TWI235157B - Inhibitors of interleukin-1beta converting enzyme - Google Patents

Abstract

The present invention relates to novel classes of compounds which are inhibitors of interleukin-1beta converting enzyme. The ICE inhibitors of this invention are characterized by specific structural and physicochemical features. This invention also relates to pharmaceutical compositions comprising these compounds. The compounds and pharmaceutical compositions of this invention are particularly well suited for inhibiting ICE activity and consequently, may be advantageously used as agents against IL-1-, apoptosis-, IGIF-, and IFN-gamma-mediated diseases, inflammatory diseases, autoimmune diseases, destructive bone disorders, proliferative disorders, infectious diseases, degenerative diseases, and necrotic diseases. This invention also relates to methods for inhibiting ICE activity, for treating interleukin-1-, apoptosis-, IGIF- and IFN-gamma-mediated diseases and decreasing IGIF and IFN-gamma production using the compounds and compositions of this invention. This invention also relates to methods for preparing N-acylamino compounds.

Description

1235157 A7 B7 V. Description of the invention (1) Field of the invention The invention relates to a novel class of compounds, which are inhibitors of melanin-1 converting enzyme ("ICEn). The invention also relates to the pharmaceutical composition containing these compounds The compounds and pharmaceutical compositions of the present invention are particularly suitable for inhibiting ICE activity and can therefore be beneficially used to antagonize interleukin-l- (nIL-r), prognosis of cell death-, interferon r-deficient molecule-riGIF " ) And interferon-r- (nIFN-r ") mediate the effects of diseases, especially inflammatory diseases, autoimmune diseases, destructive bone diseases, proliferative disorders, infectious diseases and degenerative diseases. The present invention is also related to the method of making ICE activity, reducing the production of IGIF and IFN-r production, and using the compounds and compositions of the present invention to treat interleukin-1-, expected cell death-, IGIF- and IFN-r -Methods for mediating diseases. The present invention also relates to a method for preparing an N-fluorenylamino compound. BACKGROUND OF THE INVENTION Printed Interleukin-1 (" IL-1 "), a work-consumption cooperative of the Central Bureau of Standards, Ministry of Economic Affairs, is a major pro-inflammatory and immunomodulatory protein that stimulates fibroblast differentiation and proliferation. Synoviocytes and osteocytes produce prostaglandins, prionases and phospholipases, degranulation of basophilic leukocytes and eosinophils, and activation of neutrophils. Oppenheim, J.H. et al., Immunology Today, 7, pp. 45-56 (1986). As such, it is involved in the pathogenesis of chronic and acute inflammation and autoimmune diseases. For example, in rheumatoid arthritis, IL-1 is a mediator of inflammation symptoms in damaged joints and a mediator of cartilage 'proteoglycan destruction. Wood, DD et al., Arthritis Rheum. 26, 975 (1983); Pettipher, EJ et al., Proc. Natl. AcadSci. UNITED STATES OF AMERICA 71, 295 (1986); Arend, WP and Dayer, JM , -4- The standard of this paper is applicable to the Chinese National Standard (CN'S) A4 specification (2 丨 0 ·; < 297 mm) Γ235157 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs ¾ A7 B7 V. Description of the invention (2)

Arthritis Rheum. 38, 15 1 (1995). IL-1 is also a high fl force bone loss agent. Jandiski, J.J., J. Oral Path 17, 145 (1988); Dewhirst, F.E. et al., J. Immunol. 8, 2562 19-85). It is also called " osteoclast activating factor " in destructive bone diseases, such as osteoarthritis and multiple myeloma. Bataille, R. et al., Int. J. Clin. Lab. Min 21 (4), 283 (1992). In some dysplasias, such as acute myeloid leukemia and multiple myeloma, IL-1 promotes tumor cell growth and adhesion. Bani, M.R., J. Natl. Cancer Inst / 83. 123 Π991): Vidal. Vanaciocha, F., Cancer Res. 54.2 67 (1994). In these disorders, IL-1 can also stimulate other cytokines, such as il-6, which can regulate tumor development. (Tartour et al., Cancer Res. 54, 6243 (1994). IL-1 is mainly produced by peripheral blood mononuclear cells due to a part of the inflammatory response, and exists in two different agonist types. IL · point. Mosely, BS et al ·, Proc · Nat · Acad · Sci · 84, pp. 4572-4576 (1987); Lonnemann, G. et aL, Eur. J · Immunol "19, pp ;. 153 1-1536 (1989). IL- /? Is synthesized as a biologically inactive precursor, pIL-1 / ?. pIL-1 lacks a traditional leader sequence and is not modified by signal peptidases. March, CJ ·, Nature, 315 · dd · 641-647 (1985). Conversely, pIL-1 /? Is a melanin · 1 /? Invertase (" ICE ") between Asp-116 and AU-117 Dissociation, produced in human serum and synovial fluid 'Visible bioactive (-terminal fragment. Sleath, PR ·, et al ·, J. Biol · Chem ·, 265, pp. 14526 · 14528 (1992); AD Howard et al., J. Immunol., 147, pp. 2964-2969 (1991). ICE is a cysteine protease, which is mainly located on the -5- paper scale and is commonly used by the Chinese National Standards Officer (CNS) A4. Grid (210X297 mm) (Please read it first Notes on another page)

ii 1235157 A7 B7 rJ. 'Printed by the Central Government Bureau of the Ministry of Economic Affairs, Shellfish Consumer Cooperative, V. Invention Description (3 Early nucleus cells. It can convert hepta-IL-dots to mature ^ {Formula 0 B1 ack, RA et al., FEBS Lett "247, pp. 386-390 (1989); Kostura, MJ et al., Proc. Natl. Acad, Sci. UNITED ^ STATES OF AMERICA, 86, pp. 5227-523 1 (1989). Modification with ICE is also necessary for the transport of mature IL·Lu through the 甴 cell membrane. 3 ICE, or its homologues, also appears to be involved in the regulation of scheduled sprint death or expected cell death. Yuan, J. et al., Cell, 75, pp. 641-652 (1993); Miura, M. et al., Cell, 75, pp. 653-660 (1993); Nett-Fiordalisi, MA et al., J. Cell Biochem. 17B, p. 117 (1993). In particular, ICE or ICE homologues are considered to be involved in the regulation of expected cell death in neurodegenerative diseases such as Alzheimer's and Parkinson's disease. Marx, J. and M. Baringa, Science, 259 pp. 760-762 (1993); Gagliardini, V. et al., Science, 263, pp. 826-828 (1994). Therapeutic applications of cell death suppression may include treatment Zheimer's disease, Parkinson's disease, stroke, myocardial congestion, spinal atrophy, and aging. ICE has been shown to mediate the expected death of cells in specific tissue types. Steller, H., Science, 267, p. 1445 (1995); Whyte, M. and Evan, G., Nature, 376, p. 17 (1995); Martin, SJ and Green, DR, Cell, 82, p. 349 (1995); Alnemri, ES, et al., J. Biol. Chem., 270, p. 4312 (1995); Yuan, J. Curr. Opin. Cell BioLy, p. 21 1 (1995). Introduction of ICE gene disruption into foreign gene mice, Fas Deficiencies in the expected death of mediated cells (Kuida, K. et al., Science 267, 2000 (1995)). ICE This activity and its use as a pro-lLl Lu processing paper size standards apply to Chinese National Standard (CNS) A4 specifications (2i0 * X297 mm) ((Please read the precautions on the back page first) 1235157 A7 B7 Printed by the Central Government Bureau of the Ministry of Economic Affairs and the Industrial and Commercial Cooperatives Co., Ltd. Ⅴ. Description of Invention (4) The role of enzymes is quite different. It is perceptible that in certain organizational types: [CE's inhibitory effect may not affect maturity IL- > 5 secretion, but it may also inhibit the expected cell death. 'The enzyme-active ICE has been previously described as a heterodimer (20kDa and 10kDa molecular weight) composed of two subunits p20 and plO. These subunits are derived from the 45kDa zymogen (p45) via the p30 form, and via an autocatalytic activation mechanism e Thornberry, ΝΑΑ et al., Nature, 356, pp. 768-774 (1992) .ICE The zymogen has been divided into many functional regions: a predomain (pl4), a p22 / 20 subunit, a polypeptide linker, and a plO subunit. Thornberry et al., Supra, Casano et al, Genomics, 20, ρρ · 474-481 (1994) 〇The full length of p45 has been Its cDNA and amino acid sequences are characterized. PCT cases WO 9 1/1 5577 and WO 94/00154. P20 and p 10 cDNA and amino acid sequences are also known. Thornberry et al "supra. Murine ICE has also been sequenced and cloned. It has amino acids and nucleic acid sequences that are highly homologous to human ICE. Miller, DK · et al ·, Ann · N · Υ. Acad · Sci ·, 696, pp. 133- 148 (1993); Molineaux, SM et al., Proc. Nat · Acad. Sci "90, pp. 1809-1813 (1993). The three-dimensional space structure of ICE can be resolved by atomic X-ray crystallography in atom Next decision. Wilson, K.P., et al., Nature, 370, pp. 270-275 (1994). The active enzyme presents a tetrameric form of two p20 and two plO subunits. In addition, here There is also a human homologue with ICE, whose sequence is similar to the active site region of the enzyme. This homologue includes TX (or ICemMI or ICH · 2) (Faucheu, et al., EMBO J ·, 14, p. 1914 (1995 ); Kamens J., The iron scale of this paper is applicable to China National Standards (CNS) A4 specification (210X297 mm) I --------- • Installation-(Please read the back: vi intended matter one) (Buy) Order 1235157 Α7 Β7 V. Description of the invention (5) et al., J. Biol. Chem., 270, p. 15250 (1995); Nicholson et al., J. Biol. Chem., 270 15870 (1995)), TY (or ICErel .in) (Nicholson et al., J. Biol · Chem ·, 270, p. 15870 (1995); ICH · 1 (or Nedd-2) (Wang, L. et al ·, Cell, 78, p. 739 (1994)), MCH-2, (Fernades-Alnemri, T. et al., Cancer Res., 55, p. 2737 (1995), CPP32 (or YAMA'apopain) (Fernandes-Alnemri, T. et al. , J. Biol. Chem., 269, p. 30761 (1994); Nicholson, DW et al., Nature, 376, p. 37 (1995)), and CMH-1 (or MCH-3) (Lippke, et. al., J. Biol. Chem., (1996); Fernandes-Alnemri, T. et al., Cancer Res., (1995)). Each of these ICE homologs, as well as the ICE itself, can induce expected cell death when the transfected cell line is overexpressed. Inhibition of more than one of these homologs by the peptide ICE inhibitor Tyr-VaNAla-Asp-pneumomethyl ketone can result in the inhibition of expected cell death in primary cells or cell lines. Lazebnik et aL, Nature, 37 1, p. 346 (1994). The compounds described herein can also inhibit ICE—more than one homologue (see Example 5). Therefore, these compounds can inhibit the expected death of cells in tissue types containing ICE homologues in the past, but they do not contain active ICE or can produce mature IL-Lu. Printed by the Central Bureau of Standards, Ministry of Economic Affairs, Industrial and Consumer Cooperatives (please read the “Precautions on the back page”) r-interferon-inducing factor (IGIF) is an approximately 18-kDa peptide that stimulates r-interferon production. -Cells (r-IFN) MGIF can be produced in vivo by living Kupffer cells and macrophages, and can come out of this cell when stimulated by endotoxin. Therefore, compounds that can reduce the production of IGIF can be used as inhibitors of this T-cell stimulating effect, which in turn can reduce the levels of these cells producing 7. · IPN. Each paper scale applies Chinese National Standard (CNS) A4 specification (21 × 297 mm) 1235157 Printed by W3C Industrial and Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs ¾ A7 ____ B7 _ ^ _ 5. Description of the invention (6) r-IFN is a cellular activity It can be used for immune regulation on various immune cells. In particular, IFN-r is involved in the activation of macrophages and the selection of Thl cells (F. Belardelli, APMIS, 03, P. 161 (1995)). r-IFN exhibits its effects in part by regulating genes through STAT and IRF pathways (C. Schindler and JE Darnell, Ann. Rev. Biochem., 64, p. 621 (1995); T. Taniguchi, J. Cancer Res. Clin. Oncol .. Π1, p. 516 (1995)). '' Mice lacking IFN-r or its polite mice have many deficiencies in immune cell function and are resistant to endotoxicity (S · Huang et al ·, Science · 259, p. 1742 (1993); D. Dalton et al., Science, 259, p. 1739 (1993); BD Car et al., J. Exp. Med., 179, p. 1437 (1994)). With IL-12, IGIF appears to be a potent inducer of r-IFN production by Ding cells (H. Okamura et al., Infection and Immunity, 63, p. 3966 (1995); H, Okamura et al., Nature, 378, p. 88 (1995); S. Ushio et al., J. Immunol "156, p. 4274 (1996)). IFN-r has been shown to be associated with various inflammatory, infectious, and autoimmune aphasia. And disease-related pathological reasons. Therefore, compounds that reduce the production of IFN-r will be used to ease the effects of IFN-r-related pathologies. The biological regulatory effects of IGIF and therefore r-IFN have not been elucidated. IGIF was previously known The body protein pattern is synthesized and is called "pre-IGIF". However, it is unclear how pre-IGIF is dissociated and whether its modification is biologically important. Therefore, the composition and method that can regulate the conversion of pre-IGIF to IGIF can be used in vivo to reduce the production of IGIF and IFN · r, and therefore can alleviate these causes (please first: ^ read the precautions on the back page)- Bookbinding Brigade

The silver scale of this paper applies the Chinese National Standard (CNS) M specification (210X297 mm) 1235157 Α7 Β7 Printed by the Consumer Cooperatives of the Central Bureau of the Ministry of Economic Affairs. 5. Description of the invention (7) The harmful effects of proteins on human disorders and disease causes . However, the ICE and other members of the ICE / CED-3 family have not previously been known to be involved in the conversion of pre-IGIF to IGIF or to in vivo IFN-r production. ICE inhibitors represent a class of compounds useful for controlling inflammation or cell death, or both. ICE peptides and peptide inhibitors have been described. PCT case WO 91/15577; WO 93/05071: WO 93/09135: WO 93/14777 and WO 93/16710; and European patent case 0 547 6.99. This peptide inhibitor of ICE has been observed to block the production of IL-1 y? In the inflammation mode of mice (see below) and to inhibit the growth of test tubes and leukemia cells (Estrov et al., Blood 84, 3 80a (1994)). However, due to its peptidic nature, the typical characteristics of this inhibitor are non-desired pharmacological properties, such as poor cell penetration and cell activity, poor oral absorption, poor stability, and rapid metabolism. Plattner, J.J. and D.W. Norbeck, in Drug Discovery Technologies, C.R. Clark and W.H. Moos, Eds. (Ellis Horwood, Chichester, England, 1990), pp. 92-126. This has hindered its development into an effective drug β. There are also reports that non-peptidic compounds can inhibit ICE in vitro. PC Ding WO 95/26958: US Patent 5,552,400; Dolle et al., J. Med. Chem., 39, pp. 2438-2440 (1996); however it is unclear whether these compounds have suitable pharmacological profiles for treatment application. In addition, current methods of preparing this compound are not beneficial. Tributyltin argon is used in these methods, a test that is toxic and sensitive to moisture. Therefore, these methods are not suitable for implementation, there are health risks and there will be problems of toxic waste disposal. Furthermore, it is difficult to purify compounds prepared by these methods. -10 · This paper music scale is applicable to China's national kneading rate (CNS) Α4 specification (210 × 297 mm) Yi Yi-(Poem first · ¾ read the note of δ and then JIKTI) Order. Λ 1235157 A7 B7 V. Description of the invention (8) Therefore, there is a great need for compounds that can effectively inhibit ICE as an in vivo in vivo in order to prevent and treat IL-1 -mediated diseases, and the cells are expected to die-, IGIF-, or IFN-r-regulated Disease, as well as inflammation, "autoimmune, destructive bone disease, proliferative, infectious or degenerative diseases of chronic and acute types of agents. Methods of preparing this compound are also needed. Summary of the invention The present invention proposes a new type Compounds, and their pharmaceutically acceptable derivatives, which can act as inhibitors of ICE. These compounds can also be used alone or in combination with other therapeutic or prophylactic agents, such as antibiotics, immunomodulators or other anti-inflammatory agents In order to treat or prevent diseases mediated by IL · 1, expected cell death, IGIF or IFN-r. According to a preferred embodiment, the compounds of the present invention can bind to the active site of ICE and inhibit the activity of enzymes. Field It has improved cell potency, improved pharmacokinetics, and / or improved oral bioavailability, which is compared with peptide ICE inhibitors. The main object of the present invention is to propose a new class of compounds, which are ICE inhibitors The agent is represented by the following formula ...

Printed by the Ministry of Economic Affairs and Standards Bureau W3C Industrial and Consumer Cooperatives -11-The standard of this paper is applicable to the Chinese National Standard (CNTS) A4 (210X297 mm) 1235157 Λ i Β7 5. Description of the invention (9) S1 (Industrial), (VI)

(CJ2) m-T

Ri-NH-X]

t H (CH2) g-R3 and (Please read the notes on the back first 53

(II)-(V) and (VII) RrH

OR13 Benwa) • Each of the substituents is as described herein. A further object of the present invention is to propose a method for preparing an N-fluorenylamino compound in which a carboxylic acid is coupled with an protected amine in the other position. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1A ICE can dissociate in vivo before-IGIF. From Cos cells, and analyze the presence of IGIF by the lysates showing various plastids or control groups, that is, the protein was separated by SDS-PAGE and anti-IGIF anti-blood. ----- Body _ see epidemic transport stains (1 column, blank transfected cells; 2 columns, separate front-IGIF: 3-12 columns, front-IGIF combination ICE, ICE-C285S, CPP32, CPP32- C163S, CMH-1, CMH-1-C186S, Tx, TX-C258S). Movements of pre-IGIF and 18-kDa mature IGIF are shown on the right. The molecular weight as shown in Figure 0 is shown on the left (Example 23). 12 The size of this paper is applicable to the Chinese national standard (CNS M4 Regulations (2 丨 0X297 mm). Order: ^ Printed by Deng Central Government Bureau, Shellfish Consumer Cooperative, 1235157 Λ7 B7 V. Description of Invention (1)

Figure 1B. ICE can be borrowed at the exact processing modification position in the test tube. Pre-IGIF, which can be shown by Coomassie blue staining the proteolytic reaction product separated by SDS-PAGE (Example 23). The egg enzymes and inhibitors used are: 1 column, buffer solution control group; 2 columns, 0.1 nM ICE; 3 columns, 1 nM ICE: 4 and 5 columns, 1 nM ICE plus 10 nM respectively Cbz-Val-Ala-Asp-[(2,6-dichlorofluorenyl) oxy] methyl to 100 nM

Asp: 6 and 7 columns, 15 nM CPP32 from or without 400 nM Ac-Asp-Glu-Val-Asp- ^ (DW Nicholson et aL, Nature, 376, p. 37 (1995)); 8 columns, lOOnMCMH-1 · 9 columns, 10 units / ml granzyme B: and molecular weight markers in kDa β Figure 1C ICE dissociation can convert inactive pre-IGIF into active IGIF, which can induce Th1 helper cells Production of IFN-r. Undissociated (pre-IGIF / ICE), CPP32-dissociated (pre-IGIF / CPP32), and recombinant mature IGIF (rlGIF) and A.E7 Thl cells at 12 ng / ml (open frame) and I20 Incubate at ng / ml (shaded box) for 18 hours, and then analyze IFN-r released into the cell culture medium by ELISA (Example 23). Α7 cells were cultured in buffered solution, ICE (ICE) alone, or CPP32 (CPP32) alone, and analyzed like a negative control group. Figures represent the average of three decisions. Figure 2A Mature IGIF (18-kDa) is produced by pre-IGIF and ICE co-infected cosponsors. The lysates (T2) from Cos sealed cells and the adapted medium (right) -IGIF showed a sense of plastid translocation, and could be classified as wild type (ICE) or inactive mutant (ICE-C285S) ) The performance of ICE exists. The transfected cells were metabolically labeled with 35S-sulfanthionine, and the proteins from the falling spore product and the adapted medium were immunized with -IGIF antiserum. · 13 · This paper has the same scale as the Chinese National Standard (CNS) Α4 Specifications (210X297 mm) (Read the first show of the effect of the cloud f f buy all the bindings printed by the Ministry of Economic Affairs of the Central Bureau of the Bureau of the Consumer Consumption Cooperatives * 1235157 Central Standards Bureau of the Ministry of Economic Affairs Consumer Cooperatives printed A7. ____ B7___ V. Description of the invention (11); and separated by SDS-PAGE (Example 24). The movement of pre-IGIF and [8-kDa mature IGIF is shown on the right. The molecular weight in kDa is shown on the left 3 Figure 2B Read IFN-r-inducing activity in Cos cells that previously expressed IGIF and ICE-plastid sympathy. Lysates from Cos cells (solid pinch) and Ci Shi medium (open box) Body sensation, and in the absence of (pre-, IGIF) or (pre-IGIF / ICE) encoding wild-type (ICE) performance qualitative analysis, ELISA analysis of IFN-r levels. Buffer solution (blank Group) or ICE-Cos cells expressing plastid alone (ICE) transduction were the negative control group (Example 24). * Figure 3 A From mice lacking ICE, their Coffer cells are also defective in IGIF transport. Isolate the pool of wild-type mice (ICE + / +) or ICE-deficient mice (ICE-Λ) with ICE mutations in the same spliceosome. Freund's cells and filled with LPS for 3 hours. The level of immunoreactive IGIF polypeptide in wild-type cell conditioning medium (nanograms / ml) was detected by ELISA (Example 25). N · D · (No detectable ) Indicates that the IGIF concentration is less than 0.1 nanograms / ml. Figure 3B From mice lacking ICE, their Cuffs cells are also defective in IGIF transport. Isolate wild-type mice (ICE + / +) or ICE as the same zygote ICE Defective mice (ICE-/-) of Cooper's cells, and thirst with LPS for 3 hours. The filled cells were metabolically labeled with 35S · methionine, and proteins from the lysate and the culture medium were adapted for anti- IGIF antiserum was precipitated and separated by SDS-PAGE (Example 25). Front: The movements of IGIF and 18-kDa mature IGIF are shown on the right. Molecular weight in kDa is shown on the left. Figure 3C from ICE-defective mice Serum contains a reduced amount of IGIF. Wild type mice (ICE + / +) Or ICE mutation to the same zygote-14-This paper ft standard is in accordance with Chinese National Standards (CNS) M specifications (210X 297 public). -------- f Please read the following first: this means Thing ^

Clothing FC Order 1235157 Λ7 B7 V. IGIF level (nanograms / ml) of the ICE-deficient mouse (ICE-/-) in the description of the invention (12) (Example 25). Figure 3D. Serum from ICE-deficient mice contains -reduced IFN-r. EUSA was used to analyze IFN-Γ levels (nanograms / ml) in wild-type mice (ICE + / +) or ICE-deficient mice (ICE-/-) mutated to the same zygote (Example 25). Figure 4 The serum IFN-r levels of ICE-deficient mice were significantly reduced after acute challenge with LPS. The IFN-r levels (nanograms / ml) in wild type mice (filled squares) or ICE-defective mice (filled circles) were analyzed by EUSA as a function of time (hours) after LPS challenge. The temperature of the animal at this time in degrees Celsius is shown in wild-type old rats (open squares) or ICE-defective rats (open circles). Figure 5 ICE inhibitor, AcYVAD · aldehyde (AcYVAD-CH〇) can inhibit LPS-stimulated IL-1 /? And IFN-r synthesis in human peripheral blood mononuclear cells (PBMC). The percent inhibition (%) as a function of inhibitor concentration (A M) for IL-110,000 (open square) and IFN-r (open star) synthesis is shown.

5L printed by the Central Government Bureau of the Ministry of Economic Affairs and Industrial Cooperatives (please read the different pages on the back of the note) Figure 6 Compound 214e can inhibit the production of IL-I /? By LPS-challenge mice. The 1] ^ 1 ;? levels (picograms / ml) in 001 mouse serum samples were analyzed at £]: 15, which was performed after the LPS-challenge. Compound 214e was administered intraperitoneally (IP) after LPS challenge. Blood samples were collected 7 hours after LPS-challenge (see Example 7). Figure 7 Compound 217e can inhibit the production of IL-1 /? By LPS-pick ~ war rats. After LPS-challenge, the cold level of IL-1 (picograms / ml) in CD1 mouse serum samples was analyzed by ELISA. Compound 217e was administered via intraperitoneal (IP) injection after LPS-challenge! Blood was collected 7 hours after the LPS-challenge (see Example 7). • 15 · This paper music scale is applicable to the Chinese national standard (CNS) A4 ^ grid (2 丨 0X297 mm) 1235157 A7 B7 V. Description of the invention (13) Figure 8 Chemical compound 2 14 e, but not compound 2 1 7 e Inhibition of IL-1 cold production in a LPS-challenged mice when administered orally. This analysis can detect oral absorption under similar conditions as shown in Figures 6 and 7. These crusts show that 2! 4e can be used as a potential oral active ICE inhibitor (see Example 7). The homologues of compounds 214e and 214e in FIG. 9 can also inhibit il · 1 point production after ip administration. These results were obtained in the analyses described in Figures 6 and 7 and Example 7. The homologues of compounds 214e and 214e in Fig. 10 can also inhibit the production of IL-1 /? After oral administration (ρ0). These results can be obtained in the analyses described in Figures 6 and 7 and Example 7. Figure 11A / B compounds 302 and 304a show detectable blood levels when taken orally in mice (50 mg / kg in 0.5o / o carboxymethyl cellulose). Blood samples were collected at 1 and 7 hours after administration. Compounds 300 and 300 are prodrugs of 21 ^ and can be metabolized to 214e in vivo. Compound 214e did not exceed a blood level of 0.10 µg / ml when taken at π (Example 8). Figure 12 Compound 412f blocks the progress of type II collagen bleaching-induced arthritis in male DBA / 1J mice. (Wooley, PP ·, Methods in Enzymology, 162, PP · 361-373 (1988) and Geiger, D ·, Clinical and Experimental Rheumatology, 11, pp. 515-522 (1993)) 〇 Compound 412f is administered orally Food is taken twice daily (10, 25 and 50 mg / kg) at intervals of about 7 hours. Inflammation was measured on a scale of 1 to 4 with increasing severity of arthritis. Add the two forefoot scores to get the ‘final score (see Example 21). Figure 13 Compound 412d blocks the progression of type 2 victorin-induced arthritis in male DBA / 1J mice. The results are shown in Figure 12 and Example 21. 3 Figure 14 Compound 696a can block type II collagen in male DBA / 1J mice. -16-Benzhile is again in compliance with China National Standard (CNS) A4 (210X297) (Mm) ·-· l; it —1 · 1 ··· ^-(Notes on reading the poem before reading the cloud ^ this page) Ordered by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economy ¾ 1235157 A 7. B7 5. Description of the invention (14) The progress of induced arthritis. The results are shown in Figure 12 and Example 21. Abbreviations and definitions. Named reagents or tablets printed by the Central Bureau of Standards of the Ministry of Economic Affairs of the Consumers' Cooperatives. Ala Alanine Arg Arginine Asn Asparagine Asp Asp Cys Cysteine Gin Glutamine Glu Valley Glycine Gly Glycine His Histamine Lie Isoleucine Leu Leucine Lys Lysine Met Methionine Phe Phenylalanine Pro Proline Ser Serine Thr Threonine Trp Tryptophan Tvr Carotamine Acid Val valine acid -17- this paper music scale suitable for Chinese national standards ([knowledge] six 4 specifications (2 〖0 >: 297mm) (read first read the precautions on the back-installed-this page) ) Order

1235157 A7 B7 V. Description of the invention (15) S?

Ac20 acetic anhydride n-Bu n-butyl DMF dimethylformamide, DIEA N, N-diisopropylethylamine EDC 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide Et20 hydrochloride diethyl ether EtOAc ethyl acetate 'Fmoc 9-easylmethoxycarbonyl HBTU 0-benzotriazole-f-yl-N, N, N', N'-tetramethylgallium hexafluorophosphate Η0ΒΤ 1-hydroxyl Benzotriazole hydrate MeOH formadol FA trifluoroacetic acid Alloc Allyloxycarbonyl definition The following terms are used here: · · r interferon deflecting factor n or n IGIF "means can stimulate IFN- r endogenous production "ICE-inhibitor" refers to a compound that inhibits ICE enzymes. ICE inhibition can be determined using the method described and is incorporated herein by reference. The artisan knows that ICE inhibitors in vivo are not necessarily a trial. Intratubular iCE inhibitors. For example, the compound's previous drug form is usually rare or inactive in tube analysis. This prodrug form can be altered in patients by metabolism or other biochemical processes to generate in vivo ICE inhibitors. -18- The size of this paper is applicable to the Chinese National Standard (CNS) M specifications (210X297 mm) (read first ¾ read the back Note this I ml n n K) Order

Central Bureau of Standards, Ministry of Economic Affairs, Shellfish Consumer Cooperation, Du Yinzhuang 1235157 Λ7 ··· B 7 V. Description of the invention (16 ^-The so-called "cytokines" refers to molecules that can mediate the interaction of cells to interact with each other, and animal husbandry conditions " Refers to any disease that can produce harmful biological cause-effect relationships in individuals. Eight disorders or effects. I. An individual means an animal, or more than one type of cell derived from an animal. Preferably, mammals, most preferably In humans, cells can be of any type, including the following but not limited to cells retained in tissues, cell sense sets, non-dead cells, transfected or transformed cells, and derived animals that have already Cells with phenotypic changes. Active positions refer to one or all of the following positions in ICE: sites that are bound by the mass and where the inhibitory i can bind and sites that undergo dissociation by the mass. &Quot; refers to a stable mono- or polycyclic compound, which may contain one or two double bonds as required, or more than one aromatic ring as required. Each heterocyclic ring is independently selected by hard atoms and 1 to 4 Composition of heteroatoms from nitrogen, oxygen and sulfur As used herein, "'nitrogen " and " sulfur heteroatom " includes any oxidized form of nitrogen or sulfur, and any quaternized form of any qualitative nitrogen ^ Heterocyclic rings defined herein include, for example: pyrimidine Base, tetrahydrojunyl, tetrahydroiso-4, 4-'isopropyl + radical 'in octayl, 4-butorimyl, benzimidyl, imidyl, misazolinyl, imidazolidinyl ,, Quelinyl, iso "quinolyl, fluorinyl, bipyridyl 'g bihalki' 〃birolinyl '〃bi 4yl' v bihyl, cr char 嗔 α linyl, hexahydropyridine Molybdenyl, mofapyl, i-mofrinyl, furyl, β-secenyl, triazolyl, oxazolyl, carinyl, tetrazolyl, thiazolyl, benzilfurylmethyl, 4 morpholinyl, benzoxazolyl, oxetyryl, oxopyridoryl, oxaziridyl, azapicyl, isotudinyl, tetrahydrometanyl, tetrahydrofuranyl, 4 diazolyl, benzodioxy, benzo 4 phenyl, tetra-19- This paper fcf scale is the same as China National Standard (CNS) A4 specification (210X297 male 4)

1235157 Λ7 _B7 V. Description of the invention (17) Further heterocyclic ring of hydrothiophenyl and sulfonic acid methyl group 3 is described in 8.1.1. 2 〖出 21 ^ and CW Rees, eds ·, Comprehensive Heterocyclic Chemistry: The Structure, Reactions, Synthesis and Use'of Heterocyclic Compounds, Vol. 1-8, Pergamon Press, NY (1984) «nheteroalkyl" refers to a single or polycyclic group containing 3 to 15 carbons and optionally one Or two double bonds. Examples include cyclohexyl, adamantyl, and n-fluorenyl. "Aryl" refers to a single or polycyclic group containing 6, 10, 12, or 14 carbons in which at least one of the rings is aromatic. Examples include phenyl, fluorenyl, and tetrahydrofluorene. The so-called "heteroaromatic" refers to a mono or polycyclic group, which contains 1 to 15 carbon atoms and from 1 to 4 heteroatoms, each of which is independently selected from the following It includes sulphur, nitrogen and oxygen, and it additionally contains 1 to 3 five- or six-membered rings, at least one of which is aromatic. The Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs of the People's Republic of China printed the so-called "c-amino acid" (α-amino acid) refers to naturally occurring amino acids and is often used in peptide chemistry when preparing analogs of naturally occurring peptides. Among others, • Non-protein "c-amino acids, including D and L forms. Naturally occurring amino acids are glycine, alanine, valine, leucine, isoleucine, serine, methanoic acid, threonine, phenylalanine, luminal acid, tryptophan acid , Cysteine, proline, histamine, aspartic acid, asparagine, glutamine, glutamine_r, carboxyglutamate, arginine, uramine, and lysine acid. " Non-protein "c-amino acids include hydroxylysine, homoserine, homoglutamic acid, homophenylalanine, citrulline, canine urea, 4-amino-phenylalanine, 3- (2 -Title)-Propionate '3 · (1 · Title) -Alanine, Methyl Morsine, Third Butyl-Alanine, Third Butyl Glycine, 4-Hydroxyphenyl Glycine Acid, Alanine, Phenylglycine, Propylpropanoic Acid, Propyl-Glycine, 1,2,4-Trisino-3 -Alanine, 4,4,4-Trifluoro -Threonine, glycosine • 20 · ^ Paper ft scale universal 11 national standard (CNS) 8 4 standard (21GX297 mm) " 11th Ministry of Economic Affairs Central Standards Bureau shellfish consumer cooperation Du Yin ¾ 1235157 A7 B7 V. Description of the invention (18), 6-hydroxytryptophan, 5-amyl tryptophan 'via canine urea' 3. Aminotyrosine, trifluoromethylalanine '2 Diamino acid '(2- (4-. Than this group) ethyl) -cysteine, 3,4-dioxo-phenylenediamine " acid' 3- (2-thiazolyl)- Propionate, tartaric acid glutamate 'Phenyl-1-cyclopentane-chitoic acid' Pressuyl-1-cyclohexane causes acid to make gentisine ' 3-trifluoromethylphenylalanine, trifluoro-methylphenylalanine, cyclohexylalanine'cyclohexylglycine, thiohistamine, 3-methoxycarbamate, elastatinal, n-leucine , Valeric acid, allo-isoleucine, high spermine, thioproline, dehydroproline, hydroxy-proline, isoproline, homoproline 'cyclohexyl glycine' C-amino-n-butyric acid, cyclohexyl alanine, amine phenyl butyric acid, phenylalanine ortho, meta or para to the phenyl moiety are the following, or two selected: (< ^- (: 4) alkyl, (crc4) alkoxy, dentate or nitro or substituted with methyldioxy: -2- and 3-fluorenyl-alanine, Lu-2 · and 3-furylpropylamine Acid, y5-2-, 3 · and 4-pyridyl alanine, (benzothienyl-2- and 3-yl) alanine, dot- (1- and 2-fluorenyl) alanine, serine , 0-alkylated derivatives of threonine or tyrosine, S-alkylated cysteine, S-alkylated homocysteine, sulfamic acid 0 · sulfuric acid, 0 · Phosphoric acid and 0-carboxylic acid ester, 3-sulfo-carbamic acid, 3-carboxy-tyrosine, .3-phosphono Continuing acid esters, 4-methanephosphonic acid esters of tyrosine, 3,5-diiodotyrosine, 3-nitro · amidate, S-alkyllysine and S-alkyluronic acid. Either of these α · amino groups can be substituted by a methyl group at the α position, any aryl residue on the left amino group side chain, or a suitable protecting group on the 0, N or S atom of the side chain residue. Appropriate protective groups are shown in `` Protective Groups In Organic Synthesis, nT.W. Greene and PGM Wuts, J. Wiley & Sons, -21-This paper's standard is applicable to China National Standards (CNS) M Regulations (2丨 OX297mm) I t-shirt-C 锖 Read the notes on the back ^ This page) Order 1235157 A 7. B7 V. Description of the invention (19) NY, NY, 1991 ^ The so-called π-substituted 〃 refers to the hydrogen in the compound The atom is replaced by a substituent. In the present invention, hydrogen atoms which can form a partial hydrogen bonding portion and which can form a hydrogen bond with the carbonyl oxygen of Arg-341 of ICE or the carbonyl oxygen of ICE Ser-339 are excluded from the substitution β Miscellaneous hydrogen atoms include those containing -NH- groups, which are -C0- radicals in general, and are represented by -NH- instead of X in the following schemes: Base or other name. 'The so-called π straight chain π refers to a continuous unbranched string of covalently bonded atoms. Linear substitution is possible, but these substituents are not linear Θ-parts. π •• refers to many measures of the potency of a compound in inhibiting the activity of a target enzyme, such as ICE. The lower heart is more effective. The experimentally determined rate data of palpitations are calculated in conjunction with standard enzyme kinetic equations. (See IH Segel, Enzyme Kinetics, Wiley-Interscience, 1975) 0 The so-called "patient" in this case refers to any mammal, especially Is human. The so-called "pharmaceutically effective dose" refers to the amount of a disease that can effectively treat or relieve IL-1-, expected cell death-, IGIF ·, or IFN-r-mediated diseases in a patient. The "π preventive effective dose" refers to a dose effective to prevent or substantially reduce the disease of IL-1-, expected cell death-, IGIF or IFN-r-mediated disease in a patient. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs " Pharmaceutically acceptable carrier or adjuvant π means a non-toxic carrier or adjuvant that can be administered to patients with the compound of the present invention, and it will not be damaged Its pharmacology. Activity. "" Pharmaceutically acceptable derivative "means any pharmaceutically acceptable salt, ester, or salt of this compound, or any other compound, which, once administered to a recipient, provides the compound of this invention (directly (Or indirect) or its anti-22-22 paper size suitable for Chinese National Standards (CNS) A4 specifications (210X297 mm) 1235157 Central Standards Bureau of the Ministry of Economic Affairs of the Bayer Consumer Cooperatives Seal 衮 Λ 7 _ B7 V. Description of the invention (20 ) -ICE activity substitutes for substances or residues. The compounds of the present invention are pharmaceutically acceptable, such as those derived from pharmaceutically acceptable solvents and organic acids and bases. Examples of suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, phosphonic acid, perchloric acid, fumaric acid, maleic acid, oxalic acid, glycamic acid, lactic acid, salicylic acid, succinic acid, toluene-para- Sulfuric acid, tartaric acid, citric acid, citric acid, formic acid, formic acid, benzoic acid, malonic acid, tea-2-reading acid and benzoic acid. Other acids, such as oxalic acid, are not pharmaceutically acceptable by themselves, but can be used to prepare salts that act as intermediates to obtain the compounds of the present invention and their pharmaceutically acceptable acid addition salts. Derived from suitable base salts, including alkali metals (such as sodium), alkaline earth metals (such as magnesium), ammonium, and n- (c1-4 alkyl) 4+ salts. The invention also includes any of the basic nitrogen-containing groups of the compounds disclosed herein, "quaternary alkali reaction". Basic nitrogen can be quaternized with any substrate known to the artisan, including: Basic halides such as methyl, ethyl, propyl and butyl chloride, bromine and iodine; dialkyl sulfates include dimethyl, diethyl, dibutyl and dipentyl sulfate; long chain tooth compounds such as Decyl, lauryl, myristyl and stearyl chloride, bromine and iodine, and aralkyl hydrazones include benzyl and phenethyl bromide. Water or ® soluble or dispersible products can be converted into quaternary hydrazone to obtain 3 The ICE inhibitors of the present invention may contain more than one "asymmetric" carbon atom, and may therefore be present as racemates and racemic mixtures, single antipodes, diastereoisomeric mixtures and individual non 'Enantiomers. All such isomeric forms of these compounds may be specifically included in the present invention. The carbon of each three-dimensional region may be in the R or S configuration. Although the specific compounds and skeletons exemplified in the present invention can be shown in a special stereochemical configuration, they have -23 · paper size and use China National Standard (CNS) M specifications (210X297 mm) (please first Read the notes on the back

This page) Order 1235157 A7. I _____B7 V. Description of the invention (21) Compounds and skeletons or their opposite stereochemistry at any given pair of palm centers; 'Kun compounds are also included here. The inhibitor of the present invention may contain a concentrated structure, which may be substituted with various substituents on carbon, nitrogen, or other atoms, as necessary. Such a ring structure may be mono- or multi-substituted. In comparison, the ring structure may contain 0 to 3 substituents. When multiple substitutions are made, each substituent can be independently selected from any other substituent as long as the combination of substituents can result in the formation of a stable compound. The combinations of substituents and variables included in the present invention are only those that cause the formation of stable compounds. The so-called " stable " as used herein refers to compounds which are stable enough to be manufactured and administered to mammals by methods known in the art today. Typically, this compound is stable for at least one week at a temperature of 40 ° C · below in the absence of moisture or other chemical reaction conditions. 3 The substituents can be represented by various types. These various types are known to artisans and can be used interactively. For example, the fluorenyl substituent on the phenyl ring can be represented by any of the following types: 〇 '' σ 'σ. Various types of substituents, such as methyl, can be used interchangeably herein. Employees' Cooperatives of the Central Economic Bureau of the Ministry of Economic Affairs, India. Detailed Description of the Invention In order to make the invention described herein more comprehensible, the following detailed description is shown. The ICE inhibitor of the present invention · Example (A) is of formula π:

jCJ2) m-T

Ri—NH-Xi \ (CH2) • 24- 1235157 Α7 Β7

Printed by # 部 中 夬 橾 准 局 贝 工 consuming cooperatives 5L 5. Description of the invention (22) where: XA-CH; g is 0 or 1: ― one each independently selected from the following including -0H and -F, restrictions When a unitary and second J are bound to C and the first j is -0H, the second j is _H; m is 0, 1 or 2; D is -OH, -C0-C02H, < : 〇2ϋ, or-(: 〇〇 Any bioelectronic isobaric replacement; Ri is selected from the following including the following formula, where any ring can be based on the required technical list or multiple substitutions, 任何! Nitrogen is at the heart, or at any atom is = 0, -OH, -C02H, or halogen substitution; any saturated ring may not be coordinated on one or two bonds as required; and where Ri (e) and Ri ( y) Benzene can be fused as required: (ar χΝ 2-N--CC—; I R7 〇Η λ χΝ I II; IR? 〇Η · (please read the precautions for 33 first reading & ^ | ^ This page)-Binding. The size of the bound paper is applicable to the Chinese National Standard (CNS) A4 specification (210 × 297 mm) 1235157 A7 B7 V. Description of the invention (23)

ΙΓΟ R61--C1H 〇

kL (g) X '

(Please read the Precautions for Back Cloud first, then this page) —Installation— f Order

26 This paper scale is applicable to China's National Standards (CNS) A4 specification (210X297 mm) yr: 1235157 a7 B7 V. Description of the invention (24) Printed by the Military Industry Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ¾ (j) (k) (1) (m) (n)

X4

k (CH2) d (CH2) 3

Rs Rs 〇— C— c- i II 1 11 H 〇 R7 〇 N (CH2) dI human (CHjJa-, C-R2〇-Z- (V # Η η p, -C- .. II o r7 o

--------- 襞-C (Please read the notes on the back before ^^ this page)

• 1T

C • 27 The size of this paper is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 A7 B7 Five 'Instructions for Ming (25) r \ y P / | \

\ 7 q / v

(Please read the precautions on the back first)

1T

I H Μ Printed by the Consumer Cooperatives of the Central Government Bureau of the Ministry of Economic Affairs

28 The paper and iron scales are applicable to China National Standards (CNS) Α4 (210 × 297 mm) 1235157 A7 B7 Printed by the Central Office of the Ministry of Economic Affairs

The size of the paper method applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 Λ7 B7 V. Description of the invention (27) (aa5) (bb) [cc] (dd) (〇) d

The paper scale is applicable to Chinese National Standard (CNS) A4 (210X297 mm) 1235157 Λ7 B7 V. Description of the invention (28) (ggb) (CH2) a

And (ggc) wherein each ring C is independently selected from the group consisting of benzo, pyrido, thieno, bamboo dipper, whisper, while biting, violating and sighing, sighing and binding, all-evil and beneficial, pyrimidine And, imidazo, cyclopentyl, and cyclohexyl: r3 is: -CN, -CH = CH-R9, -CH = N-0-R9, printed by the Central Ministry of Economic Affairs \ vEmployee Cooperative Cooperative Seal ¾-(CH2 ) 10-TrR9 V -CJ, -R9 '" -C0-R13, into one, ~ R;

CO-CO-N • 31-This paper scale is applicable to China National Standard #OS (s) A4 (210X297mm) 1235157 A7 _ ^ _ B7 ^ V. Description of the Invention (29) Each is independently selected from the following including: -H , -Aq, -R9 ', butt-R9, and-(CH2) K2,3-TrR9; each butan 1 is independently selected from the following: CH = CH-, -〇 ·, -S-, -s〇- , -SO,-'-NR 丨 〇-' -NRjq-CO- j -c〇-, -〇-C〇-, -C〇-〇-, -CO-NRjq- 9 -0-C 0 -N R1. ’Consumption cooperation and social printing of employees of the Central Bureau of Standards of the Ministry of Economic Affairs -NRjq-CO-O- j -NRjq-CO-NRjq- j -S0, -NRi. -'-NRiq-SO,-' and -NRIq-S0-)-NRjq- * • 32 · The paper method is common Chinese National Standard (CNS) M specification (210X297 mm) 1235157 Λ7 B7 V. Description of the invention ( 30) Each 115 is independently selected from the following: -H, (Please read the note on the back page first) -Ar !,, -CO-Ar j 9 -S 〇, -Ar 1 '-C〇-NH2,- S〇rNH2, '-R9, -C O-R9 1 -C 0-0-7 -S 〇7 -R9' / Arl

-CO-N, 丨 〇, / Arl

-S〇9-N, 10, r9

-CO-N

\ r10, and / R9 • SO, -N Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs * \ R · 116 and 117—to form a saturated 4,8-membered carbon ring or contain -0, -s ,, Or -NH- heterocyclic ring; or R7 is -Η and 116 is -Η, -Aq, • 33- The paper scale is applicable to the Chinese national standard twin (CNS> A4 specification (2! 0X297 mm) 1235157 Ministry of Economic Affairs Printed by the Central Bureau of Standards Consumer Cooperatives

AT B7 V. Description of the invention (31) -R9'α-amino acid side chain residues: each R9 is a CN6 straight or branched alkyl group, and -OH, -F or = single or multiple substitution as required, and Optionally substituted by one or two Aq groups; each R1Q is independently selected from the following including -H or Cle6 straight or branched alkyl groups: each R13 is independently selected from the following including · Αγ2, -R41-N-OH 'R5: Each Aη is a cyclic group, independently selected from the following including aryl groups containing 6, 10, 12 or 14 carbon atoms, and between 1 to 3 rings, cycloalkyl groups containing 3 to 15 carbon atoms and 1 to 3 Ring, the cycloalkyl group can be optionally fused with benzo, and the heterocyclic group contains 5 to 15 ring atoms and 1 to 3 rings, and the heterocyclic ring contains at least one heteroatom selected from -0-,,- SO ·, -S02-, = N- and -NΗ-, the heterocyclic ring needs to contain more than one double bond, the heterocyclic ring contains more than one aromatic ring, and the ring is The required is · NΗ2, -C02H, -Cl, -F, -Br ·, -I, -NO ,, -CN, = 0 = 0, -OH, perfluoro 0.3 alkyl, / \: , Or single or multiple substitutions by -Qi: \ r 〇 Each Ar2 is independently selected from the following, where any ring may be-(^ Replacement of 42 orders or more: I (please read the precautions of δ before buying this book) Binding times: -34- Chinese paper standard iron (CNS) A4 rule (2 丨 0X297 mm) 1235157 AT B7 V. Yanming Instructions (32 (hh)

γ (ii)

-X (jj) (kk) c x_ N. Y · Λ Λ and each 1 are independently selected from the following including: -Ar j -0-A r 1 -R9 '-丁 1 -R9' and • (CH2) 1, 2,3-T1-R9; each Q2 is independently selected from the group consisting of -OH, -NH2, -C02H, -Cl, -F, -Br, -I, · NO7, -CN, -CF. And / 0 .

CH 2 · 〇 The central government ’s Bureau of Poverty Alleviation Cooperatives of the Ministry of Economic Affairs prints the restriction that when one-eight ^ is replaced by ^, it contains more than one additional-eight ^, and the additional -Aq group is not Qi is replaced by: each X is independently selected from the following including = N-, and = CH-; each X2 is independently selected from the following including -O- • S 〇 ,:

CH 2 * -NH-, -S-, -SO-, and -35- (Please read the precautions on the back before filling this page)

The paper scale is applicable to Chinese national standards (CNS M4 specification (210X297 mm) 1235157 Λ7 _B7 V. Description of the invention (33) Each X3 is independently selected from the following including -CH2-, -S-, -SO-, and -s. 2-: each X4 is independently selected from the following including -CH2- and -NH-: each X5 is independently selected from the following including -CH- and -N ·;, | | X6 * -CH-or; each Y is independently selected from the following including -〇-, -S ·, and -NH: each Z is independently c0 or s02: each a is independently 0 or 1; * each c is independently 1 or 2; each d is independently 0, 1 or 2: And · each e is independently 0,1,2, or 3: the restriction is that beware of ⑴, R6 is a pan-amino acid side chain residue, and 117 is -11, Uaal) and (aa2) must be 1. Replacement; the restrictions are also when RA (〇), g is 0, ¾ Jebang Central-like Li Bureau Shellfish Consumer Cooperative Co., Ltd. J is -Η, m is 1, R6 is a Jiang · amino acid side chain residue, · RA-H, X2 is -CH2 ·, X5S-CH-,

Xg is ’and -36- The standard of this paper is applicable to China National Standard Car (CNS) Α4 specification (210X297 mm) 1235157

AT _B7_ · __ V. Description of the Invention (34) R; Yes / ho

-CO-N \ r10, or -c〇-r13, when / R13 is ... -CH, -0-C0-Ari '-CH2-SC〇-Ari, -CH ^ -O-Ar!' • CH, -S-Ai: i, or -114 when -114 is -Η:-then the ring of Ri (〇) group must be (^ substituted or benzo-fused: and the restriction is when (w), g is 0 , J is · Η, m is 1, J is -C02H, 乂 2 is 0, R5 is oxocarbonyl, and ring C is benzo. Printed by the Consumer Cooperative of the Central Ministry of Economic Affairs of the Ministry of Economic Affairs. Note on the back of the occasional reading and then fill out this page) Then 113 cannot be-(: 0-1113 When · · R13 is -CHrO-Aqa · ΑΓι is 1-phenyl-3-trifluoromethyl-cozazole-5- Phenyl group, where phenyl is optionally substituted by a chlorine atom; or -37 · This paper size applies Chinese National Standard (CNS) A4 specifications (210 × 297 mm) 1235157 A7 B7 V. Description of the invention (35) R13 is 'Where Ar * i is 2,6-dichlorophenyl. One-to-one ^ factory formula 较佳 之 is a preferred compound of specific example A, and the impact is (w) (w) Rs

The other substituents are as described above. Apply Formula c 旳 Specific Example A-Other preferred compounds, where & is (y) (y) ο (Please read the notes on the back before filling this page) The press «. Other substituents are as described above. A better compound of courtesy example A of the formula or, where: X4-CH: g is 0; J is -H: m is 0 or 1 and T is -C0-C02H, or any of ~ C02H bioelectronics, etc. Row replacement, or m is 1 and T is -C02H; selected from the following including the following formula, where any ring can be based on the required sheet or multiple • 38- This paper's standard is applicable to China National Standard (CNS) A4 specifications (210X297) (Centimeter) 1235157 A7 B7

1235157 A7 B7 V. Description of the invention (37 (〇) (r)

And (w)

r20 is (aal)

A or --------- ¾-- (read the precautions on the back of this page first ^^ this page) Order (aa2) 5? Printed by the Central Ministry of Economic Affairs and the Bureau of Industrial and Consumer Cooperatives ^, N, / (CHz) c and c is 1; ring c is benzo, optionally substituted with -c 3 alkyl, -o-Cu alkyl, -cn, -f or -CF // f: when R 丨 is (A) or (b), R5 is preferably -Η, and beware of ⑷, (e), (f), (〇), ⑴, (w), (X) or (y), R5 is preferably- 40 This paper scale is applicable to Chinese National Standards (CNS M4 Regulations (2 丨 0X297 mm) 1235157 Λ7 B7 V. Description of the Invention (38) Yes: -C 0-A rj • S 〇, -A r 1 '- --C〇-NH2, -CO-NH-Aq -CO-R9? -C〇-〇-R9, · -S〇2-R9, or -C〇-NH-R9, · 117 is -1 ·! And 116 is: -Η, -R9, or -Art * is a straight or branched alkyl group, and is optionally substituted with = 0, and optionally substituted with -eight 1 ^:

RlQ is a straight or branched alkyl group of -H or -Cu;

Aq is phenyl, fluorenyl, pyridyl, benzo4azolyl, phenophil, benzofluorenyl, benzoxazolyl, 2-hydromandyl, or 4indolyl, as required- O-Cu alkyl, -NH-C 3 alkyl, NKCw alkyl) 2, -Cl, -F, -CF3, -CP3 alkyl, or 0 (Please read the precautions on the back to write this page) 0 Binding Printed by Shellfish Consumer Cooperative, Ltd., Central Standards Bureau, Ministry of Economic Affairs \ 〇 / CH- (51 is 9 or-(. 1 ^ 2) 〇, 1,2-but 1- (〇 ^) 〇, 1, 2-eight 1 > 1 'wherein D 1 is -0- or-$. Each X is independently selected from the following including = N-, and = CH-: each X, independently selected from the following including -0-, -CH,- , · ΝΗ- -SO-, and .41-The standard of this paper is used in the Chinese national rubbing rate (〇 ^) to the specifications (210 parent 297 mm) 1235157

Λ7 B7 V. Description of the invention (39) -S 〇,-: each independently selected from the following including -CH- and -N-; | | X6 * -CH- or -N-,

The limiting condition of 1 I is when: 1 ^ is (0), X2S-CHr, X5S-CH-, and ·, then the ring of R 丨 (〇) group must be substituted by Qi or fused with benzo: and Z is C = 〇. The compound which is better for this preferred embodiment is its central group ... (Please read the precautions on the back ^ ¾ write this page)

W. e

Or order printed by the Department of Industry and Consumer Cooperatives of the Central Bureau of the Ministry of Economic Affairs and c is 2: or (e4)

Rs > Η 〇 0 or -42- This paper's standard is applicable to Chinese National Standard (CNS) A4 (2I0X297 mm) 1235157 A7 B7 V. Description of the invention (40) (e7) (CHzJc

Λ τ_% $ «乂% i Ψft which can be optionally fused with benzo, and c is 1 or 2: the limitation is when 1 ^ is (€ 4), · g is 0, J is -H, · · M is 1, D is -C02H, R5 is fluorenyloxycarbonyl, and c is 1, then R3 cannot be-(: 0-1113 when R13 is -CHyO-Aqa, and ^ is phenylphenyl-3-trifluorofluorene -Pyrazol-5-yl, in which phenyl is optionally substituted by a chlorine atom; or when Rl3 is · CH2-0-C0-Ar1, where Aq is 2,6-dichlorophenyl, and The 2-position on the ring is para-fluoro-phenyl substitution; and the restrictions are also when · R # (e7), g is 0,, I is · Η, -43 This paper uses the Chinese national standard (CNS) Α4 specification (210 × 297 mm) (Please read the notes on the back before filling out this page) 1235157 A7 B7 * 5. Description of the invention (41) m is 1, T is -C〇2H or -C〇-NH -OH, R5 is a protecting group for the N atom of the amino acid side chain residue and each c is 1, then R3 cannot be -C 0-R i $ When r13 is: -CH2 · 0 * C0-Ar j 7 -C * S-C0-Arj j -CH'-O-Ar! 'Or -CH'-S-Ar! 0 The best compound for this specific example is among them: The heart is: (Please read the note on the back first thing (Item again on this page)

(el) Ν Ν-

Ο (CHz) c

X or order

Ν I Η

(ο The Central Bureau of Standards, Ministry of Economic Affairs, Shellfish Consumer Cooperation · Social Printing ¾ and c is 2; m is 1: Ding < 02Η: and -44 This paper music standard is universal China National Standard (CNS) M specifications (210X297) 1235157 Α7 Β7 V. Description of the invention (42) R3 is -CO-R13. The other best compounds in this specific example are among them Rj: ~ one-one (wl)

: Where X2 is:-· -〇-, -S-, • s〇r, or -NH-; as desired, or 卩 丨 Substitute on: ^ when -NH-; and ring C is benzene And, it is -Cu alkyl, -0-Ci.3 alkyl, -Cl, -F or -CF: substituted ^ Another ICE inhibitor of the present invention (B) is the formula (I): (Please Please read the precautions on the back before ^: this page) Ordered by the Consumers' Cooperatives of the Central Ministry of Tobacco Bureau of the Ministry of Tobacco «. (X) RX-N-R2 Η where:, * 11 丨 is selected from the following including the following formulas ·· .45 The size of this paper is applicable to Chinese National Standard (CNS) A ^ Jl (210 × 297 mm) 1235157

A B7 V. Description of the Invention (43) (elO) F Rs ^ ---- ·--(ell) Rs (el2) R2

(Please read the notes on the back ^: this page)

Ordered by the Central Bureau of Standards of the Ministry of Economic Affairs

• 46- The standard of this paper is applicable to Chinese national standards (CNS M4 grid (210X297 mm) 1235157 A7 B7 V. Description of the invention (44) Ring C to send)] The following includes: Fenbin, Luoluo, Hanran, 5 plugs, 4 different sides, ° Evil and 'heterosexual', and bite benefits, microphones, cyclopentyl, and cyclohexyl; 'R, Yes: or (b)

(Please read the notes on the back before filling out this page) m is 1 or 2; R5 is selected from the following including -C (〇) -R 丨 0, -C (〇) 〇-R9,

Ri order

-C (0) -N kR, printed by 4 Central Standards Bureau M3C industrial and consumer cooperation Du-S (〇) 2-R9, • C (〇) -CHr〇-R9, -C (b) C (0) -R1 {>, -Rg 9 -H, and -C (O) C (O) -OR10: -47- The standard for this paper is applicable to China National Standards (CNS) A4 (2 丨 0X297 mm) S? Consumption cooperation among employees of the Central Bureau of Standards of the Ministry of Economic Affairs • Du Yin 1235157 Λ7 B7 V. Description of the invention (45) X5 * -CH- or -N-;

| I Ya 2 is 4 or 0: x7 is -N (R8)-or -0:-R6 is selected from the following including -H and -CH3;

Rs is selected from the following including: -C (〇) -R10, -C (〇) 〇-R9,--C (O) -N (H) -R10, -s (〇) 2-r9,--S ( O) rNH-R10, -C (O) -CHrOR10, -C (O) C (O) -R10 ·· -C (O) -CH2N (R1 (3) (R10), -C (0) -CH2C (0) -0-R9, -C (0) -CH2C (0) -R9, -H, and -C (O) -C (O) -OR10; each 119 is independently selected from the following including straight or branched alkanes Base, optionally substituted by Aγ3, where -C ^ 6 alkyl is unsaturated as desired; each 111 () is independently selected from the following including -H, -Ar3, C3.6 cycloalkyl, and -C ^ 6 Straight or branched alkyl is optionally substituted with Aιγ3, where -C ^ 6 alkyl is optionally unsaturated: R13 is selected from the following including fluorene, Aγ3, and (: μ6 straight or branched alkyl, as required as Replaced by Ar3, -CONH2, -0R5, -OH, -〇R9, or -C〇2H ... -48- The size of this paper method is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm>

1235157 Λ7 B7 V. Description of the invention (#) Each R31 is independently selected from the following: ^ R9, -C (〇) -N (H) -R9, or 1 ^ each together to form a saturated 4-8 member ring, or contains · 〇 ·, · 5 •, or · ΝΗ- heterocyclic ring:-each R "independently also includes the following-or -c, M4, ^^ U6 denier or branched alkyl groups; each Aq is a cyclic group It is transported from the following including Kwai < human square base which contains 6, 10, 12 or 14 carbon atoms and between 1 and 3 rings, and, ring atoms and 1 to 3 rings, the heterocyclic ring contains Zhizu_3 contains] to 1] 7 7-heteroatoms selected from the group consisting of: 0-, -S-, -SO-, S〇2, and -N 杂-, hetero or multiple double bonds, the Heterocyclic ring contains as much as you want %% contains a ring base as needed, which is a single or multiple substitution or an aromatic ring of -Ql, and each of Q is independently from -NH, ≪ opj, -N02, -CN ,, -OH, -total gas c, NHR5, OR9, -Lai 9, R9, -C (〇), Ri 〇 · Cl, -F, -Br ,. 1 N3 transport base, R5, .〇H5,-, and -------- r # II (Please read and read the notes of ^ first, please fill out this note) Order \ 〇 / CH- Chaoji Ministry Central Standard contracture Consumption Cooperation of Bureau Staff · Du Yinzhong The restriction is that when the group is substituted, it contains Αγ3 group, and this additional Αγ3 group is not replaced by another Αγ3 group. In comparison, R5 includes the following: C (O) -R10, • c (o) 〇r9, and -C (0) -NH-Ri〇3 In addition, R5it includes the following: -S ( 0) rR9, more than -49 additional paper-size universal medium-sized national samples (CNS) a4 specifications (2 丨 0X297 mm) 1235157 ¾ printed by the Central Bureau of Standards of the Ministry of Economy DESCRIPTION OF THE INVENTION (47) 'S (O) 2-NH.R10 ^ -C (O) -C (〇) -R10, -R9, and -C (O) -C (〇) -OR10. Preferably: m is 1: a straight or branched alkyl group of fluorene or -CN4, optionally substituted by -Ar3, -0H, -〇R9, or -C02H, wherein R91-CN4 is a straight or branched alkyl group, wherein Ar3 is morphoyl or phenyl, where phenyl is optionally substituted: R2 丨 is -H or -CH3; ^ 5111.6 straight or branched alkynyl 'is optionally substituted by Αγ3, where Αγ3 is benzyl If necessary, it is -Q! Substitution: Α Γ 3 is a benzyl group, a stilbene group, a fluorenyl group, a quinolyl group, a isothiol group, a sigma group, a 4zolyl group, an isoxazolyl group, and benzene Benzotriazolyl, benzimidazolyl, phenanthryl, imidazolyl, 4diazolyl, benzo [b] thiophenyl, fluorenyl, benzofuryl, and 4indolyl; each Qi is independently selected from the group consisting of -NH2, -C 丨, -F, -Br, -OH, .r9, -NH-R5 where R5 is -C (O) -R10 or -S (0) 2-R9, -0R5 where & is -C (0) -R1〇, -〇R9, -NHR9, and

0 wherein each and R10 are independently -Cw straight or branched alkyl groups, and are optionally substituted by Αγ3, where Αγ3 is a phenyl group: (Please read the precautions of Back Cloud before filling out this I)

1 50 · ^ Common paper standard (CnT) Α4 specification (2 丨 0X297 mm) ~ " --- 1235157 A., B7 V. Description of the invention (48) The limiting condition is when-8 1: 3 It is substituted by the h group, which contains more than one additional -Aγ3 group, and the additional -Aγ3 group is not substituted by another -Ar3 group. The ICE inhibitor of another specific example (C) of the present invention is / formula (II): (IX) ··· bird

Where m is 1 or 2; Ri is selected from the following including the following formula: (please read the first Li meaning on the back of the winter first write this page) (elO)

(ell)

This paper iron standard is generally Chinese National Standard (CNS) A4 (210X297 mm) 1235157 AT B7 V. Description of Invention (49) (yi)

(y2)

[z)

And (please read the precautions of S before filling out this page) The seal of the Central Standard Department of Industry and Consumer Cooperatives of the Ministry of Economic Affairs «. Ring C is selected from the following including benzo, pyrido, 4-pheno, pyrrolop, furania · Famous government officials, iso-alpha succinate, vocal bite, hetero-isode, jude, imidazo, cyclopentyl, and cyclohexyl; R3 is selected from the following: -CN, -C (〇)- H, -C (0) -CH2-TrRu, -C (〇) -CH2-F, -C = N-0-R9 1 and -C0-Ar ,: * R5 is selected from the following formulas: -C ( 0), R 丨 〇, -c (o) o-r9, -52 This paper iron scale is applicable to Chinese National Standard (CNS) A4 pit (2 丨 0X297 mm) 1235157 A 7 _ _B7_ V. Description of the invention ( 5 °) ^ RiO -C (〇) -N \ -S (〇) 2-R9, -C (〇) -CH2-〇-R9, -C (〇) C (〇) -R10, -R9, · -H, and -C (〇) C (〇) -〇R10,-is -CH- or -N-; II Y2 * H24〇; X7 is · N (Ι18)-or -0 ;; each T independently Selected from the following including -0-, -s-, -S (0)-, and -s (o) 2-: R6 is selected from the following including -Η and -CH3: Rs is selected from the following including: -C (〇) -R 丨 〇, -C (〇) 〇-R9, -C (O) -NH-R10, -S (0) rR9, • S (O) rNH-R10, -C (O) -CH2-OR10, -C (O) C (O) -R10 • C (O) -CH2-N (R10) (R10), -C (0) -CH2C (0) -0-R9, • 53- (Please read the precautions of δ before filling this page): Loading. Order

• -ir ··· p. 'Φ -...'% v The standard of this paper is applicable § National Standard (CNS) A4 (210X297 mm)! 235157 Λ7 B7 * ----- ^ ___________ 5 Description of the invention (51) -c (〇) -ch2c (0) -r9, -Η, and .C (O) -C (O) -〇Rl0: Each R9 is selected independently and the following includes -Ar3 and Cu or The branched alkyl group is optionally substituted by Aγ3, wherein the -Cl-6 alkyl group is optionally removed: each R10 is independently selected from the following including -H'-Ar3'C3-6 cycloalkyl, and -CU6 is directly or The branched alkyl group is optionally substituted by Αγ3, where -CN6 alkyl is optional! Unsaturated; each Rn is independently selected from the following including: • Aγ4,-(CH2) 丨 · Aγ4, -Η, and -C (0) -Ar4;

Rl3 is selected from the following including H'Ars' and Cl.6 straight or branched alkyl, optionally Ar3, -CONH2, -OH, -OR9, or -C02H% substituted · 0Rn is optionally- Ν (Η) β〇Η; each R2l is independently selected from the group consisting of-straight or branched alkyl:

Ar2 is independently selected from the following, in which any ring may be-卩 丨 single or multiple substitution as required;

1235157 Λ7 B7 V. Description of the invention (52 where each Y is independently from the following including 0 and S: each Ar3 is a cyclic group 'is independently selected from the following including an aryl group which contains 6, 10, D, or 14 atoms and 1 The main J rings 'and aromatic heterocycles / groups contain 5 to 1 5 partial ring atoms and 1 to 3 rings'. The heterocyclic ring contains at least one selected from -SO-, S02, and -NH-, · N (Ι15 ), And heteroatoms of -N (R9)-, the heterocyclic ring contains more than one double bond as needed, the heterocyclic ring contains more than one aromatic ring, and the ring base is-(^ Single or multiple fluorenes: Each Aγ4 is a cyclic group, independently selected from the following including aryl groups containing 6, 10, u or 14 carbon atoms and 1 to 3 rings, and fluorene heterocyclic groups containing 5 to 15 A cyclosaccharid and 1 to 3 rings, the heterocyclic ring containing at least one selected from -〇-, _s ·, _s〇, SO: '= N-, -NH -'- Nd)-, and -N (R9 ) · Heteroatom, the heterocyclic group may contain more than one double bond as required, the heterocyclic group may contain more than one aromatic ring, and the cyclic group may be a single or multiple substitution as required by _ (^ : Each Q [is independently selected from the following including -NH2, -C〇2H, -cn, -F ,, palpitations 1 · {FTr gas reads back f / λ and then attaches it to the page) Order • N02, -CN '= 〇' · 0 页, -perfluoro cN3 alkyl, &, e〇R5 The staff of the Central Ministry of Economic Affairs of the Ministry of Economic Affairs Consumption cooperation printed NHR5 ^ 0R9, .NHR9, r9, -C (0) .Rl Ό ,, V-The restriction is that when substituted by Ql group, it contains more than one additional Αγ3 is another Αγ3 substitution. · The preferred compounds of this /, / ϊα κ sentence include the following, but are not limited to them: and, Α 55 This paper has the old rule "Guo Guoxian τ ^ τ ^ (7 ^ 297)" 1235157 AT B7 jn. Description of the invention (53)

226e

0 227e

o

1235157 A7 B7 V. Description of the invention (54) ο 307b

429 CPA »called 0〇VvH Η ο ο

Ο 826e

827e

α -57- The paper Λ degree is suitable for China National Kneading Rate (CNS) Α4 size (210 × 297 mm) t «ittsumlitinf« V »I ·: 丨 ·, · 丨 --------- button clothes- -c (please read the notes on the back before filling in this page)

C 1235157 A7 B7 V. Description of the invention (55) 〇 9〇07

907b (Please read the precautions on the back before filling this page) 0

1029 Specific Example C applies a preferred compound of formula (Π), wherein the other substituents are as defined above. Elite Example C applies other preferred compounds of formula (II), wherein R1 is (el2) and the additional substituents are as defined above. Specific example c applies other preferred compounds of formula (π), where Ris (yl) and additional substituents are as defined above. Other preferred compounds of formula (π) with example c, wherein Ri; |: (y2) and the additional substituents are as defined above. Specific Example C applies to other preferred compounds of formula (II), wherein R is ⑴ and the other substituents are as defined above. 58- This paper music scale is applicable to the Chinese National Standard (CNS) AA specification (210X297 mm) 1235157 A7 ~ _ ------- V. Description of the invention (56) ~ There are only other examples of the c-type (II) Preferred compounds wherein & are (w2) ^ other substituents are as defined above. R 'is good (R2) is (W2) and m is 1: ring C is benzopyridine, pyridino or phenenopyrene; R3k from -C (〇), h, -C (〇 > Ai ,, And -C (〇) CH2 · 丁 厂 R " R5 is selected from the following including:-/ -C (〇) -Rl〇, where ri〇 is -Ar;---c (〇) -〇r9, where; < (〇) (: (〇) Xun 10, where R10 is -CH2Ar3; R9, where ^ is 匚 2 alkyl, is A. Substituted ... and -C (0) C ( 〇) -〇R1〇, where Ri〇 is · CH2Ar ;; ^ Yes. Or S:-R6 is Η: R8 is selected from the following including C (〇) -R1〇, -C (0) -CHr〇Ri. , And -C (0) CH2-N (R1〇) (R1〇), where ri〇 is η, ch3, or CH2CH3:

Rh is selected from the following including -Ai: 4,-(cha 丁丁 γγ4, and · 〇 (〇) -ΑΓ4:

Rl3 is a fluorene or a straight or branched alkyl group optionally substituted with-Αγ3, -〇η, -〇r9 or -C02H, the center of which is ^^ branched or linear alkyl group, where Αγ3 is morpholinyl or Phenyl 'where phenyl is optionally substituted by h: Aγ2 is (hh): · Y is 0: Aγ3 is phenyl, fluorenyl, "selphenyl, quinolinyl, isofluorene", linyl, Oxazolyl, benzimidazolyl,. Fluorobenzophenoyl, tr thiadiazolyl, benzotriazolyl • 59 · Large-scale paper-killing scale quick-use China National Standard (CNS) A4 regulations are · (210X297 mm) —

1. 1235157 Λ7 B7 V. Description of the invention (57), benzo [b] thiophenyl, benzofuryl and pentanyl; A r4 is phenyl, tetrabenzyl, amyl, said radon, hydrazone 4-based, edge-based or Η-based: each independently selected from the following including -NH2, -Cl, -F, -Br, -OH, -R9, -NH-R5, and its center is-中心Ib or -S (〇) 2-R9, -〇R5 where R5 is -C (O) -R10, -〇R9, -NHR9, and 〇 * / \ Ch2, \ /. 〇 Wherein each R9 & R1q Independently -Cle6 straight or branched alkyl, optionally substituted by Ar3, where eight 1 * 3 is phenyl; the limitation is that when -eight 1 * 3 is Qi group substitution, it contains more than one additional -Aγ3 This additional -octyl group is not substituted by another-Αγ3 group. The compounds of this specific example are preferred, but are not limited thereto ... (Please read the notes on the back of the page P. This page) -Printed by the Central Government Bureau of the Ministry of Economic Affairs, Printed by the Bayer Consumer Cooperatives • 60- The paper scale is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 Λ7 B7 V. Description of the invention (58) 605a

OH Η 605b 605c

Please read the note of δ first. ¥ ¥ Buy Binding 605d Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 605e 0

ο 61 · The size of this paper is applicable to China's national kneading rate (CNS) A4 specification (2 丨 0X297 mm) 1235157 A7 B7 V. Description of the invention (59) 605f

S05g 0

ΌΗ 605h -Ο Ο

605i Consumption cooperation among employees of the Central Bureau of Standards of the Ministry of Economic Affairs. Printed by the agency 605j 0¾ -62- This paper iron standard is applicable to 7 national standards (CNS) A4 specifications (210X297 mm) -------- continued ---- -. Order ------_ (Please read the notes of back > 8 before filling out this page) 1235157 Λ7 B7 605m 605η V. Description of the invention (60)

I again Ο

Ministry of Economic Affairs, Central Bureau of quasi-bureau, Department of Industrial and Consumer Cooperation. Society Printing ^-. 605p 605q

〇 • 63 The size of this paper is applicable to Chinese national standard (CNS) A4 specification (210X297 mm) 1235157 AT B7 V. Description of the invention (61) Staff consumption cooperation of the Central Bureau of the Ministry of Economic Affairs

(Please read the precautions of yT before filling out this page) -64-The paper size is applicable to the Chinese national standard (CNS M4 specification (210X297 mm) 1235157 A7 B7 V. Description of the invention (62 619 0

0H Η 6 020 Ο

(Please read the notes on the back before filling in this I) 621

Order 622

In the HO Μ Central Ministry of Economic Affairs, Central Bureau of quasi-government, shellfish consumer cooperation, Du Yin ¾ 623

65 Paper size suitable for China National Standard Vehicle (CNS) M Regulation (210X297 mm) 1235157 AT B7 V. Description of Invention (63) 624

625 626 CH3-627

(Please read the precautions on the back before filling out this page.) The 4th Central Bureau of the Ministry of Economic Affairs, the Inflammation Consumer Cooperatives 628

-66 This paper iron scale is applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 A7 B7 V. Description of the invention (64) 629 630 0

Ο 631 〇

Ο

(Please read the notes on the back before filling this page)

Order 632

633

634 0

• 67 The standard for this paper is Chinese National Standard (CNS) A4 (210X297 mm) 1235157 A7 B7 * Should be used. 5. Invention Description (Fang) 635 Specific Example C Application of other preferred compounds of formula (II), Where \ is (el 0), 乂 5 疋 CH 'and the other substituents are as defined above. Specific example C applies a preferred compound of formula (II), wherein 1 ^ is Bu 10), x5 is CH, R3 is CO-Ar2, and other substituents are as defined above. Specific example C uses other preferred compounds of formula (II), where \ is 〇10), X5 is CH, R3 is -C ^ OhCHrTVR ", Rh is-(CHJw-Aq, and other substituents are as defined above. Specific Example C applies other preferred compounds of formula (Π), where 1 ^ is Bu 1), and X5SCH and R3 are -C (0) -CHrTrRn; Ding is 0; and Rh is -C (0) -Ar4 And the other substituents are as defined above. Preferably, among these preferred compounds, r5 is selected from the group consisting of: -c (〇) -R10, -c (〇) o-r9, and -C (O) -NH-R10. Columns include : In addition, among these preferred compounds, R5it is from Τ-S (0) rR9, _-s (o) 2-NH-R10, • 68 paper size iron standard suitable for middle-g countries (CNS) A4 specifications (210 x 297 mm) 0 Office clothes-(Please read the precautions on the back before filling this page) Order: 7 I /-· — 1235157 Λ7. ______B7 ___ V. Description of the Invention (Part) -C (O) -C (O) -R10, -R9, and -C (〇) -C (O) -ORl0 ο / best, among these preferred compounds, m is 1; Ding is 0 or S: R 3 Is Η or -CC4 or straight or branched, as required -Ar3, · _0Η, -OR9 or -CO ^ H substituted 'where Rg is -Cl〆 branched or straight-bonded xyl' where 疋 morpholinyl Or phenyl, where phenyl is optionally substituted with Q 1; R21 is -H or -CH3: R5i is CN6 straight or branched alkyl, optionally substituted with Ar3, of which Ar3 昃 benzyl, as required -Qi substitution; 112112 is (hh): Y is 0, and Aγ3 is phenyl 'triyl' β-sedenyl, tetrabenzyl, heterobenzyl, pyrazolyl. Sedazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, 4-pheno-4phenyl, imidazolyl, oxadiazolyl, benzo [b] thiobenzyl, pyridyl, benzo Furanyl, and indolyl: printed by the Consumer Cooperative of the Central Bureau of the Ministry of Economic Affairs

Ar4 is phenyl, tetrazolyl, pyridyl, oxazolyl, fluorenyl, pyrimidinyl, or 4phenyl: each Qi is independently selected from the group consisting of -NH2 ,, C1, -F, -Br, -OH,- R9, -NH-R5 where R5 is -c (o) -r10 or -S (0) 2-R9, · 〇Ι15 where R5 is -C (O) -R10, -0R9, -NHR9, and 1 69- The paper and iron scales are in accordance with Chinese National Standards (CNS), 8 and 4 grids (210X297 mm) 1235157 A7 __—_ B7 V. Description of the invention (67) 〇 / 乂 CH ，, \ 〇 /-where each R9AR1 (3 unique third A straight or branched alkynyl radical is substituted as desired, wherein six 1: 3 is a phenyl group; the limitation is that when -eight ^ is Q! Substitution, it includes more than one additional -Ar3 group The additional · Aγ3 group is not substituted by another group. Specific example c applies to other preferred compounds of formula (π), where, Ris (el0), X5 is CH'R; is -C (0) -H, and the other substituents are as defined above. In these preferred compounds, R5 is selected from the group consisting of: -C (O) -Rl0, -c (o) o-r9, and -C (O) -NH-R10. In addition, in these preferred compounds, R5 is selected from the following: -S (0) 2-R9 '-S (O) rNH-R10 -C (O) -C (〇) -Rl0, -R9 'and printed by Shelley Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs -C (O) -C (O) -ORl0 0 is the best, among these better compounds In the formula, m is 1; 1 ^ is 0 or S; R13 is fluorene or -Cm straight or branched alkyl, optionally substituted by -Ar3, -0H, · 〇κ9 or -C02H, wherein R9 * -Cm is branched or straight Alkyl group, where Αγ3 is -7'Q- This paper size is applicable to China National Standards (CNS) A4 specifications (210X297 mm) " '1235157 A7 B7 V. Description of the invention (68) Maeraki or stupid Where phenyl is optionally substituted by Q ^; 2 is or -CH3; is a straight or branched alkyl, optionally substituted by Aγ3, where Aγ3 is phenyl, and optionally -Q, substituted: Αγ2 is (hh); Y is 0, and

Ar * 3 is BenQ, Yenki. Sedyl, glutamyl, isoctadyl, daggeryl, alkynyl, oxalyl, benzoyl, benzotrisyl, benzoyl stilbene, = sphenyl 4-phenyl, imidazolyl, Thiodifyl, benzo [b] thiophenyl, pyridyl, benzofuranyl, and fluorinyl: ΑΓ4 is phenyl, tetradecyl, fluorenyl, fluorenyl, fluorene, vol. Rhenyl, or 4-phenyl: each h is independently selected from the group consisting of -NH2, -cn, -F, -Br, -OH, -R9, and NH-R5, where 115 is -C (0) -R 丨. Or · 5 (0) 2 · Ι19, -〇R5 where R5 is • C (O) -R10, -OR9, -NHR9, and Ο CH- / \ \ 〇 / Consumer Consumption Cooperation of the Central Bureau of Standards, Ministry of Economic Affairs ¾ where each of 119 and 1110 are independently -0 or 6 straight or branched alkyl groups, which are optionally substituted by Aγ3, where Aγ3 * phenyl; the limitation is that when -eight "is substituted with 卩, which contains One or more additional Aγ3 groups, the additional Aγ3 groups are not replaced by another -Aγ3 group. The specific example C should be other preferred compounds of formula (II), the center of which is Bu 1), and X5 is CH 'R; is CO-CHyTi-Rii, and R " is-Ar #' and others • 71-Paper ruler Applicable to China National Standard (CNS) A4 Zhuge (2 〖0χΜ7mm） 1235157 7 A7 B7 Shellfish Consumer Cooperation • Press of the Central Government Bureau of the Ministry of Economic Affairs Ⅴ. Description of Invention (69) The substituents are as defined above. Fortunately, among these preferred compounds, r5 is selected from the group consisting of: -C (〇) -R10, -C (0) 0-R9, and -C (O) -NH-R10. In addition, among these preferred compounds, In the formula, r5 is selected from the following: -s (o) 2-r9, -S (O) 2-NH-R10, -C (〇) -C (O) -Rl0, -R9, and -C ( 〇) -C (〇) -OR10 ο best, in these preferred compounds, m is 1; ^ is. Or S; Rn is Η or -CN4 straight or branched alkyl as desired -Ar3, -OH , -〇R9, or -C02H substitution, where R9 * -CN4 * branched or straight-chain alkyl, where Ai: 3 is morpholinyl or phenyl, where phenyl is optionally substituted by I: R21 is -H Or -CH3; R5i is a C ^ 6 straight or branched alkyl group, optionally substituted by Ai * 3, where Aγ3 is phenyl, optionally substituted by -Qi; Ar2 is (hh); Y is 0, And Ar3 is phenyl, fluorenyl, fluorenyl, fluorenyl, isorinolinyl, pyrawyl, oxazolyl, isoxazolyl, benzotriazolyl, benzotriazole 4-phen • 72- (Please read the note on the back page first)-Binding paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 A7 ^ ____ B7 _ · Five 'invention description (70) 4-Phenyl, imidazolyl, thienyl, benzo [b] thiophenyl, pyridinyl, benzofuranyl, and 4-phenyl;

Ar4 is phenyl, tetrazolyl, pyridinyl, oxazolyl, pyridine, pyrimidinyl, or 4phenyl: each (^ is independently selected from the following including -NH2, -Cl, -F, -Bit, -oh , -R9, -NH-R5 where R5 is -C (0) -RI〇 or, s (〇) 2-R9, -〇r5 where R] · is -C (0) -R1〇, -0R9,- nhr9, and · 〇

\ 〇 / wherein each Rg and R 10 are independently -C straight or branched alkyl groups, substituted as desired, where Aγ3 is phenyl: The limitation is that when -Ar > 3 is substituted by Qi group, Contains more than one additional -Ar3 group, this additional ΑΓ3 group is not replaced by another Αγ3 group. Specific example C should be other preferred compounds of formula (II), wherein R1 is (el0), X5 is N, and the other substituents are as defined above. Specific Example C applies a preferred compound of formula (Π), wherein Ri is (elQ), X5 is N, R3 is CO-Ai * 2 'and the other substituents are as defined above. Printed by Shellfish Consumer Cooperative, Central Bureau of Standards, Ministry of Economic Affairs (Please read the notes on the back before filling out this page} Specific Example C: Other preferred compounds using the compound of formula (II), where \ 是 (^ 1〇), x # N, r3 is < (〇κ: η2-τγιιπ, 3. Αγ4, and other substituents are as defined above. Specific Example C applies other preferred compounds of formula (II), wherein Ri is (elO), and X5 * N, and -73-This paper's scale applies to Chinese National Standards (CNS), 8 squares (210X297 mm), 1235157 A7 B7 V. Description of the invention (71) Ding is 0; and

Rh is -C (0) -Ar4 and the other substituents are as defined above. Preferably, among these preferred compounds, R5 is selected from the group consisting of: -C (〇) -R10 '-C (〇) 〇-R9, and -C (〇) -NH-Rl0. In addition, among these preferred compounds, R5 is selected from the following including r -S (〇) 2-R9 '-S (〇) rNH-R10,--C (〇) -C (O) -R10, R9, And -C (O) -C (O) -OR10. Preferably, among these preferred compounds, r5 is selected from the group consisting of -S (0) 9-R9'-S (O) 2-NH-R10, -C (〇) -C (〇) -R10,- R9, and--C (〇) -C (〇) -OR100m is 1; consumer cooperation of employees of the Central Standards Bureau of the Ministry of Economic Affairs. Or S; Ruler 13 is Η or-(: .. 4 straight or branched alkyl is optionally substituted by-Αγ3, -OH, -0R9, or -C02H, where R9 * -CN4 is branched or linear alkyl, where Αγ3 is morpholinyl or phenyl, of which phenyl is substituted by I as required; R21 is -Η or -CH3; -74- This paper size applies to the national S standard (CNS M4 specification (210X297 mm) 1235157 A / B7 V. Description of the invention (72 The Central Government Standards Bureau, Ministry of Economic Affairs, Crying, Consumer Cooperatives · Social Printing Feet 51 is a straight or branched cymbal base, which is replaced by Ar3 as needed, where Αγ3 is Phenyl, substituted if necessary: Aγ2 is (hh):, Y is 0, and Aγ3 is phenyl, fluorenyl'thienyl, quinolinolyl, isomerinyl, phyllyl, 9 plug Benzyl 'isopyridinyl' benzotriolyl, benzimidyl 4-yl, phenenofluorenyl, imidyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzo Aryl 'and 4'-Midyl: Ar4 is phenyl, tetrazolyl, pyridinyl-, oxazolyl, pyridyl, pyrimidinyl, or phenanthryl; each is independently selected from the following including N 包括 2, -Cl, -F, -Br, -OH, -r9, -NH-R5, where rule 5 is · Ε (0) · κιο or -S (0) 2-R9, -〇r5 where ^ is -C (O) -R10, guan 9, NHR9, and / V, v where each R9 and Rio are independently _ci · 6 straight or branched alkyl, optionally substituted by Aγ3, where Aγ3 is phenyl; the limitation is that when -eight 1: 3 is substituted, it contains more than one -Aγ3 group, In addition, the Aγ3 group is not substituted by another -Aγ3 group. Specific Example C Another preferred compound, using formula (II) where 1 ^ is ^ 1〇), X5 is N, and R3 is -C (0) -H And other substituents are as defined above. Preferably, among these preferred compounds, r5 is selected from the following including: -C (O) -R10, -75 · The standard of this paper applies the Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the notes on the back of the book I > Binding 1235157 A7 B7 V. Invention Description (73) -C (〇) 0-R9, and • C (O) -NH-Rl0. In addition, In these preferred compounds, r5 is selected from the group consisting of -S (0) 2-R9 '-S (O) 2-NH-R10, -C (O) -C (O) -R10, -R9, And -C (O) -C (O) -OR10. Compared with 妤, in these preferred compounds, _ m is 1: ^ is. Or S: · R13 is Η or -CN4 or Branched alkyl, optionally substituted by ηΓ3 '-0R9, or · 0: Ο2Η, where 119 is 分支 4 branch or straight υΗ, where Αγ3 is morpholinyl or phenyl, where phenyl is A & radical 'R21 is -Η or -CH3: Chi 51 is a straight or branched alkyl group of CI · 6, if necessary, A1 · 3 is substituted, Ar3 is phenyl, and if required, substituted by -Qi : 8 1: 2 Yes (hh); On behalf of them. Xin batch of clothes-r'v f resign and read the precautions on the back before filling out this page} Order the Ministry of Economic Affairs Central Government Bureau of Procurement Bureau's consumer cooperation seal YYes 0, and Aγ3 is a phenyl group, a stilbene group, a sedenyl group, I: stilbyl group, iso, quinoxaline 4 group, exoxazolyl group, 4 oxazolyl group, isoxazolyl group, benzo'triazole group , Benzimidazolyl, 4pheno. Sedphenyl, imidazolyl, 4-diazolyl, benzo [b] thiophenyl, bishexyl, benzofuryl, and azinyl; Aγ4 is phenyl, tetrazolyl, pyridyl, oxazolyl , Benzyl, Pyridyl-76- This paper size applies to China's National Standards (CNS) A4 specifications (2 丨 0X297 mm) 1235157 A7 B7 Consumption cooperation between employees of the Central Provincial Bureau of the Ministry of Economic Affairs · Du Yin «. V. Description of the invention (74), or fluorenyl: each 卩 丨 is independently selected from the group consisting of: NH2, -Cl, -F, -Br, -OH, -R9, -NH-R5, where R5 is -C (〇) -Ri〇 or -S (0) 2-R9, -or5 where r5 is -C (0) -Ri〇 '' -NHR9 'and 〇 /) CH,, / /' 〇 wherein each of R9 and R10 is independently -cle6 straight or branched alkyl, optionally substituted by Aγ3, where Aγ3 is phenyl. The restriction is that when -Aγ3 is substituted with a Qi group, it contains more than one additional -Ar3 group, and the additional -Αγ3 Not substituted by another Aγ3 group. Specific Example C Other preferred compounds, where formula (π) is used where Ri is (e10), X5 is N, 113 is CO-CHrTVRn, and 11 丨 1 is -Ar4, and other substituents are as defined above. Preferably, among these preferred compounds, R5 is selected from the group consisting of: -C (O) -Rl0, -c (o) o-r9, and -C (O) -NH-R10. In addition, in these preferred compounds In the compound, R5 is selected from the following: -S (0) rR9, -S (O) 2-NH-Rl0 »· -C (O) -C (O) -R10, -R9 ', and • C (O ) -C (O) -OR10 〇-77 · The paper size is in accordance with Chinese National Standards (CNS) A4 specification (2 丨 0 × 297 mm) (please read «Notes on back δ before filling in this X) Pack- Order 1235157 V. Description of the invention (75) The best, among these preferred compounds: m is 1; T1 is 0 or S: RU is Η or · ~ straight or branched base, as necessary-such as -0 'or . Ah substituted 'where the rule 9 is, straight or branched pit, where is stilbyl or phenyl, where phenyl is R21 is -H or -CH3 as needed;. Straight or branched alkyl, as Needs to be substituted by Aγ], where a is phenyl, optionally substituted by -Qi:-8 3 Aγ2 is (hh): Y is 0, and A1 · 3 is phenyl, fluorenyl, and sephenyl Stilbene, stilbene, stilbyl, isoxazolyl, isoxazolyl, benzotriazolyl, benzimidyl, stilbene, stilbene, stilbene ?, Thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzo squeak and tetrahydrothiopyranyl, the I voice group:

Ai: 4 is phenyl, tetrazolyl, pyridyl, oxazolyl, fluorenyl, pyrimidinyl, or β-secenyl: each Ch is independently selected from the group consisting of: ΝΗ2, -Cl, -F, -Br, -OH , -R9, -NH-R5, where 115 is-(:( 0) -11 丨 〇 or · 5 (0) 2 · Ι19, -〇R5 where r5i • C (0) -R1〇, -〇R9, -NHR9, and • · o ./, CH ,, \ / -〇 where each R9 & R1 () is independently -Cw straight or branched alkyl 'if necessary -78 Kneading rate (CN, S M4 grid (2l0 × 297 mm) · τ / TV (Please read the note on the back ¾ before filling out this page) Order printed by the Central Ministry of Economic Affairs, Bureau of Shellfish Consumer Cooperative ¾ 1235157 Α7 Β7 Li Yanming explained (76) that Αγ3 was substituted, in which eight 1 * 3 was phenyl; ... the limitation is that when -eight 1: 3 is Qi group, it contains more than one additional -Ar3 group. The -Arj group is not substituted by another Ar $ group. Preferred compounds of Specific Example B include the following, but are not limited thereto:

302

(Please read the notes on the back before filling out this page) 304a

Η 〇. Χη3 Economic cooperation with the Central Central Bureau of quasi-government, shellfish consumer cooperation, Du Yinli ci3e

-79 The size of this paper is suitable for Chinese National Standard (CNS) A4 specification (210X297 gram) 1235157 B7 V. Description of the invention (77) 902 904a 〇

Preferred specific examples of CH3 C compounds include but are not limited to the following: • 80

The size of this paper adopts Chinese National Standard (CNS) A4 specification (2 丨 0X29? Mm) 1235157 Α7 Β7 5. Description of the invention (78 214c 0

0H Η 0 214e Ο

OH Η Ο Ο 217 c

Ο 217d

Central Government Bureau of the Ministry of Economic Affairs

6 4 2 ΝΗ

ΝΝ ο Η ο ο ΝΗ

OH 81 (Read the precautions on the back before filling in this card)

This paper size is applicable to China National Standard (CNS) A4 (210 × 297 mm) 1235157 V. Description of the invention (79) 257 265 280 281 Λ7 B7

0H Η 0 0

〇

Printed by the Central Standards Bureau of the Ministry of Economic Affairs, Consumer Cooperatives 283 〇 282

Ο

-82 · (Please read the precautions on the back before filling this page)

This paper music scale is applicable to the Chinese National Standard (CNS) A4 specification (210 × 297 mm) 1235157 Λ7 B7 V. Description of the invention (80)

The paper size of the paper applies to the Chinese National Standard (CNS) A4 (210 X 297 mm) 1235157 A7 B7 V. Description of the invention (81 406 Η Ο 407 0

-------- Clothing-(Please read the precautions for the back of vB before filling in this f) 408 0

OH order 409 Ο

Printed by the Central Government of the Ministry of Economic Affairs of the People's Republic of China, Li Weiying, Industrial and Commercial Cooperatives 411 Ο 410

Ο Ο

This paper size applies to Chinese National Standard (CNS) A4 specification (210 × 297 mm) 1235157 A7 B7 V. Description of invention (82) 412 0

0 413 Η 0 (Please read the notes on the back before filling in this page) / * 、 • equipment 415

Order 416 417 I 〇 ο

.0 c'v〆 .; · 418 Ο

The paper scale is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 A7 B7 V. Description of the invention (83) 9 1 4 ο Λ

OHH ο 2 4 ΝΗ ΟΑ

O ^ N.N ^ OO 2 2 4 ο / \ Ν. Ν

3 2 4 ΟΗΟΠΟ. On ^ vo ouff ο £.命: ΝΗΟΛν # 衣 丨 — (Please read the precautions on the back before filling out this page) Order I Printed by the Military Industry Consumer Cooperative of the Central Standards Bureau of the Ministry of Economy 4 2 4 5 2 4

Η

86 The size of this paper is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 A7 B7 V. Description of the invention (84) 426 Ο

0H Η 0 430 0

OH Ο 431 Ο

/? / 〇Η ° 〇λΝΛΤΗ 432 Ο Η

433

434 87

The paper scale is applicable to China National Standards (CNS) A4 specifications (2 丨 〇 × 297 mm) 1235157 A7 B7 V. Description of the invention (85) 435 0

0H Η 436

(Please read the notes on the back before filling out this page) 437 0

0Η Η Ο Ο 438 439 Ο

440 Ο

ΟΗ 88 · The size of this paper is applicable to China National Standards (CNS) M specifications (2 丨 0X297 mm) 1235157

V. Invention Description (86)

The paper scale is applicable to China National Standards (CNS) A4 specifications (210X297 mm) 1235157 AT B7 V. Description of the invention (87 S 4 4

4 4 ΗΝ

OHH ΟΛνο) * ΝΗ ^ Χ3 Λ ° (Please read the precautions on the back before filling this page) δ 4 4

Η 4 4

οηη0 = 0 = 0 Printed by the Central Government Office of the Central Government Bureau of Work and Consumer Cooperation ο

Η V οηη0 = 0 = 0 ο 90 The size of this paper is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 A7 B7 V. Description of the invention (88) 0 451

0 452 0 JD1

0H Η 0 453 454 0

0 — ·· *. · ,, -i:-. 1. (, f i .---- 17 455 456 0

0 CI 0

The paper scale is applicable to China National Standard (CNS) A4 (210X297 mm) 1235157 A7 B7 V. Description of the invention (89) 457 0

0H Η 458 0

(Read the precautions on the back before filling this page) 459

460 0

OH Η 4S1 462 Ο

• 92- The standard of this paper is applicable to Chinese National Standard (CN ’S) A4 specification (210X297mm) 1235157 A7 B7 V. Description of the invention (90) 463 A Η 464 Ο ^ νΟ? Λη Η Ο ο 465

Η Ο (Please read the precautions on the back before filling this page) J Pack 466 Ο

ΟΗ CI Order 〇 467 468 Ο

-93 This paper uses the Chinese national standard (CNS > A4 size (210X297 mm) 1235157 AT B7 V. Description of the invention (91) 4S9 0

OH 470 Ο

471

ο HP

H3C Ο 472 ο 473

〇 • 94- This paper size applies to Chinese National Standard (CNS) A4 specification (210: < 297 mm) (Please read the precautions on the back before filling this page)

1235157

-95 · The size of this paper is applicable to 11 Chinese twins (CNS) M specifications (210X297 mm) 1235157 V. Description of the invention (93) 479 482 A7 B7 0

0

Ο 481

0 481s

Ο

-96 ·

This paper size applies to the Chinese standard 隼 (CNS) M pit (2 丨 0X297 mm) 1235157 A7 B7 V. Description of the invention (94) 483

0 482S

cA 0

OH, Η Ο (Read the notes on the back before filling in this page) Ο 484 Ο

ΟΗ 485 Ο 486 Η Η 〇 -97 The standard of this paper is applicable to China Standard S (CNS) A4 standard (2Ι0 × 297 mm) 1235157

i. Description of the invention (95 487

Hj Ο

488 Ο

OH Η (Please read the notes on the back before filling in this page) 489 Ο

490 Η Η Ο 491 Ο

ΟΗ Η -98

The paper scale is applicable to China National Standard (CNS) Α4 size (2U3X297 mm) 1235157 AT B7 5. Description of the invention (96) 0 C0

F OHHX " -ο-

OHH

b

α 99 (please «read the precautions on the reverse side before filling out this page). The size of this paper is applicable to the Chinese National Standard (CNS) M specification (210X297 mm) 1235157 A7 B7 V. Description of the invention (97) 498 0

499 0

(Please read the notes on the back before filling in this book) 814c 〇

Ο 817c

Ο 817d

100 · The size of this paper is applicable to the Chinese National Standard (CNS) A4 grid (210X297 mm) 1235157 V. Description of the invention (98) 817e Ο

A7 B7

Η 〇

880 Ο

Ο 881 882

• Consumer Co-operation of Shellfish Consumers in the China Provincial Bureau of Samples and Printing 883 Ο

-101 (Please read the precautions on the back before filling out this page)

The paper size is applicable to 11 national standards (CNS M4 specification (210X297 mm) 1235157 A7 B7 V. Description of invention (39) 884 0

885 〇

(Please read the notes on the back before filling this page)

Winter C 886 〇

Order 887 〇

Printed by the Consumers Cooperative of the Central Government Bureau of the Ministry of Economic Affairs «. Ο 1004

102 This paper size applies to Chinese National Standards (CNS) M specifications (2 丨 0X297 mm) 1235157 A7 B7 V. Description of the invention (10 °) 1005 1006 1007 1008 1009 Ο

0

The dimensions of this paper are in accordance with Chinese National Standards (CNS), 6.4 (210X297 mm) (please read the precautions on the back before filling out this page) 1235157 A7 B7 5. Description of the invention (1Q1) 1010 〇

1011 〇

(Please read the notes on the back before filling this page) 1012 〇

Order 1013 〇

1015 〇

104 The paper kill scale is applicable to the Chinese National Standard (CNS) A4 specification (2 丨 0X297 mm) 1235157 A7 B7 V. Description of the invention (102) 1016 〇

OH 1017 Ο

(Please read the notes on the back before filling this page)

1018 Ο

Ding 1019 Ο

1020 Ο

105 · The national standard rate (CNS) of this paper is applicable. A4 grid (210 × 297 mm) 1235157 A7

The size of this paper is applicable to China National Standard (CNS) A4 specification (210X297 mm) 1235157 A7 B7 B Description of invention (104) 1030 〇

1031 1032

N

--------- Outfit-(Please read the precautions on the back before filling this page) Order 1033 Ο

X034 Ο

-107- The paper scale is applicable to the Chinese National Standard (CNS) A4 grid (210X297 mm) 1235157 AT B7 V. Description of the invention (105) 1035 Ο

1036 Ο

(Notes on reading δ in the first reading before filling out this page) 1037 Ο

1038 Ο

ΟΗ S? Printed by the Ministry of Economic Affairs, Chongyang Municipal Standard Bureau, Shellfish Consumer Cooperative «. 1039 Ο

The standard of this paper applies to the national standard rate of China (CNS) A4 specification (210 × 297 mm) 1235157 A7 B7 V. Description of the invention (106) 1040 〇

1041 〇

(Please read the notes on the back before filling out this page) 1042 0

Order 1043 Employee Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 1044 〇

Ο

This paper size applies to China's national kneading rate (CNS) A4 specification (210X297 mm) 1235157 A7 B7 V. Description of the invention (1Q7) 1045 Ο

1046 Ο

(Please read the notes on the back before filling this page)

1047 Ο

Order 1048 Ο

Printed by the Consumer Standards Cooperative of the Central Standard Bureau of the Ministry of Economic Affairs 1049 〇

• 110 paper size is applicable to Chinese standard (CNS) A4 (210X297 mm) 2 1235157 A7 B7 V. Description of invention (10S) 1050 1051 1052 0

Ο Ο

Η 〇

OH (Please read the notes on the back page first)

• 1T

I Central 1 > quasi bureau. Industrial and consumer cooperative seal% 1054 Ο 1053

〇

-111 The size of this paper is suitable for Chinese standard (CNS) A4 size (210 × 297 mm) 1235157 Λ7 B7 V. Description of the invention (109) 1055 0

1056 Ο

(Please read the precautions on the back and then 3 pages) ——Install 1057 1058 〇

Order Printed by the Shellfish Consumer Cooperative of the Central Standards Bureau of the Ministry of Economy 1059 0

112 This paper size applies to one Chinese standard (CNS> A4 size (210X297 mm) 1235157 Λ7 B7 V. Description of the invention (110) 1060 Ο

Ο

, Η Ο 1061 (Please read the precautions on the back of Jing before filling this page) 1062 1063

〇 Order Consumption Cooperation of Employees of the Central Standards Bureau of the Ministry of Economic Affairs · Du printed 1064 〇 a; 〇Vt: -113 This paper is a universal medium-sized national standard (CNS) A4 Regulation (210 × 297 mm) 1235157 _ Λ / Β7

V. Description of the invention (11V 〇

〇

1065 1066 1067 〇

〇1068 〇〇〇 'ηΥ The Ministry of Economic Affairs, Central Bureau of Standards, Staff Consumption Cooperatives, 1069 ο • 114- The paper size is common Chinese National Standard (CNS) M specifications (210X297 mm) 1235157 A7 B7 V. Description of the invention ( 112) 1070 〇

1071 〇

(Please read the notes on the back before filling in this I) " ^ 一 衣 1073 〇 〇 〇

〇 Order 1074 〇 Duiyin Consumer Cooperation of the Central Bureau of Standards, Ministry of Economic Affairs, Du Yin ¾ 1075 • 115 · This paper is a standard Chinese National Standard Vehicle (CNS) with a wish box (2ί〇 × 297 mm) 1235157

AT B7 V. Description of Invention (113) 1077

Ο (Please read the precautions on the back before this page) U5 * 1078 Ο

ο ο ο-" Ding 1079 ο w σ. Person ο

ο Printed by the Central Government of the Ministry of Economy

HjC .Ο ΗΝ HaC people. ο Η ° 〇ΛΝ-γΗ -116 · This standard is commonly used in S countries (CNS) Α4 size (2 丨 0 × 297 mm) 1235157

AT Β7 V. Description of the invention (114) 1081 Ο ΗζΝ

α 1081s

1082 ο

α 1083 ο β side Printed by the Central Government Bureau of the Ministry of Economy

α -117- (Please read the precautions of δ before filling in this purchase)

The iron scale of this paper is applicable to China II house mark (CNS) Α4 wash case (2 丨 0 · × 297mm) 1235157 AT Β7 5. Description of the invention (1Ί5) 1084

1085 〇

(Please read the precautions of Back Cloud before filling in this purchase) · € 1010

〇 Order 1087 〇

..Hr Consumption Cooperation of Employees of the Central Standards Bureau of the Ministry of Economic Affairs · Institute of Social Responsibility. 088 〇 Η 〇 118 This paper is in accordance with China National Standard (CNS) A4 (2I0X297 mm) 1235157 B7 V. Description of the invention ( 116) 1089 1090 1091 〇

(#First 53 Read Back 1 & Precautions before filling out this page), ιτ 1093

〇 H3C

1094

Losing voice at an appropriate age 隼 贝 1: ¾ Fees 痄 纭 $ L 1095 ο

Ο 〇 -119 · The paper size of this paper applies to the Chinese National Standard (CNS) A4 specification (210X 297 mm) 1235157 Λ; B7 V. Description of the invention (117) 1096 〇

1097 Η, 〇 1098 ο

α

OH 1099 (Τ ° jO1: H ο Central Standards of the Ministry of Economy 扃 Employee Consumer Cooperatives Seal 51 421 Ο CH3CH2

The standard of this paper is the Chinese National Standard (CNS) A4 Regulation (210 × 297 mm) 1235157 Λ7 Β7 V. Description of the Invention (118)

1021 Ο

Ο

Η -------- • Clothing-(Please read the precautions for back > B before filling out this page) Order 1027 Consumption Cooperation between Employees of the Central Bureau of the Ministry of Economic Affairs Du Yin ¾ 1028 Ο

Ο

-121-Standard of this paper: 1 national standard (0 3) 6 4 specifications (2 丨 0/297 mm) 1235157 Λ: B7 economy 邶 Central Standards Bureau, work and consumption cooperation Du Yin ¾ 5. Invention Note (119) The specific compounds of the present invention also include compounds whose structures include the structure of the structure, but are not limited thereto:

(Please read the VS7 precautions page first)

R

R-gutter

II

10

• 122 · This paper is a standard Chinese National Standard Vehicle (CNS) A4 specification (2 丨 0 >: 297mm) 1235157 A7 B7 V. Description of the invention (12Q)

What is the paper size? National Standard A (CNS) A4 specification (2 丨 0X297 mm) 1235157 Λ7 B7 V. Description of the invention (121: 21 H30 ",

R ^ 〇K where: R is .C02H% person 0 " 1〇 ΗX〇2Rl3 ， N Η

Among them η first 33 read the meaning of the cloud and write too buy

HO rule 3 is -ch3, -ch2ch3, -ch2ch2ch3, -ch (ch3) (ch3) • CH2CH2CH2CH3, -CHrCH (CH3) CH3, -C (CH3) 3, -CH2Ph, or

Printed by the Central Standards Bureau of the Ministry of Economic Affairs

, Of which -124 paper scale is applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 A7. B7 V. Description of the invention (122) r13 is -CH3, -CH2CH3, -CH2CH2CH3, -CH (CH3) (CH3), -CH2CH2CH2CH3, -CH2-CH (CH3) CH3, · ί: ((: Η3) 3, -CH: Ph, (please «read the notes on δ before filling out this page) or or each r51 is -CH3, -CH2CH3 ,: CH2CH2CH3, -CH (CH3) (CH3), -CH2CH2CH2CH3, -CHrCH (CH3) CH3, -C (CH3) 3; -CH2Ph, or together form ethylenedioxyacetal or Propylenedioxyacetal: or 4—one, where Η Ο r5 / r5I is -ch3, -ch2ch3, -ch2ch2ch3, -ch (ch3) (ch3), -CH2CH2CH2CH3, -CHrCH (CH3) CH3, -C (CH3) 3, -CH2Ph, -C (〇) -CH3 or -C (0) -Ph: R5 in each of the above compounds is compound 139, 214c, 2 Me, 404-413, 415-491, 493. Any of the R5 parts shown in any one of 01 is the same. 3 The specific compounds of the present invention also include compounds containing skeletons 1-28, but are not limited thereto, in which R, R5l and 115 are as defined above. And in compound 214 (:, 21 heart * 4〇4-413,415-418,422-426,430-456,458- 466,468,470-471,473-491,493,495,497-50 1 of -C (O)-to -CHr, -C (0) C (0)-or -CH2C (〇) C (〇) -replacement. -125- Common paper standard (CNS) standard of this paper (CNS) 8 4 Zhuge (210X297 mm) [235157 Λ7 B7 V. Description of the invention (123) Another The ICE inhibitor according to the invention (D) is of formula (I)

Ri-N-R2 I Η where: R is selected from the following and includes the following formula (elO)

----------- (Please read the precautions of s before writing ¾) (ell)

(e! 2)

R

(w2) Printed by Shellfish Consumer Cooperative, Central Bureau of Standards, Ministry of Economic Affairs (yi)

Re

• 126 · The paper kill scale is applicable to China National Standards (CNS) A4 specifications (210 × 297 mm) 1235157 A7 B7 V. Description of the invention (124) (Z)

And ring C is selected from the group consisting of benzopyridine, pyridopyrano, 4 azo, isoσsedazo, oxazomidimide, cyclopentyl and cyclohexyl. Is: 5 thiopheno, Speaking of Luo Bing, Xi Yi Bing sniffs, ^ Dian Bing, (please read the precautions of Behind the Cloud and fill in this page) (a) 〇

R5t, or ο

ORq ORst ORst (b) m is 1 or 2: each 115 is independently selected from the following including -C (〇), R 丨 〇, -C (〇) 〇-R9, • 127 This national standard applies to § national standards ( CNS) M specification (2 [〇297297 mm) 1235157 Λ " B7 V. Description of the invention (125) -C (〇) -N (Ri〇) (R10), -S (〇) 2-R9, • S ( 〇) 2-NH-R10, -C (〇) -CH2-〇-R9, • C (〇) C (〇) -Rl0, -R9'-H, -C (〇) C (〇) -〇Rl0 , And -c (〇) c (〇) -n (r9) (r10): ·, \ is -CH- or -N-: II ^ 2 is ^ {2 or 〇: χ7 is -N (R8)- Or -0-: R6 is selected from the following including -H and -CH3:

Rs is selected from the following including: -C (〇) -R10, -C (〇) 〇-R9, -C (〇) -N (H) -Rl0, -S (〇) rR9, -S (〇) 2 -NH-R10, the consumer cooperation of the Ministry of Economic Affairs, China Standards Bureau. Du Zhongzhuang-C (〇) -CHrOR10, • C (〇) C (O) -Rl0, · -C (〇) -CH2N (Rl0) (R10), -C (〇) -CH2C (0) -〇-R9, -C (〇) -CH2C (〇) -R9, -128- Chinese standard SS Lee (CNS) A4 Regulation (210X297 mm) 1235157 Λ7 B7 V. Description of the invention (12S) -Η, and -C (〇) -C (〇) _〇Rl〇 ·· Each R9 is independently selected from the following including -Αιγ3 and -Cu Direct Or the branch-alkyl group needs to be replaced by Αγ3, of which -Cle6 alkyl group is not required, and each R1 is sent from the following including -Η '-ΑΓ3' C3.6 '衣》 元 卷' And Ci.6 straight or branched alkyls are optionally substituted by Ai * 3, where -C! E6 pit bases are desirably non-existent;-R13 is selected from the following including Η, Ai: 3, and Cw straight or branched Alkyl, optionally substituted by Ar3, -CONH2, -0R5, -0H, -〇119, or -CO2H: each r51 is independently selected from the following including R9, · α〇), ιι9, -C (〇 ) -N (H) -R9 'or each r51-to form a 4 · 8 member carbon ring Heterocyclic ring containing -0, -S- or -NH-: each R21 is independently selected from the group including -H or straight or branched; each Aγ3 is a cyclic group independently selected from the following including aryl ' $ 6 '1 0, 12 or 14 carbon atoms and 1 to 3 rings, and aromatic heterocyclic group containing -5 to 1] ring atoms and 1 to 3 rings, the heterocyclic ring contains at least one selected from ^ ^, -SO-, S〇2, = N-, and -NH- heteroatoms, the heterocyclic ring may contain more than one double bond, β, the heterocyclic ring may contain more than one aromatic ring, and the ring The base is, depending on the need, a single or multiple substitution of -Q !: each Q 丨 is independently selected from the group consisting of -NH2, eC02H, -Cl ', -BΓ, -N02, -CN, = 0, -0H, -All gas Cu alkyl, R5 ... 0R5'-NHR5, 0R9, -N (R9) (Ri〇), R9'-C (〇) -Ri〇, and

CFL 〇-129 · The paper ft scale is applicable to fresh food from China and China (CNS) / \ 4 yarn (2lGX297 times) -I —--------- (Suddenly read the notes on the back ^ Fill in this education) --ΦΙ. Printed by the Bei Gong Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs ¾ 1235157 Λ 7 _ Β7 V. Description of the invention (127) The limitation is that when -Αγ3 is a Q i-based generation, it contains More than one additional -Ar; group, this additional Aγ3 group is not replaced by another -Ar3 group = better, R. -Selected from the group consisting of: -C (0) -Rl0, -C (0) 0-R9, and -C (O) -NH-Rl0. In addition, R5 is selected from the group consisting of: -S (〇), -R9, -S (〇) 2-NH-R10, -C (〇) -C (〇) -R 丨 ο, -R9, and- C (〇) -C (〇) -〇R10. Preferably: m is 1: R13 is H or-(: Bu 4 is a straight or branched alkyl group, optionally substituted by -Aγ3, -〇H, -〇R ^ IC〇2H, and its center is ^ 丨 ^ Branched or straight-chain alkyl, where Aγ3 is morphoyl or phenyl, where benzyl is optionally substituted by Q i · R2l is -H or -CH3: Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs? (Please read the notes on the back before filling in this I) hi is a straight or branched alkynyl group of q.6 'replaced by Αιγ3 if necessary', where Ai * 3 is phenyl and substituted as necessary: each Ar3 Is a cyclic group and is independently selected from the group consisting of phenyl, fluorenyl, hydrazyl, quinolyl, isoprotolyl, pyrazolyl, oxazolyl, isoxazolyl, and benzotriphenyl. Benzimidyl, acetophenenyl, imidazolyl, dioxo, phenyl [b] thiobenzyl, pyridyl, benzofuranyl, and indolyl, -130- paper scale遝 In the standard of domestic standard Li (CNS) A4 (2 丨 0X297 mm) 1235157 Λ7 B7 V. Description of the invention (128) And the ring base can be replaced by -Q1 single or multiple substitutions: each Q 丨 independent "A-MW :, -Cl, -F, -Bf, -OH, R9, -NH-R5 where 115 is -C (〇) -Ri〇 or -S (〇) 2-R9, -〇R5 whose center is-C (〇) ·! ^., -0R9,- N (R9) (R10), and 〇> CH2 '〇 wherein each of 119 and 111 (3 is independently a straight or branched alkyl group, depending on the need to be replaced by Αγ3, where Αι: 3 is phenyl: restriction conditions When -Αγ3 is substituted by a Q group, it contains more than one additional -Ar; group, the additional -Αγ; group is not substituted by another-ΑΓ3. ICE inhibition of another specific example (E) of the present invention The agent is formula (Π): (Please read the Precautions for Back Cloud page first) Packing (II) where: m is 1 or 2: It is selected from the following including (ρίτι R-6 Rt-N into R3 Η Ministry of Economics of Threading The Chinese Bureau of Standards and Technology Co., Ltd. has eliminated the cooperation. Du Yin ¾ -131-This standard is used in §S Family Standard Li (CNS) A4 Specification (2 丨 0 X297 mm) 1235157

AT B7 V. Description of Invention (129)

(elQ) (ell) (el2)

Re · (w2) Ί 0

Re (yi) 0 Re Rs-

H Duyin, Consumer Affairs Cooperation, Central Bureau, Ministry of Economic Affairs ¾ (y2)

Rs

H 〇〇 人和 -132 · This paper is common in the standard §1 Standard Li (CNS) A4 specifications (2 丨 0X297 mm) 1235157 Λ7 _ B7 V. Description of the invention (130) Please fill in this page again.) Ring C is selected from the following including benzo, pyridino, 4phenyi, tadpole, yinyi, 4 azo, iso-5 thiazo, thiazo, isoxazo, Pyrimidine, imidazo, cyclofluorenyl and cyclohexyl:: R; selected from the following: -CN, -C (〇) -H, -C (0) -CH2-TrRn ^ '-C (〇) -CHrF -C = N-〇-R9, and * -C Ο-A r ,: each independently selected from the following: -C (〇) -R10, -C (〇) 〇-R9 '-C (O)- N (R10) (Rl0) • S (〇) rR9, -S (〇) 2-NH-Rl0, • C (〇) -CH2-〇-R9, -C (〇) C (〇) -Rl0,- R9, -H, -C (〇) C (〇) -〇R10, and -C (〇) C (O) -N (R9) (R10): Yes -CH- or -N-;

II Ya 2 is 1 or 0: -133- The standard of this paper is applicable to China Standards (CNS) 8 and 4 (210: < 297 mm) 1235157 A7. B7 V. Description of the invention (131) X7 {-N (RS) -or: each Ti is independently selected from the group consisting of: 〇-, -S-, -s (〇)-, and s (〇):-: R6 is selected from the following including -H and -CH3:

Rs is selected from the following including: -C (〇) -R10, C (〇) 〇-R9, -C (〇) -NH-R10, -S (〇) rR9, -S (〇) 2-NH- R10,--C (〇) -CH2-〇R10, -C (〇) C (O) -R10, -C (O) -CH2N (RI0) (RI0) ^ -C (0) -CH2C (0) -0-R9 ^ -C (〇) -CH2C (〇) -R9, -H, and C (〇) -C (〇) -〇R10 Each R9 is independently selected from the following including: Ar3 & -C 6 straight or branched alkyl, optionally substituted by Aγ3, where -Cw alkyl is optionally Cs and: each Rw is independently selected from the following including -H, -Ar3, (: octacyclocycloalkyl, and -匚 6 straight or branched alkyl, optionally substituted by Aγ3, wherein the alkyl is optionally cesium and: 各 Each Rn is independently selected from the following including: -Ar4, ((CH:) bu;-Αγ4 '-134 · §1 standard in the use of this Fufa standard (CNS) A4 size (210X 297 Gongcheng) (Please read the precautions on the back before filling this page)-Binding 0 1235157

AT B; V. Description of the invention (132: • Η, and "C (0) -Ar4 * Please read the back of the book before you write this page. R15 is selected from the following including -OH '· ΟΑγ3' -N (H ) -〇H, and-OCu straight or branched dead group 'deemed as -Aγ3'-CONH2, .〇R5, .〇h, .〇il9, or -C02H substituted ... each independently selected from The following includes -Η or straight or branched alkyl groups: Aι * 2 is independently selected from the following, in which any ring may be -q [single or multiple substitutions as desired; (hh) and (ii) γ order ^. Where each Y Independently selected from the following including 0 and S: each Ar3 is a cyclic group, and independently from the following includes an aryl group containing 6, 10, 12 or 14 complete atoms and 1 to 3 lines' and a square heterocyclic group containing 5 to 15 ring atoms and 1 to 3 rings, the heterocyclic ring contains at least one selected from -0-hS-, -S〇-, S〇2, and -NH-, -N (R5)-'and -N ( A heteroatom of R9)-, the cone ring may contain more than one double bond, the heterocyclic group may contain more than one aromatic ring, and the ring group may be single or multiple substitutions as required by Q1: Each Arj is a cyclic group .. It is also white. The following includes aryl groups which contain 6, 10, 12, or 14 carbons. Atom and 丨 to 3 rings, and heterocyclic group containing 5 to 15 ring atoms and 1 to 3 rings, the heterocyclic group contains at least one selected from -0-, -S-, -SO ·, S〇2 , Two, and -N (R9)-heteroatoms, the heterocycle 135-, block ^ 5 is used in (-CN $); ^ (210X297 male f 1235157 AT · B7 V. Description of the invention (133) Base view It is necessary to contain more than one double bond, the heterocyclic group may contain more than one letter of aromatic ring as required, and the ring group may be mono- or multiple-substitution as required by -Qi: each Qi is independently selected from the following including- NH2, -CO2H, -Ck, -F, -Br,], -NO]--CN, = 〇, -〇Η, -perfluoro group, R5, -〇R5, -NHR5, OR9, -N (R9) (R10), R9, -C (〇) -R10, and 〇 / \ CH,,, / / ~ 〇 The limitation is that when -Ar3 is Q 丨 instead of #, it contains more than one additional -Αγ3 Group, the additional-Αγ3 group is not substituted by another-Αγ3. Preferred compounds of specific example E apply formula (II), where 1 ^ is 11) and other substituents are as defined above. Specific examples E other Preferred compounds are of formula (II), where 1 ^ is 12) and other substituents are as defined above . Specific Example E Other preferred compounds employ formula (II), wherein R is (yl) and other substituents are as defined above. Specific Example E Other preferred compounds use formula (II), wherein 1 ^ is (y2) denier Other substituents are as defined above. Printed by the Central Laboratories of the Ministry of Chaoji, Beige Consumer Cooperatives (Read the 33 notes on the back and then fill out this I) Specific Example E Other preferred compounds apply formula (II), where 1 ^ is (2) and other substitutions Basis is as defined above. Specific Example E Other preferred compounds employ formula (II), wherein 1 ^ is (w2) and the other substituents are as defined above. Better, 1 is Bu 2) and m is 1 ·· -136 · The size of the paper 伕;?! China National Standard Li (CNS) A4 specification (210X 297 mm) 1235157 Central Bureau of Standards, Ministry of Economic Affairs Back cooperation Du Yin ¾ Λ. B7 V. Description of the invention (134) Ring C is benzene, pyridino, or hydrazone: R3 is selected from the following including -C (〇) -H, -C (〇) -Ar2 And -C (〇) CH2-TrRn: R5 is selected from the following including: / -C (O) -ill0, where R10 is -Ar3: -C (〇) -OR9, where R9 is -CH2.Ar3: -C (〇) C (〇) -R1〇, where R10 is -ΑΓ3: • R9, where 119 is C2 pit group, substituted by -Ar3: and '• C (〇) C (0) -〇R1 〇, where R1〇 is -CH2Ar3: but 1 is 0 or S · · · R6 is Η:, R8 is selected from the following including -C (0) -Rl (), -C (〇) -CH2-ORl (), And • C (〇) CHrN (R1〇) (R10), where R10 is Η, CH ;, or CH2CH3: 丨 is sent from the Γ column including -ΑΓ4,-(CH,) i.3-Ar4, and- C (〇) -Ar4: Min 15 is -〇H4 -OCm straight or branched. The alkyl group is optionally substituted with -Aq, -〇H, -〇R9, or -C02H, where 119 is < Bu 4 Branched or straight chain alkyl, where Ar3 is morpholinyl or phenyl, The middle phenyl group is optionally substituted by Q t: Aγ2 is (hh): Y is 0: each octacyclic group is independently selected from the following including: · phenyl, naphthyl, side phenyl, " Chanoryl , Isoquinoxaline. Sedazolyl, benzimidazolyl, 4pheno, seleno, 4diazolyl, benzotriazolyl, benzo [b] thiobenzyl, benzazolyl and indolyl, and the The ring base may be -Q 丨 single or multiple substitutions as required: Each 8 * 4 ring group is independently selected from the following including: benzyl, tetrazolyl 'nyl' ~ -137- (please read the following first) Please fill in this matter if you want to buy it) Binding book paper iron standard universal §1 [Family standard car (〇 > ^) / ^ 见 格 (210 > < 297mm) 1235157 B7 V. Description of the invention (135) Group, oxazolyl, pyrimidinyl or 4-indolyl, the cyclic group may be -Qi single or multiple substitutions as required: each Qi is independently selected from the group consisting of -NH2, -Cb-F, -Br, -OH, -R9, -NH-R5, where 115 is-(: (〇) -ΙΙι〇 or -S (〇) 2-R9, -〇r5 where R5 is -C (〇) -Rl0, -〇R9, -N (R9) (Rl0), and 0 / \, where // wherein 119 and 111 () are each independently -Cle6 straight or branched alkyl, optionally substituted with Ar3, where Aγ3 is phenyl: Restrictions When -Aγ3 is replaced by Q 丨, it contains more than one additional -eight 1 * 3 group, and this additional Aγ3 group is not other -Arv. Substitution 3 Specific Example E Other preferred compounds, using formula (Π) where 1 ^ is (el 0), X. is CH, and other substituents are as defined above. Specific Example E Other preferred compounds, using formula ( II) its center is (el 0), X5 is CH, R3 is CO-Ar2, and other substituents are as defined above. Specific Example E Other preferred compounds, using formula (II) whose center is ㈠10), X5 is CH, R3S-C (0) -CH2-TrRn, Re-CCHJwAq, and other substituents are as defined above.

