TW541309B - Inhibitors of interleukin-1beta converting enzyme - Google Patents

Abstract

The present invention relates to novel classes of compounds which are inhibitors of interleukin-1beta converting enzyme. The ICE inhibitors of this invention are characterized by specific structural and physicochemical features. This invention also relates to pharmaceutical compositions comprising these compounds. The compounds and pharmaceutical compositions of this invention are particularly well suited for inhibiting ICE activity and consequently, may be advantageously used as agents against IL-1-, apoptosis-, IGIF-, and IFN-gamma-mediated diseases, inflammatory diseases, autoimmune diseases, destructive bone disorders, proliferative disorders, infectious diseases, degenerative diseases, and necrotic diseases. This invention also relates to pharmaceutical compositions formulated for use in inhibiting ICE activity, for treating interleukin-1-, apoptosis-, IGIF- and IFN-gamma-mediated diseases and decreasing IGIF and IFN-gamma production using the compounds and compositions of this invention. This invention also relates to methods for preparing N-acylamino compounds.

Description

Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 V. Description of the Invention (Technical Field of Invention_ > The present invention relates to a novel class of compounds, which are inhibitors of the conversion of S-I (ICE) to melanin-1. The present invention also relates to medicines containing these compounds, and becomes. The compounds and pharmaceutical compositions of the present invention are particularly suitable for inhibiting the activity of ICE, and thus can be beneficially used as antagonists against melanin · ι · (,, π_ι "), cells Prognosis 叱 1 = 7 ... interferon Γ mediator- (, 'IGIF ,,) and interferon-factor · ΓΙΡΝ- Γ ”) mediate diseases, especially inflammatory diseases #, autoimmune diseases, destruction Bone diseases, proliferative disorders, infectious diseases and degenerative diseases. The present invention is also related to a method for preparing ICE activity, reducing the production of IGIF and IFN-r, and using the compounds and compositions of the present invention to treat interleukins, expected cell death-, IGIF-, and IFN-r. Disease-mediated methods. The invention also relates to a method for preparing N-fluorenylamino compounds. Background of the invention

Interleukin-1 (`` IL-Γ ') is a major pro-inflammatory and immunoregulatory protein that stimulates fibroblast differentiation and proliferation, and produces prostaglandins and collagenases from synoviocytes and osteocytes. And phospholipase, basophilic eosinophils and eosinophils degranulation and neutrophil activation. Oppenheim, J.H. et al.? Immunology Todav. 7, pp. 45-50 (1986). As such, it is involved in the pathogenesis of chronic and acute inflammation and autoimmune diseases. For example, in rheumatoid arthritis, IL-1 is a mediator of inflammation symptoms in damaged joints and a mediator of cartilage proteoglycan destruction. Wood, DD et al. 5 Arthritis Rheun ^ 26: 975 (1983); Pettipher, EJ et al., Proc. Natl. Acad · Sci · UN Ding ED STATES OF AMERICA 71, 295 (1986), Arend, WP and Dayer, JM, -4- This paper size applies to China National Standard (CNS) A4 (21〇X 297mm)

541309 A7 -------- B7_ V. Description of the invention (2)

Arthritis Rheum. 38. 1 5 1 (1995). IL-1 is also a highly potent bone wasting agent. Jandiski, J.J., J. Oral Path 17, 145 (1988); Dewhirst, F.E. et al., J. Immunol. 8, 2562 1985). It is also called "osteoclast activating factor" in destructive bone diseases, such as osteoarthritis and multiple osteosarcoma. Bataille, R. et al., Int. J. Clin. Lab. 21 (4), 283 (1992). In some dysplasias, such as acute myeloid leukemia and multiple myeloma, IL- 丨 can promote the growth of tumors, Putian cells, and withering. Bani, M, R., J. Natl. Cancer Inst. 83, 123 (1991); Vidal-Vanaclocha, F., Cancer Res. 54, f667 (1994). In these disorders, IL-1 can also stimulate other cytokines, such as IL-6, which can regulate tumor development. (Tartour et al., Cancer Res. 54, 6243 (1994). IL-1 is mainly produced by peripheral blood mononuclear cells due to a part of the inflammatory response, and exists in two different agonist types. IL j. Moseiy, BS et a1, [roc · Nat. Acad · Sci · 84, pp. 4572-4576 (1987); Lonnemann, G. et al ·, Eur »J, Immunol., 19, pp ;. 1 53 1-1536 (1989) 〇IL-Lu Cheng biologically inactive precursor form was synthesized, Lu. pIL_ Printed by the Central Consumers Bureau of the Ministry of Economic Affairs, Printed by the Consumer Consumption Cooperative 1 It lacks the traditional leader sequence and does not Modified by signal peptidase. March, CJ ·, Nature, 3 1 5, ρ · 641-647 (1985). Conversely, pIL-l々 is a melanin-1 /? Converting enzyme ("ICE, ') Dissociates between Asp-116 and Ala-117, resulting in biologically active terminal fragments visible in human serum and synovial fluid. Sleath, PR, et al., J. Biol · Chem "265? Pp. 14526-14528 ( 1992); AD Howard et al., J. Immunol ·, 147 · pp · 2964-2969 (1991). ICE is a cysteine protease, which is mainly located at -5- This paper standard is applicable to the Chinese National Standard (CNS) A4 specifications (210X 297 public holidays) 541309 A7 _____ B7_ V. Description of the invention (3) Monocytes. It can convert the precursor IL- /? Into a mature form. Black, RA. Et al., FEBS Lett., 247 pp. 386-390 (1989); Kostura, MJ. et al., Proc. Natl. Acad. Sci. UNITED STATES OF AMERICA, 86, pp. 5227-523 1 (1989). Modification with ICE treatment also passes through the cell membrane Necessary for transporting mature IL-. ICE, or a homologue thereof, also appears to be involved in the regulation of scheduled or expected cell death. Yuan, J. et al., Cell, 75, pp. 641-652 ( 1993); Miura, M. et al., Cell, 75, pp. 653-660 (1993); Nett-Fiordalisi, MA et al., J. Cell Biochem. 17B, p. 117 (1993). In particular, ICE or ICE homologues are considered to be involved in the regulation of expected cell death in neurodegenerative diseases such as Alzheimer's and Parkinson's disease. Marx, J. and M. Baringa, Science, 259 pp. 760-762 (1993); Gagliardini, V. et al., Science, 263, pp. 826-828 (1994). Therapeutic applications of suppressing cell death can include treating Alzheimer's disease, Parkinson's disease, stroke, myocardial infarction, spinal atrophy, and aging. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs It has been proven that ICE can mediate the expected death of cells in specific tissue types. Steller, H., Science, 267, p. 1445 (1995); Whyte, M. and Evan, G., Nature 376, p. 17 (1995); Martin, SJ and Green, DR., Cell, 82, p. · 349 (1995); Alnemri, ES ·, et al ·, J. Biol · c_hem ·, 270, p. 43 12 (1995); Yuan, J. Curr. Opin. Cell Biol, v, p. 2 1 1 (1995) Introduced foreign gene mice with disintegrated ICE genes are defective in the expected death of Fas-mediated cells (Kuida, K. et al., Science 267, 2000 (1995)). This activity of ICE and its cold treatment repairs are used as pro_ILi. This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297 mm) Two ------ 541309 A7 ______B7 V. Description of the invention (4) (Please read the notes on the back before filling out this page.) The role of decoration enzymes is quite different. It is perceivable that in specific tissue types, the inhibitory effect of ICE may not affect the secretion of mature iL-dots, but it may also inhibit the expected cell death. Enzymatically active ICE has previously been described as a heterodimer (20 kDa and 10 kDa molecular weight) consisting of two subunits p20 and plO. These subunits are derived from the 45kDa zymogen (p45) via the p30 form, via an autocatalytic activation mechanism. Thornberry, N.A. et al., Nature, 356, ρ · 768-774 (1992). The ICE zymogen has been divided into a number of functional regions: a pre-domain (pl4), a p22 / 20 sub-mutation, a polypeptide linker, and a plO subunit. Thornberry et al., Supra, Casano et al., Genomics, 20, pp. 474-481 (1994) 0 The full-length p45 printed by the Industrial and Commercial Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs has been provided by its CDNA and amino acid sequences. Characterization. PCT cases WO 9 1/1 5577 and WO 94/00154. p20 and p10 cDNA and amino acid sequences are also known. Thornberry et al. 9 supra. Murine and rat ICE have also been sequenced and selected. It has amino acids and nucleic acid sequences that are highly homologous to human ICE. Miller, DK. Et al., Ann. ND. Acad. Sci., 696, pp. 133-148 (1993); Molineaux, SM et al., Proc. Nat. Acad. Sci ,, 90, pp. 1809 -1813 (1993). The three-dimensional structure of ICE can already be determined by X-ray crystallography under atomic resolution. Wilson, K.P., et al., Nature, 3 70, pp. 270-275 (1994). The active enzyme is a tetramer with two p20 and two plO subunits. In addition, there is also a human homologue of ICE, the sequence of which is similar to that of the active site of the enzyme. This homologue includes TX (* ICEreI-II4lCH-2) (Faucheu, et al ·, EMB〇J ·, 14, p · 1914 (1995); Kamens J ·, This paper standard applies to China National Standard (CNS) A4 specifications (210X 297 mm) 541309 A7 B7 V. Description of the invention (5) et al ·, J. Biol · Chem., 270, p. 1 5250 (1 995); Nicholson et al ·, J. Biol · Chem ·, 270 15870 (1995)), TY (or ICereMII) (Nicholson et al., J. Biol. Chem., 270, p. 15870 (1995); ICH-1 (or Nedd-2) (Wang, L. et al. ·, Cell, 78, p. 739 (1994)), MCH-2, (Fernades-Alnemri, T. et al ·, Cancer Res ·, 55, p. 2737 (1995), CPP32 (or YAMA4apopain) (Fernandes- Alnemri, T. et al., J. Biol, Chem., 269, p. 3076 1 (1 994); Nicholson, DW et al.? Nature, 376, p. 37 (1995)), and CMH-1 ( Or MCH-3) (Lippke, et al., J. Biol. Chem., (1996); Fernandes-Alnemri, T. et al. 5 Cancer Res., (1995)). These ICE homologues as well as the ICE itself Can induce expected cell death when the transfected cell line is over-expressed. More than one of these homologs is the peptide ICE inhibitor Dyr-Val-Ala- Asp-gas methylketone inhibition results in the inhibition of expected cell death in primary cells or cell lines. Lazebnik et al. ^ Jgiur ^ 371, p. 346 (1994). The compounds described herein may also Inhibition of ICE—more than one homologue (see Example 5). Therefore, these compounds can be used to inhibit the expected death of cells in tissue types containing ICE homologues, but they do not contain active ICE or can produce mature IL- 0. Plant-interferon-deficient factor (IGIF) is an approximately 18-kDa polypeptide that stimulates r-interferon to produce T-cells (r-IFN). IGIF can be a living Cooper's in vivo Kupffer cells and macrophages are produced, and they can come out of this cell when stimulated by endotoxin. Therefore, it can be reduced by 1011; the produced compounds can be used as inhibitors of T-cell stimulation, which in turn can reduce the level of Γ-IFN produced by these cells. (Please read the notes on the back before filling this page) r Pack. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs -8- Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 — ___ _B7 __ 6) IFN is a kind of cytokine, which can have immunoregulatory effects on various immune cells. In particular, IFN-r is involved in the activation of macrophages and the selection of hi cells (F. Belardelli, APMIS, 103, P. 161 (1995)). : R-IFN exhibits its role in part through δΤΑΤ and IRF pathway regulation genes (C. Schindler and JE Darnell, Ann Rev. Biochem., 64, p. 621 (1995); T. Taniguchi, J Cancer Res · Clin · Oncol ·, 121, P. 516 (1995)) 〇 'Mice lacking IFN-r or its multiple receptors have many deficiencies in immune cell function, and can resist internal toxicity. s. Huang et al., Science, 259, p. 1742 (1993); D. Dalton et al.? Science, 259, p. 1739 (1993); BD Car et al., J. Exp. Med., 179 p. 1437 (1994)). With IL-12, IGIF appears to be a potent inducer of r-IFN production by T cells (Η · Okamura et al., Infection and Immunity, 63, p. 3966 (1995); H, Okamura et al.? Nature, 378, p. 88 (1995); S.

Ushio et al., J. Immunol., 156, p. 4274 (1996)). IFN-r has been shown to be a cause of pathologies associated with various inflammations, infectious and autoimmune disorders and diseases. Therefore, compounds that reduce the production of IFN-r will be used to relieve the effects of IFN · r-related pathologies. The biological regulatory effects of IGIF and therefore r-IFN have not been elucidated. It is known that IGIF was synthesized in the former somatic protein form, called, pre-III (3ΙΙ?). However, it is not clear how pre-IGIF is dissociated and whether its modification is of biological importance. Therefore, the pre-IGIF can be adjusted. The composition and method for converting IGIF can be used to reduce the production of IGIF and IFN-r in the tongue, and therefore can alleviate these causes. 9-This paper is suitable for financial standards (CNS) A4 (21QX 297) (Li)) ----- (Please read the notes on the back before filling this page)

541309 A7 V. Description of the invention (Humans lose the harmful effects of proteins caused by chronic diseases and diseases. However, other members of the ICE and ICE / CED-3 families have not previously been known to interact with pre-IGIF to IGIF or to living body IFN- What is the relevance of the transformation effect produced by r. ICE inhibitors represent a class of useful compounds that can be used to control inflammation or the expected death of cells or both: [CE peptides and peptide inhibitors have been described. PCT case WO 91/15577; wo 93/05071; WO 93 / 〇9135; WO 93/14777 and WO 93/16710: and European patent case 0547 699. ice This peptide inhibitor has been observed to block inflammation in mice The mature Θ production system in the model (see below) and can inhibit the growth of leukemia cells in vitro (Est⑺v et al., Blood 84, 38〇a (1994)). However, due to its peptidic nature, this inhibitor is typically Properties are non-desired pharmacological properties, such as poor cell penetration and cell activity, poor oral absorption, poor stability and rapid metabolism. Planner, JJ and D, W. Norbeck, in Drug Discovery Technologies, CR Clark and WH Moos, Eds. (Ellis Hon Vood, Chichester, England, 1990), pp. 92.126. This has hindered its development into effective music. There are also reports that non-peptidic compounds can inhibit ICE in a test tube. Case No. WO 9) / 26958; US Patent 5,552,400; printed by Dolle et al ·, J. Med · Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back before filling this page) Order 39, PP · 2438-2440 (1996); however, and It is unclear whether these compounds have suitable pharmacological profiles for therapeutic use. In addition, the method for preparing this compound is not beneficial. These methods use tributyltin hydride, a toxic and moisture sensitive reagent. Therefore, these methods are not suitable for implementation, there are health risks and the problem of toxic waste disposal. Furthermore, it is difficult to purify the compounds prepared by these methods. -10- 541309 V. Description of the invention (8) Therefore, there is a great need for compounds that can effectively inhibit the existing effects in vivo, in order to prevent and treat IL-i · mediated diseases, expected cell death, IGIF-, Or IFN-r · mediated diseases, as well as chronic and acute forms of inflammation, autoimmunity, osteopathic, proliferative, infectious or degenerative diseases. Methods of making this compound are also needed. Summary of the Invention 1 The present invention proposes new-type compounds, and pharmaceutically acceptable derivatives thereof, which can act as inhibitors of ICE. These compounds can also be used alone or in combination with other therapeutic or prophylactic uses, such as antibiotics, non-production modulators or other anti-inflammatory agents, to treat or prevent cell death, expected cell death, IGIF or IFN- r-mediated disease. According to a preferred embodiment, the compounds of the present invention can bind to the active site of ICE and inhibit the activity of enzymes. Additionally, it has improved cellular potency, improved pharmacokinetics, and / or improved oral bioavailability, as compared to peptide IC] E inhibitors. The main purpose of the present invention is to propose a new class of compounds, which are ICE inhibitors and are represented by the following formula: (Please read the precautions on the back before filling this page) Order 11 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Paper size applies Chinese National Standard (CNS) M specification (2 丨 0 X M7 mm) 541309 A7 B7 V. Description of invention (9

Ri-NH-Xi (CH2) g-R3 ⑴, (VI)

Ri-n-r2 and Η (II)-(V) and (VII)

(Please read the notes on the back before filling out this page.) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. A further object of the present invention is to propose a method for preparing an N-fluorenylamino compound in which a carboxylic acid is coupled with an protected amine at an alloposition. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1A ICE can dissociate in vivo before-IGIF. From Cos cells, and analyze the presence of IGIF by the lysates showing various plastids or control groups, that is, the protein was separated by SDS-PAGE and the epidemic was absorbed by anti-IGIF antiserum (column 1) , Blank transfected cells; 2 columns, pre-IGIF alone; 3-12 columns, pre-IGIF combination ICE, ICE-C285S, CPP32, CPP32-C163S, C Μ Η-1, CMH · 1-C 1 86S, Tx, Tx-C258S). Movements of pre-IGIF and 18-kDa mature IGIF are shown on the right. The molecular weight in kDa is shown on the left (Example 23). -12- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (10) Please read the back © ί Matters before filling in this page Figure IB ICE can be confirmed in the test tube The pre-dissociation of IGIF at the modified modification position is shown by Coomassie Blue staining the proteolytic reaction product separated by sDS-PAGE (Example 23). The proteases and inhibitors used are: 1 column 'buffer solution control group; 2 columns, 0.1 nM ICE; 3 columns, 1 fu ICE, 4 and 5 columns, 1 nM ICE plus 10 nM Cbz- Val-Ala-Asp · * [(2,6-—chloro + yl) oxy] methyl ketone and loo nM Ac-Tyr-Val_Ala_ Asp-aldehyde; columns 6 and 7, 15 nM CPP32 with or without 4, respectively. 〇nM Ac_Asp_ Glu-Val-Asp-aldehyde (DW Nicholson et al., Nature, 376, p. 37 (1995)); 8 columns, 100 nM CMH-1; 9 columns, 10 units / ml granzyme B; and kDa meter molecular weight flag. Figure 1C. ICE dissociation can convert inactive pre-IGIF to active IGIF, which can induce IFN-r production in hi helper cells. Undissociated (pre-IGIF / ICE), CPP32-dissociated (pre-IGIF / CPP32), and recombinant mature IGIF (rlGIF) and A.E7 Thl cells at 12 ng / ml (open box) and 120 mM Incubate for 18 hours at μg / ml (shaded box) and analyze IFN-r released into the cell culture medium by ELISA (Example 23). AE7 cells were cultured in buffered solution, ICE (ICE) alone, or CPP32 (CPP32) alone, and analyzed like a negative control group. Numbers represent the average of three decisions. Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. Figure 2A. Mature IGIF (18-kDa) is produced by pre-IGIF and ICE-co-transformed plastids. Cos cell lysates (T2) and conditioned medium (right) before -IGIF showed plastid transduction, and in the absence of (-) or with coding wild type (ICE) or inactive mutant strain (ICE-C285S ) The performance of ICE exists. Transfected cells are metabolically labeled with 35S-methionine, and proteins from the lysate and the conditioned medium are immuno-sedimented with -IGIF antiserum. The paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm). ) 541309 A7 B7 V. Description of the invention (11) The precipitate was separated by SDS-PAGE (Example 24). Movements of pre-IGIF and 18-kDa mature IGIF are shown on the right. Molecular weight markers in kDa are shown on the left. Figure 2B Detection of IFN-r deflecting activity in previously-IGIF and ICE-expressing plastid cosensory Cos cells. Lysates from Cos cells (filled box) and conditioned medium (open box) before -IGIF showed plastid transduction, and encoded wild type (ICE) in the absence of (pre-IGIF) or the presence of (pre-IGIF / ICE) In the presence of plastids, IFN-r levels were analyzed by ELISA. Cos cells transfected with buffer solution (blank group) or ICE-expressing plastid alone (ICE) were used as the negative control group (Example 24). Fig. 3A From mice lacking ICE, Coffer cells were transported by IGIF. There are also flaws. Cooper's cells from wild-type mice (ICE + / +) or ICE-deficient mice (ICE-factory) with ICE mutations of the same conjugation were isolated and filled with LPS for 3 hours. The level of immunoreactive IGIF polypeptide in wild-type cell-adapted medium (nanograms / ml) was detected by ELISA (Example 25). N. D. (not measurable) indicates that the IGIF concentration is less than 0.1 nanogram / ml. Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the notes on the back before filling out this page) Figure 3B From mice lacking ICE, their Coffer cells are also defective in IGIF transport. Cooper's cells from wild-type mice (ICE + / +) or ICE-deficient mice (ICE-/-) with the same zygote were isolated and filled with LPS for 3 hours. The filled cells were metabolically labeled with 35S-methionine, and proteins from the lysate and the conditioned medium were precipitated with anti-IGIF antiserum and separated by SDS-PAGE (Example 25). Movements of pre-IGIF and 18-kDa mature IGIF are shown on the right. The molecular weight in kDa is shown on the left. Figure 3C. Serum from ICE-deficient mice contains reduced IGIF. Analysis of wild-type mice (ICE / 10 / +) or ICE mutations to homozygous zygote by ELISA -14- This paper applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309

V. Invention Description (12) The IGIF level (nanograms / ml) of ICE-deficient mice (ICE-Λ) (Example 25). Figure JD from ICE-deficient mice. Serum contains reduced amounts of IFN • factory. ELISA was used to analyze IFNj levels (nanograms / ml) in wild-type mice (ICE + / +) or ICE-deficient mice (iCE_Λ) with ICE mutations to the same zygote (Example 25). Figure 4 After acute challenge with LPS, the level of IFN4 in the ICE • deficient mice was significantly reduced. EUsa analysis of wild-type mice (filled squares) or ICE-defective mice (filled circles) in blood and IFN · factory levels (nanograms / ml) in samples was a function of time (hours) after LPS challenge. Animal temperatures during this period are shown in degrees Celsius in wild-type mice (open squares) or ICE-defective mice (open circles). Figure 5 ICE inhibitor ‘AcYVAD-CHO (AcYVAD-CHO) inhibits LPS-stimulated IL-1 and IFN-r synthesis in human peripheral blood mononuclear cells (PBMCs). The percentage of inhibition (%) as a function of IL-1 A (open square) and IFN-Γ (open star) synthesis inhibitor concentration (V M) is not shown. Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. Please read " K read back if.vlii and save the contents.] Figure 6 Compound 214e can inhibit LPS-challenge rat il-1 production system. CD1 mouse serum samples were analyzed for IL] cold levels (picograms / ml) by ELISA. This was performed after the LPS-challenge. Compound 2i4e was administered by intraperitoneal (IP) injection 1 hour after LPS-challenge. Blood samples were collected 7 hours after LPS-challenge (see Example 7). Figure 7 Compound 217e inhibits il-1 production in LPS · challenge mice. After LPS-challenge, the level of IL-1 /? (Picograms / ml) in serum samples of CD1 mice was analyzed by ELISA. Compound 217e was administered via intraperitoneal (IP) injection 1 hour after the LPS-challenge. Blood was collected 7 hours after the LPS-challenge (see Example 7). • 15- The paper size is suitable for Guancai County (CNS) A4 specification (21 () X 29 ^ J " y 541309 A7 B7 V. Description of the invention (13 Please read the note on the back again and write this page Figure 8) Compound 214e, but not compound 2i7e, inhibits IL-1 production in LPS-challenged mice when given orally. This analysis can detect oral administration under similar conditions as described in Figures 6 and 7. Absorption effect. These results show that 2 14e can be used as a potential oral active CE inhibitor (see Example 7). Figure 9 Compounds 214e and 214e homologues can also be inhibited by ip administration. These results Obtained in the analysis described in Figures 6 and 7 and Example 7. Figure 10 Compounds 214e and 214e homologues can also inhibit the production of IL-1々 in oral administration (p0). These results can be seen in Figure 6 and Obtained from the analysis described in 7 and Example 7. Order Figure 1 1A / B compounds 302 and 304a show detectable blood when taken orally to mice (50 mg / kg in 0.5% carboxymethyl cellulose) Levels. Blood samples were collected at 1 and 7 hours after administration. Compounds 30 and 30 are 21-peptide prodrugs, available at Metabolized in vivo into 214e. Compound 214e did not exceed blood levels of 0.10 μg / ml when taken orally (Example 8). Figure 12 Compound 412f can block type II collagen in male DBA / 1J mice · Induces 4 arthritis (Wooley, PH ·, Methods in 丨 Staff Consumption Cooperation, Central Standards Bureau, Ministry of Economic Affairs

Enzymology, 162, ρρ · 36 1-373 (1988) and Geiger, T., and Experimental Rheumatology, 11, pp. 5 1 5-522 (1 993)) 〇 Compound 412f is orally administered twice daily (i〇 , 25 and 50 mg / kg) about 7 hours apart. Inflammation was measured on a scale of 1 to 4 with increasing severity of arthritis. Add the two forefoot scores to get the final score (see Example 21). Figure 13 Compound 412d blocks the progress of type II collagen-induced arthritis in male DBA / 1J mice. The results are shown in Figure 12 and Example 21. Figure 14 Compound 696a can block type II collagen in male DBA / 1J mice-This paper size applies Chinese National Standard (CNS) A4 Regulation (210X 297 mm) 541309 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of Invention (14) The progress of slandering arthritis. The results are shown in Figure 12 and Example 21. Abbreviations and Definitions Abbreviations Named Reagents or Tablets Ala Alanine Arg Arginine Asn Asparagine Asp Ass Cys Cysteine Gin Glutamine si Glu Glutamine Gly Glycine His Histamine Lie Leucine Leu Leysine Lys Lysine Met Methionine Phe Phenylalanine Pro Proline Ser Serine Thr Threonine Trp Tryptophan Tyr Road amino acid Val Valine-17- Applicable to this paper size China National Standard (CNS) A4 specification (210X 297 mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 One by one ____B7___ V. Description of the invention (15)

Ac20 acetic anhydride n-Bu n-butyl DMF dimethoamidine DIEA N, N-diisopropylethylamine EDC 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride

Et20 diethyl ether

EtOAc ethyl acetate ’

Fmoc 9-Ethylylmethoxycarbonyl HBTU 0-benzotriazole-1'yl-N, N, Nf, Nf-tetramethylenehexahexanoate hydrochloride H〇BT to benzotrifluorene hydrate

MeOH methanol TFA trifluoroacetic acid

Alloc definition of allylicoxycarbonyl The following terms are used here: nr interferon-deficient factor "or" IGIF "refers to a factor that can stimulate the endogenous production of IFNi." ICE-inhibitor "refers to a substance that can inhibit the enzyme ICE Compound. ICE inhibitory effects can be determined using the methods described and are incorporated herein by reference. The artisan understands that ICE inhibitors in vivo are not necessarily ICE inhibitors in vitro. For example, the prodrug form of a compound is usually little or no active in in-vitro analysis. This type of peony drug can be altered in the patient through metabolism or other biochemical processes to generate ICE inhibitors in vivo. "/ -18- This paper size applies Chinese National Standard (CNS) Α4Ϊ ^ (210x297 / ^) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (16) The so-called "cytokines" refer to molecules that can mediate cellular interactions. "Condition" refers to any disease, disorder, or effect that can cause harmful biological cause-effect relationships in an individual. "'Individual'" refers to an animal, or one or more cells derived from an animal. Preferred animals are mammals, most preferably humans. Cells can be of any type, including but not limited to cells retained in tissues, cell aggregates, undead cells' transfected or transformed cells, and animals derived from animals that have been altered physically or phenotypically cell. The active position '' refers to one or all of the following positions in the ICE: the substrate binding site 'where the inhibitor can bind and the site where the substrate dissociation occurs. "π heterocycle" or "heterocyclic" refers to a stable mono- or polycyclic compound, which may contain one or two double bonds, as required, or more than one aromatic ring, as required. Each heterocycle consists of a carbon atom And 1 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. As used herein, " nitrogen heteroatom, and " sulfur heteroatom, " including any oxidation pattern of nitrogen or sulfur, and any base Four levels of sexual nitrogen. Heterocyclic groups defined herein include, for example: pyrimidinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, 'thyrinyl, pyrimidinyl, pyridolinyl, benzimidazolyl, imidazolyl, imijun #yl' Midazolam 'ρ quelinyl, isoquinone linyl, indolinyl, pyridyl, pyrrolyl, pyrrolinyl, pyrazolyl, pyrhenyl, quinoxaline, hexahydro leaf Base 'Morphyl' σSelefyl, succinyl, p-sphenyl, trisyl '4azolyl, fluorene-carynyl, tetrazolyl, oxazolidinyl, benzocranyl Methyl '4 morpholinyl iron' benzosulfinyl group, oxohexyl group, oxolidine group, oxaziridinyl group, oxazepinyl group, azafluorenyl group, isoxazolyl group, tetrahydropyridine Tranyl, tetrahydrofuryl, thiadiazolyl, benzodioxy, benzothienyl, tetra-19- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) m fa _ 1 ( Please read the notes on the back before filling out this page) Order printed by the Central Consumers Bureau of the Ministry of Economic Affairs, printed by the Consumer Cooperatives 541309 A7 B7 V. Description of the invention (17) Please read the first item before filling in the page hydrogen and sulfur Yue group, and a sulfonic acid group. Further heterocycles are described in AR Katritzky and CW Rees, eds ·, Comprehensive Heterocyclic Chemistry: The Structure, Reactions, Synthesis and Use of Heterocyclic Compounds, Vol. 1-8, Pergamon Press, NY (1984) 0 '· heteroalkyl "Means a single or polycyclic group containing 3 to 15 carbons and optionally one or two double bonds. Examples include cyclohexyl, adamantyl and n-yl." Aryl "means single or multiple A cyclic group containing 6, 10, 12 or 14 carbons, at least one of which is aromatic. Examples include phenyl, stilbene and tetrahydrofluorene. The so-called M heteroaromatic π refers to a single or polycyclic group 'which contains 1 to 15 carbon atoms and from 1 to 4 heteroatoms', each of which is independently selected from the following including sulfur, nitrogen and oxygen, and which additionally contains 1 to Three five or six member rings, at least one of which is aromatic. The Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs printed the so-called "α-amino acid π" (α-amino acid) refers to naturally occurring amino acids and is commonly used in peptide chemistry when preparing analogs of naturally occurring peptides. Other "non-protein" sink-amino acids, including types D and L. Naturally occurring amino acids are glycine, alanine, valine, leucine, isoleucine, serine, methylsulfide Amino acid, threonine 'phenylalanine, glutamic acid, tryptophan, cysteine, proline, histidine, aspartic acid, asparagine, glutamine, glutamine, r-Leptyl glutamine, arginine, ornithine and lysine. "Non-protein" ②-Examples of amino acids include hydroxylysine, homoserine, homotyrosine, homophenylalanine , Citrusin, Canine urea, 4-Amino-phenylalanine, 3- (2-fluorenyl) -alanine '3- (1-fluorenyl) · alanine, methionine, third butyl -Alanine, tert-butylglycine, 4-hydroxyphenylglycine, aminoalanine, phenylglycine, allylalanine, propynyl-glycine, 1,2,4 -Triazolyl-3- Amino acid, 4,4,4-trifluoro-threonine, methyladenosine 20- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 541309 A 7 B7 V. Description of the invention (18 ), 6-¾ tryptophan acid, 5-tryptophan tryptophan, so '3-pyridine urea' 3-aminotyrosine, trifluoromethyl alanine, 2-bendenyl alanine, (2- ( 4-p than pyridyl) ethyl) _cysteine, 3,4-dimethoxy-phenylalanine, 3_ (2-p thiazolyl) -alanine, amanitalinic acid, phenylamino 1-cyclopentane-carboxylic acid, 1-amino-1-cyclohexanecarboxylic acid, gentisine, 3-trifluoromethylphenylalanine, 4-trifluoro-methylphenylalanine, cyclic Hexylpropylamine, hexylglycine, thiohistamine, 3-methoxytyrosine, elastatinal, n-leucine, n-valine, allo-isoleucine, high spermine, thioproline Acid, dehydroproline, hydroxy-proline, isopiperidine, homoproline, cyclohexylglycine, alpha-amino-n-butyric acid, cyclohexylalanine, aminophenylbutyric acid The ortho, meta or para positions of the phenylalanine in the phenyl moiety are the following, or two: ((^-(: 4 ) Alkyl, (CrC4) alkoxy, halogen or nitro or substituted with methyldioxy; Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (Please read the notes on the back before filling out this page) 2 -And 3-7 cetylenyl-alanine, -2-and 3-oxalylalanine, / 5-2-, 3-, and 4-p-hydroxypropylalanine, A 0-2-Alkyl-2- and 3-yl) alanine, yj- (1- and 2-fluorenyl) alanine, serine, threonine, or 0-alkylated derivative of tyrosine, S-alkane Basic cysteine, S-alkylated homocysteine, 0-sulfuric acid, 0-phosphoric acid and 0-carboxylic acid esters of tyrosine, 3-sulfo-tyrosine '3-guinea Ethyl-Leuamic Acid, 3-Phosphino-Leunic Acid, 4-Methanoic Acid Ester of Leucine, 4-Methane Phosphonate of Tyrosine, 3,5-Diiodotyrosine, 3- Nitro-tyrosine, S-alkyllysine and S-alkyluronic acid. Either of these amino acids can be substituted by a methyl group at the α position, from any aryl residue 'on the α-amino side chain, or a suitable protecting group on the 0, N or S atom of the side bond residue. Appropriate protective groups are disclosed in `` Protective Groups In Organic Synthesis, MT.W. Greene and PGM Wuts, J. Wiley & Sons, -21-Paper ruler Guanjia County (CNS) A4 Secretary (21GX 297 (Mm) '~ 541309 Consumer Co-operation by the Central Bureau of Standards of the Ministry of Economic Affairs, printed A7 B7 V. Description of Invention (19) NY, NY, 1991. The so-called "substitution" refers to the replacement of a hydrogen atom in a compound by a substituent. In the present invention, a hydrogen bonding moiety may be formed and may be bonded to the carbonyl oxygen of Arg-341 of ICE or the Hydrogen atoms forming carbonyl oxygen hydrogen bonds are excluded from substitution. These excluded hydrogen atoms include those containing -NH- groups, which are -C0- radicals, and are in the following scheme: ⑷ to ⑴, ⑺ to ㈡ It is represented by -NH- instead of X group or other names.-The so-called "straight chain" refers to a continuous unbranched dream of covalently bonded atoms. The straight chain may be substituted 'but these substituents are not part of the straight chain. π K / 'refers to many measures of the compound's effectiveness in inhibiting the activity of the target enzyme, such as ICE. A lower 値 of 1 ^ reflects higher efficacy. Cardiac palpitations are derived from experimentally determined rate data combined with standard enzyme kinetic equations (see I. H. Segel, Enzyme Kinetics, Wiley-Interscience? 1975). The so-called "patient" in this case refers to any mammal, Especially human. The so-called "pharmaceutically effective dose" refers to a dose that can effectively treat or soothe ill ", IGIF- or IFN-mediated diseases in patients. The so-called "prophylactically effective dose" refers to a dose that can effectively prevent or substantially reduce the expected cell death, IGIF or IFN-r-mediated disease in a patient. "Pharmaceutically acceptable carrier or adjuvant" means a non-toxic carrier or adjuvant that can be administered to a patient with a compound of the present invention and which does not destroy its pharmacological activity. " Pharmaceutically acceptable derivative " means the compound of the invention or any other pharmaceutically acceptable salt, vinegar, or salt of this vinegar, and the compound of the invention can be provided immediately upon administration to the recipient (directly (Or indirect) or anti--22- This paper size applies Chinese National Standards (CNS) M specifications (ho〆297 public celebration)

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 ______________B7 V. Description of the Invention (20) ^ ---- -ICE active metabolite or residue. The compounds of the present invention are pharmaceutically acceptable. How to produce inorganic and organic acids that are pharmaceutically acceptable and testers. Examples of suitable acids include hydrogen acid, hydrobromic acid, sulfuric acid, shikimic acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid'salicylic acid, succinic acid, white acid, toluene-p-sulfonic acid Acid, tartaric acid 'acetic acid, citric acid' methalic acid ,? Acid, benzoic acid, malonic acid, steamed 2-sulfonic acid and benzenesulfonic acid. Other acids, such as oxalic acid, are non-pharmaceutical in themselves: they are acceptable, but they can be used to prepare salts that act as intermediates to obtain the compounds of the present invention and their pharmaceutically acceptable acid addition salts. Derived from salts suitable for bases, including alkali metals (such as sodium), alkaline earth metals (such as magnesium), ammonium, and N · ((: M alkyl) 4+ salts. The invention also includes any basicity of the compounds disclosed herein The quaternary alkali reaction of nitrogen-containing groups ”. The quasi-nitrogen can be quaternized by any of the known substances of the artisan, including“ low-carbon pit groups such as methyl, ethyl, propyl and Butyl chloride 'bromine and angstrom; Dialkyl sulfates include dimethyl, diethyl, dibutyl, and dipentyl sulfate; long chain compounds such as decyl, lauryl, meat and stilbene Fluorenyl chloride, bromine, and iodine; and aralkyl halides include fluorenyl and phenethyl bromide. Water or oil-soluble or dispersible products can be obtained by this quarterly test. The ICE inhibitor of the present invention may contain more than one 'Asymmetric' end atoms, and can therefore be present as racemates and racemic mixtures, single enantiomers, diastereoisomeric mixtures and individual diastereoisomeric forms. All of these compounds The isomeric form may be specifically included in the present invention. The carbon of each stereo region may be in the R or S configuration. The specific compounds and skeletons exemplified in the book can be shown in a special stereochemical configuration, with -23- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) (Please read the note on the back first (Fill in this page again)

541309 V. Description of the invention (21 Anti-stereochemical compounds 4 in any given pair of centers are also included here. The framework or mixtures thereof are also included. The inhibitors of the present invention may contain concentrated structures, which may Carbon, nitrogen or other atoms are substituted by various substituents. This ring structure may be substituted single or multiple. Preferably, the ring structure may contain 0 to 3 substituents. When multiple substitutions are made, each substituent may be independent Any other substituent is selected as long as the combination of substituents can cause the formation of a stable compound. The combination of substituents and variables included in the present invention is only the one that causes the formation of a stable compound. The so-called "stability", as used in this- Means a compound that is stable enough to be + manufactured and administered to mammals by methods known in the art. Typically, this compound can be used below 40 ° C in the absence of moisture or other chemical reaction conditions. Stable at temperature for at least one week. Substituents can be represented by various types. These various types are known to the artisan and can be used interchangeably. For example, a methyl substituent on a phenyl ring, Can be represented by any of the following types: (Please read the precautions on the back before filling this page)

cr 'σ' cr. Various types of substituents printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, such as methyl groups, can be used interchangeably here. Detailed description of the invention In order to make the invention described herein more understandable, the following detailed description is shown. The ICE inhibitor-example (A) of the invention is of formula α:

2) m-T a

RrNH-Xi (CH2) g-R3 -24- This paper size applies to Chinese National Standard (CNS) A4 (21 × 297 mm) 54l30 09 A7 B7 5. Description of the invention (22) where = X # -CH; g Is 0 or 1; each is independently selected from the group consisting of -H, _0H, and -F, with the restriction that a false unity and the first J are bound to C and the first j is -0h, and the second 1 is seven M is 0, 1 or 2; T is -OH'-C0-C02H, -C02H, or < 02 Renhe bioelectronic isobaric substitution; R! Is selected from the following including any of the following formulae, # The ring may be mono- or poly-substituted as required, (^ on any carbon, R5 on any nitrogen, or = 0, -OH, -C02H, or halogen on any atom; any saturated ring may be substituted as required Unsaturation on one or two bonds; and 1 ^ (Magic and Ri (y) may be fused with benzo as required;

(a) r \ X, > ZO-CO? Rz〇H Printed by the Consumers' Cooperative of Zhongli Standards Bureau of the Ministry of Economic Affairs (b) KXU-ttc- r7 o -25- This paper standard applies to Chinese national standards (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (23)

ΤΓ 0

(e)

〇 (f) F ^ N--C--R33-

X (g) ί ^ —Z—R20—Z— X, N H (h)

-Rzd 1 Z-Printed by the Consumer Cooperative of the Central Department of the Ministry of Economic Affairs (i)

X (CH2) d (, /, X \ 2, ^ (CH2) d / N, u (CH2) a 0 -26 (Please read the precautions on the back before filling in this purchase)

This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (24)

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

-27- (Please read the notes on the back before filling this page)

This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (25 \ ly p / c \

X X2

d

q) / IV

NH c

ro R6 + HZ-Νί r

(Please read the notes on the back before filling out this page) Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

N H 28 This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (26 (w) fit Η

(X)

Rm is selected from the following: (aal)

(aa2) n \ z (CH2) c Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (aa3) (aa4)

, NH

-29-(Please read the notes on the back before filling in this page)

This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of invention (27) 1 =

/

d (Please read the notes on the back before filling out this page) Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs

N

30 This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (28) (CH2) a

(ggb)

(Ggc) ° ^ > (Please read the notes on the back before filling out this page) Central Standard of the Ministry of Economic Affairs and printed by the Consumer Consumer Cooperative, where each ring c is independently selected from the following, including benzo, pyrido, pyrene, P Billo, bitumen, p, and heterodistance, ° evil and singular, heterosexual and sigma, sial, cyclopentyl, and cyclohexyl; r3 is:- CN, _CH = CH_R9, -ch = no-r9 ^-(CH2) 1-3-TrR9, -C-R9 '-CO-R "' into

-CO-CO-N R5, 1〇; -31 This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (29) Each 114 is independently selected from the following including: H , -Ar !, -R9 '-T1 -R9' and-(CH2)!? 2,3'TrR9; each! ^ Is independently selected from the following: CH = CH-, -0-, -S-, -S〇-, -S 0 7 ~ 9 -N R1 ο-, -NRi〇-C〇-, -CO-,- 0-C〇-, -c〇-〇-, -CO-NRj〇-, -0-C0-NR | q **? Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs * NR | 0-CO-O- ? -NR jq-C 0-NR jq-J -S〇7 ~ NRjq-? -N R1 〇- S 0 7-'-NR1 q-S0〇-NR10- »-32- This paper size applies to Chinese national standards (CNS) A4 specification (210X297 mm) 541309 Μ B7 V. Description of the invention (30) Each 115 is independently selected from the following: -H, -Aq, -CO-Ar ^, -S〇7 ~ Ar |? -C 〇-NH2, _S〇2-NH2, • R9? -C〇-R9, --C〇-〇-R9, -S 〇1 -R9 '/ Arl

-CO-N, ιο, / Arl

-SO? -N \ r1〇, R9

-CO-N \ r10, and / R9 -s〇7-n Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) 116 and Hua 7—a saturated 4 -8-membered carbocyclic ring or heterocyclic ring containing -0-, -S-, or -NH-; or 117 is-«[and 116 is -H, -A r 1, -33- Standard (CNS) A4 specification (210X 297 mm) 541309 Printed by A7 B7, Consumer Cooperatives of the China Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (31 -R9,-(CHAwTrh, or α-amino acid side chain residues; Each% is a straight or branched Cu radical, optionally -0Η, -F or = 0 single or multiple substitutions, and optionally one or one Ar! Radical substitutions; each R1G is independently selected from the following including -H Or straight or branched alkyl groups; each ruler 13 is independently selected from the following including -Ar2, -R4 and -N-OH, \ 5; each At *] is a soil group 'independent far from the following including a square group which contains 6,1. , I) or 14 carbon atoms, and between 1 to 3 rings, the cycloalkyl group contains 3 to 5 carbon atoms and 1 to 3 rings, and the cycloalkyl group may be fused with benzo, if necessary, And heterocyclyl containing 5 to 15 ring atoms and 1 to 3 rings The heterocyclic ring contains at least one heteroatom selected from -0-, '-SO-, -S02-, = N- and -NH-, the heterocyclic group contains more than one double bond as required, and the heterocyclic group Need to contain more than one aromatic ring, and the ring base is -nh2, -co2h, -a, _; f, -Br-, -I, -N02, -CN, six = 0, -OH , PerfluoroCu alkyl, \ / CH2, or -Qi single or multiple substitutions; 〇 Each Al: 2 is independently selected from the following, wherein any ring may be mono- or multi-substituted as required by-(^ and-(^ 2) ; -34 This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Guiming Instructions (32 (hh)

(ii)

(jj) and (kk)

Each Q i is independently selected from the following: -Ar j -Ο-Αγ ι-? -T -R9 'and-(CH2) 1,2,3-but 1-R9; each Q2 is independently selected from the following including -OH _Br, -I, -NO ?, -CN, -CF ;, and -NH2, -C02H / 〇 \ CH ,;

-Cl, -F Please read the notes on the back before filling out this page. The printing conditions for the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs are limited to when the one -Ar 丨 is replaced by the Q i group, which contains more than one additional -eight " Each additional X is independently selected from the following including = N-, and = CH-; each X2 is independently selected from the following including-·, -CH2-, -NH-, -S-, -S〇-, and -S 0 〇- »35 This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 _B7_ V. Description of the invention (33) Each X3 is the third choice Including -CH] -'- S -'- SO- 'and -S〇2-; each X4 is independently selected from the following including -CH2- and -NH-; each X5 is independently selected from the following including -CH- and- N-;

I and 6 are < ^ 1- or -N-; each Y is independently selected from the following including -0-, -S-, and -NH; each Z is independently C0 or so2; each a is independently 0 or 1; Each c is independently 1 or 2; each d is independently 0, 1 or 2; and _ each e is independently 0, 1, 2 or 3; the restriction is that beware of ⑴, R6 is an α-amino acid side chain residue And RA-H, then (aal) and (aa2) must be replaced by Qi; restrictions also have to be careful (〇), g is 0, printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the note on the back first) Please fill in this page again) J is -H, m is 1, 116 is α-amino acid side chain residue, 117 is -11, X2S-CH2-, X5 is -CH-, x6 is -Ling-, and -36- This paper size is in accordance with Chinese National Standard (CNS) A4 (210X 297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (34) R3 Yes / ίο -CO-N \ r10, or _CO-R13, when r13 is: -CH2-0-C0-Ar1 ^ -CH2-S-CO-Ar1 ^ -CH'-O-Arj '-CHrS-Ar !, or -R4 when- R4 is -Η; 'The ring of 1 ^ (〇) must be substituted by Qi or benzo-fused; and the restriction is that beware of ㈤, g is 〇, J Is -H, m is 1, J is -CO2H, H0, r5 is fluorenyloxycarbonyl, and ring C is benzo, then R3 cannot be -0: 0-1113 when: R13 is -CHyO-Aqa ^ 丨 is 丨 -phenyl-3 · trifluoromethyl-sizol-5-yl, in which phenyl is optionally substituted by chlorine atom; or when (please read the precautions on the back before filling this page)- 37- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210 X 297 mm) 541309 A7 B7 V. Description of the invention (35 R13 is -CHyO-CO-Aq, in which the diphenyl group is used. Application formula οΓ of Preferred Compound of Specific Example A, wherein Ri is (w) (w)

(y): wherein the other substituents are as described above. Example of application of formula σ 旳-other preferred compounds, where p | 〆, τ are (y) (CH / ^ X ^ a R5-ΪΓ V- (CH2) c Staff Consumption of the Central Standards Bureau of the Ministry of Economic Affairs The other substituents are printed as described above. A better compound of specific example A of formula CT is applied, where: XA-CH; g is 0; J is -Η; m is 0 or 1 and T is -C0-C02H, or -C〇2H any bioelectronic isotope replacement, or m is 1 and T is -C02H; Ri is selected from the following including the following formula, where any ring can be according to the required sheet or multiple 38. This paper size applies Chinese national standards ( CNS) A4 size (210X297mm) (Please read the precautions on the back before filling this page}

541309 V. Description of the invention (36) Substitution, (^ on any carbon, r5 on any nitrogen, or = (j any atom '· ΟΉ' _c〇2H, or halogen substituted, and ⑷ Be stupid and fused as needed (a) X, > _z-N-I r7 c-c-I II R7 0 (b)

N I H r7 0 (c)

(e)

Consumption Cooperation between Employees of China Dog Standards Bureau, Ministry of Economic Affairs (f) (g) (h > R & -N—C—C-Rao—z—

L ·

.X H Z—R20_z—

This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (37) / 2 '(〇) (CH2) c (C > i2) d ψ ~ Ah ~~ c ~ ° (r)

HO

And (w)

r20 is (aal)

Or (Please read the notes on the back before filling this page) (aa2), N, / (CH2) c Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs and c is 1; C ring is benzo, as required _Cu alkyl, -O-Cw alkyl, -Cl, -F or -CF3K; when 1 ^ is (&) or (b), R5 is preferably -Η, and when Ri is (< 0 , (E), ⑴, (〇), ⑴, (w), (X) or (y), R5 is better -40- This paper size applies to the Chinese National Standard (CNS) A4 specification (2 丨 0X297 mm ) 541309 A7 B7 V. Description of the invention (38 is -C 0-A r | -C〇-NH2, -CO-NH-Ari -C 〇-R9 '-CO-OR ^ 9 _S〇2_R9, or -CO- NH-R9, 117 is-! ...! And I ^ is -Η -R9 -Ar 1 or R9 is a C ^ 6 straight or branched alkyl group, which is substituted as = 0 if necessary, and -Ar 1 if necessary Substituted; R1Q is -H or -CN3 straight or branched alkyl; Aq is phenyl, theophyl, said phenyl, benzo 0 thiol, π selphenyl, benzo side phenyl, benzo 17 oxa Benzyl, 2-hydropyridyl, or indyl, as needed--0-€: 1.3 alkyl, to: "-€: 1-3 alkyl,-((: 1.3 alkyl) 2, -01 , Oh,-

CF • cu, alkyl, or 〇 (Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs \ 〇 / CH 'Q 1 is R9 or-(CH2) 〇, 1, 2-T 1-(CH2) 〇, 1,2-ΑΓι ′ where D 1 is -0- or -S-; each X is independently selected from the following including, and = CH-; each X2 is independently selected from the following including-. -, -CH2-, -NH-, -S-, -S〇-, and this paper size apply Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (39.S Ο 9 -; Each X5 is independently selected from the following including -CH- and -N-; | | X6 * -CH- or -N-,

The I_I restriction is when: R! Is (〇), x2 * -ch2-, χ5 is -CH-, and t X 6 is-', then the ring of the R 丨 (0) group must be substituted by Qi or Benzo is fused; and Z is c = o. The compounds that are better for this preferred embodiment are those where the Ri group is: (Please read the notes on the back before filling this page) (el) (e2) (CH2) c

/ Or printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs and c is 2; or (e4)

Or -42- The paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (4 (3) (CH2) c

The Ministry of Economic Affairs and the Central Standards Bureau's Consumer Cooperatives printed it as benzo-fused as needed, and c is 1 or 2; the restrictions are when 1 ^ is (64),, g is 0, J is -H, -m is 1, T is -CO2H, is oxocarbonyl, and c is 1, then R13 is not -CHyO-Aqa, octa is -phenyl-3-trifluoromethyl-pyrazole-5 -Group, where the phenyl group is optionally substituted by a chlorine atom; or when R13 is -CHyO-CO-Aq, where Ar 1 is 2,6 -a 2-lactoyl group, the 2-position on the JL campsite ring It is a p-fluoro-phenyl substitution; and the restrictions are also when R # (e7), g is 0, J is -Η, -43- This paper size applies the Chinese National Standard (CNS) A4 specification (210 × 297 mm) ) (Please read the notes on the back before filling out this page) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (41) m is 1, T is -0: 02 «[or-(: 0-1 ^^ 1- € ^, R5 is a protecting group for the N atom of the amino acid side chain residue, and each c is 1, then R 3 cannot be -C Ο-R13 when R1 3 疋: -C Η 2 ~ C Ο * Ar | j -CH2-S-CO-Ar1 ^ -CH2-0-Ari, or -CH'-S-Ari. For this specific example Best compounds wherein: RA:

And c is 2; m is 1; D is -C02H; and -44- This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (42) R 3 is " * C 0-R13 ° The other best compounds for this specific example are among them ~ is: (wl)

c-ϋ 0; where X2 is: · -0-, -S-, -s〇2_, or -NH-; if necessary, R5 or Qi is substituted on X2 'when 乂 2 is -NH-; and Ring C is benzo and is substituted by -Cualkyl, -O-Ci.3alkyl, -Cl, -F or -CF :. Another specific example of the present invention (B) of the ICE inhibitor is the formula (I): (I) (Please read the precautions on the back before filling this page) Printed by the Ministry of Standards Bureau's consumer cooperation

Ri-N-R〇 I Η Among them: Ri is selected from the following including the following formulas -45- This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (43 (elO)

(ell) (e! 2)

(Please read the notes on the back before filling this page) (w2)

(yi)

Printed by a member of the Central Standards Bureau of the Ministry of Economic Affairs and a Consumer Cooperative (y2)

And-46- This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (44) Ring C is from the following including: Benzo ? Biloxi's singularity, p'synthesis, heterodistance bite, oxapyrene, oxapyrene, pyrimido, imidazo, cyclopentyl, and cyclohexyl; R? Is: (a) 〇 (〆〇 or (b) 〇

ORb, 〇R51 OR51 (Please read the notes on the back before filling this page) Printed by the Fan Central Standards Bureau Employee Cooperatives m is 1 or 2; R5 is selected from the following: -C (O) -R10, -c (o) o-r9, ^ Rio -C (0) -N \ Rio ^ -S (〇) 2-R9, -c (o) -ch2-〇-r9, -C (O) C (O)- R] 0, -R9 '-H, and -C (O) C (O) -OR10; -47- This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) Set 541309 Central Standard of the Ministry of Economic Affairs Printed by the Consumer Cooperative of the Bureau A7 B7 V. Invention Description (45) 乂 5 is -0 ^ or -N-; |! Υ2 is or 0: χ7 is -N (R8)-or -0-; Rg is selected from The following includes -H and -CH3; r8 is selected from the following including: -C (〇) -R10, -C (〇) 0-R9,, -C (〇) -N (H) -R10, -s (〇) 2-r9,--S (O) 2-NH-R10, -C (〇) -CHrOR10, -C (O) C (O) -R10; -C (0) -CH2N (R1G) (R1 (3 ), -C (〇) -CH2C (〇) -0-R9, -C (〇) -CH2C (〇) -R9, -H, and -C (O) -C (O) -OR10; each R9 is independent Is selected from the following including -Ar3 and -C ^ straight or branched alkyl groups, optionally substituted by Aγ3, wherein -CN6 alkyl is optionally unsaturated; each Ri is independently selected from the following including -Η, -Αγ3, (: 3-6 Huadian Lake And -CN6 straight or branched alkyl is optionally substituted by Ar3, wherein -Cb6 alkyl is optionally unsaturated; R13 is selected from the following including fluorene, Aγ3, and < ^. 6 straight or branched alkyl, depending on Ar3, -CONH2, -OR5, -OH, -OR9, or -C02Hm should be substituted; -48- This paper size applies to China National Standard (CNS) Λ4 specification (210X 297 mm) (Please read the note on the back first Please fill in this page again for details) 541309 A7 B7 V. Description of the invention (46 each r51 is independently selected from the following including r9, _c (〇) 为 ， 々〇))%, or each of them together forms a saturated 4-8 member carbocyclic ring Or a heterocyclic ring containing _〇_, _s_, or -NH ·; each R21 is independently selected from the following including a straight or branched tiger group including .H or .Ci_6; each AΓ3 is a cyclic group and is independently selected from the following M aryl groups It contains 6, M, 12 or 14 carbon atoms and between 1 and 3 rings, and the aromatic heterocyclic ring contains a solid ring atom and 1 to 3 rings. The heterocyclic ring contains at least one selected from: 〇_ , _S_, · SO- 'S〇2, = N-, and -NH- heteroatoms, the heterocyclic ring contains one or more double bonds as required, and the heterocyclic ring contains more than one aromatic ring as needed , And the ring base can be Is a single or multiple substitution of -Q; each Qi is independently selected from the group consisting of -NH2, _co2H, -Cl, -F, -Br, -I, -N02, -CN, = 0, -OH, _ all Fluoro A 3 alkyl ,! ^, ^ ~, -NHR5, 〇R9, -NHr9, r9,-(:( 〇) · ', and o / \ CH7, γ 2 The restriction is that when -Ar * 3 is a Q i group substitution, it contains one The above additional Ai: 3 bases, this additional ΑΓ3 base is not replaced by another A ". Better 'R5 is selected from the following including: Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back first) Fill out this page again) -C (0) -R1〇, -C (0) 0-R9, and -C (0) -NH ^ R1〇〇 In addition, R5 is selected from the following including: -S (0) 2- R ^) -49- This paper size is applicable to China National Standards (CNS) A4 specification (21Qx 297 feet) Printed by the Central Bureau of Standards, Ministry of Economic Affairs, Consumer Consumption Du printed 541309 A7 __ ^ _ B7 ^ _____ 5. Description of the invention ) -S (O) 2-NH-R10, -C (〇) -C (O) -R10, -R9, and -C (O) -C (O) -ORl0 0 Preferably: m is 1; r13 Is a fluorene or / "straight or branched alkyl group, optionally substituted by -Ar3, -OH, -OR9, or -C02H, where R9 is -C and 4 straight or branched alkyl group, where Aγ * 3 is Morpholinyl or phenyl, where phenyl is optionally substituted by Q! 'R21 is or -CH3; R51 is a straight or branched C14 alkyl group, as required by ΑΓ3 'Is phenyl wherein A1 * 3, depending on the desired substitution -qL;

Ar3 is phenyl, fluorenyl, 4-phenyl, behenyl, isoquinolyl 'pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienofluorenyl, Imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzopyranyl, and 4-phenyl; each independently selected from the group consisting of -NH2, -CM, -F, -Br, -OH, -R9, -NH-R5 where r5 is -C (O) -R10 or -S (0) 2-R9, -〇R5 where R5 is -CW-Rw, -OR9, -NHR9, and / \ CH ,, \ / — o where each of R9 and 0 is independently -C straight or branched alkyl, optionally substituted by Aγ3, of which 1 * 3 is phenyl; -50 This paper size applies to China Standard (CNS) Α4 specification (210X 297 mm) (Please read the precautions on the back before filling out this page), ιτ ... 541309 AT B7 V. Description of the invention (#) The limitation is when -Ar3 is 1 base Instead, it contains more than one -Ar3 group, and the additional -A. Is not substituted by another -Aγ; The ICE inhibitor of another specific example (C) of the present invention is formula (II): 〇 (f) rn 〇R13 (XI), Ra Η where: m is 1 or 2; Ri is selected from the following including formula (elO) R2 Rsf

(Please read the notes on the back before filling this page) (ell)

(el2) 1 Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (w2)

-51-This paper size applies Chinese National Standard (CNS) Λ4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (49) (yi)

(y2)

:z)

And (Please read the notes on the back before filling out the central page of the Ministry of Economic Affairs # 贝 工 consuming cooperation Du printed ring C is selected from the following including benzo, pyrido, pyrene, pyrrole, zirconium. 4 Political dysfunction, heterodyne dysfunction, alpha dysfunction, dysprosium dysfunction, u-bite benzox, imidazo, cyclopentyl, and cyclohexyl; R3 is selected from the following: -CN, -C (0) -H , -C (0) -CH2-TrRn, -C (0) -CH2-F, -C = N-0-R9, and -C 〇 -Ar]; r5 is selected from the following including: -C (O)- R10, -c (o) o-r9, -52 This paper size applies to Chinese National Standard (CNS) A4 (2 丨 OX 297 mm) Order 541309 Printed by A7 B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Description of the invention (50) ^ R10 -C (0) -N \ R1〇, -S (〇) 2-R9, -C (0) -CHr0-R9, -C (〇) C (〇) -R10, -R9,, -H, and -C (O) C (O) -〇R10,-X5S-CH- or -N-; i I Y2 is 112 or 〇; X7 is -N (R8)-or -ο -; Each Ti is selected from the following including-〇- '-S-' -S (O)-'and -S (O),-; R6 is selected from the following including -Η and -CH3; r8 is selected from the following including : -C (O) -R10, -c (o) o-r9, -C (O) -NH-R10, -S (0) 7-R ^ j -s (〇) 2-n h-r10, -C (〇) -CH2-OR10, -C (O) C (O) -R10, -C (〇) -CHrN (R10) (R10), -C (0) -CH2C (0) -0-R9, -53- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling out this page) 541309 A7 B7 V. Description of the invention (51) -C (0) -CH2C (0) -R9, -Η, and -C (0) -C (0) -0Rjq; each R9 is independently selected and the following includes -Ars and C1> 6 straight or branched base Aγ3 substitution is required, where -C1-6 alkyl is optionally unsaturated; each R10 is independently selected from the following including -H, -Ar3, C3_6 cycloalkyl, and _Ci_6 straight or branched alkyl as desired ΑΓ3 substituted 'wherein the alkyl group is optionally unsaturated; each Rn is independently selected from the group consisting of: -Ar4,-(CH2) 1.3-Ar4 ^ -Η, and -C (0) -Ar4;

Rn is selected from the group consisting of the following: H 'ΑΓ3' and Ci-6 straight or branched alkyl, optionally substituted by Ar3, -CONH2, -OR5, -OH, -0119 or -〇: 0211; -OR13 A (H) -OH as required; each R21 is independently selected from the following including straight or branched alkyl groups;

Ar2 is independently selected from the following, and any ring can be replaced by-(^ single or multiple substitutions; (Please read the precautions on the back before filling this page)

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

, And -54- This paper size applies to China National Standard (CNS) A4 specifications (2 丨 0 > < ^ 7mm) 541309

Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (52) where each γ is independently selected from the following including 0 and s; each Aγ3 is a cyclic group, independently selected from the following including an aryl group which contains 6,1. , 12 'or 14 carbon atoms and 1 to 3 rings, and an aromatic heterocyclic group containing 5 to 15 bad atoms and 1 to 3 rings, the heterocyclic ring containing at least one selected from _〇_,,, S02 , = N- and -NH-, -N (R5)-, and -N (R9)-heteroatoms, the heterocyclic ring may contain more than one double bond as required, and the heterocyclic ring may contain more than one aromatic Ring, and the ring base may be a single or multiple substitutions as required by -q; each Ar * 4 is a ring group, independently selected from the following including aryl groups which contain 6, 12, or Η carbon atoms and 1 to 3 Ring, a heterocyclic group containing ^ to 5 ring atoms and 1 to 3 rings, the heterocyclic ring contains at least one selected from -0- ,, -SO-, S02 ', -NH-, -N (R5 )-, And -N (R9)-heteroatoms, the heterocyclic group may contain more than one double bond as required, the heterocyclic group may contain more than one compound, and the cyclic group may need Single or multiple substitutions by -q 1; each Ql is independently selected from Including -NH2, -CO2H, -CM, -F, -Br, -I'.M02 '-CN' = 0 '-0', -perfluoroci 3 alkyl, chi 5, -0115, -NHR5, 〇R9, -NHR9, R9, -C (0) -R1〇, and \ CH2,

The V limitation is that when -Ar3 is substituted with a Qi group, it contains one or more additional AΓ3s which are substituted with another -Ar3. The preferred compounds for this specific example include the following, but are not limited to them: (Please read the notes on the back before filling this page)

541309

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

223e ο

α

227e 307a Ο

Ν Η

-56 This paper size applies to Chinese fixed Lilian f, Λ Cong (Please read the precautions on the back before filling this page)

C t a "I

y ζ A 541309 Α7 Β7 V. Description of the invention (307 b 429

Ο

0 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 827e 826e

This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of invention (55) 〇

Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economics. Example C. A preferred compound of formula (II), where 1 ^ is (el 1) and the other substituents are as defined above. Specific Example C uses other preferred compounds of formula (II), the center of which is (el2) and the additional substituents are as defined above. Specific Example C applies other preferred compounds of formula (II), wherein Rls (yl) and additional substituents are as defined above. Specific Example C applies other preferred compounds of formula (II), wherein 1 ^ is 2) and the additional substituents are as defined above. Specific Example C uses other preferred compounds of formula (II), the center of which is (z) and the other substituents are as defined above. -58- This paper size applies the Chinese National Standard (CNS) A4 Regulation (210x297 mm) 541309 A7 B7 V. Description of the Invention (56) ^ Specific Example C Application of other preferred compounds of formula (II), its center Is (w2) and the other substituents are as defined above. Preferably, Ri is (w2) and m is 1; ring C is benzo, said pyrido or p-pheneno; R3 is selected from the group consisting of -C (0) -H, -C (〇) -Ar2, and -C (〇) Ch2-T "Rii; r5 is selected from the group consisting of: -C (O) -R10 'where R1O is -Aγ3; -C (〇) -〇R9, where R9 is -CH> Ar3; -C (O) C (O) -R10, where R1O is -CH2Ar3; -R9 'where 119 is C1-2: 1 end group, substituted by _Aι <3; and -C (〇) C (O ) -OR10 'where R1〇 is; T1 is 0 or S; R6 is Η; R8 is selected from the following including -C (0) -R1〇, -C (〇) -CH2-OR10, and -C (〇) CH2 -N (R10) (R10), where R10 is rhenium, CH3, or CH2CH3; selected from the following including -Aγ4,-(CH2) N3-Ar4, and -C (0) -Ar4; Ministry of Economic Affairs, China Standard Bureau of Standards Printed by employee consumer cooperatives R13 is H or -Cw straight or branched base as required -Ar3, -〇H, -〇R9 or -C〇2H substituted 'where Rg is -C1-4 branched or linear burned Group, where Aq is morpholinyl or phenyl, where phenyl is as desired (substituted by ^; eight "is ⑽); Y is 0;

Ah is phenyl, fluorenyl, thienyl, p-quinolinyl, isofluorinyl, 4azolyl'benzimidazolyl, fluoreno-4phenyl, 4diazolyl, benzotrisyl-59- This paper size applies the Chinese National Standard (CNS) A4 Regulation (210X 297 mm) 541309 A7 B7 5. Description of the Invention (57), benzo [b] thiophenyl, benzofuranyl and fluorinyl; Αγ4 is Phenyl, tetrahexyl 'fluorenyl' said alkynyl, fluorenyl, amyl, or fluorinyl; each independently selected from the following including -NH2, -Cl, -F, -Br, -OH,- R9, -NH-R5, where 115 is-(: (〇) -1110 or -S (0) 2-R9, -OR5 where 115 is -C (〇) -Ri〇 '-OR,' -NHR9 'and 〇 '/ \ ch2, \ /. 〇 where each R9 & R1 () is independently -CN6 straight or branched alkyl, optionally substituted by Aq, where A4 is phenyl; the limitation is when -Ar3 is ( ^ Group substitution, which contains more than one additional -Aγ3 group, the additional -Aγ3 group is not substituted by another -Ar3 group. Preferred compounds of this specific example include the following, but are not limited thereto: (Please read the back first Precautions Write this page-Pack. D Central Standard of the Ministry of Economic Affairs Co-op staff paper printed -60- This scale applies China National Standard (CNS) A4 size (210X 297 mm) 541309 A7 B7 V. invention is described in (58) 605a

OH Η Ο 605b

605c 605d

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs 605e

OH 〇 61-This paper size applies Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (59)

605g 605h

605i

OH Η

-62- This paper size applies to Chinese National Standard (CNS) A4 (210X 297mm) 541309 A7 B7 V. Description of the invention (60 605m H3C 0

0 νΛη 605η 〇

(Please read the precautions on the back ^^ first write this page) • Equipment · 605〇 〇 CHa

ch3〇 Η Order 605ρ

OH Η Q 〇 Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 605q -63 This paper size applies to China National Standards (CNS) 8-4 specifications (210X 297 mm) 541309 A7 B7 V. Description of invention (61) Printed by the Consumer Standards Cooperative of the Central Bureau of Standards

• 64- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (62 619 0

0

0H 020 621 0

622 d Printed by H0 Consumer Cooperatives of Central Bureau of Standards, Ministry of Economic Affairs 623

-65 This paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A 7 Β7 V. Description of the invention (63 0 624

625 Η ^ Λ ^ ν ^ Η CH. -(Please read the precautions on the back before filling this page) -Installation · 626 Ο

Order 627 Ο

印 Printed by the Consumers' Cooperative of the Central Biaohan Bureau of the Ministry of Economic Affairs

628 H3C ^ 〇 〇

/ 〇Η | fYw -66 This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 Α7 Β7 V. Description of the invention (64 629 Ο

630

OH 0 631 632 633 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 634 Ο

-67 This paper size applies to China National Standards (CNTS) A4 specifications (210 × 297 mm) 541309 A7 B7 Printed by A Consumption of Employees of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of Invention (S5) 635

Specific Example C uses other preferred compounds of formula (II), wherein 1 is (elO), X5 is CH, and the other substituents are as defined above. Specific Example C applies a preferred compound of formula (II), the center of which is (elO), X5 is CH, R3 is Co-Ar2, and other substituents are as defined above. Specific Example C: Applying other preferred compounds of formula (II), the center of which is (elO), X5 is CH 'R3 is -C (0) -CH2-TrRn' R " is-(CH2) i.3-Ar4 ' And other substituents are as defined above. Specific Example C applies other preferred compounds of formula (II), where 1 ^ is (610), and X5 is CH and R3 is-[(CO-CPVTVRn; Ding is 0; and 疋 -C (0) -Ar4 'And other substituents are as defined above. Preferably, among these preferred compounds, R5 is selected from the group consisting of: -C (〇) -R10, -C (0) 0-R9' and -C (O) -NH -R10 〇 In addition, among these preferred compounds, r5 is selected from the following including: -S (〇) 7-Rg '-S (〇) 2-NH-R10, -68- (Please read the notes on the back first (Fill in this page again.) This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 ______B7 5. Description of the invention (66) -C (O) -C (O) -R10,-'and- C (O) -C (O) -OR10 is the best. Among these preferred compounds, m is 1; 1 ^ * 0 or S: R13 is fluorene or -Ci-4 straight or branched alkyl as required -Ar3 ,: OH, -OR9 or -CO2H substituted 'where R9 is -CN4 branched or straight-chain tiger group, where eight]: 3 is morpholinyl or phenyl group, where phenyl is-required is q 1 substitution; R21 is -H or -CH3; R51 is a C 1-6 straight or branched radical 'Ar3 substitution as required, where Aγ3 phenyl, -Q as required ! To replace;

Ar is (hh); Y is 0, and

Ar3 is phenyl, fluorenyl, p-sphenenyl, p-lympholyn, iso-p-lympholyl, leafy sigma, and soul. Biosynthesis, isomer sigmayl, benzotriol, benzimidyl,. Thiophene, phenidyl, imidyl, distyryl, benzo [b] thiophenyl, p-bisyl, benzopyranyl, and pyrenyl;

Ar4 is phenyl, tetrabenzyl, said ydenyl, p-xyl, naphthyl, p-denyl, printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, or 4-phenyl; each Qi is independently selected from the following including , -Cl, -F, _Br, -〇H, -R9, -NH-R5 where r5 is -C (〇) -R10 or 4 (0) 2-1 ^, -〇R5 where R5 is -C (O ) -R10, -〇R9, -NHR9, and -69- This paper size applies the Chinese National Standard (CNS) A4 specification (210 x 297 mm) 541309 A7 B7 V. Description of the invention (67) γ where each R9 & R10 is a -Ck straight or branched alkyl group optionally substituted by ΑΓ3, where Ar3 is phenyl; the limitation is that when -A1 · 3 is Q 丨 substituted, it includes more than one additional -At * 3 groups, the additional -Aι * 3 group is not substituted by another -Ay group, and other preferred compounds of formula (Π) are specifically used in Example C, where & is (ei〇), X5 is CH, Rs Is -C (0) -H, and the additional substituents are as defined above. Preferably, among these preferred compounds, it is selected from the group consisting of -C (O) -R10, -C (0) 0-R9, and -C (O) -NH-R10. In addition, among these preferred compounds, r5 is selected from the group consisting of -S (Ο), -R9 '-S (0)-> -NH-R1 〇? -C (O) -C (O)- R10, -R9 'and -C (O) -C (〇) -OR10 0 printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs are the best. Among these preferred compounds, m is 1; ^ Yes. Or S; R13 is fluorene or -Cw straight or branched alkyl optionally substituted with-Ar3, -OH, -OR9 or -C02H, where R9 is -Cw branched or straight chain alkyl, where Ar3 is -70- Paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 ________B7 V. Description of the invention (68) Morpholine or phenyl group, where phenyl group is substituted as required; R21 is -H or -CH3; R51 is a Cl-6 straight or branched tiger group, optionally substituted with Aγ3, where AΓ3 is phenyl, optionally substituted with -Qi; eight "is ⑽); Y is 0, and

Ah is a phenyl group, a fluorenyl group, a thienyl group, a fluorenyl group, an isofluorinyl group, a pyridyl group, a side σ group, and a sigma group, a benzotrisyl group, and a benzo group. X'yl, g-phenothiophene, imidazolyl, thiadiaphthyl, benzo [b] thiophenyl, pyridyl ' benzopyranyl, and triphenyl;

At * 4 stilbene 'tetrasalyl, p-pyridyl, stilbyl, mossyl, p-pyridyl, or edge phenyl; each Qi is independently selected from the following including -NH2, -Cl, -F, -Br, -OH, -R9, -NH-R5, whose center is -C (0) -Ri (^-S (〇) 2-R9, -〇R5, whose center is -C (〇) -R1〇, -〇r9, -NHR9, and

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, where each Rg and R10 are independently-(31-6 straight or branched alkyl groups, if necessary, replaced by Ah, where αΓ3 is phenyl; the limitation is when- Eight 1: 3 is an I group substitution, which contains more than one additional -Al * 3 group. The additional _Aγ3 group is not substituted by another _A4 group. Specific Example C applies other preferred compounds of formula (II) , Its center is 01〇) 'and x5 is CH, R3 is CO-CH2-TrRn, and Rn is -Αγ4, and other __ -71 · i paper size applies to county (⑽) M specifications (2lGx2 ^^ y 541309 Α7 Β7 V. Description of the invention (69) The substituents are as defined above. Preferably among these preferred compounds, r5 is selected from the group consisting of: -C (O) -R10, -c (o) o-r9, and- C (O) -NH-Rl 0 0 In addition, in these preferred compounds, r5 is selected from the group consisting of -S (〇) 2 * -R9 '-S (〇) rNH-R10, -C (〇)- C (O) -R10, _-R9 'and -C (O) -C (O) -ORl0 0 are the best. Among these preferred compounds, m is 1; T1 is 0 or S; R13 is Η or- Ci.4 straight or branched alkyl is optionally substituted by -Ar3, -OH, -0R9, or -C02H, where R9 is-(: Branched or straight-chain alkyl, where Ar3 is morpholinyl or phenyl, where phenyl is optionally substituted by Qi; R21 is -H or -CH3; printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs, R5 1 is Cp6 is straight or branched alkyl, optionally substituted by Aγ3, where Aγ3 is phenyl, and optionally substituted by -Qi;

Ar4 (hh); Y is 0, and Aγ3 is phenyl, fluorenyl, phenenyl, sphingyl, isoprenyl, p-biphenyl, selenium, isomer, benzotrisyl , Benzimidyl group, p-sphene-72- This paper size applies to the Chinese National Standard (CNS) A4 specification (21 × m mm) 541309 A7 B7 V. Description of the invention (70) benzothienyl, imidazolyl ' Dibenzyl, benzo [b] thiophenyl, pyridyl, benzopyranyl, and 4indolyl; Ar4 is phenyl, tetraolyl'eridyl, oxazolyl, fluorenyl, pyrimidinyl Or thienyl; each is independently selected from the group consisting of -NH2, -c, -F, -Br, -OH, -R9, -NH-R5 where R5 is -C (0) -R1O or -S ( 〇) 2-R9, -C) R5 where & is -C (〇) -r1〇, -〇r9, -NHR9, and, 〇 / \ CH 'Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

γ wherein each of R9 and R10 is -C1-6 straight or branched, and optionally substituted by Ar, wherein "8" is phenyl; the limitation is that when -Aγ3 is substituted by Q, Containing more than one -Ah group, the additional -A]: 3 group is not substituted with another -Aι · 3 group. Specific Example C applies other preferred compounds of formula (II), in which R (elO), and X5 is N, and the other substituents are as defined above. Specific Example C applies a preferred compound of formula (II), wherein Rj is (e 1 0) is N ′ Rs is CO-AI * 2, and other The substituents are as defined above. Specific Example C applies to other preferred compounds of the compound of formula (II), which are: RiR (elO), X5 is N, R3 is -C ^ CO-CHrTrRn, Aq, and other substituents are as above. The specific example C applies other preferred compounds of formula (II), in which R (elO), X5 is n, and 'R3 is -C (〇) -CH2-TrR '11 (Please read the note on the back first Matters ^^ write this page) • equipment. The outside is medium -73-

Order line 541309 A7 B7 V. Description of the invention (71 printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 1 ^ 0; and Rn is -C (0) -Ai: 4, and the other substituents are as defined above. Better In these preferred compounds, & is selected from the group consisting of: -C (O) -R10, -C (0) 0-R9, and -C (〇) -N Η-R1 〇0 In addition, Among these preferred compounds, selected from the group consisting of "-S (〇) 2-R9, -s (〇) 2-nh-r10,-• C (〇) -C (O) -R10, -R9 'and- C (O) -C (O) -OR10 〇 Preferred. Among these preferred compounds, r5 is selected from the group consisting of: -S (0) 9-R9 '-S (〇) 2-NH-R10, -C ( O) -C (O) -R10, -R9, and -C (O) -C (O) -OR100 are 1; TiSO or S; R13 is fluorene or -Ci-4 straight or branched alkyl group Must be -Ar3, -OH, -OR ^ 'or -C〇2H substituted' where R9 is -CN4 branched or straight chain alkyl, where αγ_ is morpholinyl or phenyl, where phenyl is qi as required Replace; R21 is -H or -CH3; (Please read the precautions on the back before filling out this page) -Packing · ， 1Τ k -74- This paper size applies Chinese National Standard (CNS) A4 specification (2 丨 OX 297 Mm) 541309 A7 __! Z_____ 5. Description (72)

Rsi is a straight or branched ci-6 group, optionally substituted by Ar3, where is phenyl, optionally substituted by -Qi;

Ai ^ (hh); Y is 0, and Aγ3 is phenyl, fluorenyl, thienyl, quinolinolyl, isofluorinyl, pyrazolyl, oxazolyl, isoxazolyl, benzotriazole Benzyl, benzimidazolyl, galanthienyl, imidazolyl, thiadiazolyl, benzo [b] thiopyenyl, pyridyl, benzouranyl, and 4-methyl;

Ar4 is phenyl, tetrazolyl, pyridyl, oxazolyl, fluorenyl, pyrimidinyl 'or thienyl; each Qi is independently selected from the following including -NΗ]'-Cl, -F, -Br, -OH,- R9,, than 115, where 115 is-(: (〇) -1110 or -8 (〇) 2-119, -〇115 where 115 is -c (〇) -R10, -OR9, -NHR9, and

Each of R9 and R10 is independently a -CN6 straight or branched alkyl group, which is substituted by Aγ3 as required, where Ar3 is a phenyl group;. ¾ Consumption Cooperation of Employees of the Ministry of Economic Affairs, China Bureau of Printing, Du printed restrictions: When -Ar3 is substituted by Q !, it contains more than one additional Αγ3 group, and this additional _Ar3 group is not substituted by another -Ar3 group. Specific example C is another preferred compound. In formula (II), 1 ^ is (el0), x5 is N, R3 is -C (0) -H, and other substituents are as defined above. Preferably, among these preferred compounds, R5 is selected from the following: -C (〇) -R10, -75- This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 Central Standard of the Ministry of Economic Affairs A7 B7 printed by the Bureau's Consumer Cooperatives V. Invention Description (73) -C (0) 0-R9, and -C (〇) -NH-R10. In addition, among these preferred compounds, r5 is selected from the following: S (0) rR9, -S (O) rNH-R10, -C (O) -C (O) -R10, _R * 9, and- C (O) -C (O) -OR10 is better. Among these preferred compounds, m is 1; 1 ^ * 0 or S; R13 is fluorene or-(: 1-4 straight or branched alkyl group) , If necessary, substituted by -Ar3, -OH, -〇R9, or -C02H, where R9 * -CN4 is branched or straight-chain alkyl, where Aγ3 is morpholinyl or phenyl, where phenyl is required Is substituted by Q i; R21 is -H or -CH3; R51 is a straight or branched alkyl group of C i -6, optionally substituted by Aγ3, wherein Ar3 is phenyl, and optionally substituted by-(^; Αγ2 Yes (hh); Y is 0, and Aγ3 is phenyl, fluorenyl, fluorenyl, quinolinyl, isoquinolinyl, pyrazolyl, telezolyl, isoxazolyl, benzotriazole Group, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzocrotyl, and 4-indolyl;

Ar4 is phenyl, tetrazolyl, pyridyl, oxazolyl, fluorenyl, pyrimidinyl-76. This paper is also applicable to China National Standard (CNS) A4 specification (210X297 mm) --------- -Batch clothing ------ 1T (Please read the precautions on the back first to write this page)

541309 A7 B7 V. Description of the invention (74, or thienyl; each ~ is independently selected from the following including -NH2, -Cl, -F, -Br, -OH, _R9, -NH-R5, where R5 is < (0 ) -111〇 or -S (0) 2-R9, -〇r5 The center is -C (O) -R10, -OR9, -NHR9, and CH2 The Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs printed each of R9 and Ri0 is independently a -Ck straight or branched alkyl group, optionally substituted by Aγ3, where Ar3 is a phenyl group; a limitation is that when -At * 3 is a Q1 group substitution, it contains more than one additional- Αγ3 group, the additional -Αγ3 group is not substituted by another -Αγ3 group. Specific Example c Other preferred compounds, using formula (π) where Ri * (el ()), and X5 is N, R3 is CO-CH2 -TrR ", JL RH is -Aγ4, and the other substituents are as defined above. Preferably, in these preferred compounds, r5 is selected from the following: -C (O) -R10, -C (0) 〇- R9, and -C (O) -NH-R10. In addition, in these preferred compounds, r5 is selected from the following: -S (0) 2-R9'-s (o) 2-nh-r10, -C (0) -C (〇) -R1〇, -R9 'and -C (0) -C (0) -OR1〇〇77- This paper standard applies to China Standard (CNS) Α4 specification (210X29 * 7mm) (Please read the notes on the back first ^% Write this page} -Binding-Staple ·) 41309 A7

Take 'good' among these preferred compounds: m is 1; T is 0 or S; R " is Η or -C " straight or branched alkyl, optionally A, _〇h, -〇h, or -C〇2H substitution, where Rg is -Ci_4 straight or branched alkyl, where Ars morpholinyl or phenyl, where phenyl is optionally substituted by Q1; Han 21 is -H or -CH3;疋 51-6cl-6 straight or branched alkyl, optionally substituted by Ar3, where A "is phenyl, optionally substituted by -Qi; -Ar2 is (hh); Y is 0, and Αι * 3 Phenyl, Fanyl, Ethylphenidyl, Junyilinyl, Isophenoxylinyl, Ton ° P'sazolyl, Isoxazolyl, Benzotriazolyl, Benzimidazolyl, Phenotropic Benzothienyl, imidazolyl, amidazolyl, benzo [b] thiophenyl, pyridyl'benzofuryl and indolyl; A ** 4 is phenyl, tetrahexyl, p-pyridyl, fluorene Benzyl, naphthyl, sulfanyl or thienyl; each (^ independently selected from the following including -NH2, -Cl, -F, -Br, -OH, -r9, printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs- nh-r5, where R5 * -C (0) -Ri〇 or -S (0) 2-R9, -0R5 whose center is • C (0) -R1〇, -〇r9 -NHR9, and o

〇 Among them, each of R9 and R1 is independently -Cw straight or branched alkyl group, if necessary -78- This paper scale is applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 Description (76

Substituted by Aq, where eight 1: 3 is phenyl; the limitation is that when -eight 1: 3 is substituted with 1 group, it contains more than one additional -Ar3 group, the additional -Αγ3 group is not another -Αγ3 group Was replaced. Preferred compounds of specific example B include the following, but are not limited thereto: 213e

Please read the 5% item PF f 302 〇

304a 〇

〇, όη3 Printed by the Consumers Cooperative of the Central Bureau of quasi-government, j δ! 3β

-79- This paper size is applicable to Chinese National Standard (CNS) A4 (210X 297mm) 541309 A7 B7 V. Description of the invention (77) 902 904a 〇

Preferred specific examples of the compound C include the following but are not limited to this (please read the notes on the back to write this page) • Binding and ordering Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs--80- This paper size applies to China National Standard (CNS) A4 specification (210X 297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (79 257 265 280 281

OH Η 0

OH

6

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Ο 282

283

-82 The paper size applies to Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of invention (80)

This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Finance

This paper size applies to Chinese National Standard (CNS) A4 (2I0X297mm) PC] 3 lx 54 A7 B7

This paper size applies to Chinese National Standard (CNS) A4 specification (2I0X297 mm) 541309 A7 B7 V. Description of invention (83

-86- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 Α7 Β7 V. Description of the invention (84) 426 〇

OH Η 430 431

432 Ο

433) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 434

-87- This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (85 435 0

OH Η 436

437 Ο

OH Η Ο 438 Ο

439 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 440 Ο

ΟΗ Η

-88- This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (86) 441 Ο

442 Ο

443 0

0

OH Η 444

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 445

89- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of the invention (87 446 Ο

OH Η 447 Ο

OH 印 Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs

-90- This paper size is in accordance with Chinese National Standard (CNS) A4 (210X 297mm) 541309 A7 B7 V. Description of the invention (88 451 〇

OH Η 452 〇

This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (89 457 0 0

0H Η 458

0 459

OH Η 0 460

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 461 462

OH Η

〇 -92- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (9〇 463

OH Η 464 cV ^ nC9 / 〇h H 〇 465

O

(Please read the precautions on the back before _ horse page) • Packing 466

OH H order 467

OH H Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs 468

93- This paper size applies to the Chinese National Standard (CNS) six 4 ^ grid (2IOX297 mm) 541309 A7 B7 V. Description of the invention (91) 〇 469 470 Ο

471 〇

472 Ο

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs

-94-This paper applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 Α7 Β7 V. Description of the invention (92 474 0

0 475 0

0H Η 476 0

477 0

c〇N Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 478

OH Η -95- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (93 Ο 479 480ηΜ η νΛΗ Hf input. 'Ο 481

Ο 481s

Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 482 Ο

-96-This paper size is applicable to Chinese National Standard (CNS) A4 specification (21〇 × 297mm) 541309 A 7 B7 V. Description of the invention (94 482s 〇

483

0 484

485 〇

OH 印 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 486 〇

OH Η -97- This paper size applies to China National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of invention (95) 487 0

Ο

0

OH Ο

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 491 ΟΟ " 〇

-98- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 Α7 Β7 V. Description of the invention (96 493 〇

0H 494

0H Η 495 0

496 〇r 〇

OH 印 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 497 Ο

OH Η -99 This paper size is applicable to China National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (97 498

499

(T Ο

814C 〇

Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 817c

817d

-100- This paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (98 〇 817e

880

Ο 881

882

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 883

-101 This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

This paper size applies to the Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 Printed by the Offshore Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (101: 1010 〇

1011 〇 0

〇

OH ο 1012 1013 Printed by I Industrial Consumer Cooperatives, Central Bureau of Standards, Ministry of Economic Affairs 1015

-104 This paper size is applicable to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (102) 1016 1017

0 1018 〇

〇 Η

OH 1019 Printed by the Staff Consumer Cooperative of the Zhongda Standards Bureau of the Ministry of Economic Affairs 1020

CH3O

H 〇0 人 N 〇 Η

OH

〇, N

This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) 541309 Α7 Β7 V. Description of the invention (103) 1022

1023

(Please read the precautions on the back-rI package * 7 at the end) 1024 〇

, V't > 1025 Ο

〇 〇 Printed by the Consumer Consumption Office of the Central Standards Bureau of the Ministry of Economic Affairs 1026

Ο Λ OH Η -106 This paper size applies to the Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention () 1030 〇 Λ 〇

~ ΝΗ Ο (

〇 Η, 〇Η 1031

1032

1033 Printed by the Consumers' Cooperatives of the China National Standards Administration, Ministry of Economic Affairs 103 4

-107- This paper size applies to Chinese national standard (0 milk) 8 4 specifications (2 丨 0, 乂 297 mm) 541309 A7 B7 V. Description of invention (105) 1035

1036

103 7 Ο

1038

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 1039 0

-108- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (2 丨 0X 297 mm) 541309 A7 B7 V. Description of the invention (106) 1040

1041 〇

(Please read the precautions on the back before filling out this page) • Packing · 1042 0

1043 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 1044

〇

Λ; OH Η • 109- This paper size applies to the Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of the invention (1Q7) 1045 Ο

1046 〇

1047

1048

6η3 η ά Printed by the Consumers Cooperative of the Central Biaoying Bureau of the Ministry of Economic Affairs 1049 〇

-110- This paper size applies to China National Standard (CNS) A4 (210 × 297 mm) 541309 A7 B7 Printed by the Consumers ’Cooperative of the Economic and Central Standards Bureau

541309 A7 B7 V. Description of the invention (109) 1055 Ο

1056 〇

〇 1057 0

1058 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 1059 0

0

-112 The paper size is applicable to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of Invention (110) 1060 〇

1061

0 、 OH .Η Ο (Please read the notes on the back before filling in this page) r equipment Ο 1062 ο, tr ο 1063 ο

ο Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 1064 -113- This paper size applies to the Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention ("1) 1065

1066 〇

1067 1068 〇

Printed by a member of the Central Standards Bureau of the Ministry of Economic Affairs and Consumer Cooperatives 1069 〇

-114 The paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (112) 1070 〇

〇 Ο, OH.Η 1071

HjC

'N o 1073 1074 o H3

o o o o Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 1075 o

-115 This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of Invention (113) 1077

〇

〇 〇

1079 Printed by the Consumer Cooperative of the Central Sample Bureau of the Ministry of Economic Affairs 1078 〇 JO1 〇 1080

HjC H3 c people. ° -116- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

541309 A7 B7 V. Description of the invention (115) 1084 H3C Η

1085 Ο

(Please read the precautions on the back first to write this page) Pack. 1086

ο 、 -5'mouth 1087 ο

ο Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs ο

-118- This paper size is in accordance with China National Standard (CNS) A4 (210X 297mm) 541309 A7 B7 V. Description of Invention (116) 1089 仏 人 Η Η

ο 1090

ο HsC

1091 Ο

Ο 1093 ο

ο 1094 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 1095 ο

119- The paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297mm) 541309 A7 B7 V. Description of the invention (117) 1096 〇

1097

1098 〇

1099 〇

Printed by the Central Standard of the Ministry of Economic Affairs, Employee Consumer Cooperatives 421 Ο CH3CH2

-120- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (118) 427 Ο

428 Ο

1021 〇

1027 Printed by the Consumer Cooperatives of the Central Government Bureau of the Ministry of Economic Affairs 1028 0

-121-This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (119) The specific compounds of the present invention also include compounds whose structure includes the skeleton 1-22, but it is not limited to This: Ο

〇

0

(Please read the notes on the back before filling this page) 〇

0

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

R

R

This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (12Q) 〇

12

R 〇

R

R (Please read the notes on the back before filling out this page)-installed.

