder molecular size marker; lines 1-4: Cray P. pneumoniae ATCC 33495 and 3 clinical isolates; lines 5-8: Klebsiella acidigenes (footprint · ATCC 13182 and 3 clinical isolates; line 9: Klebsiella phytoplasma 12 334 200411067 ([ATCC 33531; Line 10: Klebsiella err / gewa) ATCC 33257; Line 11: You.irev / samATCC 33558; " Line 12: E. coli ATCC 25922; Line 13 : Streptococcus pyogenes · (iS7re; 7i (9MecATCC 14289; line 14: clinical intestinal rod, 5 bacteria c / c ^ cae); and line 15: Serratia marcescens) clinical isolation And Figure 5 shows the PCR products amplified from J) nAs extracted from the patient's blood culture. Specific to Klebsiella pneumoniae Sexual pcR analysis detected this bacterium in 4 samples (lines 1-4). The remaining 8 already had acid-producing Klebsiella 10 (lines 5-6) and non-Cray Bordetella pathogens [ie, Escherichia coli (lines 7-10), Enterobacter cloacae (lines 丨 丨), and Serratia marcescens (iSerrafk line 12)], and those from which The sample from which no bacterial pathogen was isolated (lines 13_ 丨 6) will not react with this P3-P4 primer pair. "M" column M0 (Kbp ladder molecule 15 size label. [Embodiment] Detailed description of the preferred embodiment _ Detailed description of the invention We accidentally observed a clinical isolate 20 of Klebsiella pneumoniae (especially low) -Hemolysis caused by low-passage clinical isolates. To explore the hemolytic properties of Klebsiella pneumoniae, we have selected and sequenced the hemolysin derived from Klebsiella pneumoniae Encoding gene. When expressed in E. coli, a unique peptide of approximately 20 kDa was identified. Nucleotide sequence analysis predicts one with 486 base pairs (bps)

13 200411067's single open reading architecture (0RF), which encodes a polypeptide with 162 amino acids with an estimated P1 value of 6.77. Me and any of the reported sequences did not identify extensive sequence homology at the nucleotide or amino acid level. In addition, DNA hybrids under severe conditions for several bacteria, 5 including Klebsiella acidigenes (Klebsiella phytoplasma (P / Clark / α)), Klebsiella terrestrial ([· Calling and Klebsiella oryzticum (Neisseria), showing no cross-reactivity. These data show that we have selected a unique gene that has been tested in Klebsiella tested Pneumococcal isolates are highly defiant. 10 Because the nucleus of this gene was not detected in other Klebsiella species and non-Klebsiella strains tested; the acid sequence, The use of this gene as a test tool for Klebsiella pneumoniae isolates is promising. We therefore further evaluated the use of this protein as a molecular marker for identifying Klebsiella pneumoniae isolates. 15 4 Therefore, provided herein according to the present invention-an isolated polynucleic acid derived from Klebsiella pneumoniae (especially / dhe / M), which basically consists of the following: ( i) a nucleotide sequence having a sequence identification number: 1; (Π) a nucleotide penetrating sequence It is a sequence identification number: a complement of one of the 20 sequences of the nucleotide sequence; or (in)-a nucleotide sequence, which will hybridize to a nucleotide sequence or a nucleotide sequence under high stringent conditions. It is one of the Klebsiella pneumoniae genes-the polynucleic acid encoding the gene-a polypeptide that has hemolytic activity and is basically composed of a deduced amino acid sequence for sequence identification number 14 200411067: 2 The peptide is considered to be a species-specific hemolysin of Klebsiella pneumoniae, and therefore can be used as an indicator in determining the presence of Klebsiella pneumoniae. Based on the nucleotide sequence of the gene, Oligonuclear acid that can be hybridized with at least 5 13 nuclear mosic acids of the moxibustion gene can be designed as a method for detecting the moxibustion gene using traditional methodologies well known in the field of biotechnology. The performance of the probe or primer.

As an example, we have designed four primers that can be used in the method of the present invention to detect Klebsiella pneumoniae, including: 10 First primer pair: Forward primer 1 5'-aacgacctgattgcattcgccactg-3 ' (Sequence identification number: 3) reverse primer 1 5'-ggtcagtccagtcgagcatcg-3 '(sequence identification number: 4) second primer pair: forward primer 2 5'-aataacaccgagcaggaggttcgtctg-3' (sequence identification number: 5) 15 reverse Directional primer 2 5'-gataaaccacaggcgcatagtgcg-3 '(sequence identification number: 6)

It is expected that the forward primer 1 can be paired with the reverse primer 2, and the forward primer 2 can be paired with the reverse primer 1. According to the present invention, the performance of the gene can be detected by analysis of an mRNA transcript from the moxibustion gene or a protein translated from the mRNA transcript of the moxibustion gene. Detection of the protein translated from the mRNA transcript of the gene can be performed by conventional methodologies well known in the field of biotechnology. For example, an antibody specific for the polypeptide of sequence identification number: 2 can be manufactured according to the common methods for the production of monoclonal antibodies in the art and used by 15 200411067 to detect Klebsiella pneumoniae isolates. On the existence. -The present invention provides a gene of Klebsiella pneumoniae. In particular, the following examples describe the identification, isolation and characterization of the genes of the Klebsiella pneumoniae CMC] strain. Southern heterozygote-5 analysis using this gene showed that the minigene was weird within Klebsiella pneumoniae and was specific-specific to the bacteria (see Example 1}. CMC] strain — The sequence of the coding region of the gene and the part of the flanking region are described in the sequence identification number: 1 (see Figure 1). As used herein, gene, the word contains one that under severe conditions · 10 will be heterozygous S CM (Kg gene of Klebsiella pneumoniae gene, or a fragment of the gene that has at least 13 base pairs (bp) in length. "Severe conditions, here are defined as those It will provide a case where there are about 10% or less base pair mismatches. As noted above, since this moxibustion gene is conserved within the Klebsiella pneumoniae 15 strain and is correct for These strains are specific. This gene, as well as the mRNAs and polypeptides encoded by this gene, are excellent targets for the detection and quantification of Klebsiella pneumoniae strains. For example, detection or quantification of Klebsiella pneumoniae By using a polymerase chain reaction (PCR) using primers (which will amplify at least a portion of the 20 moxibustion ~ gene), by using a DNA or RNA probe or mRNA fluorescence detection that will hybridize to the Me gene The system, or by an immunoassay that specifically binds to a secondary peptide from the use of a single molecule. Chaika, the presence of the secondary gene is detected by using at least one of the following methods to detect the presence of an organism MRNA transfer of moxibustion heart genes in sexual samples 16 200411067 The existence of recorded materials: hybridization, cycling probe reaction, polymerase chain reaction (PCR), nested PCR, reverse transcriptase polymerase chain reaction ( (RT-PCR), multiplex PCR polymerase chain reaction-single-stranded polymorphism, ligase chain reaction (LCR), five-primer amplification reaction (NASBA) with restriction fragment length polymorphism, and transcription-regulation Amplification reaction (TMA). In a preferred embodiment of the present invention, the performance of the Me gene is detected by using PCR to detect the presence of the A / ze gene in the biological sample. 10 15 20 In a preferred embodiment of the present invention, The detection of the presence of the gene is performed by the following steps: (a) extracting the total genomic DNA from the biological sample; (b) subjecting the extracted genomic DNA obtained from step (a) to a Polymerase chain reaction (PCR) processing using at least one primer pair with a forward primer and a reverse primer, each primer having a nucleotide sequence will be hybridized to having a nucleotide sequence corresponding to the sequence identification number: 1 At least 13 consecutive nucleotides of the moxibustion gene; and (c) detecting whether a PCR product having a portion of a nucleotide sequence identical to or complementary to a portion of the nucleotide sequence of the moxibustion gene has been removed from step (B) A PCR treatment is generated, and the presence of the PCR product is a sign of the presence of Klebsiella pneumoniae. The PCR detection method provided by the present invention can allow rapid and sensitive use in clinical detection of Klebsiella pneumoniae. Preferably, the biological sample is selected from the group consisting of:

17 200411067 Blood, stool and urine. In a preferred embodiment of the present invention, the biological sample is blood. In a preferred embodiment of the present invention, the at least one primer pair used in step (b) contains a first primer having a nuclear acid sequence of five columns selected from a sequence identification number ·, 3 and the sequence identification number: 5 and the second primer 'have m acid sequences selected from the sequences described in the sequence identification number: 4 and the sequence identification number: 6.

In a more preferred embodiment of the present invention, the at least one primer pair used in step (b) includes: one having a sequence identification number. The first primer of the 10-nucleotide sequence and a second primer having a nucleotide sequence corresponding to the sequence identification number: 4. In another preferred embodiment of the present invention, the at least one primer pair used in step (b) includes a first primer having a nucleotide sequence corresponding to a sequence identification number: 5 and A second primer having a nucleotide sequence numbered 15 corresponding to sequence identification.

The invention also provides a primer set for detecting the presence of Klebsiella pneumoniae in an individual suspected of having an infection caused by Klebsiella pneumoniae, which comprises: a first primer, It has a nucleotide sequence selected from the sequence identification number: 3 and sequence identification number: 5; and a second primer having a nucleotide sequence selected from the sequence identification number. : 4 and the sequence described in sequence identification number: 6. The invention also provides a test kit for detecting the presence of Klebsiella pneumoniae in an individual suspected of having an infection caused by Klebsiella pneumoniae, comprising a The primer pair is a primer pair with a second 18 primer. Each primer has a nucleotide sequence that is hybridized to at least 13 consecutive nucleotides of the gene with a nucleotide sequence corresponding to the sequence identification number: 1. In a preferred embodiment of the present invention, the test set includes a primer pair consisting of: a first primer having a nucleotide sequence selected from a sequence identification number: 3 and a sequence identification number : The sequence described in 5; and a second primer having a nucleotide sequence selected from the sequence described in sequence identification number: 4 and sequence identification number: 6. In a more preferred embodiment of the present invention, the test set includes a primer pair consisting of a first primer having a nucleotide sequence corresponding to a sequence identification number: 3, and a primer having a correspondence The second primer in the nucleotide sequence of sequence identification number: 4. In another preferred embodiment of the present invention, the test set includes a primer pair consisting of a first primer having a nucleoside S-text sequence corresponding to a sequence identification number: 5 and a primer having A second primer corresponding to the nucleotide sequence of the sequence identification number: 6. In addition to the above, those skilled in the art will understand that various applications falling within the scope of the present invention include the use of any form of evaluation analysis. For PCR analysis, DNA was obtained from a sample suspected of containing Klebsiella pneumoniae. Furthermore, mRNA can be obtained from the sample and used to prepare cDNA, and the cDNA can be used as a template in PCR. Methods for extracting total cellular DNA and RNA from cells and methods for preparing cDNA are well known. However, PCr does not require highly purified 200411067 DNA, and the DNA released by boiling cells can be used directly without any purification. A PCR primer is a nucleic acid molecule having a selected sequence, whereby the molecule can hybridize to one of the genes. Typically, at least 2 primers must be used for 5 (each primer will be hybridized to the respective red of the gene). However, more than one primer pair can also be used. If you want to amplify more than one part of the gene, Heart gene words. The primers should have at least 13 base pairs in length, preferably 20-30 base pairs, and have a content greater than 40%. The specificity of these primers should be determined by Southern dot analysis10.

15 Second, DNA is amplified by PCR. PCR methods, equipment, and reagents are well known and commercially available. Finally, the amplified DNA is detected or quantified. This can be achieved by many methods well known in the art. For example, the reaction mixture can be electrophoresed on a cycloaliphatic gel, and has the expected ... The jersey can be confirmed by _ color bribe glue ^. Alternatively ... a labeled ammonium acid molecule (-a probe) that will hybridize to the amplified vessel may be used to allow the amplified amidine or quantification. As an alternative-these primers can be labeled, or; the acid used during PCR can be labeled, and the label incorporated into the amplified DNA can be detected and quantified. Detection of Klebsiella pneumoniae can also be achieved by obtaining DNa or Dna from a sample suspected of containing Klebsiella pneumoniae. This can be expected in the same manner as described above for the PCR analysis. The two

20 200411067 or RNA is connected to a probe, which is a nucleic acid molecule with a selected sequence, whereby the molecule will hybridize to the gene or the mRNA encoded by the moxibustion gene. The probe is allowed to hybridize to DNA or RNA obtained from the sample. To detect the heart-free gene or mRNA, the probe is labeled with 5. The probe should be as large as possible while maintaining specificity.