(Please read the precautions of Back Cloud before filling in this page. W. Example E. Other preferred compounds, apply formula (II) where 1 ^ is (el 0), X5 is CH, and R3 is -C (〇)- CH2-TrRn, Ding! Is 0, Rn is -C (O) -Ar * 4, and the other substituents are as defined above. Preferably, among these preferred compounds, Rj is selected from the group consisting of: C (〇 ) -Rl0, -138- SS House Standard (CNS) A4 Specification (210X297 mm) 1235157 Α 一 B7 in the paper iron standard (136) -C (〇) 0-R9, and -C ( O) -NH ^ RlO ^ In addition, in these preferred compounds, R5 is selected from the following: -S (〇) rR9, -S (O) 2-NH-Rl0 ^ -C (〇) -C (〇 ) -R10, -R9, and -C (〇) -C (〇) -〇R10 〇 best, among these preferred compounds, m is 1: but 丨 or S: R15 is -OH or -OCm straight or branched alkyl, optionally substituted by -Ar3, -OH, -OR9, or -CO2H, where branched or linear alkyl, where Aγ3 is morpholinyl or phenyl , Where phenyl is optionally substituted by Q 1: R21 is -Η or -CH3: Αγ2 is (hh): Y is 0, and

-¾Beijing Central Laboratories Bureau, Ministry of Economics, Labor and Investment Cooperation. 5A, each Aγ3 is a cyclic group independently selected from the following including phenyl, fluorenyl, 4phenyl, pyrinorinyl, isorinorinyl, pyrazole , Oxazolyl, isoxazolyl, benzenetriazolyl, benzimidazolyl. ipheno 4-phenyl, imidazolyl, perylene, benzo [b] thiobenzyl, pyridyl, benzofuranyl, and fluorinyl, and the cyclic group may be- (^ All single or multiple substitutions: Each Aq ring group is independently selected from the following including phenyl, tetrazolyl, pyridinyl, and naruto. 139 · This paper is retired in the standard § National Standard Li (〇 ") 8 4 Han Lattice (210: < 297 mm) 1235157 B * V. Description of the invention (137) Bite group, fluorenyl group, continuation group, or 5-sedenyl group, the ring group may be -Q ι single or multiple substitution: each (^ Is independently selected from the following including -NH2, -Ci, -F, -Br, -OH, -R9, -N'H-R5, where 115 is 0 or -S (〇) 2-R9, -〇R5 Where 115 is -C (〇) -Rl0, -〇R9, -N (R9) (R10), and 〇 / \ CH,,, / / ^ 〇 where R9S1 Rw are each independently-[丨., Straight or Branched alkyl, optionally substituted by Ai * 3, where Ar3 is phenyl: The limitation is that when -Aγ3 is substituted with Q i, it contains more than one additional -Ar; group, the additional-group Not substituted by other -Aγ3 groups. Preferred compounds of other specific examples E, using formula (1 [) where {^ is (elO), 乂 5 is CH, 113 is -C (〇) -H, and other substituents are preferably as defined above. In these preferred compounds, R3- is selected from the following including: -C (〇) -R10 '-C (〇 ) 〇-R9, and -C (〇) -NH-R 丨 0. Duminal Cooperative Consumption Du Yin, Central Bureau of Standards, Ministry of Economic Affairs In addition, among these preferred compounds, R5 is selected from the following including--S (0 ) 2-R9, ·: -S (〇) rNH-Rl0, -C (〇) -C (〇) -R10, • R9, and • 140 ·. ¾¾ standard SS family standard twin (CNS) A4 specifications (2l0X29H $) 1235157

AT B7 V. Description of the Invention (13S) -C (〇) -C (〇) -〇Ri0: Best. Among these preferred compounds, m is 1: ’

R15 is -H or -OCy straight or branched alkyl, optionally substituted by -Ar3, -OH, -ORR9, or -CO2H, where 119 is -Cle4 branched or straight alkyl, where A "is a morpholinyl or phenyl group, wherein the benzyl group is optionally substituted by I: 'R21 is -H or · (:%; each Ar ^ f group is independently selected from the following including: benzyl, benzyl, Tryphenyl, 4-noryl, isoquinolyl, pyrazolyl, 4-azolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, cepheno-3 cephenyl, tazolyl , 4 diazolyl, benzo [b] succinyl, said this group, benzo squeenyl, and ^ 丨 noise group, the ring base may be single or multiple substitutions as required by -Qi: each Q 丨Independently selected from the following: -NH2, -CM, -F, -Br, · 〇Η, -R9, -NH-R5, where 115 is-(: (〇) -1110 or -5 (〇) 2- { 19, -OR5 of which 115 is -C (O) -Rl0, -〇R9, -N (R9) (R10), and 〇 / \ CH,, 〇 Employees' cooperation cooperation of China Economic and Trade Standards Bureau, Ministry of Economic Affairs (Please read the notes on the back before you fill in this purchase) Among them, 119 and 111 () are each independently a < bu 6 straight or branched alkyl group, which is replaced by Αγ3 if necessary, which Αγ3 is a phenyl group: · The limitation is when -Ar; is substituted by a Q group, which contains more than one additional -eight "group, the additional -Αγ3 group is not replaced by another -eight", other Exemplary preferred compounds, using 弍 (II) where 1 ^ is (el0) -141 · The standard for this paper is Chinese National Standard (CNS) A4 (2 〖0X 297mm) 1235157 Λ7 ^ B7 V. Description of the invention (139), and X,-is CH, R3 is -C (0) -CH2-TrRn, and Rn is -Aq. Other substituents are as defined above. 3 is preferred among these preferred compounds. R5 is selected from the group consisting of: -C (〇) -R10, -C (〇) 〇-R9, and -C (〇) -NH-Ri〇 In addition, among these preferred compounds, R5 is selected from the following including Γ-S (〇) rR9, -S (〇) 2-NH-R10, -C (〇VC (〇) -Ri〇, -R9, and -C (〇) -C (〇) -〇Rl0. Most preferably, among these preferred compounds, m is I .. Yes. Or S: R15 is -0H or -OCu straight or branched alkyl, as required. Αι ^, -〇H, -〇R9 , Or · C02H, where 119 is -CN4 branched or straight chain alkyl, where Aq is morphoyl or benzyl, where phenyl Replaced by I if necessary: Printed by the Central Ministry of Economic Affairs of the Ministry of Economic Affairs and Consumer Cooperatives ^ (Please read the meaning of the cloud before writing this page) Rule 21 is-幵 or -CH3: Each Ar3 ring base Benzoyl, fluorenyl, daphthyl ', quinolyl, iso, chanothyl, say 4yl, isopropyl, iso0S 4yl, benzylidene, benzimidyl, 4 Pyridino-4pyridyl, imidazolyl, quindiazolyl, benzo [b] pyrene, pyridyl, benzofuranyl, and fluorinyl, and the cyclic group may be -142 The 伕 scale is applicable to China 1 National Standard (CNS) A4 specifications (210X297 mm) 1235157 A: B7 Five 'invention description (-Qpf single or multiple substitution: each Ar4 ring group is independently selected from the following, including phenyl, Θ wow Group, oxidyl group, oxazolyl group, fluorenyl group, pyrimidinyl group, or 4-phenyl group, and the cyclic group may be mono- or poly-substituted as required by -Q1: each (^ 丨 is independently selected from the following including -NH2, -C) -F, -Br, -OH, -R9, -N'H-R5, where 115 is-€: (〇) -1110 or -S (〇) 2-R9, -0R5 where 115 is -C (〇 ) -R1 (), -〇R9, -N (R9) (R10), and 〇 / \ CH,,-\ / " 〇 of which 119 each And Ri0 are independently -C ^ 6 straight or branched alkyl groups, optionally substituted by Aγ3, where Aγ3 is phenyl: Fgen is prepared when -Αγ3 is substituted by Q, which contains more than one additional -Octa [* 3 group, this additional -Aγ3 group is not substituted by other -Ar * 3 groups. Specific Example E Other preferred compounds, where formula (II) is used where Ri is (el 0), X5 is N, and other substituents are as defined above. The preferred compound of the specific example E uses formula (II) wherein \ is (6 [0), 乂 5 is N, R3 {Co-Ar2, and the other substituents are as defined above. Seal of consumption cooperation of employees of the Central Ministry of Economic Affairs of the Ministry of Economic Affairs ^ (Please read the notes on the back before writing this page) Specific Example E Other preferred compounds, applying formula (II) where {^ 是 (el 0), X5 is N, R3 is -C ^ CO-CHrTVRH, Rn is -C (CH2) 10-Ar4, and other substituents are as defined above. 'With ft Example E other preferred compounds, using formula (II) where 1 ^ is (el 0), 乂 5 is? ^, And: R3 is -C (〇) -CHrTrRn: -143- Ben. ¾¾ standard Chinese national standard (CNS) A4 specifications (210/297 mm) 1235157 A B7 V. Description of the invention (141) Ding is 0: and RM {-C (〇) -Ar4, and other substituents are as defined above: Preferably, among these preferred compounds, R5 is selected from the following including: -C (〇) -R10,- C (〇) 〇-R9, and -C (〇) -NH-R10. In addition, among these preferred compounds, 115 is selected from the group consisting of: S (〇) 2-R9, -S (〇) 2-NH-Rl0,--C (〇) -C (〇) -R 丨 0 -R9 'and -C (〇) -C (〇) -〇R10. Preferably, in these preferred compounds, m is 1: ^ yes. Or S: Rule 15 is -0H or -Ci.4 straight or branched alkyl, optionally substituted with -Aγ3, -〇H, -〇R9, or -CO2H, where 119 is -Cy branched Or straight-chain this group, where Aq is morphoyl or phenyl, where phenyl is replaced by 1 as needed: Central Bureau of Standards, Ministry of Economic Affairs, Shellfish Consumer Cooperation Du Yin ¾ (Please read the precautions of Beyond Please fill in this page) R21 is -H or -CH3: Αγ2 is (hh): · Y is 0, and each Α. The cyclic group is independently selected from the group consisting of benzyl, fluorenyl, fluorenyl, quinolyl, isoquinolyl, pyrazolyl, 4-oxazolyl, isoxazolyl, benzazolyl • 144. Paper size Applicable Sg family standard (CNS) (210/297 mm) 1235157 A 7 _ B7 V. Description of the invention (142) fluorenyl, stupid oxazolyl, side pheno 2 selphenyl, imidazolyl. Cydiacryl, benzo [b] thiobenzyl, pyridyl, benzofuranyl, and andolyl, which may be mono- or multi-substituted as required by -Qi: / each Ara ring group is independent It is selected from the following including phenyl, tetrazolyl, ^: aryl, oxazolyl, fluorenyl, pyrimidinyl, or hydrazyl, and may be-(^ single or multiple substitutions as required: each Qi is independently selected from the following Including -NH2, -cn, -F, -Bγ, -ΌΗ, -R9, where min 5 is -C (〇) -R 丨 〇 or -S (〇) 2-R9, -0R5 where 115 is • C (〇) -Ri〇, -〇R9, -N (R9) (R10), and 〇〇CH2,

(Please read the notice on the back before filling out this page) where each of 119 and Rl () are independently -CN6, or a branched alkyl group, which is replaced by Αγ3 as required, where Αγ3 is a stupid group: the restriction is When-Α. When it is substituted with a Q1 group, it contains one or more additional Aγ3 groups, and the additional -Aγ3 group is not substituted with another Aγ3 group. Specific Example E Other preferred compounds, wherein (elO) is used in formula (II), X5 is N, R3 {-C (0) -H, and other substituents are as defined above. Preferably, among these preferred compounds, R5 is selected from the group consisting of: -C (〇) -R10, -C (〇) CM19, and -C (〇)- NH-R10 〇 In addition, among these preferred compounds, R5 is selected from the following including: -S (〇) 2-R9, -145- This paper is in standard size and used in domestic standard plum (CNS) A4 specifications (210X297 mm) ) 1235157 Λ / Β7 Μ Printed by the Shellfish Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs of the People's Republic of China 5. Description of the invention (143) -S (〇) rNH-R10, -C (〇) -C (〇) -R10, -R 9 'And -C (0) -C (〇) -〇R10. Preferably, in these preferred compounds, m is 1 to 15 and 15 is · 〇Η or -〇Cle4 straight or branched alkyl, as necessary-is -Aγ3, -〇Η, · 〇19, or -C 〇2H is substituted, its center is-匸 "straight or branched alkyl · where Aγ3 is morpholinyl or benzene 1, where phenyl is optionally substituted by h: r21 is -H or -CH3: each A The cyclic group is independently selected from the group consisting of benzyl, fluorenyl, 4 hydroxy, 4 noroxy, isoquinolyl, pyrazolyl, 4 azolyl, isoxazolyl, phenyltriazole, benzene Benzimidazolyl, p-pheneno-4phenyl, imidino, 4-dibenzyl, benzo [b] thiobenzyl, pyrimidinyl, benzosyl, and 4-benzyl, and the ring The base view may be-(^ single or multiple substitutions: each 1 is independently selected from the group consisting of: NH2, -Cl, -F, -Br, -OH, -R9, -NH-R5, where 115 is- (: (〇) -1110 or -S (〇) 2-R9, -0R5 where 115 is -C (〇) -R1 (J, -〇R9, -N (R9) (R1 {3), and 〇 / \ CH ，, * \ / ^ 〇 Wherein each R91R1 () is independently-(: Bu 6 straight or branched alkyl, if necessary Ar0f substitution, where Αγ3 is phenyl: -146- (Please read first Back No.: ！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！！ When substituted with a group, it contains more than one additional -Aγ3 group, and the additional -Aγ3 group is not substituted by another -Aγ3 group. Example 5: Other preferred compounds, should be represented by formula (Π) , Its center is (elO), X5 is N, 113 is -CO-CHylVI ^ [, Ri [is -Ar4, and other substituents are as defined above. Preferably, among these preferred compounds, R5 is selected from the following Including: -C (〇) -Ri0, '-C (〇) 0-R9, and -C (O) -NH-R10.-In addition, among these preferred compounds, R, · is selected from the following including:- S (〇) rR9, -S (〇) rNH-R10, -C (〇) -C (〇) -R10, -R9, and -C (〇) -C (〇) -〇R10 〇 are best, in Among these preferred compounds, m is 1: ^ Yes. Or S: Central Laboratories of the Ministry of Economic Affairs, Consumer Cooperation, Du Yin ¾ (please read the precautions for the cloud before filling in this I) R15 is -OH or- OCm straight or branched alkyl is optionally substituted with -Aγ3, -OH, -OR9, or -C02H, Where R9 * -CU4 is a branched or linear alkyl group, where Ai * 3 is morpholinyl or phenyl, where phenyl is optionally substituted by h: R21 * -H or -CH3: each Aγ3 ring group is independently selected From the following including benzyl, fluorenyl, 4-phenyl, quinolyl, isorinoline, pyrazolyl, thiazolyl, isoxazolyl, benzotri-147- National Li Li (CNS> Α4 Regulations (2 丨 0: < 297 mm) 1235157 AT. __B7__ V. Description of the invention (145) 4-base, stupid and imidyl, phenidyl, mijun Group, s-diphenyl group, benzo [b] thiobenzyl group, pyridyl group, benzofuran tomb, and indolyl group, once the ring group may be mono- or multiple substitution by -Qi:, each Ar4 ring The group is independently selected from the group consisting of phenyl, tetrazolyl, pyridinyl, oxazolyl, fluorenyl, pyrimidinyl, or thienyl, and the cyclic group may be-(^ single or multiple substitutions: each 1 is independently selected The following includes -NH2, -Cl, -F, -Bγ, -ΌΗ, -R9, -NH-R5, where 115 is -C (〇) -R 丨 0 or -S (〇) 2-R9, -〇R5 Where R5 is -C (〇) -R (. , -〇R9, -N (R9) (R10r, and 〇 / \ CH9, \ / '〇 where each 119 and R1Q are independently -CN6 straight or branched alkyl group and optionally substituted by Αγ3, where Αγ 5 is a phenyl group; the limitation is that when -A. Is substituted by Qt, it contains more than one additional -Ar; group, the additional -Aγ3 group is not substituted by another -Aγ3 group. The specific example (F) of the ICE inhibitor is the formula (m) ··· (III) R1-N-R2 Printed by the Shell Bureau Consumers Cooperative of the Central Bureau of the Ministry of Economic Affairs (please read the precautions on the back before writing the 4 copy) (Buy) Η Among them: · The heart is selected from the following including the following formula: -148-The scale of this paper is Yan Yan Chinese national standard (0 \ 5) / \ 4 Zhuge (2 丨 0: < 297 mm) 1235157 A- B7 V. Description of the Invention (14δ) (elO)

(ell)

(e! 2)

(w2)

Re

(yi)

Printed by the Ice Poor Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (y2)

-149- (Review the notes on the back before filling in this I)

Chinese paper standard gS house mark Li (CNS) with eight hearts (210X 297)

And 1235157 into B7 V. Description of the invention (147) (Z) R5— ring C is selected from the following including benzo, said pyrene, this pheno, p is more beneficial, " κ pain union, Sai Jun union, Different sigmoids, bite and bite, bite and bite, cancer, and taste. ^ And ^ C and CC »: R2 is: (read the first father read the meaning of the back of the cloud and fill in this purchase ) (b) o

Or m is 1 or 2: each R5 is independently selected from the following: -c (〇) -R 丨 〇, -c (o) 〇-r9, • C (〇) -N (Rl0) (R10),- S (0) rR9, -S (0) rNH-Ri〇, -150- This paper scale is universal Chinese g family standard (CNS) A4 specification (2 丨 0X29? Public 爻) 1235157 Λ7 B7 * 5. Description of the invention ( Tear) -C (〇) -CH2-〇-R9, -C (〇) C (〇) -R10, -R 9 '--Η, -C (〇) C (〇) -〇R10, and -C (〇) C (〇) -N (R9) (R10): X51CH or N: 'is h or 〇: X71-N (R8)-or -〇:-R6 is selected from the following including -H and -CH3: Selected from the following including: -C (〇) -Ri〇, • C (〇) 0-R9, -C (〇) -N (H) -Rl0, -S (〇) rR9, -s (〇) 2- nh-r10, -C (〇) -CH2-〇Rl0, -C (〇) C (〇) -R10, -C (〇) -CH2N (Rl0) (Rl0), employees of the Central Prototype Bureau of the Ministry of Economic Affairs Cooperative cooperative seal ¾ (Please read the note of Yun Yun first and then fill out this I) -C (〇) -CH2C (〇) -0-R9, -C (〇) -CH2C (〇) -R9, · -H , And -C (O) -C (O) -ORl0: Each 119 is independently selected from the following including straight or branched alkyl groups, depending on • 151 · The national standard (CNS) A4 of this standard is not applicable ( 2 丨 0X 297 mm) 1235157 A ·, B7 V. Description of the invention (need to be replaced by "" 3, of which -C ^ 3 alkyl is not necessary if necessary: (Please read > T read the back of the cloud :; χ Italian matter before filling in this I)) Each R10 is independent. From the following including -H, -Ar3, C3-6 cycloalkyl, and straight or branched pit bases as required A. Replaced, where -C 1: 6 bases are not required Juehe:

Rn is selected from the group consisting of Η, Al · 3, and (: .6 straight or branched alkyl, optionally substituted by Ar3, -CONTH2, -OR5, -OH, -OR9, or -CO2H: Each Ry is independently selected from the group consisting of -H or Bu 6 straight or branched alkyl groups: Each R5l is independently selected from the group consisting of R9, -C (〇) -R9, -C (〇) -N (H) -R9, oxygen Each R51 together forms a 4-8 member hindrance ring or contains -0-, -S-or-NH-: It is a ring group independently selected from the following including an aryl group which contains 6, 10, 12 or 1 4 ϋ 琰 ϋ 琰 atom and 1 to 3 rings, and the aromatic heterocyclic ring contains 5 to 15 ring atoms and 1 to 3 rings, the heterocyclic group contains at least one selected from -〇-, -S-, -SO -A heteroatom of-, S〇2, and -NH-, the heterocyclic group may contain more than one double bond as required. The heterocyclic group may contain more than one aromatic ring, and the ring group may Single or multiple substitutions by -Q: each (5 丨 is independently selected from the group consisting of -NH2, -CO2H, -CM, -F, -Br ·, -I, -N〇2, -CN, =. , -OH, perfluoroCu alkyl, R5, -〇R5, -NHR5, OR9, -N (R9) (R10), R9, -C (〇) -Rl0, and O / \ CH7, \ I 2 • 〇 Limit The condition is that when -Ar3 is substituted by Q 丨, it contains more than one additional -Aγ3 group, and the additional Aγ3 group is not substituted by another -Aγ3 group. A preferred specific example F is a compound of formula (III), wherein ^ Yes 2), and other substituents are as defined above. • 152 · This standard of killing is used as the national standard (CNS) A4 specification (210X 297 mm) 1235157 B7 5. Description of the invention (15 °) Well, when Ri is (w2) · · m is 1: ring C is benzo, pyridino, or 4 benzo: selected from the following: -C (〇) -Ri〇 'In the head Ri〇 is- Ar ;: -C (〇) 〇-R9, where R9 is -CH2-Ar3: -C (〇) C (〇) -Ri〇 'where Rjo is -Ar ;: -R9, where R9SCle2 alkyl is-Αγ3 Substituted: and -C (〇) C (〇) -〇R10, wherein R10 * is -CH2Ar * 3: R6SH: R8 is selected from the group consisting of -C (〇) -Rl0, -C (〇) -CH2 -〇R10, and -C (〇) CHrN (R10) (R10), where R10 is fluorene, CH3, or CH2CH3 · · R13 is fluorene or Cm straight or branched alkyl, as required, -〇H, -〇 trans 9 or-0 02 " 1, where 119 is (: 1.4 branched or linear alkyl: where Aγ3 is Fluorolinyl or phenyl, where phenyl can be substituted by I as required; ΑΓ; 5 is phenyl, theophyl, farphenyl, succinyl, 4 isopropyl, 4azolyl, benzimidazole Benzyl, 4-Phenopyridine, Thiodifluorenyl, Benzotriazolyl, Benzo [b] thiophenyl, Benzofuryl, and 4-Indolyl: Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ¾ (Please read the MT first and then read the meanings before filling out this page) Each Q 丨 is independently selected from the following including: ΝΗ2, -Cl, -F, -Br, -〇H, -R9, -NH- R5, where 115 is -C (〇) -R10 or -S (〇) 2-R9, -OR5 where 115 is -C (O) -R10, -OR9, -NHR9, and ·

-153- The size of this paper is in accordance with China National Standards (CNS) A4 specifications (210X 297 male; 5) 1235157 Λ 5. Description of the invention (151)

First, η η, the two anvil hydrogen Γ Jicheng branched base, if necessary, ΑΓ; 〒 each 119 and R 〇 地 San Di Ma-1N6 乂 乂 J, where Ar3 is phenyl;

The limitation is that when -Αγ3 is replaced by Qi, it contains an additional -Ar: 1 group above W§1, and this additional ΑΓ3 group is not another. Ar: 3, 4K with other comparisons of Example F A good compound, using the formula (II), is a (e 1 丨), and the other substituents are as defined above. · Other preferred compounds of Specific Example F, using formula (II), are (el 2), and other substituents are as defined above. Other preferred compounds of specific example F are applied by formula (ΠI), the center of the plant is (y 1), and other substituents are as defined above. Other preferred compounds of specific example F are applied by formula (ΠΙ), where Ri Yes (> .2) and other substituents are as defined above. For other preferred compounds of specific example F, apply formula (III) 'wherein Ri is (z) and other substituents are as defined above. Specific examples Other preferred compounds of F apply formula (III), where Ri is (elO) and \ 5 is CH (also referred to herein as elO-B) 'and the other substituents are as defined above. Du Yin of the Ministry of Economic Affairs of the Ministry of Economic Affairs of the People's Republic of China (please read the precautions of the cloud 3 before filling in this I) Specific Example F Other preferred compounds, apply the formula (ΠΙ) '中 民 【是 （el〇） And \ 5 is 1 > 1 (also referred to herein as elO-A), and the other substituents are as defined above, a is better, when R 丨 is (ell), (ei2), Bu 1), (y2) , (Z), (elO, A) and (elO-B), R5 is selected from the following including: • C (0) -Ri〇, -C (〇) 〇-R9, and • 154-paper scale 逑Use the gS family standard rate (CNS) A4 standard (210X 297 degrees) " 1235157 Λ7 B7 V. Description of the invention (152) -C (〇) -NH-Rl0. In addition, when 1 ^ is (ell), (El2), (yl), (>, 2), (z), (elO-A) and (e 1 OB), R5 is selected from the following including: -'- S (〇) rR9, -S (〇 ) 2-NH-R10, -C (〇) -C (〇) -R10, -R9,-(:( 0) -0 (0) -01110, and -c (〇) c (〇) -n ( r9) (r10).-Preferably, R54R-C (〇) -C (〇) -R10. In addition, 115 is-(:( 〇) -0: (〇) -〇111 (). Better, when Ri is (ell), (el2), (yi), (y2), (2 :), (elO-A) and (eiO-B): m is 1 ·· R2 1 is · Η or -CH3: hi is ci. 6 straight or branched alkynyl group 'as required is eight "substituted by 3' where Ar3 ring group is a benzyl group, which ring base is required as -Q i multiple or Single Replacement: Printed by the Shellfish Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (t ·· Please read the precautions of § before filling out this page) Each ring group is independently selected from the following including benzyl, fluorene, and 4: phenyl , Quinolyl, isopyridinyl, pyrazolyl, oxazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, telephenoβ-secenyl, imidazolyl, cedadiazole Group, benzo [b] thiobenzyl, pyridinyl, benzopyranyl, or 4indolyl, and the cyclic group is optionally substituted by-(^ selected from the following: single or multiple substitutions: each (^ is independently selected from the following) Including -NH2, -Cl, -F, -Br1, -〇H, -R9, -NH-R5, where 115 is -C (0) -Ri〇 or -S (〇) 2-R9, -0R5 where 115 Yes 1 155- This paper is in the standard side of the paper. § A home rubs (CNS) A4 size (2 丨 OX 297 gong) 1235157 B7 V. Description of the invention (153) -C (〇) -R 1 Q '-〇 R9 '-N (R9) (RIQ)' and 〇 / \ CH,, \ / — 〇, where each of 119 and Rl (3 are independently -Cw straight or branched Base, if necessary, is substituted by Αγ3, wherein the Ar * 3 ring group is a benzyl group, and the ring base is optionally a single or multiple substitutions: The limitation is that when -Ar3 is substituted by a Q group, it contains a It is believed that the additional -Aγ3 group above is not controlled by another -Aγ3 group. It is better to be selected from these preferred compounds. The Aγ3 ring group is selected from the following: phenyl, phenyl, rt phenyl, g-sigma linyl, iso: denomination, phenolyl, & sigma Xyl., Isoxazolyl, benzotriyl, benzimidazolyl, 4-phenazophenylyl, imidazolyl, 4-diazolyl, benzo [b] thiobenzyl, benzyfuryl and 4 An indolyl group, and the cyclic group may be mono- or multiple-substituted as desired by -Q. The compounds in the preferred form of this specific example F are: r5 * -c (〇) -r10, where R1Q is Ar3, where the Ar3 ring group is a benzyl group, and the ring base may be the following single or multiple family generations as required: -F, • α, -N (H) -R5 printed by the Consumers' Cooperative of the Central Standard Bureau of the Ministry of Economic Affairs, where -R5 is · Η or -C (〇) -Ri〇, where R10 is < Or branched alkyl, optionally substituted by Ar3, where A. The cyclic group is phenyl, and the cyclic group is optionally -Qi single or multiple substitution, -Nααυ, where 119 and 111 () are independently -Cy straight or branched alkyl, or -〇-R5, where 115 is 1 ·! Or -Cw straight or branched alkyl. • 156 · The standard of this paper is applicable to § National Standard Li (〇 ^) 44 Han (210/297 mm) 1235157

AT B7 V. Description of the Invention (Speaking) The preferred Aq ring group is phenyl, optionally -C1 at the 3 · or 5-position or · NΗ-Ι15 at the 4-position, -N (R9) ( R1 (3), or -0-115 single or multiple substitutions, Example F. Other preferred compounds include where 115 is-(: (R10, where R1O is eight [3 and the Aq ring group is selected from the following including 4 Indyl, benzimidazolyl, hydrazyl, and benzo [b] thiophenyl, and the ring group is optionally substituted by -Qi single or multiple:

Other preferred compounds with ft Example F include where 115 is &lt; (0) -111 (), where R1 (3 is A &quot; Single or multiple substitutions required by -Q i Specific examples F Other preferred compounds include 115 in which <(〇) -111 (3, where R1Q is Αγ3, where Αγ3 ring is phenyl, and 〇 / \ CH ， \ 〇 /-Substituted = In Yuli Example F In another form, the compound is as described above, and the further restrictions are when: m is 1: R # (elO): Supervisory Ministry of Standards Bureau staff consumer cooperation. Company seal ¾ (Please read the precautions on the back before filling out this page) X5 is CH: R | 5 is -0H: 'R2i is -Η: and y2 is 0 and R; yes -C (〇) -H , Then R5 cannot be: -C (〇) -R 丨 〇 'where Ri〇 疋-and Ar ^ ring group is the best basis, not the following -157- Chinese paper standard (CNS) M specifications (210X297 mm) 1235157 Λ7 B7 &quot; V. Description of the invention (155) Substitution: -Qi, 4- (carboxyfluorenyloxy) phenyl, 2-fluorophenyl, 2-fluoridinyl, N- ( 4-methylhexahydrofluorenyl 4-methyl) methylphenyl, or C (〇) -ORR9, where R9 is -CH2-Ar3, The Ar3 ring group is a stupid group, and is not -Qi, and when: Y2 is 0, R; Yes, Ding is 0, and the rule is Aγ4, where the Aγ4 ring group is 5- (1- ( 4-chlorophenyl) -3-trifluoromethyl) said azolyl), then R5 cannot be: '-C (〇) -R10, where R10 is -eight 1 * 3 and Aγ3 ring group is 4- (di Methylaminomethyl) benzyl, benzyl, 4- (carboxymethylthio) imidyl, 4- (carboxyethylthio) phenyl, 4- (carboxyethyl) phenyl, 4- (carboxypropyl ) Phenyl, 2-fluorophenyl, 2-fluoridinyl, N- (4-methylhexahydrofluorenyl) methylphenyl, or • C (0) -OR9, where R9 is -CH2- Ar3, and the Ar3 ring group is phenyl: and when Rn is Ar * 4, where the Aγ4 ring group is 5- (1 · benzyl · 3 · trifluoromethyl), then R5 cannot be:- C (〇) -〇R9, where 119 is -CH2-Ai: 3, then A. The ring group is phenyl: and when Ri is Ar4, where the Ar * 4 ring group is 5- (1- (2- 咄(Pyridyl) -3-trisiofluorenylKazolyl), then R5 cannot be: -C (〇) -R 丨 〇, where Ri〇 is -Αγ3 and Aι: 3 ring group is 4- (diamidoamine group Methyl) benzyl, or

Central Standards Bureau of the Ministry of Economic Affairs, Beigong Consumer Cooperatives Co., Ltd. 2L (please read the information on the back before filling out this page) -C (〇) -〇R9 'Where R9 is -CHs.Ar ^' Is not substituted by -Qi: and when 'Y2 is 0, R3 is -C (0) -CH2-but1-R11, but 1 is 0, and R 丨 I is -C (〇) -Ar4, where Aγ4 The cyclic group is 2,5-difluorobenzyl, so R5 cannot be ... -C (0) -Rl (), where R1 () is -eight 1: 3 and the Ar3 ring group is 4 (dimethylamino (Methyl) -158- This paper is a small size paper with a Chinese national standard (CNS M4 specification (210X 297 mm). Printed by the Shellfish Consumer Cooperative of the China Prototype Bureau of the Ministry of Economic Affairs. 1235157

V. Description of the invention (15δ) benzyl, 4- (N-morphofluorenylfluorenyl) phenyl, 4 · (N · fluorenylhexaargin η 七 4 凑) ^ yl) benzyl, 4- (N- (2-fluorenyl) imidazolylfluorenyl) benzyl, 5-benzyl misotai '5-benzyltrisyl, N-ethylfluorenyl-5-benzyltriazolyl, N-ethylethyl ^ Monopyrazolyl, or, C (0) -〇r9, where is -CH2-Ar3, and the A · 3 ring group is a benzyl, unsubstituted: and when γ2 is H2, R; is -C ( 〇) -CH2-TrRn, T 丨 is 〇, and the general 丨 丨 is • C (0) -Ar4, where the Ar4 ring group is 2,5-dichlorobenzyl, then R5 cannot be: • C (〇)- Or9, wherein R9 * -CH2-Ar3, and the Ar3 ring group is phenyl. In another form of Specific Example F, the preferred compound is one in which R2l is -H. In addition, preferred compounds are those in which r21 is -CH3. Specific Example F Preferred compounds employ formula (III), wherein 1 ^ is (^ / 2) and the other substituents are as defined above. better,! 1 丨 is (w2) and xn is I: the ring C is succinyl, said bite, or :: sepheno: R3 is selected from the following including -C (0) -H, -C (0) -Ar2, and -C (0) CHrTrRu: R5 is selected from the following including: • C (O) -R10, where R10 is -Αγ3: -C (0) 0-R9, where 119 is -〇 ^ 2- 入 1 * 3:- C (〇) C (〇) -R10, where R1〇 is -Ar ;: -R9 'wherein R9 is Ci.2 alkyl, substituted by · Αγ3: and -C (〇) C (O) -〇R10 , Where Rl0 is &lt; η2Αγ3: • 159 · This paper music scale is applicable to Chinese National Standard Li (CNS) Α4 Regulations (2 [Οχ 297 公 未) one by one '广 # 先 纪 读 背 ^ Note before filling in (This buy)

1235157 Λ7 B7 V. Description of the invention (157) D1 is 0 or S:

RgH:

Rs is selected from the following including -C (〇) -R10, -C (〇) -CH2-CXR101-C (〇) CH2-N (Ri0) (R10), where R10 is H, CH3, or CH2CH3: R1 The following items include-ΑΓ4 '-(CH2) bu 3-ΑΓ4 and-C (〇) -Ar4:

Rb- is -0H or -〇 (: a straight or branched alkyl group, optionally substituted by-, -〇H, -〇Ryt-C〇2H, wherein R9 * -CN4 is a branched or straight alkyl group, Among them, 1 * 3 is morpholyl or phenyl, where phenyl is optionally substituted by I: Aγ2 is (hh); &quot; Y is 0: each Aγ3 ring group is independently selected from the following including phenyl, 荇Group, 4-phenyl group, quinolyl group, iso-4 group haloyl group, 11 cetylenyl group, benzimidyl group, cepheno-3 cetylenyl group, 4 diazolyl group, benzotriazolyl group, benzo [b] Thiophenyl, benzofuryl, and indolyl, and the cyclic group may be-(^ single or multiple substitutions as required: each Ar4 ring group is independently selected from the following including phenyl, tetrazole Base, pyridyl, pyridyl, sigma, ergo, or erf, which is based on the need for -Q t # single or multiple substitution: consumption by the Central Bureau of Standards of the Ministry of Economic Affairs Cooperative Du Yinqi Each Qi is independently selected from the following including -NH2, -Cl, -F, -Br, -OH, -R9, -NH-R5 where R5 is -C (O) -Rl0 or -S (0) 2-R9, -0R5 where R5 is -C (〇) -Rl (), -〇R9, · Ν (Ι19) (ΙΙι ()) and 〇

〇 Among them, each of 119 and 111 () are independently -Cw straight or branched alkyl groups, and -160 as required. The paper scale is universal, and it is a HS standard (CNS) A4 specification (210X297 mm). 1235157 Λ &quot; Β7 V. Description of the invention (158) Aγ3 is substituted, where Ar3 is phenyl: The good condition is that when -Αγ3 is Q l substituted, it contains more than one additional -Aγ3 group, and the additional -Aq group is not Another -Air; group-so-oxo 3 is a preferred compound of Example F. Formula (III) is applied with its center at (ell) and the other substituents are as defined above. With other preferred compounds of Example F, formula (III) is used with its center at (el2) and the other substituents are as defined above. With other preferred compounds of Example F, Formula (III) is used with its center at (yl) and the other substituents are as defined above. Specific Example F Other preferred compounds, using formula (III) where 1 ^ is (y2) and its substituents are as defined above 3 Example F Other preferred compounds, using formula (III) where 1 ^ is (2) and the other substituents are as defined above. Elite Example F Other preferred compounds, where formula (III) applies! ^ Is (el0) and X5 {CH and the other substituents are as defined above. With other preferred compounds of Example F, formula (III) is used where 1 ^ is &amp; 10) and X5 is N, and the other substituents are as defined above. Preferably, among these preferred compounds, selected from the following include: -C (O) -Rl0 'Central Standard of the Ministry of Economic Affairs. Printed by Li Bureau Beigong Consumer Cooperative ¾ (Please read the note on the back first. Item then 1 || (This page) -C (〇) 〇-R9 'and • C (〇) -NH-R10. · In addition, among these preferred compounds, RD • is selected from the following including: -S (〇) rR9, -S (〇) rNH-Rl0, -161-IS Standard Car (CNS) A4 Specifications (210X297 mm) 1235157 Λ7 B7 V. Description of the invention (159) -C (〇) -C (〇) -R10, -R9, -C (〇) -C (〇) -〇R10, and--C (0) C (O) -N (R9) (R10). Most preferably, in these preferred compounds, m is 1: chi 13 is fluorene or -Cm straight or branched alkyl, optionally substituted with -Ai3, -0H, -OR9, or -CO2H, where 119 is -Cm branched or straight chain alkyl, where Ai * 3 is morpholinyl or benzyl, where phenyl is optionally substituted by h: R2l is -H or -CH3; R5l is (: Branched alkyl, optionally substituted with Aγ3, where Aγ3 is phenyl, and optionally substituted with -Qt: Each Ar * 3 ring group is independently selected from the following including phenyl, phenyl, 4phenyl, 4 Norolinyl, iso4-norolinyl, pyrazolyl, oxazolyl, isoxazolyl, benzotrisyl, benzimidyl, σ-sedenoβ-sedenyl, imidyl, σ Selenium, benzo [b] thiobenzyl, pyridyl, benzofuranyl, and 4-indolyl, and the cyclic base may be replaced by a single or multiple substitutions as required; consumption cooperation of employees of the Central Standards Bureau of the Ministry of Economic Affairs Seal «. (Please read the meaning of the back of the cloud and fill in this page) each &lt; 5 丨 independently selected from the following including -NH2, -Cl, -F, -Bi :, -〇H, -R9, -NH-R5, where 115 is -C (〇) -Rl0 or -S (〇) 2-R9, -0R5 where 115 is -C (〇) -Rl0, -〇R9 , -N (R9) (R10), and. \ CH ,, γ _ wherein each of 119 and R1Q are independently-(: Bu 6 straight or branched alkyl groups, if necessary -162- the size of this paper) General Chinese National Standard Li (CNS) 6 4 Han (2I0X 297 mm) 1235157 A: B7 V. Description of the invention (1S0)

Ar; caused generation, wherein Aγ3 is phenyl: The limitation is that when -Αγ3 is substituted by Q 丨, it contains more than -Ar; group, the additional -Ar3 group is not substituted by another -Ar3 group . Examples of preferred compounds with ft (F) include the following, but are not limited thereto: 2001 2100a.

Order --------- ^ 1 (Please read the back of the cloud .. Vi Ideas V? Different Versions 1100b 〇Λ 〇

〇 ο OiPr o East China Ministry of Economic Affairs, China · Biaobi Bureau Employee Consumption Cooperatives ¾

163 National Standard Twin (CNS) A4 Specification (2 丨 0X297 mm) 1235157 A7 B7 2100c

2100d Ο

(Xu first read the precautions for back 5 and then 4. write this page) 21〇〇e 〇

Consumption Cooperation of Employees of the Central Bureau of Standards, Ministry of Economic Affairs · Social Printing ¾

Another-specific example (G) of the ICE inhibitor of the present invention is formula (IX) (IV) where: m is 1 or 2: 1 ^ selected from the following including the following formulas: Dart twin (CNS) A4 specification (210X297 publicly) 1235157 AT B7 V. Description of invention (1 ° 2: (elO-A) (ell)

(el2)

(Please read back 5 of V: V〗 One by one (w2)

(yl)

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (y2)

And the standard of this paper is applicable to the national standard (CNS) A4 specification (210X297 mm). The staff of the Ministry of Economic Affairs of the Central Government Bureau of the Ministry of Economic Cooperation and Cooperation Du printed 1235157 Λ7. B7 V. Description of the invention (yang) Ring C is selected from the following Including benzo, pyridino, 4pheno, pyrene, thiopyridine, 4 tocopherol, diisothiophene, dipyridine, isoσxylpyridine, pyrimidinyl, azozolopyryl, and Cyclohexyl: / R3 is selected from the following: CN, -C (〇) -H, -C (0) -CH- &gt; -T | -R | jy -C (〇) -CHrF, -C ^ N ^ O-Rg ^ and -C 0-A ri · Each 115 is independently selected from the following: -C (〇) -R 丨 ο, -C (〇) 〇-R9, -C (O) -N (Rl0) (Rl0) -S (〇) 2-R9, -S (〇) rNH-R10, -C (〇) -CHr〇-R9, -C (〇) C (〇) -Rl0, -R9, • H, -C (〇) C (〇) -〇R10, and -C (〇) C (〇) -N (R9) (R10): 丫 2 是 七 or 〇: X * 7 是 · N (R g) -Or-〇-: -166 · The paper size is applicable to make SS furniture (CNS) A4 size (210X297 mm) clothing I (please read the precautions of s before filling in this page to order • 1 1235157 Λ7 37 V. Description of the Invention (1S4) Each Ding is independently selected from the following including -〇-, -S-, -s (〇)- And -s (square) 2-: R6 is selected from -H and -CH3 comprising:

Rs is selected from the group consisting of: -C (〇) -R10, -C (〇) 〇-R9, -C (O) -NH-R10, -S (〇) 2-R9,--S (〇) rNH -R10, -C (〇) -CH2-〇Rl0,--C (〇) C (〇) -Rl0, • C (〇) -CH2-N (Rl0) (Rl0), -C (〇) -CH2C (〇) -0-R9, -C (〇) -CH2C (〇) -R9, -H, and -C (〇) -C (〇) -〇R [〇 ... Each of 119 is independently selected from the following including- Aq and -Cw straight or branched alkyl groups are replaced by Αγ3 as required, of which -Ct.6 alkyl groups are continuously required: printed by the Consumers' Cooperatives of the Central Procurement Bureau of the Ministry of Economic Affairs Note on the difference ^^) Each Ri0 is independently selected from the group consisting of: Η, -Ar3, (: 3.6 cycloalkyl, trans-Cm straight or branched alkyl is optionally substituted by Αγ3, where -Ci. 6 alkyls as necessary: &amp; Rn is independently selected from the following including: '-Αγ4, BU ΑΓ4' • Η, and -167- This paper is sent to the Chinese National Standard (CNS) A4 specification (210X297) Mm) 1235157 '·-* Λ; 3, V. Description of the invention (fine • C (〇) -Ar4: r15 is selected from the following including -〇H, -〇Ar3, -N (H) -〇H, and- 0C bu 6, where Cu is a star or branch pit base view as -Αγ: , -ΒΟΝΗ] '-ORj' • OH, -〇R9, or -CO2H is substituted: each Rh is independently selected from the following including -H or -C and 6 straight or branched tiger groups: Aγ2 is independently selected from the following, Any of the rings may be a single or multiple substitutions as required by-(^, or a phenyl group, as required by the generation controlled by Q1:

Wherein each Y is independently selected from 0 and S; each Aq is a cyclic group and is independently selected from the following including aryl groups which contain 6, 10, 12 or 14 carbon atoms and 1 to 3 rings, and aromatic heterocyclic groups Contains 5 to 15 ring atoms and 1 to 3 rings, and the heterocyclic ring contains at least one selected from -0-, -S-, -S〇-, S〇2, = N-, and -NH-,- Heteroatoms of N (R5)-, and -N (R9)-, printed by the Consumer Cooperative Cooperative of the Central Bureau of the Ministry of Economic Affairs (4¾¾reading f / 背 事 大二 贝) The heterocyclic group contains one as needed For the above double bond, the heterocyclic group needs to contain more than one aromatic ring, and the cyclic group is optionally substituted by -Q 丨 single or multiple substitutions; each Aγ4 is a cyclic group, independently selected from the following including aryl groups which contain 6, 10, 12 or 14 carbon atoms and 1 to 3 rings, the heterocyclic group containing 5 to 15 ring atoms and 1 to 3 rings, the heterocyclic ring containing at least one selected from -0-, -S ·, -SO-, S〇2, = N-, -NH-, -N (R5)-, and -N (R9)-heteroatoms, the heterocycle optionally contains more than one double bond, the hetero Cyclops needs to contain more than one -168- ft-size paper (S3 house standard in use) (CNS) Α4 size (2 丨 0 × 297 mm) 1235 157 A: _ B7__ V. Aromatic ring of invention description (1S6), once the ring base is required to be single or multiple substitution by -Q i: Each Qi is independently selected from the following including -NH, -CC ^ H ' -Cl '-F' -Br '-I, -NO2, -CN, = 〇, -OH, -perfluoroC ^ 3alkyl, / R5, -〇R5, -NHR5, 〇R9, -N ( R9) (R10), R9, and 〇 ~ · / \ CH ,, 〇〇 /-The conditions are when -Ar3 is substituted with a Q group, which contains more than one additional -Aγ3 group, the additional- The Ar3 group is not substituted by another -Ar3: A preferred compound of exemplified G applies formula (IV), where \ is Bu 2) and the other substituents are as defined above. Preferably, when R # (w2) ·· m is 1: the ring C is benzopyridine, bispyridene, or σ-phenidene: R3 is selected from the following: -C (〇) -R | 〇 'where R | 〇 is -Αγ3; -C (〇) 〇-R9 'where R9 is -CH2-Ar; 5: -C (〇) C (〇) -Ri〇' where Ri〇 is -Αχ *]: -r9, where r9 is a cN2 alkyl group substituted with Aι: 3: and -C (O) C (O) -〇R10, where R1〇 is. (:? 12 eight 1 · ;: Consumption cooperation printed by Du {Please read the precautions of the first one before filling out this page}

RgH:

Rs is selected from the group consisting of -C (0) -RlQ, -C (O) -CH2-〇R10, and -C (O) CH2-N (R10) (R10), where Ri0 is H, CH3, or- CH2CH3: R 〖3 is a fluorene or -Cl-4 straight or branched alkyl group, optionally substituted by Ar3, -〇H, -〇R9 or -c〇2H, and its center is ^ · 4 branched or linear alkyl Basic, of which Αγ3 • 169 · This paper is commonly used in standard SS furniture (CNS) Α4 ^; ^ 210 &gt; &lt; 297 public housing ^ ----—- 1235157 Employees' Cooperative Cooperation of the Central Standards Bureau of the Ministry of Economic Affairs · Social Printing ¾ B7 V. Description of the invention (1δ7) is fluorinyl or phenyl, in which phenyl is substituted by Qi as required: Ar :, is Bentai's "tea-based" this ordering group, and is indifferent to 5 lin-based 'iso ^ Tumblr, telezolyl, benzimidazolyl, 4-pheno-4phenyl, 4-diazolyl, benzotriowyl, benzo [b] thiophenyl, benzofuryl, and pyridyl : Each independently selected from the group consisting of -NH2, -CM, -F, -Br, -OH, -R9, XH-R5, where 115 is -C (〇) -Ri〇 or -S (〇) 2- R9, -0R5 where 115 is -C (〇) -R ^ q '-ORg' -NHRg 'and 〇 / \ CH,,-\ / -〇 where each of 119 and 111 () are independently -C ^ or Branched alkyl, Ar3 if required Substituted, where 1 * 3 is phenyl; the limitation is that when -Αγ3 is Q i substituted, it contains more than one additional -Αγ3 group, the additional -Ar3 group is not substituted by another -Αι · 3 Specific examples G Other preferred compounds, where formula (IV) 1 ^ is (610-eight) and other substituents are as defined above. Specific Example G Other preferred compounds should be formula (IV) where 1 ^ is (el 1) and the other substituents are as defined above. Specific Example G: Other preferred compounds, using formula (IV) whose center is (el2), and other substituents are as defined above. Please read the note on the back first

Examples G Other preferred compounds Other substituents are as defined above. Specific example G Other preferred compounds Other substituents are as defined above 3 Application formula (IV) where 1 ^ is 1) and application formula (IV) where Ril (y2) and -170 §S Standard Twin (CNS) A4 specification (2 丨 0X 297 mm) 1235157 Λ 7 B7 V. Description of the invention (1SS) With ft example G other preferred compounds, should be formula (IV) where 1 ^ is (2 ) And the other substituents are as defined above. Preferred compounds with Example G are those in which R3 is -C0-Ar2. Preferably, when it is -C0-Ar2, Y is 0. Other preferred compounds are where R3 is -C (〇) -CH2-TVRn and Rn is • (CHj) \ .3 &quot; Ar4 c is best, when R3 is -C (〇) -CHrTrRniRn *-(CH-2) h3-Ar4, Ding is 0. Other preferred compounds are among them: R3 is -C ^ OlCHrTVRH: T # 〇: and Rn is -C (〇) -Ar4. Other preferred compounds are among them R3 * -C (0) -H. Other preferred compounds are 11 :; is-(:( 〇) -0 ^ 2- 丁 「11 [1 and 1111 is -eight 1 * 4. Better, when R; is &lt; (0)-(: Only 2-1 &gt; 11 丨 1 and 11 丨 | are-△., Ding 丨 is. Or S. Better, when Ri is (ell), (el2), (yl), (y2), (z), For (elO-A) and (elO-B), R5 is selected from the following including: -C (〇) -Ri〇, printed by the Central Standards Bureau of the Ministry of Economic Affairs, Beige Consumer Cooperatives-C (〇) 〇-R9, And -C (O) -NH-RI0 »In addition, when 1 ^ is (el 1), (el2), (yl), (y2), (z), (elO-A), and (elO-B) , R5 is selected from the following including: -S (〇) 2-R9 '-S (O) 2-NH-R10, -171 · SS family standard (CNS) A4 size (210X 297 mm) ) 1235157 Λ: _ B7 V. Description of the invention (139) -C (〇) -C (〇) -R1〇, -R9, -C (〇) -C (O) -〇R10, and / -C (O ) C (〇) -N (R9) (R10) 3 is preferred, and R5 is -C (〇) -C (〇) -R10. In addition, 115 is-€: (〇)-(:( 〇) -〇 111 (}. Best when Ri is (ell), (el2), (yl), (y2), (z), (el (JA), and (elO-B), m is 1: _ R21 is- H or -CH3: ci.6 straight or branched alkyl as required Substituted by Ar3, in which the eight 1 * 3 ring group is a benzyl group, which is optionally a multiple or single substitution by -Qi: each Aγ3 ring group is independently selected from the group consisting of benzyl, amidino, and fluorenyl, : Zolinyl, isoquinolyl, pyridoxyl, 4-oxazolyl, isoxazolyl, benzotrisigmato, benzimidyl, betathiopheno 4-phenyl, imidyl, Sigma phenyl, 4-benzyl, benzo [b] thiobenzyl, pyridyl, benzofuranyl, or indolyl, and the cyclic group is optionally substituted by -Q i single or multiple. Each 卩 丨 independently Is selected from the group consisting of: ΝΗ2, -Cl, -F, -Br, -OH, R9, -NH-R5 where 115 is -C (〇) -R10 or -S (0) 2-R9, -〇R5 where 115 Printed by the Consumers' Cooperative of the China Standard and Quarantine Bureau of the Ministry of Economic Affairs (please read this note before filling in this I) • C (〇) -Rl0, -〇R9, -N (R9) (Rl0), and 〇 / \ e CH ,, \ 〇 /-wherein each of 119 and RlQ are independently -cle6 straight or branched alkyl groups, optionally substituted by Ar3, wherein the Ar3 ring group is phenyl, and the ring group is Need to be -172 · The size of this paper, the national standard (CNS) A4 size in the middle of the week (210X297 male), 1235157 Λ &quot; 37 V. Description of the invention (17〇) -Ql single or multiple substitutions: The conditions are that when -Ar3 is substituted with -Q 1 group, it contains more than one additional -Ar3 丞, the additional -Ar3 group does not In addition, Aq is substituted. Preferably, the 'Ar3 ring group in these good compounds is selected from the group consisting of benzyl, vol, 5 sedenyl, Kuijin 7 tomb, Yijun Baji ,: Bijunji, this azole group, iso Oxazolyl, benzotriazolyl, benzimidazolyl, which are 4-phenyl, imidazolyl, 4-diazolyl, benzo [b] thiobenzyl, benzofuryl and 4indolyl, and The ring base is optionally -Q i mono- or poly-substituted. Specific example G is a compound of a preferred type, in which ruler 21 is Η and other 裒 groups are as defined above. Specific example G Another preferred form of the compound is wherein R2i is CH; and its ί also has a substituent as defined above. The ICE inhibitor of another specific example (i) of the present invention is the formula (V): (V)

(Please read the notes on the back before reading this page) Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ¾ where: m is 1 or 2; (elO-B) Y:

• 173 · The standard for this paper is Chinese National Standard Xin (CNS) A4 specification (2 丨 0X 297 gong) 1235157-A: B7 V. Description of the invention (171) R3 is selected from the following: • CN, -C (〇) -H,, -C (0) -CH2-TrRn ^ -C (〇) -CH2-F, -C ^ NO-Rg ^ and -C 〇-A r ,: 113 each independently selected from the following including: • C (〇) -Rl0, -C (〇) 〇-R9, -C (O) -N (R10) (R10) -S (〇) 2-R9, -S (〇) 2-NH-Rl0, -C (〇) -CH2-〇-R9, -C (〇) C (〇) -R10, -R9 '-H, and -C (〇) C (〇) -N (R9) (R10), and -C (〇) C (〇) -〇R10,

5? Y2SH2 or 0 printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs: Each Ding is independently selected from the following including -0-, -s (〇)-, and -s (〇) 2-: Rg is selected from the following including : -C (〇) -R10, -C (0) 0-R ^ y -174 · This paper method is applicable to 1 national standard (0 ^) six 4 specifications (2 [0 乂 297mm) 1235157 Λ7 B7 Printed by the Ministry of Economic Affairs of the Bureau of Consumers and Consumers of the Ministry of Economic Affairs of the People's Republic of China Du 5. Production Description (172) -C (〇) -NH-R1〇, -S (〇) 2-R9, -S (〇) 2-NH- R10,--C (〇) -CH, -〇R [〇 '-C (〇) C (〇) -R10, -C (〇) -CHrN (R10) (R10), -C (〇) -CH2C (〇) -〇-R9, -C (〇) -CH2C (0) -R9, -H, and '-C (〇) -C (〇) -〇Rl0: Each R9 is independently selected from the following including -Ar3 & amp -C ^ straight or branched alkyl, optionally substituted by Aγ3, wherein the alkyl is optionally unsaturated: each Ri is independently selected from the following including -H, -Ar3, C3.6 cycloalkyl, and- Cy straight or branched alkyl is optionally substituted by Ar3, where -CN6 alkyl is optionally unsaturated: Each Ru is independently selected from the following: -A r ;, • (CH)) Bu 3-ΑΓ4, -Η And -C (〇) -Ai * 4: R15 is selected from the following including -〇Η, · Αγ3, · -N (H) -OH, and -0 (^. 6, where Ci.6 is a straight or branched alkyl group optionally substituted with eight 1 * 3, -CONH2, -〇R5,- 〇H, -〇R9, or -C〇2H: R2 丨 is -CH3: • 175- (Please read the precautions for V1T first page B page-bound travel paper (standards) using Chinese standards (CNS) A4 specification (210 × 297 mm) 1235157 A- B7 V. Description of the invention (173) A r, independently selected from the following 'any one of the following is viewed as -Q 1 dry oxygen multiple private generation, or phenyl, as Need to be replaced by Qi:

Wherein each Y is independently selected from the following including 0 and S: each Aq is a cyclic group independently selected from the following including an aryl group containing 6, 10, 12 or 4 carbon atoms and 1 to 3 rings, and an aromatic heterocyclic ring Contains 5 to 5 ring atoms and 1 to 3 rings, the heterocyclic ring contains at least one selected from -0- ,, -SO-, S〇2, di-N-, and -NH-, -N (R5) -, And -N (R9)-heteroatoms, the heterocyclic ring may contain more than one double bond, the heterocyclic ring may contain more than one aromatic ring, and the ring may be -Q 丨 single or Multiple substitutions: each octa [4 is a ring group independently selected from the following including aryl groups which contain 6, 10, 12 or 14 carbon atoms and 1 to 3 rings, the heterocyclic group contains 5 to 15 ring atoms and I To 3 rings, the heterocyclic ring contains at least one selected from -0-, -S-, -S〇-, S〇2, = N-, -NH-, -N (R5)-, and -N (R9 )-'S heteroatom group This heterocyclic group depends on the Ministry of Economic Affairs, China Standards Bureau's off-line consumer spending: ;;: · Printed by the Society Bond, the heterocyclic group may contain more than one aromatic ring, and the ring group may be -Q i : Each &lt; 5 丨 is independently selected from the group consisting of -NΗ2, ·-(: 〇2Η, -C1, -F, -Br, · 1, -NO2, -CN, = 0: -〇Η, -all Fluorine (: Bu; Hyunyl, R5, -〇R5, • NHR5, OR9, -N (R9) (R10), R9, -C (〇) -R1〇, and • 176- S1 in paper standard Family standard (CNS) A4 specification (210X 297 mm) 1235157 Λ7 B7 V. Description of the invention (〃4) CH- \ 〇 / The restriction is that when -Αγ3 is replaced by a Q 丨 group, it contains more than one additional -Ar3 group, the additional -Aγ3 group is not replaced by another -Ar3 group: Example (I) Another type of compound (Form 1) is Formula (V): One (V) 〇 ((Jrn R5

R1—N R3 Η 2Γ; · Precautions for reading first (this page) equipment where m is 1 or heart is (elO-B) v2

The R3 printed by the Consumers' Cooperative of the Central Bureau of Quanjing Economic Development Bureau is selected from the following: CN, -C (〇) -H · -C (0) -CH2-TrRn ^ -C (〇) -CHrF,- C = N-〇-R9 'and -C 〇-A r ,: -177 · The standard of this paper is in accordance with the national standard of China ([&gt; ^) 6 4 specifications (2 〖0 ： &lt; 297 mm) 1235157 Β7 V. Description of the invention (Ί7 °) Each 115 is-€: (〇) 〇 (〇) -〇1110 ·· 2 is H: or 〇: η Read the note on the back first, then fill in each page of this page (select independently) From the following include -〇-, -S (〇) -dagger and -S (〇):-:

Rs is selected from the following including: -C (〇) -R10, -C (〇) 〇-R9, -C (〇) -NH-R10,, -S (〇) 2-R9, -S (〇) rNH- R10,--C (O) -CHr0R10, -C (〇) C (〇) -R10, -C (〇) -CHrN (R10) (R10), -C (〇) -CH2C (〇)- 〇-R9, -C (〇) -CH2C (〇) -R9, -H, and -C (〇) -C (〇) -〇R10: Each R9 is independently selected from the following including -A〇 and -C ^ Or branched alkyl, which is replaced by Ar * 3 as needed, where the alkyl is as incessant as required: each of the R10 is independently selected from the following including-包括, -Ar3 , C3.6 cycloalkyl, and -C ^ straight or branched alkyl are optionally substituted by Αγγ3, where &lt; 6 alkyl is as incessant as necessary: ^ each R, t is independently selected from the following including ： -Αγ4,-(CH2) ι · 3-Αγ4, 178 The paper method is applicable to the SS family standard twin (CNS) six 4 Tig (2 丨 0X297 mm) The Ministry of Economic Affairs Central Standards Bureau staff poverty alleviation cooperative Print 1235157 Λ &quot; B7 V. Description of the Invention (17S) -Η, and -C (〇) -Ar4:, Ri5 is selected from the following including -〇H, -〇Aq, -N (H) -〇R, and- 〇Cb 6, where (: "is a straight or branched alkyl group Must be Ar3, -CONH2, -〇R5, -〇H, -〇R9, or -C02H: Each R2l is independently selected from the following including -H or -Cw straight or branched alkyl ... Aγ2 is independently selected from the following , Where any ring is optionally -Q, all or multiple substitutions, or phenyl, if necessary, Q 1 substitution:

Wherein each Υ is independently selected from the following including 0 and S; each of 8: 3 is a cyclic group independently selected from the following including aryl, which contains 6, 10, 12 or 14 carbon atoms and 1 to 3 rings, and aromatic Heterocyclyl contains 5 to 15 ring atoms and 1 to 3 rings, and the heterocyclyl contains at least one selected from -〇 ·, -S-, · S〇-, S02, = N-, and -Ν ，-, -N (R5)-, and -N (R9)-hetero atom groups, the heterocyclic group contains more than one double bond as required, the heterocyclic group contains more than one aromatic ring as needed, and the Cyclic radicals are optionally single or multiple substitutions by -Qi: · Each Aγ4 is a cyclic radical independently selected from the following including: aryl radicals containing 6, 10, 12 or [4 carbon atoms and 1 to 3 rings, and heterocyclic The cyclic group contains 5 to 15 ring atoms and 1 to 3, but the heterocyclic group contains at least one selected from -0- ,, -SO · -179- This paper uses the ts national standard plum (CNS) Α4 specifications (210/297 mm) (please take a look at the back: V 〖Writing matters to write too buy） Binding spring 1235157-A. · B7 V. Description of the invention (1T7), S〇2, = Ν-, -NΗ-, -N (R5)-, and -N (R9)-are heteroatom radicals, and the heterot radical contains two as necessary Double bond, the heterocyclic group may contain one or more aromatic rings as required, and the ring group may be -Q 丨 / jin mono or multiple substitution as required, each Qi is independently selected from the following including -NH2, -C 〇2H, -C, -F, -Br, -I, -NO], -CN, 20, -0H, -perfluoro (: Bu 3 alkyl, R) ·, -〇R5, -NHR5, 0R9, -N (R9) (Ri〇), R9, -C (〇) -Rl0, and · 〇- / \ CH, ·. \ / ^ 〇 The restriction is that when -Ar3 is Q i substitution, it contains a The above additional -Aγ3 group, the additional -Aγ3 group is not replaced by another -Aγ3 group: In addition, Specific Example I A compound of this type (Form 2) is one in which R21 is -CH3. Specific Example (J) Another type of compound (Form 1) is formula (V): Jade-Equipment (V)

Quan Printed by the Central Government Bureau of the Ministry of Economic Affairs of the People's Republic of China, where: m is 1 or 2: heart is (elO-B) y2

-180- The iron scale of this paper is suitable for Ning § S House Standard Li (CNS) A4 specification (2 丨 0 X 297 male; $) 1235157 Λ7 B7 V. Description of the invention (178) R3 is selected from the following including: -CN, -C (〇) -Η ′ -C (〇) -CH2-TVRn, -C (〇) -CHrF, -C = N-〇-R9, and -C 〇-A r 7: Each 115 is independently selected from the following including: -C (0) -Rj 0--C (〇) 〇-R9, -C (O) -N (Rl0) (Rl0)

-S (0) 2-R9 J -S (〇) 2-NH-R1〇, -C (〇) -CHr〇-R9, -C (〇) C (〇) -R10, -R9, -H, • C (〇) C (〇) -〇R10, and -C (〇) C (〇) -N (R9) (R10): Du Yin Du, staff of the Central Standards Bureau of the Ministry of Economic Affairs Yun Zhi ...: !! Matters of second nature) Ya 2 is seven or 0: each T 丨 is independently selected from the following including -〇-, -ST-, -S (〇)-, and 4 (0) 2- : Rs is selected from the following including: -C (〇) -Ri〇, -C (〇) 0-R9, -181-Paper method scale Yan Yan § National Standard Twin (CNS) A4 (210X297 mm) 1235157 Λ; B7 Employees of the Central Bureau of Standards, Ministry of Economic Affairs, Cooperative Cooperatives Ⅴ. Description of Invention (179) -C (〇) -NH-R10, • S (〇) 2-R9, -s (〇) 2-nh- r10,, -C (〇) -CH 厂 〇〇, -C (〇) C (〇) -R10, -C (〇) -CH2-N (R10) (R10), -C (〇) -CH2C (〇) -〇-R9, -C (〇) -CH2C (〇) -R9, -H, * -C (〇) -C (〇) -〇R10, and -C (〇) -C (O ) -N (R9) (R10): Each foot 9 is independently selected from the group consisting of: Α〇 and -C ^ straight or branched alkyl, substituted as necessary, wherein -Cw alkyl as necessary and : Each min 1 () is independently selected from the following including-包括, -Αγ3,0 : 3.6 cycloalkyl, and-(: Bu 6 straight or branched alkyl is optionally substituted by A ", wherein -Cu alkyl is optionally as follows: each 1 ^ 1 is independently selected from the following including: • Ar4,-(CΗ2) ι.3 * Αγ4 j -Η, and -C (0) -Ar ^ · R15 is selected from the following including -〇Η, -〇Αγ3, -Ν (Η) -ΟΗ, and -OCm, Where Cy is a straight or branched alkyl group, optionally substituted with Aι · 3, -C〇NH2, -OR5, -〇H, -〇R9, or -C〇2H: -182- (Please read the back: νϊMatters written on this page) —The technical specifications of the binding book use the Chinese National Soap Soap (CNS) A4 specification (2 ΙΟ × 297 mm) 1235157 A: B7 V. Description of the invention (Each R2 ^ it self-explanation includes 4 or straight Or branched alkyl group: ΑΓ2 is independently selected from the following, in which any ring may be -Qi single or multiple substitution as required, or phenyl substitution is required for QI substitution;

And each Y is independently selected from the following including 0 and S: each of 1 * 3 is a cyclic group and is selected from the following including any aryl group which contains 6, 10, 12 or 14 quaternions and 1 to 3 rings And aromatic heterocyclic rings contain 5 to 15 ring atoms and 1 to 3: each, the heterocyclic ring contains at least one selected from -0-, -S ·, -SO-, S02 N and 'Η-, -N (R5 )-, And -N (R9) -heteroatom group, the heterocyclic group contains more than one double bond depending on f, the heterocyclic group contains one if necessary, aromatic / coating, and the ring group Single or multiple substitutions as required by -Qi: each Al * 4 is a cyclic group, independently selected from the following including aryl groups, which contain 6, 10, 12 or 14 carbon atoms and 1 to 3 rings, and hetero The cyclic group contains 5 to 15 carbon atoms and 1 to 3 rings, and the heterocyclic group contains at least one selected from the group consisting of,... -NH-, -N (R5)-and -N (R9)-heteroatomic group, the j ring group may contain more than one double bond, and the heterocyclic group may contain more than one square ring, if necessary. And the ring base is optionally substituted by -Q 丨 single or multiple: each Q 丨 is independently selected from the following: I'-N〇2 '-CN, = 〇, -〇H ,. perfluoroc, this group, R) ·, · 〇 ^, -nhr5, or9, -N (R9) (Ri〇), R9, .c (〇) · And 183-1235157 A * B7 CH-Fgen conditions are that when -ΑΓ3 is substituted with a Q1 group, it contains more than one additional -A "group, the additional · Aγ3 group is not another -8 1: 3 Substituted by: The control condition is when: m is 1:

Ri is (elO): X5 is CH:-Min! 5 is -〇H · · R2i is -Η: and 乂 2 is 0 and R3 is · 〇: (0)-Η, then R5 cannot be: without N- (4-fluorenyl-C (〇) -R1 (}, Where R0 is -Aγ3 and the Ar3 ring group is phenyl, 4- (carboxymethoxy) benzyl, 2-fluorophenyl, 2-pyridylhexahydropyridinyl) methylphenyl , Or -C (〇) -〇R9, where R9 is -CH2-Ar3, and the Ar3 ring group is a benzyl group, which is not substituted with -Qi ... and when: γ2 is 〇, R3 is -CCOhCHrTVRH, ^ Yes. And Rn is Αγ4, where the Ar4 ring group is 5- (1- (4-chlorophenyl) -3-trifluorofluorenyl) pyrazolyl), then the R5 Ministry of Economic Affairs won the bid of the employee co-operation seal of the Twin Bureau. The system cannot be: -C (〇) -R | 0, where R10 is -Aγ3 and A &gt; 3 ring group is 4- (dimethylaminomethyl) benzyl, benzyl, 4- (carboxymethylthio) Phenyl, 4- (carboxyethylthio) benzyl, 4- (carboxyethyl) phenyl, 4- (carboxypropyl) phenyl, 2-fluorobenzyl, 2-pyridyl, MΗ-fluorenylhexa Hydroxypyridyl) Methylbenzyl, or -184-General ft dimensions of this paper § National Standard (CNS) A4 Specification (2i × 297 mm) 1235157 Λ_ B7 V. Description of the Invention (132) -C (〇) -〇R9, where R9 {-CH2-Ar3iAr3 The ring group is phenyl: and when Rn is Ar4, where the Aγ4 ring group is 5- (1-phenyl-3-trifluoromethyl) n-heptyl), then R5 cannot be:, C (〇)- 〇R9, R9 in the head is -CHyAr ^ 'Ar "Tsuk &amp; is each; fe ·: and when Rn is Ar4, where the Ar4 ring group is 5- (1- (2-pyridyl) -3-trifluorocarbamidine (Vol.): Bi Junji) 'R 5 cannot be A ··· C (〇) -Ri〇, where R 丨 0 is -Ai * 3, Ar3 ring group is 4- (dityaminoamino) benzyl , Or -C (〇) -〇R9 'wherein R * 9 疋 -CH2-Ai * 3' and the group is phenyl 'and substituted by -QI: and when Υ2 is 0, R3 is -C (〇)- CHrTrR 丨 |, Ti is 0 and Ru is -C (〇) -Aq, where the Aγ4 ring group is 2,5-diazyl, then R5 cannot be: -C (〇) -Ri〇, where R | 〇疋-Αγ] and Ai * 3 '篆 volume is 4- (diamine amine volume volume) phenyl, 4- (N-morpholinylmethyl) benzyl, 4- (N-methylhexahydroxanthine (Yl) fluorenyl) phenyl, 4- (N- (2.methyl) imidazolylfluorenyl) phenyl, 5-benzimidazolyl, 5-benzotriazolyl, N-ethyl-5- Benzotriazolyl, N · ethylethyl-benzimidazolyl, or -C (〇) -ORR9, where Chi9 is -CH2-Ar3 and Ar3 Is a stupid group and is not replaced by -Qi: and when Y2 is H2, R3 is -CCOpCHyTt-RH, Ding is 0 'and Ri is -C (0) -Ar4, where the Aγ4 ring group is 2,5 -Two 1-benzyl, then R5 cannot be:-C (〇) -OR9, where R9 is -CH2-Ar3 and the Aγ3 ring group is benzyl. Specific Example J Another type of compound (Form 2), wherein R2l is -CH3. Specific example J Another type (type 3), where 115 is -C (〇) -C (〇)-185 This paper is suitable for standard SS furniture (CNS) M size (210X297 mm) Please read the back δ attention animal

Tai I Chaoji Ministry of Health, Standards and Health Bureau employee consumer cooperative seal? Winter 1235157 Λ &quot; S7 V. Description of Invention (183) 10

OR Please read δ %% to fill in this page. Example J Another plastic compound (type 4), where 115 is -C (〇) -C (〇)-OR ^ 〇, and R2 丨 is -CH 3, with ft Example VII, preferred compounds of I and J use formula (V), where R3 is -C0-Ar, 3 is more preferred, when -C0-Ar2, Y is 0. Specific Example Η, the preferred compounds of I and J use formula (V), 'wherein R3 is -C ^ OPCHrTVI ^ [and! ^! Is-(CHJw-Aq. Better, when R3 is -CCOhCHrTl-RH and Rn |-(CH2) "rAt * 4,

TjSO. Specific Example VII. Preferred compounds of I and J use formula (V), wherein R3 is C (〇) -CH2-TrRn, 1 ^ * 0 and Rn is -C (〇) -Ar4. Specific Example VII. Preferred compounds of I and J use formula (V), wherein R3 is -C (0) -H. Specific example Η, the preferred compounds of I and J use formula (V), wherein R3 is -C (〇) -CH7-T "Rii 'and R [丨 疋 -A ι * 4 3 is better, when R3 is -C (〇) -CH2-TrRniRn is -Al · 4, but 1 is 0 or S. Preferred specific examples Η and J compounds (type I and type 2) are wherein R5 is selected from the following including: Bureau's employee capital cooperation Du Yin ¾ -C (〇) -R10, -C (〇) CMl9, and -C (〇) -NH-Rl0. In addition, preferred specific examples Η and J (type 1 and type 2) where R5 is selected from the following including: -186 paper size, using the Chinese National Standard (CNS) A4 size (210X 297 mm), printed by the Consumers ’Cooperative of the Central Government Bureau of the Ministry of Economic Affairs ^ 1235157 Λ7 Β7 5 Description of the invention (184) -S (〇), -R9 '-S (〇) "NH-Ri〇' -C (〇) -C (〇) -R10,, -R9, -C (〇) -C (〇) -〇R10, and • C (〇) C (〇), N (R9) (R10). Preferably, R5 {-C (0) -C (0) -Ri0. -In addition, 115 is-匸 (〇)-匸 (〇) -〇1110. Specific examples Η, 1 (type 2) and J (type 2 犮 type 4) are preferred compounds among them: m is 1: yes 0: R15 is -0H or -OCm straight or branched alkyl is Ar3 if necessary, -〇H, -〇R9, -CO2H substitution, where 119 is -Ct.4 branched or straight-chain alkyl: where Aγ3 is a moffordyl or phenyl group, where the benzyl group is substituted by I if necessary: Αγ2 is (hh): Y is 0: and each Aq ring group is independently selected from the group consisting of phenyl, fluorenyl, phenenyl, quinolyl, iso- 7-Calinyl, 7-bitulyl, 5 Group, iso3-oxazyl group, phenyltriazolyl group, benzimidazolyl group, side pheno 4-phenyl group, imidazolyl group, sedadiazole group, benzo [b] thiobenzyl group, pyridyl group, benzofuranyl group And 4 indolyl, and the cyclic radical is optionally single or multiple substitutions: 'Each Ar4 cyclic radical is independently selected from the group consisting of benzyl, tetrazolyl, alphapyridyl, omnazolyl, fluorenyl, Pyrimidinyl and thienyl, and the cyclic base may be a single or multiple substitutions as required: -187- The size of the paper method is commonly used in Chinese homes, ίCNS) Α4 specification (210 × 297 mm) (please read with a smile: Notes at the end of the page 1Τ 1235157 A * &quot; B7 V. Description of the invention (135)卩 丨 is independently selected from the group consisting of -NH2, -Cl, -F, -Br, -OH, -R9, -NH-R5, where t R5 is 0 or -S (〇) 2-R9, -0115 and t 115 is -C (〇) -R1 {}, · 019, -N (R9) (R10), and 〇 八 ch2,

Printed by the Ministry of Economic Affairs, the Bureau of Work and Consumer Cooperatives, where each of ^^ and 尺 0 is independently -Cw straight or branched alkyl, optionally substituted by Ar3, where the Ar3 ring group is phenyl, and the Cyclic radicals are optionally-single or multiple substitutions: The limitation is that when -Ar3 is substituted with -Q |, it contains more than one additional -Aγ3 |, and this additional Ar3 group is not substituted by another -Aγ3 group. More specific examples of compounds I (type 1) and J (type 3) are: m is 1: R: n is -H or -CH3: R5l is (^ .6 straight or branched alkyl as required Substituted by Aγ3, in which the eight 1 * 3 ring group is a benzyl group, and the ring group is optionally -Qi multiple or single substitution: each Ar3 ring group is independently selected from the following including phenyl, fluorenyl, 4phenyl, 4 Norlingyl, Isoamidine, p-Syrenyl, Yenyl, Isoxalyl, Benzotriazolyl, Benzimidazolyl, Methacene, Imidazolyl, Amadiazolyl, Benzene [B] thiophenyl, pyridyl, benzofuryl, or fluorinyl, and the cyclic group may be mono- or poly-substituted as desired; each Q is independently selected from the following including -NH2, -Cl,- F, -Br, -OH, -R9, -NH-R5, where R5 is -C (〇) -R10 or -S (〇) 2-R9, -0R5 where 115 is -C (〇) ·! ^ ., -0R9 '-N (R9) (R10)' and -188 · (Please read the notes on the back 3 ^ -book £ order. Fruit paper size standard in use §S House Standard Li (CNS) A4 Specifications (210X297 mm) 1235157 Λ · Β; 5. Description of the invention (18S) CH- where each of 119 and 111 () are independently straight or branched fluorene groups, if necessary A Generations controlled by r3, in which the Ar3 ring group is phenyl, and the ring group is -I mono- or poly-substituted as required: The limitation is that when -Ar3 is substituted with a Q 丨 group, it contains more than one German · Ars The additional -Aγ3 group is not substituted by another-group. Preferably, in these preferred compounds, Ar; the cyclic group is selected from the group consisting of: phenyl, theophyl, 5-sedenyl, 4- and 7- Molybdenum, iso-4 parent group, sigmadol, 4-oxazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, 4 benzotetralyl, imidazolyl, cydiazolyl, benzene And [b] thiophenyl, benzyfuryl, and fluorinyl, and the cyclic group may be mono- or multi-substituted as required by -Q. Specific examples Η and J (types 1 and 1) are preferred The compound is where: R3 is -C (〇) -CH2-TrRn: butyl is 0: and

Rh is -C (〇) -Ar4, in which the Aγ4 ring group is selected from the group consisting of tetrazolyl, pyridyl, acrizolyl, pyrimidinyl, and 4phenyl, and the ring is as required by -Qi Or multiple substitutions. Printed by the Ministry of Standards and Technology of the People's Republic of China Standards Bureau (Consumer's General Matters before filling out this page) Specific examples Η, I and J preferred compounds apply formula (V), where R3 is • CO-CH2 -TVRn, Rn is -Aγ4, in which the Aγ4 ring group is pyridyl, and the ring group is mono- or multi-substituted as desired. The preferred compound for specific example J (type 1) is among them: R3 is -C (〇) -H, and -189- The paper size is applicable § National Standard Plum (CNS) A4 specification (210 x 297 mm) 1235157 Λ7. B7 V. Description of the invention (187) is -C (〇) -R10, where

R1Q is Αγ3, in which the A "ring group is a benzyl group, which may be single or multiple substitutions as required: / -F, -CM, -N (H) -R5, where -115 is-: 9 or -C ( 〇) -R1 (), where R10 is-(: Bu 6 straight or branched alkyl, optionally substituted by Ar3, where 1 * 3 is -phenyl, -N (R9) (R1Q), where 119 and 111 () are independently &lt; Bu 4 straight or branched alkyl, or--0-R5, where R5 is H or -Cy straight or branched alkyl. Preferably, Aγ; Requires -C1 at the 3- or 5-position or -NH-R5, -N (R9) (R 丨 〇) or -〇-R5 at the 4-position: Single or multiple substitutions: Specific example J Other preferred The compound (form 1) is: where R3 is -C (〇) -H: 115 is -C (〇) -RlQ, where R1 () is eight 1 * 3 and the Aγ3 ring group is selected from the following including indolyl, Benzimidazolyl, 4-phenyl, and benzo [b] thiobenzyl, and the cyclic group is-(^ single or multiple substitutions as required: Specific Example J Other preferred compounds (type 1) are among them ... R3 is -C (〇) -H .. R5S-C (〇) -R1 (), where R1Q is octa [3 and the Aγ3 ring group is selected from the following including 4-methyl and iso4-yl. Single or multiple substitutions required Specific Example J Other preferred compounds (type 1) are: where R3 is -C (〇) -H; R5 is -C (〇) -Ri〇 'where Ri〇 is ΑΓ3 and the group is hydroxy group' as the standard General Chinese gg house mark (CNS) A4 specification (210X 297 mm) (please read the precautions of S before filling in this one) Pack-order 1235157 Λτ Β7 5. Description of the invention (18S) 0 \ / CH , Substituted. Preferred compounds with example (J) include the following but are not limited thereto: 2002

.COOH ΧΗΟ Η 2201 OMe π

In addition, the ICE inhibitor with the following example (K) is the following formula: (VI) Central sample of the Ministry of Economic Affairs. Printed by the China Bureau of Beige Consumers Co-operative Society where: R is R1_N-R2 Η 191 Family Mark Li (CNS) Α4 Specification (210X297 Public Transformer) 1235157 Λ * B / V. Description of Invention (189) (el〇)

Or (w2)

(Please read the meanings of the back of the cloud before you fill out this page) C is a ring selected from the following: Benzo, pyridino, 4-pheno, pilo, furan, 4zozo, isothiazozo, Oxazo, isoxazo, edge pyrido, imidazo, cyclopentyl and cyclohexyl: single or multiple substitutions as required by the ring; R, is: 〇 (〆〇 ^ r-oRst or Central Ministry of Economic Affairs 糅Prohibited employee consumer cooperative seal ¾ (b) 0

ORa ORst ORsi m is 1 or 2: -192 · This paper 伕 standard is applicable to the gg family standard (CNS) six 4 pans (210X29? Mm) 1235157 Λ7 B7 V. Description of the invention (190) Each independently selected from the following Including: -C (〇) -R10 '-c (o) o-r9, -C (〇) -N (R10) (Ri〇), -S (〇) rR9' -S (〇) 2-NH- R10, -C (〇) -CH2-〇-R9, -C (〇) C (〇) -R10, -R9, -H, -C (〇) C (〇) -〇R10, and -C (O) C (O) -N (R9) (R10): X5 is CH or N: Y2SH2 or 0: R6 is selected from the following including -H and -CH3:

Rs is selected from the following including: -C (〇) -R | 0, -C (0) 0-Rg y -C (〇) -N (H) -Rl0, the Ministry of Economic Affairs: System (please read the meanings of the cloud before filling out this page) -S (〇) rR9 '• S (〇) rNH-Rl〇, · -C (〇) -CHr〇Rl0, -C (〇) C (〇) -R10, -C (〇) -CH2N (R10) (R10), • 193- This paper is applicable to the standard § 8 standard li (CNS M4 specification (2I0X297mm)) Printed by the Consumer Cooperatives of the Twin Bureau 1235157 Enter 7 B7 V. Description of Invention (W1) -C (〇) -CH2C (〇) -〇-R9, -C (〇) -CH2C (〇) -R9, -Η, and -C (〇) -C (〇) -〇R10: Each 119 is independently selected from the group consisting of -8 ^ 3 and -〇β6 straight or branched alkyl as required. Substituted by 1 * 3, where- Cw alkyl is unsaturated as required: Each R 丨 〇 is sent from three of the following including -Η '-A r 3'-C $. 6 泛泛 卷 'and -C 1.6 straight or branched alkyl as Ar3 as required Substituted, where -Cy alkyl is not as desired and ...

Ri3 is selected from the group consisting of fluorene, Af3, and (: Br 6 straight or branched alkyl, optionally Ar ;, -CONH2, -0R5, -〇H, -〇R9 or -CO2H substituted: 51 is independently selected from the group consisting of R9, -C (〇) -R9, -C (〇) -N (H) -R9, or each of R51 forms a saturated 4-8 member carbocyclic ring or contains -〇-,- S- or -NH-G: Each R: 1 is independently selected from the following including -H or -Cy straight or branched alkyl groups: Each A. is a cyclic group independently selected from the following including aryl, which contains 6,10 , 12 or 14 nephew atoms and 1 to 3 rings, and an aromatic heterocyclic group containing 5 to 15 carbons and 1 to 3 rings, the heterocyclic ring containing at least one selected from -Od-S-, -S〇-, S〇2, = N- and -NH- heteroatoms, and the heterocyclic group may contain more than one double bond, and the heterocyclic group may contain more than one aromatic ring as required And the ring base is optionally-(^ single or multiple substitutions: each Qi is independently selected from the group consisting of: ΝΗ2, -CO2H, -Cl, -F, · Βι :, -I, -NO] , -CN, = 0, -OH, -total C 3 alkyl, R5, -0R5, • NHR5, OR9, · N (1119) (1110), R9, -C (〇) -R10, and -194- This paper block size is suitable for S Home Standard Crimson (CNS) A4 size (210 X 297 mm) (Read depression precautions to fill out the back of this page)

Order 1235157

Ar B7 V. Description of the invention (192) CH. The limitation is that when -Al · 3 is a Q¹ group substitution, it contains more than one additional -Ar ·; group, the additional-group is not another -Ar3 group. Substitution: The preferred compounds of this example are: where m is 1: C is a ring selected from the group consisting of benzo, pyridino, or 4-pheno, and the ring is as desired, -NH-R5, -NH A single or multiple substitution of -R9, -〇Rl {) or -119, wherein they are straight or branched (: μ4 alkyl and R1 () is Η or straight or branched (: p4 alkyl: r6sh: 1113) Straight or branched alkyl of fluorene or CN4 is optionally Ar ;, -OH, -OR9, or -CO2H substituted, wherein branched or linear alkyl: where Ar3 is morphoyl or phenyl Where phenyl is optionally substituted by Q t; Chi 21 is 4 or -CH3: R51 is C μ straight or branched alkyl, optionally substituted by Aγ3, where A "is phenyl and optionally Replaced by -Qi: Printed by the Central Laboratories of the Ministry of Economic Affairs, Shellfish Consumer Cooperative, ¾ (Please read the meaning of 背? ??) i ^ prfr Bego Αγ3 ring groups are independently selected from the following including benzyl, hydrazone, Thienyl , Pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzoimidazolyl, 4 benzophenazolyl, imidazolyl, amidazolyl, benzo [b] thiobenzyl, pyridyl , Benzofuranyl, and 4 indolyl, and the cyclic group is optionally substituted by-(^ single or multiple substitutions: each Qi is independently selected from the following including -NH2, -Cl, -F, · Bι :, -OH ， -R9, 195- The standard of this paper is applicable § National Standard Twin (CNS) A4 is now (210X297 mm) 1235157 Λ7 _ _ _B7_ 5. Description of the invention (193) -NH-R $, R5 in the header is -C (〇) -Ri〇 or -S (0) 2-R9 '-〇 R5 in the 3 heads -C (〇) -R [〇' -〇R9 '-NHRg' and

Each of 119 and 111 (3 is independently -0: Bu 6 straight or branched alkyl, optionally substituted by Ar3, where Aγ3 is a benzyl group: the restriction is when -Aγ3 is substituted with a Qi group, It contains more than one additional -Aγ3 group, the additional -Ar3 group-is not replaced by another -Ar3 group. · Better, in these preferred specific examples, {^ is ~ 2) and other substituents are as above Defined by the text. The compounds with the preferred examples include the following, but are not limited to them: (Please read the precautions for δ before filling this page)

Consumption Co-operation of Employees of China Bureau of Economic Affairs, Ministry of Economic Affairs ¾

Preferably, R8 is selected from the following including: -196- The standard of the paper is suitable for the SS family standard (CNS) A4 ^ t (210 ^ &lt; 297 mm) 1235157 Λ7 B7 V. Description of the invention (1θ4)- C (〇) -R 丨 〇, -C (〇) 〇-R9, (please read the precautions of the back page first) -C (〇) -CH2-〇R10, and / -C (〇) -CH2C (〇) -〇-R9, the best, In addition, in this preferred embodiment, 1 ^ is Bu 10) and x5 is CH, and the other substituents are as defined above. In addition, in this preferred embodiment, the heart is ㈠⑺) and x5in, and the other substituents are as defined above. -Preferably, in any of the above compounds of specific example (K), 115 is &lt; (〇) -Rio or-(:( 〇)-(:( 〇) -111 (), and the other substituents are as above As defined. Preferably, Rio is -Αγ3 and the other substituents are as defined above. Better, in these preferred compounds ... R5 is -C (〇) -R | 〇 and Riq is Αγ; 'wherein Αγ3 ring The radical is phenyl, which may be mono- or multi-substituted as follows: -R9, in which R9SCle4 is a straight or branched alkyl group: -F, -C1, in the Ministry of Economic Affairs, Bureau of Standards, Offset and Consumer Cooperation Cooperation--N (H) -R5, where -R5 is -H or -C (〇) -Ri〇, where R1 () is-(: 丨. 6 straight or branched alkyl, optionally substituted by Ar3, of which eight "3 is phenyl, -N (R9) (R 丨 〇), where 119 and 111 () independently 3 is also -Cw straight or branched alkyl, or -〇-R5, where R5 * H or -CN4 is straight Or branched alkyl group. The preferred compounds of this preferred embodiment include the following, but are not limited to them: -197- §S House Standard Twin (CNS M4 Specification (2 丨 0/297)) ) 1235157 Λ * Β7 V. Description of the invention (195)

HaC

Π

(Please first &gt; τ1ίNotes on back cloud? Ben Yibei)

• IT Ministry of Economic Affairs won the bid of the Bureau's employee consumer cooperative ¾

. &gt; 1 The size of this paper is applicable. § National Kneaded Plum (CNS) A4 specification (210X297 mm) 1235157 Λ7 _ B7 V. Description of the invention (196) The best, A 4 is a stupid base, at 3-or 5- The compounds substituted with -Cl at the position or -NH-R5 at the 4-position, -N (R9) (R1 {}), or -0-R5 are substituted with the following examples: But not / limited to this ... (please read ^ Notes of Back Cloud before filling this page)

This paper removes the scale, using Chinese gg home rubs (CNS) A4 rules (210X297 mm) 1235157

AT V. Explanation of the Invention (197) Other preferred compounds of the best specific examples include the following, but not the same? Good for this: ... one 〇 213k

α ο 213m

〇 550k

And (please read the precautions of S before filling in this I)

-200 · 'Paper scale is suitable for Chinese g countries (CNS M4 specification (2 丨 0X297 mm) 1235157 Λ7 B7 V. Description of the invention (tear) In addition, Ar3 is a stupid base, which can be in 3- or 5-position Is a single or multiple substitution by R9, where R9 is a straight or branched alkyl group of CN4; and -0-R5 at the 4-position (please read the precautions of Beiyun before filling in this I) single or multiple substitution / Other preferred compounds of this best embodiment include, but are not limited to:

• 201-The size of this paper is the same as that of the standard gg domestic standard car (CNS) A4 (2 丨 0X 297 mm) 1235157 Λ: B7 V. Description of the invention (1S9)

Other preferred compounds of this preferred embodiment include the following;

〇

(Please try the following first: Please fill in this page with VJ matters) · νύ Printed by the Consumer Standards Cooperative of the Central Standard Bureau of the Economic State ¾ 〇

• 202- __ The standard of this paper is universal. §S Domestic Standard (CNS) A4 specification (2 丨 0X297mm) 1235157 B ~ 5. Description of the invention (20 °) 〇

Du Yin ¾ In addition, in this preferred embodiment, 115 is 0, where r1q is Αγ3 and Αγ3 ring group is selected from the following: Group, quinolyl, iso, quinolyl, and benzo [b] thiobenzyl, and the ring base is optionally substituted by -Qi. Preferably, the Ar3 ring group is isoquinolinyl. Preferred compounds of this best embodiment include, but are not limited to:

The standard of this paper is commonly used in 1 national standard (CNS) A4 specification (210X 297 male 5) 1235157 A. B7 V. Description of invention (2 (D1) Printed by the Central Bureau of Standards of the Ministry of Economic Affairs and Consumer Cooperatives ¾

-204- The Sg family standard (CNS) A4 specification (210X 297 mm) applicable to this paper music standard (Please read VT's back and notes before filling out this page) Order 1235157 B7 V. Description of the invention (2Q2)

(Please fill in this page first with T1i's IT), other preferred compounds for ordering this specific example include the following, but the benefits are not limited to the cooperation of employees of the China Prospective Bureau of the Ministry of Economic Affairs. Here: -205- The standard of this standard §§ Family standard (CNS) A4 specification (210X297mm) Ministry of Economic Affairs Central Standards Bureau Shellfish Consumer Cooperative · Printing 1235157 Λ7 Β7 V. Description of the invention (2D3) 〇

(Please read the precautions of Back Cloud first and then fill out this book)-Binding • 206 · This paper uses iron scale for tl! National Standard (CNS) A4 specification (2 丨 0X297 mm) 1235157 V. Description of the invention ( 204) 〇412d

Ο 412e

〇 Η 〇 412f

412g

(Please read the notes on the back &amp; before filling out this page) Order Printed by the Central Government Bureau of the Ministry of Economy Staff Consumer Cooperatives 412h

Ο

-207 · The size of this paper is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157. Λ / Β7 V. Description of the invention (205) Ο 550q

In addition, in this preferred embodiment, R5 is -C (〇) -Ri〇, where R is Ar; and the Ar3 ring group is phenyl, which is substituted by 〇 / \ \ / '

CH 2 (Finally, read the notes on the back of the cloud, Vf, and then this one. The preferred compounds for this example include the following, but are not limited to this: 213η M Ministry of Economic Affairs, Ayou Automobile Bureau, Employee Consumer Cooperatives India ¾ Ο 415a

Ο 415b

〇

Order ¾ and • 208 paper &amp; standard (Chinese national standard) (CNS) A4 size (210X 297 mm) 1235157 B7 5. Description of the invention (206) 415c

Other compounds of the specific example (K) include the following, but it is not limited to X (please read the following first: / X meaning matters and then copy) 213f

〇 213g

Ί * τ #Printed by the Consumers' Cooperatives of the Ministry of the Central Ministry of Standards and Labeling ¾ • 209- National Standards (CNS) A4 (2 丨 0X297 mm) 1235157 Λ. Β7 V. Description of the Invention (207) 213h

α 2131

ο 213j

2131 Seal of Consumer Cooperatives, Central Bureau of Standards, Ministry of Economic Affairs ^ Ο Λ

• 210 (please read the meaning of .vi before the father first fill in this page)

The standard of this paper is the national standard (CNS) A4 specification (210X 297 mm) throughout the week 1235157 Λ- A / B7 V. Description of the invention (203) 0 Printed by the Consumer Affairs Cooperative of Lida Bureau of the Ministry of Economic Affairs ¾

Binding% -211-§§ Family standard twins (CNS M4 specification (210X 297 mm)) 37 1235157 V. Description of the invention (209)

213t 〇: 0 〇

(Please read the other ..I notices on the back of this book. I. Installation Η Η

213u

Ordered by the Ministry of Economic Affairs by the Central Bureau of Standards, poverty alleviation cooperation, Du printed 〇

-212. ¾¾ standard universal house (CNS) A4 specifications (210 × 297 mm) 1235157 AT B7 V. Description of the invention (211) 〇

〇

〇 264e 264f M awarded by the Ministry of Economic Affairs of the Ministry of Foreign Affairs of the People's Republic of China. Printed by the Consumer Affairs Department of the Bureau of Foreign Affairs.

-214 This long method scale is applicable to the standard gg standard (CNS) A4 (210X 297 mm) 1235157 λ- 37 V. Description of the invention (212) 2 64h u

ο ο Ν Η Ο.

264i 〇

Ο

〇

Ο i Ύ 一 Η ° -ο (Please read the meanings of the back of the cloud before you buy ^^ buy this * ml Hr · 2S4j 〇

ο Ordered by the Ministry of Economic Affairs of China

Ben. ¾¾ scale transfer to Ning §1 standard Li (CNS Μ4 specifications (2! 0 × 297 mm) 1235157 Superconsumer Ministry Central Cup Twin Bureau staff consumer cooperation ii India

1235157 Λ7 B7 Μ The Ministry of Economic Affairs won the bid for the cooperation of the staff of the Li Bureau. Du Yin ¾

1235157 Five 'Description of the Invention (215) 2100f

2100g Ο

〇 0 (Read first &gt; τ Read the notes of the cloud before filling in this I) Pack ---- Order 2100h 〇

ο ο Τ3 ο 2100! &lt;

-218- The standard of this music is the same as the standard of the Chinese family (CNS) Α4 Teg (210X29mm)

I 1235157 Λ7 Β7 V. Description of the invention (2Ίδ) 21001 21〇〇m

〇 (Please fill in this page first &gt; 1 intent V ?, then fill in this page and install 21〇〇π

Η Ο

Η

Order 2100ο ν

Η 〇

〇

〇 〇 Another specific example (L) of the ICE inhibitor of the present invention is the following

VII (VII) -219- Dimensions of this paper are applicable to Zhongjia Li (CNS) · A4 size (210X29) 12 1235157

AT B7 L. Description of the invention (217) where: m is 1 or 2... Is selected from the following including:

Re

(Please read the precautions of Beunyun before filling out this purchase) (w2) c is a ring selected from the following including benzo, pyrene, and benzophenone. Biloxipine, squeaking, stubborn, heterosexual bite *, ° Severe spleen, iso0§, bite, pyrimide, imidazo, cyclopentyl and cyclohexyl, -Q as required Single or multiple substitutions: i; R ;; selected from the following: -CN, -C (〇) -H, -C (〇) -CHrTrRn, -C (〇) -CH2-F, -C ^ NO-Rg 'And -C 0-A r, · each R3 · are independently selected from the following including: -C (〇) -R10, • C (〇) 〇-R9, -C (〇) -N (R 丨 0) ( R | 0) -S (〇) 2-R9, -s (〇) 2-nh-r10, 220 Applicable paper scales § National Prayer (CNS> A4 specification (210X297 mm) 1235157 Λ 7. Β7 5 Description of the invention (213) -C (0) -CH2-CM19, -C (〇) C (〇) -R 丨 ο, -R9, ^ • Η, -C (〇) C (〇) -〇Rl0, And -C (〇) C (〇) -N (R9) (R10): each D is independently selected from the following including -〇-, -s-, -s (〇)-, and -s (〇) 2- r6 is selected from the following including -Η and -CH ;:

Rs is selected from the following including: • C (〇) -R10, -C (〇) 〇-R9, -C (〇) -NH-Rl0, -S (〇) 2-R9 '-S (〇) rNH- R10, -C (0)-CH ^-0 R jq 7 -C (〇) C (O) -Rl0, -C (〇) -CH2N (Rl (3) (Rl0), -C (〇) -CH2C (0) -0-R9, -C (0) -CH2C (0) -R9, Consumption Cooperation of the Central Standards Bureau of the Ministry of Economic Affairs · Social Printing (Please read the precautions on the back before filling this page) -H , And • C (〇) -C (O) -〇R10; Each R9 is independently selected from the following including -Ar3 and-straight or branched alkyl groups, which are optionally substituted by Aγ3, where alkyl groups are required Not cesium and: Each R10 is independently selected from the following including -H, -Ar3, C3.6 ring pit base, and -CN6 • 221-The national standard (CNS) A4 regulations (2 丨 0 X) 297 mm) 1235157 B7 V. Description of the invention (219) A straight branched alkyl group may be substituted by Ars if necessary, of which -Ci-6 alkyl group may be continuously added as required: Each Rn is independently selected from the following including: , -Αγ4,-(CH2) l.3-Ar4 J -Η, and -C (0) -Ar4: '

Rl5 is selected from the group consisting of -OH, -〇Αγ3, -N (H) -〇H &amp; -OCn6, where Cl.6 is a straight or branched alkyl, as desired-Ar3, -CONH2,-. R5, -OH, -OR9, or -CO2H:

Ar2 is independently selected from the following, in which any ring may be substituted by -Qi single or multiple, or phenyl may be substituted by Q 丨 as required: (hh) and (ϋ) {please read 35 of the back: VJ The matter is one more thing ^ Ma Benxi is printed by Yi Ning Central Standards Bureau Shellfish Consumer Cooperatives, where each Y is independently selected from the following including 0 and S each Aγ3 is a cyclic group, independently selected from the following including aryl, which contains 6 , 10, 12 or 14 carbon atoms and 1 to 3 rings, and an aromatic heterocyclic group containing 5 to 15 —. — Ring atoms and 1 to 3 rings, the heterocyclic group containing at least one selected from -〇_, I '* S〇-, S02, = N- and -ΝΗ-, · N (ί15)-, and -N (R9) heteroatom group' 2 Although the cyclic group contains more than one Double bond, the heterocyclic group may contain more than one a aromatic ring as required, and the ring group may be -Q 丨 or 222 ·

-{i—-I -I 1 · S) Α4 ^ / ^ (210X297 publicly available) General paper iron scale § g 1235157 Λ7 B7 V. Description of the invention (220) Multiple substitutions: Each is a cyclic group and is independently selected from The following includes aryl groups containing 6,1 0,1 2 or 4 carbon atoms and 1 to 3 rings, and heterocyclic groups containing / 5 to 15 ring atoms and 1 to 3 letter rings, the heterocyclic group Containing at least one heteroatom group selected from the group consisting of -0-,-5-,-5o ·, S0: · N-, -NΗ-, -N (R5)-, and -N (R9)-, the Heterocyclyl contains more than one double bond as required, the heterocyclyl contains more than one letter of aromatic ring as required, and the ring group is optionally substituted by -Q 丨 single or multiple substitutions; each Qi is independently selected From the following include -NH2, -C02H ·, -Cl, -F, -Br, -I, -NO], -CN, = 〇, -〇Η, -perfluoroC, 3, and 5 -〇R5, -NrHR5, OR9, -N (R9) (Ri〇), R9, -C (O) -R10, and

(Please read the precautions for back cloud first, and then make it larger .. Pages of the Ministry of Economic Affairs Central Procurement Bureau Staff Consumption Cooperation Seal ¾ Restrictions are when-eight. When replaced by 1, it contains more than one additional -Ar ; The additional-Αγ3 group is not replaced by another-eight 1: 3 group: preferably, m is 1: C is a ring selected from the group consisting of benzo, rho, and 4o Must be 3, -NH2, -NH-R5 &lt; -NH-R9, -〇Ri〇 or -R9 mono or poly substitution, where R9 is straight or branched -Cle4 alkyl, and R1Q is 1.4 alkyl: but 1 is 0 or S: 'R3H: Rii is selected from the following including -Ar4, and -C (〇) -Ar4: Αγ2 is (hh): • 223- order Chinese § National Standard (CNS) A4 (210X297 mm), Bγ, · ΟΗ, -R9. '-〇 ^^ where R and-are 1235157 Λ7 B7 V. Description of the Invention (221) Y is 〇: each The Ar ^ ring group is independently selected from the group consisting of phenyl, naphthyl ... sahyl, stubyl, isoquinolyl, tazozolyl, benzimidazolyl ^ 4phenolophenyl • thiadiazolyl , Benzotrisyl, benzo [b] thiobenzyl, benzofuryl And a pyridyl group, and the cyclic group may be a single or multiple substitutions as required: each Aγ4 ring group is independently selected from the group consisting of phenyl, tetrazolyl, fluorenyl, amidinyl, oxazolyl, pyrimidinyl, or Indolyl, and the cyclic group may be single or multiple substitutions as required by -Q1: each Qi is independently selected from the group consisting of -NHj, -Cl, -F -NH-R5 where R5 is -C (〇) -R丨 〇 or -S (〇) rR9-(:( 0) -1 ^ 0, -〇R9, -NHR9 &amp; (Please read the precautions for VS7 first.)

〇 / \\ /

CH 2 is defined in which each of 119 and R1 () are independently -C ^ 6 straight or branched alkyl groups, optionally substituted by -Aγ3, where Aγ3 is a phenyl group;

The limitation is that when -Al · 3 is substituted with an h group, it contains more than one additional -Αγ3 group, and the additional -Αγ3 group is not substituted with another · Ar3 group. The preferred compounds of this preferred embodiment include, but are not limited to, the following: Central Standard of the Ministry of Economic Affairs. SH Employee Consumption Cooperation Seal ¾ 653

-224 · The standard of this paper is applicable to the Chinese standard Li (CNS) A4 regulations (210X 297 public) 1235157 Λ. · Β: 5. Description of the invention (you)

(Please read the precautions for Back Cloud first and then fill out this page) -225 · L Paper Size Standard § National Standard Twin (CNS) M Regulation (210X297 mm) 1235157 Λ: Β1 V. Description of Invention (23) 705 7〇6

Η H -J 〇 ν ^ ν ^ η (please read the text first and fill in this page with your vJ) 〇 709

Ν Ν ^ Λ CH3 〇 Η 〇 〇 〇

ΟΗ N ^ V-H Η Ο 710

Order 4 Ji Industry and Consumer Cooperation of the Central Sample Bureau of the Ministry of Economic Affairs Du Yin ¾ 〇

And 226- Chinese Standard Standard (Monthly) Chinese National Standard Plum (CNS) A4 Regulation (210X 297 mm) 1235157 Λ, Β7 224, V. Description of Invention (HO 〇 〇

Preferably, R3 is -C (0) -Ar2 and the other substituents are as described above. In addition, R3 * -C (〇) CH2-TrRn:. In addition, R3 is-(:( 〇) -Η. Good, in the specific example (L) above- any of the compounds, 113 is selected from the following including:- C (〇) -R 丨 〇, -C (〇) 〇-R9, -C (〇) -CHRO10, and -C (〇) -CH2C (〇) -R9. Preferably, R8 * -C ( 〇) -CH2-OR10 and R 丨 is -Η or -CH3. In addition, the ICE inhibitor of the specific example (L) of the present invention is the following formula: (V)

(Please read the notes on the back before filling out this page} Printed by the Shellfish Consumer Cooperative of the Central Standards Bureau of the Ministry of Economy ¾ where: m is 1 ·· R1 is: (elO-B) YA2

§§Family Standard (CNS) A4 Regulations (210X 297) in this standard scale 1235157

AT B7 V. Description of the invention (225) R3 is selected from the following: -CN, • C (〇) -H, --- C (〇) -CH2-T "Rn, -C (〇) -CHrF, -C = N-〇-R9, and -C 0-A r 7: each 115 is independently selected from the following: -C (〇) -R 丨 〇, -C (〇) 〇-R9, -C (O ) -N (Rl0) (R10) -S (0) 2-R9, -S (〇) 2-NH-Rl (3, -C (〇) -CHr0-R9, -C (〇) C (〇 ) -Rl0, -j • H, • C (〇) C (〇) -〇RI0, and -C (O) C (O) -N (R9) (Rl0): 1 * 12 or 0: each! ^ Is independently selected from the following including or -S di: each 119 is independently selected from the following including-A. and -Cw straight or branched alkyl is optionally A. Substituted, wherein -C &quot; alkyl is as necessary and : Each Ri〇 is independently selected from the following including -Η, -Αγ3,03.6cycloalkyl, and -Cm • 228-This paper applies the national standard plum (CNS) A4 standard (210X 297 mm) (Please read first Note on the back δ and then fill out this page) Binding 1235157 A7 B7 V. Description of the Invention (Norway) Oxygenated Forking Pantai 'Deems the place as Α 3 Replaced by Gongzhong-C Bu 6 Hanji TV / -jin Needlessly, each ruler is selected independently from the following: / -Ar4,-(C Η 2) 1.3- Α Γ 4 '- And -C (0) -Ar_i · r15 is selected from the group consisting of -〇H, -〇Αγ3, -N (H) -〇H, and -〇 (: b6, where Cu is a straight or branched alkyl group) -Substituted by -Ar3, -CONH2, -〇R ,, -OH, -〇R9, or -CO2H: R〇 ^ is -H oxygen-C Η 3: A r: Yes: ( (Please read the precautions of Back Cloud before filling in. End page)

Short * · Ministry-like sample of Huahua Shellfish Consumption Packing where Υ is 0: Each Ar3 is a cyclic group independently selected from the following including phenyl, fluorenyl, 4-phenyl, and!: ΑαMulyl, Allologs β-linyl, stilbene, β-succinyl, iso-immunyl 4-yl, benzotriazolyl, benzimidyl 4-yl, 4-pheno-4phenyl, imidyl, diazolyl, Benzo [b] thiophenyl, pyridyl, benzofuryl, and fluorinyl, and the cyclic group is optionally -Qi single or multiple substitutions: each Aγ4 is a cyclic group independently selected from the following including: phenyl , Tetrazolyl, pyridinyl, ° oxo, fluorenyl, amido, and phenoyl, and the ring base may be -Q〆 single or multiple substitutions as required: -229 · This paper is suitable for ft dimensions § Family standard Lee (CNS) A4 specification (2 丨 0X297 mm) 1235157 Λ 7 B7 V. Description of the invention (227) Each Qi is independently selected from the following including: -NH2, -CM, -F, -Br, -〇 H, -R9, -NPMI5, where R5 * -C (〇) -Ri〇 or -S (〇) 2-R9, -0R5 Let 115 be -C (〇) -Rι 〇, -〇Rg '-NHRg And ^ 〇 / \ CH ,, \ /-0 The restriction is that when -Ar3 is replaced by Q 丨, it contains more than one additional -Aq group, the additional Ar3 group is not replaced by another -Aγ3 group: The limitation is when: ~ m is 1 · [^ 5 is -OH: R: l is -Η :, and Y2l0 and R3 * -C (〇) -H, then R5 cannot be: -C (〇) -R 丨 〇, where R1Q is -eight 1 * 3 and Ar3 ring group is phenyl, not substituted by -Qi, 4- ( Carboxymethyloxy) phenyl, 2-aminophenyl, 2-pyridinyl, N- (4-methylhexahydrohexanyl) methylbenzyl, or -C (〇) -OR9, of which 119 It is -CH2-Ar3, and the Αγ3 ring group is phenyl group, which has not been replaced. And when: The Ministry of Economic Affairs, the Central Bureau of the Central Government, the consumer cooperation printed by this bureau (please read the precautionary page of VS7 first) Y2 is 0, R3 is -C ^ OhCHrTVR 丨 丨, D1 is 0, and Rn is Aγ4, wherein the octa [4 ring group is 5- (1- (4-chlorobenzyl) -3-trifluoromethyl ) Heyzolyl), then 1 ^ · cannot be:--Η--C (〇) -RlQ, where Ri〇 is · and Α. The cyclic group is 4- (diamidoamino) phenyl, phenyl, 4 · (carboxyamidothio) phenyl, 4- (carboxyethylthio) benzyl, 4- (-230-benzidine Standards in use § National Standard Plum (CNS) A4 specification (2iOX29H $) 4-1235157 B7 5 'invention description (22δ) carboxyethyl) benzyl, 4- (carboxypropyl) phenyl, 2-gas Benzyl, 2-benzyl, (4-methylhexahydropyridinyl) methylphenyl, or • C (〇) -OR9, where R9 is isobutyl or -CHrAh and Ar3 is benzyl And when Rn is Ar4, wherein the Aγ4 ring group is 5- (1- (2-: pyridinyl) -3-trifluoromethyl) oxazolyl), then 115 cannot be:, where R1 (3 is- Ar3 and Ar; the ring group is 4- (dimethylammoniofluorenyl) phenyl, or -C (〇) -OR9, where 119 is -CH2-Ai: 3, and the Aq ring group is phenyl, not Substitution ... and when:-Y2 * 〇, R3 is -C (〇) -CH2-TrRM, Tι is 0, and Rn is • C (〇) -Ar * 4, where the Aγ4 ring group is 2,5-di Chlorobenzyl, then R5 cannot be: C (〇) -Rl (), where Rl (} is -Ar; and Ar; the cyclic group is 4- (dimethylaminomethyl) benzyl, 4- (N -Morpholinylmethyl) benzyl, 4- (N-methylhexahydrofluorenyl) fluorenyl) Phenyl, 4 · (N- (2-methyl) imidazolylmethyl) phenyl, 5-benzoamido, 5-benzotriazolyl, N-ethyl-5-benzytriazole Group, Ν-ethilyl group, 0-benzyl, and imidyl group, or -C (〇) -ORR9, wherein R9 is · 〇Η2-Αι * 3, and the Aγ3 ring group is phenyl, not substituted (^ ; And when the consumer cooperation of the Central Standards Bureau of the Ministry of Economic Affairs of the People's Republic of China Du Yin ¾ Υ2 is H2, R3 is · CCCO-CHrTrRH, Ti is 〇, and Rn is -C (〇) -Ar4, where the Aγ4 ring group is 2,5 -A dikisyl group, then R5 cannot be: -C (0) -〇R9, where R9 * -CH2-Ai * 3 · and the Aγ3 ring group is a benzyl group. Better than the specific example (L) any of the above compounds In the formula, R3 is 4 (0) · Η, and 115 is -C (〇) -R1 () or -C (〇) -C (〇) -R1 (}, and its 仡 substituent is as defined above. 231-This .¾¾ standard is applicable in 2! National Standard Twin (CNS) A4 is present (2 丨 0X297 mm) 1235157 Λ. A ·, 3 V. Description of the invention (22S) Better R1Q * -Ar3, and others The substituents are as defined above. Preferred among these compounds: R5 * -C (〇) -Ri〇 and Rio is Aγ3, wherein the Ar3 ring group is phenyl, if necessary, the following single or multiple substitutions:- R9, where R9 is a straight or branched Cm alkyl group: -F, -C1, · -N (H) -R5, where -R5 is -H or -C (〇) -R10, where R1Q is -Cy or A branched alkyl group, optionally substituted with Aγ3, where eight "is phenyl, -N (R9) (R1Q), where 119 and 111 () are independently-(: .. 4 straight or branched alkane Or -0-R5, where is 115? 1 or -Cm straight or branched alkyl. The preferred compounds of this preferred embodiment include the following, but are not limited to them: (Please read the precautions on the back first before _

Order

Printed by Duan Huaju, Ministry of Economic Affairs, Consumer Cooperation

This paper music scale is applicable to the TSA family standard (CNS) A4 specification (2 丨 0X 297 mm) 1235157 V. Description of the invention (23〇) 911 691b

HO Ο 4 Ο

ηΝ &quot; ο ΟΗ, Η ΗΟ Ο

(Please read the back of the cloud: VJ matters before

Order

Peiji Department · Yongyang Biao. Foreign Bureau Bei Erxiao Cooperative Cooperative Association Printing ΗΟ Ο

Η 〇 Η 及; and -233- This standard for frame killing uses tg national standard (CNS) A4 specification (210 X 297 mm) 1235157 Employees' cooperation cooperation of the Central Sample Bureau of the Ministry of Economy Du Yin ¾ 5. Description of the invention (231 916 HO4

〇 ΛhT Γ9 r ^ oh HO Ο Μ: ~

N ^ A is the best. The phenyl group is -Cl at the 3- or 5-position and • NH-R5 at the 4-position, -N (R9) (R1 (3), or -〇-R5 Or multiple substitutions. Preferred compounds of this preferred embodiment include, but are not limited to:

662

CL

HCT (Please. ¾¾ Read the notes of back cloud and fill in this I) HO 〇

Cl HO 669

• 234 paper method scales, standard domestic standard (CNS) A4 (2 丨 0X297 mm) 37 1235157 V. Description of the invention (232) 686 H2

Cl Ο

OH H H 〇 689a

914

(Please fill in this item first before paying attention to T1t)

• Staff of the Ministry of IT and Economic Affairs, China Bureau of Cooperation and Cooperation Du Yin ¾ 915

And • 235- The paper scale is universal _3 National Standard Ocean (CNS) A4 specification (210X297 mm) 1235157 Λ7 Β7 Description of the invention (233,

Other preferred compounds of this best embodiment include column T, but not here: 214k

And (Please read the precautions of Beunyun \ ^ Buy separately) Binding 〇 214πι

Printed by the Consumers' Cooperative of the China Prototype Bureau of the Ministry of Economic Affairs, Ar3 is a benzyl group, which is mono- or poly-substituted by -R9 at the 3- or 5-position, where R9lCle4 is a straight or branched alkyl group: and It is mono- or poly-substituted at the 4-position by -0-R5. The preferred compounds of this best embodiment include the following, but are not limited to the following: -236- This long κ degree stains the tS national standard (CNS> Α4 specification (210/29 mm) 1235157 A: r \ turn V. Invention Description (234) 671

η 684

689b

〇b. ¾ Central Ministry of Economic Affairs, Consumer Affairs Cooperation Bureau • Printed by the agency 691a HO a〇

0 H3C HO

H3

. ·, Aoh people, nine H

〇 Ν 'H 〇 -237 Chinese paper knead plum (CNS) with six hearts (2 丨 0X 297 mm) 1235157 3Τ 5. Instructions for issuing M (235)

(Read the first 3 readings of the back of the cloud. · V 〖I want to fill out this purchase) Order. ¾ The Ministry of Economic Affairs of the People's Republic of China's detailed bureau of the consumer consumption cooperation · Social printing 4H each of the best specific examples of other best compounds include the following , But not limited to: '214w 0

-238- This standard applies to SS furniture (CNS) A4 specifications (210X297 mm) 37 1235157 5. Description of the invention (236) In addition, in this preferred example:

Rf is -C (〇) -R10, where R10 is Αγ3 and Αγ3 ring group is selected from the group consisting of 4 AI, complete imidyl, sphenenyl, sulfonyl, isoisopropyl and benzo [b ] Is more phenyl, and the cyclic group is optionally mono- or polysubstituted by -1. The preferred compounds of this preferred embodiment include, but are not limited to:

And 920

4 Consumption co-operation seals of employees of the Sino-Youyang Bureau of the Ministry of Economic Affairs? It is preferred that the Aγ3 ring group is iso, quelinyl, and the ring group is optionally substituted by single or multiple substitutions. The preferred compounds of this best embodiment include the following, but are not limited to the following: -239- Application Standards of this paper 国家 National Standard Xin (〇 ^) '* \ 4present grid (2 丨 0 乂 297 mm 3. 1235157 V. Description of the invention (237) 69β

Ρ 696-1

Employees of the Central Government Bureau of the Ministry of Economic Affairs of the People's Republic of China eliminated the cooperative seal 51 and

Another preferred compound of this best specific example includes the following but is not limited to this: • 240 paper-based methods in general § National Rubbing (CNS Μ4 Tiege (210X297 mm) 1235157 A: B7 V.% Description (23δ)

In addition, in this preferred embodiment, R5 is -C (〇) -Rl0, where R1Q is -Ar; and the Ar3 ring group is phenyl, which is substituted by 0 °. Examples of preferred compounds include the following but are not described below 910

Printed by the Anti-Poverty Cooperative of the Central and Foreign Affairs Bureau of the Ministry of Economic Affairs. The preferred compounds of this preferred embodiment include the following, but are not here:

Specific examples (L) Other compounds include the following, but are not limited to the following: -241-Chinese paper standard (CNS) A4 size (210X297 mm) 1235157 Λ * 3: V. Description of the invention (239) 〇 2l4f

〇 214g

Ο 214h

(Please read ¾, read the back of the cloud, and then fill in this page.) Order Printed by the Central Bureau of the Ministry of Economic Affairs, poverty reduction cooperation

• 242- ft paper size _ country and country (CNS M4 specification (210X 297 mm) 1235157 214j

246b

(4? 2 ¥ Read the back of the cloud-; 1 to fill in the matter of the second big shell-j--, *-......... Binding 265a COs.

〇

, OH

nH 265c

OMe -243- This: ¾¾ standard is applicable to China National Standard Vehicle (CNS) A4 specification (210X 297 燊) 1235157 AT B7 Ningyang Standard Mou Bureau, Ministry of Economic Affairs, Consumer Consumption Co-operation · Social Printing

Fifth, 'fainting explanation' (24V 265d

265f 280b 280c Ο α

ο

MeS〇2-

Ο Me

O 28Cd

t / 244-

The standard of wood cricket is t§S domestic standard 孳 (CNS) A4 specification (2iOX 297 mm) 1235157 V. Description of the invention (242) 233b

Ο 283c Μ

Voh-A 〇 283d

Ο 284 〇 — (please read the back of the cloud: vj matters before filling in this page) Order Chaoyin Ministry of Economic Affairs, Central Bureau of Foreign Affairs, staff elimination cooperation Du Yin ¾

Called φ. .

Me〇 'Η 0 285 〇 〇 α

α ο Μ € 〇 Η °

〇 OH 〇 Me

Me • 245 · Common Chinese Standard Twin (CNS) A4 size (210X 297 mm) in 饫 ft standard 1235157 ^

A. 3- V. Description of the invention (243) 0

〇

(Please be mad Klstf / Attention \ iTr.l ^ f 贝) Staff Consumption Cooperation of the Central Bureau of Standards and Technology of the Ministry of Economic Affairs Du Yin ¾ Ο

L.1 · I Meeting -246-Standard Chinese Standard for Paper and Paper (CNS) A4 (2i0 X297mm) 1235157 Λ.- B1 V. Invention (244) Ο 501

KbC 〇 505b 505c

(Read the first 2 notes about the back of the cloud, and then fill out this purchase) Order-¾ Ministry of Economic Affairs. Economic Cooperation Bureau employee consumption cooperation print 505c

〇 5〇5e

__ Common standard for paper killings: §a Standard Soldier (CNS) A4 specification (2 丨 0X 297 male 5) 1235157 Β7 V./Huangming itming (245)

〇 510a

ο

510b 〇

ο

Q Ο 510c

-------------- ilr ------ Awl (Please read "Notes on reading back ^ before filling in this one") Ministry of Economic Affairs, Central Bureau of Sample and Anti-poverty Cooperation 员工Printed 510d

OH 〇 Η Ο

-248- Standards for this paper; Chinese 3S Family Prayer (CNS) A4 specification (210X2W, ¾) 1235157 V. Description of the invention (246) Printed by the Consumer Procurement Cooperative of the Central Sample Bureau of the Ministry of Economic Affairs ¾

MeO 〇 642

(Please ^ read the meanings of the cloud before you fill out this page) 249 · This paper is not in use § Country 琮 Li (0: 5) 6 4 backspace (210: &lt; 297 mm &gt; 37 1235157 V. Invention Description (247)

(Please read 3 of Behind Clouds .-- 5:} Issue before filling out this page) Order

Chinese Ministry of Chaoji, China Bureau of Civil Affairs and Cooperation

The standard of the long-term killing of general HS homes (CNS M4 specifications (210X297 male)) 1235157 Enter · Β7 V. Description of invention (Norway) 〇 1013

Η Ο 1052

〇 1053

1056

(Please read the precautions for Beyond Clouds by the father, J: Binding, Central Ministry of Economic Affairs, U: U.S. Bureau of Staff Consumption «· Cooperative Seal ¾ 〇 1075

-251 Ben. ¾ ¾ standard, used in the IS family of four people (2I0X 297 mm) 1235157 V. Description of the invention (2 called the economic name of the Central Standards Bureau staff consumption cooperation. Social seal ¾ 〇

(ίν &gt; τνί Behind the Clouds-^ Italian Matters Again ^ Two Erbei-Binding

-252- 1S domestic standard Li (CNS) A4 size (210X 297 mm) 1235157-A. B7 in the paper scale transfer Cooperation ··;} India ¾

--------- 11 # · Read the matter of S Vi ill sophomore betin-5-β • Jy · -253- Ben · Meiji Standard universal gg home rubbing (CXS) A4 specifications (2丨 0X29? Mm) 1235157 Λ i Β: V. Instructions (251) 1114

Ο .115

〇 1116

〇 1117

Consumption cooperation of employees of the Central Weeping Bureau of the Ministry of Economic Affairs · Printed by the company Ο 1118

-254 · (Please read the precautions for δ first and then fill in the last page)

This paper ft scale uses tga family mark Lee (CNS) A4 specification (210χ · 297 public) 1235157 Λ7 37 V. Description of the invention (252) 1119 〇

cr ^ V

ο 1120

(Please read% of the back of the cloud first .-; 1, and then fill out this page) -In = 1vfm f I -1- -1 ml nn «, · * — · ami 0 1121 〇

-i · · i-tl —i--· .....!-a— I I — 1122

.¾Consumer Cooperation of Employees of the Central Bureau of Standards of the Ministry of Economic Affairs · Social Printing ¾ 1123

OH -255 Standard for Chinese papers (CNS) with standard (210: &lt; 297 mm) 1235157 A &quot; Β7 V. Description of invention (253) Du Yin

〇 21001

2 ^ 15 Order 2100j 〇

Specific Examples (K) Other compounds include the following but are not limited thereto

256 Paper Music Standard Delivery Order g National Standard Plum (CNS) A4 Specification (2I0X297 mm) 1235157 Λ7 B? 5. Description of Invention (254)

(Please read and read the precautions of νβ before filling in too poor.) Install, ιτ Spring-257- Ben Le also used 18 Biaoyang ([&gt; ^) people 4 Tiege (110/297 public) %) 1235157 V. Description of the invention (255)

U Λ Η

Specific Examples (L) Other compounds include the following but are not limited to this

(Please read ^. Read the back of the cloud: V 〖Italian W. fill in the second two shells） Ｍ The staff of the Central Bureau of Ministry of Economic Affairs of the People's Republic of China Co-operation and Social Seal ¾

The size of this paper is applicable to the national standard plum (CNS) A4. (2 丨 0 公 297mm) 1235157

AT Β7 Fifth, issued 2 / j instructions (25δ) Printed by the Ministry of Central People ’s Daily Soap Bureau Consumer Consumption Cooperation · Social Agency

-259- National Standard Li (CNS) Α4 Specification (2 丨 0X297mm) 3- 1235157 V. Poverty Alleviation M (257) Ministry of Economic Affairs, Ministry of Economic Affairs, Central Bureau of Associated Work Crack

CH3 • 260- (Please read the precautions on the back before iPSf page) Order

Ben. ¾¾ scale side use §g Domestic Standard Ocean (CNS) Six 4 Tige (210X 297 cm) 1235157 Λ * Β- 5. Description of the invention (2SS) 723 724

---------— (Please. ^ &Gt; [Read the meaning of the cloud and then fill out this book] Ding Consumption Cooperation of Employees of the Central Standards Bureau of the Ministry of Economic Affairs Du Yin ¾ 725 726

-261-Standards on this paper are common in all countries and countries ([&gt; ^) Specification (2 丨 0 乂 297 male 5) —dr 1235157 Λ7 B7 V. Explanation of the percentage of delivery (259)

(Please read the note of Yun Yun · Note 1 r * rr to fill in this purchase) Order ^ The Ministry of Economic Affairs, China and the Li Bureau Staff Consumption Cooperation Du Yin ^

-262- This standard is printed by Ning SS furniture (CNS M4 specification (210X 297 mm) 1235157 Λ 7 37

This absolute standard is applied to 13 standard twins (〇 &gt; ^) ^ \ 4 specifications (210/297 5) 1235157 Λ / Β7 5. Explanation of% issued (261) 〇

Cooperate with the Central Bureau of Standards of the Ministry of Economic Affairs, Du Yin 51 HO 〇

• 264- The standard paper size of the paper (CNS) A4 (210X 297 males, 5) -------- Fees ------ IT ------ ψ, ( Feng Yuan &gt; τ Read the meaning of the cloud and fill in this question again \)) 1235157 Printed by the Ministry of Economic Affairs and the Bureau of Economic Development Cooperatives

This ¾¾ 疋 degree reverse tgS domestic standard car (CNS) A4 specification (2 丨 0X297 mm) [235157 A B 'V. Description of the invention (263) HO 〇

OH

〇 HO 〇

(Please read the precautions of Back Cloud before filling out this page) 4Today

HO 〇 M

o

O

-266- National paper rubbing plums (CNS) ΛβΙ grid (210X29? Mm) 1235157 V. Description of the invention (264) HO 〇 747

HO 〇 748

Η 749

Printed by the Ministry of Trade and Industry Bureau of the Central Government Bureau of Consumer Cooperatives ¾ 750

Η 267 · (Read the first notes and read the notes of back cloud, fill in this book)

The size of this paper is in accordance with the Chinese National Standards (CNS) A4 specification (210X29? Mm) 1235157 Λ: Β7 V. Invention: 265) α

ο Ν Η ΛΛ V Ο

ο α

ο Ν Η

V

ΟΠ ^ ΗΟ Ν Η (Please read the precautions of Back Cloud before filling this one hundred;)

Ν Η Η ΟΠΜ ^ ^ μμο Order Ning Yangbiao, Ministry of Economic Affairs, the staff of this bureau to eliminate poverty? clothes

26 This paper ft uses the tas standard (CNS) A4 specification (2 [0: &lt; 297 mm) 1235157 Β: 5. Description of the invention (266) 755 H0 〇

ΌΗ 7 56 757

(Please read the precautions of Back Cloud before filling out this page) Printed by the Consumer Procurement Cooperative of the Central Procurement Bureau of the Ministry of Economic Affairs ¾ HO 〇 759

269- Ben · Standards 〒SS family rubbing (CNS M4 pit grid (210X 297 mm) 1235157 Λτ 5: 5. Description of the invention (257) Ministry of Economic Affairs Ministry of Economic Affairs employee consumption cooperation Du Yin ¾

-270 · The standard of this paper method is 肀 11 national standard (〇 ^). To specifications (210 乂 297 5) 37 1235157 263. V. Description of invention (HO 〇 7S3

754

Ο Ο (Precautions for poetry $ reading and backing, end of page binding Μ SME Department Shenyang Marking Bureau staff consumer cooperation ii. Printing ¾ HO 7 65 766

〇 Η f ^ 0; 〇 〇 271 • The original method scale is reversed by the Chinese family (CNS) grid (2 丨 0X297 mm) 371235157 M printed by the Ministry of Economic Affairs of China Bureau of Plastics Cooperatives ¾

(The poem goes to the man who reads the back of the cloud: the meaning of Vi refers to the examples of ft. (K) and (L). The best compound is one in which the 8 * 3 ring group is an iso-4-yl group: The compounds of the present invention are described in the common US patent. No. 08 / 575,64 1 and 08./5 9 8,3 32, the disclosures of which have been included as references. The compounds of the present invention have a molecular weight of less than about 700 eardrums, preferably at Between about 400 and 600 ears. These preferred compounds can be easily absorbed by the bloodstream behind the patient's mouth and thighs. This oral utilization makes this compound an antagonistic IL-1-, cell-expected cell-, IGIF-or IFN- Γ is an excellent agent for the treatment and prevention of oral diseases that can be administered to the disease. 3 It should be understood that the compound of the invention can exist in various balanced forms, based on conditions including the choice of solvents, p Η, fine arts. The others are known. All such formulas of these compounds can be incorporated in the present invention. In particular, many of the compounds of the present invention, especially Rj contains a feed group or a sulfonyl group, and D contains a carboxylic acid. The base can be hemi-ketal (or hemi-condensation) or hydration type hydrazone. For example, specific examples (A ) The compound can take the form shown below: • 272 · The general scale (tSS family competition (CNS) A * Ul grid (210X 297 male 5) Ben tile)-binding spring 1235157 V. Description of the invention (270) 0I丨

CH 0II (〇j2y ^ ~~ c hydrated

(0 ^) 9— 0— · II 0II (0 · ^) τπ «—C • d /. The I CH semi-abbreviation or fengshui spasm type is based on the choice of solvent and other conditions known to those skilled in the art. The compounds of the present invention may also be in the form of acetoxy ketals, acetoxy acetals, ketals or acetals: 0

(cym-H from V

〇 (CJ2) nJ, Rp—ΓΨ—— η η \ (〇 ^) 〇-〇 ~ Heptafluorene condensation or short oxygenation taking advantage of 0.J, -N—I \ ^ Η _〇 ^ t- R3 Syndrome or Synthetic Pattern

The Central Government Bureau of the Ministry of Economic Affairs of the People's Republic of China has consumer cooperation and printing equipment. In addition, it should be understood that the equilibrium form of the compound of the present invention may include tautomerization. All such forms of these compounds are automatically incorporated in the present invention. It will be appreciated that the compounds of the present invention may be modified by suitable functional groups to enhance selective biological properties. Such changes are known in the art, and include biological penetrability (such as blood, rubbing, middle pole nervous system) that can be increased to specific biological systems, increase oral utilization, and increase the solubility of 甴 injections. Change the metabolism and change the excretion rate 3, Bu, the compound can be changed into a prodrug type, so the desired compound can be generated in the patient ft due to prodrug metabolism or other results of life and death 3 This type of prodrug Some examples of prodrug types that are usually rare or inactive in in-tube analysis include compound 273-benz. ¾¾ standard use gg family standard plum (CNS) A4 specifications (2 [〇X 297 publicly available] 1235157 AT B7 V. Description of the invention (271 bream, acetal, fatty, imine, and hydrazone type, which contains ketone or aldehyde group, especially when it occurs in the R3 group of the compound of the present invention, 3 prodrug type, please read it first The meaning of “a” in the back of the cloud is “%” and then “%” is too high. The “f” cases include half-abbreviations, abundance-condensation, turtle-condensation, acetoxy-condensation, ketal and acetal types, which are described in EQ1 and EQ2.

ICE and TX dissociation and 甴 are pre-activation-IGIF ICE protease was previously identified as a mature active IL-1 / ?, a pre-inflammation molecule, by its inactivation in a test tube and in vivo before being inactive. basis. Here we show that ICE and its close homogeneous TX (Caspase-4, C. Faucheu et al., EMB0, 14, p. 1914 (1995)) can proteolytically dissociate before inactivity-IGIF: this Processing the repair step requires converting pre-IGIF into its active, mature form, IGIF.甴 ICE and possible TX before dissociation-IGIF also helps to transport IGIF out of the women's run: We first use the transient co-expression of quality cells to transduce Cos cells to determine whether any of the ICE / CED-3 protein Xue family has been Known members can process pre-IGIF into IGIF (Example 23) in the culture excision (Figure 1A). Figure 1A shows the ICE dissociates the pro-IGIF from the Cos sprint. The cell is co-transformed by a plastid that can express pro-IGIF in the presence of tongue ICE. sense. Cos. Spores express plastids. This plastid is either a single pro-IGIF (column 2) or a combination of peptones, which encodes the protease ICE / CED-3 wild type or Inactive mutants (columns 3-12). Make lysates and analyze the presence of IGIF protein with anti-IGIF antiserum for immunosucking ^ 1 column contains the lysate α pro-IGIF from blank transfected cells and the common performance of ICE or TX will cause pro- IGIF solves difficult-to-produce peptides, which are similar in size to naturally occurring 18-kDa mature IGIF. Here Nirvana-274- This standard is applicable to the SS family standard (CNS) A4 format (210X297 mm) 1235157 Chinese Ministry of Economic Affairs · Dalian Bureau of Shellfisher Consumer Cooperatives Seal Reprint Λ: Ⅴ- Description of the invention (272) The repair event can be interrupted by a single point mutation. This mutation alters only the abundance amino acid residues and thus deactivates ICE and TX (Y. Gu et al., EMB. , 14, P. 1923 (1995)). 'And CPP32 (Caspase-3), a protein involved in sprinting that is expected to die (D. Fernandes-Alnemri et al., J. Biol. Chem., 269, p. 3 0761 (1 994); D. W. Nicholson et al., Nature, 376, p. 3 7 (1 995)) can cause dissociation of pro-IGIF to produce smaller polymorphisms, which is related to CMH-1 (Caspase-7) —a kind of When CPP32 is very similar in homogeneity (JA Uppke et al., J. Biol · Chem ·, 271, p. 1 825 (1 996)), it cannot dissociate pro-IGIF to any significant degree. Therefore, it seems that ICE and TX can dissociate pro-IGIF into peptides similar in size to naturally occurring 18 kDa IGIF. Next we checked the ability of these cysteine proteins to dissociate pro- [GIF in a test tube. Here, purified and reconstituted pro-IGIF with (His) 0 was used as the substrate (Example 23). Figure 1B shows pro-IGIF dissociated by ICE in a test tube. Purified and reconstituted (His) 6tpro-IGIF (2 micrograms) and the half ammonium protein shown were incubated with or without the ICE or CPP32 inhibitor as described in Example 23. Dissociation products were analyzed by SDS-PAGE and Coomassie blue staining. ICE can dissociate pro-IGIF from 24 kDa into two peptides of approximately 18 kDa and 6 kDa. The N-terminal amino acid sequencing of the ICE dissociation product showed that the IS kDa peptide contained the same θ N-terminal amino acid residue (Asn-Phe-Gly-Arg-Leu) as the naturally occurring IGIF. This shows that ICE can dissociate pro-IGIF at the putative modified position (Asp3 5-Asn36) (H. Okamura et al., Infection and Immunity, 63, p. 3966 (1995): H. Dkamura et al., Nature, 378, -275- This book: ¾-scale medium-use gS home furniture (CNS) A4 size (210X 297 mm) (please read the note on the back page first) Binding times: 1235157 V. Invention Explanation (273) p. 8 8 (1995)) 3 The N-terminus of the CPP32 dissociation product is shown in the sequence of the basic acid. 'CPP32 can dissociate pro-IGIF at Asp69-Ile70: ICE is highly specific for the dissociation of pro-IGIF. It has a catalytic efficiency (kcat / KM) of M X 107 / (Kμ = 0.6 ± 0 · 1α M; kcai = 8.6 ± 0.3 s-1), and can be a specific ICE inhibitor ( Ac-Tyr-Val-Aia-Asp-I) and Cbz-Val-Ala-Asp-[(2,6-dichlorooctyl) oxy] hydrazone keynotes' (N.A. Thornberry et al. 'Nature, 356 p. 768 (1992); RE Dolle et al.? J. Med. Chem., 37, p. 563 (1994)) Figure 1C demonstrates that dissociation of ICE in vitro can activate pro-IGIF. Undissociated pro-IGIF, ICE- or CPP32-dissociated pro-IGIF products, or recombinant ft mature IGIF (rlGIF) were added to A.E7 cell culture to the end of 12 ng / ml or 120 ng / ml Concentration (see, Example 23): After 18 hours, r-IFN in the medium was quantified by ELISA. Although undissociated pro-IGIF has no detectable r-IFN-inducing activity, ICE-dissociated pr0-IGIF is still active in inducing r-IFN produced by Th1 microspores. Like ICE, TX, a homogeneous substance of ICE, can also resolve pro-IGIF into chicken-like peptides. However, its catalytic efficiency is about twice that of ICE. Consistent with the observation of the above Cos germ cell experiment, CPP32 can dissociate pro-IGIF at different positions (Asp69-Ile70), and the resulting peptide has little r-IFN-inducing activity (Figure 1C). CHM-1 and granzyme B cannot dissociate pro-IGIF to any significant extent. Together, these results demonstrate that ICE and TX can process modified inactive pro-1 GIF at the desired mature position in Cos running and in test tubes to generate biologically active IGIF molecules. • 276- Chinese paper standard (Chinese national standard Xin (CNS) eight 4 Tig (2 丨 0X297 Gongcheng poems first% of memorizing notes

Order the staff consumption cooperation of the Central Bureau of Standards of the Ministry of Economy Du Yin ¾ 1235157 __B7 V. Description of Invention (274)

Pro-IGIF is a modification of ICE that helps it to transport IGIF produced by activated Couff ’s cells and macrophages in Qiaoli, and it can be transported to cells once it is stimulated (H. Okamura et al Infection and Immunity, 63, p. 3966 (1995); H, Okamura et al. Nature, 378, p. 88 (1995). We used the Cos cell co-expression system (Example 23) to examine pro-IGIF on cells Whether ICE dissociation helps mature IGIF to transport Ssj cells 3 is like pro-IL-1. For example, it can be solved by ICE Cai Chenggu; ancient IL-1 (N · A · Thornberry et al., Nature, 356, p 768 (1992)).-In Figure 2A, Cos cells express pro-IGIF alone (columns 2 and 6) or a combination encoding wild-type performance plastids (columns 3 and 7). Or inactive mutant ICE (columns 4 and 8) transfected, and metabolically labeled with 35S-methionine (see Example 2 sentence, lysate (left) and adaptation medium (right) with anti-IGIF antiserum Immunoprecipitation 3 Immunoprecipitated proteins were analyzed by SDS-PAGE and fluorometer (Figure 2A).