π

R

Order R Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

20

HN R5—N Η

〇R-123 The size of this paper is applicable to China National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of invention (121:

R5 ~ N Η

Where: R is I:

C〇2H, isr \ 〇ηο Η, Ν Η

CO2R13 Η〇 where R13 is -CH3, -CH2CH3, -CH2CH2CH3, -CH (CH3) (CH3), CH2CH2CH2CH3, -CHrCH (CH3) CH3, -C (CH3) 3, -CH2Ph, or

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

Among them -124- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (122) R13 is -CH3, -CH2CH3, -CH2CH2CH3, -CH (CH3) (CH3) , CH2CH2CH2CH3, -CH2-CH (CH3) CH3, -C (CH3) 3, -CH2Ph, or

And each R51 is -CH3, -CH2CH3, -CH2CH2CH3, -CH (CH3) (CH3), -CH2CH2CH2CH3, -CH2-CH (CH3) CH3, -C (CH3) 3; -CH2Ph, or together form ethylene second Oxyacetal or malondioxyacetal; or

Among them, the R51 printed by the K Industry Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs is -CH3, -CH2CH3, -CH2CH2CH3, -CH (CH3) (CH3), -CH2CH2CH2CH3, -CHrCH (CH3) CH3, -C (CH3) 3,- CH2Ph, -C (0) -CH3 or -C (0) -Ph; R5 in each of the above compounds is as shown in any one of compounds 139, 214c, 214e, 404-413, 415-491, 493-501 Any of the R5 parts is the same. The specific compounds of the present invention also include but are not limited to the compounds containing skeletons 1-28, in which R, 1151 and 115 are as defined above, and among the compounds 214. , 21 ".4〇4-413,415-418,422-426,430-456'458-466,468,470-471,473-491,493,495,497-501-C (O )-Replaced with -CH2-, -C (0) C (0)-or -CH2C (0) C (0)-. 125 This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the China Standards Bureau of the Ministry of Economic Affairs. 5. Description of the invention (123) Another specific example (D) The ICE inhibitor of the present invention is represented by the formula: (work) R ^ -N-R2 I (wherein : Ri is selected from the following including the formula: (elO) F Rs (ell) (el2) R (w2) Rs— R (yi) Rs— -126-

HO

This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (124)

(ζ)

And ring C is selected from the group consisting of benzo, phyllo, and n-phenedio, said harbin, bitano, pazozolo, isopazozo, oxazo, isoxazo, and pyrimido , Imidazo, cyclopentyl and cyclohexyl; 112 is:

R51 • or 〇 (b), ORi3 ^ ORsi, ORsi Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs, m is 1 or 2; each R5 is independently selected from the following including: -C (O) -R10, -C (〇 ) 0-R9, -127- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (125) -C (〇) -N (R10) (R10),- S (〇) 2-R9, -S (〇) plant NH-R10, -c (o) -ch2-o-r9, -C (O) C (O) -R10, -R9 '-H, -C (〇) C (〇) -〇R10, and -c (〇) c (o) -n (r9) (r1g);-X5S-CH- or -N-; II Y2 is ^ 12 or 0; X7 Is -N (R8)-or -0-; R6 is selected from the following including -H and -CH3; r8 is selected from the following including: _C (〇) -R10, -c (〇) o-r9, -C (O) -N (H) -R10, -S (〇) 2-R9, -S (〇) 2-NH-R10, printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs -C (O) -CH2-OR10, -C (O) C (O) -R10, -C (O) -CH2N (R10) (R10), -C (0) -CH2C (0) -0-R9, -C (〇) -CH2C (0)- R9, -128- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of Invention (126) -H, and -C (- O) -C (〇)- R10; each & is independently selected from the group consisting of -Ah and Ci-6 straight or branched alkyl, optionally substituted by Aι * 3, where the base is unsaturated as desired; each R10 is independently selected from the group including -H,- Ar3, Gy cycloalkyl, and Cu straight or branched tiger radicals are optionally A. Substituting, where _Ci6 alkyl is optionally unsaturated;-R13 is selected from the following including Η 'Ar3, and (: 丨 · 6 straight or branched alkyl, optionally Ar3,4〇 2, 2, -〇115 ， _0 再 ， _〇119 or 4〇211 is substituted; each R51 is selected from the following including R9, _C (〇) _R9, or each of them together to form a saturated 4-8 member carbocyclic ring or containing _〇_ , 4_ or, a heterocyclic ring; each R2! Is independently selected from the following including -H or -Cl_6 straight or branched alkyl groups; each A "is a cyclic group, independently selected from the following including aryl groups, which contains 6, '12 or 14 carbon atoms and 1 to 3 rings, and the aromatic heterocyclic group contains 5 to ring atoms and 1 to 3 rings, the heterocyclic ring contains at least one selected from _〇_, 々, -3. -, 3〇2 ,,-, and-then-heteroatoms, the heterocyclic ring may contain more than one double bond as required, the heterocyclic ring may contain more than one aromatic ring, and the cyclic group may be Need to be single or multiple substitutions; each Qi is independently selected from the group consisting of -NH2, _cQ2h ,, _F, ^ 'N02, -CN, = 0, -OH, -perfluoroCm alkyl, &, 〇r -NHR5,0 >, -N (R9) (R1〇), r9, "c (〇) · ^, and CH ^ (please first (Read the notes on the back before filling out this page) Binding 10 15

-I -1¾ 〇129- This paper size applies to China National Standard (CNS) A4 specification (210 ^ 7 ^ 7 541309 A7 ^ _____ — —— V. Description of the invention (127) ~ ^ ^ The limitation is when -Ar3 is When the Qi group is substituted, there is more than one additional -At3 group in the Benzyl-, σ, and the additional -Ah group is not replaced by another · Aι < 3 group. Preferably, R5 is selected from the following including ... C (〇) -R10, -C (0) 0-R9, and -c (o) -nh-r1q. In addition, R5 is selected from the following including-, -s (o) 2-r9,, s ( o) 2-nh-r10,--C (O) -C (O) -R10, -R9, and -C (O) -C (O). 〇R10 ο better: m is 1; R13 is Η Or -CK4 straight or branched alkyl, optionally substituted by -Αγ3, -〇η, -0R9 or -co2h, where R9 is a branched or straight chain alkyl, where Αγ3 is morpholinyl or phenyl, Wherein phenyl is replaced by Q ^ as required; R21 is -H or -CH3; printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs R5 1 is a straight or branched anti-base of C u as required by Ai * 3 Substitution where Ar3 is phenyl and optionally substituted by-(^; each Aγ3 is a cyclic group and is independently selected from the group consisting of phenyl, naphthyl, pyrenyl, ρChano Group, isoρquinolyl, ρbijunyl, ρsecyl, iso17oxal, benzotriazolyl, benzimidazolyl, 4 benzofluorenyl, imidazolyl, oxadiazolyl , Benzo [b] thiophenyl, pyridyl, benzofuryl, and indolyl, -130 · This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 Employees of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 printed by the consumer film cooperative V. Description of the invention (128) and the ring base may be single or multiple substitutions as required by -Q1; each Ql is independently selected from the following including -Cl, -F, -Br, -OH , R9, -NH-R5 where 115 is -C (0) -R1 () or -S (0) 2-R9, -OR5 where 115 is -C (〇) -R1 (), -OR9, -N ( R9) (R1 ()), and 〇 () CH2, 〇wherein each of R9 and R1 (3 are independently -0 or 6 straight or branched alkyl, depending on the need to be replaced by Ar3, where 1 * 3 is Phenyl; The limiting condition is that when -Aγ3 is substituted by a Q i group, it contains more than one additional -Ar3 group, and the additional -eight 1 * 3 group is not substituted by another-Αγ3K. Another specific example of the present invention (E ) Is an ICE inhibitor of formula (11):

Where: m is 1 or 2; & is selected from the following including: -131-This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (129) (elO)

(ell)

(el2)

Re (w2)

R5—N (yi)

H 〇 R

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (y2) (z)

132- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 Α7 Β7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (130) Ring C is selected from the following including benzopyrene , Α, succinyl, isopyridyl, imidazolo, cyclofluorenyl and cyclohexyl are selected from the group consisting of: -CN, -C (〇) -H, -C (〇) -CH2-T "Rn, -C ( 0) -CH2-F, -C = N-0-R9, and -C Ο-A Γ ,; each 115 is independently selected from the following including -C (O) -R10, -c (o) o-r9,- C (O) -N (R10) (R10) -S (0) 9-R9 '-S (〇) 2-NH-R10, -c (o) -ch2-o-r9, -C (O) C (O) -R10, -R9'-H, -C (O) C (O) -OR10, and -c (o) c (o) -n (r9) (r10) are -CH- or -N- II II 2 is 112 or 0; p ratio is far, and far is far, p is more than 17 each, stubborn 0 is violent, heterosexual bites, and yells, and -133 This paper size applies Chinese national standard ( CNS) Α4 specification (210 × 297 mm) Please read the precautions before filling out this page 541309 A7 B7 V. Description of the invention (131: X7 is -N (R8)-or -0; From the following include '-S-' -S (O)-'and -S (〇) 7-; please read first ιέ Winter stuff refill page R6 is selected from the following including -H and -CH3; R8 is selected from the following including: -C (O) -R10, -c (o) 〇-r9, -C (〇) -NH -R10, '-S (〇) 2-R9, -S (〇) 2-NH-R10, _ -C (〇) -CH2-OR10, -C (〇) C (〇) -R10, -C ( 〇) -CH2N (R1G) (R10), -C (〇) -CH2C (〇) -〇-R9, -C (〇) -CH2C (〇) -R9, -H, and -C (O) -C (O) -OR10; each R9 is independently selected from the following including -Ar3 and -CN6 straight or branched alkyl groups, optionally substituted by A ", where -CN6 alkyl groups are unsaturated as desired; Central Standards Bureau of the Ministry of Economic Affairs Employee Consumer Cooperatives printed each R1 〇 independently from each other including the following -H '-Ar ^' group 'and -Ci_6 straight or branched alkyl groups, which are replaced by Αγ3 as required, of which -CN6 alkyl is not required Saturation; Each ruler is selected independently from the following: -ΑΓ4 '-(CHi) 1.3 * Ar4 9 -134- This paper size applies to the Chinese National Standard (CNS) Α4 specification (210X297 mm) Printed by the Consumer Cooperative of the Bureau A7 —______ B7 _ V. Description of the Invention (132) and -C (〇) -Ar4; R15 is selected from the following packages: -〇Η, -〇Αγ3, -Ν (Η) · Ο , And -〇C1-6 straight or branched alkyl, optionally substituted with -Αγ3, -coNH2, -OR5, -OH, -〇R9, or -co2hk; each R2 i is independently selected from the following including- H or -C and 6 straight or branched alkyl;

Ar2 is independently selected from the following, in which any ring may be a single or multiple substitutions as required by-(^;

Wherein each Y is independently selected from the following including 0 and s; each Ar3 is a cyclic group, independently selected from the following including an aryl group which contains 6, 10, 12 or 14 carbon atoms and 3 to 3 rings, and an aromatic heterocyclic group Contains 5 to 15 ring atoms and 1 to 3 rings, and the heterocyclic ring contains at least one selected from _〇_, -s /, β SO-, S02 ,,-, and -NH-, -N (R5)-, And -n (r9) _ heteroatoms, the heterocyclic ring may contain more than one double bond, the heterocyclic group may contain more than one aromatic ring, and the ring group may be _ (^ Single or multiple substitutions: Each Ard is a cyclic group. Independently selected are the following including aryl groups which contain 6, 10, 12 or 14 carbon atoms and 至 to 3 rings, and heterocyclic groups contain 5 to 环 ring atoms and 1 to 3 rings, the heterocyclic group contains at least one heteroatom selected from the group consisting of _〇_,, __, _2,, -NH-, -N (R5)-, and -N (R9)- ， The heterocyclic ring-135- this paper f degree is applicable to CNs) E 2 ⑴ Father 297 mm 1 "-'' ----(Please read the precautions on the back before filling this page) • Binding 541309 A7- ------- B7_ V. Description of the invention (133) The base view contains more than one double bond, and the heterocyclic group depends on the need There are more than one square family soil, and the ring base may be single or multiple substitutions as required by -Q1: each (^ is independently selected from the following including -NH2, -C02H, -Cl, -F, _Br, -1, -N〇2, _CN, = 〇, _〇Η, _full gas CN3 alkyl, R5, 〇〇foot 5, -NHR5, 〇R9, -N (R9) (R1〇), R9, -C (〇 ) -Ri〇, and o / \ CH ,, '\ /-〇 The restriction is that when -Ar3 is Q 丨 instead of-, it contains more than one additional Ar3 group, and the additional -Αγ3 group is not another -Aγ3 is substituted. A preferred compound of specific example E applies formula (II), wherein 111 is Pl 11) and the other substituents are as defined above. Specific Example E Other preferred compounds employ formula (II), wherein R is (612) and other substituents are as defined above. Specific Example E Other preferred compounds apply Formula (II), where 1 ^ is (^ 1) and the other substituents are as defined above. Specific Example E Other preferred compounds apply formula (II), where 1 ^ is 2) and other substituents are as defined above. Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. Example E. Other preferred compounds apply formula (II), where 1 ^ is (2) and other substituents are as defined above. Specific Example E Other preferred compounds employ formula (II), wherein 1 ^ is (w2) and the other substituents are as defined above. Better, 1 ^ * 02) and m is 1; -136- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 Printed by A7 B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (134) Ring C is benzo, pyrido, or thieno; R3 is selected from the following including -C (0) -H, -C (〇) -Ar2, and -CCCOCHrTVRn; R5 is selected from the following including ...- C (〇) -R10 'wherein R10 is -Ar3; -C (0) -0R9' where R9S-CH2-Ar3; -C (O) C (O) -R10, where R10 is _Αγ3; -R9 ' Wherein 9′C 1-2 tigeryl is substituted by — Αγ3; and '-C (O) C (O) -〇R10, wherein R1O is -CH2Ar3; ^ Yes. Or S;-Rule 6 is Η; R8 is selected from the group consisting of -C (0) -R10, -C (0) -CH2-ORi〇, and -C (O) CH2-N (R10) (R10), Wherein R10 is Η, CH3, or CH2CH3; R11 is selected from the following including -Ar4 '-(CH2) i_3-Ar4, and -C (0) -Ar4; R15 is -OH or -OC1-4 straight or branched · ;): End of the base is as needed -Ar3, -OH '-OR9' or -CO2H substituted 'where r9 is -C1-4 branched or straight-bonded alkyl group' where Aγ3 is morpholinyl or phenyl group, where Phenyl is optionally substituted by Qi; eight "is ⑽); Y is 0; each A * 3 ring group is independently selected from the group consisting of: phenyl, fluorenyl, p-synyl, 4 norinyl, iso-4 Norinyl, 4-Tolyl 'benzimidyl, p-thiophenazolyl, p-diazolyl, benzotriazolyl, benzo [b] thiophenyl, benzoxanyl, and indole And the ring base may be -Q 丨 single or multiple substitutions as required. Each Aim * 4 ring group is independently selected from the following including: phenyl, tetrazolyl, tea-based, leaf-dagger-137- Applicable Chinese National Standard (CNS) Eight Views (2l0x 297mm) (Please read the notes on the back before filling this page) Order 541309 A7 ___B7 V. Description of Invention (13 5) 基 ', σ, 4, or %%, the ring base may be single or multiple substitution as required; each Q is independently selected from the following including -NH2, -ci, -F,- Br, -OH, -R, 'NH-R5, where 115 is -C (O) -R10 or -s (〇) 2-r9, -〇R5 where R) •, C (〇vr1〇, -〇 r9, _N (R9) (r1〇), and) 〇 / \ CH ?, '\ / 一 〇, each of R9 and R10 is independently -C 1-ό I or a branched base as required An Substituted, where Ar3 is phenyl; ° Limited currency condition is that when -Ars is substituted by Q 丨, it contains more than one additional -Ar * 3 group, the additional -ΑΓ3 group is not other -Αι > 3 Specific Example E Other preferred compounds, using formula (11) where I is (ei0) 'X)-is CH, and other substituents are as defined above. Specific Example E Other preferred compounds, using formula ( 11) where & Yes, A is CH, is CO-AI * 2, and other substituents are as defined above. Specific Example E Other preferred compounds, using formula (11) where I is (ei〇) 'A is CH, Rd-C (0) -CH2-TrRu, Rn is -_2) 13-7,4, Consumption Cooperation of Staff, Central Bureau of Standards, Ministry of Economic Affairs Printed and the other substituents are as defined above. Specific examples of other preferred compounds E, application of Formula (11) where \ is the (^ square) 'χ5 is CH' R3 is, τ # square, a porphyrin%

Ar * 4, and the other substituents are as defined above. Good deal 'In these preferred compounds, R5 is selected from the following: -C (〇) -R10, 541309 A7 B7 V. Description of the invention (136) • c (〇) o-r9, and • C (〇)- NH-R10. In addition, among these preferred compounds, r5 is selected from the group consisting of -S (〇) rR9, -s (o) 2-nh-r10, -C (〇) -C (O) -R10, -R9 ' And -C (〇) -C (〇) -〇R1〇〇 is best, among these preferred compounds:-m is 1; 1 * 0 or S; R15 is -0H or -0 (: 1-4 Straight or branched alkyl, optionally substituted by -Ar3, -OH'-OR9, or -C02H, where 119 is -CW4 branched or straight chain alkyl, where Aγ3 is morpholinyl or phenyl, Among them, phenyl is substituted by qi as required; R21 is ·-or -CH3; Αγ2 is (hh); Y is 〇, and each consumer printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs is printed separately. From the following includes phenyl, naphthyl, pyrenyl, quinolinyl 'isojunorinyl, p-sniffinyl, sigmaquinyl, iso-alpha-sinyl, benzotrisyl, benzylidene Phenyl, phenophenylene, imidazolyl, perylene, benzo [b] thiophenyl, exoyl, benzoanyl and < May be-(^ single or multiple substitutions: each Aγ4 ring group is independently selected from the following including phenyl, tetradecyl, p-pyridyl, 3ox-139- Applicable to China National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of the invention (137) Azolyl, naphthyl, pyrimidinyl, or fluorenyl, the cyclic group may be a single fluorene and less heavy substitution; Each Qi is independently selected from the following including -NH2, -Cl, -F, -Br, -0¾,-then 7-5, where! 15 is-(: (〇) -1110 or 4 (〇) 2-119 , -〇115 where 19 is _C (〇) -R1 (), -or9, -N (R9) (Ri〇), and 3 疋 ο / \ \ / CH2, 'ο where Han 9 and R10 are each independently Is -C1-6¾ or a branched alkyl group, optionally substituted by Ar3, where Ar3 is phenyl; the limitation is that when -eight 1 * 3 is substituted, it contains more than one additional -Ar * 3 group, This additional -Aγ3 group is not substituted by other groups. Preferred compounds of other specific examples E, where the center of the formula (π) is (el0), X5 is CH, R3 is -C (0) -H, and The other substituents are as defined above. Preferably, among these preferred compounds, r5 is selected from the group consisting of: C (〇) -R10, -C (〇) 〇-r9, and -C (0) -NH- R100. In addition, among these preferred compounds, r5 is selected from the group consisting of: -s (o) 2-R9, -s (〇) 2-nh-r1 0, -C (O) -C (〇) -R10, -R9, and -140- This paper size applies to China National Standard (CNS) A4 specification (210X297 male thin) (Please read the precautions on the back before reading (Fill in this \)) # 1 pack · T-" Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 ____ B7 V. Description of the invention (138) -C (0) -C (0) .〇R1〇〇 the most Well, in these preferred compounds, m is 1; R1S is -0H or -OCu straight or branched alkyl, optionally substituted with -A ", -OH, -0%, or -CO2H, Among them, -Cn4 is a branched or straight alkyl group, wherein A ** 3 is a morpholinyl group or a phenyl group, wherein the phenyl group is optionally substituted with%; 'R21 is or -CH3; each A "ring group is independently selected From the following include: phenyl, naphthyl, pyrimidinyl, lysinyl'isojunorinyl, α ratio π sitting group, soul bite group, isomer, fluorenyl, benzotriazolyl, benzo Imidazolyl, pyrimido 4-phenyl, imidazolyl, fluorenediazole, benzo [b] thiophenyl, pyridyl, benzofuranyl, and indolyl, the cyclic group may be -Q as required丨 All single or multiple substitutions; each Q 1 is independently selected from the group consisting of: -Cl, -F, -B r, -〇h,, -NH-R5, where r5 is -C (0) -R1 (^-S (〇) 2-R9, -〇R5 where inverse 5 is _C (0) -R1〇,- 〇r9, _N (R9) (Ri〇), and 〇 / \ CH2, \ / 〇 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, where R9 and R10 are each independently 1-6 straight or branched If necessary, it is substituted by Ar3, where A "is a phenyl group; the limitation is that when -eight 1 * 3 is substituted by (^ group, which contains more than one additional Aγ3 group, the additional -Aγ3 group is not In addition, -ΑΓ3 is substituted, and he has a better compound of Example E. Application formula (Π) of which 1 ^ is (el0 -141-the standard of this paper is Chinese National Standard (CNS) A4 (210X 297 mm) 541309) A7 B7 V. Explanation of the invention (139), and X5 is CH, R3 is, and R. Δ ^ 1 11 and Ku 疋, Aγ4, and other substituents are as defined above. Preferred among these preferred compounds are selected from the group consisting of: -C (O) -R10, -C (0) 0-R9, and -C (O) -NH-R10. In addition, among these preferred compounds, , R5 is selected from the following: -s (o) 2-r9, -s (o) 2-nh-r10, · -C (O) -C (O) -R10, -R9 ', and -C (O ) -C (O) -OR10 is the best. Among these preferred compounds, m is 1; Or S; R1S is -OH or -OCm straight or branched alkyl group, optionally substituted by -OH, -OR9, or -C〇2H, and its center is · Ci_4 branched or straight chain alkyl group, where Ah Is it Flynnyl or phenyl, where phenyl is replaced by I as required; printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs R21 is · Η or -CH3; each Ars ring group is phenyl, fluorenyl, 喽Phenyl, pinorinyl, isoquinolyl, sayyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl's benzothienyl, imidazolyl, oxadiazolyl , Benzo [b] thiophenyl, pyridyl, benzofuranyl, and pyridyl, and the cyclic group can be -142 as required. This paper size applies to China National Standard (CNS) A4 (210X 297) (%) 541309 A7 B7 printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (14〇)-Single or multiple substitutions by Qi; Each Aγ4 ring group is independently selected from the following, including phenyl, tetrazolyl, pyridine Group, oxazolyl, naphthyl, pyrimidinyl, or thienyl, the cyclic group is mono- or poly-substituted as desired by -Qi; each Qi is independently selected from the following including -NH2, -Cl,- F, -Br, _0H, -R9, -nh-r5, where meaning 5 is -C (o) -r104_s (0) 2-R9, -〇r5 and its center is -C (0) -Ri〇,- 0R9, · N (Ιΐ9) (ΙΙι ()), and '〇 / \ CH9,' \ /-1 0 where each Rq and R10 is independently a straight or branched fluorenyl group of _C1-6, and if necessary, Αγ3 Substituted, where "eight" is a phenyl group; the limitation is that when -Αγ3 is a Q1 group substitution, it contains more than one additional -Ar3 group, the additional Aγ3 group is not substituted by other groups. Specific Example E For other preferred compounds, apply formula (11) where Ri is (el0), A is N, and other substituents are as defined above. Preferred compounds of specific example E, apply formula (11) where \ is (61) ), &Amp; 疋 N '疋 co-Ai * 2, and the other substituents are as defined above. Specific Example E Other preferred compounds, using formula (11) where rule 1 is. 1〇), \ is N, R3 Is < (〇) < Yanchang TrRn, Rn is _c (c true other substituents are as defined above.-Specific Example E other preferred compounds, using formula (11) where 5 is N, and · R3 is _C (0) -CH2_TrR11; _ -143- Ben ^ -a --- (Please read first (Read the notes on the back and fill in this page)

541309 A7 B7 V. Description of the invention (141) D1 is 0; and

Rn is -C (0) -Ar4 and the other substituents are as defined above. Preferably, among these preferred compounds, r5 is selected from the group consisting of -C (〇) -R10, -C (〇) 〇-R9, and -C (〇) -NH-R10. In addition, among these preferred compounds, R5 is selected from the group consisting of -s (o) 2-R9, -s (o) 2-nh-r10, -C (〇) -C (O) -R10, -R9 and -C (O) .C (O) -OR10 are preferred. Among these preferred compounds, m is 1; 1 ^ is 0 or S; R15 is -OH or -Cw straight or branched alkane Group, optionally substituted by -Ar3, -OH, -〇r9, or -C02H, where R9 is -Ci_4 branched or linear alkyl group, where Ar3 is morpholinyl or phenyl group, where phenyl group Needed to be replaced by Q i; Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economics; R21 is -H or -CH3: Eight 1 * 2 is 邙 11); Y is 0, and each Ar3 ring group is independently selected from the following including benzene Base, fluorenyl, thienyl, quinololinyl, iso4-orolinyl, pyrazolyl, pyrazolyl, isoxazolyl, benzotri-144- This paper size applies to Chinese National Standard (CNS) A4 (2 丨 0X 297 mm) 541309 A7 B7 V. Description of the invention (M2) σ seat group, benzimidazolyl group, fluorenofluorenyl group, imidazolyl group, repeated hydrazine, benzo [b] thiophenyl group , Υ is more than a base group, and a base group, and the ring base may be a single or multiple substitutions by -Qi as required; The Ar * 4 ring group is independently selected from the group consisting of benzyl group, tetrasigma group, stilbene group, amidinyl group, pyrimidinyl group, or phenanyl group, and may be single or multiple substitutions as required by _Ql; each卩 丨 is independently selected from the following including -NH2, -C1, _F, · Bγ ,: OH, _r, -NH-R5, where ~ is -C (〇) -R1〇 or · s (〇) rR9, -〇 R5 where R9 is -C (〇) -R1〇, -〇r9, -N (R9) (R1〇: T and 5 疋 〇 / \ CH2,

V wherein each of 119 and 111 () is independently a -Cw straight or branched alkyl group, optionally substituted by Aγ3, wherein eight 1: 3 is a phenyl group; "The limitation is when -Ars is substituted by a Q group When it contains an -Ar * 3 group other than the above, the additional -Aq group is not replaced by another Aγ3 group. Specific Example E Other preferred compounds, the center of the formula (11) is ^^ ' Xs 疋 N 'R3 is -C (0) -H' and the other substituents are as defined above. Better 'Among these preferred compounds, selected from the following including: Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs -C (O) -R10, -C (0) 0-R9, and -C (0) -NH-R100. In addition, among these preferred compounds, R5 is selected from the following including: -S (〇) 2-R9 ， -145- This paper size applies Chinese National Standard (CNS) A4 Regulations 541309 A7 __ B7 V. Description of the invention (-s (o) 2-nh-r10, -C (〇) -C (〇) -R10, -R9 'and * C (O) -C (O) -OR100 are preferred, and among these preferred compounds, m is 1;

Rls is a straight or branched alkyl group of -OH or -OC ^ 4, and is optionally substituted by a oh, -or9, or -C〇2H, where r9 is a < 14 straight or branched alkyl group, where Aγ3 is Morpholinyl or phenyl, where phenyl is optionally substituted by Q i; & 21 is -H or -CHg ·, each Ar3 ring group is independently selected from the group including phenyl, naphthyl, and fluorenyl '4 Norolinyl, Isoquinolyl, Pyrazolyl, Thiazolyl, Isoxolyl'benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, 4-benzyl, benzo [b] Thiophenyl, pyridyl, benzofuranyl, and 4-hydroxy ', and the cyclic group may be mono- or multi-substituted as desired; each Qi is independently selected from the following including -NH2, -Cl,- F, -Br'-OH'-R9'-NH-R5, where r5 is-(: (〇) -1110 or -S (0) rR9, -〇R5 where R5 is -C (O) -R10, -〇R9, -N (R9) (R10), and printed by the consumer cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs o / \ CH2, \ / 0 where each of 119 and 111 () are independently -cle6 straight or branched alkyl groups 'Substituted as required by A Ar3, where eight 1: 3 is phenyl; 146- This paper size applies to China's national standard (CNS ) A4 specification (210X297 mm) 541309 A7 --___ V. Description of the invention (144) The limitation is that when -eight ^ is replaced by Qi group, it contains more than one additional -Ar3 group, the additional -Ar * The 3 group is not substituted by another _Αγ3 group. Specific Example E Other preferred compounds, using formula (π), its center is (elO), X5 is N, R3 is -CO-CH'i, R " is _ ΑΓ4, and other substituents are as defined above. Preferably, among these preferred compounds, selected from the group consisting of -C (〇) -R10,--c (o) 〇-r9, and -C ( 〇) -NH-R100-In addition, in these preferred compounds, R5 is selected from the following including: -S (〇) 2-R9 '-s (o) 2-nh-r10, -C (〇)- C (0) -R1〇, -R9, and -C (O) -C (O) -OR10 are the best. Among these preferred compounds, m is 1; Ding is 0 or S; Central Standard of the Ministry of Economic Affairs Bureau employee consumer cooperative printed R15 is · ΟΗ or -OCw straight or branched alkyl, optionally substituted by-Αγ · 3, -OH, -〇R9, or -CO2H, where branched or linear alkyl, Where Ar3 is morpholinyl or phenyl, where phenyl is optionally substituted by I: R21 is -H or -CH3; each A 3 comprises a cyclic group independently selected from phenyl, group Fan, P-thiophene group, P Kui forest base language, isobutyl 0 Kuinuolinji, Ϊ7 than Jun group, P laugh plug group, iso-Ming. Sediment, Benzotri-147- This paper size applies to Chinese national standards (CNS "A4 Entertainment Grid (210X297 mm 1 '541309 A7 B7) V. Description of the invention (145) azolyl, benzimidazolyl, pyrene Fluorenyl, imidazolyl, hydradiazolyl, benzo [b] thiophenyl, pyridoyl, benzofuran, and indolyl, and the ring group may be mono- or multiple substituted by -Qi; Each Aq ring group is independently selected from the group consisting of phenyl, tetratyl, p-pyridyl, oxazolyl, fluorenyl, pyrimidinyl, or phenphenyl, and the ring may be -Qi single or multiple substitutions; Each Q is independently selected from the group consisting of: ΝΗ2, -ci, -F, -Βγ, -ΌΗ, -R9, -nh-r5, where r5 is-<: (〇) -1110 or -S⑼plant r9,- 〇R5 whose center is -C (0) -R1〇, -〇R9, -N (R9) (R1〇: r, and 〇 / \ CH ?, \ / 〇wherein each of R9 and R10 is -CN6 straight Or branched alkynyl groups and optionally substituted by Ar3, where Ar3 is phenyl; the limitation is that when -eight [3 is Q] substituted, it contains more than one -Ah group outside the fluorene, the additional _ The Α · 3 group is not substituted by another _ Αγ3 group. I of another specific example (F) of the present invention The CE inhibitor is of formula (!): Please read the precautions on the page before printing this page (III) printed by the Consumer Cooperatives of the Central Accreditation Bureau of the Ministry of Economic Affairs where Rl is selected from the following including r1-n-r2 148 -148 The paper size applies the CNS standard (2iG) < 297 public 541309 A7 B7 V. Description of the invention (146) (elO)

(ell)

(el2)

(w2)

(yl)

Printed by Hefei Cooperative of employees of the Central Standards Bureau of the Ministry of Economic Affairs (y2)

-149 The paper size is applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (147) (Z)

And ring C is selected from the group consisting of benzo, pyrido, thieno, pyrrolo, succino, p-succinyl, heterogeneous bite, pyrene, iso-p-pyridine, yodolide, imidazo , Cyclopentyl and cyclohexyl; ~ The heart is: (a)

R51 0 or (Please read the notes on the back before filling this page) (b) (r) m ORb .ORst h, 〇r51 Printed by the Employees' Fees Cooperative of the Central Standards Bureau of the Ministry of Economy m is 1 or 2; each 115 is independent Selected from the following including -C (O) -R10, -c (o) o-r9, -C (O) -N (R10) (R10), -S (0) 2-R9, -S (O) 2 -NH-R10, -150 This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (148) -C (0) -CH2-0-R9, -C (O ) C (O) -R10, -R9'-Η, -C (O) C (〇) -OR10, and -C (O) C (O) -N (R9) (Rl0); X5 * CH or N ;, Y2 is 112 or 0; X7 is -N (R8)-or -O-;-R6 is selected from the following including -H and -CH3; R8 is selected from the following including: -C (O) -R10, -c (〇) o-r9, -C (O) -N (H) -R10, -S (0) 2 · 1 ^ 9 9 • S (O) 2-NH-R10, -C (O) -CHrOR10, -C (O) C (O) -R10, -C (O) -CH2N (R10) (R10), printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs -C (0) -CH2C (0) -〇-R9 , -C (0) -CH2C (0) -R9, -H, and -C (O) -C (O) -OR10; each 119 is independently selected from the following including -AhK-Cu straight or branched alkyl groups, depending on -151-This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (149) Ar3 needs to be substituted, in which -C1-3 alkyl is unsaturated as desired; each R10 is independently selected from the following including -H, -Ar3, C3-6 cycloalkyl , And 6 straight or branched alkyls are A if desired. Substituted, where-(: 1-6 alkyl is optionally unsaturated; RU is selected from the following including H, Aq, and ^, 6 straight or branched alkyl, optionally Ar3, -CONH2, -0R5, -0H, -0119 or-(: 0211 is substituted; each R21 is independently selected from the following including -H or -C1-6 straight or branched alkyl; each R51 is independently selected from the following including R9, -C (〇) -R9, {(; 〇;) _ Ν (; Ιί;) _: K9, or each of them form a saturated 4-8 member carbocyclic ring or a heterocyclic ring containing -0-, -S- or -NΗ; each Ar * 3 is independently selected as a ring group Included from the following are aryl groups containing 6, 10, 12 and 14 carbon atoms and 1 to 3 rings, and aromatic heterocyclic rings containing 5 to 5 ring atoms and 1 to 3 rings. The heterocyclic group contains At least one heteroatom selected from -0- ,, -S () _, S〇2, = N- and -NH-, the heterocyclyl optionally contains more than one double bond, the heterocyclyl optionally Contains more than one aromatic ring, and the ring may be mono- or poly-substituted by -Q! If necessary; &amp; Each Q! Is independently selected from the following including -NH2, -C02H, -CM, -F, , -N02, -CN, = 0, -OH, .- perfluoroC1-3 alkyl, r5, · 〇 ～, -nhr5, 〇r9, -n (r9) (r10), r9, -C (0 ) -R 10, and 0 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs <> ch2, o The restriction is that when -Ars is replaced by Q 丨, it contains more than one additional -Ah group, and the additional Ar3 group is not another -Aγ3 is substituted. A preferred embodiment of the compound F is represented by formula (II), wherein 1 ^ is (w2), and other substituents are as defined above. -152-

541309 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. The description of the invention (15Q) is better, beware of (w2): m is 1; sample C is the table and the 'p ratio bite' or ρ stope combination; r5 is selected from the group consisting of: -C (O) -R10, wherein R10 is -Aγ3; -C (0) 0-R9, wherein R9 is -CH2-Ar3; -C (O) C (O) -R10, Wherein R1〇 is · Αγ3;, -Min 9 'wherein 9 is ci · 2 alkyl substituted with -Ar3; and -C (O) C (O) -OR10, where R1〇- is · 〇Η2Αγ3; RAH R8 is selected from the group consisting of: -C (0) -R1〇, -C (〇) -CH2-〇Ri0, and -C (O) CHrN (R10) (R10), where R10 is H, CH3, or CH2CH3 R13 is straight or branched alkyl of fluorene or C1-4, optionally substituted by Ar3, -OH, -OR9 or -C02H, where R9SCN4 is branched or linear alkyl; where Ar3 is morpholinyl or Phenyl, in which phenyl is optionally substituted by q 1; Ar3 is phenyl 'fluorenyl' p-secenyl 'p-quineline, iso-p-quineline, p-sevoyl, benzimidyl Group, 4-pheno 4-phenyl group, P-stilbyl group, benzotrisyl group, benzo [b] thiophenyl'benzocranyl group, and 17-group group; each Q is independently selected from the following including- NH2 , -CM, -F, -Br, -OH, -R9, small 115, where 115 is-€: (〇) -1110 or -3 (〇) 2-119, -〇115 where 1 ^ is -C (〇) -R 丨 〇 '-〇R9' -NHR9 'and 〇 / \ CH ?, \ / -1 0 -153- This paper size applies to Chinese National Standard (CN'S) Α4 size (210X297 male sauce) (please first Read the notes on the reverse side and fill in this page)-Equipment ·, π 541309 A7 ---- _____ B7 ___ V. Description of the invention (151) where% and R10 are independently &lt; ι · 6 straight or branched alkane Base, optionally substituted by Ar, where AΓ3 is phenyl; The limiting condition is that when -eight 1 * 3 is substituted by Ql, it contains more than one -Al <3 group, and the additional -Ar3 group is not substituted by another -Aγ3. For other preferred compounds of Specific Example F, formula (III) is used, wherein \ is (e 11) 'and the other substituents are as defined above. For other preferred compounds of specific example F, formula (III) is applied, where \ is (el2) 'and the other substituents are as defined above. For other preferred compounds of Specific Example F, Formula (III) is used, where \ is (yl), and the other substituents are as defined above. Specific Example F Other preferred compounds apply Formula (III), where \ is (y2) and the other substituents are as defined above. For other preferred compounds of specific example F, formula (III) is used, wherein: ^ is d) and the other substituents are as defined above. For other preferred compounds of Specific Example F, formula (III) is used, wherein ^ is (elO) and X5 is CH (also referred to herein as elO-B), and the other substituents are as defined above. Specific Example F Other preferred compounds, using formula (III), where Ris (el0) and X5 is N (also referred to herein as ei0-A), and other substituents are as defined above for employees of the Central Standards Bureau of the Ministry of Economic Affairs Consumer cooperatives printed meaning. Preferably, when 11! Is (ell), (el2), (yl), (y2), (z), (el0-A) and (elO-B) 'R5 is selected from the following including--C (O ) -R10, -C (0) 0-R9 'and -154- This paper size applies to Chinese national standards (CNsl A4 specifications (21〇, 〆297mm 1 ~ &quot; 541309 at B7 Staff Consumption of Central Standards Bureau, Ministry of Economic Affairs) Cooperative printed 5. Description of the invention (152) -C (〇) -NH-R10. In addition, when RA (el0 '(e12)' (yl), (y2), (z), (ei0-A) And (elO-B), R5 is selected from the following including: -S (〇) 2-R9, -S (O) 2-NH-R10, -C (〇) -C (〇) -R1〇, -R9, , -C (O) -C (O) -OR10, and -C (〇) C (0) -N (R9) (Ri〇). · Preferably, 115 is 11- &lt;: (〇) &lt; (〇) -1110. In addition, R5 is -C (O) -C (O) -OR10. Better, beware of (ell), (el2), (yl), (y2), (z), (el 〇-A) and (elO-B): m is 1; R21 is -H or -CH3; Rsi is a CN6 straight or branched alkyl group, optionally substituted by Ar3, wherein the Al · 3 ring group is phenyl group, The cyclic group is optionally multiple or mono-substituted by -Q; each Ar3 ring group is independently selected from the group including phenyl, fluorenyl, thienyl, and quinoline , Isoroxolinyl, pyrazolyl, oxazolyl, isoxazolyl, benzotrisyl'benzosulfenyl, alphathiophene's benzoyl'sialyl, alphastilbenzyl, Benzo [b] thiophenyl, pyridyl, benzofuranyl, or azindolyl, and the cyclic group is optionally substituted by -Q i single or multiple; each Qi is independently selected from the following including -NH2,- Cl, -F, -Br, -OH, -R9, -NH-R5, where r5 is -C (〇) -R104 -s (o) 2-r9, -〇R5 where 115 is -155- (please first Read the notes on the back and fill in this page)-Binding, binding, and textbooks i The paper size is applicable to the Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (153) -c (o) -R1 〇, _〇R9, -n (r9) (r10), and // 〇

CH 2 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, where each of R9 and Ri0 is -CN0 straight or branched alkyl, optionally substituted by Ah, where A "ring group is phenyl, and the ring The base depends on single or multiple substitutions; the limitation is that when -Ah is substituted with a ^ group, it contains more than one additional -Ah group, the additional -Ah group is not replaced by another _ΑΓ3 group. Preferably, in these preferred compounds, the Aγ3 ring group is selected from the group consisting of: phenyl, naphthyl, pyrenyl, pinorolinyl, isoquinolyl, pyrazolyl, thiazolyl, isoxazolyl , Benzotriazolyl, benzimidazolyl, fluorenylthienyl, imidazolyl, 4-diazolyl, benzo [b] thiophenyl, benzofuryl and indolyl, and the cyclic group depends It needs to be a single or multiple substitution by _Q 1. The compounds in the preferred form of this specific example F are: R5 * -C (〇) -r1 (), where R1 〇 is Al * 3, where Ar * 3 ring group Is a phenyl group, and the cyclic group is optionally the following single or multiple substitutions: -F, -α, • N (H) -R5, where -R5 is -Η or &lt; (〇), 〇, where ^ is · c &quot; Straight or branched alkyl, Desirable is A ", where the Ay ring group is a phenyl group, and the ring group is optionally -Q i single or multiple substitution, N (R9) (Ri〇) 'wherein R9 and Ri〇 are- Cw straight or branched halo, or -O-R5, where r5SH or -C1-4 is straight or branched alkyl.

Please read the notes on the back δ before JI binding. 156 The paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 V. Description of the invention (154) The Ar3 ring group is preferably phenyl, depending on the Need to be _ci at 3_ or 5- or catch at ~~, nah. ), Or -0.R5 single or multiple substitutions. / Example F Other preferred compounds include He. Wherein the RiO 疋 Ar 'Ar; ring group is selected from the following including fluorinyl, benzimidazolyl &quot; sephenyl, and benzo [b] thiophenyl, and the ring group is as required Multiple substitutions; Specific Example F Other preferred compounds include 4 (〇) 41〇 in the center, where Ri〇 is Al * 3 and the A1 · 3 ring group is selected from fluorinyl and isofluorinyl groups, and the cyclic group is Specific examples of single or multiple substitutions are required. (F) Other preferred compounds include where 1 is {(〇) -111〇, where R10 is Ah, wherein the Ar3 ring group is phenyl, and is 0 / \ CH ?, Replaced by V ^. In another version of Specific Example F, the compound is as described above, with further restrictions as when: m is 1 ·, RA (elO); printed by the Consumer Cooperatives of the Central Standards Bureau, Ministry of Economic Affairs, X5 is CH; R15 is -OH; rule 21 is seven; and Y2 is 0 and R3 is -C (0) -H, then R5 cannot be: -C (0) -R1〇, where r1〇 is · Αγ3 and Aι · 3 ring group is Phenyl, not the following -157- This paper size applies to the Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of the invention (155) ^ 'Substitution · -Ql' Μ carboxymethoxy ) Phenyl, 2- Phenyl, pyridyl, Nα-methylhexahydropyridyl) fluorenylphenyl, or -C (0) -0R9, whose center is -CH2-Ar3, and the Ar3 ring is phenyl, not- Qi is substituted; and when: Y2 is 0, R4-C (0) -CH2-TVRn, Ding! Is 0, and Ru is Ar4, wherein the At * 4 ring group is 5- (1- (4-chlorophenyl) -3-trifluoromethyl) erazolyl), then r5 cannot be:, -C (〇 ) -R10, where R10 is -Al · 3 and Ar3 ring group is 4- (dimethylaminomethyl) phenyl, phenyl, 4- (carboxymethylthio) benzene-yl, 4- (carboxyethyl Thio) phenyl, 4- (t-ethyl) phenyl '4- (chipropyl) phenyl, 2-fluorophenyl, 2-p-pyridyl, N- (4-methylhexahydropyridine ) Methylphenyl, or -C (0) -0R9, where R9 is -CH2-Ar3, and the Ar3 ring group is phenyl; and when 丨 is Aq, where the Ar4 ring group is 5- (1-phenyl -3-trifluoromethyl) pyrazolyl), then R5 cannot be: -C (0) -0R9, where R9 is _CH factory Aγ3, then Aγ3 ring group is phenyl; and when h 丨 is Aq, where The Aγ4 ring group is 5- (1- (2-pyridyl) -3-trifluoromethyl) pyrazolyl), then R5 cannot be: -C (0) -Ri〇, where R10 is -Ar3 and Aγ3 The cyclic group is 4- (dimethylaminomethyl) phenyl, or printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the notes on the back before filling this page) • c (o) -or9, where R9 Is · CHrAr3, and the αΓ3 ring group is a phenyl group, and is not substituted for -Q1; When Υ2 is 0, R3 is -C ^ -CHrTVRn, TA 0, and Rn is -C (〇) -Ar4, where the Ar4 ring group is 2,5-diaminophenyl, then R5 cannot be: -C (0 ) -Ri〇, where R1〇 is -Ar3 and αΓ3 ring group is 4- (dimethylaminomethyl) -158- This paper size applies Chinese National Standard (CNS) 210 × 297 male sauce) 5413〇9 A7 B7 5 Description of the invention (156) phenyl, 4- (N-morpholinylmethyl) phenyl, 4- (N-methylhexahydro, ratio, wellyl) methyl) phenyl '4- (N- (2 -fluorenyl) imidylmethyl) phenyl, 5-benzimidyl, 5-benzotriazolyl, N-ethyl-5-benzyltriphenyl, N-ethylacetyl -5-benzimidazolyl, or -C (〇) -OR9, where R9 is -CH2-Ar3, and the Aγ3 ring group is phenyl, not substituted by -Qi; and when Y2 is H2, R3 is -C ( 0) -CH2-TrRn, Ding is 0, and "&quot; is -C (〇) -Ar4 'where the Aγ4 ring group is 2,5-dichlorophenyl, then R5 cannot be: -C (〇)- O9 'wherein R9'-CHg-Ar] and the Ar $ ring group is phenyl. In another form of Specific Example F, the preferred compound is one in which r21 is -Η. In addition, the preferred compounds are those in which R21 is-(:%. Specific Example F The preferred compound applies Formula (III), where 1 ^ is (w2) and the other substituents are as defined above. Preferably, 1 ^ is Bu 2) and m is 1; ring C is benzo, said pyrido, or p-pheneno; R3 is selected from the following including -C (0) -H, -C (〇) -Ar2, and-; The R5 printed by the SAE Consumer Cooperative is selected from the following: -C (0) -Ri〇 'where Ri〇 is -Ar * 3; -C (0) 0-R9, where R9 * -CH2-Ar3; -C (O) C (O) -R10 'where R1〇 is; -1 ^ 9' where 9 is 〇1-2 and is substituted by -8-13; and -C (O) C (O) -OR10, where R1〇 is: &lt;:Η2Αγ3; -159- This paper size applies to China National Standard (CNS) Α4 specification (210X297 public director) 541309 A7 B7 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Explanation (157) τΐ is 0 or S; ruler 6 is Η; R8 is selected from the following including -C (〇) -Rio, -C (〇) -CH2-〇r10j ^ -c (O) CH2-n (r1〇 ) (R10), wherein R10 is Η, ch3, or ch2CH3; Rli is selected from the group consisting of -Aγ4 '-(CH2) 1-3-Ar4A-c (〇) -Ar4; R15 is · 〇Η or -OCmstraight or Branch pit foundation Desired _αγ3, -OH, -〇R9 or -C02H substitution, where R9 is -Ci_4 branched or straight chain alkyl, where AI * 3 is morpholinyl or phenyl 'where phenyl is q as required Substituted by 1; ArA (hh); — Y is 0; each A ”ring group is independently selected from the group consisting of phenyl, fluorenyl, thienyl, amorphinyl, isoroxolinyl, oxazolyl, benzo Imidazolyl, thienophenenyl 'p-sedienyl, benzotrisyl'benzo [b] thiophenyl, benzalanyl, and fluorinyl, and the cyclic group may be as required -Q1 is a single or multiple substitution; each Aq ring group is independently selected from the group consisting of phenyl, tetrazolyl, naphthyl, sulfanyl, p-sialyl, sulfanyl, or indyl, depending on the group Need to be a single or multiple substitution; each Qi is independently selected from the following including -NH] '-Cl' -F '-Bγ, · 〇η ,, -NH-R5 where r5 is -C (0) -Ri 〇 or -S (0) 2-R9, -〇r5 where -C (0) -R1〇, · κκ, .N (R9) (Ri〇) and o where each of R9 and R10 are independently -C 〖6 straight or branched alkyl group, -160 as required- This paper size applies to China National Standard (CNS) Α4 size (210x297 mm) (Please read the notes on the back before filling out this page) • Install.

1T • 1% Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 Μ Β7 ______ ^ --------------------- 5. Description of the Invention (158)

Al: 3 is substituted, wherein Ar3 is phenyl; The limitation is that when _Αγ3 is Q1 substituted, it contains more than one additional -Ar3 group, and this additional _ group is not substituted by another -Ah group. Specific Example F: Other preferred compounds, where formula (II) is used where 1 ^ is (el 1) 'and the other substituents are as defined above. Specific Example F: Other preferred compounds, wherein Formula (II) is used, wherein R is 12) and the other substituents are as defined above. Specific Example F: Other preferred compounds, where formula (III) is used where Han 1 is 1) and other substituents are as defined above. Specific Example F Other preferred compounds, where formula (II) is used where \ is (y2) and the other substituents are as defined above. Specific Example F Other preferred compounds apply formula (HI) where R! Is. (Z) and the other substituents are as defined above. Specific Example F Other preferred compounds, where formula (III) is used where 1 ^ is (elO) and X5 is CH and the other substituents are as defined above. Specific Example F Other preferred compounds, where formula (III) is used where \ is (el 0) and X5 * N, and other substituents are as defined above. Preferably, among these preferred compounds, r5 is selected from the group consisting of: -C (〇) -R10, -C (0) 〇-R9, and -C (0) -NH-RI〇〇 In addition, Among the best compounds, r5 is selected from the following: -S (0) 2-R9, -S (0) rNH-R1〇, _ -161- This paper size applies the Chinese National Standard (CNS) A4 specification (210 x 297 mm) ) (Please read the notes on the back before filling out this page). Pack. Order 541309 A7 ________B7 V. Description of the invention (159) -C (O) -C (O) -R10, -R9, -C (O)- C (O) -OR10, and -c (〇) c (o) -n (r9) (r10). Preferably, in these preferred compounds, m is 1: R13 is fluorene or -C1-4 straight or branched alkyl, optionally substituted by -αγ3, -OH, -0%, or -CO2H, Where R9 is -CU4 branched or straight chain alkyl, where Ai * 3 is morpholinyl or phenyl, where phenyl is optionally substituted by Ql; R21 is -H or -CH3; R5i is CN6 straight or branched alkyl Base, optionally substituted by Aγ3, where Ar3 is phenyl, substituted by-(^ as required; each Aγ3 ring group is independently selected from the following including phenyl, trisyl, p-sphenyl, p-kuylin The radical 'isoρ queenyl, said fluorenyl, ρ secyl, iso. Oxal, benzotriazolyl, benzimidazolyl, fluorenothienyl, imidazolyl, thiadiazolyl, benzene Benzo [b] thiophenyl, rho, benzo, and sulfonyl, and the ring base may be replaced by a single or multiple substitutions as required by -Q i. Each Qi is independently selected from the following including -NH2, -CM, -F, -Br, -OH, seven 9, -NH-R5 ', where R5 is -C (0) -Ri0 or -S (0) 2- R9′-〇 化 5 where R is -C (0) -R10, -〇r9, -N (R9) (R10), and

/ \ CH2, where each of R9 and R10 is independently -Cw straight or branched alkyl, depending on the -162- This paper size applies to the Chinese national standard (CNS> A4 specification (210X297 mm) 541309 A7 B7 five , Description of invention (160)

Ar3 is substituted, wherein Ar3 is phenyl; the limitation is that when -eight 1: 3 is Qi substituted, it contains more than one additional -Aγ3 group, and the additional -Ar3 group is not substituted by another -Ar3 group. Specific examples (F) Preferred compounds include the following, but are not limited thereto: 2001

Please read the notes on the back before filling in this page 2100a 〇Λ: Ο

〇 LI (. OiPr 2l00b) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

163 This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of invention (161 〇 2100c

〇 COOMe

OMe 2100d Ο

(Please read the precautions on the back before filling this page): 2100e 〇

N〆 ^ 〇

〇 Η Another-specific example (G) of the ICE inhibitor of the present invention is formula (IV) printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (IV) F where: m is 1 or 2; 1 ^ is selected from the following including the following Chemical formula

164 -164- This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of Invention (162) (elO-A)

(ell)

(el2)

(w2)

(yl)

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (y2); z)

And this paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (163) Ring C is selected from the following including benzo, pyrido, pyrene, pyrrole, benzopyran ,, fluorene, iso-17 fluorene, p oxale, oxa oxa, hydrazino, imidazo, cyclopentyl and cyclohexyl; selected from the following: -CN, -C (〇) -H, -C (0) -CH2-TrRn ^ '-C (〇) -CH2-F, -c = N-0-R9, and--C 0-A "2, each 115 is independently selected from the following including : _C (O) -R10, -C (0) 0-R9, -C (O) -N (R10) (R10) -S (O) 2 -R9 '-S (O) 2-NH-R10, -C (0) -CHr0-R9, -C (O) C (O) -R10, -R9 'Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) -H , -C (O) C (O) -OR10, and -C (O) C (O) -N (R9) (Rl0); Ya 2 is 112 or 0; X7 is -N (R8)-or -0 -; -166- This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (164) Each Ding 丨 is independently selected from the following including -ο-, -S-,- S (〇)-, and -S (0) 2-; R6 is selected from the following: Η- 栝 and -CH3; R8 is selected from The columns include: -C (O) -R10, -c (o) o-r9, -C (〇) -NH-R10, -S (0) 2 ** R9 '-S (O) 2-NH-R10 , -C (O) -CHrORl0, '-C (O) C (O) -R10' -C (0) -CH2-N (Ri〇) (Ri〇)? .C (0) -CH2C (0) -〇-R9--C (0) -CH2C (0) -R9, -H, and -C (O) -C (O) -OR10; each R9 is independently selected from the following including -A1: 3 and-or The branched alkyl group is optionally substituted by Ar3, wherein -Cw alkyl is unsaturated as desired; each R10 is independently selected from the group consisting of -Η, · Αγ3, cycloalkyl, and straight or branched pit base as required Αγ3 Superseded by, and desaturated by Danjia _cN6 slave base; each Rh is independently selected from the following including: • Ar4,-(CH2) 1-3-ΑΓ4 '-Η, and -167- This paper size applies China National Standard (CNS) Α4 specification (210X297 mm) Please read the note below and fill in this page. Printed on this page by the Central Standards Bureau, Ministry of Economic Affairs and Consumers' Cooperatives. 541309 A7 __ B7 ____ 5. Description of the Invention (〇) -Ar4; Ri5 is selected from the following packages: -0H '-0Ar3' &quot; · N (Η) · 0Η 'and -0Cl-6, where Cl-6 is a straight or branch pit base as required -ΑΓ3 , -C0NH2, -0R5, -〇H, -〇r9, or -CO2H Each R21 is independently selected from the group consisting of -Η or {"straight or branched alkyl; AI * 2 is independently selected from the group consisting of the following: any ring may be mono- or multiple-substituted by -Qi, or phenyl, as required Replaced by Q i; '

(Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs where each Y is independently selected from 0 and s; each Aq is a cyclic group, independently selected from the following including aryl groups which contain 6, 10, or 14 carbon atoms and 1 to 3 rings, and the aromatic heterocyclic group contains ^ to μ atoms and 1 to 3 rings, the heterocyclic ring contains at least one selected from _〇 ·, SO S〇2 '' And -NH-, heteroatoms of N (less R, and -N (R9)-= containing: more than two double bonds, the heterocyclic group may contain a family group% as required, and It must be a single or multiple substitution of A sapphire group by -Q1, independent, 1 / iy is selected from the following including aryl groups which contain 0, 10, or 14 carbon atoms and 丨 to 3 ^ 1 ^ Contains 5 to 15 ring protos and 1 to 3 rings. The heterocyclic ring contains so ,, χτττ to the evening. One is selected from -0-, -S-, -SO-. NH, -Ning 5) "and- A heteroatom of N (R9)-, the hetero? | The double bond above, the heterocyclyl contains a κ-168 «as required

, 1T 丨 Φ 541309 A7

5. The aromatic ring of the invention description (166), and the ring base is a single or multiple substitution as required by -Qi: Each Qi is independently selected from the following including -NH2, -C02H, _C1, _F, -I , -N02, _CN, = 0, -OH, -perfluorinated C3, G3, R5, -〇foot 5, -nhr5, 〇r9, -N (R9) (R10), r9, -C (o) -Ri〇, and 0 \ CH2, \ 0 / The limitation is that when -eight 4 is substituted by Qi group, it contains more than one additional -Ar3 group, and the additional -Ar3 group is not replaced by another -AO; specifically The preferred compound of Example G applies formula (IV), where \ is (~ 2) and the other substituents are as defined above. Preferably, when 1 ^ is (~ 2): m is 1; ring C is benzo, p is pyrido, or P thieno; r3 is selected from the following including: -C (O) -R10, where R10 is -Ah; -C (0) 0-R9 ', where R9 is -CHa-Ai ^; -C (O) C (O) -R10, where R10 is -Αγ3; -R9' where R9 疋 Ci-2 Gima-Al * 3 replaced; and -C (O) C (O) -OR10, where R10 is &lt;η2Αι3; printed by the Consumer Cooperatives of the Central Standards Bureau, Ministry of Economic Affairs, R6 is Η; R8 is selected from the following Including -C (0) -R1〇, -C (〇) -CH2-OR10, and -C (O) CHrN (R10) (R10), where R10 is η, CH3, or -CH2CH3; R13 is H or -C1-4 straight or branched alkyl, optionally substituted by Aγ3, -OH, -0R9 or -C02H, where R9 is a C1-4 branched or straight chain alkyl group, of which Αγ3 -169- This paper size applies to China National Standard (CNS) Α4 Specification (210X297 mm) &quot; ~ 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the Invention (167) Is it morpholinyl or phenyl, where phenyl is required Replaced by Qi: A. It is phenyl, tea-based, far-phenyl, p-Kevinyl, isonoryl. Graveolyl, benzimidyl, phenacene, phenacenyl, fardifluorenyl, benzotrimethyl, benzo [b] thiophenyl, benzofuranyl, and indolyl; Independently selected from the following including -NH2, -Cl, -F, -Br, -OH, _H9, -NH-R5, where -〇R5 where &amp; is -C (〇) -Rio, -〇R9, _NHR9, And '〇 / \ CH ?,-\ / — 〇 where each of Han 9 and 111 () are independently -CN6 straight or branched alkyl, optionally substituted by Ar3, where 1 * 3 is phenyl; restriction The condition is that when -eight "is substituted by h, it contains more than one additional -Ai: 3 group, and this additional -Aγ3 group is not substituted by another -Ar3. Specific Example G Other preferred compounds, using formula (IV ) Where Rls (el0-A) and other substituents are as defined above. Specific Example G Other preferred compounds, applying formula (IV) where {^ is (ei 1) and other substituents are as defined above. Specific examples G Other preferred compounds, where formula (IV) is used where \ is (e 12) 'and other substituents are as defined above. Specific examples G Other preferred compounds, where formula (IV) is (yl) and other substituents are used As above Specific example G Other preferred compounds, where formula (IV) is used where \ is (y2) and the other substituents are as defined above. 170 This paper size applies to Chinese National Standard (CNS) A4 specifications (210X297 male sauce C, please First read and memorize it. ¾ I want to fill in this purchase) ΐτ 541309

2. Description of the invention (168) Specific preferred compounds of Example G apply S (IV) where R1 is ⑴ and other substituents are as defined above. Specific example G Preferred compounds are those in which R3 is -CO-Ar2. Preferably, when R3 is -CO-Ar2, Y is 0. Other preferred compounds are those where Rs is -C (0) -CH2-TrRu and R &quot; is-(CH2)] _ 3 ~ Ar4 0 is best, when R3 is -CCCO-CIVTVRn and Rn is-(CH2) yAr4, but ^ Is 0. Other preferred compounds are: -R3 is -C (0) -CH2-TVRn; T1 is 0; and Ri1 is -C (0) -Ar4. Other preferred compounds are those in which R3 is -C (0) -H. Other preferred compounds are those in which R3 is -C (0) -CH2-Ti-Ri 1 and 11 1 is -Aγ4. Preferably, when R3 is {(CO-CIVTi-Rn and Rn is -Ar ^ TiSO or S. Better, when R # (ell), (el2), (yl), (y2), 0), (elO -A) and (elO-B), R5 is selected from the following including: -C (〇) -R10, printed by the Consumer Consumption Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs -C (0) 0-R9, and -C ( O) -NH-R10 〇 In addition, when RA (ei 1), (e12), (y1), (y2), (z), (el0-A) and (elO-B), R5 is selected from the following including ： -S (0) 2-R9 '-S (O) rNH-R10, -171-This paper size is applicable to China National Standard (CNS) A4 specification (210X297 cm) 541309 A7 B7 V. Description of the invention (169)- C (0) -C (0) _R10, -R9'-C (O) -C (O) -OR10, and -C (O) C (O) -N (R9) (R10). Preferably, R5S-C (O) -C (O) -R10. R5 is -C (O) -C (O) -OR10. Preferably when 1 ^ is (611), (el2), (yl), (y2), (z), (elO'-A) and (elO-B), m is 1;-R2i is -H Or -CH3; R51 is a CN6 straight or branched alkyl group optionally substituted by Ar3, wherein the Ai * 3 ring group is a benzyl group, which ring group is optionally substituted by -Q i multiple or single; each Ar3 ring group Independently selected from the group consisting of phenyl, fluorenyl, thienyl, panorinyl, iso-quinolinyl, p-stilbyl, p-xenyl, iso-fluorenyl, benzotriazolyl, benzo Imidazolyl, alpha-sedenothiophenyl, imidazolyl, fluorenediazolyl, benzo [b] thiophenyl, pyridyl, benzofuryl, or andolyl, and the cyclic group is -Qi as required Single or multiple substitutions. Each Q! Is independently selected from the following including -NH2, -Cl'-F'-Br'-〇H, printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, · νη · ι5 whose center is -C (〇) -r1 (^ -s (o) 2-r9, -〇R5 where 115 is -C (〇) -R1., -OR9, -N (R9) (Ri〇), and 〇 仪 仪, \ 〇 / _ where each 119 and 111〇 are independently -c1-6 straight or branched lakes, optionally substituted by Ars, where the Ar3 ring group is phenyl, and the ring group is 172 as required.-This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (17〇) -Qi single or multiple substitution; The limitation is that when it is substituted by -Qi group, it contains more than one additional -Ar * 3 group, the additional -Λ. Group is not replaced by another. Preferably, in these preferred compounds, the AΓ3 ring group is selected from the group: F column includes phenyl, allyl, thienyl, hydranol Fluorenyl, isoquinolyl, pyrazolyl, oxazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienoporethenyl'imidyl, hydradiazolyl, benzene Acene [b] thiophenyl, benzofuranyl and wodolyl, And the ring base is optionally -Q i mono- or poly-substituted. Specific example G is a compound of a preferred form, wherein R 21 is Η and other substituents are as defined above. Specific example G is a compound of another preferred form. Where Rn is CH3 and the other substituents are as defined above. The ICE inhibitor of another specific example (H) of the present invention is the formula (V). Please read it first. 5- Ϊ Matters Η Order the Central Bureau of Standards of the Ministry of Economic Affairs Printed by Employee Consumer Cooperatives (V) where: m is 1 or 2; heart is (elO-B)

R21 · R5—N, Η

-173- The M's scale is applicable to the Chinese National Standard (CNS) A4 specification (21〇χ297297) 541309 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7. V. Description of the invention (171) r3 is selected from the following including : CN, -C (0) -H, -C (0) -CH2-TrRn, -C (0) -CH2-F, -C = N-〇-R9, and -C 〇-A r ': Each is independently selected from the following: -C (O) -R10, -c (o) 〇-r9, -C (O) -N (R10) (R10) -S (〇) 2-R9, -S ( 〇) 2-NH-R10, -C (〇) -CHrO-R9, -C (〇) C (O) -R10, -R9'-H, and -C (O) C (O) -N (R9 ) (R10), and -C (O) C (O) -OR10, where y2 is 112 or 0; each is independently selected from the following including -o-, -s-, -s (o)-, and- s (o) 2-; Rg is selected from the following: -C (O) -R10, -c (o) 〇-r9, -174- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297) (Please read the notes on the back before filling this page) Order 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (172) -C (O) -NH-R10, -S (0 ) 2-R9? -S (O) 2-NH-R10, -C (O) -CH2-OR10, -C (O) C (O) -R10, -C (O) -CH2-N (Ri0) (R10), -C (〇) -CH2C (0) -0-R9, — -C (〇) -CH2C (0) -R9, -H, and -C (O) -C (O) -OR10; each R9 is independently selected from the following including -Ar3 and -CN6 straight or branched alkyl groups, Optionally substituted by Aq, where -Cu alkyl is optionally unsaturated; each R10 is independently selected from the following including -H, -Ar3, C% 6 cycloalkyl, and -Cu straight or branched alkyl as required Is substituted by Ai * 3, where -Cm alkyl is optionally unsaturated; each Ru is independently selected from the following: -Aγ4, * (C Η 2) 1 · 3-A r 4 '-Η, and -C ( 0) -Ar4; R15 is selected from the following including -OH, -〇Ar3, -N (H) -OH, and -OCN6, where straight or branched alkyl is optionally substituted with Aq, -CONH2, -OR5 , -OH, -OR9, or -C〇2H; R21 is -CH3; -175- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (173) Αι : 2 is independently selected from the following, in which any ring is optionally -A mono or multiple generations, or phenyl, optionally substituted by Q 1; (hh) — ^

(ii) printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, and each of Y is independently selected from the following including 0 and S; each of the ring groups is independently selected from the following including aryl, which contains 6, 10, 0 or 14 carbon atoms and 丨 to 3 rings, and the aromatic heterocyclic ring contains 5 to 1 ring atoms and 1 to 3 rings, the heterocyclic ring contains at least one selected from s_,, and rhyme ... N (R5)- And a heteroatom group of -N (R9)-, the hetero-framework = needs to contain more than one double bond, the heterocyclic ring contains more than one aromatic ring, and the ring needs to be single or multiple substitutions; Each Ar * 4 is a ring group independently selected from the following including an aryl group containing 10, 12, or 14 carbon atoms and 1 to 3 rings, and the heterocyclic group containing 5 to 15 ring atoms ^ 1 to j rings' The heterocyclic ring contains at least one heteroatom group selected from the group consisting of ···, _s〇 ·, s〇 '' 'Shi' · N (lΐ5)-, and -N (Κ9)-. There are more than one double bond. 'The heterocyclyl contains an aromatic ring as required, and the ring base is required to be ...} single or multiple substitutions; each independently selected from the following including: ΝΗ2, -c〇 2H, -C1, -F, · ΒΓ,, -NO2, -CN ,, · 〇Η, _perfluoro ^ alkyl, R5, · 〇 ~ -NHR5, or9, -N (R9) (Ri〇 ), R9, &lt; (〇) Xun 10, and -176- 541309 A7 B7 V. Description of the invention (174) \ 〇 /

The limiting condition of CH 2 is that when -eight 1 * 3 is substituted by a ^ group, which contains more than one additional -Ar3 group, the additional -Ar3 group is not substituted by another -Aγ3 group; Specific Example (I) Another type of compound (form 1) is formula (V): (V).