The invention further includes nucleic acid molecules used as probes and primers in these techniques. These nucleic acid molecules have a selected sequence whereby the molecules will hybridize to the moxibustion gene or an mRNA encoded by the moxibustion gene. 10 For example, an appropriate probe or primer may be included in the sequence listing The sequence of the gene is described by sequence identification number: 1 or a fragment of the sequence. These nucleic acid molecules can also contain anti-message RNA molecules and ribozymes. Of course, the methods used to synthesize these nucleic acid molecules are also well known in the art. 15 These probes or primers can be labeled to allow detection of Klebsiella pneumonia

Bacillus. Appropriate labels and methods for attaching or incorporating them into nucleic acid molecules are familiar. Suitable labels include radioactive labels (eg, 32P), chemical fluorescent labels, fluorescent labels [eg, fluorescein, rhodamine], granular labels [eg, Gold 20 Colloids (gold colloids), colorimetric labels (eg, dyes), enzymes, and biotin. As noted above, labeled nucleotides can also be used in PCR to generate a labeled amplified DNA. Preferably, the nucleotides are labeled with radioactive activity by a method familiar to the art (e.g., 32P). Klebsiella pneumoniae can also be detected in an immunoassay using an antibody that specifically binds to a cardiac peptide. A peptide can be used by methods well known in the art to generate antibodies that can be applied to the immunoassay. This gene or a fragment thereof can be used to produce a peptide. Peptides can also be prepared by solid-phase synthesis. Single chain antibodies or other engineered antibodies or fragments of antibodies containing an antibody binding site can also be used. For immunoassay, a sample suspected of containing Klebsiella pneumoniae was contacted with the antibody under the conditions used, whereby the antibody could bind to a peptide (if present). Standard immunoassay formats can be used. An antibody that is bound to a peptide can be labeled to allow detection of a peptide, or a labeled portion that will bind to the antibody (eg, a secondary antibody to a primary antibody or protein A) can be used. Appropriate labels and methods for attaching them to antibodies and other proteins and compounds are well known. Suitable labels include radioactive labels (eg, 1251), fluorescent labels [eg, fluorescein, rhodamine], chemical fluorescent labels, granular labels [eg, gold colloid ( gold colloids), colorimetric labels (for example, 20 dyes), enzymes, and biotin. In a further specific example, the present invention provides a primer for detecting Klebsiella pneumoniae in a sample using nucleotide amplification technology, which is included in the sequence listing and described by sequence identification number: 1 Nucleic acid sequence. The primers of the present invention can be used as a degenerate primer (22 η, 200411067). The degenerate primer is a nucleotide sequence described in the sequence listing by sequence identification number: 3 to 6 One or more possible combinations. It is contemplated by the present invention that the nucleic acids described herein can be used in any of a number of nucleic acid detection techniques, including but not limited to: polymerase 5 chain reaction, isothermal DNA amplification and many more. Similarly, the nucleic acid described in the sequence identification number: 1 can be used as a probe for detecting or capturing a nucleic acid that is hybridized with the nucleic acid of the sequence identification number: 1.

It is anticipated by the present invention that the nucleic acids described herein can be applied to any of 10 nucleic acid detection techniques, including but not limited to: polymerase chain reaction, isothermal DNA amplification, liquid phase hybridization (Liquid hybridization) and so on. Similarly, the nucleic acid described in sequence identification number: 1 can be used as a probe for detecting Klebsiella pneumoniae.

Clinical samples that can be used in the method of the present invention include: sputum, pharynx 15 throat swabs, blood, urine, cerebrospinal hearing fluid, skin, biological specimens, saliva, synovial fluid, bronchi Bronchiallavage or other tissue or fluid samples from humans or other animals.

Many of the methods described above use heterozygous nucleic acids. Hybrid conditions and guidance for selecting high and low severe conditions are well known in the art20. See 1, for example Sambrook et al., Molecular Cloning: A. Appropriate hybridization conditions can be easily determined and optimized using techniques commonly used in the art. The present invention will be described in more detail with reference to the following examples, which are provided for the purpose of illustration only and are not intended to limit the scope of the present invention. EXAMPLES Example 1: Experimental method for breeding genes from Klebsiella pneumoniae. 5 Bacterial strains and plastids. Bacteria used include: Klebsiella pneumoniae ([⑽Me) CMC-1, 50 species of Klebsiella. Pneumoniae strains, Klebsiella acidophilus (Ruler., Klebsiella phytoales (E. W. co / a), Aeromonas hydrophila, Proteus vw / gw / * y) , 10 Pseudomonas aeruginosa, aerwgkwa), Salmonella typhimurium, Staphylococcus epidermidis, Staphylococcus aureus, Shigella sclerotiorum 0, Sterile pustule chain Coccus d. Baaw sighs, Vibrio cholerae (F / 6r / < 9 c / zo / erw), Vibrio parahaemolyticus (F / 6r / o 15 and F / Z? Rh vw / m // cz ^), all of which were isolated from the blood or feces of patients at the hospital attached to National Cheng Kung University; Klebsiella terrei krr igena) and Klebsiella trobilis ([ The tadpole strain was obtained from the Institute of Culture and Development of Hsinchu City, Taiwan Province of Taiwan. Clinical isolates, Klebsiella terrestris 20% · ier r / ge / 7 (3) and Klebsiella guanis ([(9rm7 / z / ⑽ and E. coli (f.co/z·)) were grown at 37 ° C in Luria-Bertani (LB ) J. et al. Y Molecular cloning: a laboratory manual, 2nd ed · Cold Spring Harbor) New York: Cold Spring Harbor Laboratory Press, 1989. Colonoscope (E · Q 4b 24 200411067

coli) JA221 (Beggs JD. Nature 1978, 275: 104-109) ^ JM109 (Yanisch-Perron C et al., Gene 1985, 33: 103-119) and χΙΛΒ (Stratagene, La Jolla, CAf C / H) Used as transformation hosts. Klebsiella pneumoniae and recombinant E. coli 5 cell lines were obtained by using a blood agar culture dish (containing 5% rabbit erythrocyte trypticase soybean agar [BBL, Cockeysville, MD, USA ·]) Assess hemolytic phenotype. When appropriate for screening, Ampicillin (50 pg / ml) was added. When needed, the medium was added with isopropyl 10- / 3-D-. Isopropyl-cold-D-thiogalactopyranoside (IPTG) to a final concentration of 1 mM. The plastid pBR322 F da / ·, Gwe / 977, 2: P5-773) was used in breeding experiments; the plastids pUC18 and pUC19 «/ ei a / ·, Gene 7 Yang 2, / Jiu · were used next -In breeding experiments. PET21b

15 (Novagen, Madison, WI, USA) was used in protein over expression experiments. Construction and screening of genomic libraries. All DNA manipulations were performed using standard procedures. J. et aL, Molecular cloning: a laboratory manual, 2nd ed. Cold 20 Spring Harbor, New York: Cold Spring Harbor Laboratory 79). The genomic DNA bank of Klebsiella pneumoniae CMC-1 was constructed according to Chang et al. (C / z⑽g MC a /. J Gew Mz'croMo / 7993, 739 ·· 3275-J223). The gene bank was used to transform E. coli co //) JA221, and the transformation system was screened on a blood lipid culture dish 25 200411067. After 48 hours of incubation at 37 ° C, colonies with clear areas around them were isolated. DNA sequencing and analysis