The staff of the Ministry of Economic Affairs and the Ministry of Economic Affairs have cooperated to print X. In Cos cell adaptation medium co-expressed by pro-IGIF and ICE, 18 kDa peptides of the same size or mature IGIF can be measured, and the total expression of pro-iGlF and no Cos cells of active ICE mutant strain (ICE-C285S) or pr0-IGIF (-) alone delivered only very low levels of pro-IGIF and no detectable pyrogenic IGIF. We estimate that approximately 10 ° / 〇 mature IGIF can be transported from the co-transduced sprint, while more than 99% of pro-IGIF remains in the cells 3 We also detect lysates and the above-mentioned transfected cells Whether r-IFN induces viability in the adapted medium (see Example 24). R-IFN poems can be measured in Cos cell-adjusted culture medium that produces lysate and co-expresses pro-IGIF and ICE. 277-ben. ¾¾ Reuse _ 匡 National Standards Complete (CNS) A4 Saoge (2丨 0X 297 mm) 1235157 Λ / 37 V. Description of the invention (275) Conductive activity, but only showing pi * o-IGIF or sprint run alone (Figure 2B). These crusts show that ICE de-hybridization pro-IGIF facilitates the transport of mature and consistent IGIF from A. spores. ,

Pro-IGIF is the physiological substrate in vivo of ICE. In order to study the role of ICE in the proteolytic activation and transport of IGIF under physiological conditions, we examined the processing and modification of pro-IGIF and the mature IGIF self-lipopolysaccharide (LPS). Transport in Coffer cells, which was recovered from Propionibacterium acnes-induced wild-type and ICE-deficient (ICE-/-) mice (Example 25). _ As shown in Figure 3A, Coffer cells from ICE-/-mice are missing from IGIF transport. Cooper's cell lysates from wild-type and ICE-/-mice were determined by ELISA to contain similar amounts of IGIF. However, IGIF is only detected in the wild-type adaptation medium and not in the ICE-Λ sprint. Therefore, ICE-missing (ICE-/-) mice can synthesize pro-IGIF, but they cannot be transported like sprinting outside pro- or mature IGIF. In order to determine whether ICE-deleted (ICE-/-) mice can process pro-IGIF but cannot transport IGIF, the Kuffert cells of wild-type and ICE-/-mice were metabolically labeled with 35S-sulfanthine. Acid, and perform IGIF immunoassay on lysate and conditioned medium as described in Example 25. These experiments demonstrate that untreated pro-IGIF is present in wild-type and ICE-ΛCurtis cells3 However, 18-kDa mature IGIF ^ is stored in a wild-type adaptation medium instead of ICE · / -Coffer Cells (Figure 3B). This shows active ICE transporting the treated IGIF out of the cell. In addition, the adaptation medium from wild-type rather than ICE-/-Cuff's cells -278- this standard of killing uses national standard (CNS) A4 size (210X 297 mm) (please read and read first) Precautions (I)

Consumer Co-operation Du Yin of the Central Bureau of Super Ministry of Economic Affairs Du Yin? L 1235157 B7 M Printed by the Shell Consumer Cooperative of the Central Standards Bureau of Ministry of Economic Affairs 5. Description of the invention (276) Contains IFN-r defamatory activity, which is not attributable to IL The role of -12 is because it is sensitive to the neutralization technique -IL-12 Shen Jing 3 ICE-/-Cooper's 彡 said that the iron content of IGIF in the i2L culture volume is low and it is consistent with that seen in the Cos sea run. ICE treatment of modified pro-IGIF is necessary for active IGIF transport. Figures 3C and 3D show that the serum levels of IGIF and IFN-r in ICE-Λ mice were reduced in mice 3, respectively, to prepare wild-type (ICE + / +) and P. acnes prepared by heat-inactivation, and ICE-/-mice, LPS- (vs. Example 26), and 3 hours after LPS, EUSA was used to detect the levels of IGIF (Figure 3C) and T-IFN (Figure 3D) in the serum of challenged mice (Example 25) ). ICE-/-mice stimulated with Propionibacterium acnes and LPS had a reduced amount of IGIF in their serum (Figure 3C) and had no detectable IFN-factor-inducing activity in the presence of anti-IL-12 antibodies. It seems that the reduced serum levels of IGIF should be at a premium to the significantly lower levels of IFN-r in the serum of ICE-/-mice (Figure 3D), because we have observed that under these conditions, ICE-/-mice produce IL-12 There is no significant difference, and this statement is consistent with the finding that non-adherent splenocytes from wild-type and ICE-/-mice can produce similar amounts of IFN when stimulated in vitro with recombinant active IGIF -r. Therefore, the impaired fertility of IFN-r is not caused by any obvious defect in ICE-/-old mouse T cells. Taken together, these results establish a critical role for ICE in the treatment of modified IGIF precursors and in the use of active IGIF in vitro and in vivo. In order to examine the interrelationship between IFN · r serum level and activity within 10 pounds in more detail, the time course was performed after pitting wild-type and ICE-deleted mice with LPS- (Example 26) (Figure 4). Figure 4 shows the increase in serum IFN-r over time in wild-type mice. • 279-The standard of this paper is the Chinese National Standard Complete (CNS) person 4 grid (210X297 mm). ： V 」Issue page-installation- • V5 泉 1235157 B7 V. Description of the invention (277: 1 Please i Yuan burst I ¥ Read back 1 1 Cloud of •• Cloud 1 | ί% 1 1 • Book 丨 A Ά 1 Sustained levels of $ 17 nanograms / ml occurred 9 to 8 hours after LPS- # slaughter. As predicted by the experiments described above, 7-IFN serum levels were significantly lower in ICE-/-mice, which could be at the same time. Reaching a high of 2 nanograms per millimeter, which is about 15% seen in wild plastic mice (Figure 4). Also observe the clinical signs of sepsis in animals, and the anti-Japanese war at 30 mg / kg or 100 mg / kg After LPS (ICE-/-only), body temperature changes were detected every 4 hours in wild-type and ICE-Λ mice. The results shown in Figure 4 show that wild-type mice can experience significant body temperature within 12 hours of LPS-platform Decrease (甴 36Ό to 26X :). The clinical symptoms of sepsis are 4 * points, and all animals die within 24-48 hours. ICE-/-mice with 30 mg / kg LPS experienced a decrease in S 泾 of only 33-43C, with few symptoms of pain and no lethality. ICE-Λ mice administered with 100 mg / kg LPS experienced clinical symptoms , 鳢 滠 decreased, mortality is similar to wild-type mice at a dose of 30 mg / kg LPS. ICE inhibitors Ac-YVAD-CHO and IL-1 /? And IFN-r produced by the same intensity inhibitors quan The biologically active IGIF, its modification, and secretion are mediated by ICE. We compared the ICE-reversible inhibitor (Ac-YVAD-CHO) with IL-ly5 and IFN- in peripheral blood mononuclear cell (PBMC) analysis. Consistency in the production system (Example 27), poverty alleviation cooperation of employees of the Ministry of Economic Affairs and the International Bureau of Biaoyang Bureau ^ The results in Figure 5 show that Ac-YVAD-CHO ICE inhibitors reduce the production of IL-lyS and IFN-r in human PBMCs. The strength of the system is similar, with IC5Q of 2.5 μM each. Similar results were obtained with wild-type mouse spleen cells3 These findings provide additional evidence that pro-IGIF is the physiological substance of ICE, and It is suggested that the ICE inhibitor will be a -280 version that controls the physiological levels of IGIF and IFN-r. ¾¾ Standards are used in §3 domestic standard plum (CNS) A4 Speaking grid (2 丨 0X297 mm) 371235157: The Ministry of Economics and Economics has won the bid for the second consumer capital cooperation of the bureau Du Yin ¾ 5. Description of the invention (278) Useful tools. In summary, we have found that ICE can be used in living Control IGIF and IFN-r levels in vitro and in vitro, and ICE inhibitors can reduce IGIF anti-IFN-r levels in human sprinting. These results have been described in co-owned U.S. Patent No. 08/7 12,878, the disclosure of which is incorporated herein by reference. Compositions and methods The pharmaceutical compositions and methods of the present invention can be used to control the levels of IL · 1, IGIF and IFN-r in living organisms. The method and composition of the present invention can therefore be used to treat or reduce the progress of the conditions mediated by IL-1, IGIF- and IFN-r, and the severity of the effects. 3 The compounds of the present invention are effective ligands for ICE. As a result, these compounds can target and inhibit IL-1-, expected cell death, IGIF- and IFN-r-mediated events in diseases, and therefore in inflammatory diseases, autoimmune diseases, destructive bones, proliferation The final activity of proteins in sexual disorders, infectious diseases, and degenerative diseases. For example, the compounds of the present invention inhibit ICE from inhibiting the conversion of 甴 IL-1, the precursor of 甴, to mature IL-1.甴 It is necessary for ICE to produce mature IL-1. The inhibition of this enzyme can effectively block the physiological effects of IL-1-mediated and the onset of symptoms, such as inflammation, which inhibits mature IL-1 production through 甴制 制。 Made. Therefore, the compounds of the present invention can be effectively used as IL-1 inhibitors by inhibiting IL-1 / 5 precursor activity. Similarly, the compounds of the present invention inhibit &lt; precursor IGIF conversion into mature IGIF. Therefore, by inhibiting the production of IGIF, the compounds of the present invention can be effectively used as inhibitors of IFN-r production. 3 Therefore, a specific example of the present invention is proposed to reduce IGIF-281 in this case. gCountry Kneading (CNS) A4 (210X 297 mm) (Read poems on the back of the book! ^ This page-gutter 1235157 V. Description of the invention (279: method of manufacturing, this method includes An individual drug is administered to a pharmaceutical composition containing a therapeutically effective dose of an ICE inhibitor and a pharmaceutically acceptable carrier. Another example of the present invention proposes a method for reducing the production of IFN-r in an individual drug, which includes Administering a pharmaceutical composition to an individual, which contains a therapeutically effective dose of an ICE inhibitor and a pharmaceutically acceptable carrier ^ In another embodiment, the method of the present invention includes administering a pharmaceutical composition to an individual, which contains ICE-related An inhibitor of protein Xue, which can dissociate ριτο-IGIF to produce active IGIF, and a pharmaceutically acceptable carrier. One of such ICE-related proteases is YX, as described above. The present invention therefore proposes a method and a pharmacy The composition, that is, the administration of TX inhibitors to control the levels of IGIF and IFN-r. Other ICE-related proteases that can be modified by the treatment of pro-IGIF into active IGIF types can be seen. The inhibitors of these enzymes can be known by skilled artisans and are also within the scope of the present invention.3 The compounds of the present invention can be applied in a traditional manner to treat 甴 IL-1, expected cell death, IGIF or IFN-r modulation. Diseases, such treatment methods, dosage levels and needs can be selected by the skilled artisan from available methods and techniques. For example, the compounds of the present invention can be combined with pharmaceutically acceptable adjuvants in a pharmaceutically acceptable manner. And doses effective to reduce the severity of the disease to patients suffering from IL-1-, expected cell death-, IGIF · or IFN-r-mediating the disease 3 In addition, the compounds of the present invention can be applied to the composition In the method and method, in the long-term treatment or protection of an individual that antagonizes IL-1-, the cell is expected to die-, IGIF- or IFN-r-mediated disease 3 compounds can be used alone or in combination with other compounds of the present invention.282

% Read the meaning of δ% Tai I Binding Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs (CWS ^ »210X 297 / Si5 ·) 37 37 280, 1235157 V. Description of the invention The method conforms to the traditional availability of ICE inhibitors in pharmaceutical compositions. For example, the compounds of the present invention can be combined with pharmaceutically acceptable adjuvants traditionally used in vaccines, and administered to Changxiang to protect individuals in a prophylactically effective dose. Antagonistic IL-1-, cell expected to die-, IGIF- or IFN-r-mediated diseases. The compounds of the present invention can also be co-administered with other ICE inhibitors to increase antagonistic IL-1-, expected cell death- , IGIF- or IFN-factory-mediated treatment or prevention of diseases 3 In addition, the compounds of this invention in January can be combined with "traditional anti-inflammatory agents or matrix metal protein § acoustic inhibitors, lipid-oxygenated bar inhibitors and Antagonists of cytokines other than IL-1. The compounds of the present invention may also interact with immunomodulators such as bropirimine, anti-human interferon antibodies, IL-2, GM-CSF, methionine enkephalin, Interferon, diethyl dithiocarbamate, Tumor necrosis factor, naltrexone and rEP) or in combination with prostaglandins to prevent or combat the symptoms of diseases mediated by IL-1, such as inflammation 3 When the compound of the present invention is administered in combination with other agents, they can be administered sequentially Or simultaneously administered to a patient 3 In addition, the pharmaceutical or prophylactic composition according to the present invention includes a combination of the ICE inhibitor of the present invention and other therapeutic or prophylactic agents 3 The pharmaceutical composition of the present invention includes any one of the compounds of the present invention, And pharmaceutically acceptable salts thereof, plus any pharmaceutically acceptable carrier, adjuvant or vehicle. The pharmaceutically acceptable carriers that can be used in the pharmaceutical composition of the present invention, adjuvants and vehicles include the following but not Limit to this: Ion exchanger, oxidation chain, -283 This standard is for domestic use (CNS) M specifications (210X297 mm) Please read the meaning on the back first

太 1 The staff of the Central Economic and Technical Bureau of the Ministry of Economic Affairs of the People ’s Republic of China is responsible for the cooperation of capital and investment 1235157 The member of the Ministry of Economic Affairs of the Ministry of Economic Affairs of the Ministry of Economic Affairs of the Ministry of Economic Affairs of the People ’s Republic of China is responsible for the cooperation of the two industries. Du Yin ^ 3 V. Description of the invention (281) Aluminum stearate, lecithin, self-emulsifying Drug delivery systems (SEDDS) such as αα-tocopheryl polyethylene glycol 1000 succinate, or other similar polymeric delivery matrices, serum proteins such as human serum albumin, buffer substances such as phosphate, glycine, and lysate , Part of Ganzhikun compound, water, green or electric fresh matter, such as protamine sulfate, disodium hydrogen release, potassium hydrogen acid, chlorine chloride, zinc salt , Colloidal oxidative crushing, magnesium trisilicate, polyvinylpyridone, cellulose-based substances, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylate, wax, polyethylene-polyoxygen Propylene · block polymer, polyethylene glycol and lanolin. Cyclodextrins such as G-, / 3-trans-Γ-cyclodextrin, or chemically modified derivatives such as hydroxyalkyl cyclodextrin, including 2- and 3-hydroxypropyl-cyclodextrin, or other solubilizers Derivatives can also be beneficially used to enhance the delivery of the compounds of the present invention. The pharmaceutical composition of the invention can be taken orally, enterally, by inhalation spray, topically, by direct sun, by nose, buccal, vaginal or by implantation. The store came to take sunflower 3 and we preferred to take it orally. The pharmaceutical composition of the present invention may contain any conventionally non-toxic pharmaceutically acceptable carrier, adjuvant or vehicle. In some examples, the pH of the blend can be adjusted with a pharmaceutically acceptable acid, paint or buffer substance to enhance the stability of the blended compound or its delivery form. The extra-yang methods include subcutaneous, intra-keratinous, intravenous, intramuscular, intra-glandular, intra-synovial, intra-sternal, intrathecal, intra-wound, and intra-cranial injection or infusion techniques. Injectable formulations, such as sterile injectable aqueous or oily suspensions. This suspension can be blended according to techniques known in the art, using suitable dispersing or wetting agents (such as Tween 80) and suspending agents. Sterile injectable tincture can also be used in non-toxic parenterally-acceptable diluent-284-This paper method is sent to the Chinese standard Xin (CNS) six 4 size (210X 297 mm) (Please read the back Precautions v-installed-f this) order

1235157 Α · A / B7 V. Description of the invention (2 called Zhongzhiyuanhe remedy for cream reconciliation. Carriers for topical administration of compounds of the present invention include continuous treatment, liquid paraffin, white paraffin, propylene glycol, polyoxyethylene polyoxyl Propylene compound, emulsified wax and water, but it is not limited to this./In addition, the pharmaceutical composition can be blended with a suitable lotion or emulsion, which contains the active compound ϋ suspended or dissolved in a carrier. Suitable carriers include mineral tincture, Sorbitan monostearic acid§ Polysorbate 60, cetyl ester wax, cetyl alcohol, 2-octyldodecanol, methyl alcohol and water. The pharmaceutical composition of the present invention can also be applied topically to Lower intestinal tracts, transdermal patches for topical administration via a tapping suppository blend or a suitable enemas blend 3 are also included in the present invention. The pharmaceutical composition of the present invention can be administered via a nasal aerosol or inhalation method.弍 Administration 3 This composition is prepared according to well-known techniques in pharmaceutical blending technology, and can be prepared as a solution in saline, using 芊 alcohol or other suitable Baoyi 剤, absorption enhancer to enhance bioavailability, fluorocarbon Chemicals and / or Craftsmanship Other known solubilizing or dispersing agents. ¾ Order from the Ministry of Economic Affairs of the People's Republic of China for consumption cooperation to print active ingredient compounds between about 0.01 and about 100 mg / kg per day, preferably between about 1 and 50 The daily dose level of mg / kg body weight can prevent and treat IL-1-, expected cell death, IGIF and IFN-r-mediated diseases, including inflammatory diseases, autoimmune diseases, and destructive epiphyseal disorders , Proliferative disorders, Infectious diseases, Degenerative diseases, Necrotic diseases, Osteoarthritis, Acute epistitis, Chronic viscera, Discouragement, Respiratory pain syndromes in adults, Globululonephritis, 'Rheumatoid joints Inflammation, systemic lupus erythematosus, scleroderma, chronic sacral glanditis, Grave's disease, autoimmune gastritis, island-dependent diabetes mellitus (type I), autoimmune thymocyte anemia, Immune neutrophilic leukopenia, thrombocytopenia, -286- Ben. ¾ ¾ appropriate size; ^ Chinese § country rubbing (CNS) AUi (210X 297 mm) 1235157 A_ B7 V. Description of the invention (2δ4 ) Chronic active hepatitis, myasthenia gravis, hair Sexually related diseases, Crohn's disease, psoriasis, graft-to-host disease, osteoporosis, multiple myeloma-related skeletal disorders, acute myeloid leukemia / chronic myeloid leukemia II, metastatic melanoma, Kaposi Osteosarcoma, multiple myeloma, sepsis, septic shock, shigellosis, alzheimer's disease, parkinson's disease, cerebral hemorrhage, myocardial ischemia, spinal muscular atrophy, multiple sclerosis Disease, AIDS-related encephalitis, HIV-related encephalitis, aging, hair loss, and neurological damage caused by stroke. For the sake of exemplification, the pharmaceutical composition of the present invention can be administered about 1 to 5 times a day, Or in the form of continuous infusion, this kind of administration can be used for chronic or acute treatment. It can be mixed with a carrier to produce a single dosage form of the active ingredient in the treated host and the particular mode of administration. Typical formulations usually contain about 5% to about 95% of the active compound. Preferably, the formulation contains from about 20% to about 80 ° /. Of active compounds. Once the patient's condition has improved, a maintenance dose of a compound, composition or combination of the invention can be administered if necessary. Next, the dose or frequency of administration can be reduced, which is a function of symptoms to maintain an improved condition, and treatment can be stopped when the symptoms have eased to the desired level3 However, patients may need long-term rest treatment to To prevent any recurrence or illness 3 M. Central Ministry of Economic Affairs, the staff of the Central Bureau to eliminate the «· Cooperation · Social Seal ¾ (Please read the precautions on the back before this page) As for the artisans, you may need to understand Lower or higher volume. The specific dose and treatment method for any particular patient depends on various factors, including the activity of the particular compound applied / the age of the patient, weight, health status, gender, diet, time of administration, initiation rate, and drug contraindications , The severity and course of the disease, and the patient's tendency to the disease and the judgment of the treating physician 3 -287- Ben Le scales 3 tSS family standard twin (CNS) A4 specifications (210X 297 5) 1235157 B7 V. Description of the invention (285) 'IL-1 mediated diseases that can be treated or prevented by the compounds of the present invention include, but are not limited to, the following: inflammatory diseases, autoimmune diseases, osteopathy, proliferative disorders, infections Diseases, and degenerative diseases 3 Cells that can be treated or prevented with the compounds of the present invention are expected to die-mediated diseases include degenerative diseases 3 Inflammable diseases that can be treated or prevented include the following, but are not limited to: osteoarthritis, Acute pancreatitis, chronic pancreatitis, asthma, and respiratory pain symptoms in adults. 3 Good inflammation is osteoarthritis or acute inflammation. 3 Autoimmune diseases that can be treated or prevented. Includes the following, but is not limited to: Angioglobulonephritis, rheumatoid arthritis, systemic lupus erythematosus, scleroderma, chronic sigmoiditis, Grave's disease, autoimmune gastritis, insulin dependent Diabetes (type I), autoimmune hemolytic anemia, self-immunity causes neutropenia, thrombocytopenia, chronic active hepatitis, myasthenia gravis, multiple sclerosis, inflammatory dysentery, Crohn's disease, psoriasis and graft versus host disease. A better autoimmune disease is rheumatoid arthritis, inflammatory bowel disease, Crohn, disease, or psoriasis. Destructive skeletal disorders that can be treated or prevented include osteoporosis and skeletal disorders associated with multiple myeloma 3 Printed by the Poverty Alleviation Cooperative of the China Standards Bureau of the Ministry of Economic Affairs Matters: Fill out this page

Proliferative diseases that can be treated or prevented include the following, but are not limited to: acute myeloid leukemia, chronic osteoblastic leukemia, metastatic melanoma, Kaposi's sarcoma, and multiple osteoblastoma 3 Infectious diseases include, but are not limited to, sepsis, septic shock, and Shigella disease. IL-1 which can be treated or prevented by the compounds of the present invention -Degenerate or -288- The standard method is reversed 3 national standard (CNS) A4 specifications (210X 297 5) 1235157 V. Description of the invention (286 : Necrotic diseases include Alzheimer's disease, Parkinson's disease, hemostasis, and myocardial ischemia, but are not limited to this. Better, the degenerative disease is Alzheimer's disease. 3 The present invention Expected cell death / mediated degenerative diseases treated or prevented by compounds include Alzheimer's disease, Parkinson's disease, rice despair, myocardial ischemia, spinal muscular atrophy, multiple sclerosis, AIDS-related Chronic inflammation, HIV-related encephalitis, aging, baldness, and neurological damage due to stroke3 The method of the present invention can be used to treat or reduce IGIF- or IFN-r-mediated inflammation, blood immunity, infection Sexual, proliferative, destructive bones, necrotic and amused traits. Progression, severity or effects, including diseases, disorders or effects. The condition is characterized by increased levels of IGIF or IFN-r production. 3 Inflammation: Examples of brothers include the following, but are not limited This · Osteoarthritis, acute adiposity, chronic pancreatitis, asthma, rheumatoid arthritis, inflammatory bowel disease, CrohWs disease, colon ulcer, cerebral hemorrhage, myocardial ischemia, and adult respiratory distress syndrome. Better inflammatory conditions are rheumatoid arthritis, yang ulcers, Crohn's disease, hepatitis, and respiratory distress syndrome in adults. Examples of such infectious conditions include infectious hepatitis, sepsis, septic shock, and Shigella disease, but Not limited to this 3 Examples of such autoimmune conditions include, but are not limited to: angioglobulonephritis, systemic lupus erythematosus, scleroderma, chronic thyroiditis, Grave's disease, autoimmunity Gastritis, island-dependent diabetes mellitus (type I), perennial diabetes mellitus, autoimmune hemolytic anemia, autoimmune • 289 paper ft scale reverse standard household standard 家 (CNS M4 is now (210X 297) No) First read 5c1 of the meaning of the cloud.%% On this page, the member of the Department of Economic Affairs of the People's Republic of China, the second consumer cooperation Du Yin ¾ 1235157 287, V. Description of the invention (please read the notes on the back before filling in this page) Neutropenia, thrombocytopenia, myasthenia gravis, multiple depletion · Cowhide's 'Local platform' graft for Susan disease, acute anti-inflammatory disease, creek therapy, primary sclerosis, hepatitis, uveitis , Bekcefs disease, acute dermatomyositis, atopic skin disease, pure red blood cell dysplasia, dysplasia anemia, amyotrophic lateral sclerosis, and nephrotic syndrome. Contrary, the self-respecting immune status is vascular glomerulonephritis. Island-dependent diabetes mellitus (I), juvenile diabetes, psoriasis, graft-to-host disease, including transplant rejection, and hepatitis. Examples of such weight-related skeletal disorders include osteoporosis and multiple myeloma-related Skeletal disorders. Examples of such proliferative conditions include, but are not limited to, the following: acute osteopenic JK disease, chronic bone M leukemia, metastatic melanoma, Kaposi's tumor, and multiple myeloma. Examples of such neurodegenerative conditions include, but are not limited to the following: Imam; Permel's disease, Parkinson's disease, and Huntington's disease. Although the present invention focuses on the use of the compounds here in the prevention and treatment of IL-1, known to be expected to die, IGIF- and IFN-r-mediated diseases, the compounds of the present invention can also be used as other hematins. Inhibitor 3 Μ. Ministry of Economic Affairs. Poverty: Consumers' cooperatives of the Bureau of Health. The compounds of the present invention can also be used as commercial reagents, which can be effectively bound to ICE or other semi-amino acid proteins. In terms of chemical reagents, the compounds of the present invention and their derivatives can be used in IC ^ E and ICE homologs for biochemical or sprint analysis to block the proteolysis of the target peptide, or they can be derivatized to bind to stable resins and act as A range of affinity chromatography applications. Characterized by these and other usages of each inhibitor of commercial hemicellin S is refined-290. This killer is universal again. § National Standard Soldier (CNS) A4 Specification (210X 297 Gong) 1235157 Λ / Β7 V. Description of the invention (283) 3 Methods understood by the artist 3 for preparing N-fluorenylamino compounds The ICE inhibitor of the present invention can be synthesized using conventional techniques. The compounds can be conveniently synthesized from readily available starting materials. The compounds of the present invention are the easiest to synthesize among the known ICE inhibitors: The ICE inhibitors previously described often contain more than 4 palmar centers and many peptide junctions. The compounds of the present invention can be synthesized relatively easily, which means that these compounds can be produced on a large scale. 3 For example, the compounds of the present invention can be prepared by the method described herein. To the best of the artisan's knowledge, these methods are not the only methods in which compounds described in this case and patented are synthesized. Further methods are obvious to the artisan. In addition, the various synthetic steps described herein can be performed in a different order or sequence to generate the desired compound. The present invention also proposes a preferred method 3 for preparing the compound of the present invention. Therefore, in another example (M), a method for preparing an N-acylamino compound is proposed, which includes the following steps: a) mixing a carboxylic acid with an N- Position-protected amine group, with the presence of ammonium solvents, phenylphosphine, nucleophilic scavengers, and triphenylphosphine palladium (0), at ambient temperature and inert atmosphere: and

¾ 耷. Jialing ^ 5: ¾ ^ ¾ Employee consumption cooperation. Social seal SL (please read and read ^ Yiyi Mine and then fill out this one) b) Add HOBT and EDC to the mixture in step a): and If necessary, further steps are included: c) hydrolysis b) the step mixture in the presence of a solution containing an acid and H 2 0, wherein the b) step mixture is previously concentrated as required before hydrolysis. Preferably, this inert solvent is CH2C12, DMF, or CH2Cl2 &amp; DMF -291-The standard: ¾¾ Applicable § National Youxin (CNS) AUt grid (2 丨 0X297 mm) 1235157 B7 Employees of China Standards Bureau, Ministry of Economic Affairs Printed by the Consumer Cooperative V. Description of the invention (where R5i is as defined (b) or better in Gifted Example (B), the N-allo-protected amine is:

In the preferred method, the substituents are as defined in the specific example (A). In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein Rjo is defined by the fluorene example (B), and R2 is defined by the specific example (M). More preferably, in these alternative processes, the substituents are as defined above under Example (B). In addition, the N-fluorenylamino compound is represented by formula (VIII), where h is as defined in the above example (C), and R2 is as defined in the specific example (M) above: Preferably, in these other processes, the substituents As defined in the specific example (C) above 9 In addition, the N-fluorenylamino compound is represented by formula (VIII), in which it is defined by the above example (C), and R2 is defined by the specific example (M), which is better than In these other processes, the substituents are as defined in the specific example (D). • 293 · This paper method is also used in Chinese gg home standard (CNS) A4 size (210X 297 mm) (please read 3 precautions for back page first page) 37 1235157 V. Description of invention (Μ) In addition, The NH-ammonium compound is represented by formula (VIII), in which &amp; is as defined above (E), and R2 is as defined in specific example (M): Preferably, in these additional processes, the substituents are as follows: With the definition of Example (E) 3 In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein it is defined as the specific example (F) above, and R2 is defined as the specific example (M). Preferably, in these additional processes, the substituents are as defined in the specific example (F). Taiyibei) In addition, the N-fluorenylamino compound is represented by formula (VIII), where h is as defined in specific example (G), and R2 is as defined in specific example (G). Preferably, in these different processes, the substituents are as defined in (G). In addition, the N-fluorenylamino compound is represented by fluorene (VIII), which is defined as a specific example (H), and R2 is defined as a specific example (M). In contrast to these alternative processes, the substituents are as defined in Specific Example (H). In addition, the N-fluorenylamino compound is represented by formula (VIII), in which the definition is as described in the specific example ⑴, and as defined in the specific example (M). 5 In the other processes, the substituents such as With the definition of the example (I) 3 In addition, the N-saturated amine compound is represented by the formula (VIII), the center of which is defined by the specific example ⑺, and R2 is defined by the example (M). Preferably, in these other processes, the substituents are as defined in Example (J) 3

Employees of the Central Standards Bureau of the Ministry of Economic Affairs, Consumers' Cooperatives, Co. X In addition, the N-fii-based amine compound is represented by formula (VIII), the center of which is defined by the specific example (K), and R2 is defined by the specific example (M) Preferably, in these other processes, the substituents are as defined in the ft instance (K). In addition, the N-fluorenylamino compound represented by formula (VIII) is as defined in Specific Example (L), and R2 is defined as Specific Example (M). -294- Ben. ¾¾ Inverse Week § National Standard Li (CNS) AWt 珞 (210X 297 public)

The Ministry of Foreign Affairs of the People's Republic of China wins the bid of the Employees' Co-operative Cooperatives 5L 1235157 B7 V. Description of the invention (conditions) Better than these other processes, the substituents are as defined in the specific example (L): In order to make the present invention more adequate It is understood that the following examples are shown. These examples of calcium are for illustrative purposes only, and are not intended to limit the present invention in any way. Example 1 Inhibition of ICE The inhibition constants of the compounds of the present invention (κ 〇 and 仄 50 値: 1, 1. UV-visible light receiving enzyme analysis method This analysis was carried out using the Si-Tyr-Val-Ala-Asp-para-terminal substitution benzene cavity as the substrate. Homologous Synthesis of substrates is described in LA Reitei * (Int. J Peptide Protein Res. 87-96 (1994)). These assay mixtures contain: 65 microliters of buffer solution (10 mM Tris, 1 mM DTT, 0.1% CHAPS @ pH 8.1) 10 μl ICE (50 nM final concentration gives ~ lmOD / min rate) 5 μl DMS〇 / inhibitor mixture 20 μl 400 μM substrate (80 a μ final concentration) 100 μl Total reaction ICE analysis of visible light was performed on a 96-well microtiter plate in the order listed. E and DMSO (in the presence of inhibitors) were added to the holes. 3 SL portions were incubated for 15 minutes at summer temperature, and all components started at all holes. The microtiter plate reader was set to incubate at 37 ° C. After 15 minutes of incubation, the substrate was directly added to the pores, and after the release of chromophore (pNA), it was followed for 20 minutes at 405-603 nm and 37 ° C. Linear matching of the data was performed. • 295 · Musical scale of this paper uses Ningguo National Standard (CNS) A4 specification (2 丨 0X 297 mm) (please read the precautions of the back cloud first and then fill in this book

1235157 3 Ⅴ. Description of the invention (293) The estimated rate at mOd / min = DMSO only exists in the experiment without the inhibitor. In other experiments, 100 microliters of volume was made from the buffer solution: 2. Enzyme analysis using fluorescent substrates The above analysis is basically based on Thornberry et al., (Nature 356: 768-774 (1992)), using the substrate 12 referenced in the literature. -Tyr-Val-Ala-Asp-amino-4-methylcoumarin (AMC). Mix the following components: 65 μl buffer solution (10 mM Tris, 1 mM DTT, 0.1% CHAPS @ pH 8.1) 10 μl ICE (2-10 nM final concentration) 5 μl DMSO / inhibitor solution 150 μM substrate (30 a M final concentration) 100 μl total reaction volume analysis was performed on a 96-well microtiter plate. Buffer substances and ICE are added to the holes. Incubate the components on a temperature-controlled well plate at 37 ° C for 15 minutes. After 15 minutes of incubation, the reaction began with the addition of mass, and the reaction was followed at 37T for 30 minutes. After the AMC fluorophore was released, the laser wavelength of 3S0 nm and the emission wavelength of 460 nm were used. get on. Perform a linear combination of the data of each hole, and then determine the rate of fluorescence units per second. 3 • Metaplasty of the central purdon bureau, the second poverty alleviation cooperation, Du Yin ¾ In order to determine the enzyme inhibition constant (KD or inhibition mode (competitive, not Competitive or non-competitive), the rate data for each inhibitor concentration Y determined in the enzyme analysis, using a computer and standard enzyme kinetic equations (see I. Η. Segel, Enzyme Kinetics, Wiley-Interscience 1975) 3 Combining the fluorescence time data with Mordon's evolution equation, we performed -296- this killing again (CNS) AUI grid (210X 297 5) 1235157

AT B7 V. Description of the invention (condition) Determination of the secondary rate constant of the irreversible inhibitor. Moirison, JF, Mol Cell. Biophys., 2, ρρ · 347-368 (1985) 3 D. Hornberry et al. Have published a description of these methods for detecting the rate constant of irreversible inhibitors of ICE, Thornberry, NA, et al., Biochemistry, 33, pp. 3923-3940 (1994). For no previous complex formation can be observed dynamically, the quadratic rate constant (Kinaei) is directly from k. ^ Derived from the slope of the straight line plot vs. [I]. For compounds whose previous complex formation (and enzymes) can be detected, k. ^ The double-western line graph of vs. [I] cooperates with saturation dynamics to generate the heart and k, first. Then, k, / Ki is used to generate the quadratic rate f-number kinact. 3. PBMC cell analysis method: A mixed population of human peripheral blood mononuclear cells (PBMC) or enriched adherent monocytes is used for the IL-1 / 5 analysis method. ICE's treatment of pre-IL-ly5 can be modified in various ways. Detection of like-cell-derived face cell culture. Human PBMCs obtained from healthy donors can provide a mixed population of lymphocyte subtypes and monocytes, which can produce a profile of leukokines and cytokines in response to many plastic-like physiological stimuli. Adherent monocytes from PBMC can provide a source of normal monocyte enrichment for selective study of cytokinin production by activated cells. 3 Experimental steps: Printed by the Ministry of Economic Affairs, Central Bureau of Quasi-Bureau, Shellfish Consumer Cooperative ¾ (please read the precautions of back cloud before filling in this purchase)

Prepare the initial dilution series of the test compound in DMSO or ethanol, and then dilute to the RPMI-10% FBS culture grave (containing 2 mM L-glutamic acid, 10 mM HEPES, 50 U, and 50 μg / ml penicillin / Streptomycin) to produce drugs with a final concentration of 4x in 0.4% DMSO or 0.4% ethanol. The final degree of DMSO is 0.1% in all drug diluents, and the standard of ICE-297-paper is the same as the Chinese National Standard (CNS) A4 Tige (210X297 mm) 1235157 Λ7 B7 Central Bureau of Standards, Ministry of Economic Affairs Bei Gong Xiao F, Du Yin ¾ 5. Description of the invention (295) The test compound determined in the inhibition analysis method exhibits a titration of Ki, which can usually be used for a compound screening. Usually 5-6 parts of compound dilutions are tested, and the cell components are subjected to secondary analysis, that is, a secondary ELISA determination is performed on the supernatant of each cell culture: PBMC isolation and IL-1 analysis: from a pinto human blood The separated blood yellow layer cells (producing 40-45 ml final volume blood paddles plus cells) were diluted to 80 ml with culture medium and covered with 10 ml each on a LeukoPREP separation tube (Becton Dickinson). After centrifugation at -1800 xg for a minute, the plasma / medium layer was aspirated and the monocyte layer was collected with a Pasteur pipette and transferred to a 15 ml conical centrifuge tube (Corning). The medium was added to a volume of 15 ml, the cells were gently mixed by inversion, and centrifuged at 300 xg for 15 minutes. PBMC pellets were suspended in a small amount of medium, and the cells were counted and adjusted to 6 X 106 sprints / ml. 3 In cell analysis, add 1.0 ml of cell suspension to each well of a 24-well flat-bottom tissue culture plate (Corning). 0.5 ml of the test compound dilution, 0.5 ml of LPS solution (Sigma # L-3012; 20 ng / ml solution was prepared in complete RPMI medium; final LPS concentration was 5 ngg / ml), 0.5 was added Milliliters of test compound and LPS are usually sufficient; the contents of the pores are tailed. Each experiment was performed with three control mixtures, with separate LPS, solvent vehicle controls, and / or culture medium to adjust the final culture volume to 2.0 ml. The cells were cultured at 37 ° C and 5% (: 02 for 16-18 hours. At the end of the incubation period, the cells were recovered and transferred to 15 ml conical centrifuge tubes -298- this standard was used in China. ( CNS) A4 size (210X297) 茇 (Please read the notes on the back of this book. Binding spring 1235157 236, V. Description of the invention (First read 背 5 back). After 200 xg difficult 10 minutes, the supernatant Recovered and transferred to a 1.5 ml Eppendorf tube. It can be noticed that cell clumps can be used for pre-IL-ly? And / or mature IL-1 / 5 content in the extract of running fluid. The life is also evaluated, using Western blots Method or ELISA with pre-IL-1 /? Special antiserum to perform 3 isolation of adherent monocytes: Isolate and prepare PBMC as described above. Add the culture medium (1.0 ml) to the holes first, and then add 0.5 ml PBMC suspension. After 1 hour of incubation, the pellet was carefully shaken and then sucked out the adhered cells from each hole. 3 holes were then gently washed three times with 1.0 ml of culture medium and suspended in 1.0 ml of culture medium. Plus cells with attached cells can usually generate 2.5-3.0 X 105 cells per hole. Test compounds, LPS addition, cell culture conditions and supernatant modification 3 ELISA: We used the Quantikine kit (R & D Systems) to detect mature IL-1 Lu. Analysis was performed according to the manufacturer's instructions Mature IL-1 y? Levels were found in PBMC and adherent monocyte positive control group at about 1-3 ng / ml. ELISA analysis in the supernatant of LPS-positive control group 1: 5: 1 : 10 and 1:20 dilutions to select the most appropriate dilution of the supernatant in the recipient column3 The inhibitory strength of the compound can be expressed by IC5Q 値, which is the

Concentration of inhibitors at 50% of mature IL-1 measured by the Consumers' Cooperatives printed by the Central Bureau of Standards of the Ministry of Economic Affairs, compared with 50% of mature IL-1 measured. The above can be determined by various factors, such as cell type, cell source, growth conditions, and the like. -299- Chinese standard twin (CNS) A4 specification (2 丨 0: &lt; 297 mm) 1235157 Λ 7 Β7 is used in this mounting method. Example 5 (297) Example 2 Pharmacokinetic peptides in mice Sexual ICE inhibitors can be eliminated quickly with a threatening rate of greater than 100 a / min / kg. 3 Compounds with lower clearance have improved pharmacokinetic properties compared to peptide inhibitors. 3 Using the following method, We can obtain the clearance of many compounds of the present invention in mice: sample preparation and dosing compounds were dissolved in sterile TRIS solution (0.02M or 0.05M); the agronomic level was 2.5 mg / ml. When it is determined that the solution is complete, the sample is first dissolved in a small amount of methetamine (maximum 5% of the total solution volume), and then diluted with TRIS solution. 3 The drug solution is administered to CD-1. River Laboratories-26-3 1 kg), and a drug dose of 25 mg / kg was administered via the tail vein at a dose volume of 10 mg / kg. At each time point (usually from 2 minutes to 2 hours), mice were administered in groups of 5 animals. At the appropriate time, the animals were pulverized with fluorescein and then collected into individual heparinized tubes by sacral vein cutting. . The blood sample was cooled to (TC), and the difficult plasma was divided and stored at -20 ° C until analysis. Bioanalysis The drug concentration in the blood sample was determined by HPLC analysis under UVk MS (ESP) detection. The application in reverse phase chromatography was determined by Various bonding phases from Cl to Cl 8; the eluent is 甴 aqueous buffer / acetonitrile mixture under equal density conditions, and the quantification is based on external standard methods. A pulp structure with drug solution -300-paper size Applicable to China National Standard Xin (CNS) M specifications (210X297mm) (this page) Binding Printed by the Central Standards Bureau of the Ministry of Economic Affairs and Consumer Cooperatives ¾ 1235157 Λ7 B7 V. Description of the invention (298) Corrected white line, concentration range 0.5 to 50 micrograms / Ml. Before analyzing the blood paddle samples, add acetonitrile, methanol, trichloroacetic acid or chloric acid, and then centrifuge at 10,000g for 10 minutes to remove the protein. Note / 乂 20 microwells to 50 microliters of sample accumulated for analysis 3 Compound 214e administration and sampling drug dissolved in sterile 0.02MTds to generate a 2.5 mg / ml solution, which was then passed through the tail vein at a dose of 25 mg / kg Five groups of 11 male CD-1 mice were administered. At the following time points 4: 2, 5, 10, 15, 20, 30, 45, 60, 90, and 120 minutes, a group of animals were each anesthetized and blood was collected into heparinized tubes. After the plasma was separated, it was stored at -20eC until analysis. Analysis An aliquot of plasma (150 µl) was treated with 5% perchloric acid (5 µl), vortexed and allowed to stand for 90 minutes before centrifugation. The resulting supernatant was separated and an additional 20 microliters were injected into the HPLC for analysis. HPLC conditions on this page) Binding of the staff of the Central Government Bureau of the Ministry of Economics and Consumer Cooperation Du Yin ¾ column 100x4.6 mm Kromasil KR 100 5 C4 mobile phase 0.1m Tris pH7.5 86% acetonitrile 14% flow rate 1ml / min UV retention time at 210 nm 3.4 minutes * Analysis results show that the average plasma level of the drug decreased from ~ 70 μg / ml (at 2 minutes) to <2 μg / ml (at 90 and 120 minutes). Quan-301-This standard for killing is reversed to the Chinese National Standard (CNS) A4 (2 丨 0X297 gong) 1235157 V. Description of the invention (2 &quot;) Compound 217e Administration and sampling Drugs are dissolved in sterile 0.02MTris to A 2.5 mg / milliwell solution was generated, which was administered to the male CD-1 mice in a total of 11 groups in a dose of 25 mg / kg via the tail vein. At the following time points: 2, 5, 10, 15, 20, 30, 45, 60, 90, and 120 minutes, a group of animals were anesthetized and blood samples were collected into heparinized tubes. Plasma was stored at -20 ° F after analysis until analysis. Analysis An aliquot of plasma (100 µl) was diluted with acetonitrile (100 µl) and vortexed for 20 seconds and centrifuged for 10 minutes. The resulting supernatant was separated and 20 microliters were injected and analyzed by HPLC. HPLC conditions

Zorbax SBC8 72% 28% column 150x4.6 mm mobile phase 0.05M scalylate buffer solution, ρΗ7.1 · acetonitrile flow rate 1.4ml / min Detect UV retention time at 210nm 3.0 and 3.6 minutes (non-antibody) -¾ Printed by the Consumers' Cooperative of the Ministry of Economic Affairs of the Central Bureau of Standards of China ^ (Please read the “Implications” on this page to analyze the results on this page. The average plasma level is shown to be ~ 55 μg / ml (in 2 minutes). 0.2 μg (60-120 minutes). Example 3 · Peptide ICE inhibitor can be quickly removed with a clearance rate of more than 80 ml / min / kg. 3 Compounds with lower clearance rates are more improved than peptide ICE inhibitors. The pharmacokinetic properties of many compounds of the present invention can be obtained in mice by the following methods: -302 · The size of the paper method is common Chinese national standard (CNS M4 specification (210X29? Mm) 1235157 A. '___ B7 _: __ V. Description of the invention (300) Removal rate (ml / min / kg): The rat clearance analysis method in live loops was performed one day before the pharmacokinetic study on the cervical jugular glands and carotid arteries of the moles under anesthesia. Intubation MJ Free, RA Jaffee: € 3ηηιΐΗΐ οη techniques for the collection blood and other bodily fluids': in Animal Models; p. 480-495; NJ Alexander, Ed .; Academic Press; (1978). The drug (10 mg / ml) was administered in the vehicle via the jugular vein, The vehicle usually contains propylene glycol / saline and 100 mM sodium bicarbonate in a 1: 1 ratio. Animals are given 10-20 mg of drug / kg, and then 5, 7, 10, 15, 20, 30, 60, and 90 Blood was collected from the internal carotid catheter at the minute. Blood was centrifuged out of the plasma and stored at -2CTC until analysis. Pharmacokinetic analysis of the data was performed using standard models such as RStrip (MicroMath Software, UT) and / or Pcnonlin ( SCI Software, NC) performed marginal regression to obtain the clearance rate. Analysis: Rat plasma was extracted with isovolume acetonitrile (containing 0.1% TFA). The samples were centrifuged at approximately 1,000 xg, and the supernatant was re-extracted. Analyze by gradient HPLC. The typical analysis steps are described below. 3 The Ministry of Economic Affairs Central Standards Bureau Work-Reduction Cooperative Society printed 200 μl of plasma with 200 μl of 0.1% trifluoroacetic acid (TFA) in acetonitrile and 10 μl. 50% gasified zinc aqueous solution precipitation Vortexed, then every heart ~1000 X g. The supernatant was collected and analyzed by HPLC. -303 · ^ Paper-killing standards are commonly used in China; ^ (CNS θ specification (mm) 1235157 Λ7 B7 V. Description of the invention (3Q2) Endotoxin-free sodium chloride solution (0.9%) and HBSS lipopolysaccharide (Sigma; Cat. # L-3012) stock solution at 1 mg / ml in HBSS IL-ly? ELISA proteome (R &amp; D Systems; Cat # DL'B50) TNF pan-ELISA (R &amp; D Systems: Cat # DTA50) Experimental steps for whole blood analysis in a water bath or incubator: Set the incubator or water bath at 3 (TC. A 0.25 ml blood sample is placed in a 1.5 ml eppendorf tube. Note: After every two samples, the whole blood is sold free. The test tube is indeed inverted. If the cells settle and are not evenly suspended, there may be a difference in repetition. Using a positive pressure pipette can also minimize the difference between repetitions. In sterile pyrogen-free saline Serial dilutions are used to prepare equal dilutions. The test compound supported apparent &amp; dilution series determined in the ICE inhibition analysis can often be used for initial compound screening. For extremely hydrophobic compounds, our compound dilutions are Prepared in fresh plasma from the same blood donor or contains 5 % DMS0 in PBS to enhance dissolution. Add 25 μl of the test compound dilution or vehicle control group, and gently mix with the sample a and then add 5.0 μl of LPS solution (250 ng / ml stock solution, freshly prepared: 5.0 ng / ml final concentration of LPS) and mix again. Tubes were incubated in a water bath at 30 eC for 16-18 hours and mixed frequently. In addition, the tubes were placed in a spinner at 4 rpm for the same incubation period. 3 This analysis was also performed. Can be constituted two or three times in the following internal photo group: negative contrast group-no LPS: positive control group-no test inhibition 剤: vehicle control group-the highest concentration of DMS0 or compound solvent used in the experiment 3 add additional Saline water was added to all the control tubes, so that the control group and experimental whole blood samples had normalized volumes. -305- This paper is generally used in the national standard S (CNS) A4 size (2 丨 0 × 297 mm). ) (Poem siiI.V / Notes on this page, printed on the page of the Ministry of Economic Affairs, Central Procurement Bureau, Soldiers and Consumers Cooperatives, etc. ¾ 1235157 Λ 7 Β7 V. Description of the invention (3Q3) After the incubation period, the whole blood sample is at ~ 2000 rpm In the microcentrifuge, the blood is transferred to the fresh Measure in a centrifuge tube and centrifuge at 1000x g to clump the remaining platelets if necessary. Plasma samples / can be stored frozen at -70 ° C, and then analyzed by ELISA for cytokinin levels. ELISA: For detection of IL We used the R &amp; D System (614 McKinley Place N.E. Minneapolis, MN 55413) Quantikine kit in -1 /? And a-TNF. The analysis was performed according to the manufacturer's instructions. In the individual range, we have observed IL-1 / 5 levels of ~ 1-5 nano ^^ / ml in the soup control group, and the 1: 200 plasma dilution multiples of all samples, so that the ELISA results of our experiments are sufficient to fall The linear range of the ELIS A standard west line. If differences are observed in whole blood analysis, standard dilutions can be made more ideal if necessary 3 Nerad, JL et al., J. Leukocyte Biol., 52, pp. 687-692 (1992) ° Example 5 ICE homologue Inhibition 1. Separation of ICE homologues. ¾ Printing by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions before filling in this purchase TX to use the performance of the standard virus expression system in insect cells. Tx cDNA (Faucheu et al., Supra, 1995) was selected and cloned into a modified PVL1393 transfer vector, and the resulting plastid (pVL1393 / TX) was co-transfected into insect cells. Viral DNA was used for identification. Recombinant prion-like virus. After producing high-potency recombinant diseased ginger stocks, the activity of TX in the culture medium was checked by visual ICE analysis. Typically, Spodoptera frugiperda was infected with recombinant prion stocks at MOI 5 ( Sf9), with a maximum performance of 4.7 μg / ml after 48 hours a. ICE is used as the standard in the analysis. -306- The paper ft scale is applicable to the Chinese National Standard (CNS) A4 standard (210X297 mm) 37 1235157 Λ7 5 、 Invention description (304) Note on the back This book is printed by the Ministry of Economic Affairs of the United States, and it is also printed on the ICE or TX ammonium terminal T7 decoration. The original design can help the identification and purification of recombinant proteins. Weng Yi can also be used to check different levels of performance and relative expected death levels from different homologues. In comparison with cell lines that can express ICE or TX and sprints infected with separate viral DNA, the former is Infected Sf9: Expected death of vesicles in cells (examined by cone blue exclusion analysis) increased 3 N-terminal (His) 6 • Performance of decorated CPP32 in Escherichia coli and hairiness coding The CPP32 peptide and the cDNA from Ser (29) (Fernandes-Alnemh et al, supra, 1994) were amplified by primer-line PCR. Its $ is added to the Xhol position on the 5 · and ends, and the generated The Xhol fragment was ligated to the Xhol-cut pET-15b expression vector to generate a fusion protein whose N-terminus has (his) 0n decoration in the framework of the recombinant 3 protein. The recombinant protein starts with the MGSSHHHHHHSSGLVPRGSHMLE amine margin sequence Of which LVPRGS Thrombin dissociation location, from father to Calligraphists (29) of CPP32. Harboring plasmid of Escherichia coli BL21 (DE3) at 30, C swells grow to log phase, then co-cultivation with O.SmMIPTG. After adding IPTG2 +, the cells were recovered to prepare a lysate, and the soluble protein was purified by Ni-distant sugar chromatography. All the expressed CPP32 proteins were shown through the 裒 # 修 # Plastic formula a N-terminal sequencing analysis showed that the processing modification occurred in Asp (l75) and Λ

Ser (176) is in the expected position. Approximately) micrograms of CPP32 protein are obtained from a 200 ml culture. It was determined by active site titration that the purified lean white matter was fully active. Protease preparations are also extremely in vitro active in dissociating PARP and synthesizing # DEVD-AMC substrates (Nicholson et al,

The paper scale is universal Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 a7 B7 V. Description of the invention (305), 1995 "2. Inhibition of ICE homologues Selectivity of a series of reversible inhibitors of ICE homologues The results are shown in Table 13. 3 The ICE enzyme analysis was performed by YVAD-AMC substrate (Thomberry et al, above, 1992) according to Wilson et al (above, 1994). The ICE substrate was used under the same conditions as ICE. Analysis of TX activity. Analysis of CPP32 using the DEVD-AMC substrate (Nicholson et al, supra, 1995) 3 In general, for a wide range of architectures, there is low selectivity between ICE and TX. None of the synthetic ICE compounds tested were effective inhibitors of CPP32. Analysis of reversible compounds (1 AM) at the highest concentration showed no inhibitory effect. 3 Table 1 Compounds kj ICE (nM) IqTX (nM) ^ CPP32 (nM ) 214e 7.5 7.0 ± 1.1 &gt; 1000 135a 90 55 ± 9 &gt; 1000 125b 60 57 ± 13 &gt; 1000 137 40 40 ± 7 &gt; 1000 The text shows that the selected irreversible inhibitor deactivates ICE and ICE homologues Quadratic rate constant (Table 2). The irreversible compound studied is ICE A wide range of inhibitors of β and its homologs β However, certain selectivities can be observed with irreversible compounds compared with the inhibitory effects of ICE and CPP32 3 Table 2 Compounds kmact (ICE) ^ inact (TX) '(CPP32) M · 1 s · 1 NT1 s · 1 M-1 s · 1 138 120,000 150,000 550,000 217d 475,000 250,000 150,000 108a 100,000 25,000 nd Printed by the Department of Industry and Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Notes (^^ this page) • 308- The standard of this paper is GM China National Standards (CNS) A4 (2 丨 0> &lt; 297 mm) Printed by the Consumers' Cooperative of the Central Government Bureau of the Ministry of Economic Affairs 1235157 Λ7 B7 V. Explanation of the invention (306) Example 6 Inhibition of expected death of cells Fas-induced cells expected death in U937 sprint 'Evaluation of compounds' ability to block anti-Fas-expected cells expected death. In use In the preliminary experiments of RT-PCR, we detected mRNAs encoding ICE, TX, ICH-1, CPP32 and CMH-1 during unstimulated U937 run. We have used this cell line in studies on the expected death of dysentery. U937 sprinting was seeded into the culture medium at 1 X 105 cells / ml, and regenerated to ~ 5x 106 run / ml. In experiments where cells were expected to die, 2 X 10 cells were plated in a 24-well tissue culture plate in 1 ml of KPMI-1640-10% PB5, and stimulated with 100 ng / ml anti-Fas antigen antibody ( Medical and Biological Laboratories, Ltd.) 3 After 24 hours incubation at 37eC, FACS analysis was performed with ApoTag reagent to determine the percentage of cells that were expected to die. All compounds tested were initially at 20 // M and titrated with the active compound to determine the IC50 値. Inhibition of expected sprinting death was observed in 108a, 136, and 138 (at 20% &gt; 75%). At 217e, it was determined that 0.8a 1 ^ 1 (: 5 (), and 2146 20 / ^% of anti-435-induced cells have no inhibitory effect on the expected death. Β Example 7 In vivo when used as an anti-inflammatory drug Acute analysis LPS-induced IL-ly3 produced in CD1 mice administered with LPS (20 mg / kg IP) was evaluated for the efficacy of 214e and 217e (n = 6 in each case). Test compounds were prepared in R. palmatum Gu • 309- The paper ft scale is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm)

1235157 Λ / B7 V. Description of the invention (3σ7) •• DMSO-acetase (90: 5: 5), and then injected with 甴 ip 3 Lpi 1 hour after lps and blood collection after 7 hours 3 ELISA to detect serum Medium IL-1 / 5 level. The results show that the dose of il-1 secreted by 甴 214e depends on the light-plastic effect, and the ED30 is about 15 mg / kg. Similar crusts 3 can be obtained in the second experiment and can also be observed in 217e-treated mice Significant inhibition of IL-1 / 5 secretion (Figure 7): However, a clear dose response was not obvious: Compounds 214e and 217e (50 mg / kg) were also administered by oral gavage to evaluate absorption. The results in Figure 8 show that 214e and non-217e vaccines can inhibit IL-1 secretion when taken orally. It is recommended that "ICE inhibitors act as anti-inflammatory agents for oral efficacy potential. The efficacy of 2l4e homologues is also evaluated when administered in IP (Figure 9 ) And PO after administration in mice administered with LPS (Figure 10) 3 Check the inhibition of IL- /? Production system caused by 214e homologues after administration of LPS mice in PO and IP (50 Mg / kg) β (Please read the notes on the back first

(This page) Order Employees of the Central Procurement Bureau of the Ministry of Economic Affairs, Consumer Cooperatives, India, Pei Table 3 Compound PO% Inhibition IP% Inhibition 2l4e 75 78 265 27 30 30 416 52 39 434 80 74 438 13 · 40 442 10 0 2002-78

-310- Paper size General Ningguo's family rubbing (CNS) A4 Yeluo (2 丨 0 × 297 public transformer)! 235157

3. Description of the invention (30β) Table 4 Comparison of the efficacy of 2l4e drugs in LPS mice: IL-1 Rosin-made time, Western-line inhibition as Wei --------- Compound dosing time, gas-dose time, p〇2 ^ Ting g / kg) Member of the Ministry of Economy and Trade of China

Example 8 obtained in the following analysis: Detecting the 214e prodrug of Xue Jun Yongping. Mice were administered at a ρ ··· dose of compounds 302 and 304a (50 milligrams / kg), and the drug was prepared in 0.5% carboxymethyl Based cellulose. Blood was rubbed at 1 and 7 hours after administration. Serum was extracted with acetonitrile containing 2% acetic acid: Dian Er, and the supernatant of Zanxin 3 was analyzed by liquid chromatography-mass spectrometry (ESI-MS). Standard (CN? S) M specification (210XH97 mm) 1235157 A. 'B7 V. Description of the invention (309: 0.03 to 3 μg / ml detection level. Compounds 302 and 304a show detectable when taken orally The blood level of 214e itself did not exceed the blood level of 0.10 μg / ml when taken orally. Compounds 302 and 3b4a are prodrugs of 214e and can be metabolized to 214e in living diarrhea (see Figure 11). Example 9 We Using the method described in Example 1.8, the following data of the compound of the present invention can be obtained (see Tables 5 and 6). The structure of the compound of Example 9 is shown in Examples 10-17. UV-Visible Ki (nM) 1 i Know JfePBMC Almost IC50 (nM) Whole blood IC50 (nM) Old gas clearance iv ml / min / kg Atmospheric clearance iv ml / min / kg 47b 27 1800 &lt; 600 338 47a 19 2600 5100 79 32 135a 90 2800 5000 &gt; 100 135b 320 1600 1700 • 125b 60 800 450 0 j 108b 400 25000 1! &Gt; 100 137 40 1700 14000: i 1 139 350 2000 ii 213e 130 900 600 400 * 1 214c 1200 5000 214e 7.5 1600 1300 23 12 217c 1700 7000 70 217e 175 2000 &gt; 50 220b 600 2125 • 1 223b 99 5000-&gt; 100 ί 223e 1,6 3000 &gt; 20000 89 i 22 6e 15 1100 .1800 109 227e 7 234 550 230e 325 300 67 232e 1100 4500 22 26 I 235e 510 4750 36! 238e 500 4250: 246 12 950 10000 31 -312 Please first read the meaning of the back of the cloud and write it. The size of this paper is in accordance with the Chinese National Standards (CNS) standard 4% grid (2 丨 OX297 mm) 1235157, Λ I Β7 V. Description of the invention (31〇) ¾ The Central Bureau of Standards of the Ministry of Economic Affairs and Consumer Cooperation. Printed i compounds UV-visible Ki (nM) fine & PBMC average IC50 (nM) all J0JC50 (nM) rat clearance i · ν · ml / min / kg! Damin clearing rate i. V. ml / min / kg j 257 13 11000 6600 * _:-i 1 f | 265 47 4300 1400 j 23 20 281 50 600 2500 * \ 302 4500 &gt; 20000 &gt; 20000 304a 200 1,400 2400 14000 *-307a 55 14500 16000 307b 1 65 14000 404 2.9 j 1650!! 1800 * 1100 64 24 405 i 6.5 j 1700 2100 406 j 4! 1650 2300 407 j 0.4 540 17〇〇408 0.5 1100 1000 41 23 409 3.7 2500 410 17 2000 2800 32 20 411 0.9 540 1900 412 1.3 · 580 660 * 700 1000 * 25 | 413 750 6200 415 2.5 990 1000 * 450 3500 * 26 18 416 12 1200 3400 47 417 8 2000 6000 33 22 418 2.2 1050 2200 * 7800 1800 * 13 5.9 419 280 &gt; 8000 420 1200 8000 &gt; 8000 ^ 421 200 4300 4600 * 1 422 50 2200 1200 423 10 2100 1800 * 1500 45 | 1 1 424 45 2500 4000 \ 425 0.8 650 700+ 650 i 1 (Please read the notes on the back first again! (PF page)

-313- The standard of this paper is Chinese national standard (zero) person 4 specification (210: &lt; 297 mm) 1235157 B7 V. Description of invention (311) Department of Industrial and Consumer Cooperation, Central Standards Bureau, Ministry of Economic Affairs Compound UV · Visible light Ki (nM) Fine PBMC Average IC50 (nM) ± jhIC50 (m \ I) Rat clearance rate iv ml / min / kg j Rat clearance rate i. V · ml / min / kg! 426 I! 90 4500 2500 * ί!! 427 180 4500 36 | 428 280! 429 7000 | 430 60 &gt; 8000 I 431 8 &gt; 8000 8000 432 1.6 560 :: 2000 433 2.9 1000 i 1100 1100 * |-434 4.9 1600 1 1800 t 1200 * 1 1300 * 20 435 8 j 4400 ί 436 7.5 ί 2700 j 437 I 1 12 ί 1800! 5000 ί I t 438 28 1000 700 2900 * 22 439 3.7 2800 3200 3400 * i 440 2.3 5000 2000 441 1 2500 4500 442 3.2 900 2000 54 443 3.6 2800 1500 444 15 3500 3500 445 135 4,000 4000 446 62 3000 447 5 · 8 2500 1500 448 130 4000 449 12 1500 3200 13000 ^ 450 5 800 2200 1700 * 18 12 1 451 4 1800 1500 9000 * 452 4.5 600 800 ^ 650 1600 * 27 · 3 453 0 65 1300 1900 1600 * _L | (please read the Notes on the back of the closure

ORDER-314- The paper scale is reversed to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157 Λ7 B7 V. Description of the invention (312) Printed compounds and materials by the Shellfish Consumer Cooperative of the China Prototype Bureau of the Ministry of Economic Affairs uv-visible light 'Ki (nM) PBMC average IC50 (nM) ^ j6JC50 (nM) rat clearance iv ml / min / kg rat clearance iv ml / min / kg t 454 45 2500 i 455 1.2 400 2800 2600 * 1 j 54 456 4.5 600 1300 * 600 1400 * 12.7 457 6.2 2000 3500 jj 458 20 2900 j J j 459 5 1800: •! 4 60 115 400 | 2400 • 1; 461 S 47 t; ί 462 ί 40 1- 1 1 463 '14! 2400 *! 丨 2800,: ί; 464 j 1 2.5 j 1000 j &gt; 1000 i! 1 i 2500+ j I 1 465 3 1000 I 800 1 466 0-8 1400 600 i 4 67 11 1900 ί f 468 4.5 850 2500 i • 470 5 500 360 500 * 63: 1 471 1 750 400 17 472 140 473 1 1000 400 450 * 474 85 475 5.5 690 650 * 400 350 ^ 31 21 ί j 476 7 1600 2500! I 477 60! 478 380 K 479 15 900 700 2400 * i 1 480 25 2300 1 481 1.2 390 930 * 600 500 * 34; 4 82 &lt; 0.2 340 380 260 * i -315-

The size of this paper is applicable to Chinese national standard (CNS) A4 specification (210X297 male) 1235157 Λ7 B7 V. Description of the invention (313) M printed by the Ministry of Economic Affairs, China Standards Bureau, Off-line Consumer Cooperatives! .Chemical field UV-visible light * Ki (nM) • Extreme raM (average IC50 (nM): ± jklC50 (nM) rat clearance iv ml / min / kg atmospheric clearance 1. · V. .Ml / min / kg I 1 483 1-7 900 700 1 | 484 II 2 1550 1400 ^ 5000 15! 485 f 2 900 900 ί 486 II 2.3 480 570 * 500 3Ί LI 487 I 2,4 650 950 * 500 .400 *! 20 1! 488 1-5 940 I 750 !: ί! 489 f 6 2250 1700 * I-15000 ι ί! i 490 l (4 · 3 _ 980 j 700 1000 *! 1900 *! 491! 5 | 2500 i ---------- ! 493! 25 1 丨 — i 1200; 800 ί 850 * 494 15 1350 1500 * 7000 495 43 496 16 1550 1600 * 6000 497 3.5 .740 350 700 * 498 1.5 · 560 500 400 * 499 3.5 1200 800 * 9000 605a 90 2600 &gt; 20000 605b 45 10000 97 605c 615 4500 37 605d 95 5100 16000 5100 * 33 605e 29 2250 &gt; 10000 24 -J 605f 475 12500 605g 165 22500 605h 460 &gt; 2500 0 605i 680 &gt; 20000 i 605j 110 8750 71 605m 650 20000 -316- (Please read the precautions on the back first | This long standard uses 8 Chinese standards (CNS) A4 specifications (210X297 mm) 1235157 Λ7 B7 V. Description of the invention (314) Du Yin ¾ Cooperative Field, Central Government Bureau of the Ministry of Economic Affairs and Consumer Cooperation. UV-Visible light Ki (nM) 1 Exact PBMC IC50 (nM) and IC50 (nM) of whole blood! Iv ml / min / kg rat clearance rate | iv 1 ml / min / kg rat clearance rate 605η 12 2100 &gt; 20000 &gt; 28 605〇72 18000 605ρ 125 3200 &gt; 20000 | 605q 1000! 605s 150 6000 ί 1! 605t 33! 609a 114 &gt; 30000 I 609b 27 &gt;20000; 619 300 丨 620 35! 1000 19000 621 7.2 | 1300 '&gt; 20000 1 622 35! 1300 &gt; 20000 t! 623 9! 624 300 625 105; 626 260 627 43 3250 8000 628 36 2750 &gt; 20000 I 629 230 i 630 270 631 805 632 148 633 92 5750 20000 i 634 1400 635 55 1900 3400 * 4000 605v 1100 &gt; 30000 2201 9 2000 3700 * 3500 60 2100e 250 800 600 2100a 100 1100 850 «2002 4 810 860 * 70 1400 * 32: I t 2100d &gt; 100000 &gt; 20000 &gt; 20000! 2100c 7400 &gt; 20000 &gt; 20000 1 2100b 8000 &gt; 20000 &gt; 20000 2001 135 1800 3500 ： 1027 4000 &gt; 20000 &gt; 20000 60 1015 40 2500 1700 23 -317- (Please read the precautions on the back first. Installation-'··-End page) The size of the book is in accordance with the Chinese standard. Twin (〇 ^) / \ 4 specifications (210 &gt; &lt; 297 mm) 1235157 A7 B7 V. Description of the invention (315) Table 6 Fluorescence analysis of compounds ^ inact Nf1 il Fine run reMC Average IC50 (βΜ) Full j6lI million 50 (ηΜ) clearance rate of old lice i · ν · ml / min / kg Damin clearance rate i iv j ml / min / kg! 108a ί 5 ~ &quot; 1 1x10 1 117500 I ir 1 136 j 5.4xl0 5 1 870 2800 93. 138 1 · 2χ105 900 2900 116 217d 4 · 7χ105 340 4000 1 ^ 1 280 4χ1〇5 650 &gt; 1000 187 | 283 ΙχΙΟ5 &lt; 200 450 104 j 284 3 · 5χ105 470 550 77 100 285 4 · 3χ105 810 1000 130 50. 9 ,: f-<) * The number is obtained by reanalysis. Example 10 Compound 139 was synthesized in a similar manner to that of 47a.

Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs Compounds 136 and 138 were synthesized in a similar manner to 57b. -318-Standards in this paper: §11 standard twins (〇 ^) 厶 4 specifications (2 〖0 &gt; &lt; 297mm) 1235157 A7 B7 Poverty Alleviation Cooperation Staff of the Central Standards Bureau of the Ministry of Economy Du Yin ¾ 5. Invention Explanation (316) 〇

Compounds 135a, 135b, and 137 were synthesized in a similar manner to 69a. 〇

〇

The standard of this paper is Chinese standard rate (CNS) A4 (210X297 mm) 1235157 Λ / Β7 Employee consumption cooperation of the Central Rubbing Bureau of the Ministry of Economic Affairs Du Yin ¾ 5. Description of the invention (317) Compounds 813e, 814c, 814e , 817c, 817d, 817e, 820b, S23b, 823e, 826e, 827e, 830e, 832e, 835e, 838e, 846, 857, 865, 902, 904a, 907a, 907b, 1004-1013, 1015-1045, 1046-1068 3, Compounds 47a, 47b, 108a, 108b, 125b, 213e, 214c, 217c, 217d, 217e, 220b, 223b, 1070-1091, and 1093-1099 were synthesized in a similar manner to compound 264 and equivalent compounds in Examples 10 and 11. , 223e, 226e, 227e, 230e, 232e, 235e, 238e, 246, 257, 264, 265, 280-287, 302, 304a, 307a, and 307b were synthesized as follows: 'iL N- (N-ethenyl- Tyramine-valinyl-piperidinyl) -3-ammonyl-4-ketobutanoic acid A step · N- (N-third-butoxycarbonylpiperidinyl) -4-amino group 0- N-tertiary-2-methyltetrazolane was subjected to N-third-butoxycarbonyl in a similar manner to that reported by Chapman (Bioorg. &Amp; Med. Chem. Lett. 2, ρρ · 613-618, (1992)). The reaction of pipecolic acid (460 mg, 2.0 mmol) with N-allyloxycarbonyl-4-amino-5-fluorenoxy-2-one tetrahydrofuran (530 mg, 1.82 mmol) This gave 654 mg of the title compound. Tun NMR (500 MHz, CDC13 (in the form of geometric isomers) &amp; 7.35 (m, 5H), 6.88 (br · s, 1H), 4.9 · 4 · 45 (m, 4H), 3.95+ (br · m, 2H), 3.06 (m, 1H), 2.9 (m, 1H), 2.7 (br. M, 1H), 2.45 (m &gt; iH), 2.2 (m, 1H), 1.7-1.5 (m, 3H), 1.45 (two s, 9H). B-step tanning · N-pipecolyl-4-amino 0-methoxy-2-one -Butoxycarbonylpiperidyl) -4-amino-5-fluorenyloxy-tetra-320- This paper ft scale is suitable for medium sample rate (CNS) A4 specification (210X297 mm) ~ &quot;

(Please read the precautions for VB first. V Pack-Γ pages) Order

1235157 Λ7 B7 I ...... Ϋί s! 1 · —I— I- I ---- Η1 V. Description of the invention (318) 氲 Bite reading (654¾ brother) 25% trifluoroacetic acid dissolved in 15 ml In dichloromethane, the mixture was stirred and stirred under a room stream to form a gelatinous residue. The residue was dissolved in dichloromethane and washed with 10% sodium bicarbonate. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated to give 422 mg of the title compound as a brown solid 5 lU NMR (500 MHz, CDC13) &amp; 7.38 (m, 5H), 7.15 (d, lH), 5.55 (d, 1H), 4.95-4.8 (m, 1H), 4.78 (m, 1H), 4.65 (d, 1H), 4.45 (m, 1H), 3.2 (m, 0.5H), 3.05 (m, 0.5 H), 2.95 (m, 0.5H), 2.85 (m, 0.5H), 2.65 (m, 1H), 2.55-2.38 (m, 1H), 1.95 (m, 1H), 1.8 (m, 1H), 1.6 (m, 2H), 1.38 (m, 2H). D-Beijing Ministry of Economic Affairs, Central Bureau of Associate Bureau, consumer cooperation, printing step C. N- (N-Ethyl-carbamoyl-valine-cap-wlco) -4-amino-oxy-2 -Fluorenyl-tetrahydrobenzyl-N-ethylfluorenyl-fluorenaminefluorenyl-valinic acid (464 mg, 1.44 mmol) and N-pipecolyl-4-amino-5-benzyloxy-2 -Ketotetrahydrofuran (412 mg, 1.3 mmol) was dissolved in dimethylformamide and digasmethane in each milliliter and cooled to 0eC. To the cooled solution was added hydroxybenzotriazole (HOBT: 210 mg, 1.56 mmol) and 1- (3-dimethylaminopropyl) -3 · ethylcarbodiimide hydrochloride (EDC: 326 mg , 1.7 millimoles). After stirring for 18 hours, the mixture was diluted with ethyl acetate, washed with water, 10% sodium bisulfate, 10% sodium bicarbonate, and water. The organic layer was concentrated to give a crude solid, and then subjected to flash chromatography (Si02) Purified and dissolved in 94: 6: 1 (digas'methane: isopropanol: pyridine) to produce 370 mg of the title compound. iH NMR (500 MHz, CD3OD (as diastereoisomeric and geometric isomers)) &amp; 7.35 (m, 5H), 7.05 (m, 2H), 6.68 (m, 2H), 5.65 1 321-General paper gS standard (CNS) A4 size (210X297 mm) 1235157 Printed by the Shell Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ¾ 7 _ B7 V. Description of the invention (319) &amp; 5.25 ( m, 1H), 4.9-3.95 (m, 8H), 3.4-2.6 (m, 4H), 2.5-2.1 (m5 1H)? 1.98 (s, 1H), 1.9 (s, 1H), 1.85 (s, 1H ), 1.8-1.6 (m, 2H), 1.55-1.3 (m, 4H), 0.95-0.85 (m, 6H) ^ 'DStepN 彳 N-Ethylamido -Piperidinyl-4-ketobutyric acid in 100 mg of N- (N-ethylamido-tyrosinamido-valinamido-pipecoyl) -4-amino-5-methoxy To a solution of -2-ketotetrahydrofuran in 10 ml of methanol, 60 mg of Pd (OH) 2 / C was added, and the mixture was placed in a hydrogen atmosphere of a balloon. The mixture was passed through Celite, and it was reduced to a white solid. . This crude solid was dissolved in 2 ml of methanol and triturated with diethyl ether to give 26 mg of the title compound 3 [H NMR (500 MH2, CD3OD (as diastereoisomeric and geometric isomers) & 7.1 ( m, 2H), 6.7 (m, 2H), 5.2 (bi * · m, 1H), 4.8-3.6 (m, 6H), 3.2-2.5 (m, 4H), 2.5 · 2.1 · 1 (m, 1H), 1.95 (three s, 3Η), 1 · 9-1 · 3 (m, 6H), 1 · 0 · 7 (m, 6H). Κ ^ · Ν · 「Ν- 乙 醢 基- Tyrosamidine-valineamidine- (4-amyloxy) prolaminoamidine 1 Amine-4-carboxybutyric acid ° A Step · Ν- (Ν · Allyloxycarbonyl-4-amyloxy Proline sulfonyl) -3-yl-4.ketobutyric acid third-butyl hemicarbazone title compound was prepared by mixing N-allyloxycarbonyl-4-fluorenylproline and 3-amine T'-ketobutyric acid tertiary-butyl ester + Babb (TL Graybill et. Al., Abstracts of papers, 206th National Meeting of the American Chemical Society, Abstract MEDI-235. Chicago, IL. (1993)) Reaction under similar peptide coupling conditions as reported above (compounds H, C steps) • 322- (Please read the precautions on the back first

Benwa) Revision · Long French scale: S-country (CNS) A4 specification (2 丨 0X297 mm) in the middle of the week 320, 1235157 V. Description of the invention (printed by the Central Bureau of Standards, Ministry of Economic Affairs, Consumer Cooperatives, printed lR NMR ( 500 MHz, CDC13) &amp; 9.05 (br. S, lH), 7.85 (br. M, 1H), 7.4-7.2 (m, 5H), 7.15 (br. S, 1H), 6.55 (br. S, 1H ), 5.9 (m, 1H), 5.1-4.9 (br. M, 2H), 4.65-4.4 (m, 4H), 4.2 (br. M, lH), 3.75-3.5 (m, 2H), 2.75-2.55 (m, 2H), 2.5 (br · m, 1H), 2.2) (br · m, 1H) 1.4 (s, 9H)-B step · Ethyl-fluorenylamino-valpromininyl)) -3-Amino-4-ketobutyl pen was prepared as the title compound by combining N-ethyl-fluorenyl · · tyraminofluorenyl-Xianweiyi with N · IN-allyloxycarbonyl-4-; Amine group) -3-Amino I Ketobuta tertiary-butyl ester hemi-carbazone, reacted under the reaction conditions reported by compound VII, step A 3 lH NMR (500 MHz, CD30D) &amp; 7.35 -7.2 (m, 6H), 7.0 (d, 2H), 6.65 (d, 2H), 4.85 (m, 1H), 4.6-4.45 (m, 4H), 4.3 (br. M, 1H), 4.15 (m , 1H), 3.7 (m, 1H), 2.95 (m, lH), 2.75-2.6 (m, 3H), 2.35 (m, 1H), 2.1 (m, 1H), 1.9 (s, 3H), 1.4 ( s, 9 H), 0.95 (d, 3H), 0.90 (s, 3H). Step C · N- (N-Ethylamino · Lumidyl-Amine-Cyto- (4-word lactyl ^ prolyl))-3-amino-4-ketobutanoic acid N- (N-Ethyl-L-Crylamyl · · Leeminyl- (4 -Hydroxylactyl)-· Amino-Benyl Butyric Acid Tertiary-Butyl Acetate Fungaba Neck (2 70 mg) was dissolved in 10 ml of 25% trifluoroacetic acid in dichloromethane and stirred at room temperature for 3 hours. The compound was concentrated to produce a solid residue 3 residue solution in 10 ml of a methanol: acetic acid: 37% formamidine (3: 1: 1) mixture, and stirred at room temperature for 丨 hours. Drop 323 This paper is applicable to the Chinese National Standard (CNS) A4 gauge (2 丨 0X297 mm) (please read the precautions on the back page first to write this page) ^ 1.

• IT

1235157 A7 B7

V. Description of the invention (321 compound was rolled and the resulting residue was purified by flash chromatography (Si0j, dissolved in dichloromethane / zyme / gallic acid (100: 5: 0.5)) to produce 37 mg of the title compound, $ NMR (500 MHz, CD30D (a non-parastilbene isomeric mixture as a 1: 1 hemiacetal)) &amp; 7.4-7.25 (m, 5H), 7.0 (d, 2H) , 6.65 (d, 2H), 4.65-4.05 (m, 7H), 3.75-3.4 (m, 2H), 3.05-2.3 (m, 5H), 2.2-1.95 (m, 2H), 1.90 (s, 3H) , 1.0 (d, 3H), 0.95 (d, 3H).

45 44 (Please read the back of the first: V 〖Impact wmpk page）

46

* 1T (a) X = 〇 (b) X = H2 (IS, 9S) 6,10-diketo-octahydro-9- (3-phenylpropylamido) · 6Η · , 24] [1,2] Diazapyridine-1-carboxylic acid Third: Butyl ester (4 乜).

(IS, 9S) 9-Amino-6,10-diamidino-octahydropyrido [l, 2-a] [l, 2] Digas heterocarboxylic small tert-butyl ester (690 mg ; 2.32 millimoles; GB 2128984) in a solution of No. 2 (16 ml) and water (4 ml), add -324 at 0 ° C. This paper is suitable for China 3 national standard (CNS) A4 specifications. (2 丨 0X297 male 'change)

Printed by the Shellfish Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ------ 1235157 A / B7 V. Description of the invention (322) Guli sodium bicarbonate (292 mg; 3.48 mmol) is added dropwise Chlorine (470 mg: 2.78 mmol) 3 mixture was stirred at room temperature for 2 hours, then more sodium bicarbonate (200 mg; 2. # mmol) was added and 3.phenylpropane Chlorine (丨 ⑼mg; 0.6 mmol) ° C The mixture was stirred at room temperature for 2h, diluted with ethyl acetate (50 ml), washed with saturated hydrogen chloride (2 x 25 ml), and then 137 Dry (MgS04) and concentrate the 3 residues for flash chromatography (0-50% ethyl acetate / chloroform) and finally triturate with acetic acid to crystallize. S60 mg (86%) of white solid nip. 137. -138T; [a] D23-95.1 ° (c 0.549, CH2Ci2); IR (KBr) 3327, 1736, 1677, 1664, 1536, 1422, 1156; lH NMR (CDC13) &amp; 7.24 (5H, m), 6.50 (1H, d, J = 7.5), 5.24 (1H, m), 4.90 (1H, m), 4.60 (1H, m), 3.44 (1H, m), 2.93 (2H? M)? 2.84 (lH, m ), 2.64 (1H, m), 2.54 (2H, m), 2.26 (2H, m), 1.70 (4H, m), 1.70 (9H, s), MS (FAB, m / z): 43 0 (NT + 1), 374, 242, 105, 91,. The consumer cooperation of Zhongfu · Sarate Bureau of Chaoji Ministry. Du Yinli (please read the precautions on this page first) (IS, 9S) Octahydro-10-fluorenyl-9 · (3-benzylpropionyl) -6H · ^ ρ well- [l, 2-a] [l, 2] diaza leather-dicarboxylic acid Tri-butyl ester (44b) is prepared like (44a) from (1S, 9S) 9-amino-octahydro-10-keto-6H-dapyrono [l, 2-a] [l, 2] diazepine Tertiary-1-butylcarboxylic acid (Attwood et al., J. Chem. Soc. Perkin 1, pp. 101 1-19 (1986)), yielding 810 mg (81%) of colorless treatment ^^^ 33.53 (c 0.545, CH.Cl ^; IR (film) 3334, 2935, 1737, 1728, 1659, 1642; lH NMR (CDC13) &amp; 7.24 (5H, m), 6.75 (1H, d, J = 6.7), 5.27 (1H, m), 4.92 (1H, m), 3.39 (1H, m), 3.03 (4H, m), 2.55 (3H, m), 2.33 (1H, m) , 2.17 (1H, m), 1.80 (5H, m), 1.47 (9H, s), 1.39 (1H, m) e MS (FAB, m / z): 416 (M ++ l), 360, • 325- ( CNS) (210X297 / ^) M Printed by the Consumer Cooperatives of the Central Bureau of the Ministry of Economic Affairs of the People's Republic of China 1235157 B7 V. Invention Description (323) 211, Η3, 97. (15,95) 6,10-Dikisyl-octazine-9- (3-Hydroxybenzyl) -611-: 7 Answers [1,24] [1,2] Diazabenzyl -1-Chinic acid (45 &amp;). P- (15,9,6,10-diketo-octahydro-9- (3 · phenylpropionamido) · 6Η-dapyrido [l, 2-aHl, 2] diazepine-bu Tris (4-a) tetracarboxylic acid (800 mg; 1.863 mmol) was added to a solution of anhydrous dichloromethane (5 ml) at 0 ° C. Trifluoroacetic acid (5 ml) was added. The solution was at room temperature. Allow to fall for 3 hours and concentrate. Add anhydrous B shoes (10 ml) to the residue and remove under empty space. This process is repeated three times to form a crystalline solidification. The solid is ground with ether and filtered to produce 590 mg (85 %) Of white crystalline solids: π · ρ · 196 · 197 · 5 × :; [Pan] D23-129.5. (C0.2, CH3〇H); IR (KBr) 3237, 1729, 1688, 1660, 1633 , 1574, 1432, 1285, 1205; lR NMR (CD3OD) &amp; 8.28 (1H, d, J = 7.4), 7.22 (5H, m), 5.32 (1H, dd, J = 5.9, 2.9), 4.75 (1H , m), 4.51 (1H, m), 3.50 (1H, m), 3.01 (1H, m), 2.91, (2H, m), 2.55 (2H, m), 2.29 (3H, m), 1.95 (2H , m), 1.71 (2H, m). Analysis of the calculation of C19H23N305: ，: C, 61.12; H, .6.21; N, 11.25. Measured 値: C, 60.80; H, 6.28: N, 10.97. MS (FAB, m / z) 374 (M ++ 1), 242, 105, 91. (1S, 9S) Hydrogen-10-keto-9- (3-phenylpropanamido) -6H-daphtho [1,2-a] [l, 2] diazapyridine-carboxylic acid (45b). Preparation From (IS, 9S) octahydro-10 · keto-9- (3-phenylpropanylamino) -6 ^ · ^ α wells [l, 2-a] [l, 2] diazabenzene- 1-¾ acid tert-butyl ester (44b), produced by the method described in compound '45a, yielding 657 mg (96%) of 45b as a crystalline solid: mp.l98-202eC; [PAN] d23-86.23 (c 0.5, CH3OH); IR (KBr) 3294, 2939, 1729, 1645, 1620, 1574, 1453, 1214; lR NMR (CD3OD) &amp; 7.92 (1H, d, J = 7.9), 7.20 -326-this Paper reel size applies to China National Standard (CNS) A4 (2 丨 OX 297 mm)

A7 B7 1235157 V. Description of the invention (324) (5H, m)? 5.29 (1H? M), 4.90 (1H, m), 3.47 (1H, m), 3.08 (2H, m), 2.90 (2H, m) , 2.55 (3H, m), 2.36 (1H, m), 1.81 (5H, m), 1.43 (2H, m). MS (FAB, m / z) 360 (M ++ 1), 2 price, 143, 9 [3S, 2R, S, (1S, 9S)] N- (2-benzyloxy-5-one tetrahydrofuran-3-yl ) · ， 1 ·· Diketo-octahydro-9- (3 · phenylpropionamido) -6Η-daphthoH, 2-a] [l, 2] diazepine-1- Carboxamide (46a). P- (IS, 9S) 6,10-diketo-octahydro-9- (3-phenyl-propanamido) -6H-thalco [l, 2-a] [l, 2] diazepine Hexa-1-carboxylic acid (45a) (662 mg; 1.737 mmol) in a solution of anhydrous digas methane (9 ml) and anhydrous dimethylformamidine (3 ml). (Triphenylphosphine) palladium (30 mg) and (3S, 2R, S) -3-allyloxycarbonylamino-2-fluorenyl-5-fluorenyltetrahydrooctane (Chapman, Bioorg · Med Chem Lett 丄, 2, pp. 613-18 (1992)) (568 mg; 1.95 mmol) and tri-n-butyltin hydride (1.19 g: 4.09 mmol) was added dropwise. Add 1-hydroxy-benzotriazole (479 mg, 3.546 mmol) to the mixture, and cool the mixture to add 1- (3. Diamidopropyl) -3-ethylcarbodiimide hydrochloride (408 mg: 2.128 mmol). The mixture was stirred at room temperature for 3.25 hours, diluted with ethyl acetate (50 ml), washed twice with dilute hydrochloric acid (20 ml), washed twice with planed sodium bicarbonate (20 ml), and washed with brine. The oil which was re-dried once (MgS04) and concentrated β was purified by flash chromatography (0-100% ethyl acetate / aerosol) to yield 810 mg (81%) of 46a, which was an anomer mixture: mp · 92 -94eC; IR (KBr) 33 1 1, 1791, 1659, 1651, 153.6; lH NMR (CDC13) &amp; 7.49, 6.56 (1H, 2d, J = 6.7, 7.8), 7.29 (10H, m ), 6.37, 6.18 (1H, 2d, J-7.7, 7.6), 5.56, 5.34 (1H, d, s, J = 5.2), 5.08-4.47 (6H), 3.18-2.80 (5H), 2.62-2.28 ( 5H), 2.004.53 (5H). MS (FAB, m / z), -327-This paper size is applicable to Chinese National Standard Li (CNS) A4 size (210X297 mm) '(Please read the notes on the back before filling in the page) 4 Order the Central Ministry of Economic Affairs Printed by the Consumer Goods Cooperative of the Zhuanju Bureau ¾ ΐ ¾Industry Consumers' Cooperative of the Ministry of Economic Affairs of the People's Republic of China Du Yin ¾ 1235157 Λ7 B7 V. Issue 0 Instructions (325) 563 〇Γ + 1), 328, 149, 9b [3S, 2R, S, (IS, 9S)] N- (2 · benzyloxy0-ketotetrahydrofuran-3-yl) octahydro-10-keto-9- (3-phenylpropanamido) -61 ^ Da [1,; ^ 4] [1,2] diazapyridine-Bus SS amine (46b), prepared from 45b, can produce 790 mg (96%) of glass by the method described in 46a Status: mp 58-6 (TC; IR (KBr) 3316, 2940, 1793, 1678, 1641, 1523, 1453, 1120;! H NMR (CDC13) &amp; 7.28 (10H, m)? 6.52, 6.42 (1H, 2d, J = 7.2, 7.1), 5.53, 5.44 (1H, d, s, J = 5.2), 5.35 (1H, m), 4.6-4.9, 4.34 (4H, m), 3.1-2.8 (6H, m) , 2.6-2.1 (7H), 1.95-1.05 (5H). MS (FAB, m / z), 549 (M + + 1), 400, 310, 279, 91,

[jS (1S, 9S)] j- (6,10 -—copper-based octadecane-9- (3 · base two Ss neck bases) -6H-Dalaiyi [l, 2-a] [l, 2] Diazapyridine-p-carboxamido) -4-ketobutyric acid (47a). [3S, 2R, S, (IS, 9S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-octahydro-9- (3 · benzene Propyl amidino) -6H-da- [1, 2-a] [1,2] diazapyridine-1-carboxamide (46a) (205 mg: 0.364 mmol), 10% Pd / c (200 mg) and methanol (20 ml) were stirred at atmospheric pressure under hydrogen for 5 hours. The mixture was filtered and concentrated to give 154 mg (90%) of a glassy glass: mp. 116-118eC; [PAN] D23-140. (C 0 · 1, CH3OH); IR (KBr) 3323 (br), 1783, 1731, 1658, 1539, 1455, 1425; NMR (CD3OD) &amp; 7.21 (5H, m), 5.17 (1H , m), 4.73 (1H, m), 4.50 (2H, m), 4.23 (1H, m), 3.38 (1H, m), 3.06 (1H, m), 2.91 (2H, m), 2.73-2.1 8 (6H, m) and 2.01-1.59 (5H, m). Analysis of C23H27N4O7 + Η] 〇: C, 56.32; Η, 6.16; N, 11 · 42 3 ear Test: C, 56 · 29; Η, 6.11; Ν, 11.25. MS (FAB, m / z) 473 (Μ + + -328- Paper scale, Ning National Standard (CNS) A4 connection (2 丨 0X297 mm) (Please read the precautions before reading the back ® This page) Order 1235157-A / B7 V. Description of the invention (327) Meaning 2- (3-benzyloxytantyl-1,2-dihydro-2-keto-1-pyridyl) ethene 3-Amino-5- (2,6-dichloro-fluorenyloxy) 4-keto-pentanoic acid tert-butyl ester (56a). Acetic acid (55a) (WO 93 21213) in THF ( 2 ml) at room temperature and treated with 1-benzylbenzotrimethylene (60 mg, 0.448 mmol) and difluorenyl propyl-3-ethyl diimine hydrochloride (47 Mg '(.246 millimolar) treatment 3 5 minutes later add water (2 drops) and continue stirring for 20 minutes 3 add bis (triphenylphosphine) period (Π) gas (6 mg) 缮 3- (allyl Oxyamino group) · 4 · keto-5- (2,6-dichlorosulfanyl-oxy) tert-butyl valerate (W0 93 16710) (103 mg, 0.224 mmol) In THF (1 ml). Tributyltin hydride (0.09 ml '0.336 mmol) was added dropwise at room temperature over 1 hour. The mixture was drained for another 3 hours and poured into ethyl acetate, 1M HC1 ' NaHC03 aqueous solution 'brine washed green, dried on MgS04 and concentrated in air. The residue was triturated with pentagon and discarded the supernatant. The remaining solid was purified by flash chromatography (50% ethyl acetate / hexane) to generate the title Compound 92 mg (63%) as a colorless oil: [a] D29-29.6 ° (c 1.1, CR2C \ ^ IR (film) 3377, 3365, 3332, 3312, 1733, 1691, 1650, 1599, 1515, 1366 , 1261, 1153, 1068, 747;! H NMR (CDC13) &amp; 8.09 (1H, d, J = 6.8), 7.84 (1H, s), 7_58 (1H, d, &gt; 8 · 3), 7.33 (8H, m), 7.02 (1H, dd, J = 6.9, 1.7), 6.33 (1H, t, J = 7.2), 5.20 (2H, s), 5-12 (2H, m), 4.89 (1H, dt), 4.65 (2H, m), Shellfish Consumer Cooperation of the Central Bureau of Standards, Ministry of Economic Affairs, Du Yin ¾ 2.80 (2H, m), 1.38 (9H, s). Ν · 2 · (6-fluorenyl-1,2 · diargin-2-one · 3 · ((phenylphenylpropionyl) amino-1-pyridyl) ethoxy-3-amino- 5- (2,6-Gas; oxy) -4-fluorenyl-valeric acid tert-butyl ester (56b), prepared by the method described in (56a), can produce the title compound (66%) as a colorless oil: IR (thin film) 3364, 3313, 1738, 1688, 1648, 1600, -330-This paper is used in China Standard family breeding (CNS) A4 size (2 Shu 0X297 mm), 1235157 A7 B7

56 V. Description of the invention (328) 1566, 1514, 1433, 1369, 1254, 1152; XH NMR (CDC13) &amp; 8.40 (1H, d, J 7.6), 8.30 (1H, s), 7.28 (13H, m) , 6.20 (1H, d, J = 7.6), 5.12 (2H, q), 4.86 (1H, m), 4.65 (2H, q) 9 4.06 (2H, s), 3.07-2.61 (6H, m), 1 39 (9H, s). n Read the notes on the back first

1 «page I O (a) PhCH2 cA o (b) PhCH2CH2

H

H order

Ν-2- (3 · benzyloxycarbonylamino-1,2-dihydro-2-keto-1-pyridyl) ethynyl-3 · amino- 5- (2,6-monochlorofluorene Alkoxy) -4 · benzyl-valeric acid (57a; OJ 3 §i 56a (210 mg, 0.356 mmol) in digas methane (0.5 ml) was cooled to cTC, followed by trifluoroacetic acid ( 0.5 ml), stirred and warmed to 20 eC for 30 minutes. The solution was evaporated to dryness under reduced pressure, redissolved in methylene chloride and rolled 3). The residue was triturated with ethyl acetate and diluted with acetamidine to give the title compound 162 mg (85%) as a colorless solid: 111 | 165-81 (decomposed); [PAN] 023-38.8. (c 0.1, CH3〇H); IR (KBr) 3332, 3275, 1723, 1658, 1649, 1597, 1581, 1562, 1526, 1432, 1385, 1258, 1218, 1206; NMR (d6- DMSO) &amp; 8.96 (1H, d, J = 7.3), 8.34 (1H, s), 7.85 (1H, dd, 331 · Chinese paper standard (CNS) A4 specification (2 丨 0X297))

W3C Industrial and Consumer Cooperation of Central Ministry of Chaoji Du Yinzhong 1235157 A7 _ _____B7 V. Description of Invention (329) J = 7.3), 7.58 (3H, m), 7.35 (5H, m), 6.29 (1H, t, J = 7.3), 5.26 (2H, m), 5.15 (2H, s), 4.69 (3H, m), 2.75 (2H, m) ^ Analysis of C27H23N3O9CI2's epistaxis: C, 53 · 66; H, 3.84; N, 6.93 3 Measured 値: C, 53.36; Η, 3.90; N, 6.81-MS (+ FAB); 604 (M + + 1), 285, 241, 195, 173, 149, 91. N-2- (6- + yl-1,2-dihydro-2-germanyl-3- (3-phenylpropionyl) amino-specific aceto) ethoxy-3-cavity-5 -(2,6-Difluorohenyloxy) -4-tunyl-arsinic acid (57b: R), prepared by 57a method, can produce the title compound (78%) as colorless crystals: mp 116- 12 (TC (decomposition): [yD26-41.1. (C 0.1, CH3OH); IR (KBr) 3299, 1739, 1715, 1689, 1666, 1645, 1598, 1563, 1518, 1432, 1209, 1151; lH NMR ( d6-DMSO) &amp; 9.24 (1H, s), 8.88 (1H, d, J = 7.6), 8.18 (1H, d, J = 7.7), 7.60 (3H, m), 7.26 (10H, m), 6.06 (1H, d, J = 7.7), 5.23 (2H, ABq), 4.69 (3H, m), 3.93 (2H, s), 2.78 (6H, m). Analyze C35H31N308C12. Calculation of H20: C, 59.16; H, 4.68; N, 5.91. Measured 値: C, 59.38; Η, 4.53; N, 5.84. MS (+ FAB); 694, (C1 = 35, 37), ( M ten +1); 692 (C1 = 35, 35), (NT + 1). -332- This paper uses the Chinese national standard (CNS M4 specification (2 丨 0X297 mm) 1235157 A7 B7 V. Invention Description (330) 〇

A

COjtBu Tj

6S

OH 69 a 50:50

Employees' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs

(a) R1 = OCH3 / R2 = H (b) R1 = H, R2 = 〇CH3 · 7-methoxybenzobenzoxazole (65a). A mixture of 2-nitro-6-methoxyphenol (2.62 g, 15.5 mmol) (EP 333 176) and 10% Pd / c (130 mg) in ethanol (50.0 ml) was stirred under H in air at 75 minute. The mixture is passed through Celite® -333 · This paper is ft-size universal Chinese National Standard (CNS) M size (210X297 mm) 1235157 A7 B7___; __ 5. Description of the invention (331)

It was then treated immediately with para-benzenesulfonic acid (32.0 mg) and triethyl orthoformate (6.45 ml, 38.S mmol), and then heated under reflux in the atmosphere of N2. After 20 hours, p-toluene acid (30.0 mg) and triethylorthopic acid (6.45 ml, 38.8 mmol) were added. After heating for a total of 44 hours, the reaction will be cooled and then reduced in air. The resulting residue was purified by flash chromatography (25:75 ethyl acetate / hexane) to give 1.97 g (85%) of the title compound as a yellow solid: mp · 28-315C; IR (film) 1629, 1497, 1434 , 1285, 1097; lH NMR (CDC13) &amp; 8.09 (1H, s), 7.40 (1H, d, J = 8.0), 7.28 (IHj, J = SO), 6.89 (1H, d, J = 8.0), 4.02 (3H, s); 13C NMR (CDC13) &amp; 152.84, 145.82, 142.50, 139.99, 125.75, 1 13.42, 108.80, 56.97. Analysis · 0 · 1Η20; C, 63 · 65; Η, 4.81; N, 9.29: Measured 値: C, 63.43, H, 4.88, N, 9.05. M.S. (ten FAB); 150 (ΓνΓ + I),

4-Methoxybenzyl, azole (65b). Suspension of 4-hydroxybenzoxazole (2.00 g 14.8 mmol) (Musser et al., J. Med. Chem., 30, pp. 62-67 (1987)) in acetone (80.0 ml) Anhydrous K2C03 (2.25 g, 16.3 mmol) was added to the solution followed by iodopanane (1.38 ml, 22.2 mmol). The reaction was heated at reflux under N2 for 4.5 hours, and then filtered and emptied to reduce the residue to a crude product 3. Purification by flash chromatography (25:75 ethyl acetate / hexane) yielded 2.0 g (91%) of the title compound as a white crystalline solid: mp 72-74ec; IR suitable year t5t · * 隼 马The paperwork of consumerism and cooperation is printed, please read the note on the back, and then fill out this page) (KBr) 3089, 1619, 1610, 1503, 1496, 1322, 1275, 1090, 1071, 780, 741; lH NMR ( CDC13) &amp; 8.02 · (1Η, s), 7.32 (1H, t, J = 8.0), 7.18, (1H, d, J = 8.0), 6.81 (1H, d, J = 8 〇), 4.04 (3H, s) 3 analysis CsH7N02: C, 64 · 42; H, 4.73; N, 9.39. Measured 値: C, 64.40; H, 4.84; N, 9.31; m / 2 (El) 149 (M ++ 1, 1〇00 / 0) 〇 • 334-The paper standard is universal Chinese § family standard twin (CNS) A4 specification (210X297 male cage) 1235157 Λ7 37 V. Description of invention (coffee) (3S, 4R, S) N- (dilute propoxyfluorenyl) -3-amino super group-4- (2- (7- 曱Oxybenzo 57 oxalyl)) tert-butyl butyrate (66a). For 7-methoxyqin, No. 65a (548.6 mg '3.68 mmol) was added to anhydrous thf (18.5 $ liters) at -789C, & the solution was added dropwise ι · 56M n-butyl Catch / Hex Burn (2.47 ml '3.86 mmol) can produce a yellow solution. After stirring for 20 minutes, an anhydrous MgBr20Et2 (1.045 g, 4.05 mmol) was added as a solid solution. The resulting heterogeneous mixture was warmed to -453C and stirred for 15 minutes. The reaction mixture was re-cooled to -78 &quot; C, and a solution of (s) -Alloc-Asp (tertiary-butyl) H (946.4 mg, 3.68 mmol) 4Thf (18.5 ml) was added dropwise. The reaction was defended at -78 ° C for 30 minutes, heated to 6 ° C and then taught for 1 hour. 3 The resulting heterogeneous reaction was warmed to room temperature and stirred for 16 hours. ) It was quenched again, after which the THF was removed under a vacuum and the resulting aqueous residue was extracted with a messy beaker (X 6). The combined extracts were washed with brine, dried (MgS04), filtered and decanted to yield is-grams of crude product.伕: Flash chromatography (40:60 ethyl acetate / hexane) produces ι · 2ΐg (81%) of the title compound. It is oily and is a mixture of C-4: diastereoisomeric compounds: iR (CH, Cl2) 3425, 2983, 1725, 1504, 1290, 1 157, 1101; [Η NMR (CDC13) & 7.35-7.19 (2H, m), 6.89-6.81 (1H, m), 6.00-5.57 ( 2H? M), 5.32-5.05 (3H, m), 4.68-4.35 (3H, m), 4.01 (3H, s), 2.86-2.59 Printed by the Shellfish Consumer Cooperative of the Central Bureau of the Ministry of Economic Affairs (2H, m) , 1.45 (9H, s), 1.41 (9H, s); 13C NMR (CDC13) &amp; .171.18, 171.09, 165.80, 165.30, 156.71, 156.60, 145.65, 142.76, 142.71, 140.82, 140.72, 133.23, 125.81, 125.72 , 118.41, 1 18.21, 113.07, 112.87, 108.95, 82.16, 70.28, 69.98, 66.52, 66.39, 57.03, 52.57, 52.29, 37.83, 36.86, 28.65, analysis-335- This paper uses the Chinese national rubbing plum (CNS) Rong 4 Old Case (2! 〇χ 297 mm) 1235157 Λ: _ Β7 _______ i. Description of the invention (if) (please read the precautions of the back of the cloud before filling this page) C20H26N2O7 · 〇 · 6Η2〇: C, 57 · 57; Η, 6.57; N, 6.72. Measured 値: C, 57.49, Η, 6.34, N, 6.60 3 M.S. (+ FAB); 407 (M &quot; + 1); 351, 307, 154. (3S, 4R, S) N- (allyloxycarbonyl) -3-amino-4-hydroxy-4- (2- (4-methoxybenzoxazolyl)) butyric acid tert-butyl ester (66b), prepared according to the method described in 66a, which can produce 1.29 g (68%, 26% of the recovered starting material) of the title compound as an oily C-4 non-isomeric stereoisomeric mixture: IR (CHflJ 3400, 1725, 1625, 1505, 1369, 1354, 1281, 1263, 1226, 1 158, 1092, 1048; lH NMR (CDC13) &amp; 7.34-7.24 (1H, m), 7.16 (1H, d, J = 8.2 ), 6.79 (1H, d, J = 7.9), 6.00-5.50 (2H, m), 5.30-5.05 (3H, m), 4.70-4.35 (4H, m)? 4.02 (3H, s), 2.90-2.45 (2H, m), 1.45-1.41 (9H, 2 xs) 0 Analysis of the calculation of C20H26N20.7 · 0.42 20: C, 58 · 07; H, 6.53; N, 6.77. Found: C, 58 · 09 H, 6.41; N, 6.63. MS (+ FAB); 407 (NT + 1.88%); 351 (100). (3S, 4R, S) N- (N-ethenyl- (SH 〇-Third-butyl-amidinofluorenyl)-(S) -valineamino- (S) -propylaminofluorenyl) -3-amino-4-hydroxy · 4- (2- (7-methyl Oxybenzoxazolyl)) tert-butyl butyrate (67a) β-benzoxazol 66a (481.9 mg, 1.19 mmol) and Ac-TyK ^ uVVal-Ala-OH (586.3 mg, ι · 3 〇mmol) Add bis (triphenylphosphine) palladium (II) gasification (18.0mg) to the stirred solution of methane (3.5ml) and DMF (3.5ml), and then Tributyltin argon (0.80 ml, 2.96 mmol) was added dropwise. 3 Hydroxybenzotriazole (320.4 mg, 2.37 mmol) was added and the mixture was cooled to 0 eC. 1-ethyl · 3- [ 3- (dimethylamino) propyl] carbodiimide hydrochloride (278.2 mg, 1.42 mmol), and the mixture was warmed to room temperature and stirred for 16.5 hours. The reaction was ethyl acetate-336 ·, The paper music scale is applicable to the Chinese National Standard (CNS) A4 specification (2I0X297 mm)! 235157 A1 --- V. Description of the invention (Negotiation) The ester is diluted and washed twice with 1M sodium hydrogen sulfate to plan and condense. The acid and hydrogen were washed twice with water and brine. The organic layer was dried (MgS04), filtered and reduced in volume to yield 2.0 g of crude product. Flash chromatography (95: 5 dimethane / methanol) yielded 844.0 mg (94%) of the title compound as a white solid: mp 2 05 × :; IR (ΚΒγ) 3399, 3304, 2977, 1729, 1643, 1506, 1367, 1290, 1161; [Η NMR (d6-DMSO) &amp; 8.24-7.78 (4H, m), 7.43-7.32 (2H, m), 7.23 (2H, d, J = 8.5), 7.16-7.07 (1H, m), 6.93 (2H, d; J = 8.5), 6.52, 6.40 (1H, 2 xd, J = 5.5, J = 5.0), 5.0 · 3, 4.78-4.49, 4.45-4.16 (5H, brt, 2 xm), 4.05, 4.04 (3H, 2 xs), 3.08-2.35 (14H, m), 2.11-1.89 (1H, m), 1.83 (3H, s), 1.49-1.32, 1.15, 1.0-0.81 (27H, s, 2 xm, J = 7.0); 13C NMR (d6-DMSO) &amp; 175.55, 175.18, 173.88, 173.75, 173.05, 169.23, 157.28, 148.55, 146.16, 143.21, 136.63, 133.55, 128.87, 127.17, 1 15.78, 1 1 1.92, 84.02, 81.50, 71.40, 61.15, 60.05, 57.79, 53.39, 51.62, 43.76, 40.52, 34.58, 32.52, 31.60, 26.35, 23.1 1, 22.71, 21.76 e Analysis of C39H55N5O10 · 0.5H2〇値: C, 61.40; H, 7.40; N, 9.81. Found 値: C, 61, 43; H, 7.31; N, 9.07. M.S. (+ FAB); 754 (M ++ 1); 698, 338, 267. (3S, 4R, S) N- (N-Ethyl- (S)-(0-Third-Butyl. Lumen Proyl)-($) · Aminopyridyl- (S) · Proton Pyridyl) · 3 · Amino-4 · Ethyl-4- (2- (4-methoxybenzoxazolyl)) tert-butyl butyrate (67b), prepared by the method of edge 67a generate

I. 05 g (94%) of the title compound as a finely divided white powder: mp 210-213 * C (dec); IR (KBr) 3284, 2977, 1736, 1691, 1632, 1536, 1505, 1452, 1392, 1367, 1258, 1236, 1161, 1091; NMR (d6- • 337- This paper ft scale applies to China National Standard Plum (CNS) A4 specification (210X297 mm) Read the note on the back

Printed by the Ministry of Economic Affairs, Central Sample Mou Bureau, Shellfish Consumer Cooperative «. 1235157

A

B. Description of the invention (male) DMSO) &amp; 8.20-7.75 (4H, m), 7.40-7.10 (4H, m), 7.00-6.80 (3H, m), 6.45, 6.34 (1H, 2 xd, J = 5.3, J = 5.0), 5.00-4.10 (5H, m), 4.00, 3.99 (3H, 2 xs), 3.00-2.25 (4H, m), 1.95 (1H? M), 1.78 (3H, s), 1 39-0 · 80 (27H, m). Analytical calculations for C39H55N5O10, 0.5H20: C, 61.40; H, 7.40; N, 9.18 3 Found: C, 61.58; H, 7.38; N, 8.91. M.S · (+ FAB); 754 (M + + 1, 30%); 72 (100). (3S) N- (N-Ethylfluorenyl- (S)-(〇-Third-butyl-tyrosinamino)-(S) -Valamine (•) (propyl) amino) -3 -Amino-4- (2- (7-methoxybenzoxazolyl))-4-ketobutyric acid tert-butyl ester (68a). Add Dess-Martin reagent (1.082 g, 2.55 mmol) (Ireland et al., J. Org. Chem., 58, p. 2899 (1 993); Dess et al., J. Org. Chem. 48, pp · 4155-4156 (1983)) to 67a (641.0 mg, 0.85 mmol) in a stirred suspension of dioxane (46.0 ml). The resulting mixture was stirred for 1 hour and then partitioned into saturated Sodium thiosulfate: The organic phase formed between 3 cesium and sodium bicarbonate (1: 1, 86.0 ml) and ethyl acetate (86.0 ml) was sequentially washed in the following order. Acid fishing: Penetrated post-sodium bicarbonate (1: 1), Yuhe sodium bicarbonate, and brine 3 organic phases are dried (MgS04), filtered, and reduced in volume to produce 660.0 mg of the prepared product. Flash chromatography (94: 6 digas methane / methanol) yielded 636.0 mg (100%) of the title compound as a white solid: m.p. 209eC; [a] D24-21.8. (C Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 〇16, methanol); IR (KB〇3395, 3294, 2977, 1722, 1641, 1535, 1505, 1161;! H NMR (CDC13) &amp; 8.43- 8.16 (1H, m), 7.97-7.62 (2H, m), 7.49-7.14 (3H, m), 7.08-6.95 (3H, m), 6.89-6.73 (2H, m), 5.81-5.68 (1H, m ), 5.16-4.86 (2H, m) 4.53 (1H, brt), 4.03 (3H, s), 3.16-2.84 (4H, m), 2.11-1.84 (4H, m), 1.46-1.14 (21H, • 338 -The paper scale is commonly used in the Chinese S country kneading rate (CNS). (210X 297 mm) The Central Sample Rate Bureau of the Ministry of Economic Affairs, Shellfish Consumption Cooperation · Du printed bags 1235157 Α7 Β7 5. Description of the invention (male) m), 0.92 -0.78 (6H? M); 13C NMR (CDC13) &amp; 186.28, 173.39, 171.90, 171.19, 171.03, 169.89, 156.43, 154.75, 146.32, 142.88, 140.9S, 132.31, 130.54, 126.98, 124.73, 114.95, 111.95 82.44, 78.71, 58.92, 57.20, 54.91, 53.47, 48.77, 39.43, 38.15, 32.79, 29.44, 28.60, 23.55, 20.27, 19.70, 19.34, MS (+ FAB); 752 (M + + 1); 696, 336, 265 »(3S) N- (N-Ethylfluorenyl- (S) -10) -Third-butyl-tyrosinamino)-(S) · Valamine (-)-(S) -propylamino)- 3-amino- 4- (2 · 4 · methoxybenzo &quot; oxazolyl)) · 4-ketobutyric acid third-butyl ester (68b), prepared according to the method described in ketone 68a, which can produce 420 mg (55 %) The title compound as a white solid: mp 211-213X: (dec); ["] D24-23.93 (c 0.82, methanol); IR (KB〇3277, 3075, 1723, 1690, 1632, 1530, 1506, 1392, 1366, 1269, 1234, 1 160, 1094; lH NMR (CDCi3) &amp; 8.15 (1H, brs), 7.7 (2H, brs), 7.46 (1H, t, 1 = 8.3), 7.24 (2H, d , J-8.3), 7.10 (1H, brs), 7.03 (2H, d, J = 8.3), 6.83 (3H, m), 5.74 (1H, q, J = 6.9), 5.00 (2H, m), 4.51 (1H, t, J = 7.0), 4.07 (3H, s), 3.20-2.95 (4H, m), 2.00 (4H, m), 1.42 (3H, d, J = 6.8), 1.35 (9H, s) , 1.23 (9H, s), 0.86 (6H, d, J = 6.7). M.S · (+ FAB); 752 (M + + 1, 7%); 72 (100). (3S) N- (N-Ethylfluorenyl- (S) -tyraminofluorenyl- (S) -valaminofluorenyl- (S) -propanthinomethyl) -3 · amino-4- (2- (7-Methoxybenzo "oxazolyl))-4-ketobutyric acid (69a; R). Ester 68a (600.0 mg, 0.80 mmol) at 1: 1 digas methane and three A solution of fluoroacetic acid (65.0 ml) mixture was stirred for 1 hour in 1 ^ 2 anhydrous atmosphere. The solution was reduced in air, absorbed by acetamidine and reduced again. This process was repeated 6 times to produce a crude product as a white solid. .Fast chromatography (gradient 95: 5 -339- This paper size applies to China National Standard (CNS) Α4 size (210 * × 297 mm)

1235157 Printed by the Peasant Poverty Alleviation Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ¾ Λ7 B7 V. Description of the invention (337) to 80:20 dichloromethane / methanol can produce 420.8 mg (83%) of the title compound, which is hygroscopic white solid. The product is a mixture of three isomers in CD3OD

Contains keto form (c 50%) and its epoxy-free ketone form (two isomers (c 50%) at C-4i: mp · decomposes at 150eC ·· [ubi]] 73.3.2. (C 0 · 17 ， 曱 鞟); IR (KBr) 3300, 1715, 1658, 1650, 1531, 1517, 1204; LH NMR (CD3OD) &amp; 7.46-7.19 (2H, m), 7.16-6.91 (3H, m), 6.70-6.59 (2H, m), 5.62-5.49 (1H, m), 5.00-4.72 (1H, obscurred m), 4.69-4.51 (1H, m)? 4.49-4.08 (2H, m), 4.05-3.89 ( 3H, m), 3.16-2.47 (4H, m), 2.05-1.78 (4H, m), 1.41-1.11, 1.05-0.70 (9H, 2 xm). Analyze the calculation of C31H37N501. 3H20 値: C, 53 · 67; H, 6.25; N, 10.10, measured 値: C, 53 · 76; Η, 5.56; N, 10.28. MS (+ FAB); 640 (M ++ 1); 435, 147. (3S) N- (N-Ethylfluorenyl- (S) -tyrosinaminofluorenyl- (S) -valinylfluorenyl- (S) -propylaminomethyl) -3-amino-4- (2- (4 · methoxy Benzyl α-oxazolyl))-4-ketobutyric acid tert-butyl ester (69b, S), prepared according to the method of acid 69a, which can produce 252 mg (96%) of the title compound with moisture absorption. The product is a mixture of three isomeric forms of CD30D, containing a ketone type and its epoxy-free ketal form (two different substances on C-4). The product is Single isomers in d6-DMS0: mp · 200-203O (dec ·); [ubiquitous] D24-38.0 ° (c 0.23, methanol); IR (KBr) 3289, 2968, 1718, 1713, 1658, 1634, 1548, 1517, 1506, 1461, 1453, 1393, 1369, 1268, 1228, 1174, 1092;! H NMR (d6-DMS0) &amp; 9.20 (1H, brs), 8.71 (1H, d, J = 6.2), 8.10 (2H, m), 7.83 (1H, d, J = 8.7), 7.61 (1H, t, J = 8.2), 7.46 (1H, d, J = 8.2), 7.08 (3H, m), 6.65 (2H , d, J = 8.3), 5.50 (1H, q J = 6.5), 4.50 (1H, m), 4.37 (1H, m), 4.20 (1H, m), • 340- ^ Paper scale uses China Standard (CNS) A4 size (2 丨 〇 · χ297 male bag ^ '(Xu Xianyi read the precautions on the back page)

1235157 A7 _ __ B7 V. Description of the invention · (338) 4 * 05 (3H, s), 3.09-2.77 (4H, m), 1.94 (1H, m), 1.79 (3H, s), 123 (3H, d , J = 7.0), 0 · 82 (6H, m). Analysis for C3iH37N5O10 · UHjOX, 55 · 85; H, 6.05; N, 10.51. Found 値: C, h.21; Η, 5.69; N, 10.13. M.S · (+ FAB); 640 (M + + 1, 22%); 107 (100).

(Please read the precautions of S before filling out this page) Printed by Zhengong Consumer Cooperative, Central Sample Rate Bureau

J (S)-(dilute acryloyl group) amino-4-[(2,6-dilactate-leather-base # -2-yl] -4 (R, S) -hydroxy-butyric acid -Butyl ester (99). 5- (2,6-difluorophenyl) humidazole (2.71 g, 12.7 mmol; prepared by a method similar to Tet · Let · 23, ρ. 2369 Π972) in A solution of tetrahydrofuran (65 ml) was cooled to -78 eC under a nitrogen atmosphere. To this solution was added n-butyllithium (1.5 M in hexane, 8.5 ml, 13.3 mmol) and stirred at -781 for 30 minutes. Bromide magnesium bromide (3.6 g, 13.9 mmol) was added and the solution was allowed to warm to -45 ° C for 15 minutes. The reaction was cooled to -781, and then aldehyde 58 (3.26 g, 12.7 mmol) was added dropwise: Graybill et al., Int. J. Protein Res., 44, p. 173-182 (1993)) in tetrahydrofuran ( 65 ml) e reaction was stirred for 25 minutes, then it was warmed to -40eC and stirred for 3 hours, and then at room temperature for 1 hour. The reaction was quenched with 50/0 NaHC03 (12 mL) and stirred for 3 hours. Tetrahydrofuran was removed under aerosol, and the resulting residue was extracted with dioxane. The organic layer was extracted with a caesium and gasification fishing solution, dried over magnesium sulfate, filtered and concentrated to give 6.14 g of the title compound. Purified to produce 4 79 g (80%) 99:! H NMH -341-The paper scale is applicable to the US standard (CNS) A4 specification (210X29 * 7)

1235157 Α7 Β7 V. Description of the Invention (w) (CDCI3) &amp; 1.45 (s, 9H), 2.7-2.5 (m, 2H), 2.8 (dd, 1H), 4.2, 4.4 (2 xd, 1H), 4.7- 4.5 (m, 3H), 5.35-5.1 (m, 2H), 5.6, 5.7 (2 xd, 1H), 6.0-5.8 (m, 1H), 7.2 (m, lH), 7: 3 (m, 1H) , 7.4 (m, 2H). (# .Notes on the back of the first reading first benwa)

3l R ― H b R = COCH2CH2Ph c R = CH2Ph

Printed by the Male Workers Consumer Cooperative of the Central Bureau of the Ministry of Economic Affairs of China [2-keto-3 (3)-(3-phenylpropanamido) -2,3,4,5-tetra-argon-benzo [1] ] [1,4] Diazafluoren-1-yl] fluorenyl acetate (104a). Anhydrous argon chloride effervesces to (3 (S) -third-butoxycarbonylamino-2-keto-2,3,4,5-tetrahydro · benzo [b] [l, 4] diazepine Hetero-1-yl) methyl acetate (103,1 g, 2.8'6 mmol) in 25 ml of ethyl acetate solution for 2 minutes, and then stirred at room temperature for 1 hour. Evaporation of the reaction can generate 2-keto-3 (5) -amino-2,3,4,5-tetrahydrobenzo [1]] [1,4] diazepine-1-ylfluorenyl acetate Hydrochloric acid, white solid. Hydrochloride and arginized cinnamic acid (0β47 -342- This paper is suitable for Chinese national standards (CNS M4 specification (210 × 297mm)) 1235157 Α7 Β7 Shellfish consumer cooperation of the Central Standards Bureau of the Ministry of Economic Affairs · Du Yin Instructions (340) grams, 3.15 mmoles are dissolved in 20 ml of diamidine, and cooled to. Diisopropylethylamine (1 ml, 5.72 mmoles) is added to the solution, then N-perbenztriazole and 1 · (3 · dimethylaminopropyl) -3-ethyl | carbodiimide according to the salt 3 times; I: After stirring at room temperature for 18 hours, the mixture starts at 15 0 The organic layer was diluted with 10 mL of ethyl acetate, washed with 10% sodium bisulfate, 10% sodium bicarbonate, and brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and evaporated to form a crude solid. Analysis and purification with 7: 3 ethyl acetate / dichloromethane produced 600 mg (55%) of the title compound as a white solid. 1H NMR (CDCi3) &amp; 7.3-6.85 (9H, m), 6.55- 6.0 (1H, d), 4.88-4.82 (1H, m), 4.72-4.65 (1H, d), 4.28-4.22 (1H, m), 3.95-3.9 (1H, m), 3.78 (3H, s), 3.65 (1H, br, s), 3.28-3.2 (1H, m), 2.95-2.84 (2H, m), 2. 55-2.4 (2H, m). (3〇 (3-phenylpropylamido) -2-one-2,3,4,5-tetrahydrobenzo 0] [1,4] diaza Fluoren-1-yl) acetic acid (105a) (3 (S)-(3-phenylpropionamido) -2-one-2,3,4,5 · tetrahydro-benzo [b] [1,4] Diazapyridin-1-yl) methyl acetate (104a) was dissolved in 90% methanol. Lithium hydroxide-hydrate was added to the reaction, and the reaction was stirred at room temperature for 4 hours. Reaction Evaporate under vacuum to form a white solid. This was dissolved in 20 ml of water, acidified to pH 5 and extracted with ethyl acetate to yield 304 mg (88%) of the title compound as a white solid. 111% 11 (〇0 ( : 13) &amp; 7.5- 6.9 (11Η, m), 4.92-4.8 (1H, m), 4.7-4.58 (1H, d), 4.38 -4.25 (1H, d), 3.88-3.78 (1H, m), 3.45-3.25 (1H, m), 3.05-2.85 (2H, m), 2.55-2.45 (2H, m). 4-keto-3 (S)-{2- [2-keto-3 (SH3- Phenylpropylamido). 2,3,4,5-tetraargon-benz [b] [l, 4] digasheterophenyl-1-ylethoxyamino} butanoic acid (106a). Ν · [1- (2- -343 · (Please read "Precautions on Back" -Kl ^ l

• IT

This lore scale applies to China's National Standards (CNS) A4 (210X297 mm) 1235157 Λ7 Β7 Duo Yinzhong, Central Government Bureau of Ministry of Economic Affairs, Consumer Affairs Cooperation, Du Yinzhong V. Invention Description (Correction) Yeoxy-5- Syltetrahydrog-pentan-3-ylamine, fluorenyl, fluorenyl) _2- · yl-2,3,4,5 · tetrahydro-1H-benzo [b] [l, 4] diaza萆 · 3-yl] -3-phenylpropanamide, prepared from 1 (35a) by the method of preparing compound Η (step A), can produce 390 mg (93%) of the product, which is the # enantiomer; stereoisomers 3 NMR (CD3OD) &amp; 7.58-7.22 (14H, m), 5.78ο · 73 (0.5H, d), 5.64 (0.5H, s), 5.0-4.72 (4H, m), 4.54-4.42 (2H , m), 3.82-3.76 (0.5H, m), 3.68-3.62 (0.5H, m), 3.28-3.21 (0.5H, m), 3.19-3.12 (0.5H, m), 3.07-2.98 (2H, m)? 2.78-2.48 (4H, m). The produced product was converted to 06a by the method of preparing compound H (step D). The title compound was obtained as a white solid (17%). ¾ NMR (CD3〇D ) &amp; 7.54 ^ 6.98 (9H, m), 5.58-5.44 (1H, m), 4.8-4.2 (4H, m), 3.96 · 3.3 (2H, m), 3.30-3.05 (1H, m), 2.98- 2.25 (5H, m)-[2-keto-5- (3-phenylpropanyl) -3 (SH3-phenylpropanylamino) -2,3,4,5-Tetraargon benzo [b] [l, 4] diazafluoren-1-yl] methyl acetate (104b) 3 Anhydrous hydrogen chloride effervesces to (3 (S) -th Tris-butoxycarbonylamino-2-keto-2,3,4,5-tetraargon, benzo [b] [l, 4] diazafluoren-1 · yl) methyl acetate (103 , 1 g, 2.86 mmol) in 25 ml of ethyl acetate solution for 2 minutes, and then stirred for 1 hour under room temperature. Evaporation of the reaction can produce 2-keto-3 (S) -amino · 2, 3,4,5-Tetrahydrobenzo [b] [1,4] Diazapyridin-1-ylacetic acid methyl ester hydrochloride is a white solid. 3 The hydrochloride is suspended in 20 ml of digas methane and cooled to 〇aC. Add triethylamine (1.6 ml, 5 mmol) to the suspension, and then add dihydrocinnamo (0.9 ml, 6 mmol) dropwise. Warm the mixture to Stir for another 18 hours at room temperature. The mixture was diluted with 25 ml of digas methane, washed twice with 50 ml of water and once with 50 ml of brine. The organic layer was dried over anhydrous sodium sulfate and used at -344- China's National Standards (CNS) read from the first note (2l0x297 mm) from Fengxiang 7 Winter Pages.

1235157 A7 B7 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. 5. Description of the invention (w) It is filtered and evaporated to form a thick yellow oil. It is then purified by flash chromatography and dissolved in 1: 1 ethyl acetate / digas methane. This gave 1.35 g (92%) of the title product as a white solid. 1H NMR (CDC13) &amp; 7.45-7.02 (14H, m), 6.37-6.32 (1H, d), 4.78-4.72 (1H, m), 4.5-52-4 · 3 (3H, m), 3.82-3.77 (1H, m), 3.74 (3H, s), 3.03-2.87 (4H, m), 2.58-2.45 (2H, m), 2.45-2.35 (1H, m), 2.25-2.16 (1H, m). ^ [2-keto-5- (3-phenylpropionamido) -3- (3- (S) -phenylpropionamido) · 2,3,4,5-tetrahydrobenzo [b ] [l, 4] Diazapyridin-1-yl] acetic acid (105b) M2-keto-5- (3-phenylpropionyl) -3- (3-benzylpropionylamine) -2 , 3,4,5-Tetrabenzyl [b] [l, 4] Diazapyridin-1-yl] acetic acid methyl ester (104b; 680 mg, 1.32 mmol) to hydrolyze 105a Step hydrolysis gave 645 mg (98%) of the title compound as a white solid. 1HNMR (CDC13) &amp; 7.58 (lH, br, s), 7.5-7.42 (lH, m), 7.35-6.95 (14H, m), 4.95-4.88 (1H, m), 4.64-4.55 (1H, d) , 4.54-4.45 (1H, t), 4.15-4.05 (1H, d), 3.75 (1H, m), 3.05-2.75. (4H, m), 2.58-2.45 (2H, m), 2.45-2.28 (1H , m), 2.25-2.14 (1H, m). 2-netyl-3 (S)-{2- [2-netyl-5- (3-phenylpropyl) -3 (S)-(3-phenyl · propylamido) -2,3 , 4,5-tetrahydrobenzo [13] [1,4] diazapyrene-b-yl] acetamido} butanoic acid (106a). [2-keto-5- (3 • phenylpropionamido) -3 · (3-phenylpropionamido) -2,3,4,5-tetrahydrobenzo [b] [1,4 ] Diazapyridin-1-yl] acetic acid and 3 · amino-4-ketobutyric acid third-butyl hemicarbazone, coupled with the preparation step of compound K (step A) to yield 350 mg (85% ) White solid. iH NMR (CDC13) &amp; 9.05 (1H, br. s)? 7.58-7.55 (1H, d), 7.5-7.35 (1H, m), 7.35-6.95 (14H, m), 6.75-6.72 (1H, d ), 6.25 (1H, br. S), 5.25 (1H, -345- (Please read this page's notice on the back page)

Order

The paper scale is applicable to China National Standards (CNS) A4 specifications (210X297 mm) 1235157 AT B7

br. s), 4.95-4.88 (1H, m), 4.8-4.72 (1H, m), 4.554 mu (2H, m), 3.92-3.88 (1H, d), 3.73.3.68 (1H, m), 2 95-2 · 8 (4H m)? 8 2.72 (1H, m), 2.62-2.55 (1H, m), 2.55-2.45 (iu 'V m), 2.4-2.3 ^ (1H, m), 2.2- 2.12 (1H, m), 1.45 (9H, s) 1 4-keto-3- {2- [2-keto-5- (3-phenylpropylamidino lean P-propylpropylamidoamino) -2,3,4,5, -tetrahydrobenzo [b] [l, 4] diazafluoren-1-yl] • ethylammonium} butyric acid third · butyl ester half-carbaba neck, For example, the preparation method of compound K (step C) ▲ Protected to produce 118 mg (47%) of the title compound was Bai Beitian 7 NMR (CD3OD) &amp; 7 · 48-6 · 95 (14H, m), 4 · 65 · 4 · 15 (6H m) 3 5 3 · 4 (1H, m), 2.85-2.72 (4H, m), 2.65-2 · 5 (1H, m), 2 5 · 2 34 (3H, m), 2.34-2.15 (2H, m). Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs [5-fluorenyl-2-keto-30)-(3-phenylpropanamido) · 2,3,4,5-tetrahydrobenz [b] [M] Diazafluoren-1-yl] methyl acetate (104c). [2-ketobenzylpropylamidoamino) -2,3,4,5-tetrahydrobenzo [b] [l, 4] diazapyrene- 丨 · yl] fluorenyl acetate (104a: 500 Mg, 1.31 millimoles, calcium carbonate (155 mg, us millimoles) and fluorenyl bromide (170 microliters, 1.44 millimoles) were absorbed in 10 milliliters of dimethoxamine and heated to 80eC for 8 hours The mixture was diluted with 150 ml of ethyl acetate and washed 4 times with 50 ml of water. The organic layer was dried over anhydrous sodium carbonate, filtered and evaporated to give a viscous yellow oil, which was purified by flash chromatography and evaporated with methane / Ethyl acetate (8: 2) was dissolved to produce 460 mg (75%) of the title compound as a white solid ^ iHNMRCCDCld &amp; TJ #-7.05 (14H, m), 6.32-6.28 (1H, d), 4.84-4.76 (1H , d), 4.76-4.70 (1H, m), 4.43-4.37 (1H, d), 4.26-4.18 (1H, d), 4.06-4.00 (1H, d), 3.79 (3H, s), 3.45-3.37 (1H, m), 3.02-2.95 (1H, m), 2.90- 1 346 · This paper's standard scale is a fast-moving Chinese national standard (CNS &gt; A4 size (210X297 mm)) Bei X consumer cooperative seal «. Λ 7 Β7 V. Description of the invention (344) '2.82 (2H, m), 2.5-2.34 (2H, m) ^ [54 基 -2 -Fluorenyl-3 (S)-(3-phenylbispyridylamine) · 2,3,4 5 · tetrahydro-benzo [b] [l, 4] diazafluoren-1-yl] acetic acid The preparation of (105c) was carried out by hydrolysis of (102c) by the method of Example (3) to give 450 mg (98%) of the title compound as a white solid: ¾ NMR (CD3OD) &amp; 7. · 5-7.05 (14H, m), 6 / (1H, br · s), 4.85-4.55 (2H, m), 4.5-5-4.21 (2H, m), 4.12-3.92 (1H, d), 3.45-3.3 (1H, m), 3.1-2.8 (3H, m), 2.55 ^ 2.28 (3H, m) 3, '3 (S)-{2- [5-fluorenyl-2-keto-3- (3- (S) · Phenylpropionamido ^ 2 3 4 5-tetrahydrobenzo [b] [l, 4] diazepine-1-ylbutanylaminobutyric acid (106c) 3 [5-Benzyl-2-keto-3 (S)-(3-phenylpropylamidoamino) _2,345_tetrakis-pyrono [b] [l, 4] Yiranza leather-1 -Yl] acetic acid and 3 (S) -amino-4-butyric acid butyric acid third-butyric acid semi-carbaba knee 'coupling by compound K (Bu Li A) production method, and can produce 260 mg (85%) White solid: [Η NMR (CD3OD) &amp; 7.35-7.0 (15H, m)? 4.94-4.88 (1H, m), 4.68-4.58 (1H, d), 4.57-4.52 (1H, m)? 4.41-4.34 (1H, d), 4.3 ^ 4.23 (1H, d), 4.1-4.04 (1H, d), 3.18-3.11 (1H, m), 3.09-2.98 (1H, m), 2.78-2.72 (2H, t), 2.65-2.57 (1H, m), 2.42, 2.33 (3H, m). 3 (3)-{2- [5-wordyl-2-benzyl-3 (5)-(3-phenylpropylamino) -2,3,4,5-tetrahydroepi [b] [ l, 4] «—Lazazol-1-yl] ethoxyamido} -4. tertiary-butyric acid tertiary-butyl hemicarbazone, deprotected as in the method of compound K (step C), can be generated .168 mg (81%) of the title compound was a white 'colored solid. lH NMR (CD3OD) &amp; 7.37-7.0 (14H, m), 4.75-4.62 (1H, m), 4.6-4.45 (2H, m), 4.4-4.21 (2H, m), 4.15-3.95 (2H, m ), 3.15-3.0 (2H, m), 2.82-2 · 67 (2H, m), 2.65-2.52 (1H, m), 2.5-2.32 (3H, m). -347- This paper is standard Chinese national standard plum (CNS) with the old standard (210X297 mm) (please read the precautions on the back first)

(This page)

1235157 Λ / Β7 V. Description of the invention (w)

107 R: ο α

b R: 108

CHj R: jyp 2.6- dichlorophenylarsinic acid 4- tertiary e-butoxycarbonyl · 2. Keto · 3 {_ {2- [2 • moenyl, bis (3-phenylpropanyl) -3 (S) , (3-Phenylpropanamido) -2,3,4 5-tetrahydro · stupid [b] [l, 4] diazalide-1-yl] ethenylamino (107). Sengzhifeng Carbamate uses compound 105b and 3 · (allyloxycarbonylamino) -4-keto · 5- (2, cardiodichlorobenzyloxy) pentanoic acid Tertiary butyl ester (WO93 16710) was prepared by coupling to yield 256 mg (58%) of the title compound as a white solid 3 lH nmr (CDC13) &amp; 7.45-7.04 (17H, m), 6.45-6.34 ( 2H, m), 5.28-5.21 * Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (1H, m), 5.1-5.0 (1H, m), 4.95-4.90 (1H, m), 4.75-4.70 (1H,- m), 4.55-4.44 (1H? m), 4.32-4.22 (1H, dd), 3.99-3.85 (1H, dd), 3.85-3.76 (1H, m)? 3.06-2.83 (5H, m), 2.83- 2.74 (1H, m), 2.6-2.44 (2H, m), 2.43-2.33 (1H, m), 2.24-2.15 (1H, m), 1.45 (9H, s). 2.6- Dichlorobenzoic acid 4- Carboxyl-2, keto-3 (S)-{2- [2-keto-5- (3-phenylbis-348-)-This paper is used in § Garden Standards (CNS M4 Saoge (2 ! 〇X297 mm) 1235157 Λ 7 B7 Printed by the Shellfish Consumer Cooperative of Shenyang Municipal Bureau of the Ministry of Super Economy ¾ V. Description of the Invention (w) fluorenyl) -3 (S)-(3-phenyldiaminoamine) -2,3,4,5 Tetrahydrobenzo [b] [i, 4] diazaphen-1-yl] acetamido} butyl acetic acid (108 a) is prepared from i07a, using the method described in Chemical 57b, which can produce 156 Mg (68%) of the title compound as a white solid. ^ NMR (CD3OD) &amp; 7.5-6.9 (17H, m), 5.16ο.02 (1Η, dd), 4.88-4.71 (2H, m), 4.62-4.44 (2H, m), 4.42-4.28 (2H, m), 4.27-4.18 (1H, m), 3.47-3,41 (1H, m), 2.90-2.60 (5H, m), 2.46 · 2 · 4 ( 2H, m), 2.39-2.18 (2H, m "· 4- (7-methoxybenzo, zol-2-yl) -4-one-3 (S)-{2- [2-bream The group 0- (3-phenylpropanyl) -3 (5)-(3-phenylpropanamido) -2,3,4,5-tetrahydrobenzyl [1 &gt;] [1,4] DiIIheterophenyl-butyryl] -acetoamino} butanoic acid (108 b) was prepared by the method described in compound 69a to give the title compound (50%) as a white solid. iH NMR (CD3〇D) &amp; 7.41-6.88 (17H, m), 5.6-5.55 (0.5H, t), 5.48-5.43 (0.5H, t), 4.64-4.45 (2H, m), 4.45-4.30 (1H, m), 3.93 (1.5H, s), 3.90 (1.5H, s), 3.47-3.34 (1H, m), 3.10-2.85 (2H, m), 2.84-2.63 (5H, m), 2 6-2 · 4 (2H, m), 2 · 3-2 · 1 (2H, m).