(Γί ^

Ri 一 N R3 Η (Please read the notes on the back before filling out this page) where: m is 1 or 2; R! Is (elO-B) Y2

The R3 printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs is selected from the following: -CN, -C (0) -H, -C (0) -CH2-TrRn ^ -C (〇) -CH2-F, -C = N-0-R9, and -C 〇-A r ο; -177- This paper size applies to China National Standard (CNTS) A4 specification (210X297 mm) 541309 Α7 Β7 V. Description of the invention (175) Each R5S- C (O) C (O) -OR10; y2 * h2 * o; each! ^ Independently selected from the group consisting of -O-, -S-, -S (〇)-, and -S (0) 2-; r8 is selected from the group consisting of -C (O) -R10, -c (〇) o-r9, -C (〇) -NH-R10,, -S (〇) 7-R9 '-S (〇) 2-NH-R10, -C (O) -CH2-OR10, -C (O ) C (O) -R10, -C (O) -CH2-N (R10) (R10), -C (0) -CH2C (0) -0-R9, -C (0) -CH2C (0)- R9, -H, and -C (〇) -C (O) -OR10; each R9 is independently selected from the following including -Ar * 3 and -CN6 straight or branched alkyl, optionally substituted by Aι: 3, Where -Cw alkyl is unsaturated as required; printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) Each R10 is independently selected from the following including -H, -Ar3, C3.6 Cycloalkyl and -Cu straight or branched alkyl are optionally substituted by Ar3, where -Cu alkyl is optionally unsaturated; each 1 ^ 1 is independently selected from the following including: -Ar4,-(CH2) 1 -3-Αγ4 '-178- This paper size applies to China National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of the invention (176) -H, and -C (0) -Ar4; R15 Is selected from the group consisting of -OH, -〇Αγ3, -N (H) -OH, and -OCu, where Cj 6 is straight or branched The base is optionally substituted by ΑΓ3'-C0NH2'-〇R5, -OH, -OR9, or -CD; each R71 is independently selected from the following including-^^ or ^ 1-6 straight or branched alkyl; Αγ2 Independently selected from the following, wherein any ring may be mono- or multi-substituted as desired by -Qi, or phenyl, optionally substituted as Qi; (hh)

(Please read the notes on the back before filling out this page). Install (•) • ο and order the consumer cooperation printed by the Central Bureau of Standards of the Ministry of Economic Affairs, where each γ is independently selected from the following including ο and s; each Ai * 3 Is a cyclic group independently selected from the following including aryl groups containing 6, 10, 1: or 14 carbon atoms and 1 to 3 rings, and aromatic heterocyclic groups containing 5 to 15 ring atoms and 1 to 3 rings , The heterocyclic group contains at least one heteroatom group selected from -0_ ,, .SO ·, S02, = N-, and -NH-, -N (R5) ·, and -N (R9)-, and Heterocyclyl contains more than one double bond as required, the heterocyclyl contains more than one aromatic ring as required, and the ring radical is optionally substituted by -q 1 single or multiple substitutions; each Aι: 4 is The cyclic group is independently selected from the group consisting of: an aryl group containing 6, 10, 1: or 14 carbon atoms and 1 to 3 rings, and a heterocyclic group containing 5 to 15 ring atoms and 1 to 3 rings, The heterocyclic group contains at least one selected from -s ·, -S〇-179- U national standard (CNS) A4 QX297 in this paper standard) ·-i In · 541309 Α7 __________B7_ V. Description (17 ^) '---: SO :, = N-, -NH-, -N (R5)-, and _N The hetero atom group of (R9)-, the hetero-poly group 1 contains two or more double bonds, and the heterocyclic group is as required. More than one aromatic ring, and the ring base is singly or more as required by _Q1 = each 卩 丨 is independently selected from the following including -NH2, -co2H, · α, _F, Br, ^, · NO2, -CN, = 0, · 0Η, _ all Ci3 alkyl, &amp;, _〇 heart, -nhr5, 0r9, · Ν (Ιΐ9) (ΙΙι〇), &amp;, -c ( 0) _Ri. , And, 〇 / \ 一 CH.; · \ /

The O limitation is that when -Ar3 is substituted by Q 丨, it contains more than one additional -Aγ3 group, and the additional -Aγ3 group is not replaced by another -Aγ3 group; In addition, specific example I is a compound of this type (type 2) For those who are -CH3. Specific Example (J) Another type of compound (Form 1) is formula (V):

(V) Printed by the Shellfish Consumer Cooperative of the Central Standards Bureau of the Ministry of Economics where: m is 1 or 2; (el0 ~ B) R5—N Η YA2 R21

-180- This paper size applies to Chinese National Standard (CNS) A4 (210 X 297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (178) h is selected from the following: -CN , -C (0) -H, -C (0) -CHrTrRn, -C (0) -CH2-F, -C = N-0-R9 'and -CO-Ar2;' 115 each independently selected from the following including : _C (O) -R10, --c (o) o-r9, -C (O) -N (R10) (R10) -S (0) 2-R9, -S (O) 2-NH-R10 , -C (0) -CHr0-R9, -C (O) C (O) -R10, -R9 '-H, -C (O) C (O) -OR10, and -C (O) C (O ) -N (R9) (R10); Y 2 is% or 0; each D is independently selected from the following including -0-, -s-, -s (o)-, and -s (o) 2-; r8 Selected from the following include: -C (O) -R10, -c (o) o-r9, -181-(Please read the precautions on the back before filling this page) This paper size applies to Chinese National Standard (CNS) A4 Specifications (210X 297mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A 7 B7 V. Invention Description (179) -C (O) -NH-R10, -S (0) 2-R9, -S ( 〇) 2-NH-R10, -C (O) -CH2-OR10, -C (O) C (O) -R10, -C (〇) -CH2-N (R10) (R10), -C (〇 ) -CH2C (0) -0-R9, '-C (〇) -CH2C (0) -R9 -H,--C (〇) -C (〇) -OR10, and -C (O) -C (〇) -N (R9) (R10); each 119 is independently selected from the group consisting of -Ar3 and -Cb6 Or branched alkyl, optionally substituted by Aγ * 3, where -Cle6 alkyl is optionally unsaturated; each Ri is independently selected from the following including -H, -Ar3, C3-6 cycloalkyl, and- CN6 straight or branched alkyl is optionally substituted by Ar3, where-(: ^ 6 alkyl is optionally unsaturated; each 1111 is independently selected from the following: -Aq '-(CH3 * Αγ4' -Η, and -C (0) -Ar4: R15 is selected from the following including -OH, -〇Αγ3, -N (H) -OH, and -OCu, where Cp6 is a straight or branched alkyl group optionally substituted by Ar3, -C. NH2, -OR5, -ΟΗ, -OR9, or -C02H; -182- (Please read the precautions on the back before filling out this page) This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) Economy Printed by the Consumer Standards Cooperative of the Ministry of Central Standards Bureau 541309 A7 B7 — — — — V. Description of the invention (18) Each R21 is independently selected from the I &quot; column including -H or -Cw straight or branched alkyl groups;

Ar2 is independently selected from the following, in which any ring may be-(^ single or multiple substitutions as desired, or phenyl as Q i substitution as desired);

Wherein each Y is independently selected from the following including OKS; each Ar3 is a cyclic group independently selected from the following including any aryl group containing 6, 10, 12 or 14 carbon atoms and 1 to 3 rings and aromatic heterocyclic rings containing 5 to 15 ring atoms and 1 to 3 rings, the heterocyclic ring contains at least one selected from -S〇_, S〇2, = N-, and -NH-, -N (R5)-, and -N (R9 ) -Heteroatom, the heterocyclyl contains more than one double bond as required, the heterocyclyl contains more than one aromatic ring, and the ring is optionally substituted by -Qi Each Aι * 4 is a cyclic group, independently selected from the following including an aryl group, which contains 6, 10, 12 or 14 carbon atoms and 1 to 3 rings, and a heterocyclic group containing $ to 碳 carbon atoms and 1 To 3 rings, the heterocyclic group contains at least one heteroatom group selected from -0-, 4-, -SO-, S02 ,, -NH-, Chi Shao and a righteous group. Need to contain more than one double bond, the heterocyclic group may contain more than one aromatic ring, and the ring group may be substituted by _Q 1 single or multiple; each Qi is independently selected from the following including: _Nh2, &lt; 00, -C1, 邛, · Br, -I '-N02' -CN, = 〇 '〇H , Perfluoro ^ 3 Yuan Ji, ^, 〇R5, guan R5, 〇R9, Na 9) team 0), R9, &lt; (〇)% 〇, and ___ -183- Zhang scale it Caiguan 'Ege (Ball 297 is celebrated ----_ (Please read the notes on the back before filling out this page) r equipment · * 11 V. Description of the invention (181) A7 B7

V CH- Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. When .Ars is substituted with% groups, it contains more than one -xin 3 group, and the additional -ΑΓ3 group is not replaced by another group; restrictions The conditions are: when the claw is 1;, is (el0); X5 is CH; 1 Han 5 is -OH; ruler 21 is -H; and Y2 is 0 and R3 is -C (0) -H, then R5 Cannot be: -C (〇) -R1〇 'where r1〇 is -Αγ3 and the &amp; ring group is phenyl, 4- (¾methoxy) phenyl, 2-fluorophenyl, 2.eridinyl Hexahydropyridyl) methylphenyl, or -C (0) -0R9, the center of which is -CH factory AΓ3, and the cyclic group is phenyl, substituted by -Qi; and when: 'is 0, R3 is- C (0) -CH2-TrR 丨, Ding 丨 is 0, and the rule “is the Aq * Aι * 4 ring group is 5- (1- (4-Gaphenyl) -3-trifluoromethyl) Pyrazolyl), benzamidine cannot be: .C (0) -R10, where Ri0 is · Aγ3 and Aγ3 ring group is 4. (dimethylaminomethyl: phenyl, phenyl, 4- (carboxymethyl Thio) phenyl, (carboxyethylthio) phenyl, 4-carboxyethyl) phenyl, 4-aminocarboxypropyl) phenyl, 2-fluorophenyl, 2-pyridyl, pyrene (4-methylhexa Hydropyridyl) methylphenyl, or Without N- (4 · A

-Q (Please read the precautions on the back before filling this page) ¾¾ · 订 -184- This paper size applies to China National Standard (CNS) Α4 size (210X297 mm) 541309 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Preparation of A7 ________B7 V. Description of the invention (182) -C (〇) -OR9, where Rd-CH2-Ar * 3 and Ar3 ring group are phenyl groups; and when Rn is Ar * 4, where Aq ring group is 5_ (1 -Phenyl_3 · trifluoromethyl) pyrazolyl), then R5 cannot be: -C (〇) -〇R9 'wherein R9 is · CHs.Ars, and the Aγ3 ring group is phenyl: and when Rn is Aq , Where the A1 · 4 ring group is 5- (1- (2-pyridyl) _3 · trifluoromethyl) pyrazolyl), then R5 cannot be: -C (〇) -Ri〇 'Where R1〇 is- Αγ3, Αγ3 ring group is 4- (ditylamidomethyl) epitope, or -C (0) -OR9, where R9 is -CH2: Ar3, and Αγ3 ring group is phenyl group, not by -Qi And when Y2 疋 〇, R; 疋, 丁} is 〇 and r &quot; is {(〇) · Αι * 4 'where Aι * 4 ring group is 2,5-diaminophenyl, then R5 cannot be: -C (0) -R10 ′ where R10 is Aγ3 and Aγ3 ring is 4- (dimethylaminomethyl) benzyl, 4- (N-morpholinylmethyl) Methyl, 4- (N • methylhexahydropyridinyl) methyl) phenyl, 4- (N- (2-methyl) imidazolylmethyl) phenyl, 5-benzimidazolyl, 5-benzene Benzotriazolyl, N-Ethyl-5-benzotriazolyl, N-Ethyl-5 · benzimidazolyl, or -C (0) -0R9 'where r9 is -CH2-Ar3 and Aγ3 The cyclic group is phenyl and is not substituted by -Qi; and when γ2 is H2, R3 is -C (〇) -CH2-TVRn, T! Is 0, and Rn is -C (0) -Ar4, where Aγ4 ring The group is 2,5-diaminophenyl, then R5 cannot be: -c (o) -or9, where r9 is -CH2-Ar3aAl: the 3-ring group is phenyl. Specific Example J Another type of compound (Form 2), wherein R2 i is -CH3. Specific example J Another type of compound (type 3), where 115 is -C (0) -C (0)-(Please read the precautions on the back before filling in this page). Paper scales, financial accounts, S, CNS) A4 specifications (210X297 public holidays) 541309 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs V. Invention Description (183). 〇R1〇. Specific Example J Another type of compound (Form 4), wherein 115 is -C (0) -C (0) -OR10, and R21 is -CH3. Specific Example VII. Preferred compounds of I and J use formula (V), in which -C0-Ar2. Preferably, when R3 is -CO-Ai * 2 and Y is 0. Specific example Η, the preferred compounds of I and J use the formula (V) where R3 is -QOhCHrTVRnaRH is (CH2) Bu 3-Ar4. , Preferably, when R3 is -C (〇) -CH 厂 r ^ RnaRi1 *-(CH2) i-3-Ar4, Ding is 〇. Specific Example VII. Preferred compounds of I and J use formula (V), wherein R3 is -C ^ CO-CHyTVRn, 1 ^ * 0 and Rn is -C (0) -Ar4. Specific Example VII. Preferred compounds of I and J use formula (V), wherein R3 is -C (0) -H. Specific Example VII. Preferred compounds of I and J use formula (V), wherein R3 is -CCCO-CHyTVRH, and Rn is -Aγ4. Preferably, when R3 is -C ^ CO-CHrTVRnaRn is -eight 1 * 4, Ding is 0 or S. Preferred specific examples Η and J compounds (types 1 and 2) are those in which R5 is selected from the group consisting of: -C (0) -Ri〇, -C (0) 0-R9, and -C (〇) -NH -R10 〇 In addition, the preferred specific examples Η and J (type 1 and type 2) are in which R5 is selected from the following including: -186- This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) ( Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 _____B7_____ — V. Description of Invention (彳 84) -s (〇) 2-r9, -s (o) 2- nh-r10, -C (O) -C (O) -R10, -R9? -C (O) -C (O) -OR10, and -c (〇) c (〇) -n (r9) (r10 ). Preferably, R5 * -C (0) -C (0) -R1 {). -R5 is -C (O) -C (O) -OR10. Specific examples Η, 1 (type 2) and J (type 2 犮 type 4) are preferred compounds among which: m is 1; y 2 is 0; R15 is -OH or -OCm straight or branched alkyl as required Ar3 , -OH, -OR9, -C02H substitution, where R9 is -Cb4 branched or straight chain alkyl; wherein Aγ3 is morpholinyl or phenyl, where phenyl is optionally substituted by Q i;

Ar2 is (hh); Y is 0; and each Aγ3 ring group is independently selected from the group consisting of phenyl, fluorenyl, 0 sephenyl, quinolucyl, isoquinolyl, said α sitting group, 4 Sigma group, iso-α-xanthenyl, benzotriazolyl, benzimidazolyl, pyrimidothiophenyl, imidazolyl, pyrimidiazolyl, benzo [b] thiophenyl, rhodium Succinyl, and sulfonyl, and the cyclic group is-(^ single or multiple substitutions; each A * 4 ring group is independently selected from the following including phenyl, tetrazolyl, pyridyl, Azolyl, fluorenyl, pyrimidinyl, and 4-phenyl, and the cyclic group is -Ql single or multiple substitution as required; -187- This paper size applies to China National Standard (CNS) A4 specifications (210 ^ 297 mm) ) (Please read the notes on the back before filling this page}

541309 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (185) Each 1 is independently selected from the following including -NH2, -Cl, -F, -Br, -OH, -R9, -nh-r5, Where r5 is -C (0) -R10 or -S (〇) 2-R9, -OR5 where 115 is -C (〇). R1 (), -〇r9, _N (R9) (R1.), And Eight ch2, \ / wherein each R9 and R10 are independently -C1-6 straight or branched fluorenyl groups are optionally substituted by Ar3, wherein the Ar3 ring group is phenyl, and the ring group is single or Multiple substitutions;-Limitation is that when · Ar3 is · Q 丨 substituted, it contains more than one additional -Ar3 group, the additional -Ar3 group is not substituted by another -Ar3 group. Preferred specific examples I (type 1) and J (type 3) compounds are: m is 1; R2i is or -CH3; R51 is ci-6 straight or branched alkyl, optionally substituted by Ar3, where The eight 1 * 3 ring group is a phenyl group, and the ring group is optionally-(^ multiple or mono-substituted; each eight 1 * 3 soil group alone JL is selected from the following including a private group 'naphthyl' p sephenyl, τι Quinolyl 'iso-p-quinyllinyl, bis-pyridyl, p-sethyl, iso-p-xyl, benzotriazolyl, benzimidazolyl, fluorenopyrimidyl, imidazolyl, 0 Sediazolyl, benzo [b] thiobenzyl, pyridyl, benzofuranyl, or Wolinyl, and the cyclic group is optionally -Qi mono- or poly-substituted; each Qi is independently selected from the following including- NH2, -Cl, -F, -Br, -OH, -R9, • NH-R5, its center is -C (O) -R104 -S (0) rR9, -〇R5 and its center is -C (0) -R1〇, -〇r9, -N (R9) (Ri〇), and -188- This paper size applies to China National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling This page) r Pack. Order 541309 A7 B7 V. Description of the invention (186) ch2 where each of 119 and 1110 are independently -C ^ 6 straight or branched alkyl, as required Substituted by Ar3, where the Aq ring group is phenyl, and the ring group is mono- or poly-substituted as required; the limitation is that when -Al * 3 is substituted by a Q1 group, it contains one additional -Ar3 group from above The additional -Aγ3 group is not substituted by another -Ar3 group. Preferably, in these preferred compounds, the Aγ3 ring group is selected from the group consisting of: phenyl, mosyl, phenyl, and quinyl 4 , Isojunorinyl, esialyl, .zozolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, fluoreno alpha selphenyl, imidazolyl, hydradiazolyl, benzo [b] Thiophenyl, benzofuranyl, and Mbdoyl, and the cyclic group may be mono- or multi-substituted as required by -Q. Specific Examples Η and J (叟 1 and 1) are preferred compounds Where R3 is -CCO ^ CHrTVR &quot; Ding1 is 0; and

Ri is -C (0) -Ar4, wherein the Aγ4 ring group is selected from the group consisting of tetrazolyl, pyridyl, isyl, pyrimidyl, and. Cephenyl, and the ring base is optionally substituted by single or multiple substitutions of -Q1. Specific examples printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. The preferred compounds of I and J are applied by formula (V), where 3 is -C0-CH2-TrRll, and the heart is -Aγ4, where the Ar4 ring group is pyridine. And the ring base is optionally substituted by -Q! The preferred compound for specific example J (type 1) is among them: R3 is -C (〇) -H, and -189- This paper size applies Chinese National Standard (CNS) A4 specification (2iOX 297 meal) 541309 A7 B7 Printed by the Consumer Goods Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (187) R5 * -c (o) -R1 (), of which

Rio 疋 Ar3 'in which the radical is stupid' depending on Yunliang τη and the following single or multiple substitutions: -F, -C1, -N (H) -R5, where -R5 is · Η or -C (0) -R1〇, and re 〇 ★ ° eight Y K10 疋 -Cw straight or branched alkyl, optionally substituted by Aι * 3, wherein Ar, is benzene, -N (R9) (R10), Wherein &amp; and R10 are independently -q · 4 straight or branched alkyl, or -0-R5, where 115 is 11 or -CN4 straight or branched alkyl. Preferable: Αι: 3 is phenyl optionally as -C1 at 3- or 5-position or -NH-R5, -N (R9) (R1〇) or -〇-R5 Or multiple substitutions. Specific Example J Other preferred compounds (form 1) are: where: C3 is -C (〇) -H; R5 疋 -C (0) -Ri〇 'where Ar ^ and the group is selected from the following including a dodecyl group, Benzimidazolyl, fluorenyl, and benzo [b] thiophenyl, and the cyclic group may be mono- or multi-substituted as required by -Qi; Specific Example J Other preferred compounds (form 1) are among them: R3 Is -C (0) -H; R5 is -C (O) -R10, where Ri0 is Aγ3 and the Aγ3 ring group is selected from the following including quinolinyl and iso- and quinuclyl, and the ring group is as required Single or multiple substitutions; Specific examples J Other preferred compounds (type 丨) are: where R3 is -C (0) -H; R5 is -C (〇) -R1〇, where Ri # Ar # A ring group is Phenyl, -190- 丨 X 297 mm) (Please read the notes on the back before filling this page)

541309 A7 B7 V. Description of the invention (18S) 〇 8 \ / CH, superseded. Specific examples (J) Preferred compounds include the following, but are not limited thereto: 2002 〇

Η (Please read the notes on the back before filling this page) 2201 OMe η

Another specific example (K) of the ICE inhibitor is the following formula ...

/ X Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

Yes L R 2 R 隹 N — Η-R1 -191-This paper size applies to Chinese National Standard (CNS) A4 specification (210 X 297 mm) 541309 A7 B7 V. Description of the invention (189) (el〇)

Or (w2)

C is a ring selected from the group consisting of: benzo, ρ bido, ρ cepheno, ρ biha, succino, p sawa, iso-p succinate, vomiting, isopyridine Calling pyrido, imidazo, cyclopentyl and cyclohexyl; the ring is required to be a single or multiple substitution by -Qi; R? Is:

Rsi or (Please read the precautions on the back before filling out this page) • I Binding and Ordering — Printed by the Central Consumers Cooperative of the Ministry of Economic Affairs (b) 〇

ORt3 OR51 OR51 m is 1 or 2; -192- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (190) Each 115 is independently selected from the following including: -C (〇) -R10, -c (o) o-r9, -C (O) -N (R10) (R10), -S (O) 9 ~ R9 J -S (〇) 2-NH-R10,- c (o) -ch2-o-r9, -C (〇) C (〇) -R10, -R9, _ -H, -C (O) C (O) -OR10, and -C (O) C ( O) -N (R9) (R10); X5SCH or N; y2 is% or 0; R6 is selected from the following including -H and -CH3; R8 is selected from the following including: -C (〇) -R10, -c ( o) o-r9, -C (O) -N (H) -R10, printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) -S (0) 2-R9 '-S (O) 2-NH-R10, -C (O) -CHrOR10, -C (〇) C (〇) -R10, -C (O) -CH2N (R1 ()) (R10), -193 -This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of Invention (191) Printed by the Consumer Cooperatives of the Central Standardization Bureau of the Ministry of Economy -C (0) -CH2C (0)- 0-R9, -c (o) -ch2c (o) -r9, -Η, and -C (O) -C (O) -OR10; each R9 is independently selected from the following including -Ars and -c 9 1-6 Marina or branch pit Ars is substituted as required, where -C1-0 alkyl is unsaturated as desired. Each 1110 is independently selected from the following including: «, * 3, {36 ring group, and _ straight or branched to complete the base view It needs to be substituted by AQ, where _Ci_6 alkyl is optionally unsaturated; R13 is selected from the following including fluorene, Ar3, and c1-6 straight or branched alkyl groups, and Ar3, -CONH2, -OR5,-as required OH, Qihan 9 or 40] ^ substitution; each r51 is independently selected from the following including r9, · α〇Ηΐ9, or each RSi together forms a saturated 4-8 member carbocyclic ring or contains _〇 ·, _s_ or -νη · Heterocyclic ring: each R2 is independently selected from the following including -fluorene or -C 1-6 straight or branched alkyl; each Ars is a cyclic group independently selected from the following including aryl, which contains 6, 10, 12 Or 14 carbon atoms and 1 to 3 rings, and the aromatic heterocyclic group contains 5 to 15 post atoms and 1 to 3 rings, the heterocyclic ring contains at least one selected from _〇 · ,, s ... SO-, SO ?, = N · and -NH- heteroatoms, and the heterocyclic group contains more than one double bond as required, the heterocyclic group contains more than one aromatic ring, and the ring group depends on Requires single or multiple substitution by -Qi; each Qi is independently selected from the following: -NH2 -C02H, -a, -F, _B] :, -I, -N02, -CN, = 0, -OH, -perfluoroc 3 alkyl, R5, · 〇ιι, -nhr5, or9, -N (R9) (R10), r9, -C (O) -R10, and -194- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) c Please read the precautions on the back before filling in this Page) «Shang · Ding · d 541309 Printed by A7 B7, Consumer Cooperatives of the Central Procurement Bureau of the Ministry of Economic Affairs 5. Description of the Invention (192) 0 \ CH2, \ / 0 The restriction is that when the base is replaced, it contains more than one additional • Ar3 group, this additional Ar3 group is not replaced by another _ Ah group. The preferred compound for this specific example is where: m is 1; -C is a ring selected from the group consisting of benzo, pyrido, or thieno, as desired, from -NH2, -NH-R5, -NH-R9 , -〇111〇 or -foot 9 single or multiple substitution, where R9 is straight or branched C1-4 alkyl and R10 is Η or straight or branched Cw alkyl; R6 is Η; R13 is Η or straight Or branched alkyl is Ar3, -OH, _〇r9 'or -C〇2H substituted' where ^ 疋 c〗 4 branched or straight chain alkyl; where Al: 3 is morpholinyl or Phenyl, where phenyl is optionally substituted by q 1; R21 is · Η or -CH3; is a straight or branched alkyl group of CN6, substituted by Ars if necessary, where Ar3 is phenyl, optionally -(^ Is substituted; each Aq ring group is independently selected from the group consisting of phenyl, fluorenyl, phenenyl, quinolyl, isoquinolinyl, bitulyl, p-sinolyl, isocyanin U.S., -triazolyl, benzimidazolyl, alpha pheneno farinyl, imidazolyl, hydrazone-salyl, benzo [b] thiophenyl, pyridyl, benzofuranyl, and pyrene Base, ring and ring bases are single or multiple substitutions as required by -Q i; ^

Each Qi is independently selected from the following including -NH2, -α, -F ,, R π, please read the precautions on the back and save this page)

-195-

541309 A7 B7 CH2, V. Description of the invention (193) -NH-R5, where 115 is -C (0) -R1〇4 -s (〇) 2-R9, -0R5 where Han 5 is -C (〇)- R10, -0R9, -NHR9, and 〇 / \ Wherein each of R9 and Rio is -C1-0 straight or branched alkyl, optionally substituted by Aγ3, of which Ar3s phenyl; When -Al: 3 is substituted with a fluorenyl group, it contains more than one additional -Ah group, and the additional -Ah group- is not substituted with another · AΓ3 group. It is preferred 'in these preferred embodiments' \ is ~ 2) and the other substituents are as defined above. The compounds of this preferred embodiment include the following, but are not limited to them: (Please read the notes on the back before filling in this page j

Η and, Yiding Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

Preferably, R8 is selected from the following including: 196- This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (194) -C (O) -R10, -c (o ) o-r9, -C (O) -CH2-OR10, and -c (o) -ch2c (o) -o-r9, best, RA-c (o) -CH2-〇R1〇iLRi (^ H ^ CH3. In addition, in this preferred embodiment, R1s (elG) and X ^ CH, and other substituents are as defined above.-In addition, in this preferred embodiment, R1 is (61) And 乂 5 is N, and other substituents are as defined above.-Preferably, in any of the above compounds of the specific example (K), 1 is {(〇 &gt; R10 or -C (0) -C (0 ) -R1 {) 'and the other substituents are as defined above. Preferably, Rio is -Ars and the other substituents are as defined above. Preferably, among these preferred compounds: R5 is -C (〇) -Riq And Riq is Aι: 3, wherein the Aγ3 ring group is phenyl, and optionally single or multiple substitutions as follows: -R9, where 119 is (: a straight or branched alkyl group; -F, -cn,- N (H) -R5, where -115 is-: «or-€: (〇) -1110, where 111 () is a 4 or 6 straight or branched pit foundation, as required Substituted by γ3, wherein Ar3 is phenyl, -N (R9) (R1Q), wherein 119 and 111 () are independently -Cw straight or branched alkyl, or -0-R5, where R5SH or -Cw is directly or Branched alkyl. The preferred compounds of this preferred embodiment include the following, but are not limited to this: -197- This paper size applies to China National Standard (CNS) A4 (210X297 mm) (Please read the back (Please fill in this page again)

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Invention Description (195) 682

Η

印 Printed by the Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs 695a

695b

(Please read the notes on the back before filling this page)

This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (196) Best, A "is phenyl, -C1 at the 3- or 5-position or at 4 -Positioned by -NH-R5, -N (R9) (R10) or -0-R5. --- The compounds with the surname j 鲛 佳佳 声 堂 are the following, but not limited to them: (please first (Read the notes on the back and fill out this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs

692b

-199-

This paper size applies to the Chinese National Standard (CNS) A4 (210X297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Economic State -200- A 7 B7__ 5. Description of the invention (197) Other best of this best specific example The compounds include, but are not limited to:-

Ο

〇

〇

This paper size applies to China National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. 5. Description of the Invention (198). In addition, Aγ3 is a phenyl group, which can be 119 single or multiple substitutions at the 3- or 5-position, of which R9SC ^ 4 Straight or branched alkyl; and single or multiple substitutions at the 4-position by -0-R5. Other preferred compounds of this best embodiment include, but are not limited to, the following:

• 201-This paper size is in accordance with Chinese National Standard (CNS) A4 (210X 297mm) (Please read the notes on the back before filling this page) 541309 A7 B7 V. Description of Invention (199) 695c

Other preferred compounds of this best embodiment include the following here: but are not limited.

Economic but printed by the Central Standards Bureau employee consumer cooperatives 〇

214W-4

〇

(Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 541309 〇 214w-

V. Description of the invention (20 °)

And Ο 214W-7

In addition, in this preferred embodiment, R5 is -C (0) -Ri0 ', wherein R10 is Ar3 and the Ar3 ring group is selected from the following including fluorinyl, benzimidazolyl, farphenyl, and fluorinyl , Isoquinolinyl and benzo [b] thiophenyl, and the cyclic group may be mono- or multi-substituted as required by -Qi. Preferably, the eight 1: 3 ring group is iso-P-lylyl. The preferred compounds for this best specific example include the following, but are not limited to them: (Please read the notes on the back before filling this page)

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (201) 696a-l 696b

696c

(Please read the notes on the back before filling out this page) Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 696d

-204-This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (2Q2)

(Please read the notes on the reverse side before filling out this page) Order d. Other preferred compounds printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs to print this best specific example include the following, but are not limited to this: -205- This paper Standards are applicable to Chinese National Standard (CNS) A4 specifications (210X297 mm) 541309 Printed by A7 B7, Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of Invention (2Q3) 〇

-206- (Please read the precautions on the back before filling this page) This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 Α7 Β7 V. Description of the invention (204> 〇 412d

Ο 412e

Ο Η Ο 412f

412g

Printed by the Consumers Cooperative of the Central Cup Associate Bureau of the Ministry of Economic Affairs

Ο

(Please read the notes on the back before filling this page)

This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 Printed by the Ministry of Economic Affairs-Λ Standards Bureau's Consumer Cooperatives V. Description of invention (205) 0 550q

In addition, in this preferred embodiment, 115 is -C (〇) -R1Q, where R1Q is Ar3 and the Ar3 ring group is phenyl, which is substituted by 0. / \ ch2 \ / The preferred compounds of this preferred embodiment include the following, but are not limited to this 213η 〇 415a

415b

〇 ο

CH3 and -208- (Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (206)

Other compounds of the specific example (K) include the following, but are not exhaustive: 〇

(Please read the precautions on the back before filling this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs -209- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Invention Note (207) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

-210- (Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 A7 B7 V. Description of the invention (208) Printed by the Consumers' Cooperative of the Zhongjia Standard Bureau of the Ministry of Economic Affairs 〇

-211-(Please read the precautions on the back before filling this page)

This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (2Q9) 〇 213s 〇ΧΝ ^ 〇

Or 〇 Η 〇 213t

(Please read the notes on the back before filling this page) 213u

Ο Me, MeO

Me Ο

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 〇

-212- This paper size is in accordance with Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (211) 〇

264e CIAnWY Η 〇〇 人 Ν Ο Ο ό ό.

〇 264f

f!, Ν Η Η

Ο Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 264g

Person / 〇 Η 〇 Η OO ^ N ^ S / Η ° -ο -214 (Please read the notes on the back before filling this page)

The size of this paper applies to Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of the invention (212) Ο 264h

Ο

Ο

(Please read the precautions on the back before filling out this page) Order Printed by Gan Zuosha, Staff Consumption of Central Standards Bureau, Ministry of Economic Affairs 264k

2641

-215- This paper size applies to Chinese National Standard (CNS) A4 specification (210 × 297 mm) Bee 541309 A7 B7 V. Description of the invention (213) 〇

Ο 550f

〇 550g

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 〇 550h

〇

-216 (Please read the notes on the back before filling this page)

This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (214) 〇 550j

Ο 5501

〇 550η

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 550.

55〇ρ

(Please read the notes on the back before filling this page)

This paper size applies to Chinese National Standard (CNS) Α4 size (210 X 297 mm) 541309 A7 B7 V. Description of the invention (215) Ο 2100f

〇 2100g

Ο Ο (Please read the notes on the back before filling in this page): Pack · 〇 Order 2100h 〇

VCH3 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economy 〇 2100k

-218- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of the invention (216) Economy, printed by the staff ’s consumer cooperative of the Central Bureau of Standards, Ministry of Standards and Technology

Another specific example (L) of the ICE inhibitor of the present invention is the following formula: 〇

-219- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297mm) (Please read the notes on the back before filling this page) Order 541309 A7 B7 V. Description of the invention (217) Where: m is 1 or 2; Ri is selected from the following including the following formula (w2)

Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, C is a ring selected from the group consisting of benzo, pyrido, pyrimido, pyrrolo, succinyl, η-cyclopentadiene, isoxazole, oxazo, and isoxamine And pyrimido, imidazo, cyclopentyl, and cyclohexyl, depending on the desired single or multiple substitutions; selected from the following: -CN, -C (〇) -H, -C (〇)- CH2-T "RU, -C (〇) -CH2-F, -C = N-0-R9, and -C 0 · Air ,; each 115 is independently selected from the following including: -C (〇) -R10,- c (o) o-r9, -C (〇) -N (R10) (R10) -S (0) 2-R9, -S (〇) 2-NH-R10, -220 (CNS) Α4 specification (210 × 297 mm) Please read the winter notes before filling out this page 541309 A7 B7 V. Invention Description (218; Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs-c (〇) -ch2- o-r9, -C (〇) C (O) -Ri0, -R9, -Η, -C (〇) C (〇) -OR10, and -C (〇) C (O) -N (R9) ( R10); each 1 ^ is independently selected from the following including -〇-, -s-, -s (〇)-, and -s (〇) 2-; R6 is selected from the following including-包括 and -CH3; R8 is selected from the following Including: ~ -C (O) -R10, -c (〇) o -r9, -C (〇) -NH-R10, -S (〇), -R9 '-S (〇) 2-NH-R10, -C (〇) -CH2-〇R10, -C (〇) C (〇) -R10, -C (O) -CH2N (R1G) (R10), -c (〇) -ch2c (o) -o-r9, -C (0) -CH2C (0) -R9, -H , And -C (O) -C (O) -OR10; each R9 is independently selected from the group consisting of -Ar3 and -0 or 6 straight or branched alkyl groups, optionally substituted by Al · 3, where -Cw alkyl Unsaturation required for base-view; Each R10 is independently selected from the following including -H, -Ai: 3, C3_6 cycloalkyl, and -Cu -221 This paper size applies to China National Standard (CNS) A4 specifications (210X 297 mm) ) Please read the %% on the back first and then fill in page 541309 A7 B7 V. Description of the invention (219) Straight or branched bases are replaced by Ar * 3 as needed, of which _ci 6, pit base is unsaturated as needed Each Ru is independently selected from the group consisting of: -Aγ4,-(CH2) 1.3-Ar4 ^ -Η, and -C (0) -Ar4; and R15 is selected from the group consisting of -〇H'-〇Ar3'-N (H ) -〇H and -〇Ci 6, where C1-6 is a straight or branched fe base as required-is Ar3,-(: 0Νϋ2, -OH, -0R9, or-(: replaced by 0211; Aι : 2 is independently selected from the following, and any of the rings may be- ^ Single or multiple substitutions, or phenyl is optionally substituted by (^

Each Y is independently selected from the following including 0 and S; printed by the Consumer Cooperative of the Ningyang Standards Bureau of the Ministry of Economic Affairs. Each Ars is a cyclic group. Independently selected from the following including aryl, which contains 6, 10, 12 or 14 carbon atoms. And 1 to 3 rings, and an aromatic heterocyclic group containing 5 to 15 ring atoms and 1 to 3 rings, the heterocyclic group contains at least one selected from _〇_, -S- '-SO-, S02 'And -NH-' -N (R5)-'and heteroatoms of · N (R9)' This heterocyclyl contains more than one double bond as required, and this heterocyclyl contains more than one aromatic Family ring, and the ring base is required by -Qi or -222- This paper size applies to China National Standard (CNS) A4 specifications (210X29 * 7 mm) 541309

V. Description of the invention (220) Multiple substitutions; r——Please read the notes on the back before filling out this page. Each Ai * 4 is a cyclic group, independently selected from the following including aryl groups which contain 6,1, 12, or 14 back atoms and 丨 to 3 rings, and a heterocyclic group containing $ to is ring atoms and 1 to 3 rings, the heterocyclic group contains at least one selected from · 〇 ·, _s •, -s〇_SO ? A heteroatom group of N- '· NΗ-' -N (R5)-, and -N (R9)-, the hetero% group contains more than one double bond as required, and the heterocyclic group contains one as needed The above aromatic ring, and the ring base is optionally a single or multiple substitution; each Qi is independently selected from the group consisting of -NH2, -C02H, -Cl, -F, -Br, -I, -N02, -CN, = 0, -OH, · perfluoroCw alkyl, r, -OR, -NHR5, OR9, -N (R9) (Rio),%, &lt; (〇) 氺 10, and \ The limiting condition is that when -Ar3 is substituted by Q i, it contains more than one additional -Aq group, and the additional -Ah group is not substituted by another -Ar3 group. Better, m is 1; printed by the Consumer Cooperatives of the China Standards Bureau of the Ministry of Economic Affairs; C is a ring selected from the following including benzo, pyrido, and p-pheneno, depending on the household price, -ΜΗ], -NH -R5 or -NH-R9, -〇 &amp; 10 or _ trans 9 single or polysubstituted 'where R9 is straight or branched -C! · 4 fluorenyl, and R1O is or straight or branched -CW4 alkyl ; L is 0 or S; R6 is Η;

Rii is selected from the following including -Ar4,-(CHduAr ^, and -c (〇) -Ar4; Ar2 is (hh): 223- This paper size applies Chinese National Standard (CNS) A4 specifications (210X297 mm) 541309 A7 B7 V. Description of the invention (221) Y is 0; each Ar3 ring group is independently selected from the group consisting of phenyl, naphthyl, p-phenenyl, quinolinyl, isoquinolyl, pyrazolyl, benzimidazole , Thienothienyl • fluorenedifluorenyl, benzotribenzyl'benz [b] benzobenzyl, benzoxanyl, and indolyl, and the cyclic group is as required by -Ql Or multiple substitutions; each Ar4 ring group is independently selected from the group consisting of phenyl, tetrazolyl, pyridyl, pyridyl, fluorenyl, sulfonyl, or indyl, and the cyclic group is as required Single or multiple substitutions; each Qi is independently selected from the group consisting of -NHj'-Cl'-F'-Br, -Oh, _r9., -NH-R5 where R5 is -C (0) -Ri0 or -S (0 ) 2_R9 '-〇R5 where -C (0) -R1〇, -〇R9, -NHR9 and

The Central Standard of the Ministry of Economics &amp; Employee Cooperatives printed the environment where each core and R10 are independently -C1-6 straight or branched, replaced by -Ar3 as necessary, where 1 * 3 is phenyl; restrictions Qidan-eight]: 3 is substituted with a Qi group, which contains more than one additional -Aγ3 group, and the additional -Aγ3 group is not substituted with another -Aγ3 group. The preferred compounds of this preferred embodiment include, but are not limited to:

This paper size applies to Chinese national standards (2IGX297 /; iT 541309 A7 B7 V. Description of the invention (222),

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 〇

(Please read the notes on the back before filling this page)

This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (223) 〇 7 05

Ο 706

〇 709

Ο 710

(Please read the notes on the back before filling out this page), binding and printing Printed by the Central Bureau of Standards of the Ministry of Economic Affairs i Consumer Cooperative 〇 711

And -226- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (224)

Preferably, &amp; is -C (0) -Ai · 2 and the other substituents are as described above. In addition, R3 is -C (0) CH2-TrRu; and R3 is -C (0) -H. M is good. In any compound on the specific example (L), Rs also includes: -c (〇) -R10, -c (〇) 〇-r9, -c (〇) -ch2-or1 (), And -C (0) -CH2C (0) .R9 ο is better, Rd-CW-CIVORwiLI ^ is hCH3. In addition, the ICE inhibitor of the specific example (L) of the present invention has the following formula: 〇

(V) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economics where: m is 1; heart is: ya 2

This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (225) R3 is selected from the following: -CN, -C (0) -H, -C (0)- C Η 7 ~ T |-R | j J -C (〇) -CH2-F, -C = N-0-R9, and -C 〇-A r '; each 115 is independently selected from the following including: _C (O ) -R10, _-c (o) 〇-r9, -C (〇) -N (R10) (R10) -S (0) 2-R9, -S (O) 2-NH-R10, -C ( 〇) -CH2-〇-R9, -C (〇) C (〇) -R10, -R9 '-H, -C (O) C (〇) -OR10, and -C (O) C (O)- N (R9) (R10); printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 2 is% or 0; each Ding is independently selected from the following including -0- or -s-; each R9 is independently selected from the following including-Ah And -Ci_6 straight or branched alkyl is optionally substituted by Aq, wherein -Cb6 alkyl is optionally unsaturated; each Ri is independently selected from the following including -H, -Ar3, C3-6 cycloalkyl, and- Cw -228- This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 ______B7 V. Description of the invention (226) Straight or branched base, if necessary, replaced by Αγ3 'where 1-6 The base is unsaturated as required; each Rh is independently selected The columns include: -Αγ4,-(CH2) | .3 &quot; ^ r4? -Η, and -C (〇) -Ar4;, R15 is selected from the following including -OH, -OAr3, -N (H) -OH, and- OC1-6, in which CK6 is a straight or branched alkyl group, as required -Aγ3, -conh2, -or5 ·, -OH, _〇R9, or-(: 0 # substituted; is -Η or -CH3 ;

Ar2 is:

(hh) where Y is 0; printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back before filling out this page) Each Ar3 is a cyclic group independently selected from the following including phenyl, stubyl, and thienyl , Quinolyl, isoquinolyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, tr sedenofluorenyl, imidazolyl, thiadiazolyl ^ Acyl [b] thiophenyl, 17-pyridyl, benzoanyl, and ^ 丨, and the cyclic group is-(^ single or multiple substitutions as required; each Ar4 is independently selected by the cyclic group) From the following includes: phenyl, tetrazolyl, pyridyl ', amidinyl, fluorenyl, pyrimidinyl, and pyrenyl, and the cyclic group is optionally substituted by -Qi single or multiple; This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (22?)

Each Qi is independently selected from the group consisting of: -NH2, -Cl'-F, -Br, -OH, -R '-Ν-Ι15' where R5 is -C (O) -R10 or -S (0) 2- R9 '-ORs where R5 is' C (〇) -R10, -OR9, -nhr9 and 2

The limitation of CH is that when -A1: 3 is substituted by Qi, it contains more than one additional _Ar3 group, and the additional -Ar3 group is not substituted by another -Ar3 group. The constraints are when: one m is one;

Ri5 is -〇H: R21 is; and Y2 is 0 and R3 is -C (0) -H, then R5 cannot be: -C (0) -Ri〇, where Ri〇 is -Al: 3 and Ar * 3 The cyclic group is phenyl, not substituted by-(^, 4- (multimethoxy) xyloyl, 2-fluorophenyl, 2-ρ specific group, N- (4-methylhexahydro p ratio p Jingji) methylbenzyl, or -C (0) -〇R9, where R9 is -CH2-Ar3, and the Aγ3 ring group is a benzyl group, not replaced by-(^; and when: Employees of the Central Standards Bureau of the Ministry of Economic Affairs The consumer cooperative printed Ya 2 is 0, R 3 is -CWXHrTVRn, ΊΆΟ, iRiAAr4, where the A1 · 4 ring group is 5- (1- (4-phenyl) -3-trifluoromethyl) pyrazolyl), Then r5 cannot be: -H; • C (0) -R1〇 'where R1〇 is _Αγ3 and the Ar3 ring group is 4- (dimethylaminomethyl) winteryl'phenyl, 4- (dimethylsulfide Phenyl), 4- (chiethylthio) phenyl, 4- (230- This paper size applies to the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 __ B7, -...丨 ··--One----- V. Description of the invention (228) carboxyethyl) phenyl, 4- (carboxypropyl) phenyl, 2-fluorophenyl, pyridyl, N · (4 -Methylhexahydropyridyl) methylphenyl, • C (0) -0R9, where R9 is isobutyl or -CH2-Ar3 and the Ar3 group is phenyl · and when Rn is A1 · 4, where the Aq ring group is 5- (1- (2_erenyl) ) _3-trifluoromethyl) pyrazolyl), then R5 cannot be: -C (O) -R10 'where Ri0 is -Aγ3 and the Aγ3 ring group is 4- (dimethylaminomethyl) phenyl, Or, -C (0) -0R9, where R9 is -CH2-Ar3, and the Ar3 ring group is phenyl, not substituted for -Qi; and when; -Y2 is 0, R3 is -C (0) -CH2- TrRn, T1 is 0, and Rn is -C (0) -Ar4, where the Ar4 ring group is 2,5-difluorophenyl, then R5 cannot be: -C (O) -R10, where R1〇 is _Ar3 And the Ar3 ring group is 4- (dimethylaminomethyl) phenyl, 4- (N-morpholinylmethyl) phenyl, 4- (N-methylhexahydropyridyl) methyl) '4- (N- (2-methyl) imidylmethyl) phenyl, 5-benzimidyl succinyl, 5-benzotriazolyl, N-ethylethyl-5-benzotri Azolyl, N-ethyl-5-benzimidazolyl, or -C (0) -0R9, the center of which is -CH2-Ar3, and the Aγ3 ring group is phenyl and is not substituted by (^ 丨; and When printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs, 2 is H2, R3 ^ -C (0) .CH2-TrRn ^ A 〇, and R u is -C (0) -Ar4, where the Ar4 ring group is 2,5-difluorophenyl, then R5 cannot be: -C (0) -0R9, where R9 is -CH2-Ar3 and the Ar3 ring group is benzene base. Preferably, in any of the above compounds in the specific embodiment (L), R3 is -C (0) -H, and 115 is -c (o) -r1g or -C (0) -C (0) -R1Q, and Other substituents are as defined above. -231-This paper size applies to Chinese National Standard (CNS) A4 (210X 297mm) * Ming (229)

Preferably, A and Q 疋 -4, and other substituents are as defined above. Better than these compounds: R) 疋 C (〇) -Rl0 and \ 〇 is, where Aγ; cyclic group is phenyl, need to be the following single or multiple substitutions; where anti 9 is C 1-4 Straight or branched alkyl; -F, -CM,. -N (H) -R5, where _R5 is · Η or -C (0) -Ri〇, where R10 is -C1-6 straight or branched heptyl And optionally substituted by Ar3, where Ar3 is phenyl, -N (R9) (R1 (j), where R9 and R10 are independently 41-4 straight or branched alkyl, or -0-R5 , Where R5 * H or -Cw is a straight or branched alkyl group. The preferred compounds of this preferred embodiment include the following, but are not limited to this. · Jing I Read I Back I | i

I order HO, 〇 668

Ο 〇 Consumption Cooperation of Central Standard Residence Staff, Ministry of Economic Affairs, printed 678

OMe Ο 232- This paper size applies to the Chinese National Standard (CNtS) a4 size (210X 297mm) 541309 A7 B7 V. Description of the invention (23〇) 691b 911

Η HO 〇 912

(Please read the notes on the back before filling this page)

1T. Participation-Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 913

,, and lCH3 -233- This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 Α7 Β7 V. Description of the invention (231)

Preferably, Ar3 is a single or multiple phenyl group which is -C1 at the 3- or 5-position and -NH-R5, -N (R9) (R1 (}), or -0-R5 at the 4-position. Substitute. Preferred compounds of this best embodiment include the following, but are not limited thereto:

Read first read the notes on the back, then fill out this page Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs HO 〇 662

〇

-234- This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297mm) 541309 Α7 Β7 V. Description of invention (232) 686

689a

914

(Please read the notes on the back before filling out this page) Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 915

Η and -235- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (233)

Other preferred compounds of this best embodiment include, but are not limited to: 214k

And please read the notes of δ first and then fill in this page. 214m

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs In addition, Aγ3 is a phenyl group, which is mono- or polysubstituted by -R9 at the 3- or 5-position, in which the straight or branched alkyl group is; and at the 4-position,- 0-R5 single or multiple substitutions. The preferred compounds of this best embodiment include the following, but are not limited to them: 236- This paper size applies Chinese National Standard (CNS) A4 (210X 297 mm) 541309

AT B7 V. Description of the invention (234) η 671

〇 684

689b

CHs Printed by the Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs 691a

Η

OH -237- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (235)

Printed by the Consumers' Cooperative of the Central Government Bureau of the Ministry of Economic Affairs. Another preferred compound for this best embodiment includes, but is not limited to: 214w 〇

-238- (Please read the notes on the back before filling in this page)

This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7

HO

5. Description of the invention (236: In addition, in this preferred specific example: 115 is -C (O) -R10, where R10 is Aγ3 and the Ai * 3 ring group is selected from the following including the i group, the fluorenimidine group, Far-phenyl, phenyl 4-yl, isopropylquinyl, and benzo [b] thiophenyl, and the cyclic group may be-(or mono- or poly-substituted) as required. Preferred compounds of this preferred embodiment include The following, but not limited to it: And please read on the back of Winter I Matters I Write Page 920

Printed by the Consumer Cooperatives of the China Standards Bureau of the Ministry of Economic Affairs, the Af3 ring group is isoquinolinyl, and the ring group is substituted by -Qi, as required. The preferred compounds for this best specific example include the following, but are not limited to this: -239 This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 Employee Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs Printing V. Description of Invention (237)

696-1

And other preferred compounds of this best embodiment include the following but are not limited to this: -240- (Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 Α7 Β7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (238) 0

In addition, in this preferred embodiment, R5 is -C (O) -R10, wherein R! Η is -Aγ3 and the Aγ3 ring group is substituted by phenyl '. \ / 0

CH 2 The preferred compounds of this preferred embodiment include the following but are not limited to it (please read the notes on the back before filling out this page). Here: Here: 910

The preferred compounds of this preferred embodiment include, but are not limited to

Specific examples (L) Other compounds include the following but are not limited to the following: -241-This paper size is applicable to China National Standard (CNS) 8 4 specifications (210 × 297 mm),-mouth

I 541309 A7 B7 V. Description of the invention (239) 〇 214f

Ο 214g

〇 214h

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 214

-242- (Please read the notes on the back before filling this page)

This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Invention Statement (24Q) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 〇

-243- (Please read the precautions on the back before filling out this page) The paper size applies to the Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of the invention (241: Ο 265d

265f 〇 α

ο (Please read the notes on the back before filling this page) 280b

MeSOj

Ο 280c

Printed by Ningyang Standard Bureau of the Ministry of Economic Affairs, Consumer Cooperatives 〇 28〇d

-244-This paper size is in accordance with Chinese National Standard (CNS) A4 specification (2 丨 0X 297 mm) 541309 A7 B7 V. Description of Invention (242) Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 〇

-245- This paper size applies to China National Standard (CNS) A4 (210X297mm) (Please read the notes on the back before filling out this page to order 541309 A7 B7 V. Description of invention (243) Employees of the Central Bureau of Standards, Ministry of Economic Affairs Printed by the cooperative

-246- (Please read the notes on the back before filling this page)

This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of invention (2 Cape 501

HaC Ο 505b

505c

(Read the M notes on the back before filling in this page)

, 1T Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 505e 505d

Mc6〇5-

• This paper size applies to China National Standard (CNS) A4 (210X29 * 7mm) 541309 A7 B7 V. Description of the invention (245) 〇 505f

〇 510a

ο (Please read the notes on the back before filling this page)

510b 〇

〇 510c

Order Printed by the Employees' Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 〇 510d

OH 〇 H 〇

-248- This paper size applies to Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of the invention (246) 〇 511c 640

〇 642

(Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs 645

-249- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297mm) 541309 Α7 Β7 V. Description of the invention (247)

〇

α Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 〇

(Please read the notes on the back before filling out this page)

The size of this paper is applicable to Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 Λ7 B7 V. Instruction (248) Ο 1018

Η 1052

Ο 1053

1056

(Please read the precautions on the back before filling out this page) Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 1075 Η Η

OH Η 251-This paper size applies the Chinese National Standard (CNS) Α4ί Seeker (210X 297 mm) 541309 A7 B7 V. Description of the invention (249) Printed by the Consumers Cooperative of the Central Bureau of Standards of the Ministry of Economy. 〇

-252- (Please read the precautions on the back before filling in this page) The size of this paper applies to the Chinese National Standard (CNS) A4 (210X 297 mm) 541309 Α7 Β7 V. Description of the invention (25〇) 0 1109

〇 1110

〇 1111

1112

0 〇

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 0 1113 0

OH Η 253- (Please read the precautions on the back before filling out this page)

This paper size applies to Chinese National Standard (CNS) Α4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (251) 〇 1114

〇 1115

0 1116

〇 1117

(Please read the notes on the back before filling this page), π

I The Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs has broken down.

254- The size of this paper applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (252) 1119

0 1120

〇 1121

(Please read the notes on the back before filling this page)

, 1T 1122 〇

-• i · Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 〇 1123

255- The paper size is applicable to Chinese National Standard (CNS) A4 (210X 297mm) 541309 A7 B7 V. Description of the invention (253)

Ο 21001

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 〇 2100j

Specific examples (K) Other compounds include the following but are not limited to this 256 (Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of Invention (254) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

-257- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210X297 mm) (please read the precautions on the back before filling this page)

Specific Examples (L) Other compounds include the following but are not limited to this H3〇- (684a Η 〇 .CH3 r 688c 〇

Ο

OH η α Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economy Ο 689b-l

Η〇

Νη °

Η

Η 〇 -258- (Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (256) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

-259- (Please read the notes on the back before filling out this page) The size of the paper used for this edition is applicable to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of Invention (257) Central Standard of the Ministry of Economic Affairs Printed by Bureau Consumers Cooperative

-260- (Please read the notes on the back before filling this page)

This paper size is applicable to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of Invention (258) 723

Ο Ο ΌΗ 724

Ο

, OH 725

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs 726

OH Η -261-(Please read the notes on the back before filling this page)

This paper size applies Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of invention (259)

728

729

〇 OHn ^ N ^ h Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 〇

-262- (Please read the notes on the back before filling this page)

This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (26〇) 731

732

733

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 734

263 (Please read the notes on the back before filling in this page)

This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of invention (261! 735

736

HO 〇 Ί3Ί

(Please read the notes on the back before filling this page)

, 1T, ¾ Printed by the S Fee Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs HO Ο 738

-264- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (262)

(Please read the notes on the back before filling out this page) Printed by the Consumers' Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs 〇

-265 · This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of Invention (263) HO 〇 7 43

HO 〇 744

745

(Please read the notes on the back before filling out this page) Order Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 746

ΌΗ, Η -266 This paper size applies to China National Standard (CNS) Α4 size (210 × 297 mm)

This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (265) HO 〇 751

752 HO 〇 α

ΗΟ ο 753

Printed by Ningyang Bureau of Standards, Ministry of Economic Affairs, Consumer Cooperatives 754

268- (Please read the notes on the back before filling in this page)

This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (266) 755

HO 〇 756 Ί5Ί

(Please read the notes on the back before filling out this page) Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs HO 〇 758

-269 This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of Invention (267) 759

HO 〇 760

OH HO 〇 7 61

Printed by the Employees' Cooperatives of the S-Square Bureau of the Ministry of Economic Affairs 762

270- (Please read the notes on the back before filling this page)

This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of invention (268) 0

Η

a --------- Clothing-(Please read the notes on the reverse side before filling out this page) Order Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

27 This paper is again applicable to China National Standard (CNS) A4 (210X 297 mm) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 —— ~ V. Description of Invention (269)

Specific examples (K) and (L) The best compounds are those in which the Ai &gt; 3 ring group is an isoquinolinyl group. The compounds of the present invention are described in commonly-owned U.S. Patent Series Nos. 08 / 575,641 and 08 / 598,332, the disclosures of which are incorporated herein by reference. The compounds of the invention have a molecular weight of less than about 700 ear swallows, and preferably between about 400 and 600 ear tips. These preferred compounds are readily absorbed by the patient's bloodstream after oral administration. This oral availability makes this compound an excellent agent in the treatment and prevention of orally administrable diseases against IL-1-, cell-expected cells-, IGIF- or IFN-r-mediated diseases. It should be understood that the compounds of the present invention can exist in various equilibrium forms, based on conditions including the choice of solvent, pH, and others known to the skilled artisan. All such forms of these compounds can be freely incorporated in the present invention. In particular, many compounds of the present invention, especially those containing a ketone or aldehyde group in r3 and a carboxylic acid group in T, may be in a semi-ketal (or semi-acetal) or hydrated form. For example, the compound of the specific example (A) can show the following form: -272- This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X 297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (27Q:

The hydration type is based on the choice of solvent and other conditions known to those skilled in the art. The compounds of the present invention can also be acetoxy ketals, S-containing oxyacetals, ketals, or acetals: 0 (CJ2; 〇 (C ^ Jrrv —C Please read the note before completing this page

Ri—N— ο— C-R〇: Rj-N— &gt;: Ri-N— (㈣ 9—C—Rtj χ / (CJ2) l

O acetoxy ketal or acetoxy acetal \ ^ 4 \ (〇Wg_ ^ Rx3 ketal or acetal type printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economy Allomeric forms. All such forms of these compounds are freely incorporated into the present invention. It should be understood that the compounds of the present invention may be modified by suitable functional groups to enhance selective biological properties. Such changes are known in the art, and Including biological penetrability (such as blood, lymphatic, central nervous system) that can increase to specific biological systems, increase oral utilization, increase solubility by injection, change metabolism and change excretion rate. In addition, compounds can be changed A prodrug type, such a desired compound can be produced in a patient as a result of prodrug metabolism or other life-and-death processes. This prodrug type is usually rare or inactive in in vitro assays. Examples include Compound-273- This paper is scaled to the Chinese National Standard (CNS) A4 (2I0X 297 mm) 541309 Central Bureau of Standards, Ministry of Economic Affairs A7 B7 printed by Industrial and Commercial Cooperatives V. Description of the Invention (271) The ketal, acetal, oxime, imine, and amidine form contain ketone or aldehyde groups, especially when they occur in the r3 group of the compound of the present invention. Other examples of prodrug types include hemi-ketal, hemi-acetal, acetoxy ketal, acetoxy acetal, ketal and acetal types, which are described in EQ1 and EQ2. ICE and D-X dissociation and Since it was pre-activated, the previous identification of IGIF ICE protease was through its in vitro and in vivo treatment of inactive -IL-1 /? Into a mature and active IL-1 / 3, a pre-inflammatory molecule with the ability to Here we show that ICE and its close homogeneous TX (Caspase-4, C. Faucheu et al., EMBO, 14, p. 1914 (1995)) can proteolytically dissociate before inactivity-IGIF. This processing modification step needs to convert the pre-IGIF into its active mature form, IGIF. Dissociation of the pre-IGIF by ICE and possibly TX also helps to transport IGIF out of the cell. We first use plastids to transduce Cos cells Transient co-expression to determine if any known members of the ICE / CED-3 protease family can be used in culturing cells Pre-IGIF was processed to IGIF (Example 23) (Figure 1A). Figure 1A illustrates ICE dissociates pro-IGIF from Cos cells, which are co-transfected with plastids that can express pro-IGIF in the presence of active ICE. Cos cells exhibit plastid transduction. This plastid is either the plastid plastid indicated by pro-IGIF (column 2) alone or in combination. Type (columns 3-12). Cell lysates were prepared and immunosucked with anti-IGIF antiserum to analyze the presence of IGIF protein. One column contains lysates from blank transduced cells. The joint performance of pro-IGIF and ICE or TX will cause pro-IGIF to dissociate into peptides that are similar in size to naturally-occurring 18-kDa mature IGIF. This processing -274- (Please read the notes on the back before filling this page

I This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (272) (Please read the notes on the back before filling this page) Modification events can be blocked by a single point mutation It was concluded that this point mutation altered the catalytic cysteine residues and thus deactivated ICE and TX (Y. Gu et al., EMBO, 14, P. 1923 (1995)). And CPP32 (Caspase-3)-a protease involved in expected cell death (T. Fernandes-Alnemri et al., J. Biol. Chem., 269, p. 30761 (1994); DW Nicholson et al., Nature, 376, p. 37 (1995)), can cause dissociation of pro-IGIF to produce smaller peptides, and are similar to CMH-1 (Caspase-7), a homogeneous substance very similar to CPP32 (J. A. Lippke et al., J. Biol. Chem., 271, p. 1825 (1996)) co-expressed that Bay could not dissociate pro-IGIF to any significant degree. Therefore, ICE and TX seem to be able to dissociate pro-IGIF into peptides similar in size to naturally occurring 18 kDa IGIF. Next, we checked the ability of these cysteine proteases to dissociate pro-IGIF in a test tube. Here, purified and reconstituted (His) 6i pro-IGIF was used as the substrate (Example 23). Figure 1 B shows pro-IGIF dissociated by ICE in a test tube. Purified and reconstituted (His) 6i pro-IGIF (2 micrograms) and the cysteine protease shown were incubated with or without the ICE or CPP32 inhibitor, as described in Example 23. Dissociated products were analyzed by SDS-PAGE and Cous blue staining. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, ICE can dissociate pro-IGIF of 24 kDa into two peptides of about 18 kDa and 6 kDa. The N-terminal amino acid sequencing of the ICE dissociation product showed that the 18 kDa peptide contained the same N-terminal amino acid residue (Asn-Phe-Gly-Arg-Leu) as the naturally occurring IGIF. This shows that ICE can dissociate pro-IGIF (H. Okamura et al., Infection and

Immunity, 63, p, 3966 (1995); H. Dkamura et al., Nature, 378, -275- The standard of this paper is applicable to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (273) p. 88 (1995)). The N-terminal amino acid sequencing of the CPP32 dissociation product showed that CPP32 can dissociate pro_IGIF at Asp69-Ile70. ICE has a high specificity for the dissociation of pro-IGIF, with a catalytic efficiency of 1. 4 X 107 M · 1 (Km = 0.6 ± 0.1 a M; kcat = 8.6 soil 0.3 · s · 1) (kcat / KM ), And can be specific ICE inhibitors (Ac-Tyr-Val-Ala-Asp-Sui) and Cbz-Val-Ala-Asp-[(2,6-Difluorofluorenyl) oxy] methyl ketone (NA Thornberry et al, ^ Nature, 356 p. 768 (1992); RE Dolle et al., J. Med. Chem., 37, p. 563 (1994)). Figure 1C demonstrates that the solution of ICE in a test tube can activate pro-IGIF. Undissociated pro-IGIF, ICE- or CPP32-dissociated pro-IGIF products, or recombinant mature IGIF (rlGIF) were added to A.E7 cell cultures to the end of 12 ng / ml or 120 ng / ml Concentration (see, Example 23). After 18 hours, r-IFN in the culture medium was quantified by ELISA. Although undissociated pro-IGIF has no detectable r-IFN-deficient activity, ICE-dissociated pro-IGIF is still active in deflecting r-IFN produced by Thl cells. Like ICE, the homogeneous TX of ICE can dissociate pro-IGIF into peptides of similar size. However, its catalytic efficiency is about two times less than that of ICE. Printed by the Consumer Consumption Cooperative of the China Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back before filling this page) Consistent with the observation of the above Cos cell experiment, CPP32 can dissociate pro- at different positions (Asp69-Ile70) lGIF, and the resulting peptide has little r-IFN-deficient activity (Figure 1C). CHM-1 and granzyme B each failed to dissociate prO-1 GIF to any significant degree. Together, these results demonstrate that in Cos cells and in test tubes, ICE and TX can process modified inactive pro-IGIF at the expected mature site to generate biologically active IGIF molecules. -276- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 541309 A7 B7 V. Description of Invention (274)

Pro-IGIF is a modified treatment of ICE that helps it to transport IGIF produced in vivo to activated Cooper's cells and macrophages, and can transport cells once stimulated by endotoxin (H. Okamura et al., Infection and Immunity, 63, p. 3966 (1995); H, Okamura et al., Nature, 378, p. 88 (1995). We used the Cos cell co-expression system (Example 23) to check that pro-IGIF was extracellular as Does ICE dissociation help mature IGIF to be transported out of cells. This is like pro-IL-1; 5—for example, it can dissociate ICE into active IL-1 /? (NA Thornberry et al., Nature, 356, p 768 (1992)). In Figure 2A, Cos cells express pro-IGIF alone (columns 2 and 6) or a combination of wild-type expression plastids (columns 3 and 7) or inactive mutations. ICE (columns 4 and 8) are transduced and metabolically labeled with 35S-methionine (see Example 24). Lysates (left) and adaptation media (right) are immunoprecipitated with anti-IGIF antiserum. The proteins were analyzed by SDS-PAGE and fluorometer. (Fig. 2A) 〇 Large and medium in Cos cell-adjusted medium co-expressed with pro-IGIF and ICE. An 18 kDa peptide equivalent to or mature IGIF, and Cos cells expressing pro-IGIF and inactive ICE mutant strain (ICE-C285S) or ρΓ0-IGIF (-) alone delivered only very low levels of pro-IGIF There is no measurable mature IGIF. We estimate that about 10% of mature IGIF can be transported from co-transduced cells, and more than 99% of pro-IGIF remains in the cells. We also detect lysis Whether r-IFN is viable in the product and the above-mentioned medium for transfecting cells (see Example 24). R-IFN can be detected in lysates and Cos cell-adjusting media that co-expresses pro-IGIF and ICE. Li-277- This paper size applies Chinese National Standard (CNS) Α4 specification (210X 297 mm) (Please read the precautions on the back before filling this page)

1T 541309 Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (275) Conductive activity, but not only cells that show pro-IGIF or ICE alone (Figure 2B). These results show that ICE dissociation of pro-IGIF facilitates the transport of mature and active IGIF from cells. Pro-IGIF is the physiological substrate in vivo of ICE. In order to study the role of ICE in the proteolytic activation and transport of IGIF under physiological conditions, we examined the processing modification of pro-IGIF and the mature IGIF self-lipopolysaccharide (LPS) -activated. Coffer's cells were transported, which were recovered from Propionibacterium acnes-wild wild-type and ICE-deficient (ICE-/-) mice (Example 25). -As shown in Figure 3A, Coffer cells from ICE-// mice were missing in IGIF transport. Cooper's cell lysates from wild-type and ICE-/-mice were determined by ELISA to contain similar amounts of IGIF. However, IGIF is only detected in wild-type adaptation media and not in ICE-/-cells. Therefore, ICE-deleted (ICE-/-) mice can synthesize pro-IGIF, but cannot transport it as extracellular pro- or mature IGIF. In order to determine whether ICE-/-mice can process intracellular pro-IGIF but cannot transport IGIF, the wild-type and ICE-/-mice's Kuffert cells were metabolically labeled with 35S-methionine The IGIF immunoprecipitation experiment was performed on the lysate and the adapted medium as described in Example 25. These experiments demonstrate that untreated pro-IGIF is present in wild-type and ICE-/-Coffer cells. However, 18-kDa mature IGIF is only present in wild-type adapted medium and not ICE-/-Cuff's cells (Figure 3B). This shows active ICE transporting the treated IGIF out of the cell. In addition, the adaptation medium from wild-type rather than ICE-/-Cuff's cells -278- This paper size applies to China National Standard (CNS) A4 specifications (210X 297 mm) (Please read the notes on the back before filling out (This page)

541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the Invention (276) Contains IFN-r defamatory activity, which is not due to the effect of IL-12 because it neutralizes anti-IL-12 antibodies Is sensitive. The lack of IGIF in the ICE- / Cuff's cell conditioning medium is consistent with that seen in Cos cells. Here, ICE treatment and modification of pro-IGIF is necessary for the delivery of active IGIF. Figures 3C and 3D show that IGIF and IFN-factory serum levels of ICE-/-mice were reduced in vivo, respectively. Wild-type (ICE + / +) and ICE-/-mice prepared with heat-inactivated propioni-like bacteria were tested with LPS- (example 26) and detected by EUSA 3 hours after LPS Levels of IGIF (Figure 3C) and r-IFN (Figure 3D) in the serum of challenged mice (Example 25). ICE-/-mice stimulated with Propionibacterium acnes and LPS had a reduced amount of IGIF in their serum (Fig. 3C) and had no detectable IFN-r slander activity in the presence of anti-IL-12 antibodies. The reduced serum levels of IGIF appear to be responsible for significantly lower levels of IFN-r in the serum of ICE-/-mice (Figure 3D), as we have observed that under these conditions, £ 10 /-mice produce IL-12 There are no significant differences. Consistent with this statement is the finding that non-adherent splenocytes from wild-type and ICE-/-mice can produce similar amounts of IFN-r when stimulated in vitro with recombinant-active IGIF. Therefore, the impaired fertility of IFN-r is not caused by any obvious defect in ICE-/-old mouse T cells. Taken together, these results establish a critical role for ICE in the treatment of modified IGIF precursors and in the use of active IGIF in vitro and in vivo. In order to examine the correlation between IFN-r serum levels and ICE in vivo activity in more detail, time course was performed after LPS-plating wild type and ICE-deleting mice (Example 26) (Figure 4). Figure 4 shows the increase in serum IFN-r over time in wild-type mice. -279- This paper size applies the Chinese National Standard (CNS) A4 specification (210X29 * 7 mm). (Please read the note on the back first Please fill in this page again for matters) 541309 A 7 B7 V. Description of Invention (277) Occurred 9-18 hours after LPS · platform ^ 17 ng / ml sustained level. As predicted by the above experiments, the r-IFN serum level was significantly lower in ICE-/-mice, reaching a high of 2 nanograms / ml at the same period, which is about 15% seen in wild-type mice (Figure 4). Animals were also observed for clinical signs of sepsis and challenged to detect changes in body temperature at 30-mg / kg or 100-mg / kg LPS (ICE- / · only) in wild-type and ICE-/-mice every 4 hours. The results shown in Figure 4 show that wild-type rats can experience a significant drop in body temperature (from 36X: to 26 ° C) within 12 hours of LPS-platooning. The clinical signs of sepsis were 4 *, and all animals died within 24-48 hours. In contrast, ICE-/-mice administered with 30 mg / kg LPS experienced a decrease in body temperature of only 3 °-4 ° C, with few symptoms of pain and no fatalities. ICE-/-mice administered with 100 mg / kg LPS experienced clinical symptoms, decreased body temperature, and mortality similar to wild-type mice at 30 mg / kg LPS. ICE inhibitors Ac-YVAD-CHO and IL-1 and IFN-r are equivalent strength inhibitors. Due to the biologically active IGIF, its processing modification and secretion are mediated by ICE, which is equivalent to peripheral blood mononuclear cells (PBMC In the analysis method, the activity of ICE-reversible inhibitor (Ac-YVAD_CHO) on IL-1 / 3 and IFN-r production was compared (Example 27). Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page) The results in Figure 5 show that Ac-YVAD-CHO ICE inhibitors reduce IL-1 / 5 and IFN-r in human PBMCs The ability of production system has similar strength, each IC5Q is 2.5αM. Similar results were obtained with wild-type mouse spleen cells. These findings provide additional evidence that pro-IGIF is the physiological substrate of ICE and suggest that ICE inhibitors will control the physiological levels of IGIF and IFN-r. -280- This paper is sized to the Chinese National Standard (CNS) A4 (210X29 * 7mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs. 5. Description of the invention (278) Useful tools. Taken together, we have found that ICE can control IGIF and IFN-r levels in vivo and in vitro, and ICE inhibitors can reduce IGIF and IFN-r levels in human cells. These results have been described in co-owned U.S. Patent No. 08 / 712,878, the disclosure of which is incorporated herein by reference. Compositions and methods The pharmaceutical compositions and methods of the present invention can be used to control the levels of IL-1, IGIF and IFN-7 * in vivo. The method and composition of the present invention can therefore be used to treat or reduce the progress of the mediating conditions mediated by IL-1, IGIF- and IFN-r, and the severity of the effects. The compounds of the invention are effective ligands for ICE. Therefore, these compounds can target and inhibit IL-1-, cell expected death-, IGIF-, and IFN-r-mediated events in diseases, and therefore in inflammatory diseases, autoimmune diseases, destructive bones, The ultimate activity of proteins in proliferative disorders, infectious diseases, and degenerative diseases. For example, the compounds of the present invention inhibit the conversion of precursor IL-ly5 to mature IL-1 / 3 via inhibition of ICE. Because ICE is necessary to produce mature IL-1, the inhibition of this enzyme can effectively block the physiological effects of IL-1-mediated and the onset of symptoms, such as inflammation, which is caused by inhibiting the production of mature IL-1. to make. Therefore, by inhibiting the precursor activity of IL-1 / 5, the compounds of the present invention can be effectively used as IL-1 inhibitors. Similarly, the compounds of the invention inhibit the conversion of precursor IGIF into mature IGIF. Therefore, by inhibiting the production of IGIF, the compounds of the present invention can be effectively used as inhibitors of IFN-r production. Therefore, a specific example of the present invention is proposed to reduce IGIF -281 in individuals-this paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) (please read the precautions on the back before filling this page) ) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau, Ministry of Economic Affairs. 5. Method of making the invention (279). This method involves administering a pharmaceutical composition to an individual, which contains a therapeutically effective dose of an ICE inhibitor and a pharmaceutically acceptable Accepted vehicle. Another embodiment of the present invention proposes a method for reducing the production of IFN-Γ in an individual, which includes administering a pharmaceutical composition to the individual, which contains a therapeutically effective dose of an ICE inhibitor and a pharmaceutically acceptable carrier. In another embodiment, the method of the present invention comprises administering a pharmaceutical composition to an individual, which contains an inhibitor of ICE-related protease, which can dissociate pro-IGIF to produce active IGIF, and a pharmaceutically acceptable carrier. . One such ICE-related protease is fx, as described above. The present invention therefore proposes a method and a pharmaceutical composition for controlling the levels of IGIF and IFN-r by administering a T X inhibitor. There are also other ICE-related proteases that can be modified by treatment with pro-IGIF into active IGIF forms. Therefore, it can be seen that the inhibitors of these enzymes can be known by skilled artisans and also fall within the scope of the present invention. The compounds of the invention can be applied in a conventional manner to treat diseases mediated by IL-1, expected cell death, IGIF or IFN-r. Such treatment methods, dosage levels and requirements can be selected from the methods and techniques available to artisans. For example, the compounds of the present invention can be administered in combination with a pharmaceutically acceptable adjuvant, in a pharmaceutically acceptable manner and in a dose effective to reduce the severity of the disease, to IL-1-, expected cell death-, IGIF- or IFN- In patients suffering from r-mediated diseases 3 In addition, the compounds of the present invention can be used in compositions and methods to treat or protect individuals for a long period of time against antagonistic IL-1-, expected cell death-, IGIF- or IFN-r -modulated Disease. The compound can be used alone or in combination with other compounds of the present invention. -282- This paper size applies to Chinese National Standard (CNS) A4 (2 丨 0X 297 mm) (Please read the precautions on the back before filling this page) 541309 Ministry of Economic Affairs A7 B7 printed by the Consumer Standards Cooperative of the Central Bureau of Standards 5. The invention description (28G) is applied to this composition together in a manner consistent with the traditional availability of ICE inhibitors in pharmaceutical compositions. For example, the compounds of the present invention can be combined with pharmaceutically acceptable adjuvants traditionally used in vaccines and administered in prophylactically effective doses for long-term protection. Individuals antagonize IL-1-, expected cell death-, IGIF- or IFN-r -Mediation diseases. The compounds of the present invention can also be co-administered with other ICE inhibitors to increase the therapeutic or preventive effect against various IL-1-, expected cell death-, IGIF- or IFN-r -mediated diseases. In addition, the compounds of the present invention can be combined with conventional anti-inflammatory agents or matrix metalloproteinase inhibitors, lipoxygenase inhibitors, and cytokinin antagonists other than IL-1 / 3. The compounds of the present invention can also be used with immune modulators (such as bropirimine, anti-human π interferon antibody, IL-2, GM-CSF, methionine enkephalin, interferon, diethyl dithiocarbamate, Tumor necrosis factor, naltrexone and rEPO) or in combination with prostaglandins to prevent or combat symptoms of diseases mediated by IL-1, such as inflammation. When a compound of the present invention is administered in combination with other agents, it may be administered to a patient sequentially or simultaneously. In addition, the pharmaceutical or prophylactic composition according to the present invention includes a combination of the ICE inhibitor of the present invention and other therapeutic or prophylactic agents. The pharmaceutical composition of the present invention includes any one of the compounds of the present invention, and a pharmaceutically acceptable salt thereof, plus any pharmaceutically acceptable carrier, adjuvant, or vehicle. The pharmaceutically acceptable carriers, adjuvants and solvents that can be used in the pharmaceutical composition of the present invention include the following but are not limited to the following: ion exchanger, alumina, -283- This paper is applicable to Chinese National Standard (CNS) A4 specification (210X297mm) (please read the notes on the back before filling in this one) 541309 A7 B7 V. Invention Description (281 Consumption cooperation with employees of the Central Associate Bureau of the Ministry of Economic Affairs) Printing aluminum stearate, which is phospholipid , Self-emulsifying drug delivery systems (sedds) such as pan-sheng # tocopherol polyethylene glycol 1000 succinate, or other similar polymer delivery matrix, serum proteins, such as human serum albumin, buffer substances such as phosphate Salts, glycerol, sorbic acid, potassium sorbate, a mixture of glycerol and vinegar in saturated plant fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, chlorine chloride, zinc salts, gums Silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substance, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylate, waxy, polyethylene_polyoxypropylene-form Block polymer, polyethylene Alcohols and lanolin. Cyclodextrins such as α ·, 々- and factory_cyclodextrin 'or chemically modified derivatives such as hydroxyalkyl cyclodextrin, including 2 · and 3- borrowed propyl-cyclocyclodextrin, Or other solubilizing derivatives can also be beneficially used to enhance the delivery of the compounds of the present invention. The tauological composition of the present invention can be taken orally, enterally, sprayed by inhalation, rectal, nasal, buccal, vaginal or implanted To be administered by the wild depository. The second class is more preferred: serving. The pharmaceutical composition of the present invention may contain any traditionally beneficial; sexually acceptable pharmaceutically acceptable carrier, adjuvant or solvent. The f-number can be adjusted with a pharmaceutically acceptable acid, and the substance can be adjusted to enhance the compound or its delivery mode. The parenteral means include subcutaneous, intrakeratinous, intravenous, intramuscular, arterial = intra-membrane, intrasternal. Injury ... and intracranial injection or pharmaceutical composition can be in the form of sterile injectable preparations, such as Γ; can be: aqueous or r suspension. This suspension can be used in accordance with known techniques in the art, using a dispersant Or the agent (such as Twee ^ Zhouhe bacteria injectable preparations can also be in A j. Tick ..., mother · By exogenous acceptable diluent nuisance

M's scale is applicable to China's national standard (CNS

(Please read the precautions on the back before filling in this page.) R. · 541309 V. Description of the invention (283) <Recommended suitable ointment. The present invention includes a carrier-enveloping compound containing oil, liquid rocky soil, white rock ocher, and C., emulsified soil and water, but it is not limited to a suitable lotion or emulsion, and the carrier contains . Suitable carriers include mineral oil, two: 1: vinegar, polysorbate 60, whale dagger, jealous # 甘 _ deca wax cetyl alcohol, 2 · octyldodecane: / /. The pharmaceutical composition of the present invention can also be applied topically to a lower anal preparation or a suitable enema preparation. Bureau Shao's transdermal patches are also included in the invention; ^ invention. The pharmaceutical composition of the present invention can be administered via nasal aerosol or inhalation. This composition is prepared according to techniques well known in pharmaceutical blending technology, and can be prepared as a solution in saline, using alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, carbohydrates and / Or other solubilizing or dispersing agents known in the art. The active component compounds are printed between about 0.001 and about 100 mg / kg body weight per day printed by the Consumer Cooperative of the Central Sample Bureau of the Ministry of Economic Affairs, preferably between about 1 and 50 mg / kg body weight per day at the dosage level, available In the prevention and treatment of IL-1 ·, expected cell death, committing Liaoning and IFN_, · mediated diseases, including hair and disease, autoimmune diseases, destructive osteodystrophy, proliferative disorders, infectious diseases, Degenerative disease, necrotic disease 'osteoarthritis' acute pancreatitis, chronic pancreatitis, asthma, pain syndromes in adults, angioglobulonephritis, rheumatoid arthritis, systemic lupus erythematosus 'scleroderma' Chronic thyroiditis, Graves' disease, autoimmune gastritis, insulin-dependent diabetes mellitus (type I), autoimmune hemolytic anemia, autoimmune neutropenia, thrombocytopenia, 286 The paper scale is applicable to the Chinese National Standard (CNS) A4 (210X; 297 mm). Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. 541309 A7 _ _________B7 V. Description of Invention (284) Slow Active hepatitis, myasthenia gravis, inflammatory bowel disease, heart disease, psoriasis, graft-to-host disease, osteoporosis, multiple myeloma-related skeletal disorders, acute myeloid leukemia, chronic myeloid leukemia, Metastatic melanoma, Kaposi's sarcoma, multiple myeloma sepsis, septic shock, Shigella's disease, Alzheimer's disease, Parkinson's disease, cerebral hemorrhage, myocardial ischemia, spinal muscular atrophy Disease, multiple sclerosis, AIDS-related encephalitis, HIV-related encephalitis, aging, baldness, and neurological damage due to stroke. Typically, the pharmaceutical composition of the present invention can be administered about 5 to 5 times per day, or in a continuous infusion manner. This administration can be used for chronic or acute treatment. It can be used in combination with a carrier to produce a single dosage form of the active ingredient in the treated host and the particular mode of administration. Typical formulations usually contain from about 5% to about 95% of the active compound. Well, this formulation contains from about 20% to about 80% of the active compound. Once the condition of the patient has improved, a maintenance dose of a compound, composition or combination of the present invention can be administered if necessary. Next, the dose or frequency of administration can be reduced, which is a function of symptoms to maintain a level of improvement, and treatment can be discontinued when symptoms ease to the desired level. However, patients may require long-term intermittent I treatment to prevent any recurrence or symptoms of the disease. As for the artisan, it should be understood that lower or higher dosages may be required. The specific dose and treatment of any particular patient will depend on various factors, including the activity of the particular compound used, the patient's age, weight, general health, gender, diet, time of administration, excretion rate, contraindications to medication, disease The severity and course of the disease, the patient's tendency to the disease, and the judgment of the treating physician. -287- The size of this paper is toward the towel (CNS) Α4 size (210X29 ^^ 7 (Please read the precautions on the back before filling this page)

1T 541309 V. Description of the invention (285, can be used in combination with the present invention% ^, Jiang-1 mediation disease treated or prevented by the property # listed ^, but is not limited to this: hair rickets include lower bone disease, roast颏 w &amp; human steep disease, autoimmune disease, destructive two-way :: proliferative disorders, infection can be compounds of the present invention ^ ^ ^ ^ ^ ^ · 〇 treatment or prevention of cells expected to die-mediated diseases include Degenerative diseases. &Amp;Fear; or: Γ Inflammatory diseases include the following, but are not limited to the following: ^ m pancreatitis, chronic pancreatitis, asthma, and respiratory symptoms in adults. Better inflammation The disease is osteoarthritis or acute visceritis. The autoimmune diseases that can be treated or prevented include the following, but are not limited to this. Hemorrhagic nephritis' rheumatoid arthritis, systemic lupus erythematosus, scleroderma , Chronic thyroiditis, Grave's disease, autoimmune gastritis, insulin-dependent diabetes mellitus (type 1), autoimmune hemolytic anemia, autoimmune neutropenia, thrombocytopenia, chronic Active hepatitis, myasthenia gravis' Sclerosis, inflammatory bowel disease, Crohn, s disease, = ringworm and graft versus host disease. A better autoimmune disease is rheumatoid arthritis' inflammatory bowel disease, Crohn's disease, or psoriasis. Destructive skeletal disorders that can be treated or prevented include osteoporosis and skeletal disorders related to multiple myeloma. The Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs have printed μ-treated or prevented proliferative diseases including the following, but Not limited to this: acute I * monthly "sexual leukemia" 1¾ myeloid leukemia, metastatic melanoma, Kaposi's sarcoma, and multiple myeloma. Infectious diseases that can be treated or prevented include sepsis, sepsis Shock, and Shigella disease, but it is not limited to this. IL-1 -Mediated degenerative or -288- that can be treated or prevented by the compounds of the present invention This paper is in accordance with Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (2 Ming) Bad diseases include Alzheimer's disease, Parkinson's disease, cerebral hemorrhage and Myocardial ischemia, but it is not limited to this. Preferably, the degenerative disease is Alzheimer's disease. Expected cell deaths that can be treated or prevented by the compounds of the present invention_ Mediated degenerative diseases include Alzheimer's Disease, Parkinson's disease, cerebral aversion, myocardial ischemia, spinal muscular atrophy, multiple sclerosis, AIDS_related encephalitis' HIV-related encephalitis, aging, baldness, and neurosis due to stroke The method of the present invention can be used to treat or reduce the progress, severity or effect of IGIF- or IFN-r • mediated inflammation, blood immunity, infectivity, proliferative, destructive bone, necrotic and degenerative conditions, Including diseases, disorders, or effects, where conditions are characterized by increased levels of IGIF or IFN-r production. Examples of such inflammatory conditions include, but are not limited to, the following: osteoarthritis' acute pancreatitis, chronic pancreatitis, asthma, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, colon ulcer, cerebral hemorrhage , Myocardial ischemia, and respiratory distress syndrome in adults. Good inflammatory conditions are rheumatoid arthritis, colon ulcers, Crohn's disease, hepatitis, and respiratory distress syndrome in adults. Examples of such infectious conditions include, but are not limited to, infectious hepatitis, sepsis, septic shock, and rabbit-like rickets. Examples of such autoimmune conditions include, but are not limited to the following: angioglobulonephritis, systemic lupus erythematosus, scleroderma, chronic thyroiditis, Grave's disease, autoimmune gastritis, insulin-dependent Type 2 Diabetes type) 'Diabetes type, autoimmune hemolytic anemia, autoimmune -289- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back first (Fill in this page) r Binding and printing Printed by the Central Consumers Bureau of the Ministry of Economy Staff Consumer Cooperatives 5413〇9 A7