The sequencing of Me was performed by an automated DNA analyzer (ABI 377; 5 Applied Biosystems, Inc., Foster City, CA, U.S.A.). Sequence analysis was performed using the PC / GENE software package (Intelligenetics). The nucleotide sequence and its deduced amino acid sequence are obtained by using the BLAST E-mail server (BLAST E-mail) located at the National Centre for Biotechnology and Information (Taiwan, the Republic of China) network server). SDS-PAGE analysis

E. coli (5 · eo / z ·) cells were collected by centrifugation from a 200-ml overnight culture and resuspended in analysis buffer (0.85% NaCl, 10 mM Tris, ρΗ7.5). And 3 consecutive French pressure cell treatments (14,000 lb / in2, 4 ° C)

under). The protein concentration of the obtained lysate was measured using a bicinchoninic acid protein analysis kit (Pierce Biochemicals, Rockford, IL, U.S.A.). Proteins were then separated by SDS-PAGE using a method of haemmYi (Laemmli UK · Nature 1970, 227: 680-685, 20 on an 8% polyacrylamide gel and using Coomassie Blue Gel Code reagent (Coomassie Blue GelCode reagent, Pierce) staining for visual observation. Southern hybridization Chromosomal DNA was digested with restriction endonuclease 26, and glycosyl gel electrophoresis They were separated and transferred to a Zeta-probe GT membrane (Bio-Rad Laboratories, Hercules, CA, USA). A DNA fragment excised from plastid pCH100 was used by the Prime-a-Gene labeling system (Promega, Madison, WI, USA) is labeled as [32P] dCTP (> 3,000 Ci / mmol; Amersham Pharmacia Biotech, Piscataway, NJ, USA) and then used as a probe. The diaphragm is at 60 ° C The hybridization lasted 16 hours, was exposed to X-ray film at -70 ° C for 2 days, and was developed with Kodak developer and fixative as recommended by the manufacturer. As a result, according to the present invention, when raised in Rabbit Blood Agar Fifty clinical isolates of Klebsiella pneumoniae exhibited hemolytic activity, and clear hemolytic zones were selected and enhanced by exposure to air or refrigerated. For the purpose of breeding with Klebsiella pneumoniae Determinants related to the type, the genome bank of a strong hemolytic strain CMC-1 was constructed in E. coli (5 · co / z ·) JA221. The transformed E. coli cells were screened on blood agar culture isolates Hemolytic pure strains were selected. The average insert size was 6 kb 'and about 1 in 1000 colonies showed weak hemolysis. This frequency implies that the gene exists in a single copy In the genome of Klebsiella pneumoniae, three hemolytic colonies were obtained, and the resulting plastids pKHl, pKH2, and pKH3 were clearly duplicated according to the restriction endonuclease map. The plastid pKHl was selected For further analysis, the results of sub-remote colonization showed that a 0 g_kb dccI-5 fine HI DNA fragment was able to administer hemolytic activity on 200411067 E. coli co / z ·) JA221. When this fragment was re-implanted into pUC18 and pUC19 (respectively pCHlOO and pCHlOl), the two plastids encoded active hemolysin in E. coli (v · α / ί) JA221, suggesting that the promoter together with The gene is implanted and is functional in E. coli.

Khe gene nucleotide sequence

The Zze nucleotide sequence and its flanking regions have been confirmed on both strands (see Figure 1). This sequence shows an open reading framework (ORF) consisting of 486 bps and encoding a polypeptide of 162 amino acids, and has a 6 bp upstream of the predicted start codon ATG of 10 The possible ribosome binding site GGAG comes first (iSYormo ei a /.,

/ 952, / 0 · _ 2977-299 (5). One possibility is that the palindrome of a stop codon is located 24 bp downstream of the transcription stop codon. We have not yet tried to find a promoter region upstream of the predicted transcription start 15 site. The relevant coding region has a G + C content of 60.4% and a higher G + C content at the third position of the codon (71.5%). The predicted molecular masses and pi values were 18,739 and 6.77, respectively. A GenBank search revealed that at the nucleotide or amino acid level, Moxibustion and any of the reported sequences in the computer database do not have significant homology. Nucleotide Sequence Accession Number The nucleotide sequence of the hemolysin gene selected from Klebsiella pneumoniae CMC-1 has been assigned GenBank accession number AF293352. Performance of recombinant khe (rkhe) in E. coli r ^, r -v 28 200411067

To check if it could be observed directly in a polyacrylamide gel, ammonium sulfate-precipitated lysates of E. coli JA221 cells with pCH100, pCH101 or pUC18 were examined by SDS-PAGE. Figure 2 shows that E. coli with pCHlOO or pCHlOl produces a protein of approximately 5 20-kDa, which is not produced by cells with pUC 18. The size of this recombinant protein is slightly larger than expected for the gene product, which may be due to the abnormal movement of the recombinant protein on SDS-PAGE. In E. coli JA221 and the pET expression system, this protein accumulates as an inclusion body. Attempts to obtain higher amounts of soluble protein with hemolytic activity than those obtained from strain JA221 (pCH100) grown in the absence of IPTG have been unsuccessful. Conservation of khe gene among clinical isolates of Klebsiella pneumoniae

Because most clinical isolates of Klebsiella pneumoniae exhibited a hemolytic phenotype when cultured on 15 blood agar cultures containing rabbit red blood cells, the applicant examined the possibility that the gene may be conserved. Genomic DNA from 20 Klebsiella pneumoniae strains obtained from 20 patients was digested by // Mdin and then hybridized with a 0.8-kb DNA fragment containing the entire 486 bp moxibustion gene. The results of Southern dot blot analysis under severe conditions 20 showed that all Klebsiella pneumoniae isolates contained sequences that could be hybridized to the probe. Three types of Ugly Mdn staining patterns were observed in these strains, while for other Klebsiella species (including Klebsiella acidigenes, Klebsiella phytoplasia, Klebsiella terrestrial With Klebsiella trocellum) chromosomal DNA ba r 29 200411067 No positive signal was observed. In addition, for other bacterial strains (such as _ aeromonas aquatica 叩 / π · / α), Proteus vulgaris),% ^ ® (Pseudomonas aeruginosa), typhoid fever

* Memella (* SWm < 9ne // a typhimurium), Staphylococcus epidermidis 5 (Staphylococcus epidermidis), Staphylococcus aureus, Shigella sonnei, Streptococcus pyogenes To), Vibrio cholerae (mho c / z (9 / e " (7e), Vibrio parahaemolyticus (mr / o, mrh viz / m / icz ^), and E. coli (£. Co // ·)] No hybridization was observed on chromosomal DNA 10. DNA from 10 Klebsiella pneumoniae strains and DNA from other Klebsiella species were probed for the moxibustion heart gene. The results of the Southern Dot Analysis are shown in Figure 3. Example 2: PCR analysis for the determination of Klebsiella pneumoniae 15 A PCR analysis was developed for evaluating the gene as a