122 o a 123 (Please read the notes on the back first

(This page) Order 124

125 O

349- This paper is in the standard Chinese National Twin (CNS) format (210X297 mm) 1235157 Λ / B7 Printed by the Consumers ’Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (tear) Oxycarbonyl) · 3-Amino-5- (2-Gaphenylphenylsulfanylketone · Ter-butyl valerate (123). Potassium fluoride (273 mg, 4.70 mol) and 2-chloro Benzylfluorenyl mercaptan (373 mg, 2.35 mmol) j to (3S) N- (alanoxypropyl) -3-cavity-5-molyl-valeric acid tert-butyl g (122: 74 9 mg, 2.14 mmol; WO 93 16710) 3 mixtures were mixed in a solution of diazepam (20 ml) for 3.5 hours, and then water-cold (50 ml) was added. Extract with ethyl acetate (2 x 50 ml). The combined organic extracts were washed with water (4 x 50 ml) and then brine (50 ml). It was then dried (MgS04) and concentrated to form an oil, which was quickly Chromatographic purification (10-35% ethyl acetate / hexane) yielded 832 mg (91%) of colorless crystals: mp 45-6 ° C; [a] D20-i9.03 (c 1.0 CH2C12); IR (film) 3340, 2980, 293 5, 1725, 1712, 151 1, 1503, 1474, 1446, 1421, 1393, 1368, 1281, 1244, 1157, 1052, 1040, 995, 764, 739; lR NMR (CDC13) &amp; 7.36 (2H, m), 7.21 (2H, m), 5.91 (2H, m), 5.27 (2H, m) 4.76 (1H, m), 4.59 (2H, d), 3.78 (2H, s), 3.36 (2H, m), 2.91 (1H, dd), 2.74 (1H, dd), 1.43 (9H, s) Analysis of the calculation of C20H26C1N05SS: C, 56.13; H, 6.12; N, 3.27; S, 7.49-Measured 値: C, 56.08; Η, 6. · 11; N, 3.26; S, 7.54. MS (CI) 430/28 (M + + 1, 3%), 374/2 (100) 〇 (3S) 3 (2 (6-benzyl-1,2-dihydro-2-keto-3 (3-phenyl Fluorenylamino) -pyridinyl) acetamidinyl 0- (2-chlorophenylphosphoniumthio) -4-ketophosphonic acid tert-butyl ester (124a). 6.fluorenyl-1,2- Diargon-2-one: 3- (3-phenylpropionamido) -pyridylacetic acid (52b: 300 mg, 0.76 mmol) in THF (7 ml) (205 mg, 1.52 millimoles) and 1- (3-dimethylaminopropyl-3 · ethylphosphonium diimide hydrochloride). After 3 minutes, add water (2 drops) and the mixture -350- This paper has a common national standard (CNS) A4 size (210X297 mm) (read the first note and read the precautions on the back kl)

East · 1235157 Μ The Central Bureau of Standards of the Ministry of Economic Affairs of the People's Republic of China Shellfish Consumer Cooperation Du Yinzhang Λ7 _______B7__________ V. Description of the Invention (348) After 10 minutes of mixing, (3S) N- (propoxycarbonyl) -3-benzylchlorobenzyl Sulfenyl) -tertiary-butyl 4-- valerate (123) (325 mg, 0.76 mmol), bis (triphenylphosphine) aluminum (II) gasification (20 mg) and trihydrogen Ding disease (0.6 ml, 2.28 mmol) was treated. The mixture was stirred at room temperature for 5 hours, poured into ethyl acetate and then washed with 1M aqueous HC1 solution (X 2), aqueous sodium bicarbonate solution, brine, dried (iMgS04) and concentrated. The residue was triturated with pentane and the supernatant was discarded. Chromatography (silica gel, 50% ethyl acetate / hexane) gave a colorless foam (439 mg, 81%): [from] D2i-18.3. (C 〇 · 5, CH2C12); iR (KBr) 3356, 33 1 1, 1722, 1689, 1646, 1599, 1567, 1513, 1367, 1 154; Tun NMR (CDC13) &amp; 8.39 (1Η, d ), 8.23 (1Η, s), 7.24 (14Η, m), 6.16 (1H, d), 4.95 (1H, m), 4.63 (2H, m), 4.02 (2H, s), 3.74 ( 2H, s), 3.27 (2H, s), 2.85 (6H, m), 1.40 (9H, s) ^ Analysis of the calculation of C39H42C1N306S 値: C, 65 · 39;;, 5.91; N, 5.87. Found 値: C, 65.51; H, 5.99; N, 5.77. [3S (1S, 9S) -3- (6,10-diketo-1,2,3,4,7,8,9,10-octahydro) -9- (3-phenylpropionamido ) -6H-Da [1,2-a] [l, 2] diazepine-1 · carboxyamidoamine 0- (2-Gaphenylphenylsulfanyl) -4-ketovaleric acid Butyl ester (124b) was prepared from thioethers 123 and 3S (1S, 9S) -3- (6,10-diketonyl-1,2,3,4,7,8,9,10 in a similar manner to 124a. -Octahydro) -9- (3-phenylpropylamidoamino) -6ί ^, which can be combined with [l, 2-a] [l, 2] diazapyrene-carboxylic acid (45a), which can generate 452 mg (50%) colorless foam imp 55-7eC; [a] D22-94.0 ° (c 0 · 12, CHflA IR (KBr) 3288, 2934, 1741, 1722, 1686, 1666, 1644, 1523, 1433, 1260, 1225, 1146, 757; 1H NMR (CDC13) &amp; 7.35 (3H, m), 7.20 (7H, m), 6.46 (1H, d), 5.21 (1H, m), 4.97 (2H, m), 4.56 (1H, m), 3.75 -351-The standard of this paper is universal. § National Standard (匚: ^) 八四 格格 (2 丨 (^ 297 mm) (Please read the back of the cloud: Vi intentions first ¾ --- install-Ben Yi ao

• IT

1235157 Λ /. ___________B7 Five Λ issued 9 Explanation () (2Η, s), 3.2] 〇Η, m), 2.93 (5Η, m), 2.71 (1Η, dd), 2.55 (2Η, m), 2.30 (1H, m), 1.92 (3H, m), 1.66 (2H, m), 1.42 (9H, s). Analysis C35H43C1N407S. Calculated at 25.20: C, 59:73; H, 6.23; Cl, 5.04; N, 7.96; S, 4.56. Found 値: C, 59 73; H, 6 19; cl, 5 10; n, 7.79; S, 4.58. MS (-FAB) 697 (M-1, 100). (3S) 3 (2- (6-fluorenyl · 1,2, dihydro-2-keto-3- (3-phenylpropanyl ammonium) -1-pyridyl) ethylamino-5 -(2-chlorophenylphosphoniumthioketovaleric acid (125a) 3- (2- (6-fluorenyl-I, 2 · dihydro · 2 · keto-); 3- (3-phenylpropionamidine Amino group) -Pyridinyl group) Ethyl-Alkyl-5 · (2-aminophenylmethylsulfanyl) · 'Ketovaleric acid tert-butyl ester (124a) (400 mg' 〇 · 56 millimoles) in digas methane (3 ml), treated with trifluoroacetic acid (3 ml) under yc, and then stirred off at 0 for 1 hour and at room temperature for 0.5 hours. The solution was concentrated and then dissolved in dichloromethane. Methane and reconcentration. This step was repeated three times. The residue was stirred in acetone for 1 hour and filtered to form a colorless solid hydrazone (364 mg, 99%): 165-7eC; 〇] d22-27.7. (C 0.2, CH2Cl2); IR (KBr) 3289, 1712, 1682, 1657, 1645, 1593, 1562, 1527, 1497, 1416, 1203? 1182; ιΗ NMR (CDC13) d 8.47 (1Η, d), 8.21 (1H? S) , 7.70 (1H, d), 7.22 (14H, m), 6.24 (1H, d), 5.03 (1H, m), 4.65 (2H, m), 4.06 (2H, s), 3.69 (2H, m), 3.23 (2H, m), 2.88 (6H, m) 3 Printed by the Consumer Cooperatives of the Central Sample Bureau of the Ministry of Economic Affairs [3S (1S, 9S)]-3- (6, 10-diketo-1,2,3,4,7,8,9,10-octahydro) -9- (3-phenylpropionamine odor [[1,2, a]] [1,2] ] Diazatril-l-Chitosyl, 5- (2-Gasphenyl-fluorenylthio) -4-ketovaleric acid (125b), prepared from tertiary-butyl ester 124b in a similar manner to 125a, Can produce 362 mg (93%) of colorless powder: mp 76-80Ό; [^] d2Li34 ° (c 0.10, MeOH); IR (ΚΒγ) 3309, 2935, • 352- _ Large paper 泫 scale using Chinese national standards ( CNS) A4 specification (2 丨 0: &lt; 297 degrees 1: ^ 1235157 Λ7 B7 V. Description of the invention (Norway) 1725, 1658, 1528, 1445, 1417, 1277, 1219, 1 175; NMR (D6-DMSO) &amp; 8.80 (1H, d), 8.19 (1H, d), 7.31 (9H, m), 5.09 (1H, m), 4.74 (1H, m), 4.63 (1H? m), 4.35 (ΙΗ ^ ιη) , 3.76 (2H, m), 3.28 (3H, m), 2.80 (5H, m), 2.52 (4H, m), 2.16 (2H, m), 1.90 (3H, m). Analysis C31H35C12N4〇7S. Calculated from 0.25 to 20: C, 57.49; C, 5.53; N, 8.65; S, 4.95. Found 値: C, 57 · 35; H, 5.43; N, 8.45; S, 4.88. MS (-FAB) 641 (M-1, 100).

ilik! 201 2 · Phenylmethyl iodide. A mixture of 2-chlorophenylmethyl bromide (4 g, 19.47 mmol) and Nal (14 g, 97.33 mmol) in acetone (40 ml) was stirred at reflux for 1 hour. The reaction mixture was cooled, filtered and concentrated in vacuo. The residue was triturated with hexane and filtered. The solution was concentrated in vacuo, and the resulting product was purified by flash chromatography (silica gel, hexane) to give the title compound (4.67 g, 63%) as an oil:! Η NMR (CDC13) &amp; 7.34 (4H, m) , 4.54 (2H, s). (3S) N · (allyloxycarbonyl) -3-amino-5- (2-aminophenylmethoxy) -4 · ketovaleric acid Butyl ester (201). (3S) N- (allyloxycarbonyl) -3-amino-5-hydroxy-4-carboxylic acid tertiary-butyrate (81, Chapman, et al., Bioorg. &Amp; Med. Chem. Lett · 2, ρρ · 613-618 (1992) 0.144 g, 0.5 mmol) and 2-Gaphenylphenyliodide (0.569 g, 1.5 mmol) in CH2C12 (4 ml) and silver oxide ( 0.231g, 1 millimolar) vigorously stirred, and heated at 38eC for 40 hours -353 paper standard standard Chinese national standard (CNS M4 specification (2 丨 0X297 mm) 1235157 A, B7___ V. Description of the invention ( 351) When the 3 reaction mixture was cooled, the residue was dried and purified, and the residue was purified by fast chromatography (Mai, 0-20% ethyl acetate in hexane). The product was colorless.

Oily (0.138 g, 67〇 / 〇); [a] D24 + 3.9 ° (c NMR (CDC13) &amp; 7.37 (4H, m), 5.88 (2H, m), 5.26 (2H, m), 4.69 (2H, s), 4.57 (3H, m), 4.50 (1H, d), 4.35 (1H, d), 3.03 (1H, dd), 2.76 (1H, dd), 1.42 (9H, s).

202 203 204 Shellfish consumer and capital cooperation of the Central Bureau of Standards, Ministry of Economic Affairs, Du Yin ¾ 5,7. Dichlorobenzoxazole (203). A solution of 2,4-digas · 6-nitrophenol (202, 40 g with 20% pervapor) in EtOAc (500 ml), dried over MgS04, filtered and the filter cake was washed with a small amount of EtOAc. Pd / c (5% sulfide-2 g) was added and the mixture was hydrogenated until the H2 intake ceased. Triethyl orthoformate (160 ml) and p-toluenesulfonic acid (160 mg) were added and the mixture was refluxed for 4 hours. After cooling and removing the spent catalyst by filtration, the solution was washed with saturated NaHC03 solution, water and brine, Dry with MgS04 and evaporate to dryness. Grinding with hexane can produce solid hydrazone, which can be collected by filtration, washed with hexane, and dried to give the title compound (25.5 g, 88%) as a crystalline solid: mp 98-99Ό; IR (KBr) 3 ^ 119, 1610, 1590 , 1510, 1452, 1393, 1296, 1067, 850; ικ NMR (CDCi3) &amp; 8.16 (1H, s), 7.69 (1H, d, J = 1.9), 7.42 (1H, d, J = 1.9); analysis Calculation of C7H3C12N0 値: C, 44.72; Η, 1.61; N, 7.45; Cl, 37.70. Found 値: C, 44.84; Η, 1.69; N, 7.31; .C1, 37.71. -354 · The standard of this paper is the standard of China National Standard (CNS) A4 (210X297mm) &quot; &quot; 1235157 Λ7 B7 V. Description of the invention (Ang 2)

3L (3S, 4RS) N- (allyloxycarbonyl) -3-amino-4 · hydroxy-4- (5,7-dichlorobenzopyrinol-2 -Yl) Butyric acid tertiary-Ding Xue (204). The preparation of magnesium bromide was Jiang Mg (7.45 g, 0.30 mol) in tHf (516 ml) with 12 (50 mg) and 1,2-dibromoethane (26.3 ml, 57.3 g, 0.30 mol) under reflux. The reaction was allowed to proceed for 2 hours, and then cooled to -4 ° C. The 2-lithium 〇, 7-dichlorobenzoxine in 7CTC solution (from 5,7 · dichlorobenzohumazole (203 , 28.9 g, 0.154 mol) and butyl lithium (100 ml, 1.52 M in hexane) in THF (150 ml) prepared at 7 CTC). The mixture was stirred at -40 eC for 1 hour and then cooled to -7 CTC. Then, (3S) N- (allyloxycarbonyl) -3-amino-4 · pyroyl-butyric acid tertiary-butyric acid was added (Chapman, ei al ·, Bioorg. &Amp; Med. Chem. Lett · , 2, pp · 613-618 (1992)) (20.3 g, 0.078 mol) in THF (160 ml) was performed at a temperature below -60 ° C. The reaction was warmed to ambient temperature and stirred for 16 hours The addition of gasified ammonium solution was stopped and extracted with 600 ml of 1: 1 hexane · ethyl acetate. The organic solution was washed with water and brine, dried over 1 ££ 504 and evaporated to a syrupy form (52.9 g). Fast layer Analysis (Si〇2 250 g of hexane ·· CH2C12 X 2, CH2C12, 5% EtOAc in CH2C12, 10% EtOAc in CH2C12, 20% EtOAc in CH2C12) can produce 24.6 g of impure product, which can be further chromatographed (Si02 1: 1 hexane: ether) to generate the title Compound, golden-colored glass (22.7 g, 64%); IR (thin film) 3343, 2980, 1723, 1712, 1520, 1456, 1398, 1369, 1254, 1 158, 993; lR NMR (CDC13) &amp; 7.60 (1H, m), 7.3t (1H, m), 5.72 (1H, m), 5.64 (0.5H, d), 5.10 (2.5H, m), 4.7-4.J (4H, m), 2.9-2.6 (2H, m), 1.46 and 1.42 (9H mixed, 2 xs). MS ES + Da / e 445 (M + 1) + Cl 35 62%, 447 (M + 1) + Cl 37 40%, 389 100%. -355-This ft standard uses the Chinese National Standard (CNS) A4 ^ (2 〖0X297々A) 1235157 Λ7 Β: Printed by the Shellfish Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 51 V. Invention Description (i-Bu 丨

Alloc—NH (b) S R 205a 205b i-BuC ^ C ^^^ oH Alloc—NH 206a 206b

H

Alloc-NH 〇 208a 208b

(2S) -N-allyloxycarbonyl-5- (1, dimethyldimethyl) glutamate (205a). To a mixture of THF (200 ml) and K water (100 ml) containing NaHC03 (16.6 g, 0.2 mol) was added tert-butyl glutamate (10 g, 49.2 mmol). Add chloropropanoic acid (6.8 ml, 64 mmol) dropwise over 20 minutes. The mixture was stirred for 2 hours, extracted with EtOAc, and a saturated bicarbonate solution. Washed with water and planer and saline solution, dried and evaporated to oil 205a (9.5 g, 67.2%): [a] D20-6o (c 1.5, MeOH) Tun NMR (D, 6-DMSO) &amp; 6.10 (1H, d ), 5.96-5.88 (1H, m), 5.31-5.12 (2H, m), 4.45 (2H, m), 3.90-3.84 (1H, t), 2.18 (2H, m), 1.85-1.76 (2H, m ), 1.36 (9H, s). (2R) -N-allyloxycarbonyl-5- (1,1, -dimethylethyl) glutamate (205b) can be prepared in a similar manner to 205a to produce a colorless oil (6.27 g, 88%): [PAN] D20 + 16e (c 0.095, MeOH); IR (KBr) 3678, 3332, 3088, 2980, -356-

The paper scale is universal Chinese National Standard (CNS) Α4 size (210X297 mm): 235157

AT B7 V. Description of Invention (Slave) 2937, 1724, 1530, 1453, 1393, 1370, 133 1, 1255, 1 155, 1056, 995, 935, 845, 778, 757, 636, 583; lH NMR (CDC13) &amp; 9.24 Read the note on the back% (1H, width s), 5.94-5.79 (1H, m), 5.58 (1H, d), 5. · 3ΐο · 17 (2H, m), 4.55 (2H, d), 4.3S-4.31 (1H, m), 2.41-1.95 (4H, in), 1.42 (9H, s); analysis C13H21N06i calculation 値: C, 54.35; H, 7.37; N, 4.88. Measured radon: C, 54.4; H, 7.5; N, 4 · 8. (4S) N-allyloxycarbonyl-4-amino o-hydroxyvaleric acid tert-butyl ester (206a). To a solution of 205a (3.6 g, 12.5 mmol) in THF (100 ml) was added N-methyl triamline (1.5 ml, 13 mmol) at TC followed by isobutyl formate (1.1 Ml, 13 millimoles). After 15 minutes, this mixture was added to -78X: NaBH4 (0.95 g, 25 millimoles) in THF (100 ml) and MeOH (25 M, Central Bureau of Standards, Ministry of Economic Affairs, Consumer Cooperation) Du printed in ml) suspension. After 2 hours at -7 (TC, the mixture was quenched with acetic acid, diluted with EtoAc, washed 3 times with cesium and bicarbonate solution, and then with water and saturated saline solution. Wash, dry and evaporate. Flash chromatography (2% MeOH in CH2Cl2) can produce 206a as a colorless oil (2.4 g, 70%): [PAN] 0-20-10. (C 3.88, CH2CI2); lH NMR (CDC13 ) &amp; 5.84 (1H, m), 5.34-5.17 (3H, m), 4.56-4.53 (2H, m), 3.68-3.59 (2H, m), 2.98 (1H, m), 2.40 · 2 · 30 (2H, t), 1.84 · 1 · 78 (2H, m), 1.43 (9H, s); Analysis of the calculation of C13H23N5 値: C, 57.13; H, 8.48; N, 5.12. Measured値: C, 57.1; H, 8.6; Ν, 6.0 · (4R) N-allyloxycarbonyl · 4 · yl group · 5-trimethylpentanoic acid tert-butyl ester (206b), Prepared in a similar manner to 206a, the title compound can be produced as a pale yellow oleic acid (3.42 g, 57%) [to] D20 + 14 (c 〇166, Me〇H); IR (KBr) 3341, 3083, 2976, 2936 , 2880, 1724, 1533, 1454, 1419, 1369, 1332, -357 · The standard of this paper is applicable to Chinese National Standard (CNS) Α4 (21〇 &gt; &lt; 297 public cage 1235157 Α7 Β7) 5. Description of the invention ( Class) 1251, 1156, 1062, 997, 933, 846, 777, 647; Tun NMR (CDC13) &amp; 5.980.81 (1H, m), 5.35〇; 10 (3H, m), 4.55 (2H, d) , 3.70-3 · 56 (3H, m), 2.50-2.47 (1H, width s), 2.37-2 · 30 (2H, m), 1.89, 1.74 (2H, m), 1.44 ( 9H, s); Analysis of the calculation of C13H23N05: c, H, 8.48; N, 5.12. Measured tritium: C, 56.9; H, 8.6; N, 5.6 3 (4 S) N-propionyl-4-cavity group; 5-Mengylvaleric acid, tertiary-butane purpose (207 a) To a solution of 3 pairs of DMSO (1.51 g, 19.3 mmol) in CH2C12 (25 ml) at -703C was added monogas (1.34 g, 19.3 mmol). After 10 minutes at -70 ° (:), (206a) (2.4 g, 8.8 mmol) was added dropwise in a solution of CH2C12 (10 ml), and the mixture was passed at -7OeC for 15 minutes. Add two Isopropylethylamine (3.4 g, 26.3 mmol) and the mixture was stirred at -25 ° F for 15 minutes, then diluted with EtoAc (50 ml) and washed with 2M sodium argon sulfate solution, concentrated to give an oil, which was immediately available. Use without further purification: iH NMR (CDC13) &amp; Μ printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 9.5 (1H, s), 6.0ο.5 (2H, m), 5.5-5.1 (2H, m) , 4.5 (2H, m), 4.2 (1H, m), 2.4-2.10 (2H, m), 2.05 (2H, m), 1.36 (9H, s) ^ (4R) N- # propyloxycarbonyl-4- Amino-5-ketovaleric acid third-butyl ester (207b), prepared in a similar manner to 207a, can form an oil (2 95 g, 96%), which can be used without further steps in the next step Purification: [dD20 + 2i ° (c 0.942, MeOH); lH NMR (CDC13) &amp; 9.58 (1H, s), 6.05-5.80 (1H, m), 5.57 (1H, width s), 5.35- 5.18 (2H, m), 4.56 (2H, d), 4.34-4.24 (1H, m), 2.38-2.16 (3H, m), 1.96-f.73 (1H, m), 1.43 (9H , s) ^ (4S) N-allyloxy-4-amino-5-ketopentanoic acid Tertiary-butyl ester hemicarbazine (208a). To a solution of 270a (2.39 g, 8.8 mmol) in MeOH (20 ml) was added sodium crucate (0.72 g, 8.8 mmol) and half Kappa (0.98g, -358-The standard of this paper is the same as the national kneading rate (CNS M4 specification (2 丨 0X297mm) 1235157 Λ7 B7) 5. Description of the invention (tear: S.8 Mor), stir overnight and concentrate Diluted with CH2C12 (100 ml), washed with water, dried and concentrated 3 flash chromatography (2% MeOH in CHfW can generate 208 mad (2.10 g, 73%) appears as: [PAN] 1) 20-21 ( 2.53 °, (: 112 (: 12); 111 NMR (CDC13) &amp; 9.98 (1H, s), 7.27 (1H, d), 5.8 (1H, m), 5.5 (1H, d), 5.35-5.19 (2H, m), 4.58 (2H, m), 4.14 (1H, m), 2.37 (2H, t), 2.09 (1H, m), 2.0-1.75 (2H, m); Analyze the calculation of C14H24N405 : C, 51.21; H, 7.37; N, 17.06. Found 値: C, 50 · 2; H, 7.3; N, 16.1-(HR) N-allyloxycarbonyl-4-amino o-ketovaleric acid third-butyl hemicarbazone (208b), Prepared in a similar way to 208a, which can produce glassy (2.37 g, 66%) [a] D20 + 30 (c 0.26, CHC13); IR (KBr) 3476, 3360, 2979, 2923, 1700, 1586, 1527, 1427, 1394, 1369, 1338, 1253, 1 156, 1060, 997, 929, 846, 775; 1H NMR (CDC13) &amp; 9.87 (1H, s), 7.09 (1H, d), 6.05-5.75 (3H, m) , 5.58 (1H, d), 5.32-5.16 (2H, m), 4.54 (2H, d), 4.35 (1H, m), 2.32-2,26 (2H, m), 2.15-1.55 (2H, m) ， 1 · 41 (9H, s); Analysis of the calculation of C 【4H24N405 値: C, 51.21; H, -install-(Please read the precautions on the back page first)

* 1T

Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 211 7.3 7; N, 17.06. Found 値: C, 51.0; H, 7.5; N, 16.7.

(b) R1 = MeS02 (c) R1 = MeCO (d) R1 = PhCK2〇CO (e) R1 = PhCO (f) R1 = Fmoc

212 (b) (c) (d) (e) (f) R1 R1 1

R R R

MeS02 MeCO PhCH2〇CO PhCO Fmoc 359 The size of this paper is applicable to the Chinese national standard (CNS M4 scale (2 丨 0 × 297 mm) 1235157 Λ: Β &quot; V. Description of the invention (grabbing) (is, 9S) 6,10 -Diketo-9-methylsulfonamido-l, 2,3,4,7,8,9,10 · octahydro-6H · dapyrido [1,2-aH1,2] diaza箪 · 1-carboxylic acid tertiary-butyl ester (211b), 9-amino-6,1 · diketo-1,2,3,4,7,8,9,10-octahydro-6¾. Tera- [I, 2 · a] [l, 2] diazepine small carboxylic acid tert-butyl ester (GB 2,128,984; 831 mg, 2.79 mmol) and diisopropylethylamine (ΐ 22 ml, 6.99 mmol, 2.5 equivalents) in CH2C12 (10 ml), treated with methanesulfonyl chloride (237 μl, 3.07 mmol, 1.1 equivalents) under nitrogen. The mixture was stirred 1 Hours, diluted with EtOAc (75 mL) and washed with saturated NaHCO3 (50 mL) and saturated aqueous sodium chloride solution (30 mL), dried (MgS04) and concentrated. 3 flash chromatography (10-35% EtOAc in CH2C12) can produce 211b (806 mg, 77%) as a colorless solid: mp 68-7CTC; [Pan] D23-109 (c 1.09, CH2Cl2); IR (KBr) 3270, 2980, 2939, 1735, 1677, 145 8, 1447, 1418, 1396, 1370, 1328, 1272, 1252, 1232, 1222, 1156, 1131, 991; lE NMR (CDC13) &amp; 6.15 (1H, d), 5.31 (1H, m), 4.65-4.11 (2H, m), 3.47 (1H, m), 2.99 (3H, s), 2.89 (1H, m), 2.72-2.51 (2H, m), 2.34 (1H, m), 2.26 (1H, m) , 2.05-1.62 (4H, m), 1.47 (9H, s); Analyze Cl5H23N306St Calculate 値: C, 47.97; H, 6.71; N, 11.19; S, 8.54. Measured 値: C, 48 · 28; Η, 6 68; N, 10.86; S, 8.28. MS (+ FAB) 376 (M ++ 1, 660 / 〇), 320 (100). (IS, 9S) 9. Ethylamino-6,10-diketo -1,2,3,4,7,8,9,10 · octahydro-6H-daparo [l, 2-a] [l, 2] diazabenzene-l-carboxy 'acid third- Butyl ester (211c). Acetic anhydride (307 mg, 3.01 mmol) was added to 9-amino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-61 ^ [1,2-3] [1,2] Diazapyridine-1-acid tertiary-butyl ester (GB 2,128,984; 813.7 mg, 2.74 mmol), Diiso 360 Paper Size Applicable to Chinese National Standards (CNS) Α4 Tig (210X297 mm)

Printed by the Central Standards Bureau of the Ministry of Economic Affairs and Consumer Cooperatives, printed 3L 1235157 M. The Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, printed by A7 B7. V. Description of the Invention (358) Propylacetate (884 mg, 6.84 mmol) and CH2C12 ( 20 ml) of the 3 mixture in the stool mixture was kept for 1 hour and then diluted with EtOAc, washed with NaHC03 solution and then with Mann water, dried (MgS04) and concentrated. The product was purified by chiral chromatography ( 0.5-8% MeOH / CHflj can produce 211c (S04 mg, 71%) colorless powder: mp 162-3eC; [c] D23-109 (c 1.03, CH2Ci2); IR (KBr) 3358, 2974, 1733, 1693, 1668, 1528. 1462, 1431, 1406, 1371, 1278, 1271, 1250, 1233, 1217, 1 154 · 1124; &amp; lH NMR (CDC13) d 6.32 (1H, d), 5.29-5.25 (1H, m) , 4.98- 4.85 (1H, m), 4.68-4.58 (1H, m), 3.55-3.39 (1H, m), 2.91-2.66 (2H, m), 2.39-2.18 (2H, m), 2.03 (3H, s), 1.88-1.64 (4H7 m), 1.47 (9H, s); analysis of the calculation of C16H25N305:,: C, 56.62; H, 7.43; N, 12.38, measured 値: C, 56 · 62; Η , 7.43; N, 12.36; MS (+ FAB) 340 (M + + 1,40%), 284 (100). (IS, 9S) 9- (fluorenyloxycarbonylamino)- 6,10-dione · l, 2,3,4,7,8,9,10-octahydro-6H-ring benzo [l, 2 · a] [l, 2] diazapine-l · Tertiary-butyl carboxylic acid (21d) 3 g of formic acid (1.07 g) was added dropwise to (IS, 9S) 9-amino-6,10-diketo-1,2,3,4, 7,8,9,10-octazine-611- "well A0 and [1,2-3] [1,2] — Lantrazol-1-enedicarboxylic acid third-butyl ester (GB 2,128,984; 1.55 G, 5.21 mmoles), NaHC03 (0.66 g, 7.82 mmoles), dichloromethane (32 mL) and water (8 mL) in an ice-cold mixture. The mixture was kept at 5 eC. 15 minutes and 2 hours at room temperature. The mixture was diluted with EtOAc (10 mL) and washed twice with a lean NaHC03 solution, dried (MgS04) and concentrated. The oily residue was purified by flash chromatography to give 211d (1.98 g, 88%) as a colorless form: [Pan] 024 · 56.4 (c 1.0, CH2Cl2); IR (thin film) 3325, 2979, 2946, 1728, 1677, c -361-GG Home Rolling (CNS) A4 Specification (2 丨 0X297 mm) (Please read the notes of t &amp; before filling out this page) Order Φ Central Standards Bureau of the Ministry of Economic Affairs Printed by Beigong Consumer Cooperative 1235157 Λ; Β7 V. Invention Description (Lake) 1528, 1456, 1422, 1370, 1340, 1272, 1245, 1156, 1122, 1056, 916, 734, 699; XH NMR (CDC13) &amp; 7.29 (5H, m), 5.8l 10.72 (1H, m), 5.26-5.20 (1H, m), 5.05 (2H, s), 4.69-4.51 (2H? M), 3.48-3.36 (1H, m )? 2.81-2.51 (2H, m), 2.34-2.19 (2H, m), 1.90-1 · 54 (4H, m), 1.41 (9H, s); Analysis C22H29N306 · H20: C, 58 · 79; H, 6.92; N, 9.35. Found 値: C, 59.10; H, 6.57; N, 9.25; MS (ES +) 454 (M + + Na, 87%), 432 (M + +1, 100). (15,95) 9-benzylamido-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-611-name 3] [1,2] -Diazaben-1-carbonate tertiary-butadiene carbonate (2116) 3 hen gas (1.61 g, 11.47 mmol) in CH2C12 (15 ml) Dropwise to (13,95) 9-amino-6,10-diketo-1,2,3,4,7,8,9,10-octa-argon 2-a] [l, 2] Diazabenzene-1 · Carbonate tert-butyl ester (GB 2,128,984; 3.1 grams, 10.43 mmol), anhydrous CH2C12 (20 ml) and diisopropyl Ethylamine (4.54 ¾ '26.06 ¾ ears) was removed from the cold mixture. The 3 mixture was kept in the cold for 1 hour, and then left at room temperature for 0.5 hours. The mixture was diluted with CH2C12, washed twice with brine, dried (iMgS04) and concentrated. The residue was purified by flash chromatography (0-5 ° /. Formazan in (: 112 (: 12)) can produce 211e (4.0 g, 96%) as a colorless glassy: mp 74-76X:; [ a] D30-75.0e (c 0 · 12, ChClJ. IR (KBr) 3350, 2979, 2938, 1736, 1677, 1662, 1536, 1422, 1276, 1250, 1155;! Η NMR (CDC13) &amp; 8.72 ( 2H, m), 7.53-7.40 (3H, m), 7.07 (1H, d, J = 7.2), 5.30 (1H, dd, J = 3.0, 5.8), 5.12 (1H, m), 4.66 (1H, m ), 3.51 (1H, m), 2.90 (2H, m), 2.38 (1H, dd, J 13.2, 6.8), 2.25 (1H, m), 1.9 (2H, m), 1.70 (1H, m) 。Analyze the calculation of C21H27N305 · 〇 · 5Η20 値: C, 61.45; -362 · The standard of this paper is Chinese National Standard (CNS) A4 specification (210X297 Gongcheng) '(Please read the precautions on the back before filling in Wood page) ed. 4. 1235157 A7 B7 Μ Printed by the Shell Department Consumer Cooperative of the Central Ministry of Economic Affairs of the People's Republic of China 5. Description of the invention (360) Η, 6.88; N, 10.24. Measured 値: C, 61 · 69; H ， 6 71; Ν, ι〇ι8: ㈦ ^ ^ double copper based winter stilbene-... methoxy carbonyl 'carbonyl amine--acid third butyl ester (211f), prepared in a manner similar to 211e, except that … Methylmethyl radical The word “Muqi” can produce white glassy solid 211f (2.14 '89%): mp 190-192 C; [戌] D25-8l. 5. (c 0,1, CH'CIJ 3 IR (ΚΒι ·) 3335, 2977, 1731, 1678, 1450, 1421, 1246, 1 156, 742; [H NMR (CDC13) &amp; 7.60 (2H, m), 7.57 (2H, m), 7.50 ^ 7.26 (4H, m), 5.60 (1H, d, J = 7.8), 5.28 (1H, m), 4.67 (2H, m), 4.38 (2H, m), 4.23 (1H, m), 3.59-3.41 (1H, m), 2.92- 2.65 (2H, m), 2.41-2.21 (2H, m), 1.95-1.58 (4H, m), 1.47 (9H, s) * MS (ES 'm / z) 520 (NΓ + 1, 97%), 179 (100% "(1S, 9S) 6,10-dicopper-9-methyldiaminoamine-1,2,3,4,7,8,9,10-octahydro-611-" 荅Alpha wells [1,2-a] [l, 2] diazepine-1 · metanoic acid (212b) were synthesized in the same way as compound 212e (635 mg, 85%.). It was colorless powder: mp 209 -12 ° C; [a] D24-132 (c 0.12, MeOH); IR (KBr) 3308, 2940, 1717, 1707, 1699, 1619, 1469, 1456, 1442, 1417, 1391, 1348, 1339, 1330, 1310, 1271, 1247, 1222, 1175, 1 152, 1133, 993, 976; lR NMR (CD3OD) &amp; 5.35 (1H, m), 4.58-4.48 (1H, m), 4.46-4.36 (1H, m) , 3.60-3.42 (1H, m), 3.01-2.87 (1H, m), 2.95 (3H, s), 2.55-2.39 (1H, m), 2.32-2.20 (2H, m), 2.09-1.89 (2H, m), 1.78-1.62 (2H, m); Analytical calculation 値: C, 41.37; Η, 5.37; Ν, 13.16; S, 10.04. Found 値: C, 41.59; H, 5.32; N, 12 · 57; S, 9.76; MS (ES-). ChHbNsC ^ S (ΜΗ +) 's exact quality estimate 363 · This paper's standard is common Chinese national standard (CNS Μ4 grid (210 × 297mm)) (Please read it from your father: &amp; of :; · χ Italian matter) Page) order

1235157 A7 B7 'V. Description of the Invention (361) Count: 320.0916. Found 値: 320.0943. (Notes on the back of 53 poems, then (IS, 9S) 9-acetamido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro- 611-Da [1,2-a] [l, 2] diazabenzene-1-carboxylic acid (212〇ί prepared from 211e, the same method as 212e was a white glass-like solid (595 mg, 77 %): mp &gt;250'C;] d24-153 (c 0.10, MeOH); IR (KBr) 3280, 2942, 1742, 1697, 1675, 1650, 1616, 1548, 1470, 1443, 128K 1249, 1202, 1 187, 1 171; 1H NMR (CD3OD) &amp; 5.35-5.31 ('1H, m), 4.81-4.71 (1H? M), 4.61-4.46 (1H, m), 3.59-3.44 (2H, m), 3 .Π-2.94 (1H, m), 2.58-2.39 (1H, m), 2.36-2.19 (2H, m), 2.11-1.83 (3H, m), 1.99 (3H, s), 1.78-1.56 (2H, m); Analysis C12H17N305: C, 50.88; H, 6.05; N, 14.83. Found 値: C, 50.82; Η, 6.02; N, 14.58; MS (ES-) 282 (Ml, 100% ): The exact mass estimate of C12H18N305 (MH +) 値: 284.1246. Found 28: 284.1258. (IS, 9S) 9-t oxycarbonylamino-6, l (^ diketonyl-1,2,3,4,7 , 8,9,10-octahydro-6H-da-phen [l, 2-a] [l, 2] diazapyrene-carboxylic acid (212d) was prepared from 211d using the same method as compound 212e. Colorless crystal Shape (170 mg, 97%): mp 60-100eC; [^] D22-103 (c 0.10, MeOH); IR (KBr) 3341, 2947, 1728, 1675, 1531, 1456, 1422, 1339, 1272 , 1248, 1221. 5.48-5.40 (1H, m), 5.10 (2H, s), 4.76-4.57 (2H, m), 3.49-3.30 (2H, m), 2.92-2.59 (2H, m), 2.40-2.27 (2H, m ), 1.97-1.67 (4H, m); MS (ES-) 374 (M · 1, 100%). C1SH22N306 (MH +) exact mass estimate 质量: 376.1509. Measured 値: 376.1483, C18H2lN306Na (MNa +) actual mass estimate 値: 398.1328, Measured 値 -364- The standard of this paper music standard is the National Standard S (CNS) A4 (2 丨 0X297 mm) 1235157 Ministry of Economic Affairs Printed by Shelley Consumer Cooperative ¾ Λ 7 ____ Β7 ___ V. Description of the Invention (La): 398.13 15-(15,95) 9-Benzylamido-6,10-diketo-1,2,3,4,7 , 8,9,10-Octahydro-611-Da-Chen [l, 2-a] [l, 2] diazepine picoacid piZe) THF (20 ml) was added to the tert-butyl ester 211e The solution was mixed in ice (4 · 15 g, 10.34 mmol) in anhydrous CHfl2 (20 ml) and the mixture was kept in the cold place for 5 hours, and then concentrated at 2.5 hours' temperature. TFA was removed by repeated concentration of the residue CH2C12 \ B shoes and ether solution. The residue was finally triturated with ether to give 2126, 3.05 g (85%) of a white broken glassy solid: 111? 118-126. (:; [PAN] 〇2 七 70.5 ° (c 0.1, CH2C12). IR (KBr) 336 1, 2943, 1737, 1659, 1537, 1426, 1220, 1174; 1Η NMR (CDC13) &amp; 7.80 (2H, m), 7.54-7.33 (4H, m)? 8.83 (brs), 5.44 (1H, m), 5.26o. l3 (1H, m), 4.66 (1H, m), 3.59-3.41 (1H, m), 2.97, 2.76 (2H, 2m.), 2.36 (2H, m), 1.98 (2H, m), 1.75 (2H, m). MS (ES ·, m / z) 344 (M _ 1, 100% ). (IS, 9S) 6,10-diketo-9 (fluoren-9-ylmethoxycarbonylamino) -1,2,3,4,7,8,9,10-octagas-611- * Answer [1,2-3] [1,2] -Digas hetero leather-1-chinic acid (212f), prepared from 211f, 96% yield in the same way as 212e: mp 120-126 ° C; [^] d25-72.5 ° (c 0.1, CH2C12)-IR (KBr) 3406, 2950, 1725, 1670, 1526, 1449, 1421, 1272, 1248, 1223, 1175, 761, 741; lH NMR ( CDC13) &amp; 7.76 (2H, m), 7.62-7.26 (4H, m), 6.07, 5.76 (2H, brs, d, d, 1 = 2.9), 5.46, 5.36 (1H, 2m), 4.79 · 4.54 ( 2H, m), 4.77 (2H, m), 4.21 (1H, m), 3.41 (1H, m), 2.89 (1H, m), 2.69 (1H, m), 2.35 (2H, m), 1 · 98, 1.73 (4H, 2m). MS (ES ·, m / z) 462 (M +-1,50%), 240 (100%). • 365 · (Go first read the back Note II Pack - a set of this page

Standards in the paper method are common in the national S standard (CNS &gt; A4 size (210 × 297 mm) 1235157 Λ7 B7 V. Description of the invention (R1-

(213) (c) R1 = MeCO (e) R1 = PhCO

(214) (c) R1 = MeCO 1

PhCO (ey R- [2RS, 3S (1S, 9S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -9- (acetamido) -6,10-dione -1,2,3,47,8,9,10-octahydro-611-daphtho [1,2-a] [l, 2] diazepine-1-carboxamide (213c), Synthesized from 212c, the same method as compound 213e can produce a mixture of diastereoisomeric compounds (193 mg, 36%) as colorless crystals: IR (KBr) 3272, 1799, 1701, 1682, 1650, 1555, 1424 , 1412, 1278, 1258, 1221, 1122, 937; lU NMR (CDC13) &amp; 7.41-7.28 (5H, m), 6.52 (0.5H, d), 6.38 (0.5H, d), Central Ministry of Economic Affairs扃 Non-industrial consumer cooperatives printed 6.22 (0.5H, d), 5.57 (0.5H, d), 5.36 (0.5H, s), 5.10-5.05 (1H, m), 5.00-4.45 (5.5H, m ), 3.19-2.84 (3H, m), 2.72-2.56 (1H, m), 2.51-2.25 (2H, m), 2.02 (3H, s), 1.98-1.70 (3H, m), 1.66-1.56 (3H , m); analysis C23H2SN407: C, 58 · 47; Η, 5.97; N, 11.86, measured 値: (: 231128) ^ 407 calculation 値: C, 58 · 47; Η, 5.97; N, 11.86. Measured value: C, 58 · 37; Η, 6.09; Ν, 11.47 · MS (ES-) 471 (Ml, 100%). Accurate estimate of the amount of C2i3H29N407 (MH +): 473.2036; real Test 値: 473.2012. Accurate estimated mass of C23H2SN407Na (Mna +): 495.1856; Measured 値: 495.1853. [IS, 9S (2RS, 3S)] 9-benzylamido-6,10-diketo-1,2, 3,4,7, S, 9,10 · 366 degrees Applicable to China S National Standards (CNS) A4% ^ (210X297 ^ 1235157 A7 B7 Superconstruction Ministry of China Ministry of Economic Affairs Bureau Shellfish Consumer Cooperative Cooperative Printing 5 、、 Description of the invention (running) octahydrooxy-5-cotetrahydrocran-3-yl) -6H-taffin i [ι, 2-4 [1,2] diazepine-1-carboxamide (2136). Tributyltin hydride (2.2 ml, 8.18 mmol) was added dropwise to the acid 212e (1.95 g, 5: 6 mmol), (3s, 2 RS) 3-sodium oxalanthine -2-Methoxy-5-fluorenyltetrahydrofuran (Chapman, Bioop · &amp; Med · Chem · Let ·, 2, ρ ·· 615-618 (1992); is 0 g '6.16 mmol) and ( Ph3P) 2PdCl2 (50 mg) in anhydrous CH2C12 (36 ml) in a solution of anhydrous nitrogen with stirring. After 5 minutes, 1-¾ benzotriazole (1.51 g, 11.2 mmol, 6.72 mmol) was added, and ethyl dimethylaminopropyl was added after cold simmering (ice / 冰 20). After 5 minutes of tritiated diimine hydrochloride (1.29 g, .6.72 mmol), the cooling bath was removed and the mixture was kept at room temperature for 4 hours, diluted with EtOAc, 1M HC1, brine, saturated aqueous NaHC03 And brine, dried (MgSO4) and concentrated. Flash chromatography (silica gel, 0-90% EtOAc / CH2Cl2) gave the product as a white solid, (2.34 g, 78%): IR (KBr) 3499, 1792, 1658, 1536, 1421, 1279, 1257, 1 123, 977, 699; 1H NMR (CDC13) & 7.81 (2H, m), 7.54-7.34 (8H, m), 7.1, 6.97, 6.89, 6.48 (2H, m, d, J 7.7, d, J = 7.5, d, J = 7.6), 5.57, 5.28 (1H, d, J = 5.2, s), 5.23-5.07 (2H, m), 4.93-4.42, 3.22-2.70, 2.51-2.26, 2.08-1.69, 1.22 (15Ht 5m) = Analytical calculation of CzsHso ^ 0? 0.5? 20: C, 61.87; H, 5.75; N, 10.32. Measured 値: C, 62.02; Η, 5.65; N, 10.25. [3 5 (15,95)] 3- (9-Ethylamido-6,10-tribenzyl-1,2,3,4,7,8,9,10-octahydro-6H-daparin [l, 2-a] [l, 2] diazepine-i-carboxyamido) -4-fluorenylbutyric acid (214c), synthesized from 213c, produced in the same manner as 214e from 213e, yielded Colorless crystals (140 mg, 99%): mp 90-180O; I &gt;] D22-114 • 367- This paper is a common Chinese National Standard (CNS) A4 specification (210X297 degree)-(Please read the precautions on the back first 4Ϊ

Order

1235157 Λ7 B7 Consumption Cooperation between Employees of the Central Standards Bureau of the Ministry of Economic Affairs Ⅴ. Description of Invention (365) (c 0.10, MeOH); IR (ΚΒι *) 3334, 3070, 2946, 1787, 1658, 1543, 1422, 1277, 1258 ; 1H NMR (d6-DMSO) &amp; 8.66 (1H? M), 8.18 (1H, d), 6.76 (1H, s), 5.08 (1H, m), 4.68 (1H, m), 4.30 (1H, m ), 2.92-2.70 (2H, m), 2.27-2.06 (3H, m)? 1.95-1.72 (4H, m), 1.85 (3H, s), 1.58 (2H, m): MS (ES-) 381 ( Ml, 100%); C16H, 3N407 (MH +) 's exact mass estimate: 383.1567. Found 値: 383.1548. [3S (1S, 9S)] 3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-da-mer H, 2-a] [1,2] diazepine-1-carboxamido) -4-ketobutanoic acid (214e). A mixture of 213e (2.29 g, 4.28 mmol), 10% Pd / c (1.8 g) and MeOH (160 ml) was searched for 6.3 hours under H2 and atmospheric pressure. After filtration and concentration, the hydrogenation was repeated with fresh catalyst (1.8 g). After 5 hours β was passed through the concentration and concentration, and the 'residue was triturated with dioxin, and washed with ether to produce 214e. White solid (1.67 g, 88%) mP 143-147O; ha] D23-125o (c0.2, CH3〇H) 3IR (KBr) 3391, 1657, 1651, 1538, 1421, 1280, 1258; Gore NMR (CD3OD ) &amp; 7.90 (2H, m), 7.63-7.46 (3H, m), 5.25 (1H, m), 5.08-4.85 (lH, m), 4.68-4.53 (2H, m), 4.33-4.24 (1H, m), 3.62-3.44, 3.22-3.11, 2.75-2.21, 2.15-1.92, 1.73-1.66 (1 1H, 5m) ^ Analyze the calculation of C21H24N407. H2〇 値: C, 54.54; Η, 5.67; N, 12.1 Measurements: C, 54 · 48; H, 5.63; N, 11.92 3 368- The iron scale of this paper is applicable to the Chinese National Standard (CNS) A4 specification (2i × x297 public love (please read the precautions of back cloud first)

Order

1235157 Λ / B7 V. Description of the invention (366)

(Please read the notes on back cloud first with laughter X &lt;) ¾¾¾ \ /% /) c d e

MeCO (217)

PhCH2OC〇

PhCO Μ Consumers' cooperation with the Central Government Bureau of the Ministry of Economic Affairs · Printing

[3S, 4RS (1 S, 9S)] 3- [9-Ethylamine-6,10-dibenzyl-1,2,3,4,7,8,9,10-octahydro-6 Pyrido [1,24] [1,2] diazepine-1-carboxamino) -5- (2,6-digaspyridyloxy) -4-trivalerate Xue (215 c), synthesized from 214c, can produce enantiomeric enantiomeric mixtures in the same way as compound 215e, as a white glassy solid (398 mg, 84%) IR (KBr) 3338, 2977, 1738, 1658, 1562, 1541, 1433, 1368, 1277, 1150; lU NMR (CDC13) &amp; 7.36-7.32 (3H, m), 6.91 (1H, d), 6.30 (1H, d), 5.15-5.09 ( 1H, m), 5.01-4,88 (1H, m), 4.61-4.44 (2H, m), 4.37-4.08 (3H, m), 3.32-3.18 (1H, m), 3.04-2.89 (1H,-- 369- The paper ft scale is applicable to the Chinese National Standard (CNS) A4 specification (210: &lt; 297 Public Love 1 Central Standard of the Ministry of Economic Affairs _ Bureau employee consumption cooperation Du Yin ¾ 1235157 A7 B7 V. Description of the invention (367) m) , 2.82-2.51 (4H? M), 2.39-2.29 (1H, m), 2.08-1.64 (4H, m), 2.02 (3H, s), analysis and calculation of C23H34N4Cl209: C, 52.26; H, 5.64; N, 8.7h Measured 値: C, 52.44; Η, 5.87; Ν, · 16. MS (ES-) 645/3/1 (Ml, 26%), 189 (81) , 134 (100) 〇 C2SR36N, C120 ^^ (MNa_), f mass calculation 値: 643.1938; measured 値: 643.1924 3 (MNa +), true mass estimate 値: 665.1757. Measured 値: 665.1756. '

[3S, 4RS (1S, 9S)] 3- (9-fluorenyloxycarbonylamino · 6,10-:,-1,2,3,4,7,8,9,10-octahydro-611-Da Geng [1,24] [1,2] Diazapyridine-1-chitamino) -5- (2,6-dichlorobenzyloxy) -4-hydroxypentanoic acid tert-butyl ester ( 2 1 5d), synthesized from 214d, in the same way as compound 215e, can produce a mixture of non-paraisomeric stereoisomers (657 mg, 70%) as a glassy white solid: IR (KBr) 3420, 3361, 2975, 2931 , 1716, 1658, 1529, 1434, 1367, 1348, 1250, 1 157, 1083, 1055; LH NMR (CDC13) &amp; 7.32 (8H, m), 7.14 (1H, d), 5.81 (1H, d), 5.15 (1H, m), 5.07 (2H, s), 4.74-4.65 (1H, m)? 4.58-4.22 (4H, m), 4.15-4.06 (1H, m), 3.72 (1H, m), 3.32- 3.21 (1H, m), 3.04-2.94 (1H, m), 2.69-2.52 (3H, m), 2.33 · 2 · 27 (1H, m), 1.95-1.59 (4H, m), 1.28 (9H, s); Analyze the calculation of C34H40N4Cl2O10. 5Η2O: C, 54.70; H, 5.54; N, 7.50. Found 値: C, 54 · 98; H, 5.59; N, 7.24. MS (ES-) 737/5/3 (M-ΐ, 22%), 193/1/89 (100). The true mass of C34H41N * 4Cl2O10 (M! T) is estimated to be 735.2120. Found 値: 735.2181. [3S, 4RS (1S, 9S)] 3- (9 · Amino-6,10-diketo · 1,2,3,4,7,8,9,10-octahydro-611-Da Pyrene [1,2-3] [1,2] Diazabenzene-1-Ji • 370 · This paper has a standard of gg family standard (CNS) A4 ^ grid (2 丨 0 · × 297 mm) ( (Please read the caution page on the back first)

1235157 Λ7 Β7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Ⅴ 5. Description of the Invention (Norwegian) Lumen) -5- (2,6-dichloro; oxy) -4-Thrylvaleric acid (215e), tributyltin hydride (4.6 ml, · 11.4 mmol) was added dropwise to (3S, 4RS) (N-allyloxycarbonyl) -3-amino-5- (2,6-di Chlorofluorenyl) -4-hydroxy ~ valeric acid tertiary-butyric acid (prepared by a method similar to Revesz et al ·, Tetrahedron · Let ·, 35, pp. 9693-9696 (1994) (2.64 g; 5.7 Millimoles) (? 113?) 2? (1 (: 12 (50 mg), CH2C12 (100 ml) and DMF (20 ml) in a stirred mixture at room temperature. The mixture was stirred for another 10 minutes, after which Add 1-hydroxybenzotriazole (1.54 g, 11.4 mmol of the mixture and cool to (TC, add ethyldimethylaminopropylcarbonyldiimide i acid (1.31 g: 6.84 mmol)). Mixture Keep at this temperature for 15 minutes and at room temperature for 17 hours. The mixture was diluted with EtOAc (300 mL), 1M HC1 (2 X 100 mL), saturated aqueous NaHC03 (3 X 100 mL) and brine (2 X 100 ml) washed and dried (Mg S04) and concentrated. The residue was purified by flash chromatography (20% (MeOH / CH2Cl2)) to yield 3.24 g (81%) of 215e as a glassy solid: mp 106-110 ·; IR (KBr) 3354 , 1737, 1659, 1531, 1433, 1276, 1150; NMR (CDC13) &amp; 7.80 (2 (, dd, J = 7.9 and 1.5), 7.75-7.26 (6H, m), 7.14-6.76 (2H, m), 5.30-5.02 (2H, m), 4.63-4.11 (5H, m), 3.44-3.26 (2H, m), 3.10-2.30 (5H, m), 2.10-1.60 (5H, m), 1 · 44 (9H, s); Analyze the calculation of C33H3SCl2N4 0 · 75 · 20Η: C, 55.12; Η, 5.54; N, 7.79; Cl, 9.86 ef Test: C, 55.04; Η, 5 · 34; Ν, 7.80; Cl, 10.24. MS (ES +) 709/7/5 (Μ +1), 378 (59), 324 (64), 322 (100). [35 (13,93) ] 3- (9-Ethylamido-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6 嗒 -dacrogen [l, 2-a ] [l, 2] Diazepine-induced amido group) -5 《2,6-Di.371-(Please read the precautions on the back page first) --install, ν- 口

This paper size is applicable to the Chinese national sample (zero known) 8 (4) (210 &gt; &lt; 297 mm) 1235157 A7 B7 V. Description of the invention (369) Chloroethoxy) 4-ketovalerate Tri-butyl ester (216c) was synthesized from 215c in the same manner as compound 216e. Glassy white solid (300 g, 83%): mp 80-125 ^; [a] D23-89.1 (c 1.08, C ^ Cl ^; lR (KBr) 3356, 2979, 2935, 1740, 1659, 1532 , 1434, 1369, 1276, 1260, 1151; lH NMR (CDC13) &amp; 7.39-7.32 (3H, m), 7.13 (1H, d), 6.34 (1H, d), 5.22-5.17 (1H, m), 5.11 (1H, d), 5.04 (1H, d), 4.99-4.88 (2H, m), 4.64-4.52 (1H, m), 3.29-3.11 (1H, m), 3.05- 2.67 (4H, m), 2.39-2.29 (1H, m), 2.02 (3H, s), 1.98-1.75 (4H, m), 1.46 (9H, s); Analysis of the calculation of C2S034N4C1209 値: C, 52.42; H, 5.34; N, 8.73 ^ Measured 値: C, 52 · 53; H, 5.70; N, 7.85, MS · (ES-) 643/41/39 (Ml, 100%). C23H35N4Cl2 09 (MH +) true mass estimate 値: 641.1781 Measured 値: 641.1735. Calculated for analysis of C28H34N4Cl2ONa (Mna +) 66: 663.1601. Measured 値: 663.1542.. [3S (1S, 9S)] 3- (9-fluorenoxycarbonylamino-6,10-dione -L, 2,3,4,7,8,9,10-octa.Hydroxy-6H-dacrogen [l, 2-a] [l, 2] diazepine-l-carboxyamido ) -5- (2,6-dioxofluorenyloxy) -4-ketovaleric acid tert-butyl ester (216d), synthesized from 215d in the same manner as compound 216e, yielding 216d White glassy solid (688 mg '68%); mp 90_170eC; [pan] D25-83.4 (c 1.01, CH2C13); IR (ΚΒγ) 3338, 2933, 1736, 1670, 1525, 1433, 1417, 1368, 1258 , 1 151, 1056, 1031; lE NMR (CDC13) &amp; 7.33 (8H, m), 7.18 (1H, d), 5.65 (1H, d), 5.19 (1H, m), 5.09 (2H, s), 4.98-4.86 (1H, m), 4.82-4.49 (2H, d), 3.30-3.07 (1H, m), 3.05- 2.59 (4H, m), 2.42-2.27 (1H, m), 2.18-1.59 (5H , m), 1.42 -372- This paper's standard is applicable to China National Standard (CNS) A4 specification (2 丨 0X297 mm) (please read the meaning of the back of the cloud to write a large page—install large-

Du Yin, employee consumption cooperation of the Central Bureau of Standards of the Ministry of Economic Affairs «. 1235157 Λ7. _____ B7 ^ ___ V. Invention (37D) (9H, s); MS (ES-) 737/5/3 (M? 13%), 185 (100) 3 [3 $ (15,95)] 3- (9-fluorenylamino-6,10-diketo-1,2,3,4,7; 8,9,10-octa Hydrogen · 6Η-pyrido [l, 2-a] [l, 2] diazapyridine-1-carboxyfluorenyl) -5- (2,6-dichlorofluorenyloxy) -4-one Tertiary-butyl valerate (2116e). Dess-Martin reagent (3.82 g: 9.0 mmol) was added to a stirred solution of alcohol 215e (3.17 g; 4.5 mmol) in CH2C12 (100 ml). The mixture was stirred for 1 hour, diluted with EtOAc (300 mL), washed with a mixture of 1: 1 saturated Na2S203 and absolute NaHC03 (100 mL) and washed with brine (100 mL) .3 The mixture was dried (MgS04) and concentrated. Residues were purified by flash chromatography, which produced 2.2 g (70%) of 2166 as a colorless solid: 1 ^ 102-107 \ :; ["] 1:) 32-. Red seal for work-consumption cooperation ¾ (Please read the precautions for Beyond Cloud and fill in the two) 82.5 (c 0.1, CH2Cl2); IR (KBr) 3374, 2937, 1739, 1661, 1525, 1433 , 1275, 1260, 1 152; lR NMR (CDC13) &amp; 7.85-7.78 (2H, m), 7.57-7.32 (6H, m), 7.09 (1H, d, J = 7.9), 7.01 (1H, d, J 7.3), 5.25-5.16 (1H, m), 5.16-5.05 (1H, m), 5.15 (1H, d), 5.03 (1H, d), 4.99-4.90 (1H, m), 4.68-4.54 (1H , m), 3.31-3.17 (1H, m), 3.17-2.72 (4H, m), 2.45-2.35 (1H, m), 2.30-1.66 (5H, m), 1.44 (9H, s); analysis C33H36CI2N4O9 · Calculation of 0.5 · 20Η. C, 55.62, H, 5.23; N, 7.86; Cl, 9.95. Found: C, 55.79; H, 5.15; N, 7.80; Cl, 9.81 ^ MS (ES +) 729/7/5 (Μ + Na), 707/5/3 (Μ + 1), 163 (100%). [3S (IS, 9S)] 3- (9-ethylamino -6,10-'difluorenyl-1,2,3,4,7,8,9,10-octahydro-6 stilbene [1,2-3] [1,2] diazabenzene -Carboxamido) -5- (2,6-dioxofluorenyloxy) -4-ketopentanoic acid (2 17c), synthesized from 216c in the same way as compound 217e, as a glassy white solid U66 mg, 66%): mP 85- • 373 · This scale is applicable to the tgg family standard (CNS M4 is present (210X297 mm) Printed by the Central Bureau of Standards, Ministry of Economic Affairs, Consumer Goods Cooperatives ¾ 1235157 V. Description of Invention (371) 175 ° C; [Pan] D25-156 (c 0.13, Me〇H); IR (KBr) 3373, 2929, 1742, 1659, 1562, 1533, 1433, 1412, 1274, 1266, 1223, 1 197, 1 145, 1138; lH NMR (CD3OD) &amp; 7.38 (3H, s), 5.14-5.03 (1H, m), 4.49-4.32 (2H, m), 3.50-3.27 (1H, m), 3.11-2.92 (1H, m), 2.84-2.62 (2H, m), 2.46-2.11 (2H, m), 2.05-1.46 (5H, m) , 1.92 (3H, s); analysis C24H26N4C1209 · H20: C, 47.77; H, 4.68; N, 9 · 29. Found 値: C, 47.75; N, 4.59; N, 9.07. MS (ES +) 627/5/3 (M + K, 21%), 611/9/7 (M + Na, 87), 5 89/7/5 (M + +1, 71), 266 (100) ; C24H27N4CI2O9 (MH +) confirmed quality estimate: 585.1155. Found 値: 585.1 134. [3S (IS, 9S)] 3- (9-fluorenyloxycarbonylamino-6,10-diketo · 1,2,3,4,7,8,9,10-octahydro-611-dahu And [1,24] [1,2] diazepine-1-carboxamido) -5- (2,6-dichlorobenzyloxy) -4-ketovaleric acid (21 7d), Synthesized from 216d in the same way as compound 217e, a white glassy solid (310 mg, 96%) can be produced: mp85-110 ° C; k] D24-85.9 (c 0.13,

MeOH); IR (KBr) 3351, 2945, 1738, 1669, 1524, 1433, 1258, 1 147, 1057; ικ NMR (CD3〇D) &amp; 7.56 (4Η, m), 7.45 (5H, m), 5.32 (2H, m), 5.20 (2H, s), 4.76-4.48 (3H, m), 3.65-3.38 (3H, m), 3.27-3.09 (2H, m), 3.03-2.89 (2H, m), 2.65 -2.24 (3H, m), 2.19-1.62 (5H, m); MS (ES-) 679/7/5 (Ml, 100%): Exact mass of C30H31N4Cl2O10 (MH +) · Estimated 値: 677.1417. Found 値: 677.1430. [3S (IS, 9S)] 3- (9-fluorenylamino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-611-da [1,24] [1,2] Diazapyridine "-Carboxylamido) -5- (2,6-Di-374-Chinese standard for paper scale (CNS) A4 (210X297) (B)) &quot;

1235157 A7 ____B7 · One __ V. Description of the Invention (372) Chlorobenzyloxy) -4-pentanoic acid (217e), TFA (25 milligrams) was added dropwise to Xue 216e (2.11 grams, 3.0 millimoles The 5 mixture in the ice-cold solution was stirred at 0 ° C for 20 minutes, and then the β mixture / evaporated to dryness at room temperature for 1 hour, and then co-evaporated three times with acetamidine. Anhydrous acetamidine (50 ml) was added and filtered to obtain 1.9 g (98%) of 217e as a colorless solid: mp 126-130 ° C; [pan] d30-122.0 (c 0.1, MeOH); IR (KBr ) 3322, 1740, 1658, 1651, 1532, 1433, 1277, 1150; lE NMR (D6-DMSO) &amp; 8.87 (1H, d, J = 7.4), 8.61 (1H, d, J = 7.8), 7.92- 7.86 (2H, m), 7.65-7.43 (6H, m), 5.25-5.12 (3H, m), 4.94-4.60 (2H, m), 4.44-4.22 (1H, m), 3.43-3.10 (1H, m ), 3.00-2.52 (3H, m), 2.45-2.10 (3H, m), 2.10-1.75 (2H, m), 1.75-1.50 (2H, m); analyze the calculation of C29H2SC12N409 · 1H2020: C, 52 · 34; H, 4.54; N, 8.42; Cl, 10.66. Found 値: C, 52.02; H, 4.36; N, 8.12; Cl, 10.36. MS (ES-) 649/7/5 (M-1), 411 (100%). (Please read the meaning of VS7 and then fill out this page) 51

• 375 · The standard of this paper is applicable to China's National Standards (CNS) A4 (210X297), 1235157 Β7 Printed by the Ministry of Economic Affairs of the Central Bureau of Standards of the People's Republic of China on the Printing of Five 'Inventions (373) [3S · 4RS (IS , 9S)] 4- [5- (2,6-dichlorophenylyzazole · 2 · kib 3- (61〇-diamidin ·, methyl diamylamine, 8,9,10- Octahydro &amp;] [1,2] diaza leather-1-carboxamido) ice-chityl butyric acid third_butt § (21 ribs) 'Prepared from acid 212 in a similar manner to compound 215e { ) And 99, which can form non-nailed trisomers (865 g, 80%) as colorless solids: IR (KBr) j298, 2974, 1723, 1659, 1544, 1518, 1430, 1394, 1370, 1328 , 127j, 1256, 1 156, 1134; lH NMR (CDC13) &amp; 7.45-7.28 (4H, m), 7.26-7.15 (2H, m), 5.26 · 5 · 1〇 (2H, m), 4.80 -4.67 (1H, m), 4.59-4.42 (2H, m), 3.32-3.17 (1H, m), 2.96 (3H, 2xs), 2.93-2.79 (1H, m), 2.71-2.53 (4H, m) , 2.38-2.28 (1H, m), 2.07-1.81 (4H, m); Analysis of the calculation of C28H35N5C1209S · 0.5H2O 値: C, 48.21; H, 5.20; N, 10.03. Found 値: C, 48.35; H, 5.26; N, 9.48. MS (ES +) 714/2/0 (M + Na, 25%), 692/90/88 (M + + 1, 51), 636/4/2 (3 8), 246 (100) a C28H36N5C1209S (MH + The true quality estimate 値: 688.1611. Found 値: 688.1615. [3S (IS, 9S)] 4- [5- (2,6-Difluorophenyl) -pyrazole-2 · yl] -3- (6,10-diketo-9-fluorenylsulfonamide -L, 2,3,4,7,8,9,10-octahydro-6H · dapyrido [l, 2-a] [l, 2] diazapyridine-1-carboxamido) · 4 · Ketobutyric acid third-butyric (219b), prepared from 212b in a similar manner to compound 216e, with white powder (675 mg, 81%): mp 100-20 (TC; [a] D24 -84.9 (c 1.01, CHP1 # IR (KBr) 3336, 2978, 2936, 1719, 1674, 1510, 1433, 1421, 1369, 1329, 1274, 1257, 1155, 991, 789; ^ NMR (CDCi3) ^ 7.47-7.38 (4H, m), 7.24 (1H, d), 5.61 · 5.53 (1H, m), 5.48 (1 shirt, d), 5.38〇30 (1H, m) , 4.67-4 · 45 (2H, m), 3.48-3.18 (2H, m),

(Please read the notes on the back before filling out this page) 0 "Fill in too much '

The scale of this paper is applicable to Chinese national standard (CNS) A4 (210X297 mm) 1235157 A / B7 V. Description of the invention (374) 3.04-2.90 (2H, m)? 2.97 (3H, s), 2.69-2.54 (1H, m), 2.42-2.32 (1H, m), 2.22-2.15 (1H, m), 2.07-1.93 (3H? M), 1.71-1.65 (2H, m), 1.38 (9H, s); analysis Calculation of C28H33N3C12〇9S: C, 48.98; H, 4.84; N, 10.2; S, 4.67. Found: C, 48.73; H, 4.95; N, 9.65; S, 4.54 ^ MS (ES +) 692/90/88 (M ++ 1, 100%), 636/4/2 (71) -C2 « H34N5C1209S (MH's exact mass estimate: 686.1454. Found: 686.1474. [35 (15,95)] 4- [5- (2,6-dichlorophenyl) pyrazol-2-yl] -3- (6,10-diketo-9-methylsulfonamido-1,2,3,4,7, -8,9,10-octahydro-61 1,2] diazapyridine-1-carboxamido) -4-ketobutyric acid (220b), prepared from 219b in a similar manner to compound 217e, as a light cream powder (396 mg, 870 / 〇) : mp 100-20CTC; [a] D27-129 (c 0.12, MeOH); IR (KBr) 33 10, 3153, 1713, 1667, 1557, 1510, 1432, 1421, 1329, 1273, 1258, 1221, 1193, 1153, 1 134, 992, 789; lH NMR (d6 DMSO)

(Please read the Precautions of Back® before this page W &amp; 7.88 (1H, s), 7.81-7.60 (4H, m), 5.49-5.28 (1H, m), 5.24-5.14 (1H, m), 4 46-4 · 22 (2H, m), 3.30-3 · 03 (2H, m), 2.97-2.76 (3H, m), 2.96 (3Ht s), 2.46-2.24 (1H, m), 2.16 -2.05 (1H, m), 2.03-1.78 (3H, m), 1.68-1.46 (2H, m); MS (ES-) 632/30/28 (M -1, 68%), 149/7/5 (100). C24H26N5C12〇9S (MH's exact mass estimate: 630 · 0828. Measured: 630.0852. • 377- This paper is a universal medium-sized domestic standard car (CNS) A4 (2I0X297 mm) 1235157 AT B7 V. Description of the Invention (375)

0

223e Rx = phc〇

• End page) Order [35,4115 (15,93)] 4- (5,7-Digas benzo "oxazol-2-yl) -3- (6,10-diamidino-9-methyl Sulfonylamino-1,2,3,4,7,8,9,10-octahydro-611-, pyrido [1,2-a] [l, 2] diazepine-1- Carboxamidine) tert-butyl 3-hydroxybutyrate (221b), prepared in the same manner as compound 215e, from acids 212b and 13S, 4RS) N- (allyloxycarbonyl) -3-amine. 4-Hydroxy-4-hydroxy-4- (5,7-digas benzoxazol. 2-yl) butyric acid tertiary-butyl ester (204), a mixture of diastereoisomeric fluorene isomers (460 Mg, 70 ° /.) Glassy: IR (film) 3325, 1725, 1664, 1453, 1399, 1373, 1327, 1274, 1256, 1 155; lU NMR (CDC13) & 7.57 (1H, m), 7.36 (2Hr m), 6.06 (1H, t), 5.29 (2H, m), 4.79 -378- The size of this paper is applicable. § Country (窣 ^) 戍 4 specifications (210 father 297 mm &gt;

Printed by the Consumer Procurement Cooperative of the Central Provincial Bureau of the Ministry of Economic Affairs «. 1235157 A7 B7 Printed by the Procurement Consumer Cooperative of the Central Standard Administration of the Ministry of Economy j (1H, m), 2.97 and 2.94 (3H combined, 2 xs), 2.9-2.4 (4H, m), 2.30 (1H, m), 1.96 (4H, m), 1,41 &amp; 1.37 (9Hcombined, 2xs) aMSES, Da / e 660 (Ml) · Cl33 100%, 662 (M-1) · Cl37. (3S, 4RS (IS, 9S)) 3- (9-fluorenylamino-6,10-difluorenyl.1,2,3,4,7,8,9,10-octahydro-611-Da Geng Ben [1,2-3,1,2] Diazapyridine-1-ene §S Amine) -4- (5,7-Digas, and O 2 -yl) -4 _short Butyric acid tert-butyric acid (221e), prepared in a manner similar to that used for compound 215e, from acids (2i2e) and (3S, 4RS) N- (allyloxyalkyl) -3-amino group-4 3- (5-, 7-dichlorobenzimidazol-2-yl) butyric acid tertiary-butyl ester (204), which can produce a mixture of non-parastereoisomers (613 mg, 87%) Glassy: IR (film) 3328, 1729, 1660, 1534, 1454, 1422, 1399, 1276, 1254, 1155; lU NMR (CDC13) &amp; 7.80 (2H, d), 7.60-7.35 (5H, m), 7.05 (2H, m), 5.13 (3H, m), 4.74 (1H, m), 4.51 (1H, m), 3.25 (1H, m), 3.1-2.6 (5H, m), 2.33 (1H, m), 2.1-1.5 (5H, m), 1.43 and 1.41 (9H combined, 2 xs). MS ES + Da / e 688 (M + 1) + Cl35 55%, 690 (M + 1) + Cl37 35 %, 328 100%. [3S (IS, 9S)] 4- (5,7-Digas Benzozol-2 · yl) · 3- (6,10-Dibenzyl-9-methylsulfo Amino-1,2,3,4,7,8,9,10-O-argon-611-dapyrido [1,2-3] [1,2] diazapyridine-1-carboxamido -4-ketobutyric acid tert-butyl ester (222b), prepared in a similar manner to compound 216e from 221b 'as a colorless glass (371 mg, 86%):] d26-81.0 (c 0.1, CH2C12): IR ( ΚΒγ) 3324, 2979, 2936, 1726, 1664, 1394, 1370, 1328, 1 155, 991; lH NMR (CDC13) &amp; 7.78 (1H, d), 7.57 (2H, m), 5.87 (1H, d) , 5.69 (1H, m), 5.47 • 379- The standard of this paper is universal § National Standard (CNS) A4 specification (210 × 297 mm) (Please read the precautions on the back first—κι ^ — This page order

1235157 Λ: B7 V. Description of the invention, (377) (1H, m), 4.55 (2H, m), 3.24 (2H, m), 3.0 (5H, m + s), 2.59 (1H , M), 2.39 (1H, m), 2.2-1.7 (4H, m), 1.65, (1H, m), 1.40 (9H, s) 〇 / [35 (15,93)] 3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octaargon-6H- ", and [i, 2-a] [l , 2] Diazapyridine-1-carboxamido) -4- (5,7-diazidobenzoyl, oxazolyl-2-yl) -4-ketobutyric acid tert-butyl ester (222e), Prepared from 221e in the same way as compound 2 16e, it can produce colorless glass (480 mg, 84%): [a] d25-86.4〇 (c 0.1 CH2C12); IR (KBr) 3337, 2978, 2938, 1728, 1657 , 1534, 1456, 1422, 1395, 1370, 1277, 1250, 1154; lH NMR (CDC13) &amp; 7.80 (3H, m), 7.50 (4H, m), 7.20 (1H, d), 7.02 (1H, d ), 5.60 (1H, m), 5.28 (1H, m), 5.15 (1H, m)? 4.11 (1H, m), 3.34 (2H, m), 2.96 (3H, m), 2.40 (1H, m) , 2.20 (1H, m), 1.92 (2H, m), 1.67 (2H, m), 1.38 (9H, s) ^ MS ES · Da / e 684 (M-I) · Cl35 47%, 686 (M- 1) · Cl37 32%: [35 (15,95)] 4- (5,7-digas benzoxazol-2-yl) -3- (6,10-diaphthyl-9-formaldehyde Sulfonamido-1,2,3,4,7,8,9,10-octahydro-6H-dapyrido [l, 2-a] [l, 2] diazabenzene-1-carboxamidine Amine) -4-ketobutyric acid (223b), prepared from 222b in a similar manner to compound 217e, can be obtained with a white solid (257 mg, 78%): [a] D2M 05.7 ° (c 0.1, CHflJ; IR (KB〇3321, 1723, 1663, printed by the Consumers' Cooperatives of the Central Government Bureau of the Ministry of Economic Affairs 1407, 1325, 1151, 992; lH NMR (D6-DMSO) &amp; 8.96 (1H, d), 8.18 (1H, d ), 7.96 (1H, d), 5.50 (1H, m), 5.15 (1H, m), 4.30 (2H, m), 3.06 (2H, m), 2.87 (5H, m + s), 2.29 (1H, m), 1.99 (4H, m), 1.56 (2H, m) 3 [35 (13 95)] 3- (9- + donylamino-6,10-diamidino-1,2 ,. ， 4,7,8,9,10-Eight-380 · The winning bid (CNS) for this paper ft ruler production specification (210X 297 mm) 1235157 A7 B7 V. Description of the invention (378) Hydrogen_611- [1,2_3] [1,2] Diazapyridine-1-carboxamido) -4- (5,7-digasbenzoxazol-2-yl) -4-ketobutanoic acid (223e ), Similar to the method used for compound 217e, prepared from 222e, can produce light cream gf 鳢 (311 mg, 78%): mp 167-180eC; [a] D23-88.6 ° (c 0.1 C ^ Cl ^; IR ( KBr) 3331, 1724, 1658, 1534, 1458, 1421, 1279, 1256, 991; Go NMR (CDC13) &amp; 7.77 (4H, m), 7.4 (5H, m), 5.57 (1H, bs), 5.33 ( 1H, bs), 5.47 (1H, q), 4.56 (1H, bd), 3.60 (2H, m), 3.20 (3H, m), 2.76 (1H, m), 2.36 (1H, dd), 2.0 (3H , m), 1.66 (1H, m). MS ES Da / e 628 (M-1) · 35 7%, 630 (M-1) · Cl37 2.3%, 584 100%.

224e = PhCO / X = S 226e = PhCO, X = S 225e Ri = PhCO, X = O 227e ~ PhCO, X = 0 Printed by the Central Government Bureau of the Ministry of Economic Affairs, Shellfish Consumer Cooperatives [35 (15,95) 3 -(9-benzylamidinyl-6,10-dicyryl-1,2,3,4,7,8,9,10-octahydro-6H-daparo [l, 2-a] [l , 2] -Diazapyridine-1-carboxamido) -5- (2-Gaphenyl) methylamidino-4-ketovaleric acid tert-butyridine (224e). 1. · Hydroxybenzotris (0.23 g, 1.71 mmol) and ethyl dimethylaminopropyl Lingimide hydrochloride were added to the acid 212e (0.295 g, 0.853 mmol) in THF (5 3) After adding water (0.5 ml) to the stir-fry solution for 3 to 5 minutes, add (3S) -381-degrees to the Chinese national standard (CNS) Α4 specification (210X297 public) ~ &quot; 1235157 Λ 7 _ __Β7 V. Description of the invention (379)

3-Allyloxycarbonylammonium ο- (2-chloro-phenyl) fluorenylthio-4-ketovalerate tert-butyl il (123, 0.478 g, 1.02 mmol) and (PPh3) 2PdCl2 (20 mg ) In Ding HF (2 ml). Hydrogen-tributyltin (0.65 ml, 2.33 mmol) was added dropwise over 20 minutes and kept for 4.5 hours, then diluted with EtOAc, washed with 1M HC1, clear water, NaHC03 saturated aqueous solution, and then washed with saline. (MgS04) and concentrated. The residue was triturated with hexane several times, it was decanted and discarded, and then purified by flash chromatography (1CM00% Et〇Ac / CH2Cl2) to produce 0.2 g (35%). White glassy solid mp 70-72 ° C; [c] D26-S2.5 ° (c 0,02, CH2Cl2). IR (KBr) 3404, 1726, 1660, 1 534, 1524, 1422, 1277, 1254, 1 154; lK NMR (CDC13) &amp; 7.83-7.78 (2H, m), 7.7, 7.75-7.32, 7.26-7.20 (7H, 3m), 7.12 (1H, d, J = 8.2), 7.01 (1H, d , J = 7.3), 5.23-5.08 (2H, m), 5.03-4.94 (1H, m), 4.62 (1H, dt, J = 14.5), 3.78 (2H, m), 3.38-3.29 (1H, m) , 3.26 (2H, s), 3.06-2.82 (4H, m), 2.71 (1H, dd, J = 17.2, 4.5), 2.39 (1H, dd, J = 13.2, 6.5), 2.15-1.83, 1.73-1.63 (5H, m), 1.45 (9H, s). Analysis of c33H39ClN407Si Calculated 値: C, 59.05; H, 5.86; N, 8.35. Measured 値: 59.0; H, 5.80; N, 7.92. Printed by the Central Procurement Bureau of the Ministry of Work and Consumer Cooperatives ¾ [ 3RS, (IS, 9S)] 3- (9-benzylamido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-daparin [l, 2-a] [l, 2] Diazapyridine-1-carboxamido) -5- (2-Gasphenylmethoxy) -4-ketovaleric acid tert-butyl ester ( 225e), using a method similar to compound 224e, prepared from acid 212e and · (3S) N- (allyloxycarbonyl) -3 · amino-5- (2-aminophenylmethoxy) · 4-keto Tertiary-butyl valerate (201), yielding 40 mg (23%) of a glassy solid: ¾ NMR (CDC13) &amp; 7,83-7.73 (2H, m), 7.67-7.10 (9H, m) , 5.23-5.09 (2H, m), 4.59 (1H, m), • 382 · This paper has a ft standard common Chinese national standard (CNS) M specification (2 丨 OX297 mm) 1235157 Λ7 B7 Central Standards Bureau of the Ministry of Economic Affairs Printed by employee consumer cooperatives V. Description of invention (380) 4.45-4.22 (2H? M)? 3.7-3, 19, 3.08-2.72, 2.71-2.47, 2.05-1.85, 1.72-1 · 61, 1.45-1.26 (20H, 6m). [35 (15,95)] 3- (9-Amido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-Dagen And [l, 2-a] [l, 2] diazafluoren-1-carboxylamino) -5 · (2 · chlorophenyl) methylthio-4-fluorenylpentanoic acid (226e), A method similar to compound 21, prepared from 224e, yields 0.22 g (81%) of a white solid: mp 95-10CTC; [a] D23-95.6C (c 0.2, CH2Cl2). IR (KBr) 3393, 1720, 1658, 1529, 1422, 1279; lU NMR (D6-DMSO) &amp; 8.80 (1H, d, J = 7.5), 7.89 (2H, m), 7.7 (1H, d, J = 7.7), 7.56-7.28 (7H, m)? 5.10 (1H, m), 4.87-4.73 (2H? M), 4.39 (1H, m), 3.77 (2H, m), 3.44, 3.35 (2H, + H20, 2m), 2.97-2.56, 2.2, 1.92, 1.61 (11H, 4m): Analysis of the calculation of C29H31C1N407S 0 · 5Η2〇Ο: C, 55 · 02; H, 5.10; N, 8.85, Measured 値: C, 55.00; H, 5.09; N, 8.71. [3RS, (IS, 9S)] 3 · Amino-6,10-diketo-1,2,3,4,7,8,9,10-octaamine-6Η · ^ α well and [ l, 2-a] [l, 2] Dioxazi-1-octylamino) -5- (2-lactoepoxymethoxy) -4-ketovaleric acid (227e), similar to the compound 217e This method was prepared from 225e. The product was further purified by flash chromatography (0_5% MeOH / CH2Cl2) to yield 19 mg (81%) of a glassy solid: ¾ NMR (CDCI3) &amp; 7.79 (2H, m), 7.66- 7.18 (9H, m), 5.30-5.10 (2H, m), 4.85 (1H, m), 4.65 (2H, m), 4.53 (1H, m), 4.28 (2H, m), 3.28, 3.01, 2.72, 2.33, 1.94, 1.60 (11H, in). MS (ES ·, m / z) 597 (M + -1, 100%). -383- The standard of this paper is applicable to Chinese National Standards (CNS) 6 and 4 grid U10X297 mm) (please read the items on the back and then 111 ^ this tile) • Binding

1235157 A7 B7 V. Description of the invention (381) 0

(Please read the precautions for Back Cloud J—Order [3RS, 4RS (IS, 9S)] 3- (9-fluorenyl-6,10-diketo-1,2,3,4,7 , 8,9,10-octahydro-611-dapyrido [1,24] [1,2] diazapyridine-1-eneamido) -5-fluoro-4-oxopentanoate Butyl ester (228e). Hydroxybenzotris (0.23 g, 1.68 mmol) followed by ethyl dimethylaminopropyl phosphonium amine acid (0.21 g, 1.09 mmol) was added to · Acid 212e (0.29 g, 0.84 mmol) in a solution of CH2C12 (3 ml) at room temperature. The mixture was held for 10 minutes, and then (3RS, 4RS) 3-aminoo-fluoro-4-hydroxy Tertiary valeric acid (Revesz, L. et al. Tetrahedron Lett., 52, pp. 9693-9696 -384- The standard of this paper is applicable to the national standard Xin (CNS) A4 specification (210 × 297 mm)

Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs of the People's Republic of China. 1235157 A7 B7 Du Yin of the China National Standards Bureau of the Ministry of Economic Affairs. (3 ml) followed by 4-dimethylaminopyridine (10 mg). The solution was stirred for 17 hours, diluted with EtOAc, washed with 1M HC1, brine, saturated aqueous NaHC03 solution and brine again, dried (MgS04) and concentrated. The residue was purified by flash chromatography (50-100% EtoAc / CH2Cl2 and 5% MeOH / EtoAc) to yield 0.25 g (56%) of a white glassy solid (KBr) 3343, 1726, 1658, 1536, 1426, 1279, 1257 , 1 157; LH NMR (CDC13) &amp; 7.84-7.79 (2H, m), 7.57-7.40 (3H, m), 7.05-6.92, 6.73 (2H, 2m), 5.17-5.04 (2H, m), 4.56 , 4.35-4.21, 4.04 (5H, 3m), 3.36, 3.09 ^ 2.34, 2.00 (11H, 3m), 1.46 (9H, s). Analyze the calculation of C26H35FN407 · 0.5 · 20. 値: C, 57 · 45; H, 6.65; N, 10.31. Found 値: C, 57.64; H, 6.56; N, 10.15. [3RS, 4RS (1S, 9S)] 3- (9-T amido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-611-da Pyrene [1,24] [1,2] diazapyridine-1-carboxamido) -5-fluoro-4-oxopentanoic acid third-butyl ester (229e) was prepared from a compound similar to 2116e 228c. Purified by flash chromatography (30-50% EtOAc / CH2Cl2) to obtain the product as a white glassy solid (0.194 g, 89%): IR (KBr) 3376, 1728, 1659, 1529, 1424, 1279, 1256, 1156. [3RS, (IS, 9S)] 3- (9-benzylideneamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6Η-da 啩And [1,2-a] [l, 2] diaza · heterofluorene-1-carboxamido) -5-fluoro-4-ketopentanoic acid (23〇e), similar to the method of compound 21: 7e Prepared from 229e, yielding 23 0e as a white glassy solid (1000/0) mp 105-125 ° C; [a] D23-91.4. (C 0.72, CH3OH). IR (KBr) 3336, 1789, 1737, 1659, 1535, -385- (Read the notes of δ before reading the poem 3Fill in this book

The national standard (CNS) of this paper method is in general. A · 4% grid (210X 297 mm) 1235157 A7 B7 V. Description of the invention () 1426, 1279, 1258, 1186; 1E NMR (GD3〇D) &amp; 7.71- 7.68 (2H, m)? 7.37-7.23 (3H? M), 5.02, 4.88-4.63, 4.37-4.0 (6H, 3m), 3.30, 2.97, 2.68-2.60, 2.37-1.54 (11H, 4m). MS (ES., M / z) 475 (M + -1, 1000 / 〇). O n ρΛ

Consumption Cooperation of Employees of Zhongli Bureau of the Ministry of Economic Affairs · Du Yinzhuang [3S (1S, 9S)] 9- (fluorenylamino) -3- [6,10-diketo-l, 2,3,4, 7,8,9,10-Octahydro-6H-dalopano [l, 2-a] [l, 2] diaza-l-carboxamido] -3-cyanopropanoic acid methyl ester ( 23 le). N-fluorenylmethoxy-carbonyl-3-amino-3-cyanopropanoic acid methyl ester (EP0547699A1, 3 85 mg, 1.1 mmol) treated with 17 ml of diethylamine 3 at room temperature 1 · After 5 hours, the solution was concentrated and the residue was chromatographed on crushed gel (3% methanol in CH2C12) and a free-state amine was formed as a pale yellow oil. To this oil and hydroxybenzotriazole (297 mg, 2.19 mmol) in a solution of DMF (5 ml), ethyl dimethylaminopropylcarbodiimide (232 mg , 1.21 millimoles, 1.1 equivalents) plus (is, 9S) 9- (Word turtle amino H6,10-diketo-1,2,3,4,7,8,9'10-octahydro- 611-Da "Jing [1,2-a] [l, 2] diazepine-I-carboxylic acid (212e). Stir for 5 minutes at (TC, and then overnight at room temperature, the mixture was mixed with CHfl2 Diluted (50 ml) and the resulting solution was successively .1M HC1 (2 X 30 ml), H2 0 (30 ml), 10% -386 each paper flower scale is applicable to 1! National standard (€%) 6 4 specifications ( 2 丨 0 \ 297 mm) 1235157 Λ7 B7, V. Description of the invention (384)

Washed with NaHC03 (2 X 30 ml) and saturated aqueous N-Q solution, dried (MgS04) and concentrated 3 and purified by flash chromatography on a crushed gel (3% methanol in CH2C12) to give compound 231e (404 mg '83%) Solid: [a] D20_ 121 ° (c 0.14, CH2Cl2);! H NMR (CDC13) & 7.40-7.83 (5H, m) 7.38 (1H, d), 6.96 (1H, d), 5.27- 5.07 (2H, m), 4.66-4.50 (ih m), 3.79 (3H, s), 3.23-2 · 73 (6H, m), 2.47-2.33 (1H, m), 2 15_ 1.82 (4H, in); analysis (^ 22 ^ 25 ^ 5〇6 of * ten different ^ C, 58.0; H, 5 53. n 15.38. Found 値: C, 57.6; H, 5.6; N, 15.0. [3S ( 1S, 9S)] 9- (fluorenylamino) -3- [6,10-diketo-l, 2,3,4,7,8,9, l (^ Shellfish Consumption of Central Standards Bureau, Ministry of Economic Affairs Cooperative printing of octahydro · 6H-da- [1,2-a] [l, 2] diazepine-l-epiaminoamino l · 3-aminopropionic acid (232e). Methyl ester 23le (400 mg, 0.88 mmol) in methanol (30 liters) and water (30 ml), cooled at 0 ° C and then treated with diisopropylethylamine. The solution was perturbed at 0eC. Mix for 10 minutes, and then at room temperature overnight, 3 substantial mixtures ▲ shrink and the solids in the crushed gel Chromatography (5% methanol / 1% formic acid in CH2C12) can produce 232e (170 mg, 44%) of hydration acid as a white solid. Mp 155 ° C (dec); 〇] d20-117. (C 0.1 , Me〇H); IR (KBr) 3343, 3061, 2955, 1733, 1656, 1577, 1533, 1490, 1421, 1342, 1279, 1256, 1222, 1185, 708; lH NMR (D4-Me〇H) &amp; 7.88-7.28 (5H, m), 5.20-5.03 (1H, m), 4.98-4.84 (2H, m), 4.75-4.53 (1H, m), 4.51-4.34 (1H, m), 3.45-3.22 ( 1H, m), 3.14-2.94 (1H, m), 3.14-2.94 (1H? M), 2.88-2.61 (2H, m), 2.53-1.50 (8H, m); Analyze the calculation of C21H23N506 · 1.5 · 20 : C, 53 · 84; Η, 5.59; N, 14.95; 0, 25 · 61. Found 値: C, 54.3; H, 5.4; N, 14.3. • 387- The standard of this paper is the Chinese National Standard (CNS) A4 Tige (210 dogs and 297 male transformers) 1235157 Λ7 B7 V. Description of the invention (385) 0

0 people Η COrN8u ΝΗ2 Η

H COrNBu

233β R

234e R C〇2-/-Bu *

236e R 237eR = 0

co2h

23SeR co2h (Please read the notes on the back before filling ^: this page)

Du Yinshang, Consumer Cooperation of Employees of Zhongli Bureau, Ministry of Economic Affairs

238eR

[4S, (IS, 9S)] 4- (9- (fluorenylamino) -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H- Daphno [l, 2-a] [l, 2] diaza · heteroderma-1-carboxamido] -5-ketovalerate tert-butyl hemicarbazone (233e). (IS, 9S) 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-9- (fluorenylamino) -6 &amp; -dapyrono [1,24] [ 1,2] Diazapyridine-1-carboxylic acid (212e) (345 mg, 1.0 millimolar), (4S) N- (allyl-388-) paper standard (Chinese national standard (CNS) A4) % Grid (210X 297 mm) 1235157 A; B7 V. Description of the invention (386) Oxygen group) _4-Amino-5 · Mengylvaleric acid Third · Butyl hemicarbazone (208a) (361 pen grams, A solution of 1.1 mmoles (1.1 equivalents) and (Ph3P) 2PdCl2 (20 mg) in CH2C12 (5 mL) was treated dropwise with n-Bu3SnH (0.621 mL, 2.3 mmoles' 2.1 equivalents). The resulting The orange-brown solution was stirred at 25τ for 10 minutes, and then I-hydroxybenzotriazole (297 mg, 2.2 mmol, 2 equivalents) was added. The mixture was cooled to 0 ° C and then ethyldimethylaminopropylcarbodicarbide was added. Imine (253 mg, 1.3 mmol, 1.2 equiv). Stir for 10 minutes at CTC Then at room temperature overnight, the mixture was diluted with EtOAc (50 mL), and the resulting solution was washed successively with 1M HC1 (3 X 25 mL), 10% NaHC〇3 (3 X 25 mL) and an aqueous NaCl solution. Dry (MgS04) and concentrate. Flash chromatography on silica gel (2-10% methanol in (: 112 (: 12) can produce compound 23 3 € (280 mg, 49%) as a brown solid: [PAN] 〇20- 95 (c 0.09, MeOH); IR (KBr) 3477, 3333, 2968, 2932, 1633, 1580, 1535, 1423, 1378, 1335, 1259, 1 156, 1085, 709; lK NMR (CDC13) &amp; 9.32 ( 1H, s), 7.83- 7.39 (6H, m), 7.11-7.09 (1H, m), 6.30-5.30 (2H, brs), 5.17-5.05 (2H, m), 4.62-4.38 (2H, m), 3.30-3.15 (1H, m), 3.13-2.65 (2H, m), 2.46-2.19 (3H, m), 2.15-1.54 (8H, m), 1.42 (9H, s) ^ [411, (13,95 )] 4- [9- (benzylamido) -6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-thalco [l, 2 -a] [l, 2] Diazapyridinocarboxamido] -5-ketoacetic acid tert-butyl hemicarbazone (236e), using (4R) N-allyl in a similar manner to 233e Oxycarbonyl · 4 · aminoketodivaleric acid third-butyl hemicarbazone (208b, 435 mg, 1.33 mmol) ) Can be made into a foamy product (542 mg, 71%): 〇] D20-99 ° (c 0.19, CHC13); IR (KBr) 3473, 333 1, 3065, 2932, 2872, 1660, 1580, 1533 , 1488, 1423, 1370, -389 · The size of this paper is applicable to China National Standards (CNS) Α4 grid (210 × 297 mm) (Please read the notes on the back 13 ^ Fill in this note)

* 1T

Printed by the Consumer Affairs Cooperative of the Central Government Bureau of the Ministry of Economic Affairs 5L 1235157 Λ 7 Β7 ____ V. Description of the Invention (387) ^ 1337, 1278, 1254, 1224, 1 155, 1080, 1024, 983, 925, 877, 846, 801, 770 , 705; lK NMR (CDC13) &amp; 9.42 (1H, s), 7.81 (2H, d), 7.51-7.40 (4H, m)? 7.06 (1H, d), 6.50-5.50 (2H, width s), 5.25-5.00 (2H, m), 4.60-4.45 (2H, m), 3.15-2.85 (2H, m), 2.75-2.35 (1H, m), 2.30-1.23 (1 1H, m), 1.42 (9H, s) ^ [4S, (IS, 9S)] 4- [9- (benzylamido) -6,1C ^ diketo-l, 2,3,4,7,8,9,10-octahydro -6H-β and benzo [l, 2-a] [l, 2] diazepine-l-kidamine] -5-trivalerate tert-butyl ester (234e) e hemi-carbabazone 233e (390 mg, 0.68 mmol) was cooled to a solution of methanol (10 ml), and then treated with 38% formaldehyde (2 ml) and 1M HC1 (2 ml) in water. 3 The reaction mixture was then allowed to stand at room temperature. Stir overnight. The solution was concentrated to remove methanol and the non-solution was extracted with EtoAc (30 mL). The organic solution was washed successively with 10% NaHC03 (30 ml) and a saturated aqueous NaCl solution, dried (MgS04) and concentrated. Rapid repeated analysis and purification on crushed gel (2-5% methanol in CH2Cl2) can produce 234e (179 mg, 51%) as a white foam: 〇] D20-101. (C 〇.064, Me〇H); IR (KBr) 3346, 2976, 2934, 1730, 1657, 1535, 1456, 1425, 1278, 1255, 1 156, 708; Tun NMR (CDC13) &amp; 9.56 (1Η, s), 7.88-7.38 (5Η, m), 7.01 and printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs ¾ 6.92 (2H, 2d), 5.27-5.08 (2H, m), 4.69-4.46 (1H, m), 3.50-3.27 (2H, m), 3.15-2.73 (2H, m), 2.46-1.83 (10H, m), 1.45 (9H, s). [4trans, (15,95)] 4- [9- (fluorenylamino) -6, 丨 0-diketo-1,2,3,4,7,8,9,10-octahydrowell And [l, 2-a] [l, 2] diaza-l-chitylamino] ·· ketovaleric acid third-butyl ester (237e), prepared from 236e in a similar manner to 234e, Can produce a white bubble-like shape (390¾g '85%): [called D'u3. (C 0.242, • 390- This paper's standard is applicable to the Chinese National Standard (CNS) A4 (2 丨 0X297 mm)) Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs 1235157 A7. _ B7__ V. Description of the invention (388) CHC13); IR (KBr) 3352, 3065, 2974, 1729, 1657, 1536, 1489, 1454, 1423, 1369, 1338, 1278, 1255, 1223, 1 156, 1078, 1026, 981, 846, 709. [4S, (IS, 9S)] 4- [9- (Benzylamido) -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6Η- Da [l, 2-a] [l, 2] diazepine-1-carboxyamido] -5-ketovaleric acid (235e). A solution of tertiary-butyl ester 234e (179 mg, 0.35 mmol) in anhydrous CH2C12 (3 ml) was cooled to 0 ° C, and then treated with trifluoroacetate (2 ml). The resulting solution was stirred at 0 ° C for 30 minutes and then at room temperature for 2 hours. The solution was concentrated, the residue was taken up in anhydrous CH ^ C12 (5 ml), and the mixture was concentrated again. This process was repeated again with more CH2C12 (5 ml). Income

The residue was crystallized from diethyl ether. The precipitate was collected and purified on a silica gel column (5% methanol in CH2C12) to give compound 235e as a white solid (111 mg, 70%): mp 142. (: (Dec); [or] D20-85.5 (c 0.062, Me〇H); IR (KBr) 3409, 3075, 2952, 1651, 1541, 1424, 1280, 1198, 1136, 717; 1K NMR (D6- DMS0) &amp; 9.40 (1H, s), 8.62 (2H, m)? 7.96 · 7.38 (5H, m), 5.19 -5.02 (1H, m), 4.98-4.79 (1H, m), 4.48-4.19 (1H , m), 3.51-3.11 (2H, m), 3.04-2.90 (2H, m), 2.38-1.46 (10H, m). [4R, (IS, 9S)] 4-〇 (benzylamino)- 6, l (^ diketo-l, 2,3,4,7,8,9, l (^ octahydro-6H-, benzophenone [l, 2-a] [l, 2] diaza G-l-carboxamido] -5-ketovaleric acid (23 8e), prepared from 237e in a similar manner to 235e, can form a brown foam (190 mg, 60%): [a] D20-78 ( c 0.145, MeOH); IR (KBr) 3400, 3070, 2955, 2925, 2855, 1653, 1576, 1541, 1490, 1445, 1427, 1342, 1280, 1258, 1205, 1 189, 1 137, 1075, 1023, 983, -391-The standard of this paper is the Chinese National Standard (CNS) Α4, see the standard (210 × 297 mm) '~ ^ (Please read the notes of δ before filling in this f)

1235157 A7 B7 V. Description of the invention (389, 930, 878, 843, 801, 777, 722; NMR (D6-DMSO) &amp; 9.40 (1H, s), 8.72-8.60 (2H, m), 7.89 (2H, d), 7.56-7.44 (3H, m), 5 17 (1H, m), 4.90-4.83 (1H, m), 4.46-4.36 (1H, m), 4.20-4.15 (1H, m), 3.40-3.30 (1H, m), 2.98-2.90 (2H, m), 2.50-1.60 (10H, m) 3 λΡ H ° cr ^ 〇i.Bu (243)

H (246) Consumption cooperation among employees of the China Bureau of Economic Affairs of the Ministry of Economic Affairs

(Please read the notes on the back &amp; first fill in this f) (IS, 9S) 9-benzylamido-octahydro-10-keto-6H-daphno [1,24] [1,2] Diazapyridine-1-carboxylic acid tertiary-butyl ester (243), prepared from (1S, 9S) 9-amino-octahydro-10-keto-6H_dapyrido [l, 2-a] [1,2] Diazapyridine-1-carboxylic acid tertiary-butanone (Attwood, et al., J. Chem Soc ·, Perkin 1, pp · 1011-19 (1986)) method described in 211e , Can be produced into 2.03 g (86%) colorless foam: [from] d2) -15.9. (C 0.5, CH2C12); IR (KBr) 3400, 2976, 2937, 1740, 1644, 1537, 1448, 1425, 1367, 1154; 1Η NMR (CDC13) &amp; 7.88-7.82 (2H, m), 7.60-7.38 (4H, m), 5.48 (1H, m), 4.98 -392- The size of this record is based on "Changxian (CNS) Congmi" (21QX 297). Printed by the Consumer Sample Cooperative of the Central Provincial Bureau of Economic Development, Ministry of Economic Affairs, 1235157 Λ 7 Β7 V. Description of the invention (39 °) (1Η, m), 3.45 (1H? M), 3.22-2.96 (2H, m)? 2.64 (1H, m), 2.43-2.27 (2H, m), 1.95 ( 2H, m), 1.82-1.36 (4H, m), 1.50 (9H, s); C2lH29N304 · 0.25 · 20Essential mass estimate: C, 64.35; H, 7.59; N, 10.72. Measured: C, 64.57 H, 7.43; N, 10.62. MS (ES +, m / z) 388 (100%, M + 1). (IS, 9S) 9-amido-octahydro-10-keto- 6H-Da-Phen [1,24] [1,2] diazafluorene-carboxylic acid (244) was prepared from (1S, 9S) 9-fluorenylamino-octahydro-10-one by 212e method -6H-da-phen [l, 2-a] [l, 2] diazepine-1 · carboxylic acid tert-butyl ester (243), which can produce 1.52 g (89%) of white powder: mp · 166-169 eC (dec); [a] D25-56.40 (c 0.5, CH3OH); IR (KB〇3361, 2963, 2851, 1737, 1663, 1620, 1534, 1 195, 1 179; lH NMR (D6- DMSO) &amp; 12.93 (1H, brs), 8.44 (1H, d, J = 8.4), 7.93 (2H, m), 7.54 (3H, m) 5.46 ( 1H, m), 4.87 (1H, m), 3.12 (2H, m), 2.64 (1H, m), 2.27 (1H, m), 1.98-1.68 (7H, m), 1.40 (1H, m) ; Analyze C17H2lN304.0.25H2O ^ 1f% O.: C, 60.79; H, 6.45; N, 12.51-Found: C, 61.07; H, 6.35; N, 12.55. MS (ES +, m / z) 332 (58%, 1VT + 1), 211 (100). [3S, 2RS (1S, 9S)] N- (2-benzyloxy-5-ketotetrahydrofuran-3-yl) -9-benzylamido-octahydro-10-keto-6H-dapyridine [l, 2-a] [l, 2] Diazapyridine-1-carboxamide (245) 'was prepared from (IS, 9S) 9-fluorenylamino-octahydro-10- by the method described in 213e. Keto-6H-dacrogen [l, 2-ani, i] diazepine-1-carboxylic acid (244), yielding 601 mg (76%) of a colorless foam: IR (KBr) 3401, 2945 , 1794, 1685, 1638, 1521, 1451, H20; lH NMR (CDC13) &amp; 7.87- 7.77 (2H, m), 7.57-7.14 (10H, m), 5.59-5 · 47 (2H, m), 4.97- -393-This standard is in accordance with the Chinese National Standard (CNS) A4 specification (21 ^ 297 public holidays) (Please read the precautions on the back before filling in this f) Order

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 1235157 Λ 7 _Β7 _____ V. Description of the Invention (391). 4 · 32 (4H, m), 3.27-1.35 (14H, m); Analysis of the calculation of C2SH32N406 · 0.5H2〇 Tritium: C, 63.50; H, 6.28; N, 10.58. Found 値: C, 63 · 48; H, 6.14; N, 10.52. MS (ES +, m / z) 521 (100%, M + + 1) 3 [3S (1S, 9S)] 3- (9-fluorenylamino-octahydro-10-keto-6H-dapyron [1,2-a] [1,2] diazepine-1-carboxamidin-4-one-butyric acid (246), prepared from [3S, 2RS (IS, 9S)] by the method described in 2Ue N- (2-Methoxy-5 · ketotetrahydrofuran • 3-yl) -9 · ^ δδ Cavityl-octazine-10-8¾yl-6H- * Anorphino [1,2-a] [l ， 2] — Azapyridine-1-carboxamide (245), which can produce 396 mg (84%) of white powder: mp. 110-115Ό; [a] d26-126.3 ° (c 0.2, CH3OH); IR ( KBr) 3345, 2943, 1787? 1730, 1635, 1578, 1528, 1488, 1450, 1429; lH NMR (CD3OD) &amp; 7.88 (2H, m), 7.48 (3H, m), 5.55 (1H? M), 4.91 (1H, m), 4.56 (1H, m), 4.29 (1H, m), 3.41-3.05 (3H, m), 2.76-2.41 (3H, m)? 2.28-2.01 (3H, m), 1.86- 1.65 (4H, m), 1.36 (1H, m); Analysis of the calculation of C21H26N406. 1.25H20: C, 55.68; H, 6.34; N, 12.37. Found: C, 55.68; H, 6.14; N, 12.16. MS (ES-, m / z) 429 (100%, M +-1) 〇-394-This paper scale is applicable to China National Standard (CNS) A4 ^ i factory (2urx 297 male) (please First read the notes on the back-41 )

1235157 A7 B7 V. Description of the Invention (392)

+

Printed by the Consumer Affairs Cooperative of the Ministry of Economic Affairs of the People's Republic of China ^ [(3S (2R, 5S)]-4-methoxyphenyl 5-dihydro_3,6-dimethoxy · 2- (1-methyl Ethyl) Pyryl)] Butyric acid 2,6-di-tertiary-butyl ester (247) 3 n-Butyl (1.6M in hexane) (22.3 ml, 35 · 7 mmol) Add dropwise to (2RH-)-2'5- —Wind-3,6-monomethyllactyl-2- (1-methylethyl) leaf [: 11 wells (5.8 ml, 6.0 g, 32.4 mmol) ) In a solution of THF (250 ml) cooled to -75X for 20 minutes at a rate that keeps the temperature below -721 Reaction Mix -395- This paper ruler / person is in use § National Winter Standard Ocean (CNS) grid (210 X 297 liters) 1235157 Order of the Ministry of Economic Affairs Standards Bureau Employees' Cooperative Printed A1 B7 V. Description of Invention (393) The mixture was stirred at -75X: for 1 hour, and then 4-methoxyphenyl-2-butanoic acid, 2,6-di · tertiary-butyric acid (Suzuck et al. Liebigs Ann. Chem. ρρ · 5 61 61 (1992)) (9.9 g, 32.5 mmol) in THF (60 ml) and the temperature was kept below -7 2 C during the addition. The reaction mixture was kept at -75X: For 1.5 hours, add a solution of glacial acetic acid (6 mL) in THF (25 mL) at -75X, and warm the solution to room temperature. 3 Pour the solution into 10% NH4C1 (300 mL) and extract with diethyl ether (3 X 250 Ml). The combined organic phases were washed with brine (2 X 200 ml), dried over Na2S04 and evaporated to dryness under reduced pressure. The remaining oil was purified by silica gel flash chromatography (20% heptane in CH2Cl2: >> to give the title compound as a pale yellow oil (13.5 g, 85%): [α] D20-64. (C 0.22, MeOH) ; IR (KBr) 2962, 2873, 2840, 1757, 1697, 1593, 1460, 1433, 1366, 1306, 1269, 1236, 1 187, 1 157, 1 126, 1063, 1038, 101 1, 970, 924, 892 , 867, 846, 831, 797, 773, 754; ιΕ NMR (CDC13) &amp; 6.85 (2Η, s), 4.21 (1H, t, J = 3.5), 3.98 (1H, t, J = 3.5), 3.79 (3H, s), 3.71 (3H, s), 3.69 (3H, s), 3.15 (1H, dd, J 17.8, 7.9), 2.86-2.81 (1H, m), 2.58 (1H, dd, J = 17.8 , 5.9), 2.28-2.19 (1H, m), 1.33 (18H, s), 1.02 (3H, d, J = 6.8), 0.70 (6H, dd, J = 13, 6.8)-

(2S, 3S) 1-methyl-3.methylpyramic acid 5- [2,6-di-tertiary-butyl-4-methoxyphenyl] ester (248). [3S (2R, 5S)]-2,6-di-third-butyl-4-methoxyphenyl-3- [5- (2,5-dihydro-3,6-dioxan -2- (1-methylethyl) pyryl.)] Butyrate (247) (22.4 g, 45.8 mmol) in acetonitrile (300 ml) and 0.25 NHC1 (366 ml, 2 equivalents) Stir under nitrogen atmosphere and room temperature for 4 days. Acetonitrile was evaporated under reduced pressure and diacetamidine (250 ml) was added to the aqueous phase. PH of PHASE PHASE -396-This paper is a common Chinese national standard (CNS) A4 scale (210x 297g; $ &gt; (Please read the notice on the back before filling out the page)) Shiyi * ^ τ 1235157 A7 B7 V. Description of the invention (394) 値 Adjust the pH to 8-9 with concentrated ammonia (32%), and then separate the phases. The aqueous phase is extracted with diethyl ether (2 X 250 ml). The mixed organic phase is in Na2S04 It was dried over dry and evaporated to dryness under reduced pressure. The remaining oil was purified by flash chromatography. The desired product was formed on silica gel (2% formamidine in CH2C12) as a pale yellow oil (8.2 g, 45%): [ α] D20 + 20. (c 0.26, MeOH]; IR (ΚΒι〇3394, 3332, 3000, 2962, 2915, 2877, 2838, 1738, 1697, 1593, 1453, 1430, 1419, 1398, 1367, 1304, 1273 , 1251, 1221, 1203, 1 183, 1126, 1063, 1025, 996, 932, 891, 866, 847, 800, 772, 745; Go NMR (CDC13) &amp; 6.85 (2H, s), 3.79 (3H, s), 3.74 (3H, s), 3.72-3.69 (1H, m)? 3.05-2.85 (1H? m)? 2.67-2.50 (2H, m), 1.32 (18H, s), 0.93 (3H, d, J = 7); Analysis C22H35N05i Calculate 値: C, 67.15; H, 8.96; N, 3.56 3 Measured 値: C, 67.20; H, 9.20; N, 3.70. (2S 9S) 3-methylglutamine 5- [2,6-di-tertiary-butyl-4-methoxyphenyl ester (249). (2S, 3S) 3-methylglutamine 5- [2,6-Di-tertiary-butyl-4-methoxybenzyl] ester (248) (8.0 g, 20.3 mmol) in 5NHC1 (200 ml), heated at reflux for 2 hours. Reaction The compound was evaporated to dryness under reduced reputation. The residue was dissolved in cyclohexane (X 4) and evaporated to dryness (X 4) to obtain a white solid (7.9 g, 93%): mp 230 ° C; [沈] D20 + 22. (C 0.27, MeOH); IR (KBr) 3423, 2964, 1755, 1593, 1514, 1456, 1421, 1371, 1303, 1259, 1201, 1 179, 1 138, 1 106, 1060, 966 , 926, 861, 790, 710; 1H NMR (MeOD) &amp; 6.76 (2H, s), 4.02 (1H, d, J = 3.7), 3.67 (3H, s), 3.05-2.85 (1H, m), 2.80-2.55 (2H, m), 1.22 (18H, s), 1.09 (3H, d, J = 6.3); l3C NMR (MeOD) &amp; 174.5, 171.4, 158.6, 145.2, 143.1, 1 13.2, 58.3, 56.3 , 39 · 8, 36.9, 32.5, 16.6; Analyze-397- This paper has a common Chinese national standard (CNS) with Tigger (210X297 mm)

Printed by the Consumers' Cooperatives of the China Prospective Bureau of the Ministry of Economic Affairs 1235157 A7 B7______ V. Description of the invention (395) _ C21H34ClN05t Calculation 値: C, 60, 64; Η, 8, 24; Ν, 3.37. Measured fluorene: C, 60.80; hydrazone, 8.40; N, 3.40 ° (2S, 3S) 3-methyl-2-phthalimidoimino-1,5 · pentanedicarboxylic acid 5 · [2,6-di · Tertiary-butyl-4 · methoxyphenyl] ester (250), diisopropylethylamine (4.1 ml, 3.04 g, 23.5 mmol, 1.25 equiv), and Xianxian '2 °. 6¾ Ear '1.25 equivalents) was added to (2S, 3S) 3-fluorenylglutamate-5- [2,6-di-tertiary-butyl-4-fluorenoxyphenylbutyl (249) (7.8 g (18.6 mmol) in toluene (300 ml), and the resulting mixture was heated at reflux for 3 hours. After cooling to room temperature, the reaction mixture was evaporated to dryness. The resulting oil was purified by flash chromatography on silica gel (2% methanol in CH2C12) to yield the desired product as a white foam (8.35 g, 87%): [ a) D20-2 (T (C 1.04, Me〇H); IR (KBr) 3480, 2968, 2880, 1753, 1721, 1594, 1462, 1422, 13 88, 1303, 1263, 1216, 1 183, 1 148 , 1062, 1003, 933, 899, 755, 723; lK NMR (CDC13) &amp; 7.92-7.87 (2H, m), 7.78 · 7.73 (2H, m), 6.84 (2H, s), 4.95 (1H, d ), 3.78 (3H, s), 3.30-3.05 (2H, m), 2.85-2.65 (1H, m), 1.30 (18H, s), 1.13 (3H, d). (Please read the first Note: Please fill in this page again.) Order the consumer cooperation between the Ministry of Economic Affairs and the Ministry of Economic Affairs of the Ministry of Economic Affairs of the People's Republic of China. Du-print pack-398 · This paper ft has been re-used in the Chinese standard of SI house (CNS) A4 (210: 297); 1235157 A7 B7 V. Description of Invention (396)

(250) (251)

(252) Seal of Consumers' Cooperatives, Central Bureau of Standards, Ministry of Economic Affairs ¾

(257) (256) -399- (Please read the intent on the back before filling this page)

This paper size applies to China National Standard Soap (CNS) A4 specification (210X297 mm) 1235157 Λ7 ______ ^ Β7_ · V. Description of the invention (tearing) 1- (2,6 · Di-tertiary-butyl-4-methoxy -), Benzene, 0- (1-fluorenyloxycarbonyl-3-tert-butoxycarbonyl-hexahydropyridin-2-yl) -3-methyl-4-phthalimidoiminopentane- 丨,% Diacid (251). A solution of amino acid (250) (1.2 g, 2.35 mmol) in anhydrous diethyl ether (10 ml) was treated with phosphorus pentagas (0.52 g, 2.5 mmol) at room temperature for 2 hours. The mixture was concentrated and treated several times with toluene and evaporated again to dryness. The generated amidine gas was dissolved in anhydrous THF (5 ml) and CH2C12 (5 ml) and cooled to 0 ° C. Add tertiary-butyl-1- (fluorenyloxycarbonyl) hexahydro-phenyl-carboxylate (0.753 g, 2.35 mmol, 1 equivalent) and N-ethylmorpholine (3 ml) to In solution. The reaction mixture was stirred under CTC for 30 minutes and then overnight at room temperature. The mixture was evaporated and the resulting residue was taken up in CH2C12 (30 ml). The solution was washed with 1M HC1, water, 10% NaHC03, and dried (MgS04) And the white foam and foam produced by evaporation 3 were purified on gluten (0-2% methanol in CH2C12) to produce the required compound 251 as a pale yellow glassy solid (740 mg, 39%): | &gt;] D20 -22 (c 0.42, MeOH); IR (KBr) 3441, 2966, 1725, 1693, 1386, 1255, 1221, 1 186, 1 154, 1 123, 1063, 724; lU NMR (CDC13) ά 7.94-7.89 (4H, m), 7.56-7.28 (5H, Consumers' Cooperation and Du Yin of the Ministry of Economic Affairs, China Standards Bureau · Du Yin ¾ m), 6.84 (2H, 2s), 5.29-5.20 (2H, AB), 4.91- 4.81 (1H, m), 4.05-3.88 (1H, m), 3.78 (3H, s), 3.75-3.80 (1H, m), 3.28-2.95 (2H, m), 2.23-1.51 (6H, m ), 1.45 (9H, s), 1.31 (9H, s), 1.28 (9H, s), 1.27 (3H, d) 〇 (IS, 8S, 9S) 6,10-diketo-8-methyl- 1,2,3,4,7,8,9.10-octahydro-9-醯 imino-6H-dacro [1,2-a] [l, 2] diazabenzene-tricarboxylic acid tert-butyl ester (254). Protected acid (251) (715 mg, 0.893 millimolar) in acetonitrile solution with ammonium cesium (IV) nitrate (1.8 g, 3.3 millimolar, 3.7 equivalents) in water at -400-this paper is compliant with China National Standard (CNS) A4 210X2W mm) 1235157 Λ 7 ________ Β7 ___ V. Description of the invention (398) Treatment at xuan temperature for 4 hours 3 Add mannitol (600 mg, 3.3 mmol, 3.7 equivalents) and stir the mixture for 1 hour. Add diethyl ether (5 0 ml) and water (30 ml) into the mixture. After decantation, the aqueous phase was extracted with diethyl ether (4 X 50 ml). The combined organic phases were washed with water, dried (MgS04) and concentrated. Chromatography on silica gel (10% methanol in CH2C12) can generate 5- (1-fluorenyloxycarbonyl-3-tertiary-butoxycarbonyl-hexahydropyrido-2-yl) carbonyl-3-methyl-4-phthalimidoimine Valeric acid (252) (360 mg, 64%): [0] D20-49.2. (C 0.118, MeOH). This product was used without further purification (360 mg, 0.609 mmol) and hydrogenated in methanol (30 ml) using 10%. / 0 Pd / C (36 mg) over 3 hours. The reaction mixture was filtered and the resulting solution was concentrated to give amine (253) as a foam (270 mg, 96%) [dD20-56.1. (C0.18, MeOH). Amine (253) dissolved by the Consumers ’Cooperative of the Ministry of Economic Affairs, printed in anhydrous THF (10 ml) and added with phosphorus pentachloride (305 mg, 1.47 mmol &quot; &quot; &quot; τ '2.5') 3) The compound was cooled to -5C and ethylmorpholine was added under gas. The reaction mixture was stirred at room temperature overnight. The mixture was concentrated and the residue was taken up in CH2C12 (20 ml), cold water (20 ml), 1MHC1 (20 ml). After decantation, the aqueous phase was extracted again with (: ^ 12 &lt;: 12 (2 X 20 ml). The mixed organic phases were washed with 10% NaHC03 and water, dried (MgS04) and concentrated. The resulting oil Purification with silica gel (1% methanol / CH2C12) can produce bicyclic compound (252) as a solid (65 mg, 25%): [a] D20 -77., 0.208, MeOH); IR (KBr) 3471, 3434, 2975 , 2928, 1767, 1723, 1443, 1389, 1284, 1243, 1 15 1, 1 1 12, 720; Go NkR (CDC13) d 7.94-7.69 (4H, m), 5.34-5.27 (1H, m), 4.89 -4.66 (2H, m), 3.94-3.64 (2H, m), 3.02-2.84 (1H, m), 2.34-2.19 (2H, m), 1.94-1.61 (3H, m), 1.47 (9H, s) , 1 · 14 (3H, d); Analyze the calculation of C23H27N306C: C, -401-Consumption cooperation between employees of the Ministry of Economic Affairs and the Bureau of Standards, Du Yin «. 1235157 A7 B7 _____ V. Description of the invention (399) 62 · 57; No, 6.17; N, 9.52. Found 値: C, 62.60; Η, 6.40; N, 9.10. (IS, 8S, 9S) di-butyl-9-epi-amino-6,10--benzyl-8-methyl-1,2,3,4,7,8,9,10-octahydro -611-Dageno [1,24] [1,2] diazafluorene-1-carboxylic acid ester (255). A solution of the bicyclic compound (254) (70 mg, 0.16 mmol) in ethanol was treated with hydrazine hydrate (0.02 ml, 4 mmol, 2.5 equivalents). After stirring at room temperature for 5 hours, the mixture was concentrated and the resulting residue was taken up in &apos; toluene and evaporated. The residue was treated with 2M acetic acid (2 ml) for 16 hours. The resulting precipitate was filtered and washed with 2M acetic acid (10 ml). The 3 filtrate was basified with solid NaHC03 and extracted with EtOAc. The organic solution was washed with water, dried (MgS04) and concentrated. Purification by flash chromatography on silica gel (2% methanol / CH2C12) gave a free amine as a foam (50 mg, 100%). Amine (50 mg, 0.16 mmol) was dissolved in dioxane (1 ml) and water (0.25 ml), followed by NaHC03 (0.034 g, 0.04 mmol) followed by benzamidine chloride (0.047 ml). , 0.40 mol, 2.8 equivalents). The mixture was stirred at room temperature overnight and then diluted with EtOAc (15 mL). The organic solution was washed with 10% NaHC03 and a saturated NaCl aqueous solution, dried (MgS04), and concentrated. 3 Purified by silica gel flash chromatography (2% methanol / CH2C12) to obtain amidine 255 as a foam (67 mg, 100%). ): lK NMR (CDC13) (ί 7.89-7.39 (5Η, m), 6.79 (1H, d), 5.32-5.20 (1H, m), 4.98-4.82 (1H, m), 4.75-4.64 (1H, m ), 3.84-3.65 (1H, m), 3.09-2.89 (1H, m), 2.45-2.18 (2H, m), 2.00-1.61 (4H, m), 1.48 (9H, s), 1.28 (3H, d ) ^ (3S) (1S, 8S, 9S) 3- (9-fluorenylamino-6,10-diketo-8-methyl-1,2,3,4, 7,8,9,10 -Octahydro-6 ^ 1-da-phen [1,24] [1,2] diazabenzene-1-carboxamido) -4-ketobutanoic acid (257). Tertiary-butyl ester 255 (67 mg, 0.16 mmol) at -402-(Please read the precautions for Ιδ before filling this page)

^ ^ Γ Γχ5;) (710 ν? 07 / Λ4ί5 · \ 1235157 A7 _ _________ B7_____ V. Description of the invention (400) The solution of CHfl2 was treated with trifluoroacetic acid and acid (1 ml of p Stir for 15 minutes at 0 C, and then for 1 hour at room temperature. The solution was concentrated, and the residue was taken up in anhydrous (: 112 (: 12 (2 X 2 ml), and the mixture was concentrated again (x2). Crystallized from ether. Filtration of the precipitate yielded 255 free-state acid as a gray solid (40 mg, 70%). Acid (40 mg, 0.11 mmol), N-allyloxycarbonyl-4-amino-5 -Methoxy-2-ketotetrahydrofuran (Chapman, Bioorg &amp; Med. Chem. Lett. · 2, pp. 615-18 (1992); 39 mmol, 0.13 mmol, 1.2 equivalents) and ( Ph3P) 2PdCl2 (3 mg) in a mixture of anhydrous CH2C12 (1 ml) and anhydrous DMF / 0.2 ml), printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) ) Treated dropwise with n-Bu3SnH (0.089 ml, 0.33 mmol, 3 eq.) The resulting solution was stirred at 25 ° C for 10 minutes, and then added with hydroxybenzodione (36 mg, 0.266 mmol, 2.4 equivalents) ^ The mixture was cooled to 0 ° C, and ethyldimethylaminopropylcarbodiimide (31 mg, 0.16 mmol, 1.5 equivalents) was added. At 0 ° C Stir for 10 minutes, and then overnight at room temperature. The mixture was diluted with EtOAc (20 mL) and the resulting solution was successively iM HC1 (2 X 5 mL), 10% NaHC03 (2 X 5 mL) and saturated aqueous NaCl solution (5 Ml) was washed, dried (MgS04) and concentrated. Flash chromatography on silica gel (2% methanol / CH2C12) can produce a mixture of diastereoisomeric (256), a gray solid (50 mg, 82%). This product (256) was used without further purification (50 mg, 0.091 mmol) and hydrogenated in methanol (5 ml) at 10% Pd / C (30 mg) for 24 hours. The reaction mixture was filtered and the resulting solution was re- Concentration-flash chromatography on silica gel (2-20% methanol / CH2C12) yields compound 257 (9 mg, 21%) as a white solid. · 4 NMR (D4-MeOH) β 7 · 88-7 · 29 (5H , M), 5.18-4.99 (1H, m), 4.59-4.35 (3H, m), 4.26-4.11 (1H, m), -403- This paper scale is applicable to China National Standard (CNS) A4 specifications (2丨 0X29 7 Gong Guang 1 ~ &quot; 1235157 A7 B7 V. Description of the invention (401) 3.65-3.41 (2H, m), 3.18-2.91 (1H, nr), 2.62-1.47 (8H, m), 1.29-1.00 (3H, 2d) (mixture of acetals and hemiacetals). MS (ES-) 457

PhCONHNH2 (258)

PhCO-N ^ H Η (259)

(Please read the note on the back to fill in this f) Order the seal of the Consumer Consumption Cooperative of the China Standards Bureau of the Ministry of Economic Affairs ¾ 〇

〇

-404- This paper applies the tg national standard (CNS) A4 specification (210X29? Mm) 1235157 A7 ___B7 ____ V. Description of the invention (402) 3 · (N, Octyl base) Propionate (g ) 3 Acrylic acid + vinegar (1.13¾ liters, 7.34 mmoles) was added to a stirred suspension of benzamidine (285) (1.0 g, 7.34 mmoles) in isopropanol (28 ml) 3 The mixture was refluxed for 20 hours, cooled to room temperature, and concentrated. The residue was purified by flash chromatography (20% EtOAc / CH2Cl2) to give 259 (1.098 g, 50%) as an oil, which crystallized after standing: mp 65X: IR (KBr) 3283, 1723, 1644, 1316, 1201, 1 156; lU NMR (CDCi3) ά 8.32-8.18 (1H, m), 7.81-7.70 (2H? M), 7.57-7.23 (8H, m ), 5.36-4.92 (1H, brm), 5.11 (2H, s), 3.26 (2H, t, J = 6.5), 2.59 (2H, t, J = 6.5); 13C NMR (CDC13) ^ 172.12, Ministry of Economic Affairs Printed by the Consumers' Cooperatives of the China Provincial Sample Bureau 167.27, 135.65, 132.54, 131.66, 128.45, 128.10, 128.06, 126.84, 66.31, 47.33, 33.31; Analysis of calculation of Cl7H13N203: C 68.44; H, 6.08; N, 9.39. Found 値: C, 68.42; H, 6.10; N, 9.38. MS (ES +) 321 (M + Na, 38%), 299 (M + + 1,100) 3 (3S) 2 · (N, fluorenyl-N- (2-methoxyoxyethylethyl) hydrazine (Carbonyl) hexadacorphine-1,3-dicarboxylic acid 1-benzyl 3-third-butyl ester (260). Hexahydrophenyl-1,3-dicicarboxylic acid (3S) -1-fluorenyl 3-tert-butyl ester (Hassall et al. J. Chem. Soc. Perjon i, p. 1451-1454 (1979)) (925.3 mg, 2.89 mmol) and a solution of diisopropylethylamine (0.70 ml, 4.0 mmol) in 1.93% phosgene (17.96 ml, 34.7 mmol) in toluene and stirred at room temperature for 45 minutes , And concentrated to leave a yellow solid. To this solid were added toluene (18 ml), osmium (259) (861.6 mg, 2.89 mmol) and diisopropylethylamine (0.70 ml, 4.0 mmol). The mixture was stirred at room temperature for 2.75 hours and then concentrated. The resulting residue was taken up in EtOAc, washed with 1M HC1, brine, and dried (MgSO), filtered and concentrated to give 2.15 g of crude material. Quick Chromatography-405- This paper standard is applicable to China National Standards (CNS) A4 specifications (2 丨 0X 297 public holidays) 1 '^ &quot; 1235157 Printed by the Ministry of Economic Affairs, China Standards Bureau, Off-line Consumer Cooperatives A 7 B7 _V. Description of the invention (403) (40% EtOAc in hexane) can produce 1.65 g (, 89%) of the title compound, which is white foamy ♦ · mp · 40 ° C; [PAN] 〇24 * 55.78 (c 0.40, CH2Cl2); IR (KBr) 3436, 2930, 1733, 1689, 1455, 1412, 1367, 1258, 1 156, 697; NMR (CDC13) ά 8.54-8.23 (0.5H, m), 7.97 -7.09 (15.5H), 5.16-4.80 (4H, m), 4.66-4.32 (1H, m), 4.24-3.55 (3.3H, m), 3.50-3.26 (0.4H, m), 3.19-2.49 (2.3 H, m), 2.11-1.43 (6H, m), 1.32-1.05 (7H, m); analysis of the calculation of C35H40N4O8.0.5H20: C, 64.31; H, 6.32; N, 8.57. Found 値: C, 64.18; H, 6.27; N, 8.56. MS (ES +) 662 (M + Na, 84%), 645 (M + + 1, 100), 384 (77) 〇 (6S) -3-(N '-Yekuji-N- (6 -Third -Butoxy talks on the base point hydrogen curling 〃Sakai-1-loading base) prefecture base) propionic acid (261). A solution of 260 (1.59 g, 2.47 mmol) in MeOH (142 ml) was treated with 10% 100 / (: (230.0 mg), and then stirred for 1.5 hours under 112 atmosphere. The mixture was filtered and the solvent Evaporation yielded 1.04 g (100%) of a white foam. This was used in the next step without further purification: mP &lt;4〇1; [from] D26 + 1.6. (C 0.26, CH2C12); IR (KBr) 3422, 2977, 2986, 1728, 1677, 1486, 1445, 1396, 1369, 1309, 1228, 1 155, 916, 716; [H NMR (CDCI3) ^ 10.0-9.7 (1H, brm), 7.86 (2H, d , J = 7.5), 7.62-7.38 (3H, m), 7.3-5.6 (2H, brm), 4.57 (1H, brd, J = 4.0), 4.05-3.77 (2H, m), 3.00-2.82 (1H, m), 2.80-2.43 (3H, m), 2.20-2.03 (1H, m), 2.00-1.47 (1H, m), 1.62-1.14 (11H, m); l3C NMR (CDCI3) S 175.00, 171.17, 167.62 , 160.68, 132.39, 13 1.77, 128.67, 127.38, 82.27, 54.38, 48.04, 46.35, 33.62, 28.02, 25.68, 21.61-MS (ES +) 443 (M + Na, 68%), 421 (M &quot; -406- The size of this paper is applicable to the Chinese standard of a family house (CNS) M (210X 297 male 4) (Please read the notes on the back before filling out this page) Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 1235157 A7 — B7 V. Description of the invention (404) + 1), 100), 365 (50), 131 (61 "—— (45) 7-benzylamido-6,10-diketo- 1,2,3,4,7,8,9,10-octahydro-6-daphno [1,24] [1,2,4] triazafluorene-4-carboxylic acid tert-butyl ester (262). A solution of p-amino acid 261 (1.012 g, 2.41 mmol) in anhydrous THF (26 ml) was added N-ethylmorpholine (597 μl, 4.69 mmol) at 0 ° C. PC15 (65 1.3 mg, 3.12 mmol) was added. The reaction was stirred at (TC for 2 hours, then warmed to room temperature and stirred for another 15.5 hours. The mixture was concentrated and the resulting residue was taken up in EtOAc, washed twice with 1M HC1, saturated NaHC03, brine, dried (MgS04), &amp; and concentrated. Flash chromatography (20% EtOAc / CH2Cl2) gave 727.3 mg (75%) of the title compound as a white foam: 0] D26 + 51.0. (C 〇 · 20, CH2C12); IR (KBr) 3436, 2979, 1733, 1670, 1483, 1437, 1420, 1299, 1243, 1 156; lHNMR (CDC13) ά 8.70 (1H, s), 7.78 (2H, d, J = 7.0), 7.57-7.32 (3H, m), 5.08 (1H, dd, J = 2.5, 5.5), 4.59-4.43 (1H, m), 4.08-3.69 (3H, m), 3.07-2.84 (1H, m), 2.57-2.35 (1H, m), 2.34-2.14 (1H, m), 2.07-1.43 (3H, m), 1.48 (9H, s); 13C NMR (CDC13) d 172.41, 169.04, 166.35, 158.35, 132.24, 132.03, 128.61, 127.3 1, 82.77, 55.41, 54.07, 41.57, 32.21, 28.04, 24.97, 20.37; Analysis of the calculation of C20H26N40.5: C, 59 · 69; H, 6.51; N , 13.92. Measured 値: C, 59.53; Η, 6.53; N, 13.84. MS (ES +) 425 (M + Na, 71%), 403 (M + + 1,100), 145 °). (45) -7-benzylamido-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6 ^ 1-carbo [l, 2 -a] [1,2,4] triazafluorene-4-carboxylic acid (263). Vinegar 262 (720.0 mg, 1.80 mmol) in i: 1 CH2C12 &amp; TFA (150 ml) mixture of -407- this paper 诙 standard applicable ϋ Ι house standard rate (CNS) A4 format (2H) X297 public holiday ) --- (Please read the precautions on the back before filling out this page)

Consumption cooperation by employees of the China Prospective Bureau of the Ministry of Economic Affairs, produced by Du Yin 1235157 Λ7 B7 V. Description of the invention (405) Solution, stirred for 1.3 hours in an anhydrous atmosphere. The solution was reduced again under vacuum, and the solution was reduced with Et201 and reduced again. This process was repeated six times to produce the crude product as a white solid. The product was purified by flash chromatography (5% MeOH / CH2C12) to yield 520.0 mg (83%) of the title compound as a white foam ...] D25 +59.5. (C 1.82, CH2C12); IR (KBr) 3435, 3266, 2956, 1732, 1664, 1524, 1486, 1440, 1302; lH NMR (CDC13) 9.13 (1H, s), 7.77 (2H, d, J = 7.5 ), 7.57-7.32 (3H, m), 5.27 · 5.16 (1H, m), 4.62-4.43 (1H, m), 4.09-2.70 (3ΗΫ m), 3.14-2.89 (1H, m), 2.59-2.43 ( 1H, m), 2.38-2,20 (1H, m), 2.14-1.89 (1H, m), 1.82-L59 (2H, m); l3C NMR (CDC13) ^ 173.65, 1 72.28, 166.44, 158.42, 132.44 , 13 1.3 1, 128.61, 127.39, 54.83, 54.01, 42.11, 31.79, 24.42, 20.29; MS (ES-) 345 (M-H +, 100%), 161 (45). [21 ^, 33 (43)] 1> 1- (2-methoxyoxy-ketotetrahydrofuran-3-yl) -6,10-diketo-1,2,3,4,7,8, 9,10-octahydro-6H-dapyrido [l, 2-a] [l, 2,4] triazapyridin-4-carboxamide (264). To acid 263 (300.0 mg, 0.87 mmol) and (2RS, 3S) -3-alanoxyamino-2-benzyloxy-5-benzyltetrahydrobitan (Chapman, Bioorg. & Amp Med. Chem. Lett. 2. pp. 615-18 (1992)) (277.6 mg, 0.95 mmol) in anhydrous CH2C12 (2.5 ml) and anhydrous DMF (2.5 ml) at rt. (Triphenylphosphine) palladium chloride (13.0 mg), followed by tri-n-butyltinhydrogen (466.0 µl, 1.73 mmol). The reaction was stirred for 5 minutes, followed by adding 1-benzylbenzene and three vomiting (234.1 mg, 1.73 mmol) and cooling the mixture to 0 × :, then adding · N (3-dimethylaminopropyl) -3 -Ethylphosphonium diimide hydrochloride (204.5 mg, 1.04 mmol). Warm up the mixture -408 · This paper &amp; dimensions are applicable to the Chinese National Cricket (CNS) Μ current grid (210X 297 male chromium) (please read the meaning of the © before filling in this I)

Printed by the Consumers 'Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 1235157 A7 B7' V. Description of the invention (406) to rt, stirring for another 16.5 hours. The mixture was diluted with EtOAc and washed with 1M NaHS03, saturated NaHC03 (x2), H20 and then brine. The organic layer was dried (MgS04), filtered and concentrated. Purification of the residue by flash chromatography (5% MeOH / CH2Cl2) yielded 358.3 mg (77%) of the title compound as a white solid: IR (KB〇3435, 1791, 1665, 1526, 1421, 1285; β NMR (CDC13) d 8.76 and 8.49 (1Η, 2 X s), 7.92-7.73 (2Η, m), 7.62-7.24 (8.5H, m), 6.86 (0 · 5Η, d, J = 8.0), 5.53 and 5.33 ( 1H, d, J = 5.5, s), 4.95-4.34 (5H, m), 4.04-3.54 (3H, m), 3.03-2.64 (2H, m), 2.49-2.14 (2H, m), 2.11-1.46 (4H, m); MS (ES +) 558 (M + Na, 100%), 536 (M + + 1, 78), 404 (58) 〇 [3S (4S)] 3- (7-benzylamine -6,10-diketo-1,2,3,4,7,8,9,10-octahydrodiamine and [l, 2-a] [l, 2,4] triazale-4 -Carboxamido) -4-ketobutyric acid (265). A mixture of 264 (350.0 mg, 0.65 mmol), 10% Pd / C (350 mg) and methanol (36 liters) in h2 atmosphere Stir for 6.5 hours. The mixture was evaporated and the solvent was evaporated. 3 Et20 was added and the solvent was removed again. This process was repeated four times to remove 283 mg (97%) of the title compound as a white crystalline solid: mp off the carboxylate salt. 14 . (:; [PAN] D26 +33.5. (C 0.18, MeOH); IR (KBr) 3428, 16 63, 1528, 1487, 1437, 1288; LH NMR (D6-DMSO) d 10.56 (1H, S), 8.71-8.57 (1H, m), 7.88-7.81 (2H, m), 7.65 · 7.46 (3H, m ), 4.97-4.85 (1H, m), 4.38-4.0 (3H, m), 3.88-3.52 (3H, m), 2.91-2.71 (2H, m), 2.50-2.38 (1H, m), 2.35-2.21 (1H, m), 2.10-1.94 (1H, m), 1.93-1.49 (3H, m); 13C NMR (D6- DMSO) δ 173.66, 172.49, 169.97, 169.89, 164.96, 157.62, 132.35, 131,85, 128.39, 127.32, 53.81, 52.69, 40.90, 33.17, ______- 409-_ Tai Mi This old office si meets on both sides: · Da (ΓΝ; ς, therefore ^ v, Q7 饬, (Please read the note of vB first Matters refill this I)

