TWI245799B - New DNA combination making green fluorescence be able to mark living fish heart and its preparing method - Google Patents

Abstract

This invention is related to provide a technology of making fish hearts to be able to specifically radiate fluorescence, which can be used to research hearts related genes and functions in the future and proceed to screen drugs and materials for gene therapy and related methods thereof. This method includes transferring a DNA combination fragment containing the fluorescent protein gene into the fish chromosome, which displays specific fluorescence in fish hearts. Among which, this gene transfer procedure at least comprises steps as follows: first, extracting out the fish chromosome DNA and proceeding to cut by utilizing restriction enzymes; and then jointing with an appropriate adapter to proceed twice polymerase chain reactions to amplify the targeted DNA fragment. After treating the amplified DNA fragment with the sequencing step to make sure that it is the fish cardiac myosin light chain 2, cmlc2 gene and construct a displaying plasmid. The plasmid comprises the upstream regulatory region of the fish cardiac myosin light chain 2, partial structure sequence, cDNA of fluorescent protein and this whole combination sequence with its two end jointed with adeno-associated virus inverted terminal repeats. At last, treat the linearized plasmid with micro-injection and transfer it into the fish zygote to keep on cultivating. Then observe under a fluorescence microscope, which can sieve out the gene-transferred animal breed with hearts capable of specifically radiating fluorescence, and their sub-generations can stably inherit this characteristic.

Description

1245799 Jade, description of the invention (l) Invented jaw area ... The invention relates to a technology that enables the animal and fish heart to specifically fluoresce as a post-mortem study of human heart-related factors and functions, as well as drug screening and Gene therapy materials and related methods. Background of the Invention: The 4'Heart Disease Bureau in Taiwan ranks fourth among the top ten causes of death, and it is mostly the elderly over 65 years old. Heart failure is often the most troublesome symptom for patients with heart disease.

Heart failure is an important cause of death for Taiwan residents. However, there has been no obvious breakthrough in the treatment of severe heart failure in clinical practice. Heart replacement therapy is also often suffering from organ donors. Therefore, gene transfection is used to study new drugs for the heart. The influence or treatment of development has become an emerging and important research method. Gene or nucleic acid fragment, by grabbing or chemical agents, etc.) to force the nucleus or cytoplasm inside, so as to allow the outside to "express gene-specific functions in the individual (gene trans fe r < gene-specific functions, so animal) technology. Mature and beneficial methods to study heart disease, research direction. However, the use of radicals to continue to replicate a segment of cells that are radioactive, energized, particles, or somatic cells continues to replicate in cells. This is called genetically transgenic animals because of the transgenic gene transfer of experimental animals to establish research into medical centers.

Through external forces (such as the fact that it enters gametes, embryos, genes that can be foreign genes in the embryo's i segment), and is treated like this, it is called gene transfection and transgenic with disease-causing genes. ”It has gradually become European and American j Due to the model of transgenic mice

1245799 V. Description of the invention (2) There are some disadvantages to studying myocardial exhaustion: Difficult, it) The number of successful transgenic mice is small, and the embryos are more difficult to observe. It is difficult to observe the heart at different times. Developmental epidemic? & potential if, to sacrifice the specimen. This is not good for the study of gene dynamics and subsequent gene therapy research. (3) The development and care of transgenic mice requires a professional team to co-operate, and the breeding space is large. It requires more manpower, and the required funding is also high. Difficulty. 9 Fish is the lowest vertebrate and the earliest animal with a heart organ. Zebra fish (Denio rerio) has recently become an emerging experimental animal for heart research. The use of zebrafish to study cardiac diseases has several advantages: (1) the offspring it lays have the characteristics of multiple eggs, large imprints, and transparency (observable organ formation); (2) rapid embryo development ^ (embryo from a single It takes only one day for the cells to develop into complete juveniles.) (3) Ovulation can be controlled with light, so you can use the light to ovulate daily without restrictions on ovulation period; (4) The embryo is transparent and fertilized in vitro. Gene transgenic mice are easier to observe their heart development and lesions; (5) The zebrafish's cardiac contractile function can be observed from the outside, without the need to sacrifice the fish's body, so it is possible to explore the physiological functions close to the living body. Unfortunately, so far no zebrafish has been specifically labeled with fluorescent light in the right heart for research. Purpose and summary of the invention:

Page 7 1245799 V. Description of the invention (3) _ The first object of the present invention is to provide a material that allows fish hearts to have specific fluorescent / tongue markers to facilitate the tracking of the origin, movement, metastasis, and fusion of heart cells and Its related methods. … The second object of the present invention is to provide a material that gives fish hearts specific glory biomarkers to find new heart-specific genes and related methods. A third object of the present invention is to provide a material and a method for making a fish heart with a specific biological marker, which can be used as a biological indicator of environmental pollutants. A fourth object of the present invention is to provide a fluorescent heart-specific biomarker for the fish heart to study the effects of new drugs on the development of the heart or to treat the materials and related methods. The present invention provides a kind of heart-specific fluorescent light for fish, which is used as a material and related method for researching heart-related genes and functions, drug screening and gene therapy. This method involves the transfection of a combination of DNA containing a fluorescent protein gene into a fish chromosome for specific fluorescent expression in a fish heart. In a preferred embodiment, the green fluorescent protein (GFP) gene can be constructed first, and then transfected into the chromosome of the zebrafish. The translocation process includes at least the following steps: first The chromosomal DNA # of the zebrafish was extracted and subjected to a shearing action using a restriction enzyme (restr i ct i on enzyme) at 37 ° C in a water bath. Next, the adaptor (adaptor) Padl and PR-Spel are conjugated to perform secondary polymerization (polymerase chain reaction, PCR) to enlarge

Page 8 1245799 V. Description of the invention (4) '' The target DNA fragment. After this amplified MA was subjected to a sequencing step, it was confirmed that the product was the upstream regulatory sequence and partial structural sequence of the V-terminus of the cardiac myosin light chain gene of zebrafish type II. After the sequence of this human was confirmed, a special expression plastid was constructed next. This plastid contains the zebrafish type II cardiac myosin light chain gene 5, the upstream upstream regulatory sequence, the expression 1 and the expression 1 Partial fragments of insert 1 and expressor 2 are added to the c DNA of jellyfish fluorescent protein and the adeno-associated virus terminal repeats attached to the two ends of the entire combined sequence. Finally, the linearized plastids were transfected into the zebrafish fertilization print by microinjection, and continued to be cultured, and then observed under a fluorescence microscope, and screened to have specific fluorescence in the heart and continue Zebrafish strains stably inheriting this characteristic from generation to generation. / Detailed description of the invention: An object of the present invention is to provide a technology that enables fish hearts to specifically fluorescein to facilitate the tracking of the origin, movement, transfer, and fusion of heart cells to find new heart-specific genes. Biological agents for environmental pollutants, as well as materials and methods for studying the effects of new drugs on cardiac development or treatment. This method includes translocating dn "and :, slices & containing a fluorescent protein gene into fish chromosomes to have a uniform fluorescent expression in the heart of the fish. The transplantation procedure at least includes Step two: first extract the chromosome DM of the fish, use / rejoin the appropriate adaptation +, and then perform a second poly-human chain reaction to enlarge the target DNA fragment. This is sequenced by σ ΜΑ Steps to confirm that it is fish type II cardiac myosin = 1245799 V. Description of the invention (5) Strand gene, then construct a special performance plastid. This plastid contains type II cardiac myosin light chain gene Upstream regulatory sequences, parts, scorpion sequences, cDNAs of fluorescent proteins, and adeno-associated virus terminal repeats constructed at both ends of the entire combined sequence. Finally, the linearized quality Zhao and fine upper pole were injected and transferred It is introduced into the fertilized eggs of fish. The following is a preferred embodiment of DNA combination fragments containing the two dominant green fluorescent protein genes, which are transferred into the zebra preparation ^ mother chromosome. Who, when the wood is not known to limit the spirit of the invention and the invention is solid, but only limited to this embodiment wherein the above-described two ^ ^ colonization of rotation procedure comprises at least the following steps: applying

Extraction of chromosomal DNA and shearing of restriction enzymes Collect juvenile fish that are 48 hours after fertilization, and extract their chromosomal DNA according to the general method. Take 1 / zg of zebrafish chromosome!), At 50 2Spef restriction enzyme buffer (50 mM NaCl, 10 mM Tris-HC1, 10 mM m§C12, 1 mM DTT, the solution was pH 7 · 9 at 25 ° C to limit the enzyme Spel in a 37 ° C water bath Shear effect for 12 hours. The applied DNA samples were purified by ethanol precipitation. Zygote