The identification of R. pneumoniae is one of the target uses. Specific primers derived from the Me gene encoding Klebsiella pneumoniae hemolysin were designed to supply a 222 bp fragment located in the secondary gene and specific to Klebsiella pneumoniae. 20 Materials and Methods A total of 282 strains, that is, 12 control strains and 270 clinical isolates including 23 different species were used in this study (see Table 1). Strains were obtained from: Department of Clinical Pathology, Chimei Basic Medical Center; Department of Microbiology, National Cheng Kung University Hospital, Tainan, Tainan; Dr. Po-Ren Hsueh, National Taiwan University Medical 30 200411067 Hospital, Taipei; and Institute of Culture and Development , Hsinchu, Taiwan, Republic of China. Bacteria were cultured in TSB (Tryptic Soy Broth) or LB (Luria-Bertani Broth) at 37 ° C overnight. The genomic DNA was extracted from the culture of each strain using the boiling method (Lw, JJ, α /., C7z> 2. 5 2000, 3S ... 207 (5-2050). Table 1: For grams The number of species-specific strains of P3-P4 primers designed for the identification of P. pneumoniae showed that the number of strains with moxibustion "amplifier aeromonas cav / cze) 1 0 Aeromonas hydrophila (children Knowing how to do 10 0 Mild Aeromonas (sofcr / fl) 3 0 Enterobacter agglomerans (5 "/ erofeac to r agg / oweraws) 6 0 Enterobacter cloacae (5 · c / oacfle) 20 0 E. coli ATCC 25922 and 20 clinical isolates 21 0 Klebsiella acidigenes ([ATCC 13 1 82 and 20 clinical isolates) 21 0 Klebsiella plant (S.ATCC 3353 1) 1 0 Klebsiella Klebsiella pneumoniae (Nissl / 1 ATCC 33495 and 90 clinical isolates) 91 91 Klebsiella terrestrial ([krr / gwa ATCC 33257) 1 0 (K. trevisanii ATCC 33558) 1 0 Proteus mirabilis 10 0 Common Proteus vw / gaWy 10 0 Pseudomonas aeruginosa ATCC 27853 and 9 clinical isolates) 10 0 Salmonella enteritidis group B) 5 0 Salmonella enteritidis S. Enteritidis (Group 51. C) 3 0 S. Enteritidis (Group S) e 0 S. Enteritidis (Group 5. ewierzWh E) 2 0 Serratia marcescens 10 0 Staphylococcus aureus (57a / 7 / ^ / oc0ccw * y awrews ATCC 25923, 29213, 27664, CCRC 12989 and 10 bed isolates) 14 0 Staphylococcus epidermidis 1 0 Streptococcus pneumonia 12 0 Streptococcus pyogenes (¾. ATCC 14289 and 10 clinical Isolates) 11 0 Vibrio cholerae cAo / erae) 1 0 Vibrio parahaemolyticus K 7 0 Vibrio vulnificus vw / ^ nyVcw ·?) 5 0

31 200411067 Table 2. The size of the PCR product of the selected nucleophila primer sequence (5'-3 ') of the selected gene for PCR (bp) PI P2 P3 P4 U1 U2 aacgacctgattgcattcgccactg ggtcagtccagtcgagcatcg ggtcagtccagtcgagcatcg gataaaccacagccggctaggctagcggctagcggcta taccttgttacgacttc Hemolysin 16S rRNA 663 222 996

As shown in Table 2, two primer pairs, meaning the primer pi-p2 (5'-aacgacctgattgcattcgccactg-3 '[sequence identification number: 3] and 5'-ggtcagtccagtcgagcatcg-3' [sequence identification number: 4], and the primer 5 P3-P4 (5'-aataacaccgagcaggaggttcgtctg-3, [sequence identification number: 5] and 5'-gataaaccacaggcgcatagtgcg-3, [sequence identification number: 6],

It is designed based on the sequence from Klebsiella pneumoniae (khe gene of CMC-1 (GenBank accession no. AF293352). One has a broad 10 specificity for the conserved 16S rRNA sequence present in bacteria Additional primer pairs, U1-U2 (5'-ccagcagccgcggtaatacg-3 '[sequence identification number: 7] and 5, -atcgg (c / t) taccttgttacgacttc-3' [sequence identification number: 8]) were used As an amplification control (Zw, JJ et al., Clin. Microbiol. 2000, 38: 2076-2⑽0). For PCR amplification, prepare a reaction mixture containing 15: 10 μ 之 of bacterial lysate; PCR Buffer solution (10 mM Tris-HCl, pH 8 · 8, 1.5 mM MgCl2, 50 mM KC1, and 0.1% Triton X-100 at 25 ° C);-each PCR primer with a concentration of 1 μM; a concentration of 0.1 mM of each deoxynucleoside triphosphate (PROtech Technologies, Inc., Taipei, Taiwan) and 2 units of 20 DyNAzyme TMII DNA polymerase (FINNZYMES OY, Espoo, 32 200411067

(Finland), this was formulated in a total volume of 50 μΐ. After an initial denaturation reaction at -5 minutes at 96 ° C, the reaction mixture was subjected to 25 thermal cycles one (the denaturation reaction was performed at 96 ° C for 30 seconds, and the annealing was performed at 60 ° C for 30 seconds, And extended reaction at 72 ° C for 1 minute), and then 72-

Incubate at 5 ° C for 7 minutes. 5 μΐ PCR product using 0.5X

Tris_borate-EDTA electrophoresis buffer (TBE; 45 mM Tris-borate, 1 mM EDTA) was run on a 2% agar gel, and a 100-bp DNA ladder label (pRoTech Technology) was included in Marked as a molecular size. One consisting of all PCR components but no template] 0] ^ 8 reagent control groups are included in each PCR operation. All experiments were repeated. result

In the initial PCR analysis using primer pairs P1-P2, a major band of 663_bp amplification product was observed in all Klebsiella pneumoniae, and several non-specific amplification products appeared in other species. Klebsiella 15 (data not shown). However, the specificity for Klebsiella pneumoniae in the pCR knife analysis using primer pairs p3_p4 was shown in the amplification products of all 282 strains (see Table U. From Klebsiella pneumoniae, other Cray The PCR amplification products of the genus Bordetella species and non-Klebsiella isolates are clearly shown in Fig. 4. Among the tested strains, 20 of all the tested strains produced seven broadly specific primers. 2 and 996-bp amplicons generated (see panel A, Figure 4), but only Klebsiella pneumoniae strains produced an additional PCR amplicon generated via a wide range of specific primers p3_p4 (see p. (Figure 4, area B). To further confirm the PCR identification, a saline suspension with a 10-fold dilution of Klebsiella pneumoniae 33 200411067 CMC-1 was prepared and used as a template for PCR amplification. These cells The diluted solution was also plated on 5% blood agar to compare colony-forming ability plus PCR sensitivity. The results showed that 30 CFU of bacterial cells were used in each reaction tube. 5 P3-P4 primer set can be used Specific amplification of a 222-bp fragment of the gene khe.