^ Born neutropenia, thrombocytopenia, myasthenia gravis, multiple sclerosis 'psoriasis, lichen planus, graft versus host disease, acute dermatomyositis' wet therapy, primary sclerosis, hepatitis, uveitis, Behcefs disease, acute dermatomyositis, atopic skin disease, pure red blood cell dysplasia, male dysplasia, amyotrophic lateral sclerosis and nephrotic syndrome. Preferably, the autoimmune conditions are glomerulonephritis, insulin-dependent diabetes (type I), juvenile diabetes, psoriasis, graft-to-host disease, including transplant rejection, and hepatitis. Examples of such destructive skeletal disorders include osteoporosis and multiple myeloma-related skeletal disorders. Examples of such colonic conditions include, but are not limited to the following: acute myeloid leukemia, chronic myeloid leukemia, metastatic melanoma, Kaposi's tumor, and multiple myeloma. Examples of such neurodegenerative conditions include, but are not limited to, the following: Alzheimer's disease, Parkinson's disease, and Huntington's disease. Although the present invention focuses on the use of the compounds herein for the prevention and treatment of ILq, expected cell death, IGIF- and IFN-mediated diseases, the compounds of the present invention can also be used as inhibitors of other cysteine proteases. The compounds of the present invention can also be used as commercial reagents, which can effectively bind to ICE or other cysteine proteases. As a commercial reagent, the compounds of the present invention and their derivatives can be used in biochemical or cellular analysis of 1 (:) £ and ICE homologs to block proteolysis of the target peptide, or can be derivatized to bind to stable The resin is used as a range substrate for affinity chromatography applications. These and other uses are characterized by commercial cysteine protease inhibitors -290- This paper is sized to the Chinese National Standard (CNS) A4 (210X 297mm) (Please read the notes on the back before filling this page)

541309 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. 5. Description of Invention (288) Artists understand. Method for preparing N-fluorenylamino compound The ICE inhibitor of the present invention can be synthesized using conventional techniques. Beneficially, the compounds can be conveniently synthesized from readily available starting materials. The compounds of the invention are the most easily synthesized of the known ICE inhibitors. The previously mentioned ICE inhibitors often contain more than 4 palm centers and many peptide chains. The compounds of the present invention can be synthesized relatively easily, which represents the advantage that these compounds can be produced on a large scale. For example, the compounds of the invention can be prepared using the methods described herein. To the best of the artisan's knowledge, these methods are not the only methods in which compounds described in this case and patented are synthesized. Further methods are obvious to the artisan. In addition, the various synthetic steps described herein can be performed in a different order or sequence to generate the desired compound. The invention also proposes a preferred method for preparing the compounds of the invention. Therefore, a method for preparing an N-fluorenylamino compound is proposed in another specific example (M), which includes the following steps: a) mixing a carboxylic acid with an N-allo-protected amine group, and the presence of an inert solvent, Phenylphosphine, nucleophilic scavenger, and triphenylphosphine palladium (0) at ambient temperature and inert atmosphere; and b) Add HOBT and EDC to the mixture in step a); and include further if necessary: c) hydrolysis b) the step mixture in the presence of a solution containing an acid and H20, wherein the b) step mixture is previously concentrated as required before hydrolysis. Preferably, this inert solvent is CH2C12, DMF, or CH2C12 &amp; DMF -291-This paper size is applicable to China National Standard (CNS) A4 specification (210X 297 mm) (Please read the precautions on the back before filling this page ) 541309 A7 B7 V. Description of the invention (29G) where R51 is as defined in the specific example (B); (b) 〇

Or (C) is better, the N-allo-protected amine is: 0

(Please read the notes on the back before filling out this page) Printed by the Employees' Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs, where R51 is as defined above. In a preferred method, the substituents are as defined in the specific example (A). In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein &amp; is as defined in the specific example (B) above, and R2 is as defined in the specific example (M). Preferably, in these alternative methods, the substituent is as defined in the specific example (B) above. In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein &amp; is as defined in the specific example (C) above, and R2 is as defined in the specific example (M) above. Preferably, in these additional processes, the substituents are as defined in the specific example (C) above. In addition, the N-fluorenylamino compound is represented by the formula (VIII), wherein it is as defined in the specific example (C) above, and R2 is as defined in the specific example (M). Preferably, in these other processes, the substituents are as defined in the specific example (D). -293 This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economy The base compound is represented by formula (VIII), wherein h is as defined in the specific example (E) above, and R2 is defined as the specific example (M). Preferably in these additional processes, the substituents are as defined in the specific example (E). In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein &amp; is as defined in the specific example (F) above, and R2 is as defined in the specific example (M). Preferably, in these additional processes, the substituents are as defined in the specific example (F). In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein &amp; is as defined in Specific Example (G), and R2 is as defined in Example M (G). Preferably, in these different processes, the substituents are as defined in the specific example (G). In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein Ri is defined as a specific example (H), and R2 is defined as a specific example (M). Preferably, in these additional processes, the substituents are as defined in the specific example (H). In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein Ri is defined as a specific example ⑴, and R2 is defined as a specific example (M). Preferably, in these additional processes, the substituents are as defined in the specific example (I). In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein & is as defined in Specific Example ⑺, and R2 is as defined in Specific Example (M). Preferably, in these other processes, the substituents are as defined in the specific example (J). In addition, the N-fluorenylamino compound is represented by formula (VIII), where \ is defined as a specific example (K), and R2 is defined as a specific example (M). Preferably, in these additional processes, the substituent is as defined in the specific example (K). In addition, the N-fluorenylamino compound is represented by formula (VIII), wherein it is defined as a specific example (L), and R2 is defined as a specific example (M). -294- This paper size is applicable to China National Standard (CNS) A4 (210X 297 mm) (Please read the notes on the back before filling this page) Inventive note (292) is better than these alternative processes, and the substituents are as defined in the specific example (L). In order to make the present invention more fully understood, the following examples are shown. These examples are for illustrative purposes only and are not intended to limit the invention in any way. Example 1 Inhibition of ICE The inhibitory constants (iq) and IC 50 μE of the compounds of the present invention can be obtained by using the following three methods: 1. UV-visible light receiving enzyme analysis method. Tyr-Val-Ala-Asp-parabens was used as the substrate. Synthesis of homologues is described in LA Reiter (Int. J. Peptide Protein Res. 43 ^, 87-96 (1994)). These assay mixtures contain: 65 microliters of buffer solution (10 mM Tris, 1 mM DTT, 0.1 % CHAPS @ pH 8.1) 10 μl ICE (50 nM final concentration gives a rate of ~ ImOD / min) 5 μl DMSO / inhibitor mixture 20 μl 400 μM substrate (80 μM final concentration) 100 μL The ICE analysis of the total reaction volume in visible light was performed on a 96-well microtiter plate. Add buffer substances, ICE, and DMSO (in the presence of inhibitors) to the holes in the order of the order. The components were incubated at room temperature for 15 minutes, starting when all components were in all holes. The microtiter plate reader was set to incubate at 37 ° C. After 15 minutes of incubation, the substrate was directly added to the pores, and after the release of chromophore (pNA), it was followed for 20 minutes at 405-603 nm and 37 ° C. Perform linear allocation of data -295- (Please read the notes on the back before filling out this page) This paper size applies to China National Standard (CNS) A4 specification (210X 297 mm) System A7 B7 V. Description of the invention (293) The rate is estimated in mOD / min. DMSO was present only when the inhibitor was involved in the experiment, and in other experiments a buffer volume of 100 microliters was made. 2. Enzyme analysis using fluorescent substrates The analysis is basically based on Thornberry et al., (Nature 356 ^: 768-774 (1992)), using substrates 12 referenced in the literature. Substances are: Ethyl-Tyr-Val-Ala-Asp-amino-4-methyl vanillin (AMC) ° Mix the following components: 65 μl buffer solution (10 mM Tris, 1 mM DTT, 0.1 % CHAPS @ pH 8.1) 10 μl ICE (2-10 nM final concentration) 5 μl DMSO / inhibitor solution 20 μl 150 # Μ substrate (30 &quot; M final concentration) 100 μl total reaction volume was analyzed at Perform on a 96-well microtiter plate. Buffer substances and ICE are added to the holes. Incubate the components on a temperature-controlled well plate at 37 ° C for 15 minutes. After 15 minutes of incubation, the reaction began with the addition of substrates, and the reaction was tracked at 37 ° C for 30 minutes. After the AMC fluorophore was released, the laser wavelength of 380 nm and the emission wavelength of 460 nm were used. get on. The data of each hole is linearly matched to determine the rate of fluorescence units per second. In order to determine the enzyme inhibition constant (iq) or the inhibition mode (competitive, uncompetitive or non-competitive), the rate data determined in the enzyme analysis at each inhibitor concentration, using a computer to match the standard enzyme dynamic equation ( (See IH Segel, Enzyme Kinetics, Wiley-Interscience 1975) 0 Match the time-series data of fluorescence with the evolution equation of Morrion to -296- This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) ( (Please read the notes on the back before filling out this page)

541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (294) The determination of the secondary rate constant of the irreversible inhibitor. Morrison, J.F., Mol Cell · Biophys ·, 2, pp. 347-368 (1985) o Thornberry et al. Have published instructions for these methods for detecting the rate constant of ICE irreversible inhibitors. Thornberry, N.A., et al., Biochemistry, 33, pp. 3923-3940 (1994). For no previous complex formation can be observed dynamically, the quadratic rate constant (Kinact) is directly from k. ^ Derived from the straight line plot slope of vs. [I]. For compounds in which the formation of complexes (and enzymes) can be detected previously, the hyperbola of kQbs vs. [I] is combined with saturation kinetics to generate and k, first. Then, k, / Ki is used to generate the quadratic rate t number kinact. 3. PBMC cell analysis method: Use a mixed population of human peripheral blood mononuclear cells (PBMC) or enriched adherent monocytes to perform the IL-1 analysis method. ICE can modify the pre-IL-1 /? Detection of cell-like cell-derived cell culture. Human PBMCs obtained from healthy donors can provide a mixed population of lymphocyte subtypes and monocytes, which can produce an overview of the interleukins and cytokines between many types of physiological stimuli. Adherent monocytes from PBMC can provide a source of normal monocyte enrichment for selective study of cytokines produced by activated cells. Experimental steps: Prepare the initial dilution series of the test compound in DMSO or ethanol, and then dilute to RPMI-10% FBS medium (containing 2 mM L-glutamic acid, 10 mM HEPES, 50 U and 50 μg / ml Penicillin / streptomycin) to produce drugs with a final test concentration of 4x in 0.4% DMSO or 0.4% ethanol. The final concentration of DMSO was 0.1% in all drug dilutions. At ICE-297- (Please read the precautions on the back before filling this page) This paper size is applicable to China National Standard (CNS) A4 (210X 297 mm) 541309 Printed by A7 ^ B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs V. Description of the invention (295) The titration of Ki concentration of the test compound determined in the inhibition analysis method is usually used for one-time compound screening. Usually 5 to 6 compound dilutions are tested and the cell components are subjected to a secondary analysis, i.e. a secondary ELISA determination is performed on the supernatant of each cell culture. Isolation of PBMC and analysis of IL-1: Hematopoietic cells isolated from human blood in a pinto (generating 40-45 ml of final volume of plasma plus cells) were diluted to 80 ml in culture medium and placed on a LeukoPREP separation tube (Becton Dickinson) Cover each with 10 ml of cell suspension. After centrifugation at 1500-1800 xg for 15 minutes, the plasma / medium layer was aspirated, and the mononuclear cell layer was collected with a Pasteur pipette, and transferred to a 15 ml conical centrifuge tube (Corning). The medium was added to a volume of 15 ml, the cells were gently mixed by inversion, and centrifuged at 300 xg for 15 minutes. The PBMC pellet was suspended in a small amount of medium, and the cells were counted and adjusted to 6 X 106 cells / ml. For cell analysis, add 1.0 ml of cell suspension, 0.5 ml of test compound dilution, and 0.5 ml of LPS solution (Sigma # L-3012;) to each well of a 24-well flat-bottom tissue culture plate (Corning). A 20 ng / ml solution was prepared in complete RPMI medium; the final LPS concentration was 5 ng / ml). The 0.5 ml of test compound and LPS added are usually sufficient to mix the contents of the pores. Three control mixtures were performed for each experiment with separate LPS, solvent vehicle controls, and / or additional media to adjust the final culture volume to 2.0 ml. Cells were cultured at 37 ° C and 5% &lt;: 02 for 16-18 hours. At the end of the incubation period, the cells were recovered and transferred to a 15 ml conical centrifuge tube. -298- This paper is sized for China National Standard (CNS) A4 (210X 297 mm). (Please read the precautions on the back before filling this page. ) 541309

Description of the invention (produced by the consumer cooperation of the Central Bureau of Standards, Ministry of Economic Affairs, Du Yin. After centrifugation at 200 times for 10 minutes, the supernatant is recovered and transferred to a 5 ml Eppendorf tube. It can be noted that the cell mass can be used in the cytosol extract Pre-IL-l /? and / or mature Jiang- ^ content of the biochemical evaluation, using Western blot method or Pre-IL-ly5 specific antiserum ^^ Qiaoba. Adhesive monocytes Isolation: Isolate and prepare PBMC as described above. Medium (10 ml) is first added to the holes, and then 0.5 ml of PBMC suspension is added. After incubation for 1 hour, the pellets are carefully shaken and then sucked out of each hole and adhered The cells were washed and washed three times with 10 ml of culture medium and suspended in 10 ml of culture medium. The enrichment of adhered cells usually produced 2.30 x 105 cells per well. As described above Perform test compounds, LPS addition, cell culture conditions, and modification of supernatant treatment. ELISA: We use Quantikine kit (R &amp; D Systems) to detect mature IL] $ 3 for analysis according to manufacturer's instructions. Mature ZLq Lu level in pBMC and sticky Approximately 1.3 nanograms / ml were seen in the positive mononuclear cell control group. £ 1 ^ 8 analysis in! ^-1: 5; 1:10 and 1:20 dilutions of the supernatant of the positive control group The selection was performed to select the most appropriate dilution of the supernatant in the test column. The inhibitory intensity of the compound can be expressed as IC50 値, which is the mature ILel 0 50C measured in the supernatant compared with the positive control group. Inhibitor concentration per hour. Fine arts understand that the number of cells obtained in the cell analysis, as described in the above, may depend on multiple factors, such as cell type, cell source, growth conditions, etc. -299- This paper size applies to Chinese National Standard (CNS) A4 specifications for public holidays (please read the precautions on the back before filling this page), and install-

1T 541309 A7 B7 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (297) Example 2 Pharmacokinetics in mice Peptide ICE inhibitors can be quickly removed with a clearance rate greater than 100 # / min / kg To clear. Lower clearance compounds have better pharmacokinetic properties than peptide inhibitors. We can obtain clearance of many compounds of the present invention in mice using the following methods: Sample preparation and administration The compounds were dissolved in sterile TRIS solution (0.02M or 0.05M) at a concentration of 2.5 mg / ml. When it is determined that the solution is complete, the sample is first dissolved in a small amount of metformamide (up to 5% of the total solution volume), and then diluted with a TRIS solution. The drug solution was administered to CD-1 mice (Charles River Laboratories-26-31 kg), and a drug dose of 25 mg / kg was administered via the tail vein at a dose volume of 10 mg / kg. At each time point (usually from 2 minutes to 2 hours), mice were administered in groups of five. At the appropriate time, the animals were anesthetized with halothane, and then collected into individual heparinized tubes by jugular vein transection. The blood sample was cooled to 0 ° C, and the plasma was separated and stored at -20 ° C until analysis. Biological analysis Drug concentrations in blood samples were determined by HPLC analysis with UV and MS (ESP) detection. Reverse phase chromatography uses a variety of bonded phases from C1 to C18, and the eluent is carried out from an aqueous buffer / acetonitrile mixture under equal density conditions. The external standard method is used for quantification, in which the plasma structure of the drug solution is mixed with -300- This paper size is applicable to China National Standard (CNS) A4 specifications (210X 297 mm) (Please read the precautions on the back before filling this page) 541309 A7 _ B7 V. Description of the invention (298) A calibration curve is formed with a concentration range of 0.5 to 50 μg / ml. Before analyzing the plasma sample, add acetonitrile, methanol, trichloroacetic acid or perchloric acid and centrifuge at 10,000g for 10 minutes to remove the protein. Inject 20 μl to 50 μl sample volume for analysis. Compound 214e was administered and the sample was dissolved in sterile 0.02MTris to produce a 2.5 mg / ml solution, which was then administered via the tail vein at a dose of 25 mg / kg to five male CD-1 mice in a total of 11 groups . At the following time points ^: 2, 5, 10, 15, 20, 30, 45, 60, 90, and 120 minutes, each group was anesthetized and blood was collected into heparinized tubes. After the plasma was separated, it was stored at -20 ° C until analysis. Analysis An aliquot of plasma (150 µl) was treated with 5% perchloric acid (5 µl), vortexed and allowed to stand for 90 minutes before centrifugation. The resulting supernatant was separated and an additional 20 microliters were injected into the HPLC for analysis. HPLC conditions (please read the notes on the back before filling this page) Printed column 100 X 4.6 mm Kromasil KR 100 5C4 Mobile phase 0.1m Tris pH7.5 86% Acetonitrile 14% Flow 1 Detect UV retention time at 210 nanometers per minute at 3.4 ml. The analysis results show that the average plasma level of the drug decreased from ~ 70 μg / ml (at 2 minutes) to <2 μg / ml (at 90 and 120 minutes). . -301-This paper size is in accordance with Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. 'Explanation of the invention (2 &quot;) Compound 217e for administration and sampling Drugs are dissolved in sterile 0.02M Tris to A 2.5 mg / ml solution was produced, which was administered to the male CD-1 mice in a total of 11 groups in a dose of 25 mg / kg via the tail vein. At the following time points: 2, 5, 10, 15, 20, 30, 45, 60, 90, and 120 minutes, a group of animals were anesthetized and blood samples were collected into heparinized tubes. Plasma was stored at -20 ° C after analysis until analysis. Analysis An aliquot of plasma (100 µl) was diluted with acetonitrile (100 µl), vortexed for 20 seconds and centrifuged for 10 minutes. The resulting supernatant was separated and 20 microliters were injected and analyzed by HPLC. (Please read the notes on the back before filling this page) Printed by HPLC conditions column 150x4.6 mm mobile phase 0.05M osmate buffer solution, pH7.1 acetonitrile flow rate 1.4ml / min Detection of UV at 210 nm retention time 3.0 and 3.6 minutes (diastereomers). The analysis results showed that the average plasma concentration decreased from ~ 55 μg / ml (in 2 minutes) to <0.2 μg (60-120 minutes). Example 3 Peptidic ICE inhibitors can be quickly cleared at a clearance rate of greater than 80 ml / min / kg. Compounds with lower clearance have more improved pharmacokinetic properties than peptide ICE inhibitors. We can obtain many compounds of the present invention in mice by the following methods

Zorbax SBC8 72% 28% 302- This paper size is applicable to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. 5. Description of the invention (3〇〇) Elimination rate (liters / min / kg): The in vivo rat clearance analysis method was performed one day before the pharmacokinetic study by intubating the jugular veins and carotid arteries of the rats under anesthesia. M.J. Free, R.A. Jaffee; ‘Cannulation techniques for the collection blood and other bodily fluids' ^ in Animal Models; p. 480-495; N.J. Alexander, Ed .; Academic Press; (1978). The drug (10 mg / ml) is administered in a vehicle via the jugular vein. The vehicle usually contains propylene glycol / saline and 100 mM sodium bicarbonate in a 1: 1 ratio. Animals were given 10-20 mg of drug / kg, and blood was collected from the internal carotid catheter at 5, 7, 10, 15, 20, 30, 60, and 90 minutes. The blood was centrifuged out of the plasma and stored at -20 ° C until analysis. The pharmacokinetic analysis of the data was performed using standard software such as RStrip (MicroMath Software, UT) and / or Pcnonlin (SCI Software, NC) for non-linear regression to obtain the clearance data. Analysis: Rat plasma was extracted with an equal volume of acetonitrile (containing 0.1% TFA). The samples were centrifuged at approximately 1,000 X g, and the supernatant was analyzed by gradient HPLC. A typical analysis procedure is described below. 200 microliters of plasma was precipitated with 200 microliters of 0.1% trifluoroacetic acid (TFA) in acetonitrile and 10 microliters of 50% zinc chloride in water, vortexed, and centrifuged at ~ 1000X g. The supernatant was collected and treated with HPLC analysis. -303- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (2 丨 0X297mm) (Please read the precautions on the back before filling out this page) 541309 A7 B7 Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs 2. Description of the invention (302) Endotoxin-free sodium chloride solution (0.9%) and HBSS lipopolysaccharide (Sigma; Cat J L-3012) stock solution, IL-1々ELISA proteome in HBSS at 1 mg / ml (R &amp; D Systems; Cat # DLB50) TNFa ELISA proteome (R &amp; D Systems; Cat # DTA50) Experimental steps for whole blood analysis in a water bath or incubator: Set the incubator or water bath at 30 ° C. A 0.25 ml blood sample is placed in a 1.5 ml eppendorf tube. Note: Invert the whole blood sample tube after every two copies. If the cells settle and are not uniformly suspended, there may be a difference of repetition. Using a positive pressure pipette also minimizes the difference between duplicates. The dilutions were prepared in serial dilutions in sterile pyrogen-free saline. The dilution series of the test compound supporting apparent iq determined in the ICE inhibition assay is often used for initial compound screening. For extremely hydrophobic compounds, our compound dilutions are prepared in fresh plasma from the same blood donor or in PBS containing 5% DMS0 to enhance dissolution. Add 25 μl of test compound dilution or vehicle control and gently mix with the sample. Add another 5.0 µl of LPS solution (250 ng / ml stock solution, fresh preparation: 5.0 ng / ml final concentration of LPS) and mix again. Tubes are incubated in a water bath at 30 ° C for 16-18 hours and often mixed. In addition, the tubes were placed in the same incubator in a 4 rpm spinner. This analysis can also be performed two or three times in the following control group: negative control group-no LPS; positive control group-no test inhibitor; vehicle control group-the highest concentration of DMS0 or compound solvent used in the experiment. Add additional saline to all control tubes to normalize the volume of the control and experimental whole blood test samples. -305- (Please read the notes on the reverse side before filling out this page) This paper size applies to China's national standard (CNS) A4 specification (2I0X 297 mm) 541309 A7 B7 Ministry of Economic Affairs Central Government Procurement Bureau employee consumption cooperation 衽5) Description of the invention (3C) 3) After the incubation period, the whole blood sample is centrifuged in a ~ 2000 rPm microcentrifuge, the plasma is transferred to a fresh microcentrifuge tube, and the remaining platelets are centrifuged at 1000 X g to make it necessary When clumped. Plasma samples can be stored cold-rolled at -70 ° C and analyzed for cytokinin levels using ELIS A. ELISA: The R & D System (614 McKinley Place N.E. Minneapolis, MN 55413) Quantikine kit was used in the detection of IL-1 /? And Han-TNF. The analysis was performed according to the manufacturer's instructions. IL-ly5 levels of ~ 1-5 nanomls were observed in individual ranges in the equal control group. The 1: 200 plasma dilution multiples of all samples allowed the ELISA results of our experiments to fall well above the linear range of the ELISA standard curve. If differences are observed in whole blood analysis, standard dilutions can be made more ideal if necessary. Nerad, JL et al., J. Leukocyte Biol., 52, pp. 687-692 (1992) ° Example 5 Inhibition of ICE Homologs 1. Isolation of ICE Homologs TX Uses the standard virus expression system in insect cells Performance We subcultured Tx cDNA (Faucheu et al., Above, 1995) to a modified pVL1393 transfer vector, co-transfected the resulting plastid (PVL1393 / TX) to insect cells, and used viral DNA , And then identify the recombinant body-like disease. Poison. After generating high titer recombinant virus stocks, the activity of TX in the culture medium was checked by visual ICE analysis. Typically, Spodoptera frugiperda (Sf9) was infected with recombinant virus stocks at MOI 5, with a maximum performance of 4.7 μg / ml after 48 hours. ICE is used as the standard for analysis -306- The standard of this and the Zhang scale applies the Zhongguanjia Standard (CNS) A4 specification (2lQx 297 public holidays (please read the precautions on the back before filling this page) Order # 541309 Ministry of Economy A7 B7 printed by the China Standards Bureau for employee cooperation. 5. Description of the invention (304) Product 0 ICE or TX amino terminal T7 decoration. The original design can also be used to identify and purify recombinant proteins. Various constructs can also be used to check different levels of performance and relative expected levels of cell death experienced by different homologues. Comparing cell lines that can express ICE or TX with cells infected with early single virus DNA, the former is Expected cell death in infected Sf9 cells (examined by cone blue exclusion analysis) has increased. Performance of N-terminal (His) 6-decorated CPP32 in coliform bacteria and purification of CPP32-encoded polypeptide The cDNA from Ser (29) (Fernandes-Alnemri et al, supra, 1994) was amplified by primer line PCR, which can be added to the Xhol position of the framework at both the 5 'and 3' ends, and the Xhol fragment generated Connected to Xhol-cut pET-15b performance The fusion protein was generated on the N-terminus of the fusion protein with a structure of (his) 0u. The predicted recombinant protein starts with the MGSSHHHHHHSSGLVPRGSHMLE amino acid sequence, where LVPRGS represents the thrombin dissociation position, followed by Ser (29) CPP32. Plastid-bearing E. coli BL21 (DE3) was grown to logarithmic phase at 3CTC and co-cultivated with 0.8 mM IPTG. Cells were recovered 2 hours after IPTG was added to prepare a lysate, and the soluble protein was Purified by Ni-Sepharose chromatography. All expressed CPP32 proteins were treated with modified forms. N-terminal sequencing analysis showed that processed modifications occurred at the putative position between Asp (175) and Ser (176). From 200 Approximately 50 micrograms of CPP32 protein can be obtained from a milliliter culture. The purified protein is fully active after titration at the active site. The protease preparation is also highly in vitro in dissociating PARP and synthetic DEDV-AMC substrates (Nicholson et al The above-307- scale is applicable to the Chinese country i ^ CNS) A4g (2ι〇χ 297 mm) (Please read the precautions on the back before filling this page) 541309 A7 B7 (3〇5), 1995). 2. Inhibition of ICE homologs The selectivity of a series of reversible inhibitors of ICE homologs is shown in Table 1. Wilson et al (above, 1994) used the YVAD-AMC substrate (Thornbeiry et al, supra, 1992) for ICE enzyme analysis. TX activity was analyzed using ICE substrates under the same conditions as ICE. CPP32 analysis was performed using the DEVD-AMC substrate (Nicholson et al, supra, 1995). In general, for a wide range of architectures, there is low selectivity between ICE and TX. None of the synthetic ICE compounds tested were potent inhibitors of CPP32. Analysis of reversible compounds (1 V M) at the highest concentration showed no inhibitory effect. Table 1 Compounds ICE (nM) kiTX (nM) CPP32 (nM) 214e 7.5 7.0 ± 1.1 &gt; 1000 135a 90 55 ± 9 &gt; 1000 125b 60 57 ± 13 &gt; 1000 137 40 40 ± 7 &gt; 1000 shown below The secondary rate constants of the selected irreversible inhibitors that deactivate ICE and ICE homologues (Table 2). The irreversible compounds studied are a wide range of inhibitors of ICE and its homologs. However, certain selectivities are observed as irreversible compounds compared to the inhibitory effects of ICE and CPP32. Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. 150,000 108a 100,000 25,000 nd -308- (Please read the notes on the back before filling this page)

This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (306) Example 6 Inhibition of expected cell death U93 7 Fas_Bio-Suppressed Cells in Cells Expected Death Assessment Compounds block the ability of anti-Fas-M-produced cells to expect death. In preliminary experiments using RT-PCR, we detected mRNAs encoding ICE, TX, ICH-1, CPP32 and CMH-1 in unstimulated U937 cells. We have used this cell line in studies of expected cell death. U937 cells were seeded into the medium at 1 X 105 cells / ml and regenerated to ~ 5X 106 cells / ml. In the experiment of expected cell death, 2 × 106 cells were coated in a 24-well tissue culture plate in 1 ml of RPMI-1640-10% FBS, and stimulated with 100 ng / ml anti-Fas antigen antibody (Medical and Biological Laboratories, Ltd.). After 24 hours incubation at 37 ° C, FACS analysis was performed with ApoTag reagent to determine the percentage of cells that were expected to die. All compounds tested were initially at 20a and titrated with the active compound to determine the IC5Q 値. Inhibition of expected cell death was observed in 108a, 136, and 138 (&gt; 75% at 20 aM). It was decided at 217e that 0.8 C of 1M50 was compared with the expected death of anti-Fas-defamatory cells at 214e 20 // M. Example 7 Acute analysis of in vivo efficacy when used as an anti-inflammatory agent LPS-induced IL-1 /? Produced in CD1 mice administered LPS (20 mg / kg IP) was evaluated for the efficacy of 214e and 217e (each (N = 6). The test compound was prepared in olive oil-309- (Please read the precautions on the back before filling in this page) 1 pack · The size of the paper is applicable to China National Standard (CNS) A4 (210 X 297 mm) Ministry of Light Industry Printed in 541309 A 7. _____ B7 by the Chinese Prospective Bureau member. V. Description of the invention (307) ~ ': DMSO-ethanol (90: 5: 5), and then injected via IP 1 hour after LPS. Blood was collected 7 hours after Lps administration. ELISA was used to detect the level of IL-1 y? In serum. The results in Figure 6 show a dose-dependent inhibition of IL-1 /? Secreted by 214e, with an ED% of about 15 mg / kg. Similar results were obtained in the second experiment. Significant inhibition of IL-ΙΘ secretion was also observed in 217e-treated mice (Figure 7). However, a clear dose response is not obvious. Compounds 214e and 217e (50 mg / kg) were also administered by oral gavage to assess absorption. The results in Figure 8 show that 214e and non-217e seedlings can inhibit the secretion of IL-1 when taken orally. It is suggested that the oral efficacy potential of ICE inhibitors as anti-inflammatory agents. The efficacy of the 214e homologue was also evaluated and performed in mice administered LPS after IP administration (Figure 9) and PO administration (Figure 10). Qin Qin's% inhibition of IL production by 214e homologue after administration of LPS mice at P0 and IP (50 mg / kg). Table 3 Compound PO% inhibitory effect IP% inhibitory effect X 297 mm) (Please read the notes on the back before filling out this page)

Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Description of the invention (30) Table 4 ----- Comparison of the efficacy of 214e prodrug in LPS mice: Time curve of IL-1 /? Production system Dosage time of inhibitory compound _ South compared to LPS administration time, PO, 50 units 矣 · / kg) _ _ Compound-2 hours-1 hour 0 hours 2l 4e 55% 39 * 80 * 75 * 43 * 44? 48 * 11 * • Ben ___304a 30 33 68 ---- ._2l00e 49 54 94 __--- 2100a 8 71 _ 67 _____--- 213e 0 48 _ 41 a ------ 89__ — 3 02 0 27 21 21〇 〇c 0 0 85 _40_. 2l〇〇d 42 35 52 21〇b 0 0 47 ---- 16 __ ^ 2001 ～ 63 ～ 62 ～ 57 ^ 54 64 * * 62 58 * 55 *-Example 8 jj 测 211-4e The blood of the prodrug was administered to mice at a p.0. Dose of compounds 302 and 304a (50 mg / kg), and the drug was prepared in 0.5% carboxymethyl cellulose. Blood was collected at 1 and 7 hours after administration. Serum was extracted with an equal volume of acetonitrile containing 2% formic acid, and the serum was separated. The β solution was analyzed by liquid chromatography-mass spectrometry (ESI-MS). (Please read the precautions on the back and fill in this page)

311-541309 A7 B7 V. Description of the invention (coffee) The detection level of 0.03 to 3 μg / ml. Compounds 302 and 304a showed detectable blood levels when taken orally, and 214e itself did not exceed blood levels of 0.10 μg / ml when taken orally. Compounds 302 and 304a are 214e prodrugs and can be metabolized to 214e in vivo (see Figure 11). Example 9 Using the method described in Examples 1-8, we can obtain the following data for the compounds of the present invention (see Tables 5 and 6). The structure of the compound of Example 9 is shown in Examples 10-17. Table 5 Compounds printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs | UV-visible light Ki (nM) j Fine running PBMC Average IC50 (nM) Whole blood IC50 (nM) Rat clearance iv ml / min / kg Rat clearance iv Ml / min / kg 47b 27 1800 &lt; 600 338 47a 19 2600 5100 79 32 —135a 90 2800 5000 &gt; 100 135b 320 1600 1700 125b 60 800 4500 108b 400 25000 &gt; 100 137 40 1700 14000! I I 139 350 2000 213e 130 900 600 400 + 214c 1200 5000 214e 7.5 1600 1300 23 12 217c 1700 7000 70 217e 175 2000 &gt; 50 220b 600 2125 223b 99 5000 &gt; 100 223e 1.6 3000 &gt; 20000 89 i 22 6e 15 1100 1800 109 227e 7 234 550 230e 325 300 67 232e 1100 4500 22 26 235e 510 4750 36 i 238e 500 4250 ： 246 12 950 10000 31 -312- 丨 !!-(Please read the notes on the back before filling this page) Order-1¾ This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (31〇) Printed by the Consumers Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs UV-visible light Ki (nM) cells PBMC average IC50 (nM) whole blood IC50 (nM) rat clearance iv ml / min / kg. Rat clearance iv ml / min / kg 257 13 11000 6600 * i: j 265 47 4300 1400 1 23 20 281 50 600 2500 * 302 4500 &gt; 20000 &gt; 20000 304a 200 1,400 2400 14000 * 307a 55 14500 16000 307b 165 14000 404 2.9 1650 1800 * • 1100 64 24 405 6.5 1700 2100 406 i 4! 1650 2300 407 0.4 540 1700 408 0.5 1100 1000 41 23 409 3.7 2500 410 17 2000 2800 32 20 411 0.9 540 1900 412 1-3 580 660 * 700 1000 * 25 413 750 6200 415 2.5 990 1000 * 450 3500 * 26 18 416 12 1200 3400 47 417 8 2000 6000 33 22 418 2.2 1050 2200 * 7800 1800 * 13 5.9 419 280 &gt; 8000 420 1200 8000 &gt; 8000 * 421 200 4300 4600 * 1 422 50 2200 1200 423 10 2100 1800 * 1500 45 1! 424 45 2500 4000 j 425 0.8 650 700 * 650 _L i -313- This paper size applies to China National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling out this page to order 541309 by A7 B7 compounds printed by the Ministry of Standards and Staff ’s Consumer Cooperatives UV-visible light * Ki (nM) cells PBMC average IC50 (nM) whole blood IC; 0 (nM) rat clearance iv ml / min / kg rat clearance iv ml / Min / kg 426 90 4500 2500 * 427 180 4500 36 428 280 429 7000 430 60 &gt; 8000 431 8 &gt; 8000 8000 ^ 432 1.6 560 丨 2000 1! 433 2.9 1000 1100 * j 1100 434 4.9 1600 1200 * 丨1800 i 1300 * 20 435 8 4400 1 436 7.5 ί 2700 * i 437 12 1800 i 5000 438 28 1000 700 2900 * 22 439 3.7 2800 3200 3400 * L_______________ 440 2.3 5000 2000 441 1 2500 4500 442 3.2 900 2000 54 443 3.6 2800 1500 444 15 3500 3500 445 135 4000 446 62 3000 447 5.8 2500 1500 448 130 4000 449 12 1500 3200 13000 * 450 5 800 2200 1700 * 18 12 451 4 1800 1500 9000 * 452 4.5 600 800 * 650 1600 * 27.3 453 0.65 1300 1900 1600 * (Please read the notes on the back before filling out this page) Order -314- This paper size is applicable to China National Standard (CNS) A4 specification (2IOX 297) (%) 541309 A7 B7 V. Description of the invention (312) Printed compounds and materials UV-visible light 'Ki (nM) in the Ministry of Economy ’s Consumer Cooperatives Consumers Cooperative Society IfePBMC Average IC50 (nM) Whole blood IC50 (nM) Rat clearance Rate iv ml / min / kg rat clearance iv ml / min / kg 454 45 2500 455 1.2 400 2800 2600 * 54 456 4.5 600 1300 * 600 1400 * 12.7 457 6.2 2000 3500 458 20 2900; j 459 5 1800; ; 460 115 400; 2400 |! 461 47: ^! &Gt; · ·: · 1 462 j 40 __ ___ _ _ 463 14 j 2400 '! 2800 *;: 464 2.5 1000! &Gt;1000; i 2500 * jj I 465 3 1000 I 800 466 0 · 8 1400 600, 467 11 1900 468 4.5 850 2500! 470 5 500 360 500 * 63 ί I 471 1 750 400 17 472 140 473 1 1000 400 450 * 474 85 475 5.5 690 650 * 400 350 * 31 21 476 7 1600 2500 477 60 478 380 479 15 900 700 2400 * 1 1 480 25 2300 j 481 1.2 390 930 * 600 500 * 34; 482 &lt; 0.2 340 380 260 * i (read first read the back Please note this page before filling out this page) -315- This paper size is applicable to China National Standard (CNS) A4 specification (210X 297 mm) 541309 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (313) Compound UV-visible light Ki (nM) Known PBMC IC50 (nM) : Full jkIC50 (nM) rat clearance iv ml / min / kg rat clearance iv .ml / min / kg 483 1-7 900 700 1 484 2 1550 1400 * 5000 15 485 2 900 900 486 2.3 480 570 * 500 37 487 2.4 650 950 * 500 .400 * 20 'Factory 488!-1,5 940 750 ~!: | 489 6 2250 1700 * | -15000 ii! ί 4 90 i I 4.3 _ 980 | 700 1000 * | 1900 * 491 Γ --- r 5; 2500;-! 493 1 25 1200! ί—- ί 800 850 * 494 15 1350 1500 * 7000 495 43 496 16 1550 1600 * 6000 497 3.5 740 350 700 * 498 1.5 560 500 400 * 499 3.5 1200 800 * 9000 605a 90 2600 &gt; 20000 605b 45 10000 97 605c 615 4500 37 605d 95 5100 16000 5100 * 33 605e 29 2250 &gt; 10000 24 605f 475 12500 _I 605g 165 22500 605h 460 &gt; 25000 605i 680 &gt; 20000 _J 605j 110 8750 71 605m 650 20000-^ 1 -316- (Please read the precautions on the back before filling this page) This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309

A

7 B V. Description of the invention (314) Compounds printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. UV · Visible light Ki (nM) cells PBMC Average IC50 (nM) Whole blood IC50 (nM) Rat clearance iv ml / min / kg i rat clearance iv] ml / min / kg | 605η 12 2100 &gt; 20000 28 605〇72 18000 605ρ 125 3200 &gt; 20000 605q 1000 I 605s 150 6000 1_ 605t 33 j; 609a 114 &gt; 30000 609b 27 &gt; 20000 619 300 t. 620 35 1000! 19000 621 7.2 | 丨 1300-; &gt; 20000 622 35 丨! 1300: &gt; 20000 623 9 1; 624 300 i 625 105 626 260 627 43 3250 8000 628 36 2750 &gt; 20000 | 629 230 630 270 631 805 632 148 633 92 5750 20000 634 1400 635 55 1900 3400 * 4000 605v 1100 &gt; 30000 2201 9 2000 3700 * 3500 60 2100e 250 800 600 2100a 100 1100 850 2002 4 810 860 * 70 1400 * 32 1 1 I 1 2100d &gt; 100000 &gt; 20000 &gt; 20000! 2100c 7400 &gt; 20000 &gt; 20000 j 2100b 8000 &gt; 20000 &gt; 20000 2001 135 1800 3500 1027 4000 &gt; 20000 &gt; 20000 60 1 1015 40 2500 1700 23; -317- (Please read the precautions on the back before filling out this page) ·· The size of the paper is bound to the Chinese National Standard (CNS) A4 specification ( 210 × 297 mm) 541309 A7 B7 V. Description of the invention (315) Table 6 Fluorescent analysis of compounds Kinact M-1 s'1 cells PBMC Average IC50 (ηΜ) Whole blood 1050 (ηΜ) Mouse clearance i. Ν · ml / Min / kg rat clearance i iv I ml / min / kg | 1 108a! 5 '· 1x10 117500 r} 136 5.4xl05 5 1 870! 2800 * 93 138 1 · 2χ105 900 2900 116 | 217d 4 · 7χ105 340 4000 1 1! 280 4xl05 650 &gt; 1000 187 283 ΙχΙΟ5 &lt; 200 450 104 284 3 · 5χ 105 470 550 77 100 285 4 · 3χ 105 810 1000 130 50 1 * Numbers were obtained by reanalysis. Example 10 Compound 139 was synthesized in a similar manner to that of 47a. (Please read the notes on the back before filling this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs J 〇 (A, 〆) 0 u 139 〇H3-SVn &gt; 0 Η f I r ^ OH ° 0 ^ v H 0 Compounds 136 and 138 were synthesized in a similar manner to 57b. -318- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (316) Ο

Compounds 135a, 135b, and 137 were synthesized in a similar manner to 69a. 〇

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs 37

(Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 (210X 297 mm) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Description of the invention (317) Compounds 813e, 814c, 814e, 817c, 817d, 817e , 820b, 823b, 823e, 826e, 827e, 830e, 832e, 835e, 838e, 846, 857, 865, 902, 904a, 907a, 907b, 1004-1013, 1015-1045, 1046-1068, 1070-1091, and 1093-1099 was synthesized in a similar manner to compound 264 and the equivalent compounds in Examples 10 and 11. Compounds 47a, 47b, 108a, 108b, 125b, 213e, 214c, 217c, 217d, 217e, 220b, 223b, 223e, 226e, 227e, 230e, 232e, 235e, 238e, 246, 257, 264, 265, 280-287 , 302, 304a, 307a, and 307b were synthesized as follows. IL N- (N-Ethyl-Tyramine-Thryl-Valamine-Pyridyl) -3-Amino-4-Ketobutanoic Acid A Step · N- (N-Third-butoxycarbonylpiperidine Cotyl) -4-amino-5-benzyloxy-2-one tetrahydrocran, in a similar manner to that reported by Chapman (Bioorg. &Amp; Med. Chem. Lett. 2, pp. 613-618, (1992 )) Perform N-Third-butoxycarbonyl pipecolic acid (460 mg, 2.0 mmol) with N-allyloxycarbonyl-4-amino-5-benzyloxy-2-ketotetrahydrocran (530 mg, 1.82 mmol) to give 654 mg of the title compound. Tun NMR (500 MHz, CDC13 (in geometric isomeric form) &amp; 7.35 (m, 5H), 6.88 (br · s, 1H), 4 · 9-4_45 (m, 4H), 3.95+ (br M, 2H), 3.06 (m, 1H), 2.9 (m, 1H), 2.7 (br. M, 1H), 2.45 (m, 1H), 2.2 (m, 1H), 1.7-1.5 (m, 3H), 1.45 (two s, 9H). Step B: N-pipecolyl-4-amino-5-fluorenoxy_2-one-tetrazowan N- (N-brother Di-butoxyzoyl ^ guacoyl) -4-amino-5-Hanoxy-2-fluorenyl-tetra-320- 1 paper wave scale applicable to household standards (CNS) A4 specification (21GX 297 male (King) '~' (Please read the notes on the back before filling this page)

541309 A7 ______ B7 V. Description of the invention (318) Hydrofuran (654 mg) was dissolved in 15 ml of 25% trifluoroacetic acid in dichloromethane ′ and stirred at room temperature. The mixture was concentrated to give a gummy residue. The residue was dissolved in a mouse-clad tiger and washed with 10% Ling acid steel. The organic layer was dried over anhydrous sulfuric acid steel, filtered, and concentrated to give 422 mg of the title compound as a brown solid. NMR (500 MHz, CDC13) &amp; 7.38 (m, 5H), 7.15 (d, 1H), 5.55 (d, 1H), 4.95-4.8 (m, 1H), 4,78 (m, 1H), 4.65 (d, 1H), 4.45 (m, 1H), 3.2 (m, 0.5H), 3.05 (m, 0.5H), 2.95 (m, 0.5H), 2.85 (m, 0.5H), 2.65 ( m, 1H), 2.55-2.38 (m, 1H), 1.95 (m, 1H), 1.8 (m, 1H), 1.6 (m, 2H), 1.38 (m, 2H). Step C. N- (N-Ethyl-Ethylamine-Ethylamine-Ethylamine Coolyl-Weikeji) · 4_ Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ) Amino group · 5-Methoxy-2 -benzyl-tetrahydrocranyl N-ethylfluorenyl · tyraminofluorenyl · valinic acid (464 mg, 1.44 mmol) and Np-Chenyl-4-amine Dimethyl-5-ethoxy-2-fluorenyltetrachlorotetramethylene (412 mg, 1.3 mol) was dissolved in dimethylformamide and digasmethane in each milliliter, and cooled to 0 ° C. To the cooled solution was added 1-hydroxybenzotriazole (HOBT; 210 mg, 1.56 mmol) and then 1- (3-dimethylaminopropyl) · 3-ethylcarbodiimide hydrochloride (EDC 326 mg, 1.7 millimoles). After 18 hours of incubation, the mixture was diluted with ethyl acetate and washed with water, 10% sodium bisulfate, 100/0 sodium bicarbonate, and water. The organic layer was concentrated to give a crude solid, which was then purified by flash chromatography (SiO2) and dissolved with 94: 6: 1 (dichloromethane: isopropanol ratio) to yield 370 mg of the title compound. Tun NMR (500 MHz, CD3OD (as diastereoisomeric and geometric isomers)) &amp; 7.35 (m, 5H), 7.05 (m, 2H), 6.68 (m, 2H), 5.65 -321 -This paper size applies Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (319) &amp; 5.25 (m, 1H), 4.9- 3.95 (m, 8H), 3.4-2.6 (m, 4H), 2.5-2.1 (m, 1H), 1.98 (S? 1H)? 1.9 (s, 1H), 1.85 (s, 1H), 1.8-1.6 ( m &gt; 2H)? 1.55-1.3 (m, 4Ii), 0.95_0 · 85 (m, 6H) 〇D step · Ethyl-butyrococoyl-valamine, a certain amine 4-ketobutyric acid 100,000 g of N- (N-ethylammonyl-tyraminofluorenyl-valaminoammonyl-pipecoyl) -4-amino-5-benzyloxy-2-ketotetrahydrofuran in 10 ml of methanol To the solution, 60 g of Pd (OH) 2 / C was added, and the mixture was placed in a hydrogen atmosphere of a balloon. The mixture was filtered through Celite and concentrated to form a white solid. This crude solid was dissolved in 2 ml of methanol and triturated with diethyl ether to give 26 mg of the title compound. Insect NMR (500 MHz, CD3D (diastereomeric) Isomers and geometric isomers) &amp; 7.1 (m, 2H), 6.7 (m, 2H), 5.2 (br · m, 1H), 4.8-3.6 (m, 6H), 3.2-2.5 ( m, 4H), 2.5-2.1 (m, 1H), 1.95 (three s, 3Η) 1.9-1.3 (m, 6H), 1.1-0.7 (m, 6H). Ethyl-Tyramine -Valamine group- (4-fluorenyl) proline group 1-3-amino-4-fluorenyl butyric acid. Step A N- (N-allyloxyalkyl-4-yoxy Proline group) · 3 · Amino-4-ketobutyric acid tertiary-butyl ester Foncaba face super compound is prepared by mixing N-fluorenyloxycarbyl-4-benzyloxyproline and 3 -Amino-4-ketobutyric acid tertiary-butyl ester hemi-carbazone (Butyl. Graybill et. Al., Abstracts of papers, 206th National Meeting of the American Chemical Society, Abstract MEDI-235. Chicago, IL · (1993)) The reaction was performed under similar peptide coupling conditions as reported above (compounds H, C steps). -322- Cap for this paper Jia Jin Zhuan (CNS) A4 specification (2i〇X297 public fantasy &quot; (Please read the precautions on the back before filling in this I). Packing. Order 541309 Printed by the Consumer Standards Cooperative of the Central Standard Bureau of the Ministry of Economic Affairs A7-B7 ___- ------------ ~ --- 5. Description of the invention (320) NMR (500 MHz, CDC13) &amp; 9.05 (br. S, 1H), 7.85 (bi * · m, 1H ), 7.4-7.2 (m, 5H), 7.15 (br · s, 1H), 6.55 (br. S, 1H), 5. · 9 (m, 1H), 5.1-4.9 (br. M, 2H) , 4.65-4.4 (m, 4H), 4.2 (br · m, 1H), 3.75-3.5 (m, 2H), 2.75-2.55 (m, 2H), 2.5 (br · m, 1H), 2.25 (br. m, 1H) 1.4 (s, 9H) 〇b step · n- (n-ethylamido-tyrosinamido-valproaminino))-3-amino-4-ketobutane The title compound was prepared by combining N-ethyl ^ -methyl-tyrosinyl-peptidyl-amino acid with N-1N-allyloxycarbonyl-4-uroxyprolyl) -3- Amino-ketobutyrate tertiary-butyl hemi-carbaba, reacted under the reaction conditions reported for compound VII, step A. lH NMR (500 MHz, CD3OD) &amp; 7.35-7.2 (m? 6H), 7.0 (d, 2H), 6.65 (d, 2H), 4.85 (m, 1H), 4.6-4.45 (m, 4H) , 4.3 (br. M, 1H), 4.15 (m, 1H), 3.7 (m, 1H), 2.95 (m, 1H), 2.75-2.6 (m, 3H), 2.35 (m, 1H), 2.1 (m, 1H), 1.9 (s, 3H), 1.4 (s, 9H), 0.95 (d, 3H), 0.90 (s, 3H). Step C · N- (N-Ethyl-Tyramine-Thryl-Valamine-Thryl- (4-methoxypropionyl))-3-amino-4-fluorenylbutyric acid N- (N -Ethyl-Tyramine-Thryl-Valamine-Thryl- (4-Methoxyprolyl-Thryl))-3-Amino-4-Ketobutyric Acid Tertiary-Butyl Acetate Hemicarbazine (270 mg ) Dissolved in 10 ml of 25% trifluoroacetic acid in methane, and stirred at room temperature for 3 hours. The mixture was concentrated to produce a solid residue. The residue solution was mixed with 10 ml of a methanol: acetic acid: 37% formaldehyde (3: 1: 1) mixture and stirred at room temperature for another hour. Mixed -323-This paper scale is applicable to China National Standard (CNS) A4 specification (210X29? Mm) '' ~ ~ (Please read the precautions on the back before filling out this page): Binding -4

541309 A7 B7 321 V. Description of the invention (The compound was concentrated and the resulting residue was purified by flash chromatography (SiO 2), and dissolved in dichloromethane / methanol / formic acid (100: 5: 0.5) to give 37 mg of the title compound. NMR (500 MHz, CD3OD (diastereoisomeric mixture of 1: 1 hemiacetal)) &amp; 7.4-7.25 (m, 5H), 7.0 (d, 2H), 6.65 (d, 2H), 4.65 -4.05 (m, 7H)? 3.75-3.4 (m? 2H), 3.05-2.3 (m, 5H), 2.2-1.95 (m, 2H), 1.90 (s, 3H), 1.0 (d, 3H), 0 95 (d, 3H). One Be 44

(Please read the notes on the back before filling this page)

(a) X = O (b) X = H2 OBt

47 Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs (1S, 9S) 6,10-diketo-octahydro-9- (3-phenylpropanamido) -6H-Da Geng [1,2 -a] [l, 2] Diaza leather-1-carboxylic acid third-butyl ester (44a). (13,95) 9-Amino-6,10-diketo-octahydro-611-da- [1,24] [1,2] diaza-tricarboxylic acid tert-butyl ester ( 690 mg; 2.32 millimoles; GB 2128984) in a solution of diuridine (16 ml) and water (4 ml), add (-324) under (TC) This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the Invention (322) Solid sodium bicarbonate (292 mg; 3.48 mmol) was added dropwise and 3-phenylpropanyl chloride (470 Mg; 2.78 mmoles). The mixture was stirred at room temperature for 2 hours, then more sodium bicarbonate (200 mg; 2,38 mmoles) and 3-phenylpropanyl chloride (100 mg; 0.6 mmol). The mixture was stirred at room temperature for 2 h, diluted with ethyl acetate (50 mL), washed with saturated sodium bicarbonate (2 X 25 mL), dried (MgS04) and concentrated. Residue The material was purified by flash chromatography (0-50% ethyl acetate / chloroform) and finally triturated with diethyl ether to crystallize, which gave 860 mg (86%) of a white solid mp. 137-138 ° C; [a] D23-95.1. (C 0. 549, CH2C12); IR (KBr) 3327, 1736, 1677, 1664, 1536, 1422, 1156; [H NMR (CDC13) &amp; 7.24 (5H, m), 6.50 (1H, d, J = 7.5), 5.24 (1H, m), 4.90 (1H, m), 4.60 (1H, m), 3.44 (1H, m), 2.93 (2H, m), 2.84 (1H, m), 2.64 (1H, m ), 2.54 (2H, m), 2.26 (2H, m), 1.70 (4H, m), 1.70 (9H, s). MS (FAB, m / z): 430 (M ++ 1), 374 , 242, 105, 91. (IS, 9S) octahydro-10-keto-9- (3-phenylpropionamidoamino) -6H-dapono- [l, .2-a] [l , 2] Diazapyrene · 1-carboxylic acid tertiary-butyl ester (44b) was prepared as 44a from (1S, 9S) 9-amino-octahydro-10-keto-6H-da-p- [1] , 2-a] [l, 2] diazepine-1-acid tertiary-butanidine (Attwood et al., J. Chem. Soc. Perkin 1, pp. 101 1-19 (1986)), Can produce 810 mg (81%) of colorless oil 彳 "; ^ 23-33.5. (C 0.545, CH2C12); IR (film) 3334, 2935, 1737, 1728, 1659, 1642; 1U NMR (CDC13) &amp; 7.24 ( 5H, m)? 6.75 (1H, d, J = 6.7), 5.27 (1H, m), 4.92 (1H, m), 3.39 (1H, m), 3.03 (4H, m), 2.55 (3H, m), 2.33 (1H, m), 2.17 (1H, m), 1.80 (5H, m), 1.47 (9H, s), 1,39 (1H, m). MS (FAB, m / z): 416 (M ++ 1), 360, -325- This paper wave scale is applicable to China National Standard (CNS) A4 specifications (210X 297 mm) '{Please read the precautions on the back before filling in this Page) 541309 A7 _____B7 V. Description of Invention (323) 211, 143, 97. (IS, 9S) 6,10-diketo-octahydro-9- (3-phenylpropionamido) -6H-thalco [1,24ting1,2,2] diazepine-1- Carboxylic acid (453). P- (13,98) 6,10-diketo-octahydro-9- (3-phenylpropanylamino) -611-tau- [1,2 * ^ [1,2] diaza Tertiary-1-carboxylic acid tertiary-butyl ester (44a) (800 mg; 1.863 mmol) was added to a solution of anhydrous dichloromethane (5 ml) at 0 ° C, and trifluoroacetic acid (5 ml) was added. The solution was stirred at room temperature for 3 hours and then concentrated. Anhydrous diethyl ether (10 ml) was added to the residue and removed under vacuum. This process was repeated three times to produce a crystalline solid. The solid was triturated with ether and filtered to yield 5 90 mg (8 5%) of a white crystalline solid: m.p. 196-197.5X:; [,] D23-129.5. (C0.2, CH3OH); IR (KBr) 3237, 1729, 1688, 1660, 1633, 1574, 1432, 1285, 1205; Go NMR (CD3OD) &amp; 8.28 (1H, d, J = 7.4), 7.22 (5H, m), 5.32 (1H, dd, J = 5.9, 2.9), 4.75 (1H, m), 4.51 (1H, m), 3.50 (1H, m), 3.01 (1H, m), 2.91 , (2H, m), 2.55 (2H, m), 2.29 (3H, m), 1.95 (2H, m), 1.71 (2H, m). Analysis Calculated for C19H23N305N: C, 61.12; Η, 6.21; N, 11.25 〇 Measured 値: C, 60.80; H, 6.28; N, 10.97. MS (FAB, m / z) 374 (M ++ 1), 242, 105, 91. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) (1S, 9S) Octahydro-10-keto-9_ (3-phenylpropanamido) -6H- Dageng [1,2-a] [l, 2] diaza-p-carboxylic acid (45b). Prepared from (1S, 9S) octahydro-10-keto-9- (3-phenylpropionamido) -6H-thalco [1,2-a] [l, 2] diaza- 1-carboxylic acid tertiary-butyl ester (44b), produced by the method described in compound 45a, yielding 657 mg (96%) of 45b as a crystalline solid: mp. 198-202 ° C; [a] D23- 86.2. (c 0.5, CH3OH); IR (KBr) 3294, 2939, 1729, 1645, 1620, 1574, 1453, 1214; XH NMR (CD3OD) &amp; 7.92 (1H, d? J = 7.9)? 7.20 -326- this Paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (324) (5H, m), 5.29 (1H, m), 4.90 (1H, m), 3.47 (1H, m), 3.08 (2H, m), 2.90 (2H, m), 2.55 (3H, m), 2.36 (1H, m), 1.81 (5H, m), 1.43 (2H, m). MS (FAB, m / z) 360 (M ++ 1), 211, 143, 91. [3S, 2R, S, (1S, 9S)] N- (2-fluorenyl-5-one tetrahydrofuran-3 · yl) -6,10-diketo-octahydro-9- (3-phenyl (Propanamido) -6H-dacrogen [1,2-a] [l, 2] diazepine-1-carboxamide (46a). P- (1S, 9S) 6,10-diketo-octahydro-9- (3-phenyl-propanamido) -6H-dalopano [l, 2-a] [l, 2] diazepine Hetero-1-carboxylic acid (45a) (662 mg; 1.737 mmol) in a solution of anhydrous digas methane (9 ml) and anhydrous dimethylformamidine (3 ml). (Triphenylphosphine) Palladium Chloride (30 mg) and (3S, 2R, S) -3-allyloxycarbonylamino-2-benzyloxy-5-ketotetrahydrocran (Chapman, Bioorg. Med Chem. Lett., 2, ρ ·· 613-18 (1992)) (568 mg; 1.95 mmol) and tri-n-butyltin hydride (1.19 g; 4.09 mmol) was added dropwise. Add 1-hydroxy-benzotriazole (479 mg, 3.546 mmol) to the mixture and cool the mixture to (TC plus 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide Amine hydrochloride (408 mg; 2.128 mmol). The mixture was stirred at room temperature for 3.25 hours, then diluted with ethyl acetate (50 ml), washed twice with dilute hydrochloric acid (20 ml), and washed with saturated sodium bicarbonate. Twice (20 ml), washed once with brine and dried (MgS04) & printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page). Purification (0-100% ethyl acetate / aeroform) yielded 810 mg (81%) of 46a as a mixture of anomas: mp. 92-94 ° C; IR (KBr) 3311, 1791, 1659, 1651, 1536; Tun NMR (CDC13) &amp; 7.49, 6.56 (1H, 2d, J = 6.7, 7.8), 7.29 (10H, m), 6.37, 6 · 18 (1H, 2d, J = 7.7, 7.6), 5.56, 5.34 (lH, d, s, J = 5.2), 5.08-4.47 (6H), 3.18-2.80 (5H), 2.62-2.28 (5H), 2.04-1.53 (5H). MS (FAB, m / z), -327-This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs V. Invention Description (325) 563 (M Ten + 1), 328, 149, 9 [3S, 2R, S, (1S, 9S) ] N- (2-benzyloxy-5-one tetrahydrofuran-3-yl) octahydro-10-keto-9- (3-phenylpropylamidoamino) _6H-dapyrono [l, 2-a ] [l, 2] Diazapyridine-1-carboxamide (46b), prepared from 45b, can produce 790 mg (96%) of glass like method described in 46a: mp · 58-60 ° C; IR (KBr) 3316, 2940, 1793, 1678, 1641, 1523, 1453, 1 120; Go NMR (CDC13) &amp; 7.28 (10Η, m), 6.52, 6.42 (1H, 2d, J = 7.2, 7.1) , 5.53, 5.44 (1H, d, s, J = 5.2), 5.35 (1H, m), 4.6-4.9, 4.34 (4H, m), 3.1-2 · 8 (6H, m), 2.6 -2.1 (7H), 1.95-1.05 (5H), MS (FAB, m / z), 549 (M + + 1), 400, 310, 279, 91. [3S (1S, 9S)] 3- (6,10-diketo-octahydro-9- (3-phenylpropanamido) -6H-thalco [1,2-a] [l, 2 ] Diaza- 1-carboxamido) -4-ketobutanoic acid (47a). [3S, 2R, S, (IS, 9S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-octahydro-9- (3 · benzene Propyl amidino) -6H-da- [1,2-a] [l, 2] diaza-p-carboxamide (46a) (205 mg; 0.364 mmol), 10% Pd / A mixture of c (200 mg) and methanol (20 ml) was stirred at atmospheric pressure under hydrogen for 5 hours. The mixture was filtered and concentrated to give 154 mg (90%) of a glass: mp. 116-118 ° C; [a] D23-140 ° (c 0.1, CH3OH); IR (KB〇3323 (br), 1783, 1731, 1658, 1539, 1455, 1425; Go NMR (CD3OD) & 7.21 (5H, m), 5.17 (1H, m), 4.73 (1H, m), 4.50 (2H, m), 4.23 (1H , M), 3.38 (1H, m), 3.06 (1H, m), 2.91 (2H, m), 2.73-2.18 (6H, m), and 2.01-1.59 (5H, m). Analysis of C23H27N407 + H20 Calculated 値: C, 56 · 32; H, 6.16; N, 11.42 〇 Measured 値: C, 56.29; H, 6.11; N, 11.25. MS (FAB, m / z) 473 (M + + -328 -(Please read the notes on the back before filling out this page) This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 Printed by A7 B7, Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 327) Ν · 2 · (&gt; fluorenyloxycarbonylamino-1,2-dihydro-2-keto-1-pyridyl) ethenyl-3-amino group 0- (2,6-digas- Trimethoxy-butyl keto-pentanoic acid tert-butyl ester (56a). Acetic acid (55 &) (Pan 0 93 21213) in butane (2 ml) was stirred at room temperature with 1-¾ylbenzo Triazole (60 mg, 0.44 8 mmol) and dimethylaminopropyl-3-ethyl diimine hydrochloride (47 mg, 0.246 mmol). After 5 minutes, add water (2 drops) and continue to stir for 20 minutes. Add Bis (triphenylphosphine) free (η) chlorination (6 φg) followed by 3 · (allyloxycarbonylamino group) 4-keto-5- (2,6-dichlorofluorenyl-oxy group ) Tert-butyl valerate (WO 93 16710) (103 mg, 0.224 mmol) in THF (1 ml). Tributyltin hydride (0.09 ml, 0.336) was added dropwise at room temperature over 1 hour. MM). The mixture was stirred for another 3 hours and poured into ethyl acetate, washed with 1M HC1, NaHC03 aqueous solution, brine, dried over MgSO and concentrated in vacuo. The residue was triturated with pentane and the supernatant was discarded. The remaining solid was purified by flash chromatography (500 /. Ethyl acetate / hexane) to give 92¾ g (63%) of the title compound as a colorless oil: [^] D29_29.6. (C 1.1, CH2C12) ; IR (film) 3377, 3365, 3332, 33 12, 1733, 1691, 1650, 1599, 1515, 1366, 1261, 1153, 1068, 747; iHNMR (CDC13) &amp; 8.09 (1H, d, J = 6.8) , 7.84 (1H, s), 7.58 (1H? D5 J = 8.3), 7.33 (8H, m) 7.02 (1H, dd, J = 6.9, 1.7), 6.33 (1H, t, J = 7.2), 5.20 (2H, s), 5.12 (2H, m), 4.89 (1H, dt), 4 , 65 (2H, m), 2.80 (2H, m), 1.38 (9H, s). N-2- (6-Usyl-1,2-dihydro-2-keto- 3 · (3-phenylpropanyl) amino-1 * ^ specification group) Ethyl-3-amine 5- (2,6-monolactamoxy) -4 · fluorenyl-valeric acid tert-butyl ester (56b), prepared by the method described in (56a), can yield the title compound (66%) as Colorless oily: IR (thin film) 3364, 3313, 1738, 1688, 1648, 1600, -330-This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the note on the back first (Fill in this page again)

1T 541309 A7 B7 V. Description of the invention (328) 1566, 1514, 1433, 1369, 1254, 1152; Go NMR (CDC13) &amp; 8.40 (1H, d, J 7.6), 8.30 (1H, s), 7 · 28 (13H, m), 6.20 (1H, d, J = 7.6), 5.12 (2H, q), 4.86 (1H, m), 4.65 (2H, q), 4.06 (2H, s), 3.07-2.61 (6H, m), 1.39 (9H, s). 〇 〇 Cl

56 —►

(a) PhCH: (b) PhCH2CHf

OcA O Person R2 H -CHj-PIi

H H

f Please read the notes on the back before you fill out this one. C: Binding N-2- (3-benzyloxycarbonylamino-u · dihydro-2-keto-1-pyridyl) ethenyl · 3 · Amino-5- (2,6-difluorobenzylfluorenyloxyketo-pentanoic acid (57a; ester (210¾Br, 0.) 56¾mol) was cooled to dichloromethane (05ml). ° C, and then treated with trifluoroacetic acid (0.5 ml), stir and warm to 20. ^ for 30 minutes. The falling liquid was evaporated to dryness under reduced pressure, redissolved in methane and concentrated (Χ 3). The residue was triturated with ethyl acetate and diluted with diethyl ether to give 162¾ g (85%) of the title compound as a colorless solid: mp i65_8 ° C (decomposed); [from] 〇23 · 38 8. (c 0 ·· 1, CH3OH); IR (KBr) 3332, 3275, 1723, 1658, 1649, 1597, 1581, 1562, 1526, 1432, 1385, 1258, 1218, 1206; lR NMR (d6-DMSO) &amp; 8.96 (1H, d, J = 7.3), 8.34 (1H, s), 7.85 (1H, dd, 331-This paper size applies to the Chinese National Standard (CNS) A4 specification (210X 297 mm) -1¾ Employee Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Printed 541309 A7

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs; 7.3), 7.58 (3H, m), 7,35 (5H, m), 6.29 (1H, t, J = 7.3), 5.26 ( 2H, m), 5.15 (2H, s), 4.69 (3H, m), 2.75 (2H, m). Analysis for C27H23N3O9Cl2: c, 53 · 66; H, 3 μ; N, 6 95. Measured Jun C, 53 · 36; Η, 3.90; N, 6.81. MS · (+ FAB); 604 (M + + 1), 285 241, 195, 173, 149, 91 〇N-2- (6-fluorenyl-1, 2-dihydro-2-one-based-3- ( 3-phenylpropionyl) amino-1-pyridyl) ethynyl-3-amino-5- (2,6-digas benzylfluorenyloxy) _4-keto_valeric acid (57b; R ), Prepared by the method of 57a, can produce the title compound (78%) as colorless crystals: mp 116-12 (TC (decomposition); [a] D26-41.1. (C 0.1, CH3OH); IR (κΒγ) 3299, 1739, 1715, 1689, 1666, 1645, 1598, 1563, 1518, 1432, 1209, 1 151; NMR (d6-DMSO) &amp; 9.24 (1H, s), 8.88 (1H, d, J = 7.6 ), 8.18 (1H, d, J = 7.7), 7.60 (3H, m), 7.26 (10H, m), 6.06 (1H, d, J = 7.7), 5.23 (2H, ABq), 4.69 (3H, m ), 3.93 (2H, s), 2.78 (6H, m). Analysis of the calculation of C35H31N308C12 · H20 値 ... (:, 59.16; H, 4.68; N, 5.91. Measured 値: C, 59.38; H , 4.53; N, 5.84. MS (+ FAB); 694, (C1 = 35,37), (M ++ 1); 692 (C1 = 35, 35), (M + + 1). -332- This paper Standards are applicable to China National Standard (CNS) A4 specifications (210X 297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (coffee) R1 Ο,

65

/ 67 、 Η ’

(Please read the notes on the back before filling this page)

69 〜50: 50 rati 丨

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

(a) R1 = 〇CH3, R2 = H (b) R1 = H, R2

OCH 3 7 -methoxy is not sigma (65 a). A mixture of 2-nitro-6-fluorenol (2.62 g, 15.5 mmol) (EP 333176) and 10% Pd / c (130 mg) in ethanol (50.0 ml) was stirred under H2 atmosphere for 75 minutes. The mixture is filtered through Celite®-333. This paper size is in accordance with Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 5. Description of the invention (such as) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs and aligned -Benzenesulfonic acid (32.0 mg) and triethyl orthoformate (6.45 ml, 8.8 mol) were treated immediately, and then heated under reflux at &gt; 12 in the atmosphere. After 20 hours, 'para-toluenesulfonic acid (30.0 mg) and triethyl orthoformate (6.45 ml']] 8.8 mmol were added. After a total of 44 hours of heating, the reaction will be cooled and then reduced at 眞 2. The resulting residue was purified by flash chromatography (25:75 ethyl acetate / hexane) to give 1.97 g (85%) of the title compound as a yellow solid: mp 28-31 ° C; IR (film) 1629, 1497, 1434 , 1285, 1097; NMR (CDC13) &amp; 8 〇9 (m, s), 7.40 (m, d, j = 8.0), 7.28 (1H, t, J = 8 〇), 6.89 (1H, d, J = 8.0), 4.02 · (3H, s); 13C NMR (CDC13) & 152.84, 145.82, 142.50, 139.99, 125.75, 113.42, 108.80, 56.97. Analysis · 0.1H20; C, 63.65; H, 4.81; N, 9.29. Measured 値: C, 63.43, H, 4.8 8, N, 9.05. M.S · (+ FAB); 150 (M + + 1). 4-methoxybenzoxazole (65b). 4-Hydroxybenzohumazole (2.00 g 14.8 mol) (Musser et al., J. Med. Chem., 30, pp. 62-67 (1987)) in a suspension of acetone (80.0 ml) Anhydrous k2CO3 (2.25 g, 16.3 mmol) was added followed by methyl iodide (1.38 ml, 22.2 mmol). The reaction was heated at reflux under n2 for 4.5 hours, then filtered and emptied to yield a crude product. The resulting residue was purified by flash chromatography (25:75 ethyl acetate / hexane) to give 2.0 g (91%) of the title compound as a white crystalline solid: mp 72-74 ° c; (KBr) 3089, 1619 , 1610, 1503, 1496, 1322, 1275, 1090, 1071, 780, 741; Go NMR (CDC13) & 8.02 (1H, s), 7.32 (1H, t, &gt; 8.0), 7.18, (1H, d, J = 8.0), 6.81 (1H, d, J = 8.0), 4.04 (3H, s). Analysis C8H7N02: C, 64 · 42; H, 4.73; N, 9.39. Found 値: c, 64.40; H, 4.84; N, 9.31; m / z (El) 149 (M ++ 1, 100%). -334-This paper size applies Chinese National Standard (CNS) A4 specification (210X 297mm) ---- (Please read the precautions on the back before filling in the page). Ding,-· α 丨 Refer to 541309 A7 B7 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. 5. Description of the Invention (332) (3S, 4R, S) N- (Dilute propoxycarbonylamino hydroxyl · 4_ (2 · (7 • methoxybenzo &quot; Chromatyl)) Tertiary-butyl butyrate (66a). 7-methoxybenzoxazole 65a (548.6 mg, 3.68 mmol) in anhydrous 1: 1117 (185 ml) at -78. :, The solution was stirred at%, and 1.56M n-butyl chain / hexane (2.47 ml '3.86¾ mole) was added dropwise to produce a yellow solution. After stirring at · 78 ° for 20 minutes, the solution was solid. Anhydrous MgBr20Et2 (1.045 g, 4.05 mmol). The resulting heterogeneous mixture was warmed to _45. (: Stirred for another 15 minutes. The reaction mixture was cooled again to -78X :, and (s) -Alloc- was added dropwise. A solution of Asp (tertiary-butyl) H (946.4¾ g, 3.68 mmol) #THF (18.5 ml). The reaction was stirred at -78 ° C for 30 minutes, warmed to 6.0 and stirred for hr. generate The heterogeneous reaction was warmed to room temperature and stirred for 16 hours. The reaction was quenched with 5% sodium bicarbonate (3.5 ml), after which the THF was removed under vacant air. The resulting aqueous residue was extracted with dichloromethane (X 6). The combined extracts were washed with brine, dried (MgS04), filtered and reduced to yield ι · 8 g of crude product. Flash chromatography (40:60 ethyl acetate / hexane) yielded 121 g (81%) ) The title compound, as an oil, is C-4: a mixture of diastereoisomers: IR (ch2C12) 3425, 2983, 1725, 1504, 1290, 1 157, 1 101; iH NMR (CDC13) &amp; 7.35-7.19 (2H, m), 6.89-6.81 (1H, m), 6.00-5.57 (2H, m), 5.32-5.05 (3H, m), 4.68-4.35 (3H, m), 4.01 (3H, s) ), 2.86-2.59 (2H, m), 1.45 (9H, s), 1.41 (9H, s); 13C NMR (CDC13) &amp; 171.18, 171.09, 165.80, 165.30, 156.71, 156.60, 145.65, 142.76, 142.71, 140.82, 140.72, 133.23, 125.81, 125.72, 118.41, 118.21, 113.07, 112.87, 108.95, 82.16, 70.28, 69.98, 66.52, 66.39, 57.03, 52.57, 52.29, 37.83, 36.86, 28.65. Analysis -335- This paper scale is applicable to the Chinese National Standard (CNS) A4 specification (2 丨 OX 297 mm) (Please read the precautions on the back before filling this page);

1T • 1% 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (333) C2H26N2〇7 · 〇.611] 0 ·· C, 57 · 57; Ή, 6.57; N, 6,72. Found 値: C, 57.49, H, 6.34, Ν, 6.60. M.S. (+ FAB); 407 (Μ + + 1); 351, 307, 154. (3S, 4R, S) N- (allyloxycarbonyl) -3-aminohydroxy · 4- (2- (4-methoxybenzoxazolyl)) butyric acid tert-butyl ester (66b) , Prepared according to the method described in 66a, can produce 1.29 g (68%, 26% of the recovered starting material) of the title compound as an oily C-4 diastereoisomeric mixture: IR (CH2C12) 3400, 1725, 1625, 1505, 1369, 1354, 1281, 1263, 1226, 1 158, 1092, 1048; Tun NMR (CDC13) &amp; 7.34-7.24 ("H, m), 7.16 (1H, d, J = 8.2), 6.79 (1H, d, J = 7.9), 6.00-5.50 (2H, m), 5.30-5.05 (3H, m), 4.70-4.35 (4H, m), 4.02 (3H, s ), 2.90-2.45 (2H, m), 1.45-1.41 (9H, 2 xs). Analyze the calculation of C20H26N2O7 · 0.4 · 2Η 値: C, 58.07; H, 6.53; N, 6.77. Measured 値: C, 58.09; H, 6.41; N, 6.63. MS (+ FAB); 407 (M ++ 1, 88%); 351 (100). (3S, 4R, S) N- (N-ethenyl) ⑻- (0-Third · butyl_enzymeamine group) _⑻ · Valamine group- (s) -propylamine group) _3_amino group_4_ (2_ (7-methoxybenzobenzo ' Tetyl)) Tertiary-butyl butyrate (67a). Parabenzazole 66a (481 9 mg, 1.19 Emole) and mg, I ] Bi Mo Er) To a stirred solution of methane (3.5 ml) and DMF (3.5 ml) was added bis (triphenylphosphine) palladium (11) gasification (180 mg), and then tintin hydride was added dropwise. (0.80 ml, 2.96 mmol). Hydroxybenzotriazole (3204 t g, 2.37 mmol) was added and the mixture was cooled to ... ^. Ethyl (monomethylamino) propyl was added] Linghua diimine hydrochloride (278 · 2 mg, 1C mmol), and the mixture was allowed to warm to room temperature and stirred for 16.5 hours. The reaction was suitable for fiscal countries on ethyl acetate paper scale--336-541309 A7 B7 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. 5. Description of the invention (w) The ester is diluted and washed twice with 1M sodium bisulfate, twice with saturated sodium bicarbonate, water and brine. The organic layer is dried ( MgS04), filtered and reduced to yield 2.0 g of crude product. Flash chromatography (9 5: 5 dichloromethane / methanol) yielded 844.0 mg (94%) of the title compound as a white solid: mp 2 〇5 ° c. IR (KBr) 3399, 3304, 2977, 1729, 1643, 1506, 1367, 1290, 1161; lR NMR (d6-DMSO) &amp; 8.24-7.78 (4H, m), 7.43 -7.32 (2H, m), 7.23 (2H, d, J = 8.5), 7.16-7.07 (1H, m), 6.93 (2H, d, J = 8.5), 6.52, 6.40 (1H, 2 xd, J = 5.5, J = 5.0), 5.03, 4.78-4.49, 4.45-4.16 (5H, brt, 2 xm), 4,05, 4.04 (3H, 2 xs), 3.08-2.35 (14H, m), 2.11-1.89 ( 1H, m), 1.83 (3H, s), 1.49-1.32, 1.15, 1.0-0.81 (27H, s, 2 xm, J = 7.0); 13C NMR (d6-DMSO) &amp; 175.55, 175.18, 173.88, 173.75 , 173.05, 169.23, 157.28, 148.55, 146.16, 143.21, 136.63, 133.55, 128.87, 127.17, 115.78, 111.92, 84.02, 81.50, 71.40, 61.15, 60.05, 57.79, 53.39, 51.62, 43.76, 40.52, 34.58, 32.52, 32.52, 34.58, 32.52, 34.58, 32.52, 34.58, 32.52, 34.58, 32.52, 34.58, 32.52, 34.58, 32.52, 34.58, 32.52, 31.05, 169.23, 157.28, 148.55, 146.16, 143.21, 136.63, 133.55, 128.87, 127.17, 115.78, 111.92, 84.02, 81.50, 71.40, 61.15, 60.05, 57.79, 53.39, 51.62, 43.76, 40.52, 34.58, 32.52. , 26.35, 23.1 1, 22.71, 21.76. Analyze the calculation of C39H55N5O10 · 0.5H2O.: C, 61.40. H, 7.40; N, 9.81 ° Measured 値: C, 61.43; H, 7.31; N, 9.07. 1 VI.S (+ FAB); 754 ( M + + 1); 698, 338, 267. (3S, 4R, S) N- (N-Ethyl- (S)-(〇-Third-Butylaminomethylamino)-(S) -Propanylamino Benzobenzoxazolyl) butyric acid tertiary butyric acid (67b), prepared according to 67a method, can produce 1.05 g (94%) of the title compound as a finely divided white powder: mp 210-213X: (dec ); IR (KBr) 3284, 2977, 1736, 1691, 1632, 1536, 1505, 1452, 1392, 1367, 1258, 1236, 1161, 1091; ^ NMR (d6--337- This paper applies Chinese national standards Rate (CNS) A4 specification (2iQX 297 / A $) [Please read the precautions on the back before filling out this page} • Packed with Ding, -φ .-¾ Printed by the Consumers Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, printed 541309 A7, B7 V. Description of invention (coffee)

DMSO) &amp; 8.20-7.75 (4H? M), 7.40-7.10 (4H, m), 7.00-6.80 (3H, m), 6.45, 6.34 (1H, 2 xd, J = 5.3, J = 5.0) , 5.00-4.10 (5H, m), 4.00, 3.99 (3H, 2 xs), 3.00-2.25 (4H, m), 1.95 (1H, m), 1.78 (3H, s), 1.39-0.80 (27H, m). Analysis of C39H55N5O10. Calculation of 0.5H2O: C, 61 · 40; H, 7.40; N, 9.18. Found 値: C, 61.58; H, 7.38; N, 8.91. M.S · (+ FAB); 754 (M + + 1, 30%); 72 (100). (3S) N- (N-Ethylfluorenyl- (SHO-Third-butyl-tyrosinamino)-(S) -Valamine (-)-(S) -propylamino) -Amino- 4- (2- (7-methoxybenzoxazolyl))-4-ketobutyric acid tertiary-butane (68a). Add Dess-Martin reagent (1.082 g, 2.55 mmol) (Ireland et al., J. Org. Chem., 58, p. 2899 (1993); Dess et al., J. Org. Chem. 48, pp 41 55-41 56 (1983)) to a stirred suspension of alcohol 67a (641.0 mg, 0.85 mmol) in dichloromethane (46.0 ml). The resulting mixture was stirred for 1 hour and then partitioned between saturated sodium thiosulfate: saturated sodium bicarbonate (1: 1, 86.0 ml) and ethyl acetate (86.0 ml). The resulting organic phase was washed sequentially with the following, saturated sodium thiosulfate: saturated beta sodium bicarbonate (1 · ♦ 1), saturated sodium bicarbonate, and brine. The organic phase was dried (MgS04), filtered, and reduced in volume to yield 660.0 mg of a crude product. Flash chromatography (94: 6 digas methane / methanol) yielded 636.0 mg (100%) of the title compound as a white solid: random 209 ° C; [a] D24-21.8. (C 0.16, methanol); IR (KBr) 3395, 3294, 2977, 1722, 1641, 1535, 1505, 1 161; 1U NMR (CDC13) &amp; 8.43-8.16 (1H, m), 7.97-7.62 (2H, m), 7.49-7.14 (3H, m), 7.08-6.95 (3H, m), 6.89-6.73 (2H, m), 5.81-5.68 (1H, m), 5.16-4.86 (2H, m) 4.53 (1H , brt), 4.03 (3H, s), 3.16-2.84 (4H, m), 2.11-1.84 (4H, m), 1.46-1.14 (21H, -338-) This paper size applies to China National Standard (CNS) A4 specifications (210X 297mm 1 '' (Please read the notes on the back before filling this page)-Binding 541309 A 7 _____B7_ V. Description of the invention (336) m), 0.92-0.78 (6H, m); 13C NMR (CDC13 ) &amp; 186 · 28, 173.39, 171.90, 171.19, 171.03, 169.89, 156.43, 154.75, 146.32, 142.88, 140.98, 132.31, 130.54, 126.98, 124.73, 1 14.95, 111.42, 82 · 44, 78.71, 58.92, 57.20 54.91, 53.47, 48.77, 39.43, 38.15, 32.79, 29.44, 28.60, 23.55, 20.27, 19.70, 19.34, MS (+ FAB); 752 (M + + 1); 696, 336, 265. (3S) N- (N-Ethyl- (S) -10) -Third-Butyl-Amine-Dynyl) _ (s) -Valinyl- (S) -propylamino) -3 -Amine-4 -(2-4-A Tertiary-butyl ketone ketobutyrate third-butyl ester (68b), prepared according to the method described in ketone 68a, which can produce 420 mg (55%) of the title compound as a white solid: mp 21ι_213χ: (dec) [a] D24-23.9a (c 0.82, methanol); IR (ΚΒγ) 3277, 3075, 1723, 1690, 1632, 1530, 1506, 1392, 1366, 1269, 1234, 1 160, 1094; lR NMR (CDC13 ) &amp; 8.15 (1H, brs), 7.7 (2H, brs), 7.46 (1H, t, J = 8.3), 7.24 (2H, d, J = 8.3) 5 7.10 (1H, brs), 7.03 (2H? d? J = 8.3), 6.83 (3H, m), 5.74 (1H, q, J = 6.9), 5.00 (2H, m), 4.51 (1H, t, J = 7.0), 4.07 (3H , S), 3.20-2.95 (4H, m), 2.00 (4H, m), 1.42 (3H, d, J = 6.8), 1.35 (9H, s), 1.23 (9H, s), 0.86 (6H , D, J = 6.7). M.S. (+ FAB); 752 (M + + 1,7%); 72 (100). Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) (3S) N- (N-Ethyl- (S)-Complex Amine- (S) -Valamine Alkyl- (s) -propylamine Si) -3-amino-4- (2- (7-methoxybenzoxazolyl))-4-ketobutyric acid (69a; R). A solution of the ester 68a (600.0 mg, 0.80 mmol) in a 1: 1 mixture of methane and trifluoroacetic acid (65.0 ml) was stirred for 1 hour under an atmosphere of anhydrous n2. The solution was reduced in volume again, absorbed in ether and reduced again. This process was repeated 6 times to give the crude product as a white solid. Fast chromatography (gradient 95: 5 -339- This paper size is applicable to Zhongguanjia Standard (CNS) A4 specification (210X297 mm) — ~ &quot; &quot; 541309 A7 B7 V. Description of the invention (337) to 80:20 Chloropane / methanol) yielded 40.8 mg (83%) of the title compound as a hygroscopic white solid. The product is a mixture of three isomers in CD3OD

, Containing keto form (c 50%) and its epoxy ketone form (two isomers on c_4 (c 50%): mp decomposes at 150 C: [to] d2 seven 33 2. (C 〇 17, methanol); IR (KBr) 3300, 1715, 1658, 1650, 1531, 1517, 1204; also NMR (CD3OD) &amp; 7.46-7 · 19 (2H, m), 7.16-6.91 (3H, m), 6.70-6.59 (2H, m), 5.62-5.49 (1H, m), 5.00-4.72 (1H, obscurred m), 4.69-4.51 (1H, m), 4.49-4.08 (2H, m), 4.05 -3.89 (3H, m), 3.16-2.47 (4H, m)? 2.05-1.78 (4H, m), 1.41-1.11, 1.05-0.70 (9H, 2 xm). Analyze the calculation of C31H37N501. 3H2020: C , 53 · 67; H, 6.25; N, 10.10. Measured C: C, 53.76; H, 5.56; N, 10.28. MS · (+ FAB); 640 (M + + 1); 435, 147. (3S ) N- (N-Ethylfluorenyl- (S) -Tyrostylenyl_ (s) _Valaminofluorenyl_ (s) _propylaminofluorenyl) -3-amino-4- (2- (4- Methoxybenzoxazolyl))-4-ketobutyric acid tert-butyl ester (69b, S), prepared according to the method of acid 69a, can produce 252 mg (96%) of the title compound with moisture absorption. The product is a mixture of three isomeric forms of CD3OD, containing a keto form and its epoxy-free ketal form (two C-4 The above isomers). The product is a single isomer in d6-DMS0: π · ρ · 200-203 ° C (dec ·); [Jiang] D24-38.0. (C 0.23, methanol); IR ( KBr) 3289, 2968, 1718, 1713, 1658, 1634, 1548, 1517, 1506, 1461, 1453, 1393, 1369, 1268, 1228, 1174, 1092; lR NMR (d6-DMS0) &amp; 9.20 (1H, brs ) 5 8.71 (1H, d, J = 6.2), 8.10 (2H, m), 7.83 (1H, d, J = 8.7), 7.61 (1H, t, J = 8.2), 7.46 ( 1H, d, J = 8.2), 7.08 (3H, m), 6.65 (2H, d, J = 8.3), 5.50 (1H, q J = 6.5), 4.50 (1H, m), 4.37 (1H, m), 4.20 (1H, m), -340- This paper size applies to China National Standard (CNS) Α4 size (210X 297 mm) (Please read the precautions on the back before filling in this page.), \ -ά Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 541309 A7 B7 V. Description of Invention (Coffee) 4.05 (3H, s), 3.09-2 · 77 (4H, m), 1.94 (1H, m) , 1.79 (3H, s), 1.23 (3H, d, J = 7.0), 0.82 (6H, m). Analysis for C31H37N5O10 · 1.5H20: C, 55.85; H, 6.05; N, 10.51. Found 値 χ, 55.21; H, 5.69; N, 10.13. M.S. (+ FAB); 640 (M + + 1, 22%); 107 (100).