The zebrafish chromosomes that had been affected by the Spel restriction enzyme were mutated, and the adaptor Padl (sequence: TGCGAGTAAGGATCCTCACGCAAGGA

ATTCCGACCAGACACC) and PR-Spel (sequence: p-CTAGG

Page 10 1245799 V. Description of the invention (6) GTGTCTGGTCGC). First, take 1 // g of the DNA treated with the restriction enzyme SpeI, and 100 pmol of aptamers Padl and PR-Spel, in a 20 # 1 binding enzyme buffer solution (50 mM NaCl, 10 mM Tris-HC1, 10 mM MgC12, 10 mM DTT, 1 mM ATP, 25 BSA, pH value of this solution at 25 ° C is 7 · 9), react in Gene Amp PCR system 2400 at 70 ° C for 20 minutes, then let the sample Slowly cool down to 4 (approximately 3 hours). The cooled sample was added with 6 units of restriction enzyme Avr I I and 3 units of T4 DNA ligase and reacted at 4 ° C for 16 hours. The extra aptamers were then removed using Microcon-100, with a final sample volume of 50 / z1. Take a sample of 1 β 1 for polymerization (酉) chain reaction. Aggregation (及其) chain reaction and its products The target DNA is amplified by two polymerization (酉) chain reactions. The first polymerization (each) chain reaction is to take 20 ng of DNA (ligated aptamer) as a template,

1 pmol of primer P1 (sequence: ACTCCATCCCGGTTCTGATCT), 200 pmol of each dATP, dCTP, dGTP, dTTP, and 1 unit of VioTaq (Polymerase) were polymerized (酉) chain reaction. The reaction conditions in the GeneAmp PCR System 2400 were denaturation at 94 ° C for 1 minute, and then set at 94 ° C for 30 seconds and 68 ° C for 6 minutes.

1245799 V. Description of the invention (7) Set 35 cycles, and finally react at 68 ° C for 8 minutes. The obtained polymerization (酉) chain reaction product is subjected to the second polymerization (酉 mother) chain reaction, the reaction conditions are the same as the first time, except that the DNA template is replaced by the first product of 1/1, 4 pmol primer P1, 4 pmol primer CML2 (sequence: GGAGAAGACATTGGAAGAGCCT), and 1 unit of ExTaq. Subsequently, the result of the chain reaction of polymerization (酉) was analyzed by agarose gel electrophoresis ° Sequencing the product (j) NA of the chain reaction obtained by polymerization (酉) was 1.6 kB. Purified from agarose gel electrophoresis analysis, inserted into pgem-T Easy vector, and performed DNA sequencing steps. After analysis and comparison of this DNA sequence, it was confirmed that the product after the polymerization (酉) chain reaction was the zebrafish type 2 cardiac myosin light chain gene 5, the upstream upstream regulatory sequence, the expressor 1, and the interposer 1 and part of the sequence of the expressor 2. Construction of expression plastids. A pair of primers (primeΓ) cmL4- were designed according to the above 1 · 6 kb pGEM-T Easy_selection sequence (clone) I 5 and the sequence on the inner side of the 3 ends.

Xhol (sequence: AACAACTCGAGTGTGACCAAAGCTTAAATC) and CML2-NcoI (sequence: CTCAACCATGGAGAAGACATTGGAA

Page 12 1245799 V. Description of the invention (8) The chromosomes of zebrafish that have been treated with a restriction enzyme by H t should undergo a β 'into (combination) chain reaction. This aggregated (linked) CML: th-like chromosome MA containing 100 ng zebrafish, CM-X 〇1 ^ CML2-Nc〇I 5, ^^ 20 0 pm〇l ^ dATP. DCTp. DTTP, And one unit of ExTacl. The polymerization reaction conditions of the chain reaction are as follows: denaturation at 9 4 c for 1 minute, then 30 = at g 4 and 30 ° C at 68 ° C for 3 minutes. Mount and finally let it stand at 68 to react for 8 minutes. The polymerized (linked) chain reaction product was treated with 20 units of XhOI and H2O1 in a restriction enzyme reaction buffer.