When performing a two-step nested PCR [where the first PCR (25 cycles) uses the primer pair P1-P2 to generate a 663-bp product, and a second PCR (25 cycles to The first product of 2 μΐ was used as a 10 template). Using a primer pair P3-P4 to generate a 222-bp product], a sensitivity of more than 10 times was observed, which was as low as in each reaction test tube. A strong signal of 222 bp was observed under only 3 CFU of bacterial cells (data not shown).

To confirm the potential usefulness of this PCR-based assay as a test test, clinical blood samples were evaluated by culture and PCR. A BACTEC blood culture bottle (Becton Dickinson Microbiology Systems, Cockeysville, Md.) Inoculated with 3-10 liters of blood from a patient from Chi Mei Foundation Medical Center was inserted into the BACTEC NR9240 instrument (Becton Dickinson Microbiology Systems) at 37 Incubated at ° C. Samples from 20 self-positive blood cultures were examined by Gram staining and cultured separately in a clay gum containing 5% sheep blood and EMB (Eosin-Methylene Blue). m, and then use Commercial Scanner, J System MicroScan WalkAwayTM-96 (Dade Behring, Frankfurt, Germany) to analyze and confirm the results of the PCR analysis 34 200411067

fruit. For PCR amplification, DNAs were extracted from 12 positive blood cultures characterized as Gram-negative and 4 negative blood using GenomicPrep cell and tissue DNA isolation kit (Amersham Pharmacia Biotech, Asia Pacific Ltd., Taiwan). 5 ml of the whole portion of the culture. Conditions for PCR amplification are performed as described above. These experiments were performed in a blind test in which participants did not know whether they were conducting an experimental or control trial. 12 positive blood cultures [contains 4 strains of E. coli, one strain of Enterobacter cloacae (five c / oacae), 2 strains of Klebsiella acidigenes (Neisseria strains, 4 strains of Klebsiella pneumoniae, 10 strains of Klebsiella pneumoniae) And an iSerraik marcacew strain] were isolated and identified using conventional methods. PCR products from blood cultures of these positive and negative strains are in line with results obtained from other traditional tests Consistent. As shown in Figure 5, positive PCR results of a moxibustion gene with a 222-bp fragment were confirmed to be from four blood culture samples consisting of Klebsiella pneumonia 15 and negative results were Confirmed to be from 8 other blood cultures from Klebsiella acidophilus (E. oxyioca) and other non-Klebsiella pathogens. This analysis confirms the amplification of this 222-bp Me fragment for blood samples as well as The identification of Klebsiella pneumoniae in routine clinical microbiology laboratories20 is sensitive and specific. Although the present invention has been described in terms of what is considered to be the most applicable and preferred embodiment, it will be appreciated that To be The present invention is not limited by the embodiments disclosed embodiments, but is intended to be included within the spirit and encompass a variety of different configurations within the scope of the broadest interpretation, serve to encompass all such modifications and equivalent arrangements.

35 200411067 Brief Description of Schema 3 Figure 1 shows the nucleotide sequence and the deduced amino acid sequence of the heart gene of Klebsiella pneumoniae moxibustion. The nucleotides are numbered with the first letter of the initiator Met codon as +1, and the amino acid 5 residues are numbered with the initiator Met as +1. A Shine-Dalgarno sequence with an inference about a ribosome binding site is underlined. The termination code is represented by an asterisk, and a palindromic sequence is represented by a convergent arrows;

Figure 2 shows sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of recombinant protein expression in an overnight culture of 10 E. coli transformed by parental and recombinant plastids. PAGE) analysis, where line 1 is the low molecular weight protein standard (Amersham Pharmacia Biotech); line 2 is pUC18; line 3 is pUC19; line 4 is pCHl100; and line 5 is pCHlOl. The location of the gene product is indicated by an arrow. The number on the left side of line 15 of 15 represents the size standard expressed in kilodaltons (kDa);

Figure 3 shows different isolates from Klebsiella pneumoniae and other Klebsiella genus (especially Southern blots). Genomic DNA 20 of these bacterial strains was removed Digested and probed with a 0.8-kb DNA fragment containing the Me gene. Lines 1 to 10: CMC-1 isolate from Klebsiella pneumoniae (line 1), isolate 86008 (line 2) ), Isolate 86016 (line 3), isolate 86028 (line 4), isolate 86〇37 (line 5), isolate 86053 (line 6), isolate 86060 (line 7). 36 200411067 Line), isolate 87012 (line 8), isolate 87021 (line 9), and isolate 87024 (line 10); line 11: Klebsiella acid producing (Similarly less ⑺); line 12 Line: Klebsiella phytoales ([house / ⑽ 〇 / α); Line 13: Klebsiella terrestrial ([erWg⑼α); Line 14: Klebsiella oryzoic acid以及; and line 15: [ireWwm ·. The number on the left of line 1 represents the i / Mc / II-digested lambda DNA size standard expressed in base pairs;

Figure 4 shows DNAs extracted from Klebsiella pneumoniae and non-Klebsiella bacteria, using the 16S rRNA gene universal primer (Column A) and the P3-P4 primer pair of the present invention 10 (Column B) PCR analysis, line M: 100-bp ladder molecular size marker; line 1-4: Klebsiella pneumoniae ATCC 33495 and 3 clinical isolates; lines 5-8: Klebsiella acidigenes (Fire. 绐 (α) ATCC 13182 and 3 clinical isolates; line 9: Klebsiella phytoplasma ([;? / ⑽ί / Μ / α) ATCC 3353 1; line 10: Klebsiella native ATCC 33257; line 11: You · irev / sam ATCC 33558; line 12: E. coli ATCC 25922; line 13: Pseudomonas pyogenes