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs

3 (S)-(dilute propoxycarbonyl) -amino-4-[(2,6-digas-phenyl) oxazol-2-yl] -4 (R, S) -hydroxy-butyric acid -Butyl ester (99). A solution of 5_ (2,6-difluorophenyl) humidazole (2.71 g, 12.7 mmol; prepared in a manner similar to 23, p. 2369 (1972)) in tetrahydrocondensation (65 ml) Cool to -78 ° C under nitrogen. To this solution was added n-butyllithium (15m solution in hexane, 8.5 strokes' 13.3¾ mole) and stirred at -78 ° C for 30 minutes. Magnesium bromide (3.6 g, 13.9 mmol) was added and the solution was allowed to warm to -45. 〇 calendar 15 minutes. The reaction was cooled to -78 C, and then aldehyde 58 (326 g, 127 mmol, Graybill et al., Int. J. Protein Res .. 44, p. 173-182 (1993)) was added dropwise to tetrahydrofuran. (65 ml). The reaction was stirred for 25 minutes, then allowed to warm to -40 ° C and stirred for 3 hours, and then at room temperature for 1 hour. The reaction was quenched with 5% NaHC03 (12 mL) and stirred for 3 hours. Tetrahydrofuran was removed under aerosol and the resulting residue was extracted with methane gas. The organic layer was extracted with a saturated sodium chloride solution, dried over magnesium sulfate, filtered and concentrated to give 6.14 g of the title compound. Purification yielded 4 79 g (80%) 99: lH NMR -341-541309 Α7 Β7 5. Description of the invention &lt; 339)

ochs 103 (CDC13) &amp; 1.45 (s, 9Η), 2.7-2.5 (m, 2Η), 2.8 (dd, 1Η), 4.2, "(2 xd, 1H), 4.7-4.5 (m, 3H), 5.35 -5.1 (m, 2H), 5.6, 5 · 7 (2 xd, 1H), 6.0 · 5 8 (m, ih), 7.2 (m, 1H), 7.3 (m, 1H), 7.4 ( m, 2H) 〇 (Please read the precautions on the back before filling in this page)

b R = C〇CH2CH2Ph c R = CH2Ph R-H

Order -1% Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs [2-keto_3 (3)-(3-phenylpropanamido) -2,3,4,5-tetrahydro_benzo [ 13] [1,4] Diazetidin-1-yl] methyl acetate (104a). Anhydrous hydrogen chloride efferves to (3 (s) _third · butoxycarbonylaminoketone group_2,3,4,5_tetrahydro-benzo [1]] [1,4] diaza leather small group ) Methyl acetate (103, 1 g, 2.86 mmol) in 25 ml of ethyl acetate solution for 2 minutes, and then at room temperature for 1 hour. Evaporation of the reaction can produce 2-keto · 3⑶ · amino-2,3,4,5_tetrahydrobenzodon, 4]: aza leather small group Acetic acid methyl acetate is said to be a hydrochloric white solid. Hydrochloride and hydrogenated cinnamic acid (〇. "Scales are applicable to Chinese national standards (-342- 541309 A7 --__ ^ ____ V. Description of the invention (340) g '3.15 mmol) dissolved in 20 ml of metformin Amine, and cooled to. Monoisopropylethylamine (1 ml, 5.72 mmol) was added to the solution, followed by N-perylbenzotriazole and 1- (3-dimethylaminopropylpropane). Alkyl) -3-ethylcarbodiimide hydrochloride. After stirring at room temperature for 18 hours, the mixture was diluted with 150 ml of ethyl acetate, and then 10% sodium bisulfate, 10% sodium bicarbonate, and The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and evaporated to give a crude solid, which was purified by flash chromatography and dissolved in 7: 3 ethyl acetate / dichloromethane to yield 600 mg (55%) of the title compound. White solid. IHNMR (CDC13) & 7.3-6.85 (9H, m), 6.5.5-5-6 · 0 (1H, d), 4.88-4 · 82 (1H, m), 4.72-4.65 (1Η, d), 4.28-4.22 (1Η, m), 3.95-3.9 (1Η, m), 3.78 (3H, s), 3.65 (1H, br, s), 3.28-3.2 (1H, m) , 2.95-2.84 (2H, m), 2.55-2.4 (2H, m). (3 (3)-(3-phenylpropionamido) -2-one-2,3,4,5 -Tetrahydrobenzo [13] [1,4] diazepine · 1-yl) acetic acid (105a) (3 (SH3-phenylpropionamido) -2-one-2,3, Methyl 4,5-tetrahydro-benzo [b] [l, 4] diazepine-1-yl) acetate (104a) was dissolved in 90% methanol. Lithium hydroxide-hydrate was added to the reaction, and the reaction It was stirred at room temperature for 4 hours. The reaction was evaporated under vacuum to give a white solid. This was dissolved in 20 ml of water, acidified to pH 5 and extracted with ethyl acetate to give 304 mg (88%) of the title compound as a white solid. 1HNMR (CDC13) & 7.5- Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs, please read the precautions before filling in this page) 6.9 (11H, m), 4.92-4.8 (1H, m) , 4.7-4.58 (1H, d), 4.38 -4.25 (1H, d), 3.88-3.78 (1H, m), 3.45-3.25 (1H, m), 3.05-2.85 (2H, m), 2.55-2.45 ( 2H, m). 4-keto-3 (S)-{2- [2-keto-3 (S)-(3-phenylpropionamido) -2,3,4,5-tetrahydro -Benzo [b] [l, 4] diazapyridin-1-ylacetamido} butanoic acid (106a). N- [l- (2- -343- This paper size applies to Chinese national standards (CNS) A4 specification (210X297 mm) 541309 A7 ——___ B7 V. Invention Ming (341) (Please read the notes on the back before filling out this page) Lower oxy-5_ketotetrahydrofuran-3-ylamine formamidine-methyl &gt; 2-keto-2,3,4, 5-tetrahydro_1H • benzo [b] [14] diazafluoren-3-yl> 3. Phenylpropanamidin 'to prepare compound VII (step A). This gave 390 g (93%) of the product as a diastereomer. iH nmr (CD3OD) &amp; 7.58-7.22 (14H, m), 5.78-5.73 (0.5Η, d), 5.64 (0.5H, s),). 0-4.72 (4Η, m), 4.54-4.42 ( 2Η, m), 3.82-3.76 (0.5Η, m), 3.68-3.62 (0.5Η, m), 3.28-3.21 (0.5H, m), 3.19-3 · 12 (0.5H, m), 3 07-2.98 (2H, m), 2.78-2.48 (4H, m). The resulting product was converted to i〇6a by the method of preparing compound H (step D), and the title compound was obtained as a white solid (17%)] H NMR (CD3OD) &amp; 7.54-6.98 (9H, m)? 5.58-5.44 (1H, m), 4.8-4.2 (4H, m), 3.96-3 · 3 (2H, m), 3.30-3.05 (1H, m), 2.98-2.25 (5H, m). Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs U-fluorenyl-5- (3-phenylpropionyl) -3 (SH3_phenylpropionylamino) -2,3,4,5_ [b] [1,4] Diazafluoren-1-yl] methyl acetate g (104b). Anhydrous hydrogen chloride efferves to (3 (S) -third-butoxycarbonylamino-2-keto-2,3,4,5-tetrahydro, the benzo is [1,4] diaza leather- A solution of 1-yl) methyl acetate (103, 1 g, 2.86 mmol) in 25 ml of ethyl acetate for 2 minutes, and stirred at room temperature for 1 hour. Evaporation of reaction can generate 2-keto-3 (S) -amino-2,3,4,5-tetrahydrobenzo [b] [l, 4] diazepine-1-yl acetate hydrochloride The salt was a white solid. The hydrochloride is suspended in 20 ml of dioxane and then cooled to (TC. Triethylamine (1.6 ml, 1.5 mmol) is added to the suspension, and then dihydrocinnamon chloride is added dropwise. (0.9 ml, 6 moles). The mixture was warmed to room temperature and stirred; mixed for 18 hours. The mixture was diluted with 25 ml of dichloromethane, washed twice with 50 ml of water and once with 50 ml of brine. Organic The layer was dried over anhydrous sodium sulfate, over -344- This paper size is applicable to Chinese National Standard (CNS) A4 size (210X297 mm) Central Standard of the Ministry of Economic Affairs_Printed by the Bureau ’s Consumer Cooperatives 541309 A7-B7 V. Description of the invention ( 342); and was evaporated to give a thick yellow oil, which was purified by flash chromatography and dissolved in 1: 1 ethyl acetate / dichloromethane to yield 1.35 g (92%) of the title product as a white solid. 1H NMR (CDC13 ) &amp; 7.45-7.02 (14H, m), 6.37-6.32 (1H, d), 4.78 · 4.42 (1H, m), 4.52-4.3 (3H, m), 3.82-3.77 (1H, m ), 3.74 (3H, s), 3.03-2.87 (4H, m), 2.58-2.45 (2H, m), 2.45-2 · 35 (1H, m), 2.25-2.16 (1H, m). [2_ Keto-5- (3-phenylpropanyl) -3- (3- (S) -phenylpropanyl Fluorenylamino) -2,3,4,5-tetrahydrobenzo [b] [l, 4] diazepine-1-yl] acetic acid (105b). [2-keto-5- (3- Phenylpropanyl) -3- (3-phenylpropanylamino) -2,3,4,5-tetrahydrobenzo [b] [l, 4] diazepine-1-yl] acetic acid The methyl ester (104b; 680 mg, 1.32 mmol) was hydrolyzed in the step 105a to yield 645 mg (98%) of the title compound as a white solid. 1H NMR (CDC13) &amp; 7.58 (1H, br, s), 7.5-7 · 42 (1H, m), 7.35-6.95 (14Η, m), 4.95-4.88 (1Η, m), 4.64-4.55 (1Η, d), 4.54-4 · 45 (1H, t), 4.15-4.05 (1H, d), 3.75 (1H, m), 3.05-2.75 (4H, m), 2.58-2.45 (2H, m), 2.45-2.28 (1H, m) , 2.25-2.14 (1H, m) 0 2-keto-3 (S)-{2- [2-keto-5- (3-phenylpropionyl) -3 (S)-(3-benzene -Propanylamino) -2,3,4,5-tetrahydrobenzo [13] [1,4] diazafluoren-1-yl] ethenylamino} butanoic acid (106 a). [2-keto- 5- (3-phenylpropionyl) -3- (3-phenylpropionamido) -2,3,4,5-tetrahydrobenzo [b] [l, 4 ] Diaza leather-1 · yl] acetic acid and 3-amino-4-ketobutyric acid tert-butyl ester hemicarbazone, coupled with the preparation step of compound K (step A) to yield 350 mg (85% ) White solid. 1H NMR (CDC13) &amp; 9.05 (1H, br. S)? 7.58-7.55 (1H, d)? 7.5-7.35 (1H, m)? 7.35-6.95 (14H, m), 6.75-6 · 72 (1H, d), 6.25 (1H, br · s), 5 · 25 (1H, -345- This paper size applies to the Chinese National Standard (CNS) A4 size (210X 297 mm) (Please read the note on the back first) Please fill in this page for matters): Pack. Order 541309 A7 B7

Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs, 4.95-4.88 (1H, m), 4.8-4.72 (1H, m), 4.554 4, 3.92-3.88 (1Η, d), 3.73_3.68 (1Η, m), 2.95-2.8 Utt, 4H, m), 2.8- 2.72 (1H, m), 2.62-2.55 (1H, m), 2.55-2.45 (2H, n, W), 2.4-2.32 ( 1H, m), 2.2-2.12 (1H, m), 1.45 (9H, s). 4-keto-3- {2- [2-keto-5- (3-phenylpropionylglycerylepidinopropionamido) _2,3,4,5, -tetrahydrobenzo [1 )] [1,4] Diazepine-1-yl] _ethynylamino} Tertiary-butyl butyrate semicarbazone, such as compound K (Step C) can be generated by deprotection 118 mg (47%) of the title compound as a white solid \ also NMR (CD3〇D) &amp; 7.48-6.95 (14H, m), 4.65-4.15 (6H 3 5 3.4 (1H, m), 2.85-2 72 (4H, m), 2.65-2.5 (1H, m), 2 5_2 34 (3H, m), 2.34-2.15 (2H, m). [5-benzyl-2-keto-3 (S) -(3-phenylpropanamido) -2,3,4,5 · tetrahydrobenzo [b] [l, 4] diaza-1-yl] acetic acid methyl ester (104c). [2-ketophenylpropanylamino] -2,3,4,5-tetrahydrobenzo [b] [l, 4] diaza-i-yl] acetic acid methyl ester (104a; 500 Mg, m millimoles, calcium carbonate (155 mg, 1% millimoles) and fluorenyl bromide (170 microliters, 1.44 millimoles) were absorbed in 10 mL of metformamide and heated to 80 ° C for 8 hours. The mixture was diluted with 150 ml of ethyl acetate and washed 4 times with 50 ml of water. The organic layer was dried over anhydrous sodium sulfate, filtered and evaporated to form a thick Yellow oil, which was purified by flash chromatography and isolated with digas methane / ethyl acetate (8.2.2) to give 460 mg (75%) of the title compound as a white solid. 1HNMR (CDC13) &amp; 7.34-7.05 (HH, m), 6.32-6.28 (1Η, d), 4.84-4.76 (1Η, d), 4.76-4.70 (1H, m), 4.43-4.37 (1H, d), 4.26-4.18 (1H, d) ， 4.06-4.00 (1H, d)? 3.79 (3H, s), 3.45-3.37 (1H, m), 3.02-2.95 (1H, m), 2.90- -346- The paper's wave scale is applicable to the Chinese National Standard (CNS) Α4 specification (210X 297mm) (please read the notes on the back before filling this page). Binding and ordering 541309 A7 __ B7 V. Description of the invention (W) 2.82 (2H, m), 2.5-2.34 (2H, πι) ° (Please read the precautions on the reverse side before filling out this page) [5-Benzyl-2-keto-3 (SH3 · phenylpropionamido) _2,3,4,5_tetrahydro_ Benzo [b] [l, 4] diazepine-1-yl] acetic acid (105c) was prepared by hydrolyzing the ester (102c) by the method of ^ 105a, yielding 450 mg (98%) of The title compound is a white solid NMR (CD3OD) &amp; 7.5-7.05 (14H, m), 6.4 (1H, br · s), 4.85-4.55 (2H, m), 4.5-4.21 (2H, m), 4.12-3.92 (lH, d), 3.45-3.3 (1H, m), 3.1-2.8 (3H, m), 2.55-2.28 (3H, m) ^ 3 (S)-{2- [5-wordyl-2-keto-3- (3 -(S) -Phenylpropanamine) _2,3,4,5-tetrahydrobenzo [b] [l, 4] diazepine-1-ylbutylethylamine 4-keto Butyric acid (106c). [5-Benzyl-2-keto-3 (S)-(3-phenylpropionamido) -2,3,4,5-tetrahydro-benzo [b] [l, 4] diazepine Hetero-1-yl] acetic acid and 3 (S) -amino-4-ketobutyric acid tertiary-butyl hemicarbazone, coupled by the method of compound K (step A), can produce 260 mg (85 %) Of white solid: Tun NMR (CD3OD) &amp; 7.35 · 7.0 (15H, m), 4.94-4.88 (1H, m), 4.68-4.58 (1H, d), 4.57-4.52 (1H? M) 4.41-4.34 (1H, d)? 4.3-4.23 (1H, d)? 4.1-4.04 (1H, d), 3.18-3.11 (1H, m), 3.09-2.98 (1H, m), 2.78- 2.72 (2H, t), 2.65-2.57 (1H, m), 2.42-2.33 (3H, m). 3 (S)-{2- [5-fluorenyl-2-keto-3 (S)-(3-phenylpropanamido) -2,3,4 printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs , 5-tetrahydrobenzo [bni, 4] diazepine-1-yl] acetamido} -4 · ketobutyrate tertiary-butyl ester hemicarbazone, such as the method for preparing compound K (C step Deprotection, yielded 168 mg (81%) of the title compound as a white solid. Tun NMR (CD3OD) &amp; 7.37-7.0 (14H, m), 4.75-4 · 62 (1H, m), 4.6-4 · 45 (2H, m), 4.4-4.21 (2H, m) , 4.15-3.95 (2H, m), 3.15-3.0 (2H, m), 2.82- 2.67 (2H, m), 2.65-2.52 (1H, m), 2.5-5-2 · 32 (3H, m). -347- A--— This paper scale is applicable to China National Standard (CNS) A4 specification (210X 297mm) 'Invention Note (345)

〇 0

C〇2.tBu 107

ο α R: R:

f Read the precautions on the reverse side before filling out this page) 'Packing 2 6 plant gas benzoic acid' third · butoxycarbonyl I keto • keto d (〇phenylpropionase group> 3 (S)- (3-Phenylpropanamido) -2,3,4,5-tetrahydro-benzyl [b] U, 4] diaza-1-yl] ethenyl-amino} butyl ester ( 107a). Guicheng's semi-carba knee compound is compound ⑺ and 晞 propoxycarbonylamino) -4 · keto · 5 · (2 &amp; monochloro + methoxy) valeric acid tert-butyl ester ( WO09 16710) was prepared by coupling to give 256 mg (58%) of the title compound as a white solid. 1H NMR (CDC13) &amp; 7.45_7.04 (17Η, m), 6.45-6.34 (2Η, m), 5.28.5 · 21 (1H, m), 5.1-5.0 (1H, m), 4.95-4.90 (1H, m), 4.75-4.70 (1H, m), 4.55-4.44 (1H, m), 4.32-4.22 (1H, dd), 3.99-3.85 (1H, dd), 3.85-3.76 ( 1H, m)? 3.06-2.83 (5H, m), 2.83-2.74 (1H, m), 2.6-2 · 44 (2H, m), 2.43-2.33 (1H, m), 2.24-2.15 (1H, m ), 1.45 (9H, s) 〇2,6-dichlorobenzoic acid 4-carboxy-2-keto-3 (S)-{2- [2-keto-5- (3-phenylpropane-348 -This paper size is applicable to China National Standard (CNS) A4 specification (2ι〇χ 297 public directors) D, ρα • k Employees' cooperation of China Standards Bureau, Ministry of Economic Affairs, printed 5413〇9 A7. B7____ 5. Description of the invention (346 ) Enzyme group) -3 (SH3-phenylpropionamido) -2,3,4,5-tetrahydrobenzo [b] [l, 4] diazepine-1-yl] acetamido } Butyl ester (108a) was prepared from the method described in compound 57a to produce 56 mg (68%) of the title compound as a white solid ° l NMR (CD3OD) &amp; 7.5-6.9 (17H, m), 5.16-5.02 (1H, dd), 4.88-4.71 (2H, m), 4.62-4.44 (2H, m), 4.42-4.28 (2H, m), 4.27, 4.18 (1H, m) 3.47-3.41 (1H, m), 2.90-2.60 (5H, m), 2.46 · 2 · 4 (2H, m), 2.39-2.18 (2H, m). 4- (7 · methoxybenzoxazolyl) -4-keto-3 (S)-{2_ [2-keto-5- (3-phenylpropionyl) -3 (SH3-benzene Propylpropionyl) -2,3,4,5 · tetrahydrobenzoρΠ1,4] monoazapyridine-butylyl · acetamido} Butyric acid (108b) as described in compound 69a Prepared by the method, the title compound (50%) was produced as a white solid. 1hNMr (CD3〇D) &amp; 7.41-6 · 88 (17H, m), 5.6-5.55 (0.5H, t), 5.48-5.43 (〇 · 5Η, t), 4.64_4.45 (2H, m), 4.45-4.30 (1H, m), 3.93 (1.5H, s), 3.90 (i.5H, S), 3.47-3.34 (1H, m), 3.10-2.85 (2H, m), 2.84-2.63 (5H, m), 2.6-2.4 (2H, m), 2 · 3-2 · 1 (2H, m). (Please read the notes on the back before filling this page)

Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs a

-349- This paper size applies to Zhongguanjia Standard (CNS) A4 specification (21GX 297 male 4) 541309 A7 B7 V. Description of the invention (347) (3S) N- (allyloxycarbonyl) -3-amino-5 -(2-chlorophenylmethylthio) -4-keto-valeric acid tertiary-butane § (123). Fluoride (273 mg, 4.70 mmol) and 2-chlorophenylmethyl mercaptan (373 mg, 2.35 mmol) were successively added to (3S) N- (allyloxycarbonyl) -3-amine -Bromo-5-bromo-4-keto · valeric acid tert-butyric acid (122; 749 mg, 2. millimolar; WO 93 16710) in dimethylformamidine (20 ml) In solution. The mixture was allowed to drain for 3.5 hours, quenched with water (50 mL) and extracted with ethyl acetate (2 X 50 mL). The combined organic extracts were washed with water (4 x 50 mL) and then brine (50 mL). It was then dried (MgS04) and concentrated to give an oil, which was purified by flash chromatography (10-35% ethyl acetate / hexane) to yield 832 mg (91%) of colorless crystals: mp 45-6 ° C; [a] D20 -19.0. (C 1.0, CH2C12); IR (film) 3340, 2980, 2935, 1725, 1712, 151 1, 1 503, 1474, 1446, 1421, 1393, 1368, 1281, 1244, 1157, 1052, 1040, 995, 764 , 739; NMR (CDC13) &amp; 7.36 (2H, m), 7.21 (2H, m), 5.91 (2H, m), 5.27 (2H, m) 4.76 (1H, m), 4.59 (2H, d), 3.78 (2H, s), 3.36 (2H, m), 2.91 (1H, dd), 2.74 (1H, dd), 1.43 (9H, s) p Analysis of the calculation of C20H26C1N05S値: C, 56.13; H, 6.12; N, 3.27; S, 7.49. Found 値: C, 56.08; H, 6.11; N, 3.26; S, 7.54. MS (CI) 430/28 (M ++ 1, 3%), 374/2 (100) 〇 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (Please read the notes on the back before filling out this page} • (3S) 3 (2 (6-Ceto-1,2-dihydroyl-3 (3-phenylpropanylamino) -lp ratio) Ethylamino-5- (2-chlorophenylmethylthio) ) -4-benzyl valeric acid tertiary-butyridine (124a). 6-Amino-1,2-dihydro-2-copperyl-3- (3-phenylpropylamino) -p-pyridyl Acetic acid (52b; 300 mg, 0.76 mmol) in THF (7 ml) with 1-hydroxybenzotriazole (205 mg, 1.52 mmol) and 1- (3-dimethylaminopropyl-3- Ethyl carbodiimide hydrochloric acid) Stir. After 3 minutes, add water (2 drops) and the mixture -350- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 Central Standard of the Ministry of Economic Affairs Printed by the Bureau ’s Consumer Cooperatives V. Description of the invention (⑽) Stir for 10 minutes and then use (3S) N- (晞 propyloxycarbonyl) -3-amino-5- (2-chlorophenylmethylthio) -4 Ketovaleric acid tert-butyl ester (123) (325 mg, 0.76 mol), bis (triphenylphosphine) palladium (II) gasification (20 mg) and tributyl hydrogenated (0.6 ml, 2.28 mmol). The mixture was stirred at room temperature for 5 hours, poured into ethyl acetate, and then washed with 1M aqueous HC1 solution (X 2), washed with aqueous sodium hydrogen acid solution, brine, and dried (MgS04 ) And concentrated. The residue was triturated with pentane and the supernatant was discarded. Chromatography (silica gel, 50% ethyl acetate / hexane) gave a colorless foam (439 mg, 81%): [a] D21- 18.3. (C 0.5, CH2C12); IR (KBr) 3356, 331 1, 1722, 1689, 1646, 1599, 1567, 1513, 1367, 1154; NMR (CDC13) &amp; 8.39 (1H, d), 8.23 (1H , s), 7.24 (14H, m), 6.16 (1H, d), 4.95 (1H, m), 4.63 (2H, m), 4.02 (2H, s), 3.74 (2H, s), 3. · 27 (2H, s), 2.85 (6H, m), 1.40 (9H, s). Analysis of the calculation of C39H42C1N306S C: C, 65.39; Η, 5.91; N, 5.87. Measured 値: C, 65.51; H, 5.99; N, 5.77 〇 [3S (1S, 9S) -3- (6,10-diketo-1,2,3,4,7,8,9,10-octahydro) -9- (3-phenyl (Propanamido) -6H-Da [1,2-a] [l, 2] Diazapyridine-1-carboxamido-5- (2-chlorophenylmethylthio) -4-one Tertiary butyl valerate (124b) prepared from thioether 123 in a similar manner to 124a And 3S (1S, 9S) -3- (6,10-diketo-l, 2,3,4,7,8,9,10-octahydro) -9- (3-phenylpropionamido ) -6H · Dagen and [l, 2-a] [l, 2] diaza-p-carboxylic acid (45a), can produce 452 mg (50%) of colorless foam: mp55-7〇C; ] D22,94.0. (C 0.12, CH2Cl2): IR (KB〇3288, 2934, 1741, 1722, 1686, 1666, 1644, 1523, 1433, 1260, 1225, 1146, 757; 1H NMR (CDC13) &amp; 7.35 (3H, m) , 7.20 (7H, m), 6.46 (1H, d), 5.21 (1H, m), 4.97 (2H, m), 4.56 (1H, m), 3.75 -351-(Please read the notes on the back first (Fill in this page again). The paper size of the binding and binding is applicable to the Chinese National Standard (CNS) A4 specification (21 × 297 mm) 541309 A7 B7 Consumer cooperation of the Central Bureau of Standards of the Ministry of Economic Affairs. ) (2H, s), 3.25 (3H, m), 2.93 (5H, m), 2.71 (1H, dd), 2.55 (2H, m), 2.30 (1H, m), 1.92 (3H, m), 1.66 (2H, m), 1.42 (9H, s). Analysis of the calculation of C35H43C1N407S · 0.25H2O 値: C, 59.73; H, 6.23; Cl, 5.04; N, 7.96; S, 4.56. Found 値: C, 59 · 73; H, 6.19; Cl, 5.10; N, 7.79; S, 4.58. MS (-FAB) 697 (Ml, loo) 〇 (33) 3 (2- (6 -Fluorenyl-1,2-dihydro-2-keto_3- (3-phenylpropanylamino) -1-gadolide) ethylamino-5- (2-aminophenylmethyl) Thio) -4-ketovaleric acid (i25a) 3- (2- (6-Hanyl-1,2-dihydro-2-one- 3- (3-Phenylpropanylaminopyridyl) ethoxy-amino-5- (2-chlorophenylmethylthio) -4-ketovaleric acid (400 mg, 0.56 mmol) in digas methane (3 ml), treated with trifluoroacetic acid (3 ml) at 0 ° C, then stirred at 0 for 1 hour at room temperature and 0.5 hours at room temperature. The solution was concentrated and then It was dissolved in dichloromethane and concentrated again. This step was repeated three times. The residue was stirred in ether for 1 hour and filtered to give a colorless solid (364 mg, 99%): 165-7 ° C; 〇] d22-27.7. ( c 0.2, CH2C12); IR (KBr) 3289, 1712, 1682, 1657, 1645, 1593, 1562, 1527, 1497, 1416, 12〇3, 1182; NMR (CDC13) d 8.47 (1Η, d), 8.21 (1Η, s), 7.70 (1H, d), 7.22 (14H, m), 6.24 (1H, d), 5.03 (1H, m), 4.65 (2H, m), 4.06 (2H, s ), 3.69 (2H, m), 3.23 (2H, m), 2.88 (6H, m) 〇 [3S (1S, 9S)]-3- (6,10-diketo-1,2,3 , 4,7,8,9,10-octahydro) -9- (3-phenylpropanamido) -6H-daphtho [l, 2-a] [l, 2] diaza leather- 1-carboxyamido-5- (2-chlorophenyl-methylthio) -4-ketovaleric acid (125b), prepared from tertiary-butyl ester 1 in a similar manner to 125a 24b, can produce 362 mg (93%) of colorless powder: mp 76 * 80 ° C; [a] d21-134 ° (c 0.10, MeOH); IR (ΚΒγ) 3309, 2935, -352- National Standard (CNS) A4 Specification (210X297 mm) (Please read the precautions on the back before filling this page) 541309 A7 ___ —__ B7 V. Description of Invention (350) 1725, 1658, 1528, 1445, 1417, 1277, 1219, 1175; iHNMR (D6-DMSO) &amp; 8.80 (1H, d), 8.19 (1H, d), 7.31 (9H, m), 5.09 (1H, m), 4.74 (1H, m), 4.63 (1H, m), 4.35 (1H, m), 3.76 (2H, m), 3.28 (3H, m), 2.80 (5H, m), 2.52 (4H, m) , 2.16 (2H, m), 1.90 (3H, m). Analyze c31h35C12N407S. Calculate 0.25: 20: ，: c, 57.49; Η, 5.53; Ν, 8.65; S, 4.95. Found 値: C, 57.35; H, 5.43; N, 8.45; S, 4.88. MS (-FAB) 641 (M-1, 100).

(Please read the precautions on the back before filling this page) 2-Chlorophenylmethyl is broken. A mixture of 2-chlorophenylmethyl bromide (4 g, 19.47 mmol) and Nal (14 g, 97.33 mmol) in acetone (40 ml) was left under reflux for 1 hour. The reaction mixture was cooled, filtered and concentrated in vacuo. The residue was triturated with hexane and filtered. The solution was concentrated in vacuo and the resulting oil was purified by flash chromatography (silica gel, hexane) to give the title compound (4.67 g, 63%) as an oil: NMR (CDC13) &amp; 7.34 (4H, m), 4. · 54 (2H, s). Consumption Cooperation with Employees of the Central Bureau of Standards of the Ministry of Economic Affairs Du (3S) N- (allyloxycarbonyl) -3-amino-5- (2-Gaphenylphenylmethoxy) _4_ketovalerate Esters (201). (3S) N- (fluorenyloxycarbonyl) -3-amino-5 · hydroxy + tert-butyl copper valerate (81, Chapman, et al ·, Bioorg. &Amp; Med

Chem. Lett., 2, pp. 613-618 (1992) 0.144 g, 0.5 mol) and 2. Chlorophenylphosphonium iodide (0.569 g, 1.5 mmol) in CH2C12 (4 ml ) Stir vigorously with silver oxide (0.231 g, 1 mmol) and place at 38. 〇Heating 4 ℃ -353-This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X 297 public holidays) ~ -------- 541309 A7 B7 V. Description of the invention (351). The reaction mixture was cooled, filtered and the filtrate was evaporated. The material was separated into quick layers: purified hydrazone, 0-20% ethyl acetate, and its appearance). The product was colorless / like (0.138 g, 67%); [q] d24 + 3 9 . &amp;} 3, cH2Cl2); lHNMR (CDC13) &amp; 7. 7 (4H, m), 5.88 (2H, m), 5.26 (2H, m), 4.69 (2H, s), 4.57 (3H, m), 4.50 (1H, d), 4.35 (1H, d) , 3.03 (1H, dd), 2.76 (1H, dd), 1.42 (9H, s).

203

Alloc—

(Read the precautions on the back before you fill out this page): Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, printed 5,7-one gas benzotriazole (203). A solution of 2,4-dichloroaspartic acid (20,40 g of 20% hydrous) in EtOAc (500 ml), dried over MgSC ^, filtered and the filter cake was washed with a small amount of EtOAc. Pd / c (5% sulfide_2g) was added and the mixture was hydrogenated until% stopped ingestion. Triethyl orthoformate (160 ml) and p-toluenesulfonic acid (160 mg) were added and the mixture was refluxed for 4 hours. After cooling and removing the spent catalyst by filtration, the solution was washed with saturated NajjC03 solution, water and brine, dried over MgS04 and evaporated to dryness. Triturate with hexane to form a solid, collect by filtration, wash with hexane and dry to yield the title compound (25.5 g, 88%) as a crystalline solid: mp 98-99qC; IR (KBr) 3Ί19, 1610, 1590, 1510, 1452, 1393, 1296, 1067, 850; Go NMR (CDC13) & 8.16 (1H, s), 7.69 (1H, d, J = 1.9), 7.42 (1H, d, J = 1.9); analyze the calculation of C7H3C12N0 Tritium: C, 44.72; H, 1.61; N, 7.45; Cl, 37.70. Found 値: C, 44.84; H, 1.69; N, 7.31; Cl, 3 7.71. 354 This paper size applies the Chinese National Standard (CNS) A4 specification (2i0 &gt; &lt; 297mm) Order j-n .-- 541309 Printed by A7 B7, Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (3S, 4RS) N- (allyloxycarbonyl) -3-amino-4-hydroxy-4- (5,7-dichlorobenzohumazol-2-yl) butyric acid tert-butyl ester (204). Magnesium bromide was prepared by mixing Mg (7.45 g, 0.30 mol) with THF (516 ml) and 12 (50 mg) and 1,2-dibromoethane (26.3 ml, 57.3 g, 0.30 mol) It was reacted under reflux for 2 hours and then cooled to -40 ° C. Quickly add a solution of 2-lithium-5,7-dichlorobenzoxazole at 70 ° (:) (from 5,7-digas benzohumazole (203, 28.9 g, 0.154 mole)) via the catheter and above Butyllithium (100 mL, 1.52 M in Kojiin) was prepared in THF (150 mL) at 70 ° C. The mixture was stirred at -40 ° C for 1 hour and then cooled to -70. (:, After that, (3S) N- (ene '^ propoxycarbonyl) -3-amino-4-fluorenyl-butyric acid, butyric acid (Chapman, et al., Bioorg. &Amp; Med. Chem. Lett. , 2, pp. 613-618 (1992)) (20.3 g, 0.078 moles) in THF (160 ml) was performed at a temperature below -60 ° C. The reaction was warmed to ambient temperature and stirred for 16 hours. It was stopped by adding ammonium chloride solution and extracted with 600 ml of 1 · 1 hexane: ethyl acetate. The organic solution was washed with water and brine, dried over 304§304 and evaporated to a syrupy form (52.9 g). Flash chromatography (Si02 250 g-u times 1: 1 hexane: CH2C12 X 2, CH2C12, 5% EtOAc in CH2C12, 10% EtOAc in CH2C12, 20% EtOAc in CH2C12) can produce 24.6 g of impure product, which is further Chromatography (Si02: l hexane: ether) yields the title Compound, golden-brown glass (22.7 g, 64%); IR (thin film) 3343, 2980, 1723, 1712, 1520, 1456, 1398, 1369, 1254, 1158, 993; Tun NMR (CDC13) &amp; 7.60 (1H, m), 7.37 (1H, m), 5.72 (1H, m), 5.64 (0.5H, d), 5.10 (2.5H, m), 4.7-4.3 (4H, m ), 2.9-2.6 (2H, m), 1.46 and 1.42 (9H mixed, 2 xs). MS ES + Da / e 445 (M + 1) + Cl 35 62%, 447 (M + 1) + Cl 37 40 %, 389 100%. -355- This paper size applies to Chinese National Standard (CNS) A4 (210X297mm) (Please read the precautions on the back before filling out this page)-Binding and binding 541309 Α7 Β7 Central Standard of the Ministry of Economic Affairs Printed by the Bureau's Consumer Cooperatives V. Invention Description (Tear) f-Bu NH2

Alloc—NH

^ Βυ〇2 ° ν ^ Ν * ^ 〇Η Alloc—NH (a) (b)

S R 205a 205b 206a 206b

H

(2S) -N-N-propylalanyl-5- (1,1-dimethylethyl) ine amino acid (205a). To a mixture of THF (200 ml) and water (100 ml) containing NaHC03 (16.6 g, 0.2 mol) was added tert-butyl glutamate (10 g, 49.2 mmol). Allyl chloroformate (6.8 ml, 64 mmol) was added dropwise over 20 minutes. The mixture was stirred for 2 hours, extracted with EtOAc, and a saturated bicarbonate solution. Wash your knees with water and saturated saline solution, dry and evaporate to 2 0 5 a (9.5 g, 67.2%): [PAN] D20-6o (c 1.5, MeOH) Tun NMR (D, 6-DMSO) &amp; 6.10 (1H, d), 5.96-5.88 (1H, m), 5.31-5.12 (2H, m), 4.45 (2H, m), 3.90-3.84 (1H, t), 2.18 (2H, m), 1.85- 1.76 (2H, m), 1.36 (9H, s). (2R) -N-allyloxycarbonyl-5- (1,1, -dimethylethyl) glutamate (205b) can be prepared in a similar manner to 205a to produce a colorless oil (6.27 g, 88% ): [α] D20 + 16 ° (c 0.095, MeOH); IR (KBr) 3678, 3332, 3088, 2980, -356- This paper size is applicable to Chinese national standard (0 ~ 5) 6-4 specifications (210 / 297 mm) (Please read the notes on the back before filling out this page) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (354) 2937, 1724, 1530, 1453, 1393, 1370, 1331 , 1255, 1 155, 1056, 995, 935, 845, 778, 757, 636, 583; Go NMR (CDC13) &amp; 9.24 (1H, width s), 5.94-5.79 (1H, m), 5.58 (1H, d), 5.33-5.17 (2H, m), 4.55 (2H, d), 4.38-4.31 (1H, m), 2.41-1.95 (4H, m), 1.42 (9H, s); analysis C13H21N06t calculation 値: C , 54.35; H, 7.37; N, 4.88. Measured radon: C, 54.4; H, 7.5; N, 4.8. (4S) N-allyloxy-4-amino-5- # to valeric acid tertiary-butyric acid (206a). To a solution of 205a (3.6 g, 12.5 mmol) in THF (100 ml) was added N-methylmorpholine (1.5 ml, 13 mmol) at 0 ° C followed by isochlorochloroisocyanate. Butyl ester (1.1 ml, 13 mmol). After 15 minutes, the mixture was added to a suspension of NaBH4 (0.95 g, 25 mmol) in THF (100 mL) and MeOH (25 mL) at -78 ° C. After 2 hours at -70 ° C, the mixture was quenched with acetic acid, diluted with Eto Ac, washed 3 times with a saturated bicarbonate solution, washed with water and a saturated salt solution, dried and evaporated. Flash chromatography (2% MeOH in CH2C12) yielded 206a as a colorless oil (2.4 g, 70%): [a] D20-10. (C 3.88, CH2C12); NMR (CDC13) &amp; 5.84 (1H, m), 5.34-5.17 (3H, m), 4.56-4.53 (2H, m), 3.68-3.59 (2H, m), 2.98 (1H, m), 2.40-2.30 (2H, t), 1.84-1.78 (2H, m), 1.43 (9H, s); Analysis of the calculation of C13H23N5: C, 57.13; H, 8.48; N, 5.12. Found 値: C, 57.1; H, 8.6; N, 6.0. (4R) N-allyloxycarbonyl-4-amino-5-hydroxypentanoic acid third-butyl ester (206b), prepared in a manner similar to 206a, can yield the title compound as a pale yellow oil (3.42 g, 57 %) [a] D20 + 14 (c 0.166, MeOH); IR (KBr) 3341, 3083, 2976, 2936, 2880, 1724, 1533, 1454, 1419, 1369, 1332, -357- (Please read the Note: Please fill in this page again.) This paper size is applicable to Chinese National Standard (CNS) A4 specification (210 × 297 mm). 541309 Printed by A7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs. ____B7 _ V. Description of Invention (355) U51, 1156 , 1062, 997, 933, 846, 777, 647; Tun NMR (CDC13) &amp; 5.98-5.81 (1H, m), 5.35-5.10 (3H, m), 4.55 (2H? D), 3.70-3.56 (3H , M), 2.50-2.47 (1H, width s), 2.37-2.30 (2H, m), 1.89-1.74 (2H, m), 1.44 (9H, s); Analysis of the calculation of C13H23N05 値: C, 57.13; H, 8.48; N, 5.12. Found 値: C, 56.9; H, 8.6; N, 5.6. (4S) tert-butyl N-allyloxycarbonyl-4-amino-5-ketovalerate (207a). To a solution of DMSO (1.51 g, 19.3 mmol) in CH2C12 (25 ml) at -70 ° C was added monochloro chloride (1.34 g, 19.3 mmol). After 10 minutes at -70 ° C, a solution of (206a) (2.4 g, 8.8 mmol) in CH2C12 (10 ml) was added dropwise, and the mixture was stirred at -70 ° C for 15 minutes. Diisopropylethylamine (3.4 g, 26.3 mmol) was added and the mixture was stirred at -25 ° C for 15 minutes, then diluted with EtoAc (50 ml) and washed with 2M sodium hydrogen sulfate solution, and concentrated to an oil. , Can be used immediately without further purification: ¾ NMR (CDC13) &amp; 9.5 (1H, s), 6.0-5.5 (2H, m), 5.5-5.1 (2H, m), 4.5 · 2 (2H, m), 4.2 (1H, m), 2.4-2.10 (2H, m), 2.05 (2H, m), 1.36 (9H, s). (4R) N-allyloxycarbonyl-4-amino-5-ketovaleric acid third-butyl ester (207b), prepared in a similar manner to 207a, can form an oil (2.95 g, 96% ), This can be used without further purification in the next step: [+21. (C 0.942, MeOH); 1U NMR (CDC13) &amp; 9.58 (1H, s)? 6.05-5.80 (1H, m)? 5.57 (1H, width s), 5.35-5.18 (2H, m), 4 56 (2H, d), 4.34-4.24 (1H, m), 2.38-2.16 (3H, m), 1.96-1.73 (1H, m), 1.43 (9H, s). (4S) N-Hydroxypropoxy-4-aminovaleric acid tertiary-butyrate hemikabazine (208a). To a solution of 270a (2.39 g, 8.8 mmol) in MeOH (20 ml) was added sodium acetate (0.72 g, 8.8 mmol) and half carbohydrate (〇98 g, -358-). Standard (CNS) A4 (210 X 297 mm) '-(Please read the precautions on the back before filling this page) 541309 A7 B7

8.8 mo)), stirred overnight, concentrated and diluted with CH2C12 (100 ml), washed with water, dried and concentrated. Flash chromatography (2% MeOH in CH2C12) yields

208a (2.10 g, 73%) was oily: [to] 02-20 (c 2 55., ch2C12); iH NMR (CDC13) &amp; 9.98 (1H, s), 7. · 27 (1H, d), 5.8 (1H, m), 5.5 (1H, d), 5.35-5.19 (2H, m), 4.58 (2H, m), 4.14 (1H, m), 2.37 ( 2H, t), 2.09 (1H, m), 2 · (M.75 (2H, m); calculation of analysis C14H24N405; 5: C, 51.21; H, 7.37; N, 17.06. Measured 値: C , 50.2; H, 7.3; N, 16.1. (HR) N-fluorenylpropoxycarbonyl-4-aminofluorenylvaleric acid tert-butyl ester hemicarbazine (208b), prepared by a method similar to 208a, can be generated Glassy oil (2 37 g, 66%) [a] D20 + 30 (c 0.26, CHC13); IR (KBr) 3476, 3360, 2979, 2923, 1700, 1586, 1527, 1427, 1394, 1369, 1338, 1253 , 1156, 1060, 997, 929, 846, 775; 1Η NMR (CDC13) &amp; 9.87 (1Η, s), 7.09 (1H, d), 6.05-5 · 75 (3H, m), 5.58 (1H, d), 5.32-5.16 (2H, m), 4.54 (2H, d), 4.35 (1H, m), 2.32-2.26 (2H, m), 2.15-1.55 (2H, m), 1.41 (9H , S); Analyze the calculation of C14H24N405: C, 51.21; H, 7.3 7; N, 17.06. Measured 値: C, 51.0; H, 7.5; N, 16.7. (Please read the back first Notes on filling out this page) Ministry of Economic Affairs Bureau of Standards staff printed consumer cooperatives

(b) R1 = MeS〇2 212 (b) R1 = MeS02 (c) R1 = MeCO (c) R1 = MeCO (d) R1 = PhCH20C0 (d) R1 = PhCH2〇C〇 (e) R1 = PhCO (e ) R1 = PhCO (f) R1 = Fmoc (f) R1 = Fmoc -359- The national standard (CNS) A4 size (210X 297 mm) applicable to this paper size 541309 Α7 Β7 V. Description of the invention (No) (please (Please read the notes on the back before filling out this page) (13,95) 6,10-Diketo-9-methylpyridamido_12,3,4,7,8,9,10-octahydro_ 6H-Da-Pheno [i, 2-a] [l, 2] Diazapyridine-1-citric acid tert-butyl ester (2iib). 9-Amino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro_611-tago [1,2, a] [l, 2] Tertiary butyl diaza-l-carboxylic acid (GB 2,128,984; 831 mg, 2.79 mmol) and diisopropylethylamine (1.22 ml, 6.99 mmol, 2.5 equivalents) The solution in CH2C12 (10 ml) was treated with methanesulfonyl chloride (237 µl, 3.07 mmol, 1.1 equivalents) under nitrogen. The mixture was stirred; stirred for 1 hour, diluted with EtOAc (75 mL), washed with saturated NaHCO3 (50 mL) and saturated aqueous sodium chloride solution (30 mL), dried (MgSO4) and concentrated. Flash chromatography (10-35% EtOAc in CH2C12) yielded 21 lb (806 mg, 77%) as a colorless solid: mp 68-70 ° C; [to] D23-109 (c 1.09, CH2C12); IR (κΒγ ) 3270, 2980, 2939, 1735, 1677, 1458, 1447, 1418, 1396, 1370, 1328, 1272, 1252, 1232, 1222, 1 156, 1 131, 991; Tun NMR (CDC13) &amp; 6 · 15 ( 1H, d), 5.31 (1H, m), 4.65-4.11 (2H, m), 3.47 (1H, m), 2.99 (3H, s), 2.89 (1H, m), 2.72-2.51 (2H, m), 2.34 (1H, m), 2.26 (lH, m), 2.05-1.62 (4H, m), 1.47 (9H, s); Analysis of the calculation of C15H23N306S 値: C, 47.97; H, 6.71; N, 11.19 S, 8.54. Found 値: C, 48.28; H, 6.68; N, 10.86; S, 8.28. MS (+ FAB) 376 (M + +1, 66%), 320 (100) 〇 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (13,93) 9-acetamido-6,10-dione- 1,2,3,4,7,8,9,10-octahydro-611-da-[[1,2-a] [l, 2] diazepine-1-carboxylic acid tert-butyl ester (211c). Acetic anhydride (307 mg, 3.01 mmol) was added to 9-amino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro_611- [1,2- &amp;] [1,2] Diazapyridine-1-carboxylic acid tert-butyl ester (GB 2,128,984; 813.7 mg, 2.74 mmol), diiso-360-benzyl Paper size applies Chinese National Standard (CNS) A4 specification (210X29 * 7 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 _ B7 ___ V. Description of the invention (358) Propylethylamine (884 mg, 6.84 MM) and CH2C12 (20 ml) in a stirred mixture. The mixture was kept for 1 hour and then diluted with EtOAc, washed with NaHC03 solution and brine, dried (MgS04) and concentrated to give a colorless oil. The product was purified by flash chromatography (0.5-8% MeOH / CH2Cl2) to give 211c (804 mg, 71%) as a colorless powder: mp 162-3eC; [a] D23-109 (c 1.03, CH2C12); IR ( KBr) 3358, 2974, 1733, 1693, 1668, 1528, 1462, 1431, 1406, 1371, 1278, 1271, 1250, 1233, 1217, 1154, 1124; &amp; 1HNMR (CDCl3) d6.32 (lH, d) , 5.29-5.25 (lH, m), 4.98- 4.85 (1H, m), 4.68-4.58 (1H, m)? 3.55-3.39 (1H, m), 2.91-2.66 (2H, m), 2.39-2.18 ( 2H, m), 2.03 (3H, s), 1.88-1.64 (4H, m)? 1.47 (9H, s); Analysis of the calculation of C16H25N305: C, 56.62; H, 7.43; N, 12.38. Found 値: C, 56.62; H, 7.43; N, 12.36; MS (+ FAB) 340 (M + + 1, 40%), 284 (100). (1S, 9S) 9- (fluorenyloxycarbonylamino) -6,10-diketone-1,2,3,4,7,8,9,10-octahydro-6H-thalco [i, 2 -a] [l, 2] Diazapyridine-1-carboxylic acid tert-butyl ester (21d). Phenyl formate (1.07 g) was added dropwise to (1S, 9S) 9-amino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro- 611-Da Geng [1,24] [1,2] Diaza leather-1-carboxylic acid tert-butyl ester (GB 2,128,984; 1.55 g, 5.21 mmol), NaHC03 (0.66 g , 7.82 mmol), diazane (32 ml) and water (8 ml) in a stirred ice-cold mixture. The mixture was held at 5 ° C for 15 minutes and then at room temperature for 2 hours. The mixture was diluted with EtOAc (50 mL), washed twice with saturated NaHC03 solution, dried: (MgS04) and concentrated. The oily residue was purified by rapid stratification to produce 2lld (I · 98 g, 88%) as a colorless oil: [WD24- 56 · 4 (c 1.〇, CH2cl2); IR (thin film) 3325, 2979, 2946, 1728 , 1677, (Please read the precautions on the back before filling this page)-Binding. Order -361-This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 Staff Consumption of Central Standards Bureau, Ministry of Economic Affairs Printed by the cooperative V. Description of the invention (359) 1528, 1456, 1422, 1370, 1340, 1272, 1245, 1156, 1122, 1056, 916, 734, 699; Go NMR (CDC13) &amp; 7 · 29 (5H, m ), 5.81-5.72 (1H, m), 5.26-5.20 (1H, m), 5.05 (2H, s), 4.69-4.51 (2H, m), 3.48-3.36 (1H, m), 2.81 · 2.51 (2H, m), 2.34-2.19 (2H, m), L904.54 (4H, m), 1.41 (9H, s); Analysis C22H29N306. H20: C, 58.79; H, 6.92; N, 9.35. Found 値: C, 59.10; H, 6.57; N, 9.25; MS (ES +) 454 (M + + Na, 87%), 432 (M + +1, 100) 〇 (15,95) 9- 芊 醯Amino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-611-da-co- [1,2, a] [l, 2] -diaza Hexa-1-carboxylic acid tert-butyl ester (211e). A solution of chloro (1.61 g, 11.47 mmol) in CH2C12 (15 ml) was added dropwise to (1S, 9S) 9 · amino-6,10-diketonyl1,2,3,4 , 7,8,9,10-octahydro-6H-da-co- [1,2-a] [l, 2] diaza leather 1-carbonyl acid tert-butyl ester (GB 2,128,984; 3.1 G, 10.43 mmol), anhydrous CH2C12 (20 ml) and diisopropylethylamine (4.54 ml, 26.06 mmol) in a stirred ice-cold mixture. The mixture was kept in the cold for 1 hour and then left at room temperature for 0.5 hours. The mixture was diluted with CH2C12, washed twice with brine, dried (MgS04) and concentrated. The residue was purified by flash chromatography (0-5% methanol in CH2C12) to give 21 le (4.0 g, 96%) as a colorless glass: mp 74-76 ° C; [to] d30-75. ° (c 0.12, CHflJ. IR (KBr) 3350, 2979, 2938, 1736, 1677, 1662, 1536, 1422, 1276, 1250, 1155; Go NMR (CDC13) &amp; 8.72 (2H, m), 7.53-7.40 ( 3H, m), 7.07 (1H, d, J = 7.2), 5.30 (1H, dd, j = 3.0, 5.8), 5.12 (1H, m), 4.66 (1H, m) , 3.51 (1H, m), 2.90 (2H, m), 2.38 (1H, dd, J 13.2, 6.8), 2.25 (1H, m), 1 · 9 (2H, m) , 1.70 (1H, m). Analyze the calculation of C21H27N305.0 · 5Η20. 値: C, 61.45; -362- The paper scale is applicable to the Chinese National Standard (CNS) A4 specification (210X 297 mm) (Please read the note on the back first) Please fill in this page again for matters) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 V. Invention Description (360) Η, 6.88; N, 10.24. Measured 値: C, 61.69; Η, 6.71; N, 10.18. ⑴ Shoulder with '仏 diketo-asparthenyl methoxycarbonylamido) · 1 ^^ 3,4,7,8,9,10-octahydro-611_Da Gong [1,24] [12] Diaza leather 1-butanoic acid second-butyl ester (211f) Prepared in a 2ue-like manner, except that 9 • fluorenylmethylchloroformyl ester was used instead of tritium gas, a white glassy solid 2Uf (2.14 g, 89〇 / 0): mp19 (M92X:; h) D25- 8l.5. (CO.LCH / y. IR (KBr) 3335, 2977, 1731, 1678, 1450, 1421, 1246, 1 156, 742; NMR (CDC13) &amp; 7.60 (2H? M), 7.57 (2H , m), 7.50-

7.26 (4H, m), 5.60 (1H, d, J = 7.8), 5.28 (1H, m), 4.67 (2H, m), 4.38 (2H, m), 4.23 (1H, m ), 3.59-3.41 (1H, m), 2.92-2 · 65 (2H, m), 2.41-2.21 (2H, m), 1.95-1.58 (4H, m), 1.47 (9H, s). MS (ES_, m / z) 520 (M + + 1,97%), 179 (100%) 〇 (1S, 9S) 6,10-diketo-9-methylsulfonamido-1,2, 3,4,7,8,9,10-octahydro-6H-da-co- [1,2-a] [l, 2] dihydrofluorene-1 · carboxylic acid (212b), same as compound 212e Synthesized (635 mg, 85%) as a colorless powder: mp 209-12 ° C; [a] D24-132 (c 0.12, MeOH); IR (KBr) 3308, 2940, 1717, 1707, 1699, 1619, 1469, 1456, 1442, 1417, 1391, 1348, 1339, 1330, 1310, 1271, 1247, 1222, 1 175, 1 152, 1133, 993, 976; Tun NMR (CD3OD) &amp; 5.35 (1H, m), 4.58-4.48 (1H, m), 4.46-4.36 (1H, m), 3.60-3.42 (1H, m), 3.01-2.87 (1H, m), 2.95 (3H, s), 2.55-2 · 39 (1H, m), 2.32-2.20 (2H, m), 2.09-1.89 (2H, m), 1.78-1.62 (2H, m); calculations for analysis: C, 41.37; H, 5.37; N, 13.16; S, 10.04. Found 値: C, 41.59; H, 5.32; N, 12.57; S, 9.76; MS (ES-). CnHlsN306S (MH +) True Quality Estimate -363-(Please read the notes on the back before filling out this page): Packing-The size of the paper is applicable to the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 Ministry of Economic Affairs Printed by the Consumer Standards Cooperative of the Central Bureau of Standards A7 ________ B7_ · _ V. Description of the invention (36 ”Count: 320.0916. Measured 値: 320.0943. (15,93) 9-Ethylamido-6,10-di-yl- 1,2,3,4,7,8,9,10-octahydro-611-p-well and [1,2-a] [l, 2] diazepine-1-metarate (212c ), Prepared from 211e, the same method as 212e was a white glassy solid (595 mg, 77%): mp &gt; 250 C; [] d24-153 (c 0.10, MeOH); IR (KBr) 3 280, 2942 , 1742, 1697, 1675, 1650, 1616, 1548, 1470, 1443, 1281, 1249, 1202, 1 187, 1 171; 1HNMR (CD30D) &amp; 5.35-5.31 (m, m), 4.81-4.71 (1H, m), 4.61-4.46 (1H, m), 3.59-3.44 (2H, m), 3.11-2.94 (1H, m), 2.58-2.39 (1H, m), 2.36-2 · 19 (2H, m ), 2.11-1 · 83 (3H, m), 1.99 (3H, s), 1.78-1.56 (2H, m); Analysis C12H17N305: C, 50 · 88; H, 6.05; N, 14.83. Measured 値: C, 50.82; H, 6.02; N, 14.58; MS (ES-) 282 (Ml, 100%): C12H18N305 (MH +): Mass estimation: 284.1246. Found: 284.1258. (1S, 9S) 9-benzyloxycarbonylamino · 6,10-diketo-l, 2,3,4,7,8,9,10-octahydro-6H-thalco [l, 2-a] [l, 2] diaza leather- l-carboxylic acid (212d) was prepared from 211d and showed colorless crystals (170 mg, 97%) using the same method as compound 212e: mp 60-100 ° C; [^] D22-103 (c 0.10, MeOH) ; IR (KBr) 3341? 2947, 1728, 1675, 1531, 1456, 1422, 1339, 1272, 1248, 1221, 1174, 1122, 1056, 982, 699; Go NMR (CDC13) &amp; 7.35 (5H, s) , 5.65 (1H, d), 5.48-5.40 (1H, m), 5.10 (2H, s), 4.76-4.57 (2H, m), 3.49-3.30 (2H, m), 2.92 · 2 · 59 (2H, m), 2.40-2.27 (2H, m), 1.97-1.67 (4H, m); MS (ES-) 374 (M -1, 100%). ci8H, 2N306 (MH +) for exact mass estimation: 376.1509. Found 値: 376.1483. Ci8H2iN3O6Na (MNa +) estimated mass 値: 398.1328. Measured 値 -364- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before writing this page) 541309 A7 _____ ΒΊ _ V. Description of the invention (^) : 398.13 15. (Please read the precautions on the back before filling this page) (IS, 9S) 9-fluorenylamino-6,10_diketo-1,2,3,4,7,8,9,10_ Octahydro · 6H_ Dagen [l, 2-a] [l, 2] -Aza leather_1-carboxylic acid (212e) THF (20 ml) was added to the ice-cold stirring solution of tertiary-butyl ester 211e ( 415 grams, 1034 millimoles) in anhydrous liters). The mixture was kept cold for 15 hours, then at room temperature for 2.5 hours, and then concentrated. TFA was removed by repetition of the residue CH2C12 \ ether and ether solution. The residue was finally ground with ether to give 212 €, 3.05 g (85%) of a white glassy solid: 1111) 118-126. (:; Bu) 〇24-70.5. (C 0.1, CH2C12). IR (KBr) 3361, 2943, 1737, 1659, 1537, 1426, 1220, 1174; 1Η NMR (CDC13) &amp; 7.80 (2Η, m) , 7.54-7.33 (4H, m), 8.83 (brs), 5.44 (1H, m), 5.26-5.13 (1H, m), 4.66 (1H, m), 3.59-3.41 (1H, m), 2.97, 2.76 (2H, 2m,), 2.36 (2H, m), 1.98 (2H, m), 1.75 (2H, m). MS (ES ·, m / z) 344 (M-1,100%). ( 1S, 9S) 6,10-diketo · 9 (fluoren-9-ylfluorenyloxycarbonylamino) &gt; 1,2,3,4,7,8,9,10-octahydro-611_ [1,24] [1,2] -Diazapyridine-1-carboxylic acid (212f), prepared from 211f, printed in the same way as 212e, yielding 96% yield, printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs: mp 120-126 ...; 〇] D25-72.5. (c 0.1, CH2C12). IR (KBr) 3406, 2950, 1725, 1670, 1526, 1449, 1421, 1272, 1248, 1223, 1 175, 761,741 ; NMR (CDC13) &amp; 7.76 (2H, m), 7.62-7.26 (4H, m), 6.07, 5.76 (2H, brs? D, d, J = 2.9), 5.46, 5.36 (1H, 2m), 4.79-4.54 (2H, m), 4.77 (2H, m), 4.21 (1H, m), 3.41 (1H, m), 2.89 (1H, m), 2.69 (1H, m), 2.35 ( 2H, m) , 1.98, 1.73 (4H, 2m) 〇MS (ES ·, m / z) 462 (M +-1,50%), 240 (100%). -365- This paper size applies to Chinese National Standard (CNS) A4 Specifications (210X 297mm) 541309 A7 B7 Five 'invention description (363,

R1-I

(c) R '' (e) R]

MeCO PhCO R1—

(213)

(214) (c) R = MeCO (el · R1 = PhCO Printed by [2RS, 3S (1S, 9S)] N- (2-Methoxy-5-one-tetrahydro) Sulfur-3_yl) -9- (acetamido) -6,10_diketonyl_1,2,3,47,8,9,10-octahydro-611-da-bond [1, 2-a] [l, 2] Diazapyridine-1-fermenting amine (213c), synthesized from 212c, can produce diastereoisomeric mixtures in the same manner as compound 213e (193 mg, 36 %) Showed colorless crystals: IR (KBr) 3272, 1799, 1701, 1682, 1650, 1555, 1424, 1412, 1278, 1258, 1221, 1122, 937; iHNMR (CDC13) &amp; 7.41-7.28 (5H, m) , 6.52 (0.5H, d), 6.38 (0.5H, d), 6.22 (0.5H, d), 5.57 (0.5H, d), 5.36 (0.5H, s), 5.10-5.05 ( 1H, m), 5.00-4.45 (5.5H, m), 3.19-2.84 (3H, m), 2.72-2.56 (1H, m), 2.51-2.25 (2H, m), 2.02 (3H, s), 1.98 -1.70 (3H, m), 1.66-1.56 (3H, m); Analysis C23H28N407: C, 58.47; H, 5.97; N, 11.86. Measured 値: Calculation of C23H28N407 C: C, 58.47; H, 5.97; N, 11.86. Found 値: C, 58 · 37; H, 6.09; N, 11.47. MS (ES-) 471 (M-1, 100%). C ^ H29 Accurate estimated mass of N407 (MH +): 473 · 2036; Measured radon: 473.2012. Accurate estimated mass of C23H28N407Na (Mna +): 495.1856; Measured radon: 495.1853. [1S, 9S (2RS, 3S)] 9-benzylamino -6,10 · diketone group 42,3,4,7,8,9,10- • 366 This paper size applies to China National Standard (CNS) A4 specification (210X 297 mm) (Please read the note on the back first Please fill in this page again for details) 541309 A7 __B7 V. Explanation of the invention (364) Octahydro-N · (2-methoxy-5-ketotetrahydrofuran_3_yl) -6Η · a] [l, 2] Diazapyridine-1 · Betaamine (2lSe). Hydrogenated tributyl kick (22 ml, 8.18 mmol) was added dropwise to the acid 212e (1.95 g, 5.6 mmol) (3S, 2RS) 3-allyloxycarbonylamino-2-ethoxy-5-ketotetrahydrocran (chapman, Bioorg. &Amp; Med · Chem. Lett ·, 2, ρρ · 615-618 (1992); 1.80 grams, 6.16 millimoles) and (? 113?) 2? 01 (: 12 (50 mg) in anhydrous 0112 (: 12 (36 ml) in anhydrous nitrogen and stirred solution. After 5 minutes, 1-hydroxybenzotriazole (1.51 G, 11.2 mmol, 6.72 mmol), and after cooling (ice / 20), add ethyl dimethylaminopropyl chloride; carbodiimide hydrochloride (1.29 g, 6.72 mmol). After 5 minutes, the cooling bath was removed and the mixture was kept at room temperature for 4 hours, diluted with EtOAc, washed with 1M HC1, brine, a saturated aqueous solution of NaHC03 and brine, dried (MgS04) and concentrated. Flash chromatography (silica, 0- 90% EtOAc / CH2Cl2) can give the product as a white solid, (2.34 g, 78%): IR (KBr) 3499, 1792, 1658, 1536, 1421, 1279, 1257, 1123, 977, 699; 1Η NMR (CDC13) &amp; 7.81 (2Η, m), 7.54-7.34 (8H, m), 7.1, 6.97, 6.89, 6.48 (2H, m, d, J 7.7, d, J = 7.5, d, J = 7.6), 5.57, 5.28 (1H, d, J = 5.2, s), 5.23-5.07 (2H, m), 4.93-4.42, 3.22-2.70, 2.51-2.26, 2.08-1.69, 1.22 (15H, 5m). Analyze C28H30N4O7. 0.5H2O Calculated 値: C, 61.87; H, 5.75; N, 10.32. Measured 値: C, 62.02; H, 5.65; N, 10.25. [3S (1S, 9S)] 3- (9-Ethylamine-6,10-di-Hydrogen-6H-Dageno [l, 2-a] [l, 2] diaza leather_ 1 · Chinomine group · 4 · Ketobutyric acid (214c), synthesized from 213c, using the same method as 213e from 213e, to produce colorless crystals (140 mg, 99%): mP 90_180 ° c; [Wd22 -i14 • 367-This paper size is applicable to China National Standard (CNS) A4 (210X297). (Please read the precautions on the back before filling out this page.) Preparation 541309 A7 B7 V. Description of the invention (365) (c 0.10, MeOH); IR (KBr) 3334, 3070, 2946, 1787, 1658, 1543, 1422, 1277, 1258; 1Η NMR (d6_DMSO) &amp; 8.66 (1Η , M), 8.18 (1H, d), 6.76 (1H, s), 5.08 (1H, m), 4.68 (1H, m), 4.30 (1H, m), 2.92-2.70 (2H , M), 2.27-2.06 (3H, m), 1.95-1.72 (4H, m), 1.85 (3H, s), 1.58 (2H, m); MS (ES-) 381 (Ml, 100%) ; C16H23N407 (MH +) exact mass estimate 质量: 383.1567. Found 値: 383,1548 0 [3 5 (13,93)] 3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10- Octahydro-6H-dacrogen [l, 2-a] [l, 2] diaza-p-carboxamido) -4-ketobutanoic acid (214e). A mixture of 213e (2.29 g, 4.28 mmol), 10% Pd / c (1.8 g), and MeOH (160 ml) was stirred under H2 and atmospheric pressure for 6.3 hours. After filtration and concentration, the hydrogenation (18 g) was repeated with fresh catalyst for 5 hours. After filtration and concentration, the residue was triturated with diethyl ether, filtered and washed thoroughly with diethyl ether to yield 214e as a white solid (1.67 g, 88%) mpl43-147 ° C; [aa] D23-125 ° (c 0.2 , CH3OH). IR (KB〇3391, 1657, 1651, 1538, 1421, 1280, 1258; iH NMR (CD3OD) &amp; Printed by Employee Consumer Cooperative of Central Bureau of Standards, Ministry of Economic Affairs 7.90 (2H, m)? 7.63-7.46 (3H, m ), 5.25 (1H, m), 5.08-4.85 (1H, m), 4.68-4.53 (2H? M), 4.33-4.24 (1H, m)? 3.62-3.44, 3.22-3.11, 2.75-2.21, 2.15- 1.92, 1.73-1.66 (1 1H, 5m). Analysis of the calculation of C21H24N407. H20 値: C, 54.54; H, 5.67; N, 12.11. Measured 値: C, 54.48; H, 5.63; N, 11 · 92.- 368- The paper scale is applicable to the Chinese National Standard (CNS) A4 specification (210X 297 public holidays) 541309 A7 B7 V. Description of the invention (366) 〇

f Please read the notes on the back first, and then fill out this page j-Install · (c)% = MeCO (217)

(d) Rx = PhCH2OCO

(e) Rx = PhCO

[3S, 4RS (1S, 9S)] 3- [9-Ethylamino-6,10-diketonyl1,2,3,4,7,8,9,10-octahydro-611-Da Geng [1,24] [1,2] Diazapyridine, 1-Chloramido) -5- (2,6-dichlorobenzyloxy) -4-hydroxypentanoic acid tert-butyl ester ( 2l5y, synthesized from 214c, can produce diastereoisomeric mixtures in the same way as compound 215e, as a white glassy solid (3 98 mg, 84%) IR (KBr) 3338, 2977, 1738, 1658, 1562, 1541, 1433, 1368, 1277, 1150; lR NMR (CDC13) &amp; 7.36-7.32 (3H, m), 6.91 (1H, d), 6.30 (1H, d), 5.15-5.09 (1H, m) , 5.01-4,88 (1H, m), 4.61-4.44 (2H, m), 4.37-4.08 (3H, m), 3.32-3.18 (1H, m), 3.04-2.89 (1H, -369- this paper Standards are applicable to China National Standard (CNS) A4 specifications (210X 297 mm). Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. Printed by the Central Standards Bureau of the Ministry of Economic Affairs. , 2.82-2.51 (4H · m), 2.39-2.29 (1H, m), 2.08-1.64 (4H, m), 2.02 (3H, s); Analysis of the calculation of C28H34N4C1209 値: C, 52 · 26; Η , 5.64; N, 8.71. Real Tritium: C, 52.44; H, 5.87; N, 8.16. MS (ES-) 645/3/1 (Ml, 26%), 189 (81), 134 (100) ... Exact mass calculation: 643.1938; actual measurement: 643 1924. Exact mass estimation of C28H36N4Cl2O9Na (MNa +): 665.1757. Actual measurement: 665.1756. [3S, 4RS (1S, 9S)] 3- (9- 芊 oxycarbonyl Amine-6,10 · diketone · 1,2,3,4,7,8,9,10-octahydro-611-da-phen [1,24] [1,2] diazapine-1 -A few amines) -5- (2,6-dichlorofluorenyloxy) tert-butyl ester of hydroxypentanoic acid (2l5d),

Synthesized from 214d in the same way as compound 21 5e to give a diastereoisomeric mixture (657 mg, 70%) as a glassy white solid: IR (KBr) 3420, 3361, 2975, 2931, 1716, 1658 , 1529, 1434, 1367, 1348, 1250, 1 157, 1083, 1055; Go NMR (CDC13) &amp; 7.32 (8Η, m), 7.14 (1Η, d), 5.81 (1Η, d), 5.15 (1Η, m), 5 07 (2Η, s), 4.74-4.65 (1H, m)? 4.58-4.22 (4H, m), 4.15-4.06 (1H, m), 3 72 (1H, m), 3.32-3.21 (1H, m), 3.04-2.94 (1H, m), 2.69-2.52 (3H, m), 2.33-2.27 (1H, m), 1.95-1 · 59 (4H, m), 1.28 (9H, s); Analyze the calculation of C34H40N4Cl2O10 · 0.5 · 2Ο C: C, 54.70; H, 5.54; κτ, 7.50. Found 値: C, 54 · 98; Η, 5.59; Ν, 7.24. MS (ES-) 737/5/3 (M-ΐ, 22%), 193/1/89 (100). The confirmed mass of C34H41N4Cl2O10 (MH +) is estimated to be 735.2120. Found 値: 735.2181. [3S, 4RS (IS, 9S)] 3- (9-benzylamido-6,10-diketonyl_1,2,3,4,7,8,9,10-octahydro-611-Da Geng Bing [1,24] [1,2] Diazapyridine-1_carboxy-370- The standard paper size of this paper is applicable to the Chinese National Standard (Fangfang) 6 4 specifications (210/297 mm) (please read the back first) Please note this page before filling in this page)-Binding · Order 541309 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs Α7 Β7 V. Description of the Invention (Na) Amine) -5- (2,6-dichloroacetoxy) Tert-butyl 4-hydroxyvalerate (215e), tributyltin hydride (4.6 ml; 11.4 mmol) was added dropwise to (3S, 4RS) (N-allyloxyl) -3 -Amino-5- (2,6-dibenzyl donkeyoxy) -4- # presents the third-butanyl valerate (similar to Revesz et al., Tetrahedron. Lett., 35, pp. 9693- 9696 (1994) (2.64 g; 5.7 mmol) (? 113?) 2? 4 (: 12 (50 mg), CH2C12 (100 ml) and DMF (20 ml) stirred at room temperature The mixture was perturbed for another 10 minutes, after which 1-¾ benzotriazole (1.54 g, 11.4 mmol) was added. The mixture was cooled to 0. (:, ethyldimethylamine was added Carbonyl diimide hydrochloride (1.31 g; 6.84 mmol). The mixture was kept at this temperature for 15 minutes and then at room temperature for 17 hours. The mixture was diluted with EtOAc (300 mL) and 1M HC1 (2 X 100 mL), saturated NaHC03 aqueous solution (3 X 100 mL) and brine (2 X 100 mL), washed (MgS04) and concentrated. The residue was purified by flash chromatography (2-5% (^^ 〇 ~ 0 ^ 2 (: 12)) can generate 3.24 g (81%) of 2156 as a glassy solid: mp 106-110 ° C; IR (KBr) 3354, 1737, 1659, 1531, 1433, 1276, 1150; Gou NMR ( CDC13) &amp; 7.80 (2Η, dd, J = 7.9 and 1.5), 7.75-7.26 (6H, m), 7.14-6.76 (2H, m), 5.30-5.02 (2H, m ), 4.63-4.11 (5H, m), 3.44-3.26 (2H, m), 3.10-2.30 (5H, m), 2.HM.60 (5H, m), 1.44 (9H, s); Analyze C33H38Cl2N4. Calculated from 9 · 75 · 20Η: c, 55.12; H, 5.54; N, 7.79; Cl, 9.86. Found 値: C, 55.04; H, 5.34; N, 7.80; Cl, 10.24. MS (ES +) 709/7/5 (Μ +1), 378 (59), 324 (64), 322 (100) 〇 [3S (1S, 9S)] 3- (9-acetamido-6 , 10-diketo_1,2,3,4,7,8,9,10-octahydro-6H-da-co- [1,2-a] [l, 2] diazapyridine醯 Amine group) -5- (2,6-Di-371-This paper size applies to China National Standard (CNS) Α4 size (210 '乂 297 mm) (Please read the precautions on the back before filling this page) • Packing-Book 541309 Λ7 B7 V. Description of the invention (W) Chlorofluorenyl-4-ketovaleric acid Third, butylated iy Γ ester (216c), synthesized from 215e in the same way as compound 216e . "" Color solid (then mg, SS ^ mpSOWC) D ~ 9l (ci〇8CH2Ci2); iR (KBr) 3356, 2979, 2935, 174〇, 1659'1532, 1434, 1369, 1276, 1260, 1151; 1HNMR (CDCl3) &amp; 7.39-7.32 (3Hm) 7i3 (iHd), 6.34 (1H, d), 5.22-5.17 (1H, m), 5.U (1H, d), 5 〇4 (1H, d), 4.99-4.88 (2H, m), 4.64-4.52 (1H, m), 3 29_311 (m, m), 3.05- 2.67 (4H, m), 2: 9-2.29 (If, m), 2 〇2 (3H, s), 198-175 (hate m), 1.46 (9H, s); analysis (: 28ΐϊ34N4 (calculation of 229): c, 52 42; H, 5.34; N, 8.73. Found: C, 52.53; H, 5.70; N, 7.85. MS · (ES-) 643/41/39 (Ml, 100%) 〇c28H35n4C1209 (MH +) The true mass estimation 値: 641 · 1781. Measured 値: 641 1735. Calculated for analysis of C28H34N4Cl2O9Na (Mna +) 663: 663 1 60. Measured 値: 663.1542. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs [33 (13,93)] 3- (9-fluorenoxycarbonylamino- 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H_Dahu [1,2-a] [l, 2] Diazapyridine Fluorenylamino) · 5_ (2,6-dioxofluorenyloxy) -4-ketopentanoic acid third-butyl ester (216d), such as Compound 216e was synthesized from 215d in the same way, and 216d was produced as a white glassy solid (688 mg, 68%); mp 90-17CTC; [a] D25-83.4 (c 1.01, CH2C13); IR (KBr) 3338, 2933, 1736, 1670, 1525, 1433, 1417, 1368, 1258, 1 151, 1056, 1031; Go NMR (CDC13) &amp; 7.33 (8H, m), 7.18 (1H, d), 5.65 (1H, d), 5.19 (1H, m), 5.09 (2H, s), 4.98 · 4.86 (1H, m), 4.82 4.49 (2H, d), 3.30-3.07 (1H, m), 3.05- 2.59 (4H, m), 2.42-2.27 (1H, m), 2.18-1.59 (5H, m), 1.42 -372- This paper size applies to China National Standard (CNS) A4 specifications (210, 乂 297 mm) Printed by the Employees' Cooperative of the Central Sample Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Explanation of the invention (37Ό) (9Η, s); MS (ES-) 737/5/3 (M, 13%), 185 (100) . [3 8 (15,98)] 3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-Dagen And [l, 2-a] [l, 2] diazepine-1-carboxyfluorenylamino) -5- (2,6-dichlorofluorenyloxy) -4-ketopentanoic acid Butyl ester (216e). Dess-Martin reagent (3.82 g; 9.0 mmol) was added to a stirred solution of alcohol 2156 (3.17 g; 4.5 mmol) in 0112 (: 12 (100 mL). The mixture was stirred for 1 hour with EtOAc (300 Ml), diluted with a 1: 1 saturated mixture of Na2S203 and saturated NaHC03 (100 ml) and washed with brine (100 ml). The mixture was dried (MgS04) and concentrated. Each residue was purified by flash chromatography, which can be produced 2.2 g (70%) of 216e as a colorless solid: 1 ^ 102-107 ° 0; ["] 〇32-82.5 (c 0.1, CH2C12); IR (KBr) 3374, 2937, 1739, 1661, 1525, 1433 , 1275, 1260, 1 152; Go NMR (CDC13) &amp; 7.85-7.78 (2H, m), 7.57-7.32 (6H, m), 7.09 (1H, d, J = 7.9), 7.01 (1H, d, J 7.3), 5.25-5.16 (1H, m), 5.16-5.05 (1H, m), 5.15 (1H, d), 5.03 (1H, d), 4.99-4.90 (1H, m), 4.68-4.54 (1H, m)? 3.31-3.17 (1H, m), 3.17-2.72 (4H, m), 2.45-2.35 (1H, m), 2.30-1.66 (5H, m), 1.44 (9H, s); analysis C33H36C12N409. Calculation of 0.5H2O 値: C, 55.62; H, 5.23; N, 7.86; Cl, 9.95. Measured 値: C, 55.79; H, 5.15; N, 7.80; Cl, 9.81 .MS (ES +) 729/7/5 (M + Na), 707/5/3 (M + 1), 163 (100%) 〇 [3S (1S, 9S)] 3- (9-acetamidine -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-dalopano [l, 2-a] [l, 2] diaza leather -1-Carboxylamido) -5- (2,6-dilactamyloxy) -4-benzylvaleric acid (217c), synthesized from 216c in the same manner as compound 217e, as a glassy white solid (166 (Mg, 66%): mp 85- -373- This paper size applies to Chinese National Standard (CNS) A4 size (210X297 mm) (Please read the precautions on the back before ^ Γ this page) Binding 541309 A7 ^ ___ _B7 5 Description of the invention (371) 17) C; [a] D25-156 (c 0.13, MeOH); IR (KBr) 3373, 2929, 1742, 1659, 1562, 1533, 1433, 1412, 1274, 1266, 1223, 1 197, 1145, 1138; NMR (CD3OD) &amp; 7.38 (3Η, s), 5.14-5.03 (1Η, m), 4.49-4.32 (2H, m), 3.50 face 3.27 (1H, m) , 3.11-2.92 (1H, m), 2.84-2.62 (2H, m) 5 2.46-2.11 (2H, m), 2.05-1.46 (5H, m), 1.92 (3H, s); analysis c24H26N4C1209 · H20: C 47.77; H, 4.68; N, 9.29. Found 値: C, 47.75; N, 4.59; N, 9.07. MS (ES +) 627/5/3 (M + K, 21%), 611/9/7 (M + Na, 87), 589/7/5 (M ++ l, 71), 266 (l〇 〇); C24H27N4C1209 (MH +) of the mass quality estimate 値: 585.1 155. Found 値: 585.1 134. [jS (IS, 98)] 3- (9- ^ oxalylamino-6,10-diamidino-1,2,3,4,7,8,9,10-octahydro-611-da [1,24] [1,2] diazepine-1-carboxamido) -5- (2,6-dichlorobenzyloxy) -4-ketovaleric acid (217d), Synthesized from 216d in the same way as compound 217e, 217d can be generated as a white glassy solid (3 10 mg, 96%): mp 85-110 ° C; [a] D24-85.9 (c 0, 13, MeOH); IR (KBr) 3351, 2945, 1738, 1669, 1524, 1433, 1258, 1147, 1057; Go NMR (CD3OD) &amp; 7.56 (4H, m), 7.45 (5H, m), 5.32 (2H, m ), 5.20 (2H, s), 4.76-4.48 (3H, m), 3.65-3.38 (3H, m), 3.27-3.09 (2H, m), 3.03-2.89 (2H, m), 2.65-2.24 (3H , M), printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 2.19-1.62 (5H, m); MS (ES-) 679/7/5 (Ml, 100%); the exact quality of C3〇H31N4C1201〇 (MH +) Estimate 値: 677.1417. Found 値: 677.1430. [3S (1S, 9S)] 3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H [l, 2-a; l [l, 2] diaza leather-1-carboxamido) -5- (2,6-bis-374- This paper is in accordance with China National Standard (CNS) A4 specification ( 210X 297 mm Γ '541309 A7 B7 V. Description of the invention (372) Chlorobutyryloxy) -4-ketovaleric acid (217e), TFA (25 ml) was added dropwise to the ester 216e (2.11 g' 3.0¾ Mo The solution was stirred in ice. The mixture was stirred at 0 ° C for 20 minutes' and then at room temperature for 1 hour. The mixture was evaporated to dryness, and co-evaporated with ether three times. Anhydrous ether (50 ml) was added and 1.9 g (98%) of 217e was obtained by filtration as a colorless solid: mp 126_130. (:; [A] D3〇-122 〇 (c 0.1, MeOH); IR (KBr) 3322, 1740, 1658, 1651 , 1532, 1433, 1277, 1 150; NMR (D6-DMSO) &amp; 8.87 (1Η, d, J = 7.4), 8.61 (1H, d, J = 7.8), 7.92-7.86 (2H, m ), 7.65-7.43 (6H, m)? 5.25-5.12 (3H, m), 4.94-4.60 (2H? M), 4.44-4.22 (1H, m), 3.43-3.10 (1H, m), 3.00 -2.52 (3H, m), 2.45-2.10 (3H, m), 2.10-1.75 (2H, m), 1.75-1 .50 (2H, m); Analytical calculations for C29H28Cl2N40.9. 1H20: C, 52.34; H, 4.54; N, 8.42; Cl, 10.66. Found: C, 52.02; H, 4.36; N, 8.12; Cl , 10.36. MS (ES-) 649/7/5 (M-1), 411 (100%). Please read the back I rich