1235157 A7 B7 V. Description of the invention (407) 31.60, 24.40, 24.13, 19.24; MS (ES-)

^ NHZ Η

1) TFA

ΝΗZ Phth-N ^^^ H Η (266) 1) PCI5 2) ZN ^

Employees' Cooperatives of the China Economic and Trade Standards Bureau of the Ministry of Economic Affairs (it) (2S) 3-Aminooxycarbonylamino-2-phthalimidoimidopropionic acid (266). (2S) a solution of 3 · fluorenyloxycarbonylamino-2-tertiary-butoxycarbonylaminopropionic acid dicyclohexylamine salt (3 g, 5.8 mmol) in digas methane (200 ml), at 1 M The HC1 solution was washed four times, dried (MgS04) and concentrated. The resulting oil was redissolved in anhydrous methane (33 ml), cooled to 0eC and treated with trifluoroacetic acid (35 ml). This solution was stirred at (TC for 1.5 hours and evaporated to dryness. Add methane ( 50 ml: Remove the residue under empty air. Repeat this process six times to produce a white solid. The white solid is suspended in toluene (50½ liters) and powdered phthalic anhydride (94 mg, 6.35 mmol) (Ear)) treated and refluxed for another 18 hours. The resulting solution was agriculturally contracted to form an oil, which was purified by flash chromatography (2-10% methanol / digassing) to yield 266, 2.01 g (94%) as a white powder: ir (KBr) 3600-2500br, 1776 1714, -410-This paper music standard is commonly used in the Chinese National Standard (CNS) A4 specification (210 X29 * 7 mm) 1235157 Λ7 B7 V. Description of the invention (408) 1530, 1469, 1455, 1392, 1263, 1 13 1, 722; NMR (CDC13) d 7.83 (2H, m), 7.72 (2H, m), 7.29 (5H, m), 5.41 (1H, m), 5.03 (2H, s ), 3.90 (2H, m); MS (ES 367 (M-1). [3S (2S) 1-fluorenyloxycarbonyl-2- (3-; oxocarbonylaminophthalimidoimidopropylidene) ) Answer ^ and -3- enemies second-butyric acid (267). Acid 266 (1.32 g, 3.58 millimoles) in anhydrous acetamidine (37 mL), treated with phosphorus pentachloride (104 g, millimoles), and stirred at room temperature for 2 hours. The solution was filtered to remove The unreacted pentachloride was evaporated to dryness. The residue was treated with anhydrous benzene (25 ml) and evaporated. This process was repeated several times. The resulting oil was dissolved in anhydrous dichloromethane (25 ml) and cooled to 〇eC and (3S) 1-benzyloxycarbonyl dagen-3-acid tert-butyl ester (1.15 g, 3.58 mmol) in anhydrous digas methyl pit (2 ml) followed by 5% sodium bicarbonate Aqueous solution (25 ml) was treated; • The kun compound was quickly stirred at room temperature for 20 hours, then diluted with ethyl acetate (100 ml), and acidified to pH 2 with 1M HCI. The organic phase was diluted with HC1 solution It was washed with brine, dried (MgS04), and shrunk. The resulting oil was purified by flash chromatography (2-20% ethyl acetate / digas methane, and then 10-20% methanol / digas methane). (267) W Consumption cooperation with employees of the China Bureau of Standards and Technology, Ministry of Economic Affairs, Du printed f, 1.25 grams (52%) was white powder: IR (KBr) 3367, 2955, 1722, 1517, 1455, 1387, 1369, 1251 , 1 1 53, 721; lH ^ NMR (CDC13)

7.81 (2H, m), 7.74 (2H, m), 7.63 (1H, brs)? 7.31 (i〇H, m), 5.46-4.76 (5H, m), 4.07-3.54 (4H, m), 2.4 ( 1H, m) 7 2.0-1.6 (3H, m), 1.40 (9H, s); MS (ES +), 671 (M + 1), 693 (M + Na). (15,95) 1,2,3,4,7,8,9,10-octahydro-10-keto-9-phthaloimine-61 * 1-dioxo [l, 2-a] [1,2,4] Triazabenzene tricarboxylic acid tertiary-butane § (268). Ester 267 (50 mg ·, 0.074 mol) in methanol (15 ml) solution at 10% Pd / C 411- this paper ife scale applies Chinese National Standard (CNS) A4 (2l0X ^ 97mm) ) 1235157 A7 B7 V. Description of the invention (409) (50 mg) Treatment and hydrogenation at room temperature and repeated atmospheric pressure for 24 hours. The mixture was fully evacuated to remove hydrogen, and then treated with a 37% aqueous formaldehyde solution (18 mg, 0.22 mmol) and stirred under nitrogen for 2 hours. The mixture was filtered and evaporated to dry product and purified by flash chromatography (4-100% ethyl acetate / dichloromethane) to yield 268 14.5 mg (48%) as a mash: W NMR (CDC13) d 7.85 (2H Bit), 7.71 (2H, m), 5.78 (1H, dd, J = 10, 5), 4.99 (1H, dd, J = 6 丄 1.5), 4.07 (1H, d, J = 10.6), 3.49 (1H, dd, J = 14, 5), 3.39 (lH, d, J = 10.3), 3.24 (1H, dd, J = 14, 10.2), 3.17 (2H, m), 2.39 (1H, m), 1.84-1.46 (3H), 1.51 (9H, s); MS (ES +), 415 (M + 43 7 (M + Na). Compounds 280-283 were prepared in a similar manner to 226e 212b 3 compound 284-227 was prepared in a similar manner to 217e. Printed by the Central Consumer Bureau of the Ministry of Economic Affairs and the Consumer Cooperatives -412- This paper scale is applicable to the national standard Li (CNS) A4 (210x 297 mm) 1235157 A7 B7 V. Description of the invention (410) 〇 R5, N N Η

280-287

Compound A

R 280 281 282 283 〇r ^ 〇r ^% Please read η Note on the back first_fill! I Binding 284 ,. Sub-285 Printed by the Consumer Standards Cooperative of the Central Standardization Bureau of the Ministry of Economic Affairs 286 287

-413- 1235157 Λ7 B7 V. Description of the invention (411)

H2N-OR

0

a R

b R Printed by (3S) 3-allyloxycarbonylamino-4-ketobutanoic acid in the Biaoconsumer Cooperative of the Ministry of Economic Affairs of the Ministry of Economic Affairs. ) Oxime (306a), similar to 208a, Sushima. The chair 'except for the use of 2,6-digas phenylmethoxyamine (prepared in a similar way to 306b) to produce 870 mg (quantitative) tibazone was clarified Of oil. Generation of half card (3S) 3-alanoxypropylamino-4-benzyl butyl succinyl _ sucker two, butyl ester 0- (2- (phenyl) ethyl) oxo (306b), similar to Step 208a is a special preparation, except that 2- (phenyl) ethoxyamine (US 5 346 911) is used in place of the half card p &gt;, which yields 395 mg (fixed tin) of a clear oil. -414- The size of this paper is applicable to China National Standard (CNS) A4 (210x297 G 1235157 Printed by the Consumers' Cooperatives of the China National Standards Bureau of the Ministry of Economic Affairs Λ7 ___ — —_B7 ____ V. Description of the invention (412) [3S (1S , 9S) 3- (9-; amido-6,10-diketonyl-1,2,3,4,7,8,9.10-octahydro-6H-da-pene [i, 2-a] [i, 2] Diazapyridine-1-carboxamidoamino) -amino] -4-ketobutyric acid third-butyl ester, 0- (2,6-difluorophenylmethyl) fat ( 307a) was prepared in a similar procedure to 233e, except that 207a was replaced with 306a, which yielded 23 mg (23%) of 307a as a white solid. [3 5 (15,93) 3- (9-fluorenylamino-6, 10_diketo-1,2,3,4,7,8,9,10-octahydro-611-dapono [1,24] [1,2] diazapine-1-carboxamide ) -Amino] -4-ketobutyric acid tert-butyl ester, 0- (2- (phenyl) ethyl) zine (307b) was prepared in a similar manner to 233e, except that 207a was replaced by 306b, yielding 43 Mg (48%) of 307b as a white solid. [3S (1S, 9S) 3- (9-benzylamido-6,10-diketonyl-1,2,3,4,7,8,9 , 10-octahydro-6H-daphno [l, 2-a] [l, 2] diazepine-1-carboxamido) -amino] -4-ketobutanoic acid, 0- ( 2,6-two gas Phenylmethyl) oxime (308a), prepared from 307a in a similar way to 235e from 234e, yields 15.2 mg (74%) of a white solid: lH NMR (CD3OD) ά 0.9 (m), 1.3 (s), 1.7 (m), 1.8 (m)? 2.0 (m &gt;, 2.1-2.2 (m), 2.3 (dd), 2.4-2.5 (m), 2.6 (m), 2.7-2.8 (m), 3.1 (m), 3.3 (m), 3.4-3.5 (m), 4.5 (m), 4.9 (m), 5.1 (m)? 5.3 (d), 5.4 (s), 6.8 (d), 7.2-7.5 (m), 7.8 (dd), 8.4 (dd) 〇 [3S (1S, 9S) 3- (9-fluorenylamino-6,10-diketo-1,2,3,4,7,8,9,10- Octahydro-6H-dalopano [l, 2-a] [l, 2] diazapyridine-carboxamido) -amino] -4-ketobutanoic acid, 0- (2- (benzene (Ethyl) ethyl) oxime (308b), prepared from 307b in a similar manner to that of 235e from 23 puff, yields 25.2 mg (68%) of white solids. · NMR (CD3OD) δ 1.2 (m), 1.6- 1.7 (m), 2.0-2.1 (m), 2.2 (m), 2.3 (m), 2.5 (m), 2.6-2.7 (dd), 2.9 (t), 3.0 (t), 3.1 (m), 3.3 -3.5 -415-The size of this paper is applicable to Chinese National Standard Car (CNS) A4 (210X 297mm) 1235157 A7 B7 V. Description of the invention (413 (m), 4.2 (t), 4.25 (m), 4.5 ( m), 5.2 ('t), 5.3 (t), 6.7 (d), 7.1-7.2 (m), 7.35 (dd), 7.4 (m), 7.5 (m), 7.8 (dd), 8.3 (dd) ^

O O

O

H OR (Please read the note on the reverse side first and fill in the tile) Binding of the Consumers' Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 10-di'_yl-1,2,3,4,7,8,9,10-octahydro-6H-da-peng [l, 2-a] [l, 2] diazapyridine-1- Carboxamido) -amino] -4-ketobutyric acid tert-butyl ester (302). Step A: 301 is prepared in a similar step to 605a (Step A), except that -416- paper scale is applicable to Chinese national standard plums (CNS) with a courtesy (2I0X 297 mm) 1235157 Λ7 B7 V. Description of the invention (414) Instead of 603, 54Q mg (, 34%) of a white solid ^ B step can be generated. 〇2. 〇1 () 0.7¾g; 〇91mmol) in 28 ml of a solution of tartar / MOAc (5: 1: 1) solution for 5 hours under n, and the reaction was carried out under the air Rolled to 0.7 ml 1 retentate dissolved in 3 ml of CH3CN, and then concentrated to 0.7 ml (3x), dissolved in glutinous rice; reduced to 07 ml (2 x 2X), and concentrated to Dry analysis (fast, S02, 5% isopropanol / CH2C12) yields j02 (4). 5¾ g '78%) as a white solid: iH NMR (DMS〇.d6) ^ 1.0-1.15 ( m, 2H), 1.4 (s? 9H), 1.65 (m, 2H), 1.9-2.1 (m, 2H), 2.15 ^ 2.4 (m, 3H)? 2.55 (m, 1H), 2.7-3.0 (m, 2H), 4.3-4.6 (m, 2H), 4.9 (m, 1H), 5.2 (m, 1H), 7.4-7.6 (m, 2H), 7 · 8-8 · 0 (m, 2H), 8.6 ( m, 1H), 8.8 (m, 1H), 9.4 (s, 1H). [1S, 9S (2RS,) S)] 9-benzylgg amino-6,10-diamidino_1,2,3,4,7,8,9,10-octahydro-N- (2 -Methoxy-5-keto-tetrahydrocranyl-3-yl) _6H_datr and [1,2-a] [l, 2] diazafluorene-1-carboxylic acid amine (3〇 4a) 3 Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs A Step: 302 (90 mg; 0.18 mmol) in 10 ml of MeOH solution of dimethyl orthoformate (1 ml) and The meta-ammonium benzyl acid-hydrate (5 mg, 0.026 mmol) was treated and the reaction was stirred for another 20 hours. The reaction was treated with 3 ml of a saturated NaHC03 aqueous solution and concentrated under vacuum. The residue was taken up in EtOAc and washed with dilute aqueous NaHC03 solution, dried over MgS04 and concentrated in vacuo to give 80 mg of 303a. Step B: 303a was dissolved in 2 ml of TFA, and then stirred at room temperature for 15 minutes. 3 The reaction was dissolved in CHzCl2 and concentrated in vacuo (3χ). Chromatography (Rapid, SiO ,, "/ 0 to 3% MeOH / CH2Cl2 yielded 43 mg (64%) of 304a as a white solid: 1H NMR (CDC13) d 1.55-1.8 (m, 2H), 1.9- 2.15 (m, 4H), -417- 1235157 A7 B7 V. Description of the invention (415) 2.25-2.5 (m, 2H), 2.7-3.3 (m, 4H), Ϊ.45, 3.6 (s, s, 3H) , 4.4, 4.75 (2m, 1H), 4.6 (m, 1H), 4.95, 5.4 (t, d? 1H), 5.1-5.2 (m, 1H), 6.45, 7.05 (2d, 1H), 6.95 (m, 1H), 7.45 (m, 2H), 7.5 (m? 1H), 7.85 (m, 2H). Example 11 Compounds 214e, 404-413, 415-445, 446-468, 470-491, and 493-499 Example 11 and Table 7. Synthesize as described in Table 7. Please read the meaning of “%” before you fill in the “Ministry of Economic Affairs and Standards Bureau of the People ’s Republic of China” employee cooperation cooperation printed-418- This standard is applicable to S3 domestic standards (CNS ) Six 4 hans (210X 297 mm) 1235157 A7 B7 V. Description of invention (416) Printed by the Consumers' Cooperative of China Standards Bureau of the Ministry of Economic Affairs

0 -419- Chinese standard car (CNS) A4 grid (210 X 297 mm) applicable to the standard of this paper (remember to read the precautions of back cloud before filling out this page) Shiyi-Order 1235157 A7 B7- ---_______---^--.-_ 5. Description of the invention (417) Step A. Synthesis 401. TentaGel S®, NH2 resin (0.16 mmol / g, 10.0 g) was placed in a glass funnel with sieve holes, and DMF (3 x 50 ml), 10% (v / v) DIEA in DMF (2 X 50 Ml) and finally DMF (4 x 50 ml). Add sufficient DMF to the resin, then add 400 (1.42 g, 2.4 mmol, prepared from (3S) -3- (retylmethoxycarbonyl) -4-ketobutanoic acid tert-butyl According to A.M. Murphy et. Al. J. Am. Chem. Soc., 114, 3 156-3157 (1992)), 1-hydroxybenzotriazole-hydrate (唑 ΟΒΤ · Η20: 0.367 g , 2.4 mmoles), 0-benzyltriazol-1-yl-N, N, N, Nf · tetramethylphosphonium hexafluorophosphate (HBTU; 0.91 g, 2.4 mmoles) and DIEA (0.55 Ml, 3.2 mmol) to obtain a slurry. The reaction mixture was stirred at rt overnight using a wrist-arm shaker. The resin was separated on a perforated glass funnel by vacuum suction and washed with DMF (3 X 50 ml). Unreacted amines were capped and the resin was reacted directly with a 20% (v / v) Ac20 / DMF (2 X 25 ml) in the funnel (10 min / wash). The resin was washed with DMF (3 X 50 ml) and CH2C12 (3 X 50 ml), and then dried overnight in the air to produce 401 (11.0 g, quantitative yield). (Please read the back; i. What you want ¾ before filling out this page)

B step. Synthesis 402. Resin 401 (6.0 g, 0.16 mmol / g, 0.96 mmol) was washed in a perforated glass funnel with DMF (3 x 25 ml) and swelled. The Fmoc protecting group was then resolved with 25% (v / v) hexahydropyridine / DMF (25 ml) for 10 minutes (intermittent stirring) and fresh hexahydropyridine reagent (25 ml) for 20 minutes. 3 resins were then resolved with DMF (3 X 25 Ml) and k-methylpyrrolidone (2 x 25 ml). After the resin was transferred to a 100 ml flask, N-methylpyrrolidone was added to obtain a slurry, and 212f (0.725 g, 1.57 mmol), 〇〇ΒΤ · Η, 〇 (〇.25 g, 1.6 Millimoles), HBTU (0.61 grams, 1.6 millimoles) and dIEA -420- The standard of this paper is applicable to the national standard TcNS of China II) A4 Tiege (210 X 297 Public Transformer Ί 1235157 Ministry of Economic Affairs, China Standards Bureau Printed by employee consumer cooperative A7. _ B7___ V. Description of the invention (418) (0.84 ml, 4.8 millimoles) 3 The reaction mixture was stirred overnight at rt, and the wrist arm oscillating tank 3 was treated with resin and 20% (v / v) Ac2O / DMF was capped as described in 401 to produce 402 (6.21 g, quantitative yield). C Step 3 Synthesis of 403. This compound was prepared from resin 402 (0.24 g, 0.038 mmol). , Using Advanced ChemTech 3 96 Multiple Peptide Synthesizer. The automated cycle includes washing the resin with DMF (3 x 1 ml), deprotecting with 25% (v / v) hexahydropyridine / DMF (1 ml) for 3 minutes, and then Fresh reagent (1 ml) over 10 minutes to produce resin 403. Resin was washed with DMF (3 X 1 ml) and N-methyl siloxone (3 X 1 ml). A D Method 1. [3S (lS, 9S)]-3- (6,10-diketo-1,2,3,4,7,8,9, 10-octahydro-9 heptathione-3 -Fluorenylcarbonylamino) -6H-da [[1,2-a] [1,2] diazafluoren-1-carboxamido) -4-ketobutanoic acid (409). Resin 403 with 0.4M, Sephen-3-carboxylic acid and 0.4M HOBT in N-methylpyrrolidone (1ml), 0.4M HBTU in N-methylpyrrolidone (0.5ml) and 1.6M DIE A was tritiated with a solution of N-methylpyrrolidone (0.35 ml), and the reaction was shaken at rt for 2 hours. The tritiated step was repeated. Finally, the resin was washed with DMF (3 X 1 mL), CH2C12 (3 X 1 mL), and dried under air. The aldehyde was dissociated from the resin and treated neatly with 95% TFA / 5% H20 (v / v, 1.5 ml) at rt for 30 minutes. After washing the resin with a dissociation reagent (1 ml), the mixed solution was added to cold 1: 1 Et20: pentamidine (12 ml), and the resulting precipitate was separated by centrifugation and decantation. The resulting pellet was re-dissolved in 10% CH3CN / 90% H2O / 0.1% TFA (15 ml) and freeze-dried to obtain crude 409 as a white powder. The 3 compound was purified by semi-preparative HPLC using a MicrosorbTM C18 column (5 micron, 21.4 X 250 ml), with a line receiving -421-This paper music scale uses China 1] House standard Li (CNS) A4 (210X 297 male splash) '&quot; (Please read first Fill in the matters on the back.fr) 1235157 A7 B7 V. Description of the invention (419) CH3CN gradient (5% -45%) dissolves, containing 0.1% TFA (v / v) for 45 minutes, at 12 ml / Fractions containing the desired product were pooled in 3 and freeze-dried to yield 409 (10.8 mg, 63%). Step D. Method 1A. Synthesis 41 8. According to the similar method, the resin 403 ′ is completely transformed with 4- (1-trimethylmethoxy group) and the amino group is repeated. The Fmoc group is removed as in step C, and the free amine is 20% (v / v) Ac20 was acetylated in DMF (1 milliwell) and 1.6M DIEA in N-methylpyrrolidone (0.35 ml) at rt for 2 hours. Repeat this ethylation step. Dissociation of the aldehyde from the resin yields 41 8 (3.2 mg). Step D. Method 1B. Synthesis 447. Follow steps as in Method 1A. Resin 403 was repeatedly triturated with 0.4M 4- (1-fluorenylmethoxycarbonylamino) benzoic acid. The Fmoc group was removed as above, and the autofluorinated amine was reacted with 1M methanesulfonium in CH2C12 (0.5 ml) and 1M pyridine in CH2C12 (0.60 ml) at rt for 4 hours. Dissociation of the aldehyde from the resin produces 447 (10.0 mg). D Step 3 Method 2 to synthesize 214e. Following a similar procedure as Method 1, Resin 403 was 0.5M tritium in N-methyl said pyridone (1 ml) and 1.6M DIEA in N-methyl said Luodian copper (0.35 ml) with rtSS Repeat for 2 hours and 3 stitches. Dissociation of the aldehyde from the resin produces 214e (5.1 mg, 30%). Seal of Consumer Co-operation of the Bureau of Standards of the Ministry of Economic Affairs ¾ (Please read the notes on the back before filling this page) Step D. Method 3. Synthesis 427. Following a similar procedure to Method 1, resin 403 and 1.0M benzenesulfonium were reacted in CH2C12 (0.5 ml) and 1M pyridine in CH2C12 (0.60 ml) at rt for 4 hours. The response was repeated. Dissociation of aldehyde from resin yields 427 (7.2 mg, 40%) ^

Step D. Method 4. Synthesis 420 3 Follow the steps of similar method 1, resin 403 and 0.5M methyl isocyanate in N-methylpyrrolidone (1 ml) and 1.6M _-422-This paper is a common Chinese national standard (CNS) Μ current grid (210: &lt; 297 mm) 1235157 Λ7 B7 V. Description of the invention (420) Please read the note after 35

Fill in ¥ DIEA in N-methylpyrrolidone (0.35 ml) for 2 hours. The reaction was repeated and the aldehyde was dissociated from the resin to give 420 (8.3 mg, 55 ° / 〇) 3 D step. Method 5. Synthesis 445. Following a similar procedure to Method 1, resin 403 was 0.27M imidazole-2-carboxylic acid (1 ml) in 2: 1 DMF: H20 (with 1 equivalent of DIEA) and 1M 1- (3-dimethylaminopropyl)- 3-ethylcarbodiimide hydrochloride (EDC) was tritiated at 2: 1 N-methylpyrrolidone / H2O (0.35 mL) at rt for 3 hours. Dissociation of the aldehyde from the resin produces 445 (9.5 mg) 3 Analytical HPLC method: (1) Waters DeltaPak C18, 300A (5 microns, 3.9 x 150 mm). The linear CH3CN gradient (5 ° / -45%) contains 0.1% TFA (v / v) at 1 ml / min for 14 minutes. (2) Waters DeltaPak C18, 300A (5 microns, 3.9 x 150 mm). Linear CH3CN gradient (0% -25 ° / 〇) containing 0.1% TFA (v / v) for 14 minutes at 1 ml / min β (3) Waters DeltaPak C18, 300Α (5 microns, 3. 9 X 150 Mm). Dissolve at equal density and 0.1% TFA / water (v / v) at 1 ml / min. (4) Waters DeltaPak C18, 300Α (5 microns, 3.9 x 150 mm). A straight CH3CN gradient (0% -30% / 0) containing 0.1% TFA (Wv) at 1 ml / min for 14 minutes.

5L (5) Waters DeltaPak C18, 300A (5 micrometers, 3.9 x 150 mm) printed by the China Consumer Affairs Bureau of the Ministry of Economic Affairs. 3 Linear CH3CN gradient (0% -35%) contains 0 ″% TFA (v / v) 14 minutes at 1 ml / min. • 423- The paper scale is applicable to the Chinese National Standard (CNS) A4 standard (210X 297 male elk) 1235157

A

7 B 42 / ^ \ Explanatory note issued by the Ministry of Economic Affairs, the Central Bureau of Standards and Technology for the consumption cooperation of employees Du Yin ¾ Ψ &lt; (&amp; 牧 csj CM CNJ + cn X 2 in in &lt; J \ in to Η CC CU IT CvJ 1 dQ ～ ① VO (NJ oiP KD $ KO VO rH —afi CO -c \ i σ \ 00 Σ in π rr 00-00 to 卜卜 t4 s 卜 〇Z CM re rl &lt; N 〇〇〇〇VD C \ JX CNi CN CJ CO 〇2 VD CM X CNJ CN U Race 5 δχ ° &lt; &gt; °. Tide. ° s. Chemical mother: 5 re ° &lt; &gt; °,: s &lt; u * ^ r tH CN Ο in o -424- The standard of this paper is applicable to the national standard of Chinese g (CNS) Α · 4 Tiege (210X 297 mm) (Please read the back &amp; note the contents first): Fill in this book Order 1235157 μ Β7 V. Description of the invention (422) Employees' Cooperatives of the National Bureau of Samples of the Ministry of Economic Affairs, CN CN CM eg + cn re s 1 r · LD cn U〇a \ L〇 · Η a: U j CLi re 1-4 cfP VO rH-df &gt; 〇 ^ σ \ rH Op CO 〇 (Ti a \ rH dP 00, rH G \ rH fH 2: 2 σι 00 CO bu rH &lt; Tk ^ r rl L〇a \ iT &gt; L〇o CM L〇X BU 0 2 r—1 〇 m CN rH CN U 2: vo CN re tO CNJ CJ BU 02 CM X «r &gt; CVJ CJ; o &lt; r 2 CD CN CNJ CJ 5 = ° &lt; &gt; 0. Send δ re ° ^ °. Ji Srn o = ^ J &gt; = o. Dig δ = if interesting. \ VD 〇 卜 〇03 〇σ \ ο 42. (Please read the precautions on the back before filling in this page) The size of the paper is applicable to the national standard of the country (CNS Μ4 Tiege (210X29? Mm) 1235157 Λ7 B7 V. Description of the invention (423) Central Ministry of Economic Affairs Printed by Standards Bureau Consumer Cooperatives

Please read the book "Shi Shi" t I I ^ t Ordering -426- The standard of this paper is applicable to Chinese national standard (CNS) A4 (2 丨 0X297 mm) 1235157 A7 B7 V. Description of the invention (424 ) Printed by the Consumers' Cooperatives of the Ministry of Economic Affairs, China Standards Bureau

γΗ rH rH + cn 2: X + X 00 σ \ bu in cn in Η CC α. re rH afi CO 5 tn ^ b t—ί dP κο α rH L〇tn 00 3: X KO rr 00 CO * * 3 * 〇〇. 00 Γ0 tn ro L〇Ct4 X a \ 〇2-^ r C \ JX CNJ CNJ CJ 〇 2 rH U cn CN a: rH CM 〇o tH oo ΓΊ X &lt; r CM U : I -r σ x. Into. school. . Women δχ 〇 = &lt; ~ &gt; = 〇s = 〇 == &lt; 7 &gt; = 〇% r, -oo— in rH VO rH r- rH -427- (Fill in this page)

The standard of this paper is applicable to Chinese National Standards (CNS) A4 (210X 297mm) 1235157 Λ7 B7 V. Description of the invention (425) + &lt; H + W) ss sun 66ΓΟ 86ΓΟ

Φ iHuldH (JPCD6Ξ ε6 · ς S6 5 ς3 · ς 2: 2: 〇ς · ι〇ς 8Ξ6ε 6ε · bu 6rn 80LON bu CNlHrnCNo 80SSH9I3 stnNroCSIH9Io Printed by the Consumer Affairs Cooperative of the China Economic Development Bureau of the Ministry of Economic Affairs ^

&gt;. NH

Ο = ¾¾ ocvl ^ r -428-

The ft scale of this paper applies to the Chinese national standard (CNS M4 is now (210 X 297 mm) 1235157

V. Description of Invention (426) Printed by the Consumers' Cooperative of the Central Government Bureau of the Ministry of Economic Affairs ^

cn 1-H rH rH Ξ * X + X CO ro bu o CD ot〇Η CC g order α. 3C CM ~ dP 2-Bu tH-c? ps &quot; VD rH-d〇 ~ c〇s ^ L 〇rH 1 o CN ^ S Σ VD CN m £ T ^-kO bu CNi 0Ί &lt; Tk bu CM as U4 X CO CO 〇Z CNJ 2: vo rH U r- O VO Z CO CVJ r ri C \ J o cn ooO 2 L〇CN-ro CNJ. 〇CO OL〇2 cn CN 5 1— »u Race s = 0¾ 〇.« Λ ^ 〇i = 〇 = H = ° 5 = ° &lt; &gt; 0. Inverse δ = 0 = ^ = 0. &amp;! ° v tH CN4 OJ CVJ cn OJ ry CM

I

I 1 ·% Έ Order -429- 1235157 A7 B7 V. Description of the invention (427) Employees of the China Standards Bureau of the Ministry of Economic Affairs will print the cooperative seal ^

rH cvj cn + cn X Σ § f- »t— &lt; UO rH L〇rH 00 s 〇 4 X rH dP CS4 u 00 rH '-dP CO O CTi 00 cfP ^ CO ε ^ s Σ rH vr &gt; o tH in o in · o L〇O in o 00 CT4 Σ 00 〇 ^ 3 * CVJ 2: iD CN U buπ 2: 〇ro X rH CnJ 〇CO CO o &quot; «T 2 &lt; NX o cvj ； U s δχ. &amp; t \ re 〇 工 〇 = 〇 = 〇 o〇. . ° b 'S x 0 = ^ ° o ^^ o ° ° 6 ° m C4 VO 04 r- &lt; N (# .Please read the precautions for the back of the girl before filling in this one) -430- This paper size applies Chinese National Standard (CNS) A4 is now available (210X 297 mm)

1235157 A7 B7 V. Description of the invention (428) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs cn • &lt; tH rH + cn X CO rH n CNJ 〇iT &gt; o VD &lt; r e- cc a. One dP ^ -mm a &lt; ^ P 2-ath s s-L〇CNJ-cfP VD ^ VD, i Γ0 · omo L〇rH o L〇VO 々C7N tO Cu cn 00 〇in zm CN X VD rl 〇VO 〇Z o CN X rH o CD 〇L〇2: BU CNJ X Γ0 CNJ υ Bu 〇in 2 L〇CvJ X iH CN u -r · δ e 〇 = 〇 = 〇. ^. V- ac0. · Plant 3: O X 0 = Q = 0 rw2X ° Cr; X o X 〇 = &lt; &gt; = 〇. school. ZI 1¾ O 'W ox 0 &lt; ^ = 0.莩% ω 04 Oi CVJ o cn r-4 m -431-The size of this paper is applicable to Chinese National Standard Plum (CNS) Μ Appearance (210X297 mm)

1235157 A 7 B7 V. Description of the invention (429) Employees of the Li Bureau of the Ministry of Economic Affairs of the People's Republic of China will print fH cooperatives rH rH rH + cn S + X VO CO 00 σ »L〇00 σν CC 〇4 X rH as s & quot L〇rH aP OB O &lt; Ti r—H rH rH-σP 5-rH-ciP, 〇S η ^ L〇s 2 v «o L〇00 rH L〇 * σ \ 卜 00 o uO 0 &quot;) C7k 々U4 X 卜 〇 卜 2 cn CM rc *-(CNJ o r- 〇L〇2 r · CNJ n: CN CJ S ZZ S c \ i CNJ υ_ · r- 〇lD 2 m 04 X CN CJ 5 x 0 = V = 0% work zzz §x 0 = ^ °. Reverse 5 work 〇 = 〇 = 〇. Reverse 1¾ §x ° &lt; &gt; 〇oi ° o ° ^ 3 CM m cn rT m in rn first Read the back of Sr and fill in this book. Bookmark -432- This paper scale is applicable to the standard gg family standard (CNS) A4 (210 X297 mm) 1235157 A7B7 5. Description of the invention (430) Ministry of Economic Affairs t Central Standard Twin Bureau employee consumer cooperatives printed 4μ ^ rH rH i—l tH + (η X x X VO &lt; y \ &lt; NJ L〇VO (Ti VD σ \ Η α: &gt; -— Ο 2 2: d〇〇s CN w 00 t〇cfP 00 &lt; 23 r- &lt; Jk CVJ rH rH to dP s-&lt; r lD to &lt; 5P CO 3: Σ 〇L〇u〇a \ CNi lD uO CNJ L〇o-L〇L〇c \ o L〇in σ \ 々txu Σ 〇〇 2 2 〇CN &quot; ζΓ CM CJ CO o in 2: CN CN XL〇cvj u 芝芝 CM X CNJ CJ r · 〇tr &gt; 2 L〇CN X 04 CJ Race OI ° § OX SP 0eCC ° &gt; δχ ° ^ °. &! \ XOX 〇 = () = 0 ° o ° ° U &gt; VO m Γ η CD cn c \ cn rr (please read the precautions of Back Cloud 3 before filling out this page) &gt; Shui Ding • 433-The SS family standard is applicable to the paper size (CNS) with a grid (210X 297 mm) 1235157 Λ7 B7 V. Description of Invention (431) Seal of Consumption Cooperation between Standards and Bureau of Ministry of Economic Affairs ¾

&lt; (ci rH rH rH + CO X Σ i 〇rH iH 00 mu 〇 oO cC 〇ι rr a? cfP S-cn 一 όΡ Λ CO q π VD CfP O 00 rH 0Λ 〇3: Σ CN ID σ \ o in 0D L〇 · bu cn L〇tn U5 o ID Cu Σ bu s 2: r- CM 5 &lt; N u bu m 2 r-4 Γ0 X bu CM cn CN cn bu oz CN CNJ X rH CNJ U δ x OX 0 = w = ° Sx 0 = v = ° —— yr ° &lt;! C ° 5 ~. It is ° o °° z- / ° cc ° ο r ~ 4 CVJ -434- (Please first ». Read the notes before filling in this page)

The paper &amp; standard is a national standard (CNS) A4 (210X 297 mm) 1235157 A7 B7 5. Description of the invention (432) Printed by the Consumers ’Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs ¾ rH rH L〇 + κη X Γ0 If) o rH m L〇cn Η CC α. X t—1 dP CNJ 〇〇rH Γ0 rH £ ^ cfp &lt; J \ r-4 -op 00 Pi ^ lD 3: Σ tn in ro tn m · M r- &lt; m rH mu * X GO 〇 • z CO 04 a: BU CNi o BU 02 CNJ · -1 o CN CM X t-4 CN u 〇vo Z CN] CNJ s rH 〇ox ° ^ t. ° 〇:-δ x 〇 = w = 〇. Inverse 〇 = Q ^ O X 〇 = c ^ °. Inverse ° u n XT in -435- This paper is a universal standard of Chinese standard S (CNS M4 is now (210 X 297 mm) Please Saa Yunyi%% 4 Write too page

Order A 1235157 Λ7 B7 V. Description of the invention (2 &lt;

(H + w) SH εςπ 8ες 9Itn Please read it first 33

φ JLHCJldH S6Ξ 00 · ς% 86 {Ι) 3ε · 9 dp86Ξ 9ε · 9 3: 2 ςς · Γ-ες ες · ςΐιο s 09Nosi.o 80ςN62Η {7ΰ Ministry of Economic Affairs t Central Bureau of Associate Bureau Consumer Consumption Cooperative ¾

-Λ

Kn

} ΛZ /; i means

^ 4α ^ -436- The standard of this paper is applicable to the Chinese National Leather (CNS) A4 specification (210X 297 Public Holiday 7 1235157 A7 B7) V. Description of the invention

rH &lt; rH CN + cn X 2: + X r-4 r— &lt; m CNJ o in ID e- cc 〇ι re &lt; —4 CW3 a 00 αο σ \ cn rH rH-cfP 2-rH-dP ~ 00 g ^ -00 Σ rH L〇o f- »u〇o iD rH o L〇Bu U4 Σ CO 〇2 VO CN 3: t〇CM O CO 〇tn 2 Bu CM X CN U CO 〇2 K 〇CN X CNJ CNJ U Sai 4a 5 x ° ^ ° ° κ. M3 OX 〇 = 〇 = 〇. Inverse ° ^ -i -r δ x 〇ν = °. Inverse ° s. 、 Σ \ 〇lO ιΗ LO -437- Paper &amp; Standards Applicable in China National Standard Leather (CNS) A4 (210 X 297 mm) (Please read the precautions on the back before filling this page) Order tweezers 1235157 A7 B7 V. Description of the invention (printed by the Consumer Cooperative of the Central Government Bureau of the Ministry of Economic Affairs 435 CN CN CNJ &lt; NJ + cn ϊ 〇 *) rH o L〇VO &lt; J \ ^ · Η cC Η-ί 〇4 3: r—4 a &quot; df &gt; ~ ① i iH dP rH 00 rH OS rH pH CNJ a c〇CD z ^ VD CtP ^ s σ \ 3: 2 r- &lt; 3 * r- cD-oom L〇 σ \ CO CO tu tu CD S σ z VO CNJ X CNJ CNJ U CO r- 〇2 CM rc n CNi U Γ '〇in zm CNJ CNJ 〇 Ο 〇 r 0 Γ Ο CM 3: f ~ i CN u ^ α ix o = Q = or ^ l. 〇. . Λ ^ ζχ *. Common o— O X 0 = ^ °. Inverse °% O I 0 = ^ °.莩 s δχ 〇 = v = 〇.莩 5 CVJ IT) cn mm spoon · in in -438-This paper music standard is applicable to China National Standard (CNS) A4 (2 丨 0 X 297 male cage) (Please read the precautions on the back before filling in this I ) Binding 1235157 A7 B7 V. Description of the invention

&lt; (&amp; rH rH + (Π X 2 + S 2 cn ί c〇S ^ I n X 〇X ^ fH «-Η CO CC 〇4 re-dP 〇〇® L〇ID PH &lt; JP CNJ CD 々CTk o »-H rH ^ cfP S -00 S Σ L〇o VO VO L〇 * o 00 L〇O 00 π Cjli Σ CD o rr zc \ i re rH CN4 CJ o« -Η o 2 o CNJ X 00 CNJ CJ BU 02 2 CM CS4 OJ &lt; NX rH 〇 Race δ x ° ^ t ° Hard. Ox. = 〇:. O = ^ o Q〇po X 工 〇 == &lt; &gt; = 〇% ι LL LL m nr GO to GO ID • 439- This paper &amp; standard is applicable in g countries (CNS M4 is now standard (210X 297mm) Please read the back of Γ &amp; 's attention to the animal and then fill in this page to order 1235157 Λ7B7 V. Description of the invention

fH rH fH cn s cn 00 σ \ VD m CN in cn m K〇ε- α: 〇 &lt; k »—4 〇re re fH ri 00» —4 〇 &quot; \ o tH rH -σP 2 -VD rH ciP rH 03 * BU X X CO 00 KD (Ti ir &gt;-CNJ C \ JL〇CNJ VD L · * BU 〇s 〇CM CN X pH CM 〇cn c \ 〇2 CVJ X CN C \ ju BU 2 CS4 m CN X rH C \ JU Sai 屮 α δ x 〇 = w = 〇 ° &amp; ° zx ° k 5 x oQ = ° 〇Qt ° ZX Mt ° d:. 5 x =.. Inverse 4 &gt; 4α a \ o VO rH KO -440- This paper scale is applicable to tS national standard (CNS) Α4 Tiege (210X 297 male cage). 玎 玎 (Please read the notes on the back before filling this page) 1235157 A7 B7 V. Invention Note (439) Printed by the Consumers' Cooperatives of the Ministry of Economic Affairs, China Standards Bureau

-442- This paper size is applicable to Chinese standard car (CNS) A4 (210 X 297). (Please read the precautions on the back before filling this page.) Order 1235157 A7 B7 V. Description of the invention (440 Ministry of Economic Affairs Printed by the Central Bureau of Standards Consumer Cooperatives! ^

Please read it on the back.%

II Fill in the form of I-443- This paper size applies to the national standard of China (CNS) A4 (210X297 mm) 1235157 A7 B7 V. Description of the invention (441 Printed by the China Consumer Standards Cooperative Standards Bureau of the Ministry of Economic Affairs ¾ rH fH + cn X s 1 BU VD &quot; ro 〇tn rH CO 00 Ou X tH cN〇§-rH dP in SK〇 ^ BU rH-dP S-BU s X BU cr r- &lt; BU CNl 〇 to ( Ti ◦ CO tx4 X sm &lt; \ j 山 CM CVJ O c \ o Z CN 3: Γ0 CN 〇CO 〇2 vo CNi X cn CN; 〇 赛 5 x. = &^; \. 5x .〇4 ° Κ & lt δ Q '° ^ ° δι 〇 = ^ °. School. CVJ n rr rr -444- This paper music scale is applicable to the Chinese national standard (〇 &gt; ^) six 4 grids (210/297 mm) (please first (Please read the notes on the back of the K and fill in this one) 1235157 A7 B7 V. Description of the invention (442) Member of the China Standards Bureau of the Ministry of Economic Affairs X Poverty Alleviation Cooperative Society ¾ fH »-H rH + CO S * S + 2 rH ιΤ) 0D 00 tn bu 00 rH ΚΩ tn Η cc CJ order v-5 Ο 5C rH ^ -ON rH dP ^% CNJ WL〇 «-Η ciP ^ 'SX &lt; Jk m 00 r ·-^ r bl rr 00 L〇cn in uO C ^ i 卜 〇in ZL〇CNJ re Γ0 eg U CO 〇§ CVJ X CM CNJ u 〇uO 2 m cn X VO OJ ·· U 5 OX ° ^ r °. Δδχ 〇 = &lt; ^ &gt; = 〇. Inverse 0 XOX ° ^ °. &Amp;. 2X Hb swallow i 〇r * VO 卜卜卜 -445- This paper music scale is applicable to the Chinese National Standard Li (CNS) VI "See box (210X297 mm) (Please read the precautions on the back before filling this page)

1235157 A7 B7 V. Description of the Invention (443 Employee Consumption Cooperation of the Ministry of Economic Affairs, China Standards Bureau, Du Yin ¾ 4μ ^ γ-1 rH &lt; r-4 + CO X Σ 1 Γ0 c \ i L〇00 L〇 卜 cn cn in in ο Φ Ι-Η 〇4 32 rH-dP _ 〇〇L〇r-f-CfP S-uO-cfP 00, q ^ L〇3: Σ ΓΟ tD r &gt; CN in 5-r- m in CO L〇ID Cu cn &lt; ji 〇L〇 芝 CNJ X rH CM U 00 〇2 VD CVJ rr CN4 CN U a \ 〇VD 2 om X uD CN CJ Race δχ ° = &lt; i &gt; 〇. 麦 \ δ xo = w =.. Ji. QU · ο X • gi 〇 = 〇 = 〇. Inverse. Each o ο A 工 工 AXX 豸 ^ 3 ω ο σ \ Bu ο 00 -446- This paper standard applies to the national standard of China and China. (CNS) A4 is now available (2 丨 0X2W mm) (Please read the precautions on the back before filling out this page) 1235157 Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

A B7 V. Description of Invention (444)

Δ Please read the note on the back, jt, fill in too, the size of the paper, the size of the national standard (CNS) A4 is applicable (210 X 297 mm), 1235157 A7 B7 5. Description of the invention (445 Ministry of Economic Affairs) Printed CN, rH CN,, rH CNJ rH + cn Ξ S + rH ro L〇VO mm 々σ \ ID ID CC ο Φ cu X fH a ciP CO g ao… rH cfP g- Γ 'dP cn co G \ 〇rI 3: X ιΠ ιΤ) σ \ CNJ in ro u〇 · in f—1 m 〇VO in Ud CO s 2; rH Γ〇 X lD C \ i CJ GO 〇m • za \ CN re CN a 00 〇tD 2 r- (m re CM •• CJ Han 440 such as-5 X ° ^ Jr ° .Net .: zx ° i ^ 5x 〇 = &lt; &gt; = 〇. Inverse o = sa OX 0 = w = °. Threaten 3 QO m 03 VO ω

Order A-448- The standard of this paper is applicable to the standard of gg family standard (CNS) A4 Tige (210X 297 mm) 1235157 A7 B7 V. Description of the invention (446) CNPC Standards Bureau employee consumer cooperative printed CN, 1 -H CNJ, rH CT rK CNJ rH + cn 3: BU LO Lf) rH rH cn L〇CO BU rH uD CO fX3 · 2.. + S ^ a: 〇4 X rH rH-cfP ^ -CO-dP s SL〇rH GiP 〜 03 * ^ C \ &lt; N .Γ- X 00 L〇m L〇in in -cn CN L〇CN L〇KD rH ID o L〇 卜 rH m Ud X CO 〇 L〇2 cn m X VO CM o 00 s 2 «-Η n re ID CNJ CJ CO 〇VD 2 CD CNJ X m CM U c \ 〇lD Z Bu CN cn CN U Sai QQ δ x 0 = &lt; w ^ = 0% AX 5x ° = c ^ = 〇. Inverse ° Λ X 5 x o = &lt; ^ v = o. Inverse 〇 = &lt; zx δχ ° = &lt; w ^. zx 〇 = &lt; o-«r r * GO GO 00 -cr ω o σ \ 449

The standard of wood paper is applicable to the national standard of China S (CNS M4 is now (210X 297 mm) 1235157 Λ7 B7 V. Description of the invention (447) Printed by the Central Bureau of Standards of the Ministry of Economics, printed by the Bayer Consumer Cooperative, rH rH CN + CO X Σ gm lD vo L〇CTi m cn 々CN rH r * Η a: u command cu 2: rH cP r-4 r — ♦ CtP CD CO rH _ CD 2: S vo L〇vo L〇VO -々 CNJ ON rr σ \ 〇r- Ou X &lt; Tk 〇Z CO CM 3: CO CSi (J 00 〇2 CZ4 iT) oa X Csi CN U r- 〇 CN X cn CN. U Race o X 〇 = w = 〇 ° &amp; ° 〇 = b δ x 〇 = ^ =. Q ^ 〇x ° \ JT〇px ° OX ο == ^ Γ &gt; = ο. Press. ZJZ \ λ3 rH &lt; J \ m

Please read Back Gas I and fill in too I binding -450- This paper ft size is suitable for tg national standard extraction icNS) A4 size (210X297 male) 1235157

7 7 AB states that it is printed by the Consumers' Cooperative of the Li Bureau in the Ministry of Economic Affairs ^ C \ i CN fH t—i + cn 2: Σ 1 σ \ α \ L〇 卜 L〇r- L〇σν o L〇 rH Lf &gt; α: ^ &lt; -〇4 re «-Η one dP -S CNJ U r rH ofP CTk« —4 one a〇_ CD S ^ C7i rH OP-_ CO Ξ ^ 3 3: X CO 々00 vT) 々 · rr CN CN a \ CD 0 L〇σ \ GO σ \ U4 r * 〇Z VO CVJ X OvJ CNi u 0D VO CN re CVi CNJ U CO 0 Z ί-Η CJ L〇C \ JX CN. CN '〇αο Ο Shou 2 (Ο m CN 3: fH CV] u 5 X 〇 = w = 〇 ° & ° zx 3 0 XQ = ^ &gt; = 〇. Calibration. ZX 〇 == &lt; 0. B 〇X 〇 = 〇 = 〇p X 0 X =... 0 X m σ \ &lt; T U3 C \ \ σ \ αο σ \ -451-This paper scale is applicable to China National Standards Extraction (CNS) A4 specification (2 丨 0X297mm) I In .......... 1--:---士 5 &quot; 1----I: -I Hi ------- ----- Ding, T (Please read the note of Back Cloud before filling out this page) 1235157 Λ7B7 V. Description of the invention (449) Printed by the Employees' Cooperatives of the Central Standardization Bureau of the Ministry of Economic Affairs «-Η + cn X c \] LO LT) CC rH 〇1 X cfP CO CO 〇4 m rH LLo 〇o L〇in CO 〇C ^ l XT 2 〇Γ0 i 04 u OX ° = ^ = ° / — \ ^ 工 〇Z.2: 〇Q \ ^ Tx 0 = ζ M) b &lt; J \ a \ rr -452- Paper &amp; standard applicable ag house standard 莩 (CNS &gt; Α4 size (210 X 297 mm) 1235157

V. Description of the Invention (Gamma) Example 1: Compounds 605a-j, 605m-q, 605s, 605t and 605v were synthesized as follows: boc-n ^ y &quot; oh

Η Ο BOC—Ν

Step D

Compound No. r2 r5 605a / 103 Η ch3 600b Η CH2Ph 600c ch3 CH2Ph (please read the note of 5 and fill in this I first)

• 1T Printed by the Central Standards Bureau of the Ministry of Gas and Energy, Consumer Cooperatives (3S) -2-fluorenyl-3-third-butoxyalkylamino-2,3,4,5-tetrahydro-1 ^ 1- 1,5-Benzodiazepine-Methyl Acetate (600a / 103 "3 A step. (2S) -2-Third-butoxycarbonylamino-3- (2-nitrophenyl -Amino) -propionic acid. (2S) -2-Third-butoxycarbonylamino-3-aminopropionic acid (10 g, 49 mmol), 2-fluoronitrobenzene (5.7 ml , 54 millimoles), and NaHC03 (8.25 grams, 98 millimoles) were added to 130¾ liters of DMF, and heated to 18 hours at 80 ° C. 453- This paper is sized for China National Standard Leather (CNS) A4. Case (2 丨 0 &gt; &lt; 297 mm) 1235157 Λ7 37 V. Description of the invention (451) Attention of reading the back%

Time. Evaporate at reaction 2 to give a viscous, orange residue, which is dissolved in 300 ml of H20 and extracted with Et20 (3 x 150 ml). The 3 aqueous solution is acidified to pH with 100 / 〇 • NaHS〇4 5, and extracted with EtoAc (3 X 250 ml) 3 The mixed extract was dried over anhydrous Na2SO4, filtered, and evaporated to give 12 64 g (83%) of the title compound as an orange amorphous solid: Goo NMR (CD3〇D) 5 8.15-8.10 (iH, d), 7_54-7 · 48 (lH, t), 7.13-7.08 (1H, d), 6.73-6.65 (1H, t), 4.45 ^ 4.35 (1H , m), 3.9-3.8 (1H, dd), 3.65-3.55 (1H, dd)? 1.45 (9H, s) ^ ^ 3 (2S) · 2 · tertiary-butoxycarbonylamino-3- (2 -Aminophenylamino) -propionic acid. (2S) -2-Third-butoxycarbonylamino-3a-2-nitrobenzylamino) propionic acid (12.65 g, 40.5 mmol) and 0.5 g 10% Pd / C at 100 A mixture of ml of MeOH was stirred under 1 atmosphere of hydrogen for 4 hours. The solution was filtered through Celite 545, and the filtrate was evaporated under the air to produce 11.95 g of the title compound in a quantitative yield as a dark brown solid, which was ready for use without further purification. H NMR (CD3OD) ά 6.75-6.70 (3H, m), 6.65-6.58 (1H, m), 4.35-4.3 (1H, m), 3.6-3.38 (2H, m), 1.45 (9H, s) ^ Printed by the Consumers' Cooperatives of the Central Procurement Bureau of the Ministry of Economic Affairs ^ Step C . (3S) -2-keto-3-tertiary-butoxytanylamino-1,3,4,5-tetrahydro-1H-1,5-benzodiazepine. 1- (3-Dimethylaminopropyl) -3-ethylphosphonium diimide hydrochloride (8.54 g, 44.5 mmol) was added to (2S) -2-third-butoxycarbonylamino-3 -(2-Aminoaniline) propionic acid (11.95 g, 40.5 mmol) in 100 ml of a cooled (0 汜) solution of DMF and stirred for 18 hours. The reaction was poured into 700 mL of EtOAc and washed 4 times with ml of H20. The organic layer was dried over anhydrous Na2S04, filtered, and evaporated to give a brown solid, which was purified by flash chromatography and dissociated with 3: 7 EtOAc / hexane to yield 8 g (71%) of the title compound -454- This paper is suitable for standard scale g National Standards (CNS) A4 specification (2i0x 297 male thin)> Printed by the Central Bureau of Standards of the Ministry of Economic Affairs, printed 1235157 A7 B7 _ V. Description of the invention (452) Object: NMR (CD3〇D) d 7.78 (1R, s), 7.02-6.95 (1H, m), 6.88- 6.82 (1H? M), 6.82-6.78 (1H, m), 6.75-6.70 (1H, m)? 5.8-5.7 (1H, d ), 4.55-4.45 (1H? M)? 3.95 (1H, s), 3.9-3.82 (1H, m)? 3.48-3.40 (lH? M), 1.45 (9H, s) 3 D step. (3S)- 2-keto-3-tertiary-butoxycarbonylamino-2,3,4,5-tetrahydro-lH-1,5-benzodiazepine-l-acetic acid acetate (600a / 103) A solution of 3 l · 0M lithium bis (trimethylsilyl) phosphonium amine (3.4 ml, 3.4 mmol) in THF was added dropwise to (3 5) -2-keto-3-tert-butoxycarbonylamine -2,3,4,5-tetrahydro-111-1.5-benzodiazepine (0.94 g, 3.38 mmol) in 20 ml of anhydrous THF-78X: solution, and stirred for 30 minutes Methyl bromoacetate (0.44 ml, 4 mmol) ) Was added dropwise to the reaction mixture, and then warmed to RT. The reaction was diluted with 100 mL of EtOAc, and then washed with 0.3N KHS04 (50 mL), H, 0 (2 X 50 mL) and brine. Mixed organic The layer was dried over anhydrous Na2SO4, filtered, and evaporated to give a gum, which was purified by flash chromatography and dissolved at 3: 7 EtoAc / hexane to give 0.98 g (83%) of the title compound as a white color. 3 lH NMR (CD3C1) ci 7.15-7.07 (2Η, m), 6.98-6.94 (1H, m), 6.88- 6.84 (1H, d), 5.62-5.55 (1H, d), 4.71-4.65 (1H, d), 4.65-4.6 (1H, m), 4.33-4.27 (1H, d), 3.96-3.90 (1H, m), 3.78 (3H, s), 3.44-3.37 (1H, m), 1.4 (9H, s). (3S) -2-keto-3-tert-butoxycarbonylamino-2,3,4,5-tetrahydro-1H-1,5-pyridobiazale-1-acetic acid + The purpose of S (600b) 3 is similar to 600 a / 103 (D step), except that it uses methyl bromoacetate instead of methyl bromoacetate to produce a quantitative yield of 600b. (35) -2-keto-3-tertiary-butoxycarbonylamino-2,3,4,5-tetrahydro-7,9-dimethyl--455 Standard (CNS) A4 specification (210X297 mm) (Please read the notes on the back and fill in this page first) Binding 1235157 Λ7 ___________ Β7 V. Description of the invention (Beginning 3) 1 仏 1,5-benzodiazine- 1-acetic acid acetate (600 (:) 3 (2S) -2-third-butoxycarbonylamino-3- (2-nitro-3,5-dimethylaniline) -propionic acid. A similar method to prepare 60 (^ / 103 (eight steps), except that the use of 2-fluoro-4,6-diamidino-nitrobenzene instead of 2-fluoronitrobenzine can produce the desired compound, yield 93%. 3 Miao崞 &quot; 3 (2S) -2-Third-butoxycarbonylamino-3- (2-amino-3,5-dimethylphenylamino) -propionic acid. (2S) -2-section Tributoxycarbonylamino-3- (2-nitro0,5-dimethylphenylamino) propanoic acid is converted to the title compound in a quantitative yield, such as the method for preparation of 600a / 103 (B step Q Step 3 2-keto third-butoxycarbonylamino-2,3,4,5-tetrahydro · 7.9-dimethyl-111-1,5-benzodiazepine. (25) -2 -Third-butoxycalyl-3- (2-amino-3,5-dimethylphenylamino) · propyl (763 mg, 2.36 mmol) and N-methylmorpholine (483 mg, 4.78 mmol) in 60 liters of anhydrous THF in 0X: solution, treated dropwise with isobutyl aquamate (3 52 mg, 2.5 mmol). The reaction was stirred for 2 hours at 0 ° C, 1 hour at RT and poured into EtoAc. The mixture was saturated with 5% NaHS047] c solution, NaHC03i &amp; and aqueous solution, and NaCl. Wash with aqueous solution, dry in NaS04i and concentrate under air. Chromatography (quick, SiO2, 10% to 25% to 50% EtOAc / CH2Cl2) can produce 490 mg (68%) of the desired product. Employees of the Ministry of Economic Affairs Consumers' cooperatives print ¾ step D. (3S) -2-keto-3-third-butoxycarbonylamino-2,3,4,5-tetrahydro-7.9-dimethyl-lH-l, 5 -Benzodiazepine-l-fluorenyl acetate (600c). (2S) -2-Third-butoxycarbonylamino · 3- (2-amino-3,5-dimethylphenyl- Amino) propionic acid is converted into 600c, 75% by a method similar to 60b. -456- Paper &amp; ruler (cns7a4— (2lGx 297 public waste) 1235157 Λ7 B7 V. Description of the invention (454

Step A * HC1 丄 &gt; Step B. PhCQoH Step C. R3X 600

Step D

Employees of the Central Bureau of Standards of the Ministry of Economic Affairs exempted the printing of (3S) -2-keto-3-benzylamido-5- (3-phenylpropanyl) -2,3,4,5-tetrahydro- 1H- 1,5-Benzodiazepine-1-acetic acid methyl ester (602a). 〆4 step sample 3 anhydrous HC1 effervescent to (3S) -2-keto-3-tertiary-butoxychicamamine some 2,3,4,5-tetrahydro-1H-1,5-benzodi Aza-p-methyl acetate (600a / io3, 4.0g, 11.4mmol) in 20ml (: ^ 12 (: 12 for 20 minutes, then stirred under {1 丁丁) 1 hour. The reaction was evaporated to form (3S) -2-keto-3-amino-2,3,4,5-tetraargine-1H-1,5-benzodiazepine-1-acetic acid methyl ester hydrochloride. A white solid was added in 3 steps. The white solid was dissolved in 70 ml of DMF and benzoic acid (1.5 g, 12.3 mmol) was added. The reaction was cooled in ice / h2O, and then 1- (3-dimethylamine group was added. Propyl) -3-ethylcarbodiimide hydrochloride (2.4 g, 12.5 mmol) 1-hydroxybenzotriazole (1.7 g, 12.6 mmol) and diisopropylethylamine (3.0 g , 23 · mmol). The reaction was stirred at RT and nitrogen atmosphere for 18 hours, and then poured into H20. The aqueous mixture was extracted with EtOAc (2x). The mixed organic layer was saturated with 2 (please read the note on the back first) (Fill in this question and fill in this one)

-457- The standard for this paper is General Chinese National Standard Li (CNS) A4 (210X 297 mm) 1235157 Yin Sang, Co-operative Cooperative of Employees of the Central Procurement Bureau of the Ministry of Economic Affairs; 5. Description of Invention (455) and 0.5N NaHS04, H20, saturated aqueous NaHC03 solution, h90 and aqueous NaCl solution were washed, dried over 1 ^ 1 §304 and then rolled under air. Chromatography (fast, Si02, 10% to 30% Et〇Ac / CH2Cl2) yielded 3.4 g (85%) of (35) -2-diketo-3- (fluorenylamino) -2,3 , 4,5-tetrahydro-1,1,5-benzodiazepine-1-acetic acid methyl ester as a white solid. Step C. A method. (3S) -2-Iki-3-benzylamidinyl-5- (3-benzylpropanyl) -2,3,4,5-tetrahydro-111-1,5-benzodiazepine Pyrene-1-acetate methyl ester (602). (3S) -2-keto-3- (fluorenylamino) -2,3,4,5-tetrahydro-1H-1,5-benzyl A solution of N-Hexane-1-methyl acetate (200 mg, 0.57 mmol) in CH2C12 (10 ml), triethylamine (119 mg, 1.13 mmol) and 3-phenylpropanine (1M Mg, 0.68 milli-ears). The reaction was stirred at RT for 30 minutes, and then diluted with CH2C12. The solution was washed with 10% HC1 aqueous solution, saturated NaHC03 aqueous solution, NaCl saturated aqueous solution, dried over Na2S04 and concentrated under vacuum. 24.0 mg (87%) of 602a was produced as a white foam. GJ: Step 3 I Method 3 (3S) -2-keto-3-benzylamido-5-ethylamidineethyl-2,3,4 , 5-tetrahydro-1H-1,5-benzodiazepine-1-acetic acid (60.2 g) 3 (3S) -2-keto-3- (fluorenamino) -2 , 3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-acetic acid benzyl (600b) (465 mg, 1.10 mmol) in CH2C12 (5 ml) (TC solution , Treated with acetic acid in 1 ml of ch2ci2, and then slowly added 1- (3 · dimethylaminopropylethyl carbonization Diimine hydrochloride (431 mg, 2.2 mmol) in 2 ml of CH2C12 under atmospheric air. After 15 minutes, the reaction was poured into EtOAc, washed with a saturated 50 / 〇NaHS〇4 aqueous solution, dried over NajO4 and Concentrated in the air. Chromatography (quick beating, SiO2, 0% to 〇00 / 〇 to 25% MeOH / CH2Cl2) can produce 580 mg (3S) -2-keto-3- (fluorenamine -___ -458-μg house mark ^ Τ ^ Γπ10χ 297: ^-^ 一 ~ ^ (碕 Xian Min read the back: i! I intended to fill in this page} li clothes-order 1235157 B7 V. Invention Explanation (456) group) -5-Ethyl 2-3,4,5-tetrahydro-1H-1,5-benzodiazabenzyl-butyrate acetate, white solid β C step Method C. (3S) -2-keto-3-benzylamido-5 · methoxycarbonyl. 2,3,4,5-tetrachloro-1H-1,5-naphthoacetic acid Symptoms (6〇2j). (3 3) -2-keto-3- (fluorenamino) -2,3,4,5-tetrahydro-1 ^ [-1,5_benzoyl Azabenzene-1-acetic acid octane (6001)) (461 Love Brother, 1.07¾ mol) in thf (5 ml) and saturated NaHC03 (2.5 ml) vigorously stirred οχ: liquid / methyl chloroformate Ester (151 mg, 1.6 mmol) in THF (0 25 Ml), and the reaction was stirred at RT for 45 minutes. The reaction was poured into CH2Cl2t, washed with water, dried over Na2SO4, and concentrated by air chromatography (fast, SiO, 0% to 10% MeOH / CH2Cl2) to produce 525 mg of 602j, which was a white solid. Step C. D method. (3S) -2-copperyl-3-fluorenylamino-5-fluorenylaminocarbonyl-2,3,4,5 · tetrazine-1 fluorene-1,5-epoxy曱 g purpose (602p). A solution of 602a / 103 (400 mg / 1.1 mmol) and benzyl isocyanate (166 mg, 1.2 mmol) in 10 ml of CH2C12 & 10 ml of DMF, heated at 8 ° C for 3 days. The reaction was cooled to RT It was then poured into H20 and extracted with EtOAc (2x). The combined organic layers were washed with H20 (4x), then with saturated NaCl, dried over 1 ^ 504 and concentrated under vacuum. Chromatography (Rapid, SiO2, 50% to 80% EtOAc / hexane) can produce 440 mg (80%) of 602p as a white solid. Step C, printed by the Consumer Cooperative of the Central Standards Bureau, Ministry of Economic Affairs, Method 3 (3S) -2-keto-3 -Methylamino-5- (3-phenylpropylamido) -2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-acetic acid methyl ester (602v). (3S) 2-keto-3-amino-5- (3-phenylpropanyl-2,3; 4,5-tetrahydro-1 ^ 1-1,5-benzodiazepine- 1-methyl acetate hydrochloride (560 mg, 1.34 mmol), benzaldehyde (146 mg, 1.34 mmol) and sodium acetate (220 mg, 2.68 mmol) are used in _ · 459 -_ This paper is applicable to the standard China National Standard CNS &gt; A4 Tiege (210 X 297 male splashes) ~ ^ Printed by the Consumers' Cooperative of the China Prospective Bureau of the Ministry of Economic Affairs 1235157 A 7 _B7____ V. Description of the invention (457) A solution of methanol (20 ml), treated with a 4A sieve (2 g,) and NaCNBH3 (168 mg, 2.68 mmol). The reaction was stirred for 2.5 hours, and acidified to pH with a 10% HC1 aqueous solution. 2. Wash the strip with Et20 (2x75 ml) ° and empty the organic layer; the agricultural shrinkage can generate oil. Chromatography (quick, SiO2, 0 to 35% Et〇Ac / CH2Cl2) can produce 250 mg (40%) 602v, showing Clear oil 3 Step D. Method A. (3S) -2-ketoamidoamino · (3-phenylpropylamido) -2,3,4,5-tetrahydro-1 仏 1,5- Benzodiazepine-1-acetic acid (603 &). (35) -2-keto-3-amidoamino group 0- (3-phenylpropylamido) -2,3,4,5- Tetrahydro-1 Qin 1,5-Benzodiazepine-1-acetic acid methyl ester (602a); 1.25 g, 2.57 mmoles are dissolved in 11 ml of 1 ^ ?, 乂 6〇 ^ [and 1120 (5: 5: 1), and then treated with 1 ^ 01 ^ 112 (42 mg, 0.62 mmol) and stirred at RT for 64 hours. The reaction was concentrated under vacuum, diluted with pH 20 and acidified with IN HCi aqueous solution. To produce 230 mg of 603a as a white solid. Step B method, (3S) 2-keto-3-amidinoamino-ethyl-2,3,4,5-tetrahydro-1H-1, 5-benzodiazepine · ι_ Acid (603d). (3S) -2-_l-3- (benzylSiamino) -5 -ethynyl-2,3,4,5-tetramethane-1 fluorene-1,5-benzodiazepine fluorene-acetic acid A mixture of methyl ester (602d; 510 mg, 1.08 mmol) and 5% Pd / C (250 mmol) in Me OH (10¾ liters) was disturbed at h2 (at 1 atmosphere) for 0.5 hours. It has been reacted; and it can be concentrated in the air to produce 410 mg of 603d as a white solid. 3 The compound of Table 8 was prepared as described in Table 9, using the method of Example 12. -460- The standard of this paper is applicable to China's national standard (CNS &gt; A4 Tiege (210X 297mm)) (Please read the notes on the back and fill in this page. Order 1235157

7 7 AB V. Description of Invention (458) Table 8 Consumption Cooperation of the Central Sample Industry Bureau of the Ministry of Economic Affairs · Social Printing ¾ Compound No. R2 R3 r4% 602b H PhCH2C (0) PhC (O) CH2Ph 602c H PhC (O) PhC ( O) CH2Ph 602d H CH3C (0) PhC (O), CH2Ph 602e H ch3〇ch2c (o) PhC (O) CH2Ph 602f H (CH3) 2CHCH2C (0) PhC (0) CH2Ph 602g H CH3C (0) CH2C ( 0) PhC (0) CH2Ph 602h H CH30C (0) C (0) PhC (0) CH2Ph 602i H ch3c (〇) c (o) PhC (0) CH2Ph 602j H ch3〇c (o) PhC (O) CH2Ph 602k H CH3C (0) Boc CH2Ph 6021 CH3 CH3C (0) Boc ·· CH2Ph 602m H CH3S (02) PhC (0) ch3 602p H PhCH2NHC (0) PhC (0) ch3 602q H ^ 000 PhC (0) CH2Ph 602r H PhCH2CH2C (0) PhCH2CH2C (0) CH2Ph 602s H 4 · Pyridyl CH2C (0) PhC (O) CH2Ph -461-This paper scale is applicable to Chinese National Standard Ocean (CNS) A4 (2IOX 297 mm) 1235157 V. Description of the invention (459) Table 9 Printed serial number starting material R3X by the Consumer Cooperatives of the China Standards Bureau of the Ministry of Economics c Step method / (% yield) D step method / (% production car) 603b 600b PhCH2C (0) Cl A (98) Β (89) 603c 600b PhC (0) Cl A (quant.) Β (quant.) 603d 600b CH3 C (0) C1 A (quant.) Β (quant ·) 603e 600b ch3〇ch2c (〇) ci A (59) Β (quant.) 603f 600b (CH3) 2CHCH2C (0) C1 A (88) Β (95 ) 603g 600b CH3C (0) CH2C02H B (quant.) Β (quant.) 603h 600b CH30C (0) C (0) C1 A (96) Β (quant.) 603i 600b CH3C (0) C02H B (87) Β (94) 603j 600b CH30C (0) C1 C (quant.) 3 (quant.) 603k 600b CH3C (0) C1 A, only step C (quant.) Not operated 6031 600c CH3C (0) C1 A, step only Li C (quant.) Did not operate 603m S00a / 103 CH3S03C1, replaced NE2 with <3, and replaced CH2C12 A (76) A (92) 603p 600a / 103 PhCH2C = N = 0 D (80) A ( 86) 603q 600b ^^ οοοαα C (83) B 〇71) 603r 600a / 103 PhCH2CH2C (0) Cl A 603s 600b 'pyridyl ch2co2h B (90) B (98) (please read the 5 of the first 5) ^ Fill in _5 shells) -462- The paper ft scale is applicable to 3 national standard (CNS) A4 specifications (210X29? Mm) 1235157 A7 __B7 V. Description of the invention (460)

602

1) Step C. R3X 2) Step human HC1

3) Step C. R4X

Ο ', ΟΗ 603

Step D R4-N Η Table 10 compounds were prepared as described in Table 11, using Example 12 Method 3 Table 10 Compound No. R2 R3 r4% 602η Η printed by the Ministry of Economic Affairs and Standards Bureau Consumer Cooperatives Η CH3C (0) Extend Fluorenyl-2-C (0) CH2Ph 602〇ch3 CH3C (0) PhC (O) CH2Ph 6021 Η 3-CH3PhCH2C (0) PhC (O) CH2Ph 602u Η CH3C (0) Fmoc CH2Ph 602v Η PhCH2CH2CO PhCH2 ch3 -463 -The paper ft scale is in accordance with the Chinese National Standard (CNS) A4 specification (210X29? Mm) 1235157 A 7 B7 V. Description of the invention (461) Table 1 1 Numbering starter 1 &gt; Step C. R3x method (° /. 1 rate) 3) Step C R4X method (% yield) Step D method (% yield) 603η 602k CH3C (0) C1 A (quant.) Dendronyl-2-C (0) Cl A (70) B (quant.) 603〇6021 CH3C (0) C1. A (quant ·) PhC (0) Cl A (73) B (quant.) 603t 602k 3- CH3PhCH2C (0) Cl A (quant.) PhC (0) Cl A (93): B (95) 603u 602k CH3C (0) C1 A (quant.) Fmoc-Cl C (82) C (98) 603v 600a / 103 PhCH2CH2C (0) Cl A PhCHO E (40) A ( 95) (Please read the precautions before filling in this one) Order printed by the Offshore Consumer Cooperative of the China Standards Bureau of the Ministry of Economic Affairs

Step B

464 Paper and paper music scale universal Chinese S national standard (CNS> A4 size (210X 297 mm) 1235157

7 7 A B Printed by the Order of the Ministry of Economic Affairs, the Consumer Cooperatives of the Bureau. 5. Description of the invention (you 2) The compounds in Table 12 were prepared as follows. Table 12 Compound numbers R2 R3 R4 605a H PhCH2CH2C (〇) PhC (O) 605b H PhCH2C (〇) PhC (O) 605c H PhC (O) PhC (O) 605d H CH3C (0) PhC (O) 60Se H ch3〇ch2c (〇) PhC (0) 605f H (CH3) 2CHCH2C (0) PhC (0) 605g H ch3c (〇) ch2c (o) PhC (0) 605h H CH30C (0) C (0) PhC (O ) 605i H ch3c (〇) c (〇) PhC (0) 605j H CH30C (0) PhC (O) 605m H CH3S03 PhC (0). 605n H CH3C (0) Amidino-2-C (0) 605. ch3 CH3C (0) PhC (O) 605p H PhCH2NHC (0) PhC (0) 605q H ^^ 000 PhC (O) 605s H 4- pyridylCH ^ C (0) PhC (0) 605t H 3-CH3PhCH2C (〇) PhC (O) 605v H PhCH2CH2C (0) PhCH2 (35) -3-[(35) -2-keto-3-octylamido-5- (3-phenylpropoxy) -2,3, 4,5- (Please read the meanings of the back * before filling out this page • νά • f -465- The standard of this paper is applicable to China National Standards (CNS) Α4; ^ (210X 297 mm) 1235157 A7 ______B7_ ^ _____ V. Description of the invention (463) Tetrahydro-1H-1,5-benzodiazepine-1-acetamido] -4-keto-butanoic acid (605a) 3A step. (3S) -3- (l-fluorenylmethoxycarbonylamino) -4-ketobutyric acid tert-butyl hemicarbazone (2 10 mg. 0.45 Mol, dissolved in 10 ml of DMF and 2 ml of diethylamine in the manner described by Graybill et al., Int. J. Protein Res., 44, pp. 173-82 (1994) similar to the oxocarbonyl homologue , And stirred for another 2 hours. The reaction was concentrated in the air to form (3S) -3-amino-4-one butanone tert-butyl ester hemicarbazone. The above residue and 603a (200 mg, 0.42 mmol) were 5 ml of DMF and 5 ml of CH2Cl2iO'C solution with 1-hydroxybenzotriazole (57 mg, 0.42 mmol) and 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide Treatment with hydrochloric acid (98 mg, 0.51 mmol). The reaction was stirred at RT for 18 hours, poured into EtOAc (75 mL), and washed with 0.3N aqueous KHS04 solution, saturated NaHC03 aqueous solution and saturated NaCl aqueous solution, dried over NaS04 and concentrated in vacuo. Chromatography (Si02, 0% -4% MeOH / 0/1% NH40H / CH2C12) yielded 240 mg (83%) of 604a.

Employees 'Cooperative Cooperatives' Seal X of the Central Procurement Bureau of the Ministry of Economic Affairs (please read and read the precautions of the back of the cloud before filling in this \) Step B. 604a was stirred with 10 ml of 33% TFA / H20 for 4 hours, and then concentrated in the air. The residue was dissolved in 7 ml of MeOH / acetic acid / 37% aqueous formaldehyde (5: 1: 1) and stirred for 18 hours. Chromatography (reverse phase C1 8, 4.4 mm ID X 25 cm, 15% to 70% CH3CN / 0.1% TFA / H20) yields 32 mg (16%) of 605a as a white solid: iH NMR (CD3OD, half shrinkage Non-stereoisomeric form of aldehyde) d 7 · 85-7 · 78 (2H, d), 7.5-7.32 (6H, m), 7.32-7.28 (1H, m), 7.18-6.98 (5H, m), 4.92 ^ 4.85 (2H, m), 4.5-4.32 (2H, m), 4.31-4.20 (2H, m), 3.7-3.6 (1H, m), 2.90-2.75 (2H, m), 2.65-2.5 (1H , m), 2.48-2.25 (3H, m) 〇 The following compounds were prepared in a similar manner: ____ -466- This paper ft scale is applicable to China National Standard Car (CNS) A4 (210 &gt; &lt; 297 public celebration) '- -1235157 Λ7 B7 V. Description of the invention (464) (35) -3-[(33) -2-keto-3-benzylamido-5-phenylethylfluorenyl-2,3,4,5- Tetragon-111-1,5-benzodiazepine-1-acetamido] 4-keto-butanoic acid (60513). .148 mg (33%) as a white solid · 4 NMR (CD3〇D) β 7.9-6.9 (m, 16H), 4.9 (s, 2H), 4.5 (m, 1H), 4.4 (m, 2H), 3.75 (s, 1H), 3.6 (dd, 1H), 3.45 (dd, 1H), 2.7 (m, 1H), 2.5 (m, 1H) ^ (35) -3-[(33) -2-one -3-benzylamidinyl-5-fluorenyl-2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-ethylamidino] 4-keto- Butyric acid (605c). 3 19 mg (56%) as a white solid: 4 NMR (CD3OD) β 7 · 9-6 · 9 (m, 16H), 5.1 (m, 1Η), 4.9 (dd, 1Η), 4 · 7 (m, 1Η), 4.6 (dd, 1Η), 4.4 (m, 2H), 4.05 (m, 1H), 2.7 (m, 1H), 2.5 (m, 1H) ^ (3 5) -3-[(3 3) -2-keto-3-benzylamidinyl-5-ethenyl-2,3,4,5-tetrahydro-1,1,5-benzodiazepine-1-ethenylamino] 4-keto-butanoic acid (605d). 190 mg (38%) as a white solid: [H NMR (CD3OD) β 1.9 (d, H), 2.4 (m, 1H)? 2.65 (m, 1H), 3.7 (m, 1H), 4.25 (m, 1H )? 4.45 (m, 2H), 4.8-5.05 (m, 3H), 7.3-7.7 (m, 7H), 7.9 (d, 2H) ^ (35)-]-[(〇5) -2-Netbase -3-Cycloamino-5-methoxyethynyl-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-buethamidinyl] 4-one -Butyric acid (605e). 250 mg (78%): NMR (CD3OD) β 1.87 (bs), 1.95 (s, 2H), printed by the Consumers' Cooperatives of the China Prospective Bureau, Ministry of Economic Affairs 2.1 (bs), 2.4 (m, 2H), 2.65 ( m, 2H), 3.59 (bs), 3.75 (bs), 3.87 (bs), 4.19 (m), 4.37 (m), 4.50-4.78 (bm), 4.92 (m), 5.27 (bs), 7.41-7.58 (m, 7H), and 7.87 ppm (d, 2H). (3S) -3-[(3S) -2 · Keto-3-benzylamidinyl-5- (3-methylbutylamidino) -2,3,4,5- Tetrazol-1Η-1,5 · Benzene-Isotriazol-1-Ethylamino] 4-acetyl-butanoic acid (605 f). 210.5 mg (46%) as a white solid: lH NMR (CD3〇D) d 7.9- —____-467-Applicable to national standard CN (CNS) (2ι〇χ2π variable) on i scale &quot;-~ 1235157 Central Ministry of Economic Affairs Printed by the staff of the Bureau of Standards, Xiaoxian Cooperative Λ7 B7 V. Description of the invention (46δ) 7.4 (m, 9H), 5.1 (m, 1H), 4.9 (m, 1H), 4.6 (dd, 1H), 4.4 (m, 2H ), 4.1 (d, 1H), 3.8 (m, 1H), 3.5 (q, 1H), 2.7 (m, 1H), 2.5 (m, 1H), 2.0 (m, 3H), 1.2 (t, 1H) , 0.9 (d, 3H), 0.S (d, 3H) ^ (3 3) -3-[(33) -2-keto-3-amido-5-acetamidoethenyl-2 , 3,4,5-tetrahydro-1H-1,5-benzodiazepine-l-acetamido] 4-keto · butanoic acid (605 g). 81 mg (19%) white solid: NMR (CD3〇D) β 7 · 9-7 · 3 (m, 11H), 4.9 ^ 4.8 (m, 2H), 4.6-4.4 (m, 3H), 4.3 (m , 1H), 3.75 (q, 1H), 3.55 (d, 1H), 2.7 (m, 1H), 2.5 (m, 1H), 2.05 (s, 3H) ^ (jS) -3-[(3S)- 2-fluorenylS-Linylamino-5-methylsuccinyl-2,3,4,5-tetrahydro-1 ± 1,5-benzodiazepine-1-ethylfluorenyl] 4_ Keto-butyric acid (60511). 227 mg (54%) as a white solid: iH NMR (CD3OD) d 2.5 (m, 1H), 2.7 (m, 1H), 3.55 (s, 3H), 3.8-4.0 (m, 2H), 4.4 (m, 1H), 4.6-4.8 (m, 2H), 4.95 (d, 1H), 5.1 (m, 1H), 7.3-7.7 (m, 7H), 7.9 (d, 2H), 8.6 (d, 1H) 〇 ( 3S) -3-[(3S) -2-keto-3-amidino-5-acetamidocarbonyl-2,3,4,5-tetrahydro-lH-1,5-benzodiazepine Amidine-l-acetamido] 4-keto-butanoic acid (605i). 150 mg (37%), white solid: iH NMR (CD3〇D) d 7.9-7.3 (m, 12H), 5.1 (m, 1H), 4.65 (t, 1H), 4.55 (dd, 1H), 4.35 ( m, 1H), 4.1 (d, 1H), 3.9 (q, 1H), 3.45 (q, 1H), 2.7 (m, 1H), 2.5 (m, 1H), 2.25 (s, 3H). (3S) -3-[(3S) -2-keto-3-amidino-5-methoxycarbonyl-2,3,4,5-tetrahydro-1 fluorene -1,5- Lanzaza-1 -ethoxyamido] 4-fluorenyl-butyric acid (605j). 234 mg (44%) as a white solid: iHNMR (CD3〇D) d 7.9-7.4 (m, 12H), 5.0 (m, 1H), 4.8-4.5 (m, 3H), 4.4 (m, 1H), 4.3 (t, 1H), -468- The size of this paper is applicable to the Chinese National Standard (CNS) A4 specification (2 丨 0X 297 cm) (Read the meanings of the back of the cloud before filling in this page)

.1T 1235157 Λ7 B7 V. Description of the invention (466) 3.9-3.75 (m, 2H), 3.6 (s, 3H), 2.7 (m, 1H), 2.5 (m, 1H) ^ (3S) -3-[( 3S) _2-keto-3-benzylamidinyl-5-methanesulfonyl-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-ethylfluorenamine Group] 4-keto-butyric acid (605m). 64.5 mg (34%) as a white solid: 4 NMR (DMS 0-d6, diastereomeric form of hemiacetal & open form of aldehyde) ^ 9.48 (0.2 ° 5), 8.85-8.72 (1H, m), 8.65-8.60 (0.8 H, d), 8.30-8.26 (0.2 H, d), 7.95-7.88 (2H, d), 7.6-7.45 (6H, m), 7.44-7.38 (1H, m), 5.78-5.75 (0.2H, d), 5.48 (0.6H, s), 4.85-4.70 (2H, m), 4.62-4.54 (1H, d), 4.50-4.40 (2H, m), 4.25-4.14 (1H , m), 3.9-3.85 (1H, m), 3.16 (3H, s), 3.05-2.3 (2, m). (jS) -3-[(jS) -2-copperyl-3 -codonylamino-5- (each-2-yl) -2,3,4,5 -tetraki-1H-1,5 -Benzodiazepine-1-acetamido] 4-keto-butanoic acid (605n). 103 mg (17%) as a white solid · 4 NMR (CD3OD) θ 1 · 9 (s, 3Η), 2.5 (m, 1H), 2.65 (m, 1H), 3.75 (m, 1H), 4.3 (m , 1H), 4.5-4.7 (m, 3H), 4.85-5.1 (m, 2H), 7.3-7.65 (m, 6H), 7.85-8.05 (m, 4H), 8.45 (s, 1H). (3 5) -3-[(3 3) -2-keto-3-; fluorenyl-5-ethylfluorenyl-2,3,4,5-tetrahydro-7,9-dimethyl- 1H-1,5-benzodiazepine-1-acetamido] 4-keto-butanoic acid (605o). 42 mg (12%) as a white solid: β NMR (CD3OD, printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Semi-Economy (please read yinyunzhi first and then fill in this f).玦 Stereoisomeric form) d 7.85-7.74 (2H, m), 7 · 5-7 · 44 (1Η, m), 7.43-7.35 (4H? M), 5.6-5.05 (2H, m), 4.82-4.42 (2H, m), 4.40-3.95 (2H, m), 3.6-3.5 (1H, m), 2.7-2.38 (2H, m), 2.32 (3H, s), 2.27 (3H, s), 1.92 (3H, s). (3S) -3-[(3S) -2-keto-3-amidino-5-amidoaminocarbonyl-2,3,4,5-tetra-469-this paper is suitable for medium g National Standard Li (CNS) M Tige (210X 297 mm) 1235157 _____ · B7_ V. Description of the invention (467) Hydrogen-1H-1, 5-leather and miscellaneous leather-1 · ethoxyamido] 4 -Copper-butyric acid (605p) 3 165 mg (37%) as a white solid: iH NMR (CD3OD) Θ 2.45 (m, 1H), 2.7 (m, 1H), 3.8 (m, 1H) , 4.15-4.5 (m, 4H), 4.5-4.75 (m, 2H), 4.8-5.0 (m, 2H), 7.1-7.7 (m? 12H), 7.9 (d, 2H) ^ (3S) -3- [(3S) _2-keto-3-wordamidoamino-5-[(3R, S) 3-tetrahydrofuranyloxocarbonyl] -2,3,4,5-tetrahydro-1 fluorene-1, 5-Benzodiazepine-1-acetamido] 4-keto-butanoic acid (605q). 210 mg (66%) 4 NMR (CD3OD) 0 '1.95 (s, 2H), 2.4 (m, 2H), 2.65 (m, 2H), 3.29 (s, 3H), 3.78 (m), 3.87 ( bs), 4.0 (d, 1H), 4.32 (m), 4.50-4.15 (m), 4.95 (m)? 5.27 (bs), 7.45-7.65 (m, 7H), and 7.89 ppm (d, 2H). (3S) -3-[(3S) -2-keto-3-benzylamidinyl-5- (4-pyridylethylfluorenyl) 2.3.4.5-tetrahydro-1H-1,5-benzo Diazapyridine-1-acetamido] 4-keto-butanoic acid (605s). 128 mg (19%) white solid. IH NMR (CD3OD) β 8.5- 7.4 (m, 13H), 5.0 (m, 1H), 4.7 (m, 1H), 4.5 (m, 2H), 4.45- 4.4 (m, 3H), 3.8-3.7 (m, 2H), 2.7 (m, 1H), 2.5 (m, 1H) ^ (3S) -3-[(3S) -2-i3 group Ss amino-5 -(3-methylphenylethenyl) · 2.3.4.5-tetrahydro-1H-1,5-benzobisI heteropyridine-1-acetamido] 4-keto-butanoic acid (605t) . 132 mg (24%) as a white solid: iH NMR (CD3〇D) d Consumption cooperation among employees of the Central Bureau of Standards, Ministry of Economic Affairs. Du Yin ^ 7.8-6.7 (m, 13H), 4.9 (t, 1H), 4.75 (dd , 1H), 4.2 (dd, 1H), 4.1 (m, 2H), 3.8 (dd? 1H), 3.6 (q, 1H), 3.45 (dd, 1H), 3.3 (dd, 1H), 2.6 (m, 1H), 2.3 (m, 1H), 2.15 (s, 3H). (3S) -3-[(3S) -2-keto-3-amidino-5- (3-phenylpropanyl) -2,3,4,5-tetrahydro-1H-1, 5-Benzodiazepine-1-acetamido] 4-keto · butanoic acid trifluoroacetic acid (605v). 88 mg (28%) as a white solid: [Η NMR (CD3〇D) -470- Applicable to paper and paper scales in China National Standards (CNS) A4 specifications (210 ×: 9 ·; mm) '1235157 Λ7 __B7_ 5 Description of the invention (468) δ 7.63-7.51 (2Η, m), 7.5-7.35 (7H, 'm), 7.25-7.10 (3H, m), 7.1-7.02 (2H, m), 5.04-4.96 (1H, m), 4.75-4.57 (2H, m), 4.38-4.26 (2H, m), 4.24-4.12 (2H, m), 4.10-4.02 (1H, d), 4.88-4.80 (1H, m), 2.90- 2.80 (2H, m), 2.78-2.63 (1H, m), 2.55-2.35 (2H, m), 2.34-2.22 (1H, m).

Re Step B. R2

Please read Ϊ% of the cloud first and then complete this 本 Step C. Printed by the Employees' Cooperative of the Sample Rate Bureau in the Ministry of Economic Affairs Table 13 Compounds are described below

609 -471-This paper size is applicable to China National Standard Ocean (CNS) A4 Tige (210X297 mm 1235157 A7 B7 Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ^ V. Description of the invention (469 Table 13 # r2 R3 r4 r6 Rt 609a Η PhCH2CH2C (0) PhCH2CH2C (0) Cl Cl 609b Η CH3C (0) phcro) Cl Cl (3S) -3-[(3S) -2-keto-3- (3-benzylpropylamido) -5- (3-phenylammonyl 1,2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-buethamidinyl J-4- (5,7 • Digas benzohumazol-2-yl) -4-one-butyric acid (609a). Step A. 204 (223 mg, 0.5 mmol) and 603r (300 mg, 0.36 mmol) (Ear) in a solution of 4 ml of DMF and 4 ml of CH2C12 'with (Ph3P) 2PdCl2 (10 mg), hydroxybenzotriazole (135 mg, 1.0 mmol) and 1- (3-dimethylamino Treatment with propyl) -3-ethylcarbodiimide hydrochloride (115 mg, 0.6 mmol). Tri-n-butyltin hydride (219 mg '0.75 mmol) was added dropwise to the reaction and stirred for 18 hours. Reaction Pour into EtOAc and wash with 10% NaHSOyjc solution, saturated aqueous NaHC03 solution and NaCl abalone and aqueous solution, dry over Na2S04 and concentrate in air. Chromatography (quick, SiO2, 0% to 50% EtOAc / hexanes) yields 360 mg (86%) of 607a as a bubble 3 B Step 3 607a (360 mg) in 5 ml of CH2C12 solution, Add dropwise 1,1,1-triethylfluorenyl-1,1-dihydro-1,2-benzodiketo-3 (1H) -one (362 mg, 0.85 mmol) to 20 ml &lt;: 112 (: 12 in suspension of 3 was stirred for 4.5 hours, diluted with (: 112 (: 12 and then saturated with 1: 1 saturated NaHC03 aqueous solution / Na2S203 solution, saturated NaHC0; 3 aqueous solution ( 2x) and saturated NaCl aqueous solution, dried over Na2S04 and concentrated in vacuo. Chromatography (fast, SiO2, 20% EtOAc / CH2Cl2) can produce 340 mg (95%) -472- This paper is suitable for standard scale 311 Standard Li (CNS) A4 specifications (210X 297mm) ---------- grams-(please write down the / X notices on the back page first) Order d 1235157 Λ7 ___B7 5 Description of the invention (470) class 608a. C Step irritability, 608a (300 mg, 0.36 mmol) is dissolved in 25 ml of 25% TFA / (^ 2 (: 12), and then stirred at RT for 5 hours and left to concentrate . Chromatography (quick, SiO2, 0-5% MeOH / CH2Cl2) yielded 118 mg (42%) of 609a as a white solid. · IHNMR (CD3〇D), y7 · 62-6 · 65 (16H, m) , 4.85- 4.7 (1H, m), 4.68-4.42 (2H, m), 4.40-4.15 (2H, m), 3.48-3.28 (1H, m)? 3.0-2.9 (1H, m), 2.9- 2.6 (4H, m), 2.55-2.18 (3H, m), 2.16-1.96 (2H, m). (3S) -3-[(3S) -2-keto-3-; fluorenyl-5-ethylfluorenyl. 2,3,4,5-tetrahydro-1H-1,5 -benzyl Benzene-1 -ethylaminyl] -4- (5,7-digas benzo4-bitan-2-yl) -4-keto-butanoic acid (609b), prepared from 603d, can be prepared in a similar manner to 609a 287 mg (43% overall yield) was obtained as a white solid: 1HNMR (DMSC ^ d6), 1.6 (s, 3H), 2.7-3.1 (m, 2H), 3.45 (m, 1H) , 4.4 (t, 1H), 4.7 (m, 2H), 4.95 (m, 1H), 5.2, 5.4 (2s, 1H), 7.2-7.65 (m, 8H), 7.9 (d, 2H), 8.8 (t , 1H), 8.9, 9.1 (2s, 1H), 12.6 (br, 1H)

• 473- The paper and paper scale is applicable to the 11 national standards (CNS) Μ Tig (210x 297 public holidays) 1235157 A7 37 V. Description of the invention (471)

611

Step B

612 Printed by the Wac Industrial and Consumer Cooperatives, China Standards Bureau, Ministry of Economic Affairs (3S) -3-[(3S) -2-keto-3-amido-5-methanesulfonyl_2,3,4, 5-tetrahydro-111-1,5-benzodiazepine-1-ethenylamino] -5- (2,6-difluorofluorenyloxy) -4-one-pentanoic acid (612 ), Using a method similar to 607a (steps A and C only) using 603111 (150 mg, 0.36 mmol) instead of 6031 :, and (35) -3- (alanoxycarbonylamino) -4-one- Tertiary-butyl 5- (2,6-difluoroalkoxy) valerate (110; 160 mg, 0.36 mmol, WO 93/16710) instead of 606a, yielding 612 (56%) as a white solid [H'NMR (CDC13) d 7.85-7.10 (12H, m), 5.4-4.65 (4H, m), 4.6-4.15 (4H, m) 7 3.10-2.72 (5H, s &amp; m). -474- The paper size is in Chinese National Standard (CNS) A4 (2 丨 0X 297 mm) 1235157 The Ministry of Economic Affairs ordered the staff of the Prospective Bureau to cooperate and print A7 B7. V. Description of Invention (472) Example 13 'Compounds 619-635 were synthesized as described in Example 13 and Table 14.

-475- The size of the paper and paper music scale is applicable to the Chinese National Standard (CNS) A4 (210X 297 mm) 1235157 Λ7 _B7_ V. Synthesis of Invention Note (473) 619-635. Step A. Synthesis of 614 3 TentaGel S® 1 ^% resin (0.16 mmol / g, 10.0 g) was placed in a glass funnel of porous 1, and dimethylformamide (3 X 50 ml), 10% (v / v) Diisopropylethylamine (DIEA) was washed with dimethylformamide (2 X 50 ml) and the last dimethylformamide (4 X 50 ml) 3 plus a sufficient amount of dimethylformamide Add amidine to the resin to obtain the pulp, add 400 (1.42 g, 2.4 mmol, prepared from (3S) -3- (fluorenylfluorenyloxycarbonyl) -4-ketobutyrate third -Butyl ester, prepared according to AM Murphy et al. J. Am. Chem. Soc. 1 14, 3 156-3157 (1992)), 1-hydroxybenzotriazole hydrate (HOBT, H20: 0.367 g , 2.4 millimolar) o-benzotrisial-n, n, N, N, -tetramethylphosphonium hexafluorophosphate (HBTU; 0.91 g, 2.4 millimolar) and DIEA (0.55 ml, 3.2 Mol). The reaction mixture was stirred overnight at room temperature using a wrist-arm shaker. The resin was separated by suction on a porous glass funnel and washed with diamidine (3 x 50 ml). Unreacted amines were capped, ie, the resin was reacted with 20% (v / v) hepatic acetate / dimethylformamide (2X25 ml) in the funnel and allowed to react (10 minutes / washing). The resin was washed with dimethyltetramidine (3 X 50 ml) and digas methane (3 X 50 ml), and then dried overnight in the air to produce 614 (11.0 g, quantitative yield) β Μ 部 部 central standard Printed by the Bureau of Consumer Affairs Cooperatives (Read the notes on the back of the poem before filling out this page) Β Step 3 616 Synthesis. Resin 614 (3.0 g, 0.16 mmol / g, 0.48 mmol) is porous The glass funnel was washed with dimethylformamide (15ml for 3 fathers) and swelled. The Fmoc protecting group was dissociated with 25% (v / v) hexahydropyridine / dimethylformamide (15ml). 〇 minutes (intermittent stirring), and then fresh hexahydropyridine reagent for 20 minutes. The resin was washed with dimethylformamide (3 x 5 ml) and N-methylpyrrolidone (2 x 15 ml). Transfer to 100ml-476- Applicable national standard Xin (CNS) A4 is now available (210 × 297 publicly available) —---- 1235157 Α7 B7 V. Description of the invention (474) N-methylpyrrolidone is added after the flask In order to obtain the pulp, add 〇3u (〇736 grams, 0.72 millimoles) Η0BT · Η20 (0.112 grams, 0.73 millimoles), HBTU (0.27 grams, 0.73 millimoles) and 〇 圧 八 ( 0 .26 ml, 1.5 mmol). The reaction mixture was stirred overnight with a wrist-arm shaker at room temperature. The resin was manipulated and capped with 20% (ν / ν) acetic anhydride in dimethylformamide, as 614 was performed as described to produce 616 (3.13 g, quantitative yield). Step C. Synthesis of 617. This compound was prepared from 616 (0.24 g, 0.038 mmol) using an Advanced ChemTech 396 Multiple Peptide Synthesizer. The automated cycle included washing the resin with dimethylformamide (3 XI ml), deprotection with 25% (ν / ν) hexahydropyridine / dimethotamine (1 ml), and fresh reagents (1 ml) over 10 minutes to produce Resin 61 7. The resin was washed with Dimethoamine (3 X 1 ml) and N-methylpyrrolidone (3 X 1 ml). Central Bureau of Standards, Ministry of Economic Affairs Employees' cooperatives printed D-step irritability. Method 1. (624). Resin 617 was 0.4M, cefin-3-guinic acid and 0.4MΗBBT in N-fluorenylpyrrolidone (1ml) solution, 0.4MHBTU in 1 ^ -methyl-Pycnogenol _ (0.5 ml) and 1.61 ^ 10 ^ ^ ^ -methyl 0 Bidong disease 嗣 (0.35 ml) solution, and It should be stirred at room temperature for 2 hours. Repeat the hydration step. Finally, the resin was washed with dimethylformamidine (3 XI ml), digas methane (3 XI ml), and then dried in the air. The aldehyde was removed from the resin. It was dissociated in medium, and then treated with 95% TFA / 5% Η20 (ν / ν, 1.5 ml) as a whole for 30 minutes at room temperature to deprotect it. After the resin was washed with a dissociation reagent (1 ml), the mixed filtrate was added to cold 1: 1 ether: pentane (12 ml) (the resulting precipitate; the pellet formed by centrifugation and decantation of the β-soluble pellet was dissolved 10% acetonitrile / 90% Η20 / 0.1% TFA (15 ml), and then freeze-dried to obtain the crude 624, which is white -477- The paper scale is applicable to the Chinese National Standard (CNS) Μ Appearance (2 丨 0X 297 mm) '^ 1235157 A7 ________ Β7 _: __ 5. Description of the invention (475) color powder. The compound was purified by semi-preparative Rp_HPLC using a Rainin MicnDS〇rbTM ci8 column (5 microns, 21.4 x 250 mm), and Dissolve in a linear gradient (5% -45%) containing 0.1% TFA (v / v) for 45 minutes, 12 liters / min. Fractions containing the desired product are pooled and freeze-dried to produce 624 (10.0. Mg, 54%). Step D. Method 1A. Synthesis 627. Following a similar procedure to Method 1, the resin 01 7 was tritiated with 4- (1-retylmethoxycarbonylamino) benzoic acid and repeated ^ Fmoc group. Removed as described in step C, and the ammonium amine is acetic acid at 20.0 / v (v / v) in dimethylformamide (1 ml) and L6M DIEA in N-methylpyrrolidone (0. j5 Aisheng) Brew for 2 hours at 1 ° C. 3 Repeated B fermentation steps. 3 Dissociate from street fat to produce 627 (4.2 mg, 20%). Step D. Method 2. Synthesis 632 Following the similar steps of Method 1, resin 617 was treated with 0.5% of cinnamonyl radicals in sense methylpyrrolidone (1 ml) and 1.61 ^ DIEA in N-methylpyrrolidone (0.35 ml) in the room. It was decanted for 2 hours at room temperature. Cooling step repeats the dissociation of 3 aldehydes from the resin to produce 632 (1 1 丨 mg, 58%) ^

Steps of $ L D step for consumer cooperation of the Central Government Bureau of the Ministry of Economic Affairs. Party; cloud 3. Synthesis 629. Following a similar procedure to method 1, resin 617 and 1.0 M benzenesulfonium gas were reacted in digas methane (05 ml) and "pyridine in dichloromethane (0.60 ml) at room temperature for 4 hours and the β reaction was repeated. The aldehyde dissociates from the resin to yield 629 (4.7 mg, 24%). Analytical HPLC method '(1) Waters DeltaPak C18, 300A (5 microns, 3.9 x 150 mm). Linear acetonitrile gradient (5% -450 / 〇 ) Contains 0.1% DFA / 4 calendars for 14 minutes at i ml / min. _____-478-Paper &amp; Standard General § National Winter Standard Li (CNS) A4 (210 X 297 notarized) 1235157 A7 B7 V. Description of Invention (476) Printed by the Consumers' Cooperatives of the Ministry of Economic Affairs

fj rH CN + cn X CN cn L〇CN cn m, + (T3 m in + L〇e- cC ^ 令 Οι rH dP rH CO ON rH rH ^ CO ^ r CTi oo rH iH ao BU CO in ' σ \ rH r- »3: S ro L〇cn lD cn-in« -Η mm L〇o Γ0 in 0. BU〇L〇ZL〇Csi 2: BU CN UL〇2 in CM X BU CVJ U BU 〇 2 CNJ X 00 CNJ 〇. Potential.% 〇 \ ^ ° T yo ° rz ^ T zx .々. (Ff TZ 工 / V c \ tH VX) O CV4 VD τΗ CM VO (Please read the meaning of the back side first Please fill in this page) -479- This paper method is applicable to tgil house standard soap (CNS) Yakisumi (210 · X 297 mm) 1235157 A7 B7 V. Description of invention (477) Ministry of Economic Affairs t 夬 Standards Bureau Printed by Employee Consumer Cooperative

rH tH + cn re + 〇3 σν + m ST 2 Γ ΟΟ Η CC Η-1 〇4 X tH dP CTk GO tH oi ~ 4 fH-&lt; ίΡ 〇〇 ^ • 〇iD rH rH dP ^ CO -00 3 : X in in r—4 VD rH and rH m VD 00 Ε × 4 X CD 〇z VO CN rc CD CVJ uot—i 〇2 &lt; N4 Γ0 X (Ti r &gt; CJ cn 卜 〇 &lt; NJ CNi 5: CN CN CJ competition. 々. 4¾. \. 々. 5x. 乂. 2J CVi VD m CM VD eg VO 48 The size of this paper is applicable to Chinese national standard (CNS) A4 grid (210X 297 mm) (please read the back first) For the matters needing attention, fill in this I) ly 1235157 A7 B7 V. Description of the invention (478 Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs

^ * rH 1-t + cn £ S + X ι-ί vn tH ri in CO CO m 〇 4 3: a dP S 笤 f— &lt; dP ^ 00 bu dfi ^ &quot; * bu 3: 2: in to tn rH vn fl m. o rH un cn L〇 卜 CO m (X4 X cn Buzhi CNJ K cn CN o CO 〇 ^ 3 * z VO CM as to C \ J o CO s 2; bu CN X VD C \ J .u Sx 〇KwC ° v X 5x ° ^. .Fen ^ 〇 = T 0 1 5x Φ m 2 U) CM vo r- &lt; N ^ Fill in. End of page if Bookmark -481-The size of this paper is applicable to Chinese National Standard Li (CNS) 64 4 Teg (210X297 mm) 1235157 Λ7 B7 V. Description of Invention (479) The Ministry of Economic Affairs Central Standardization Bureau staff consumption Printed by a cooperative

(Please read the / X notice on the back before filling this page)

The scale of this paper is applicable to Chinese National Standards (CNS). \ 4 蚬 Grid (210X 297mm) 1235157 Λ7 B7 Printed by the Shellfish Consumer Cooperative of the China Prototype Bureau of the Ministry of Economic Affairs *. 5. Description of the Invention (480) CM CN CM rH 4- m re Σ 1 BU〇L〇f— (iH in rH cn σι o L〇cC 〇4 X η rH dP a \ 〇〇cTi σ \ ο rH rH «« — «» dP 00 CO sr &lt; Jk rH rH rH-c ^ P bu 00 'sO rH cP &lt; n cd O (Ti o 1 CSJ ID VJD 〇L〇1-4—ir &gt; · 〇rH 0Ί 〇as 00 o in CM 2 or o 2; VD CVJ X VO CM u CO 〇Z VO CNJ 5: in Csi 〇σ \ Ο § CN X CM CNJ CJ CO 〇2 * ^ r CN4 2: tD CSJ U 5 x 〇 * &lt; 7 &gt; = 〇b δ x ° XL ° ^ ° = &lt; 〇b 5x 〇 = &lt; &gt; = 〇 工 O 5 X 〇 = &lt; 7) = 〇 &lt; N &lt; n VO nn vo n VO m cn VD -483- Please read Meaning of back-sale 4% of this 1 book size is applicable to Chinese national standard (CNS) Α4 standard (210 × 297 mm) 1235157 A7 B7

V. Description of the invention (481) Example 14, Compounds 1605a-j, 1605m, 1605n, 1605p, 1605t and 1605v are synthesized as follows

Step B (Please read the notes on the back and fill in this page) &quot; α

Step E_

Step C

Step D 〇 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (3S) N- (2-net-based-ο-Second-butyranylamino-2,3,4,5-® ^ -1Η- ^ ® ^ and [3,4-1 ^ [1,4-diazapyrene (1600). Step A. (2S) 2-third-butoxycarbonylamino-3- (3-nitropyridine- 2-Aminoamino) propanoic acid, similar to the 2-third-butoxycarbonylamino-3 · (2-nitrophenyl · amino) propanoic acid A method similar to 600a / 103 synthesis, except that 3 -Chloro-3-nitro bite replaces 2-fluoroazylbenzene, which can produce 4.05 g (64%) of yellow solid. • 484-The paper scale is suitable for Chinese national standard plums (CNSM4 condition (210X297 mm) 1235157 A7 B7 V. Description of the Invention (Trick 2) Step B, (2S) 2-Third-butoxyepiamino-3- (3-aminosigma ratio-2-ylamino) propionic acid, similar to 600a / 103 Synthesis of (2S) 2-third-butoxycarbonylamino-3- (2-aminophenylamino) propanoic acid in 3 steps, which can produce 3.68 g (quantitative) of dark solid 3 C Steps. (2S) 2-Third-butyrocarbamoylamino-3- (3-aminoa ratio-2-ylamino) propionic acid methyl ester 3 (2S) 2 · Third-butoxycarbonyl Amino-3- (3-aminopyridin-2-ylamino A solution of propionic acid (360 mg, I · 21 mmol) and MeOH (59 mg, 1.82 mmol) in anhydrous CH2C12 (20 ml), with 4-dimethyl linker 1 ^ pyridine ( DMAP, 163 mg, 1.33 mmoles) and 1- (3-dimethylaminodiyl) -3 · ethylcarbodiimide hydrochloride (280 mg, 1.45 mmoles). The reaction was stirred for 18 hours to Diluted with EtOAc (150 mL), washed with water (2x), absolute NaHC03 and saturated aqueous NaCl solution, dried over Na2S04 and concentrated in vacuo. 3 Chromatography (Rapid, SiO2, 0 to 5% MeOH / CH2Cl2 ) Can produce 250 mg (67%) of the title compound as a light brown solid. Consumers' cooperation with the China Bureau of Standards, Ministry of Economic Affairs, Du Yin ¾ D Step 3 (3S) N- (2-keto-3-third-butoxy Carboxylamino-2,3,4,5-tetrahydro JE. [-), 4-b] [1,4-Anodic leather (1600) 3 (2S) 2-Second-butoxycarbonylamino Methyl 3- (3-aminopyridin-2-ylamino) propanoate (70 mg, 0.225 mol) and 25% sodium methoxide / MeOH (130 μl, 0.56 mmol) in anhydrous MeOH ( 4 ml) of the solution was heated to 60eCl for 6 hours. The reaction was concentrated under vacuum and the residue was dissolved in 2 ml of H2O and then Et OAc extraction (3x). The combined extracts were dried over Na2S04 and concentrated in vacuo. 3 Chromatography (Foam, SiO2, 0 to 3% MeOH / CH2Cl2) yielded 7.5 mg (3%) of 1600 as a light brown 31HNMR (CD3OD) (7.99-7.92 (lH, d), 7.75-7.65 (1H, br.s), 7.14-7.08 (1H, d), 6.73-6.65 (lH, m), 5.83- ______-485-(CNS) (2i0x 297 / ^ ¾) '1235157 A 7 B7 V. Description of the invention (Ming 3) D.7D (1H, br. S), 5.40.25 (1H, br. S) , 4.6-4.5 (lH, m), 3.95, 3.84 (1H, m), 3.55, 3.48 (1H, m), 1.4 (9H, s). E step irritability. 1601 was prepared from 1600, followed by step D method of 600a / 103

Step D

Printed by the staff of the Central Bureau of Economic Affairs of the Ministry of Economic Affairs, Cooperative Society, 160j, 160, 160, prepared from 1601, followed by 603 synthesis from 600

Step A

NH2

486- The paper scale is applicable to the Chinese national ginseng standard plum (〇 \ 5) 焱 4 (210 &gt; &lt; 297 &gt; Gongning 1235157 Λ7 37 V. Synthesis of the invention (484) 1605. 1605 was prepared from 1603, according to Method for preparing 605 from 603. Table 15 1605 Rs r4 a PhCH2CH2C0PhCO b PhCH2CO PhCO c PhCO PhCO d CH3C0 PhCO e CH3OCH2CO PhCO f (ch3) 2chch2c0PhCO g ch3coch2co PhCO h CH30COCO PhCO i CH3COCO PhCO j CHO. CH3S03 PhCO n CH3C0 Nyki-2-CO P PhCH2NHC0 PhCO t 3-CH3PhCH2CO PhCO V PhCH2CH2CO PhCH2 Example 15 Printed by the Consumers' Cooperatives of the Ministry of Economic Affairs of the China Standards Administration Bureau-(Please read the ^ 意 事 1_ on the back first ^ Written compound 1610-1621 was prepared from 1600, similar to the method used to prepare compounds 619-63 5 from 600a / 103 and 600b. -487- This paper has a common Chinese national standard (CNS). 210X 297 mm> 1235157 Orders from the Ministry of Economic Affairs, Standards Bureau, Consumer Cooperation Du Yin ¾

The paper &amp; standard is applicable to China National Standard (CNS) A4 specification (2 丨 0X297 mm) 1235157 Λ7 B7 V. Description of the invention (486) Among the compounds 1610-1612, a R3 = CH3C (0) -b R3 = CH3 〇CH2C (〇)-: 1610

1611

1612

1613

1614

1615

1616

1617 Employees' Cooperation of Central Standards Bureau, Ministry of Economic Affairs Du Yin ¾

161S 1619 1620

CH3 O

〇V o

CH, -489 The standard of this paper is applicable to Chinese national standard plum (CNS M4 grid (2 [0X 297 mm) 1235157 A7 B7 V. Invention. Explanation (487)). Please also refer to Example 16 · Compound contains skeleton (ell) , (Yl), (y2), (z), and (el: 2) can be synthesized as follows: RiS (ell) and Y2 * = 0.

NH—NH Reading Meaning

Write page C〇2〇H2Ph

O

Bocl

Printed by the Consumer Affairs Cooperative of Zhongli Bureau of the Ministry of Economic Affairs ¾

O

O 269 490- The standard of this paper is universal Chinese national standard (CNS) A4 is present (210X 297 mm) 1235157 A7 B7 Printed by the Consumers' Cooperatives of China Standards Bureau of the Ministry of Economic Affairs Ⅴ 5. Description of invention (488) Synthesis of skeleton Ri Where 1 ^ is (71) and y2 is = 〇.

270 (Please read the notes on the back before filling in this f) -491-This paper &amp; standard common Chinese national standard plum (CNS) M is present (210X: 97 mm) 1235157 A7 B7 V. Description of the invention ( 489) Synthesis of skeleton I, where Ri * (y2) and ¥ 2 are 仏 and 乂 7 is 〇

Boc SN Η

Η Ο

Poverty alleviation cooperation for employees of the Ministry of Economic Affairs

TFA Ο

-492 The standard of this paper is applicable to China National Standards (CNS) Α4 tier grid (210X29? Mm) 1235157 A7 B7 V. Description of the invention (490)

Synthesis of skeleton I, where Ri is (y2) and its, y2 is = 0 and X7 is NH

+ Η

TFA Ο

(Please read the-on the back of the first; 1 note \ ^% write this page)-Binding and ordering Printed by the Employees' Cooperatives of the China Standards Bureau of the Ministry of Economic Affairs -493- The national standard (CNS) Α4 specification of this paper method applies (210X 297 mm) 1235157 A7 B7 V. Description of the invention (491

Synthesis of skeleton Ri, where 1 ^ is 2) and Y2 * H2iX7 * NH

CbzHl · ^ o, c

(Please read the precautions on the back before filling in this page. It is bound by it. It is printed by the Employees' Cooperatives of the Prospective Bureau of the Ministry of Economic Affairs ¾ -494- This paper method is suitable for the National Standard Vehicle (CNS) A4 (2 丨0X2W mm) 1235157 Λ7 B7 V. Description of the invention (492) The synthesis of the skeleton Ri, the center of which is Bu), and γ 2 is 〇

PhCH2〇2〇 ^^ 1) PC15

hA, nJ

Boc 2) NaHC〇3 X = NHCbz X = OCH2Ph

PhCH2〇2C

267

H2, Pd / C

oc

O

1) NH2NH2 Consumer Cooperatives' Seal of the Central Sample Bureau of the Ministry of Economic Affairs 0 o

1) TFA 2) COCl2

274 275 X7 = NH X7 = 〇-495 This paper scale is applicable to Chinese National Standard Plum (CNS) Λ4 specification (210 X 297 mm) 1235157 A7 B7 V. Description of the invention (493) Synthesis of skeleton Ri, where 1 ^ is 021) and ¥ 2 is = 〇, C〇2CH2Ph ^^ C〇2CH2Ph /

t-BuONH2 __- t-BuO-NH 276

Cbz

COCl2

276

M Ministry of Economic Affairs wins bid for Li Bureau employee consumption cooperation

1> H2, Pd / C 2) PC15 0

277 -496- The standard of this paper is Chinese national standard plum (CNS M4 dyke (210X297 mm) 1235157 A7 B7 V. Description of the invention (494) Example 17,

Compounds 2001, 2002, 2100a-e and 2201 were prepared as follows.

Ο

2002 Ο

Η 2001 Consumption Cooperation between Employees of China and the Central Bureau of the Ministry of Economic Affairs Du Yin ¾ (1S, 9S) 9-Aminomethylamido-6,10-diketo-1,2,3,4,7,8, 9,1 octahydro-6H "Anhydro [1,2-a] [l, 2] diazabenzene-1-carboxylic acid (2000). P-9 monoamine 1-yl-6,10-dione -1,2,3,4,7,8,9,10-octahydro-611-dalopano [1,24] [1 '^ diazapyridine-1-carboxylic acid tert-butyl ester ( 〇3 2,128,984; 340 mg, 1.1) mol) in a solution of CH2C12, adding quilted formic acid (260 mg 1.7 mol), HOBT (230 mg, 1.7 mol) and EDC ( (34 mM, 1.7 mM)) The mixture generated by β was stirred at ambient temperature for 16 hours, poured into IN HC1 and extracted with CH2C12. The organic extract was further washed with NaHC03 and dried on MgS04. And concentrated to form 1999, a ochre yellow solid. The solid is dissolved in CH2C12 (25 ml) and TFA (25 ml) and -497. This paper scale is suitable for Chinese national standard plum (CNS) A4 (210x 297 mm) 1235157 A7 ___B7_____ 5. Description of the invention (495) Stir overnight and concentrate in the air to produce 560 milligrams and 2000 grams, which is oily 3 [1S, 9S (2RS, 3 S)] 9-benzylfluorenylmethaneamido-6,10-diketonyl-1,2,3,4,7 ′, 9,10-octahydro-N- (2 (R, S) -fluorene Oxy-5-ketone tetra-argon sulfanyl group 3 wells and [l, 2-a] [l, 2] -diazapyridine-1_chipinamine (2001), synthesized from 2000, to A method similar to compound 213e can yield 410 mg (63%) of 200 丨 as a white solid; 4 NMR (CDC13; a mixture of diastereoisomeric forms) 0 '25 (1H, d), 8.23 (1H , d), 7.78 (1H, dd), 7.65 (1H, bm), 7.50 (2H, m), 7.40-7.25 (4H, m), 6.55 (1H? d), 5.57 (1H, d)? 5.10 (1H, t), 5.05-4.95 (2H, m), 4.90 (1H, d), 4.80 (1H, d), 4.72 (1H, bm), 4.65 (1H, m), 4,55 ( 1H, m), 4,45 (1H, t), 3.25 (1H, m), 3.15 (1H, m), 3.00 (2H, bm), 2.90 (1H, dd), 2.70 (1H, m) , 2.47 (1H, dd), 2.45 (1H, m), 2.35 (1H, m), 2.0-1.75 (4H, m), 1.60 (1H, bm) ° Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Printed (please read the notes on the back before filling in this one) [3S (1S, 9S)] 3- (9-benzylmethylformamidine-6,10-diketo · 1,2 , 3,4,7,8,9, 10-octahydro-6Η-da-benzo [l, 2-a] [l, 2]- Diazapyridine-1-carboxylaminoketobutyric acid (2002). Compound 2001 (58.6 mg, 0.10 mmol) was treated with 5 mL of TFA / MeCN / water (1: 2: 3) and stirred at room temperature for 6.5 hours. The reaction was extracted with acetic acid. The aqueous layer was concentrated by removing water by azeotropic distillation with MeCN. The product was suspended in CH2C12, concentrated under a vacant space and precipitated with ether to give 46.8 mg (99%) of 2002 as a white solid: lH NMR (CD3OD) d 9 · 05 (0.25H, d), 8 · 15 (1H, d), 7.68 (1H, t), 7.64 (0.25H, d), 7.55 (3H, t), 7.35 (0.5H, m), 5.22 (1H, t), 4.90 (1H, m)? 4.58 (1H , dd), 4.50 (1H, m), 4.28 (1H, bm), 3.45 (1H, m), 3.10 (1H, bt), 2.68 (1H, ddd), 2.60-2.45 (2H, m), 2.30 ( 1H, dd), 2.15- -498- This paper is commonly used in ft scale 1] National standard (CNS) A4 is now (210X 29Y mm) &quot; &quot; 1235157 A7 B7 V. Description of the invention (496) 2 · 05 ( 2H, m), 1.90 (2H, bm), 1.68 (1, H, bm). 〇

(Please read the notes on the back of the first 8 and fill it out. Exhaust) 214c 2100a R1 2100b R1 [1S, 9S (2RS, 3S)] 9-Amine-6, 10-Diketo-1 ， 2,3,4,7,8,9,10 -—- The staff of the Central Procurement Bureau of the Ministry of Economic Affairs cooperated with Du Yin ¾ octahydro-N- (2-isopropoxy-5-one-tetrahydro -Furan-3-yl) -6H-dalop [1,2-a] [l, 2] diazabenzene-1-carboxamide (2100a). A solution of 214e (101 mg, 0.23 mmol) in isopropanol (10 ml) was stirred at room temperature with a catalytic amount of para-toluenesulfonic acid (10 mg). After 75 minutes, the reaction mixture was poured into saturated NaHC03 and extracted with CH2C12. The combined extracts were dried over Na2SO4 and concentrated. Flash chromatography (Si02, CH2C12 to EtOAc) yielded 56 mg (51%) of 2100a as a white solid: (CDC13; a mixture of non-isomeric stereoisomers) (^ 7.9-7.8 (2 trans 111), 7 &gt; 7.5 (1H, m), 7.5-7.4 (2H, m), 7.1 (〇 · 5Η, d), 6.9 (0.5H, d), 6.4 (0.5H, d), 5.6 (0 · 5Η, d), 5.3 (0.5H, s), 5.2-5.1 (1H, m), 4.95 (0.5H, m), 4.75-4.5 (1.5H, m), 4.35 (0.5 ·, t), 4 · 1 (〇 · 5Η, m), -499-_ A paper size is selected from Chinese National Standard (CNS) A4 (210X 297 mm) 1235157 Printed by the Bayong Consumer Cooperative of the Central Bureau of the Ministry of Economic Affairs ¾ A 7 B7 V. Description of the invention (497) 3.98 (0.5H, m), 3.3-2.75 (4H, m), 2,5-2.4 (2H, m), 2.25 (1H, m), 2.1-1.9 (3H , M), 1.75-1.55 (2H, m). [3S (1S, 9S)] 3- (9-fluorenylamido-6,10-dicopperyl-1,2'3,4, 7,8,9, 10-octahydro-6H-dapyrolo [l, 2-a] [l, 2] -diazabenzene-1-carboxamido) -4, 'diethoxy- Ethyl butyrate (2100b). 214e (16 mg '0.036 Emole) in ethanol (2 ml) at room temperature in catalytic amount of para-toluene acid (2 mg Treatment. After 5 days, the reaction mixture was poured into saturated NaHC03 and extracted with CH2C12. The combined extracts were dried over Na2SO4 and concentrated. Flash chromatography (Si02, CH2Cl2: EtOA0 95: 5 v / v) Generates 16 mg (81%) of 2100b as a white solid: NMR (CDC13) d 7.85-7.74 (2H, m), 7.55-7.38 (3H, m), 7.04-6.95 (lH, d), 6.61-6.48 (lH, d), 5.15- 5.08 (lH, m), 4.63-4.53 (lH, m), 4.52-4.45 (lH, m), 4.42-4.35 (lH, m), 4.15-4.05 (2H, m) , 3.74-3.60 (2H, m), 3.57-3.42 (2H, m), 3.39-3.28 (lH, m), 3.03-2.93 (lH, m), 2.92-2.82 (lH, m), 2.65-2.52 ( 2H, m), 2.42-2.25 (lH, m), 2.20-1.88 (4H, m), 1.76-1.50 (2H, m), 1.35 · 1 · 10 (9H, m). [3 3 (15,93)] 3- (9-Aminomethylamido-6,10-diketonyl.1,2,3,4,8,9,10-octahydro-6H-Da And [l, 2-a] [l, 2] -diaza leather-1-carboxamido) -4,4-dimethoxy-butyric acid methyl ester (2100c). A solution of 214e (165 mg, 0.37 mmol) in methanol (5 ml) was co-stirred with a catalyst amount of para-ammonium sulfonic acid (17.5 ml) at room temperature. After 4 days, the reaction mixture was diluted with EtOAc and washed with 10% NaHC03 (3x) and brine. The combined extracts were dried over Na2S04 and concentrated. Flash chromatography / Si02, EtOAc) can produce 127 mg (68%) of 2100c as a white solid: iH NMR (CDC13) Θ 7.S2 (2H, _ _ ^ 500- this paper scale is suitable for national g standard plums (CNS) A4 specification (2 丨 〇χ 297 mm) I ---------- (Please read the note on the back to write this page) Order 1235157 A i B7 V. Description of the invention (498) d) , 7.55-7.50 (1H, m), 7.47-7.43 (2H; m), 7.02 (1H, d), 6.53 (1H, d), 5.20〇.10 (1H, m), 4.56-4.50 (1H? M ), 4.45-4.50 (1H, each, two m), 3.69 (3H, s), 3.41 (3H, s), 3.43 (3H? S), 3.35 · 3.25 (1H, m), 3.06-2.98 (1H, m), 2.94-2.83 (1H, m), 2.65-2.53 (2H, m), 2.35-2.32 (1H, m), 2.15-2.07 (lH? m), 2.00-1.89 (3H, m), 1.75- 1.56 (2H, m)-[3S (1S, 9S)] 3- (9-; fluorenylamido-6,10-diketo-1,2,3,4,7,8,9, 10-octahydro-6H-dapyrido [l, 2-a] [l, 2] -diazabenzene-1-carboxamido) -4,4-diisopropoxy-butyric acid isopropyl Ester (2100d). 2 A solution of 14e (53 mg, 0.12 mmol) in isopropanol (5 ml) was co-stirred with a catalyst amount of para-toluenesulfonic acid (5 mg) at 5 CTC. After 3 days, the reaction mixture was poured into NaHC03 and extracted with CH2C12. The combined extracts were dried and concentrated on Na2SO4, and flash chromatography (Si02, CH2Cl2: EtOAc (4: 1 to 1: 1 v / v) yielded 49 mg (68%) of 2100d. White solid: 4 NMR (CDC13) ^ 7.85 (2H, d), 7.50-7.43 (1H, m), 7.41-7.35 (2H, M, Ministry of Economic Affairs, China Purchasing Bureau. Read the second question of the lambda in mind and fill in sophomore) m), 7.02 (1H, d), 6.47 (1H, d), 5.13O.07 (1H, m), 5.00-4.9 (1H, m ), 4.61-4.55 (2H, m), 4.37 ^ 4.30 (1H, m), 3.80-3.70 (1H, m), 3.90-3.80 (1H, m), 3.42-3.35 (1H, m), 3.03-2.93 (1H, m), 2.91-2.81 (1H, m), 2.62-2.50 (2H, m), 2.38-2.33 (1H, m), 2.12-2.06 (lH, m), 1.97-1.81 (3H, m) , 1.70-1.60 (2H, m), 1.28-1.05 (18H, m).