ATCC 14289; line 14: clinical isolates of Enterobacter cloacae (c / oacae); and line 15: clinical isolates of Serratia marcescens (like iSerraikmarcace); and Figure 5 shows cultures from blood extracted from a patient PCR products amplified by the dNAs of the target. Specific pcR analysis for Klebsiella pneumoniae detected the presence of this bacterium in 4 samples (lines 1-4). The remaining 8 already have acid-producing Klebsiella (especially > ^^^) (lines 5-6) and non-Klebsiella pathogens [ie, E. coli (Sections 7-10 Line), Enterobacter cloacae (line 丨 丨), and Serratia marida 200411067 (line 12)] and samples from which no bacterial pathogens were isolated (lines 13-16) ) Will not react with this P3-P4 primer pair. Column "M": 100-bp ladder molecular size marker. 5 [Representative symbol table for main components of the diagram] (none)

38 200411067 SEQUENCE LIST < 110〉 Chung (Yin-Ching) Chang, Ming-Chung < 120> Isolated gene encoding a unique hemolysin of Klebsiella pneumoniae ⑽㈤ And its application in detecting infections caused by Klebsiella pneumoniae isolates < 130 > NP-17021 < 160> 8 < 170> Microsoft Word 2000

< 303 > ChuangJ.C., et al. (2002), Microb. Pathog. 33 (1), 1-6 < 210〉 1 < 211 > 809 < 212 > DNA < 213> Kreb Pneumoniae < 223 > gene encoding Klebsiella pneumoniae hemolysin < 400> 1

gatcgctaaa accgtcctgc ccgatttaat cgcaacacgc atgaccctgg gtatgctata 60 tctgaagtgt ctcattttcg ggagaaaacg atg aaa cga cct gat tgc att cgc 114

Met Lys Arg Pro Asp Cys lie Arg 1 5 cac tgg cgc gaa ctg gaa ggg ccc gac gat gcc act tat ccc gac age 162

His Trp Arg Glu Leu Glu Gly Pro Asp Asp Ala Thr Tyr Pro Asp Ser 10 15 20 ccg gag cgt ttt teg att ggc geg ccg ctg ggg cgc ggt tta cgt etc 210

Pro Glu Arg Phe Ser lie Gly Ala Pro Leu Gly Arg Gly Leu Arg Leu 39 200411067 25 30 35 40 aac egg ttg ggg ate cac cac gag ega ctg ccg ccc ggg egg ege acc 258

Asn Arg Leu Gly lie His His Glu Arg Leu Pro Pro Gly Arg Arg Thr 45 50 55 teg tac ccg cac geg gag age gat gag gaa gag ttc ate tac gtg ctg 306

Ser Tyr Pro His Ala Glu Ser Asp Glu Glu Glu Phe lie Tyr Val Leu 60 65 70 gag ggc tat ccg gaa gtg tgg ata aag ggc tat etc tgg aag ctg gag 354

Glu Gly Tyr Pro Glu Val Trp He Asn Gly Tyr Leu Trp Lys Leu Glu 75 80 85 ccg ggg gac age gtg ggt ttt ccc geg ggt acc ggt ate tgc cac act 402

Pro Gly Asp Ser Val Gly Phe Pro Ala Gly Thr Gly lie Cys his Thr 90 95 100 ttt etc aat aac acc gag cag gag gtt cgt ctg ctg gtg gtg ggc gag 450

Phe Leu Asn Asn Thr Glu Gin Glu Val Arg Leu Leu Val Val Gly Glu 105 110 115 120

gee aac aag aaa tac aac ege ate tat tat ccg etc aat cca ggc tat 498

Ala Asn Lys Lys Tyr Asn Arg lie Tyr Tyr Pro Leu Asn Pro Gly Tyr 125 130 135 gee geg aeg ege cag gat cgt tgg gtt gac cat ccg ccg caa ttc ttc 546

Ala Ala Thr Arg Gin Asp Arg Trp Val Asp His Pro Pro Gin Phe Phe 140 145 150 ggt cca cac gac ggc aag aag egg aaa aag taatctaccc ggggaagggg 596

Gly Pro his Asp Gly Lys Pro Arg Lys Lys 40 200411067 155 60 cgaagcgcgg cgcactatgc gcctgtggtt tatctttgtg ctatagtagc gccccttttt 656 acccggatgc ttatttattc ggccattgat gcctgaatca acgtcacctg ttttccctgc 716 tcaccgcttc tccatcgcgc cgatgctcga ctggactgac cgacactccg gctacttcct 776 gcggctcgtg tcgcgcgata cgctgctgtatac 809

< 210 > 2 < 211> 162 < 212> amino acid < 213 > < 220 > < 223> deduced amino acid sequence < 400 > 2

Met Lys Arg Pro Asp Cys lie Arg His Trp Arg Glu Leu Glu Gly Pro 15 10 15

Asp Asp Ala Thr Tyr Pro Asp Ser Pro Glu Arg Phe Ser He Gly Ala 20 25 30

Pro Leu Gly Arg Gly Leu Arg Leu Asn Arg Leu Gly He His His Glu 35 40 45

Arg Leu Pro Pro Gly Arg Arg Thr Ser Tyr Pro His Ala Glu Ser Asp 50 55 60

Glu Glu Glu Phe He Tyr Val Leu Glu Gly Tyr Pro Glu Val Trp He 65 70 75 80

Asn Gly Tyr Leu Trp Lys Leu Glu Pro Gly Asp Ser Val Gly Phe Pro 41 2004 110 67 85 90 95

Ala Gly Thr Gly lie Cys his Thr Phe Leu Asn Asn Thr Glu Gin Glu 100 105 110

Val Arg Leu Leu Val Val Gly Glu Ala Asn Lys Lys Tyr Asn Arg lie 115 120 125

Tyr Tyr Pro Leu Asn Pro Gly Tyr Ala Ala Thr Arg Gin Asp Arg Trp 130 135 140

Val Asp His Pro Pro Gin Phe Phe Gly Pro his Asp Gly Lys Pro Arg 145 150 155 160

Lys Lys < 210 > 3 < 211 > 25 < 212 > DNA < 213 > artificial sequence < 220 > < 223 > amplification primers for khe < 400 > 3 aacgacctga ttgcattcgc cactg < 210 > 4 < 211 > 21 < 212 > DNA < 213> artificial sequence 25

42 < 220 > 200411067 < 223 > Amplification primers for 1 ^^ < 400> 4 21 ggtcagtcca gtcgagcatc g

< 210> 5 < 211 > 27 < 212> DNA < 213 > artificial sequence < 220> < 223 > Amplification primer for application < 400> 5 27 aataacaccg agcaggaggt tcgtctg