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

O

375- The size of this paper applies to the Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (373) [3 3,41 ^ (13,95)] 4-〇 (2,6-II Chlorophenyl) pyrazol-2-yl] -3- (6,10-diketo-9-methylpyridinamido-1,2,3,4,7,8,9,10-octahydro -611-Ta Geng [19 · a] [1,2] diaza leather-1-lepinamine) -4-tert-butyric acid third-butyl ester (outside 21), similar to compound 215e Prepared from acids 212b and 99, a diastereoisomeric mixture (865 mg, 80%) was formed as a colorless solid: ir 3298, 2974, 1723, 1659, 1544, 1518, 1430, 1394, 1370, 1328, 1273 , 1256, 1 156, 1 134; lR NMR (CDC13) &amp; 7.45-7.28 (4H, m), 7.26-7.15 (2H, m), 5.26-5.10 (2H, m), 4.80-4.67 (1H, m ), 4.59-4.42 (2H, m), 3.32-3.17 (lH, m), 2.96 (3H, 2xs), 2.93-2.79 (1H, m), 2.71-2.53 (4H, m), 2.38-2.28 (1H , M), 2.07-1.81 (4H, m); Analyze the calculation of C28H35N5C1209S · 0.5Η2OΟ: C, 48.21; H, 5.20; N, 10 · 03. Found 値: C, 48.35; H, 5.26; N, 9.48. MS (ES +) 714/2/0 (M + Na, 25%), 692/90/88 (M + + 1,51), 636/4/2 (38), 246 (100). C28H36N5Cl2O9S (MH +) exact mass estimate: 688.1611. Found 値: 688.1615. [3S (1S, 9S)] 4- [5- (2,6-dichlorophenylazol-2-yl] -3- (6,10-diketo-9-methylsulfonamido-1, 2,3,4,7,8,9,10-Octahydro-611-Da-Phen [1,2-a] [l, 2] diazepine-1-carboxamido) -4-one Tertiary-butyric acid g-butyric acid (219b), prepared from 212b in a similar way to compound 216e, printed as a white powder with a white powder (675 mg, 81%): mpl00-200 ° C ; [a] D24-84.9 (c 1.01, CH2Cl2); IR (KBr) 3336, 2978, 2936, 1719, 1674, 1510, 1433, 1421, 1369, 1329, 1274, 1257, 1155, 991, 789; Go NMR (CDC13) &amp; 7.47-7.38 (4H, m), 7.24 (1H, d), 5.61-5.53 (1H, m), 5.48 (1H, d), 5,38-5.30 (1H, m), 4.67-4.45 (2H, m), 3.48-3.18 (2H, m), -376- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) &quot; 541309 A7 B7 Central Bureau of Standards, Ministry of Economic Affairs Printed by Employee Consumer Cooperatives V. Description of invention (374) 3.04-2.90 (2H, m), 2.97 (3H, s), 2.69-2.54 (1H, m), 2.42-2.32 (1H, m), 2.22-2.15 ( 1H, m), 2.07-1.93 (3H, m), 1.7.1-1 · 65 (2H, m), 1.38 (9H, s); Analysis of the calculation of C28H33N3C1209S: C, 48.98; H, 4.84; N, 10.20; S, 4.67. Found: c, 48.73; H, 4.95; N, 9.65; S, 4.54. MS (ES +) 692/90 / 88 (M ++ 1, loo%), 636/4/2 (71). C28H34N5C12O9S (MH +) exact mass estimate: 686.1454. Found: 686.1474. '[3S (1S, 9S)] 4- [5 -(2,6-Dioxophenylazol-2-yl) dong (61-diketyl 9-methylsulfonamido-1,2,3,4,7,8,9,1〇 -Octahydro-611-Da-Chen [1,2-a] [l, 2] diazapyridine-1-epiamino) -4-ketobutanoic acid (220b), in a manner similar to compound 217e Prepared from 219b as a light cream powder (396 mg, 87%): mp 100-200 ° C; [a] D27-129 (c 0.12, MeOH); IR (KBr) 3310, 3153, 1713, 1667, 1557 , 1510, 1432, 1421, 1329, 1273, 125 8, 1221, 1 193, 1153, 1 134, 992, 789; Go NMR (d6 DMSO) &amp; 7.88 (lH, s), 7.81-7.60 (4H, m ), 5.49-5.28 (lH, m), 5.24-5.14 (1H, m)? 4.46-4.22 (2H, m), 3.30-3.03 (2H, m), 2.97-2.76 (3H, m), 2.96 (3H, s), 2.46-2.24 (1H, m), 2.16-2.05 (1H, m), 2.03-1.78 (3H, m), 1.68-1.46 (2H, m); MS (E S-) 632/30/28 (M -1, 68%), 149/7/5 (100). The exact mass estimate of C24H26N5C1209S (MH +): 630.0828. Found 値: 630.0852. -377- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210X 297mm) (Please read the notes on the back before filling in this one) Order 541309 A7 B7 V. Description of the invention (375 〇

Cl

223b 223 ^ R1 = MeS〇2 Ri PhCO Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs α [3S, 4RS (1S, 9S)] 4- (5,7-Digas benzoxazole king A group) -3 -(6,10-diketo-9-methylsulfonamidoamino-1,2,3,4,7,8,9,10-octadecane, 1,2-aHl, 2] diazepine-1-carboxamidohydroxy group τ ^ ^ "tri-butyl ester (221b), in the same manner as compound 215e, type t prepared from acid 212b and 13S, 4RS) N- (allyloxycarbonyl) -3-amino-4-hydroxy-4- (5,?-Digas benzindazole · 2-yl) butyric acid tert-butyl ester (204) , Can generate a mixture of diastereoisomeric compounds (460 mg, 70%) is glassy: IR 3325, 1725, 1664, 1453, 1399, 1373, 1327, 1274, 1256, 1155; Go NMR (CDC13) &amp; 7.57 (1H, m), 7.36 (2H, m), 6.06 (1H, t), 5.29 (2H, m), 4.79 -378 This paper scale is applicable to China National Standard (CNS) A4 specifications (210 X mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 _ B7 V. Description of the invention (376) (1H, m), 4.47 (1H, m), 3.23 (1H, m), 2.97 and 2.94 (3H combined, 2 xs), 2.9-2.4 (4H, m), 2.30 (1H, m), 1.96 (4H, m), 1.41 and 1.37 (9H combined, 2 xs). MSESDa / e 660 (Ml), Cl35 1〇. 〇 / 0, 662 (M-1) -Cl37. (3S, 4RS (1S, 9S)] 3- (9-amido-6,10-diketo · 1,2,3,4, 7,8,9,10-Octahydro-611-Da-Phen [1,24] [1,2] Diazapyrene-1_carboxamido) -4- (5,7-dichlorobenzo Pyrazol-2-yl) tert-butyl ester of hydroxybutyric acid (221 e), prepared in a manner similar to that used for compound 215e, from acids (212e) and (3S, 4RS) N- (allyloxycarbonyl) ) -3-amine i-4-hydroxy-4- (5,7-dichlorobenzoxazol-2-yl) butyric acid tertiary-butyl ester (204), which can generate diastereoisomeric compounds Mixed (613 mg, 87%) is glassy: IR (film) 3328, 1729, 1660, 1534, 1454, 1422, 1399, 1276, 1254, 1155; Go NMR (CDC13) &amp; 7.80 (2H, d), 7.60-7.35 (5H, m), 7.05 (2H, m), 5.13 (3H, m), 4.74 (1H, m), 4.51 (1H, m), 3.25 (1H, m), 3.1-2.6 (5H, m), 2.33 (1H, m), 2.1-1.5 (5H, m), 1.43 and 1.41 (9H combined, 2 xs) p MS ES + Da / e 688 (M + 1) + Cl35 55%, 690 ( M + 1) + Cl37 35%, 328 100% 〇 [3S (IS, 9S)] 4- (5,7-dichlorobenzoxazol-2-yl) -3- (6,10-diketo-9-methylsulfonylamino1,2 , 3,4,7,8,9,10-Octahydro-611-Da-Phen [1,2-3] [1,2] Diazapyridin-1-carboxamido) -4-one Tertiary-butyl butyrate (222b), prepared from 221b in a similar manner to compound 216e, as colorless glass (371 mg, 86%): [a] d26-81.0 (c 0.1, CH2C12): IR (KBr) 3324 , 2979, 2936, 1726, 1664, 1394, 1370, 1328, 1155, 991; ^ NMR (CDC13) &amp; 7.78 (1H, d), 7.57 (2H, m), 5.87 (1H, d), 5.69 (1H, m), 5.47 -379- The standard for this paper is applicable to Chinese National Standard (CNS) A4 (210X297 mm) 541309 Printed by A7 B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (377) (1H, m), 4.55 (2H, m), 3 24 (2H, m), 3.0 (5H, m + s), 2.59 (1H, m)? 2.39 (1H? m)? 2.2-1.7 (4H, m ), 1.65, (1H, m), 1.40 (9H, s). [3S (1S, 9S)] 3- (9-benzylamidoamino-610-diketohydrogen-6H-dapono [l, 2-a] [12] diazepinecarboxamido) _4 Gas 5 7-dichlorobenzohumidin-2-yl) -4-ketobutyric acid tertiary-butyl ester (222e) was prepared from 221e in the same manner as compound 216e, and a colorless glass (48 mg, 84〇 /.) [A] d25-86.4. (C 0.1 CH2C12); IR (KBr) 3337, 2978, 2938, 1728, 1657, 1534, 1456, 1422, 1395, 1370, 1277, 1250, 1154; ιΗ NMR (CDC13) &amp; 7.80 (3Η, m), 7.50 (4Η, m), 7.20 (1H, d), 7.02 (1H, d), 5.60 (1H, m), 5.28 (1H, m), 5.15 (1H, m), 4.11 (1H, m), 3.34 (2H, m), 2.96 (3H, m) 5 2.40 (1H, m), 2.20 (1H, m), 1.92 (2H, m), 1.67 (2H, m), 1.38 (9H , S). MS ES · Da / e 684 (M-I) · Cl35 47%, 686 (M I) · Cl37 32%. [33 (13,93)] 4- (5,7-dichlorobenzazol-2-yl) -3- (6,10-diketo-9-methylsulfonamido-1,2 , 3,4,7,8,9,10-Octahydro-611-Da-Feng [1,2- &amp;] [1,2] Diazapyridin-1-carboxyamido) -4-one Butyric acid (223b) was prepared from 222b in a similar manner to compound 217e, and a white solid (257 mg, 78%) was obtained: [Pan] D25_105.7. (C 0.1, CH2C12); IR (KBr) 3321, 1723, 1663, 1407, 1325, 5151,992; Tun NMR (D6-DMSO) &amp; 8.96 (1Η, d), 8.18 (1H, d), 7. · 96 (1H, d), 5.50 (1H, m), 5.15 (1H, m), 4.30 (2H, m), 3.06 (2H5 m), 2.87 (5H, m + s), 2.29 (1H, m), 1.99 (4H, m), 1.56 (2H, m) 0 [35 (13,93)] 3- (9-fluorenylamino-6,10-diketonyl-1,2 , 3,4,7,8,9,10-Eight-380- This paper scale is applicable to China National Standard (CNS) A4 (2i0X 297 mm) (Please read the precautions on the back before filling in this Page), ιτ 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs V. Description of the invention (378) Hydrogen-611- tower p well and [l, 2-a] [l, 2] diazepine-1 -Aminoamine) -4- (5,7-dichlorobenzoxazol-2-yl) -4-ketobutanoic acid (223e), similar to compound 217e, prepared from 222e. Cream-colored solid (311 g, 78%): mp 167-180 ° C; [a] D23-88 · 6. (c 0 · 1 CH2C12); IR (KBr) 333 1,1724, 1658, 1534, 1458, 1421, 1279, 1256, 991; also NMR (CDC13) &amp; 7.77 (4H, m), 7.4 (5H , M), 5.57 (1H, bs), 5.33 (1H, bs), 5.47 (1H, q), 4.56 (1H, bd), 3.60 (2H, m), 3.20 (3H , M), 2.76 (1H, m), 2.36 (1H, dd), 2.0 (3H, m), 1.66 (1H, m). MS ES Da / e 628 (M-1) · Cl35 7%, 630 (M-1). Cl37 2.3%, 584 100% 〇

224e RX = PhCO, X = S 226e R, = PhC〇, X = S 225e RX = PhCOf X = 0 227e R, = PhC0 / χ = 〇 [33 (15,93) 3- (9-benzylamino) -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-thalco [l, 2-a] [l, 2] -diaza leather 1-carboxymethylamino) -5- (2-chlorophenyl) methylthio-4-ketovaleric acid tert-butyl ester (224e). 1-Hydroxybenzotriazole (0.2'3 g, 1.71 mmol) and ethyldiamidinopropylcarbodiimide hydrochloride were added to the acid 212e (0.295 g, 0.853 mmol) in THF (5 ml ) In the stirring solution. Add water (0.5 ml) after 5 minutes, and add (3S) -381 after 7 minutes-This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 _ B7 _ V. Description of the invention (379) 3-allyloxycarbonylamino-5- (2-chloro-phenyl) methylthio-4-ketovaleric acid tert-butyl vinegar (123, 0.478 g, 1.02 mmol) and (PPh3) 2PdCl2 (20 mg) in THF (2 ml). Tributyltin hydride (0.65 ml, 2.33 mmol) was added dropwise over 20 minutes. The mixture was held for 4.5 hours, then diluted with EtOAc ', washed with saturated aqueous 1M HC1, brine, NaHC03 and brine, and the mixture was dried (MgS04) and concentrated. The residue was triturated several times with hexane, it was decanted and discarded, and then purified by flash chromatography (10-100% EtOAc / CH2Cl2) to yield 0.2 g (35%) of a white glassy solid 11 ^ 70-72 ° (:; [Chem.] 〇26-82.5. (C 0.02, CH2C12). IR (KBr) 3404, 1726, 1660, 1534, 1524, 1422, 1277, 1254, 1 154; lR NMR (CDC13) &amp; 7.83- 7.78 (2H, m), 7.7, 7.75-7 · 32, 7.26-7.20 (7H, 3m), 7.12 (1H, d, J = 8.2), 7.01 (1H, d, J = 7.3), 5.23-5.08 (2H, m), 5.03-4.94 (1H, m), 4.62 (1H, dt, J = 14.5), 3.78 (2H, m), 3.38-3.29 (1H, m), 3.26 (2H , S), 3.06-2.82 (4H, m), 2.71 (1H, dd, J = 17, 2, 4.5), 2.39 (1H, dd, J = 13.2, 6.5), 2.15-1.83, 1.73-1.63 (5H , m), 1.45 (9H, s). Analysis of the calculation of C33H39C1N407SS: C, 59.05; H, 5.86; N, 8.35. Measured 値: 59.0; H, 5.80; N, 7.92. Employees of the Central Standards Bureau of the Ministry of Economic Affairs Printed by Consumer Cooperatives [35 ^, (13,93)] 3- (9-Benzylamido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro -6H-da-dibenzodiazepine d-polyamido) -5- (2-Gaphenylmethoxyketovaleric acid tert-butyl ester (225e), Using a method similar to compound 224e, prepared from acid 212e and (3S) N- (allyloxycarbonyl) -3-amino group 5- (2.peptylmethoxy) -4-ketovaleric acid. -Butyl ester (201), which can produce 40 mg (23%) of glass-breaking solids: 1H NMR (CDC13) & 7.83_7 · 73 (2Η, m), 7.67-7.10 (9Η, m), 5. · 23-5 · 09 (2Η, m), 4.59 (1Η, m), -382- This paper size is applicable to China A4 size (2l0x 297 male thin one) ^ ~~ 541309 A7-one -_ ^ '_ V. Description of the invention (38〇) 4.45_4.22 (2H, m), 3.7-3.19, 3.08-2.72, 2.71-2.47, 2.05_1 · 85, 72-161, 145-1.26 (20Η, 6m) . Bu 3 (13,93)] 3- (9-fluorenylamino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6 And [l, 2-a] [l, 2] diazepine-1-carboxamido) -5- (2-chlorophenyl) methylthio-4-ketovaleric acid (226e), A method similar to compound 217e, prepared from 224e, yields 022 g (81%) of a white solid: mp 95-100 (pan) d23-95.6. (C 0.2, CH2C12). IR (KBr) 3393, 1720, 1658, 1:> 29, 1422, 1279; lR NMR (D6-DMSO) &amp; 8.80 (1H, d, J = 7.5), 7.89 (2H, m), 7 · 7 (1H, d, J = 7.7), 7.56-7.28 (7H, m), 5.10 (1H, m), 4.87-4.73 (2H, m), 4.39 (1H, m), 3.77 (2H, m), 3.44, 3.35 (2H, + H20, 2m), 2.97-2.56, 2.2, 1.92, 1.61 (1 1H, 4m). Analysis C29H31C1N407S 0 · 5Η2ΗCalculated 値: C, 55.02; H, 5.10; N, 8.85. Found 値: C, 55.00; H, 5.09; N, 8.71.

[jRS, (1S, 93)] 3-Glycine-6,10-diketo-1,2,3,4,7,8,9,1〇_octahydro-6H_ Hani, 2] diaza-l-carboxamido) -5- (2-chlorophenylmethoxy) -4-benzylvaleric acid (227e) was prepared from 225e in a similar manner to the 217e compound. The product was further purified by flash chromatography (0.5% MeOH / CH2Cl2) to produce 19 mg (81%) of a glass-breaking solid: ifj NMR Printed by the Consumer Cooperative of the Central Standards Bureau, Ministry of Economic Affairs (CDC13) &amp; 7.79 (2H , M), 7.66-7.18 (9H, πχ), 5 30-5.10 (2H, m), 4.85 (1H, m), 4.65 (2H, m), 4.53 (1H, m), 4 28 (2H , M), 3.28, 3.01, 2.72, 2.u, 1.94, 1.60 (11H, m). MS (ES-, m / z) 597 (M + -1, 100%). -383- This paper size is in accordance with Chinese National Standard (CNS) A4 (2i0x 297 mm) 541309 A7 B7 Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (381) 〇

[3RS, 4RS (1S, 9S)] 3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-611-da Cultivated [1,24] [1,2] diazafluorene-1-carboxamido) -5-fluoro-4-oxopentanoic acid third-butyl ester (228e). 1-Hydroxybenzotriazole (0.23 g, 1.68 mmol) followed by ethyldimethylaminopropylcarbodiimide hydrochloride (0.21 g, 1.09 mmol) to acid 212e (0.29 g, 0.84 mmol) Mol) in a stirred solution of CH2C12 (3 ml) at room temperature. The mixture was held for 10 minutes, and (3RS, 4RS) 3-amino-5-fluoro-4-hydroxyvaleric acid tertiary-butanthine was added (Revesz, L. et al. Tetrahedron Lett., 52, pp. 9693-9696 -384- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A 7 _ __B7 V. Description of the invention (382) (1994); 0.29 g, 1.40 millimolar) in CH2C12 ( 3 ml), followed by 4-dimethylamino P ratio (10 mg). The solution was stirred for 17 hours, diluted with EtOAc, washed with 1M HC1, brine, saturated aqueous NaHC03 solution and brine again, dried (MgS04) and concentrated. The residue was purified by flash chromatography (50-100% EtoAc / CH2Cl2 and 5% MeOH / EtoAc) to yield 0.25 g (56%) of a white glassy solid: IR (KBr) 3343, 1726, 1658, 1536, 1426, 1279, 1257, 1 157; Go NMR (CDC13) &amp; 7.84-7.79 (2Η, m), 7.57-7.40 (3H, m), 7.05-6.92, 6.73 (2H, 2m), 5.17-5.04 (2H, m ), 4.56, 4.35-4.21, 4.04 (5H, 3m), 3.36, 3.09-2.34, 2.00 (11H, 3m), 1.46 (9H, s). Analysis of the calculation of C26H35FN407 · 0.5H20 値: C, 57.45; H, 6.65; N, 10.31. Found 値: C, 57.64; H, 6.56; N, 10.15. [3RS, 4RS (1S, 9S)] 3- (9-T amido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-611-da [1,24] [1,2] diazamus-1-carboxamido) -5-fluoro-4-oxopentanoic acid third-butyl ester (229e) was prepared from a compound similar to 216e 228c. Purification by flash chromatography (30-50% EtOAc / CH2Cl2) gave the product as a white glassy solid (0.194 g, 89%): IR (KBr) 3376, 1728, 1659, 1529, 1424, 1279, 1256, 1156. Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs [31 ^, (13,98)] 3- (9-Benzylamido-6,10-di-yl-1, 2,3,4,7,8 , 9,10-octazine-6 Η -preparative benzo [l, 2-a] [l, 2] «— Ranzaozhuo-amino group) -5-Ga-4-ketovaleric acid (230e), Prepared from 229e in a similar manner to compound 217e, yielding 23 0e as a white glassy solid (100 ° / 〇) mp 105-125 ° C; [to] d23-91.4. (C 0.72, CH30H). IR (KBr) 3336, 1789, 1737, 1659, 1535, -385- This paper size is applicable to China National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (

1426, 1279, 1258, 1186; Tun NMR (CD3OD) &amp; 7.71-7 · 68 (2H, m), 7.37-7.23 (3H? M), 5.02, 4.88-4.63, 4.37-4.0 (6H, 3m ), 3.30, 2.97, 2.68-2.60, 2.37-1 · 54 (11H, 4m). MS (ES% m / z) 475 (M +-1, 100%). O

H 〇〇 ^ n ^ CN 〇

H (Please read the notes on the back before filling this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (231b) (232e) [3S (1S, 9S)] 9- (fluorenylamino) -3- [ 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-thalco [l, 2-a] [l, 2] diaza leather-1 -Carboxamido] methyl 3-cyanopropanoate (23 le). Methyl N-fluorenylmethoxy-carbonyl-3-amino-3-cyanopropanoate (EP0547699A1, 385 mg, 1.1 mmol) was treated with 17 ml of diethylamine. After stirring at room temperature for 1.5 hours, the solution was concentrated. The residue was chromatographed on silica gel (3% methanol in CH2C12) and formed the free amine as a pale yellow oil. A solution of this oil and hydroxybenzotriazole (297 mg, 2.19 mmol) in DMF (5 ml) was added. (： Ethyldimethylaminopropylcarbodiimide (232 mg, 1.21 mmol, ι · ι equivalent) was added, and (ls, 9S) 9- (fluorenylamino)-[6 , 10-diketo1,2,3,4,7,8,9,10-octahydro-611-dapyr [1,2-phantom [1,2] diazepine_1_carboxylic acid (212e). Stir for 5 minutes at 0 ° C and stir overnight at room temperature. The mixture was diluted with CH2cl2 (50 ml) and the resulting solution was successively 1M HC1 (2 X 30 ml), H2O (30 Ml), 10% • 386- This paper size applies to the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (384) NaHC〇3 (2 X 30 ml) and a saturated NaCl aqueous solution, the strip was washed, dried (MgS04) and concentrated. Purified by flash chromatography on silica gel (3% methanol in CH2Cl2) to give compound 231e (404 mg, 83%) as a solid: [To] 〇20-121 ° (c 0.14, CH2C12); NMR (CDC13) &amp; 7.40-7.83 (5H, m), 7.38 (1H, d), 6.96 (1H, d), 5.27-5.07 (2H, m), 4.66-4.50 (1H, m), 3.79 (3H, s), 3.23-2.73 (6H, m), 2.47 sunny 2.33 (1H, m) 2.15-1.82 (4H, m); Analysis of the calculation of C22H25N5065: C, 58.0; 'Η, 5.53; N, 15.38. Found: C, 57.6; H, 5.6; N, 15.0. [ 3S (1S, 9S)] 9 · (fluorenylamino) -3- [6,10-diketo-l, 2,3,4,7,8,9, l0-octahydro-6 And [l, 2-a] [l, 2] diazapyridinylamino] -3-cyanopropanoic acid (232e). Methyl ester 2Me (400 mg, 0.88 mmol) in methanol (30 Ml) and water (30 ml), cooled at 0 ° C and then treated with diisopropylethylamine. The solution was stirred at 0 ° C for 10 minutes, and then at room temperature overnight. The substantial mixture was concentrated and the resulting Chromatography of a solid on silica gel (5% methanol / 1% acetic acid in CH2C12) yielded the free acid 232e (170 mg, 44%) as a white solid: mp 155 ° C (dec); [PAN] D20-117 (C 0.1, MeOH); IR (ΚΒι *) 3343, 3061, 2955, 1733, 1656, 1577, 1533, 1490, 1421, 1342, 1279, 1256, 1222, 1185, 708; lR NMR (D4-MeOH) &amp; 7.88- 7.28 (5H, m), 5.20-5.03 (1H, m), 4.98-4.84 (2H, m), 4.75-4.53 (1H, m), 4.51-4.34 (1H, m), 3.45-3.22 (1H, m), 3.14-2.94 (1H, m), 3.14-2.94 (1H, m), 2.88-2.61 (2H, m), 2.53-1.50 (8H, m); Analysis of the calculation of C21H23N506.1.5H20 値: C, 53.84; H, 5.59; N, 14.95; 0 , 25.61. Found 値: C, 54.3; H, 5.4; N, 14.3. Read the notes on the back of the book, t-binding -387- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) ^ 1309 V. Description of the invention

R Ο person NH2 Η

C〇rNBu C〇2 * ^ * Bu

233e R

234e R C〇2-NBu C〇2-/-Bu

236q R

237eR

C02H

235eR co2h Printed by the Ministry of Economic Affairs of the Central Bureau of Quasi-Employees for consumer cooperation

238eR

[4S, (1S, 9S)] 4- (9-(; amido) -6,10-diketone 4,23,4,7,8,9,10-octahydro-6H- [l, 2-a] [l, 2] Diazapyridine-1-carboxamido] -5-ketovalerate tert-butyl hemicarbazone (233e). (IS, 9S) 6, 10-diketo-1,2,3,4,7,8,9,10_octahydro-9- (fluorenylamino) _611-thalco [1,24] [1,2] di Aza leather-1-polyacid (2l2e) (345 mg, 1.0 mmol), (4S) N-(-propyl-388-) This paper size is applicable to the Chinese National Standard (CNS) A4 (210X297 mm) 541309 Α7 Β7 V. Description of the invention (3δ6) Oxycarbonyl printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs -4-Amino-5-ketovaleric acid tertiary-butyl ester hemicarbazone (208a) (361 Pico, 1.1¾ Mor, 1.1 equivalents) and (Ph3p) 2Pdcl2 (20 mg) in CH2C12 (5 * liters), n_Bu3snH (0.621 ml, 2.3 mmol, 2.1 equivalents) Drop treatment. The resulting orange-brown solution was stirred at 25 ° C for 10 minutes, and then hydroxybenzotriazole (297 g, 22 mmol, 2 equivalents) was added. The mixture was cooled to 0X: ethyl diacetate was added Methylaminopropylcarbodiimide (253 Mg, 1.3 mmol, 1.2 eq.). At 0. (: stirred for 10 minutes at room temperature overnight, the mixture was diluted with EtOAc (50 ml), the resulting solution was successively 1M HC1 (3 X 25 ml ), 10% NaHC〇3 (3 x 25 ml) and saturated NaCl aqueous solution, dried (MgS04) and concentrated. Flash chromatography on silica gel (2-10% methanol in CH2C12) can produce compound 233e (280 mg , 49%) as a brown solid: [a] D2O-95 (c 0.09, MeOH); IR (KBr) 3477, 3333, 2968, 2932, 1633, 1580, 1535, 1423, 1378, 1335, 1259 , 1156, 1085, 709; lR NMR (CDC13) &amp; 9.32 (1H, s)? 7.83-7.39 (6H, m), 7.11-7.09 (lH, m), 6.30-5.30 (2H, brs), 5.17- 5.05 (2H, m), 4.62-4.38 (2H, m), 3.30-3.15 (1H, m), 3.13-2.65 (2H, m), 2.46-2.19 (3H, m), 2.15-1.54 (8H, m ), 1.42 (9H, s). [411, (13,93)] 4- [9- (fluorenylamino) -6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H · Da [l, 2-a] [l, 2] diazapyridine-1-carboxamido] -5-ketovalerate tert-butyl hemicarbazone (236e), similar to 233e Methods Using (4R) N-fluorenyloxycarbonyl-4-amino-5-keto-valeric acid tertiary-butyric acid, carbachol (208b, 435 mg, 1.33 mmol) can be made into a foam. Product (542 mg, 71%): [a] D20-99. (C 0.19, CHC13); IR (ΚΒι3473, 333 1, 3065, 2932, 2872, 1660, 1580, 1533, 1488, 1423, 1370, -389 This paper size applies to China National Standard (CNS) Α4 specifications ( 210 × 297 mm) Please read the precautions for δ first and then order 1 # 541309 A7 B7 V. Invention Description (387) 1337, 1278, 1254, 1224, 1155, 1080, 1024, 983, 925, 877, 846, 801, 770, 705; NMR (CDC13) &amp; 9.42 (1H, s), 7.81 (2H, d), 7.51-7 · 40 (4H, m), 7.06 (1H, d), 6.50-5.50 (2H , Width s), 5.25-5 · 00 (2H, m), 4.60-4 · 45 (2H, m), 3.15-2.85 (2H, m), 2.75-2.35 (1H, m), 2.30-1.23 (11H, m), 1.42 (9H, s). [4S, (1S, 9S)] 4- [9- (fluorenylamino) -6,10-diketo-l, 2,3,4, 7,8,9, l (^ octahydro-6l · ^ tacro [l, 2-a] [l, 2] diaza-l-carboxyamido] -5-ketovalerate -Butyl ester (234e). Half carbachol 233e (390 mg, 0.68 mmol) in methanol (10 ml) was cooled to CTC, and then 38% formaldehyde (2 ml) and 1M HC1 (2 ml) were added. Aqueous solution treatment. The reaction mixture was stirred at room temperature overnight. The solution was concentrated. It was decompressed to remove methanol. The non-solution was extracted with EtoAc (30 mL). The organic solution was washed successively with 10% NaHC03 (30 mL) and saturated aqueous NaCl solution, dried (MgS04) and concentrated. Purified by flash chromatography on silica gel (2- 5% methanol in CH2Cl2) can produce 234e (179 mg, 51%) as a white foam: [to] D20-101 (c 0.064, MeOH); IR (KB〇3346, 2976, 2934, 1730, 1657 , 1535, 1456, 1425, 1278, 1255, 1156, 708; Tun NMR (CDC13) &amp; 9.56 (1Η, s), 7.88-7.38 (5Η, m), 7.01 and 6.92 (2H, 2d), 5.27 -5.08 (2H, m), 4.69-4.46 (lH, m), 3.50- Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 3.27 (2H, m), 3.15-2.73 (2H, m), 2.46-1.83 (10H , m), 1.45 (9H, s) 〇 [4R, (1S, 9S)] 4- [9- (rare amino) -6,10-diamidino-l, 2,3,4,7, 8,9,10-Octahydro-6H ", and [[1,2-a] [l, 2] diaza-l-chiralamino] · 5-ketovaleric acid tert-butyl ester ( 237e), which was prepared from 236e in a similar manner to 234e, and produced a white foam (390 mg, 85%): [α] d20 ″ 13. (C 〇242, -390- This paper size applies to the Chinese National Standard (CNS) A4 specification (210 X 297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (388) CHC13); IR (KBr) 3352, 3065, 2974, 1729, 1657, 1536, 1489, 1454, 1423, 1369, 1338, 1278, 1255, 1223, 1156, 1078, 1026, 981, 846, 709. [4S, (1S, 9S)] 4- [9- (Bentamidineamino) -6,10-diketonyl, 2,3,4,7,8,9,10_ octahydro-6H- Dageng [l, 2_a] [l, 2] diaza leather- 丨 -Chrysaminol 5-ketovaleric acid (235e). A solution of the third-butyl ester 234e (179 mg, 0.35 mmol) in anhydrous CHfl2 (3 ml) was cooled to 0x :, and then treated with trifluoroacetic acid (2 ml). The resulting solution was stirred at 0C for 30 minutes and then at room temperature for 2 hours. The solution was concentrated, the residue was taken up in anhydrous CH2C12 (5 ml), and the mixture was concentrated again. This process was repeated again with more CH2C12 (5 ml). The resulting residue was crystallized from diethyl ether. The precipitate was collected and purified on a silica gel column (50 / 〇 methanol in CHfl2) 'can produce compound 235e as a white solid (111 mg, 70%): mp 142eC (dec); [a] D2O-85 5 (c 〇〇62, Me〇H); IR (KBr) 3409, 3075, 2952, 1651, 1541, 1424, 1280, 1198, 1136, 717; lR NMR (D6-DMSO) &amp; 9.40 (1H, s), 8.62 (2H, m), 7.96- 7.38 (5H, m), 5.19-5.02 (lH, m), 4.98-4.79 (lH, m), 4.48-4.19 (1H, m), 3.51-3.11 (2H, m) , 3.04-2.90 (2H, m), 2.38-1.46. (10H, m) 0 [4R, (1S, 9S)] 4- [9- (benzylamido) -6,10-diketo- l, 2,3,4,7,8,9,10 · octahydro-6H-da-phen [l, 2-a] [l, 2] diazapyrene-i-carboxamido 5. · Ketovaleric acid (23 8e), prepared from 237e in a similar manner to 235e, yields a brown foam (190 mg, 60%): [from] D20-78 (c 0.145, MeOH); IR (KBr) 3400, 3070 , 2955, 2925, 2855, 1653, 1576, 1541, 1490, 1445, 1427, 1342, 1280, 1258, 1205, 1189, 1137, 1075, 1023, 983, -391-This paper is again applicable to the Chinese National Standard (CNS ) A4 size (210X297 mm) Page 541309 A7 B7 V. Description of the invention (389) 930, 878, 843, 801, 777, 722; Go NMR (D6-DMSO) &amp; 9.40 (1H, s), 8.72-8.60 (2H, m), 7 · 89 (2H, d), 7.56-7.44 (3H, m), 5.17 (1H, m), 4.90-4.83 (1H, m), 4.46-4.36 (1H, m), 4.20-4.15 (1H, m) , 3.40-3.30 (1H, m), 2.98-2.90 (2H, m), 2.50-1.60 (10H, m) 0

H (243)

H Read First Read Back 5 I Things Then _ Fill in I |

ρΛ

(245) Order printed by (1S, 9S) 9-fluorenylamino-octahydro-10-keto-6H-da-co- [1,2-a] [l, 2] Diazapyridine-tricarboxylic acid tertiary-butyl ester (243), prepared from (IS, 9S) 9-amino-octahydro-10-keto-6H-thalco [l, 2-a ] [l, 2] Diazapyridine-1-carboxylic acid tert-butyl ester (Attwood, et al., J. Chem Soc., Perkin 1, pp. 1011-19 (1986)) as described in 211e This method yielded 2.03 g (86%) of a colorless foam: [a] D25 · 15 · 9. (C 0.5, CH2C12); IR (KBr) 3400, 2976, 2937, 1740, 1644, 1537, 1448, 1425, 1367, 1154; 1Η NMR (CDC13) &amp; 7.88-7.82 (2H, m), 7.60-7.38 (4H, m), 5.48 (1H, m) 5 4.98 392 This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 Printed by A7 B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Description of the invention (39 °) (lH, m), 3.45 (lH, m), 3.22-2.96 (2H, m), 2.64 (lH, m), 2.43-2.27 (2H, m), 1.95 (2H, m) , 1.82-1 · 36 (4H, m), 1.50 (9H, s); C21H29N304 · 25 · 20 The exact mass estimate 値: c, 64 35; Η, 7 59; Ν, 10.72. Found 値: C, 64 · 57; Η, 7.43; Ν, 10.62. MS (ES +, m / z) 388 (100%, M ++ 1). (IS, 9S) 9-octylamino-octahydro-10-keto-6H-thalo [i, 2-a] [l, 2]: aza leather-1-fatty acid (244), Prepared from 2l2e from (1S, 9S) 9-benzylamidoamino · octahydro-10-keto-6H-da-co- [1,2-a] [l, 2] diazepine-1- Chitoic acid tert-butyl ester (243) can produce 1.52 ¥ (89%) white powder: mp · 166-169 ° C (dec); [^] D25 · 56 · 4. (C 〇 · 5, CH3OH); IR (KBr) 3361, 2963, 2851, 1737, 1663, 1620, 1534, 1 195, 1179; XH NMR (D6- DMSO) &amp; 12 · 93 (1H, brs), 8.44 (1H, d, J = 8.4), 7.93 (2H, m) 5 7.54 (3H, m) 5.46 (1H, m), 4.87 (1H, m), 3.12 (2H, m), 2.64 (1H, m ), 2.27 (1H, m), 1.98-1.68 (7H, m), 1.40 (1H, m); Analysis of the calculation of cl7H2lN304. 0 · 25Η20, 値: C, 60.79; H, 6.45; N, 12.51 . Found 値: C, 61.07; H, 6.35; N, 12.55. MS (ES +, m / z) 332 (58%, M + + 1), 211 (100) 〇 [3S, 2RS (1S, 9S)] N- (2- + oxy-5-ketotetrahydrobite (Nan-3-yl) -9-benzylamino-octahydro-10-keto-6H-da-pyrido [i, 2-a] [l, 2] diazapyridine-1-carboxamide ( 245), prepared from (is, 9S) 9-fluorenylamino-octahydro-10-keto-6H-dalopheno [l, 2-a] [l, 2] di Aza leather-1-carboxylic acid (244), which produces 601 mg (76%) of a colorless foam: IR (KBr) 3401, 2945, 1794, 1685, 1638, 1521, 1451, 1120; XH NMR (CDC13) &amp; 7.87- 7.77 (2H, m), 7.57 · 7 · 14 (10H, m), 5.59-5.47 (2H, m), 4.97- -393-1 paper standards are applicable to Chinese national standards ( CNS) A4 specifications (210X 297 public holidays): (Please read the precautions on the back before filling out this page) r Pack-Order 541309 A7 __67 _ _ 5. Invention Description (391) 4 · 32 (4H, m), 3.27-1.35 (14H, m); Anal. C28H32N406 · 0.5H2Ol Calculated C: C, 63.50; H, 6.28; N, 10.58. Found 値: C, 63.48; ^ 6.14; N, 10.52. MS (ES +, m / z) 521 (100%, M ++ 1). [3S (1S, 9S)] 3- (9-fluorenylamino-octahydro-10-keto-6H-thalco [1,2-a] [1,2, diazepine-1- Carboxamidine-4-ketobutyric acid (246), prepared from [3S, 2RS (1S, 9S)] N- (2-fluorenyl-5-ketotetrahydrocran-3) by the method described in 214e -Yl) -9 · fluorenylamino-octahydro-10-keto-6H · daquino [l, 2-a] [l, 2] diazepine-1-leanamine (245) ' Can produce 396 mg (84%) of white powder: mp · 110-115 ° C; [a] D26-126.3. (·· 0.2, CH3OH); IR (KBr) 3345, 2943, 1787, 1730, 1635, 1578, 1528, 1488, 1450, 1429; Tun NMR (CD3OD) &amp; 7.88 (2H, m), 7.48 (3H, m), 5.55 (1H, m), 4.91 (1H, m), 4.56 (1H, m ), 4.29 (1H, m), 3.4 · 1-3 · 05 (3H, m), 2.76_2 · 41 (3H, m), 2.28-2 · 01 (3H, m), 1.86-1.65 ( 4H, m), 1.36 (1H, m); Analysis of the calculation of C21H26N406 · 1.25 · 20Η: C, 55.68; H, 6.34; N, 12.37. Measured 値: C, 55 · 68; H, 6 · 14; N, 12 · 16. MS (ES-, m / z) 429 (100%, M +-1) 〇 Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs -394- This paper size applies to Chinese national standards ( CNS) A4 specification (21 0X 297 mm) 541309 A7 B7 V. Description of the invention (392)

+

(249) (250) (Read the precautions on the back before filling this page) Order

I Printed by [(3S (2R, 5S)]-4-methoxyphenyl-3- [5- (2,5 · dihydro-3,6-dimethoxy) -2- (1-methylethyl) pyracyl)] butyric acid 2,6-di-tertiary-butyl ester (247). N-butyllithium (1.6M in hexane) (22.3 ml, 35.7 mmol) (Mole) dropwise to (2R)-(-)-2,5-dihydro-3,6-dioxo-2- (1-methylethyl) pyracine (5.8 ml, 6.0 g, 32.4 mmol) in a solution of THF (250 ml) cooled to -75 ° C for 20 minutes. The rate of addition is to keep the temperature below -72 ° C. The reaction mixture is -395. This paper applies Chinese national standards ( CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (393) The mixture was stirred at -75 ° C for 1 hour, and 4-methoxyphenyl-2 · butane was added over 30 minutes. '2,6-Di-Second-Ding g (Suzuck et al. Liebigs Ann. ChenL pp. 51-61 (1992)) (9.9 g, 32.5 mmol) in THF (60 ml), and During the addition, the temperature was maintained at -72χ: below. The reaction mixture was kept at -75 ° C for 1.5 hours, and glacial acetic acid (6 ml) was added to THF (25 ml) at -75 ° C. Solution, and the solution was warmed to room temperature. The solution was poured into 10 / 〇NH4C1 (300 ml) and extracted with diethyl ether (3 X 250 ml). The combined organic phases were washed with brine (2 X 200 ml) and Dry over Na2S04 and evaporate to dryness under reduced pressure. The remaining oil was purified by flash chromatography on silica gel (20% heptane in CH2Cl2) to give the title compound as a pale yellow oil (135 g, 85%): d20- 64 ° (c 0.22, MeOH); IR (KBr) 2962, 2873, 2840, 1757, 1697, 1593, 1460, 1433, 1366, 1306, 1269, 1236, 1187, 1157, 1126, 1063, 1038, 1011, 970 , 924, 892, 867, 846, 831, 797, 773, 754;! H NMR (CDC13) &amp; 6.85 (2H, s), 4.21 (1H, t, J = 3.5), 3.98 (1H, t, J = 3.5), 3.79 (3H, s), 3.71 (3H, s), 3.69 (3H, s), 3.15 (1H, dd, J 17.8, 7.9), 2.86-2.81 (1H, m), 2.58 (1H, dd, J = 17.8, 5.9), 2.28-2.19 (1H, m), 1.33 (18H, s), 1.02 (3H, d, J = 6.8), 0.70 (6H, dd, J = 13, 6.8) 0 Economy Printed by the Ministry of Standards and Staff's Consumer Cooperatives (Please read the precautions on the back before filling this page)

(2S, 3S) 1-methyl · 3-methylglutamate 5- [2,6-di · tertiary-butyl-4-methoxyphenyl] ester (248). [3S (2R, 5S)]-2,6-di-tertiary-butyl-4-methoxyphenyl-3- [5- (2,5-dihydro-3,6-dimethoxy) -2- (1-methylethyl) pyridyl ·)] Butyrate (247) (22.4 g, 45.8 mmol) in acetonitrile (300 ml) and 0.25 NHC1 (366 ml, 2 equivalents) in nitrogen Stir for 4 days at atmospheric and room temperature. Acetonitrile was evaporated under reduced pressure and diethyl ether (250 ml) was added to the aqueous phase. PH of aqueous phase • 396- This paper size is applicable to China National Standard (CNS) A4 (210X29 * 7mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A 7 _ B7 V. Description of the invention (394) 値Adjust the pH to 8-9 with concentrated ammonia (32%) and separate the phases. The aqueous phase was extracted with diethyl ether (2 X 250 ml). The combined organic phases were dried over Na2S04 and evaporated to dryness under reduced pressure. The remaining oil was purified by flash chromatography. The desired product was formed on silica gel (2% methanol in CH2C12) as a pale yellow oil (8.2 g, 45%): [α] D20 10-20. (C 0.26, MeOH]; IR (KB〇3394, 3332, 3000, 2962, 2915, 2877, 2838, 1738, 1697, 1593, 1453, 1430, 1419, 1398, 1367, 1304, 1273, 1251, 1221, 1203 , 1183, 1126, 1063, 1025, 996, 932, 891, 866, 847, 800, 772, 745; Go NMR (CDC13) &amp; 6.85 (2H, s), 3.79 (3H, s), 3.74 ( 3H, s), 3.72-3.69 (1H, m), 3.05-2.85 (1H, m)? 2.67-2.50 (2H, m), 1.32 (18H, s), 0.93 (3H, d, J = 7); Analytical calculations for C22H35N05: C, 67.15; H, 8.96; N, 3.56 0 Found: C, 67.20; H, 9.20; N, 3.70. (2S, 9S) 3-Aminoglutamic acid 5- [ 2,6-di-tertiary-butyl-4-methoxyphenyl ester (249). (2S, 3S) 3-methylglutamine 5- [2,6-di-tertiary-butyl A solution of 4-methoxyphenyl] ester (248) (8.0 g, 20.3 mmol) in 5NHC1 (200 ml), heated at reflux for 2 hours. The reaction mixture was evaporated to dryness under reduced pressure. The residue was dissolved in Cyclohexane (X 4) and evaporated to dryness (X 4), a white solid (7.9 g, 93%) was obtained: mp 230 ° C; [H] D20 + 22. (C 0.27, MeOH); IR (KBr ) 3423, 2964, 1755, 1593, 1514, 1456, 1421, 1371, 1303, 1259, 1201 1179, 1138, 1 106, 1060, 966, 926, 861, 790, 710; 1H NMR (MeOD) &amp; 6.76 (2H, s), 4.02 (1H, d, J = 3.7), 3.67 (3H, s), 3.05-2.85 (1H, m), 2.80-2 · 55 (2H, m), 1.22 (18H, s), 1.09 (3H, d, J = 6.3); 13C NMR (MeOD) &amp; 174.5, 171.4, 158.6, 145.2, 143.1, 113.2, 58.3, 56.3, 39.8, 36.9, 32.5, 16.6; Analysis • 397 · l Paper size applies to China National Standard (CNS) A4 specifications (210X 297 public holidays) 541309 A7 — B7 V. Explanation of the invention (395) Calculation of C21H34C1N05 値: C, 60.64; Η, 8.24; N, 3.37. Measured fluorene: c, 60 · 80; hydrazone, 8.40; N, 3.40 〇 (2S, 3S) 3-methyl-2-phthalimidoimino-1,5-pentanedicarboxylic acid% [2,6 -Di-tertiary-butyl-4-methoxyphenyl] ester (250) 'diisopropylethylamine (v ml, 3.0 g, 23.5 mmol, 1.25 equiv) and phthalic anhydride (35 G, 23 6 millimoles, 1.25 equivalents) to (23,3 3) 3-methylglutamic acid 5- [2,6-di-tert-butyl-4-methoxyphenylbutane Ester (249) (7.8 g, 18.6 moles) in a solution of toluene (300 ml), and the resulting mixture was heated at reflux for 3 hours. After cooling to room temperature, the reaction mixture was evaporated to dryness. The resulting oil was purified by flash chromatography on silica gel (2% methanol in CH2C12) to give the desired product as a white foam (8.35 g, 87%): 〇 ] D20-20 ° (c 1.04, MeOH); IR (KBr) 3480, 2968, 2880, 1753, 1721, 1594, 1462, 1422, 1388, 1303, 1263, 1216, 1183, 1148, 1062, 1003, 933, 899, 755, 723; NMR (CDC13) &amp; 7.92-7.87 (2H, m), 7.78-7.73 (2H, m), 6.84 (2H, s), 4.95 (1H, d), 3.78 (3H , S), 3.30-3.05 (2H, m), 2.85-2.65 (1H, m), 1.30 (18H, s), 1.13 (3H, d). Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 39 This paper size is applicable to the national standard (CNS) A4 (210 X 297 mm) 541309 Α7 Β7 V. Description of the invention (396,

ΌΜβ (250)

(252) (Please read the notes on the back before filling out this page)

Ο

(257) (256) -399- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (397) 1- (2,6-di-tertiary-butyl-4-fluorenyloxy) _phenylphosphoniumoxycarbonyl · 3 · tertiary-butoxycarbonyl-hexahydrodaphto-2-yl) -3-methyl- 4-phthaliminoiminopentane-fluorene, a 5-diester (251). A solution of amino acid (250) (1.2 g, 2.35 mmol) in anhydrous diethyl ether (10 ml) was treated with phosphorus pentachloride (0.52 g, 2.5 mmol) at room temperature for 2 hours. The mixture was concentrated and treated several times with toluene and evaporated again to dryness. The generated amidine gas was dissolved in anhydrous THF (5 ml) and CH2C12 (5 ml) and cooled to 0 ° C. Add tertiary-butyl-i- (fluorenyloxycarbonyl) -hexahydrocarboxylcarboxylate (0.753 g '2.35 mmol, 1 eq.) And N-ethylmorpholin (3 ml) to the solution. The reaction mixture was at 0. Stir for 30 minutes at 0 ° C and then overnight at room temperature. The mixture was evaporated and the resulting residue was taken up in CH2C12 (30 ml). The solution was washed with 1M HC1, water, 10% NaHC03, dried (MgS04) and evaporated. The resulting white foam was purified on silica gel (0-20 / 0 methanol in CH2C12) to give the desired compound 251 as a pale yellow glassy solid (740 mg, 39%): [a] D2〇-22 ( c 〇42, Me〇H); IR (KBr) 3441, 2966, 1725, 1693, 1386, 1255, 1221, 1186, 1 154, 1 123, 1063, 724; 咜 NMR (CDC13) 7.94-7 · 89 (4Η, m), 7.56-7.28 (5Η, m), 6.84 (2H, 2s), 5.29-5.20 (2H, AB), 4.91-4.81 (1H, m), 4.05-3.88 (1H, m ), 3.78 (3H, s), 3.75-3.80 (1H, m), 3.28-2.95 (2H, m), 2.23-1.51 (6H, m), 1.45 (9H, s), 1.31 (9H, s), 1.28 (9H, s), 1.27 (3H, d). (IS, 8S, 9S) 6,10-monobenzyl-8-methyl-1,2,3,4,7,8,9 · 10-octahydro-9-pyridamidineimino-6-dioxolene And [i, 2-a] [l, 2] diazepine-1-carboxylic acid tert-butyl ester (254). Protected acid (251) (715 mg, 0.893 mmol) in acetonitrile with ammonium cesium (IV) nitrate (1.8 g, 3.3 mmol, 3.7 equiv) in water at -400-applicable to paper size China National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling out this page) Clothing. Order 541309 A7 B7 V. Description of the invention (398) Please read the back 5 I matter chestnut page Treated at room temperature for 4 hours. Mannitol (600 mg, 3.3 mmol, 3.7 equiv) was added and the mixture was stirred for 1 hour. Diethyl ether (50 ml) and water (30 ml) were added to the mixture. After decantation, the aqueous phase was extracted with diethyl ether (4 X 50 ml). The combined organic phases were washed with water, dried (MgSO4) and concentrated. Chromatography on silica gel (10% methanol in CH2C12) yields 5- (1-fluorenyloxycarbonyl-3-tertiary-butoxycarbonyl-hexahydropyridin-2-yl) carbonyl-3-methyl-4- Phthalideneiminovaleric acid (252) (360 mg, 64%) j &gt;] D20-49.2. (C 0.118, MeOH). Can this product be used without further purification (360 mg, 0.609 mmol)? It was then hydrogenated in methanol (30 mL) using 100/0 Pd / C (36 mg) for 3 hours. The reaction mixture was filtered, and the resulting solution was concentrated to give amine (253) as a foam (270 mg, 96%) [a] D20-56.1. (C0.18, MeOH). Amine (253) was dissolved in anhydrous THF (10 ml) and phosphorus pentagas (305 mg, 1.47 mmol, 2.5 eq) was added. The mixture was cooled to -5 ° C and N-ethylmorpholine was added under nitrogen. The reaction mixture was stirred at room temperature overnight. The mixture was concentrated and the residue was taken up in CH2C12 (20 ml), cold water (20 ml), 1MHC1 (20 ml). After decantation, the aqueous phase was extracted with CH2C12 (2 X 20 mL). The combined organic phases were washed with 10% NaHC03 &amp; water, dried (MgS04) and concentrated. The resulting oil was purified by silica gel (1% methanol / CH2C12) to form a bicyclic compound (252) as a solid (65 mg, 25%): [a] D20 -77 ° (c 0.208, MeOH); Central Standard of the Ministry of Economic Affairs IR (KBr) 3471, 3434, 2975, 2928, 1767, 1723, 1443, 1389, 1284, 1243, 1151, 1112, 720; iH NMR (CDC13) β 7.94-7.69 (4H, m) , 5.34-5.27 (1H, m), 4.89 · 4.66 (2H, m), 3.94-3.64 (2H, m), 3.02-2.84 (1H, m), 2.34-2.19 (2H, m), 1.94- 1.61 (3H, m), 1.47 (9H, s), 1 · 14 (3H, d); Analysis of the calculation of C23H27N306 値: C, -401-This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 (Mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Description of Invention (399) 62.57;;, 6.17; N, 9.52. Found 値: C, 62.60; H, 6.40; N, 9.10. (1S, 8S, 9S) tert-butyl-9-benzylamino-6,10-diamidomethyl-1,2,3,4,7,8,9,10-octahydro -611-Tower_ [1,24] [1,2] Diazapyridin-1-olate (255). A solution of the bicyclic compound (254) (70 mg, 0.16 mmol) in ethanol was treated with hydrazone (0.02 ml, 4 mmol, 2.5 equivalents). Stirred at room temperature: After 5 hours of dropping, the mixture was concentrated and the resulting residue was taken up in toluene and evaporated. The residue was treated with 2M acetic acid (2 ml) for 16 hours. The resulting precipitate was filtered and washed with 2M acetic acid (10 ml). The filtrate was basified with solid NaHC03 and extracted with EtOAc. The organic solution was washed with water, dried (MgS04) and concentrated. Purification by flash chromatography on silica gel (2% methanol / CH2C12) yielded a free amine as a foam (50 mg, 100%). Amine (50 mg, 0.16 mmol) was dissolved in dipurinane (1 ml) and water (0.25 ml), followed by NaHC03 (0.034 g, 0.04 mmol) followed by radon gas (0.047 ml, 〇. · 40 millimoles, 2.8 equivalents). The mixture was stirred at room temperature overnight and diluted with EtOAc (15 mL). The organic solution was washed with 10% NaHC03 and a saturated aqueous NaCl solution, dried (MgS04) and concentrated. Purification by flash chromatography on silica gel (2% methanol / CH2C12) gave amine 255 as a foam (67 mg '100%): XH NMR (CDC13) (ί 7.89-7.39 (5H, m), 6.79 (1H , d), 5.32-5.20 (1H, m), 4.98-4.82 (1H, m), 4.75-4.64 (1H, m), 3.84-3.65 (1H, m), 3.09-2.89 (1H, m), 2.45 -2.18 (2H, m), 2.00-1.61 (4H, m), 1.48 (9H, s), 1.28 (3H, d). (: &Gt; 8) (18, 88, 98) 3- (9-Bromoamino-6,10-difluorenyl-8-methyl-1,2,3,4,7,8,9,10-octahydro-6H-da-co- [1, 2-a] [l, 2] Diazepine-1-carboxyamido) -4-ketobutanoic acid (257). Tertiary-butyl ester 255 (67 mg, 0.16 mmol) at -402 -This paper size applies to China National Standard (CNS) A4 (210X297mm) (Please read the precautions on the back before filling this page)

541309 A7 _-------- B7 V. Description of the invention (400) The solution of CHfl2 is at 0. (Q ml treated with trifluoroacetic acid). The resulting liquid was stirred at 0 ° C for 15 minutes and then at room temperature for 1 hour. The solution was concentrated, the residue was taken up in anhydrous CH2C12 (2 X 2 ml), and the mixture was concentrated again (x2) ° The residue was crystallized from diethyl ether. The precipitate was filtered to give 255 free acid as a gray solid (40 mg, 70%). Acid (40 mg, 0.11 pen mole), N-allyloxycarbonyl-4-amino-5_methoxy-2-ketotetrahydrofuran (Chapman, Bioorg. &Amp; Med. Chem. Lett .. 2, pp. 615-18 (1992); a solution of 39 mmol, 0.13 mmol, 1.2 eq) and (Ph3P) 2PdCl2 (3 mg) in a mixture of anhydrous CHfh (1 ml) and anhydrous DMF / 0.2 ml), Printed by n-Bu3SnH (0.089 ml, 0.33 millimoles, 3 equivalents) drop-wise processed by the Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs. The resulting solution was stirred at 25C; stirred for 10 minutes, and then added with 1-benzylbenzoate (36 mg, 0.266 mmol, 2.4 equivalents). The mixture was cooled to (TC, and ethyl monomethylaminopropyl diimide (31 mg, 016 mmol, 1.5 equivalents) was added. Stir for 10 minutes at 0 ° C, and then at room temperature Overnight, the mixture was diluted with EtOAc (20 mL) and the resulting solution was washed successively with iM HC1 (2 X 5 mL), 10% NaHC03 (2 X 5 mL) and saturated aqueous NaCl solution (5 mL). (MgS04) and concentrated. Flash chromatography (2% methanol / CH2C12) on the crushed gel can give a mixture of diastereoisomeric (256) as a gray solid (50 mg, 82%). This product ( 256) Can be used without further purification (50 μg, 0.091 mmol) and hydrogenated in methanol (5 ml) at 100/0 Pd / C (30 mg) for 24 hours. The reaction mixture was dried and the resulting The solution was reconcentrated. Flash chromatography (2-20% methanol / CH'l2) on a gel yielded compound 257 (9 g, 21%) as a white solid: 4 NMR (D4-MeOH) d 7 · 88- 7 · 29 (5H, m) 5.18-4.99 (1H, m), 4.59-4.35 (3H, m), 4.26-4.11 (1H, m), -403- This paper size applies to China National Standard (CNS) A4 specifications (210X297 mm) 541309 A7 B7 V. Description of the invention (401 3.65-3.41 (2H, m), 3.18-2.91 (1H, m), 2.62-1.47 (8H, m), 1.29-1.00 (3H, 2d) (acetal and hemiacetal Mixture) 〇MS (ES _) 457 C〇2Bn

PhCONHNH2 (258)

PhCO ^ fvT ^ H H (259)

Please read the notes on the back first and then fill in and write this page. Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 〇

〇

-404- This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (402) 3- (NL 芊 醯Hydrazino) propyl propionate (259). Acrylate (1.13 ml, 7.34 mmol) was added to a suspension of hydrazine (285) (1.0 g, 7.34 mmol) in isopropanol (28 ml). The mixture was refluxed for 20 hours, cooled to room temperature and concentrated. The residue was purified by flash chromatography (20% EtOAc / CH2Cl2) to give 259 (1.098 g, 50%) as an oil, which crystallized after standing: mp65 ° C; IR (KBr) 3283, 1723, 1644, 1316 , 1201, 1156; 4 NMR (CDC13M 8.32-8.18 (1H, m), 7.81-7.70 (2H, m), 7.57-7.23 (8H, m), 5.36-4.92 (1H, brm), 5.11 (2H , S), 3.26 (2H, t, J = 6.5), 2.59 (2H, t, J = 6.5); 13C NMR (CDC13) d 172.12, 167.27, 135.65, 132.54, 131.66, 128.45, 128.10, 128.06, 126.84, 66.31, 47.33, 33.31; Analysis of the calculation of C17H18N203N: C, 68.44; H, 6.08; N, 9.39. Found 値: C, 68.42; H, 6.10; N, 9.38. MS (ES +) 321 (M + Na, 38%), 299 (M + + 1,100). (3S) 2- (N '· fluorenyl-N- (2-fluorenyloxyethyl) hydrazinocarbonyl) Hexahydro-peptone · 1,3-dicarboxylic acid 1-fluorenyl 3-third-butyl ester (260). Hexahydro-peptamine-1,3-dicarboxylic acid (3S) -1-character 3 -th Tris-butylamine (Hassall et al. J. Chem. Soc. Perkin 1, p. 1451-1454 (1979)) (925.3 mg, 2.89 mmol) and diisopropylethylamine (0.70 ml, 4.0 mmol) Ear) at 1.93 乂 phosgene (17.96 ml, 34.7 mmol) Ear) toluene solution, stirred at room temperature for 45 minutes, and concentrated to leave a yellow solid. To this solid was added toluene (18 ml) '醯 胼 (259) (861.6 mg, 2.89 mmol) and diisopropyl Ethylamine (0.70 mL, 4.0 mmol). The mixture was stirred at room temperature for 2.75 hours and concentrated. The resulting residue was taken up in EtOAc, washed with 1M HC1, brine, and dried (MgS04), filtered and Concentration can produce 2.15 grams of crude material. Fast chromatography-405- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page) r Pack. Order 541309 Economy Printed by A7 B7 of the Consumer Cooperatives of the Ministry of Standards of the People's Republic of China 5. Description of the invention (403) (40% EtOAc in hexane) can produce 1.65 g (89%) of the title compound as a white foam: mp. 40 ° C; [a] D24 -55.78 ° (c 0.40, CH2C12); IR (KBr) 3436, 2930, 1733, 1689, 1455, 1412, 1367, 1258, 1 156, 697;! H NMR (CDC13) S 8.54-8.23 ( 0.5H, m) 9 7.97-7.09 (15.5H), 5.16-4 · 80 (4H, m), 4.66-4.32 (1H, m), 4.24-3.55 (3.3H, m), 3.50-3.26 ( 0.4H, m), 3.19-2.49 (2.3H, m), 2.11-1.43 (6H, m), 1.32-1.05 (7H, m); analysis (: calculation of 35Η4〇Ν408 · 0.5Η20): C, 64.31; H, 6.32; N, 8.57. Found 値: C, 64.18; H, 6.27; N, 8_56. MS (ES +) 662 (M + Na, 84%), 645 (M + + 1, 100), 384 (77). (6S) -3- (Nf-benzylfluorenyl-N- (6-tertiary-butoxycarbonylhexahydropyridin-1-carbonyl) hydrazino) propionic acid (261). A solution of 260 (1.59 g, 2.47 mmol) in MeOH (142 ml) was treated with 10% Pd / C (230.0 mg) and stirred for 1.5 hours at 112 atmosphere. The mixture was filtered and the solvent was evaporated to give 1.04 g (100%) of a white foam. This can be used in the next step without further purification.mp &lt; 40 ° C; [a] D26 + 1.60 (c 0.26, CH2C12); IR (KBr) 3422, 2977, 2986, 1728, 1677, 1486, 1445, 1396, 1369, 1309, 1228, 1 155, 916, 716; 4 NMR (CDC13) d 10.0-9.7 (1H, brm), 7.86 (2H, d, J = 7.5), 7.62-7.38 (3H, m ), 7.3-5.6 (2H, brm), 4.57 (1H, brd, J = 4.0), 4.05-3.77 (2H, m), 3.00-2.82 (1H, m), 2.80-2.43 (3H, m), 2.20 -2.03 (1H, m), 2.00-1.47 (1H, m), 1.62-1.14 (11H, m); 13C NMR (CDC13) d 175.00, 171.17, 167.62, 160.68, 132.39, 131.77, 128.67, 127.38, 82.27, 54.38, 48.04, 46.35, 33.62, 28.02, 25.68, 21.61. MS (ES +) 443 (M + Na, 68%), 421 (M + -406- This paper size applies to China National Standard (CNS) A4 specifications (210 X 297 mm) (Please read the notes on the back before filling (This page)

1T 541309 A7 B7 V. Description of the invention (4〇4) + 1), 100), 365 (50), 131 (61). (4S) 7-benzylamido-6,10-diketonyl_1,2,3,4,7,8,9,10-octahydro-611-dacrobenzyl [1,2-3 ] [1,2,4] Triazapyridine-4-tanoate tert-butyl ester (262) 3 p-amino acid 261 (1.012 g, 2.41 mmol) in anhydrous THF (26 ml) in At 0 ° C, N-ethylmorpholine (597 μl, 4.69 mmol) was added followed by PC15 (651.3 mg, 3.12 mmol). The reaction was stirred at 0 ° C for 2 hours, then warmed to room temperature and stirred for another 15.5 hours. The mixture was concentrated and the resulting residue was taken up in EtOAc, washed twice with 1M HC1, saturated NaHC03, brine, dried (MgS04), dried over i and concentrated. Flash chromatography (20% EtOAc / CH2C12) gave 727.3 mg (75%) of the title compound as a white foam: [a] D26 +51.0. (C 0.20, CH2C12); IR (KBr) 3436, 2979, 1733, 1670, 1483, 1437, 1420, 1299, 1243, 1 156; iHNMR (CDC13M 8.70 (1H, s), 7.78 (2H, d, J = 7.0), 7.57-7.32 (3H, m), 5.08 (1H, dd, J = 2.5, 5.5), 4.59-4.43 (1H, m), 4.08-3.69 (3H, m), 3.07-2.84 (1H , m), 2.57-2.35 (1H, m), 2.34-2.14 (1H, m), 2.07-1.43 (3H, m), 1.48 (9H, s); 13C NMR (CDC13) d 172.41, 169.04, 166.35, 158.35, 132.24, 132.03, 128.61, printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 127.31, 82.77, 55.41, 54.07, 41.57, 32.21, 28.04, 24.97, 20.37; Analyze the calculation of C20H26N4O5: C, 59.69; H, 6.51; N, 13.92. Found: C, 59.53; H, 6.53; N, 13.84. MS (ES +) 425 (M + Na, 71%), 403 (M + + 1,100), 145 (41). (4S ) -7-benzylamido-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6 ^ 1-tapano [1,24] [ 1,2,4] -Triazapyridin-4-carboxylic acid (263). -407- in a 1: 1 CH2C12 &amp; TFA (150 ml) mixture of ester 262 (720.0 mg, 1.80 mmol) This paper size applies to China National Standard (CNS) A4 (210X 297mm) 541309 A7 ___ B7__ 5. Description of the invention (405) The solution is stirred in an anhydrous atmosphere for 1.3 hours. The solution is reduced in air, absorbed with Et20 and reduced again. This process is repeated six times to produce a crude product, which is doped with white. Solid. The product was purified by flash chromatography (5% MeOH / CH2C12) to yield 520.0 gram (83%) of the title compound as a white foam: [a] D25 +59.5. (C 1.82, CH2C12); IR (KBr) 3435 , 3266, 2956, 1732, 1664, 1524, 1486, 1440, 1302; 4 NMR (CDC13) d 9.13 (1H, s), 7.77 (2H, d, J = 7.5), 7.57-7.32 (3H, m), 5.27-5.16 (1H, m), 4.62-4.43 (1H, m)? 4.09-2.70 (3H, m), 3.14-2.89 (1H, m), 2.59-2.43 (1H, m), 2.38-2.20 (1H , M), 2.14-1.89 (1H, m), 1.82-1.59 (2H, m); 13C NMR (CDC13) d 173.65, 172.28, 166.44, 158.42, 132.44, 131.31, 128.61, 127.39, 54.83, 54.01, 42.11, 31.79, 24.42, 20.29; MS (ES-) 345 (M-H +, 100%), 161 (45). Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) [2RS, jS (4S)] N- (2-fluorenyl-5-fluorenyltetrachlorobutan-3 -Based) -6,10 -dicopper-based 1,2,3,4,7,8,9,10-octahydro-611-dagen [1,24] [1,2,4] triazine Hetero-4-carboxamide (264). To acid 263 (300.0 mg, 0.87 mmol) and (2RS, 3S) -3-allyloxycarbonylamino-2-; oxy-5-ketotetrahydrofuran (Chapman, Bioorg. &Amp; Med. Chem. Lett. 2. pp. 615-18 (1992)) (277.6 mg, 0.95 mmol) was added to a solution of anhydrous CH2C12 (2.5 ml) and anhydrous DMF (2.5 ml) at rt, and bis (triphenylphosphine) was added. Palladium gas (13.0 mg) followed by tri-n-butyltin hydride (466.0 µl, 1.73 mmol). The reaction was disturbed for 5 minutes, and then 1-light benzotrio (234.1 mg, 1.73 mmol) was added and the mixture was cooled to 0 ° C, followed by 1- (3-dimethylaminopropyl) -3- Ethyl postionized diimine hydrochloride (204.5 mg, ΐ0.04 mmol). Let the mixture warm -408- Wood paper size applies Chinese National Standard (CNS) A4 specification (210x797 mm) &quot; — 541309 A7 _______B7 'V. Description of the invention (paste) (Please read the notes on the back before filling in this Page) to rt 'and stir for another 16.5 hours. The mixture was diluted with EtOAc and washed with 1M NaHS03, saturated NaHC03 (x2), H20 and then brine. The organic layer was dried (MgS04), filtered and concentrated. Purification of the residue by flash chromatography (5% MeOH / CH2Cl2) yielded 358.3 mg (77%) of the title compound as a white solid: IR (KBr) 3435, 1791, 1665, 1526, 1421, 1285; 4 NMR (CDC13) d 8.76 and 8.49 (1Η, 2 X s), 7.92-7.73 (2Η, m), 7.62-7.24 (8 · 5Η, m), 6.86 (0 · 5Η, d, J = 8.0), 5.53, and 5.33 (1H, d, J = 5.5, s), 4.95-4.34 (5H, m), 4.04-3.54 (3H, m), 3.03-2.64 (2H, m), 2.49-2.14 (2H, m), 2.11-1.46 (4H, m); MS (ES +) 558 (M + Na, 100%), 536 (M + + 1,78), 404 (58) 〇 [3S (4S)] 3- (7 · benzene Formamido-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-dapono [l, 2-a] [l, 2,4 ] Triazale-4-carboxyamido) -4-ketobutanoic acid (265). A mixture of 264 (350.0 mg, 0.65 mmol), 10% Pd / C (350 mg) and methanol (36 ml) was stirred under H2 atmosphere for 6.5 hours. The mixture was filtered and the solvent was evaporated. Et20 was added and the solvent was removed again. This procedure was repeated four times to remove 283 mg (97%) of the title compound as a white crystalline solid: mp to carboxylate 14 (TC; [Pan] 026 +33.5. (C 0.18, MeOH); IR (KBr ) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 3428, 1663, 1528, 1487, 1437, 1288; 2H NMR (D6-DMSO) ^ 10.56 (1H, s), 8.71-8.57 (1H, m), 7.88-7.81 (2H, m), 7.65-7.46 (3H, m), 4.97-4.85 (1H, m), 4.38-4.0 (3H, m), 3.88-3.52 (3H, m), 2.9, 2.71 (2H, m) , 2.50-2.38 (1H, m), 2.35-2.21 (1H, m)? 2.10-1.94 (1H, m), 1.93-1.49 (3H, m); 13C NMR (D6-DMSOM 173.66, 172.49, 169.97, 169.89 , 164.96, 157.62, 132.35, 131, 85, 128.39, 127.32, 53.81, 52.69, 40.90, 33.17, Saki 409-, This paper size applies to China National Standard (CNS) A4 (210x 297 mm) 541309 A7 B7 Ministry of Economic Affairs Printed by the Consumer Standards Cooperative of the Central Bureau of Standards 5. Description of Invention (407 31.60, 24.40, 24.13, 19.24; MS (ES-) BOC-N Η

CO2H DOHA

J ^ HZ

Phth--N ^ C〇2H H

(2S) 3-Aminooxycarbonylamino-2-phthalimidoiminopropionic acid (266). (2S) 3-Methoxycarbonylamino-2-tertiary-butoxycarbonylaminopropionic acid dicyclohexylamine salt (3 g, 5.8 mmol) in dichloromethane (200 ml) as a solution of 1 MHC1 The solution was washed four times, dried (MgS04) and concentrated. The resulting oil was redissolved in anhydrous chloroform (35 ml), cooled to 0 ° C and treated with trifluoroacetic acid (35 ml). The solution was stirred at 0 ° C for 1.5 hours and evaporated to dryness. Add dichloromethane (50 mL) to the residue and remove under vacuum. This process was repeated six times to produce a white solid. The white solid was suspended in toluene (50 ml), treated with powdered phthalic anhydride (940 mg, 6.35 mmol) and refluxed for another 18 hours. The resulting solution was concentrated to form an oil, which was purified by flash chromatography (2-10% methanol / dioxane) to yield 266, 2.01 g (94%) as a white powder: IR (KBr) 3600-2500br, 1776, 1714 , -410- This paper size applies to China National Standard (CNS) A4 specification (210X 297 mm) 541309 A7

(50 mg) and hydrogenated at room temperature and atmospheric pressure for 24 hours. The mixture was fully evacuated to remove hydrogen, treated with a 37% aqueous formaldehyde solution (8 mg, 0.22 mol) and stirred under nitrogen for 2 hours. The mixture was filtered, evaporated to dryness and the product was purified by flash chromatography (4-1000% ethyl acetate / dichloromethane) to yield 268 14.5 mg (48%) as an oil: iH NMR (CDC13) d 7.85 (2H , M), 7.71 (2H, m), 5.78 (1H, dd, J = 10, 5), 4.99 (1H, dd, J = 6.1, 1.5), 4.07 (1H, d, J = ΐ 〇6), 3.49 (1H, dd, J = 14, 5), 3.39 (1H, d, J = 10.3), 3.24 (1H, dd, J = 14, 10.2), 3.17 (2H, m) , 2.39 (1H, m), 1.84-1.46 (3H), 1.51 (9H, s); MS (ES +), 415 (M + 1), 437 (M + Na). Compound 28CU283 was prepared from 212b in a similar manner to 226e. Compound 284-227 was prepared by a method similar to the preparation of 2117e. Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs ------- -412- This paper size applies to the Chinese national standard x29f ^ · 541309 A7 B7 V. Description of the invention (410 Ο

280-287 compounds%

R 280 281 282 283 284 0 ^ 〇r ^ bf4-

α —s ο 9

α 285 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 286

HP

287 'Foot. ¾ -413- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (411 C〇2-i-Bu ΑΙΙοο ^ N ^ γ ^ 1

l ^ N-OR

Ο

Ο

a R

b R

Printed by (3S) 3-allyloxycarbonylamino-4-ketobutyric acid third-butyl ester 0- (2,6-dichlorophenylfluorenyl) B (306a ), Prepared in a manner similar to 208a, except that 2,6-dichlorophenylmethoxyamine (prepared in a manner similar to 306b) was used instead of hemcarbazide to yield 870 mg (quantitative) of a clear oil. (3S) 3-Allyloxylanyl-4-ketobutyric acid tertiary-butyl g- (2 · (phenylhydrazone) ethyl) M (306 b) ′ was prepared in a similar manner to 208a, In addition to the use of 2 · (benzyl) ethoxyamine (US 5 346 911) instead of semicarbazide to produce 395 mg (fixed) of a clear oil. -414 This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 _ ______B7_ V. Description of the invention (412) [3S (1S, 9S) 3- ( 9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-dalopano [l, 2-a] [l, 2 ] Diazapyridine-1-carboxamidoamino) -amino] -4-ketobutyric acid tert-butyl ester, 0- (2,6-dichlorophenylmethyl) oxime (307a) is similar Prepared by the procedure of 233e, in addition to replacing 207a with 306a, 23 mg (23%) of 307a can be produced as a white solid. [3S (1S, 9S) 3- (9-benzylamido-6,10-diketonyl-1,2,3,4,7,8,9,10_octahydro-6H-daphthol [ 1,2-a] [l, 2] Diazapyridine-1-carboxamidoamine) -amino] -4-ketobutyric acid third-butyl ester, 0- (2- (phenyl) ethyl Base) milk (307b) was prepared in a similar manner to 233e, except that 207a was replaced by 306b, yielding 43 mg (48%) of 307b as a white solid. [3S (1S, 9S) 3- (9-benzylamido-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-daphthol [ l, 2-a] [l, 2] diazapyridine-1-carboxamido) -amino] -4-ketobutyl '0- (2,6 --peptylmethyl) ribs ( 308a) 'Prepared from 307a in a similar manner to 235e from 234e, yielding 15.2 mg (74%) of a white solid: lH NMR (CD3OD) ^ 0.9 (m), 1.3 (s), 1.7 (m), 1.8 (m ), 2.0 (m), 2.1-2.2 (m), 2.3 (dd), 2.4-2.5 (m), 2. 6 (m), 2.7-2.8 (m), 3.1 (m), 3.3 (m ), 3.4-3.5 (m), 4.5 (m), 4.9 (m), 5.1 (m), 5.3 (d), 5.4 (s), 6.8 (d), 7.2-7.5 (m), 7.8 ( dd), 8.4 (dd). [3 8 (13,95) 3- (9-fluorenylamino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro [l, 2-a] [l, 2] diazepine-1-carboxymethylamino) -amino] · ketobutyric acid, 0- (2- (phenyl) ethyl) pyridine ( 30o), prepared from 307b in a similar way to the preparation of 235e from 23 cores, which can generate 25.2 mg (68%) of white solid ft "4 NMR (CD3OD) d 1.2 (m), 1.6-1.7 (m), 2.0-2.1 (m), 2.2 ⑻, 2.3 (m), 2.5 (m), 2.6-2.7 (dd), 2.9 (t), 3.0 (t), 3.1 (m), 3.3-3.5 -415- This paper is suitable for Guancai County (CNS) A4 size (210X297 mm) ~: (Please read the precautions on the back before writing this page) • Binding and ordering 541309 A7 B7 Staff Consumer Cooperatives of the Central Standards Bureau Printed 5. Description of the invention (413) (m), 4.2 ⑴, 4.25 (m), 4.5 (m), 5.2 ⑴, 5.3 ⑴, 6.7 ⑷, 7 · 1 ~ 7 · 2 (m), 7.35 (dd), 7.4 (m), 7.5 (m), 7.8 (dd), 8.3 (dd).

0 O

〇

[3S (1S, 9S) 3_ (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-Dagen and [1 , 2-a] [1,2] Diazapyridine-1-carboxamidoamino) -amino] -4-ketobutyric acid tertiary-butyl ester (302). Step A: 301 is prepared in a similar step to 605a (Step A), except that -416- paper scale is applicable to China National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (414) In addition to 212e instead of 603a, Wo 亳 g (34%) was formed as a white solid.