The paper ft scale is applicable to the ta country # 挛 (CNS) A4 gauge (210X297 male) 1235157 A7 B7 V. Description of the invention (499) [15,95 (2,5,35)] , 10-diketo-1,2,3,4,7,3,9,10 · octahydro-N- (2-ethoxy-5-keto-tetrahydro-furan-3-yl)- 6H-Dahu [1,2-a] [l, 2] -diaza leather-1-carboxamide (2100e), synthesized from 302, and by the method of 3 04a, 2100e can be produced, except for using Ethanol and triethyl orthoacetate replace methanol and trimethyl orthoformate. Chromatography (Si02, 5% ethanol / CH2C12) yielded 92 mg (68%) of a white solid: lH NMR (CDC13; diastereomeric mixture) c? 7.90-7.80 (2H, m), 7.60 -7.50 (1H, m), 7.50-7.40 (2H, m), 7.30 (0.5H, d), 7.00 (0.5H? D), 6.50 (0.5H, d), 5.50 (0.5H, d), 5.20 -5.10 (1.5H, m), 4.95 (0.5H, m), 4.75-4.65 (0.5H, m), 4.65-4.50 (1H, m), 4.38 (0.05H, t), 4.00-3.90 (0.5H , m), 3.85-3.75 (0.5H, m), 3.75-3.65 (0.5H, m), 3.65-3.55 (0.5H, m), 3.30-2.70 (4H, m), 2.50-2.35 (2H, m ), 2.30 (1H, d), 2.15-1.90 (3H, m), 1.80-1.60 (2H, m), 1.25-1.20 (3H, two t). Λ π

(3S) -3-[(3S) -2-keto-3- (1-fluorenylmethylfluorenyl) amino-5-methoxyethylfluorenyl-2,3,4,5-tetrahydro-1H -1,5-Benzodiazepine-1-acetamidinyl 4-pyridylbutyric acid (2201) is synthesized from 600b, and 2201 ·· lH NMR (CDC13) Θ 8.30 can be generated by the method synthesized from 605b -8.22 (lH, m), 8.05-7.98 (1H, d), -502- This paper is generally used in standard papers, such as Jiashui Li (CNS) Α4 (210X297 mm)

I please if the back

Write too f

Ｍ 部 部 .7central sample bureau _ member two consumer cooperation Du Yinx

VT7 1235157 Λ7 B7, description of the invention (500) 7.96-7.83 (lH, m), 7.77-7.68 (lH, m); '7.67.7.40 (7H, m). 5.12-5.02 (lH, m), 4.98 -4.41 (5H, m), 4.38-4.24 (lH, m), 4.07-4.00 (lH, d), 3.92-3.80 (2H, m), 3.32 (3H, s), 2.75-2.60 (lH, m) , 2.58-2.35 (lH, m). Example 18 We used the method described here to obtain the following data for selected compounds of the present invention (Table 16, see Example 7; Tables 17 and 18, see Examples 1-4). The structure and preparation of the compounds of the present invention are described in Example 28-31. _Table 16 Comparison of potency of prodrugs in LPS challenged mice ... The percentage of inhibition of IL-1 production after treatment with the compounds of the present invention is shown as a function of time after LPS challenge, expressed in countless times at relative time). (Please read the following items of Yunyi ’s intentions 4) Fill in the order printed by Taiyibei Ministry of Economic Affairs, the member of the Bureau of Consumers and Consumers Cooperatives, 2h -lh 〇h 213f (-4)-8-213h 9-53-213i (- 11) • 62-213k 0-63 read 2131 (-18)-80 213m 26-42 • 213o 4-8-213p 21-29-213q 17 • 91-213r 59-37-213x 0-78 B 1- 1 213y 29-. 50 i pin I 214e 39-70 75 I 43 44 48 11 ί--• 47 ί 214k 12-31 i 2141 0-54-214m 0-17-214w 11-91 i 2641 0-23 -404---56 55 Scale 6 — ί 1 503-The standard of this paper is applicable to the national standard plum (CNS) Λ4 (2! 0x:! 97); $) 1235157 A7 __ 5. Description of the invention (501 ) Poverty Alleviation Cooperation among Employees of the China Prospective Bureau of the Ministry of Economic Affairs Du Yin ¾ Compound-2h -lh Oh 412 0-, 0-11-37-418--• S4 25-52-434 0-S3 80 450 0-35- 452 • Mon-70 28-89-456 •--5S 41-69-470 0-36-471 0 Meals 34 Boxes 475 0-15 • 481 27-0-486 19-15-487 17-20-528 25 -67-550f 0-50-550h 55-73-SSOi (-10)-23-5S0k 36-34-5501 9-38 • 550m 45-52-550a 19-65 • 550〇19-64-550p 30-SO 655 0-68-656 31-16 1 662 41 -75-668-Mon-53 695a 49-78-1015 15-28-2001 64 62 58 55 2001a 10 • 16 2002 5-87 «2100h 34 side 32 — · 2100i 19-74-i 2100j 48 41 0 33, : 2100k 30 50 32 72 21001 52-28-1 2100m 40-42 2100n 21 9 64 73; 2100o 31 44 68 64 (Please close the back 5 of the-; ± Notes ear fill in this book \ Paper binding 4 -504- In the application of this paper, the national standard (CNS) Λ4 is now (210 X 297 mm) 1235157 Λ7 B7 V. Description of the invention (502) Table 17 The selected compounds of the present invention obtained by the method described in Example 1-4 Data 3 Order of the Ministry of Economic Affairs of the People's Republic of China 2. Consumption Cooperation Du Yin ¾ Compound UV-Visible Ki (nM) Cell PBMC avg · IC50 (nM) Human total IC50 (nM) rat clearance rate, iv ml / min / kg rat clearance Rate, iv · · ml / min / kg 213f 3000 213g 2200 rpm 213h 1500 213i 1100 213j 213k 2000 213 1 2000! 213m 2500 213o 5000 3300 j 213p &lt; 300 1 1 213q &lt; 300 1 I: 213r &lt; 300 1 1 1 213v 0.5 1,100 1100 41 23! 213x 4500 2500 1 j 213y 930 | 214j 4.2 2500 6000 214k 0.2 500 580 22, 2141 6 1900 1100 12 彳 214m 1.5 530 2200 33.4 214w 0,6 620 370 15 246b 30000 &gt; 30000 87 I t 2641 3000 265a 2600 25000 1 1 1 265c 1100 4500! 32 26Sd 500 1500 ί 35 265f 1200! 24 280b I 13000! I 280c j 10000 1; 86 280d 25000 1 283b 1750 41 283c 4000!! 50 I * -505- This paper method is commonly used in China National Standards (CNS &gt; A4 is now available (210X 297) (%) (Please read the back of the cloud .. V! Meaning Vf and then fill out this package 1235157 _B7 V. Invention Description (503) M Ministry of Economic Affairs of the Ministry of Economic Affairs of Tvi Bureau two poverty alleviation cooperation let India ¾ compound UV-visible light Ki (nM) Cell PBMC avg. IC50 (nM) human whole blood '' IC50 (nM) rat clearance, iv · ml / min / mice rat smear. Rate, iv · | liter / min / kg 283d &gt; 8000 10000 | 308c 3000 1 1 ί 308d 3000 -1 500 25 1800 1800 I j 501 2.5 1800 1600 1 1 r 505c 1500 505d &gt; 20000-505f 550 510a 65 200 267 510d 2300 &gt; 20000-511c 730 &gt; 20000 78 40 528 2200 5S0f 1100 550h 1800 550i 1400 550k 3000 5501 750 550m 2000; I S50n &lt; 300 1 550〇450 3000 t! 5S0p 2900 1 550q 700 1 640 155 2250 3900; 642 35 8000 2900; 645 150 1 650 550 4000 1 1 653 30 2300 -6000, ί 655 i I 656 0 · 6 2100 1600;! 2.9 662 0 · 5 1800 800 i 2 · 75 668 9 5200 3700 29 i 669 14 10000 670 4500 i 1 671 5 2000 2500 I 33.2 677 1! 1 610 i; 678 5 2700 2200 680 -506 -The standard & standard tS national standard (CNS) A4 Luo (21〇 ', &lt; 297 mm) (please read the precautions of Beyond Cloud before filling this page)

1235157 Λ7 B7

J • rf Stated by the Ministry of Economic Affairs, Bureau of Labor Standards, Consumer Consumption Cooperatives ^ Compound UV-Visible Ki (nM) Cell PBMC avg. IC50 (nM) Human Whole Blood IC50 (nM) Rat Clearance, iv · ml / min / Public rat clearance: rate, iv · _ml / min / gong 681 9 3000 5000 1 | 682 1300 683 400 &gt; 20000 &gt; 20000 i 684 15 5000 2800 1 I 686 4 4000 9000 j 688a 3000 688b 1300 -689a 0.8 910 2500 689b 2.2 600 2000 690a 1600a 690a i 691a 2.1 2900 1200 9,9 691b 11.5 1,900 1400 692a 692b 1800 693 694 3 2600 2100 II 695a 1 • 695b 695c 2500 (696 4.5 2000 2900 13; 700 275 I 701 90 702 45 &gt; 5000 20000 703 5 1400 20000 704 30 2600 9800 705 5 2300 3200 706 S 2400 5800 707 180 708 140 1 | 709 10 2100 14000 i: 710 110 t: 711 175 910 10 3400 3800; 911 9 3500 1900 912 10 4200 3800 ΐ 913 4.5 2400 7000! 丨 I -507- The standard of this paper is applicable to the Chinese house standard (CNS) A4 蚬 (2 丨 OX 297簦) (please read ^ Parent's reading \ -5 the above matters and fill in this page again. • Binding 1235157 Α7 S7 V. Description of the invention (505 Employees of the Central Samples Bureau of the Ministry of Economic Affairs, printed by the cooperative) ¾ Compound UV- Visible light Ki (nM) Cell PBMC avg. ICSO (nM) human whole blood, IC50 (dM) mouse clearance, iv 丨 ml / min / male clearance, iv _ml / min / kg 914 5.2 2600 2800 I 915 11.5 &gt; 8000 1900 918 7 1150 919 4 2000 4300 920 16 2100 3000 921 8.5 1800 3000 1018 170 4000 5500 -9.1 1052 100 2500 16 1053 27 2000 &gt; 20000 34 1056 170 • 17 1075 120 5000 5500 14.5 1095 360 6000 28 1105 250 3500 3000 1106 75 4000 1700 1107 65 1108 22 1400 2600 1109 80 1110 45; 1111 18 6050 4400 1112 3.5 1800 2300 1113 290 1114 125! 1 1115 250 i 1116 215 i J 1117 35 1700 1300 1 i 1118 380; 1119 515 1 1120 95 i 1121 170 ii 1122 400 I: 1123 30 2,400 4500 1 * 1124 270 i; r 1125 55 2300 9000 2001a 3000 • * 2100f 1 f; 2100g ι;-. I; 2100h 2000 i -508-

Please Yuan. ¾ Read the matter and fill in the s. I The paper scale is in accordance with the Chinese National Standards (CNS) six 4 squares (210X297 mm) 1235157 A7 B7 5. Description of the invention (5 06) Compound UV-visible light (nM) Cell PBMC avg. ICSO (nM) Human's whole blood IC50 (nM) rat clearance, iv ml / min / kg rat clearance, iv · ml / min / kg 2100i 2100j 30000 12000 t 21001c 520 4000 600 21001 750 2200 2100m r 2100η 670 770 4000-2100ο 670 1150 1500% Read back; · idea rich ψ_ it We use the method described here (see Examples 1-4) to obtain the following data for selected compounds of the present invention (Table 18 ). The structure and preparation of the compound of the present invention are shown in Example 2 8-3 1 3 Table 18 Fluorescent analysis of compounds kinact m * 1 s &quot; 1 Ceil PBMC avg. IC50 (nM) Human-wide ICSO (nM) rat clearance, iv ml Rat clearance rate per minute / kg, iv ml / min / kg 286 370000 300 1600 119 505 b 190000 1500 2100 161 196 505 e 420000 9000 1000 The efficacy of the anti-inflammatory agents in the in vivo acute analysis method shown in Table 19 shows that 412f, 412d, and 696a can be used after oral administration using ethanol / PEG / water, -cyclodextrin, labrosol / water or cremophor / water as a vehicle. LPS-Challenge Inhibition of IL-1 Production in Mice. The compound is administered at the time of LPS administration. The strategy is described in Example 7. Table 19 Inhibition rate (%) of IL-1 /? Production system in LPS-challenge mice. -509-Printed by the Consumer Cooperatives of the Central Government Bureau of the Ministry of Economic Affairs 1235157 A7 ________ BT ^ V. Description of the Invention (507) Compound 10 milligram / kg dose 25 mg / kg dose table, 50 mg / kg dose 412f 17% 25 % 32% _ 412e 5% 17% — 61% 696a 0 45% 52% Example 20 Child _ rat horn and vegetable glue peritoneal rash: rats take 10 millihorn and carrageenan in 0.5 ml of saline solution Intraperitoneal (IP) injection induces inflammation (Griswold et al., Inflammation. 13, ρρ · 727-739 (1989)). Equal in ethanol / peg / water, cyclophosphine, labrosol / water or cremophor / water solvent and then orally administered. The rats were sacrificed 4 hours after the administration of carrageenan, and then 2ml of saline IP containing 5 units / ml of heparin was injected into the abdomen, and a small incision was made after gentle massage on the abdomen. The contents were collected and the recorded volume was kept on ice The cells were removed by centrifugation (130 × g, 8 minutes, 4eC) to remove the cellular material, and the resulting supernatant was stored at -20. C was determined by ELISA to determine the level of IL-10 in ascites. The results in Table 20 show that the prodrug 412f can inhibit IL-1 production in mice challenged by carrageenan after oral administration. Compound 214e does not inhibit IL-1 / production system when taken orally at 50 mg / kg 3 (If $$ read on the back of the ·: 5 Yiyi Shi Vf Jade: fill in the clothing page)

Table 20 Inhibition rates (%) of IL-1 / 5 production in mice challenged with carrageenan by 412f and 412d. Dose (mg / kg) Compound 412f Compound 412d 1 3 0% 0 10 54% 3 2% 25 49% [3 1% 50 73% 3 6% 100 75% 53% -510- The paper scale is applicable to S countries Standard rate (CNS) Λ4 now Luo (2 丨 0X29? Male, ¾) 1235157 Λ7 _B7__ V. Description of the invention (508) Example 2 1 ', Type II collagen-slandering arthritis in male DBA / 1J mice Collagen type II is pronounced against arthritis, such as Wooley and Geiger (Wooley, PH, Methods in Enzvmology, 162, pp. 361-373 (1988) and Geiger, T., Clinical and Experimental Rheumatology, 11, pp. 3 15-522 (1 993)) The 3 chicken sternal type II collagen (4 mg / kg in 10 mM acetic acid) was emulsified with an equal volume of FreuncTs complete filter (FCA) and was tied to two 10 ml glass syringes And the number 16 double-bobbin needle drawn repeatedly (400). After 21 days, mice were immunized with collagen white emulsion (50 microliters: 100 microliters (11 / rat)) intradermally at the opposite and lateral sides of the tail base. The drug was orally administered twice daily for about 7 hours. 3 The solvents used include ethanol / DEG / water, -Cyclopline, labrosol / water or cremophor / water. Drug treatment will be started within 2 hours of CII additional immunization. Record the inflammation on the two forefoot, and gradually increase the severity. Record 1 to 4 and accumulate the scores to get the final score. The results shown in Figures 12, 13 and 14 show that the prodrugs 412f, 412d and 696a can inhibit inflammation induced by collagen-induced arthritis after oral administration to mice. Compound 214e does not inhibit inflammation when administered orally once a day (50 mg / kg) Example 22: Determination of bioavailability in vivo Drugs were administered orally (10-100 mg / kg) to rats (10 ml / kg) in ethanol / DEG / water, cyclodextrin, labrosol / water or cremophor / water. Movement from the neck after 0.25, 0.50, 1, 1.5, 2, 3, 4, 6 and 8 hours after administration -511-The standard of this paper is applicable to the national standard of China (CNS) A4 Tige (210 X297) 7 1235157 Λ7 B7 Printed by the Consumer Cooperative of the Central Bureau of Sample Guidance of the Ministry of Economic Affairs Ⅴ 5. Description of the invention (509) Plasma was removed and stored at -7CTC until analysis. Enzyme analysis was used to determine the concentration. 3 RStrip (MicroMath Software, UT) was used for pharmacokinetic analysis of the data through nonlinear regression. 3 The bioavailability of the drug can be determined as follows: ( Prodrug AUC / drug iv · drug AUC) x (iv · dose / ρ · 〇 · dose) × ίοο%, the results in Table 21 show the prodrugs 412f, 412d, and 696a when σ is administered Significant blood levels of the drug are available and good drug utilization rates 3 Blood levels of 2 14e were not measured when taken orally. Table 2 1 -H2f '412d, 696a, and 214e rats oral bioavailability 3 Compound dosage (mg / kg) Cmax (μg / ml) Drug utilization (%) 4l2f 25 2.4 32 4l2d 25 2.6 35 696a 50 1.2 Γο 214e 45 0.2 0.9% Example 23

ICE dissociates and activates pro-IGIF ICE and ICE homologues express plastids 0.6 kb encoding a full-length mouse pro-IGIF cDNA (H. Okamuraetal., Nature, 3 78, ρ 88 (199 5) linked to a mammalian expression vector pCDLSR α (Y. Takebe et al., Mol. Cell Biol., 8, p. 466 (1988)) ^ In general, it encodes active ICE (above £) or three ICE-related enzymes TX, CPP32, and CMH -1, plastids in the pCDLSR pan-expression vector (3 micrograms), (C. Faucheu et al., EMBO, 14, p. 1914 (1995); Υ Gu et al., EMBO, 14, p. 1923 ( 1995); J. A. Lippke et al., J. Biol. Chem. · __ -512- Paper &amp; Standards Applicable to Shen Guo National Standard Li (CNS) A 'Specifications (2I0 a mm) (Please first% (Read the note of back cloud and fill in this book)

Λ7 1235157 · 37 V. Description of the invention (510) (Read the poem first, please recite the 5th. V! Italian matter, and then fill in too f) 271, p. 1825 (1996)) using the DEAE-right, caramel method (Y. Gu. Et al., EMBO J., 14, p. 1923 (1995)) transduced Cos cells in a 35 mm disc to a confluent monolayer. After 24 hours, the cells were lysed, and the lysates were subjected to SDS-PAGE and immunosucking, using antiserum specific to IGIF (H. Okamura et al., Nature, 378, ρ 88 (1995). Using polymerization The enzymatic chain reaction introduced Ndel positions at the ends and ends of the mouse pro-IGIF cDNA. He used the following primers: GGAATTCCATATGGCTGCCAT GTCAGAAGAC (forward) and GGTTAACCATATGCTAACTTTGATG TAAGTTAGTGAG (reverse). The resulting Ndel fragment was linked to the coliform at the Ndel position The expression contains pET-15B (Novagen) to generate plastids. The staff of the Central Bureau of Economic Affairs of the Ministry of Economic Affairs has cooperated with Du Yin. It can instruct the synthesis of 213 amino acid peptides. This peptide includes a peptide with 2 residues (MGSSHHHHHHSSGLVLVPRGSHM). (Where LVPRGS represents a thrombin dissociation site) is fused structurally to the N-song end of AU2 in pro-IGIF, which can be confirmed by tDNA sequencing and N-terminal sequencing of expressed proteins. Large intestine with plastids Strain BL21 (DE3) was induced with 0.8 mM isopropyl-1-thio- / 3-D-galactopyranoside at 37sc for 1.5 hours, recovered, and recovered in trace amounts ("Microfluidic, Watertown, MA ) In buffer solution A (20 Soluble in mM sodium bramate, pH 7.0, 300 mM Nal, 2 mM dithioisobutyridine, 10% glycerol, 1 mM phenylsulfonylsulfonyl fluoride, and 2.5 μg / ml leupeptin) 3 The lysate was centrifuged at 100,000 X g for 30 minutes to clarify 3, and then the Ni-NTA-sepharose (Qiagen) chromatography was used to clarify (H1S) and sieved pro-IGIF protein from the supernatant under conditions such as the manufacturer The proposed dissociation reaction within 3 dissociation reactions (30 microliters) contains 2 micrograms of purified pro-IGIF --- ·-—___ -513- '' s Chengwadu__ 11 National Counties (CNS) AUt Luo (Public plague of 10x: 97) 1235157 A7 B7 V. Description of the invention (511) and purified proteases in various concentrations, containing 20 mM Hepes, pH 7.2, 0.1% Triton X, 100, 2 mM DTT, 1 mM PMSF was reversed to 2.5 μg / ml Leupeptin in a buffer solution and incubated at 37 aC for 1 hour. The conditions for dissociation of granzyme B were as described previously (γ · Gu et ai ·, J. Biol · Chem., 2.71, p 10816 (1996)). The dissociated products were analyzed by SDS-PAGE and Coomassie blue staining on a 16% gel, and subjected to N-terminal amino acid sequencing. The ABI automated peptide sequencer was used under the conditions recommended by the manufacturer. Dynamics of ICE dissociation of IGIF The dynamic variables (kcat / KM, and kcat) of ICE dissociation of IGIF are determined as follows. Pro-IGIF labeled with 35S-methionine (3000 cpm, in vitro endoplasmic reticulocyte hemolysing system (Promega) and pro-IGIF cDNA in pSP73 vector as template) in 60 μl containing 0.1 to 1 riM recombinant Incubate with ICE and 190 nM to 12 // M unlabeled pro-IGIF in a reaction mixture at 371 for 8.10 minutes. SDS-PAGE and Phosphholmager analysis were used to determine the concentration of the problem-solving product. 3 The velocity versus concentration data was combined with the Michaelis-Menten flat- punch method using nonlinear regression with the program Enzifitter (Biosoft) to estimate dynamic variables. Induced by IFN-r analysis of A.E7 Thl cells (H. Quill) in a 96-well plate by the Kidney Cooperative Society of the Ministry of Economic Affairs of the United States of America and R. Schwartz, J- Immunol .. 138, p. 3704 (1987)) (1.3 x 10) cells in 0.1 5 ml with 10% FBS, 50 μM 2-mercaptoethanol and 50 units / ml IL-2 Click's medium) was treated with IGIF for 18-20 hours, and the culture supernatant was analyzed for INF-r (using ELISA (Endogen, Cambridge, MA)) 3 __ -514- This paper is in Chinese standard (CNS) ): U present (210X 297 mm) 1235157 Λ7 B7 V. Description of the invention (512) Example 24. ICE's consideration of pro-IGIF in Cos cells

Please read Min Yun's notes below and fill in this note. As in Example 23, Cos cells are transfected with various combinations of plastids. Transduced Cos cells (3.5 x 105 cells in a 35 mm orphan) Ml of methionine-free DMEM, containing 2.5% normal DMEM, 1% dialyzed embryonic bovine serum, and 300 microcurie / ml 35S-Expression Labeling-Mix, New England Nuclear 7 hours ο lysosomal product (prepared in 20 mM Hepes, pH 7.2, 150 mM Naa, 0.1% Tritox \, 100, 51111 \ 4 &gt; 1-ethylmaleimide, 11111 ^? ^^ ?, 2.5 μg / ml leucopeptin) or an adaptation medium that is immunoprecipitated with anti-IGIF antibodies, which can confirm the precursor and mature form of IGIF (H. Okamura et al., Nature, 3 78, ρ 88 (1995 )). Immunoprecipitated proteins were analyzed by SDS-PAGE (polyacrylamide gel electrophoresis) and fluorescence photography (Figure 2A).

The Ministry of Economic Affairs of the People's Republic of China. The staff of the Bureau of Consumer Cooperation Du Yin 5L We measured the IFN-r induction activity in the lysate and the adapted medium of transfected cells (Figure 2B) 3 Transduced Cos cells (3.5 X 1 (0) Sprint in 35 mm dish) and grow in 1 ml of medium for 18 hours. The culture medium was recovered and applied to the IFN-r induction analysis at a final dilution of 1:10 (Example 23). 3 Cos microspore masses from the same transduction effect were dissolved in 100 microliters of 20 mM Hepes, pH 7.0, and cold; -Solution; Dongda 3 times lysate was invented by centrifugation as described above, and applied to the analysis at a dilution factor of 1:10. Examples 25 ~ IGIF is the physiological type of wild type (ICE + / +) and ICE of ICE -Λ mice were given heat-inactivated P. acnes, and Kupffer cells were isolated from the mice 7 days after preparation and challenged with 1 -515- _ This paper is compliant with China National Standard (CNS) A4 (210X297 mm) 1235157 A 'B / V. Description of the invention (513) Micrograms / ml LPS over 3 hours. The amount of IGIF in the adjustment medium was detected by ELISA. Wild-type or ICE-deficient mice are injected intraperitoneally with heat-killed p. Acnes, as described in 4 (H. Okamura et al., Infection and Immunity, 63, p. 3966 (1955)). 3 KupfferM is ready after 7 days According to Tsutsui et al. (H. Tsutsui et al., Hepato-Gastroenterol., 39, p. 553 (1992)), the use of nycodenz gradient instead of metrizamide was agreed. In each experiment, Kupffer cells of 2-3 animals were pooled and cultured in RPMI 1640 supplemented with 10% embryonic bovine serum and 1 μg / ml LPS and conditioned medium for 3 hours before preparation. Kupffer cells from wild-type and ICE-1-rats were labeled metabolically with 35S-methionine, as Cos cells (as described in Example 24), except that RPMI 1640 without pyridine was used instead of DMEM. An IGIF immunoprecipitation experiment was performed on the lysate and the adapted medium. The immunoprecipitate was analyzed by SDS-PAGE and fluorescence photography, as described in Example 23. See Figure 3. Example 26: In vivo production of IFN-r produced by the Ministry of Economic Affairs of the China Bureau of Labor and Consumer Cooperatives, printed (please read the precautions of the cloud before filling in this I). LPS and 0.5% carboxymethyl fiber It was mixed in PBS, pH 7.4, and administered to Lao Xia via intraperitoneal injection (30 mg / kg LPS) at a dose volume of 10 mg / kg. The blood was collected every 3 hours for 24 hours. Or wild type mouse. Determine INF-r level in serum by ELISA (Eadogen) ° Example 27 ICIF and INF-r inhibition analysis -516- The standard of this paper is applicable § National Standard Ocean (CNS) A4 specification (210X29? Public) 1235157

7 7 A B V. Description of the invention (514) In the ICE inhibition analysis described herein, the inhibitory effect of ICE inhibitors on the repair of IGIF treatment is measured (see Example 1 and Table 22). Analysis of human PBMCs. The yellow layer of human gold solution. Known cells were obtained from donors, and peripherally separated into peripheral enterprise fluid mononuclear cells (PBMCs) in LeukoPrep tubes (Becton-Dick: inson, Lincoln Park, NJ). PBMC (Add to (3 X 106 / holes) 24 holes of Corning tissue culture plate, and incubate at 37 &quot; C for 1 hour, then remove the non-adherent cells by gentle washing. The adhered monocytes are treated with LPS (1 μg / ml) was stimulated in 2 ml RPMI-1640-10% FBS with or without ICE inhibitor. After incubation at 37 ° C for 16-18 hours, IGIF in the culture supernatant was quantified by ELISA For example, we can use the method described here to obtain the following data for compound 412 of the present invention. 3 The structure of compound 412 is shown below. Table 22 Compound UV-visible light K {(πΜ) Cell PBMC average IC50 ( niM) 412 1.3 580 Example 28 Printed by the Consumers' Cooperatives of the Ministry of Economic Affairs of the Ministry of Economic Affairs (please read the notes on the back 3 * to fill out the page) The compound of the present invention can be prepared by various methods. The following describes a preferred method ： -517- Applicable scale of this paper is the order of National Standard (CNS) A4 (210 X 297 healed) 1235157 AT B7 V. Description of Invention (515)

To a solution of A (1.1 equivalents) in CH2C12 (or DMF, or CH2C12: DMF (1: 1)) was added triphenylphosphine (0-0.5 equivalents), and a nucleophilic scavenger (200 equivalents). Triphenylphosphine) palladium (0) (0.05-0.1 equivalents) at an ambient temperature of an inert atmosphere (nitrogen or argon). After 10 minutes, the above reaction mixture was concentrated as needed, and then a paint solution of acid A-1 or A-1 in CH2C12 (or DMF or CH2C12: DMF (1: 1)) was added, followed by Η〇ΒΤ (1.1 equivalents) And EDC (丨 · 1 equivalent). The resulting reaction mixture is allowed to stir at ambient temperature for 1 to 48 hours to produce the coupling product CI or Cn. 3 The staff of the sample rate bureau in the Ministry of Economic Affairs and the cooperative society printed the disaster (please read the precautions for back cloud before filling in Ben \ Bei) Various nucleophilic scavengers can be used in the above process: Merzouk and Guibe, Tetrahedron Letters, 33, pp. 477-480 (1992); Guibe and Balavoine, Journal of Organic Chemistry, 52, pp. 4984- 4993 (1987)). Preferred nucleophilic scavengers that can be used include: bisone, morpholine, trimethylsilyldimethylamine and dimethylbarbituric acid. The better nucleophilic scavengers are trimethylsilyldimethylamine (20 equivalents) and dimethylbarbituric acid (500 equivalents). When the nucleophilic scavenger is trimethylsilyldimethylamine, the above reaction mixture must be concentrated, and then add A -1 or A -11 3 ^ _ -518 · Degree Applicable National Standard (CNS) Λ4 ^格 （： ι〇, &lt;: 9 · 公; ^ &quot; 1235157 Λ: Β7 V. Description of the invention (516) Other compounds of the present invention can be described in the following scheme. HI and H-II compounds:

〇

(Please read the precautions of Beiyun before filling in this one)

The Ministry of Economic Affairs, the Central Government Bureau, and the Consumer Co-operation of the Bureau. The SL hydrolysis can be performed under various conditions, as long as the files include acid and H20. Acids that can be used include para-methanesulfonic acid, methanesulfonic acid, sulfuric acid, perchloric acid, trifluoroacetic acid, and hydrogen acid 3 such as trifluoroacetic acid (90% by weight) or hydrogen acid (0.01%). 1-30 ° /. By weight) at (: 1130 ^ / 1120 (90% by 112% by weight), between 0-5 (TC, available). Example 29 Compound 213f, 213g, 213h, 213i, 213j, 213k, 213, 213m, 214f, 214g, 214h, 214i, 214j, 214k, 2141, 214m, 550f, 550g, 550h, 550i, 550j, 550k, 5501, and 550m can be prepared as follows. -519- Size of paper method Applicable to Chinese National Standards (CNS) Liu Xin Jian Luo (2 丨 〇 '<297 male cage 1235157 AT B7 V. Description of the invention (517)

550f-m, R1 = Et

(碕 元 翊 read the back of the cloud; V 〖I want to fill in this matter again I) Printed by the Consumers' Cooperatives of the China Prospective Bureau of the Ministry of Economic Affairs [15,95 (21 ^, 35)] 9-[(4-Diamine Amidino) amino] -6,10-diamidino-pyrene [l, 2-a] [l, 2] diazapyridine-1-carboxamide (213f), synthesized from 212f, The method of preparing 213e from 212e can generate 504 mg of 213f as a yellow solid, 1H NMR (CD3OD) d 1.10 (br · m, 0.25H), 1.30 (br · m, 2H), 1.50 (br. M , 1H), 1.65 (br. M, 1.5H), 1.80 (br. M, 0.25H), 1.90 (br · m, 0.25H), 1.95 (br. M, 0.5H), 2.05 (br. M, 0.25H), 2.15 (m, 1H), 2.3 (m, 1H), 2.5 (br. M, 1H), 2.6 (dd, 1H), 2.8 (m, 1H), 3.1 (bi *. S, 3H) , 3.15 (br · m, 1H), 3.32 (br. S, -520- This paper music scale is applicable to the Chinese national standard (CNS) A4 now (210X 297 mm) 1235157 A7 B7 V. Description of the invention (518) 3H ), 3.5 (m, 1H), 4.5 (br. M, 1H), 4 ', 62 (d, 0.25H), 4.72 (m, 3H), 4.95 (m, 1H), 5.1 (br. T, 0.25 H), 5.15 (br. T, 0.75H), 5.7 (d, iH), 6.75 (d, 2H), 7.35 (br. S, 5H), 7.75 (d, 2H) ^ [lS, 9S (2RS, 3S)] 9-[(3- 二 曱Amidino) amino] -6,10-diketo · 1,2,3,4,7,8,9,10-octahydro-N- (2-fluorenyl-5-one tetrahydrofuran- 3-yl) -6H-, pyracino [l, 2-a] [l, 2] diazapyridine-1-carboxamide (213g), synthesized from 212g, can be produced by the method of preparing 213e from 212e 400 mg of 213g, 4 NMR (CD3OD), 1.5 (br. M, 1H), 1.65 (br. M, 2H), 1.70 (br. M, 0.25H), 1.90 (br. M, 1H), 1.95 ( br. m, 1H), 2.05 (br. m, 0.25H), 2.10 (m, 1H), 2.3 (m, 1H), 2.5 (m, 2H), 2.59 (d · 1H), 2.6 (d, 1H) ), 2.78 (d, 1H), 2.8 (d, 1H), 2.93 (br · s, 4H) · 3.05 (br. M, 1H), 3.15 (br. M, 0.25H), 3.3 (br. s, 3H), 3.5 (m, 2H)? 4.5 (br. m, 2H), 4.65 (d, 1H), 4.7 (br · m, 2H), 4.95 (br. m, 1H), 5.15 (br · t, 0.25H), 5.2 (br · t, 0.75H), 5.2 (d, 1H), 6.95 (d, 1H), 7.15 (d, 1H), 7.25 (br · s, 1H), 7.3 (br. t, 2H), 7.45 (br: s, 6H). [1S, 9S (2RS, 3S)] 9-[(3-Ga-4-Aminoamido) amino] -6,10-diketo- &gt; 2 Ministry of Economy, Purine 31 Consumption Cooperation Du Yin ^ 1,2,3,4,7,8,9,10-eight rats-1 ^-(2- 卞 lactyl-5-copper four rats eat ran-»)-based) -61 · ! -Larcono [l, 2-a] [l, 2] diazepine-1-carboxamide (213h), synthesized from 212h, using the method of preparing 213e from 212e can generate 296 mg of 213h, 4 NMR (CDC13) 0 '1.55-1.68 (m, 1H ·), 1.7-2.05 (m, 3H), 2.3-2.5 (m, 2H), 2.65-2.8 (m, 1H), 2.85-2.93 (m, 1H ), 2.95-3.25 (m, 3H), 4.44-4.65 (m, 2H), 4.68-4.82 (m, 1H), 4.9 ^ 4.95 (d. 1H), 5.05-5.18 (m, 2H), 5.28 (s , 0.5H), 5.55-5.58 (d, 0.5H), 6.52- -521-This paper is applicable to Chinese National Standard Ocean (CNS) A4% grid (UlOx public holiday) ~ 1235157 __B7_ V. Description of the invention (519) 6.58 (d, 0.5H), 6.7-6.76 (m? 2H), 6.82-6.85 (d, 0.5H), 7.3-7.4 (m, 5H), 7.52-7.58 (m, 1H), 7.75 (s, 0.5 H), 7.8 (s, 0.5H). [1S, 9S (2RS, 3S)] 9-[(4-Methoxyfluorenyl) amino group 6,10-diketo-1,2,3,4,7,8,9,10- Octahydro-sense (2-fluorenyl-5-one tetraargylfuran-3-yl) -6 ^ 1-daphno [l, 2-a] [l, 2] diazafluorene-1-carboxyl Phenamine (213i), synthesized from 212i, and the method of preparing 213e using polonium 212e can generate 1.1 g of 213i, 4 NMR (CDCi3) δ 1.55-2.05 (m, 6H), 2.26-2.5 (m, 2H), 2.68- 2.82 (m, 1H), 2.85-2.92 (m, 1H)? 2.95-.325 (m, 2H), 3.82 (s? 1.5H), 3.85 (s, 1.5H), 4.4-4.65 (m, 2H) , 4.7-4.78 (m, 1H), 4.83-4.95 (m, 1H), 5.05-5.23 (m, 1H), 5.28 (s, 0.5H)? 5.55-5.58 (d? 0.5H), 6.6-6.65 ( m? 1H), 6.8-6.84 (m, 1H), 6.9-6.95 (m? 3H), 7.3-7.45 (m, 4H), 7.78-7.85 (m, 2H) ^ [13,95 (2115,35) ] 9-[(3,5-Diaziridinyl) amino] -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-N- (2 -Methoxy-5-onetetrahydrofuran-3-yl) -6H-da- [1,2-a] [l, 2] diazepine-1 · carboxamide (213j), synthesized from 212j, Using the method of preparing 213e from 212e, 367 mg of 213j, W NMR (CDC13) ^ 1.55-2.05 (m, 12H), 2.25 (d, 1H), 2.35 (m,

Printed by Xiaoxian Cooperative of Employees of Zhongli Standards Bureau, Ministry of Economic Affairs X 1H), 2.48 (m, 2H), 2.75 (m, 2H), 2.9 (m, 1H), 2.95-3.25 (m, 5H), 4.45 (t, IH ), 4.5-4.6 (m, 4H), 4.7 (m, 1H), 4.75 (d, 1H), 4.88 (m, 1H), 5.05 (m, 2H), 5.15 (q, IH), 5.3 (s, 1H), 5.58 (d. 1H), 6.5 (d, 1H), 6.9 (d, iH), 7.05 (d, IH), 7.25-7.3 5 (m, 5H), 7.6 (s, 2H), 7.7 ( s, 2H) ^ [15,95 (2115,35)] 9-[(3,5-Digas-4-hydroxyfluorenyl) amino group 6,10-diketo-1,2,3, 4,7,8,9,10-octahydro-: ^-(2-fluorenyl-5-ketotetrahydrofuran-3-yl) ___- 522-_ This paper is applicable to Chinese national standards (CNS) A4 gauge (2 丨 0X297 mm) 1235157 Λ 7 _Β7 ___ V. Description of the invention (520) -6H-Ka Teng and [l, 2-a] [l, 2] diazapine-1-carboxyl Amidine (213k), synthesized from 212k, and using the method of preparing 213e from 212e, 593 mg of 213k can be generated, lH NMR (CD3OD), 1.5 (m, 1Η), 1.6-1.7 (m, 2H), 1.75-1.95 ( m, 4H), 2.15 (m, 2H), 2.3 (m, 1H), 2.6 (m, 1H), 2.7 (m, iH), 3.05 (m, 2H), 3.15 (m, 1H), 3.5 (m , 2H), 4.45 (m? 2H)? 4.65 (d, 1H), 4.7 (m, 1H), 4.95 (m, 1H), 5.15 (m, 1H)? 5.4 (s? 1H ), 5.7 (d, 1H), 7.3 (m, 5H), 7.85 (s, 2H) ^ [lS, 9S (2RS, 3S)] 9-[(3-Ga-4-ethylamidino; fluorenyl ) Amino], 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-; (2- (2-oxooxy-one-tetrahydrofuran-3-) Base) -6Η- [2,2-a] [l, 2] diazapyridine-1-carboxamide (2131), synthesized from 2121, and produced from 212e by 212e, yielding 133 mg 2131 ^ lH NMR (CDCI3) δ 1.55-1.7 (m, 1H), 1.75-2.05 (m, 3H), Yin Chang, an employee of the China Standards Bureau, Ministry of Economic Affairs, Xiaoxian Cooperative (please read the intention on the back ^ Fill out this page again) 2.25 (s, 1.5 H), 2.27 (s, 1.5H), 2.3-2.48 (m? 2H)? 2.7-2.83 (m, 1H), 2.85 ^ 2.94 (dd, 1H), 2.95- 3.25 (m, 2H), 4.42-4.65 (m, 2H), 4.68-4.85 (m, 1H), 4.88-4.95 (m, 1H), 5.05-5.18 (m, 2H), 5.32 (s, 0.5H) , 5.55-5.6 (d, 0.5H), 6.48 ^ 6.55 (d, 1H), 6.88-6.92 (d, 1H), 7.0-7.04 (d, 0.5H), 7.15-7.2 (d, 0.5H), 7.3 -7.4 (m, 4H), 7.64-7.78 (m, 2H), 7.88 ^ 7.94 (m, 1H), 8.45-8.56 (m7 1H) ^ [15,95 (2 feet 5,3 5)] 9- [ (3,5-Digas-4-methoxyfluorenyl) amino] -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-; -(2-Methoxy-5 -Ketotetrahydrofuran-3-yl) -6H-, which is [1,2-a] [l, 2] diazapyrene-carboxamide (213m), synthesized from 212m, using 甴 212e The method for preparing 213e can produce 991 mg of 213m, lHNMR (CDCl3) d 1.5-2.15 (m, 5H), 2.2-2.55 (m, 3H), 2.6-3.3 (m, 4H), 3.95 (2s, 3H) ， 4.45-4.7 (m, 2H), 4.7- -523-The standard of this paper is applicable to Chinese National Standard Grass (CNS) A4 specification (210X 297 mm) 1235157 Λ7 B7 15. Description of the invention (521), 4.85 (m , 1H), 4.85-4.95 (mt 1H), 5.05-5.25 (m? 1H), 5.3 (s, 0.5H), 5.6 (d, 0.5H), 6.55 (d, 0.5H), 6.85 (d, 0.5H)? 7.0 (d? 0.5H), 7.25-7.6 (m, 5.5H), 7.75 (s, 1H), 7.85 (s? 1H) [lS, 9S (2RS, 3S)] 9-[(4 -Dimethylamino fluorenyl chain) amine 1 · 6,10 · monoketo-1,2,3,4,7,8,9,10-octahydro- Discussion- (2-ethoxy- 5-ketotetrahydrofuran-3-yl) -6 «^ Geng [1,2-a] [l, 2] Diazapyridine-1-carboxamidine (550f), synthesized from 212f, prepared using 甴 212e 213e method can produce 420 mg of 'jade

Doped with white solid, lH NMR (CDC13) d 1.2-1.25 (br · t, 3H), U (m, 1H), 1.55 (br. M, 1H), 1.88-2.02 (br. M, 4H), 2 · : (d, 1H) '2.35 (m, 1H), 2.45 (m, 1H), 2.55-2.75 (m, 3H), 3.0 (s, 6H), 3.25 (m, 1H), 3.55 ( m, 1H), 3.65 (m, 1H), 3.75 (m, 1H), 3.9 (m, 1H), 4.3 (t, 1H), 4.55 (m, 2H), 4.68 (bf · m, 1H) , 3.9 (m, 1H), 4.3 (t, 1H), 4.55 (m, 2H), 4.68 (br · m, 1H), 4.95 (br. M, 1H), 5.1 (br. M, 2H), 5.45 (d, 1H), 6.5 (m, 2H), 7.7 (m, 2H) ^ [15,95 (2115,3 5)] 9-[(3-Ga-4-aminofluorenyl) amino] -6,10-diketo-1,2,3,4,7,8,9,10-octahydro _: ^-(2-ethoxy-5-ketotetrahydrofuran-3-yl) -6 -»Answer [l, 2-a] [l, 2] diazepine-1-carboxamide (550h), synthesized from 212h, using the method of preparing 213e from 212e, can produce 195 mg of 550h, It was a white solid, 1H NMR (DMSO-d0) d 1.1-1.18 (2t, 3H), printed by the second consumer cooperative of the bureau of the Ministry of Economic Affairs. 1.6-1.7 (m, 2H), 1.88-2.05 (m, 2H) ), 2.1-2.5 (m, 3H), 2.48-2 · 56 (m, 1H), 2.75-2.8 (m, 0.75H), 2.88-3.08 (m, 1.25H), 3.25-3.4 (m, 1H), 3.55-3.8 (m, 2H), 4.35-4.45 (m, 1H), 4.55-4.62 (m, 1H), 4.8-4.88 (m, 1H ), 4.98-5.03 (m? 0.25H), 5.1-5.13 (m, 0.75H), 5.33 (s, 0.25H), 5.58-5.6 (d, 0.75H), 5.9-6.0 a National standard (CNS> A4 specification (210X297 mm) -524- _ 1235157 Λ7 _B7_ V. Description of the invention (S22) (br. s, 2H), 6.8-6.85 (d, 1H), 7.58-7, 62 (d, 1H), 7.82 (s, 1H), 8.22 ^ 8.28 (d7 1H), 8.48-8.52 (d, 0.75H), 8.72 ^ 8.76 (d, 0.25H) ^ [15,95 (2 feet 5, 35)] 9-[(4-methoxyfluorenyl) amino] -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-1 ^ ( 2-Ethoxy-5-ketotetrahydrofuran-3-yl) -6H-dapyrido [l, 2-a] [l, 2] diazapine-1-carboxamide (550m), synthesized from 212i, the method of preparing 213e with 甴 212e can generate 315 mg of 550i, lH NMR (CDC13) δ 1.18-1.28 (2t? 3Η), 1.6-1.75 (τη, 1.5Η), 1.9-2.1 (m, 3.5Η) , 2.22-2.3 (d, 0.5H), 2.38-2.47 (m, 1.5H), 2.7- 2.8 (m, 0.5H), 2.8-2.93 (m, 1H), 2.94-3.15 (m, 1.5H), 3.15-3.28 (m, 1H), 3.55-3.62 (q, 0.5H), 3.62-3.73 (q, 0.5H), 3.780.88 (q, 0.5H), 3.88 (s, 3H), 3.9-3.95 (q, 0.5H), 4.33-4.4 (m, 0.5H), 4.5-4.55 (m, 1H), 4.68-4.76 (m, 0.5H), 4.9-4.95 (m , 0.5H), 5.10.2 (m7 1.5H), 5.18 (s, 0.5H), 5.48-5.52 (d, 0.5H), 6.48-6.55 (d, 0.5H), 6.85-6.9 (m, 1H) , 6.9-6.95 (m, 2H), 7.34-7.38 (d, 0.5H), 7.78-7.85 (m, 2H) ^ Industry Consumer Cooperative Cooperative, Zhongli Standards Bureau, Ministry of Economic Affairs /-£ Please fill in the trr item I) [15,95 (21 ^, 3 5)] 9-[(3,5-Digas-4-hydroxyfluorenyl) amino group 6,10-dione N- (1,2,3,4,7,8,9,10-octaazepine-N- (2-ethyllactyl-5-carboxamidine * 7-furan-3 -yl) -6H- And [l, 2-a] [l, 2] diazepine-1-carboxamide (550k), synthesized from 212k, using the method of preparing 213e from 212e to produce 174 mg of 550k, as a white solid, lH NMR (DMSO-d6) J 1.15 (2t, 3H), 1.6-1.75 (m, 2H), 1.9-2.05 (m, 2H), 2.1-2.4 (m, 5H), 2.5-2.55 (m, 1H)? 2.7- 2.8 (m, 0.5H), 2.85-3.0 (m, 1H)? 3.0-3.1 (m, 0.5H), 3.55-3.7 (m, 1H), 3.7-3.8 (m, IH), 4.2 (t , 0.5H), 4.35-4.45 (m? 0.5H), 4.55-4.65 (m, 0.5H), 4.8-4.9 (m, 0.5H), 5.05 (t, 0.5H), -525-Paper scale In use National Standards (CNS) A4 specifications (210: &lt; 1 cm) 1235157 AT B7 V. Description of the invention (523) 5.15 (t, 0.5mm), 5.35 (s, 0.5mm), 5.6 (d, , 0.5H), 7.95 (s, 2H), 8.5 (d, 0.50), 8.65 (d, 1Η), 8.75 (d, 0.5Η), 10.9 (br ·· s, 1Η) . [1S, 9S (2RS, 3S)] 9-[(3-Ga-4-Ethylamidofluorenyl) calyl (^ Diamido-1,2,3,4,7,8,9 , 10-octahydro-1 ^-(2-ethyllactyl-5-nettetrahydroketra-3-yl) -6H-daphtho [l, 2-a] [l, 2] diazabenzene -1-Carboxamidamine (5501), synthesized from 2U1, and 2ne using osmium 2lZe, can produce 55 g of m gram, 1H NMR (CDC13) β 1.2, 1.28 (2t, 3H) , 1.6-1.72 (m, 1.5H), 1.88-2.15 (m, 3.5H), 2.22-2.28 (m, 0.5H), 2.28 (s, 3H). 2.38-2.48 (m, 1.5H), 2.66- 2.92 (m, 1.5H), 2.95-3.14 (m, 1.5H), 3.2- 3.34 (m, 1H), 3.56-3.63 (q, 0.5H), 3.63-3.72 (q, 0.5H), 3.8- 3.85 (q, 0.5H), 3.9-3.95 (q, 0.5H), 4.32-4.38 (m, 0.5H), printed by the Shellfish Consumer Cooperative of the China Standards Bureau of the Ministry of Economic Affairs ¾ {hold. Please fill in this item if you want to buy 1) 4.5- 4.62 (m, 1H), 4.68-4.75 (m, 0.5H), 4.88-4.92 (m, 0.5H), 5.08ο.2 (m, 1.5H), 5.18 ( s, 0.5H), 5.46 ^ 5.5 (d, 0.5H), 6.5-6.55 (d, 0.5H), 6.98-7.05 (m, 1H), 7.42-7.48 (d, 0.5H), 7.63-7.78 (m , 2.5H), 7.9-7.94 (d, 0.5H), 8.44-8.52 (m, 1H) ^ [15,95 (2 reverse 5,35)] 9-[(3,5- 二 气 -4- 曱Oxyfluorenyl) amino] -6 10-diketo-1,2,3,4,7,8,9,10-octahydro- &gt; 1- (2-ethoxy-5-ketotetrahydrocran-3-yl)- 6H-Da Geng and [l, 2-aHl, 2] diazapyrene-1-carboxamide (550m), synthesized from 212m, the method of preparing 213e using 甴 212e can produce 301 mg of 550m, as a white solid NMR (CDC13) β 1.2-1.35 (2t, 3H), 1.5- 1.8 (m, 2H), 1.9-2.15 (5H), 2.25 (d, 0.5H), 2.4-2.5 (m, 2H), 2.65-2.8 (m, 0.5H), 2.8-3.0 (m, 0.5H), 3.0-3.2 (m, 1H), 3.2- 3.35 (m, 0.5H), 3.55-3.65 (m, 0.5H), 3.65-3.75 ( m, 0.5H), 3.8- 3.9 (m, 0.5H), 3.9-4.0 (m, 0.5H), 4.4-4.45 (m, 0.5H), -526-Chinese paper standard (CNS M4) Present (210X297) 1235157 A7 _B7_ V. Description of the invention (524) 4.55-4.65 (m, 0.5H), 4.7-4.8 (m. 0.5Ή), 4.85-4.95 (m, 0.5H), 5.05- 5.2 (m, 0.5H), 5.2 (s, 0.5H)? 5.5 (d, 0.5H), 6.5 (d? 0.5H), 6.9 (d, 0.5H), 6.95 (d, 0.5H), 7.35 ( d, 0.5H), 7.75 (s, 1H), 7.85 (s, 1H). [3 5 (15,95)] 3- (9- (3,5-Diaziridinyl) amino] -6,10-diketo-1,2,3,4, 7,8,9 , 10-Octahydro-611-Da-Chen [1,24] [1,2] Diazapyridine-1-carboxamido) -4-ketoacetic acid (214j), synthesized from 213j, prepared using pyrene 2001 The method of 2002 can produce 62 mg of 214j as a white solid, lH NMR (CD3〇D), 0.9 (t, 1H), 1.3 (br · s, 1H), 1.7 (br. M, 1H) , 1.9 (br. M, 1H), 2.1 (br. S, 1H), 2.25 (q, 1H)? 2.35 (m, 1H), 2.48 (m, 2H), 2.65 (t, 1H), 3.15 (br t, 1H), 3.5 (br · m, 1H), 4.3 (br · s, 1H), 4.55 (m, 2H), 4.95 (t, 1H), 5.25 (br. s, 1H), 7.6 (br s, 1H)? 7.85 (br. s, 1H). [3 5 (15,95)] 3- (9- (3,5-Digas-4-hydroxybenzylfluorenyl) amino] -6,10-dione-1,2,3,4,7, 8,9,10-octahydro-611-dapyrido [1,24] [1,2] diazapyridine-1-carboxySIamino) -4-ketobutanoic acid (214k), synthesized from 213k, Using the method of 甴 2001 to prepare 2002, 80 mg of 214k can be generated, which is a white solid, 4 NMR (CD3OD), 1.6-1.7 (m, 1H), 1.8-2.0 (m, 2H), 2.0-2.1 (m, 2H), 2.15-2.25 (m, 1H), 2.3-2.4 (m, 1H), 2.4-2.55 (m? 2H)?

The Ministry of Economic Affairs, the Bureau of the Ministry of Economic Cooperation and Cooperation Du Yin X 2.6- 2.75 (m, iH), 3.05-3.2 (m, 1H), 3.4-3.6 (m? 2H), 4.2 ^ 4.3 (m, IH) , 4.45-4.6 (m, iH), 4.8-5.0 (m, 1H), 5.1-5.2 (m, 1H), 7.85 (s, 2H). [3S (1S, 9S)] 3- (9- (3-Ga-4-ethylamidoamidinyl) amino group 6,10-dione-1,2,3,4,7,8, 9,10-octahydro-61 ^ Da [1,24,1,2,2] diazepine-1-carboxyl-527-The paper * size is applicable to China National Standard (CNS) A4 Tillow (210 X297 Public thin) 1235157 Ministry of Economic Affairs, Ministry of Economics and Trade, Co-operation and Consumption Cooperation, Du Yin ¾ B7 V. Description of the invention (525) · Amido) -4-ketobutyric acid (214 〖), synthetic house 2131, using The method of 2001 and 2002 can produce 91 mg of 214 丨 as a white solid. 1H NMR (DMSO-d6) S 1.65 (br. M, 6H), 1.9 (br. M, 6H), 2.15 (s, 3H) , 2.3 (m, 3H), 2.6-2.85 (m, 3H), 2.9 (m, 2H), 3.0 (m, 1H); 4.15 (br. Q, 1H), 4.4 (m, 3H), 5.0 (m , 1H), 5.15 (m, 1H), 5.45 (s5 1H), 7.8 (d, 2H), 7.95 (d, 1H), 8.05 (s, 1H &gt;, 8.65 (m, 2H), 9.65 (s , 1H "[3S (lS, 9S)] 3- (9- (3,5 · Dichloro-fluorene · yl) amino] · 6,10-diketo · ι, 2,3, 4, 7,8,9,10-octahydro-6-da- [1,24] [1,2] diazepine-1-carboxamido) -4-ketobutanoic acid (214m), synthesis From 213m, using the method of 甴 2001 to prepare 2002, 105mg of 214m can be generated. White solid, β NMR (CD3〇D) δ 1.6-1.75 (m, IH), 1.85-1.95 (m, iH), 2.0-2.1 (m, 2H), 2.15-2.25 (m, 1H), 2.3-2.4 (m, 1H), 2.45-2.55 (m, 2H), 2.65-2.75 (m, 1H), 3.4-3.55 (m, 2H), 3.95 (s, 3H), 4.2-4.3 (m, 1H), 4.45 -4.6 (m, 1H), 4.90.0 (m &gt; 1H), 5.15-5.2 (m, 1H), 7.9 (s, 2H) a Compounds 308c and 308d were prepared as follows 3

O

_-528-The Chinese paper standard (CNS) 遴 4 is selected for this paper. Try 1235157 Λ7 B7 V. Description of the invention (526) [3S (lS, 9S)] 3- (9- (4 -Methoxy nodoxy) amino] -6,10-di'-1,2,3,4,7,8,9,10-octahydro-6'-dapyrido [l, 2-a ] [1,2] Diaza leather-1-induced amine-forming amino group) · Amino] -4-ketoacetic acid, 0-fluorenyl fatty acid (308c), synthesized from 212e, and 308b was prepared using 甴 212e Method, 266 mg of 308c'lH NMR (CDC13) 6 1.6-1.7 (m, 1H), 1.88-1.98 (m, 3H), 2.02-2.15 (m. 1H), 2.3-2.4 (m, 1H) , 2.65-2.95 (m, 3H), 3.04-3.09 (m? 1H)? 3.12-3.25 (m, 1H), 3.84 (s, 3H), 3.86 (s, 3H), 4.5-4.58 (m, 1H) , 4.88-4.95 (m, 1H), 5.1-5.25 (m, 2H), 6.86-6.9 (d? 2H), 7.15-7.25 (m, 2H), 7.36-7.4 (m, 1H), 7.75-7.8 ( d, 2H). [3 3 (15,95)] 3- (9- (4-methoxy; fluorenyl) amino] -6,10-dione-1,2,3,4,7,8,9,10 -Octahydro-6- &lt; 7A * Jing [1,2-wang] [1,2] diazepine-1-cavity) -amino] -4-ketobutanoic acid l 〇-fluorenyl oxime (300d), synthesized from 212e, using 212e to prepare 308b, can generate 308d, β NMR (CDC13) c? 1.55-1.65 (m, 1H), 1.8-2.1 (m, 4H), 2.3-2.4 (m, 1H), 2.65-2.88 (m, 3H)? 2.9-3.3 (m, 3H), 4.5-4.58 (m, 1H), 4.88-4.95 (m, 1H), 5.05 ( s, 2H), 5.10.2 (m, 1H), 6.82-6.95 (m? 2H), 7.02-7.15 (m, 2H), 7.28 (m, 5H), 7.45 (m, 1H), 7.72 (d, 2H) 3 Compounds 2100f, 2100g, 2100h, 2100i, and 2100j are prepared as follows 3 (Please read back the cloud first; ^ 意 事 \ ^ Continue to write a dog two shells) Binding and ordering by the Ministry of Economic Affairs, Associate Bureau staff Cooperative cooperative seal ¾ -529- The standard of this paper is free to use the national sample of China (CNS M4 specification (2 〖0 X 297mm) 1235157 A7 β V. Description of invention (527)

: Yin Chang (3S, 2RS), 3-allyloxycarbonylamino-2- (4-pyridyl) oxy-5-one tetrahydrofuran (2101a) , Synthesized from 晞 -Propoxy-amino-diodo-di-butylaspartate, using the method of Chapman rBioorg. &Amp; Med. Chem. Lett ,, 2, pp. 615-618 (1992)) Preparation of (3S, 2RS) 3-ene dioxocarbonylamino-2-octyloxy-5-ketotetrahydrofuran, and the use of 4-peranyl alcohol instead of fluorenyl alcohol can generate 2 · 101a of I · 84, which is crystal Like solid. [1S, 9S (2RS, 3S)] 9-benzylamido-6,10-diketonyl-1,2,3,4,7,8,9,10- octa-argon-N- (2- (4. Chlorofluorenyl) oxy-5-ketotetrahydrofuran-3-ylfluorene and [l, 2-a] [l, 2] diazafluorene-1-¾fluorenamine (2100f), synthesized from 212e 'use

The standard for this paper is the Chinese National Standard (CNS). Tigger (2 丨 0X2W mm) 1235157 Λ7 B7 V. Description of the invention (S2S) The method for preparing 213e from 212e can generate 2100f at 38 and 0 mg. (CDCI3) ^ 1.8-2.0 (m, 10H), 2.30 (d &gt; 1H) ^ 2.31-2.5 (m, 3H), 2.7-2.9 (m, 3H), 3.05 (m, 2H), 3.1.3 2 ( Melon, 々Η), 4.45 (q, 1H), 4.5-4.6 (m, 3H), 4.7 (d, 2H), 4.85 (d, iH), 4.9 (t, 1H), 5 : 2 (t, 1H), 5.15 (m, 2H), 5.25 (s, 1H), 5.55 (d, iH), 6.5 (d, 1H), 6.9 (d, 1H), 6.95 (d, 1H), 7.25 (m, 3H), 7.35 (t, 2H), 7.45 (m, 2H), 7.55 (1H), 7.8 (m, 3H). (3S, 2RS) 3-Allyloxycarbonylamino-2: contra-isopropoxy-5-one tetrahydrofuran (2101b), synthesized from (3S, 2RS) 3-allylfluorenylcarbonylaminofluorenyl -5-ketotetrahydrofuran, using the method of preparing 2100d from 214e, and replacing pTSA with H2S04 can generate 2101b. [13,95 (2113,33)] 9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-N- (2-pair Pendant-isopropoxyketotetrahydrofuran-3-yl) -6H-dapyrido [l, 2-ani, 2] diazapyridine-1-carboxamidine (2100g), synthesized from 212e, using 甴 212e The method for preparing 213e can generate 31 mg of 2 lOOg, 4 NMR (CDCI3) S 1.19 (d), 1.94 (br s), 2.00-2.12 (m), 2.24 (d), in the Ministry of Economic Affairs Bureau Consumer Consumption Du printed 2.42 (dd), 2.71-2.83 (m), 3.02 (dd), 3.12-3.27 (overlapping m), 3.93 (m), 4.32-4.37 (m,), 4.52-4.63 (m ), 4.90-4.95 (m), 5.12-5.20 (m), 5.28 (s), 6.93 (d), 7.10 (d), 7.41-7.50 (m), 7.51-7.58 (m), 7.84 (d)-

O

(Discuss ¥ -read the back-of-the-cloud;-1 note 4 fill in the present one) 214e -531 paper standard universal 3 national standard plum (CNS &gt; AKt grid (210 Λ 297 public celebration) 1235157 Λ7 B7 V. Invention Explanation (529) [1S, 9S (2RS, 3RS)] 9-benzylamido-6,10: diketo-i, 2,3,4,7,8,9,10-octahydro-N -(2-Ethyloxy-5-ketotetrahydro-3-anyl) -6pyridine [1,2-a] [l, 2] diazepine-1-carboxamidine (2100h), a solution of 214e (287 mg, 0.65 mmol) in pyridine (5 ml), treated with Ac20 (0.4 ml, 3.62 mmol). After 6 hours, the reaction mixture was poured into 5% NaHSOj It was extracted 3 times with EtOAc. The combined organics were washed with brine, dried over Na2S04, and concentrated under reduced pressure. 3 Chromatography (Si02, EtOAc) yielded 19 mg of 2100 h. Mixture of isomers) ά 1.80-2.05 (m), 2.12 (s), 2.13 (s), 2.19 (s), 2.22 (d), 2.67-2.75 (m), 2.80-2.95 (m), 3.00- 3.20 (m), 3.21-3.33 (m), 3.50-3.95 (4 separate multimodal), 4.19 (m), 4.55 (m), 4.57-4.65 (m), 4.69 (m), 4.85- 4.95 (m), 5.04 (m), 5.10 (s), 5.10-5.22 (m), 6. 46 (d)? 6.03 (s), 6.50 (d), 6.58 (d), 6.75 (d), 6.95-7.05 (m), 7.22 (m), 7.30 (m), 7.71 (d), 7.75-7.83 (m) «O 2100b

M ^ 部 也 -Fuchanda Bureau member Erxiao Cooperative Co., Ltd. [3S (lS, 9S)] 3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7 Ethyl, 8,9,10-octahydro-6H-da-co- [1,2-a] [l, 2] diazepine-p-carboxamido 1.4-copper ethyl butyrate (2l00i ). 2100b (1.5 g, 2.7 mmol) in a solution of CH3CN (10 ml) was added IE HC1 at ambient temperature. After 6 hours, solid NaHC03 was added, and the product was extracted with EtOAc on MgS04. Dry bath and 眞 -532-1235157 A 7 B7 V. Description of the invention (530) Concentrated in air. Chromatography (Si02, 30-100% CHiCl2 / EtOAc) can produce 123 mg of 2100i, β NMR (CDC13) d 1 · 25 (t, 3H), 1.6-1.8 (m, 1H) 2.9 · 2.2 (m, 5H), 2.4-2.5 (m, 1H), 2.75-2.9 (m, 2H), 3.0 ^ 3 ^ ^ 2H), 3.2-3.25 (m, 1H), 4.05-4.2 (m, 1H), 4.5-4.7 (m, 1H)? 5 u 5.25 (m, 1H), 7.0-7.2 (m, 2H), 7.4-7.45 (m, 2H), 7.5 (t, 7 · 8 (t, 2H), 9.5 (s, 1H).

O

-Equipped with [3S (lS, 9S)] 3- (9-benzylideneamino-6,10-diketonyl-1,2,3,4,7,8,9,10, octahydro-6H-Ka Pyrene [l, 2-a] [l., 2] Diazapyridine-1-carboxamido) -4-ethylwall gas • yl-3-butenoate ethyl ester (2100j), synthesized from 2100i Using 甴 2Ue to produce 2100h, 347 mg of 2100j, W NMR (CDCl3), 1.3 (t, 3H), 1.6-1.8 (m, 2H), 1.9-2.25 (m, 4H), 2 · 25 (s, 3H), 2.3-2.45 (m, 1H), 2.8-3.0 (m, 1H), 3.0-3.25 (m, 2H), 3.4-3.45 (m, 2H), 4.1-4.2 (m, 2H), 4.55-4.7 (m, 1H), 5.1-5.25 (m? 1H), 6.8 (s, IH), 7.0-7.1 (m, 2H), 7.5 (tvlH), 7.8 (t, 2H), 9.5 (s, 1H). Compounds 500 and 501 are described in Table 23. These compounds were prepared in a similar manner to compounds 404-449 (see Example 11). -533- The paper &amp; standard is applicable to the Chinese Garden Standard (CNS) A4 specification (2 丨 0: &lt; 297 mm). Ordered by the Ministry of Economic Affairs, Central Procurement Bureau, Staff Consumer Cooperatives Co., Ltd. 1235157 V. Description of the invention (

+ {Ηέ SS

(5 iron) ^ &lt; ki &gt; l DldH 3: 2 cus Consumption cooperation between employees of China Standards Bureau, Ministry of Economic Affairs

This paper is a permanent Chinese Standard (CNS) A4 standard (210x 297 mm). 1235157

V. Description of the invention (532) The following compound (213m &lt; 213n, 21, 30, 213p, 213 213s, 213t, 213u, 213v, 213w, 213x5. 214w;-Compound 213b-f is prepared in a similar manner to 3 compounds 419, 415, 450, 456, 475, 404, 486, 408, and 418 can also be prepared as follows: 2 1 3 r

YY \ 213r ^ x. 214w, 404, 408, 415, R1 Ο

Members of the Chinese Ministry of Foreign Affairs, China and the Western Bureau of the Second Anti-Poverty Cooperation: 5 ί printed 417, 418, 419, 450, 456, 475, 486, 487 Compound R1 213ιη ^ 419 MeOC (O)-213η, 415 CO1 535-this The size of the mark is applicable to the Chinese National Standard (CNS). A4 is present (210X29—mm). S Member of the Ministry of Economic Affairs and China ’s Tuda Bureau. 2 Consumption cooperation print. 1235157 Λ7 B7. 5. Description of the invention (533) 213〇, 450 0 HN M Ϊ 213ρ, 456 213q, 475 213r, 404 Μ · Ο 213s, 486 Η 213t, 487 Η 213u, 417 ΟΜβ (please read the first page on the back) ± Issue before filling in this page)-Binding 1 · -536 · Money &amp; Scale Applicable_National Standards (CNS) A ·; Now (： 10χ2π 公 没) 1235157

V. Description of the invention (534). ¾ Yinshang 213v, 408 213w, 214w 1 ^ 213x, 418 h, anj〇t ^ 员工 [1S, 9S (2RS, 3S)] Ν -(2 ·; oxy-5, yltetrahydro-squeeze% 〇 ′ nitrogen Η-diketone-9- (3,4-methoxydioxybenzylamino) -U2,3,4,7,8, 9, l〇; Tara [l, 2-a] [l, 2] diazabenzene-carboxamidine (2Πϋ), a mixture of isomers is separated (ipsilateral: contralateral Isomer ratio 6.4

G, 82%) was white solid: mp · 206-UTC; IR (KBr) 3288, 1787, 1680, 1657, 1651, 1619, 1548, 1440, 1256, 1 135; lHNMR (D6-DMSO) δ 8.75 ( 0.4H, d), 8.55 (0.6H, d), 8.45¾. 8.43 (1H, 2 xd), 7.50 (1H, d), 7.42 (1H, s), 7.40 · 7 · 27 (5H, m), 7.01 (1H, d), 6.11 (2H, s), 5.67 (0.6H, d), 5.43 (0.4H, s), 5.10〇.00 (1H, m), 4.90-4.59 (3.5H, m), 4.45-4.25 (1.5H, m), 3.47 ^ 3.20 (1H, m), 3.20-2.70 (2H, m), 2.65-2.35 (1H, m), 2.35-2.00 (3H, m), 2.00-1.75 ( 2H, m), 1.65] · 40 (2H, m) 3 Analysis of C29H3ON4409-537- This paper block size is applicable to China National Standard Ocean (CNS). Λ4 ^ grid (common) 1 — 1235157 Order of the Ministry of Economic Affairs ¾ Consumption Cooperation among Employees of Associate Bureau Du Yin Λ7 V. Description of Invention (535) Calculation: C, 60.20; H, 5.23; N, 9.68. Found 値: C, 60 · 08; H, 5.32; N, 9.50. MS (ES +) 580 (M + + 2, 35%), 579 (M + +1, 100), 404 (5), 367 (5), 236 (7), 107 (5 ”[1S, 9S (2RS, 3S)] 9-[(3-Ethylamido) amido] -N · (2-methoxyoxy-O-tetrahydroazetidin-3-yl) -6,10-di S3 radical. 1,2,3,4,7,8,9,10-octahydro-6H-pyrene and [l, 2 · a] [l, 2] diazapyrene-l-carboxamide ( 213o), para-isomer as a white foam solid (0.73 g, 69%): mp. 135-4 (TC; | &gt;) D2i -37 · 35 (c 0.1, CH2Ci2); IR ( KBr) 3452, 3310, 1790, 1664, 1659, 1650, 1549, 1425, 1258, 1 121; LH NMR (D6-DMSO) ά 10.H (1H, s), 8.77 (1H, d), 8.57 (1H , d), 8.01 (1H, s), 7.76 (1H, d), 7.55 (1H, d), 7.45-7.25 (6H, m), 5.43 (1H, s)? 5.08-5.00 (1H, m), 4.95-4.73 (1H, m), 4.76 and 4.68 (2H, dd), 3.40-3.20 (1H, m), 3.09 (1H, dd), 3.02-2.75 (1H, m), 2.45-2.06 (4H, m ), 2.06 (3H, s), 2.00-1.75 (2H, m), 1.70-1.40 (2H, m). Analysis of the calculation of C30H33N5Os · 0.75H2O 値: C, 59.54; Η, 5.75; N, 11.57. Measured 値: C, 59.40; H, 5.62; N, il. 50 ^ MS (ES +) 593 (M + + 2, 33%), 592 (NT + 1, 100), 574 (7), 487 (7 ), 475 (6), 385 (9), 373 (26), 318 (14), 296 (11), 266 (10), 221 (22). [1S, 9S (2RS, 3S) 1 Ν- ( 2. · Ethoxy-5-ketotetrahydrocran-3-yl) -6,10-diketo-9- (4-hydroxyfluorenyl) amino-1,2,3,4,7 , 8,9,10-octahydro-6! ·!-^ Gong [1,2-a] [l, 2] Diazapyridine-1-carboxamide (213p) was isolated as a foam ( 1.2 g, 77%) D20-115. (C 0.20, CH2C12); IR (KBr) 3368, 2946, 1794, 1654, 1609, 1540, 1505, 1421, 1277, 1 175, 1 1 19, 980; 1H NMR (D6-DMSO) δ 10.1 (1H, s), 8.80 (0.5H,-538-The standard of this paper is applicable to the national standard of China (CNS) A4 (2 丨 OX 297 mm) — (Please read the precautions of the back © before writing this page) ), Installed-'δ 1235157 A7 _B7_ V. Description of the invention (S36) Printed by the Central Consumers Cooperative Bureau of the Ministry of Economic Affairs (Please read the notes on the back before filling in this f) d? J = 6.6), 8.60 ( 0.5H, d, J = 7.2), 8 ^ .40-8.36 (1H, 2d). 7.82 (2H, d, J = 8.0), 7.41 (5H, bs), 6.86 (2H, d, J 8.6), 5.72 (0.5H, d, J = 5.0), 5.49 (0.5H, bs), 5.13-5.07 (1H? M), 4.95-4.65 (2.5H, m), 4.49-4.38 (2.5H, m)? 3.49 -3.30 (2H, m), 3.21, 2.79 (2H, m), 2.40-1.41 (7H, m). MS (ES +) 55, [1S, 9S (2RS, 3S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo · 9- (4 indole- 2-methylamido))-1,2,3,4,7,8,9,10-octahydro-61 * 1 ^ pyridino [l, 2-a] [l, 2] diazapine · 1-Carboxamide (213q), white glassy solid was isolated (80%): mp. 145-149Ό; [α] Ό23 〇6.03 (c 0.05, CH2C12); IR (KBr) 3399-3319, 1791 , 1657, 1543, 1420, 1253, 1119; lH NMR (CDCI3) ά 9.54 (1H, s), 7.65 (1H, d, J = 7.9), 7.51 (1H, d, J = 6.9), 7.44- 7.25 (7H, m), 7.18-7.06 (3H, m), 5.30-5.20 (IH, m), 5,27 (1H, s), 4.84 (1H, m), 4.79 (1H, d , J = il.4)? 4.56 (1H, d, J = 11.3), 4.47 (2H, m), 3.28 (1H, m), 3.10-2.97 (2H, m), 2.71 (IH, m), 2.47 -2.37 (1H, m), 2.26 (1H, d, J = 17.9), 2.09 (1H, m), 1.83, 1.70, 1.51 (4H · 3m). [1S, 9S (2RS, 3S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo · 1,2,3,4,7,8, 9,10-octahydro-9- (2-toluidinemethylamino) -6 ^!-Daphtho [l, 2-a] [l, 2] diazepine small carboxamide (213r), The mixture in the diastereoisomeric form was separated (isotope: ratio of the opposite isomers 5 5: 4 5), as a white foamy solid (1.46 g, 89%): mp. 106-1CTC; IR ( KBr) 3306, 2947, 1791, 1659, 1650, &quot; 35, 1421, 1256, U22; 4 NMR (D6-DMSO) (y8.76 (0.45H, d), 8:56 (0.55H, d ), 8.49 and 8.47 (1H, 2 xd), 7.41-7.19 (9H, m), 5.67 (0.55H, d), 5.43 -539- This standard is commonly used in the SS family standard (CNS) A4 Luo Luo ( 2 丨 〇 乂 巧 7 公 笼> 1235157 Λ7 _B7____ V. Description of the invention (537) (0.45H, s), 5.11-5.02 (1H, m), 4.86-'4.55 (3.5H, m)? 4.45 ^ 4.25 (1.5H, m), 3.40-3.20 (1H, m), 3.20-2.70 (2H? M), 2.65-2.40 (1H, m), 2.34 (3H, s), 2.30-1.70 (5H, m), 1.65-1.40 (2H, m) ^ Analysis of the calculation of C29H32N407 C: C, 62 · 66; Η, 5.95; N, 10.08 3 Measured 値 · C, 62.91; H, 6.00; N, 9.70, MS (ES +) 550 (M + + 2, 43%), 549 (M + + 1,100), 374 (3), 280 (4), 279 (20), 118 (5) 3 [1S, 9S (2RS, 3S)] N- (2-fluorene oxygen Methyl-5-ketotetrahydrofuran-3-yl) -6,10-monofluorenyl-1,2,], 4,7,8,9,10-octagas-9- (4- (benzylethyl) Amine group] 卞 donkey amino group] -61 ^-»A * 1 and [1,2-3] [1,2] Diargin-1-guinea-2 produces amine (2135), which is contralateral-iso The structure was isolated as a white foamy solid (0.64 g, 77%): mp. 137-4TC; [a] D2 {-48.2 ° (c 0.05, CH3OH); IR (KBr) 3477, 3314, 1791, 1659, 1599, 1529, 1499? 1406, 1256, 1 122; lH NMR (D6-DMSO) ά 10.45 (1H, s), 8.76 (1H, d), 8.50 (1H, Ministry of Economic Affairs, China. Prospective staff Printed by Consumer Cooperatives (please read the precautions for νί back cloud before writing 4 f) d), 7.86 (2H, d), 7.69 (2H, d) t 7.41 ^ 7.20 (10H, m), 5.43 (1H, s ), 5.08-4.98 (1H, m), 4.90-4.73 (1H, m), 4.76 and 4.68 (2H, dd), 3.67 (2H, s), 3.40-3.20 (1H, m), 3.09 (1H? Dd ), 3.02-2.75 (1H, m), 2.39 (1H, dd), 2.30-2.00 (3H, m), 2.00-1.75 (2H, m), 1.70-1 · 40 (2H, m). Analyze the calculation of C36H37N5O8.0.5H2O 値: C, 63 · 90; H, 5.66; N, 10.35. Measured 値: C, 63.68; H, 5.67; N, 10.24, MS (ES +) 669 (M + + 2, 40%), 668 (M + + 1,100), 640 (12), 435 (18), 425 (23), 403 (33), 328 (17), 302, (32), 274 (22), 197 (16), 138 (17) ^ [1S, 9S (2RS, 3S)] N- (2 -^ Oxy-5-copper-based tetrahydrocyclopentadiene-3-yl) -6,10-diamidino-9- [4- (3-methylbutane-1-methylamido) pyridine Kibí, 2,3,4,7, ___ -540- This or S scale is applicable to the national standard 隼 (C. \ S) 焱 4 (21ΰχ 297 公 苍) 1235157 Λ7 B7 V. Description of the invention ( 538) Please read the notes on the back first and then fill in% Taiji 8,9,10-octahydro-61 ^, answer [1,24] [1,2], diazapyridine-: 1-carboxypyridine Press (213〇, white foamy solid (0.63 g, 80%): mp. 159 «C; 〇] D] i -37.0 ° (c 0.05, CH3OH); IR (KBr) 3463, 3321, 1790, 1680 , 1658, 1650, 1644, 1595, 1525, 1501, 1408, 125i? 1 1 13. 933; 1H NMR (D6-DMSO) ά 10.13 (1H, s), 8.76 (1H, d), 8.48 (1H, d ), 7.85 (2H, d), 7.68 (2H, d), 7.40-7.25 (5H? M), 5.43 (1H, s), 5.08-4.95 (1H, m), 4.92 · 4 · 73 (1H , M), 4.76 and 4.68 (2H, dd ), 3.40-3.20 (1H, m), 3.09 (1H, dd), 3.02-2.75 (1H, m), 2.39 (1H, dd), 2.35-2.00 (6H, m), 2.00-1.75 (2H, m ), 1.70-1.40 (2H, m), 0.93 (6H, d) 3 Analysis of the calculation of C33H39N5O8-0.5H2O 値: C, 61.67; H, 6.27; N, 10.90. Measured 値 ·· C, 61 · 49; H , 6.24; N, 10.86. MS (ES +) 635 (M + + 2, 39%), 634 (M + + 1,100), 484 (10), 427 (9), 274 (18), 268 (37), 204 (19), 117 (13). [1S, 9S (2RS, 3S)] N- (2-; oxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-l, 2,3,4,7,8, 9,10-octahydro-9- (3,4,5-trimethoxyfluorenylamino) · 61 + * and [1,2-wang] [1,2] diaza leather-1-gui 8 Amine production (21311), white solid gift (81%): mp. 120-132 ° C; IR (KBr) 3361-3334, 1792, 1659, 1585, 1536, 1499, 1457, 1416, 1340, 1236, 1 126, 989; lH NMR (CDCi3) (ί 7.39-7.29 (6H, m), 7.12 (1H, s), 7.03 (1H, s), M. Probationary Bureau of the Ministry of Economic Affairs of the People's Republic of China, second consumer cooperation printing 6.92 , 6.83T 6.48 (approx 3H, 3d, J = 8.1, 7.5, 8.1), 5.57 (d, J = 5.3), 5.27 (1H, s), 5.23-5.06, 4.91-4.71, 4.64-4.43, (6H, 3m), 3.92, 3.91, 3.89, 3.88 (9H, 4s), 3.32-2.70, 2.52-2.08, 1.91, 1.63 (1H, 4m). [1S, 9S (2RS, 3S)] N- (2-; oxygen Methyl-5-ketotetrahydrofuran-3-yl) -6,10- -541-This paper uses three Chinese standards (CNS> A4 size (2I0X 297 mm) for paper size inversion) Two consumer cooperation Du Yin ¾ 1235157 Λ7 _B7__ V. Description of the invention (539) Diketo-9- (fluoren-1-methylamido) -1, 2, 3, 4, 7, 7, 9, 10, 10- Octahydro-611-Winter Pyrene [1,24] [1,2 】 Diazapyridine-1-carboxamide (213 fluorene, white solid (78%): mp. 121-7 121; IR (KBr) 3534-3331, 1791, 1659, 1528, 1420, 1256, 1122; lH NMR (CDC13) ό '8.34-8.29 (1H, m), 7.98-7 · 87 (2H, m), 7.68-7.45 (4H, m), 7.34-7.24 (5H, m), 7.04 (d, J = 6.8), 6.78 (d, J = 7.8), 6.66 (d, J = 7.7), 6.48 (2H, d, J = 7.5)? 5.56 (d, J = 5.4), 5.15 (iH, s), 5.30-5.14, 5.0? 4.89 (d, J -il.2), 4.71-4.41 (6H), 3.18-2.80, 2.50-2.27, 2.08 ^ 1.60 (11H? 3m ”[1S, 9S (2RS, 3S)] N- (2-; oxy-5-ketotetrahydrocran-3-yl) -6,10-diketo-9- (4-hydroxy-3,5-difluorenylbenzyl) amine Yl l, 2,3,4,7, S, 9,1C ^ octahydro-6 and benzophenone [l, 2-aΠl, 2] diazepine-: l-carboxamide (213w), It is a mixture of non-epicyclic stereoisomers (65/35) and white solid (0.9 g, 65%): mp. 110-115'C (decomposition): IR (KBr) 3409, 2945, 1792, 1658 , 1606, 1534, 1486, 1420, 1330, 1276, 1209, 1 122? 980, 960; lH NMR (CDCi3) ^ 7.66 (0.35H, d? J = 6.9), 7.46-7.20 (7H, m), 6.93 (0.35H, d, J = 7.7), 6.85 (0.65H, d, J = 7.6), 6.73 (0.65H, d , J = 7.6), 5.96 (0.35H, bs), 5.85 (0.65H. Bs), 5.56 (0.65H, d, J = 5.2), 5.28 (0.35H, bs), 5.20-4.98 (2H, m) , 4.96-4.40 (4H, m), 3.28-2.55 (3H, m), 2.53-2.32 (1H, m), 2.23 (6H, 2s), 2.03-1.40 (7H, m), MS (ESJ 577, ( ES +) 579, [1S, 9S (2RS, 3S)] 9- [4- (Ethylamido) amido] -N- (2-Methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6'-daphno [l, 2-a] [l, 2] diazabenzene -1-Carboxamide (213x), colorless powder-542- This paper is a universal t S national standard (CNS M4 is present (210 X: ^ 7 mm) (please read the scum on the back first) Fill out this f-binding 1235157 V. Description of the invention (540) (691 mg, 86%): mp. 150-7 (TC: {w] D21 -10.1 ° (c 0.10, Me2CO); IR (KBr) 33 13, 1 791, 1679, 1654, 1597, 1528, 1501, 1457, 1407, 1371, 13 15, 1255, 1 184. 1 122, 933; lH NMR (d6-DMSO) S 8.75 (1H, d), 8.47 (1H d), 7.84 (2H, d), 7.66 (2H, d), 7.35 (5H, m), 5.43 (1H, s), 5.06〇.00 (1H, m), 4.90-4.64 (3H, m) , 4.46-4.26 (2H, m), 3.16-2.86 (2H, m), 2.45 · 2.05 (5H , m), 2.07 (3H, s), 2.0- 1.84 (2H, m) 1.68-1.56 (2H, m); Analysis of the calculation of C30H33N5O3.H2O C C, 59.11; H , 5.79; N, 11.49 a Found 値: C, 59 · 38; H, 5.66; N, 11.31; MS (ES +) 614 (100%), 592 (M ++ 1.66), [3S (1S, 9S )] 3 [[6,10-Diketo-9- (3,4-methoxydioxyamido)] 1,2,3,4,7,8,9,10-octahydro-611 -Tong Geng and [1,24] [1,2] diazapyrene-carboxamido] -4-ketobutyric acid (415), which is prepared by a method of bismuth-like 214e compound, can produce a white solid ( 297 mg, 84%): mp. 158-62'C; [a] D24 • 109.5. (C 0.1, CH3OH); IR (KB〇3700-2500 (br), 1 783, 1659, 1650, 1538, 1486, 1439, 1257, 1037; 1H NMR (CD3OD) 7.48 (1H, dd), 7.35 (1H , d), 6.88 (1H, d), 6.03 (2H, s), 5.25-5.15 (1H, m), 5.02-4.90 (1H, m), 4.63-4.45 (2H, m), 4.30-4.20 (1H , m), 3.57-3.30 (1H, m), 3.20-3.05 (1H, m), 2.75-2.10 (5H, m), 2.10-1.60 (4H, m) ^ MS (ES-) 488 (M +, 25 %), 487 (M + -1, 100), 443 (8), 387 (3), 315 (5), 150 (6), 127 (5), 113 (8). Accurate mass calculation of CnH25N409 (MH +)値 ·· 489.1621. Measured 値 489.1648. [3S (1S, 9S)] 3- {9-[(3-Ethylamido) carboxamido] -6,10-diketo- -543-Paper Le scale it uses the Ningguo national standard (CNS M4 is now (2 丨 0X29).) Irk should write the name of the owner and buy the printed materials of the China Consumer Goods Cooperatives Bureau of the Ministry of Economic Affairs 1235157 Λ 7- _Β7 .___ V. Description of the invention (541)-1,2,3,4,7,8,9,1〇-Yaegei-611-Volume and [1,2,2-21] [1,2] Diqi Hetero-1-caproamido-4-ketobutyric acid (450) was prepared in a similar manner to compound 2Ue, yielding a white foamy solid (378 mg, 94%) : mp · 175-9X :; [a] D22 -91.7 ° (c 0.1, CH3OH); IR (KBr) 3700-2500 (br), 33 19. 1659, 1590, 1553, 1427, 1260; lH NMR (CD3OD ) ^ S.01 (1H? D), 7.74 (1H, dd), 7.58 (1H, d), 7.45 ^ 7.35 (1H, m), 5.25-5.15 (1H, m), 5.05-4.90 (1H, m ), 4.60-4.45 (2H, m), 4.30-4.20 (1H, m), 3.55-3.3 * 0 (1H, m), 3.20-3.00 (1H, m), 2.75-2.20 (5H, m), 2.14 (3H, s), 2.20-1 · 60 (4H). Analyze the calculation of C23H27N508 · 1.5 · 20Η C, 52.27; H, 5.72; N, 13.25. Measured 値 C, 52 · 31; H, 5.86; N, 12.85, MS (ES +) 501 (M +, 26%), 500 (NT-1, 100), 328 (2), 149 (3), Π3 (3 ) 3 [3S (1S, 9S)] 3- [4- (hydroxyfluorenyl) amino] -6,10-diketo-1,2.3,4,7,8,9,10-octaargon- 6H-Da [1,2-ani, 2] diazepine · 1-carboxyamido] -4-ketobutanoic acid (456), prepared in a similar manner to compound 214e, can produce a white solid ( 0.73 g, 72%) ·· mp · &gt;260eC; 〇] D20 -66c (c 0.34,

MeOH); IR (KBr) 3401, 2946, 1651, 1584, 1506, 1426, 1277, 1257, 1177; lH NMR (D6 ^ DMSO) S 10.2 (1H, very bs) r 9.17 (1H, bs), 8.65 ( 1H, s), 8.37 (1H, d, J 5.4), 7.81 (2H, d, J = consumer cooperation between employees of China Economic and Trade Bureau, Ministry of Economic Affairs. Du Yin ¾ 8.2), 6.87 (2H, d, J = 8.4) , 5.24 (1H, m), 4.92-4.86 (1H. M), 4.41-4.32 (2H, m), 3.68-3.21 (3H, m), 3.12-2.79 (lH, m), 2.50-1.42 (7H, m). MS (ES +) 459. [3S (1S, 9S) 3- [6,10-diketo-9- (indole-2-carboxamido) -1,2,3,4,7,8,9,10-octahydro -6H-plow farming and [l, 2-a] [l, 2] diazapyrene-bu residue amine] -4- -544-scale applicable to Chinese National Standards (CNS) A4 (210X 297) (Mm) _ 1235157 Consumer cooperation between China and China Bureau of the Ministry of Economic Affairs, Du Yin disaster Λ7. B7 V. Description of the invention (542) Ketobutyric acid (475), prepared by a method similar to compound 214e, can produce a white solid (79 %): mp · 150Ό (transformation) 190-210 ° C; [to] 〇23 .97 5: (c 0.1, CH3〇H); IR (KBr) 3319, 1658, 1650, 1549, 1421, 1256; lH NMR (CD3OD) δ 7.61 (1H, d, J = 8.0), 7.43 (1H, dt J = 8.1), 7.21 (2H, m), 7.05 (1H, m), 5.21 (1H, m), 5.07-4.77 (1H, m)? 4.54 (2H, m), 4.23 (1H, m), 3.46 (1H, m), 3.14 (1H? M), 2.66-1 · 71 (9H, m). MS (ES 'm / z), 482 (M, 1, 1000/0) 3 [3S (1S, 9S) 3- [6,10-diketo-1,2,3,4,7 , 8,9,10-octa-argon-9- (2-toluidineamido) -6H-dapyrido [l, 2-a] [l, 2] diazapyridine-1-carboxamido 4. Ketobutyric acid (404), prepared by a method similar to compound 214e, can produce a white solid (0.79 g, 86%): mp · 156-9 ° C; 〇] D25-ΐΐ9 · 7: (c 0.1 , CH3OH); IR (KBr) 3700-2500 (br), 3387, 3309, 2956, 1785, 1659, 1650, 1535, 1422, 1278; lH NMR (CD3OD) ά 7.46-7.15 (4H? M), 5.25- 5.15 (1H, m), 5.02-4.90 (1H, m), 4.58-4.45 (2H, m), 4.30-4.20 (1H, m), 3.55-3.30 (1H, m), 3.20-3.05 (1H, m ), 2.80-2.20 (4H, m), 2.41 (3H, s), 2.20-1.60 (5H, m) 0 MS (ES ^) 458 (M ten, 27%), 457 (M +-1,100), 413 (13), 339 (8), 285 (5), 134 (6), 127 (11). Accurate mass calculation for C22H27N407 (MH +) 値: 459.1880. Found 値 459.1854. [3S (1S, 9S) 3- [6,10 · diketo-1,2,3,4,7,8,9,10-octahydro-9- (4- (benzylacetamido)) Amido] -6Η-daphne [l, 2-a] [l, 2] diazapyrene-u-chipinamino] -4-ketobutanoic acid (486), similar to that of compound 214e Prepared by the method to produce a white solid (325 mg, 89%): mp. 165-9'C; [] 〇22 -69.1 ° (c 0.1, CH3OH); IR (KBr) 3700-2500 (br), 33 18 , 1658, -545- General standard of Chinese standard plums (CNS &gt; A4 size (210X297 gong)) ~ (please read the back of the ©© Notes before filling in this book) Binding 4 1235157 A / B7 V. Description of the invention (543) 1599, 1530, 1505, 1407, 1258; lH NMR (CD3OD) ά 7.85 (2H? D), 7.69 (2H, d), 7.38-7.20 (5H, m), 5.25-5.15 ( 1H, m), 5.05-4.90 (1H, m), 4.57-4.45 (2H, m), 4.30-4.20 (1H, m), 3.70 (2H? S), 3.55-3.30 (1H, m), 3.20- 3.00 (1H, m), 2.75-1.60 (9H, m) ^ Analyze the calculation of C29H31N508 * 1.5H20 値: C, 57.61 ;, H, 5.67; N, 11.58. Measured 値: C, 57.81; H, 5.74 N, 11.47. MS (ES +) 577 (M +, 33%), 576 (M +-1,100), 502 (2). [3S (1S, 9S) 3- {6,10-diketo- 9- [4- (3-methylbut-1-fluorenylamino) fluorenamine] -1,2,3,4,7,8,9,10-octahydro-611-da-benzo [ 1,24] [1,2] Diazapyridine-1-carboxamido] -4-ketobutanoic acid (487), prepared in a similar manner to compound 214e, can form a white foamy solid (335 mg, 93 ° / 〇) ·· mp · 176-80'C; [α] Ό22 -88.0 '(c 0.1, CH3OH); IR (KBr) 3700-2500 (br), 3321, 2960, 1781, 1660, 1597, 1529 , 1407, 1258, 1187; lH NMR (CD3OD) δ 7.86 (2H, d), 7.69 (2H, d), 5.25o.l5 (1H, Ministry of Economic Affairs, Bureau of Samples, Work and Consumption Cooperation Du Yin ¾ ( Please read the precautions of vB before filling in this purchase) m), 5.05-4.90 (lH, m), 4.60-4.45 (2H, m), 4.30-4.20 (1H, m), 3.57-3.30 (1H, m ), 3.20-3.00 (1H, m), 2.75-1.60 (12H, m), 1.00 (6H, d). Analyze the calculations for C26H33N503.H20: C, 55.61; H, 6.28; N, 12.45 3 Found: C, 56 · 00; H, 6.37; N, 12.15. MS (ES +) 543 (M +, 31%), 542 (M +-1, 100), 498 (2), 468 (3) 〇 [3S (1S, 9S) 3- (6,10-diketo-1 , 2,3,4,7,8,9,10-octahydro-9- (3,4,5-trimethoxyfluorenylamino) -6H ^ Aza [Halt1,2] diaza leather -1-Carboxamidinyl] · 4-ketobutyric acid (417), prepared in a similar manner to compound 214e, can produce a white solid (0.63 g, 92%): mp · 145-155 ° C (about 値, Not clear): [戌] D27 -114.6. (C 011, CH3〇H); IR (KBr) 3327, 1658, -546- The standard of this paper is applicable to China National Standard (CNS) A4 (2 丨 0x 297) Male thin ^ 1235157 A7 B7 V. Description of the invention (544) 1586, 1548, 1501, 1416, 1341, 1238,, 1126; iHNMR (CD3〇D) ά 7.22 (2Η, s), 5.21 (1H, m), 5.00 (1H, m), 4.56, 4.49 (2H, 2m), 4.25 (1H, m), 3.88 (6H, s), 3.80 (3H, s), 3.55 ^ 3.43 (1H, m), 3.12 (1H, m), 2.71-1.70 (9H, m) 3 analysis C24H30N4Oi0.2H; Calculated 値: C, 50.52; Η, 6.01; N, 9.82. Found 値: &lt;5〇49; H, 6.05; N , 9.68 ^ MS (ES +, m / z 533 (M + · 1, 100%) 〇 [3S (1S, 9S) 3- [6,10-bisS3 group-9 · (tea-1-methylaminoamino group 2.3,4,7,8, 9,10-octahydrogen and [l, 2-a] [l, 2] diazepine, small sloppy, prepared by the method similar to the compound 214e based on 4-keto 4-ketobutyric acid (408), can be Generated a white solid (73%): mp · 157-165X (unclear): 〇] D27 -14〇5. (C Oi, CH3〇H); IR (KBr) 3325, 1658, 1531, 1420, 1278? 1257; ιΗ NMR (CD3OD) β 8.33-8.28 (1Η, m), 8.01-7.78 (2Η, m), 7.71 (lH, d, J = 6.0), 7.59-7.52 (3H, m), 5.27 (lH, m) , 5.12-5.03 (1Η, m), 4.55 (2H, m), 4.25 (1H, m), 3.64-3.43 (1H, m), 3.24-3.12 (1H, m), 2.80 · 1.67 (9H, m). Analyze the calculation of C25H26N407.2H2〇 The consumption cooperation of the Central Government Bureau of the Ministry of Economic Affairs of the People's Republic of China Du Yin ¾ {Please read the back of the Yun-i matter before filling out this page) Calculation: C, 56.60; . Found 値: C, 56.70; H, 5.80; N, 10.33. MS (ES +, m / z), 493 (M + · 1,100%). [3S (1S, 9S) 3- [6,10-diketo-4- (hydroxy-3,5-dimethylfluorenyl) amino-1,2,3,4,7,8,9 , 10-Octahydro-6H ^ Daparo [l, 2-a] Π, 2] Diazabenzene-l-carboxamido 4-ketobutyric acid (214w), similar method as compound 214e Preparation, can produce 210 mg (62%) of a white solid: mp. &Gt; 260 Ό: [to] D20 -93. (C 0 · 20, MeOH); IR (KBr) 3401, 2948, 1651, 1604, 1559, I486, 1421, 1325, 1276, 1210; lH NMR (D6-DMSO) d 9.39 (1H, bs), 8.29 ( 1H, d, J = 5.9), 7.55 (2H, s), -547-The standard of this paper is the same as that of China National Standards (CNS) A4 (2i0x297 mm) 1235157 A7 B7 V. Description of the invention ( 545) 6.64 (1H, d, J = 6.1), 5.79 (1H, s), 5: 25-5.21 (1H, m), 1.90-1.82 (1H, m), 4.410.69 (2H, m), 3.47 -3.20 (3H, m), 2.97-2.91 (1H, m), 2.23 (6H, s), 2.25-1.60 (7H, m)-

O

213y R = Bn-[1S, 9S (2RS, 3S)] N- (2-ethoxy-5-ketotetrahydrofuran-3-yl) -6,10 ^ diketo-9- (isoquinoline- 1-formamidine) -1,2,3,4,7,8,9,10-octaargon-6-H-daparo [l, 2-a] [l, 2] diazapine -1-Carboxamide (550q), synthesized by the method of preparing 213e, can produce 550q. [1S, 9S (2RS, 3S)] Ν · (2-methoxy-5-ketotetrahydrofuran-3 · yl) -6,10-diketo-9- (isoquinoline-1-carboxamide) Radical) -1,2,3,4,7,8,9,10-octahydro-6-11-ependorphin [l, 2-a] [l, 2] diazapine-1-carboxamidine Amine (213y) can be synthesized by the same method as 213e to produce 213y. (Please read the precautions of Back Cloud before completing this I) The Ministry of Economic Affairs has won the bid.

v〇 ^ €), 0〇-548- Chinese paper standard (CNS) A4 specifications (2 丨 OX 297 mm) 1235157 A7 ______B7 V. Description of the invention (546) [1S, 9S (2S) ,, jS)] N, (2-phenethoxy-5-fluoren ', radical tetrazolium sigma-3-yl), 6,10-diketo-9- (isoquinoline q-formamidine Amine) -1,2,3,4,7,8,9,10 · Octahydrogen [1,24] [1,2] diazapine-1-carboxamide, (412 &amp;) The method of preparing 550q can be used to generate 412a by using 513a-1. [1S, 9S (2R, jS)] Ν- (2. Epilactyl-5-copper-based four rat bite 1 ^ group) · 6,1 〇 · Diketo-9- (isoquinoline-1-methylamidoamino) -1,2,3,4,7,8,9,10-octaargon-6_ 2-a] [l, 2] Diazapyridine-1-carboxamide, (412b) Using the method of preparing 550q, 412b can be generated with 513a-2. [1S, 9S (2S, 3S)] Ν · ( 2-cyclopentyloxy-5-ketotetrahydrofuran-3-yl) -6,10, diketo-9- (isoquinoline-1-carboxamido) -1,2,3,4, 7,8,9,10-octahydro-6-{^ ta [[1,2, a] [l, 2] diazepine · carboxamide, (412c) was synthesized by the method of preparing 550q, 513b-1 can be used to generate 412c, [1S, 9S (2R, 3S)] N- (2-cyclopentyloxy -5-ketotetrahydrofuran-3-yl) -6,10_diketo-9- (isoquinolin-1-methylamidoamino) -1,2,3,4,7,8,9 , 10-octagas-6 · daphta [1,24] [1,2] diazapyridine-1-carboxamide, (412 (1) was synthesized by the method of preparing 550q, and 513b-2 was used 412d · 4 NMR (CDCl3) 9.5 (1Η, d), 8.9 (1H, d), 8.5 (1H? D), 7.9-7.8 (2H, m), 7.g, 7.65 (2H, m) , 6.55 (1H, d), 5.55 (1H, d), 5.25-5.1 (2H, m), 4.75-4.65 (1H, m), 4.65-4.6 (1H, m), 4.4-4.3 (1H, m) ? 3.25 ^ Employees' Cooperatives of the China National Standards Bureau, Ministry of Economic Affairs, Yin Chang 3.15 (lHt m), 3.15-3.05 (1H, m), 2.95-2.8 (2H, m), 2.55-2.4 (2H, m), 2.15- 1.5 (14H, m). [15,95 (25,35)] 1 ^-(2-Ethyl-5-one-tetraargin-3-yl) -6,10, diketo- 9- (isoquinoline-bucarboxylamino) -1,2,3,4,7,8,9,10-octagas-6, {^ gong [1, 2-a] [l , 2] Diazapyridine-1-carboxamide, (412e) using the preparation of -549-This paper is suitable for Chinese national standard (CNS) A4 (210X297 mmΊ ^ 1235157 A7 B7) V. Description of the invention ( 547) 550q method, using 5 13f-1 to produce 412e 3 [1S, 9S (2R, 3S)] N- (2-ethoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-9- (isoquinoline-l-methylamidoamino) -l, 2,3,4,7,8,9,10-octahydro-6-H-pyridine and [l, 2-a] [l, 2] diazapine small carboxamide, (412f ) Synthesis using the method of preparing 550q, using 513f-2 can generate 412f. Compounds 410 and 412 were prepared by the method of preparing 605 from 60.

410, 412 Printed by the Consumer Cooperatives of Zhongda Bureau of the Ministry of Economic Affairs

5022 Compound R1. 0 502γ, 410 502ζ, 412 CO

[: SUS, 9S)] 3-[(6,10-diketodeca, 2,3 4,7,8,91〇-octagas-6 Staya [1,24] [1,2] di Azafluorene-9- (thiophene-3-yl-carboxamido-b-carboxamido) · 550-

1235157 M Ministry of Economic Affairs. F Shi Yan, a member of the Bureau of Consumers' Cooperatives ¾ A7_B7___ V. Description of the invention (548) 4-§3 Butyric acid (410), purified by flash chromatography (5-25% methanol in two gases (Methane) can produce 296 mg (94%) of colorless solid: mp · 90-200 &quot;C; IR (KBr) 3338, 3096, 2950, 1787, 1726, 1657, 1546, 1420, 1279, 1258, 1 125, 1092, 984, 933; lH NMR (CD3OD) ά 8.41 (1H, d), 8.13 (IH, d), 7.54-7.41 (3H, m), 7.20 (1H, d), 5.19-5.11 (1H, m) , 4.54-4.30 (1H, m), 3.27 (1H, m), 3.18-3.03 (1H, m)? 2.81-2.64 (2H, m), 2.56-1.59 (7H, m) 3 Analysis of Cl9H22N407S.2.5H20 Calculate 値: C, 46.05; Η, 5.49; N, 11.3 Measured 値 · C, 46.36; H, 5.25; N, 11.10. MS (ES, 449 (M-1, 80%), 113 (100). Correct mass calculation of Cl9H23N407S (MH +): 451.1287. Found: 451.1295-[35 (丨 5, 95)] 3-[( 6,10-diketo-9- (iso4line-1-methylamidoamino-amino) -1,2,3,4,7,8,9,10-octahydro-6H-da [1,2-a] [1,2] diazepine-1-carboxamido] -4 · ketobutyric acid (412), prepared in a similar manner to compound 605, can produce a white glassy solid (69%) ·· mp · 138-141X :; [from] D23 -105.5. (C 0 · 5, CH2C12); IR (KB〇3375, 1787, 1659, 1515, 1421, 1278, 1256; lH NMR ( CDC13) ά 9.32 (1H, m), 8.79 (1H, m), 8.47 (iH, m), 7.86-7.64 (4H, m), 5.3 1, 5.18, 4.59, 4.37 (4 or 5H, ιη), 3 · 55-2 · 76, 2.49-2.39, 2.05, 1.65 (11H, 4m). Analysis &lt;: "Only 2 # 5〇7 * 1.5 ^ 12〇 calculations: (:, 55.17; 11, 5.40; team 13.40. Measured 値 ·· C, 54.87; H, 5.22; N, 13.15. MS (ES 'm / z) 494 (M + -1, 100%) 0 [3S (1S, 9S)] 3-[( 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-9- (tastephen-3-yl) -6H-benzopyrene [l, 2-a] [1,2] Diazafluorene-carbonylamino group) -carboxamido-551- ^ China Crushing leather (CNS) 'With specifications (210X297 male cage) One (please read the precautions of δ first and then fill out this f) Binding 4 1235157 Λ7 B7 ---------------- -V. Description of the invention (549) Alkyl 4-ketobutyrate tertiary-butyl hemicarbazone, '(502y), synthesized by the method of preparation 604 of 甴 603, can produce light cream powder: mp. 120-180 ° C; 〇] D23 -109 ° (c 0.18, CH2C12); IR (KBr) 3478, 3327, 1670, 1582, 1543, 1421, 1279, 1257, 1 155; lH NMR (CDCi3, CD3OD) ά 8.04 (1H , m), 7.49 (1H, m), 7.38 (1H, m), 7.17 (1H, m), 5.170.01 (2H, m), 4.86 (1H, m)? 4.61-4.50 (1H? m), 3.45-3.29 (2H, m), 3.21-3.03 (1H, m), 2.79-2.54 (3H, m), 2.43-2.33 (1H, m), 2.11-1.66 (5H, m), i.44 (9H , s) ^ Analyze the calculation of C24H33N707S-H20 値: C, 49.56; Η, 6.07; N, 16.86; S, 5.5 Measured 値: C, 49.51; Η, 5.93; N, 16.31; S, 5.17. MS (ES +) 586 (100%), 564 (M + + 1, 1.59). C24H34N707S (MH +) accurate mass calculationMH: 564.2240. Found 値: 564.2267. [3S (1S, 9S)] 3-[(6,10-diketo-9- (isoquinoline-1-amidino) -1,2,3,4,7,8,9,10 -Octahydro-611-Da-Chen [1,24] [1,2] diazapyridine-1-carboxamido-4-ketobutyric acid tert-butyl hemicarbazone (502z) to Prepared in a similar manner as described for compound 604, yielding a pale yellow solid (90%): 〇 ^ .142_ 145Ό; [a] D24 -136.5 ° (c 0.06, CH2C12); lH NMR (CDC13) d '9.51-9.46 (1H, m), 9.11 (iH, s), 8.83 (1H, d, J = 7.8), 8.53 (1H, d, J = 5.5), 7.89-7.83 (2H? M), 7.77-7.65 (2H, m), 7.55 (iH, d, J = 7.2), 7.18 (1H, d, J = 2.7), 5.26-5.12 (2H, m), 4.87 (1H, m), 4.59 (1H, m), 3.25- 3.12 (2H, m), 2.95-2.76 (2H, m), 2.59-2.38, 2.18-1.94, 1.70 (5H, 3m), 1.44 (9H, s) ^ -552- The paper ft scale is applicable to Chinese national standard (CNS M4 specifications (210x 297 male cage i, order 4 printed by the Consumers' Cooperative of the Shenyang Bureau of the Ministry of Economic Affairs 1 1235157 Λ7 B7 V. Description of the invention (55)) 0

Consumption cooperation between employees of the Ministry of Economic Affairs and the Central Bureau of Commerce. Du Yin ¾ Compound R4 R1 415a 415b 415c 214w-l 214w-2 CHj 214w-3 CH3 214w-4 CHa 214w-5 CH3 -553- The standard of this paper is applicable to S National standard plum (CNS) June 4 now Luo (2 丨 0 X297 mm) 1235157 AT B7 V. Description of the invention (551) Compound R4 'R1 214w-6, 0 0 214w-7 ρΌ 412g 412h ^ 0 (Please read first Please fill in this matter of the back of the cloud f) -Pack [13,93 (25,35)] 1 ^-(2-: ^: oxy-5-fluorenyltetrahydrobite-3-yl) -6 , 10-diketo-9- (methyldioxy; fluorenyl) -1,2,3,4,7,8,9,10-octahydro-61 ^ Resin: and [1,24] [1,2] Diazapyridine-carboxamide, (4153) was synthesized by the method of preparation 55 (^) to produce 415a. [1S, 9S (2RS, 3S)] N- (2-ethoxy-5 -Ketotetrahydrofuran-3-yl) -6,10-diketo-9- (methyldioxyamidoamino) -1,2,3,4,7,8,9,10-octaargon- 6 ^ 1-Daphno [l, 2-a] [l, 2] diazabenzene-1-carboxamide, (415b) can be synthesized by the method of preparing 550q to produce 415b. [1S, 9S (2R, 3S)] N- (2- ^ oxy-5-fluorenyltetrazine 11-fluorocontinyl-3-yl) -6,10-diketo-9- (fluorenedifluorene Sulfonylamino) -1,2,3,4,7,8,9,10-octahydro-6 ^ 1-pyrido [1,24] [1,2] diazafluorene-1- Carboxamidine, (415 (:) was synthesized by the method of Preparation 55 (^) to produce 415c. [1S, 9S (2RS, 3S)] N- (2-Methoxy-5-one tetrahydrofuran-3- Base) -6, 10- _-554-This paper is in accordance with the Chinese National Standard (CNS) / U Ti Luo (210X2W public cage). The bid is awarded by the Ministry of Economic Affairs. The Associate Bureau ’s second consumerism f cooperative print ¾ 1235157 ______B7 __ 5 、 Explanation of the invention (552) Dicopper-9- (3,5-dimethyl, 4-acryl, amine) -1,2,3,4,7,8,9,10-octahydro -6H-dapyrolo [l, 2-a] [i, 2] diazamycin-carboxamide, (214w-l) was synthesized by the method of preparing 5 5 Oq to generate 214w-l 3 [1S , 9S (2R, 3S)] Ν- (2 ·; oxy-5 • ketotetrahydrofuran-3-yl) -6,10-diketo-9- (3,5-difluorenyl-4-hydroxyl Fluorenylamino) -1,2,3,4,7,8,9,10-octahydro-6H-, and [1,2-aHl, 2] diazepine-p-carboxamide, (214W-2) 2i4w-2 3 can be synthesized by the method of preparing 550q [1S, 9S (2S, 3S)] N- (2 · fluorenyl-5 · ketotetrahydrofuran small group) -610-diS3 group -9- (3,5 · dimethyl-4 -Hydroxy; fluorenylamino) -1,2,3,4,7,8,9,10-octahydro-6'-dapyrido [l, 2-aHl, 2] diazapyridine-1-carboxyfluorene Amine, (214W-3) is synthesized by the method of preparing 550q, which can produce 214w-3. [1S, 9S (2R, jS)] N- (2-benzylethoxy-5-coppertetrazine-3-yl) -6,10 * diketo-9- (3,5-di Methyl-4 -hydroxyamido)) 1,2,3,4,7,8,9,10-octahydro-6Η- »aporphino [l, 2-a] [l, 2] di Azamus-1-chiamine, (2i4w-4) is synthesized by the method of preparing 550q, which can produce 214w-4. [1S, 9S (2S, 3S)] Ν · (2-benzylethoxy-5-ketotetrahydrocran-3-yl) -6,10-dicopper-9- (3,5-di Methyl-4-light fluorene δ δ amino group), ι, 2,3,4,7,8,9,10-octaazepine-6 fluorene-4 σ well [1,2-a] [1,2 ] -Miscellaneous leather. 1-A few s of amines, (214w-5) can be synthesized by the method of preparing 550q to produce 214wo.

Employees' Cooperation of Zhongli Sample Leather Bureau, Ministry of Economic Affairs · Social Seal 5L

[1S, 9S (2R, 3S)] N- (2-Cyclooxy-5-ketotetrahydrofuran-3-yl) -6,10-dione-9- (3,5-dimethyl-4 -Hydroxybenzylamino) -1,2,3,4,7,8,9,10-octahydro-6Η- ^ β well and [1,2-a] [1,2] — Chaos ¥- 1-¾ δδ amine, (2 14w-6) is synthesized by the method of preparing 550q, which can generate 214w-6. [1S, 9S (2S, 3S)] N- (2-Cyclooxyloxy'ketotetrahydrofuran-3-yl) -6,10 · -555-This paper method is commonly used in Chinese national samples ( CNS) A4 specification (210 × 297 male cage> 1235157 Λ7 _ _ B7__ V. Description of the invention (553) diketo-9- (3,5-dimethyl-4-hydroxyfluorene, amine group) -1, 2, 3,4,7,8,9,10-octahydro-6H-daphne [1,24] [1,2] diazapyridine-1-carboxamide, (214 ~ -7) Preparation 550q It can be synthesized by the method to produce 2Mw-7. [1S, 9S (2R, 3S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6; 10 · diketo-9- (Isoquinoline · 1-methylamido) 1,2,3,4,7,8,9,10-octahydro-6 only-daphtho [l, 2-a] [l, 2] Diazabenzene-carboxamidine, (4! 2g) was synthesized by the method of preparing 550q, and 412g was produced. [1S, 9S (2S, 3S)] N- (2-Methoxy-5-ketotetrahydrofuran -3-yl) -6,10-diketo-9- (isojunyl-1-carboxamido) -1,2,3,4,7,8,9,10-octahydro-6 { ^ Dain and [l, 2-a] [l, 2] diazapyrene-buguisamine '(412h) is synthesized by the method of preparing 550q, which can generate 412he 0

415 0

214w [3S (1S 9S)] 3- (9- (4,5-methyldilactyl + donyl) amino-6,10-difluorenyl-

Order from the Ministry of Economic Affairs. Employees of the China Bureau of the People's Republic of China 5L 17 3 4 7 8 9,10-octahydro-6] 3-'* Jing [1,2- 玨] [1,2] -1-Aminomethylamino) -4-ketobutyric acid (415) was synthesized by the method of 2002 from 2002 to produce 415. [35 (13,95)] 3- (9- (3,5-Digas-4-superylhexyl) amino-6,10-dicopperyl · 1 7 3 4 7 8 9 10-eight Hydrogen σ wells [1,2-a] [l, 2] two-gas heterocycle-1-induced amido) -4-ketobutanoic acid (214W), 556-

1235157 A7 B7 5. The invention description (554) was completed to generate 214w.

2100k-o Employees of the China Bureau of Economic Affairs, China Ministry of Economic Affairs, Cooperative Cooperative Association, Compound R 2100k 21001 χ〇-〇 2100m. &lt; 〇2100η V ° T) 2100ο &gt; 0Τ3 [15,95 (2 feet 5,35) 9-amido-6,10-diketo-1,2,3,4,7,8, 9,10-octahydro-N- (2-phenethoxy-5-ketotetrahydrofuran-3-yl) -6H-pyrene [1,2-a] [l, 2] diaza leather- 1-Carboxamide (2100k), prepared in a similar manner as compound 213e, to produce a mixture of diastereoisomeric compounds (75/25), which is -557- Bennol &amp; standard in general a national standard (CNS) A4 is now available (210 乂 2mm) (please read the meaning of the back of the cloud 1 ^ 1 to complete this page) Male bookbinding 1235157 A? __B7_ 5. Description of the invention (555) White solid gift (258 mg , 83%): mp. ΙΌΐΧ; • [立] / 5 -96. (C 0.2, CH2C12); IR (KBr) 3328, 2935, 2978, 1732, 1669, 1603, 1483, 1450, 1414, 1237, 1155, 1082, 989, 755; lH NMR (CDC13) ά 7.84 ^ 7.80 (2H , m), 7.54-7.17 (8H, m), 7.06-6.99 (1H, m), 6.25 (1H, d, J = 7.9H), 5.41 (0.75H, d? J = 5.4H), 5.31 (0.25 H? Bs), 5.23 ^ 5.09 (1H, m), 4.93-4.87 (1H, m), 4.68 ^ 4.51 (2H, m), 4.40-4.33 (0.25H, m), 4.24-4.14 (0.75H, m ), 3.95-3.70 (1H, m), 3.30-3.13 (1H, m), 3.14-2.78 (5H, m)? 2.47-2.21 (2H, m)? 2.05-1.50 (5H, m). Calculated for analysis of C29H32N4O7.0.5H2O 値 'C, 62 · 47; H, 5.97; N, 10.05. Found 値 · C, 62.17; H, 5.83; N, 9.97 3 MS (ES +) 549. [1S, 9S (2RS, 3S) 9-phenylamido-N- (2-cyclopentyloxy-5-one-tetrahydrofuran · 3-yl) -6,10 · diketo-1,2 , 3,4,7,8,9,10-octahydro-611-, answer to [l, 2-a] [l, 2] diazahetero-1-chitamine (21001) 'such as 213e Prepared by a similar method as a colorless solid: mp · 172-8CTC; [Pan] D23 -91.53 (c 0.1, CH-2Ci2); IR (KBr) 3290, 1792, 1677, 1657, 1642, 1544, 1425, 1280, 1259, 1 124, 977; lR NMR (CDCi3) c? 7.80 (2H, m), Du Yin, employee cooperation of the Central Bureau of Standards of the Ministry of Economic Affairs Book I) 7.46 (3.5H, m), 7.00 (1H, d, J = 6.7), 6.48 (0.5H, d, J = 7.9) ^ 5.55 (0.5H, d, J = 5.3), 5.19 ( 2H, s + m), 4.93 (0.5H, m), 4.62 (1.5H, m), 4.34 (1H, m), 4.18 (0.5H, m), 3.28-2.70 (4H, m), 2.49-2.29 (2H, m), 205-1.48 (15H, m). [1S, 9S (2R, 3S) 9 · Benzamidoamino-6,10-diketofluorene-〇 (2-hydroindenylfluorenyl) -5-keto-tetrahydrofuran-3-yl] -1 , 2,3,4,7,8,9,10-octahydro-6 {^ each ac [1,24] [1,2] diazepine-1-carboxamide (210〇111), Similar to 213 € -558-___ --------- _ 1 _____ — ______ ______ ^ This paper has a standard Chinese national standard (CNS) A4 grid (210 people 297 mm) 1235157 A7 __ B7 V. Description of the invention (556) method, (76%) was a colorless solid, mp., ~ 14 (TC, redissolved 187-VC; l &gt;) D23 -96.90 (c 0.11, CH2C12); IR (KBr) 3507, 3308, 3251, 1772, 1660, 1641, 1566, 1545, 1457, 1424, 1346, 1326, 1302, 1275, 1258, 1 136, 1085, 1018, 981; lH NMR (CDC13) ό 7.78 (2H, m), 7.53 (3H, m), 7.19 (4H, m), 6.91 (1H, d, J = 7.4), 6.27 (1H, d, J = 7.6), 5.66 (1H, d, J = 5.3), 5.10 (1H, m), 4.96 (1H, m), 4.75 (2H, m), 4.52 (1H, m), 3.08 (3H, m), 3.03-2.71 (5H, m), 2.48 -2.31 (2H, m), 1.90-1.40 (4H, m), 1.22 (1H, m) 〇 [1S, 9S (2S, 3S) 9-fluorenylamino-N- (2-fluorenyloxy)- Ketotetrahydrofuran-3-yl) -6,10- Diketo-1,2,3,4,7,8,9,10-octahydro-611-dapyrido [1,24] [1,2] diazapyridine-1-carboxamide (21 〇〇n), prepared according to a similar method of compound 213e, can produce a white glassy solid (76%); mp. U2-5X:; 〇] 〇23 -62 · 0ο (c 0 · 1, CH2C12); IR (ΚΒγ) 3305, 1789, 1677, 1665, 1535, 1422, 1279, 1256, 11 19, 942, 700; 1K NMR (CDCi3) ^ 7.84 (2H, s), 7.58 ^ 7.27 (9H, m), 6.99 ( 1H, d, J = 7.8), 5.23 (1H, s), 5.23-5.11 (1H, m), 4.89 (1H? M), 4.76 (1H, d, J = 11.3), 4.55 (1H, d, J = 1 1.4), 4.58-4.43 (2H, m), 3.30 ^ 2.96, 2.81-2.69, 2.46-2.37, 2Λ6Λ.66 (10H, 4m), 2.27 (1H, d, J =, M) Member of the Bureau, Consumer Cooperation, Du Yinzhuang 17.8). Analyze the calculation of C28H30N4O7.0.5H2O 値: C, 61.87; H, 5.75. Y N, 10.32 3 Measured 値: c, 61.88; H, 5.70; N, 10.33 ° MS (ES '//) 535 (M + + 1, 100%). -[1S, 9S (2R, 3S) 9-fluorenylamino-N- (2-octyloxy-5-ketotetrahydrocarbyl) -6,10-diketoyl, ι, 2, 3 , 4,7,8,9,10-octahydro-6H-da-porphyrin, diazapyrene, 1-epioxamine (2100) (containing about 7% (2S)), according to compound -559 -The standard of this paper is the Chinese National Standard (CNS) A4. (21〇 &gt; &lt; 297 public holiday) 1235157 A7 B7 V. Description of the invention (557) 213e. It can be produced by a similar method, which can produce white, stained glass. Solid (81%); mp 115-7'C; 〇] D2l12l (c 〇u, called (: 12); IR (KBr) 3326, 1792, 1659, 1535, 1421, 1278, 1257, 1 124, 978 ; lH NMR (CDC13) ά 7.82 (2H, m), 7.58-7.24 (8H, m), 6.90 (1H; d, J = 7.3), 6.49 (1H, d, J = 7 7), 5 57 (lfi, J = 5.5), 5.11 (2H, m), 4.91 (IH, d, J = 11.4), 4 57 (1H, d, j = lhl), 4 · 81-4.68 (1H , M), 4.65-4.54 (1H, m), 3.18-2.71, 2.52-2.30, 2.05-1.62 (1 1H? 3m). Analyze the calculation of C28H3〇N4.07.0.5H2〇 C · C, 61.87 Η, 5.75; N, 10.32 3 Measured 値: c, 61.70; H, 5.71; N, 10 · 15. MS (ES +, m / z) 535 (M, 10, 94.3%), 557 (100%) Ο

Central sample of the Ministry of Economic Affairs. Printed by the Anti-Poverty Cooperative of the Associate Bureau [13,93 (2 feet 3,35) -Ethoxy-5-keto-tetrahydrofuran-3-yl)-: 1,2,3,4,7,8,9,10-octahydro-611-, pyrenol n, 2-aHl, 2 ] Diazapyridoxamine (550η), prepared in a similar manner to compound 213e, to form a mixture of diastereoisomeric compounds (65/35), as a brown powder (390 mg, 28%); .139-145 ° (:; [PAN] 〇23 -1043 (c 0.2, MeOH); IR (KBr) 3318, 2405, 2369, 1792, 1660, 1591, _One: 560- __ This paper method is common in China National Standards (CNS) A4 now available (2 丨 0 '&lt; 2Q7 public dredging) 1235157 Λ7 _B7_ V. Description of the invention (558) 1549, 1484, 1422, 1257, 1 1 17; XH NMR (D6-DMSO) ά 10.1 (1Η, s), 8.80 (0.65H, d, J = 6.6), 8.58 (0.35H, d, J = 6.6), 8.59 (1H, d, J = 7.0), 8.06 (1H, bs), 7.83 -7.79 (1H, m), 7.61-7.57 (1H, m), 7.47-7.39 (1H, m), 5.61 (0.35H, d? J = 5.0), 5.37 (0.65H, bs), 5.170.14 ( 0.35H, m), 5.08-5.06 (0.65H, m), 4.92-4.86 (1H, m), 4.67-4.61 (0.35H, m), 4.47-4.41 (0.65H, m), 4. 28-4.11 (1H, 2m), 3.80-3.59 (2H, m), 3.23-2.75 (3H, m), 2.6b 1.48 (7H, m), 2.10 (3H, s), 1.25 and 1.17 (3H, 2t , J = 5.8). MS (ES "528.

550〇

Staff of the Ministry of Economic Affairs, Bureau of Standards, Consumers, Cooperatives, SL

[15,95 (2115,35) 6,10-diketo-: ^-(2-ethoxy-5-ketotetrahydrofuran · 3-yl) -9- (2-oxindolecarboxamide Radical) -1,2,3,4,7,8,9,10-octahydro-611-dapyrido [l, 2-a] [l, 2] diazapine-1-carboxamide ( 550), prepared according to the similar method of compound 213e, which can produce colorless solid (1.071 g, 80%); 111? .155-7 ° C; [α] Ό22 -75.8 ° (c 0.26, CH2C12 ); IR (KBr) 3314, 2941, 1791, 1658, 1545, 1420, 1341, 1312, 1252, 1 181, 11 18, 939, 749; lH NMR (CDCi3) 9.45 (0.5H, s), 9.34 (0.5 H, s), 7.68- 7.62 (1H, m), 7.49-7.39 (2H, m), 7.33-7.26 (1H, m), 7.18-7.03 -561-This paper's standard is applicable to 3 national standards (李&gt; ^) Six 4 squares (2 丨 0 乂 297 mm) 1235157 Ministry of Economic Affairs: 夭 Sample cooperation between employees of the Bureau · Du Yin ¾

AT B7 V. Description of the invention (559) (3H, m), 5.49 (0.5Η, d), 5.30 (0.5H, 's), 5.26-5.13 (1H, m), 4.90-4.83 (0.5H, m ), 4.76-4.49 (1H, m), 4.42-4.35 (0.5H, m), 3.97-3.74 (1H, m), 3.72-3.53 (1H, m), 3.35 ^ 2.64 (4H, m), 2.50- 2.37 (1H, m), 2.20-1.82 (5H, m), 1.69-1.50 (2H, m) ', 1.30-1.19 (3H, m). 0

[15,95 (2,5,3 3) 6,10-Difluorenyl-sense (2-ethoxy-5-ketotetrahydrofuran · 3-yl) -9- (4-hydroxyfluorenyl) amine -1,2,3,4,7,8,9,10-octaargon · 6Η-dapyrido [l, 2-a] [l, 2] diazapyridine-1-carboxamide (550ρ ), Prepared according to a similar method of compound 213e to produce a mixture of diastereoisomeric compounds as a white foam (820 mg, 47%): [ubiquitous] 〇24 -75 ° (c 0.16, CH2C12); IR ( KBr) 3401, 2937, 1791, 1657, 1609, 1539, 1505, 1423, 1277, 1177, Π18; lH NMR (CDCI3) ά 8.07-8.05 (1H, m), 7.67 (2H? D, J = 7.9), 7.38-7.29 (2H, m), 6.80 (2H, d, J = 8.5), 5.49 (0.5H, d, J = 4.6), 5.23 (0.5H, bs), 5.24-5.20 (1H, m), 5.12 -5.08 (1H, m), 4.68-4.29 (2H, m), 3.92-3.45 (3H, m), 3.32-2.30 (2H, m), 2.80-1.56 (1 1H, m), 1.21 (3H, t , J = 7.0H). -562- Chinese paper scales are sold through a Chinese family standard (CNS) (thin, please read the precautions of the back of your father before filling in, 5 shells)

1235157 AT Β7 V. Description of the invention (56〇) Ο Ο

〇

(Please read the precautions of VB before filling out this page)

Compound R 503a 504a 286 00 503b 504b Me Vo 505b 503c 504c 505c OPh 503d 504d 505d XT -563- Ben. ¾ ¾ standard China National Standard Ocean (CNS) Mello (2 [0: &lt; 57 mm) Order 4 1235157 Λ 7 Β7 V. Description of the invention (561) 503β 504e 505β

[35,411 (15,93) 3- (6,10-diketo-9-methanesulfonylamino-1,2,3,4,7, 8,9,10-octahydro-6H-da And [l, 2 · a] [l, 2] diazepine-l-carboxamido) -4-hydroxy-5- (1-methylformyloxy) valeric acid tert-butyl ester ( 503a), prepared by the method of (213e) from 212b and (3S, 4R) (N-allylfluorenylcarbonyl) -3-amino-4-hydroxy 0- (1-fluorenylmethyloxy) valeric acid Tertiary butyl ester, which can generate 533 mg (81%) of white foam: [a] D22-81.4e (c0.5, CH2Ci2); IR (KBr) 3342, 2976, 1719, 1664, 1328, 1278, 1246, 1 153, 1 137. lH NMR (CDC13) β 8.86 (1H, d, J = 8.4), 8.21 (1H, dd, J = 1.3, 7.3), 8.03 (1H, d, J = 8.1), 7.88 (1H, d, J = 8.6), 7.66-7.45 (3H, m), 7.23 (1H, d, J = 8.6), 5.96 (1H, d, J = 9.2), 5.30 (1H, m), 4.59-4.33 (5H, m) , 4.24 (1H, m), 3.96 (1H, brd), 3.29 (1H, m), 2.95 (1H, m), 2.93 (3H, s), 2.69-2.50 (3H, m), 2.36 (1H, m ), 1.96 (4H, m), 1.62 (1H, m), 1.41 (9H, s). Analysis of the calculation of C31H40N4O10S-0.25H2O ·· C, 55 · 97; Η, 6.14; N, 8.42 3 Found: C, 55 · 90; Η, 6.11; Ν, 8.23 a MS (ES +) 683 (M + Na, Printed by the Ministry of Economic Affairs of the Ministry of Economic Affairs and Consumer Affairs Cooperatives (100%), 661 (M + 1, 39), 605 (78). [3S (1S, 9S) 3- (6,10-diketo-9-methanesulfonamido-1,2,3,4,7,8,9,10 [l, 2-a] [l, 2] Diazabenzene-1-carboxamido) · 5- (1-fluorenylmethyloxy) -4-ketovaleric acid tert-butyl ester ( 504a) 'Using the method from 21 to 216e, synthesized from 503a, it can generate 446 milligrams (91%) of bee bark -564- National Standard (CNS) .A4 grid (2108) Mm) 1235157 A 7. _B7___ _ V. Description of the Invention (562) _ Foam: 〇] D21 -111.6. (C 0.5, CH2, t12); IR (KBr) 33 19, 2978, 2936, 1723, 1670, 1413, 1370, 1329, 1278, 1246, 1 153 ^ Η NMR (CDC13) ά 8.87 (1H, d, J = 8.9), 8.29 (1H, d, J = 7.2); 8.06 (1H, d, J = 8.3), 7.90 (1H, d, J = 8.2), 7.66-7.48 (3H, m), 7.37 (1H, d, J = 8.1), 5.61 (1H, d, J = 9.0), 5.31 (1H, m), 5.22 (1H, AB, J = 16.9), 5.09 (1H, AB, J = 16.92), 4.99 (1H ? m), 4.65-4.43 (2H, m), 3.28 (1H, m), 2.96 (3H, s), 2.86 (2H, m), 2.59 (1H, m), 2.38 (1H, dd, J = 6.8 , 13.2), 2.21-1.70 (6Hy m), 1.45 (9H, s). Analysis of the calculation of C3lH33N4O10S-0.25H2O 値 · C, 56.14; Η, 5.85; N, 8.45. Found 値: C, 56.11; Η, 5.83; N, 8.29, MS · (ES.) 657 (Ml, 100%) 3 [3S (1S, 9S) 3- (6,10-diketo-9 -Methanesulfonylamino-1,2,3,4,7,8,9, 10-octahydro-6H-dapyridine [l, 2-a] [l, 2] diazepine-Bu Carboxamido) -5- (1-methylformamyloxy) -4-ketovaleric acid (286), prepared from 504a by 217 method, can produce 356 mg (93%) of white powder: mp 120-123 ° C; [a] D23 -121. (C 0 · 194, CH2C12); IR (KBr) 3314, 2937, 1722, 1663, 1412, 1328, 1278, 1245, 1 195, 1132. lH NMR (d6-DMS〇) o '12.63 (1H, brs), 8.94 (1H, d, J = 7.4), 8.78 (1H, d, J = 8.6),

M Printed by the Ministry of Economic Affairs of the China Prospective Bureau Consumers Cooperatives X (please read the precautions for the back cloud first and then fill in sophomore) 8.26 (2H, m), 8.11 (1H, d, J = 8.0), 7.77- 7.62 (4H, m), 5.28 (2H, s), 5.21 (1H, m), 4.82 (1H, m), 4.44-4.29 (2H, m), 3.31 (1H, m), 2.98 (3H, s), 2.98-2.86 (2H, m), 2.72 (iH, dd? J = 7.3, 16.9), 2.40 (1H, m), 2.24-1.84 (4H, m), 1.69 (2H, m ) 3 Analyze the calculation of C27H30N4O10S-H2O 値: C, 52 · 25; H, 5.20; N, 9.03 3 Measured 値: C, 52.11; H, 4.97; N, 8.89. MS · (ES +) 601 (Ml, -565-Chinese paper standard (CNS) AMt Luo (210X 297 male cage) is applicable to the standard of this paper) &quot; '1235157 A7 B7 V. Description of the invention (knowledge) 100% ", please 53 Attention% of reading δ Fill in too [3 5,4 feet 5 (15,95)] 3- [6,10-diketo-1,2,3,4,7,8,9,10-eight Hydrogen-6 ^ 1-dapyrido [l, 2-a] [l, 2] diazepine-9- (methanesulfonamido) · 1-carboxyamido] -4-hydroxy-5- (5-fluorenyl-3-benzyl isoxazolyloxy) phosphonium tert-butyl ester (503b) was synthesized in a similar manner to the compound 213e to give a white powder (671 mg, 88%): mp · 90-12CTC; IR (KBr) 3345, 2977, 1727, 1664, 1532, 1450, 1423, 1369, 1323, 1310, 1276, 1257, 1154, i iOi, 990, 766; lH NMR (CDC13) ά 7.61-7.55 (2H, m). 7.51- 7.42 (3H, m), 6.86 (1H, d), 5.69 (1H, d), 5.21 (1H, m)? 4.64 · 4.38 (2H, m), 4.15-4.05 (3H , m), 3.84 (1H, s), 3.31-3.14 (2H, m), 2.97-2.87 (1H, m), 2.94 (3H, s), 2.76 (3H? s), 2.64-2.48 (3H, m ), 2.39 · 2 · 29 (1H, m), 2.04-1.61 (5H, m). Analysis of the calculation of C3lH4lN50uS.H20 値: C, 52.46; H, 6.U; N, 9.87; S, 4.52 Measured 値 ·· C, 52 · 34; H, 5.92; N, 9.56; S, 4.44 3 MS (ES—) 714 (47%), 692 (M + + 1, 84), 636 (100)-Μ Employees of the Ministry of Economic Affairs of China

[3S (1S, 9S) 3- [6,10-diketo-9- (methanesulfonamido) -1,2,3,4,7,8,9, 10-octahydro-6H- Pyrene [l, 2-a] [l, 2] diazapyrene-1 · carboxamido] -5- (5-methyl-3 · phenylisoxazolyloxy) -4-one Tertiary-butyl valerate (504b), synthesized in a manner similar to compound 216b, can produce a colorless powder (601 mg, 93%) .. mp. 75-115X :; 〇] D23-104. (C 0.26, CH2C1 :); IR (fCBr) 3324, 2977, 2935, 1730, 1670, 1525, 1452, 1422, 1369, 13 17, 1276, 1256, 1222, 1 155, 1 107, 990, 766; lH NMR (CDCl3) o '7.68-7.61 (2H, m), 7.47 · 7.38 (3H, m), 7.32-7.24 (iH, m), 5.56 (1H, d), 5.36-5.24 (1H, m), 5.04 (1H, d)? 4.88 -566- This standard is applicable to SS standards (CNS) A4 (210 乂 57 mm) 1235157 Λ / V. Description of the invention (564) (1H, d), 4.86 ^ 4.77 (1H, m), 4.64-4.3P (2H? M), 3.32-3.17 (1H? M), 2.97-2.85 (1H, m), 2.93 (3H, s), 2.76 (3H, s), 2.80 -2.71 (1H, m), 2.65-2.49 (1H, m), 2.41-2.30 (1H, m), 2.12-1.61 (6H? M), 1.42 (9H, s). Analyze the calculation of CsiHwNjOnS.i ^ O: C, 52.61; H, 5.84; N, 9.90; S, 4.53 ^ Measured: C, 52.94; Η, 5.69; N, 9.72; S, 4 51, MS (ES +) 712 (31%), 707 (100), 690 (M, +1, 41), 634 (55)-[3S (1S, 9S) 3- [6,10-diketo -9-methanesulfonamido) -1,2,3,4,7,8,9,10-octahydro · 6Η · dageno [l, 2-a] [l, 2] diazapine -1-Carboxamidinyl] -5- (5-methyl-3-phenylisoxazolyloxy) -4-ketopentanoic acid (505b), synthesized in a similar manner to compound 217, which can produce colorless Powder (499 mg, 96%): mp. 95-145 ° C; [a] D22 -137 ° (c 0.12, MeOH); IR (KBr) 3323, 2936, 1732, 1665, 1529, 1452, 1421, 13 12? 1275, 1256, 1221, 1 183, 1 153, 1 135, 1 101, 990; NMR (CD3OD) δ 7.67-7.56 (2H, m), 7.49-7.38 (4H, m), 5.23-5.12 (1H , m), 5.02 (1H, d)? 4.79-4.73 (1H, m), 4.52-4.34 (3H, m), 3.48-3.25 (2H, m), 3.03-2.85 (2H, m), 2.94 (3H , s), 2.74 (3H, s), 2.79-2.66 (1H, m), 2.52-2.38 (1H, m), 2.29-2.14 (1H, m), 2.04-1.70 (4H, m). Analysis of the calculation of C27H31N50uS ‘H20 C · C, 49.77; H, 5.18; N, printed by the Consumer Cooperatives of the Central Government Bureau of the Ministry of Economic Affairs ¾ (Please read the intent on the back before filling in this purchase) 10.75; S, 4.92. Measured: C, 49.83; H, 5.01; N, 10.27; S, 4.84 -MS (ES +) 746 (42%), 632 (M-1, 100), 386 (60) -CyHnNsOnSCMH (accurate mass calculation) : 634.18 19. Found 値: 634.1807. bSi4RS (1S, 9S) 3- [6,10-diketo-9-pyranesulfonamido) -1,2,3,4,7,8, -567- This paper is sized for China. (CNS) slightly (public cage) _ &quot; 1235157

AT B7 ---- 'V. Description of the invention (565) _ 9,10-octachloro-6H- ^ * Bin [l, 2-a] [l, 2] — SL heteroben-1-¾¾ ] -4-Hydroxy-5- (2-phenoxyfluorenyloxy) tert-butyl valerate (503c), synthesized in a similar manner to compound 213e, to give a colorless solid (446 mg, 84%) ): IR (KBr) 3345, 2976, 2935, 1727, 1664, 1603, 1 535, 1483, 1451, 1416, 1395, 1369, 1328, 1297, 1277, 1237, 1 155 · 1135. 1076, 990; 755; NMR (CDCi3) ^ 7.98-7.89 (1H, m), 7.55-7.45 (1H, m), 7.39-7 · 18 (3H, m), 7.14-7.07 (1H, m), 7.00-6.90 (3H, m), 6.75 (1H, d), 5.570.50- (1Η, m), 5.21-5.09 (1H, m), 4.64-4.42 (2H, m), 4.36-4.12 ( 3H, m), 3.95-3.87 (1H, m), 3.39-3.18 (1H, m), 3.00-2.82 (1H, m), 2.95 (3H, s), 2.69-2.48 (3H, m), 2.42- 2.28 (1H, m), 2.07-1.62 (6H, m), 1.42 (9H, s). Analysis calculation 値: C, 54 · 99; Η, 6.15; N, 7.77; S, 4.45 3 Measured 値: C, 54 · 95; H, 5.95; N, 7.34; S, 4.20. MS (ES +) 725 (26%), 720 (47), 703 (M + + 1, 34), 433 (100), 403 (89) First read the precautions for reading δ, then fill out this one) [33 (15,95) 3- [6,10-diketo-9-methanesulfonamido) -1, 2, 3, 4, 7,8,9, 10-octaargon-6H-da-phen [l, 2-a] [l, 2] diazapyridine-1-carboxamido] -4 · keto-0- (2- Phenoxy; fluorenoxy) tert-butyl valerate (504c), synthesized in a similar manner to compound 216e, can produce colorless powder: mp. 85-10CTC; [^] D22 -91.3 ° (c 0.52, CH2C12 ); IR (KBr) 332S, 2978, 2935, 1732, 1669, 1603, 1524, 1483, 1450, 1396, 1369, 1296? 1276, 1237, 1 155, 1 132, 1082, 989, 755; lH NMR (CDC13 ) δ 8.03- 7.98 (1H, m), 7.52-7.44 (1H, m), 7.37-7.07 (5H, m) 7 7.01-6.92 (3H, m), 5.52 (1H, d), 5.28-5.20 (1H , m), 5.06-4.84 (3H, m), • 568-The paper scale uses Chinese g standard Chinese (CNS) AW.t grid (210X 297 mm) 1235157 Λ7 B7 V. Description of the invention (566) 4.64-4.39 (2H, m), 3.32-3.14 (1H, m '), 2.99-2.88 (1H, m), 2.94 (3H, s), 2.65-2.45 (2H, m), 2.39-2.29 (1H, m), 2.12-1.58 (6H, m), 1.40 (9H, s) 3 Calculation of CuHwNPnS analysis: C, 56.56; H, 5.75; N, 8.00; S, 4.58 ^ Actual measurement: C , 56.37; H, 5.84; N, 7.69; S, 4.37. MS (ES "723 (30%), 718 (100), 701 (NT + 1,23), 645 (59" · [3S (1S, 9S) 3- [6,10-diketo · 9-methane Sulfonylamino) · 1,2,3,4,7,8,9,10-octahydro · 6Η-Da [1,2-a] [l, 2] Diazapyrene-1 · Carboxylamido] -4-keto 0- (2-benzyloxyfluorenyloxy) pentanoic acid (505c) was synthesized in a similar manner to compound 21 7 to produce a colorless foam (252 mg, 72%): 1 ^ .90-125; [^] D23 -1333 (c 0.11, MeOH); IR (KBr) 33 14, 2938, 1 792, 1734, 1663, 1604, 1535, 1483, 1448, 1415, 1250? 1 132 , 756; lH NMR (d6-DMSO) ά 8.81-8.76 (1H, m), 7.92 (1H, d), 7.68- 7.54 (2H, m), 7.41-7.25 (3H, m), 7.16-6.91 (4H , m), 5.13-4.98 (2H, m), 4.72-4.63 (1H, m), 4.37-4.21 (2H, m), 2.92 (3H, s), 2.90-2.60 (3H, m), 2.35-2.26 (1H, m), 2.17 ^ 2.05 (2H, m), 1.99-1.08 (2H, m), 1.61-1.50 (1H, m). Calculation of analysis: C, 53.29; H, 5.09; N, 8.57; The staff of the Central Ministry of Economic Affairs and the Bureau of the People ’s Republic of China shall cancel the cooperative seal ^ (please read the precautions of S before filling in this page) S, 4.90, measured 値: C, 53.57; H, 5.18; N, 8.32: S, 4.75. MS (ES +) 643 (M-1, 10 0% "[3 5,4115 (15,95) 3-1; 6,10-diketo-9-methanesulfonylamino) -1,2,3,4,7,8,9,10 -Octahydro-6H-da-pheno [l, 2-a] [1,2] diazapyridine-1-carboxyamidoamino 1A-hydroxy-5- (3-benzyloxyfluorenyloxy) hydrazone Acid tert-butyl ester (503d), synthesized in a similar manner to compound 213e, can produce a colorless solid (563 mg, -569- this paper scale is suitable for S3 house standard (CNS) A4 grid U10X 297 ($.) 1235157 Λ7 B7 V. Description of the invention (567) 90%): IR (KBr) 3349, 2978, 2935, 1724, 1664, 1583, 1536,

Please %% memorize %% and then fill in% too I 1489, 1443, 1370, 1327, 1271, 1226, 1 189, 1 155, 1073, 990, 755; lH NMR (CDC13) ό '7.77 (1H, d), 7.67 (1H, m), 7.45- 7.10 (6H, m), 7.00 (2H? D), 5.93-5.80 (1H, m), 5.36-5.30 (1H, m), 4.63-4.24 (5H, m), 4.15-4.09 (1H, m)? 3.37-3.22 (1H, m), 2.98-2.74 (1H, m), 2.94 (3H, s), 2.70-2.47 (3H? M), 2.40-2.30 (1H, m ), 2.15-1.60 (5H, m), 1.42 (9H, s) 3 Calculations for analysis: C, 54.99; H, 6.15; N, 7.77; S, 4.45. Found 値: C, 54.60; H, 5.88; N, 7.49; S, 4.50. MS (ES +) 725 (19%), 720 (91), 703 (M + + 1, 74), 647 (76), 629 (100), 433 (78). [3S (1S, 9S) 3- [6,10-diketo-9-methanesulfonamido) -1,2,3,4,7,8,9, 10-octahydro-6H-da Benzene [l, 2-a] [l, 2] diazepine-1-carboxamido-keto- 5- (3-phenoxy + phenyloxy) valeric acid d), synthesized by a method similar to compound 216e, which can produce colorless powder (466 mg, 85%) ·· mp. 175-160eC; [α] Ό22 -99.3 ° (c 0.60, CH2C12); IR (KBr) 3335, 2978, 2937, 1728, 1669, 1584, 1525, 1487, 1444-1416, 1369, 1328, 1272, 1227, 1 188, 1 155, 989, 754; lH NMR (CDCi3) δ 7.82-7.77 (1H, m) , 7.66-7.65 (1H, m), 7.46-7.32 Employee Consumption Cooperation of the Ministry of Economic Affairs of the Ministry of Economic Affairs, Du Yin ¾ (4H, m), 7.26-7.10 (2H, m), 7.04-6.98 (2H, m), 5.68 (lH, d)? 5.37-5.31 (1H, m), 5.11 (1H, d), 5.02-4.88 (2H, m), 4.66-4.42 (2H, m), 3.35-3.17 (1H, m), 2.98-2.89 (1H, m), 2.96 (3H, s), 2.84-2.78 (1H, m), 2.72-2.47 (1H, m), 2.42-2.32 (lH, m), 2.14-1.58 (6H, m ), 1.43 (9H, s) a Analysis of the calculation of C ^ HwI ^ OnS 値 -570- The paper scale is applicable to the Chinese national standard plum (CNS) Μ Tegge (2 丨 〇, &lt; 297 public celebration) 1235157 Λ 7

V. Description of the invention (568)-: C, 56.56; Η, 5.75; Ν, 8.00. Measured, 値 · C, 56.36; Η · 5.82; Yi 7.71. MS (ES +) 723 (56%), 718 (90), 701 (NT + 1,36), 645 (100 "[3S (1S, 9S) 3- [6,10-diketo-9- (曱Alkylsulfonylamino) -1,2,3,4,7,8,9,10-octahydro-6H-daparo [l, 2-a] [l, 2] diazapine-1- Carboxylamido] -4-naphthyl-5 · (3-phenoxyfluorenyloxy) pentanoic acid (505d), synthesized in a similar manner to compound 217 to give a colorless foam (353 mg, 73%): mp 80-11 5C; [a] D23 -138 ° (c 0.11, MeOH); IR (KBr) 3327, 2937, 1728, 1666, 1584, 1529, 1487, 1443, 1413, 1328, 1273, 1227 · 1189, Member of the China Standards Bureau of the Ministry of Economic Affairs X Consumer Cooperatives, printed 1 155, 1 134, 989, 754; lE NMR (D6-DMSO) 0 '8.82 (1H, d), 7.76-7.72 (1H, m), 7.61-7.53 (2H, m), 7.48-7.32 (4H, m), 7.24-7.17 (1H, m), 7.11-7.06 (2H, m), 5.14O.06 (3H, m), 4.73-4.64 (1H, m ), 4.38-4.24 (2H, m) t 2.92 (3H, s), 2.89-2.61 (3H, m), 2.38-2.27 (1H, m), 2.19-2.06 (2H, m), 2.02-1.79 (3H , m), 1.63-1.52 (1H, m) a Analysis of CaHnNjOnS-O.SHzO calculation 値: C, 53.29;;, 5.09; N, 8.57; S, 4.90. Measured 値: C, 53.24; H, 5.14; N, 8.34; S, 4.86 ^ MS (ES +) 643 (M- 1, 100%), 385 (62) ^ [35,4 feet (15,95)] 5- (3-Ga4phen-2-methylamidinooxy) -3- (6,10-diketonyl -9-methanesulfonamido) -1,2,3,4,7,8,9,10-octahydro-6 ^ 1-tap_ [1,2, a] [l, 2] diazepine Hetero-p-carboxamido) -4-hydroxyvaleric acid tertiary-butyric acid (503) was prepared in a similar manner to compound 213e to give a white solid (70%): mp. 100-103eC; [a ] D25 -84.0 ° (c 0.05, CH2Ci2); IR (KBr) 3459-3359, 1722, 1664, 1514, 1368, 1328, 1278, 1247, 1155; lH NMR (CDCi3) ά 7.52 (1H, m ), 7.06-6.99 (2H, m), 5.69 _____- 571-_____ The paper standard is common Chinese national standard (CNS) A4 Tig (2 丨 0 \ 297); ^ 1 ^ &quot; 1235157 Λ 7 _ Β7 ___ five Description of the invention (569). (1H, d, J = 9.0), 5.23 (1H, m), 4.61-4.16 (6H? M), 3.36-3.19 (iH, m), 2.96 (3H, s), 2.67 -2.49, 2.42-2.32, 2.06-1.89. 1.69 (10H, 4m), 1.43 (9H, s). [3S (1S, 9S)] 5- (3-Azophen-2-aminoamineoxy) -3- (6,10 · diketo-9-methanesulfonamido) -1,2, 3,4,7,8,9,10-Octahydro-61 ^ Da [1,24] [1,2] Diazapyridine-1-carboxamido) -4-ketovalerate Tri-butyl ester (504e) was prepared according to the method of compound 216e, yielding a white solid (98%) · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ························· , 1668, 15 13, 1420, 1368, 1245, 1 155; ιΗ NMR (CDCl3) ^ 7.54 (1Η, d, J = 5.3), 7.18 (1Η, d, J = 7.18), 7.05 (1H, d, J -5.4), 5.42 (1H, d, J = 8.9), 5.25 (1H, m), 5.02 (2H, m), 4.96-4.87 (iH, m), 4.65-4.42 (2H, m), 3.34-3.17 (1H? M), 2.97-2.93 (1H, m), 2.97 (3H, s), 2.87-2.78, 2.73-2.50, 2.38-2.32, 2.13-1.8S, 1.69-1.60 (9H, 5m), 1.44 ( 9H, s) 0 Member of the China Standards Bureau of the Ministry of Economic Affairs v Yixianxian Cooperative Press (please read the precautions before completing this page) [3S (1S, 9S)] 5- (3- 气 S 苯- 2-methylfluorenyloxy) -3- (6,10-diketo-9-fluoransulfonamido) -1,2,3,4,7,8,9,10-octahydro-61 ^ Da [1,24] [丨, 2] Diazabenzene-1-carboxamido) -4-one Acid (505e). 217 (0.33 g, 0.51 mol) in anhydrous digas methane (3 ml) solution, cool to avoid water vapor (ice / water) 3 add trifluoroacetic acid (2 ml) while searching 3 keep the solution in the room After 2 hours at room temperature, the cooling bath was removed and concentrated under air. The residue was evaporated three times from digas methane, triturated with diethyl ether and filtered. The solid was purified by flash chromatography (silica gel, 0-6% methanol in digas methane) to give the product as a white glassy solid (0.296 g, 98 %): mp100-122 ° C; (a) D22 -163.5 ° (c 0.1, CH3OH); IR (KBr) 35 14-3337, 1726, 1664, ___- 572 Standard (CNS) A4 grid (2 丨 0 乂 297 mm) 1235157 B; V. Description of the invention (57〇) 1513, 1420, 1245, 1152, 1134, 990; '1U NMR (CD3OD) δ 7.79 (1H, d, J = 5.2), 7.12 (1H, d, J = 5.2), 5.20 (1H, m), 5.02-4.72 (2H, m, covered by H20), 4.59-4.32 (3H, m), 3.48- 3.29, 3.08-2.75, 2.50-2.41, 2.3 1-2.22, 2.08-1.89, 1.72-1.63 (1 1H, 6m)? 2: 95 (3H, s).