< 210> 6 < 211 > 24 < 212> DNA < 213 > Artificial Sequence < 220 > < 223> Amplification primers for khe < 400> 6 gataaaccac aggcgcatag tgcg < 210> 7 43 24 200411067 < 211〉 20 < 212〉 DNA < 213 > Artificial Sequence < 220> < 223 > Amplification primers for 16SrRNA < 400〉 7 ccagcagccg cggtaatacg < 210〉 8 < 211> 23 < 212> DNA < 213> Artificial sequence < 220> < 223> Amplification primer (c / t) for 16SrRNA < 400> 8 atcggytacc ttgttacgac ttc 20

23 44

Claims (1)

200411067 The scope of patent application: 1. An isolated polynucleotide is basically composed of the following: (i) a nucleotide sequence with a sequence identification number: 1; (ii) a nucleotide sequence , Which is the sequence identification number: one of the complement 5; or (iii) a nucleotide sequence that will hybridize to the nucleotide sequence of ⑴ or (ii) under high stringency conditions. 2. —Peptide with hemolytic activity, which basically consists of an amino acid sequence of sequence identification number: 2. 10 3. The polypeptide according to item 2 of the scope of patent application, which is encoded by the polynucleic acid according to item 1 of the scope of patent application. 4. A method for detecting the presence of Klebsiella pneumoniae in an individual suspected of having an infection caused by Klebsiella pneumoniae (brother), comprising the following steps: 15 (a) from The individual obtains a biological sample; and (b) detects the expression of the sand gene in the sample, and the detected expression of the gene is characteristic of the presence of Klebsiella pneumoniae. 5. If applied The method of item 4 of the patent, wherein the gene for moxibustion basically consists of the following: 20 (i) a nucleotide sequence of sequence identification number: 1; (ii) a nucleotide sequence of The sequence identification number is: one of the complements; or (iii) a nucleotide sequence that will hybridize to the nucleotide sequence of hydrazone or (ii) under high stringency conditions. /-45 6 · The method according to item 4 of the scope of patent application, wherein the biological sample is selected from the group consisting of: · blood, feces and urine. 7. The method according to item 4 of the patent application, wherein the biological sample is blood. 5 8_ The method according to item 4 of the patent application scope, wherein the measurement of the shirt gene is performed by detecting the presence of the mRNA transcript of the anxiety-free gene in the biological sample. 9. The method according to item 8 of the patent application, wherein the presence of the mRNA transcript of the moxibustion gene is detected by using at least one of the following methodologies: 10 Hybrid rice: heterozygous, circulating probe reaction , Polymerase chain reaction (PCR), nested pCR, reverse transcriptase polymerase chain reaction (RT_PCR), multiple PCR polymerisation chain reaction-single-stranded polymorphism, ligase chain reaction (LCR), to limit fragment length Polymorphic nucleic acid sequence-based amplification reactions (NASBA) and transcription-regulated amplification reactions (TMA). 15 1〇 The method according to item 4 of the scope of patent application, wherein the measurement of the debt of the Me gene is performed by using RT-PCR. 1. The method according to item 4 of the patent application scope, wherein the detection of the presence of the Me gene is performed by the following steps: (a) extracting total genomic DNA from the biological sample; 20 (b) order from The genomic DNA extracted in step (a) is subjected to a polymerase chain reaction (PCR) process using at least one primer pair having a forward primer and a reverse primer. Each primer has a nucleotide sequence that will hybridize to Having a nucleotide sequence corresponding to the sequence identification number: 1 of at least 13 consecutive nucleotides of the slave e gene; and 46 (e) detecting whether there is a nucleotide sequence that is the same as or complementary to the & A PCR product of a part of the nucleotide sequence of the heart gene has been generated from the PCR process of step (b), and the presence of the PCR product is characteristic of the presence of Klebsiella pneumoniae. 5 12 · The method according to item 11 of the patent application scope, wherein it is used in step (b) The at least one primer pair includes: a first primer having a nucleotide sequence selected from the sequence described in sequence identification number: 3 and sequence identification number: 5; and a second primer having a nucleus The nucleotide sequence was selected from the sequence described in Sequence ID: 4 and SEQ ID: 6. 10 13. The method according to item 11 of the scope of patent application, wherein the at least one primer pair used in step (b) comprises: a first primer having a nucleotide sequence corresponding to a sequence identification number: 3, And a second primer having a nucleotide sequence corresponding to the sequence identification number: 4. 14. The method of claim 11 in the scope of patent application, wherein 15 of the at least one primer pair is used in step (b), which includes: one having a sequence identification number: 5 The first primer of the nucleotide sequence of the cDNA and a second primer having a nucleotide sequence corresponding to the sequence identification number: 6. 15. A DNA sequence having a nucleotide sequence selected from the sequence described in sequence identification number: 3 to sequence identification number: 6. 20 16 · —A primer set for detecting the presence of Klebsiella pneumoniae in an individual suspected of having an infection caused by Klebsiella pneumoniae, comprising: a first primer, which Has a nucleotide sequence selected from the sequence described in sequence identification number: 3 and sequence identification number: 5; and a second primer having a nucleotide sequence selected from sequence identification number: 4 and Sequence 47 200411067 The sequence described in Identification Number: 6. 17. The primer set according to item 16 of the scope of patent application, wherein the first primer has a nucleotide sequence as described in SEQ ID NO: 3. 18. The primer set according to item 16 of the scope of patent application, wherein the first primer has a nucleotide sequence as described in 5 sequence identification number: 5. 19. The primer set according to item 16 of the scope of patent application, wherein the second primer has a nucleotide sequence as described in SEQ ID NO: 4. 20. The primer set according to item 16 of the scope of patent application, wherein the second primer has a nucleotide sequence as described in SEQ ID NO: 6. 10 21. —Test kit for detecting the presence of Klebsiella pneumoniae in an individual suspected of having an infection caused by Klebsiella pneumoniae, comprising a first primer With a primer pair of a second primer, each primer has a nucleotide sequence that is hybridized to at least 13 consecutive nucleotides of the Me gene with a nucleotide sequence corresponding to the sequence identification number: 1. 15 22. The inspection kit of the scope of application for patent No. 21, which includes a Primer pair: a first primer having a nucleotide sequence selected from the sequence described in sequence identification number: 3 and sequence identification number: 5; and a second primer having a nucleotide sequence The sequence is selected from the sequence identification number: 4 and the sequence identification number: 6. 20 23. The inspection kit of claim 21, comprising a primer pair consisting of: a first primer having a nucleotide sequence corresponding to a sequence identification number: 3, and a correspondence having a correspondence The second primer in the nucleotide sequence of sequence identification number: 4. 24. The inspection kit of claim 21, which includes a primer pair consisting of 48 200411067: a first primer having a nucleotide sequence corresponding to the sequence identification number: 5 and a primer having a The second primer of the nucleotide sequence corresponding to the sequence identification number: 6. 49