Step B: 302.301 (50.7 mg; 0.091 mmol) in 28 ml of a solution of MeOH / MOAc / 3 7% formaldehyde in water (5: 1: 1) and stirred at rt for 5.5 hours, and the reaction was continued In the tool: k down to 0.7 ml. The residue was dissolved in 3 ml of cjj3CN

The medium was further reduced to 0.7¾ liters (3χ) and dissolved in toluene and concentrated to 0. 7 ml (2χ), and then reduced to dryness. Chromatography (fast, isopropanol / CH2C12) yielded 302 (45.5 mg, 78%) as a white solid ': iH NMR (DMSO-d6M 1 · 0-1 · 15 (m, 2H), 1.4 (s, 9H ), 1.65 (m, 2H), 1.9-2.1 (m, 2H), 2.15-2.4 (m, 3H), 2.55 (m, 1H), 2.7-3.0 (m, 2H), 4.3-4.6 (m, 2H), 4.9 (m, 1H), 5.2 (m, 1H), 7.4-7.6 (m, 2H), 7.8-8.0 (m, 2H), 8.6 (m, 1H), 8.8 (m, 1H) ), 9.4 (s, 1H). [1S, 9S (2RS ,: &gt; S)] 9- + amido-6,10-diketo-i, 2,3,4,7,8,9 i〇_ octahydro-N- (2-methoxyketo-tetrahydrofuranyl) -6H- ♦ Homo [ua] [l, 2] diazafluorene-1_ | acid amine (304a). Economy Printed by the Ministry of Standards and Staff ’s Consumer Cooperatives (please read the precautions on the back before filling out this page) Step A: 302 (90 mg '· 〇 · ΐ 8mmol) in 10 ml of MeOH solution Treated with trimethyl orthoformate (1 ml) and para-toluenesulfonic acid-hydrate (5 mg, 0.026 mmol), and the reaction was stirred for another 20 hours. The reaction was reacted with 3 ml of a saturated NaHC03 aqueous solution. Worked up and concentrated under reduced pressure. The residue was taken up in EtOAc and diluted with NaHC It was washed with 3 aqueous solution, dried on MgS04, and concentrated by air to produce 80 mg of 303a. Step B: 303a was dissolved in 2 ml of TFA, and then disturbed at room temperature for 15 minutes. The reaction was dissolved in CH / l2 and concentrated by air. (3χ). Chromatography (Fast, SiO, Jo /. To 3% MeOH / CH2Cl2 yielded 43 mg (64%) of 304a as a white solid: 4 NMR (CDC13) d 1.55-1.8 (m, 2H) , 1.9-2.15 (m, 4H), -417- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs ) 2.25-2.5 (m, 2H), 2.7-3.3 (m, 4H), 3.45, 3.6 (s, s, 3H), 4.4, 4.75 (2m, 1H), 4.6 (m, 1H), 4.95, 5.4 ( t, d, 1H), 5.1-5.2 (m, 1H), 6.45, 7.05 (2d, 1H), 6.95 (m, 1H), 7.45 (m, 2H), 7.5 (m, 1H), 7.85 ( m, 2H). Example 11 Compounds 214e, 404-413, 415-445, 446-468, 470-491, and 493-499 were synthesized as described in Example 11 and Table 7. -418- This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) (please read the precautions on the back before filling out this page) 541309 A7 B7 V. Description of Invention (416) Employees of the Central Standards Bureau of the Ministry of Economic Affairs Printed by Consumer Cooperatives

〇-419- (Please read the notes on the back before filling out this page) This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 Printed by A7 B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Description of the invention (417) Step A. Synthesis 401. TentaGel S® NH2 resin (0.16 mmol / g, 10.0 g) was placed in a sieve glass funnel and DMF (3 X 50 ml), 10% (v / v) DIEA in DMF (2 X 50 Ml) and finally DMF (4 x 50 ml). Add sufficient DMF to the resin, and then add 400 (1.42 g, 2.4 mmol, prepared from (3S) -3- (thenylmethoxycarbonyl) -4-ketobutyric acid third-butyl ester, according to AM Murphy et. Al. J. Am. Chem. Soc., 114, 3156-3157 (1992)), 1-hydroxybenzotriazole-hydrate (η〇ΒΤΗΗ〇; 0.367 g, 2.4 mmol) , 0-benzotriazol-1-yl-N, N, N, N, -tetramethylphosphonium hexafluorophosphate (HBTU; 0.91 g, 2.4 mmol) and DIEA (0.55 ml, 3.2 mmol) Ear) to get a slurry. The reaction mixture was stirred at rt overnight and the trough was shaken with a wrist arm. The resin was evacuated on a perforated glass funnel; separated by filtration and washed with DMF (3 X 50 ml). Unreacted amines were capped and the resin was reacted with 20% (v / v) Ac20 / DMF (2 X 25 mL) directly in the funnel (10 min / wash). The resin was washed with DMF (3 X 50 mL) and CH2C12 (3 X 50 mL), and dried overnight under vacuum to yield 401 (110 g, quantitative yield). B step. Synthesis 402. Resin 401 (6.0 g, 0.16 mmol / g, 0.096 mmol) was washed in a glass funnel with DMF (3 x 25 ml) and swelled. Fmoc stilbene was then resolved at 25% (v / v) hexahydropi ratio / DMF (25 ml) for 10 minutes (intermittent stirring) and fresh hexahydropyridine reagent (25 ml) for 20 minutes. The resin was washed with DMF (3 X 25 mL) and N-methylpyrrolidone (2 X 25 mL). After the resin was transferred to a 100 ml flask, N-methylpyrrolidine was added to obtain a slurry, and 21 l 2f (0.725 g, 1.57 mmol) was added, and ΗΒΤ · Η20 (0.25 g, 1.6 mmol), hbtu (〇61 grams, 16 millimoles) and mEA _-420 _ This paper size is applicable to Chinese National Standard (CNS) M specification (21QX 297 g) (Please read the precautions on the back before filling this page)

541309 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A 7 _ B7 V. Description of Invention (418) (0.84 ¾ liters, 4.8 millimoles). The reaction mixture was stirred at rt overnight, and the trough was shaken with the wrist. Resin treatment and capping with 20% (v / v) Ac20 / DMF as described in 401 yielded 402 (6.21 g, quantitative yield). Step C. Synthesis 403. This compound was prepared from resin 402 (0.24 g, 0.038 mmol) using an Advanced ChemTech 396 Multiple Peptide synthesizer. The automated cycle included washing the resin with DMF (3 x 1 ml), deprotecting with 25% (v / v) hexahydropyridine / DMF (1 ml) for 3 minutes, and fresh reagent (1 ml) for 10 minutes to generate Resin 403. The resin was washed with DMF (3 X 1 ml) and N-methyl p-bilidene (3 X 1 ml). Step D. method 1. [3S (1S, 9S)]-3- (6,10-diketo-l, 2,3,4,7,8,9,10-octahydro-9- (thiophen-3-methylcarbonylamine) ) -6H-Da-Chen [l, 2-a] [l, 2] diaza-butanilamine) -4-ketobutyric acid (409). Resin 403 with 0.4Mp cephen-3-carboxylic acid and 0.4M HOBT in N-methyl pilopyril (1 ml), 0.4M HBTU in N-methylpyrrolidone (0.5 ml) and 1.6M DIEA It was tritiated in a solution of N-methylpyrimidone (0.35 ml), and the reaction was shaken at rt for 2 hours. Repeat the steps. Finally, the resin was washed with DMF (3 X 1 ml), CH9C1, (3 X 1 liters), and dried in air. While dissociating from the resin, the whole was deprotected by treating with 95% TFA / 5% H20 (v / v, 1.5 ml) at rt for 30 minutes. After washing the resin with a dissociation reagent (1 ml), the mixed filtrate was added to cold 1: 1 Et20: pentane (12¾ liters), and the resulting precipitate was separated by centrifugation and decantation. The resulting agglomerates were redissolved in 10% CH3CN / 90% Η20 / 0.1% TFA (15¾ liters) and freeze-dried to obtain crude 409 as a white powder. Compounds were purified by semi-preparative HPIχ using Raimn MlCrOSorbTM Cl8 columns (5 micron, 21 4 x 25.0 ml) in a linear form • 421-This paper size applies to China National Standard (CNS) A4 specifications ( 210 ^^^-(Please read the notes on the back before filling out this page) 541309 A7 B7 V. Description of the invention (419) The gradient of CH3CN (5% -45%) falls off, which contains 〇1〇 / 〇TFA (乂 ~) For 45 minutes, at 12 ml / min. The fractions containing the desired product were pooled and freeze-dried to yield 409 (10.8 mg, 63%). Step D. Method 1A. Synthesis 418. Follow similar method 1 In step 403, the resin 403 was triturated with 4- (1-fluorenylmethoxycarbonylamino) benzoic acid and repeated. The Fmoc group was removed as in step C. The free amine was 20/0 (v / v). ^ 20 〇] ^ (1 ml) and 1.6M DIEA in N-methylpyrrolidone (ο. "Ml) in the following acetylation for 2 hours. Repeat this step of acetylation. Jun Zi resin Dissociation can produce 48 (3.2 mg). Step D. Method 1B. Synthesis 447. Follow steps as in Method 1A. Resin 403 is tritiated with 0.4M 4- (1-fluorenylmethoxycarbonylamino) benzoic acid. 醯Step Repeat again. The Fmoc group was removed as above, and the free-state amine was reacted with 1Mτ alkanesulfonyl chloride in CH / l2 (0.5 ml) and iM pyridine in CH2C12 (0.60 ml) at rt for 4 hours. Dissociation of the aldehyde from the resin yields 447 (10.0 mg). Step D. Method 2 'Synthesis of 214e. Following a similar procedure as Method 1, Resin 403 uses 0.5 M benzamidine gas to N-methylpyrrolidone. (1 ml) and 16M DIEA in N-methylpyrrolidone (0.35 ml), and then rt was reacted for 2 hours at rt. The hydration step was repeated. 214e (51 mg, 30%) was then dissociated from the resin. ). Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (read the first note and read the note on the back, take the i item and fill out this page) Step D. Method 3. Synthesis 427. Follow the steps similar to Method 1, resin 403 and 1.0M benzene The sulfonium gas was reacted in CH2C12 (0.5 ml) and 1M pyridine in CH2C12 (0.60 ml) at rt for 4 hours. The reaction was repeated. The dissociation of the aldehyde from the resin yielded 427 (7.2 mg, 40%). Step D. Method 4 Synthetic 420. Following a similar procedure to method 1, resin 403 and 0.5M methyl isocyanate in acetaminophen (0 ml) and ι.6 -422-The size of this paper is applicable to the Chinese National Standard (CNS) A4 (210X297 mm) 541309 Employees' cooperation of the Central Bureau of Standards of the Ministry of Economic Affairs, printed by the company V. Description of the invention (42〇) 〇 Zhuangbayu team methylpyrrolidine The ketone (0.35 ml) was reacted and repeated for 2 hours at 1 h. The dissociation of the aldehyde from the resin yielded 420 (8.3 g, 55%). Reaction D step. Method 5. Synthesis 445. Follow a similar step 403 of method 1 with 0.27M imidazole-2-carboxylic acid (1 ml) in 2: 1 DMF: H η water 'resin DIEA) and 1M 1- (3-dimethylaminopropyl) -3-ethyl Dicarbodicarbide (EDC) at 2: 1 N-methylpyrrolidone / HP (0.35 ml) was fermented. Dissociation of the aldehyde from the resin produces 445 (9.5 mg). Analytical HPLC method · (Ό Waters DeltaPak C18, 300A (5 micron, 3 9 X! 々.X 1 5 〇 亳 tip straight CH3CN gradient (5% -45%) containing 0.1% TFA clothing) mask 1 / ί 八 β Gross liter / minute 14 minutes. (2) Waters DeltaPak C18, 300Α (5 microns, 3.9 X 15〇 一. Linear CH3CN gradient (0% -25%) contains 0.1〇 /. TFA (v / v) # 1 which Gross rice) over 14 minutes. (3) Waters DeltaPak C18, 300A (5 microns, 3.9 X 15 ° Paleoisotope dissolution, 0.1% TFA / water (v / v) at 1 ml / min. (4) Waters DeltaPak C18, 300A (5 micron, 3.9 X 15 ° ancient linear CH3CN gradient (0% -30%) contains 0.1% TFA (v / v) in meters), ml / minute for 14 minutes. "Under 3 hours and Liters / minute (5) Waters DeltaPak C18, 300A (5 microns, 3.9 X 15 ° Paleo CH3CN gradient (0% -35%) contains 0.1% TFA (ν / ν) in & 14 minutes. 423- This paper scale applies Chinese National Standard (CNS) A4 specification (2 丨 〇 '297 mm) (lower and lower meters) lower 541309 A7 B7 V. Description of the invention (421 printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economy C \ J CNJ CVJ + cn κ s ι 〇〇L0ID 卜 Η cC 〇4 5 One dP CNJ one c # P KD $ VO ^ VO r-1 · dO 00 -cnj σ \ 00 2 L〇CO 00 L〇 卜 ΚΓ π BuΪAXA X 〇〇'Z CVJ K rH OvJ U 〇〇2; VD CM DC CNJ CNJ 〇CD 〇K CNJ CN u Race SE ° &lt; &gt; 〇. Hair 〇 = b &gt; δ re 0 = Hn ° Female: Ex ° &lt; &gt; 0. Xi. ZX ♦ φ spoon rH CM O mo Please read the first 5 notes on the back I. Dong Zhuang

Order I-424- This paper size applies Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of invention (422 Printed by CM Cvj CN CN + cn κ s CTk Γ- l〇lD σ \ rl CN in η Ο J port φ CU κ rH S-rH-dP ^-· CPi Γ-i-dp 00 ο σ \ σ \ rH dP 〇〇 'r- &lt; G \ rH rH 3: cn CD CO tH S-σ \ rH in σ \ iD lD 〇 (NJ L〇ΪΧ4 〇〇Z, u Γ〇 〇g X t-1 CNJ 〇 〇 〇 〔EG 5 &lt; NU 卜〇 • ζ κΩ CNJ Ε LO CN CJ, oo 2 CD CM X CNCNJ o Sai δη: 〇chemical. Corrected. Δχ 〇 = 〇 = °. 1 δ 3: 〇 = 〇 = 〇. Hard. Go. \ VO o ο 00 ο o 425- (Please read the notes on the back before filling out this page)

This paper size applies to the Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (423) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

γΗ rH rH i-1 + s r r L L &lt; Tk (Tk o. Η CU X rH-dP bu 00 r— 1 00 bu · so rH rH -1 * dP bu 00 CO CNi ό ρ, H CO bu 〇ι〇o lD -L〇CTk o L〇m σ \ r—1-^ r CO 〇Csj s cn 〇〇2; CM CM K &lt; Tk rH CJ 〇 〇 vD CM X, CvJ U 〇iD's lT &gt; CNJ CNJ u r- 〇 &lt; NX 00 rH 〇〇 乂. Mother. Δ 3: 〇 = ^ °. Calibration. Δ = 0 = HK °. Towards °° P 3 x ° &lt; & gt 0. Inverse ° v Λ3 ο tH ιΗ &lt; N rH m rH -426- This paper size applies to China National Standard (CNS) A4 size (210X 297 mm) (Please read the precautions on the back before filling in this page)

541309 A7 B7 V. Description of the invention (424) Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economy rH rH + CO S * S + X σ \ CO 卜 m ΓΟ L〇CC 〇4 rH cfP co 5? ID ^ 卜 rH dP VD ?? one m 00 VD ^ r CO 00 σ \ 00 one CO ro ro m ro m X a \ 〇C \ JX CNJ CNJ CJ BU 〇S: rH um CM re t—1 CNJ U o rH O o ro XC \ JL); match δ x ° &lt; ^ °. school. B = \ ° \ y ° ° &amp; t °% r, one o o- ΙΟ rH VO tH r- tH 1 -427- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) (please first Read the notes on the back and fill in this page) 541309 A7 B7 V. Description of the invention (425) Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs &lt; t-f CN + cn κ ^ 1 CM Ο L〇 &lt; D ro co σι m Η cC S order t \ ^ όΡ ^ s in CNJ ^ dP CD s ^ KD CNJ-dP _ 00 L〇o iD rH 〇if) 〇〇-Γ0 00 σ \ cn ON Γ0 σσ ΓΟ DU CO o L 〇 Bu CN E cn &lt; N 〇 00 〇2: CNJ C \ JX VD t-1 CJ Bu 0 l 2 CVJ X VD t-Η 〇o = ^ _ &gt; = o. Dad ° &lt; &gt; 0 / Π: O 3 :. Inverse 〇 = &lt; ZΠ: / 00 rH cn rH o 04 Please read the notes of the memorandum first

-428- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 A7 B7 V. Description of invention (426) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

ΓΟ i—1 tH rH + cn κ s ΓΟ ΓΟ nr oo 00 o L〇η CC g Let Du CNJ-dP 2-bu f ~ 1-Zffl _ CO CO VO rH talk about VD L〇tH ^ 〇 CNJ ^ VO s VD C \ J ro cn ^-VD bu CM if) bu CNJ cn 00 〇〇VO οι bu 0000 〇in 2: CD L〇2: tr \ 'Z ro s CNJ D: VO CNJ 工 tH u; CM o CNJ: c cn rH CJ CNJ u OJ CJ: tH CJ Race 〇 = ^! 卞 δ x ° = c &gt; 〇. attack. Ex Q = H:. path. δ x ο == Γ &gt; = ο. &amp;! 〇.cb〇 〇 = Vx ° v rH CN4 1 CNJ CVJ cn c \ j cr OJ -429- (Please read the precautions on the back before filling this page)

This paper size applies to the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7B7 V. Description of the invention (427) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

rH 04 CO + cn K sr r—4 ι— &lt; in rH If) rH CO 3 order〇4 tH dP S-搴 00 tH-dP CO O CTk 00 tH-dP bu 1-1 〇-1 if) 〇ID · 〇if) o L〇o CO 00 o § CNJ D: LD CNJ o BU ο ΓΟ tH C \ J u cn CO 〇2: ^ r C \ JX o CNJ · U δ κ ° &lt; &gt; °. \ \ X οχ 0 ^ ° ° 〇r ° b Si. to. ° ό ° ^ 3 L〇 Csi ^ 3 * VO CNJ 卜 CVJ -430- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm)

541309 A7 B7 V. Description of the invention (428) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs ΓΟ &lt; tH rH + ίΠ s 1 00 «sT '« νΓ rH m CNJ 〇m ο VD cc Order 〇4 ι-Η -DP 2 -LD 5 ό 2 -m-dP s-L〇CNJ-dP VO ® S (r- o ro o L〇rH om VO OS L〇CO CO 〇LT) 'Z m CM E VD rH O 〇 2; o CNi rH o 00 〇L〇2: CN X Γ0 &lt; NJ U BU 0lD 2: iD CNJ x 1-4 CM CJ case XOX o = &lt; ^^ = or \ J &quot; x 0Cr: ° . ·, R 3: 0 3 :. = 〇 =. rvr. 〇: X O X ° ^ °. Mai Sx 0 = v ° 00 CVJ 〇 \ &lt; N Ο on rH m (Please read the precautions on the back before filling this page) -431-This paper size applies to China National Standard (CNS) A4 (210X 297 mm ) 541309 A7 B7 V. Description of the invention (429) Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economy t-1 rH ri tH + CO XX + KD 00 00 σ \ m 00 VD C \ Eh P: CU X rH-dP L 〇r—i dP 卜 σ \ 1-1 tH tH 1 (Λ〇rH dP '〇S rH ^ L〇VO L〇00 rH L〇 ~ r- σ \ CD om L〇c \ CX4 〇 CN Ni X rH CM Ο r- 〇m 2; CM X CNJ 〇 〇〇VO 2: CN D: CNJ CNJ 〇 · '卜 〇lD 2: if) eg eg CJ match 51 0 = V = 0% xzzz OX . = 〇 =. Γ &gt; -ζ ο ^ ζ * ζ ^ ο ° 5x. Service: ¾ work o work =. ° Cr: Ip C \ J cn (η m cn in m -432) This paper size is applicable to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling this page). 541309 A7 B7 V. Description of the invention (430) Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 1-H t— &lt; t—l rH + cn n: s ard KD σ \ VD CNJ L〇U3 G \ vo σ »Ο Ο: Η-1 〇4 X όΡ s-CD L〇dP 00 CO r- σ \ CNJ fH rH ～ ¢ P * CO S ^ i〇_dP 〇00 3: 〇L〇L〇CM IT) m CvJ U &quot;) 〇lD L〇o L〇iD CTk Cu ID of CN K CNJ u CO 〇in 2: VP CVJ X in CN 〇 〇〇2 2; CM X CM 〇 〇〇〇〇〇〇 CNJ re CNJ CJ δχ 〇 = CJ = o. § o x 0eCC ° \, 5 x o = ^. . Reverse \ Work 〇 = 0 = 〇. &amp;. zx IP VO n Γ- Γη 00 rn cn -433- (Please read the precautions on the back before filling this page)

This paper size applies to the Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (431) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

1—1 rH ι ~ Ι + CO X s | 〇t—1 if) 00 Γ0 in BU ο L〇㈠ CC 〇4 L〇-dp VD S σ) σ \ rH Vw- ^ όρ 2 -VO Γ— & lt c? P 〇 00 r—l G \ 〇r— &lt; CNJ mo L〇00 LD · Γ0 in lD VD 〇L〇 〇〇〇2: CM EL〇CNJ U 〇〇J2: tH ΓΟ X Bu CNJ CJ Csj cn γ- Ο 'Z oa CNJ X rH CN ○ match δ x ° = 〇 = 〇. Pan ° y O X 〇 = Q =. z- / OX 〇 = &lt; w ^ ° 荽 O rH CVJ Please read the τδ notice before filling in _ Taiji page order -434- This paper size applies to China National Standard (CNS) A4 (210XM7 mm) 541309 A7 B7 V. Description of the invention (432) L〇

(Two H + W) SIR Γ-ες οις ςεπ φ SοΊαιΗ

% 86 mCSJrroT% 86 (ς) 96 · 6% 86 (T) CN 卜 · 客 2 ςιο · 9ειη Art · εΐς τί ^ επ (Please read the precautions on the back before filling out this page 8SN8SG3 S9NSH8T3, 1Τ Central Ministry of Economic Affairs Printed by Standards Bureau Consumer Cooperatives

ει ^ -435- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (433 Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs t— (2 &lt; rH + ιη κ ^ 1 ΓΟ L〇00 Γ0 m VO tH u〇Η QC CU X rH-dfi g-mr-1-dP VD-dP VD S 3: L〇CN if). -iD Γ0 L〇Γ0 L〇 lD rH m BU 0 VD 'Z o CN BU 1—iu CO σ \ 〇L〇2: BU CM X 04 CN U 00 〇L〇2 σι &lt; N DC: CM 〇 Auditor O worker OX 〇 = C &gt; 〇 δ x 〇 = w = 〇 / ~ Λ 2X rwz0x ° Cr ° 'yr ·· ° 〇r ° = &lt;, ° 〇r ° = c 4Γ., L ° V' W 9 〇Q. VO r- ω -436- (Please read the notes on the back before filling this page)

This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of Invention (434) 4is 2

VI iH + w) ss ιις

SLO

Loi φ Icr: 0ΊΟ4Η i (I) 98 · ετ% 86U) 0ΐ · 9 i (T) C \ J0.8 ΐς.οτς οιη ·· τος (Please read the notes on the back before filling this page) ΐ 82Ν9 3ς 3 8〇ςΝΔεΗεΰ Ordered by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs to print fi

ΗΝ 〇 Η H〇 οιοπ -437- The standard of this paper is applicable to China National Standard (CNS) A4 (210X 297mm) ο

0, ο rHLOt? 541309 A7B7 5. Description of the invention (435 CM CNJ CM + s | L 〇 π π rH ο lT printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs) df &gt; 0000 HrH dP rH 00 rH r-1 rH CN ^ dP ^ CO $ π ^ dP bD 00 COCO L〇- oom if) σ \ oo CD U4 CO 〇vo 04 K &lt; N CM o cn 〇 〇 12: CM X ΓΟ CNJ CJ 〇 〇 〇Z cn CsJ 工 o CNJ o 〇 02: rH 〇ro CNJ X rH CN 〇 match OX 0 = 0 =. . Public o— O X. ^ = 〇 ° \ X ° O X ° ^ °.莩 = &amp; 工 o 工 o = ^ V = o. &amp; 1. CNJ l〇 r〇 to L〇 IT) u〇 -438- This paper size applies to Chinese National Standard (CNS) Α4 size (210X297 mm) (Please read the precautions on the back before filling this page

、 1T 541309 A7 B7 V. Description of the invention

rH i—1 tH cn 5 s 1 s 〇〇►2 r〇5 〇g VD rH rH 00 Η 3 order Ot DC rH ^ dP CO S in ^ L〇rH όρ CNJ CD &lt; r &gt; ot-1 rH dP _ 〇〇00 2: SL 〇〇VD KD L〇 ~ o CO L〇ro 〇00 Cx4 s CO 〇cut C \ JX rH CN u 〇rH 〇00 CNJ K CD CNJ 〇 〇 02: S CNJ CNJ X rH CnJ u match 5 x. Inverse / ¾ s O X o = Q = ° 〇 Gas ο qp 〇 §x 〇 = ^ =. . Net% LL UL m 0000 ID (Please read the precautions on the back before filling in this page. -439- This paper size applies to China National Standard (CNS) A4 specification (210X 297mm) oc] 3 1X54) A7B7 V. Description of Invention (43 * 7) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

τ-I rH rH + cn X s s m 00 σ »VD cn CNJ L〇cn ro VD Η cc ^ Φ HJ α« rH dP τ-Η 00 rH Ο ι—4 t—i-dP 2-rH—throp rH 00-Bu 00 00 VX) CTi L〇- OvJ CN L〇C \ J VD ΪΧ4 Bu ο 'Z U * rH 〇 CM CNJ Κ rH CNJ CJ m σ \ 〇§ CNJ X CNJ CNJ 〇 〇 02: Cl4 ro CNJ rH CNJ 〇 Race 0 X 0 = ^ 0 ° &amp; ° zx I 〇UL SI 0 = {} = 0 rVf〇 ° Cr °. Δχ for each job. = ^ 〇. to. C \ l〇ο VD rH VO -440- This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) (Please read the precautions on the back before filling this page) Order 541309 A7 B7 V. Invention Note (438) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

rH i ~ 1 tH + cn E s Γ〇 cn KD L〇fH Η 0: Pu X rH dP 〇〇 卜 rH-dP _ CO s ^ rH dP OS CO in σ \ rH rH S OJ VD ^-CNJ VD Γ0 ro rH 10 Ua s U U cn CNJ D: rH eg U 〇% ro CSJ tc rH CNJ u 〇 2; CNJ «-Η 〇 CNJ &lt; ND: tH CSJ 〇OX 0 = v = 0 % o X ° ^ c ° ° &amp; °% LL OX. = 〇 =. . school. % ο ο 04 VO m VD VD -441-(Please read the precautions on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of Invention (439). Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

-442- (Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7B7 V. Description of invention (440) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

t—i rH rH + CO κ s 1 σσ ο L〇CTk CO CM 00 00 Η cC 〇4 DC rH όρ cd 00 CTk rH rH-dP bu00 iH-ό β ^ -in 3: S CTk lD CTi o VO CNJ lD. Bu CO CNJ in Γ ΟΟ ΪΧ4 CO Bu 〇0〇Γ0 VD CNJ CNJ 〇 卜 〇if) 2 G \ C \ i D: cn CM CJ Bu tt 'Z CM X Γ0 CNJ ·· o OI o 2 * 2 ^ o ° ° K v δ x ° ^ ° ° β ^ ° X • 5 jobs 0 = ^ = 0. press. 2: Industrial 00 VD o Γ- rH -443- This paper size is applicable to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs of the People's Republic of China 1-1 rH t—ί + cn κ s 142 VO ΓΟ Ο L〇rH 00 00 η a: 3 orders 0 4 X rH 1 G ^ P 〇 泛 ο ^ rH a dP Λ 〇〇s ^ t— &lt; dP ~ CO bu 3: S bu • ^ τ rH bu CM ο m &lt; J \ KD CO h4 X bu ο in § CM Ε CNJ CM 〇 σ \ 〇§ CSJ D: vo CM DC of ro csj 〇CO 〇; Γ0 CM: o 琮 δ ι =. \ 5x ° Cr :; 5x 0 = ^ °. Inverse 〇 = k〇X Λ3 Οί Bu cn r r- -444- This paper size applies to Chinese National Standard (CNS) Α4 size (210X 297 mm) (Please read the precautions on the back before filling in this page)

541309 A7 B7 V. Description of the invention (442 printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economy rH 1- | rH + CO E ^ 1 rH ί 00 00 L〇 卜 00 r-1 VD L〇Η U command CU rH ^ dP CTk-dP _ 〇〇in r—H ciP ^ 'CTk cut ΓΟ CO 卜 00 m as if) L〇 卜 〇in m CN K 00 CM o CD 〇§ CNJ tc CNJ CM 〇σ &gt; 〇L〇 之cn ro X VD CSJ • 〇 赛 OX ^ = o% δχ. Reverse 〇 O X 〇 = v = 〇. school. ° v in r- VD Γ- -445- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling this page) 541309 A7 B7 V. Description of the invention ( Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economy rH I— &lt; + CO XX + S ΓΟ CN m CO L〇 卜 ΓΟ ⑦ L〇m Η PC 1-1 Du. X a dp _ CD L〇rH df &gt; a CD m rH 一 όΡ η 00 'lD ΓΟ L〇ΓΟ C \ JL〇 Bu to L〇00 in m CO &lt; T &gt; eg X rH 04 u 00 〇2 VD CSJ KC \ J CNJ u CTk 〇KD • zo ro X LD CNJ CJ Race 5x ° &lt; &gt; 0. Xi: δ x 0 = ^ °. Going forward. Let 〇X Sx 0 = ^ = 0. Net. Name ο &gt; = &lt; ο%工 工 .cn X 工 CO σ \ r- ο ω -446- (Please read the notes on the back before filling this page)

This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (printed by the Consumer Cooperatives of the Central Standardization Bureau of the Ministry of Economic Affairs rH CN rH + CO 5C rH L〇00 CTk eg lT) KD L〇lD ㈠ CC 〇4! —1 -dP 2 -Buyi &quot; dP Λ 〇〇S ^ CTk rH c &gt; P rH 00, ο o rH σι ro σ \ ^ CO &lt; NJ L〇 B10m VX) L〇Ci4 B0tn Zn rH U CM X tH CN] u B0′Z CNJ I—1 〇ro CNJ K rH CNJ 〇00 〇L〇 • Z CTi CNJ X CO (NU δ x 〇 = w == 〇. Bearing 〇 = ζ ^-Sx 〇 = Q =. Towards. '5x 0 = ^ °. Inverse 〇 = s 0 = b τ-Ι CO 04 ① on ω -447 Paper size Applicable Chinese National Standard (CNS) Α4 specification (210 × 297 mm) (Please read the precautions on the back before filling this page)

1T 541309 A7 B7 V. Description of the invention (445) CN γΗ CM printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, rH CVJ 1- (+ S + X rH ΓΟ L〇VD iiH t〇σν ID ID Η CC U Φ 口 cu κ ι ~ 1-dP CD 氐 CO ^ r r &lt; ^ P §-r r-i dP ro 〇〇cn o r- (L〇in &lt; T \ CNJ L〇ΓΟ in · m rH in o 卜卜 in Uu X CO 〇in 2 rH ΓΟ lD CM U 00 〇to 'Z σ »C \ JK cva 〇00 〇'Z r—t cn X CVJ; o δχ 〇 = w = o ° sf &gt; 5 X. Calibration. OX 0 = ^ ° 2X 〇 = b zx 3 λ3 00 l〇ω VD ω -448- (Please read the precautions on the back before filling this page)

This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of invention (printed by CNJ rH CNJ rH, (N, rH + cn E) L〇tn rH rH ro L〇CO ri ID-CO c · 2:-O + S 10 Η oC 〇. RH-dP 〇 ?? cn rH-Cfp ^ -CO-όρ _ 〇DS · π LD i —I — dP 00 00 lD ro cut m LD L〇 — CTk CNJ L〇eg lD rH L〇o lT) r rH L〇Ua CO 〇un Sai Π: CNJ o OQ 〇m 'Z t-I ro D : L〇CNJ CJ 00 〇'sO z 00 CNJ D: m CNJ CJ CTi 〇m 2 r- CNJ X cn CNJ 〇 δ x ° ^ ° Λ 5x 〇 = 〇 = 〇. Hard ° Δ δ χ Si. 〇 = ^ 工 5x o = &lt; ^ = 〇2X 〇ω 00 00 as 00 o rr -449- This paper size applies to China National Standard (CNS) Α4 specification (210X 297 mm) (Please read the note on the back first (Fill in this item and then buy)

1T. 541309 A7 B7 Consumption cooperation by employees of the Central Bureau of Standards, Ministry of Economic Affairs, Du printed 5. Invention Description (447 rH rH CNJ + cn X s ΓΟ L〇VD LD m σ »CNJ r—1 卜 CC ο φ a CU rH-dQ C \ J tH rH-df &gt; h 00 CO tH _ 00 &lt; Tk ◦ ID m KO _ CN ON &lt; Ty 〇r- Ua s σ \ 〇'Z CD CsJ E CO CN o CO 〇ΪΧ4 in CN D: CM CVJ U BU § CNJ &lt; T) Race δχ 〇 = W =. . dig. 〇 = b 5 x ° ^ ° §X 〇 ^ °. Mai \ r- »m CJi c \ -450- This paper size is applicable to Chinese National Standard (CNS) A4 (210X 297 mm) (Please read the notes on the back before filling this page)

541309 A7 B7 V. Description of the invention (448) Printed by CN CN rj rH + s σ \ c \ m BU • L〇r- LD G \ 〇if) rH u &gt; σ \ Η cC α. x γ-1 &quot; &quot; &quot; dP ㈣ c〇b t-1 a dP σ \ t-1 l &lt; ^ &gt; 〇〇 LD ^ &lt; J \ tH dP b 2: S CD ^ Γ 00 m Bu-Bu CNJ a \ 00 o L〇as 00 a \ Bu 〇§ &lt; Ν X CNJ CM 〇 CD 〇§ eg K CVJ CNJ u 00 〇% r—i UL〇CNJ X CVJ. 04 〇 00 〇 • z rH U m CM n: «-Η 04 〇quasi 5 χ 0 = ^ = 0. Inverse 3 §x o = ^. 〇 <XJ 〇- &2; 2X ob Sx 0 = ^ 0 o Industrial OX 0 = Ch ° ° &amp; ° O Industrial m σ \ VO σ \ Bu 00 σ \ 451-This paper size applies to Chinese National Standard (CNS) A4 specifications (210X297 mm) (Please read the notes on the back before filling out this page), 11 541309 A7 B7 V. Description of the invention (449) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economy rH + cn E 2 CM mm Η a: pH cu X dP (CO CNJ &lt; Tk cn rH (BlT)) 〇mm CO 〇pL | 2 om K 00 CN UOX ° = o = ° ο 2 · ζ 〇〇 赛 \ JT 工 b -452 -(Please read the notes on the back before filling in this page)

This paper size applies Chinese National Standard (CNS) A4 specification (210X29? Mm) 541309 A7 B7 V. Description of the invention (450) Example 12 Compounds 605a-j, 605m-q, 605s, 6051 and 605v were synthesized as follows

BOO

Η 〇

Η 〇

Step D

Compound No. r2 605a / 103 Η ch3 600b Η CH2Ph 600c ch3 CH2Ph (Please read the notes on the back before filling out this page) Printed by (3S) -2-one-3- -Butoxycarbonylamino-2,3,4,5-tetrahydro-1, -1,5-benzodiazepine-1-acetic acid methyl ester (600a / 103). A Step a (2S) -2-Di-di-butoxyylamino-3- (2-nitrophenyl-amino) · propionic acid. (2S) -2-Third-butoxycarbonylamino-3-aminopropionic acid (10 g, 49 mmol), 2-fluoronitrobenzene (5.7 ml, 54 mmol), and NaHC. 3 (8.25 grams, 98 millimoles) added to 130 ml of DMF and heated to 18 hours at 80 ° C -453 This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 Ministry of Economic Affairs Printed by A7 B7, Consumer Standards Cooperative of the Central Bureau of Standards 5. Description of Invention (451)

Time. The reaction was evaporated under air to give a viscous orange residue, which was dissolved in 0.01 liters of H2O and extracted with E20 (3 x 150 ml). The aqueous solution was adjusted to pH 5 with 10% NaHSC and extracted with EtOAc (3 X 250 mL). The combined extracts were dried over anhydrous Na 2 SO 4, filtered, and evaporated to give 12 64 g (83%) of the title compound as an orange amorphous solid: iH NMR (CD3OD) β 8.15-8.10 (1H, d), 7.54 -7.48 (lH, t), 7.13-7.08 (1H, d), 6.73-6.65 (1H, t), 4.45 · 4 · 35 (1H, m), 3.9-3.8 (1H, dd), 3. · 65-3 · 55 (1H, dd), 1.45 (9H, s).

Mutual steps. (2S) -2-Third-butoxycarbonylamino-3- (2-aminophenylamino) -propionic acid. (2S) -2-Third-butoxycarbonylamino-3- (2-nitrophenylamino) propionic acid (12.65 g, 40.5 mmol) and 0.5 g of 10% Pd / C in 100 ml of MeOH The mixture was stirred under an atmosphere of hydrogen for 4 hours. The solution was filtered through Celite 545, and the filtrate was evaporated in the air to produce 11.95 g of the title compound in a quantitative yield as a dark brown solid, which was used without further purification: iH NMR (CD3OD) d 6.75-6.70 (3H, m), 6.65-6.58 (1H, m), 4.35-4.3 (1H, m), 3.6-3.38 (2H, m), 1.45 (9H, s). Step C. (3S) -2-keto-3-third-butoxycarbonylamino-i, 3,4,5-tetrahydro-1H-1,5-benzodiazepine. 1- (3-Dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (8.54 g, 44.5 mmol) was added to (2S) -2-third-butoxycarbonylamino-3- A solution of (2-aminoaniline) propionic acid (11.95 g, 40.5 mmol) in 100 ml of DMF was cooled (0 ° C) and stirred for 18 hours. The reaction was poured into 700 mL of EtOAc and washed 4 times with 100 mL of H20. The organic layer was dried over anhydrous Na2SO4, filtered, and evaporated to give a brown solid, which was purified by flash chromatography and dissociated with 3: 7 EtOAc / hexane to give 8 g (71%) of the title compound -454-paper size Applicable Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page)

541309 Printed by A7 _ ______ B7 of the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the Invention (452) Object: iH NMR (CD3OD) d 7.78 (1H, s), 7.02-6.95 (1H, m), 6.88- 6.82 ( 1H, m)? 6.82-6.78 (1H, m), 6.75-6.70 (1H, m), 5.8-5.7 (1H, d), 4.55-4.45 (1H, m), 3.95 (1H, s), 3.9- 3.82 (1H, m), 3,48-3.40 (lH, m), 1.45 (9H, s). Step D. (To) -2-keto-3-third-butoxycarbonylamino-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-acetic acid methyl ester ( 600a / 103). A solution of 1.0M lithium bis (trimethylsilyl) phosphoniumamide (3.4 ml, 3.4 mmol) in THF was added dropwise to (3 3) -2-keto-3-third butoxycarbonyl Amine_2,3,4,5-tetrahydro-111-1,5-benzodiazepine (0.94 g, 3.38 mmol) in 20 ml of anhydrous THF at -78 ° C. And disturb Mix for 30 minutes. Methyl bromoacetate (0.44 ml, 4 mmol) was added dropwise to the reaction mixture and warmed to RT. The reaction was diluted with 100 mL of EtOAc and washed with 0.3N KHS04 (50 mL), H20 (2 X 50 mL) and brine. The combined organic layers were dried over anhydrous ^ 32304, filtered, and evaporated to give a gum, which was then purified by flash chromatography and dissolved in 3: 7 EtOAc / hexane to give 0.98 g (83%) of the title compound as a white solid 〇NMR (CD3C1) d 7.15-7.07 (2H, m), 6.98-6.94 (1H, m), 6.88- 6.84 (1H? D), 5.62-5.55 (1H, d), 4.71-4.65 (1H, d) , 4.65-4.6 (1H, m), 4.33-4 · 27 (1H, d), 3.96-3.90 (1H, m), 3.78 (3H, s), 3.44-3 · 37 (1H, m ), 1.4 (9H, s). (3S) -2-keto-3-third-butoxycarbonylamino-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-acetoacetate ( 6〇b). In a method similar to 600a / 103 (step D), except that phosphonium bromoacetate was used instead of phosphonium bromoacetate, a quantitative yield of 600b was produced. (3S) -2-keto-3-tertiary-butoxycarbonylamino-2,3,4,5-tetrahydro-7,9-dimethyl · -455-This paper scale is applicable to Chinese national standards (CNS) A4 size (210X 297mm) (Please read the notes on the back before filling this page)

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 541309 A7 __B7 V. Description of the invention (453) m-i, 5-benzodiazepine-1_acetate (600c). Lean scales. (2S) -2 · Third-butoxycarbonylamino-3- (2-nitro-3,5-dimethylaniline) -propionic acid. In a similar way to prepare 600a / 1O3 (step A), except that 2-fluoro-4,6-monomethyl-nitrobenzene is used instead of 2-fluoronitrobenzene, the desired compound can be obtained, yield 93 %. Step (23) -2_Third-butoxycarbonylamino-3- (2-amino-3,5-dimethylphenylamino) -propionic acid. (2S) -2-Third-butoxycarbonylamino_3- (2 • nitro-3,5-monomethylphenylamino) propionic acid is converted into the title compound in a quantitative yield, such as 600a / 103 system (B step). Operation 02 · Keto- (3S) · 3-Third-butoxycarbonylamino-2,3,4,5-tetrahydro- 7.9-dimethyl-1H-1,5_benzodiazepine Miscellaneous leather. (2S) _2-Third-butoxycarbonylamino-3- (2-amino-3,5-dimethylphenylamino) _propionic acid (763 mg, 236 mmol) and N-formyl Glyphosate (483 mg, 4.78 mmol) was treated with 60 mL of anhydrous THF at 0 ° C dropwise with isobutylchloroformate (352 mg, 2.5 mmol). The reaction was stirred at 0 ° C for 2 hours, 1 hour at RT and poured into EtOAc. The mixture was washed with 5% NaHS04A solution, NaHC03 saturated aqueous solution, and NaCl saturated aqueous solution, dried over NaS04 and concentrated under air. Chromatography (quick, SiO2, 10% to 25% to 50% EtOAc / CH2Cl2) yielded 490 mg (68%) of the desired product. Step D. (3S) -2-keto-3 -tert-butoxycarbonylamino 2,3,4,5-tetrahydro-7.9-dimethyl-lH-1,5-benzodiazepine-1 -Benzyl acetate (600c). (2S;)-2-Third-butoxycarbonylamino-3- (2-amino-3,5-dimethylphenyl-amino) propionic acid is converted into 600c, 75 by a method similar to 600b %. -456- This paper size applies to Chinese National Standard (CNS) Α4 specification (210 × 297 mm) (Please read the precautions on the back before filling this page)

1T 541309 A7 B7 V. Description of the invention (

Step human HC1 2> Step B. PhCOoH 3> Step C. R3X 6〇〇

Step D

(Please read the precautions on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (33) -2-11¾Base-3-Yacylamine-5- (3-Phenylpropanol) ) _2,3,4,5-tetrahydro-111-1,5-benzodiazepine- ^ methyl acetate (602a). Δϋ. Anhydrous HC1 effervesces to (3S) -2-keto-3-third-butoxycarbonylamino-2,], 4,5-tetral-1} ^-1,5-benzodiazepine leather Methyl-1-acetate (6003/103, 4.0 g, u.4 mmol) was placed in 20 ml of ch2C12 for 20 minutes and stirred at RT for 1 hour. The reaction was evaporated to form (3S) -2-keto-3-amino-2,3,4,5-tetrahydrobenzodiazepine-1-acetic acid methyl ester hydrochloride as a white solid. MA. The white solid was dissolved in 70 ml of DMF and benzoic acid (1.5 g, 12.3 mmol) was added. The reaction was cooled in ice / h20, and then treated with 1- (3-diaminoaminopropyl) -3-ethylcarbodiimide hydrochloride (2.4 g, 12.5 mmol) and hydroxybenzotriazole (1.7 G, 12.6 mmoles) and diisopropylethylamine (3.0 g, 23.2 mmoles). The reaction was stirred at RT and nitrogen atmosphere for 18 hours, and then poured into H20. The aqueous mixture was extracted with EtOAc (2x). The mixed organic layer is 457- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297 mm) Order 541309 Printed by A7 ____ B7 of the Consumer Cooperatives of the China Standards Bureau of the Ministry of Economic Affairs. 5. Description of the invention (Beginning 5) It was washed with 0.5N NaHS〇4, Ηβ, saturated NaHC03 aqueous solution, h2〇 and saturated NaCl aqueous solution, dried over MgS04 and concentrated under a vacuum. Chromatography (quick, SiO2, 10% to 30% EtOAc / CH2Cl2) yielded 3 4 g (85%) of (3S) -2-diketo-3- (benzylamino) · 2,3,4, 5. Tetrapyrene qHq,% benzodiazepine-1-acetic acid methyl ester, as a white solid. Step 0 method ° (3S) 1 keto-3-epiamidoamino 5- (3-phenylpropylamido) -2,3,4,)-tetrahydro-1H-1,5-benzo Diaza leather;! -Methyl acetate (602a). (3S) -2-keto-3- (fluorenamino) -2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-acetic acid methyl ester (200 mg (0.57 mmol) in CH2Ci2 (10 ml), treated with triethylamine (119 mg, 1.13 mmol) and 3-phenylpropanyl chloride (114 mg, 0.68 mmol). The reaction was stirred at rt for 30 minutes, and then diluted with CHfl2. The solution was washed with a 10% HC1 aqueous solution, a saturated NaHC03 aqueous solution, and a saturated NaCl aqueous solution, dried over Na2S04 and concentrated under the air to produce 240 gram (87%) of 602a as a white foam. Face with-矍 °. (3S) -2-keto-3-benzylfluorenylamino-5ethylfluorenylacetamyl-2,3,4,5 · tetrahydro-1H-1,5-benzodiazepine- 丨- Benzyl acetate (602 g). (3S) -2-keto-3- (benzylideneamino) _2,3,4,5-tetrahydro-1H_1,5-benzodiazepine-1-acetoacetate (600b) (465 mg , 1.10 mmol) in CH2C12 (5 ml) at 0 ° C, treated with acetic acid in 1 ml ch2C12, and then slowly added 1- (3-dimethylaminopropyl) _3_ethyl carbon Diimine hydrochloride (431 mg, 2.2 mmol) in 2 ml of CH2C12 under &gt; 12 atmosphere. After 15 minutes the reaction was poured into EtOAc, saturated with 5. / 0 NaHS04 aqueous solution was washed, dried over Na2S04 and air-concentrated. Chromatography (quick, SiO2, 0% to 10% of soil 25 / 〇MeOH / CH2Cl2) can produce 580 mg (3S) -2-keto-3- (uramine-458-) This paper is applicable to China Standard (CNS) A4 specification (210X 297 mm) (Please read the precautions on the back before filling this page) ml 111 —1-· Order 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description ( 456) yl) -5-ethenylethenyl-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-b-acetate, as a white solid. Make a noise. Ephraim. (3S) _2_keto-3-benzylamido-5_methoxycarbonyl- 2.3.4.5- tetrahydro-1H-1,5-benzodiazepine-benzyl acetate (60.2j · ). (3S) -2-keto-3- (fluorenylamino) _2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-benzyl acetate (600b) ( 461 mg, 107 mmol) in THF (5 ml) and a vigorously stirred yc solution of saturated NaHC0 3 (2.5 ml), and a solution of methyl chloroformate (151 mg, 1.6 mmol) in THF ( 0.25 mL), and the reaction was stirred at RT for 45 minutes. The reaction was poured into ch2C12, washed with water, dried over Να # 04 and concentrated in vacuo. Chromatography (flash, SiO2, 0/10 to 10% MeOH / CH2Cl2) yielded 525 mg of 602j as a white solid. C. P method. (3S) -2-keto-3-benzylamido-5-benzylaminecarbonyl- 2.3.4.5- tetrahydro · 1Η-1,5-benzodiazepine-1-acetic acid methyl acetate (602p) . A solution of 602a / 103 (400 mg / 1.1 mmol) and fluorenyl isocyanate (166 mg, 1.2 mmol) in 10 ml of CH2C12 and 10 ml of DMF was heated at 80 ° C for 3 days. The reaction was cooled to RT and poured into H20 and extracted with EtOAc (2x). The combined organic layers were washed with Η20 (4x), then with saturated NaCl, dried over ^^ 304 and concentrated under vacant air. Chromatography (flash, SiO 2, 50% to 80% EtOAc / hexane) yielded 440 mg (80%) of 602ρ as a white solid. Step C. E method. (3S) -2-keto · 3-benzylamino-5- (3-phenylpropanyl)-2.3.4.5- tetrahydro-1H-1,5-benzodiazepine-1-acetic acid Methyl ester (602 v). (3S) 2-keto-3-amino 0- (3-phenylpropanyl-2,3,4,5-tetrahydrobenzodiazepine-1-acetic acid methyl ester hydrochloride (560 mg, 1.34 millimoles), benzaldehyde (146 mg, 1.34 millimoles) and sodium acetate (220 mg, 2.68 millimoles) in _____ -459 -___ This paper size applies Chinese National Standard (CNS) A4 specifications (210X 297 mm) (Please read the notes on the back before filling this one hundred.

541309 A7 B7 printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (beginning 7) a solution of methanol (20 liters) with a 4A sieve (2 g) and NaCNBH3 (16S gram, 2.68 mor deal with. The reaction was stirred for 2.5 hours, acidified to pH 2 with 10% aqueous HC1 solution, and washed with Et20 (2 x 75 ml). The organic layer can be concentrated in vacuo to form an oil. Chromatography (flash, SiO2, 0 to 35% EtOAc / CH2Cl2) yielded 250 mg (40%) of 602v as a clear oil. A method. (3S) -2-keto-3-benzylamidinyl-5- (3-phenylpropanyl) -2,3,4,5-tetrahydro-111-1,5-benzodiazepine Ge-1-acetic acid (6033). (33) -2-keto-3-fluorenamino-5_ (3-phenylpropanyl) -2,3,4,5-tetrahydro-11 ^ 1,5-benzodiazepine Methyl-1-acetate (602a); 1.25 g, 2.57 mmoles were dissolved in 11 ml of THF, Me0H &amp; H20 (5: 5: 1), and then Li0H.H20 (42 mg, 0.2%). 62 mmol) and stirred at rt for 64 hours. The reaction was concentrated under vacuum, diluted with pH θ and acidified with aq. HC1 to give 230 mg of 603a as a white solid. Step U. B-t method. (3S) 2-keto-3-amido-5-ethylfluorenyl-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine • acetic acid (603d ). (3S) -fluorenone-3. (Benzylamido) -5-ethylfluorenyl-2,3,4,5-tetrahydro-111-1,5-benzodiazepine_1 · acetic acid A mixture of methyl ester (602d; 510 μg, 0.58 mmol) and 5% pd / c (250,000 μg) in MeOH (10 mL) was stirred at% (1 atm) for 0.5 h. The reaction was filtered and concentrated in vacuo to yield 403 mg of 603d as a white solid. The compounds of Table 8 were prepared as described in Table 9, using the method of Example 12. _______- 460- This paper size applies to Chinese National Standards (CNS) (Please read the precautions on the back before filling this page)

541309

7 B V. Description of the invention (beginning 8) Table 8 Compound No. R2 R3 r4% 602b H PhCH2C (0) PhC (O) CH2Ph 602c H PhC (O) PhC (O) CH2Ph 602d H ch3c (〇) PhC (O ), CH2Ph 602e H ch3〇ch2c (〇) PhC (O) CH2Ph 602f H (ch3) 2chch2c (〇) PhC (O) CH2Ph 602g H CH3C (0) CH2C (0) PhC (O) CH2Ph 602h H ch3OC (〇) c (o) PhC (O) CH2Ph 602i H ch3c (〇) c (〇) PhC (O) CH2Ph 602j H ch3〇c (〇) PhC (O) CH2Ph 602k H CH3C (0) Boc CH2Ph 6021 CH3 ch3c (〇) Boc. CH2Ph 602m H CH3S (〇2) PhC (O) ch3 602p H PhCH2NHC (0) PhC (O) ch3 602q H ^ 000 PhC (O) CH2Ph 602r H PhCH2CH2C (0) PhCH2CH2C (0) CH2Ph 602s H 'pyridyl ch2c (o) PhC (O) CH2Ph (Please read the notes on the back before filling out this page) Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economy ) A4 size (210X 297mm) 541309

A

7 B V. Description of the invention (459) Table 9 Numbered starting material R3X printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economics c Step method / (% yield) D step method / (% yield) 603b 600b PhCH2C (0 ) Cl A (98) B (89) 603c 600b PhC (0) Cl A (quant ·) B (quant.) 603d 600b CH3C (0) C1 A (quant.) B (quant.) 603e 600b ch3〇ch2c ( 〇) ci A (59) B (quant.) 603f 600b (CH3) 2CHCH2C (〇iCl A (88) B (95) 603g 600b CH3C (0) CH2C02H B (quant.) B (quant.) 603h 600b ch3. c (o) c (〇) ci A (96) B (quant.) 603i 600b ch3c (〇) c〇2h B (87) B (94) 603j 600b CH30C (0) C1 C (quant.) B (quant .) 603k 600b CH3C (0) C1 A, only step C (quant.) Is not operated. 6031 600c CH3C (0) C1 A, only step C (quant.) Is not operated. 603m 600a / 103 CH3S03C1, replace the bite with NEt3, And THF instead of CH2C12 A (76) A (92) '603p 600a / 103 PhCH2C = N = 0 D (80) A C86) 603q 600b C (83) B 071) 603r 600a / 103 PhCH2CH2C (0) Cl A 603s 600b 4 &gt; pyridyl CH2C02H B (90) B (98) (Please read the precautions on the back before filling this page)

、 1T -462- This paper size is applicable to China National Standard (CNS) A4 specification (210X 297mm)

Printed by the Employees' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 541309 A7 B7 V. Description of Invention (460)

603 Table 10 Compounds were prepared as described in Table 11, using Example 12 Method 3 Table 10 Compound No. R2 R3 r4% 602η Η CH3C (0) Tranyl-2-C (0) CH2Ph 602〇ch3 CH3C (0) PhC (O) CH2Ph 6021 Η 3-CH3PhCH2C (0) PhC (O) CH2Ph 602u Η CH3C (0) Fmoc CH2Ph 602v Η PhCH2CH2CO PhCH2 CH3 -463- This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 male Li) (Please read the notes on the back before filling in this page)

541309

7 B V. Description of the invention (46Ί) Table 11 Printed serial number starting materials for employees' cooperatives of the China Standards Bureau of the Ministry of Economic Affairs c. R3x method (% yield) 3) Step C R4X method (% yield) Step D (% Yield) 603η 602k CH3C (0) C1 A (quant.) Dendronyl- 2-C (〇) Cl A (70) B (quant.) 603〇6021 CH3C (〇) C1 _ A (quant. ) PhC (〇) Cl A (73) B (quant.) 603t 602k 3- CH3PhCH2C (0) Cl A (quant.) PhC (〇) Cl A (93) B (95) 603u 602k CH3C (〇) C1 A (quant.) Fmoc-Cl C (82) C (98) 603v 600a / 103 PhCH2CH2C (〇) Cl A PhCHO E (40) A (95)

(Please read the precautions on the back before filling out this page) &gt; 464- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309

A B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of Invention (462) The compounds in Table 12 were prepared as follows. Table 12 Compound number r2 R4 605a H PhCH2CH2C (〇) PhC (O) 605b H PhCH2C (0) PhC (O) 605c H PhC (O) PhC (O) 605d H CH3C (〇) PhC (O) 605e H ch3. ch2c (〇) PhC (〇) 605f H (ch3) 2chch2c (〇) PhC (0) 605g H ch3c (〇) ch2c (〇) PhC (0) 605h H ch3〇c (〇) c (〇) PhC (O ) 605i H CH3C (0) C (0) PhC (O) 605j H CH30C (0) PhC (O) 605m H CH3S03 PhC (0). 605n H CH3C (〇) Amidino-2-C (0) 605〇 ch3 CH3C (0) PhC (0) 605p H PhCH2NHC (0) PhC (0) 605q H ^^ 000 PhC (O) 605s H 4- pyridylCH2C (0) PhC (0) 605t H 3 ~ CH3PhCH2C (0) PhC ( O) 605v H PhCH2CH2C (0) PhCH2 (3S) -3-[(3S) -2-keto-3-benzylamino-5- (3-phenylpropanyl) -2,3,4, 5- (Please read the precautions on the back before filling out this page-465- This paper size is applicable to Chinese National Standard (CNS) A4 size (210X297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Explanation (463) Tetrahydro-1H-1,5-benzodiazepineacetamidinyl] · cardione-butanoic acid (605,3 (3S) -3- (l-resylmethoxy Carbonylaminoxingo ketobutyrate Batam (2 10 g. 0.45 mole, dissolved in a manner similar to the benzyloxycarbonyl homolog of Graybill et al., Int. J. Protein Res., 44, pp. 173-82 (1994)) In 10 liters of DMF and 2 ml of diethylamine, stir for another 2 hours. The reaction was concentrated in the air to form (3S) -3-amino-4-ketobutyric acid third-butyl hemicarbazone. The above residue And 603a (200 mg, 0.42 mmol) in 5 ml of DMF and 5 ml of CH2C12 (TC solution with 1-hydroxybenzotriazole (57 mg, 0.42 mmol) and 1- (3-dimethylamine) Propyl) -3-ethylcarbodiimide hydrochloride (98 mg, 0.51 mmol) was treated. The reaction was stirred at RT for 18 hours, poured into EtOAc (75 ml) and then 0.3N KHS04 aqueous solution, NaHC03 The saturated aqueous solution and the saturated aqueous NaCl solution were washed, dried over NaS04 and concentrated in vacuo. Chromatography (flash, SiO 2, 0% -4% MeOH / 0 / io / o NH4OH / CH2C12) yielded 240 mg (83%) of 604a. B step. 604a was stirred with 10 ml of 33% TFA / H20 for 4 hours, and then concentrated in the air. The residue was dissolved in 7 ml of MeOH / acetic acid / 3 7% aqueous formic acid (5: 1: 1) and stirred for 18 hours. Chromatography (reverse phase C18, 4 · 4 mm ID X 25 cm, 15% to 70% CH3CN / 0.1% TFA / H20) can produce 32 g (16%) of 605a as a white solid ... β NMR (CD3OD, Hemiacetal diastereoisomeric form 7.85 · 7.78 (2H, d), 7.5-7.32 (6H, m), 7.32-7.28 (1H, m)? 7.18-6.98 (5H, m), 4.92 -4.85 (2H, m), 4.5. 4.32 (2H, m), 4.31-4.20 (2H, m), 3.7-3.6 (1H, m), 2.90-2.75 (2H, m), 2.65-2.5 (1H, m), 2.48-2.25 (3H, m). The following compounds were prepared in a similar manner: -466-This paper is sized to the Chinese National Standard (CNS) A4 (210X297 male f).

In II-1-I---=-........ I I ...... I il_H · ϋ% (Please read the notes on the back before filling this page) Order 0 541309 A7 B7

Printed by (3S) -3-[(3S) _2-keto-3-amido-5-phenylacetamido-2,3,4,5-tetrahydro 1H 1,5-Epi-azepinediazol-1-ethylamine amino] 4-fluorenyl-butyric acid (605b) ° 148 mg (33%) as a white solid: 4 NMR (CD3OD) d 7.9-6.9 ( m, 16H), 4 · 9 (s, 2H), 4.5 (m, 1Η), 4 · 4 (m, 2H), 3.75 (s, 1H), 3.6 (dd, 1H), 3.45 (dd, 1H) , 2.7 (m, 1H), 2.5 (m, 1H). (38) -3-[(3 8) -2-keto-3-amido-5-fluorenyl-2,3,4,5-tetrahydro-111-1,5-benzobis Aza leather-1-acetamido] 4-keto-butanoic acid (605c). 319 mg (56%) as a white solid: 4 NMR (CD3OD) β 7.9-6.9 (m, 16H), 5.1 (m, 1H), 4.9 (dd, 1H), 4.7 (m, 1H), 4.6 (dd, 1H), 4.4 (m, 2H), 4.05 (m, 1H), 2.7 (m, 1H), 2.5 (m, 1H). (38) -3-[(38) -2-Amidino-3-benzylamino-5-ethynyl-2,3,4,5-tetrachloro-1 ^ 1-1,5-benzo Diazepine-1-acetamido] 4-keto-butanoic acid (605d). 190 mg (38%) as a white solid: 4 NMR (CD3OD) 1.9 (d, Η), 2.4 (m, 1H), 2.65 (m, 1H), 3.7 (m, 1H), 4.25 (m, 1H), 4.45 (m, 2H), 4.8-5.05 (m, 3H), 7.3-7.7 (m, 7H), 7.9 (d, 2H) 〇 (3S) -3-[(3S) -2-one- 3-Aminoamino-5-methoxyethenyl-2,3,4,5-tetraaza-1H-1,5 -benzodiazepine-1-ethylamino] 4-benzyl -Butyric acid (605e) ° 250 mg (78%) ·· 4 NMR (CD3OD) β 1.87 (bs), 1.95 (s, 2H), 2.1 (bs), 2.4 (m, 2H), 2.65 (m, 2H), 3.59 (bs), 3.75 (bs), 3.87 (bs), 4.19 (m), 4.37 (m), 4.50-4.78 (bm), 4.92 (m), 5.27 (bs), 7.41-7.58 (m, 7H), and 7.87 ppm (d, 2H). (3S) -3-[(3S) -2-fluorenyl-3-benzylamino-5- (3-methylbutynyl) -2,3,4,5-tetraaza-lH-1, 5-Benzodiazepine-l-ethoxyamido] 4-fluorenyl-butyric acid (605f). 210.5 mg (46%) as a white solid: 4 NMR (CD3OD) 7.9 '-467- This paper size applies to China National Standards (CNS) A4 specifications (2 丨 〇297mm) (Please read the back (Please fill out this page again)

, 1T 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (465) 7.4 (m, 9H), 5.1 (m, 1H), 4.9 (m, 1H), 4.6 (dd, 1H), 4.4 (m, 2H), 4.1 (d, 1H), 3.8 (m, 1H), 3.5 (q, 1H), 2.7 (m, 1H), 2.5 (m, 1H), 2.0 (m, 3H), 1.2 (t, 1H), 0.9 (d, 3H), 0.8 (d, 3H). (3S) -3-[(3S) -2-fluorenyl-3-word aminoamine-5-ethylamine ethyl-2,3,4,5-tetrahydro-1H-1,5-benzo Diazepine-1-ethylamino] 4-copper-butyric acid (605 g). 81 mg (19%) white solid: W NMR (CD3OD) d 7.9-7.3 (m, 11H), 4.9-4.8 (m, 2H), 4.6-4.4 (m, 3H)? 4.3 (m, 1H), 3.75 (q, 1H), 3.55 (d, 1H), 2.7 (m, 1H), 2.5 (m, 1H), 2.05 (s, 3H). (3S) _3-[(3S) -2-keto-3-amido-5-methyloxanthryl-2,3,4,5-tetrahydro-1H-1,5-benzobis Azapyridine-1-acetamido] 'keto-butanoic acid (605h). 227 mg (54%) as a white solid: 4 NMR (CD3OD) 0 '2.5 (m, 1H), 2.7 (m, 1H), 3.55 (s, 3H), 3 · 8-4 · 0 (m, 2H) , 4 · 4 (m, 1H), 4.6-4.8 (m, 2H), 4.95 (d, 1H), 5.1 (m, 1H), 7.3-7.7 (m, 7H), 7.9 (d, 2H) , 8.6 (d, 1H). (3 3) -3-[(3 3) -2-keto-3-amidino-5-acetamidocarbonyl-2,3,4,5-tetrahydro-1H-1,5 · benzo Diaza-p-acetylamido] 4-keto-butanoic acid (605i). 150 mg (37%), white solid: 4 NMR (CD3OD) d 7.9-7.3 (m, 12H), 5.1 (m, 1H), 4.65 (t, 1H), 4.55 (dd, 1H), 4.35 ( m, 1H), 4.1 (d, 1H), 3.9 (q, 1H), 3.45 (q, 1H), 2.7 (m, 1H), 2.5 (m, 1H), 2.25 (s, 3H). (3S) -3-[(3S) -2 · Keto-3-amido-5-methyloxycarbonyl-2,3,4,5-tetrahydro · 1H-1,5-benzodiazepine Hexamidine-1-acetamido] 4-keto-butanoic acid (605j). 234 mg (44%) as a white solid: iH NMR (CD3OD) β 7.9-7.4 (m, 12H), 5.0 (m5 1H), 4.8-4.5 (m, 3H), 4.4 (m, 1H) , 4.3 (t, 1H), • 468-This paper applies the Chinese National Standard (CNTS) A4 size (210X 297 mm) (Please read the precautions on the back before filling this page)

Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs 541309 A 7 _ __________B7 _ __ V. Description of the Invention (466) ° · 9 · 3.75 (m, 2H), 3.6 · s (3H), 2.7 (m , 1H), 2.5 (m, 1H). (^ 3) -3-[(3 8) -2-keto-3-amido-5-methylpyridino-2,3,4,5-tetrahydro • Hl, 5-benzyl Diazepine-1-acetamido] 4-keto-butanoic acid (605 m). 64 · 5 g (34%) as a white solid: NMR (DMSO-d6, diastereomeric form of hemiacetal & open form of aldehyde) 59.48 (0.211,5), 8.85-8 72 (1H , m), 8.65-8.60 (0.8 H, d), 8.30-8.26 (0.2 H, d), 7.95-7.88 (2H, d), 7.6-7.45 (6Η, m), 7.44-7.38 (1Η, m) , 5.78-5.75 (0 · 2Η, d), 5.48 (0.6H, s), 4.85-4.70 (2H, m), 4.62-4.54 (1H, d), 4,50-4.40 (2H, m), 4 · 25-4 · 14 (1H, m), 3.9-3.85 (1H, m), 3.16 (3H, s), 3.05-2.3 (2, m). (3S) -3-[(3S) -2-keto-3-benzylamidinyl-5- (fluorene-2-carbonyl) -2,3,4,5-tetrahydro-1H-1,5- Benzodiazepine-1-acetamido] 4-keto-butanoic acid (605n). 103 mg (17%) as a white solid: W NMR (CD3OD) Θ 1.9 (s, 3H), 2.5 (m, 1H), 2.65 (m, 1H), 3.75 (m, 1H), 4.3 (m, 1H), 4.5-4.7 (m, 3H), 4.85-5.1 (m, 2H), 7.3-7.65 (m, 6H), 7.85-8.05 (m, 4H), 8.45 (s, 1H). (3 8) -3-[(3 3) -2-fluorenyl-3-: ^: amino-amino-5-ethynyl-2,3,4,5-tetrahydro-7,9-dimethyl Yl-1 fluoren-1,5-benzodiazepine-buethamidinyl] 4-keto-butanoic acid (605 °). 42 mg (12%) as a white solid: 4 NMR (CD3OD, diastereomeric stereoisomeric form) $ 7.85-7.74 (2H, m), 7.5-7.44 (1H, m), 7.43-7.35 (4H, m), 5.6-5.05 (2H, m), 4.82-4.42 (2H? M), 4.40-3.95 (2H, m), 3.6-3.5 (1H, m), 2.7-2.38 (2H, m) , 2.32 (3H, s), 2.27 (3H, s), 1.92 (3H, s). (3§) -3-[(33) -2-Keto_3-kilmamine-5-Hanylaminocarbonyl-2,3,4,5-tetra-469- This paper is applicable to China National Standard (CNS) A4 Specification (21 × 297 mm) (Please read the notes on the back before filling this page) Order 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 5. Description of the invention (467) Hydrobenzene Benzodiazepine-1-acetamido] 4-keto-butanoic acid (605P). 165 mg (37%) as a white solid · NMR (CD3OD) β 2.45 (m, 1H), 2.7 (m, 1Η), 3 · 8 (m, 1H), 4.15-4.5 (m, 4H), 4.5_4.75 (m, 2H), 4.8-5.0 (m, 2H), 7.1-7.7 (m, 12H), 7.9 (d, 2H). (3S) -3-[(3S) -2-keto-3-amidoamino-5-[(3R, S) 3-tetrahydrofurylmethoxycarbonyl] -2,3,4,5-tetrahydro -1H-1,5-benzodiazepine-1-acetamido] 4. Keto-butanoic acid (605q). 210 mg (66%) 4 NMR (CD3OD) β 1.95 (s, 2Η), 2.4 (m, 2Η), 2.65 (m, 2Η), 3.29 (s, 3Η), 3.78 (m), 3.87 (bs), 4.0 (d, 1H), 4.32 (m) 5 4.50-4.15 (m), 4.95 (m), 5.27 (bs), 7.45-7.65 (m, 7H), and 7 · 89 ppm (d, 2H). (3S) -3-[(3S) -2-keto-3-amidoamino-5 · (4-pyridylethylfluorenyl) 2.3.4.5-tetrahydro-1fluorene-1,5-benzodiazepine Hexamidine-1-acetamido] 4-keto-butanoic acid (605s). 128 mg (19%) of white solid: 4 NMR (CD3OD) β 8.5- 7.4 (m, 13H), 5.0 (m, 1H), 4.7 (m, 1H), 4.5 (m, 2H), 4.45-4 · 4 (m, 3H), 3.8-3.7 (m, 2H), 2.7 (m, 1H), 2.5 (m, 1H). (3S &gt; 3-[(3S) -2-keto-3-benzylfluorenylamino-5- (3-methylphenylethylfluorenyl)-2.3.4.5- tetrahydro-1H-1,5-benzene Benzodiazepine-1-acetamido] 4-keto-butanoic acid (605t). 132 mg (24%) as a white solid: 4 NMR (CD3OD) d 7.8-6.7 (m, 13H), 4.9 (t, 1H), 4.75 (dd, 1H), 4.2 (dd, 1H), 4.1 (m, 2H), 3.8 (dd, 1H), 3.6 (q, 1H), 3.45 (dd, 1H), 3.3 ( dd, 1H), 2.6 (m, 1H), 2.3 (m, 1H), 2.15 (s, 3H). (3S) -3-[(3S) -2-keto-3-benzylamido-5 -(3-phenylpropanyl) -2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-ethylamidino] 4-keto-butanoic acid tri Fluoroacetic acid (605v). 88 mg (28%) as a white solid: 4 NMR (CD3〇D) -470- This paper is sized for China National Standard (CNS) A4 (210X 297 mm) (please read the back first) Please fill in this page again, τ 541309 A7 B7 V. Description of the invention (468) d 7.63-7.51 (2H, m), 7.5-7.35 (7H, m), 7.25-7.10 (3H, m), 7.1- 7.02 (2H? M), 5.04-4.96 (1H? M), 4.75-4.57 (2H, m), 4.38-4.26 (2H, m), 4.24-4.12 (2H, m), 4.10-4.02 (1H, d ), 4.88-4.80 (1H, m), 2.90-2.80 (2H, m) 2.78-2.63 (1H, m), 2.55-2.35 (2H, m), 2.34-2.22 (1H, m) 0 Ministry of Economic Affairs Bureau of Standards staff printed consumer cooperatives

609 The compounds of Table 13 are described below. -471-This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210X 297mm) (Please read the notes on the back before filling this page) 541309 A7 B7 V. Description of the invention (469) Table 13 # r2 Rs r4 r6 Ry 609a Η PhCH2CH2C (0) PhCH2CH2C (0) Cl Cl 609b Η CH3C (0) PhC (O) Cl Cl Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (3S) -3 _ [(3S) -2- Keto · 3- (3-phenylpropionamido) -5- (3-phenylpropionamido) -2,3,4,5-tetrahydro-111-1,5-benzodiazepine Geran-1-acetamido] -4- (5,7-dichlorobenzoxazol-2-yl) -4-one-butanoic acid (609a). Step. A solution of 204 (223 mg, 0.5 mmol) and 603r (300 mg, 0.36 mmol) in 4 ml of DMF and 4 ml of CH2C12, (Ph3P) 2PdCl2 (10 mg), 1-hydroxybenzotriazole ( (5 mg, 1.0 mmol) and 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (115 mg, 0.6 mmol). Tri-n-butyltin hydride (219 mg, 0.75 mmol) was added dropwise to the reaction and stirred for 18 hours. The reaction was poured into EtoAc and washed with a 10% NaHSOyic solution, a saturated aqueous solution of NaHC03 and a saturated aqueous solution of NaCl, dried over Na2S04 and concentrated in vacuo. Chromatography (quick, SiO2, 0% to 50% EtOAc / hexane) yielded 360 mg (86%) of 607a as a foam. Color A solution of 607a (360 g) in 5 ml of CH2C12 was added dropwise to 1,1,1-triethylvinyl- ^ • dihydro-12-benzodionyl · 3 (1H) _one (362 mg '0.85 mmol) in 20 ml of CH2Cl2 suspension. The reaction was stirred for 45 hours. It was released in CH2C12 # and then washed with a 1: 1 saturated NaHC03 aqueous solution / Nap ^ 3 saturated aqueous solution mixture, a saturated NaHC〇3 aqueous solution (2χ) and a saturated NaC1 aqueous solution, dried on Na2S04 and emptied concentrate. Chromatography (Rapid, SiO2, 20% EtOAc / CH2Cl2) can produce 340 mg (95%) -----472-This paper is suitable for + ¥ ^^ quasi (CNS) M specification (21〇 × 297) Foot)---I-1 11 1: ----i—1 —ii · -....... ϋ φ (Please read the notes on the back before filling this page), 1Τ # 1. A7 '^ __ B7 V. Invention ^ I_6〇8a. , '^ I. 608a (300 mg'0. 36 mmol) was dissolved in 25 ml of 25% tfA / CHfl2, and it was stirred under a ruler for 5 hours and concentrated in air. Chromatography (fast, Sl02'0-5% MeOH / CH2Cl2) yielded 118 mg (42%) of 609a as a white solid: 11 ^] ^ (〇〇〇〇〇〇) (^ 7.62-6.65 (1611,111), 4.85-4 · 7 (1H, m), 4.68-4.42 (2H, m), 4.40-4.15 (2H, m), 3.48-3 · 28 UH, m), 3.0-2.9 (1Η , M), 2.9-2.6 (4Η, m), 2.55-2.18 (3Η, m), 216-1.96 (2H, m). (JS) -3-[(3S) _2-keto-3amidoamino-5_ethylfluorenyl_2,3,4,5_tetrahydro_1Hl · 1,5-benzodiazepine 1-Ethylamidophenyl 4- (5,7-dichlorobenzoxazol-2-yl) -4-benzyl-butyric acid (609b) 'Prepared from 603d, can be generated in a similar manner to 609a 287¾ g (43% overall yield) as a white solid: 1] 3 ^^ 111 (01 ^ 〇d6) δ 1.6 (s, 3H), 2.7-3.1 (m? 2h), 3.45 (m5 1H), 4.4 ( t, 1H), 4.7 (m, 2H), 4.95 (m, 1H), 5.2, 5.4 (2s, 1H), 7.2-7.65 (m, 8H), 7.9 (d, 2H), 8.8 (t, 1H), 8.9, 9.1 (2s, 1H), 12.6 (br, 1H). (Please read the notes on the back before filling out this page) 4 Order Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

__ 473-^ 's scale is applicable to Chinese National Standard (CNS) A4 Regulation 541309

612 〇S) -3-[(3S) -2-keto-3-etoamidoamino-5-methanesulfonamido-2,3,4 &gt; tetrahydro-1H-1,5. Benzodiazepine "Hybrid" · Ethyl 5-6- (2,6-dichloropalyloxy) 4 Keto-valeric acid (612) 'Using a method similar to 607a (steps a and c only) using 603m (150¾ G, 0.36 mol) in place of 603Γ, and (3S) -3- (allyloxyalkylamino) -4-fluorenyl-5- (2,6-difluorofluorenyloxy) Tertiary butyl valerate (110; 160 mg '0.36 mol, WO 93/16710) replaces 606a and produces 612 (56%) as a white solid: iH nmR (CDC13) d 7.85-7.10 (12H, m ), 5 · 4-4 · 65 (4H, m), 4.6-4.15 (4H, m), 3 · 10-2 · 72 (5H, s &amp; m) 0 -474- This paper size applies to Chinese national standards (CNS) A4 specification (2x0 mm) 搴 Printed by the Consumers 'Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7. 635 was synthesized as described in Example 13 and Table 14.