Solution (50 mM NaCl, 10 mM Tris-HCl, 10 niM 1gC12, 1 mM DTT—, the pH value of this solution at 25 ° C is 7.9), and shearing in a 37 t water bath 2 0 hours. After that, the reaction product was purified from agar gelatin, and then inserted into XTR and ITR, a carrier acting with 〇1 restriction enzymes, to construct pICMLE. Please refer to the first figure. This plastid contains the zebrafish type II cardiac myosin light chain gene 50, and its sequence is shown in the fourth figure. This gene sequence includes the zebrafish type II cardiac myosin light chain 869 base pairs (bp) of the upstream regulatory sequence 52 of the 5 ′ end of gene 50, 40 base pairs of expressor 1 54, 682 test base pairs of interpolator 1 56 and expressor 2 58 69 base pairs. Among them, the first 66 base pairs of the expressor 2 58 of this gene sequence are followed by the cDNA 60 'of the jellyfish fluorescent protein to constitute a combined sequence. Finally, an adeno-associated virus terminal repeat sequence containing 1 45 base pairs was added to both ends of this combination sequence 62. It is worth noting that this jellyfish green fluorescent protein gene can regulate the fluorescence performance of zebrafish type II cardiac myosin light chain gene. 1245799

Zebrafish rearing and breeding with a photoperiod of 14 hours at a ratio of 1: 1 are placed at 60 cm X 2 0 Cm x 3 n mesh: males and females, and then after the light cycle starts and before the end, In a glass-breaking aquarium, select a robust diet-isolated net before the end of the photoperiod, and move another 30 cmx 10 female fish into a cmx 20 cm aquarium. Microinjection and genetic pairing After the start of the photoperiod, the fertilized eggs are aspirated with a siphon and placed into a glass injection needle with a 9-11 caliber. The% oil is sealed. Then the department uses Notl enzyme to linearize the plastid (such as f == no), microinjection into the fertilized egg in one cell stage of the newly fertilized, the volume of the solution injected in the basin is about 2-4nl. '' 〃, Τ The embryo developed from the fertilized egg after microinjection is placed in a petri dish containing a low-concentration, methylene blue aqueous solution, cultured in a 28 ^ 忮 incubator, and fertilized On the third day afterwards (the heart is at the ^ Shishi-Da Jifa's Yueyuanquan), the development of the heart and the appearance of green glory were observed using a fluorescent microscope. … In this example, this plastid was injected into the fertilized egg and continued to be selected. It can be observed that the survival rate after 3 days is 50% ~ 70%, and the embryos that survived here

Page 12 1245799

V. Description of the invention (10) 45% to 50% of the fetuses will have a heart nourishment after 10 days, and about 12 weeks later, 10% to 40% of the progeny of the fluorescent protein gene will be transgenic. The second child produced by the first will grow to mature fish with green specificity. It has a specific fluorescence reachability in the heart and has a jellyfish wild species. 1: Three images with green fluorescence. When the green fluorescent marker in (F2) is obtained, the heart is still recorded. Can specifically emit green fluorescence. 5. The performance individuals were moved to the aquarium to be cooked. The broodstock of the fluorescein gene was paired with a ratio of no. After pairing, and the strongest fluorescent marker was screened, in the first offspring (F1), about 73% ~ 77% of the zebrafish hearts were selfed. When these transgenic tadpoles can be observed under a fluorescent microscope, although the present invention is illustrated above with a preferred example, it is not intended to limit the spirit and the inventive entity of the present invention, but only to this example. . Therefore, all modifications made within the spirit and scope of the present invention should be included in the scope of the following patent applications.

The chart shows the composition of the plastids ::, :: the composition of the plastids. The schematic diagram shows the structure of the invention according to the present invention. The line chart according to the present invention is a genetic pairing diagram. The laboratory does not make the fourth picture of the fish the zebra sound second: fruit according to the technology of the present invention; and, ~ _ cardiac myosin light chain gene partial sequence diagram number oblique table: 50525456586062

Zebrafish Class II Cardiac Myosin Light Upstream Regulatory Sequences Fortunately, Expressor 1 Interpolator 1 Expressor 2 Jellyfish Fluorescent Protein Gene Terminal Repeat Sequence of Adenovirus

Page 16 Strand genes

Claims (1)