(Please read the precautions of Beunyun before filling in this one) O 0

Compound. R1 506a PhC (O)-507a 506b MeS (0) 2- 507b 506c MeOC (O)-507c 506g CH3C (0)-507g

Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs

[3 5 (15,95)] 3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-da And [l, 2-a] [l, 2] diazafluoren-1-carboxamido) -5-azo-4-ketopentanoic acid tert-butyl ester (506a). 212e (321 mg, 0.929 millimoles) -573- This paper scale is universal Chinese national standard plum (CNS) A4 Tige (2 丨 0 x 297 gong) 1235157 A7 __B7 _ V. Description of the invention (571) and ( 3S) A solution of 3-amino-5-azo-4-ketopentyl, tertiary-butyric acid (198 mg, 0.929 mmol) in dioxane (3 ml) was cooled to (TC, Add N, N-diisopropylethylamine (0.16 ml, 1.86 mmol) and 〇 (1Βί-benzotriazol-1-yl) -1,1,3,3-tetramethyl radium tetrafluoro Borate (3 28 mg, 1.02 mmol) was stirred overnight at S temperature, diluted with ethyl acetate and washed with 1M NaHS04 (x2), NaHC03 aqueous solution (X2), brine, and dried over sulphuric acid. Bath and evaporate. 3 Chromatography on silica gel and dissolving with ethyl acetate can produce 506a (425 mg, 85%) as a colorless foam: [yD23 -124.9: (c 0.2, CH2C12); IR (KBr) 3332, 21 1 1, 1728, 1658, 1532, 1421 · 1392, 1367, 1279, 1256, 1 155; lH NMR (CDC13) δ 7.82 (2H. M)? 7.49 (3H, m), 7.28 (1H, d, J = 9.3), 7.05 (1H, d, J = 7.3), 5.06 (1H, s), 5.18 (2H, m), 4.78 (1H, m), 4.62 (1H, m), 3.29 (1H , m), 3.08-2.79 (3H, m), 2.58 (1H, dd, J = 16.8, 5.6), 2.20-1.85 (4H, m), 1.70 (1H, m), 1.45 (9H, s) .MS (ES 勹 539.58 (M-1, 97.9%) 529.59 (100) ^ Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs [3S (1S, 9S)] 5-Azo-3- [6, 10- Diketo- (9-methylsulfenylpyridinyl) -1,2,3,4,7,8,9,10-octahydro-6 «^ Da 啩 [1,24] [1,2] Diazabenzene-carboxamido] -4-ketovaleric acid tert-butyl ester (506b), prepared in a similar manner to compound 506a. 74% yellow-orange solid: mp 75eC (decomposition); [Li] D20 -92.0 ° (c 0.036, CH2C12); IR (KBr) 3438, 2904, 21 13, 1728, 1669, 1523, 1368, 1328, 1 155; lH NMR (CDCi3) ά 7.48 (1H? D, J = 8.1), 5.83-5.68 (iH, m,), 5.55-5.50 (1H, m), 5.43-5.14 (iH, m), 4.83-4.45 (3H, m), 3.40-3.19 (1H, m) , 2.98 (3H? S), 2.92-2.30 (4H, m), 2.24-1.70 (6H, m), 1.43 (9H, s) ^ -574- The national standard (CNS) / \ 4See Luo （210 _ '&lt; 297 Public Transformers &gt; Consumption Cooperation between Employees of the Central China Enthalpy and War Bureau, Ministry of Economic Affairs 枉 1235157 Λ7 B7 V. Description of Invention (572) [35 (15,95)] 5-Azo -3- [6 10-diketone,-(9-methoxycarbonyl) amino-1,2,3,4,7,8,9,10-octahydro-6H-dapyrido [l, 2-a] [ 1,2] Diazabenzene-1-carboxamido] -4-ketovaleric acid tert-butyl ester (506c) was prepared in a similar manner to compound 506a. Can produce light yellow foam (405 mg, 82%): [to] 〇2 () -144 ° (c 0.2, CH2Ci2); IR (KBr) 3339, 2978, 2958, 21 12, 1728, 1674, 1530, 1459 , 1415, 1367, 1274, 1252, 1 154, 1063; lH NMR (CDC13) ά 7.23 (1H, d, J = 8.2), 5.51-5.31 (2H, m), 5.21-5.16 (1H, m), 4.77 -4.55 (3H, m), 3.68 (3H, s), 3.35-3.18 (1H? M), 3.04-2.51 (4H, m), 2.40-2.30 (1H, m), 2.09-1.66 (5H, m) , 1.45 (9H, s) 3 MS (ES +) 493. [3 5 (15,95)] 3- (9-acetamido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-da And [l, 2-a] [l, 2] diazepine-1-carboxamido) -5-azo-4-ketoacetic acid tertiary-butyl ester (506g), with similar compounds 506a. 81%: [a] D28, 146.7. (C 0.4, CH2C12); IR (KBr) 3438, 2904, 21 13, 1728, 1669, 1523, 1368, 1328, 1 155; NMR (CDCI3) δ 7.32 (1H, d), 6.43 (1H, d), 5.50 (1H, s), 5.22 (1H? M), 4.94 (1H, m), 4.77 (1H, m), 4.60 (1H, m), 3.24 (1H · m), 3.03-2.52 (4H, m) , 2.36 (1H, m), 2.10-1.64 (5H, m), 2.02 (3H, s), 1.45 (9H, s). Analysis C2 [Calculation of H20N6O7 値: c, 52 · 69; H, 6.32; N, 17.05, measured 値: C, 52 · 51; Η, 6.27; N, 17.36 3 MS (ES ') 477 (M +- i, 100%) 0 [3S (1S, 9S) 5-bromo-3- (9-fluorenylamino-6,10-diketo 10-octahydro-6H-daphne [l, 2- a] [l, 2] Diazapyridine · 1-Carboxylamino-M-ketovaleric acid third-butyl ester (507a) 3 506a (3.0 g, 5 55 mmol) in anhydrous -575-clothing The Chinese standard (CNS) is used in the standard scale (210X297 mm). (Please read the notes before reading the poem before filling in this f) Binding 1235157 A 7 B7 V. Description of the invention (573) Dichloromethane (40 ml) was cooled to 0 ° C, and 30% chlorobromic acid in acetic acid (1.1 ml, 5.55 mmol) was added dropwise over 4 minutes. The conjugate was removed for 9 minutes, and then carbonated. Suspension of sodium bicarbonate solution 3 The product was extracted with ethyl acetate, washed with aqueous sodium bicarbonate solution, brine, dried (MgS04) and evaporated to give 2.97 g (92%) of a colorless foam: 1>] D23 -82.3 ° (c 0.23, CH2C1,); IR (KBr) 3 3 33, 1726, 1659, 1530, 1458, 1447, 1422, 1395, 1368, 1279, 1256, 1222, 1 155, 728; ι Η NMR (CDC13) ο 7.81 (2Η, m), 7.50 (3Η, m), 7.11 (1Η: d, J-8.0), 7.01 (1H, d, J -7.4), 5.20 (2H, m), 5.00 (1H, m), 4.06 (2H, s), 3.28 (1H? M), 3.20-2.70 (4H, m), 2.42 (1H, m), 2.10-1.85 (4H, m), 1.72 (1H, m ), 1.44 (9H, s). Analysis of C26H33N4O7Br. 0.7H2O calculation: C, 51.35; H, 5.72; N, 9.24. Found: C, 51.55; H, 5.52; N, 9.09. MS (ES +) 595, 593 (M + + 1).

[35 (15,95) 5-bromo-3- (6,10-diketo-9-methanesulfonamido-1,2,3,4,7,8,9,10-octaargon-6H · Dageno [l, 2-a] [l, 2] diazapyrene-1 · carboxamido) -4-ketovaleric acid tert-butyl ester (507b), in a similar manner to compound 507a preparation. (68%) was an orange foam: | &gt;] D20 -135. (C 0.053, CH2C12); IR (KBr) 3429, 2944, 2935, 1723, 1670, 1458, 1408, 1327, 1225, 1154, 991; lH NMR (CDC13) δ 7.38 (1H, d, J = 8.2), 5.69 Central Standard of the Ministry of Economic Affairs, Printed by the China Bureau of Work and Consumer Cooperatives ¾ (1H, d, J = 9.3), 5.43-5.34 (1H, m)? 5.07-4.97 (1H, m), 4.70-4.42 (2H, m ), 4.12 (2H, s), 3.35-3.17 (1H, m), 3.10-2.69 (4H, m), 2.98 (3H, s), 2.43-2.33 (lH, m), 2.15-1.65 (5H , m). 1.43 (9H, s). Analyze the calculation of C20H31BrN4O8S 値: C, 42.3 3; H, 5.51; N, 9.87 a Measured 値: C, 42.69; H, 5.52; N, 9.97, -576 -____ This paper scale is applicable to Chinese national standard (CNS) ) Six 4 grids (210 乂 37 male cage) 1235157 A7 B7 V. Description of the invention (574) _ [3S (1S, 9S) 5-bromo-3- (6,10-diketo-9- (methoxy) Carbonyl) amino-1,2,3,4,7,8,9,10-octahydro-6 ^ -dapyrido [1,24] [1,2] diazapyridine Propyl) tertiary-butyl 4-ketovalerate (507c), prepared in a similar manner to compound 507a, can produce a light yellow foam (320 mg, 78%) ·· 〇] D20 -1072 (c 0 · 2, CH2Ci2); IR (KBr) 3401, 2956, 1726, 1670, 1528, 1452. 1415, 1395, 1368, 1276, 1251, 1155, 1064; lH NMR (CDC13) 0 '7.07 (1H, d, J = 7.6), 5.47 (1H, d, J = 8.1), 5.21-5.16 (1H, m)? 5.03-4.94 (1H, m), 4.75-4.56 (2H, m), 4.06 (2H? S), 3.69 ( 3H, s)? 3.31-3.13 (1H, m), 3.03-2.92 (2H, m), 2.81-2.58 (2H, m), 2.41-2.31 (1H, m), 2.10-1.66 (5H, m), 1.44 (9H? S) 3 [3S (1S, 9S)] 3- (9-acetamido-6,10-diketo-1,2,3,4,7,8,9,10, Octahydro-6 Statar [1,24] [1,2] Diazapyridine-1-carboxamido]] ′, tertiary-butyl 4-valerate (507g), prepared in a similar manner to compound 507a, but Formation of light yellow foam (84%): 〇] D22 -109.6. (C 0.1, IR (KBr) 3324, 1727, 1659, 1535, 1458, 1444, 1423, 1369, 1279, 1256, 1223, 1 155; lR NMR (CDC13) ά 7.12 (1H, d, j ^ Printed by the Consumers' Cooperative of the Ministry of Economic Affairs, China Standards Bureau, 7.8), 6.33 (1H, d, J = 7.5), 5.19 (1H, m,), 4.97 ( 2H, m), 4 58 (1H, m), 4.06 (2H, s), 3.20 (1H, m), 3.05-2.69 (4H, m)? 2.35 (IH, m), 2.14-1.68 (5H, m ), 2.03 (3H, s), 1.44 (9H, s) ^ ^ ^ C21H31BrN407.0.0.3H20 calculation: C, 46.99; H, 5.93; N, 104. Found 値: C, 46.97; Η, 5.90; N, 10.35. _____ · 577- This paper is in ft scale. It is a common Chinese g family standard. (CNs) A4 Tiege (2 丨 0: &lt; 297 liters) 1235157 A7 B7 V. Description of the invention (575) 0

508a, b 0

284, 285

Economy 邡 r 夬 Green 'Quasi- Bureau employee consumer cooperative printed [3S (1S, 9S)] 5- (2,6-digas fluorenyloxy) -3- [6,10-diketo-9- ( Methoxycarbonyl) amino-1,2,3,4,7,8,9,10-octahydro-6 ^ 1-pyrido [1,24] [1,2] diargin-1- Difenyl] -4-ketobutyrate tertiary-butyl ester (5.08a) 3 to 506c (547 mg, 1 mmol) in a solution of DMF (4 ml), potassium carbide added (145 mg, 2.5 millimoles, 2.5 equivalents). After stirring for 10 minutes at room temperature, 2.6 -...-Qimujia § ^ (229 Ai'er '2 · molar, I, equivalent) 3 After reacting at room temperature for 3 hours, ethyl acetate was added (30 ml of the solution was washed with a saturated aqueous solution of sodium bicarbonate (30 ml) and brine, dried over MgS04 and concentrated in vacuo to yield 590 mg (90%) of light yellow bubble almond qa] D22-85. (C 0 · 20, CH2Cl2); IR (KBr) 3400, 2956, 1737, 1675, 1528, 1434, 1414, 1368, 1344, 1272, 1197, 1 152, 1061; [Η -578- 大 咴 汝 尺度 定 月 月 China National Standard Leather (CNS) A4 Tiger (210 × 297 mm) 1235157 B; V. Description of the invention (576) NMR (CDC13) d 7.36-7.33 (3H, m), 7.04 (1H, d, J = 8.0), Please read the meaning of memorization and then fill in page 5.46 (1H, d, J =: 7.8), 5.19-5.16 (1H, m), 5.08 (2H, AB)? 4.97-4.55 (1H, m), 4.69- 4.55 (2H, m), 3.68 (3H, s), 3.30-3.10 (1H? M), 3.01-2.50 (4H, m), 2.40-2.33 (1H, m), 2.15-L60 (5H, m)? 1.44 (9H, s). Analysis (: calculation of 2 # 34〇121 ^ 4〇10 値: C, 51.15; H, 5.21; N, 8.52, measured 値: C, 51 · 35; H, 5.32; N, 8.56 / [3 3 (15,93)] 5- (2,6-dichlorofluorenyloxy) -3- [6,10-diketo-9- (methoxycarbonyl) amino-1,2 , 3,4,7,8,9,1 0-octadecane-6H-dapyrolo [l, 2-a] [l, 2] diazapyridine-1-carboxamido] -4-pyrene Valproic acid (284), synthesized from 508a, using the method of preparing 505 from 504, to produce 330 mg (65%) of white solids: mp. 115. (: (decomposition); 0) D20-107 ° (c 〇.2, CH2C12); IR (KB〇3340, 2954, 1738, 1664, 1530, 1434, 1272, 1198, 1 148, 1060; ικ NMR (d6-DMSO) ά 8.91 (1Η, d, J = 7.2Η), 7.67-7.63 (3Η, m), 7.54 (1Η, d, J = 8.0), 5.24 (2H, s), 5.20-5.15 (1H, m), 4.79 · 70 (1H, m), 4.46 -4.37 (2H, m), 3.58 (3H, s), 3.33-3.20 (1H, m), 2.94-2 · 55 (4H, m), 2.30-1 · 60 (6H, m). Analyze C24H26C12N4〇1 (calculation of TH20: C, 46.54; H, 4.56; N, 9.05 3 Measured: · C, 46.36; H, 4.14; N, 8.88. Employees of the bidding bureau of the Ministry of Economic Affairs Cooperating with Dufun [35 (15,95)] 5- (2,6-dimethylfluorenyloxy) -3- [6,10-diketo-9- (fluorenyloxycarbonyl) amino -1,2,3,4,7,8,9,10-octahydro-6 ^ 1-daphno [1,24] [1,2] diazapine-1-carboxamido]- 4-ketovaleric acid tertiary-butyl ester (508b) is prepared by a method such as 508a compound, which can generate a light yellow foam (460 mg, 82%): | &gt;] D22 -115 ° (c 0.20, CH2C12); IR (fCBr) 3413, 2960, 1729, 1675, 1528, 1514, 1461, 1421, 1368, 1265, 1 1 16, 1096; -579- The size of the paper method is applicable to the Chinese National Standard (CNS) A4 (210X297) ) 1235157 V. Description of the invention (577) (Please ask your friends to fill in this book after reading the will of Yun Yun) lH NMR (CDCI3) δ 7.27-7.03 (4Η, ϊη), 5.48 (1Η, d, J = 8.2 ), 5.20-5.14 (1H, m), 5.04 (2H, AB), 4.93-4.86 (1H, m), 4.80-4.56 (2H, m), 3.77 (3H, s), 3.22-3.15 (1H, m ), 3.00-2.56 (4H, m), 2.37 (6H, s), 2.19-1.77 (5H, m), 1.45 (9H, s), 2. 41-2.25 (1H, m). MS (ES +) 617. [3S (1S, 9S)] 5- (2,6-dimethylfluorenyloxy) -3- [6,10-dialkyl -9- (fluorenyloxycarbonyl) amino-1,2,3,4,7,8,9,10-octahydro-611-fluorene "and [1,24] [1,2] diazapine -1-Carboxamidine is synthesized according to the group] -4-ketovaleric acid (285) in a similar manner to compound 284, and a white solid (303 mg, 78%) can be formed: mp. 1103C (decomposition); l &gt;] D20 -128. (C 0 · 10, CH2C12); IR (KB〇3339, 2958, 1731, 1666, 1529, 1420, 1266, 1248, 1115, 1070; [H NMR (d6-DMSO) δ 8.90 (lH, d , J = 7.4), 7.54 (1H, d, J = 7.9), 7.36-7.28 (1H, m), 7.17-7.14 (2H, m), 5.19-5.15 (3H, m), 4.84-4.74 (1H, m), 4.45-4.37 (2H, m), 3.59 (3H, s), 3.45-3.25 (1H, m), 2.95-2.64 (4H, m), 2.35 (6H, s), 2.30-1.60 (6H, m) 3 analysis (: 26% 2 乂 〇1 (). ^ 12〇 calculation 値 · c, 53 · 98; H, 5.92; N, 9.6 measured 値: C, 53.50; H, 5.52; N, 9.49. MS (ES +) 559 »Employees of the China Central Standards Bureau, Ministry of Economic Affairs, Cooperation and Printing

O

O

510a, 280, 283, SlOd. -580 Paper (210x 297 ^ ®) 1235157 V. Description of the invention (578) Compound 509a 510a 509b 280 509c 283 S09d 51〇d

R

(Please read the precautions on the back first, fill in this I} • Binding [3S (1S, 9S)] 3- (9- ^ 醯 Amino-6,10-diketohydrogen-6H-Da 啩 and [ l, 2-a] [l, 2] diazepine-p-carboxamide) 0- (2-Arylpyrazole) -4-ketovaleric acid (510a) a 506a (2.27 g, 4.2 mmol) Moπ) In a solution of Yinshang digas methane (50 ml) in the Consumer Cooperative of the Shenyang Biaoju Bureau of the Ministry of Hot Water Economy, take 30% hydrobromic acid in acetic acid (1.84 pen liters, 9.2 millimoles, 2.2 equivalents) at Treated at 0 ° C under nitrogen. After stirring at 0 ° C for 10 minutes, the reaction can be far completed, and a white solid is crystallized in the medium. 3 The solid is filtered off and washed with ethyl acetate and diethyl ether. 2 20 brothers (100%) of [3S (1S, 9S)] 5-bromo-3- (9-octylamino-6,10-diketonyl 1,2,3,4,7,8,9 , 10-Octahydro-6H-Da-Chen [l, 2-a] [l, 2] diazepine-p-carboxamido) -4 · ketovaleric acid, can be used without further purification: lH NMR DMSO) ά 8.87 (1Η, d, J = 7.3), 8.63 (1H, d, J ^ 7.6), 7.91- -581-Standard SS standard (CNS) for paper size. A4 is now available (210 x 297) Cage> 1235157 Λ7 _B7 V. Description of the invention (579)

7.87 (2H? M), 7.60-7.44 (3H, m), 6.92 (1H, bs)? 5.14-5.09 (1H m), 4.92-4.65 (2H, m), 4.43 (2H, AB), 4.41 -4.35 (1H, m), 3.33-3.22 (1H, m), 2.98-2.90 (1H, m), 2.89-2.57 (2H? M), 2.35-2.15 (3H, m), 1.99-1.91 (2H, m), 1.75-1.60 (2H, m). A solution of concentrated ketone (5 35 mg, 1 mmol) in anhydrous DMF (10 ml) was treated with potassium gas (150 mg, 2.5 mmol, 2.5 equivalents) under nitrogen. After stirring at room temperature for 5 minutes, 'mercapto, sedazole (140 mg, 1.2 mmol, 1.2 equivalents) β was added overnight. After overnight reaction, ethyl acetate (150 ml) was added and the organic solution was washed with brine, and sulfuric acid Dry over magnesium and deflate. The residue was crystallized from dioxin, filtered and purified on silica gel using a gradient of MeOH (0% 0%) in digas methane. Evaporation yields 3 44 mg (60%) of a white solid: mp. 90-95Ό (decomposed); l &gt;] D20 -82 ° (c 0.2, CH2Cl2); IR (KBr) 3328, 2941, 1745, 1659, 1535 , 1422, 1276, 1255, 1223, 1072; lH NMR (D6-DMSO) δ 8.92 (1H, d, J = 7.6), 8.68 (1H, d, J = Printed by the Consumers' Cooperatives of the China Prospective Bureau, Ministry of Economic Affairs ¾ 7.6), 7.98-7.90 (2H, m), 7.75-7.67 (1H, m), 7.64-7.50 (4H, m), 5.22-5.18 (1H, m), 4.95-4.74 (2H, m), 4.58 ^ 4.38 (3H, m), 3.5 · 2-3.19 (1H, m), 3.05-2.65 (4H, m), 2.40-1.50 (6H, m). Analysis of C25H27N504S2.H20 calculation: C, 50.75; H, 4.94; N, 11.84. Found 値: C, 51.34; H, 4.70; N, 11.58. MS (ES +) 572. [3S (1S, 9S)] 3- (9-; amido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-daphine Benzene [l, 2-a] [l, 2] diazepine-l-carboxamido) -4-copperyl (phenylphenyl-1,4-tetrazol-5-thio) valeric acid tert-butyl Ester (509b). 507a (100 mg, 0.17 mmol) in anhydrous metformamide (1.5 ml) with phenylphenyl 1H-tetrazole 0-thiol (33 mg, 0.187 mmol) and potassium fluoride (丨5 mg, ___- 582-___ This paper has the same size as the Chinese national standard (CNS M4 specification (210X297)) 1235157 Λ7 B7 V. Description of the invention (580) 0.34 mmoles. The mixture is at room temperature. Stir for 2 hours, dilute with ethyl acetate, wash with sodium bicarbonate aqueous solution (X2), brine, and dry (MgS04) (read the back side) · t t%, then fill in and buy 3 products flash chromatography on the gel Purification and dissociation with ethyl acetate g yielded 103 mg (88%) of a colorless foam: [Pan] 02.92 2. (C 〇 丄 ch2C12); IR (KBr) 3334, 1726, 1660, 1528, 1501, 1417, 1394, 1368, 1279, 1253, 1 155; lK NMR (CDC13) ά 7.82 (2H, m), 7.60- 7.40 (8H, m), 7.39 (1H, d, J = 8.1), 7.05 (1H, d, J == 7.3), 5.26 (1H, m), 5.15 (1H, m), 4.99 (1H, m), 4.60 (2H, m), 4.30 (1H, d, J = 17.2H), 3.32 (1H, m), 3.10-2.75 (4H, m)? 2.40 (1H, m), 2.24 (1H, m), 1.90 (3H, m), 1.75 (1H, m), 1.44 (9H, s)? MS (ES +) 691.47 (M + + 1). Printed by the Central Government Bureau of Sample Paint, Consumers and Consumers Cooperatives [3S (1S, 9S)] 3- (9-benzylamido · 6,10-diketo-1,2,3,4,7,8 , 9,10-octahydro-6H-pyrido [l, 2-a] [l, 2] diazapyridine-1-carboxamido) -4-daiminyl (buphenyl-1H-tetra Azole-5 · thio) valeric acid (280), synthesized from 504 and 505, 509b (98 mg, 0.142 mmol) in digas methane (1 ml), cooled to (TC, then added trifluoro The acetic acid (1 ml) 3 mixture was stirred for 15 minutes at χ, and 30 minutes at room temperature, and then evaporated under reduced pressure. The residue was triturated with toluene and evaporated, and chromatographed on silica gel with 10% methanol. Dissolved in methane gas to form a colorless glass, which crystallizes from methane gas / diethylhydrazine to produce 62 mg (69%) of a colorless solid ·· mp · 145eC (decomposed); [a] D2] -80 9〇 (c 0.1, CH2C12); IR (KBr) 3400, 1727, 1658, 1530, 1501, 1460, 1445, 1416, 1280, 1254; lH NMR (CDCI3) ό 8.00 (1H, m), 7.79 (2H , d, J = 6.7), 7.58-7.30 (9H, m), 5.25 (2H, m), 4.94 (1H, m), 4.53 (2H, m), 4.35 (1H, m), 3.35 (1H,-- 583- This paper's standard is applicable to Chinese national standard (CN S) A4 (210X 297 mm) 1235157 Λ7 B7 V. Description of the invention (581)

m), 3.01 (3H, m), 2.73 (1H, m), 2.38 '(1H,>), 198 (4H, m), 1.64 (1H, m). Analyze the calculation boundary of C29H30N8O7S.0.2TFA: c,]. 71; H, 4.63; N, 17.04. Measured 値 ·· c, 53 · 97; H, 4.92; N, 16.77 3 MS (ES, 633.55 (M, 1) 3 [3S (1S, 9S)] 3- [9-fluorenylamino-6 , 10-diketo-1,2,3,4,7,8,9,10 &quot;, Ar-6H-dapyrido [l, 2-a] [l, 2] diazepine Benzylamino]: 4-benzyl- (3-amidinyloxy) phosphonium tertiary-butyl ester (509c), prepared in a similar manner except for compound 50, which can yield a colorless glass (34%): 0] d22 -77.1 ° (c 0.25, CH2C12); IR (thin film) 3311, 1724, 1658, 1603, 1578, 1536, 1488, 1458, 1426, 1368, 1340, 1279, 1256, 123 1, 1 155, 707; lH NMR (CDC13) ά 8.29 (2H, m), 7.84 (2H, m), 7.48 (4H, m), 7.22 (3H, m), 5.20 (2H, m), 4.90 (2H, m), 4.58 (1H , m), 3.29 (1H, m) t 3.20-2.70 (4H, m), 2.38 (2H, m), 1.96 (4H, m), 1.68 (1H, m), 1.42 (9H, s) ^ MS ( ES +) 608.54 (M + 1) 3 [3S (IS, 9S)] 3- [9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9, 10-octahydro-6H-dapyrido [l, 2-a] [l, 2] diazapyridine-1-carboxamido] · 4-pyridyl-5- (3-pyridyloxy) Valeric acid (283), prepared by a similar method to compound 280, can produce colorless foam (100%): mp. ~ 125 ° C ; 〇] D19 -84.1 ° (c 0.K 20% MeOH / CH2Cl2); IR (KBr) 3401, 1736, 1663, 1538, China-China Bureau of Ministry of Economic Affairs, Consumer Consumption Copies, 1489, 1459, 1425, 1281, 1258, 1200, 1 134; lH NMR (CD3OD / CDCI3) ά 8.38 (2H, m), 7.84-7.40 (8H, m), 5.16 (4H, m), 4.80 (1H, m), 4.56 (1H , m), 3.50 (1H, m), 3.12 (2H? m), 2.82 (2H, m), 2.37 (lH, m), 2.10-1.65 (5H, m) ^ Analyze the calculation of C27H29N5O8-0.4H2O 値: C, 51.77; Η, 4.61; Η, 4.61; N, -584-wood. ¾¾-scale universal Chinese national standard twin (CNS M4 present grid (Ox 297)) 1235157 Λ7 _Β7 _____ V. Description of the invention (582) 10 · 41 »Measured 値 ·· C, 52.19; Η, 4.93; N, 9.99. [3 5 (15,95)] 3- [6,10-Diketo-1,2,3,4,7,8,9,10-octahydro-9- (phenylcarbonylamino) -6Η -Da (1,2-a) [1,2] Diazapyridine-1-Epiaminoamido l · 4 · copperyl-5- {2- [4 (3H) -pyrimidinone]} 戍Acid tert-butyl ester (509d), synthesized in a similar manner to compound 509b, yielded a colorless solid (49.6 mg, 82%): lH NMR (CDCi3) δ 8.02 (1Η, s), 7.95-7.86 ( 1H, m), 7.84-

7.76 (2H, m), 7.62-7.35 (4H, m), 7.22-7.07 (1H, m), 6.43 (1H, d), 5.26o.08 (2H, m), 5.03-4.72 (3H, m) , 4.66-4.50 (1H, m), 3.43-3.19 (1H, m), 3.15-2.97 (1H, m), 2.86-2.72 (3H, m), 2.48-2.31 (1H, m), 2.18-1.60 ( 6H, m), 1.43 (9H, s) ^ [3S (1S, 9S)] 3- [6,10-diketo-1,2,3,4,7,8,9,10-octahydro- 9- (phenylcarbonylaminopyrido [l, 2-a] [l, 2] diazafluorene · 1 · carboxylic acid group] -4-copperyl · 5- {2- [4 (3Η) -Pyrimidinone]} valeric acid (510d) was synthesized by a similar method to compound 280, which can produce a colorless solid (25.7 mg, 57%): mp · 140-8CTC; IR (KBr) 3391, 2945, 1733, 1664, 1530, 1422, 1363, 1277? 1259, 1204; lH NMR (CD3OD) ά 8.23 (1H, s), 7.94 (1H, d), 7.87 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (2H, d), 7.54 -7.42 (3H, m), 6.48 (1H, d), 5.22-5.15 (1H, m) t 4.57-4.46 (1H, in), 3.620.41 (1H, m), 3.22-3.13 (1H, m) , 3.02-2.81 (2H, m), 2 · 7 (M.80 (6H, m). Analysis of the calculation of C26H28N60.3 · 5 · 20Η: C, 54.30; H, 5.35; N, 14.61. Measured 値: C 54.14; H, 5.35; N, 13.04 〇MS (ES +) 55i (M-1, 100%) 3 C26H29N6〇8 (Μ ΒΓ) accurate mass calculation 値 · 553.2047. Measured 値: 553.2080. __ · 585-This paper is suitable for S country materials (CNS) New York grid (21GX297 public φ) 1235157 A7 B7 V. Description of the invention (583)

504f-h SOSf, 280b, 283b Compound R 504f 505f 504g 280b Q, and l / 504h 283b &quot; G. Please read the precautions on the back before filling in the seal of the Consumers ’Cooperative of the Central Bureau of Standards, Yiyibei Ministry of Economic Affairs ¾ [3S (IS, 9S)] 5- (3-Gas-2-fluorenyl-4H-pyrido [1,2-a] pyrimidin-4-one) -3- [6,10-diketo-9 -(Methylsulfonyl) amino-1,2,3,4,7,8,9,10-octahydro-611-dapyrido [1,24] [1,2] diazapyrene- 1-Carboxamido] -4-ketovaleric acid (505f), similar to compound 508a, using 507b and 3-gas-2-hydroxy-4 ^^ ratio to cross and [1,2-3] ° ^ Yodo-4-Ming and direct fresh water with trifluoroacetic acid 50 ^, can produce brown powder (65 mg, 30%) ·· [a] D20 -128 ° (c 0.10 -586- Standard (CNS) 8 4 gauge (210 ,, &lt;: 97 mm) 1235157 Λ7 _BT_ __ 5. Description of the invention (tear)

MeOH); IR (KBr) 3414, 2928, 1667, 1527, 2459, 1407, 1328, 1274, 1153, 1 134; [H NMR (MeOH) ά 9.35 (1Η, d, J = 6.6H), 8.34 (1H, t, J = 7.2H), 7.99-7.95 (1H, m), 7.76-7.69 (1H, m), 5.85-5.45 (3H, m), 5.30-5.21 (1H, m), 4.93-4.66 (2H, m), 3.81-3.65 (1H, m), 3.66 (3H, m), 3.45-2.52 (4H, m), 2.52-1.71 (6H, m) 3 DJ Hlasta et al., J. Med. Chem. 1995, 38, 4687- 4692-[35 (15,95)] 3- (6,10-Diketo-9-methanesulfonamido-1,2,3,4,7,8,9 , 10-octahydro-6H-dalopano [l, 2-a] [l, 2] diazapyridine-carboxamido) -4 · keto-5- (1-phenyl-1 ^ 1-tetrazol-5-thio) valeric acid third-butyl ester (5043), prepared in a similar manner to compound 509b, (83%) showed a colorless foam: 〇] D23 · 112.7s (c 0.2, CH2CI2) ; IR (KBr) 33 12, 1726, 1668, 1501, 1413, 1395, 1369, 1328, 1276, 1254, 1 155; lH NMR (CDC13) δ 7.59 (5H, in), 7.48 (1H, d, J = 8.0), 5.68 (1H, d, J = 9.0), 5.37 (1H, m), 4.95 (1H, m), 4.62-4.31 (4H, m), 3.36 (1H, m), 2.98 (3H, s) , 2.88 (4H, m), 2.66 (1H, m), 2.42 (2H, m), i.98 (1H, m), 1.75 (1H, m), 1.43 (9H s). Printed by the Consumers' Cooperatives of the China Standards Bureau, Ministry of Economic Affairs [3S (1S, 9S)] 3- (6,10-diketo-9-methanesulfonamido · 1,2,3,4,7,8 , 9, 10-octahydro · 6Η · Da ([i, 2-a] [l, 2] diazepine-1-carboxamido) -4-one-5- (1-phenyl -1H-tetramethyl-5-meryl) valeric acid (208b), prepared by a method similar to compound 280 (100%), can produce colorless foam: mp. 120〇3C; [PAN] D25 -112.4 ° (c 0.1 , CH2Ci2); IR (KBr) 3328, 1730, 1664, 1529,

1501, 1410, 1328, 1277, 1219, 1 153, 1 134, 991; lH NMR (CDCI3) ά 8.07 (1H, d, J = 7.8), 7.58 (5H, s), 6.41 (1H, d, J- 587- This paper is commonly used in the standard of guilt (CNS) A4 (ZIOXZW mm) 1235157 Λ / 5. Description of the invention (58S) = 9.5), 5.32 (1H, m), 5.04 (1H, m) , 4.70 (1H, d, J = 17.5), 4.60 (3H, m), 3.50-2.9 (3H, m), 2.98 (3H, s), 2.45 (2H, m), 2.06 (4H, m), 1.68 (1H, m) 3 [3S (1S, 9S)] 3- (6,10 · diketo-9-methylsulfonamido-1,2,3,4,7,8,9, 10- Octahydro-6H-daphtho [l, 2-a] [l, 2] diazepine-1-carboxamido) -4-one group 0- (3-pyridyloxy) valerate Tributyl ester (504h) was prepared by a method similar to compound 509b (24%) as a colorless foam: o] D23 -101.0. (C 0.2, CH2C12); IR (KBr) 3330, 1727, 1669, 1425, 1396, 1369, 1328, 1276, 1256, 123 1, 1 155, 1 137, 991; lH NMR (CDCi3) ά 8.28 (2H, br d, J = 9.4), 7.7i (1H, d, J = 7.9), 7.22 (2H, s), 6.03 (1H, d, J = 9.4), 5.36 (1H, m), 4.95 (2H, m ), 4.52 (2H, m), 3.29 (1H, m), 3.07 (3H, s), 3.23-2.75 (3H? M)? 2.66-2.35 (2H, m), 2.3 (Μ · 60 (5H , m), 1.42 (9H, s). [3S (1S, 9S)] 3- (6,10-diketo · 9-methanesulfonamido-1,2,3,4,7, 8,9, 10-octahydro-6H-dalopano [l, 2-a] [l, 2] diazepine · 1-carboxyamido) -4-one · 5- (3-pyridine Alkoxy) valeric acid (283b), prepared in a similar manner to compound 280, (100%) was a colorless foam. Mp. 120-5X :; [Pan] D25-85.2. (C 0.1, CH30H / CH2C12); IR (KBr) 3337, 1738, 1667, 1 560, 1457, printed by the Consumers' Cooperatives of the Central Sample Bureau of the Ministry of Economic Affairs (read the intention of the father and read the δ, then fill in this f) 1424, 1326, 1317, 1278 , 1258, 1200, U89, 1 1 50, 1 133, 991; aH NMR (CDCi3 / CD3OD) ά 8.35 (2H, m), 7.54 (2H, m), 5.32 (2H, m), 4.83 (2H, m ), 4.45 (2H, m), 3.43-2.77 (4H, m), 2. 97 (3H, s), 2.42 (2H, m), 2.05-1.72 (5H, m). -588-The size of this paper is applicable to the Chinese national standard (CNS) A4 Tiege (2! 0 乂 297 male cage) 1235157 Λ7 B7

V. Invention Description (586)

Compound R 508c 511c, X) 508d 28Qc o 508e 283c &quot; Ό. Printed by the Consumers' Cooperatives of the Bureau of Samples in the Ministry of Economic Affairs [3 $ (13,95)] 3- [6,10-Difluorenyl-9- (Methoxy) amino.1,2,: &gt;, 4,7,8,9, 10-octahydro-6ί-da-pyrido [l, 2-a] [l, 2] diaza Fluorenyl-carboxamidoamino 5- (2 · mercaptopyrimidine) -4-keto-pentanoic acid tert-butyl ester (508c), prepared in a similar manner to compound 509b, yields 544 mg (9) %) Of light yellow foam: 0] d20 -86 ° (c 0.19, CH2C12); IR (KBr) 3426, 2947, 1725, 1669, 155 1, 1418, 1383, 1253, 1 155, 1064; lH NMR ( CDCl3) ό 8.49 (2H, d, J = 4.8), 7.13 (1H, d, J = 7.9), 7.03-6.98 (1H, m), -589- Paper scales are generally made in China National Standard Leather (CNS) A4 Present (210 X 297 male cage) 1235157 Μ Printed by the Consumers' Cooperative of the Ministry of Economic Affairs of the Ministry of Economic Affairs ¾ 7 _B7_____ V. Description of the invention (587) 5.47 (1H, d, J = 7.9), 5.23-5.19 (1H, m ), 5.09-5.01 (1H, m), 4.84-4.51 (2H, m), 4.04 (2H, AB), 3.69 (3H, s), 3.38-3.19 (1H, m), 3.06 -2 · 64 (4H, m), 2.40-1.76 (6H, m), 1.43 (9H, s), analysis C25 Calculation of H34N608S 値: C, 51.89; H, 5.92; N, 14.52 3 Found: C, 51.49; H, 6.04; N, 13.87 3 MS (ES +) 579, [3S (1S, 9S)] 3- [6,10-diketo-9- (methoxycarbonyl) amino-1: 2,3,4,7,8,9,10-octahydro-611-dapyrido [1,24 ] [1,2] Diazapyridine-carboxamido] -5- (2-mercaptopyrimidine) -4-ketopentanoic acid (511c), prepared in a similar manner to compound 280, can produce 370 mg ( 79%) white foam: mp. 105'C (decomposed); [c] D22 -94 ° (c 0.20, CH2C12); IR (KBr) 33 16, 3057, 2957, 1724, 1664, 1252, 1416, 1384 , 1254, 1 189, 1063; lH NMR (D6-DMSO) δ 8.85 (1H, d, J = 7.8), 8.62 (2H, d, J = 4.7), 7.53 (1H. D, J = 8.0), 7.28 -7.23 (1H, m) t 5.21-5.17 (iH, m), 4.87-4.79 (1H, m), 4.47-4.35 (2H, m), 4.23 (2H, AB)? 3.58 (3H, s), 3.30 -3.21 (1H, m), 2.95-2.50 * (4H, m), 2.35-1.60 (6H, m) ^ Analyze the calculation of C2lH26N60sS * H20 値: c, 46.66; H, 5.22; N, 15.55 ^ Measured 値: C, 46.66; H, 5.13; N, 15.07. MS (ES +) 523, (ES +) 521. [3S (1S, 9S)] 3- [6,10-diketo-9- (methoxycarbonylamino) -12 3 4 7 8 9, 10-octahydro-6H-thalco [1,2 -a] [l, 2] diaza leather · 1-carboxamido) -4-one-5--5- (5- (phenylphenyltetrayl) thio) thio] valerate tert-butyl ester (5 〇8d), synthesized in a similar manner to compound 509b to produce a colorless solid (269 mg, 87%): mp. 80-11 (TC; [PAN] 〇23-i〇8. (C 〇〇〇, ch2C12 ); IR (BCBr) 3315, 2977, 1727, 1688, 1527, 1501, 1458, 1418, 1368, 1279. 1250, (please read and read the following first :; χ Italian matter and then fill out this one-pack l · Order% ___-590-This paper is applicable to the national standard (CM) 297 (Guangzhou) 1235157 A: B1 V. Description of the invention (588) Please read KK 1 1155, 1064; lH NMR (CDC13) ^ 7.70 (1H, d), 7.63-7.53 (5H, m), 5.84 (1H, d), 5.34-5.27 (1H, m), 5.05-4.92 (lH, m), 4.78-4.54 (3H , m), 4.38 (1H, d), 3.66 (3H? s), 3.37-3.19 (1H, m), 3.07-2.94 (1H, m), 2.91-2.82 (2H, m), 2.71-2.56 (1H , m)? 2.40-2.30 (1H, m), 2.19-2.13 (1H, m), 2.08-1.68 (4H, m), 1.42 (9H, s). MS (ES +) 667 (31%), 6 45 (NT + 1,100), 589 (62). [35 (15,95)] 3- [6,10-diketo-9- (methoxycarbonylamino) -1,2,3,4 , 7,8,9,10 -octazine-6H-, answer to σ well and [l, 2-a] [l, 2] · — hetero Zhuo-1-jiminamido 4-fluorenyl · 5 · [5- (1-phenyltetrazolyl) -thio] valeric acid (280c), synthesized in a similar manner to compound 280, can produce a light cream-colored solid (203 mg, 85%): 0 ^ 10: 5-130eC ; (a) D22 -235 ° (c 0.11, MeOH); IR (KBr) 3342, 295 1, 1727, 1667, 1529, 1501, 1459, 1416, 1276, 1252, 1192 · 1062; lH NMR (D6-DMSO ) δ 8.89 (1H, d), 7.69 (5H, s), 7.50 (1H, MW, Ministry of Economic Affairs, Central Standards Bureau, Consumer Consumption Cooperation, Du Printing, d), 5.180.11 (1H, m), 4.79-4.69 ( 1H, m), 4.57 (2H, s)? 4.42 · 4.32 (1H, m), 3.54 (3H, s), 2.92-2.63 (3H, m), 2.21-1.82 (5H, m), 1.65-1.57 ( 1H, m). MS (ES +) 587 (M · 1,100% "[3S (1S, 9S)] 3- [6,10-diketo-9- (methoxycarbonylamino) -1,2,3,4, 7,8,9,10-octaargon-6H · Da-Phen [l, 2-ani, 2] diazapyridine-1-carboxamido] -4-one group 0- (3-pyridyloxy Tert-butyl acetic acid (508e), synthesized in a manner similar to compound 509b, can produce a light orange solid (199 mg, 25%): mp 80-120eC; [a] D23 -89 ° (c 0.51 , CH2C12); IR (KBr) 3333, 2978, 1726, 1669, 1578, 1536, 1478, 1426, 1368, 1277, 1253, 123 2, Π55, 1064; lH NMR (CDC13) ό S.41-8.18 (2H , m), 7.81 (1H, d), 7.26-7.20 (2H, s), 5.91 (1H, d), 5.24-5.16 (1H, -591-This paper's standard is applicable to Chinese National Standard (CNS) A4. 2 丨 0X297 male) 1235157 A 7 _B7_ V. Description of the invention (589) m), 5.07-4.86 (3H, m), 4.81-4.51 (2H, m), 3.67 (3H, s), 3.34-3.16 (1H , m), 3.10-2.81 (3H, m), 2.72-2.54 (1H, m), 2.41-2.31 (1H, m), 2.07-1.62 (5H, m), 1.47 (9H s). MS ( ES spoon 562 (M + + 1, 100%), 506 (38)-[3S (1S, 9S)] 3- [6,10-diketo-9- (methoxycarbonylamino) -1,2, 3,4,7,8,9, 10-octahydro-6H-da- [ -a] [l, 2] diazapyridine-1-carboxypyretyl] -4-one-5- (3-pyridyloxy) pentanoic acid (283c), synthesized in a similar manner to compound 280, Can produce white powder (167 mg, 98%): mp 9 CM 05 &quot; C: [Not] D22 -106. (C 0 · 11, MeOH); IR (KBr) 3325, 3070, 2956, 1669, 1544 , 1423, 1256, 1 199, 1133, 1062; LH NMR (D6-DMSO) δ 8.95 (1H, d), 8.45-8.20 (2H, m), 7.53-7.45 (3H, m), 5.19-5.08 (3H , m), 4.70-4.62 (1H, m), 4.41-4.30 (2H, m), 3.53 (3H, s), 2.92-2.68 (3H, m), 2.22-2.06 (2H, m), 1.95-1.82 (2H, m), 1.63-1.53 (1H, m). MS (ES +) 506 (M + + 1, 100%).

O O

Printed bags of the Consumers' Cooperatives of the Central Procurement Bureau of the Ministry of Economic Affairs _________ -592-This condition is suitable for financial CNS) A4, Secret (21QX: 97 Public Holiday 1 1235157 Λ7 B7 V. Description of the invention (590) Compound R 512a Q 280d 、 SAr 512b 283d Ό (Please read the precautions of Back Cloud 3 before filling in this page and install [3S (1S, 9S)] 3- (9-Ethylamino-6,10-diketo-1,2, 3,4,7,8,9,10-octahydro-6H-da-phen [l, 2-a] [l, 2] diazapyrene-1 · carboxamido) -4-ketobenzene Butyl-1H-tetrazolyl-thio) valeric acid tert-butyl ester (512a), prepared in a similar manner as compound 509b, can produce (83%) a colorless foam: l &gt;] D23 -129 · 6. (C 0.1, CH2C12); IR (KBr) 3326, 1726, 1664, 1531, 1501, 1444, 1415, 1394, 1369, 1279, 1254, 1 156; ^ NMR (CDC13) δ 7.59 (5Η, s), 7.37 (1Η, d , J-7.9), 6.38 (1H, d, J = 7.4), 5.27 (1H, m), 4.98 (2H, m), 4.58 (2H, d, + m), 4.28 (1H, d, J -17.2 ), 3.28 (1H, m), 3.10-2.65 (4H, m), 2.31 (2H, m), 2.03 (3H, s), 2.10-1.72 (4H, m), 1.48 (9H, s). [35 (15,95)] 3- (9-ethynyl-6,10-dicopperyl-1,2,3,4,7,8,9,10-octahydro-6H-daphne [l , 2-a] [l, 2] diazepine-1-carboxyamidoamino M-keto-5- (1-phenyl-1fluorene-tetrazole-5-thio) valeric acid (280d) Prepared in a similar way as compound 280, which can produce (77%) colorless foam: k] D22 -93.3 ° (c 0.1, CH2Ci2); IR (KBr) 33 16, 1728, 1659, 153 1, 1501, 1415, 1341, -593- This paper wave is also applicable to the Chinese S® Family Standard Twin (CNS), \ 4 dead grid U10X297 times. Ordering of the consumer cooperation cooperation of the China Central Standards Bureau of the Ministry of Economic Affairs DU 1235157 Λ 7 B7 V. Description of the invention ( 591) 1278, 1253, 1222, 1 185; lE NMR (CDC13) (ί 8.05 (1Η, d, J = 7.9), 7.57 (5H, br s), 5.30 (1H, m), 5.01 (2H, m) , 4.70-4.10 (4H, m), 3, 40_2.85 (4H, m), 2.62 (lH, m), 2.33 (lH, m), 2.27-1.65 (5H, m), 2.01 (3H, s) . [3 5 (13,95)] 3- (9-Ethylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octazine-6H · L * Irido [1,2-a] [1,2] Digas [1,2-diamino] -4-copperyl-5 · (3-pyridyloxy) valeric acid tert-butyl ester ( 512b), prepared by a method similar to compound 509b, which can produce (9%) colorless foam: IR (KBr) 3333, 1727, 1661, 1542, 1427, 1369, 1279, 1257, 1232, 1 156: lH NMR (CDC13) ^ 8.30 (2Η, m), 7.20 (3Η, m), 6.45 (1H,, d, J = 7.4), 5.17 (lH, m), 4.91 (3H, m), 4.55 (lH, m), 3.27 ( lH, m), 3.14- 2.70 (4H, m), 2.41 (1H, m), 2.04 (3H, s), 2.10-1.64 (6H, m), 1.44 (9H, s) Ministry of Economic Affairs tb · Yang [35 (15,95)] 3- (9-Ethylamino-6,10-diketo-1,2,3,4,7,8,9,10 -Octahydro-6H-dalopano [l, 2-a] [l, 2] diazapyridine-1-carboxamido) -4-one o- (3-pyridinyloxy) pentane Acid (283 d), prepared in a similar manner to compound 280, (100 //) as a colorless foam: 〇] D22 -106.0. (C 0.2, CH30H / CH2C12); IR (κΒγ) 33 12, 1735, 1664, 1549, 1426, 1279, 1258, 1200, 1135; lK NMR (CDCi3) ά 8.27 (2H , m), 7.46 (2H, m), 5.09 (1H, m), 4.79 (3H, m), 4.47 (1H, m), 3.40 (1H, m), 3.30 · 2.70 (3H, m), 2.54 (1H, m), 2.30 (lH, m), i.98 (3H, s), 2.05- 1.65 (4H, m BU-594- The paper size is suitable for China S furniture (CNS) A4 lacquer (210X297 male acid) 1235157 Λ7 B7 ¾ Printed by the Consumers' Cooperative of the Chinese Provincial Bureau of Procurement and Quarantine of the Ministry of Economic Affairs Ⅴ. Description of the Invention (592)

245b · 24Sb [1S, 9S (2RS, 3S)] 9-benzylamido-N- (2-benzyloxy-5-brenzyltetrahydrofuran · 3-yl) -1,2,3,4,7, 8,9,10-octahydro-1O-keto-6 ^ 1-dapyrido [1,24] [1,2] diazapyridine-1-carboxamide (245b), prepared from (1S ， 9R) 9-benzylamidoamino group 1,2,3,4,7,8,9,10-octahydro-10-keto-61 ^ da [1,24] [1,2] di Azapyridine-1-carboxylic acid, using method 245, can produce 416 mg (85%) of about colorless foam (~ 1: 1 diastereoisomeric diisomeric mixture): IR (KBr) 3392, 3302, 2942 , 1792, 1642, 1529, 1520, 1454, 1 119; lH NMR (CDC13) δ 7.79 (2Η, m), 7.51 ^ 7.09 (10Η, m), 5.52 (0.5H, d, J = 5.3), 5.51 ( 0.5H, s), 5.36 (1H, m), 4.84 (1H, m), 4.74-4.59 (1.5H, m), 4.51 (iH, m), 4.38 (0.5H, m), 3.22-2.83 (5H , m), 2.51 (1H, m), 2.25 (2H, m), 2 · 01 · 1 · 46 (6H, m). Analyze the calculation of C23H32N406. 0 · 75Η20. 値: C, 62.97; H, 6. · 32; N, 10.49 3 Measured 値: C, 63.10; Η, 6.16; N, 10 · 2. MS (ES +) 521 ( M + 1,100%) 0 [35 (15,95)] 3- (9-benzylamidoamino1,2,3,4,7,8,9,10-octahydro-61 ^ tower Pyrene [l, 2-a] [l, 2] diazepine small carboxyamido) -4-ketobutanoic acid (246b) 'Preparation __ -595- _ This paper is suitable for SS furniture Rate (CNS) A4 (2) 〇χ 297 males while taking 1 (please read the 5 of the prophet: / JS. Please fill in this note) Note. Order 1235157 A7 87 V. Description of the invention (593) Since 245b, Using the 246 method, 104 mg (33%) of white powder can be generated: mp. 115-119eC; 〇] D24 -19.8. (C 0.2, MeOH); IR (KBr) 3293, 2944, 1786, 1639, 1578, 1537, 1489, 1450, 1329, 1 162, 1 124; lH NMR (CD3OD) &lt; S 7.85 (2H, d, J = 7.0), 7.49 (3H, m), 5.49 (1H, m), 4.55 (1H, m ), 4.30 (2H, m), 3.40 (1H, m), 3.19-2.89 (3H, m), 2.63 (2H, m), 2.16-1.81 (5H, m), 1.60 (3H, m). Analyze the calculation of C2iH26N406.H20: C, 56.24; H, 6.29; N, 12.49 3 Found: C, 56 · 54; H, 6.05; N, 12.29. MS (ES +) 4 29 (Μ-1, 100%). Compounds 513a-j were prepared as follows. Please read the notes below and then write Ά 〇

Printed Compound R 513a 513a-l 513a_2 513b 513b-l KD -596- The standard of this paper is applicable to the national standard of China (CNS) A4 (2 丨 0, &lt;: ^ public (%) 1235157 A 7 B7 V. Description of the invention (594) 513b-2 K3 513c. &lt; 3〇513d v〇X) 513β &gt; 〇X) 513f S13f-1 ··· ~ 513f-2 &gt; ° x / (旖 Precautions for reading the back cloud first 云 Fill in this f) DuPont Print

-597- SS standard paper used in the ft scale of this paper (CNS M4 Tige (: 丨 0 A H97 mm) 1235157 Λ7 B7 V. Description of the invention (595)

0

〇

(Please read this matter before going back to the cloud before filling in this f) Ingo (2RS, 3S) 3- (allyloxycarbonyl) amino-2- (2-benzene Ethoxy) -5-ketotetrahydrofuran (513a), prepared by the method of compound 513d / e, can produce a mixture of non-paraisomeric stereoisomers (670 mg, 50%) as an oil: IR (KBr) 3331 , 2946, 1790, 1723, 1713, 1531, 1329, 1257, 1164, 1120, 1060, 977, 937, 701; lH NMR (CDCi3) ^ 7.36-7.18 (5H, m), -598 China National Standards (CNS) A4 division (210X297 mm) 1235157 S? Printed by the Employees' Cooperatives of the China Economic and Social Council * Λ7 B7 V. Description of the invention (S96) 5.99-5.83 (1H, m), 5.41 -5.34 (2H, m), 5.28-5.18 (2H, m), 4.59-4.56 (2H, m), 4.32-3.96 (2H, m), 3.85-3.73 (1H? M), 3.02-2.76 (3H, m), 2.49-2.34 (1H, m) ^ (2 RS, 3 S) 3- (associated dioxo) amino-2-cyclopentyllactyl-5-steel-based tetrahydrobitan (5 13b) , Prepared by the method of 5 13d / e to produce 8 g (5 1%) of the non-parallel Li-Isomer complex, in the form of a clear oil · · 〇] D20 · 13 ° (c 0.25, CH2C1,); IR (KBr) 3325, 2959, 2875, 1790, 1723, 1535, 1420, 1328, 1257, 1 120, 1049, 973? 937; lH NMR (CDCi3) ό 6.02-5.80 (1H, m), 5.53-5.46 (2H, m) , 5.37o.21 (2H, m), 4.58 (2H, d? J = 5.5), 4.50-4.46 (0.5H, m). 4.34-4.25 (1H, m), 4.19-4.12 (0.5H, m) T 3.06-2.77 (1H, m), 2.53-2.35 (1H, m), L85-1.50 (8H, m). Analysis C13H19N05i Calculated 値: C, 57 · 98; H, 7.U; N, 5.20 3 Measured 値: C, 56.62; H, 7.22; N, 4.95. MS (ES +) 270 ο (2R, 3S) 3-propanylaminoamino-2- (nitrogen and 2-yllactyl) -5-isopropyltetrahydrool (513c), with compound 513 d / e method, a single isomer (20%) was formed as a light yellow oil a [ubiquitous] 〇24 -63.1 ° (c 0.2, CH2C12); IR (thin film) 3338, 2948, 1791, 1723, 1529, 1421, 1330, 1253, 1122, 984, 929, 746; lH NMR (CDCl3) d 7 · 20 (4H, m), 5.87 (IH, m), 5.61 (1H, d, J = 5 · 4) , 5.33〇 · 10 (2H, m), 4.70 (1H, m), 4.56 (3H, m), 3.33-3.19 (2H, m)? 3.10-2.94 (2H, m), 2.81 (1H, dd , J = 8.3, 17.3), 2.43 (1H, dd, J = 10.5, 17.3) ^ (2R, 3S) 3-allyloxycarbonylamino-2-oxo-5-one-tetrahydrofuran ( 513d) trans (2S, 3S) 3-allyloxycarbonylamino-2-benzyloxy-5-keto-tetrahydrofuran (5l3d / e), via Chapman Biorg. &Amp; Med. Chem. Lett., 2, ρρ · 615- -599-Applicable to Chinese house logo (CNSM4 condition 珞 (210X297mm) ~ (Please read the intent on the back before filling in this page) Order 1235157

AT

3T V. Invention Description (597)

618 (1992). After t-acetic acid extraction and NaHCOy ^ extraction, the product was dried (MgS04), dried and evaporated to form an oil, which contained the product and the alcohol. Add hexane (200 ml) (200 ml of hexane per 56 g of AllocAsp (Co2tBu) CH2OH), stir the mixture and cool overnight 3 This can form an oily solid. For chromatography. The oily residue was dissolved in ethyl acetate and evaporated to form crystalline, which was crystallized from 10% ethyl acetate / hexane (~ 500 ml). Solid filtration can produce 513d (12.2g ^ 19%): mp. 108-110Ό; [a] D24 + 75.72 ° (c 0.25? CH2CI2); IR (KBir) 3361, 1778, 1720, 1517, 1262, 1236, 1222 , 1 135, 1 121, 944, 930, 760; NMR (CDC13) i 7.38 (5H, m), 5.90 (1H, m), 5.50 (1H, s), 5.37 (0.5H, m), 5.26 (2.5 H, m), 4.87 (1H, ABq), 4.63 (3H, m), 4.31 (1H, m), 3.07 (1H, dd), 2.46 (1H, dd). Analysis of the calculation of C15H17N05: C, 61.85; Η, 5.88; N, 4.81. Measured 値: C, 61.85; Η, 5.89; N, 4 · 80 a Member of the sample rate bureau in the Ministry of Economic Affairs, X Xiaot cooperation signature ¾ (please read the precautions on the back before filling in this purchase) The liquid is mixed and evaporated An alcohol (~ 200 g) was formed. Hexane / ethyl acetate (9: 1, 100 ml) was added and the product was purified by chromatography, and then dissolved with 10% ethyl acetate / hexane to remove excess; alcohol, and then digas methane / Hexane (1: 1 with 10% ethyl acetate). This generates 513e, containing some 513d (20.5 g, 32%): mp. 45-481; | &gt;] D24 -71.26s (c 0.25, CH2C12); IR (KBr) 3332, 1804, 1691, 1536, 1279 , 1252, 1125, 976. lH NMR (CDC13) d 7 · 38 (5H, m), 5.91 (1H, m), 5.54 (1H, d, J-5.2), 5.38 (3H, m); 4.90 (1H, ABq); 4.60 (4H , m), 2.86 (1H, dd), 2.52 (1H, dd). C15H17N5S. 0.1H2O analysis 値: C, 61.47; Η, 5.91; N, 4.78. Measured 値 ··, C, 61.42; Η, 5.88; N, -600-This paper 伕 standard is applicable to the SS family standard puppet (CNS with 4 cells (210X 297 Gongcheng) 1235157 Λ7 ________B7___ 5. Description of the invention (598) 4.81- '(2RS, 3R) 3- (allyloxycarbonylamino) -2-ethoxy-5-ketotetrahydrofuran (513f), prepared by the method of 513d / e, can produce a colorless oil (152 Mg, 79%): IR (thin film) 3334, 2983, 2941, 1783, 1727, 1713, 1547, 1529, 1422, 1378, 1331, 1313, 1 164, 1 122, 1060, 938; lU NMR (CDC13) ά 6.090.82 (2Η, m), 5.50-5.18 (3H, m), 4.64-4.54 (2H, m), 4.27-4.16 (1H, m), 3.95-3.78 (1H, m), 3.73-3.56 (1H , m), 3.05-2.77 (1H, m), 2.56-2.37 (1H, m), 1.35-1.17 (4H, m) a Calculation of Cl0H15NO5 analysis: C, 52.40 ;, 6.60; N, 6 · 11: Measured by the Chinese Ministry of Economic Affairs, China ’s Husband and Workers ’Bureau, Consumers’ Cooperatives ¾ (Please read ^ 1. Please read the precautions for δ before filling in the clothes f)

: C, 52 · 16; H, 6.62; N, 5.99. MS (ES 勹 229 (M + + 1,100%). (3S, 4RS) 3- (allyloxycarbonylamino) -4-hydroxyo- (2-phenoxyfluorenyl) acetic acid Third · Butyl ester (513g). 4-Diamidopyridine (76.0 mg, 622 mmol) was added to 2-phenoxyphosphonium (579 mg, 2.49 mmol) and 517 (600 mg, 2.07) 3 moles) in a solution of pyridine (10 ml). 3 The mixture was quenched at room temperature for 18 hours, then brine (25 ml) was added and extracted with ethyl acetate (30 X 2.5 ml). The organic extract was washed with 1M brine (3 X 25 ml), saturated aqueous sodium bicarbonate solution (2x25 ml) and brine (25 ml), dried (MgS04) and concentrated. The light orange oil was lumped by flash column chromatography (1-10% acetone / digas methane) produces 447 mg (44%) of colorless oil: IR (thin film) 3375, 2980, 1721, 1712, 1602, 1579, 1514, 1484, 1451, 1368, 1294, 1250 , 1234, 1 161, 1137, 1081, 754; lHNMR (CDCi3) d 7.98 ^ 7.93 (1H, m), 7.50-7.41 (1H, m), 7.35-7.25 (2H, m) t 7.22-7.03 (3H, m), 6.95 (3H, d), 5.95-5.76 (1H, m), 5-57 (1H, d), 5.30-5.13 (2H, m), 4.51 (2H, d) t 4.25 (2H? d), -601-This paper size is in accordance with China National Standard Car (CNS) A4 specifications (210 乂 297 mm) 1235157 A 7. __B7_ 5. Description of the invention (599). 4.18-4.04 (1H, m), 3.88 (1H, m), 3.50 (1H, m), 2.51 (2H, m), 1.41 (9H, s)-MS (ES +) 508 (57%), 503 (76), 486 (M ^ + 1, 45), 468 (27), 412 (100). Accurate mass calculation for C26H32N08 (MIT) 値: 486.2128. Found 48: 486.2158. (3S, 4R) (N-allyloxycarbonyl) -3-amine 4-Hydroxy-5- (1-methylformamyloxy) tert-butyl valerate (513h), prepared from (3S, 4R) (N-allyloxetyryl) -3-amino Tertiary-butyl 4,5-dihydroxyvalerate, yielding 562 mg (85%) of a colorless oil a IR (thin film) 3418, 2980, 1722, 171 1, 1512, 1368, 1278, 1245 , 1198, 1157, 1139; lH NMR (CD3〇D) ά 8.90 (1Η, d, J = 8.6), 8.21 (1Η, dd, J = 1.2, 7.3), 8.04 (1Η , d, J = 8.2), 7.89 (1H, dd, J = 1.5, 7.9), 7.67-7.46 (3H, m)? 5.88 (1H, m), 5.49 (1H, d, J = 9.0), 5.35- 5.18 (2H, m), 4.57-4.46 (4H, m), 4.19 (2H, m), 2.67 (2H, m), 1.40 (9H, s). Analysis C24H29N07t calculates 値: C, 65.00; Η, 6.59; N, 3.16. Measured 値: C, 64 · 74; Η, 6.56; N, 3.09. M.S (ES +) 466 (M + Na, 100%), 444 (M + 1, 39), 388 (4). (3S, 4RS) 3- (allyloxycarbonylamino) -4-hydroxy-5- (3-phenoxyfluorenyloxy) tert-butyl valerate (513i), synthesized by the method of compound 513g , Can produce colorless oil (569 mg, 85%): IR (thin film) 3400, 1723, 1712, M. Central Ministry of Economic Affairs, Ministry of Economic Affairs, Employee Consumption Cooperation , 1 190, 1 161, 1098, 1074? 995, 755; lH NMR (CDCi3) ^ 8.65-8.59 (iH, d), 7.84-

7.66 (2H, m), 7.45-711 (5H, m), 7.05-6.97 (2H, m), 6.00-5.78 (1H, m), 5.54-5.14 (2H, m), 4.62-4.52 (2H, m ), 4.42-4.32 (2H, m), 4.08-4.22 (2H, m), 2.78-2.47 (2H, m), 1.44 (9H, s) 3 MS -602- ____ This paper is a universal standard in the national standard of SI (CNS) M inverse (2 [0X 297 mm) 1235157 Α7 B7 V. Description of invention (600) (ES +) 508 (100%), 486 (M + + 1, 33C26H32N08 (MH +) accurate mass calculation 値: 486.2128 Measured 値 486.2121. (3S, 4RS) 3- (allyloxycarbonylfluorenyl) -4-hydroxy 0- (5-methyl-3-phenylisoxazolylmethylfluorenyloxy) valeric acid Tertiary-butyl ester (513j), synthesized by the method of compound 513g, can produce light orange oil (905 mg, 91%): IR (thin tincture) 3418, 3383, 2980, 1722, 1711, 1601, 1517, 1450 , 1424, 1368, 1308, 1252, 1154, 1100, 994, 767, 698; NMR (CDC13) ά 7.62- 7.55 (2Η, m), 7.51-7.42 (3H, m), 5.98-5.76 (1H, m) , 5.33-5.18 (2H, m), 4.53 (2H, d), 4.18 (2H, d), 3.91 (1H, m), 3.80 (1H, m), 2.76 (3H, s), 2.50 (2H, m), 1.43 (9H, s). Analysis of the calculation of C24H30N2O8.0.5H2O 値: C, 59.62; H, 6.46; N, 5.79. Found 値: C, 59 · 46; H, 6.24; N, 5.72. MS (ES +) 497 (100%), 475 (M + + 1, 15), 419 (48), ( Please read back &amp; notes before filling out this page)-Binding and ordering.

-603- Standard Chinese Standard Twin (CNS) Α4 Tige (210 × 297 mm) 1235157

AT B7 V. Description of Invention (601).

(3S, 4R) 3-Usaminodimethyldimethyldicarbazone) valeric acid tertiary butan (514), according to H. Matsuaaga, et al. Tetrahedron Letters 24, ρρ 3009-3012 (1983) Prepared by the method, it is a pure non-block Lili isomeric form (60%), and it is oily: l &gt;] D23 -36.9 ° (c 0.5, digas radon); iR (thin film) 2982, 2934 , 1726, 1455, 1369, 1257, 1214, 1 157, 106S: lH NMR (CDC13) c) '7.31 (5H, m), 4.10 (1H, q, J = 6.0), 4.05 · 3.75 (4H, m), 3.10 (1H, q, J = 6.0), 2.40 (2H, m), 1.42 (9H, s), 1.40 (3H, s), 1.34 (3H, s) ^ _ (3S, 4R) 3- (Amine group after dioxygenation) -4,5- (dimethylmethylmonolactyl) penta second-butyl ester (516). 514 (302 g, 9.00 mmol) and 10 ° /. ? (1 / (: (300 mg) was stirred in ethyl diacetate (30 ml) under hydrogen for 2 hours. 3 The suspension was passed through a Ceiite filter (and a 0.45 mm filter membrane), and the filtrate was concentrated to give a colorless oil 515 (2 · 106 g, 95%), can be used without further purification. Oil (1.93 g '7.88 mmol) is dissolved in water (10 ml), and then added with I · 4 · dihumane and sodium hydrogen phosphate (695 (Mg, 8.27 mmol), a mixture was cooled to 0 * C, and then allyl pivalate (1.04 g, 919 ml, 8.66 mmol) was added dropwise after 3 hours, and the compound was extracted with ether (2 X 50 Ml). The mixed ether extract was washed with water (2 x 25 ml) and brine (25 ml), dried (MgS04), and concentrated to produce a colorless Ministry of Economic Affairs, China Standards Bureau staff. Du Yinshang { Please fill in the notes of δ before filling in this I) oil. Flash chromatography (10-35% ethyl acetate / hexane) can produce a colorless solid solution (2.69 g, 95%): mp. 64-5Ό [PAN] d2j -21. (C 1.00, CH2Cl2); IR (KBr) 3329, 1735, 1702; ιΗ NMR (CDCl3) ^ 6.00-5.82 (1Η, m), 5.360.14 (2Η, m), 542 (1Η, s)? 4.56 (1H, d)? 4.40-4.08 (2H, m), 4.0 3 (1H, m), 3.70 (1H, m), 2.52 (2H, m)? 1.44 (12H, 2 xs), 1.33 (3H, s); analysis of Cl6H27NO〆 calculation: C, 58.34; _-604- __ This paper is suitable for Chinese S Standards (CNS), * \ 4 dyke (210X 297 mm) 1235157 A 7 B7 V. Description of the invention (602)

H, 8, 26; Ν, 4.25. Measured 値: C, 58, 12; Η, 8.16; Ν, 4.19; MS (+ FAB) 320 (M ++ 1, 41%), 274 (70), 216 (100 ”(please first闳 Read the notes on the reverse side and fill in this 萸) (3 S, 4R) 3- (allyloxycarbonylamino) · 4,5-di # to tert-butyl valerate (517). 516 (2.44 G, 7.41 mmol) in 80% aqueous acetic acid (25 ml), stirred at room temperature for 24 hours, concentrated and azeotroped with methylbenzyl (2 x 25 ml). The residue was treated with brine (25 Ml), and then extracted with ethyl acetate (2 X 25 ml). The organic fractions were dried (MgS04) and concentrated to produce a colorless oil. Flash chromatography (20-80% ethyl acetate / digas methane) yielded colorless (1,99 g, 90%) ·· mp · 74ol; 〇] D25 -1.3. (C 1.0, CH2C12); IR (KBr) 1723, 1691; ι NMR (CDCi3) ά 6.02-5.78 (2Η , m), 5.35-5.16 (2Η, m), 4.55 (2Η, d), 4.16-4.04 (2H, m), 2.76 (2H, s), 3.56 (2H, m), 2.56 (2H , M), 1.43 (9H, s). Analysis of the calculation of C13H23N06 〇 · C, 53 · 97; H, 8.01; N, 4.84 a Measured 値 · C, 53.79; H, 7.88; N, 4.81; MS (+ FAB) 290 (NT + 1, 44%), 2 34 (100), Example 30 Compounds 1105-1125 were prepared as follows. The physical data of these compounds are listed in Table 24. Printed by the Economic Order of the Central Government Bureau of the Consumer Consumption Cooperative ¾ ____- 605 -__---- 1235157 A: B7 V. Description of the invention (603) Printed by the Ministry of Economic Affairs, Central Standards Bureau, Off-line Consumer Cooperatives

First read the li on the back |! Fill in% of this book 1 • 606-This paper size uses Chinese National Standard (CNS) '* \ 4 now (210x 297 mm) 1235157 A7 B7 V. Description of Invention (604 Economy Co-operation with employees of the Ministry of Standards and Standards Bureau Du Yinzhuang

+ -1 X σ \ CVJ 〇ιΠ, vr vo r) tr &gt; d Mu 豸 0 W h4 〇4 X rH CN ^ 5 &amp; rH fi a \ s-m rH 3: bu • a \ bu 00-&lt; N r-1 ID Ct4 s CO GO s 2 rH CSi 3; σ \ rH o QD s 2 cva X &lt; n CM U Race XOX. Introduce.工 工 'z X o ^ yp 0 〇 = Q = 〇 mx 〇 ^ M ^ cP,: 2 X γ>. • Oi o tH r-4 ω o r-4 rH -607- (Precautions for reading poems before reading the clouds and filling in too much) 1235157 Λ7 B7 V. Description of the invention (605) Employees of the Central Bureau of Standards, Ministry of Economic Affairs Cooperative Du Printing

S CM rH Shouto &lt; Ti CM tn r * v〇CvJ L〇〇4 X fH CNJ fH rH CN t-4 o rH 2 S κο bt— &lt; LO bcn o • m bm 〇wn C &amp; IS 〇rH sz cn CVi rn CNJ CM CJ a \ S 2 m CNJ X CNJ CNl CJ a \ 〇uO 2 uO CVJ S CNJ ca U 鸯. Section 1 〇 = Q = o. O ^ zx 〇 ^^ yO ° 〇 ^ s ^ 〇 • φ 〆〇OX 0 = ^ = 0 CA: o ^ y &gt; ° &quot; X) ^ 3 as 〇tH rH o « Η tH tH r- »rH tH rH -608-Paper &amp; Standard Common S National Standard (CNS) A4 Presentation (2 丨 0X 297 mm) I) 1235157 A: B7 V. Description of Invention (606) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

+ ^! X cvj m m wn.: L〇iH m tn 〇 X fH -S port ° &quot; rH r-4 r—4 1 o uO cn ro to n CTk r * 〇uO tu X o rH 〇 »R &gt; 2 CNJ rc CM CJ g L 2 rH CJ VO CN cvj CM CJ O = 0 = 0. Sand = Industrial S2 X 〇 ^ N ^ 〇 ♦ \ ο CN fH tH «m« Η rH rH (please first a. Read the back of the cloud, Jiang Yi matters jade: fill in, as much as possible) -609- Paper flower scale Applicable to China National Standards (CNS) A4 Tige (210X 297 male f) 1235157 Λ7 B V. Description of the invention (607) Sample of the Ministry of Economic Affairs. Consumption cooperation seal of employees of the quasi bureau ¾

(Please read the back of the cloud: the meaning of vi, and then fill out this one) The standard of this rogue is the Chinese national standard (CNS &gt; grid (210X 297 mm) 1235157 Λ / Β7 V. Description of the invention (608) + SN 十 Η) ss 8 · 8ες 8 · 8ες The Ministry of Economic Affairs wins the bid for the cooperation with the staff of the China Bureau Du printed

UW ^ 〇 4 re rH 3 IT) t—4 CM rH ^ S · S iH rH 3: S GO L〇rH in m in L〇rH ID C3U X &lt; Ti s CM s CO CM U 00 s Nano CN 35 &lt; r &lt; NU 5. Service rwzx O ^^ yO〇N2 X \ ° ^ γ °.. Γ VO t-4 «Η rH bl rr rH rH (Xu. 3 first read the back of the cloud &gt; 1 intention and then fill in too \ shell) -611 -This is a full-size GM China National Sample Car (CNS) A4 Tiege (BOX 297 mm> 1235157 A, 87 V. Description of the invention (609 printed by the staff of the Central Bureau of Samples of the Ministry of Economic Affairs, China) ¾

+ CO ^ S 〇 \ 03 CO cn CNi om Φ / -V uw 〇4 S ΓΟ »H CN rH rH 3: 2 rH L〇ID VO L〇 Tu X Γ- s 2: iH Γ0 3: tH CM CJ 〇 〇to 2 cn m C \ JU Sai O :, 〇 = 〇 = 〇ΓΚΧ 〇 ^^ Y〇 °, z X 〇 = 0 = ° rw 〇 ^ V °° N2 r C? ♦ 00 rl rl tH C \ rH tH rH -612- The size of this paper is applicable to the Chinese National Standard (CNS) grid (2 丨 0X 297 mm) (please read and read the meanings of the back of the cloud to fill in and buy everything) 1235157 A737 V. Description of the invention (610) Printed by the Consumer Cooperatives of the Central Bureau of Standards and Technology of the Ministry of Economic Affairs

+-、 CO 5 S ro BU ^ 3 · m BU Oi tn 〇4 X rl VO 艺?-Fl 5 s VD rH fj rH s S rH ⑦ CN CM m BU Γ〇 om Cft4 s CO Ο ^ -4 U ΓΟ CM X —— · sz to CM X CN 8 1 r · ^ CNJ CJ \ &gt; lu Sx 〇 = ο = ° ox 0 = Q = ° / -Λ / χ 〇ί 〈Η ° c ^ c: 2: X ” o 'X rvx 、 (P ♦ ¥ o (N rH tH Oi • H rH (please read the notes of S first and fill in this f)) 613- This paper method is common in China National Sample (CNS) A4 (210 乂 297 mm) 1235157 Λ7B7 V. Description of the invention (611) Du Yinfu, Consumer Co-operation and Cooperation of Employees in the Bureau of the Ministry of Economic Affairs

cn ^ uO uO CV4 tO r * in ί Ή CJ w Οι 3: Csi S · π o 1-H 0 &quot;) 00 oo a \ in o r-4 AS 2 L〇iH om 〇l〇 &lt; NJ to iD CS4 X ss rH S CNJ CJ 〇rH 〇2 CM 22 Co CM U o = {^ = 〇. Press: Industrial δ X 〇 = Q = 〇〇 \ ί &lt;a; x3 &lt; N CN4 rH iH η οι rl rH (please pay attention to the notes of reading 5 before filling in this book) -614- this paper &amp; Applicable standard: Chinese National Standard (CNS) A4 (210: &lt; 297 mm) 1235157 Wuming Instructions 2 61

f / 7Λ B Consumption cooperation between employees of the Central Standards Bureau of the Ministry of Economic Affairs · Du Yin ¾

CO LO VD ID U ^ 〇4 X m tH (T \ L〇a \ a \ 00 o 3: 2 cn in m K〇in uO m L〇Cu X r-4 tl S Nai CM 22 cut CM U CD .〇L〇2 CN rH 〇CO CNJ X rH CM U 5 H: ▼ 0-0 o% XXOX 〇 = / V = o% r 〇P 9, X TP &lt; N rH «Η m CVJ rH -615- (Please read the meaning of the back of the cloud before filling in the page)

The ft scale of this paper is applicable to China National Standards (CNS) six 4 flying grid (2 丨 0X297 mm) 1235157 A7 B7 V. Description of the invention (613)

Step C 1103 (Please fill in the ^ lilfVB's precautions before filling in the clothing) Printed by the Consumer Affairs Department of the Central Government Bureau of the Ministry of Economy

ο

1105-1125 Step A. Synthesis of 401. TentaGel S® NH2 resin (0.25 millimoles / -616-this paper method is applicable to China National Standard (CNS) M (2 丨 0 乂 297mm) 1235157 Ministry of Economic Affairs, China Standard Technology Bureau, staff consumer cooperatives Print ¾ A7 B7 V. Description of the invention (6U), 5.25g) Put in a porous glass shaker and container, and then wash with dimethylacetamide (3x15ml compound 400 (1.36g, 2.3mmol) ) Dissolved in DMA (10 ml), then added 0-benzotriazole-N, N, N ,, N, tetramethylbin hexafluorophosphate (HBTU; 0.88 g, 2.3 mmol) and DIEA (0.8 ml, 4.6 mmol) 3 solution was transferred to the resin, 5 ml of DMA 3 reaction mixture was added and stirred at room temperature for 1.5 hours, filtered with a wrist arm shaker 3 resin and washed with dimethylacetamide (4 X 15 ml). Step B. Synthesis of 1102. Resin 401 was deprotected with 20% (v / v) hexahydropyridine / dimethylacetamide (15 ml) for 10 minutes (shock) and then fresh Hydropyridine reagent (15¾ liters) was washed for 10 minutes, β-fat was washed with dimethylacetam (6 X 15 ml), and then washed with N-methylpyrrolidone (2 X 25 ml). Compound 1101 (0.979 g, 2.11 mmol) was dissolved in dimethyl ethylamine (8 ml), followed by HBTU (0.81 g, 2.1 mmol) and DIEA (0.75 ml, 4.3 mmol), and The solution was added to the resin, followed by dimethylethane (4 ml). The reaction mixture was stirred at room temperature for 2 hours, and the resin was operated like a 401 with a wan arm shaker to produce 1102. Step C. Synthesis of 1103. This compound was prepared from Resin 1102 (0.040 mmol), using Advanced ChemTech 396 Multiple Peptide Synthesizer 3, the resin was included in the automated cycle, and washed with dimethomethamine (2 X 1 ml), Deprotection with 25% (v / v) hexahydro sigma / metformidine (1 ml) for 3 minutes, and fresh reagent (1 ml) for 10 minutes to produce resin 1103 3 resin with dimethyl Tetracycline (3 X 1¾ liters) and N-fluorenyl σ bilo bite (3 X 1 ml) were washed. Resin 1103 was treated with 0.4M carboxylic acid and 0.4M 〇ΟΒΤ in N-methylpyrrolidone-617. -The scale of this paper method is applicable to Tug's house mark (CNS) Λ4 is present (2 丨 0: &lt; 297 mm1 · '&quot;' (please read the meaning of the back of the cloud carefully and fill in This!) Pack 1- 1235157 Printed by the Consumers ’Cooperative of the China Standards Bureau of the Ministry of Economic Affairs Λ7 37 V. Description of the invention (615) (0.5 ml), 0.4 MHBTU in N-methylpyrididone (0.5 ml) The solution, and a solution of 1.6 M DIE A in N-methyl pololine (0 25 ml) were cooled and reacted! Shock at 2 ° C for 2 hours. A Repeat the donkey step. Finally, the resin is N-methyl leaf. I: Luo bite (1 X 1 ml), metformamide (4 X 1 ml), digas. Wash with methane (5 XI ml), and then dry in air and dissociate the 3 aldehyde from the resin, and deprotect it with 95% TFA / 5% H20 (v / v, 1.5 ml) at room temperature for 30 minutes. . After the resin was washed with dissociation reagent (1 ml), the mixed mash was added to cold 1: 1 ethyl chain: hexane (10 ml), and the resulting precipitate was separated by centrifugation and decantation. The resulting agglomerates were dissolved in 10% acetone / 90% Η20 / 0.1% TFA (5 ml) and freeze-dried to obtain crude 1105-U25, which was a white powder β compound purified by semi-preparative RP-HPLC using Rainin MicrosorbTMC18 column (5 micron, 21.4 X 250 mm) was dissolved in a linear acetonitrile gradient (8% -48 ° / 〇) containing 0.1% TFA (v / v) for 30 minutes at 12 ml / min. Fractions, and freeze-dried to yield 1105-1 125 (10.8 mg, 63%) 3 Analytical HPLC method: (1) Waters DeltaPak C18, 300A (5 microns, 3.9 x 150 mm) 3 contains 0.1% TFA (ν / ν) linear acetonitrile gradient (0% -25%) at 1 ml / min for 14 minutes 3 (2) Waters DeltaPak C18, 300A (5 microns, 3.9 x 150 mm). Linear acetonitrile gradient (5% -45%) with 0.1% TFA (ν / ν), 1 ml / min for 14 minutes β -618-This paper method is applicable to China National Standard (CNS) M gauge (210 × 297) 5) (please fill in the precautions of S. V4I) binding 1235157 A7 B7 V. invention description (616) 〇 丨 N is t8u〇Η 〇f ην eight tBuO people &quot; OtBu tBuO ·

〆 ΤΓ τ 〇0 人 ο, 〇Βπ

261b Ο

Ο

Visit first to read the 5th in the back. Fill in the Jiang Yi matters.

1T Printed by the Consumers' Cooperative of the Central Bureau of Procurement, Ministry of Economic Affairs 262b 3- (N, -Third-butoxycarbonylfluorenyl) propionate (250b), synthesized by the method of preparing 259 from 25S, can produce waxy Solid (87g, 51 ° /.) ·· mp · 54-55eC; IR (thin film) 3324, 2978, 1732, 1713, 1455, 1367, 1277, 1254, 1 171; lH NMR (CDC13) ά 7.35 (5H , m), 6.15 (1H, bs), 5.13 (2H, s), 3.15 (2H, t, J = 6.5), 2.54 (2H, t, J = 6.5), 1.45 (9H, s) a Analysis Calculation of C15H22N203: C, 61.21; Η, 7.53; N, 9.52. Found 値: C, 61.29; Η, 7.51; N, 9.51. MS (ES +) 295 (M + + 1). (3S) 2- (N-2-fluorenyloxycarbonylethyl-NI-2-butoxycarbonylfluorenyl) carbonylhexakinium dicarboxylic acid 1-fluorenyl 3-third-butyl ester (206b), Using 甴 259? Synthesized by the method of 60, it can be produced into a gelatinous form (81 g), which can be used without purification for the next -619 paper standard, the standard Chinese national standard (〇15), 6 (4), (210/297 mm) Printed by the Employees 'Cooperatives of the Prospective Bureau of the Ministry of Economic Affairs 1235157 A7 B7 V. Description of the invention (617) Step 3 Analysis data of pure samples: IR' (thin film) 33 18, 2976, 1733, 1451, 1412, 1393, 1366 , 1256, 1 161; lHNMR (CDCl3) d 7.34 (10H, m), 6.68 (0.5H, bs), 5.11 (4H, m), 4.63 (0.5H, bs), 4.14 (1H , m), 3.53 (2H? m), 3.08 (1H? m), 2.63 (2H? m)? 2.10-1.60 (4H, m), 1.60-1.35 (19H, m + 2 xs). (3S) 2- (N · -tertiary-butoxycarbonyl-N-2-carboxyethylhydrazino) carbonylhexahydrohydrazine 3-carboxylic acid tert-butyl ester (261b), using 260 to prepare 261 Synthesized by the method, a gel can be formed, which can be purified by flash chromatography (1: 1 ethyl acetate / dichloromethane) to give the title compound 261b (36.0 g, 79.4% over 2 stages). IR (thin film) 3267, 2979, 2937, 1728, 1668, 1394, 1369, 1245, 1159; lH NMR (CDC13) ^ 7.6 (1Η, bs), 6.8 (1H, vbs), 4.47 (1H, bs), 3.73 (2H, bs), 2.98 ( 1H, bs), 2.66 (3H, m), 2.04 (1H, bs), 1.84 (1H, m), 1.6-1.2 (21H, m + s). (45) 7-Third-butoxycarbonylamino-6,10-diketonyl_1,2,3,4,7,8,9,10-octahydro-61 daphno [1,24] [1,2,4] Triazapyridine-4-carboxylic acid tertiary-butyl ester (26215) was synthesized by the method of preparing 262 with thorium 261, and the title compound 262b (18.6 g, 54%) was obtained as an oil. Condition: 0] D20 +47.7. (C 0.236, CH2C12); IR (thin film) 3291, 2978, 1738, 1727, 1690, 1678, 1439, 1243, Π64; lH NMR (CDCi3) ά 6.59 (lH, s), 5.06 (1H, m), 4.47 (1H, m), 3.85 (3H, m), 2.82 (1H, m), 2.37 (1H, m), 2.22 (1H, m), 1.92 (1H, m), 1.63 (2H , M), 1.48 and 1.46 (18H, 2 xs). MS (ES +) 399 (NT + 1). (4S) 7-Amino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-61 ^ Dafang [1,24] [1,2, 4] Trisazinium-4-carboxylic acid tert-butyl ester (518). Compound 2620 __ -620-_ Applicable to Chinese Standard SS Standard (CNS) A4 (210 X297 mm) (Please read the precautions on the back before filling this page) Binding 1235157 Λ 7 Β7 _ V. Invention Instructions (618)-(2.43 g, 6.1 mmol) dissolved in 1M hydrogen chloride in ethyl acetate (30 liters and stirred at room temperature for 20 hours, add solid sodium phosphonate sodium (4 g 5 mmol) Ear) and 20 ml of water, and the mixture was stirred for 5 minutes before separation, and the aqueous portion was extracted with ethyl acetate. The mixed organic solution was washed with water and salt, dried (MgS04) and concentrated 3 for flash chromatography Purification (50% ethyl acetate / digas methane-100% ethyl acetate) yielded pure product 518 (H08 winter ') 9%) as an unstable oil ... D20 + 82. (C 0.55, CH2C12); IR (thin 貘)

2977, 1731, 1680, 1664, 1439, 1.420, 1315, Π] 8; lHNMR (CDC13) d 5.08 (1Η, m), 4.48 (1Η, m), 3.80 (2Η, Abq) , 3.70 (2H, bs, exchanged with D20), 3.53 (1H, m), 2.75 (1H, m), 2.30 (2H, m), 1.88 (1H, m), 1.71 (2H, m) , 1.47 (9H, s) 3 (Please read the notes of δ before filling in too f) Printed by the Consumers ’Cooperatives of the China Prospective Bureau of the Ministry of Economic Affairs

524 -621-Correction of tSIU on the paper scale:?: Standards (CNS) / \ Fuge (21GX297 Employees' Co-operation of the Central Government Bureau of the Ministry of Economic Affairs of the People's Republic of China. Social printing ¾ 1235157 ------ B2 ___ ^ --- ^ V. Description of the invention (619) _ (3S) 1 ·; oxycarbonyl-hexahydroda, well small carboxylic acid, methyl ester (520 "519 (9.4 g, 35.6 mmol) was suspended in methanol (23 ml) ) And cooled in an ice bath at 0eC. Add thionyl disulfide (3ml, 4.89g, 41.1mmol) dropwise over 30 minutes and stir the mixture at ambient temperature for 48 hours. 3 Solvent under 303C Removed and the oily residue was dissolved in ethyl acetate (500 ml). 3 The organic solution was washed with planed sodium bicarbonate, water and brine, dried (MgS04) and concentrated to yield 52 (7 84 g, 79%). ) Is in the shape of: [PAN] 〇22 -25.9 ° (c 0.615, CH2C12); IR (thin film) 2953, 1739, 1703, 1694, 1440, 1403, 1357, 1261, 1241, 1 174; lHNMR (CDCl3) 0 '7.36 (5H, s), 5.18 (2H, s), 4.00 (1H, bd), 3.73 (3H, s), 3.55 (1H, dd), 3.12 (1H, t), 2.06 (1H, m), 1.73 (3H, m). Analysis of the calculation of Cl4Hl7N20, 0.25H20 値: C, 59.46; Η, 6.59; N, 9 91 3 Found 値: C, 59 · 44; Η, 6.46; N, 10.09. (3S) 2- (N-2 ·; oxycarbonylethyl-NΙ-tertiary-butoxycarbonylfluorenyl) carbonyl hexa Hydrogen, dibenzyl 3-methyl dicarboxylate (52 丨). Using a similar method to 26 above, 521, 96% crude oil can be prepared: 〇] D22 -22.16. (C 0.25, CH2C12) ; IR (thin film) 3316, 2976, 2953, 1738, 1726, 1714, 1690, 1367, 1260, 1167; [H NMR (CDC13) 7.25 (10H, m)? 6.82 (1H, bs), 5.10 (4H, m ), 4.80 (1H, bs), 4.3-3.4 (6H, m), 3.10 (IH, m), 2.59 (2H, m), 1.95 (2H, m), 1.44 (10H, m ^ s) ^ 2- (N'-Third, butoxycarbonyl-N-2 · carboxyethylfluorenyl) carbonyl hexahydrophenyl 3-carboxylic acid methyl ester (522) 3 It can be made into 522 by a similar method as described in 261 above. , 92% was a white solid: 111 port 146-1483 (: (decomposition); 0] 1;) 22 ten 27.83 (〇0.25, CH: Cl2); IR (KBr) 3346, 1740, 1710, 1626, 1497, 1290 , -622- Standard for Chinese paper (CNS) Α4 ^ Grid (2 丨 〇 &lt; 29 mm) (Please read the precautions for the back cover first ^ 4 Write this page) Binding 1235157 Member of Economic and Central Bureau Printed by the Consumer Cooperative Λ7 37 V. Description of the Invention (620). 1250, 1206, 1 179, 1 159; lK NMR (CDC13) ά 7.60 (lH, bs), 7.5ο · 5 (1H, vbs), 4 · 64 (1H, bs), 3.76 (5H, m + s), 3.00 (1H, m), 2.70 (3H, m), 2.16 (1H, m), 1.92 ( 1H, m), 1.56 (1H, m),

1.46 (llH, m + s) 3 Analysis of the calculation of C15H26N407 値: C, 48.12; H, 7.00; N, 14.96 3 Measured 値 ·· C, 48 · 21; H, 6.96; N, 14.86 3 MS (ES +) 373 (Μ * -1) ^ (4S) 7-tert-butoxycarbonylamino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro- 6H-Da [1,2-a] [1,2,4] triazapyrene · 4 · carboxylate (523). 522 (7.15 g, 19.1 mmol) was dissolved in dichloromethane (100 ml), which contained difamidamine (0.5 ml) and cooled to 0X :. Sulfur gas (116 ml, 2.61 g, 22 mmol) and N-ethylmorpholine (486 ml '440 mg, 38.2 mmol) were added, and the mixture was stirred for 2 hours. The organic complex is washed with 2M argon sodium (50 ml), absolute sodium bicarbonate (50 ml) and brine (50 ml), dried (MgS04) and concentrated. White solid (5.73 g, 84%): mp · 186-188 ° C (decomposed); l &gt;] D22 + 65 · 3. (C 〇 · 25, CH2C12); flood (KBr) 3298, 2978, 1750, 1720, 1682, 1658, 1455, 1423, 1369, 13 16, 1241, 1212, 1160; lH NMR (CDCi3) ^ 6.56 (lH, s), 5.17 (1H, dd), 4.48 (1H, bd), 3.81 (3H, m), 3.75 (3H, s), 2.83 (1H, dt), 2.40 (1H, m), 2.28 (1H , m), 1.95 (1H, m), 1.67 (1H, m), i.47 (9H, s) ^ Analysis of the calculation of C 〖5H24N406-1 / 6H20 値: C, 50.13; H, 6.82; N, 15.59 . Found 値: C, 50.12; H, 6.71; N, 15.58 a MS (ES +) 357 (M +-1, 46%), 301 (100%) 3 (45) 7-amino-6,10-di Keto-1,2,3,4,7,8,9,10-O-argon-6 ^ 1-Da Geng Bing-623- This paper 中 standard is suitable for Chinese SS family standard (CNS grid (210X29? ) (Please read the notes of t &amp; first and then write this page) binding 1235157

Employees' Cooperatives of the Central Bureau of Economic Affairs, Ministry of Economic Affairs, India A-V. Description of the invention (621) [l, 2-a] [l, 2,4] triazine-4-carboxylic acid formamidine (524) The method for preparing 518 was synthesized from 523. Compounds 262a-k can be synthesized by the method for preparing 211b-f. 〇 〇

262a-k 263a-k Compound R 262a 263a COW 262b 263b ccy. 262c 263c 262d 263d CC 262e 263e ΟΛ 262f 263f CXA H

-624- The standard of this paper is applicable to the SS family standard (CNS), 6 and 4 worries (2! 0X 297 mm) 1235157 Λ7 ___B77, Description of invention (622)

(Please read the notes in §% before you fill out this f) Binding staff in the Ministry of Economics and Economics, Consumer Affairs Cooperative, Cooperative Co., Ltd. Yinchang Hydrogen-6H-Dawei and [12- ^ 1,2,4] triaza The tertiary-butyl carboxylic acid tertiary-butyl ester (262a) 0 443 mg (91%) of the title compound was obtained: 〇1. 56-7 ° (:; [PAN] 1325 4-76 ° (c 015, CH2C12); IR (KBr) 3429, 2979, 1734, 1675, 1418, 1369, 1339, 1323, 1244, 1164, 665; lH NMR (CDC13) ^ 8.45 (1H, s), 8.00-7.59 (7H, m) , 4.69-4.65 (1H, m), 4.25-4.12 (1H, m), 4.10-3.99 (1H, m), 3.73-3.55 (2H, m), 2.40-2.30 (1H, m), 1.99-1.91 ( 1H, m), 1.82-1.62 (2H, m), 1.48-1.46 (2H, m), 1.37 (9H, s). Analysis of the calculation of c23h28N406S * H20 値 · C, 54.53; Rule money post 4 1235157 A 7 B7 V. Description of the invention (623) ^ H, 5.97; N, 11.06. Measured 値: C, 54 · δ, 0; H, 5.73; N, 10.95. MS (ES +) 489. (45) 6,10-Diketo-7- (3-methoxyoxyphenylureido) -1,2,3,4,7,8,9,10-octahydro-611-, [1,24] [1,2,4] Terazine-4-carboxylic acid tert-butyl ester (262 (:). 120 mg (80%) colorless foam can be obtained: 0] D22 +22.6 (c 0.1, CH2C12); IR (KBr) 33 16, 1732, 1671, 1609, 1551, 1455, 1432, 13 16, 1288, 1245, 12 18, 1 1 58, 1 122, 1023; lH NMR (CDC13) ό '7.16 (4H, m), 6.79 (1H, m), 6.60 (1H, m), 5.11 (1H, m), 4.59 (1H, m), 3.89 (2H, m), 3.77 ( 3H, s), 3.72 (2H, m), 2.85 (iH, m) 3 (4S) 6,10-diketo-7- (2-methoxyphenylureido) -1,2,3, 4,7,8,9,10 · octahydro-6H-daphne [l, 2-a] [〖, 2,4] triazafluorene-4-carboxylic acid tertiary-butan (262d), (81%) showed colorless foam: 〇] D22 (c 01, Ch2C12); IR (KBr) 3468, 3446, 3269, 1734, 1698, 1667, 1609, 1555, 1490, 1461, 1433, 1423, 1296, 1246, 1215, 1 173, 1 157, 1028, 756; lH NMR (CDC13) δ 8.23 (1H, m), 7.95 (1H, s), 6.95 (4H, m), 5.15 (1H, m), 4.60 (1H, m), 3.98-3.65 (4H, m), 3.89 (3H, s), 2.90 (1H, m), 2.48 (1H, m), 2.25 (1H, m), 2.05-1.65 (2H, m), i .48 (9H, s) ^ (4S) 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-7-phenylacetamido-61 ^ Phyto [1,24] [1,2,4] triazapyridin-4-carboxylic acid tert-butyl ester (2626) as a white foamy solid (155 mg, 53%) ·· mp. 53-7X:; [a] D22 + 57.40 (c 0.1, CH2C12); IR (KBr) 3271, 2978, 1733, 1680, 1437, 13 14, 1245, 1 156, lH NMR (CDCI3) d 7.46 ( 1H, s), _ -626- __________ The standard of the paper method is commonly used in the aa family standard (CNS) A4 Tiege (210 X297) '— (Please read the precautions of the back of the cloud before filling out this f). 1235157 Ministry of Economic Affairs Zhong Liqun. Consumption Cooperation of Employees of the Nie Bureau · Du Yin ¾ 7 _______ 87 ___— V. Description of the Invention (624) ^ 7.42-7.20 (5H, m), 5.03 (1H, dd), 4 / 52-4.40 (1H, m) , 3.96-3 · 70 (2H, m), 3.70-3.49 (1H, m), 3.63 (2H, s), 2.92-2 · 75 (1H, m), 2.43-2.33 (1H, m ), 2.33-2.15 (1H, m), 2.00-1.50 (3H, m)? 1.45 (9H, s). Analyze the calculated value of C21H2SN4O5S-0.25H2O: C, 59.91; H, 6.82; N, 13.31. Measured 値: c, 60.19; H, 6.80; N, 13.30 3 MS (ES +) 418 (M + + 2, 250 / 〇), 417 (NT + 1,100), 362 (9), 361 (45) 3 ( 4S) 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-7- (3-benzylureido) -6H-daparo [l, 2- a] [l, 2,4] Terza-tricarboxylic acid tert-butyl ester (262f) as a white solid (273 mg, 93%) ·· mp · 102-6Ό; [a] D22 + 7.5 ° (c 0.07, CH2C12); IR (KBr) 3320, 2979, 173 1,1676, 16691601, 1549, 1444, 1314, 1240, 1156; 1H NMR (CDC13) d 7.37-7.20 (6H, m), 7.08-6.98 (1H, m), 5.12 (1H, dd), 4.64-4.55 (1H, m), 4.020.78 (2H, m), 3.75-3.65 (1H, m), 2.94-2.75 ( 1H, m), 2.57-2.35 (1H, m), 2.35-2.20 (1H, m), 2.00-1.50 (3H, m), 1.48 (9H, s). Analysis (: 20Η27N5050 · 0.4Η20 calculations: C, 56.56; H, 6.60; N, 16.49 ^ Found: C, 56.89; H, 6.58; N, 16.07. MS (ES +) 419 (M + + 2, 24%), 418 (M + + 1,100), 363 (15), 362 (81), 242 (10). (4S) 6,10-diketo-7- (4 indole-2-carboxamide ) -1,2,3,4,7,8,9,10-octahydro-6-daphta [1,24] [1,2,4] triazafluorene-4-carboxylic acid third -Butyl ester (2623), (1 3 g) as a white solid (298 mg, 70%): mp · 138-43'C; [a] D23 +69.8. (C 0.1, CH2C12); IR (KBr) 3282 , 2978, 1733, 1664, 1536, 1421, 13 10, 1 156, 748; lH NMR (CDC13) o 9.67 (1H, s), 9.53 (1H, s), 7.50 (lH, d), 7.30-7.15 ( 2H, m), 7.10-7.00-627-The standard of the paper method is applicable to the national standard of China (CNS) A4 now Luo (210 x 297 public variable) (_Read the precautions of back cloud before filling in this f) Binding r 1235157 A 7 _B7____ V. Description of the invention (625) _ Please read the meaning of i on the back and fill in%. Buy this (1H, m), 6.93 (1H, s), 5.16ο · 12 (1H: m), 4 · 60 · 4 · 50 (1H, m), 4.05-3.85 (2H, m), 3.85-3.70 (1H, m), 3.05-2.90 (1H? m), 2.55-2.3 5 (1H, m), 2.35-2.20 (1H, m), 2.00-1.85 (1H, m), 1.85-1.50 (2H, m), 1.47 (9H, s). Analysis 〇22 ^ 27 ^ 5 〇5 * 〇.45112〇 Calculated 値: C, 58 · 77; Η, 6.36; Ν, 15.58 a Found 値: C, 59.14; Η, 6.24; N, 15.18 a MS (ES +) 433 (M + + 2, 26%), 442 · (Μ · + 1, 100), 387 (17), 386 (79), 285 (20), 229 (85), 211 (26), 185 (15), 183 (57 ), 139 (9). _ (4S) 7-[(4-acetamido); amido] -6,10-diketo-1,2,3,4,7,8,9,10-octahydropyridine [l, 2-a] [1,2,4] triazapyridin-4-carboxylic acid tert-butyl ester (262h) as a white solid (325 mg, 73%): mp 209-12eC; 〇 ] D24 + 62.4 ° (c 0.2, CH2Ci2); IR (KBr) 3513, 3269, 2980, 173 1, 1680, 1653, 1599, 153 1? 1314, 1158; NMR (CDCi3) δ 9.40 (1H, s), 8.75 (1H, s), 7.72 (2H, d), 7.47 (2H, d), 5.15-5.05 (1H, m), 4.55-4.45 (1H, m), 4.05-3.70 (3H, m), 3.00- 2.80 (1H, m), 2.45-2.35 (1H, m), 2.30-2.15 (1H, m), 2.10 (3H, s), 2.00-1.80 (1H, m), 1.80-1.50 (2H, m), 1.48 (9H, s)-Analysis of C22H29N506 calculation: C, 57.51; H, 6.36; N, 15.24. Measured 値: C, 57.41; H, 6.38; N, 15 · 12 a MS (ES +) 461 (M— + 2, 26%), the Ministry of Economic Affairs and the Central Bureau of Standards, Consumer Cooperative Printing 460 (M + + 1 , 100), 405 (12), 404 (55), 354 (7), 285 (23), 229 (52), 183 (22). (4S) 6,10-diketo-7- (4-methoxyamidoamino) -octahydrotrioxo [l, 2-a] [l, 2,4] triazafluorene-carboxyl Acid tert-butyl ester (262i) as a white glassy solid (76%): mp. 85-9Ό; I &gt;] D25 +66.4. (C 0.11, CH2C12); -628- The standard of this paper is the standard of China's S (隼) (CNS M4 (21〇: & 297)) 1235157 A 7 B7 _ V. Description of the invention (626) _ IR ( KBr) 1732, 1668, 1607, 1502, 1 &lt; 40, 13 12, 1295, 1258, 1 176, 1 157, 1025; lH NMR (CDC13) '' 8.25 (1H, s), 7.77 (2H, m )? 6.90 (2Η, m), 5.11-5.07 (1H, m)? 4.55-4.48 (1H, m)? 4.01-3.91 (2H, m), 3.86-3.78 (1H, m), 3.785 (3H, s ), 2.98 (1H? M), 2.46-2.40 (1H, m), 2.26-2.20 (1H, m), 2.05-1.80 (1H, m), 1.70-1.64 (2H, m), 1.48 (9H, s ). (4S) 6,10-diketo-l, 2,3,4,7,8,9,10-octahydro-7-phenylsulfonylamino-6H-synthesis [l, 2-a] [l, 2,4] Triazapyridin-4-carboxylic acid tert-butyl ester (262j), as a white crystalline solid (79%) ·· mp · 182-3 ° C (decomposed) 〇] D22 +92.1. (C 0.4, CH2Cl2); IR (KBr) 3283, 1732, 1684, 1448, 1430, 1404, 1369, 1338, 1306, 1285, 1242, 1169, 1091, 692; lH NMR (CDC13) ά 7.89 (2H, d, J = 7.4), 7.76 (1H, s), 7.64-7.49 (3H? M), 4.83 (1H, m), 4.35 (1H, brd, J = 13.0), 4.00 (1H, m)? 3.74-3,63 (2H, m), 2.39-2.26 ( 2H, m), 2.06 (1H, m), 1.50-1.41 (10H, m) 3 Analysis of the calculation of C19H26SN406 C · C, 52.04; H, 5.98; N, 12.78. Measured 値: C, 52.11; H , 5.95; N, 12.7 MS (ES +) 437 (M +-I, 100%) 〇 Cooperative printing by employees of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions of vB before filling out this page) ( 3S) (7- (4-Methoxyphenyl) carbonylamino-610-diketone H3 4 7 8 9, 10-octahydro-6 stilbene [1,2 ^ [1,2,4 ] Triazapyridine-4-carboxylic acid tert-butyl ester (262k), (83%) ···]. +42.30 (c 0.11, CH2C12); IR (KBr) 3287, 2997, 2935, 1735, 1681, 1606, 1501, 1296, 1248, 1173, 1155-{H NMR (CDCi3) 9.6 9.23 (1H, s), 7.73 (2H, d), 7.3 8 (5H, m), 6.85 (2H, d), 5.OS (1H, m), 5.02 (2H? S), 4.4S (1H, bd), 4.15-3.65 ( 3H, m), 2.96 (1H, m), 2.45-2.10 (2H, m), 1.88 ____ -629- S 3 standard mark (CNS) 44¾ grid (210 x 297 notarized) 1235157 Λ7 B7_ V. Description of the invention (627) (1H, m), 1.63 (2H, m), 1.48 (9H, s) (ES + 509 (M ++ 1), compound 263a-k Method to synthesize 3 (43) 6,10-diketo-7- (2-fluorenylsulfonyl) amino-1,2,3,4,7,8,9,10-octahydro-6H-dahu And [l, 2-a] [l, 2,4] triazafluorene-4-carboxylic acid (263a), 348 mg (94%) was a white foamy solid: mp. [PAN] D21 +171 ° ( c 0.056, CH2C12); IR (KBr) 3426, 3233, 2953, 1 734, 1663, 1481, 1415, 1340, 1214, 1167, 1 132, 1075, 668; 4 NMR (CDC13) ό '8.44 (1H, s ), 8.00-7.60 (7H, m), 4.85-4.83 (1H, m)? 4.25-4.00 (1H, m), 4.07-3.90 (1H, m), 3.70-3.46 (2H, m), 2.38-2.30 (1H, m), 2.12- 2.01 (1H, m), 1.91-1 .83 (1H, m), 1.46-1.26 (1H, m), 1.13- 1.06 (1H, m), 0.90-0.77 (1H, m). MS (on ES) 43 BU (4S) 7- (Stupid [bh thiophene-2-carbonyl) amino-6,10-diketo-1,2,3,4,7,8,9, 10-octahydro-6Η-βA * [1,2 -a] [l, 2,4] Tris-Gas-4--4-acid (263b) 3 200 mg (100%) as a white solid. mp 155X; [a] D20 -13. (C 0.07, CH2C12); IR (KBr) 343 1,2935, 1734, 1663, 1 53 1,1435, 1292, 1177; lH NMR (CDC13) (J 9.73 (1H, bs), 7.73-7.27 (5H, Du Yinzhuang, Consumer Co-operation of the Sample Prospective Bureau of the Ministry of Economic Affairs (Notes on reading the poem first and then filling out this page) m), 5.35-5.25 (1H, m), 4.56-4.48 (1H, m), 4.05- 3.65 (3H, m), 3.12-3.00 (1H, m), 2.50-2.45 (1H, m), 2.30-2.20 (1H, m), 2.10-2.00 (1H, m), 1.75 · 1.61 (2H , m) a MS (ES +) 40 (4S) 6,10-diketo-7- (3-methoxybenzylureido) -1,2,3,4,7,8,9, 10-Octahydro-611-Da-Phen [1,24] [1,2,4] triazapyrene-4-carboxylic acid (263 (:), 216 mg (100 +%) showed a colorless foam: [a ] D23 32.5 ° (c 0.1, CH2C12); IR (KBr) 3326, 1730, 1661, 1610, 1555, 1495, 1431, 1314, 1288, 1217, 1175, 1161; lH NMR (CDC13) ό '7.87 (1H, s), 7.58 (1H, s), -630- The standard of this paper is applicable to Chinese national standard plum (CNS) A4 (210X 297mm)-1235157 Λ: _Β7 ___ V. Description of the invention (628) Money 7.19 ( 2Η, m), 6.82 (1H, m), 6.62 (1H, m), 5.21 (1H, m), 4.55 (1H, m), 3.76 (3H, s), 4.00.65 (4H, m), 2.85 (1H, m), 2.35 (2H, m), 1.75 (1H, m), 1.71 (2H, m)-(4S) 6,10-diketo-7- (2-methoxyphenylureido ) -1,2,3,4,7,8,9,10-Octahydro-6-scarpin [1,24] [1,2,4] triazapyrene-4-carboxylic acid (263 ( 1), (100 +%) is a colorless foam: 〇] D24 +11.7. (C 0_1, CH2C12); IR (KBr) 3394, 3325, 1666, 1603, 1543, 1490, 1463, 1438, 1329, 13 1 1 , 1292, 1249, 1214, 1 176, 1 1 19, 1024, 752; lH NMR (CDC13) d 8.15 (1H, m), 7.97 (2H, m), 7.15-6.84 (3H, m), 5.29 (1H m)? 4.62 (1H, m), 4.04-3.65 (4H, m), 3.89 (3H, s), 2.92 (1H, m), 2.50 (1H, m), 2.30 (1H, m), 2.10-1.75 (2H, m). (45) 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-7-phenylethylfluorenyl-amino group ] [1,2,4] Triazapyrene-4-carboxylic acid (263 €), solid foam as a white foam (117 mg, 98%): mp. 109-14Ό; 〇] D24 + 82.6 ° (c 0.06, CH2C12); IR (KBr) 3700-2250 (br), 3437, 3274, 2959, 1733, 1664, 1481, 1437, 1310, 1 177; lH NMR (CDCi3) Cooperation · Du Yinshang (please read the intent on the back separately before filling in the clothing page) 7.99 (1H, s), 7.40-7.15 (5H, m), 5.15-5.10 (1H, m), 5.25-4.70 (1H , bs), 4.50-4.35 (1H, m), 3.95-3.50 (3H, m), 3.61 (2H, s), 2.93-2.78 (1H, m), 2.40-2.20 (2H, m), 2.10-1.80 (1H, m), 1.80-1.60 (2H, m). Analysis for Cl7H20N4O5S.lH2O Calculated ... C, 53.96; H, 5.86; N, 14.81. Measured 値: C, 54.12; H, 5.50; N, 14.68-MS (ES &quot;) 360 (M +, 21%), 359 (M +-1, 100), 196 (14), 182 (14), \ {\ (7) 〇 (45) 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-7- (3-phenylureido) -6 ^ 1 -_-631-Applicable Chinese National Standard (CNS) A4 standard (210X 297) 1235157 Λ7 B7 Printed by Shellfish Consumer Cooperative, China Prototype Bureau, Ministry of Economic Affairs ¾ 5. Description of Invention (629) Brown [1,24] [1,2,4] triazapyrene-4-end, acid (263 °, to give a white foamy solid (199 mg, 92%): mp · 149_52eC; 〇] D24 +92.0 (C 0.01, CH3OH); IR (KBr) 3700-2300 (br), 33 19, 2956, 1726, 1664, 1600, 1548, 1500, 1444, 13 13, 1238, 755; lH NMR (D6-DMSO) o '8.90 (1H, s), 8.24 (1H, s), 7.42 (2H, d), 7.30-7.20 (2H, m), 7.00-6.90 (1H, m), 4.98-4.92 (1H, m ), 4.32-4.22 (1H, m), 3.80-3.55 (3H? M), 2.85-2.70 (1H, m), 2.30-2.20 (1H, m), 2.20-2.00 (1H, m), 1.90-1.35 (3H, m). Analysis of Cl6H19N505 · 0.75H2O O: C, 51.26; H, 5.51; N, 18.68. Measured 値: C, 51.U; H, 5.23; N, 18.42. MS (ES +) 361 (M +, 20%), 360 (M ten • 1, 100), 241 (1 1), 240 (89), 196 (15), 175 (29), 111 (12). (4S) 6, 10- Diketo-7- (pyridin-2-carboxamido) -1,2,3,4,7,8,9,10-octahydro-6H-, pyrido [l, 2-a] [l, 2,4] Triazapyridin-4-carboxylic acid (263 g) as a white solid (259 mg, 92%): mp 248-51. (:; | &gt;) D24 +94.0. (c 0.01, CH3〇H); IR (KBr) 3700-2300 (br) 3341, 2956, 1738, 1668, 165 1, 1529, 1425, 13 1 1, 1259, 751; lH NMR (D6-DMSO) 0 13.29 ( 1H, bs), 11.72 (1H, s), 10.64 (1H, s), 7.65 (1H, d), 7.45 (1H, d), 7.26-7.15 (1H, m), 7.17 (lH, s), 7.10 ^ 7.00 (iH, m), 5.05-4.95 (1H, m), 4.40-4.25 (1H, m), 3.90-3.50 (3H, m), 2.88-2.75 (1H, m), 2.38-2.20 (1H, m), 2.20-2.00 (1H, m), 1.90-1.35 (3H) 3 Analytical calculation of CisHi9N505: 05H2O: c, 53 59; H, 5.25; N, 17.35. Found 値: C, 53.66; H, 4.88; N, 17.11. MS (ES +) 385 (M +, 23%), 384 (M ten-1, 100), 298 (6), 253 (8), -227 (10), 199 (23), 196 (10), 173 (9), 126 (21) ^ ___ -632- General-purpose 〒ϋ national standard car (CNS) A4 (210 X 2Q7 mm) --------- ^ (Please read the precautions for δ ^^ this page) r 1235157 B7 V. Description of the invention (630) n First heard If% (4S) 7-[(4-ethylamido) pyridine Yl] -6,, 10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-da-benzo [1,24] [1,2,4] triazine Hexa-4-carboxylic acid (26311) as a white solid (282 mg; 99%): mp. 2100aC; 0] D24 + 74.5. (c 0.01, CH3OH); IR (KBr) 3700-2300 (br), 3444, 3316, 2960, 1664, 1599, 1531, 1439, 1301, 1 184;! H NMR (D6-DMSO) δ 13.30 (1H, bs), 10.50 (1H, s), 10.25 (1H, s), 7.80 (2H, d), 7.68 (2H, d), 5.00-4.90 (1H, m), 4.35-4.25 (1H, m), 3.90 -3.40 (3H, m), 2.88-2.70 (1H, m), 2.35-2.25 (1H, m), 2.25-1.95 (1H, m), 2.08 (3H, s), 1.95-1.35 (3H, m) . MS (ES Ten) 403 (M +, 10%), 402 (M &quot;-1, 100), 358 (10), 247 (10), 227 (16)), 219 (51), 198 (12), 184 (17) 〇 (45) 6,10-diketo-7- (4-methoxybenzylamido) -octahydro-6, which is [1,24] [1,2,4] Triazapyrene-carboxylic acid (263 丨), a white glassy solid (about 100%), can be used without further purification 4 NMR (CDC13) β 9.23 (1H, s), 7.72 (2H, d, J = 8.8), 6.81 (2H, d, J = 8.9), 5.22 (1H, m)? 4.51 (1H, m), 3.97-3.72 (2H, m), 3.81 (3H, s), 3.03 (1H, m), 2.51-2.46 (1H, m), 2.31-2.25 (1H, m), 2.03 (1H, m), 1.72 (2H? m)

(45) 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-7-phenylsulfonamido-6H-daphne [1,24] [ 1,2,4] triazapyrene-4-carboxylic acid (263), as a white solid (100%): mp 73-83Ό; [a] D22 Che 14.7. (C 0.3, CH2C12); IR (KBr) 3600-2500 (br) 3208; 1734, 1666, 1481, 1448, 1416, 1338, 13 1 1, 1214, 1 171, 1091, 729, 689; lH NMR (CDCl3 ) d 7.87 (3H, m), 7.70-7.50 (3H, m), 7.16 (1H, brs), 4.99 (1H, m), -633 This paper music scale is applicable to 3 national standard plums (匚 &gt; ^) Person 4 is present (2 丨 0 &gt; &lt; 297) 12 1235157 A7 B7 V. Description of the invention (631) 4.37 (1H, brd, J = 12.8), 3.92 (1H, m), 3.67 (2H, m), 2.36 (2H, m), 2.13 (1H, brd, J = 12 · 2), 1.56 (3H, m). Analysis for Cl5H18SN4O6 * 0,25CF3CO2Hi Calculated 値: C, 45.31; H, 4.48; N, 13.64. Measured 値 · C, 45.48; H, 4.71; N, 13.43. MS (ES +) 383 (MET, 100%), accurate mass calculation of C15H19SN406 (MH +) 値: 383.1025. Found 値: 383.1007. (45) 7- (4-fluorenoxyphenyl) carbonylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro · 6Η-dapyridine [ 1,24] [1,2,4] triazafluorene-4-carboxylic acid (2631〇, (100%): mp. 130-142'C; IR (KBr) 3272, 2945, 1738, 1650, 161 1, 1501, 1445, 1309, 1255, 1 171; 1K NMR (CDC13) ^ 9.35 (1H, s), 7.74 (2H, d), 7.38 (5H, m), 6.85 (2H, d), 5.40 (1H, bs), 5.19 (1H, s), 5.02 (2H, s), 4.49 (1H, d), 3.92 (2H, m), 3.68 (1H, m), 2.99 (1H, bs), 2.43 ( 1H, bs), 2.22 (1H, bs), 1.99 (1H, bs), 1.68 (2H, bs).

5251 2631 Consumer cooperation of the China Standards Bureau of the Ministry of Economic Affairs (4S) 6,10-diketo-7- (3,4-methyldioxyamido) -1,2,3,4, 7'8'9 '10-octahydro · 6Η-daphne [l, 2-a] [l, 2,4] triazafluorene-4-carboxylic acid methylene is synthesized by the method of preparing 211, which can be A white crystal was formed (3)) g, 83%) ·· mp · 214-5 ° C; | &gt;] D20 +75.2. (C 0.01, CH2Cl2); -634- The paper standard is commonly used in Chinese national standards (CNS) A4 Tiege (210 X 297 public cage) Central Ministry of Economic Affairs. China Bureau staff cooperation 4! India ¾ 1235157 Λ7 ___B7_ V. Description of the invention (632) (KBr) 3272, 2955, 1747, 1664, 1610; 1485, 1443, 1265, 1040; 1K NMR (CDC13) ^ 8.66 (1Η, s), 7.32 (1H, dd), 7.23 ( 1H, d), 6.76 (1H, d), 6.02 (2H, s), 5.20 (1H, dd), 4.55-4.45 (iH, m), 4.03-3.70 (3H, m), 3.78 (3H, s) , 3.05 ^ 2.88 (1H, m), 2.47-2.35 (1H? M), 2.35-2.20 (1H, m), 2.10-1.90 (1H, m), 1.85-1.50 (2H? M ”analysis ClsH20N4O7.0.5H2O Calculated 値: c, 52.87; H, 5.06; N, 13.70 3 Measured 値 ·, C, 52 · 84; H, 5.00; N, 13.66. MS (ES +) 406 (M ”2, 20%) , 405 (M + + 1,100), 391 (10), 162 (6), 148 (3), 105 (2 "(4S) 6,10-diketofluorenyldioxyfluorenylamino)-: i, 2,3,4,7,8,9, 10-octahydro-6 stilbene [1,24] [1,2,4] triazapyrene-4-carboxylic acid (2631), 5251 (3.32 g, 8.2 mmol) in a suspension of tetrahydrofuran (60 ml) with LiOH, H2O (0.69 g, 16.4 mmol, 2.0 eq) Water (20 ml) solution treatment 3 The resulting mixture was stirred for 1 hour, concentrated, and the residue was dissolved in water (50 ml). The solution was acidified with 2M NaHS04, and the product was extracted with EtOAc (100 ml and 50 ml). Mixed extraction The material was washed once with brine (2 X 50 ml), dried (MgS04) and concentrated to give 2631 as a white crystalline solid (2.87 g, 90%): mp · 154-8 ° C; [a] D20 +85.6. (C 0.01, CH3OH); IR (KBr) 3700-2300 (br), 3248, 2942, 1733, 1681, 1658, 1648, 1536, 1486, 1440, 1297, 1255, 1037; lH NMR (D6-DMSO) ά 13.23 (1H, bs), 10.45 (iH, s), 7.45 (1H? D), 7.35 (IH, s), 7.03 (1H, d), 6.12 (2H, s), 5.00-4.93 (1H, m) , 4.35-4.25 (1H, m), 3.0-3.40 (3H, m), 2.95-2.70 (1H, m), 2.40-2.25 (1H, m), 2.15-2.00 (1H, m), 1.91-1.40 ( 3H, m) 3 Analysis _-635-This paper is commonly used in ft scale 11¾ standard Chinese standard (CNS) A4 ^ Luo (; M0χ π? Mm) (please close the precautions of δ before filling in. Ί) •! Binding 1235157

R ^ -N Η Λ

〇 B7 V. Explanation of the invention (633) _ C17Hl8N4O7 * 0.8H2O Calculation: C, J. 45; J, 4.88; N, 13.84 Measured 値 ·· C, 50 · 80; H, 4.95; Ν, 13.36. MS (ES +) 390 (ΝΓ, 19%), 389 (M +-1, 100), 545 (9), 204 (3 1), 182 (27), 111 (12) ^ Ο ηΎ 265a, c, d, f 1015, 1018, 1027, 1052, 1056, 1075, 1095

Irf 丨 (Please read and read the precautions of the back of the cloud before filling out this book?) The consumer cooperation of the Ministry of Economic Affairs of the Central Bureau of Du Ducheng

Order 4 papers 伕 1 national standard car (〇 ^) 々4 dige (11.0, &lt; 297 mm) 1235157 Λ7 B7 V. Description of the invention (034) 264g 1075 264h 1018 H 2S4i 1052 jcA 264j 1027 264k 1056 JO1 2641 1015 (XT1 Printed by the Consumers' Cooperatives of the China Prospective Bureau of the Ministry of Economic Affairs ¾ (Discuss ¥¥ 5 and read it again; please fill in this page for the Italian matters) [4S (2S, 3S)] N -(2-fluorenyl-5-keto-tetrahydrofuran-3-yl) -6,10-diketo-7 · (2- ^ 1sulfonyl) amino-1,2,3,4, 7,8,9,10-octaargon-611-, A_ [1,24] [1,2,4] triazapyrene-4-carboxamide (264 &), method using compound 213 6 Synthesis, white solid (240 mg, 82%): IR (KBr) __- 637-_ This paper ft scale GM China Standard Car (CNS) 8 4 specifications (210X 297 mm) 1235157 Λ7 B7 V. Invention (635) 338〇, 3066, 2947, 1789, 1750, 1691 ;, 1454, 1417, 1368, 1298, 1 ^ 62, 1235, 1193, 11 18, 756, 696; 1E NMR (D6-DMSO) ^ 8 -59 (in, d, J = 6.8), 8.48 (1H, s), 8.25-8.09 (3H, m), 7.85-7 · 75 (3H, m), 7.36 (5H, m), 5.39 (1H, m), 4 · 21 (2H, AB, J = l4-2), 4.53-4.49 (1H, m), 4.25-4.10 (2H, m), 3.65-3,44 (3H, 3.13-2.99 (1H, m), 2.43-2.16 (1H, m), 1.72-0.72 (7H, m). Calculation of split C30H31N5OsS 値: C, 57.96; Η, 5.03; N, 11.27. Measured 値: C, 57 · 28; Η, 5.14; N, 10.48. MS (ES +) 622. [4S (2S , 3S)] N · (2-benzyloxy-5-keto-tetrahydrofuran-3-yl) -6,10-diketo-7- (3-methoxyphenylureido) -1,2 , 3,4,7,8,9,10-octahydro-6 ^ 1-benzyl [triazine-4-carboxamide (264c), prepared in a similar manner as 21 3e, (55% ) Showed colorless foam: mp · 135-40X:; 〇] D22 +59.6. (c 0.1, CH2C12); IR (KBr) 3314, 1790, 1664, 1608, 1543, 1496, 1455, 1428, 1325, 1287, 1250, 1218, 1 160, 1 1 18;! H NMR (CDC13) ^ 8.00 (1H, d, J = 7.1), 7.66 (1H, s), 7.55 (1H, s), printed by the Employees' Cooperatives of the Central Procurement Bureau of the Ministry of Economic Affairs (please read the precautions of Back Cloud before filling out this page) 7.28 (5H, m), 7.14 (2H, m), 6.87 (1H, d), J = 7.4), 6.59 (IH, m), 5.42 (1H, s), 4.66 (5H, m), 3.90-3.65 (4H, m), 3.73 (3H, s)? 2.98 (2H, m), 2.38 (2H, m), 2.01-1.65 (3H, m) ^ [45 (25,35)] &gt; 1- (2 -Methoxy-5-keto-tetrahydrofuran-3-yl) -6,10-diketo-7- (2-methoxyphenylureido) -1,2,3,4,7,8 , 9,10-octahydro-6? 1-, benzo [HaKl, 2,4] triazapyridine-1-carboxamide (264d), prepared in a similar manner to 213e (72%) as a colorless foam : 0] D22 + 21.4. (C 0.1, CH2C12); IR (KBr) 3302, 1791, 1689, 1678, 1664, 1602, 1536, 1489,

1461, 1437, 1420, 1249, 1 1 19, 1023, 942, 751; lH NMR ___ -638-_ Applicable to Chinese Standard Li (CNS) At% (210X 297 mm) 1235157 Λ 7 Β7 Seal of the Consumer Cooperatives of the China Prospective Bureau, Ministry of Economic Affairs

V. Description of the invention (636) (CDCi3) ί 8.07 (1Η, d, J = 7.7), 7.87 (1H, S). 7.68 (1H, d, J = 6.7), 7.49 (lH, s), 7.34 (5H, m), 6.96 (3H, m), 5 47 gh, s), 4.82 (2H, d -H m, J = 11.5), 4.63 (1H, d? J = U.5), 4.49 (2H, m), 3.85 (4H, s + m), 3.68 (2H, m), 3.01 (2H? M), 2.46 (2H, m), 1:95 (3H, m), 1.57 (1H, m ). [4S (2RS, 3S)] N- (2- ^ oxy-5-ketotetrahydroanan-3, yl x-copper-1,2,3,4,7,8,9,10 -Octahydro-7-phenylethylamino group, 6 ^ 1-more than 17 wells and [1,2-fluorene] [1,2,4] triazafluorene, 4-carboxamide (264 €) , Synthesized according to a similar method to prepare 21 ^, can produce a mixture of diastereomeric isomers (same side: opposite isomer ratio 9: 1), white glassy solid (128 mg, 78%): mp 1〇3 · 8Ό; IR (KBr) 3419, 3302, 1793, 1664, 1535, H21, 1327, 1256, 1 123, 973; lH NMR (D6-DMSO) ci 10.20 (〇 · 9Η, s), 9.35 (0.1H, s), 8.74 (0.1H, d), 8.49 (0.9H, d), 7.36-7.15 (10H, m), 5.67 (0.9H, d), 5.44 (0.1H, s), 4.85- 4.75 (iH, ni), 4.74- 4.60 (1H, m), 4.77 &amp; 4.63 (2H, dd), 4.30-4.10 (lH, m), 3.80 · 3.40 (3H, m), 3.43 ( 2H, s), 3.10-2.40 (3H, m), 2.25-2. = (1H, m), 2.0 (M · 35 (4H, m). Analysis (: 2811311 ^ 5〇7.0.5 ^ 2 〇 値 · C, 60 · 21; Η, 5.77; Ν, 12.53. Measured 値: C, 60.W; H,). 8j, N, 12.13. MS (ES, 551 (M + 10 2 , 33%), 550 (M17K 100), 480 (7), 343 (8), 27 9 (4) 〇 • it Λ-6,1 〇-Dinet [4S (2RS, 3S)] Ν- (2 ·; oxy small ketotetrahydrofuran-3-viol J, &lt; 4 and [1, 2 -Amino-1,2,3,4,7,8,9,10-Octahydro-7- (3-benzylureidow analogue a) [l, 2,4] triazafluorene-4 -Carboxamide (264f), prepared according to compound 21 &gt;: and · terminal solid method, which can produce pure ipsilateral-isomers, presented as Bai Ba A Xu Yuan yuan This book) Binding 4 -639 This paper is the standard for Chinese national standard (CNS M4 (2 丨 0, &lt; 297 mm) 1235157 Λ7 __B7_ _ V. Description of the invention (637) (225 mg, 82%) · _ mp · 130-5X :; | &gt;] 5, 24 +10.8. (C 0.1, CH2C12); IR (KBr) 3316, 1791, 1688, 1676, 1664, 1601, 1536, 1445, 1314, 1242, 973; LH NMR (D6-DMSO) ά 8.84 (1H, s)? 8.49 ( 1H, d), 8.19 (1H, s), 7.45-7.18 (9H, m), 7.00-6.90 (1H, m), 5.68 (1H, d), 4.90-4.81 (1H, m), 4.75-4.60 ( 1H, m), 4.78 and 4.63 (2H, dd), 4.30-4.20 (1H, m), 3.75-3.55 (3H, m), 2.85-2.55 (3H, m), 2.25-2 · 15 (1H, m ), 2.0 (M · 35 (4H, m). Analysis of the calculation of C27H30N6O7-0.5H2O 値: C, 57.95; Η, 5.58; N, 15.02.

Printed by U.S. Consumer Cooperatives, China Bureau of the Ministry of Economic Affairs: C, 58.12; H, 5.64; N, 14.81. MS (ES +) 552 (M + + 2, 30%), 551 (M + + 1, 100), 362 (19), 299 (10), 279 ⑷ a [45 (25,35)] 1 ^-(2- : ^: Oxy-5-copper-based tetrahydrocarboxyl-3-yl) -6,10-bistetrayl-7- (fluorenyl-2-carboxamido) -1,2,3, 4,7,8,9,10-octahydro-6 ^ 1 ^ Ansino [1,24] [1,2,4] triazapyridin-4-carboxamidine (264§), as compound Prepared by a similar method of 213 °, which can produce pure contra-isomers as a white solid (284 mg, 80%): mp · 148-53X:; 〇] D24 +72 0 ° (c 0.1, CH2Ci2); IR (KBr) IR (ΚΒγ) 3404, 3295, 1789? 1660, 1536, 1421, 13 10, 1260, 1122, 749; [H NMR (D6-DMSO) δ 11.72 (1H, s), 10.58 (1H, s ), 8.73 (1H, d), 7.65 (1H, d), 7.58-7.27 (6H, m), 7.27-7.10 (1H, m), 7.17 (1H, s), 7.10-7.00 (1H, m), 5.46 (1H, s), 4.90 · 4 · 85 (1H, m), 4.77 &amp; 4.68 (2H, dd), 4.35-4.25 (2H? M), 3.95-3.55 (3H, m), 3.09 ( 1H, d), 2.95-2.80 (1H, m), 2.47-2 · 25 (2H, m), 2.10-1.35 (4H, m). MS (ES +) 574 (M '35%), 573 (NT-1,100), 384 (16), 383 (69), 341 (23), 327 (12), 267 (13), 200 (22 ). -640- Paper &amp; Standard General China National Standard Ocean (CNS) A4 Tige (210X 297 mm) 1235157 Λ7 __ Βτ_ 5. Description of the invention (638) [4S (2RS, 3S)] 7-[('二 ·醯 amino group); acid, amine group] -N- (2-; oxy-5-ketotetrahydrocran-3-yl) -6,10-diketo-1,2,3,4, 7,8,9,10-octahydro-611-dapyrido [1,24] [1,2,4] triazapyridin-4-carboxamide (26411), prepared in a similar manner to compound 213e, Kunhe compound which can generate diastereoisomeric compounds (Isoside: Isomer ratio 9: 1), white solid (276 mg, 70%): mp · H7-52X:; IR (KBr) 3444 , 3304, 1793, 1665, 1602, 153 1, 1505, 1423, 1294, 1264, 1 181, 1 123, 966; lH NMR (D6-DMSO) i 10.41 (1H, s), 10.22 (1H, s), 8.71 (0.1H, d), 8.48 (0.9H, d), 7.78 (2H, d), 7.67 (2H, d), 7.35-7.30 (5H, m), 5.68 (0.9H, d), 5.45 (0.1H, s), 4.88-4.80 (1H, m), 4.75-4.60 (1H, m), 4.77 and 4.63 (2H, dd), 4.30-4.20 (1H, m), 3.90-3.50 (3H, m ), 3.10-2.50 (3H, m), 2.35-2.20 (1H, m), 2.07 (3H, s), 2.05-1.35 (4H, m). Analyze the calculation of C29H32N608 * 1H20 値: C, 57.04; Η, 5.61; N, 13.76. Found 値: C, 56.79; H, 5, 50; N, 13.53. MS (ES —) 594 (M + 10, 34%), 593 (M + + 1,100), 387 (8), 386 (38), 358 (8), 162 (9 ”employees of the Central Puryang Bureau of the Ministry of Economic Affairs Consumer Cooperative Seal ¾ [45 ($ 2,35)] 1 ^-(2-methoxyoxy-ketotetrahydrofuran-3-yl) -6,10-diketo-7- (4-methoxy Sulfonylamino) -octahydro-6H-dabenzo [l, 2-a] [l, 2,4] tri-I hetero leather-4-carboxamidine (264i), prepared in a similar manner to compound 213e, (7〇)% white solid: mP · 116-118 C; IR (KBr) 3315, 2951, 1793, 1664, 1607, 1502, 1258, 1177; lR NMR (CDCi3) 6 8.07 (1H, s), 7.77 (2H, d, J = 8.6), 7.35 (5H, m), 6.94 (2H, d, J = 8.5), 6.74 (1H), 4.89 (1H, d J = 11.1), 4.74 (1H, m) , 4.60 (IH, d, J = 11.0), 4.48, 4.41 (iH, 2m), 3.86 (3H, s). 3.79, -641-This paper's ft scale is generally used in the national standard of China (CNS grid (2I0X297 mm) Printed by the Prospective Bureau of the Ministry of Economic Affairs on the consumption cooperation of employees ¾. 1235157 V. Description of the invention (639)-3.71-3.53 (3H, 2m), 2.87 (2H, m), 2:44 (1H? M), 2.18, 1.9K 1.68 (5H, 3m). [4S (2S, 3S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-dinetwork- 1,2,3,4,7,8,9,10-octahydro-7-benzylsulfonamido-6 ^ 1-pyrido [1,2-a] [l, 2,4] tri Azapyridine-4-carboxamide (264j), synthesized in a similar manner to compound 213e, can form a foam (88%): 〇] D24 + 74 · 23 (c 〇36, CH2C12); IR (ΚΒ〇 3332, 3235, 1793, 1664, 1537, 1448, 1416, 1337, 1 169, 118, 1092, 940, 690; lK NMR (CDCi3) 7.99 (1H, s), 7.88 (2H, d, J-6.8), 7.64-7.48 (3H, m), 7.34 (5H, s), 7.13 (1H, d, J = 6.9), 5.39 (1H, s), 4.81 (2H, m), 4.62 (1H, d) , J = 11.5), 4.48 (IH, m), 4.33 (1H? M), 3.85 (1H, m), 3.59 (2H? M), 3.03 (1H, dd, J = 7.6, 18.2), 2.49-2.28 (3H, m), 1.94-1.40 (4H, m). Analyze the calculations of C26H29SN508: C, 54.63; H, 5.U; N, 12.25. Found 値: C, 54.42; H, 5.28; N, 11.62. MS (ES +) 572 (MH '100%) a C26H30SN5O8 (MH +) accurate mass calculation 値: 572.1815. Found 値: 572.1802. [4S (2RS, 3S)] 7- (4-Methoxyphenyl) carbonylamino-N- (2-Methoxy-5 · ketotetrahydrofuran-3-yl) -6,10-diketo -1,2,3,4,7,8,9,10-Octahydro-61 ^ Da-Feng [l, 2-a] [l, 2,4] triazine-4-carboxamide ( 264k), prepared by the method 213e (96%): IR (KBr) 3294, 2946, 1793, 1658, 1606, 1535, 1501, 1248, 1 174, 1 1 19. lE NMR (CDCl3) S 8.91 (iH? s), 7.85 (3H, m), 7.4 (10H, m), 7.02 (2H, d), 5.35 (1H, s), 5.10 (2H, s), 4.8- 4.3 (5H, m), 4.00 (iH, bs), 3.78 (2H, m), 2.90 (2H, m), 2.5-1.5 (6H, m) ^ 642- The standard of this paper is applicable to Chinese national standard (CNS) ) A4 is present (: ι〇χ 297 mm) Please read the precautions of the cloud and fill in this book \ Paper binding 1235157 Printed by the Employees' Cooperatives of the China National Standards and Technology Bureau of the Ministry of Economic Affairs Λ7 Β7 V. Invention Μ ( 640) [4S (2RS,] S)] N- (2-fluorenyl-5-fluorenyltetrazafuran-3-yl) -6,10-difluorenyl-7- (3,4-methyl Dioxyoctylamine) -l, 2,3,4,7,8,9,10-octahydro-6H-da-co- [l, 2-a] [l, 2,4] triaza箪 -4-Epioxamine (2641), prepared in a similar manner to compound 213e, can produce a mixture of diastereoisomeric compounds (isomeric · isomeric ratio 1: 1), as a white solid ( 1.72 g, 71%): mp. 148-60 &quot;C; IR (KBr) 3314, 1780, 1677, 1658, 1651, 1550, 1485, 1439, 1258, 1132, 1038, 943; lU NMR (D6-DMSO) ^ 10.39 (1H, s), 8.71 (0.5H, d), 8.49 (0.5H, d), 7.44 (1H? D)? 7.42-7.30 (6H, m), 7.03 (1H, d), 6.12 (2H, s), 5.68 (0.5H, d), 5.45 (0.5H, s), 4.90-4.82 (1H, m), 4.82-4.58 (2.5H, m). 4.40-4.10 (1.5 H, m), 3.900.65 (2H, m), 3.65-3.43 (1H, m), 3.09 (0.5H, dd), 2.90-2.55 (1.5H, m), 2.45-2.10 (2H, m), 2.10-1.35 (4H, m) 3 analysis (: calculation of 23Η29N5Ο9 · 0.2Η20): C, 57.67; H, 5.08; team 12.0, actual measurement: (:,: 58.01; 1 * 1, 5.33 ;; ^, 11.51 .] ^ (ES X) 581 (M + + 2, 33%), 580 (M +, 100), 374 (9), 373 (48), 345 (1 2), 261 (4), 239 (7), 149 (9), [3S (4S)] 3- [6,10-diketo-7- (2-fluorenylsulfonyl) amino 4,2,3,4,7,8,9, 1〇 -Octahydro-6 ^^ »A * Jing [1,24] [1,2,4] tri-1heterobenzene-4-jimonylamino] -4-ketobutyric acid (265a), with similar compounds Prepared by the method of 265, which can produce a white solid (37 mg, 17%): mp · 126-3 (TC (decomposed); [α] 02 + 30. (C 0 · 05, MeOH); IR (KBr) 3371, 2935, 1785, 1663, 1538, 1418, 1339, 1 164, 669; lH NMR (CD3OD) 0 '8.44 (1H, s), 8.06-7.50 ( 7H, m), 7.22 (1H, d, J = 8.4), 4.58-4.57 (1H, m) &gt; 4.46 ^ 4.42 (1H, m), 4.16-4.09 (2H? M), 3.85-3.50 (3Ht m ), 2.84-2.78 (1H, _-643-_ This paper's standard is applicable to the national standard (C ^ S) A4 specification (2! 0X 297 public ϋ · surprise first ^. Read back to the cloud; 1 meaning) ^ # Fill in. End page) 1235157 Consumption cooperation between employees of the Central Procurement Bureau of the Ministry of Economy Du Yin ¾ 7 _B7 V. Description of the invention (6 ^) m)? 2.64-2.51 (1H, m), 2.44-2.15 (2H, m), 1.81-0.89 (4H, m), analysis of C23H25N508S.H20 calculation: C, 50.27; H, 4.95; N, 12.74. Found 値 ·· C, 50.33;;, 5.04; N, 12.60 a MS (ES +) 530. [3S (4S)] 3- [6,10-diketo-7- (3-methoxyphenylureido) -1,2,3,4,7,8,9,10-octahydro- 6H-Da-Pheno [l, 2-a] [l, 2,4] triazapyrene-4-carboxyamido-4-ketobutyric acid (265c), prepared in a similar manner to compound 265, ( 90%) as a colorless solid: mp · ~ 150eC (decomposed); o] D23 +94.8. (C 0.1, 20% MeOH / CH2Cl2); IR (KBr) 3330, 1780, 1660, 1610, 1550, 1495, 1428, 1326, 1287, 1251, 1223, 1 160; lHNMR (CD3〇DW 7.16 (2H, m ), 6.89 (1H, d, J = 7.8), 4.58 (1H, m), 4.37 (2H, m), 3.76 (6H, s + m), 2.95 (1H, m), 2.67 (1H, m), 2.33 (1H, m), 2.20-1, 85 (3H, m), 1.66 (1H, m). [3S (4S)] 3- [6,10-diketo · 7- (2-methyl Oxyphenylureido) 4,2,3,4,7,8,9,10-octaargon-6 ^ Da [1,24] [1,2,4] triazafluorene-4- Chitosamine 4-ketobutyric acid (265d), prepared in a similar manner to 265, was colorless and solid. Mp. 176-85Ό (decomposition); 〇] D23 + 11.〇 ° (c 〇 ″, MeOH); IR (fCBr) 3392, 3328, 1784w, 1665, 1603, 1537, 1490, 1462, 1437, 1337, 1290, 1290, 1217, 1177, 1119, 1〇23; lHNMR (CD3OD) 0 '8.02 (2H , M), 6.95 (4H, m), 5.05 (1H, m), 4.60 (2H, m), 3.92 (4H, s + m), 3.00 (2H, m), 2.68 (1H, m ), 2.39 (1H, m), 2.00 (4H, m), 1.69 (1H, m). [3S (4S)] 3- (6,10-diketo-1,2,3,4 , 7,8,9,10-octahydrophenylacetamido-6, and [1,24] [1,2,4] triaza ¥ | carboxy醢 Amino group) _4-ketobutyric acid (1095), prepared in a similar way to compound 265, can produce a white solid ____- 644-___ The paper scale is universal Chinese National Standard Ocean (CNS) Α4 is present (2Ι0χ 297 Gongshou Ί ~ '(please refer to the poem of the ancestor; 1 note 4 fill in this book) binding 4 1235157 Λ 7 __Β7_ V. Description of the invention (642) Body (84 mg, 90%): 180-6 ° C ; | &gt;] d21, 22.3. (c 0.065, CH3OH); IR (ΚΒγ) 3700-2300 (br), 3287, 1664, 1536, 1425, 1261, 1181; lH NMR (CD3OD) ά 7.35-7.20 (5H , m), 5.00-4.90 (1H, m), 4.60-4.50 (1H? m), 4.50-4.10 (2H, m), 3.90-3.50 (3H? m), 3.54 (2H, s), 3.00-2.80 (1H, m), 2.80-2.40 (2H, m), 2.35-2.20 (1H, m), 2.20-1 · 50 (4H, m). MS (ES 10) 459 (M 10 24%), 458 (M, 1, 100), 358 (27), 175 (9), 149 (7), 137 (12). C21H26N507 (MH accurate mass calculation: 460.1832 3 found: 460.1840, [3S (4S)] 3- [6,10-diketo-1,2,3,4,7,8,9,10- Octahydro-7- (3-phenylureido) -6H-daphno [l, 2-a] [l, 2,4] triazapyridin-4-carboxyamido] -4-one -Butyric acid (265f), prepared in a similar manner to compound 265, can form a white foamy solid tincture (130 mg, 88%) ·· mp · 157-62Ό; [PAN] D24 + 4i.7c (c 0.1, CH3OH ); IR (KBr) 3700-2300 (br), 3325, 1782, 1663, 1547, 1443, 1315, 1242, 1 181; lH NMR (CD3OD) ά 7.40 (2H, dd), Central Bureau of Samples, Ministry of Economic Affairs Printed by Industrial and Consumer Cooperatives ¾ (Please read the precautions for back cloud first and fill in this f) 7.35-7.20 (2H, m), 7.06-6.95 (1H, m), 5.05-4.95 (1H? M), 4.64-4.54 (1H, m), 4.50-4.35 (1H, m), 4.35-4.15 (1H, m), 3.90-3.69 (3H, m), 3.00-2.85 (1H, m), 2.80-2.45 (3H? M) , 3.40-1.50 (4H, m) 3 MS (ES 10) 460 (M +, 24%), 459 (M ·· 1, 100), 341 (9), 340 (54), 296 (6), 239 ( 9) 3 [3S (4S)] 3- [6,10-diketo-7- (pyridin-2-carboxamide) -1,2,3,4,7,8,9,10-eight Hydrogen-6 stilbene [1,24] [1,2,4] triazapyrene-4- Amido] -4-ketobutyric acid (1075), prepared by the method of compound 265, can produce a white solid (184 mg, 83%): mp. 210-5 ° C; J &gt;] D24 +43.9. ( c 0.1, CH3〇H); IR (ΚΒγ) 3700-2300 (br), 3309, 1660, 1537, 1423, 13 1 1,1262, -645-This paper scale is applicable to China National Standard (CNS) 8-4 specifications (210X 297 male cage) 1235157

AT _B7_ V. Description of the Invention (643) 1184; lH NMR (CD3〇D) ά 7.61 (1H; d), 7.45 (1H, d), 7.28-

7.15 (1H, m), 7.15-7.00 (1H, m), 7.13 (1H, s), 5.12-4.96 (1H, m), 4.62-4.55 (1H? M), 4.50-4.25 (2H, m), 4.00-3.69 (3H, m). 3.05-2.90 (1H, m), 2.80-2.30 (3H, m), 2.25-1.50 (4H, m) ^ MS (ES +) 484 (M +, 26%), 483 ( M +-1,100), 383 (25), 245 (12), 208 (1 1), 200 (21), 174 (31), 137 (18). [3S (4S)] 3- {7-[(4-ethylamido) r-amido] -6,10-diketo-i, 2,3,4, 7,8,9,10- Octa-611-Ha 1 * well and [1,2-3] [1,2,4] diazepines 4-chitamine} 4-ketobutanoic acid (1018) to compound 265 Prepared in a similar manner, a white solid (177 mg, 82%) was obtained: mp · 235-40eC; [a] D23 +27.3. (C 0.1, CH3OH); IR (KBr) 3700-2300 (br), 3311, 2957, 1662, 1599, 153 1, 13 18, 1266, 1 182; lH NMR (CD3OD) ά 7.83 (2H, d), 7.69 (2H, d), 5.10-4.95 (1H, m), 4.64-4.55 (1H, m), 4.50-4.35 (1H, m), 4.32-4.22 (1H, m), 4.00-3.65 (3H, m ), 3.05-2.90 (1H, m), 2.80-2.30 (3H, m), 2.15 (3H, s), 2.15-1.50 (4H, m) ^ Analyze the calculation of C22H26N008.1.5H20 値 C, 49 · 90; H, 5.52; N, 15.87. Measured 値: C, 50.21; H, 5.41; N, 15.49 a MS (ES, 502 (M ten, 28%), 501 (M +-1, 100), 401 (8), 218 (4), 119 (2), 118 (5), 113 (16) 3 Printed by the Consumer Cooperative of the Central Sample Bureau of the Ministry of Economic Affairs (please read the precautions of © before filling out this purchase)

[3S (4S)] 3- [6,10 · diketo-7- (4-methoxyfluorenylamino) -octahydro-6H-, and [1,2-a] [l, 2,4] triazapyrene-4-carboxyamido] -4-ketobutylamidine (1052), synthesized by the method of compound 265, can produce a white solid (0.194 g, 100%): mp · 138- 142eC; J &gt;] D20 +36.3. (C 0.19, CH3OH); IR (KBr) 3434-2962, 1782, 1660, 1607, 1537, 1504, 1441, 1424, _-646 &lt; The scale of this paper is applicable to Chinese S Jiaping Ping (CNS) A4 Tiege ( 2 丨 0X 297 mm) 1235157 Λ7 _B7 _ V. Description of the invention (644) 13 13, 1293, 1258, 1 177; [H NMR (GD3〇D) ^ 7.11 (2H, d, J = 8.8), 6.90 ( 2H, d, J = 8.9), 4.48 (1H, m), 4.34, 4.28 (1H, 2m), 4.15 (1H, m), 3.75 (3H, s), 3.75, 3.70 (3H, m), 2.88, 2.49, 2.28, 2.23, 2.00, 1.86, 1.79, 1.58 (8H, m)-[3S (4S)] 3- (6,10-diketo-1,2,3,4,7,8,9, 10-octahydro-7-phenylsulfonamido-6H-dapyrido [l, 2-a] [l, 2,4] triazapyridin-4-carboxyamido) -4-one Butyric acid (1027), synthesized in a similar manner to compound 265, yields a white foam (880 / 〇): 〇] D24 +22.6. (C 0.17, MeOH); IR (KBr) 3349, 1789, 1663, 1537, 1448, 1337, 1 169, 1092, 690; [H NMR (CD3OD) ά 7.82 (2H, d, J = 7.8), 7.57 ( 3H, m), 4.74 (1H, m)? 4.47 (1H, m), 4.24-4.10 (2H, m), 3.72-3.47 (4H, m), 2.62-2.48 (3H, m), 2.20 (1H, m), 1.94-1.35 (3H, m) ^ MS (ES +) 480 (M ^ • 1,100%) 3 C19H24SN503 (MH 勹 accurate mass calculation 48 482.1346. Measured 値 482.1325. [3S (4S )] 3- [6,10-dione-7- (4-hydroxybenzylamino) -1,2,3,4,7,8,9,10-octahydro-6H , 2-a] [l, 2,4] triazapyridin-4-carboxyamido 4-ketobutanoic acid (1056), prepared by the method of compound 265 (95%): mp. &Gt;3003C; IR (KBr) 3392, 1660, 1610, 1507, 1442, 1280, 1171, 1149, 1133 ^ lH NMR (CD3OD) (ί 7.74 (2H, d, J = 8.7), 6.84 (2H, d J = Ministry of Economy Printed by the Central Bureau of Standards Consumer Cooperative ¾ 8.7), 4.58 (1H, m), 4.41 (1H, bd, J = 12.6), 4.28 (1H, m)? 3.85 (3H, m), 2.98 (1H, m) , 2.8-2.3 (3H, m), 2.3 ^ 1.6 (4H, m)-[3S (4S)] 3- [6,10-dione-7- (3,4-methyldioxyamidino) ) -12,3 4 7 8, 9, 10-octa-61-61 ^ answer farming and [1, 24] [1, 2, 4] Triazapyridine-4-chitamido] -4-ketobutyric acid (1015), prepared by the method of compound 265, to produce a white solid (210X297 mm) '-1235157 A7 __B7 V. Description of the invention (645) (142 mg, 58%): mp. 170-5 ° C; 〇] D, 25 +32.70 (c 0.1, CH3OH); IR ( KBr) 3700-2500 (br), 3325, 2969, 1784, 1662, 1485, 1440, 1292, 1258, 1037; lE NMR (CD3OD) ά 7.45 (1H, dd), 7.32 (1H, d), 6.90 (1H , d), 6.05 (2H s), 5.10-4.90 (1H, m), 4.62-4.54 (1H, m), 4.45-4.35 (1H, m), 4.33-4.22 (1H, m), 3.95-3.65 ( 3H, m), 3.05-2.90 (1H, m), 2.80-2.30 (3H, m), 2.20-1.50 (4H, m).

(#. First read the meanings on the back and then fill in too f) 〇 o

[3S (4S)] 3- [7- (benzo [b] pyrene-2-carbonyl) amino-6,10-diketo-1,2,3,4,7,8,9, 10 · Octahydro-6H-dapyrido [1,2-aKl: 2,4] triazapyridine] -4-ketobutyric acid tert-butyl hemicarbazine (526), method of compound 502 It can be produced as a glassy solid. U] D20 + 34 ° (c 0.13, CH2C12); IR (KBr) 3437, 2929, 1670, 1530, 1428, 1288, 1 156; lH NMR (CDCi3) ά 10.0 (1H , bs), 9.74 (1H, bs), 7.93 (1H, s), 7.80

7.60 (2H, m), 7.40-7.18 (3H, m), 6.15〇.30 (2H, bs), 5.00-4.85 (2H, m), 4.50-4.25 (1H, m), 3.95-3.75 (3H, m), 3.12-2.78 (2H, m), 2.73-1.60 (7H, m), 1.36 (9H, s). Analyze the calculation of C27H34N807SS: C, 52.76; H, 5.58; N, 18.23. Found 値: C, 52.25; H, 5.74; N, 16.30 »MS (ES +) 615. [3S (4S)] 3- [7- (Benzo [b], thiophen-2-carbonyl) amino-6,10-diketo- -648-This paper's standard is applicable to China National Standard (CNS ) A4 specification (2 丨 OX 29? Mm) 1235157 A 7 __B7___ V. Description of the invention (646) 1,2,3,4,7,8,9,10-octahydro-611-Da and [1 , 24] [1,2,4] triazapyrene-4-carboxyamido] -4-ketobutyric acid (1053), prepared by the method of compound 214, can produce a white solid solution (106 mg, 73 %): 〇] 20 + 22 ° (c 0.1Q,

MeOH); IR (KBr) 3428, 2944, 1733, 1652, 1532, 1433, 1337, 1288, 1 186; lE NMR (CD3OD) ά 7.95 (1H, s), 7.90-7.85 (2H, m), 7.43- 7.35 (2H, m), 4.98 (1H, m), 4.65-4.52 (1H, m), 4.40 ^ 4.20 (2H, m), 3.85-3.70 (3H, m), 3.30-3.25 (3H, m), 3.03-2.85 (1H, m), 2.70 ^ 2.31 (3H, m), 2.10-1.55 (4H, m) 3 MS (ES +) 500 (such as the methyl reduction of azine). Ο

[4S (2RS, jS)] 6,10-Difluorenylethoxy-5-fluorenyltetrazine-3-yl) -7- (3, 'fluorendioxyfluorenamine) -1 , 2,3,4,7,8,9,10-octahydro-611-dapyrido [1,24] [1,2,4] triazine-4-carboxamide (528), with Compound 2136 is prepared by the method, which can generate a mixture of diastereoisomeric compounds (ipsilateral: isomeric ratio 1: 1), as a milky white foamy solid (1.05 g, 58%): mp · 124_3 Jiang; IR (KBr) 3312, 2979, 1790, 1664, 1610, 1532, 1485, 1285, 1 120, 1037, 932; lH NMR (D6-DMSO) ά 10.39 (1H, s), 8.71 (0.5H, d), 8.43 (0.5H, d), 7.45 (1H, d), 7.36 (1H, __-649-This paper scale is applicable to China National Standard Ocean (CNS) A4 Sigma (210 X 297)) (Please read Yuanwen Behind the clouds, .V 〖I want to fill in this book-binding d 中央 Central Standards Bureau of the Ministry of Economic Affairs X X Cooperative Cooperative printed 1235157 __B7 Five 'invention description (647) s), 7.04 (1H, d), 6.12 ( 2H, s), 5.5S (Ό.5Η, d), 5.34 (0.5H, s), 4.95- 4.85 (1H, m), 4.70-4.52 (0.5H, m), 4.35-4.10 (1.5H, m ), 3.95- 3.50 (5H, m), 3.03 (0.5H, dd), 2.90-2.55 (1.5H, m), 2.46-2.20 (2H? M), 2.1 0-2.40 (4H, m), 1.16-1.13 (3H, 2 xt) ^ Analysis of the calculation of C23H27N5〇9.0.6H2O 値 · C, 52.29; Η, 5.38; N, 13.26. Measured 値: C, 52.53; Η , 5.35; N, 12.78. MS (ES +) 519 (M + + 2, 27%), 518 (M + + 1,100), 472 (7), 374 (12), 373 (53), 345 (14 ), 149 (12) »Example 3 1 Compound 640,642,645,650,653,655,656,662,668,669,670,671,677,678,681,682,683,684,686,688a , 688b, 689, 689b, 690a, 690b, 691a, 691b, 695a, 695b, 695c, 692a, 692b, 693;? 1694 were prepared as follows. (Please read the Prophet's back: / «Implement matters before filling out this page." Order 0ri: cb ’printed by the Ministry of Economic Affairs of the Central Government Bureau for consumer cooperation

-650- The size of this paper is suitable for China National Standard Ocean (CNS) A4 condition (210 &lt; 297 mm) 1235157 A: B7 V. Description of the invention (648) _ (3S) -2-keto-3-amine · 5-Aminoethoxyfluorenyl, -2,3,4,5-tetrahydro-11 ^ 1,5-benzodiazepine-diacetic acid acetate (638), synthesized from 600a, with compound 600a Method of making 602m, which can generate 2.4 g of 63 8 as a white solid 3 (3S) -2-keto-3- (2-fluorenylene) amino-5-methoxyethylfluorenyl-2; Methyl 3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-acetate (639). To a solution of 638 (630 mg, 1.76 mmol) and 2-¾: methylmethyl bromide (428 mg, 1.94 mmol) in CH3CN, K2C03 (608 mg, 4.4 mmol) was added. 3 Stir at ambient temperature. After 18 hours, the reaction mixture was diluted with C2C12, washed in%, then washed with brine, dried on N ^ SO ^, and concentrated in vacuo. Flash chromatography (Si0, 0 to 20% Et〇Ac / CH2Cl,) 450 mg of 639 a (3S) -3-[(3S) -2-keto-3- (2-fluorenylmethylene) amino-5-methoxyethynyl-2,3,4 1,5-tetrazine-1,1,5-epi-dioxane-1,1-ethylamine amine group 4, _morning-butyric acid (640), synthesized by the method of 602v to 605v, can generate 2O. 5 mg of 640 as a white solid, W NMR (CDC13) β 2.4-2.55 (m, 1H) 2.65-2.8 (m, 1H), 3.2 (s, 3H), 3.72-3.78 (m, 1H), 3.85- 4.0 (m 2H), 4.22-4.28 (d, 1H), 4.26-4.5 (m, 4H), 4.58-4.75 (m &gt; 1H) 4.78-4.85 (m, 1H), 5.0〇.08 (t, 1H) , 7.3 5-7.65 (m, 7H), 7.85- 8.02 (m, 4H) 0 (Please read the precautions of the back of the cloud before filling in too f bindings-Central Government Bureau of the Ministry of Economy

-651-The standard of this paper is Chinese national standard plum (〇 &gt; ^ &gt;. * \ 4% slightly (2! 0; &lt; 297 gong)) 1235157 V. Description of the invention (649) (35) -3- [(35) -2-keto-3-amidinoformamidine, aminoamino-:>-methoxyethenyl-2,3,4,5-tetrahydro-1H-1,5- Benzamidine diazabenzene small ethyl alcohol 4′-yl-butyric acid (642), synthesized from 6j8 ′ by the method of 605m, can produce 213 mg of 642, [H NMR (CD3OD) β 2.5 (m, lH), 2,6§ (ddd, 1H), 3.25 (s, 2H), 3.3 (s, 3H), 3.78 (m, 2H), 4.0 (d, 1H), 4 "(m, 1H), 4.6 (m, 2H), 4.85 (br. s, 2H), 7.08-7.22 (m, 2H), 7.3d (m, 1H), 7.4-7.65 (m, 4H), 7.7 (dd, 1H), 8.1 ( dd, 1H).

2-Acetylamino · acetylammonium (643) e-N-ethoxyglycylic acid (200 mg, 1.7 mmol) in CH2C12 (2 · 5 ml) of the Ministry of Economic Affairs of the Ministry of Economic Affairs of the Ministry of Economic Affairs of the Ministry of Economic Affairs and Consumer Cooperative Seal ^ Suspension, added grass base gas (0.450 ml, 5.1 mmol) 3 after stirring at ambient temperature for 30 minutes, the mixture &amp; 643, as a crude product. (3S) -2-keto-3- (buthyl) aminoethanylamino) ethynyl 2,3,4,5-tetrahydro-ih-1,5-benzodiazepine箪 -Benzyl acetate (644), -652 · This paper is suitable for Chinese National Standard (CNS) A4 specifications (210X297 male Θ &quot;-1235157 Λ7 Β7) 5. Description of the invention (650) 600b made of 602d Method Synthesized from 600b ^ Using 643 can produce 112 mg of 644. (3 3) -3-[(3 5) -2-keto-3- (1-fluorenyl) amino-5- (2-ethyl Fluorenylamino) ethenyl-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-ethenylaminob 4 · -keto-butanoic acid (645) , Synthesized from 644 by 602d and 605d, which can produce 43 mg of 645 as a white solid, iH NMR (CD3OD) d 1.95 (s, 3H), 2.4 (m, 1H), 2.65 (m, 1H ), 3.4 (s, 1H), 3.55 (m, 1H), 3.85 (m, 1H), 4.05 (d, 1H), 4.3 (m, 1H), 4.4-4.6 (m, 2H), 5.0 (m, 1H). 7.4-7.7 (m, 6H), 7.86 · 8.0 (m, 2H).

Fmoc 〇 Fmoc 〇

Department of Economic Affairs, Tsinghua Bureau, Employee Consumption Cooperation, Du Yin ¾ (Please read the precautions for the back of the cloud, and then fill out this page) 2- (N-methyl 'N · fluorenylmethoxycarbonyl) aminoethylfluorene ( 646), prepared from N-Fmoc-sarcosinate to prepare 6 * 4j heart square β, which can produce 646 crude 3 (3S) · 2 'groups, 3- (1-naphthylmethyl) amino groups -〇 (N-methyl, N-thyl group 〒 -653-Na scale Hao ^^ · $) Λ4 ^ (： 10χ 297 ^ 1 1235157 Λ 'Β7 5. Explanation of the invention (Ming 1) Please read the back Italian animal re %% 1 oxycarbonyl) amino] ethylfluorenyl-2,3,4,5-tetrahydro_1H-1,5-benzodiazepine small benzyl acetate (647) to 600b The method of synthesizing 6002d is synthesized from 600b. Using 646 can produce 481 mg of 647. (3S) -3-[(3S) -2-keto-3- (1-fluorenylmethylamino) amino-5- [2- (N-methyl, N-fluorenylmethoxycarbonyl) amino ] Acetyl-2,3,4,5-tetraargon-111-1,5-benzodiazepine-1-ethylamidino] -4-keto-butyric acid tert-butyl half carbamate Tritium (648), prepared from 647 by 602d and 604d, can produce 409 mg of 648. (3S) -3-[(3S) -2-keto-3- (1-methylformamyl) amino-5- (2-methylamino) ethynyl-2,3,4,5 -Tetrakis-1H-1,5 · benzyldiazine leather-1-ethyl amine amino] 4-molyl-butyric acid tertiary-butyl hemicarbazone (649). A solution of 648 (409 mg, 0.465 mmol) in MeCN: Et2NH (4 ·· 1, v / v) was stirred at ambient temperature. After 45 minutes, the reaction mixture was concentrated in the air. Flash chromatography (Si02, 5% to 20% MeOH in CH2C12) yielded 241 mg of 649. (3S) -3-[(3S) -2-keto-3-0naphthyridinyl) amino-5- (2-methylamino) ethenyl-2,3,4,5-tetra Hydrogen-1H-1,5-benzodiazepine-1-acetamido] -4-keto-butanoic acid (650), synthesized by the method of preparing 605d from 604 and 649, can produce 179 mg of 650, white solid, 1HNMR (CD3OD) (y2 · 4- cooperating with the staff of the China Standards Bureau of the Ministry of Economic Affairs, Du printed 2.6 (m, 2H), 2.7 (s, 3H), 3.5 (q, 1H), 3.8 (m, 2H), 4.2-4.4 (m, 2H), 4.3-4.45 (m, 1H), 5.0ol (m, 2H), 7.4-7.7 (m, 6H), 7.85-7.9 (m, 2H), 8.2 (m, 1H) ^ *

The scale of this paper is applicable to the Chinese National Standard (CNS) A4 (2 丨 0χπ7 mm) 1235157 Λ7 B7 V. Description of the invention (652) (3s)-^ Meng ^ pu pu jia ji ji) Amine. 5: A Junki, 2 3 4 5-tetraaza. 1,5-benzodiazepine, μ benzyl acetate (652), synthesized from 6 甴 b using the method prepared from 甴, using DMF and 3 equivalents of grass 醯The gas is reacted in a solution of CH2C [2] to form a reagent obtained by RX, which can generate 404 mg of 652. (3S) -3-[(3S) -2'yl-3- (1-Tetramethylamyl) cavity The radical ′ ′ acyl-2,3 4 5-tetra argon-1H-1,5-benzyldiazaheteroacetic acid ammonium-butyric acid-butyric acid (㈠3) was synthesized by the method of preparing 605d from 602d. From 652, 84 mg of 653 can be generated, which is a white solid, β NMR (CD3OD) β 2.3 (m, 1H), 2.55 (dd, 1H), 3.75 (br. S, 1H), 4.25-4.6 ( m, 5H), 5.15 (m, 1H), 7.2 ^ 7.45 (m, 6H), 7.8-7.9 (dd, 3H), 8.1 (s, 1H), 8.2 (m, 2H) ^

(Father, please read the following: vi «Fill out the sophomore package. Du Yin, Staff Consumption Cooperation of the Ministry of Economic Affairs of the People's Republic of China ¾

(33) -2-keto-3- (3,5-digas-4-hydroxyfluorenyl) amino-5_ethylfluorenyl-2,3,4,5-tetrahydro-1H-1, 5-Benzodiazapyrene-acetic acid (654) was synthesized from 600b to produce 603d, which was synthesized from 600b to yield 775 mg of 654 3 -655- This paper method is commonly used in China National Standards (CNS). 4 grid (210X 297 mm) 1235157 Λ7 B7 V. Description of the invention (653) (jS) -2-anthyl- -di-rat-4- mesityl, famous base) amine volume-5-ethyl Ss- N- [(2 feet 5,3 $) -_ oxy-5-keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-111-1,5-benzodiazepine箪 -1-Ethetamine (655), synthesized from 654 by the method of preparing 213e, can produce 304 mg of 655, lH NMR (CD3OD) d 2.4 (d, 1H), 2.6-2.75 (m, 2H), 3.0 (m, 1H), 3.45 (m. iH), 3.8 (d, 1H), 4.0 (t, 2H), 4.4 (m, 2H), 4.5-4.55 (m, 2H) · 7.2-7.45 (m, 4H ), 7.85 (s, 2H). (35) -3-[(33) -2-keto-3- (3,5-digas, 4-hydroxyfluorenyl) amino-5-ethoxy-2,3,4,5- Tetrahydro-1H-1,5-benzobisI heteropyridine-1.acetoamido] -4-one-butyric acid (6 5 6) was synthesized from 655 using a similar method to that of fluorene 2001 preparation 2002. Can produce 136 mg of 656, which is white solid. 4 NMR (CD3〇D) ά 1.85 (s, 3H), 2.5 (m, 1H), 2.65 (m, 1H), 3.7 (m, 1H), 4.3 (m, IH), 4.55 (m, 2H), 7.4-7.6 (m, 4H), 7.85 (s, 2H) ^ -656- Clothing scale ii uses Chinese SS house standard (CNS) A4 grid (Long public --------— 7 pack) ------ Order ------ Form (please read and read 1 &.; VJ notice * fill in this one) 1235157 A 7 B7 V. Description of the invention (654 〇〇〇 X 859 H0 — ^ T Fm〇C〇- ^ 〇e ~? M〇c〇- ^ oi 657 853

(Surprising ^ Please fill in your ears and fill in the wood \ shell)

662 ； -V ο N ^ S &gt; 8u 〇 Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 657- This standard is commonly used in the SS family standard ocean (CNS) with Tig (2 丨 0X 297). ¾ Staff of the Ministry of Economic Affairs of the Ministry of Economic Affairs of the People's Republic of China, Du Yin ¾. 1235157 A7 _ B7 Five 'invention description (6S5) 2- (fluorenylmethoxycarbonyl) glycolic acid ester (Shi 57) 3 benzyl glycolate A solution of esters (6.0 g, 36.1 mmol) in CH2C12, cooled in an ice-water bath, added tris (methyl oxybenzyl) oxylate (14 g, 1.5 eq) and diisopropylethylamine (9 ml '1 5 equivalents). After 1 hour, the reaction mixture was poured into a gasified ammonium planer and an aqueous solution, and then extracted with CH2C12, dried over Na2SO4, and concentrated in vacuo. The product was triturated in MeOH to give 2.2 g of 657 (657) acetic acid (658) as a white solid. To a solution of 657 (2.2 g, 5.93 mmol) in tetrahydrofuran was added 5% Pd / C (220 mg). After the resulting suspension was vigorously entrained in an atmosphere of hydrogen for 3 90 minutes, the reaction mixture was poured into absolute NaHC03 aqueous solution through Celite solution, washed with EtOAc twice, and the aqueous layer was acidified again. 〇112 (: 12 was extracted twice, dried on Na2S04, and concentrated under airspace to produce 1.46 g (88%) of 658, which was a white solid 3 2 · (retylmethoxycarbonyl) acetamidine gas (659), Prepared from 658 by the method of 643, and can produce 659 as a crude product. (3 $)-3-[(3 5) -2-keto-3- (3,5-digas-4-hydroxyfluorenyl) Amino group 0 ′ (2-Dimethoxymethoxycarbonyl) ethynyl-2,3,4,5-tetrahydro-111,5-benzodiazepine-benzene-1-ethylamino] -4-fluorene Butyl-butyric acid third, D-g semi-carbaba (660), synthesized from 660b, and 604d prepared by 甴 600b, using 659 to generate 453 mg of 660 a (3 S) -3-[(3 S) 2-Amidino-3- (3,5-difluoro-4-acrylamino) amino · 5- (2- / £ yl) ethene 6-2-2,3,4,5-tetra Argon-1 ^ 1-1,5-benzyl-1,11-benzyl-1-ethylperamido 4-keto-butyric acid tert-butyl hemicarbazone (661), 660 (423 mg) in MeOH : Et2NH (1: 1, ν / ν) solution was stirred at ambient temperature. 10 minutes Afterwards, the reaction mixture was concentrated in the air to produce a small volume. Adding Ethylene-Pan-Precipitation -658-Standard Paper S3 Standard Chinese Ping (CNS) Α4 Tige (210X 297 public «) -------- pack- ----- Order ----- One τ. ^ (Poetry, Yuan Min, read back, cloud, .. V ", read νΛ and fill in clothes to buy) 1235157 A7 37 V. Description of the invention (656 can produce 230 mg 661 0 (3 5) -3, [(3 5) _2-keto, 3- (3,5-digas-4-hydroxybenzylidene) amino group 0- (2, hydroxy) ethenyl-2 , 3,4,5 · tetrazine-1H-1,5 -pyridine hetero main-1-ethanoyl] -4-keto • butanoic acid (662), synthesized by the method of preparing 605d from 604 Since, 661, can produce 37 mg of 662, white imagination 9 Οθπ 'TIPSO. 66 ^ a ^ T-tips0 TPSO, 564 665 (Zhong Xian wrote this page on the back of the OT's different ball)

The Ministry of Economic Affairs of the People's Republic of China .. «'珞 局 炎 二 消 资 投资 杜 印 ^

0¾ 払. 667 -6S9 Twenty-three bids in the center (CNS Gongge (210X297)) Printed by the Consumers' Cooperative of the Central Ministry of Economic Affairs of Laos ¾ 1235157 ΛΤ Β7 V. Description of the invention (position) 2 · (—isopropyl wheat (Oxy) octyl acetate (663) a p-Glycolate (46.91 g, 0,282 mol) and diisopropylethylamine (74 ml, CM23 mol) in a solution of CH2C12, cooled in a water bath, and added TiPS / 〇Tf (95 grams, 〇31 mol) in a solution of CHaClj "The mixture was heated to ambient temperature and then poured into human water, washed with 10% NaHS〇4 aqueous solution, washed twice, on Na2S〇4 Dry bath and empty the concentrated green beta block speed chromatography (Si02, 0 to 5% EtOAc in Jihu) to produce 71.6 g of 663. ^ 2- (triisopropylsilyloxy) acetic acid (664) vs. 663 (0 , 4 g, 1,2 mmol) in EtOAc, 10% Pd / C (33 mg) was added. After the resulting suspension was stirred under a hydrogen atmosphere for 9 15 hours, the reaction mixture was filtered through cdite, and The filtrate was concentrated by air to produce 0.29 g of oil.a This oil was added to a solution of 174 · dihumane and NaHC03 (0.5M, 2.4 ml) was added. The resulting solution was concentrated from toluene in the air to produce 664 was a waxy solid. 2- (triisodiylsilyloxy) acetamidine gas (665) was synthesized from 664 by the method of preparing 643, and a crude product of 663, (3S) -3-[(3S ) -2-ketobenzylamidoamine 0- (2-triisopropylsilyloxy) ethanoyl_2,3,4,5-tetrahydro · 1Η-1,5-benzodiazepine -Ethylamine 4-Hexyl-butyric acid third butyl hemi-carbamidine (666), synthesized from 600b, and the method of preparing 604d by dysprosium 600b can produce 13 1 mg of 666. (3S) -3- [(3S) -2 · keto-3 · fluorenylamino-0- (2-hydroxy) ethylfluorenyl-2,3,4,5-tetrahydrobenzodiazepine, 1-ethylamine amino ] -4 · Keto-butyric acid tert-butyl ester carbohydrate (667). A solution of 66δ (131 mg, 0.17 mmol) in tetrahydrofuran was cooled in an ice water bath, and tetrabutyl fluoride was added. Ammonium (1 M, 0.1 90 milliwell), after 2 hours, the reaction mixture was poured into water and extracted with EtOAc two 660- this iron scale is universal Chinese national luck (CNS &gt; ~ Division (2 丨 〇 · (〆297 Posture) ------- ^ ---- ^-{Please read the precautions for the back * before filling in this page)

.1T Ministry of Economic Affairs, Ministry of Economic Affairs, Ministry of Economic Affairs, Anti-poverty Cooperation. Du Yin ¾. 1235157 A 7 _B7_ V. Description of the Invention (658) times, dry bath on MgS〇4 and empty the agricultural contraction to produce 63 mg of 667, presented White solid. (35) -3-[(3 3) -2-keto-3-amidino-5- (2-hydroxy) acetamido-2,3,4,5-tetramus-benzine Luanzao-1-Ethylamino] -4 · fluorenyl-butyric acid (668) was synthesized from 604d to 605d, and synthesized from 667 to produce 48 mg of 668 as a white solid. LH NMR (CD3〇D) ci 2.45 (m, 1H), 2.67 (dddd, 1H), 3.78 (d, 1H), 3.85 (br. M, 1H), 4.05 (d, 1H), 4.28 (m, 1H ), 4.5 (m, 2H), 4.65 (m, 1H), 4.95 (br. S, 2H), 7.4-7.5 (m, 4H), 7.52-7.65 (m, 3H), 7.88 (d, 2H).

(33) -3-[(35) -2-keto-3- (3,5-difluoro-4-methylamidinobenzyl) amino group 0-ethane-5 aceto-2,3,4, 5-tetrahydro-111-1,5-benzodiazepine-1-acetamido] -4-brenzyl-butanoic acid (669), synthesized from 600b by the method of preparing 605d from 600b, can be generated 63 mg of 669, white solid, NMR (CD3OD), 1.90 (s, 3H), 2.4-2.7 (m, 2H), 3.6-3.7 (m, 2H), 3.9 (s, 3H), 4.2- 4.4 (m, 2H), 4.4-4.6 (m, 3H), 7.4-7.8 (m, 4H), 7.9 (s, 2H) ^ -661-General SS Home Standard (CNS) A4 Tiger ( 210 乂 297mm) -------- VI β ------ IT ------ i (please read the meanings on the back .. V) and fill in this page) 1235157 Λ7 B7 V. Invention Description (659)

(35) -2-keto-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino-5-ethanoyl-: ^ [(2 民 5,35)-芊 氡Methyl-5-keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-1 仏 1,5-benzodiazepine-1-acetamidine (670), starting from 600b The method of preparing 655 is synthesized from 600b, which can generate 218 mg of 670 as a white solid. NMR (CD3OD) 1.7, 1.75 (2s, 3H), 2.15, 2.2 (2s, 6H), 2.4- (please read first) Back &amp; for the slag matters, please fill in Taibuy) ¾ Printed by the China Consumer Sample Cooperatives of the Ministry of Economic Affairs of the People's Republic of China 2.5 (m, 1H), 2.6-2.75 (m, 1H), 3.65-3.75 (m, 2H) 4.2-4.3 (m, 2H), 4.45-4.6 (m, 3H), 7.35-7.6 (m, 4H), 7.5 (s, 2H) ^ (35) -3-[(35) -2- 萌 基- 3- (3,5-Dimethyl-4-merylylamino) amino-5-ethylfluorenyl-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine箪 -Buethylamido] -4-keto · butanoic acid (671), synthesized from 670 by the method of 2001 and 2002, can produce 253 mg of 671 as a white solid, iH NMR (CD3OD) d 1.9 ( s, 3H), 2.25 (s, 6H), 2.4-2.5 (m, 1H); 2.6-2.75 (m, 1H), 3.65 ^ 3.75 (m, 2H), 4.2-4.3 (m, 2H), 4.45- 4.6 (m, 3H), 7.35-7.6 (m, 4H), 7.5 (s, 2H) ^ -662- this ft scale S in the national standard Universal Li (CNS M4 now grid (210 X 297 mm) 1235157 Λ7 B7 V. invention is described in (660)

(Please fill in this question first, please remember the matter of the cloud) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs ¾ (3S) -2-keto-3 · third-butoxycarbonylamino-5- (2-triisopropylsilyloxy) ethynyl-2,3,4,5-tetrahydro-1H-1,5-benzo-diazafluorene-benzyl acetate (672), from The method of preparing 602η in 600b, synthesized from 600b, and using 665 to produce 1.08 grams of 672. (3S) -2 · Keto-3-amino group 0- (2-triisopropylsilyloxy) ethenyl group--663- The standard of this paper is applicable to the national standard of China (CNS> M) (210X 297 mm) 1235157 A7 B7 _ V. Description of the invention (66〇2,3,4,5 · tetrahydro-IH-I, 5-benzodiazepine-1-acetamidine acetate (6U) 3 to 672 (1.08 g, 1.69 mmol) To a solution of CH2C12 was added 2.6-dimethylpyridine (0.8 ml) followed by TMSOTf (1 ml, 5.1 mmol). After 1 hour, the reaction mixture was poured into NaHC03 and extracted with CH2C1. , Dried on MgS04 and condensed in the air to generate a small volume, which can be directly used in the next reaction 3 (3 S) -2-keto-3- (1,6-dimethoxyfluorenylmethanyl) Amino-5- (2-triisopropylsilyloxy) ethenyl · 2,3,4,5-tetrahydrobenzodiazepine · 1-acetic acid; ester (674) to prepare 602b The method was synthesized from 673, and 0.91 g of 674 was produced. (3S) -2 · keto-3 · (1,6-dimethoxyfluorenylmethylamidino) amino-5- (2-triisopropyl Silyloxy) ethenyl-2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1, acetic acid (675). 674 (0.365 g, 0.5 mmol) In MeOH and IN NaOH (1.2 ml, 1.2 mmol) was stirred for 16 hours. The reaction mixture was concentrated under vacuum, redissolved in water and washed twice with ethyl acetate. The aqueous layer was acidified with IN HC and the product was extracted with EtOAc. Drying on MgS04 and concentrating in the air gave 337 mg of 675 as a solid.

Employees' cooperation of t 夬 橾 隼 bureau of the Ministry of Economic Affairs, Du India 5L (3 S) -2-keto-3- (1,6-dimethoxyfluorenylfluorenyl) amino-5- (2-tri Isopropylsilyloxy) Ethylfluorenyl-N-[(2RS, 3S) -benzyloxy-0-fluorenyl-tetrahydrofuran-3-yl] · 2,3,4,5-tetrahydro-1H-1 The 5-benzodiazepine-1-acetamidine was synthesized from 675 ′ according to (676) by the method of preparing 213e, and 166 mg of 676 was produced as a white solid. (3S) -2-keto-3- (1,6-dimethoxyfluorenylmethylamidino) amino-5- (2-hydroxy) ethenyl-N-[(2RS, 3S)- Ethoxy-5-keto-tetrahydrocran-3-yl]--664- The standard of this paper is applicable to Chinese National Standard (CNS) A4 Tiege (210X 297 mm) 1235157 Λ7 _B7_____ 5. Description of the invention Part 2) 2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-ethoxyamine (677) 3 but 8 ^ (6 ml, 3 mmol) in H A solution of 0Ac (0.46 ml, 8 mmol) was added to 676 (0.213 g, 0.256 mmol). After 16 hours, the reaction mixture was poured into Et〇Ac, washed twice with IN HC〇3, once with brine and then dried on -mSs〇4 and concentrated in the air, yielding 139 mg of 677 'as a solid' lH NMR (CDCI3) ^ 2.4 (d, 1H), 2.5 (dd, 1H), 2.8 (dd, 1H), 2,92 (dd? 1H), 3.15 (m, 2H), 3.55-3.65 (m, 2H) , 3.72 (s, 6H), 3.92 (m, 1H), 4.05 (m, 1H), 4.3 (m, 1H), 4.42 (d, 1H), 4.6 (dd, 1H), 4.65-4.8 (m, 2H ), 4.88 (d, 1H), 5.55 (d, 1H), 6.55 (m, 2H), 6.75 (d, 1H), 7.25-7.55 (m, 8H), 7.75 (m, 2H) ^ (3 5) -3-[(3 3) -2-keto-3- (3,5-dimethoxybenzylidenemethylamidino) amino group 0 '(2-hydroxy) ethylfluorenyl-2,3,4 , 5-tetrahydro-1H-1,5-benzodiazepine-buethamidinyl] -4 · keto-butyric acid (678), synthesized by the method of preparing 667 from 666, can produce 54 mg 678 as a white solid, NMR (CD3〇D) 〇 '2.45 (m, 1H), 2.7 (m, 1H), 3.5 (m, 2H), 3.75 (br.s, 6H), 4.05 (d, 1H) , 4.3 (m, 1H), 4.51-4.6 (m, 2H), 4.8 (br. M, 2H), 6.7 (d, 2H)? 7.4-7.5 (br. M, 3H), 7.6-7.65 (br. m, 2H), ^ Ministry of Economic Affairs, Ministry of Economic Affairs, Consumer Co-operation and Cooperation, Du Yin ¾

This paper is a universal tS national standard (CNS) A4 specification (210 X297 male cage) 1235157 __ΒΤ__ V. Description of the invention (663) (3S) -2-keto-3-amidinomethylamidoamino group 5- (2-Hydroxy) ethenyl-N · (2,5,35) -methoxy-5-keto-tetrahydrofuran-3-yl) -2,3,4,5-tetrahydro-1 ^ 1- 1,5-Benzodiazepine-1-acetamidine (680) was synthesized from 600b by the method of preparing 677 from europium 600b. 140 mg of 680 was obtained as a white solid. 4 NMR (CDC13) cT 2.31 (d, 1H), 2.4 (dd, 2H), 2.75 (dd, 2H), 2.85 (dd, 1H), 3.36 (br. s, 1H), 3.45 (br. s, 1H), 3.6 (br. t , 2H), 3.82 (br. M, 2H), 3.95 (br. D, 2H), 4.35 (m, 2H), 4.42 (d, 1H), 4.55 (m, 1H), 4.70 (d, 1H), 4.82 (br. S, 2H), 5.5 (d, 1H), 6.91 (d, 1H), 7.25 (br. M, 5H), 7.35-7.46 (br. M, 3H), 7.5-7.6 (m, 2H ), 8.15 (br. D, 2H) ^ (3S) -3-[(3S) -2-keto-3-amidinomethylamidoamino-5 (2-hydroxy) acetamido-2.3. 4.5- Tetrazol-1 {1-1,5-benzodiazepine-1-ethylenylyl] -4-copperyl-butyric acid (681), synthesized from 680 by 677, 678 Yields 45 mg of 681 as a gray solid, 4 NMR (CD30D) 0 ' 2.5 (m, 1H), 2.7 (dt, 1H), 3.65-3.85 (br. M, 3H), 4.05 (m, 1H), 4.3 (m, 1H), 4.5- 4.7 (br. M, 3H), 4.85 (br. S, 2H), 7.3 (br. M, 2H), 7.4-7.7 (m, 5H), 8.15 (d, 2H).

Printed by (3S) -2-keto-3-benzylfluorenylamino-5- (2-acetamyloxy) ethenyl-N-[(2 feet 5,33 ) -Methoxy-5-keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-11 ^ -666- The size of this paper is applicable to Chinese National Standard (CNS) A4 specifications (2 丨OxWnG 1235157 Λ7 __—__ B7 _ * ___ V. Description of the invention (correction) 1.5- Benzodiazepine-Buethamine (682); synthesized from 600b by the method of preparing 655 from 600b, which can be generated 495 mg of 682 as a white solid, lH NMR (CDC13), 2.00 (s, 3H), 2.05 (s, 3H), 2.47 (d, 1H), 2.58 (dd, 1H), 2.85 (dd, 1H) , 2.89 (dd, 1H), 3.9 (m, 2H), 4.05-4.15 (m, 2H), 4.19 (dd, 1H), 4.45 (m, 2H), 4.55-5.05 (m, 8H), 5.55 (d , 1H), 6.85 (d, 1H), 7.15 (d, 1H), 7.25-7.55 (m, 10H)? 7.75 (d, 2H). (3S) -3-[(3S) -2-one- 3-fluorenylamino o- (2-ethylfluorenyloxy) ethylfluorenyl · 2.3.4.5- tetrahydro-1 ^ 1-1,5-benzodiazepine-1-ethylfluorenylamino ] -4-keto · butyric acid (683), synthesized from 682 by the method of 甴 2001 preparation 2002, 82 mg of 683 can be obtained as a white solid, W NMR (CD3OD) d 2.1 (s, 3H ), 2.5 (m, 1H), 2.68 (m, 1H), 3.8 (m, 1H), 4.29 (dd, 1H), 4.31 (m, 1H), 4.45 (d, 1H), 4.55 (d, 1H) , 4.6 (d, 1H), 4.72 (d, 1H), 4.95 (br. S, 2H), 7.45 (br. M, 2H), 7.52-7.65 (br. M, 5H), 7.88 (d, 2H) (Notes on reading the poems in the poem before entering the second year)

(3S) -3-[(3S) -2-copperyl-3- (3,5-dimethyl'-4-methoxyfluorenyl) yl-5-ethoxy-2,3,4 , 5-Tetrawind-111-1,5-benzodicarbazone-1-ethoxyamino] -4-keto-butanoic acid (684) was synthesized from 60b by the method of preparing 605d from 600b. b 'can produce 72 mg of 684 as a white solid, [Η NMR (CD3〇D) ό' Printed by the Central Labor Department of the Ministry of Economic Affairs, Shellfish Consumer Cooperatives -667- Grid (2 丨 0X 297 public housing) 1235157 Λ7 37 Printed by the Consumer Cooperative of the Central Government Bureau of the Ministry of Economic Affairs Ⅴ. Description of the invention (665) 1.9 (s, 3H), 2.25 (s, 6H), 2.45 (m, 1H) , 2.6 (m, 1H), 3.3 (s, 1H), 3.7 (s, 3H), 4.25 (m, 1H), 4.45-4.6 (m, 3H), 7.4 (br. S, .2H), 7.55 ( br · d, 4H).

OBn

686 (3S) -2-fluorenyl-3- (3-amino · 4-aminooctyloctyl) amino-5 · (2-triisodiyl crushed alkoxy) ethenyl-N-[( 2RS, 3S) -methoxyoxy-ketone k-tetrahydrofuran-3-yl] -2,3,4,5-tetraaza-1 ^ 1-1,5-benzodiazepine-1-ethane Amine (685), synthesized from 600b by the method of preparing 676 from 600b, can produce 165 mg of 685 3 (3S) -3-[(3S) -2-keto-3- (3-gas-4 · benzyl) Fluorenyl) amino-5- (2-triisopropylsilyloxy) ethylfluorenyl-2,3,4,5-tetrahydro-lH-1,5-benzodiazepine-buethyl Amido] 4-ketobutyric acid (686) 3685 (165 mg, 0.21 mmol) was dissolved in THF and TBAF (1M, 0.21 ml) was added. The product was precipitated in the reaction mixture and separated by filtration through 甴. Reverse phase chromatography (10% -80% MeCN in water / 0.1% TFA) yielded 25 mg of 686 as a white solid, [Η NMR (CD3〇D) &lt; S 2.37-2.42 (m) , 2.59-2.70 (m) y 3.60-3.89 (m), 4.01 (d), 4.20-4.31 (m), 4.42-4.70 (m), 4.80〇.05 (m), 6.79 (d), 668 paper sheets Standards applicable in 3 countries (CNS) A4 is now available (210 x 29 to 4) (Poems. Try to read the back of the cloud first ... fill in the notes)

1235157 Λ / Β7 V. Description of the invention (666) 7.32-7.65 (m), 7.81 (s) ΜβΟ η

Ο

$ 39at b Central Standards of the Ministry of Economic Affairs &amp; Bureau Employees' Co-operative Cooperative (3 S) -2 · keto-3- (3,5-digas-4-¾ylfluorenyl) amino-5-methyl Oxyacetylamidine-2,3,4,5-tetraargon-111-1,5-benzodiazepine-acetic acid (687 &amp;) was synthesized from 600b by the method of preparing 654 from 600b , Which can produce 1.6 grams of 687a3 (3 S) -2-5S group-3- (3,5-dimethyl, 4. Fluorenyl) amino-5-methoxyethylfluorenyl-2, 3,4,5-tetrahydro-1 ± 1,5_benzodiazepine-diacetic acid (68713) was synthesized from 600b by the method of preparing 654 of 600b, which can produce 1.1 grams of 687b 3 (3S) · 2 · Keto-3- (3,5-difluorohydroxyoctyl · fluorenyl) amino-5-methoxyethenyl-N-[(2RS, 3S) -benzyloxy-tetrahydrofuran small group] -2,3,4,5-tetra-argon-1, -1,5-dibenzodiazepine. 1-acetamide (688a). For (3S, 2R, S) -3-allyloxycarbonylamino-2-fluorenyl-5-ketotetrahydrocondensate (Chapman, -669- This paper method is applicable to China National Standard Vehicle (CNS) Μ said grid (2l0x: 97 male cage) 1235157 _B7_ 5. Description of the invention (667).

Biorg. Med. Chem. Lett., 2, ρρ · 613-618 (1992)) (1.13 g '1.2 equivalent) To a solution of CH2Ci2 was added triphenylphosphine (423 mg, 0.5 equivalent), dimethylbar After 5 minutes, the reaction mixture was cooled in an ice bath with bitalic acid (1.26 g, 2.5 eq.) And palladium phosphonium palladium (0), 3 7 3 mg '0.1 eq.'. Then 687a was added to DMF (1.6 g, 1 equivalent), ΗΒΤ (480 mg, 1.1 equivalent) and EDC (681 mg, 1.1 equivalent). The resulting mixture was stirred at ambient temperature. After 16 hours, the reaction mixture was poured into NaHS04 and extracted twice with EtOAc. The organic layer was washed with NaHC03, brine, dried over Na2S04 and concentrated in vacuo. Chromatography (Si02, 20% to 100% EtOAc in CH2Cl2) can produce 880 mg of 688a as a white solid, 1H NMR (CD30D), 2.55 (dd, 1H), 2.7 (dd, 1H), 3.0 (m, 1H ), 3.6 (m, 1H), 3.75 (d, 1H), 3.9-4.0 (m, 2H), 4.3-4.45 (m, 3H), 4.5-4.6 (m, 3H), 4.7 (m, 2H), 5.35 (s, 1H), 5.55 (d, 1H), 7.1-7.5 (m, 4H), 7.85 (s, 2H) ^ (3 S) -2-keto-3- (3,5-difluorenyl) -4-hydroxyfluorenyl) amino o-methoxyethenyl-N-[(2RS, 3S) -fluorenyl-5-keto-tetrahydrofuran-3-yl] -2,3,4, 5-tetrahydro-1H-1,5-benzodiazapyridine-1-acetamate (688b) was synthesized from 687b by the method of preparing 688a with a687a, which can generate 960 mg of 688b as a white solid, 1H NMR (CD30D) β 2.6 (dd, 1H), 2 · 7 (dd, 1H), printed by the Consumer Cooperatives of Zhongli and Li Bureau of the Ministry of Economic Affairs 3.0 (dd, 1H), 3.2 (s, 3H), 3.7 ( m, 3H), 3.9 (m, 2H), 4.4-4.5 (m, 2H), 4.6 (m, 3H)? 5.35 (s, 1H), 5.55 (d, 1H), 7.25 (m, 2H), 7.4 -7.5 (m, 4H)-(3S) -3-[(3S) -2-keto-3- (3,5-diaminohydroxy; fluorenyl) amino-5-methoxyethynyl- 2,3,4,5-Tetrahydrobenzodiazepine-Ethylamine-B-670-suitable for paper method Chinese National Standards (CNS) μ Specifications (21〇 &lt; 297 mm) '1235157 Λ 7 __37_ V. Description of the Invention (Ming 3) 4-keto-butyric acid (689a), prepared with 甴 2001, The method of 2002 was synthesized from 688a to produce 184 mg of 689a as a white solid, 4 NMR (CD3OD) d 2.45 (m, 1H), 2.6 (m, 1H), 3.3 (s, 3H), 3.7-3.85 ( m, 2H), 4.0 (d, 1H), 4.3 (m, 1H), 4.5-4.6 (m, 3H), 7.3-7.6 (m, 4H)? 7.85 (s, 2H). (3 5) -3-[(3 5) -2-keto-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino-5-fluorethenyl-2,3 , 4,5-tetrahydro-1,1,5-benzodiazepine-1-acetamido] -4-one-butyric acid (689b), synthesized from 688b by the method of 2001 and 2002 , Which can produce 412 mg of 689b as a white solid, 4 NMR (CD3〇D), 2.5 (m, 1H), 2.7 (m, 1H), 3.3 (s, 3H), 3.7-3.85 (m, 2H), 4.05 (dd, 1H), 4.3 (m, 1H), 4.6 (m, 2H), 7.45-7.4 (m, 2H), 7.5 (s, 2H), 7.55 (m, 2H) ^

Employees of the Central China Economic and Trade Bureau of the Ministry of Economic Affairs of China cooperate in the production of (3S) -2-copper-3--3- (j, 5-difluorenyl-4-¾-ylsulfonyl) amino- 5- ¾ylethyl KU-671-Chinese paper standard (CNS) W standard (210 乂 297mm) 1235157 Λ7 87 V. Description of invention (669) [[2RS, jS)-卞 乳 基 -5- Cu-Tetralactone, 17-F, 17-N-3-yl] 2,3,4,5 -tetrakis-1H-1,5-benzodiazepine-buethamidine (690a), prepared using pyrene 600b 676, 甴 687a to prepare 688a, 甴 676 to prepare 677, synthesized from 600b to produce 863 mg of 690a, white solid, (CD3OD) d 2 · 2 (s, 6H), 2 · 45 (d, 0.5 · Η) ), 2.6-2.9 (m, 1H), 3.05 (dd, 0.5H), 3.65-3.85 (m, 2H), 3.95-4.1 (m, 1H), 4.35-5.0 (m, 7H)? 5.35 ( s, 0.5H), 5.65 (d, 0.5H), 7.2-7.4 (mt 4H), 7.4-7.7 (m, 7H) 3 (3S) -2-keto-3 · (4-hydroxyfluorenyl) Amino-5-hydroxyethylfluorenyl-N-[(2RS, 3S) -fluorenyloxy-keto-tetrahydroxan-3-yl] -2,3,4,5-tetrahydro-1H- 1,5 · Benzodiazepine-1-acetamidine (690b), synthesized from 600b by the method of preparing 677 from 600b, can produce 200 mg of 690b, 4 NMR (CD3OD) δ 2.49 (d, 1H) , 2. 65 (d, 1H), 2.66 (d, 1H), 2.85 (d, Yinyang 1H, Consumer Cooperative, Employees' Cooperative, Order of the Ministry of Economic Affairs, 2.87 (d, 1H), 3.05 (dd, 1H), 3.35 (br .s, 1H), 3.72 (br. s, 2H), 4.01 (m, 2H), 4.45 (br. m, 1H), 4.6 (m, 1H), 4.7 (m, 1H), 4.8 (m, 1H ), 4.95 (br. S, 2H), 5.65 (d, 1H), 6.8 (d, 2H), 7.2 · 7.35 (br. M, 3H), 7.45 (m, 2H), 7.75 (d, 2H) ^ (35) -3-[(35) -2-keto-3- (3,5-diamidino-4-hydroxyfluorenyl) amino-5-hydroxyethylfluorenyl-2,3,4, 5-tetrahydro-1H-1,5-benzodiazepine-l-acetamido] -4-one-butyric acid (691a) 'Synthesized from 690a by the method of 2001 and 2002 560 mg of 691a as a white solid, lH NMR (CD3OD), 2.15 (s, 6H), 2.45 (m, 1H), 2.65 (m, IH), 3.55 (m, 1H), 3.7 (d, IH), 4.0 (d, 1H), 4.25 (m, 1H), 4.5-4.6 (m, 3H), 7.3-7.5 (m, 6H) ^ (3 5) -3-[(3 (5) -2-one -3- (4-hydroxybenzylfluorenyl) amino-5-hydroxyethylsulfonyl- -672- The standard of this paper is applicable to the national standard of China (CNS M4 specification (2 丨 0 X 297 mm) 1235157 Λ7 B7 V. Description of the invention (670) 2,3,4,5-tetrahydro-1H-1,5-benzodiazepineacetamidinyl] -4-breamyl- Butyric acid (691b), synthesized from 690b by the method of 甴 2001 preparation, can produce 410 mg of 691b as a white solid, 4 NMR (CD3OD) β 2.5 (m, 1H), 2.65 (m, 1H), 3.75 (m , 1H), 3.8 (d, 1H), 4.05 (d, 1H), 4; 25 (m, 1H), 4.5 (m, 1H), 4.6 (m, 1H), 4.95 (br. S, 2H), 6.8 (d, 2H), 7.45 (m, 2H), 7.6 (m, 2H ·), 7'75 (d, 2H).

(Precautions for reading the poems in the poems first: fill in this book) Printed by the member of the Central Bureau of the Ministry of Economic Affairs X Consumer Cooperatives ¾ (3S) -2-keto-3-benzylaminoamino-5-hydroxyethyl -N-[(2RS, 3S) -fluorenyloxy · 5-copperyl-tetrakis β-ranan-3 -yl]-2,3,4,5-tetrazine-1H-1,5-benzyl Disorganized heteropyridine-1-acetamide (695a), synthesized from 600b by the method of preparing 677 from 600b, can produce 75 mg of 695a, NMR (CD3OD) β 2.2 (s, 6H), 2.45 (m, 1Η), 2 · 6 (m, 1Η), 3.65 (m, 1Η), 3.75 (d, 1Η), 4.0 (d, 1H), 4.28 (m, 1H), 4.5 (m, 3H) , 7.4-7.6 (m, 6H). (3S) -2-keto-3- (4-acetamidoamidinyl) amino-5-hydroxyethoxytyl-N-[(2RS, 3S) -fluorenyl-5-keto- Tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-1H- -673- This paper is suitable for the standard SS Lee (CNS). Λ4 is present (210X 297 mm) 1235157 Λ7 B7 _ V. Description of the invention (671) 1.5-Benzodiazepine-1 · acetamidine (695c &gt;, synthesized from 600b by the method of preparation of 677b from 600b, can produce 880mg of 695b, W NMR (CD3OD) d 2.1 (s, 3H), 2.25-2.5 (m, 2H), 2.8-2.92 (m, 0.5H), 3.150.2 (m, 0.5H), 3.45-3.6 (m, 2H) , 3.75-3.95 (m, 2H), 4.15-4.25 (m? 1H), 4.35-4.6 (m, 2H), 4.6-4.88 (m, 3H), 5.22 (s, 0.25H), 5.33 (s, 0.25 H), 5.52-5.58 (d, 0.5H), 7.15-7.45 (m, 9.5H), 7.5-7.75 (m, 5H), 8.3-8.35 (m, 0.5H), 9.08-9.18 (m, 1H) ^ (3 5) -2 trans-5-fluorenyl-3- (3,5-dimethyl-4-technyl + acyl) amino-5-heptyl-N- (2-methyloxy -5-fluorenyl · tetrahydro11-fluoro-3-yl) -2,3,4,5-tetrahydro · 1Η · 1.5-benzodiazepine-buethamide (695c), used by 600b The method of preparation 677 is synthesized from 600b, which can generate 840 mg of 695c, lH NMR (CDC13). 2.23 (s, 3Η), 2.26 (s, 3H), 2.45-2.62 (m, 1H), 2.8-2.9 (dd, 0.5H), 2.9-3.05 (dd, 0.5H), 3.45-3.63 (m, 1H ), 3.64 (s, 1.5H), 3.68 (s, 1.5H), 3.78-4.05 (m, 2H), 4.2-4.33 (m, 1H), 4.4-4.63 (m, 2H), 4.65-4.94 (m , 2H), 4.95-5.1 (m, 1H), 5.45 (s, 0.5H), 5.5- 5.6 (d, 0.5H), 6.9-6.95 (d, 1H), 7.25-7.7 (m, 12H) ^ • 〇 Please η Behind the Clouds-Shi lt

Written by I Economic Orders Bureau staff eliminates cooperative seals ^

, R1

(3S) -2-keto-3- (3,5-dichloro-4-hydroxyfluorenyl) amino hydroxyethylsulfonyl-674 Ground (210 X 297 male cage) 1235157

AT B7 V. Description of the invention (672) N-[(2RS, 3S) -Methoxy-5-one-tetrahydropyran. Hongjibu 2,3,4,5-tetrakis, 1H-1,5 -Benzodiazepine-1-acetamidine (692a), synthesized from 600b by the method of making 661 from 600b, except for the step of making 688a from 603d, replacing the method of 688a from 687a Generates 854 mg of 6.92a, lH NMR (CDC13) ^ 2.45 (d, 1Η), 2.6 (m, 1H), 2.7 (m, 1H), 3.0 (m, 1H), 3.5-3.7 (m, 4H) , 4.0 (q, 2H), 4.45 (m, 3H), 4.55 (m, 4H), 5.35 (s, 1H), 5.6 (d, 1H), 7.2-7.5 (m, 9H), 7.85 (s, 2H ). (3S) -2-keto-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino · 5 · hydroxyethylsulfanyl-N-[(2RS, 3S) -ethoxy- 5-keto-tetrahydropyran-3-yl] -2,3,4,5-tetrahydro-1H · 1,5-benzodiazepine-1-ethanamine (692b), using fluorene The method of preparing 661 from 600b was synthesized from 600b, excluding the step of preparing 604d from 603d, and the method of preparing 688a from 甴 687a was used instead of 692b which can produce 207 mg. LH NMR (CD3OD) ά 1.05 (t, 3Η), 1.15 (t , 3H), 2.45 (d? 1H), 2.55 (m, 1H), 2.7 (m, 1H), 3.55 (m, 2H), 3.6-3.75 (m, 5H), 4.0 (dd, 2H), 4.3 ( d, 1H), 4.4-4.7 (m, 5H), 5.25 (s, 1H), 5.5 (d, 1H), 7.25-7.6 (m, 4H), 7.85 (s, 2H). o

(3S) -2-ketofluorenylamino-5-ethenyl-N-[(2RS, 3S) -fluorenyl-5-keto-tetrahydrofuran-3-yl] -2,3,4,5 -Tetrahydrobenzodiazepine-Bu Yi paper standard is applicable to a national standard (CNS) A4 (210X 297 mm) (Please read the precautions for back cloud before filling this page) Order economy Printed by the Central Spline Bureau, Consumer Work Cooperative ¾ -675 -_____ 1235157 Λ7 _B7____ 5. Description of the Invention (67: 3) Phenamine (693), synthesized from 600b by the method of preparing 688a from 600b, can produce 30 mg of 693 , IH NMR (CD3OD) d 1.7 (s, 3H), 1.8 (s, 3H) 2.51 (d, 1H), 2.6 (m, 1H), 2.85 (m, 1H), 3.0 (m, 1H), 3.75 ( br. d, 2H), 4.0-4.1 (dd, 2H), 4.5-5.0 (m, 6H), 5.45 (s, 1H), 5.55 (s, 1H), 7.15 ^ 7.85 (m, 14H) ^

(3S) -3-[(3S) -2-keto-3- (3,5-dimethyl-4-methoxyfluorenyl) benzyl-5 · hydroxyethylfluorenyl-2,3, 4,5-tetrahydro-1H-1,5-benzodiazepine-buethenylamino] -4-keto-butanoic acid (694), synthesized from 691cco by the method of 2001 and 2002 Generated 380 mg of 694 as a white solid, lH NMR (CD3〇D), 2.25 (s, 6H), 2.45 (m, 1H), 2.65 (m, 1H), 3.65 (m, 5H), 4.0 (d , 1H), 4.28 (m, 1H), 4.55 (d, 2H), 4.95 (m, 1H), 7.4-7.6 (m, 6H). Compounds 700-711 can be prepared in a similar manner to compounds 619-63 5 (see, Example 13). The physical data of compounds 700-711 are listed in Table 25. Compounds 910-915 and 918-921 printed by the Consumers' Cooperative of the Standards Bureau of the Ministry of Economic Affairs were prepared as follows. The physical data of these compounds are listed in Table 26. -676- Standard Chinese Standard Lithium (CNS) A4 of this paper is standard (210X297 mm) 1235157 Λ7 B7 V. Description of the invention (674) Ministry of Economic Affairs, Ministry of Economic Affairs, Ministry of Economic Affairs, 2 Consumer Cooperation Printing + 厶 + 2 ο ο κο, 00 00 cn in u J w CU IS &lt; Ν Ο ^ tH f-4 s = tO «-Ι 2; S fH to ΓΓ &gt; CN L〇» -H in CS4 2: 卜 Ο 2 : CM rH ο CN4 s VO Cvj u cn ao 〇rr 2 CM CN X m CM CJ Sai-r PX ° -Q = 〇a \ X 〇x -〇 = 〇2: X. Set &lt; (α O o rrH o 请 Please read the meaning on the back side first. ▲ Page -677- ft scale applicable to a national standard (CNS) A4 (2 丨 O x 29 ^ 公 1235157) Λ7 B7 67 / (\ Declares that the five Ministry of Economic Affairs ordered the sample quasi bureau Beigong consumer cooperatives Yin Changcn ^ 2 5 S &lt; J \ WO r-to 、, TH CN Γ * 0 &quot;) h4 〇4 X rH tD ^ s-un r-4 CNJ o fH 3: S o L〇CNi ID tO mu〇r- uO so rH O Shou 2 eg SC VO CM U CO s 2 uO CNJ 3: r- CM o XP x ° = Q-〇A, 〇5r ° v = ° ZXA: ¾ CM o bu cn o bu-678- This paper scale is applicable to Chinese national standard plum (CNS) A4 (210X 297 public spring) ----- ^ ^ Installation ---- Please read the intent matters before filling in this f) Order d 1235157 AT B7 V. Description of Invention (676) Printed by the Employees' Cooperatives of the Bureau of Samples in the Ministry of Economic Affairs ¾ + S rH CM VO m , D CN VO ir &gt; CM σι L〇φ A a 〇4 s CNJ os ^ CM ^, rH t-4 vo 5 2 S; CO rH 3: X CNi L〇00 m CNJ ID 00 m ID • ir &gt; L 〇00 VO L〇u »2 σ \ 〇 ^ 5P CM * T | 3 CM o σ \ 〇§ CN S Co CM CJ o tJ 〇 2 GO CNJ 卜 CM C J 3 X px ° rQ: —orpx 甘 X rr ° ^ Q- 〇 = / Q ~ ° \ 卜 in o 卜 VO 〇 卜 (Please read the intentions of the back of the cloud before filling out this page) -679- The standard of this paper is applicable to the standard of GG family standard (CNS) M (210 X 297 mm) 1235157 Λ7 B7 V. Description of the invention (677) Ministry of Economic Affairs. 员工 Printing of this bureau's consumer cooperation + CO ^ X σ \ LO 卜 cO νο, r- L〇 卜 L〇 Pier. Let A (J ^ Λ Οι X υί) rH CM Η ice 〇 tH CNJ m rH 3: S in in 04 υΤ &gt; ιΓ) cn mo vT) L〇 Γ ΙΟ o in m 〇L &gt; X σ \ 〇 CNI S? CM U &lt; Ti 〇§ CN 3: CM U CO 〇 ^ r 2 〇m 3: CD C \ J u δχ. = 〇 = 〇 \ 〇Ν / ° Z X *. Department \ ° x / ° r 〇r -〇 = 〇 * Bu 0 Bu ω o Bu σ &gt; ο Bu (please read and read the back first: /-£, and then fill out this I) -680- Standard for killing paper General Chinese National Standard Li (CNS) A4 is now available (210 X 297 mm) 1235157 Λ 7 Β7 V. Description of the invention (678) Printed by the Consumers ’Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs ¾ CD ^ CM CN CD ID σν, rH CVi ID 〇〇4 X CNJ VO ^ s-(N rH s ^ ΓΟ rH 3: X «r &gt; a \ bu m in m GO cn tu S CO S 2 • Ή CJ 々CM 5 CV4 U (Ti 〇CNJ &lt; N 3S cn CM CJ 2 XA ° i = 〇X 2 a X 〇xo = C ^ ° rQ: ^ 3 O r-4 bu * H rH bu (please read the back &amp; the work idea before filling in 忒苋) loaded

• T d -681-This paper is a universal Chinese standard national standard (CNS) A4 gauge (210x29? Public) 1235157 A7B7 V. Description of the invention (679 Printed by the Consumers ’Cooperative of the Central Bureau of the Ministry of Economic Affairs 2 S VD t〇 'ιΓ &gt; BU r · tO u &gt; -4 〇ι DC CN cM〇CN (J \ r * c \ rH CD Ξ c / P c \ as &lt; Js σ \ SX a \ 〇IT) cn in L〇L〇Cl4 X o rH O 2: CVJ 5 CVJ CJ ON 〇WO 2 CM S VO CM u XOX 〇 = 〇 = 〇c XOX 0 = 〇 = 〇 • eight cn X ^ 3 O rH σ \ r-4 Tl (J \ -682- This paper scale is applicable to the Chinese National Standard (CNS) A4 (210X 2974 $)) (please read the § first; please fill in the second year with a note) 1235157 A7 B7 V. Description of Invention (680) Consumption Cooperation between Employees of China Standards Bureau, Ministry of Economic Affairs, Du Yin ¾

+ ^ 1 X BU 〇mu〇 ,, in ro VO L〇0 w CU re CM dP 卜 \ τ-ι α \ cn 00 «-λ · &lt; \ i dP CO &lt; n CO (Ti in VO 3 : S rH l〇VO CM in m 'L〇 • c \ m in iu s σ \ 〇§ CM 5 CN 〇CO 〇vn 奈 CVJ re VD CVJ U 〇 = C ^ = °? O' ° = ^ V = = 〇y ^ C: r. \; T 9, X CN4 (Λ m tH (Please read the precautions on the back δ before filling this page) Pack 1- d -683- This paper &amp; scales are applicable to China S house standard 沣(CNS) A4 grid (210 乂 297 mm) 1235157 AT B7 V. Description of the invention (681) M Printed by the Ministry of Economic Affairs of the People's Republic of China X Xuanxian Cooperative Club ¾. + S CN CVJ 1-1 VD bu VD 〇4 3: CN in σ \ rH CO &lt; N &lt; JP O GO σ \ σ \ bu 3: X CO (Tk bu 00 m CVJ. &Lt; r CN CN U5 Cu X σ &gt; 〇 m 2: »m U VO CN 3C VO CNJ U CPl 〇uO 2 04 CN 32 s C4 (J 3. ^ = 〇. Choose s ^ 〇Λ 9, X ix. = 〇 = 〇 丫 s, oo ^ on X ^ 3 σ \ in tH σ \ (Please read the precautions of the back cloud first and then fill out this one) -684- The standard of this paper is applicable to the national standard (CNS) A4 (210X297 mm) 1235157 A7 B7 V. Description of the invention (682 ) Du Yinshang, Consumer Co-operation of the Ministry of Economic Affairs of the Ministry of Economic Affairs of the People's Republic of China ^ Z ^ + S Γ η m, σ \ VO L〇〇1 X ζ »-1 CO mc \ cn &lt; D CN 〇P 々CJN r— &lt; 〇 \ r—4 00 SS CO c \ i fH L〇mmom C & 4 2 c \ 〇2 &lt; N4 5: 々CM L &gt; σ \ 〇2: 00 CVi X VO CVi CJ Race 5 §x 〇 = 〇 = 〇〇Y ^ Cx 〇X 〇 &lt; r ^% = 〇so Engineering Ί: ^ 3 &lt; 0 tH σ \ vo VD rH σ \ cd tH σι vo \ r- tC σι (Please read the (Please fill in this page for 2 items of interest) Re-685- The standard of this paper is applicable to China National Standard (CNS) A4 Tige (210X 297 mm) 1235157 Λ7 B7 V. Description of Invention (683) Cooperation with India ^ ^ 1 X m σι rH VO, η · σ \ L〇uO CU X CN ～ dQ rl rH CN4 dP cn ti ο σν σ &gt; S 2 〇L〇σ \ m CN ιΠ ιΠ ΓΟ ιη CS4 2 (Tk 〇2 CN »HU order 04 rr Csi u 00 Chi CM 3: CV] U 5 〇 = 0 = 〇〇V2: n ^ Cx s. Daughter-in-law QX ξχ Ο = 〇 = ο Υ ^ ζχ 8 ^ &lt; α 00 rH σι ri as -686- The scale of this paper method is applicable to Chinese national standard plum (CNS) Α4 standard (210 X297 mm) (Please axk Read the back of the cloud:; · Please fill in the meaning of the item 4 1235157 _____B7 V. Description of the invention (684) -687- The standard of this paper is 13 national standards (CNS M4 specification (210 X 297)

+ ^ 1 X VO ο VO m, r—4 &lt; J \ 卜 U〇〇ι X CNJ dP 〇D as a \ to CNJ dP Γ- ^ C \ | ON CO bu 1 rl U〇VO cn uO CVJ tO iD L〇iu ① 2 2 2: in CN U 〇tH o 2 v £> CN S Co CVJ u XOX ° ^ t ° Φ; r. 、 X o 工 ° &lt; ^ ° Y ^ Cx ° ^ V ° Xiao λ3 ▼ o &lt; N a \ rH CN Printed by the Consumers' Cooperatives of the Zhongli Bureau of the Ministry of Economic Affairs 1235157 AT B7 V. Description of the invention (in the Ministry of Economic Affairs印 Institute of Consumer Standards Cooperative of Standard Bureau ¾. + ^! 2 αο CO 卜 tn 令 ^ ί ^ W Ο s-^ 〇 ^ o tH s 2 VO tn 々tn in Cu 2 σ \ 〇im 22 bu Csi UX τ O '° = Q = o 〇Y ^ C 工 s. Times 9, ci X £ rr cs VO \ C4 CM σι -688- The standard of this paper is applicable to the Chinese house standard Li (CNS) A4 (2 丨 0x29? (Mm) Please read the precautions of Back Cloud before filling in it. Ex. 3; Order d 1235157 A7 B7 Yin Yin Bureau of the Ministry of Economic Affairs 2 Consumption Cooperation Du printed

The ft scale of this paper meets the national standard of China S (CNS) A4 (210X297 mm) (please read the information on the back of δ: V, and then complete this page)

1235157 Λ7 3 ^ V. Description of the invention (687) Step A. For the synthesis of 401, TentaGelS, NH2 resin (0.25 mmol / g, 6.8 g) was placed in a glass shaker container and washed with dimethylacetamide (3 x 20 ml). For 400 (1.70 g, 2.9 millimoles, prepared from (3S) 3- (fluorenylmethoxide) -4-copperylbutyric acid tertiary-butanone, according to AM Murphy et. Al. J. Am · Chem. Soc ·· 114, 3 156-3 157 (1992)) in a solution of difluorenylacetamide (15 ml), and 0-benzotrioi-N, N, NfNf-tetramethylfluorene hexakis Gallic acid (HBTU; 1.09 g, 2.9 mmol) and DIEA (1.0 ml, 5.7 mmol). The solution was added to the resin, and then dimethylacetamide (5 ml) was added. The reaction mixture was stirred at room temperature for 3 hours using a wrist-arm shaker. The resin was separated by vacuum filtration, and then dimethylacetamidine was used. Washed with amine (6 x 20 ml). 3 Resin (2.4 mg). The sample was washed thoroughly with 50% methanol in dioxane and then dried under inhalation. The Fmoc group was deprotected with 20% hexahydropyridine / dimethylacetamide (10.0 ml), and the analysis by UV analysis solution showed a substitution of 0.19 mmol / g. Printing step B. Synthesis of 903. Resin 401 was deprotected with 20% (Wv) hexahydropyridine / dimethylacetamide (20 ml) for 10 minutes (shock), and then fresh hexahydropyridine reagent (20 ml) was used for 10 minutes. Washed with amidacetam (6 x 20 ml). A solution of 902 (1.52 g, 2.81 mmol) was treated with HBTU (1.07 g, 2.83 mmol) and DIEA (1.0 ml, 5.7 mmol), transferred to the resin, and then treated with dimethylacetamide ( 5ml) Treatment a The reaction mixture was stirred at room temperature for 2.5 hours using a wrist-arm shaker. The resin was separated by suction filtration, washed with dimethylacetamide (4 X 20 ml) and digas methane (4 X 20 ml), and dried under nitrogen aeration. 3 Replace the resin as described in 401. And decided to be 0.169 millimoles / g. -690- The standard of this paper is Chinese 3 national standard plum (CNS) A4 lacquer (2 丨 mm) 1235157 Λ7 _____B7__ 5. Description of the invention (6 fats) Synthesis of step C, 905. Resin 903 ('7.54 g, 1.27 mmol) and dimedone (2.19 g, 15.6 mmol) were placed in a 100 ml round-bottomed flask, and freshly steamed stuffed anhydrous tetrahydrofuran (60 ml) was added. Add (triphenylphosphine) palladium (0) (0.32 g, 0.28 mmol), and stir with a nitrogen-covered and sealed reaction on the oscillating groove of the wrist for 15 hours. The resin was filtered and washed with dimethylacetamide (4 X 20 ml), dichloromethane (4 X 20 ml) and dimethylacetamide (1 X 20 ml). Add sufficient diethylammonium amine to the resin to obtain a slurry, and then add a solution of pyridine (1.5 ml, 18.5 mmol) and 904 (5.5 mmol) in methane (10 ml). The reaction was shaken under nitrogen for 8 hours and then filtered. The resin was washed with dimethylacetamide (5 X 20 ml) and methane (5 X 20 ml). Step D. Synthesis of 906. This compound was prepared from resin 905 (0.24 g, 0.038 mmol) using an Advanced ChemTech 396 Multiple Peptide synthesizer. An automated cycle includes: washing with dimethylformamide (3 XI ml), and 25% (v / v) Hexapyridine / dimethylformamidine (1 mL) was deprotected for 10 minutes, and then fresh reagent (1 mL) was added for 20 minutes to form resin 906. The resin was washed with dimethylformamidine (3 X 1 ml) and N-methylpyrrolidone (3 X 1 ml). Printed by the Consumers' Cooperatives of the Ministry of Economic Affairs, China Standards Bureau. Step Ε. (910 · 922) Resin 906 with 0.4M formic acid and 0.4M ΒΒΤ in a solution of N-methylpyrrolidone (0.5 ml), and ι. 6M 01 八 y-pyridylpyrrolidone (0.25 The solution was triturated and the reaction was shaken at room temperature for 2 hours. 3 The resin was treated with N-methylpyrrolidone (1 X 1 mL), dimethylformamide (4 X 1 mL), and 50% methanol in Wash with methane (5 XI ml) and air-dry. The aldehyde dissociates from the resin and is 95% TFA / 5% Η20 (ν / ν, 1.5 ml) at • 691-this paper is compliant with the national standard of Shen Guo (CNS &gt; 8 4 Sig (2 丨 0/297 Mm 1 — &quot; ~ &quot; 1235157 Λ7 B7 V. Description of the invention (689) Treat at room temperature for 30 minutes without disdain. After washing the resin with dissociation reagent (2 X 1 ml), add the mixed filtrate and add In cold 1: 1 ether: hexane (35 ml), the resulting precipitate was separated by centrifugation and decantation. 3 The resulting pellet was dissolved in acetonitrile (0.5 ml) &amp; H20 (0.5 ml) and passed through 0.45 μm. Filtration with a microcentrifugal filter. Compounds were purified by semi-preparative RP-HPLC using a Rainin MicrosorbTM C18 column (5 micron, 21.4 x 250 mm) at a linear acetonitrile content of 0.1% TFA (v / v). 〇% 〇00 / 〇) dissociation, 12 ml / min 3 Fractions containing the desired product are pooled and freeze-dried to produce 910-922. Analytical HPLC method: (1) Waters DeltaPak C18, 300A (5 microns, 3. 9 X 150 mm) a tJL line acetonitrile gradient (0% -25%) containing 0.1% TFA (v / v) for 14 minutes, 1 ml / min. (2) Waters DeltaPak C18, 300A ( 5 micron, 3.9 X 150 mm). Linear linear gradient (5% -45%) contains 0.1% TFA (Wv; ^ 14 minutes, 1 ml / min3 (锖 Please read the precautions for back cloud before filling in the second shell) )

L

T

I Consumption cooperation between employees of the Ministry of Economic Affairs and the Bureau of the Bureau Du Yinzhuang (3S) -3-[(3S) -2-copperyl-3- (isoquinoline-butyryl) amino group 0-hydroxyethylamyl-2,3, 4,5-tetrahydro-1Η-1,5 · benzodiazepine-buethamido] -4-one-butyric acid (696), synthesized from 600b by the method of preparing 691a from 600b, but Build 696. NMR (CD3OD) J 2.45 (in, 1H), 2 · 7 (m, 1H), 3.75 (d, -692- ft scale applicable to ts national standard (CNS) A4 (21〇 '&lt; 297 1235157 mm_B7_ V. Description of the invention U90) 1H), 3.95 (q, 1H), 4.05 (d, 1H), 4.3 '(m, 1H), 4.45-4.65 (m, 2H), 5.05 (m, 1H) , 7.5-7.76 (m, 3H), 7.7 (t, 1H), 7.8 (t, 1H), 7.98 (t, 1H), 8.55 (d, 1H), 9.1 (d, 1H) ^

696 · Rl- ^ ogp 69 «c R1- ^ 696bRl- ^ QQ. (3S) -2-Mengyl-3- (iso" -1 -Slit base) Waist base-5-Methylethoxy-N · [(2trans-5, .5) -fluorenyl-5-meneyl-tetraazepine-3-yl] -2,3,4,5-tetrahydro-111-1,5-benzobis Azapyridine-1-acetamidamine (696a) is a method for preparing 690a by using 600b, which is synthesized from 600b, and can produce 696a. 4 NMR (CDC13) d 0.95 Printed by the Ministry of Economic Affairs of the Ministry of Economic Affairs and Staff for Consumer Cooperation (t, 2H), 1.25 (t, 1H), 1.4 (m, 2H), 1.55 (m, 1H), 2.55 (m , 1H), 2.85 (m, 1H), 2.95 (dd, 1H), 3.15 (m, 1H), 3.55 (m, 1H), 3.9 (m, 2H), 4.35 (t, 1H), 4.4-4.55 ( m, 2H), 4.75 (m, 1H), 4.8-5.05 (m, 2H), 5.45 (s, 1H), 5.55 (d, 1H), 6.85 (d, 1H), 7.15 (d, 1H) T 7.2 -7.5 (m, 5H), 7.6-7.8 (m, 3H), 8.45 (d, 1H), 9.05 (d, 1H), 9.35 (d, 1H) ^ (3S) -2-keto-3- ( Isoquinoline-1-fluorenyl) amino-5-hydroxyacetamidine-N- -693- This paper method is commonly used in the 31 national standard (CNS) A4 Tiger (210, &lt; 297 Public Holiday) 1235157 A7 — B7 V. Description of the invention (691) [(2RS, 3S) -ethoxy-5-fluorenyl-tetrahydrodecan-3-yl] -2,3,4,5-tetrahydro] η, 1,5 -Benzodiazepine-1-epioxamine (696a), synthesized from 600b by the method of fluorene 690a made of fluorene 600b, which can produce 696b. 4 NMR (CDCl;) j 0 9 (m, 3H), 1.15 (q, 3H), 1.15 (m, 1H), 1.65 (m, 1H), 2.5 (m, 1H), 2.8 (m, 1H), 2.95-3.0 (m, 2H), 3.6 (m, 2H), 3.7-3.85 (m, 4H), 4.0 (m, 2H), 4.3 (m, 1H), 4.55 (m, 1H), 4.65 (m, 1H), 4.85-4.95 (m, 1H), 5.05 (m, 1H), 5.35 (s, 1H), 5.45 (d, 1H), 6.85 (d, 1H), 7.25 (d, 1H), 7.35-7.85 (6H), 8.85 (dd, 2H)? 9.05 (m, 1H), 9.35 (dd, 2H) ^ (3S) -2-fluorenyl-3- (isoteolin-1-vinyl) amino-5 -¾Acetoyl- [2RS- (4-Arylidene) lactylpyridyl-tetrazineyl-3 -yl] -2,3,4,5-θ ^ -1Η-1,5 · benzo Diazapyridine-1-carboxamide (696c), synthesized from 600b by the method of preparing 690a from 600b, can generate 696c 3 old NMR (CD3OD) d 1 · 25 (t, 1H), 1.65 (q, 1H) , 1.9 (m, 1H), 2.9 (m, 1H), 3.05 (m, 1H), 3.9 (d, 1H), 4.2 (m, 1H), 4.3 (d, 1H), 4.7-5.0 (m, 3H ), 5.25 (m, 1H), 5.7 (s, 1H), 5.9 (d, 1H), 7.5 (d, 2H), 7.7.7 · 9 (m, 3H), 8.0 (t, 1H ), 8.2 (m, 2H), 8.75 (d, 1H), 9.35 (d, 1H) ^ Printed by the Ministry of Economic Affairs, the Consumers' Cooperatives of the Bureau of Standards and Labor Bureau 讶 (Suddenly read the back & note and fill in Big dibe) (3S) -2-keto- 3- (isoquinoline-butyryl) amino-5-hydroxyethylfluorenyl- (2RS-epoxymethoxyketo-tetrahydrofuran-3-yl) -2,3,4,5-tetrahydro-1H-1 , 5-Benzodiazepinecarboxamide (696d), synthesized from 600b by the method of preparing 690a from 600b, can produce 696d. lH NMR * (CDC13) d 0.9 (t, 1H), 1.2 (t, 1H), 1.3-1.45 (m, 2H), 1.6-1.8 (m, 4H), 2.45 (m, 1H), 2.8 (m, 1H), 3.0 (m, 1H), 3.4 (q, 1H), 3.5 (d, 1H), 4.0 (m, 2H), 4.2-4.3 (m, 2H), 4.55 (d, 1H), 4.65 (m , 1H), 4.9 (m, 1H), 5.05 -694- The standard of this paper is applicable to China a standard (CNS) A4 specification (210X 297 mm) 1235157 Λ 7 Β7 ___ 5. Description of the invention (692) (m, 1Η), 5.4 (s, 1Η), 5.5 (d, 1Η), 6.8 (d, 1Η), 7.3-7.9 (m, 6Η), 8.5 (d, lH), 9.05 (d, 1H), 9.4 (d , 1H). (3S) -2-keto-3- (isofluorin-1-yl) amino-5-hydroxyethylfluorenyl-N-[(2RS, jS) -Ethyllactyl-5-benzyl-tetra Fenghanchuan-3-yl] -2,3,4,5-tetrakis ** 1H-1,5-benzodiazepine-1-acetamidine (696e), a method for preparing 690a by using 600b Synthesized from 600b, it can generate 696e. NMR (CDCl3) 1.2 (t, 1H), 2.4 (m, 1H), 2.8 (m, 2H), 3.6 (d, 1H), 3.7 (q, 1H), 4.0 (m, 2H), 4.3 ( d, 2H), 4.65 (m, 1H), 4.85 (t, 1H), 5.0 (m, 1H), 5.35 (d, 1H), 6.5 (d, 1H), 7.15-7.85 (m, 8H), 8.45 (d, 1H), 9,05 (d, 1H), 9.4 (d, 1H). (Please read what's on the back ^ before filling out this page) Printed by the China-China Bureau of Consumer Affairs, Ministry of Economic Affairs, Du printed -695- The standard is appropriate;?! China National Standards (&quot; cG &gt; A4 gauge (2! 0 X 29? Mm i 1235157 7 7 Λ Β V. Description of the invention (693) Employees in the Ministry of Economic Affairs of the Ministry of Economic Affairs and Standards Bureau consumer cooperation Du printed compounds UV-visible light Ki (nM) Cell PBMC avg. IC50 (nM) human whole blood IC50 (nM) rat clearance, iv · ml / min / kg rat clearance * · rate, iv · ml / min / kg 688c 200% 689b-l 3.5 2700 696-1 0-5 696-2 0.5-697 1.8 5000 698 18 13500 699 1.1 699a-2 720 2-7 721 1.3 5000 722 5 5000 723 2.3 2000 * 724 2 1800 725 3.7 3000 726 300 727 50 2300 728 300 729 28 2800 730 90 8000 * 731 150 732 5 1800 733 5 1500 734 9 6000 735 6 10000 -696- The standard of this paper is applicable to the national standard plum (CNS) Α4 gauge (210 × 297 public holiday) 1235157 Λ7-____ B7_ V. Description of the invention (694) Example 3 3. Compounds 684a, 688b-l 688c, 689b-1, 690a-1, 696-1, 696-2, 696a-2, 696a-1, 697, 697a, 698, 698a, 699, 699a, 699a-1, 699a-2, 800 and 801 are as follows (Please read and read the intentions of the back of the cloud before filling in the clothing page) The central sample of the Ministry of Economic Affairs and the employee's consumer cooperation for printing CIP # R4 R3 R5 R1 684a H 0 x ^ OtBu OAc 688b-l CH3 o Me〇_ ^ F 4 688c 0 MeO_ ^ H 0 々OH Λτ ^ P 689b-l CH3?. Mine CH3 0 F 0 ^ OH &quot; V 690a-l 〇h 0 H〇 ^ H 〇A〇et -A ^ oet OEt R5

-697- This paper is a standard of China National Standard (CNS) A4 Tige (210X 297 mm) 1235157 A7 B7 V. Description of the invention (695) Printed by the Consumer Affairs Cooperative of the Central China Bureau of the Ministry of Economic Affairs ¾ CIP # R4 R3, R5 R1 696-1 0 F 0 696-2 0 H〇Ji ^ Cl XoH V 696a-2 0 H〇 ^ Cl 696a-l 0 F 4: 697 0 H 697a 0 H〇_l ^ H 4: 698 hX HO ^ OH 698a hA H Λ O day n 699 o H 0 produced OH ^ VH 699a MeO ^^ H 4 ° 0 OBn (Please read the precautions of δ before filling in this page} -698- Clothing &amp;amp; size in use SI National Standard (CNS) 4 people (210 X297 mm) 1235157

(3S) -3-[(3S) -2-keto-3- (3,5-dimethylhydroxyfluorenyl) aminohydroxytriethyl-2,3,4,5-tetrahydro- 1H-1,5-benzo-azabenzene small ethyl chain amino group] 4 4-diethoxybutyric acid ethyl ester (690a-1), synthesized by the methods of 6903 and 21001 ?, can produce 690a- l JH NMR (CDC13) 〇 '1.15 (t, 6H), 1.3 (t, printed by Shelley Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs ¾ 3H), 2.25 (s, 6H), 2.60 (d, 2H), 3.50 (m, 2H), 3.70 (m, 4H), 4.05 (m, 2H), 4.15 (m, 2H), 4.30 (d, 1H), 4.45 (m, lH), 4.d0 (d, 1H), 4.55 (d, 1H), 4.70 (t, 1H), 5.05 (m, iH), 5.3〇 (s, 1H), 6.70 (d, 1H), 7.10 (d, 2H), 7.30-7.50 (m, 7H ) (3 5) -2-keto-3- (3,5-digas-4-aminobenzyl) amino-5-mercaptoethoxy · N-[(2RS, 3S) 2- Fluorenyl small keto-tetrahydrofuran-3-yl] -2,3,4,5'tetrahydro-1 fluorene · 1,5-benzazadiazepine-ethylacetamide (697a), using the method of 677 Synthesized, 840 mg of 697a can be produced, [Η NMR (CD3OD) 5 1.78 (br · -699- This paper flower scale is applicable to Chinese national plum (〇 ^) six 4 specifications (210 &gt; &lt; 37 mm) 1235157 A7 _ __B7______ One or five, the description of the invention (697) s, 2H), 2.48-3.58 (d, 0.5 ·), 2.6-2.7, (m, 0.5Η), 2.8-2 · 9 (m, 0.5Η), 2.92-3.03 (m, 0.5Η), 3.55-3.8 (m, 2H), 3.92-4.02 (d, 1H), 4.25-4.3 (d, 0.5H), 4.37-4.42 (d, 0.5H), 4.43-4.48 (m, 0.5H), 4.55-4.65 (m , 1.5H), 4.7o.l2 (m, 5H), 5.44 (s, 0.5H), 5.58-5.63 (d, 0.5H), 6.95-8.1 (m, 13H) ^ (3 5) -3- [ (35) -2-keto-3- (3,5-digas-4-aminofluorenyl) amine_yl-5-ethanoyl-2,3,4,5-tetrahydro-1 1,5-Benzodiazepine-1-acetamidinyl] -4-ketobutanoic acid (697), synthesized by the method of 2001 and 2002, yielding 140 mg of 697, lH NMR (CD3OD) d 238-2.5 (m, 1H), 2.55-2.75 (m, 1H), 3.68-3.9 (m, 3H), 3.95-4.03 (m, 1H), 4.2-4.3 (m, 1H)? 4.4-4, 7 (m, 4H), 7.35-7.8 (m, 6H). (3S) -3-[(3S) -2-keto-3- (3,5-dimethyl-4-methoxybenzylfluorenyl) ammonium via ethylethoxy-2,3,4, 5-tetrahydro-1 fluorene-1,5 · benzodiazepine-1-ethylamine amine] -4-ethylfluorenyloxy-3-butenoate (684a), synthesized by the method of 2100j 684a, lH NMR (500 MHz, CDC13 diastereoisomeric mixture of isomers) β 1 · 3 (s, 9H), 1.8 (s, 3H), 2.1 (s, 3H), 2.15 ( s, 3H), 2.3 (s, 6H), 3.3-3.5 (m, 3H), 3.65 (s, 3H), 3.9 (m, 1H), 4.1 (d, 1H), 4.3 ( d, 1H), 4.6-4.8 (m, 3H), 5.0 (m, 1H), 6.7 (s, ih), 7.0 (d, 1H), 7.1 (d, 1H), 7.2-7.5 (m, 6H) «Printed by the Ministry of Economic Affairs and the Consumers' Cooperatives of the China Bureau of Printing ¾ (3S) -2-keto-3-isoquinolin-1-amidinoamino-5-methylamido-N-[(2RS, 3S ) -2_ alkoxy-5-83yl-tetrahydroxan-3-yl] -2,3,4,5-tetraargon-1FM, 5-benzodiazepine · buethamidinyl ( 698a), synthesized by the method of 652, can produce 795 mg of 698a, lH NMR (500 MHz, CDC13 diastereoisomeric mixture) β 2 · 8 (m, 2H), 4.0 (m, 1H ), 4.5-4.8 (m, 4H), 5.2 -700- The standard of this paper is applicable to Chinese national standard (Former case of CNSM4 (210 ·, &lt; 297 mm) 1235157 Λ 7 Β7 ___ V. Description of the invention (698) ^ (m, 1H), 5.5 (s, 1H), 5.75 (d, 1H), 7 ^ 3- 7.85 (m, ΠΗ), 7.9 (t, iH), 8.2 (d, 1H), 8.6 (m, 1H), 9.3 (m, 1H) 3 (3S) -3-[(3S) -2-one -3-isoquinolin-1-amidinoamino-5-methylamido-2,3,4,5-tetrahydro · 1Η · 1,5-benzodiazepine-1-ethylamidoamino Bu 4-ketobutyric acid (698), synthesized by the method of 653, can produce 225 mg of 698, β NMR (500 MHz, CD3OD) d 2.4 (m, 1H), 2.6 (m, 1H), 3.9 (m , 1H), 4.2 (m? 1H), 4.3-4.7 (m, 4H), 5.1 (m, 1H), 7.3-7.5 (m, 4H), 7.6-7.8 (m, 2H), 7.8 (m, 2H ), 8.2 (d, 1H), 8.5 (d, 1H), 9.0 (d, 1H). (3S) -2 · keto · 3 · isoquinolin-1-fluorenylamino · 5-methoxyethenyl-N-[(2RS, 3S) 2-benzyloxy · 5-keto- Tetrahydrofuran-3-yl) -2,3,4,5-tetrahydro-lPM, 5-benzodiazepine-l-acetamide (699a), synthesized by the method of 655, can produce 820 mg of 699a , As a brown solid, 4 NMR (500 MHz, CDCI3) ^ 2.60 (ddd, 1H), 2.90 (ddd, 1H), 3.20 (s, 3H), 3.25 (s, 3H), 3.70 (t, 1H), 3.90 (m, 2H), 4.20 (dd, 1H), 4.60 (m, 2H), 4.70-5.00 (m, 5H), 5.55 (d, 1H), 7.00 (d, 1H), 7.20- Ministry of Economic Affairs Printed by the member of the Bureau v. Consumer Cooperatives (please read this matter before reading this question before filling in this I) 7.50 (m, 7H), 8.45 (dd, 1H), 9.0 (dd, 1H), and 9.35 ppm ( dd, 1H (3S) -2-keto-3- (3,5 · dimethyl-4-hydroxyfluorenyl) aminofluorenylethynyl-N-[(2RS, 3S) 2- Benzyloxy-5-keto-tetrahydrofuranyl 1,2,3,4,5-tetrahydrofuran-7-gas benzodiazepine-oxetamine (688b-1) can be synthesized by the method of 655 600 mg of 688b-i, 1H NMR (CDCl3: mixture of non-paraisomeric stereoisomers) ί 2.21 (s, 3H), 2.28 (s, 3Η), 2.42-2.50 (m, 0.5 Η) , 2.53-2.65 (m, 0.5H), 2.83-2.9.1 (m, 0.5H), 2.98-3.1 (m, 0.5H), 3.18 (s, i.5H), 3.22 (s, 1.5H),- 701- __ This 泜 & footing is applicable to Chinese National Standards (CNS) '* \ 4 see grid (2i〇x: 9 public 茇) 1235157 A7 B7 V. Description of the invention (6 &quot;) 3.72-3.78 (d, lH), 3.78-3.9 (m, 2H), 4.08-4.15 (d, lH), 4.5- 4.69 (m, 3H), 4.7-4.85 (m, 1H), 4.88ο.1 (m, 2H), 5.45 (s, 0.5H), 5.55-5.65 (d, 0.5H), 6.85-6.92 (m, 1H), 7.02 ^ 7.13 (m? 2H), 7.24 ^ 7.55 (m, 9H) ^ (35) -3 -[(35) -2-copperyl-3- (3,5-dimethyl-4-caproxyl § radical) cavity group_5-methylethylfluorenyl-2,3,4,5- Tetrahydro-7-fluoro-1 ± 1,5-benzodiazepine-1-acetamidinylamino] · 4-ketobutyric acid (689b-1), synthesized by the method of fluorene 2001 preparation 2002 Generates 6891) -1, 1 ^ 1 to] ^ (00300) (^ 2.18 (5,6 buckle, 2.36-2.47 (m, 1H), 2.6-2.72 (m, 1H), 3.34 (s, 3H), 3.66-3.88 (m, 2H), 3.95-4.05 (m, 1H), 4.2-4.78 (m, 5H), 4.9 (m, 1H)? 7.3 · 7.41 (m, 2H), 7.48 (s, 2H), 7.5-7.63 (m, 1H) ^ (3S) -3-[(3S) -2 · steel-3-isojunlin-l-δ-aminoamino-5-methoxyethynyl, 2,3 , 4,5-tetra-argon-1-1,5-benzene Diazapyridine-1-ethylamidoamino 4-ketobutyric acid (699), synthesized by the method of 2001 and 2002, can produce 699 as a white solid, 4 NMR (500 MHz, CD3OD) d 2.50 (m, 1Η), printed by the Consumers ’Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (Notes on Poems and Reading Clouds: Jade Filling. This page) 2.70 (m, 1H), 3.25 (s, 3H) , 3.80 (bd, 1H), 3.90 (bd, 1H)? 4.00 (bd, 1H), 4.30 (m, 1H), 4.50-4.70 (m, 3H), 4.80-4.85 (bt, 1H), 5.00 (bm , 1H), 7.40-7.55 (m, 5H), 7.70 (bm, 1H), 7.85 (bm, 1H), 8.00 (bm, 1H), 8.55 (bd, 1H), and 9.05 ppm (bd, 1H) a (3S) -2-fluorenyl-3-isojunlin-1-pyridylamino-5-hexylethoxy-N-[(2RS, 3S) 2-benzyloxy-5-keto-tetra Argofuran-3-yl] -2,3,4,5-tetrahydro-7-gas-1H-1,5-benzodiazepine-1-acetamidine (696a-l) Synthesized by the method, 800 solids can be generated, 4 NMR (500, MHz, CDCi3) 2.55 (ddd, 1H), 2.85 (ddd, 1H), 3.70-3.80 (m, 2H), -702 Chinese National Standard Li (CNS M4 is now Luo (2 丨 OX 297 public cage) 1235157 A7 —____ B7____ 5. Description of the invention (7〇〇) 3.9 5 (bm, 1H), 4.05 (d, 1H), 4.30 (d; 1H), 4.40-4.60 (m, 4H), 4.70-5.05 (m, 4H), 5.55 (d, 1H), 7.10 ( d, 1H), 7.20-7.35 (m, 3H), 7.40-7.50 (m, 1H), 7.60-7.85 (m, 3H), 8.40 (dd, 1H), 9.10 (m, 1H), and 9.30 pp (m, 1H) a (3S) -2-keto-3-iso4-pyridin-1-aminoamino-5 · superylethynyl-N- [(2trans5,33) 2- Benzyl-5-copperyl-tetrahydroxan-3, yl] -2,3,4,5-tetrahydro-7-gas-1Η · 1,5-benzyl-digas heteroben-1-ethyl Fermented amine (696a-2), synthesized by the method of 677, can produce 204 mg of 696a-2, which is a white solid gift. The following exception is applied to reduce the nitro group: p-nitro compound (72 g, 20%) To a solution of MeOH, NH4C1 (2.1 g, 39 mmol) and Zn (17 g '260 mmol) c »were added and the mixture was heated under reflux for 1 hour, then cooled and filtered through Celite. The filtrate was concentrated under vacuum and treated with cold in HC1 to produce 3.6 grams of light red solid. W NMR (CDC13) 〇 '1.85 (s, 1H), 2.45 (d, 0.5H), 2.50-2.65 (m, 0.5H), 2.80-2.90 (m, 0.5H), 2.90-3.00 (m, 0.5H ), 3.45 (s, 0.5H), 3.55-3.75 (m, 1H), 3.85-4.15 (m &gt; 2H), 4.25 (d, 1H), 4.40-4.65 (m, 2H), 4.70-4.80 (m, 0.5H), 4.85oM5 (m, 3H), 5.40 (s, 0.5H), 5.60 (d, 0.5H), 7.00 (d, 0.5H), 7.15-7.90 (m, 12.5H), 8.35-8.45 ( m, 1H), 9.00-9.10 (m, 1H), 9.25-9.40 (m, 1H) The staff of the Central Bureau of the Ministry of Economic Affairs should cooperate with the printed documents (please read the legal meaning of δ before filling out this page) ) (3S) -3-[(3S) -2-keto-3-iso4line-1-amidinoamino-5-hydroxyacetamido-2. , 4,5-tetrakis, 7-qi-11 ^ -1,5-private-diazacha-1-ethynylamino] -4-benzylbutyric acid (696-1), prepared from 2001 2002 Synthesized by this method, 140 mg of 696-1 was produced as a white solid. 4 NMR (500, MHz, CD3OD) was 2.50 (m, 1H), 2.70 (m, 1H), 3.85 (d, 1H), 3.95 ( m, -703- This paper scale is applicable to the Chinese national standard (CNS) A4 condition (210X 297 cm) 1235157 Λ7 B7 V. Description of the invention (701) 1H), 4.10 (d, 1H), 4.35 (m, 1H ), 4.50-4.60 (m? 2H), 4.80 (bm, iH), 5.00 (m, 1H), 7.40-7.48 (m, 3H), 7.65 (m, 1H), 7.75 (t, 1H), 7. 85 (t, 1H), 8.00 (d, 1H), 8.55 (d, 1H), and 9.05 ppm (d, 1H). (3S) -3-[(3S) -2-keto-3-isoquinolin-1-amidinoamino-5-hydroxyacetamido2.3.4.5- tetrahydro-7-gas-111-1 , 5-Benzodiazepine-1-acetamido] -4-ketobutanoic acid (696-2), synthesized by the method of 2001 and 2002, can produce 250 mg of 696.2, which is white Solid, 111 1 ^ 11 (00300) 0'2.40- 2.55 (m, 1H), 2.60-2.75 (m, IH), 3.80-4.00 (m, 2H), 4.05 (d, 1H), 4.20-4.35 ( m, 1H), 4.45-4.65 (m, 3H), 4.80-5.10 (m, 2H) (3S) -2-ylisocyanate -N-[(2RS, 3S) oxy-5-copperyl-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-7-gas-1pyrene-1,5 · benzo Diazapyridine-1-acetamidine (699a-l), synthesized by the method of preparation 655, can generate 699a-1, W NMR (500 MHz, CDC13) d 2.55 (ddd, 1H), 2.90 (ddd, 1H ), 3.25 (s, 3H), 3.28 (s, 3H), 3.80 (bt, 2H), 3.95 (bm, 2H), 4.25 (dd, 1H), 4.45-4.90 (m, 3H)? 5.60 (d, 1H), 7.05-7.40 (m, 8H), 7.50 (bm, 1H), 7.65-7.85 (in, 2H), 8.45 (d, lH), 9.1 (m, lH), & 9.35ppm (m, lH ) (3S) -3-[(3S) -2-keto-3-iso4line-1-amidinoamino-5-methoxyethynyl-Member of the Central Standards Bureau of the Ministry of Economic Affairs Printed by the Industrial and Consumer Cooperatives (Read the air-brush and cloud-filled items together) 2.3.4.4.5-tetrahydro-7-gas-lH-l, 5-benzodiazepine-Bu Yi Fluorenylamino] -4-ketobutanoic acid (699a-2), synthesized by the method 2001 k Preparation 2002, can generate 699a-2, lH NMR (500 MHz, CD3OD) 2.51 (m, 1H), 2.70 (dt, 1H), 3.31 (bs, 3H), 3.90 (bdt, iH), 3.95 (bm, 1H), 4.05 (d, 1H), 4.35 (m, 1H), 4.50 (d, 1H), 4.60 (dd, 1H), 4.65 • 704- Λ paper scale is applicable to the Chinese National Leather (CNS) A4 specification (2l0x: 9 mm) 1235157 Λ7 __B7_____ V. Description of the invention (702) (dt, 1H), 4.80 (m, 1H), 5.05 (m, 1H), 7.35-7.48 (m, 3H), 7.65 (bm, 1H), 7.75 (t, 1H), 7.82 (t, 1H), 8.05 (d, 1H) , 8.55 (d, 1H), and 9.05 ppm (d, 1H). (35) -3-[(3 5) -2-keto-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino-5-fluorenoxyethenyl-2,3 , 4,5-tetrahydro-1 fluorene-1,5-benzodiazepine-1-ethylfluorenylamino] 4-ketobutanoic acid, 0-2,6-diaziridinyloxime (688c) Using the 308d synthesis method, 800, lHNMR (CD3OD), '2.2 (s, 6H), 2.58- 2.83 (m, 2H), 3.28 (s, 3H), 3.29-3.34 (m, 1H) , 3.68-3.80 (m, 2H), 3.95-4.05 (dd, 1H), 4.38-4.48 (dd, 1H)? 4.82-5.00 (m, 2H), 5.26-5.36 (m, 2H), 722-7.65 ( m, 10H) ^ Order of the Ministry of Economic Affairs, Employees' Cooperative Consumer Cooperative, India (3S) -2-keto- (2,4-dimethyl, sedazol-5-yl) amino-5-hydroxyacetamidine -N-[(2RS, 3S) 2-methoxy-5-keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-1H-1,5-benzodiazepine Pyrene-oxetamine (800), synthesized by the method of preparing 696a-1, can produce 204 mg of 800 as a yellow solid, β NMR (CDC13) (a mixture of non-isomeric stereoisomers) 0, 1.70 ( 5,1 buckle, 2.40-2.80 (m, 7H), 2.80-2.90 (m, 0.5H), 2.95-3.05 (m, 0.5H), 3.30-3.35 (m, 0.5H), 3.45-3.55 (m , 0.5H), 3.55-3.65 (m? 1H), 3.804.05 (m, 2H), 4.30-4.50 (m, 2H), 4.55-4.65 (m, 1H), 4.75-4.95 (m, 3H), 5.45 (s, 0.5H), 5.55 (d, 0.5H), 6.70 (d, 0.5H), 6.90 (d, 0.5H), 7.15-7.80 (m, 10H) (3S) -3-[(3S) -2 · keto-3- (2,4-dimethylthiazolyl · ι · fluorenyl) amino-5-hydroxyacetamidine -2,3,4,5-tetrahydro-1,1,5-benzodiazepine-1-ethanamido] 4-ketobutanoic acid (801), prepared from 2001 and 2002 Synthesized by method, it can generate 80-705- this paper wave scale is applicable to 3 Chinese national standard (CNS) A4 ^ grid (210 X 297 mm> 1235157 Λ7 B7 V. Description of the invention (703 Example 34, compound 720- 73 was prepared in a similar manner to compound 619-635 (see Example 13). The physical data of compounds 720-73 are listed in Table 29. Real {please read the precautions of the back of the cloud before filling in the tr). M Ministry of Economic Affairs, China Prospective Bureau X Consumer Cooperation Du Yin ¾ -706 This paper ft standard universal 1 national standard (CNS) M specifications ( 210X 297 mm) 1235157 A7 B7 V. Description of the invention (704) Employees of the Ministry of Economic Affairs and the Ministry of Economic Cooperation and Cooperation printed 6CN4 CO Q9 VO UO 〇 VJD X dP &lt; Tk σ \ σ \ C \ J Bu ο f—4 dQ 〇 &gt; tl &lt; r CNJ Γ0 t—4 I ro C7i • VD guard wO m VO VD «-Η VD tX4 2 c \ o 5 CJ &lt; n CM • x ^ r CN U CTk sz 04 CO 5 CVJ 〇 Race X px. Divide r-V. = ^ 〇2: X Λ ί ~ ο CV4 ιΗ CV4 Bu-707- This paper method is again applicable to Chinese national standard cars (〇 &gt; ^) Six 4 dikes (210/297 mm) (Please read the 5 Note: Please fill in this note again) 1235157 Λ7 B7 V. Description of the invention (705) The work of the Central Bureau of Standards of the Ministry of Economic Affairs, printed by the cooperative + cn 5 2 Cvj CO t〇tO Today VO L〇〇ι X dP cn (7 ^ rH VO r · t-4 rH OP &lt; JS BU L〇L〇VO o fl ss VO ΙΛ uo to m in o if) Cu s 〇2; 〇r〇X r * C \ J CJ σ \ 〇 ^ 3 * 2 CO CM 2: VO &lt; N | CJ Race 2 X £ ♦ ZX Li CM CM bu m &lt; N bu -708- The paper standard is common Chinese national standard (CNS) A4 specification (210X 297 (Mm) (Please read the precautions for back cloud before filling out this page) Binding 1235157 A7 B7 V. Description of the invention (708) Employees' cooperation with the Order of the Ministry of Economic Affairs and the Ministry of Standards and Economics. · CO 5 ι-Η m VD lD, CNJ bu bu m X dP σ \ 00 ιη ο rH dP σ \ as as 04 cn tH 3: 2 LO 03 C0 tO &lt; J \ · vO CM to in tu X GO Ο i Γ0 X B &lt; N α CO 0z CM m X o CM u Race 5 r. Meaning δ x ° ^ r. Select CM to CM

Please read the back // idea% and then fill in the% I-709- The standard of this paper is applicable to Chinese National Standards (CNS) A4 (210 ×:! 97 mm) 1235157 Λ7B7 V. Description of Invention (707) Ministry of Economic Affairs FREE--Members of the Technical Bureau X eliminate cooperation cooperation ¾ + cn 2 2 GO 〇CM VO, VO VO o L〇X dP ON σ &gt; BU κο VO ο rH Cffi c \ i (Ti iD 03 〇CTk 2 2 Ο VO VO CTi to O 'to • CN GO U4 X o tH 〇2: &lt; N cn X CN o 〇 〇§ CNJ X CVJ 〇ifr. ^: Code 〇x £ δχ. Female ^ 3 VO CM 卜卜 &lt; N Bu (please read the precautions of Beiyun before filling in this tile) -710- This paper music scale is applicable to the national standard of the country (CNS) eight 4 dige (210X 297 mm) 1235157 AT B7 V. Description of the invention ( 7Ό8) 部 Ministry of Economy and Trade Standards Bureau of the People's Republic of China negative M consumer cooperatives ¾ X σ \ cn VO, cn 〇〇VD £ VD in L〇f-4 rl dP σι a \ «— ♦ rH VO f-4 rH 2 m VD 〇1-1 VO r- 'L〇CM 00 «r &gt; Cu SO r-4 O z &lt; nso ΓΟ CJ or—4 〇 2 o cn s CNi u X. 殳 ° ^ yC ^ x X or. &lt; α 00 CM. BU α &gt; CM BU-711-Common in paper scale National Standard Twin (CNS) A4 is present (2 丨 0, &lt; 297 mm) Poem ¾. Notes on reading δ are different. Fill in. Vj poor)

• 1T 1235157 A7 B7 V. Description of the invention (709) Ministry of Economic Affairs tr-rTfr China Bureau of Labor and Consumer Affairs Cooperative Press ¾ 2 CN4 CN BU LO 03 03 〇〇4 X dP σ \ α \ r &gt; σ &gt; η d4 & gt CM σ \ 00 σ \ CVJ 3: S ο ιΤ) σ \ uO cn-ιΛ ΓΟ VD tO Gu S ι-1 rH S Bu CNJ X η CM U 隹 ι-Η tH s Nai (VJ SC cut CM CJ. 々: Υ XP r 兹 s .. V1 X ο m r rH &lt; n ((please read the precautions of the back cloud first and then fill out this page) 712- The standard of this paper is applicable to China National Standard (CNS) A4逯 Grid (210 X297 mm) 1235157 A7 B7 V. Description of the invention (710) The Ministry of Economic Affairs ordered the staff of the Bureau to cooperate and print S ΐ 〇 \ in as ιΟ 'σ \ in VD in 52 &lt; JP CO σ \ ο VO BU d〇GO ON L〇Γ η BU 3: X cn 0 &quot;) CM Γ ιο η * L〇CM to Cau X f-4 tH O z CO CM X VO C \ J 〇o rl 〇 * &T; T § s to CM U Race X px ° ^ T δ x 0 = ^ r. &Gt; CM cn bu cn cn bu (please read the notes on the back before filling this page) -713- paper Music scale is applicable to Chinese national standard (CNS M4 is now (2iOx29? Mm) 1235157 A7 B7 5 Description of the invention (711) Printing of MS by the Ministry of Economic Affairs, Bureau of Standards, Consumer Affairs Cooperatives | (M + Na) + 630 · 6 / / 632.1 HPLC RT minutes 1 Purity 9.656 99% 10,887 92% ss 608.62 I 609.62 * CS4 X C32H28N607 C28H27N509S Structure § X h / ″, s: 〇 ″. * Hybrid compounds 734 735 -714- (Please read the notes on the back before filling in this one) The paper scale is common Chinese National Standard (CNS) A4 now (210X297 mm) 1235157 A7 _B7 _ V. Description of the Invention (712) Example 35. Compound 736-767 was prepared in a similar manner to compound 619-635 (see Example 13). Physical data for compound 736-767 In Table 30, (Please read the precautions on the back before filling in this f. Install the printed compound R4 R3 736 0 ΗΟ ^ Λ. 737: 0 H〇Ji ^ 738 0 ΗΟ ^ Λ 739 0 0 H〇Ji ^ 740 0 741 0 Order • ft,

• 715- The size of the paper method is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1235157

A V. Explanation of the invention (No. 3) Consumption cooperation between employees of the China Central Standards Bureau of the Ministry of Economic Affairs and the printing of 'compound R4, R3 742 0 H〇_J ^ 743 0 H〇 ^ 744 0〇Γ ^ 0 745 0 H〇4 746 0 H〇Ji ^ 747 〇 / 00¾ H〇 义 748 Η〇 ^ Λ. 749 0 ΗΟ ^ Λ, 750 0 η〇4 751 0 HO_J ^ 752 0CH3 Ο ΗΟ_1 ^ (Please read the precautions on the back first (鸾 Page) Binding 1-716-Standards for clothing, clothing, clothing, clothing, etc. (CNS) A4 specifications (210X297 mm) 1235157 A7 B7 V. Description of invention (714) Central Bureau of Standards, Ministry of Economic Affairs W; Industry and Consumer Cooperatives Printed compounds R4 R3 753 H3C HaC 0 ΗΟ ^ Λ, 754 • 0 ^ ο ΗΟ ^ Λ 755 0 H0_J ^ 756 OHO 0 757 OH 0 0 758 Ο 759 0 760 Η 0 0 hoJC ^? 61 Ο HC〇 ^ 762 0 763 0 • 717 · The national standard (CNS) of this paper is applicable to a national standard (CNS) A4% grid (210 × 297 mm) (Please read the precautions on the back first; ^ | write this page) Binding 1235157 A7 B7 V. Description of invention (715 ) Compound R4 R3 764 0 765 0 HO_j ^ 766 Η 0 767 o (Please read the precautions on the back before filling this page) Specify the data of the example A compound according to the present invention, can be converted to the IL-1 exhibits enzyme inhibitory activity. The compound of the present invention can inhibit ICE in a test tube, and can be further delivered orally to mammals, and has obvious clinical application in treating IL-1-, one of the expected cell death, and diseases mediated by IGIF- and IFN-r. value. These tests show the ability of the compounds to inhibit ICE in living pupae. Although we have described many specific examples of the present invention, it is obvious that our basic idea can be changed to propose other courteous examples in which the products and methods of the present invention are used. Therefore, it is obvious that the scope of the present invention is defined by the scope of the attached patent application, rather than by the specific specific examples shown in the examples. -718- The size of this paper is applicable to China National Standard (CNS) A4 (210X297mm)

Claims (1)

d touch 5157 "Patent Application No. 091132804 Chinese patent application scope replaces ⑼ and 月) Acupoints and patent application scope 2 · — a type of interleukin-inhibiting pharmaceutical composition that occupies conversion enzymes, and it is twisted. According to the scope of the patent application, the compound and the pharmaceutically acceptable '= root 3 · According to the patent application of the second patent scope The composition is, ... ^ It is used for the manufacture of 10,000; in the patient to treat or prevent a disease selected from the following agents: dagger-mediated diseases, cell-mediated death-mediated diseases, inflammatory diseases, self; 'Second epidemic diseases, proliferative disorders, infectious diseases, degenerative diseases, death diseases, osteoarthritis, acute pancreatitis' chronic pancreatitis, asthma, adult breathing and pain syndromes, glomerulonephritis, Rheumatoid arthritis, systemic lupus erythematosus, scleroderma, chronic thyroiditis, Grae's disease, autoimmune gastritis, insulin-dependent diabetes mellitus (type 1), autoimmune beans immunity> vernal anemia , Autoimmune neutropenia, thrombocytopenia, chronic active hepatitis, myasthenia gravis, inflammatory bowel disease, Crohn's disease, psoriasis, host-to-host disease, osteoporosis, and multiple Myeloma-related skeletal disorders, acute myeloid leukemia, chronic myelogenous leukemia, metastatic melanoma, Kaposi's sarcoma, multiple myeloma, sepsis, septic shock, Shigella's disease, Alzheimer's 'S disease, Parkinson's disease, cerebral ischemia, myocardial infarction, spinal muscular atrophy, multiple sclerosis, aids-associated encephalitis, HIV-associated encephalitis, aging, baldness, or Kampo paper caused by stroke Standards apply to Chinese National Standard (CNS) A4 specifications (210 X 297 mm) 1235157 Menstrual injuries. 4. The pharmaceutical composition according to item 3 of the scope of the patent application, wherein the 11 ^ 1-mediated disease is an inflammatory disease, which is selected from the following including osteoarthritis, heart (stomach and chronic pancreatitis) , Asthma and respiratory distress syndrome in adults. 5. The medical composition according to item 4 of the patent application, wherein the inflammatory disease is osteoarthritis or acute pancreatitis. The medical composition according to item 3 of the patent application Among them, the IL-1_ mediator, disease, autoimmune disease, is selected from the group consisting of the following: vasoglobulin I), rheumatoid arthritis, systemic lupus erythematosus, scleroderma, ten sex thyroid Inflammation, Grave's disease, autoimmune gastritis, insulin-dependent diabetes mellitus (type 丨), autoimmune hemolytic anemia, autoimmune immunity, neutropenia, thrombocytopenia, Chronic active liver fire, myasthenia gravis, inflammatory bowel disease, Crohn's disease, and graft-to-host disease. 7. The pharmaceutical composition according to item 6 of the scope of patent application, wherein the autoimmune disease is rheumatoid arthritis, inflammatory bowel disease, crohn's disease, or bovine dermatitis. 8. The pharmaceutical composition according to item 3 of the scope of the patent application, wherein the disease mediated by IL_i_ is a destructive gastro-skeletal disorder, which is selected from the following including osteoporosis or bones associated with multiple myeloma Disorders. 9. The pharmaceutical composition according to item 3 of the scope of patent application, wherein the disease mediated by IL_ 丨 is a proliferative disorder selected from the group consisting of acute myeloid leukemia, chronic myeloid leukemia, and metastatic melanoma Kappa-2-t paper scale suitable for financial @ S 家 standard (CNS) A4 specification (21G X 297 mm) 1235157 A8 B8 C8 Patent application scope Wester's sarcoma and multiple myeloma. 10. The pharmaceutical composition according to item 2 of the scope of patent application, wherein the IL-1-mediated disease is an infectious disease, which is selected from the following including sepsis, septic shock, and Shigella disease. il. The pharmaceutical composition according to item 3 of the scope of patent application, wherein the 乩-丨 -mediated disease is a degenerative or necrotic disease, which is selected from the following including Alzheimer's disease, Parkinson's Disease, cerebral ischemia and myocardial infarction. 1 2. The pharmaceutical composition according to item n of the scope of patent application, wherein the degenerative disease is Alzheimer's disease. 1 3 · The pharmaceutical composition according to item 3 of the scope of the patent application, wherein the disease mediated by the cell's expected death is a degenerative disease selected from the following including Alzheimer's disease, Parkinson's Disease, cerebral ischemia, myocardial infarction, spinal muscular atrophy, multiple sclerosis, AIDS-related encephalitis, HIV-related encephalitis, aging, onset, and neurological damage due to stroke. -3- This paper size applies to China National Standard (CNS) A4 (210X 297 mm)