A method for specifically expressing fluorescent protein in a fish heart, wherein the preparation is developed from a transparent embryo, and the method includes the following steps: ", inserting a transgenic gene into the genome of the transparent embryo, wherein said transduction The gene contains a gene fragment that can express one of the fluorescent proteins, and the expression of the gene chip is controlled by the second-class cardiac myosin light factor regulatory region derived from the fish. The method according to item 1, wherein the fish is a zebra 3. The method according to item 1 of the patent application scope, wherein the fluorescent protein is fluorescent protein. 4. The method according to item 1 of the patent application scope, forming the The method for transgenic gene includes: extracting the chromosomal DNA of the fish; cutting the chromosomal DNA with a restriction enzyme to form a plurality of DNA fragments; adapting the aptamer to the DNA fragment to form an aptamer conjugation product; advance polymerization (酉Each) a chain reaction to amplify the aptamer mating product; sequencing the DNA fragment; constructing a plastid, wherein the plastid contains the gene fragment; and linear The plastid. Page 17 1245799 VI. Application for patent scope 5. The method described in the scope of patent application, wherein the restriction enzyme is Spe I ° 6 · The method described in the scope of patent application No. 4 'The etiquette adaptor line is selected From Padl, pR-SpeI, or any combination thereof. 7. The method as described in item 6 of the scope of patent application, wherein the sequences of the Padl and the sPeI are tgcgagtaaggatcctcacgcaaggaattcc GACCAGACACC and CTAGGGTGTCTGGTCGC. 8 · A method for specifically expressing green fluorescent protein in the heart of fish, wherein the epidermis is developed from a transparent embryo, the method includes the following steps: · A transgenic gene is inserted into the genome of the transparent embryo, wherein the The transgene contains a gene fragment that expresses one of the green fluorescent proteins, and the expression of the gene is controlled by the regulatory region of the cardiac muscle coagulation gene derived from the fish. ^ The zebra 9 is prepared according to the method described in the “Scope of Patent Application”, wherein the fish is 10. The method based on the scope of patent application includes: The method described in the eighth method, forming the transgenic base to extract the chromosomes of the fish. Following; Page 18 1245799 VI. Application scope of the patent The restriction enzyme is used to cut the chromosome MA to form a plurality of DNA fragments; the aptamer joins the DNA fragment to form an aptamer conjugation product; performs a polymerization (酉) chain reaction to Amplifying the adaptor conjugation product; sequencing the DNA fragment; constructing a plastid, wherein the plastid contains the gene fragment; and linearizing the plastid. 11 · The method according to item 10 of the scope of patent application, wherein the restriction enzyme is spel 〇1 2 · The method according to item 10 of the scope of patent application, wherein the adaptor line is selected from Padl, PR- Spel or any combination thereof. 1 3 · —A method for specifically expressing green fluorescent protein in the zebrafish heart, wherein the zebrafish line develops from a transparent embryo, the method includes the following steps: constructing a plastid, wherein the transgenic gene contains A gene fragment of green fluorescent protein, and the expression of the gene fragment is controlled by the second-class cardiac myosin light chain gene regulatory region derived from the zebrafish; and inserting the plastid into the genome of the transparent embryo . 14. The method according to item 13 of the scope of patent application, the method for forming the transgenic gene comprises: Page 19 1245799 6. Extraction of the chromosomal DNA of the zebrafish using the scope of patent application; using restriction enzymes to cut the chromosomal DNA to form a plurality of DNA fragments; so that the DNA fragments are joined to form an adaptor junction product · Perform a chain reaction of polymerisation (酉) to amplify the aptamer junction to sequence the DNA fragment. 15.-A method for the specific expression of fluorescent protein in the heart of fish, the method includes the following steps: A transgenic gene is inserted into the genome of the fish embryo. The transgenic gene contains a gene fragment that can express one of the fluorescent proteins, and the G base: the expression of the fragment is derived from the second type of cardiac muscle derived from the fish. Agglutinin is regulated by light gene regulatory regions. 16. The method according to item 15 of the patent application, wherein the fish is a spot 17. The method according to item n of the patent application, wherein fluorescent protein is green fluorescent protein. ^ Ma 1 8 · The method described in item 5 of the scope of patent application, the method of forming the transgenic group comprises: extracting the chromosome DNA of the fish; Page 20 ----- 1245799 VI. Application scope of the patent Use restriction enzymes to cut the chromosomal DNA 'to form a plurality of DNA fragments; to adapt the aptamer to join the DNA chip 纟 to form an aptamer conjugation product; to polymerize (酉Each) a chain reaction to amplify the aptamer conjugation product; sequence the MA fragment; ^ construct a plastid, wherein the plastid contains a helium soil film and linearize the plastid. 19. The method according to item 18 of the scope of patent application, wherein the restriction enzyme is Spel. 20 The method according to item 18 of the scope of patent application, is used, wherein the adaptor lines β, τ 丄, ^. Reserve combination 0 from Padl, PR-SPeI or any of them