-475- (Please read the notes on the back before filling in this page) This paper size applies to Chinese National Standard (CNS) Α4 specification (210 × 297 mm) 541309 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 2. Synthesis of invention description (473) 619-635. A step. Synthesis of 614. TentaGel S® NH2 resin (0.16 mmol / g, 10.0 g) was placed in a glass funnel of porous 1, and dimethylformamide (3 X 50 ml), 10% (v / v) diisopropyl Ethylethylamine (DIEA) was washed with dimethylformamide (2 X 50 ml) and finally with dimethylformamide (4 X 50 ml). Add a sufficient amount of dimethetamine to the resin to obtain a slurry, and then add 400 (1.42 g, 2.4 mmol, prepared from (3S) -3- (fluorenylmethoxycarbonyl) -4-one Tertiary-butyl butyrate, prepared according to AM Murphy et al. J. Am. Chem. Soc., 1 14, 3156-3157 (1992)) Hydroxybenzotriazole hydrate (HOBT, H20; 0.3 67 g, 2.4 millimolar) o-benzotriazole-N, N, N, N, · tetramethylphosphonium hexafluorophosphate (HBTU; 0.91 g, 2.4 millimolar) and DIEA (0.55 ml, 3 · 2 millimoles). The reaction mixture was stirred overnight at room temperature using a wrist-arm vibrator. The resin is separated on a porous glass funnel by suction

Wash again with methamphetamine (3 x 50 ml). Unreacted amines were capped ', ie the resin reacted directly with 20% (v / v) acetic anhydride / dimethoamine (2 X 25 ml) in the funnel (10 min / wash). The resin was washed with dimethylformamidine (3 X: &gt; 0 * L) and digas methane (3 X 50 ml), and then dried overnight under a vacuum to yield 614 (11.0 g, quantitative yield). B step. Synthesis of 616. Resin 614 (3.0 g, 0.16 mmol / g, 0.48 ¾ mole) was washed in a porous glass funnel with dimethylformamide (3 mL 15 mL) and bubbled. The Fmoc protecting group was dissociated with 25% (v / v) hexahydropyridine / dimethylformamidine (15 ml) for 10 minutes (intermittent stirring), and then with fresh hexahydropyridine reagent for 20 minutes. The resin was washed with dimethetamine (3 x 5 ml) and N-methylpyrrolidone (2 x 15 ml). Resin transferred to 100 ml (Please read the precautions on the back before filling this page)

-476- 541309 A7 B7 V. Description of the invention (474) After the flask, add N-methylpyrrolidone to obtain a slurry, and then add 603u (.736g (please read the precautions on the back before filling) This page) '0.72¾ Molar) ηΒΤΤΗ20 (0.112 g, 0.73 mmol), HBTU (0.27 g, 0.73 mmol) and DIEA (0.26 ml, 1.5 mmol). The reaction mixture was stirred overnight at room temperature using a wrist-arm shaker. The operation and capping of 2000 / 〇 (ν / ν) acetic anhydride in dimethylformamide was performed as described in 614 to generate 616 (3.13 g, quantitative yield). Step C. Synthesis of 617. This compound was prepared from 616 (0.24 g, 0.038 Emole) 'using an Advanced ChemTech 396 Multiple Peptide Synthesizer. The automated cycle includes washing the resin with dimethylformamidine (3 x ΐml) and deprotecting it with 25% (v / v) hexahydropyridine / metformamide (ml) for 3 minutes, followed by fresh Reagent (1 liter) over 10 minutes to produce resin 617. The resin was washed with dimethylformamide (3 X 1 ml) and isomethylpyrrolidone (3 X 1 liter). Step D is printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs. method 1. (62 sentences. Resin 617 contains 0.4M4 phen-3-acid and 0.4M HOBT in N-methylpyrrolidone (1ml) solution, 0.4M HBTU in N-methylpyrrolidone (0.5ml) and 1.6M DIEA was triturated in a solution of N-methylpyrrolidone (0.35 mL), and the reaction was stirred at room temperature for 2 hours. The tritiation step was repeated. Finally, the resin was dimethylformamide (3 XI mL) , Dichloromethane (3 XI ml), and then dried in the air. The aldehyde was dissociated from the resin, and then treated with 95% TFA / 5% Η20 (ν / ν, 1.5 ml) for 30 minutes at room temperature as a whole. Deprotect it. After the resin was washed with dissociation reagent (丨 ml), the mixed filtrate was added to cold 1: 1 acetone · pentane (12 liters) (the resulting precipitate was centrifuged and separated by decantation. Formation The agglomerates are dissolved in 10% acetonitrile / 90% h20 / 0.1% TFA (15 ml), and then freeze-dried to obtain the crude 624, which is white -477- This paper is in accordance with China National Standard (A4) (210X297) 541309 A7 B7 V. Description of the invention (475) Bar powder. The compound was purified by semi-preparative RP-HPLC using Rainin (please read the note on the back first) Matters then fill out this page)

MicrosorbTM C18 column (5 micron, 21.4 x 250 mm) and dissociated in a linear acetonitrile gradient (5% -450 / 〇) containing .io0 / 〇TFA (v / v) for 45 minutes, 12 ml / Minute. Fractions containing the desired product were pooled and freeze-dried to yield (10.0 mg, 54%). Step D. 1A method. Synthesis 627. Following a similar procedure as described in Method 1, resin 617 was triturated with 4- (bulfoxymethoxycarbonylamino) benzoic acid and repeated 3 Fmoc groups were removed as described in step C, and the free-state amine was 200/0 (v / v) Ethyl trimethoprim (1 ml) and 1.6 M DIEA were tritiated at room temperature for 2 hours at N-methylpyloride (0.35 ml). Repeat the acetylation step. Dissociation of the aldehyde from the resin produces 627 (4.2 mg, 20%). Step D. Method 2. Synthesis 632. Following a similar procedure as in Method 1, resin 617 was made with 0.5M cinnamon base gas in N-methylρbilodolone (1ml) and 16M DIEA in N-methylpholoridone (0.35ml) at room temperature Decant for 2 hours. The tritiated step is repeated. Dissociation of the aldehyde from the resin produces 632 (11.1 mg, 58%). Step D is printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. Method 3. Synthesis 629. Following a similar procedure to Method 1, resin 617 was reacted with 1.0 M benzylsulfonium chloride in dichloromethane (0.5 ml) and 1 M pyridine in dichloromethane (0.60 ml) at room temperature for 4 hours. The response was repeated. Dissociation from the resin yields 629 (4.7 mg ’24%). Analytical HPLC method (1) Waters DeltaPak C18, 300A (5 microns, 3.9 x 150 mm). A linear acetonitrile gradient (5% -45%) contains 0.1% TFA (v / v) for 14 minutes at 1 ml / min. -478- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7B7 V. Description of Invention (476) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

rH r-4 CNJ + CNJ Γ0 1〇CN 00 if) + Π3 Γ0 + L〇S s Η φ Ol. X rH dP rH 00 rH r ~ H dP oo os 〇r—1 rH dfi bu 00 m 'a \ t-4 «—t 1 cn ID tH Γ0 L〇Γ0-m rH Γ0 L〇mo ro m 2 BU〇L〇'Z LD CM IX BU CsJ 〇in m CM BU CM 〇bu 〇'Z VD CNJ Π: 00 CNJ L &gt; Race ° = Q = 〇. not. %. Minute. Do f i y〇 〇々. (ff 1 yo T 2 industrial z order σ \ rH VO o 2 rH CM VO 479- This paper size applies to China National Standard (CNS) A4 specification (2 丨 0X 297 mm) --------- % ------ 1T ------ 0— (Please read the notes on the back before filling out this page) 541309 A7 B7 V. Description of the invention (477) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs rH rH ri + CO 5 * + ^ σ \ $ ^ ST 2 BU 00 Η »—1 κ ri dP σ \ od rH ο γΗ rH ~ όρ ① · ο m rH T—1 dP ^ CD-00 S:% π ΓΓ) VD ιη rH VD rH ρrH m • VO 00 Cz-I 00 〇§ (Ν κ 00 (Ν ο o tH 〇'Z CM Γ0 Jr σ \ ro U (Π 卜 〇2: c \ i CNJ K CNJ CM o Contest. \... 娜 δχ 0K &lt; 0. Λ3 οι VD m OJ 2 -480- (Please read the precautions on the back before filling this page)

This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (478 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs rH rH &lt; rH + s VO r-1 L〇tH rH L〇CO Γ0 L〇η PC ^ Φ cu rH-dP 〇 汔 K〇⑦ r rH-dP CD ® r rH-dP ◦ S ⑦, s S m L〇ir &gt; rH L〇rH to · iH m Γ0 L〇 卜 Γ0 ms cn L〇m &lt; NK CO Csi u 00 o § CM s CM U 00 s CM K VD CNJ .o OX o = Q =. t 工 5x ° ^ ° &lt; Λ〇. 蛛 〇 工 5 X ° ^ ° ° v ιο CNJ vo VO s r- 2 -481-This paper size applies to China National Standard (CNS) A4 (210X 297 mm)-(Please read the back first Please pay attention to this page and fill in this page) Order. Few. 541309 A7 B7 V. Description of invention

tH cn CM Γ0 + CO S + S in eg in Brr m L〇c \ ri CO ID Η 〇4 τΗ dP S-rH ^ dP A CO S ^ a \ rH ^ dP _ CD σ \. dP C \ CO »—1 o tH S CM mm-L〇VO t—1 in ri L〇CTi VO in o CO in X σ \ 〇CM X in CNJ U CO 00 〇CNi X cn CNJ 〇 卜 〇 CM K m &lt; N r CJ cn 00 〇§ CN4 E CNJ CJ Race 5x ° ^ ° δχ ° ^ 〇5x.乂 &quot; 3 δχ 4. island. ο ω 2 as 2 ο m τΗ η VD -482- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297 mm) (Please read the precautions on the back before filling in this page to order 541309 A7B7 V. Invention Note (480) Printed by the Consumers' Cooperative of the Central Bureau of Quasi-Economic Bureau of the Ministry of Economy

CNJ (N CN rH + cn S * 3 g BU〇LO iH rH L〇rH σ »ο if) Η CC α. Κ dP co σ \ σ \ ο rH rH dP 00 CO CTi r-1 rH rH dP bu① κο r— (TO 00 ο σ \ ο rH 1 CNJ LD Ο m 1—4 L〇 · o rH u〇 卜 〇as 々σ \ 00 ο LO Ua BU 〇 CM X VO eg U CO 〇 VO CM ID CNJ o σι Ο § (Μ &lt; Ν CNJ 〇 00 〇% CN4 Κ LO &lt; Ν Ο Race 5 X 〇 乂. # B δχ. Probably ° = &lt; 〇b 5χ 〇 = c ^ ° # 工 ο ο 5 X 0 = W = ° sense. 04 cn vo m CO VO ΓΟ VD ID cn VD -483- This paper size applies to China National Standard (CNS) A4 specification (210X 297 mm) (Please read the precautions on the back first (Fill in this page again)

541309 A7 B7 V. Description of the invention (481) Example 14 Compounds 1605a-j, 1605m, 1605n, 1605p, 1605t and 1605v were synthesized as follows.

(Please read the precautions on the back before filling in this page. Order »Printed by (3S) N- (2-keto-3-third-butoxycarbonylamino-2) , 3,4,5-tetrahydro-1H-pyrido [3,4 tons] [1,4-diaza leather (1600). 'Step A. (2S) 2-third-butoxycarbonylamino 3- (3-nitropyridin-2-ylamino) propanoic acid, 2-third-butoxycarbonylamino-3- (2-nitrophenyl-amino) synthesized similar to 600a / 103 Propionic acid is prepared by the method of step A. In addition to using 3-gas-3-nitroeridine instead of 2-fluoronitrobenzene, 4.05 g (64%) of a yellow solid can be produced. -484- This paper is in accordance with Chinese national standards (CNS ) A4 specification (210X297 mm) 541309 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (482) Step B. (2S) 2-Third-butoxycarbonylamino-3- (3_ Aminopyridine | Aminoamino) propanoic acid, similar to step 600a / 103, (BS) 2-Third · butoxoylamino-3- (2-aminophenylamino) propionic acid, step B Preparation, yielding 368 g (quantitative) of a dark solid. Step C. (2S) 2-Third-butoxycarbonylamino-3- (3-aminopyridine 1-based amino) methyl propionate. (2S) 2-tertiary-butoxycarbonylamino-3- (3-aminopyridylamino) propionic acid (360 mg, 1.21 mmol) and Me. H (59 mg, 1.82 mmol) in anhydrous CK ^ Cl2 (20 ml) with 4-dimethylamino leaf dagger (DMAP, 163 mg, 1.33 mmol) and 1_ (3_dimethylformate) Aminopropyl) -3-ethylcarbodiimide hydrochloride (280 mg, 1.45 mmol) was treated. The reaction was stirred for 18 hours, diluted with EtOAc (150 mL), and diluted with water (2X), saturated NaHC03 and Washed with saturated aqueous NaCl solution, dried over Na2S04 and concentrated in vacuo. Chromatography (quick, SiO2, 0 to 5% MeOH / CH2Cl2) yielded 250 mg (67%) of the title compound as a light brown solid. Step D. (SS) N- (2-keto-3-tertiary-butoxycarbonylamino-2,3,4,5-tetrahydro-1H-orbipyrido [3,4-b] [l, 4-diazepine Miscellaneous leather (1600). (2S) 2-Third-butoxycarbonylamino-3- (3-aminopyridin-2-ylamino) propanoic acid methyl ester (70 mg, 0.225 mole) and 25% A solution of sodium methoxide / MeOH (130 μl, 0.56 mmol) in anhydrous MeOH (4 mL) was heated to 60 ° C. for 16 hours. Empty concentrated, the residue was dissolved in 2 ml of H20 and then extracted with EtOAc (3x). The combined extracts were dried over Na2S04 and concentrated in vacuo Zhen. Chromatography (flash, SiO2, 0 to 3% MeOH / CH2Cl2) yielded 7.5 mg (3%) of 1600 as a light brown solid. iH NMR (CD3OD) d 7.96-7.92 (1H, d), 7.75 · 7.65 (1H, br. s), 7.14-7.08 (1H, d)? 6.73-6.65 (1H, m), 5.83- -485- this Paper size applies Chinese National Standard (CNS) A4 specification (2 丨 0X297 mm) ---------- C Please read the notes on the back before filling this page) Order 541309 A7 B7 V. Description of the invention (483 5.75 (lH, br.s), 5.4-5.25 (lH, br.s), 4.6-4.5 (lH, m), 3.95-3.84 (1H, m), 3.55-3.48 (1H, m), 1.4 (9H, s). Step E. 1601 is prepared from 1600, followed by step D of 600a / 103.

(Please read the notes on the back before filling this page)

Step D

Synthesis of 1603. 1603 Prepared from 1601, followed by the method of synthesizing 603 from 600 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economy

Step A Step B

-486- This paper size applies to China National Standards (CNS) A4 specifications (210X 297 mm) 541309 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 'V. Synthesis of invention description (484) 1605. 1605 is prepared from 1603, and 605 is prepared according to 603. Table 15. PhCO t 3-CH3PhCH2CO PhCO V PhCH2CH2CO PhCH2 Example 15 Compound 1610-1021 was prepared from 1600 in a similar manner to compound 619-635 from 600a / l 03 and 600b. (Please read the precautions on the back before filling this page) -487- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (485)

i I— u · n n n I (please read C: Notes before filling out this page) Order Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (486) Among the compounds 1610-1621, a R3 = CH3C (0) -b R3 = CH30CH2C (0 )-;

This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm). (Please read the precautions on the back before filling this page) (487) 1621. In Example 16, the compound containing a skeleton (ell), (yl), (y2), (z), and (el2) can be synthesized as follows. Synthesis of skeleton Ri, where 1 is 011) and y2 is = 0.

BocNH ^ NH

Cbz CQzCH ^ h

Ο

(Please read the precautions on the back before filling this page) -490- This paper size applies to Chinese National Standard (CNS) Α4 size (210X 297 mm) 5 541309 A7 B7 h7 9 9 V. Description of the invention (488) Frame Ri In the synthesis, its center is ^ 1) and y2 is = 0. Printed by Zhongli Standards Bureau Member 2 of the Ministry of Economic Affairs, Consumer Cooperative

(Please read the notes on the back before filling out this page) -491-

This paper size applies to the Chinese National Standard (CMS) A4 specification (210X 297 mm) I 541309 A7 B7 V. Description of the invention (489) Synthesis of skeleton Ri, where 1 is 2) and ya 2 is 112 and meaning 7 is 0

HO + 、 N Η

Η Ο

〇 (Read the precautions on the back before filling this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

TFA

-492- This paper size is in accordance with Chinese National Standard (CNS) Α4 specification (210X29 * 7mm "541309: Α7 Β7 V. Description of the invention (490)

Synthesis of skeleton Ri, the center of which is &amp; 2) and γ2 is = 0 and X7SNH

BoCx ^

Η +

TFA Ο

(Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs -493- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (491) Synthesis of skeleton Ri, where 1 is ("" 2) and y2 is 112 and 乂 7 is &gt; ^.

(Please read the precautions on the back before filling this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs -494- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 Explanation (492 The synthesis of the skeleton Ri, where 1 ^ is (2) and ah 2 is 0

X = OCH2Ph

Boo 1) PC15 2) NaHC〇3

PhCH2〇2C

H2, Pd / C

(Please read the notes on the back before filling this page)

O

1) nh2nh2 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 〇

1) TFA 2) COCl2 〇

275 X7 = 〇-495- This paper size is applicable to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (493) Synthesis of skeleton Ri, where 1 is Bu 21) and Ya 2 is = 0 .C〇2〇H2Ph t-BuONH2-t-BuO-NH 276

Cbz

COCI2

(Please read the notes on the back before filling this page)

PhH2C〇2C 276

OCH3 t-BuO Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 1) H2, Pd / c 2) PC15 0

277 496- This paper size applies Chinese National Standard (CNS) A4 (210X297mm) 541309 A7 B7 V. Description of the invention (494) Example 17 Compounds 2001, 2002, 2100a-e and 2201 are prepared as follows 〇

〇

(Please read the notes on the back before filling this page) 〇

2002 0

Η 2001 乂 2 &lt; »Consumption cooperation between employees of the Central Bureau of Standards of the Ministry of Economic Affairs (1S, 9S) 9-Yeast-based methylamino-6,10-diketone_1, 2, 3, 4, 7, 8,9,10-octahydro-6H-da-phen [1,2-a] [l, 2] diazepine picoacid (2000). To 9-amino-6,10-diketodiazepine-1-chitoic acid tertiary-butyl ester (GB2, 128,984; 340 mg, 1.15 mmol) was added to CH2Cl2i solution, and benzamidinecarboxylic acid (26 mg, 1.7¾ mole), HOBT (230 mg, 1.7 mmol) and EDC (340 mg '1.7 mmol). The resulting mixture was stirred at ambient temperature for 16 hours, poured into IN HC1 and extracted with CE ^ Cl2. The organic extract was further washed with saturated NaHC03, dried over MgS04 and concentrated to give 1999 as a pale yellow solid. The solid is dissolved in CHfl2 (25 ml) and tf A (25 ml) and -497- The paper scale is applicable to the Chinese National Standard (CNTS) A4 specification (210X 297 public holidays) 541309 A7

V. Description of the invention (495) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, mixed overnight, and concentrated in the air to produce 560 mg of 2000, which is oily. [1S, 9S (2RS, 3S)] 9-fluorenylformamido-6,10-diketo-12,3,4,78 9,10-octahydrooxy-5-one tetrahydrofuran · 3 · Base) · 6Η-Da Geng 'and [1,2-a] [1,2] -Dimurazine-1-g g amine (2001), synthesized from 2000, can be similar to the method of compound 213e 410 mg (63%) of 2001 was formed as a white solid; 1H NMR (CDC13; a mixture of diastereoisomers) 0 '8.25 (1H, d), 8.23 (1H, d), 7.78 (1H, dd), 7.65 (1H, bm), 7.50 (2H? M), 7.40-7.25 (4H, m), 6.55 (1H? D), 5.57 (1H, d), 5.10 (1H, t), 5.05-4.95 (2H, m), 4.90 (1H, d), 4.80 (1H, d), 4.72 (1H, bm), 4.65 (1H, m), 4.55 (1H, m), 4.45 (1H, t), 3.25 (1H, m), 3.15 (1H, m), 3.00 (2H, bm), 2.90 (1H, dd), 2.70 (1H, m), 2.47 (1H, dd), 2.45 (1H, m), 2.35 (1H, m), 2.00-1.75 (4H, m), 1.60 (1H, bm) 〇 [〇3 (18,98)] 3- (9-: ^ brewing group Methylamine-6,10-diketonyl1,2,3,4,7 8 9 10-octahydro-6H-da-co- [1,2, a] [l, 2] -diaza丨 ··· Carboxamido) ketobutyric acid (2002). Compound 2001 (58.6 mg, 0.1 mmol) at 5 mL? Eight / 1 ^ 0 &gt; 1 / water (1: 2: 3) treatment, and stirred at room temperature for 65 hours. The reaction was extracted with ether. The aqueous layer was concentrated by removing water by azeotropic distillation with MeCN. The product was suspended in CHzCl2, concentrated under a vacant space and precipitated with ether to produce 46.8 mg (99%) of 2002 as a white solid: ijj NMR (CD30D) d 9.05 (0.25H, d), 8.15 (1H, d) , 7.68 (1H, t), 7.64 (0.25H, d), 7.55 (3H, t), 7.35 (0.5H, m), 5.22 (1H, t), 4.90 (1H, m), 4.58 (1H, dd), 4.50 (1H, m), 4.28 (1H, bm), 3.45 (1H, m), 3.10 (1H, bt), 2.68 (1H, ddd), 2.60 -2.45 (2H, m), 2.30 (1H, dd), 2.15--498- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) --------_ clothing- ----- 1T ------ · (Please read the notes on the back before filling this page) 541309 A7 __ B7 V. Description of the invention (496) 2 〇5 (2H, m), 1.90 (2H , Bm), 1.68 (1H, bm).

4! (Please read the precautions on the back before filling out this page. J Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs [1S, 9! (2RS, 3S)] 9-benzylamino_6 l〇-dione _12,3,4,7,8 9,10, octahydro-N- (2-isopropoxy · 5-keto-tetrahydro_aramidino) -6H , 2-a] [1,2] diazepine microcarboxamide (2100a). A solution of 214e (101 mg, 0.23¾ mole) in isopropanol (10 ml), Stir the catalyst with para-toluenesulfonic acid (10 mg) at room temperature. After 75 minutes, pour the reaction mixture into saturated NaHC03 and extract with CH2C12. The combined extracts are dried over NaJO4 and concentrated. Fast Chromatography (si02, (^ / ^ to EtOAc) yielded 56 mg (51%) of 2100a as a white solid: 4 NMR (CDC13; mixture of diastereoisomeric compounds) 7 9- 7.8 (211, 111), 7, 6-7.5 (1H, m), 7.5-7 · 4 (2H, m), 7.1 (0.5H, d), 6.9 (0.5H, d), 6.4 (0.5H, d), 5 · 6 (0.5H, d), 5.3 (0.5H, s), 5 · 2-5 · ί (1H, m), 4.95 (0 · 5Η, m), 4.75-4.5 (1.5H, m), 4.35 (0.5Η, t), 4.1 (0 · 5 ·, m), • 499-paper The scale depends on the project ?: County (CNS) A4 ^ (210X297 ^) 541309 Α7 Β7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (497) 3.98 (0.5H, m), 3.3-2.75 (4H, m), 2.5-2.4 (2H, m), 2.25 (1H, m), 2.1-1.9 (3H, m), 1.75-1.55 (2H, m). [3 3 (13,93)] 3_ (9- Benzylamidinoamido-6,10-diketonyl-1,2,3,4,7,8,9, 10-octahydro-611-dalopano [1,2-3] [1, 2] -Diazepine-1-carboxamido) -4,4-monoethoxy-butyric acid (2100b). 214e (16 mg '0.036 mmol) in ethanol (2 ml) The solution was treated with a catalyst amount of para-toluenesulfonic acid (2 mg) at room temperature. After 5 days, the reaction mixture was poured into saturated NaHC03 * and extracted with CH2CI2. The combined extracts were dried over Na2SO4 and Rolling. Flash chromatography (Si02, CH2Cl2: EtOAc 95: 5 v / v) yields 16 mg (81%) of 2100b as a white solid: 1h NMR (CDC13) d 7.85-7.74 (2H, m), 7.55 -7.38 (3H, m), 7.04-6.95 (lH, d), 6.61-6.48 (lH, d), 5.15-5.08 (lH, m), 4.63-4.53 (lH, m), 4.52-4.45 (lH, m)? 4.42-4.35 (lH, m), 4.15-4.05 (2H, m), 3.74-3.60 (2H, m) 3.57-3.42 (2H, m), 3.39-3.28 (lH, m), 3.03-2.93 (lH, m), 2.92-2.82 (lH, m), 2.65-2.52 (2H, m), 2.42-2.25 (lH , M), 2.20-1.88 (4H, m), 1.76-1.50 (2H, m), 1.35-1.10 (9H, m). [3S (1S, 9S)] 3- (9-benzylformamidineamino-6,10-diketo-1,2,3,4,8,9,10-octahydro-611-da [1,24] [1,2, -Diazepine-1-carboxamido) -4,4-dimethoxy-butyric acid methyl ester (2100c). A solution of 214e (165 mg, 0.37 mmol) in methanol (5 ml) was co-stirred with a catalyst amount of para-toluenesulfonic acid (17.5 ml) at room temperature. After 4 days, the reaction mixture was diluted with EtOAc and washed with 10% NaHC03 (3x) and brine. The combined extracts were dried over Na2S04 and concentrated. Flash chromatography / Si02, EtOAc) can produce 127 mg (68%) of 2100c as a white solid: β NMR (CDC13) β 7 · 82 (2H, -500- (Please read the precautions on the back before filling this page ) This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (498) d), 7.55-7.50 (1H, m), 7.47-7.43 (2H, m), 7.02 (1H, d) 5 6.53 (1H, d), 5.20-5.10 (1H, m), 4.56-4 · 50 (1H, m), 4.45- 4.50 (1H, each, two m), 3.69 (3H, s), 3.41 (3H, s), 3.43 (3H, s), 3.35-3.25 (1H, m), 3.06-2.98 (1H, m), 2.94 -2.83 (1H, m), 2.65-2.53 (2H, m), 2.35-2.32 (1H, m), 2.15-2.07 (lH, m), 2.0-1.89 (3H, m), 1.75-1.56 (2H, m) 〇 [3S (1S, 9S)] 3- (9-fluorenylformamidinyl-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro -611-da-co- [1,24] [1,2] -diazafluorene-1-carboxamido) -4,4-diisopropoxy-isopropyl isobutyrate (2100 d). A solution of 214e (53 mg, 0.12 mmol) in isopropanol (5 ml) was co-stirred with a catalyst amount of para-toluenesulfonic acid (5 g) at 50 ° C. After 3 days, the reaction mixture was poured into saturated NaHC03 and extracted with CH2C12. The combined extracts were dried and concentrated in Na2S04i, and flash chromatography (Si02, CH2Cl2: EtOAc (4: 1 to 1: 1 v / v) yielded 49 mg (68%) of 2100d as a white solid:! H NMR ( CDC13) β 7.85 (2H, d), 7.50-7.43 (1H, m), 7.41-7.35 (2H, m), 7.02 (1H, d), 6.47 (1H, d), 5.13-5.07 (1H, m) , 5.00-4.9 (1H, m), 4.61-4.55 (2H, m), 4.37-4.30 (1H, m), 3.80-3.70 (1H, m), 3.90-3.80 (ih, m), 3.42-3.35 ( 1H, m), 3.03-2.93 (1H, m), 2.91-2.81 (1H, m) 5 2.62-2.50 (2H, m), 2.38-2.33 (1H, m), 2.12-2.06 (lH, m), 1.97-1.81 (3H, m), 1.70-1.60 (2H, m), 1.28-1 · 05 (18H, m) .Vi

2100e

_ -501-This paper is again suitable for China National Standards (CNS) A4 (210X297 mm) Clothing — (Please read the precautions on the back before filling this page) Order ·· 541309 Μ _ _ Β7 ______ V. Invention Explanation (4 &quot;) [1S, 9S (2RS, 3S)] 9 · Benzamido-6,10-diketo-1,2,3,4,7,8,9,10 · Octahydro-N -(2-ethoxy-5-keto-tetrahydro-tetra-3-yl) -6Η_ ^ 11 wells [1,2-a] [l, 2] -diaza leather-1-bet Ammonium amine (2100e), synthesized from 302, can produce 2100e by the method of synthesizing 304a, except that ethanol and triethyl orthoformate are used instead of methanol and trimethyl orthoformate. Chromatography (Si02, 5% ethanol / CH2C12) yielded 92 mg (68%) of a white solid: iHNMR (CDC13; mixture of diastereomers) Θ 7.90-7.80 (2H, m), 7.60-7.50 (1H, m), 7.50-7.40 (2H, m), 7.30 (0 · 5Η, d), 7.00 (0.5H, d), 6.50 (0 · 5Η, d), 5.50 (0 · 5Η, d), 5.20 -5 · 10 (1.5H, m), 4.95 (0.5H, m), 4.75-4 · 65 (0 · 5Η, m), 4.65-4.50 (1H, m), 4.38 (0.05H, t) , 4.00-3.90 (0.5H, m), 3.85-3.75 (0.5H, m), 3.75-3.65 (0.5H, m), 3.65-3.55 (0.5H, m), 3.30-2.70 (4H? M)? 2.50-2 · 35 (2H, m), 2.30 (1H, d), 2.15-1.90 (3H, m), 1.80-1 · 60 (2H, m), 1.25-1.20 (3H, two t). (Please read the notes on the back before filling this page)

Central Bureau of Standards, Ministry of Economic Affairs. Employees' cooperatives printed 600b 2201 (3S) -3-[(3S) -2-fluorenyl-3- (1-teamethyl) amino-5-methoxyethyl -2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-acetamidinyl] -4-amidobutanoic acid (2201) was synthesized from 600b, and synthesized from 605b This method can generate 2201: lE NMR (CDC13) ^ 8.30-8.22 (lH, m), 8.05-7.98 (1H, d), -502- ^ Zhang scales are applicable to China National Standard (CNS) M specifications (210X297 mm 1 '' 541309 A7 B7 V. Description of the invention (500) 7.96-7.83 (lH, m), 7.77-7.68 (lH, m), 7.67-7.40 (7H, m), 5.12-5.02 (lH, m), 4.98 -4.41 (5H, m), 4.38 and 4.24 (lH, m), 4.07-4.00 (lH, d), 3.92_3 · 80 (2H, m), 3.32 (3H, s), 2.75-2.60 ( lH, m), 2.58-2.35 (lH, m).-Example 18 We used the method described here to obtain the following data for selected compounds of the present invention (Table 16, see Example 7; Tables 17 and 18, see Examples 1-4). The structure and preparation of the compounds of the present invention are described in Examples 28-31. Table 16 Comparison of potency of prodrugs in LPS challenged mice: inhibitory effect of IL-1 /? Production. The present invention is shown Compound treated IL -1 The inhibition percentage of the production system is a function of time after LPS challenge, which is expressed in countless times at relative time). (Please read the notes on the back before filling this page) Compounds printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs-2h -lh Oh + lh 213f (-4)-8-213h 9-53 213i (-11)-62 -213k 0-68-2131 (-18)-80-213m 26-42-213o 4-8-213p 21-29-213q 17-91-213r 59-37-213x 0-78-213y 29-50-214e 39-70 75 43 44 48 11-one-47; 214k 12-31 i •! 2141 0-54-214m 0-17-; 214w 11-91 i 2641 0-23 404 55-6% 1 -503- This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (501) Compound printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs-2h -lh Oh + lh 412 0-0 -11-37-418 One--64 25-52-434---80 0-63-450 0-35-452---70 28-89-456 One-56-41-69-470 0-36 -471 0-34 475 0-15-481 27-0-486 19-15-487 17-20-528 25-67-550f 0 • 50-550h 55-73-550i (-10)-23-550k 36-34 • 550 1 9-38-550m 45-52-550n 19 • 65, 550 019 • 64 • 550p 30-60-655 0 • 68-656 31-16 j 662 41-75 every 668---53 695a 49-78 -1015 15-28-2001 64 62 58 55. 2001a 10-16-i 2002 5-87 1 2100h 34-32-j 2100i 19-74-1 2100j 48 41 0 33 · 2100k 30 50 32 72 21001 52-28 -2100m 40-42 — f 2100n 21 9 64 73 2100o 31 44 68 64! -504- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling in (This page) • _ Order… 541309 Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (502) Table 17 shows the data of selected compounds of the present invention obtained by the method described in Example 1-4. Compound UV-Visible light Ki (nM) Cell PBMC avg. IC50 (nM) Human whole blood IC50 (nM) Rat clearance, iv ml / min / kg Rat clearance, iv ml / min / kg 213f 3000 213g 2200 213h 1500 213i 1100 213j 213k 2000 2131 2000 1 213m 2500 213o 5000 3300 j 213p &lt; 300 1 »213q &lt; 300 1 1 1 213r &lt; 300 \ 1 213v 0.5 1,100 1100 41 23 j 213x 4500 2500 ί I 213y 930 j 214j 4.2 2500 6000! 214k 0.2 500 580 22, 2141 6 1900 1100 12 丨 214m 1.5 530 2200 33.4 214w 0.6 620 370 15 246b 30000 &gt; 30000 87 1 1 2641 3000 265a 2600 25000 1 265c 1100 4500! 32 265d 500 1500 j 35 265f 1200 j .24: 280b 1 13000 ti 280c 10000 1 »1 {86 j 280d 1 25000: I jj 283b 1750 i! 41 I 283c 4000 I! 50 ---------- (Please read the back first Please note this page before filling out-5 »丨 -505- This paper size is applicable to Chinese National Standard (CNS ·) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (503) Economy Printed compound UV-Visible light Ki (nM) Cell PBHC avg. IC50 (nM) Human whole blood IC50 (nM) Rat clearance rate, iv ml / min / mice rat clearance. Rate, iv ml / Min / kg 283d &gt; 8000 10000 308c 3000 -j 1 308d 3000 500 25 1800 1800 j 501 2.5 1800 1600 I 505c 1500 505d &gt; 20000 505f 550 510a 65 200 267 510d 2300 &gt; 20000-511c 730 &gt; 20000 78 40 528 2200 550f 1100 5S0h 1800 550i 1400 550k 3000 5501 750 550m 2000 s 550n &lt; 300 550〇450 3000 i! 550p 2900! 550q 700 i 640 155 2250 3900 642 35 8000 2900 i 645 150 -1 650 550 4000 1 653 30 2300 6000 i 655 I! 656 0 · 6 2100 1600!! 2.9 662 0.5 1800 800 2.75 668 9 5200 3700 29! 669 14 10000 .. ί 670 4500 i: 1 671 5 2000 2500: 33.2 677 610 i 678 5 2700 2200 680 -506- (Please read the precautions on the back before filling out this page) This paper size applies to Chinese national standards (CNS ) A4 size (210X 297mm) 541309 A7 B7 V. Description of invention (504) Printed by the Consumers ’Cooperative Bureau of the Central Bureau of Standards of the Ministry of Economic Affairs

(Please read the precautions on the back before filling in this page. (505) Compound UV-Visible light Ki (nM) Cell PBMC avg. IC50 (nM) Human whole blood IC50 (nM) rat clearance rate, iv · 丨 ml / min / kg rat Clearance, iv ml / min / kg | 914 5.2 2600 2800 915 11.5 &gt; 8000 1900 918 7 1150 919 4 2000 4300 920 16 2100 3000 921 8.5 1800 3000 1018 170 4000 5500 '9.1 1052 100 2500 16 1053 27 2000 &gt; 20000 34 1056 170-17 1075 120 5000 5500 14.5 1095 360 6000 28 1105 250 3500 3000 1106 75 4000 1700 1107 65 1108 22 1400 2600 1109 80 1110 45. 1111 18 6050 4400 1112 3.5 1800 2300 1113 290 1114 125 i} 1115 250 1116 215 1117 35 1700 1300 • 1118 380 1119 515 1 1120 95 i 1121 170; 1122 400: 1123 30 2,400 4500 1! ^ 1124 270 ___I_____, 1125 55 2300 9000 2001a 3000 * i 2100f * 1; 2100g ί; 1; 2100h 2000:; -508- (Please read the precautions on the back before filling this page)

This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (5 06) Compound UV surface visible light Ki (nM) Cell PBMC avg. IC50 (nM) Human whole blood IC50 (nM) Rat clearance, iv · ml / min / kg rat clearance, iv · ml / min / kg 2100i 2100j 30000 12000 • 2100k 520 4000 600 21001 750 2200 2100m 2100η 670 770 4000-2100ο 670 1150 1500 we Using the methods described here (see Examples 1-4), the following data for selected compounds of the present invention were obtained (Table 18). The structure and preparation of the compound of the present invention are shown in Example 28-3. Table 18 Compound fluorescence analysis V ^ inact ΠΓ1 S'1 Cell PBMC avg. IC50 (nM) Human whole blood IC50 (nM) mouse clearance, iv ml / min Rat clearance rate per kg, iv ml / min / kg 286 370000 300 1600 119 505 b 190000 1500 2100 161 196 505 e 420000 9000 1000 Example 19 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back first) (Fill in this page again) Effectiveness as an anti-inflammatory agent. The results of in vivo acute analysis in Table 19 show that 412f, 412d, and 696a were used in ethanol / PEG / water, -cyclodextrin, labrosol / water, or cremophor / water. After oral administration as a vehicle, the production of IL-1 y? Can be suppressed in LPS-challenge mice. The compound is administered at the time of LPS administration. The strategy is described in Example 7. Table 19 Inhibition rate (%) of IL-1 /? Production system in LPS-challenge mice. -509-This paper size applies Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 Five 'Invention Description (5 07) Compound 10 mg / kg 25 mg / kg 50 mg / kg dose dose dose 142? 17% 25% 32% 412e 5% 17% 61% 696a 0 45% 52% Example 20 #Mouse carrageenan capsule inflammation Inflammatory mice take 10 millicarrageenan (carrageenan) in 0.5 ml saline to pass through the peritoneum Inflammation induced by internal (IP) injection (Griswold et al., Inflammation, 13, PP · 727-739 (1989)). Equal in ethanol / peg / water, / 3-cyclodextrin, labrosol / water or cremophor / water vehicle and then administer orally. Carrageenan was administered 4 hours later, and the rats were sacrificed and then injected with 2 ml of IP containing 5 units / ml of heparin saline. Make a small incision after the abdomen is gently massaged, collect the internal grains and record the volume. The samples were kept on ice until centrifugation (130xg, 8 minutes, 4 ° C) to remove cellular material, and the resulting supernatant was stored at -2 (TC. The level of IL-1 /? In ascites was determined by ELISA. The results in Table 20 show that prodrug 412f can inhibit the production of IL-1 Θ after oral administration in mice challenged by carrageenan. Compound 214e does not inhibit the production of IL-1 /? When taken orally at 50 mg / kg. (Please read the precautions on the back before filling out this page) Inhibition rate (IL%) produced by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs on the production of 20 412f and 412d in mice challenged with carrageenan (%) ) ._ Dose (mg / kg) Compound 412f Compound 412d 1 3 0% 0 10 54% 32% 25 49% 31% 50 73% 3 6% 100 75% 53% -510- This paper size applies to Chinese national standards (CNS) A4 size (210X297 mm) 541309 A7 B7 Printed by the Consumers' Cooperation Department of the Central Bureau of Standards of the Ministry of Economic Affairs. 5. Description of the invention (508) Example 21 Type II collagen-slandering arthritis in public DBA / 1J Type II collagen is pronounced in mice, such as Wooley and Geiger (Wooley, PH ·, Methods in Enzymo logy, 162, pp. 361-373 (1988) and Geiger, T., Clinical and Experimental Rheumatology, 11, pp. 515-522 (1993)) 3 small sternum type II collagen (4 mg / kg in 10 mM acetic acid) was emulsified with an equal volume of Freund, complete filter (FCA), and was made by repeatedly pumping (400) between two 10 ml glass syringes and a 16-gauge double-bore needle. Base pair-Immunization with collagen white emulsion (50 microliters: 100 microliters (Π / rat)) intradermally at the side. The drug is administered orally twice a day for about 7 hours. The solvent used includes ethanol / DEG / water, -cyclodextrin, labrosol / water or cremophor / water. Drug treatment should be started within 2 hours of CII additional immunization. Record the inflammation on the two forefoot, according to the progressive severity of 1 to 4, and tired Score the final score. The results in Figures 12, 13 and 14 show that the prodrugs 412f, 412d, and 696a can inhibit inflammation of collagen-induced arthritis after oral administration to mice. Compound 214e is orally administered for one day One time (50 mg / kg) does not inhibit inflammation. Example 22 Bioavailability in vivo The pharmaceutical decided in ethanol / of DEG / water, Θ - cyclodextrin 'labrosol / water or Cremophor / water for oral administration (10-100 mg / kg) to rats (10 mL / kg). Neck movement after 0.25, 0.50, 1, 1.5, 2, 3, 4, 6, and 8 hours after administration -511-(Please read the precautions on the back before filling this page) The paper scale is applicable to Chinese national standards (CNS ) A4 size (210X297 mm) 541309 A7 B7 V. Description of the invention (509) Blood is drawn from the vein, plasma is removed and stored at -70 ° C until analysis. Enzyme analysis was used to determine the acid concentration. 3 RStrip (MicroMath Software, UT) was used for pharmacokinetic analysis of the data by non-linear regression. The bioavailability of a drug can be determined as follows: (AUC of drug after oral administration of prodrug / i.v. Of drug after administration AUC) x (i.v · dose / ρ · 〇.dose) x 100%. The results in Table 21 show that prodrugs 412f, 412d, and 696a have significant blood levels of the drug when taken orally and have good drug utilization. Blood levels of 214e were not measured when taken orally. Table 21 Oral bioavailability in rats of 412f, 412d, 696a and 214e. (Please read the precautions on the back before filling this page) Compound Dosage (mg / kg) Cmax (μg / ml) Drug Utilization Rate (%) 412f 25 2.4 32 412d 25 2.6 35 696a 50 1.2 10 214e 45 0.2 0.9%

Example 23 ICE dissociation and activation of pro-IGIF The Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs printed ICE and ICE homologues expressing plastids 0.6 kb encoding a full-length mouse pro-IGIF cDNA (H. Okamura et al., Nature, 378, ρ 88 (1995) linked to a mammalian expression vector pCDLSR α (Y. Takebe et al., Mol. Cell Biol., 8, p. 466 (1988)). In general, an active ICE (above) or three ICE-related enzymes TX, CPP32, and CMH-1 in pCDLSRa expression vectors (3 micrograms), (C. Faucheu et al., EMBO, 14, 1919 (1995); Y. Gu et al ·, EMB〇, 14, p. 1923 (1995); JA Lippke et al., J. Biol. Chem., -512- This paper size is applicable to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 Printed by A7 __B7 _ ^ _ for the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. 5. Description of the Invention (510) 271, ρ 1825 (1996)) Using the DEAE-dextrose method (Y · Gu · et al ·, EMBO J ·, 14, ρ · 1923 (1995)) transfected Cos cells in a 35 mm disk second to a confluent monolayer. After 24 hours, the cells were lysed and the lysates were subjected to SDS-PAGE and immunization. Cholesterol, using antiserum specific for IGIF (H. Okamura et al., Nature, 378, p. 88 (1995) ° was introduced at the 5 'and 3' ends of the mouse pro-IGIF cDNA using polymerase chain reaction Ndel position using the following primers: GGAATTCCATATGGCTGCCAT GTCAGAAGAC (forward) and GGTTAACCATATGCTAACTTTGATG TAAGTTAGTGAG (reverse). The generated Ndel fragment is connected at the Ndel position to the coliform expression vector pET-15B (Novagen) to generate plastids, which can be directed to 213 Synthesis of amino acid peptides. This peptide includes a 21-residue peptide (MGSSHHHHHHSSGLVPRGSHM, where LVPRGS represents a thrombin dissociation site). It is structurally fused to pro-IGIF at the N-terminus of Ala2. Sequencing and N-terminal sequencing of the expressed protein were confirmed. The plastid-bearing E. coli strain BL21 (DE3) was lysed with 0.8 mM isopropyl-1-thio-D-galactopyranoside at 37 ° C. It was recovered for 1.5 hours and recovered by microfluidization (Microfluidic, Watertown, MA) in buffer solution A (20 mM sodium phosphate, pH 7.0, 300 mM Nal, 2 mM dithioisoerythritol, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, and 2.5 μg / milliliter Luciferin). The lysate was clarified by centrifugation at 100,000 X g for 30 minutes. From the supernatant, Ni-NTA-sepharose (Qiagen) chromatography was used to purify (His) 6-screened pro-IGIF protein under the conditions recommended by the consultant. In-tube pro_IGIF deblocking reaction The in-tube dissociation reaction (30 microliters) contains 2 micrograms of purified pro-IGIF ____- 513-_ ^ 怅 scales are applicable to Chinese national standard (0 ~ 3) 8.4 specifications (210 father 297 public) (Please read the notes on the back before filling out this page) 541309 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs-V. Description of the invention (511), and purified proteases of various concentrations, in In a buffer solution containing 20 mM Hepes, pH 7.2, 0.1% butan 〇11 乂 -100, 2 111 ^ 10 butane, 1111] 3? And 2.5 μg / ml leupeptin, and at 37 ° C Incubate for 1 hour. The conditions for dissociation of a granzyme B are as previously described (Y. Gu et al., J. Biol. Chem., 2.71, p. 10816 (1996)). The dissociation product is SDS-PAGE on a 16% gel. And Coomassie blue staining analysis, and accept N-terminal amino acid sequencing, using ABI automated peptide sequencer, the conditions are as recommended by the manufacturer. Kinetic variables of ICE dissociation of IGIF The kinetics of ICE dissociation of IGIF is determined as follows Variables (kcat / KM, KM, and kcat). Pro-IGIF (3000 cpm, labeled with 35S-methionine) Intratubular fibrous reticulocyte lysis system (Promega) and pro-IGIF cDNA in pSP73 vector as template) In 60 microliters of a reaction mixture containing 0.1 to 1 nM recombinant ICE and 190 nM to 12 unlabeled pro-IGIF, 37X: Incubate for 8-10 minutes. Determine the concentration of the dissociation product by SDS-PAGE and Phosphholmager analysis. Combine the rate-concentration data with the Michaelis-Menten flat-burst method and use the program Enzifitter (Biosoft) to perform nonlinear regression to estimate the kinetic variables. IFN-r induced A.E7 Thl cells (H. Quill and RH Schwartz, J. Immunol., 138, p. 3704 (1987)) in a 96-well plate (1.3 x 105 cells were added in 0.15 ml 10% FBS, 50 μM 2-mercaptoethanol and 50 units / ml IL-2 in Click, medium) were treated with IGIF for 18-20 hours, and culture supernatants were analyzed for INF-r (using ELISA (Endogen, Cambridge, MA)). (Please read the notes on the back before filling out this page) -514- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of Invention (512) Example 24 Modification of pro-IGIF by ICE in Cos cells ( (Please read the notes on the back before filling out this page) As in Example 23, Cos cells are transfected with various combinations of plastids. Transduced Cos cells (3.5 X 105 cells within 35 mm) with 1 ml of methionine-free DMEM, containing 2.5% normal DMEM, 1% dialyzed embryonic bovine serum, and 300 microcurie / ml 3 :) S-methionine (35S-Express Protein Labeling-Mix, New England Nuclear) for 7 hours. Lysate (prepared in 20 mM Hepes, pH 7.2, 150 mM NaCn, 0.1% Tritox 乂 -100, 5111] ^] ^-ethylmaleimide, 11111 ^?% 5 ?, 2.5 μg / ml Peptin) or an adaptation medium, immunoprecipitated with anti-IGIF antibodies, which can confirm the precursor and mature form of IGIF (H. Okamura et al., Nature, 378, ρ 88 (1995)). Immunoprecipitated proteins were analyzed by SDS-PAGE (Polyamidamine Gel Electrophoresis) and fluorescence photography (Figure 2A). Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs. We measured IFN-r defensive activity in lysates and conditioned media of transfected cells (Figure 2B). Transduced Cos cells (3.5 x 105 cells in a 35 mm dish) were grown in 1 ml of medium for 18 hours. The culture medium was recovered and used at a final dilution of 1:10 for IFN-r transduction analysis (Example 23). Cos cell masses from the same transduction effect were dissolved in 100 microliters of 20 mM Hepes, pH 7.0, and were freeze-thawed up to 3 times. The lysate was invented by centrifugation as described above and applied to the analysis at a 1:10 dilution. Example 25 IGIF is a physiologically-accepted wild type (ICE + / +) of ICE and ICE-/-mice were given heat-inactivated P. acnes, and Kupffer cells were isolated from the mice 7 days after preparation and challenged Based on 1-515- This paper size applies Chinese National Standard (CNS) A4 specifications (2 丨 〇 &lt; 297 mm) 541309 Printed by A7 B7, Employees' Cooperative of Central Bureau of Standards, Ministry of Economic Affairs 5. Description of invention (513) Micrograms / liter of LPS over 3 hours. The amount of IGIF in the adjustment medium was detected by ELISA. Wild-type or ICE-deficient mice are injected intraperitoneally with heat-killed p. Acnes' as described (H. Okamura et al., Infection and Immunity, 63, p. 3966 (1955)). After 7 days, Kupffer cells were prepared (H. Tsutsui et al., Hepato-Gastroenterol., 39, p. 553 (1992)) except for using nycodenz gradient instead of metrizine mide. In each experiment, Kupffer cells of 2-3 animals were pooled and cultured in RPMI 1640 supplemented with 10% embryonic bovine serum and 1 μg / ml LPS and conditioned medium for 3 hours before preparation. Kupffer cells from wild-type and ICE-rat mice are metabolically labeled with 35S-methionine, as Cos cells (as described in Example 24), except that methionine-free RPMI 1640 is used instead of DMEM. An IGIF immunoprecipitation experiment was performed on the lysate and the adapted medium, and the immunoprecipitate was analyzed by SDS-PAGE and fluorescence photography, as described in Example 23. See Figure 3. Example 26 In vivo preparation of IFN-r production LPS was mixed with 0.5% carboxymethyl cellulose in PBS, pH 7.4, and administered to a 10 mg / kg dose volume by intraperitoneal injection (30 mg / kg LPS). mouse. Blood samples were collected every 3 hours for 24 hours and taken from triplicate ICE-deleted or wild-type mice. Determine INF-r level (Endogen) in serum by ELISA 0 Example 27 ICIF and INF-r inhibition analysis -516- This standard is applicable to China National Standard (CNS) A4 specification (21 × 297 mm) Please read the precautions on the back before filling in this page) Order Wu 541309 A7 _ B7 V. Description of the Invention (514) In the ICE inhibition analysis described here, the inhibitory effect of ICE inhibitors on the modification of IGIF treatment (see examples) 1 and Table 22). Human PBMC analysis Human yellow blood cells were obtained from donors and peripheral blood mononuclear cells (PBMCs) were isolated in LeukoPrep tubes (Becton-Dickinson, Lincoln Park, NJ). PBMC (Add to (3 X 106 / well) 24 holes of Corning tissue culture plate, and incubate at 37 ° C for 1 hour, then remove the non-adherent cells by gentle washing. The adhered monocytes are treated with LPS (1 μg / ml) was stimulated in 2 ml RPMI-1640-10% FBS with or without ICE inhibitor. After incubation at 37 ° C for 16-18 hours, IGIF in the culture supernatant was quantified by ELISA And IFN-r. For example, we can use the method described here to obtain the following data for compound 412 of the present invention. The structure of compound 412 is shown below. (Please read the precautions on the back before filling this page) Table 22 Compounds UV-visible light K {(ηΜ) cell PBMC average IC50 (ηΜ) 412 1.3 580 Example 28 The compound of the present invention printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs can be prepared by various methods. A preferred method is described below: Paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (515) Ο Ο

The Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs printed a solution of A (1.1 equivalents) in CH2C12 (or DMF, or CH2C12: DMF (1: 1)) by adding triphenylphosphine (0-0.5 equivalents) to eliminate nucleophilicity. Agent (2-50 equivalents) and palladium (triphenylphosphine) palladium (0) (0.05-0.1 equivalents) at an ambient temperature of an inert atmosphere (nitrogen or argon). After 10 minutes, the above reaction mixture was concentrated as needed, and a solution of acid A-1 or A-II in CH2C12 (or DMF or CH2C12: DMF (1: 1)) was added, followed by Η〇ΒΤ (1.1 equivalents) And EDC (1.1 equivalent). The resulting reaction mixture is allowed to stir at ambient temperature for 1 to 48 hours to form the coupling product C-1 or C-II. Various nucleophilic scavengers can be used in the above process: Merzouk and Guibe, Tetrahedron Letters, 33, pp. 477-480 (1992); Guibe and Balavoine, Journal of Organic Chemistry, 52, pp. 4984-4993 (1987) ). Preferred nucleophilic scavengers that can be used include bisoxone, morpholine, trimethylsilyldimethylamine and dimethylbarbituric acid. The better nucleophilic scavengers are trimethylsilyldiamidamine (2-5 equivalents) and dimethylbarbituric acid (5-50 equivalents). When the nucleophilic scavenger is trimethylsilyldimethylamine, the above reaction mixture must be concentrated, and then A-1 or A-II is added. -518- The size of this paper applies to the Chinese National Standard (CNS) grid (210X297 mm). Clothes binding (please read the precautions on the back before filling out this page) 541309 V. Description of the invention (516) Other compounds of the present invention can be processed as follows All

Shaben, servant servant χττππ ^ Prepared by hydrolyzing the compounds represented by C-I and C-II to compounds represented by η-τκη-π:

c-l H 〇r51

〇

The hydrolysis can be performed under various conditions as long as the conditions include acid and H2O. Acids that can be used include para-toluene acid, methylorthotropic acid, sulfuric acid, peroxyacid, trifluoroacetic acid, and hydrogen acid. For example, trifluoroacetic acid (1-90% by weight) or hydrogen acid (0.1-30% by weight) in CH3CN / H20 (1-90% H20 by weight), between 0-50 ° C, can use. Example 29 Printed compounds 213f, 213g, 213h, 213i, 213j, 213k, 2131, 213m, 214f, 214g, 214h, 214i, 214j, 214k, 2141, 214m, 550f, 550g, 550h 550i, 550j, 550k, 5501 and 550m can be prepared as follows. -519- This paper size applies to China National Standard (CNS) A4 (210X297mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

A7 B7 V. Description of the invention (517)

[13,93 (21 ^, 35)] 9-[(4-dimethylaminofluorenyl) amino] -6,10-diketo-1,2,3,4,7,8,9 , 10-octahydro-1 ^-(2-fluorenyl-5-onetetrahydrofuran-3-yl) _611-dapyrido [l, 2-a] [l, 2] diazepine-1-carboxyl Ammonium amine (213f), synthesized from 212f, using the method of preparing 213e from 212e to produce 504 mg of 213f as a yellow solid, 1H NMR (CD3OD) β 1.10 (br. M, 0.25 ·), 1.30 (br m, 2H), 1.50 (br · m, 1H), 1.65 (br. m, 1.5m), 1.80 (br · m, 0.25H), 1.90 (br · m, 0.25H), 1.95 (br · m, 0.5H), 2.05 (br. M, 0.25H), 2.15 (m, 1H), 2.3 (m, 1H), 2.5 (br · m, 1H), 2.6 (dd, 1H ), 2.8 (m, 1H), 3.1 (br · s, 3H), 3.15 (br. M, 1H), 3.32 (br. S, -520- This paper music scale is applicable to China National Standard (CNS) A4 specifications ( 210X 29? Mm) (Please read the notes on the back before filling in this page)

541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs V. Invention Description (518) 3H), 3.5 (m, 1H), 4.5 (br. M, 1H), 4.62 (d, 0.25H), 4.72 (m , 3H), 4.95 (m, 1H), 5.1 (br. T, 0.25H), 5.15 (br. T, 0.75H), 5.7 (d, 1H), 6.75 (d, 2H), 7.35 (br. S 5H), 7.75 (d, 2H). [1S, 9S (2RS, 3S)] 9-[(3-dimethylaminofluorenyl) amino] -6,10-diketo- 1.2.3.4.7.8.9.10-octahydro-1 ^ ( 2-Methoxy-5-onetetrahydrofuran-3-yl) -611-da-polo [l, 2-a] [l, 2] diazapyridine-1-carboxamide (213g), synthesized from 212g Using the method of preparing 213e from 212e, 400 mg of 213g can be generated, 4 NMR (CD3OD) δ 1.5 (br. M, 1H), 1.65 (br. M? 2H), 1.70 (br. M, 0.25H), 1.90 (br · m, 1H), 1.95 (br. m, 1H), 2.05 (br. m, 0.25H), 2.10 (m, 1H), 2.3 (m, 1H), 2.5 (m, 2H), 2.59 ( d, 1H), 2.6 (d, 1H), 2.78 (d, 1H), 2.8 (d, 1H), 2.93 (br. s, 4H), 3.05 (br. m, 1H), 3.15 (br. m, 0.25H), 3.3 (br. S? 3H), 3.5 (m, 2H), 4.5 (bi *. M, 2H), 4.65 (d, 1H), 4.7 (br. M, 2H), 4.95 (br · m, 1H)? 5.15 (br. t, 0.25H), 5.2 (br. t, 0.75H), 5.2 (d, 1H), 6.95 (d, 1H), 7.15 (d, 1H), 7.25 (br · s, 1H), 7.3 (br · t, 2H), 7.45 (br: s, 6H). [15,93 (2113,3 3)] 9-[(3-chloro-4-aminofluorenyl) amino] -6,10-diketo- 1.2.3.4.7.8.9.10- octahydro- &gt; 1- (2-Methoxy-5-onetetrahydrofuran-3-yl) -611-dapono [1,24] [1,2] diazepine-1-carboxamide (21311), Synthesized from 21211, using the method of preparing 213e from 212e to generate 296 mg of 213h, 4 NMR (CDCI3) 1.55-1.68 (m, 1H), 1.7-2.05 (m, 3H), 2.3-2.5 (m, 2H), 2.65-2.8 (m, 1H), 2.85-2.93 (m, 1H), 2.95-3.25 (m, 3H), 4.44-4.65 (m, 2H), 4.68-4.82 (m, 1H), 4.9-4.95 (d , 1H), 5.05-5.18 (m, 2H), 5.28 (s, 0.5H), 5.55-5.58 (d, 0.5H), 6.52- -521-This paper size applies to China National Standard (CNS) A4 specifications (2 ! 0X: Z97 mm) ~ 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (519) 6.58 (d, 0.5H), 6.7-6.76 (m, 2H), 6.82- 6.85 (d, 0.5H), 7.3-7.4 (m, 5H), 7.52-7.58 (m, 1H), 7.75 (s, 0.5H), 7.8 (s, 0.5H). [1S, 9S (2RS, 3S)] 9-[(4-Methoxyfluorenyl) amino] -6,10-diketo-1,2,3,4,7,8,9,10 _Octahydro- &gt; 1- (2-fluorenyl-5-onetetrahydrofuran-3-yl) -611-dapono [1,24] [1,2] diazapine-1-carboxamide (213, synthesized from 2121, using the method of preparing 213e from 212e, 1.1 g of 213i, 4 NMR (CDC13) d 1.55-2.05 (m, 6H), 2.26-2.5 (m, 2H), 2.68-2.82 ( m, 1H), 2.85-2.92 (m, 1H), 2.95-.325 (m, 2H), 3.82 (s, 1.5H), 3.85 (s, 1.5H), 4.4-4.65 (m, 2H) , 4.7-4.78 (m, 1H), 4.88-4.95 (m, 1H), 5.05-5.23 (m, 1H), 5.28 (s, 0.5H), 5.55-5.58 (d, 0.5H), 6.6-6.65 ( m, 1H), 6.8-6.84 (m, 1H), 6.9-6.95 (m, 3H), 7.3-7.45 (m, 4H), 7.78-7.85 (m, 2H) 〇 [1S, 9S (2RS, 3S) ] 9-[(3,5-Diaminobenzyl) amino] -6,10-diketonyl-1,2,3,4,7,8,9,10-octamus-N- (2 -Pyroxy-5- 嗣 tetramethylpyridin-3-yl) -6Η · daquino [l, 2-ani, 2] diazapyridine-1-carboxamide (213j), synthesized from 212j, Using the method of preparing 213e from 212e, 367 mg of 213j, 4 NMR (CDC13) β 1.55-2.05 (m, 12H), 2.25 (d, 1H), 2.3 5 (m, 1H), 2.48 (m, 2H), 2.75 (m, 2H), 2.9 (m, 1H), 2.95-3.25 (m, 5H), 4.45 (t, 1H), 4.5-4.6 ( m, 4H), 4.7 (m, 1H), 4.75 (d, 1H), 4.88 (m, 1H), 5.05 (m, 2H), 5.15 (q, 1H), 5.3 (s, 1H), 5.58 (d , 1H), 6.5 (d, 1H), 6.9 (d, 1H), 7.05 (d, 1H), 7.25-7.35 (m, 5H), 7.6 (s, 2H), 7.7 (s, 2H). [15 , 95 (21 ^, 35)] 9-[(3,5-Digas-4-hydroxyfluorenyl) amino] -6,10-diketo-1,2,3,4,7,8 , 9,10-octahydro-1 ^ (2-methyloxy-5-ketotetrahydrofuran-3-yl) -522 This paper size applies to Chinese National Standard (CMS) A4 specification (210X 297 mm) Please read first Carrying back the paralysis matters 5 · Binding 541309 A7 ___B7 — V. Description of the invention (520) -6H-Da Geng [l, 2-a] [l, 2] diaza leather-1-carboxamide (2nk), synthesized from 212k, using the method of preparing 213e from 212e to generate 593 mg of 213k, 1U NMR (CD3OD) δ 1.5 (m? 1Η), 1.6-1.7 (m? 2H), 1.75-1.95 ( m, 4H), 2.15 (m, 2H), 2.3 (m, 1H), 2.6 (m, 1H), 2.7 (m, 1H), 3.05 (m, 2H), 3.15 (m, 1H), 3.5 (m , 2H), 4.45 (m, 2H)? 4.65 (d 1H), 4.7 (m, 1H), 4.95 (m, 1H), 5.15 (m, 1H), 5.4 (s, 1H), 5.7 (d, 1H), 7.3 (m, 5H), 7.85 (s, 2H). [1S, 9S (2RS, 3S)] 9-[(3-Chloro-4-acetamidobenzylamido) amino] · 6,10-di-yl-1,2,3,4,7, 8,9,10-octahydro- &gt; 1- (2-benzyloxy-5-one tetrahydrocreak-3-yl) -6Η-da-co- [l, 2-a] [l, 2] Diazapyridine-1-carboxamide (2131), synthesized from 2121, and 213e prepared from 212e, can produce 133 mg of 2131, 4 NMR (CDC13) d 1.55-1.7 (m, 1H), 1.75 -2.05 (m. 3H), 2.25 (s, 1.5 H), 2.27 (s, 1.5H), 2.3-2.48 (m, 2H)? 2.7-2.83 (m, 1H), 2.85-2.94 (dd, 1H) , 2.95-3.25 (m, 2H), 4.42-4.65 (m, 2H), 4.68-4.85 (m, 1H), 4.88-4.95 (m, 1H), 5.05-5.18 (m, 2H), 5.32 Central Ministry of Economic Affairs Standard Bureau employee consumer cooperatives India (s, Ό.5Η), 5.55-5.6 (d, 0.5H), 6.48-6.55 (d, 1H), 6.88-6.92 (d? 1H), 7.0-7.04 (d, 0.5 H), 7.15-7.2 (d, 0.5H), 7.3-7.4 (m, 4H), 7.64 · 7.78 (m, 2H), 7.88-7.94 (m, 1H), 8.45-8.56 (m, 1H) . [13,93 (2 ^^, 33)] 9-[(3,5-Dichloro-4-methoxyfluorenyl) amino] -6,10-diketo-1,2,3, 4,7,8,9,10-octahydro-1 ^ (2-benzyloxy-5-one tetrahydrofluoran-3-yl) p-well [l, 2-a] [l, 2] di Aza leather-1-chimamine (213m), synthesized from 212m, using the method of preparing 2ne from 2Ue, can produce 991 mg of 213m ^ lR NMR (CDC13) δ 1.5-2.15 (m, 5H), 2.2-2.55 (m, 3H), 2.6-3.3 (m, 4H), 3.95 (2s, 3H), 4.45-4.7 (m, 2H)? 4.7- -523- This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) '541309 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs Λ7. B7_ _V. Description of the Invention (521) 4.85 (m, 1H), 4.85-4.95 (m, 1H), 5.05-5.25 (m , 1H), 5.3 (s, 0.5Η), 5.6 (d, 0.5Η), 6.55 (d, 0.5H), 6.85 (d, 0.5H), 7.0 (d, 0.5H), 7.25-7.6 ( m, 5.5H), 7.75 (s, 1H), 7.85 (s, 1H). [18,98 (2 and 3,3 5)] 9-[(4-dimethylaminobenzylfluorenyl) amino] -6,10-diketo-1,2,3,4,7, 8,9,10-octahydro-N- (2-ethoxy-5-onetetrahydrofuran-3-yl) -6H-da-pheno [l, 2-a] [l, 2] diazapyrene- 1-Carboxamide (550f), synthesized from 212f, using the method of preparing 213e from 212e, can produce 420 mg of 550f as a white solid, 4 NMR (CDC13) d 1.2-1.25 (br. T, 3H), 1.35 (m, 1H), 1.55 (br · m, 1H), 1.88-2.02 (br · m, 4H), 2.3 (d, 1H), 2.35 (m, 1H), 2.45 (m, 1H), 2.55- 2.75 (m, 3H), 3.0 (s, 6H), 3.25 (m, 1H), 3.55 (m, 1H), 3.65 (m, 1H), 3.75 (m, 1H), 3.9 (m, 1H) , 4.3 (t, 1H), 4.55 (m, 2H), 4.68 (br · m, 1H), 3.9 (m, 1H), 4.3 (t, 1H), 4.55 (m, 2H), 4.68 (br. M , 1H), 4.95 (br.m, 1H), 5.1 (br · m, 2H), 5.45 (d, 1H), 6.5 (m, 2H), 7.7 (m, 2H). [13,93 (21 ^, 3 3)] 9-[(3-chloro-4-aminofluorenyl) amino] -6,10-diketo-1,2,3,4,7, 8,9,10-octahydro- &gt; 1- (2-ethoxy-5-ketotetrahydro-3-anyl) -6H-thalco [l, 2-a] [l, 2 ] Diazepine-1-carboxamide (55h), synthesized from 21211, and using the method of preparing 2136 from 2126, 195 mg of 55011 can be produced as a white solid, iHNMRCDMSO-dJ Θ I "]. 18 ( 2t 3H), 1.6-1.7 (m, 2H), 1.88-2.05 (m, 2H), 2.1-2.5 (m, 3H), 2.48- 2.56 (m, 1H), 2.75-2.8 (m, 0.75H), 2.88-3.08 (m, 1.25H), 3.25-3.4 (m, 1H), 3.55-3.8 (m, 2H), 4.35-4.45 (m, 1H)? 4.55-4.62 (m, 1H), 4.8-4.88 ( m, 1H)? 4.98-5.03 (m, 0.25H), 5.1-5.13 (m, 0.75H), 5.33 (s, 0.25H), 5.58-5.6 (d, 0.75H), 5.9-6.0 -524- present Paper size applies Chinese National Standard (CNS) A4 specification (210X29? Mm) '&quot; ~ 541309 Printed by the Consumer Cooperatives of the Central Procurement Bureau of the Ministry of Economic Affairs A7 B7 5. Invention Description (522) (br. S, 2H) , 6.8-6.85 (d, 1H), 7.58-7.62 (d, 1H), 7.82 (S, 1H), 8.22-8.28 (d, 1H), 8.48-8.52 (d, 0.75H), 8.72-8.76 (d , 0.25H). [1S, 9S (2RS, 3S)] 9-[(4-methoxybenzyl) amino] -6,1CU diketo-1,2,3,4,7,8,9,10- Octahydro-N- (2-ethoxy-5-ketotetrahydrofuran-3-yl) -6H-da-pheno [l, 2-a] [l, 2] diazepine-1-carboxamide (550i), synthesized from 212i, using the method of preparing 213e from 212e to generate 315 mg of 550i, 1U NMR (CDC13) 1.18-1.28 (2t, 3H), 1.6-1.75 (m, 1.5H), 1.9-2.1 ( m, 3.5H), 2.22-2.3 (d, 0 "5H), 2.38-2.47 (ιη, 1.5H), 2.7-2.8 (m, 0.5H), 2.8-2.93 (m, 1H), 2.94- 3.15 (m, 1.5H), 3.15-3.28 (m, 1H), 3.55-3.62 (q, 0.5H), 3.62-3.73 (q, 0.5H), 3.78-3.88 (q, 0.5H), 3.88 (s , 3H), 3.9-3.95 (q, 0.5H), 4.33-4.4 (m, 0.5H), 4.5-4.55 (m, 1H), 4.68-4.76 (m, 0.5H), 4.9-4.95 (m, 0.5 H), 5.1-5.2 (m, 1.5H), 5.18 (s, 0.5H), 5.48-5.52 (d, 0.5H), 6.48-6.55 (d, 0.5H), 6.85-6.9 (m, lH), 6.9-6.95 (m, 2H), 7.34- 7.38 (d, 0.5H), 7.78-7.85 (m, 2H) 〇 [13,93 (2 ^^, 35)] 9-[(3,5-Digas -4-hydroxy group; fluorenyl) amino group 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-1 ^-(2-ethoxy-5- Ketotetrahydrofuran-3-yl) -6H-Dagen and [l, 2-aHl, 2] diaza leather-1-carboxamide (550k), synthesized from 212k, 174e of 550k can be produced by the method of preparing 213e from 212e, as a white solid , 4 NMR (DMSO-d6) β 1.15 (2t, 3H), 1.6-1.75 (m, 2H), 1.9-2.05 (m, 2H), 2.1-2.4 (m, 5H), 2.5-2.55 (m, 1H ), 2.7- 2.8 (m, 0.5H), 2.85-3.0 (m, 1H), 3.0-3.1 (m, 0.5H), 3.55- 3.7 (m, 1H), 3.7-3.8 (m, 1H), 4 · 2 (t, 0.5H), 4.35-4.45 (m, 0.5H), 4.55-4.65 (m, 0.5H), 4.8-4.9 (m, 0.5H), 5.05 (t, 0.5H), -525- This paper size applies to China National Standard (CNS) A4 (210X297 mm) '541309 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7. B7 V. Description of the invention (523) 5.15 (t, 0 · 5Η), 5 · 35 (s, 0.5Η), 5.6 (d, 0.5H), 7.95 (s, 2H), 8.5 (d, 0.5Η), 8.65 (d, 1Η), 8.75 (d, 0.5 ·), 10.9 (br · s, 1Η). [13,93 (21 ^, 33)] 9-[(3-Ga-4-Ethylaminobenzylamino) amino] -6,10-diketo-1,2,3,4,7 , 8,9,10-octahydro-1 &gt; 1- (2-ethoxy-5-one tetrahydrobite-3 -yl) -6H-da-co- [l, 2-a] [l, 2 ] Diazapyrene · 1-carboxamide (5501), synthesized from 2121, and using the method of preparing 213e from 212e, 5151 ^ 1U NMR (CDC13) &lt; S 1.2-1.28 (2t, 3H) ), 1.6-1.72 (m, 1.5H), 1.88-2.15 (m? 3.5H)? 2.22-2.28 (m, 0.5H), 2.28 (s, 3H). 2.38-2.48 (m, 1.5H), 2.66 -2.92 (m, 1.5H)? 2.95-3.14 (m, 1.5H), 3.2- 3.34 (m, 1H), 3.56-3.63 (q, 0.5H), 3.63-3.72 (q, 0.5H), 3.8- 3.85 (q, 0.5H), 3 · 9-3 · 95 (q, 0 · 5Η), 4.32-4.38 (m, 0 · 5Η), 4 · 5 · 4 · 62 (m, 1H), 4.68-4.75 (m, 0.5H), 4.88-4.92 (m, 0.5H), 5.08- 5.2 (m, 1.5H), 5.18 (s, 0.5H), 5.46-5.5 (d, 0.5H), 6.5 -6.55 (d, 0.5H), 6.98-7.05 (m, 1H), 7.42-7.48 (d, 0.5H), 7.63-7.78 (m, 2.5H), 7.9-7.94 (d, 0.5H), 8.44- 8.52 (m, 1H). [13,93 (21 ^, 3 3)] 9-[(3,5-Digas-4-methoxyethynyl) amino] -6,10-diketo-1,2,3, 4,7,8,9,10-Octahydro · ν · (2-ethoxy-5-ketotetrahydrofuran-3-yl) -6Η-dapono [i, 2_a] [i, 2] diazepine Hesperidin (550m), synthesized from 212m, 301e of 550m can be produced by the method of preparing 213e from 212e, as a white solid, 1h NMR (CDC13) β 1.2-1.35 (2t, 3H), 1.5-1.8 (m, 2H), 1.9-2.15 (5H), 2.25 (d, 0.5Η), 2.4-2.5 (m, 2H), 2.65-2.8 (m, 0.5H), 2.8-3.0 (m, 0.5H), 3.0-3.2 (m, 1H), 3.2- 3.35 (m, 0.5H), 3.55-3 · 65 (m, 0.5H), 3.65-3.75 (m, 0.5H), 3.8- 3.9 (m, 0.5H), 3.9-4.0 (m, 0.5 ·), 4.4-4.45 (m, 0.5H), -526- This paper size applies Chinese National Standard (CNS) A4 regulations;) &quot; &quot; a 541309 A7 B7 V. Description of the invention (similar) 155-4.65 (m, 0.5H), 4.7-4.8 (m, 0.5H), 4.85-4.95 (m, 0.5H), 5.05-5.2 (m, 0.5) , 5.2 (s, 0.5H), 5.5 (d, 0.5Η), 6.5 (d, 0.5Η), 6.9 (d, 0.5Η), 6.95 (d, 0.5H), 7.35 (d5 0.5H), 7.75 (s, 1H), 7.85 (s, 1H). [33 (13,93)] 3- (9- (3,5-dichlorofluorenyl) amino] -6,10-diketo-1,2,3,4, 7,8,9, 10-Octahydro-611-Da-Feng [1,24] [1,2] diazamycin-1-falbinyl) -4-oneacetic acid (214j), synthesized from 213j, prepared by 2001 The 2002 method produced 62 mg of 214j as a white solid, 4 NMR (CD3OD) β 0.9 (t, 1H), 1.3 (br. S, 1H), 1.7 (br. M, 1H), 1.9 (br · m, 1H), 2.1 (br. s, 1H), 2.25 (q, 1H), 2.35 (m, 1H), 2.48 (m, 2H), 2.65 (t, 1H), 3.15 (br. t, 1H) , 3.5 (br · m, 1H), 4.3 (br. S, 1H), 4.55 (m, 2H), 4.95 (t, 1H), 5.25 (br · s, 1H), 7.6 (br. S, 1H) , 7.85 (br. S, 1H). [38 (18,93)] 3- (9- (3,5-dichloro-4-meryl ^: amino) amino] -6,10-di__1,2,3,4,7 , 8,9,10-Octahydro-611-Da-Phen [1,24] [1,2] Diazapyridine-1-carboxamido) -4-ketobutyric acid (214k), synthesized from 213k, using the method of preparing 2002 from 2000l, can produce 80mg of 214k as a white solid, Ή NMR (CD3OD) S 1.6-1.7 (m, 1H), L8-2.0 (m, 2H)? 2.00.1 (m, 2H), 2.15-2.25 (m, 1H), 2.3-2.4 (m, 1H), 2.4-2.55 (m, 2H) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 2.6- 2.75 (m , 1H), 3.05-3.2 (m, 1H), 3.4-3.6 (m, 2H), 4.2-4.3 (m, 1H), 4.45-4.6 (m, 1H), 4.8-5.0 (m, 1H), 5.1 -5.2 (m, ltj), 7.85 (s, 2H). [3 3 (13,93)] 3- (9- (3-Ga-4-ethylaminoamine ^: fluorenyl) amino] -6,10-bis- · 1,2,3,4,7 , 8,9,10-octahydro-611- tower 3 and [1,2, &amp; several 1,2] diaza leather-1, several -527- This paper size applies to China's national STcNS) A4 specifications (210X297 mm) · ^ 541309 A7 B7 Printed by the Consumers 'Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (525) Amido) ·' Ketobutyric acid (2141), synthesized from 2131, using 1 The method of preparing 20002 can produce 91 mg of 2141 as a white solid, (DMSO-d6) d 1.65 (br. M, 6H), 1.9 (br. M, 6H), 2.15 (s, 3H) 2.3 (m, 3H), 2.6-2.85 (m, 3H), 2.9 (m, 2H), 3.0 (m, ιη) / 4 · 15 (bi * · q, 1H), 4.4 (m, 3H) , 5.0 (m, 1H), 5.15 (m, ih), 5.45 (s, 1H), 7.8 (d, 2H), 7.95 (d, 1H), 8.05 (s, 1H), 8.65 (ψ , 2H), 9.65 (s, 1H). [3S (1S, 9S)] 3- (9- (3,5-dichloro-benzyl) amino] -6,10-diketo-1,2,3,4,7,8,9 , 10-octahydro-611-da-co- [1,24-1,2] diazapyridine-1-carboxamido) -4-ketobutanoic acid (214m), synthesized from 213m, using 2001 The method of preparing 2002 produced 105 mg of 214m as a white solid. The old NMR (CD3〇D) was 1.6-1.75 (m, 1H), 1.85-1.95 (m, 1H), 2.0-2.1 (m, 2H). , 2.15-2.25 (m, 1H), 2.3-2.4 (m, 1H), 2.45-2.55 (m, 2H), 2.65-2.75 (m? 1H), 3.4-3.55 (m, 2H), 3.95 (s, 3H), 4.2-4.3 (m, 1H), 4.45-4.6 (m, 1H), 4.9-5.0 (m, 1H), 5.15-5.2 (m, 1H), 7.9 (s, 2H "Compounds 308c and 308d are as follows Preparation. 〇

-528- The size of this paper is applicable to China National Standards (CNS) A4 specifications (210X297 mm) 541309 A7 B7 V. Description of the invention (S26) [jS (1S, 9S)] 3- (9- (4-methoxy Fluorenyl) amino], 6,10-dione-1,2,3,4,7,8,9,10-octahydro ) _Amino] glycolic acid '0-methylpyridine (308c), synthesized from 212e, using the method of preparing 308b from 212e, 266mg of 308c can be generated, 4 NMR (CDC13) ^ 1.6-1.7 (m, 1H ), 1.88-1.98 (m, 3H), 2.02-2.15 (m? 1H), 2.3 ^ 2.4 (m, 1H), 2.65-2.95 (m, 3H)? 3.04-3.09 (m, 1H)? 312-3 25 (m, 1H), 3.84 (s, 3H), 3.86 (s, 3H), 4.5-4.58 (m, 1H), 4.88-4.95 (m, 1H), 5.1-5.25 (m, 2H), 6.86 -6.9 (d, 2H), 7.15-7.25 (m, 2H), 7.36-7.4 (m, 1H), 7.75-7.8 (d, 2H). [3 3 (13,98)] 3- (9- (4-methoxyfluorenyl) amino] -6,10-dione-1,2,3,4,7,8,9,10 -Octahydro-6H-da-phen [l, 2-a] [l, 2] diaza-1-carboxamido) -amino] -4-ketobutanoic acid 10-benzyloxime ( 300d), synthesized from 212e, using the method of preparing 308b from 212e, can generate 308d, 4 NMR (CDC13) d 1.55-1.65 (m, 1H)? 1.8-2.1 (m, 4H), 2.3-2.4 (m, 1H ), 2.65-2.88 (m, 3H), 2.9-3.3 (m, 3H), 4.5-4.58 (m, 1H), 4.88-4.95 (m, lH), 5.05 (s, 2H), 5.1-5.2 (m 1H), 6.82-6.95 (m, 2H), 7.02-7.15 (m, 2H), 7.28 (m, 5H), 7.45 (m, 1H), 7.72 (d, 2H). Compounds 2100f, 2100g, 2100h, 2100i and 2100j are prepared as follows. Please read the precautions on the back before filling out this page. Printed by the Central Government Bureau of Standards, Ministry of Economic Affairs, Employee Consumption Cooperatives. 52 This paper is again compatible with China National Standard (CNS) A4 (210X297 mm) 541309 Γ ·: A7

Printed by (3 S, 2RS) 3-allyloxycarbonylamino-2- (4-chlorobenzyl) oxy-5-one tetrahydroanthran (2101 a), synthesized by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs It was prepared from allyloxycarbonylamino-dot-tert-butylaspartate 'using the Chapman method (Bioorg. &Amp; Med. Chem. Lett., 2, PP. 615-618 (1992)) ( 3S, 2RS) 3. Allyloxycarboxyamino-2_fluorenyloxy-5-ketotetrahydrofuran. Using 4-gas benzyl alcohol instead of fluorenyl alcohol, 1.84 g of 2101a can be produced as a crystalline solid. [1S, 9S (2RS, 3S)] 9-benzylamido-6,10-diketo-4,2,3,4,7,8,9,10-octahydro-N- (2- (4 -Chloroyl) oxyketotetrahydrofuran | yl) -6H-dacrobenz [l, 2-a] [l, 2] diazepine-1 · dimethanamine (2100f), synthesized from 212e ， Using -530-This paper size applies to Chinese National Standard Plum (CNTS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (S2S) The method of preparing 213e from 212e can generate 380 mg of 2100f, iHNMR (CDC13 ) 1.8-2.0 (m, 10H)? 2.30 (d, 1H), 2.31-2.5 (m, 3H)? 2.7-2.9 (m, 3H), 3.05 (m, 2H), 3.1-3.2 (m, 4H) , 4.45 (q, 1H), 4.5-4.6 (m, 3H), 4.7 (d, 2H), 4.85 (d, 1H), 4.9 (t, 1H) 5 5: 2 (t, 1H), 5.15 (m , 2H), 5.25 (s, 1H), 5.55 (d, 1H), 6.5 (d, 1H), 6.9 (d, 1H), 6.95 (d, 1H), 7.25 (m, 3H), 7.35 (t, 2H), 7:45 (m, 2H), 7.55 (1H), 7.8 (m, 3H). (3S, 2RS) 3-Flyoxypropylamino-2-contra-isopropoxy-5-fluorenetetrahydrooctane (2101b), synthesized from (3S, 2RS) 3-fluorenyloxycarbonylamine Based on the method of preparing 2100d from 214e, and replacing pTSA with H2S04, it can generate 2101b. [1S, 9S (2RS, 3S)] 9-fluorenylamino-6,10-diketo-i, 2,3,4,7,8,9,10-octahydro-N- (2-pair Pendant-isopropoxy · 5 · ketotetrahydrofuran-3-yl) -6H-tapero [l, 2-a] [l, 2] diazepine-1-carboxamide (2 lOOg ), Synthesized from 212e, and using the method of preparing 213e from 212e, 31 mg of 2100 g, 4 NMR (CDCI3) δ 1.19 (d), 1.94 (br s)? 2.00-2.12 (m), 2.24 (d), Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 2.42 (dd), 2.71-2.83 (m), 3.02 (dd), 3.12-3.27 (overlapping m), 3.93 (m), 4.32-4.37 (m5), 4.52- 4.63 (m) 5 4.90-4.95 (m), 5.12-5.20 (m), 5.28 (s), 6.93 (d), 7.10 (d)? 7.41-7.50 (m), 7.51-7.58 (m), 7.84 ( d). 〇

This paper music is again applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 ____ B7 V. Description of the invention (529) [1S, 9S (2RS, 3RS)] 9-amido-6,10_ Diketo-1,2,3,4,7,8,9,10-octahydro-N- (2. Ethoxylated ketotetrahydrofuran-3-yl) -6H-daphno [1,2 -M [1,2] diazepine-1-carboxamide (2100h), a solution of 214e (287 mg, 0.65 mmol) in pyridine (5 ml), treated with Ac20 (0.4 ml , 3.62 millimoles). After 6 hours, the reaction mixture was poured into 5% NaHS04 and extracted 3 times with EtOAc. The combined organics were washed with brine, dried on a core 2804, and concentrated under air. Chromatography (Si02, EtOAc) can be generated, 19 mg of 2100h, 4 NMR (CDC13, a mixture of 4 diastereoisomeric compounds) δ 1.80-2.05 (m)? 2.12 (s), 2.13 (s), 2.19 (s), 2.22 (d), 2.67-2.75 (m), 2.80-2.95 (m), 3.00-3.20 (m), 3.21-3.33 (m) 5 3.50-3.95 (4 separate multimodal), 4.19 (m), 4.55 (m), 4.57-4.65 (m), 4.69 (m), 4.85-4.95 (m), 5.04 (m), 5.10 (s), 5.10-5.22 (m), 6.46 ( d), 6.03 (s), 6.50 (d), 6.58 (d), 6.75 (d), 6.95-7.05 (m), 7.22 (m), 7.30 (m), 7.71 (d), 7.75-7.83 (m).

O

2100b Printed by [3S (lS, 9S)] 3- (9-benzylamido-6,10-diketo-1,2,3,4,7,8, Ethyl 9,10-octahydro-6H-da-co- [1,2-a] [l, 2] diaza-1-aminoethyl) -4-copperylbutyrate (2100i). In a solution of 2100b (1.5 g, 2.7 mmol) in CH3CN (10 ml), IN HC1 was added at ambient temperature. After 6 hours, solid NaHC03 was added, and the product was extracted with EtOAc, dried over MgS04 and- 532- The size of this paper applies to China National Standard (CNS) 8-4 (210X297 mm). Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs. 541309 A7 B7 5. Description of the invention (53〇) Air enrichment. Chromatography (Si02, 30-100% CH2Cl2 / EtOAc) yields 123 mg of 2100i, 4 NMR (CDC13) d 1.25 (t, 3H), 1.6-1.8 (m, 1H), 1.9-2.2 (m, 5H) , 2.4-2.5 (m, 1H), 2.75-2.9 (m, 2H), 3.0-3.1 (m, 2H), 3.2-3.25 (m, 1H), 4.05-4.2 (m, 1H), 4.5-4.7 ( m, lH), 5.1-5 · 25 (m, 1H), 7.0-7.2 (m, 2H), 7.4-7.45 (m, 2H), 7.5 (t, 1H), 7.8 (t, 2H), 9.5 ( s, 1H).

O

[3S (1S, 9S)] 3- (9-fluorenylamino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-da [l, 2-a] [l, 2] Diazepine-1-carboxamido) -4-acetamido U-butenoic acid ethyl ester (2100j), synthesized from 2100i, using 2100h from 214e This method can generate 347 mg of 2100j, 4 NMR (CDC13) β 1.3 (t, 3H), 1.6-1.8 (m, 2H), 1.9-2.25 (m, 4H), 2.25 (s, 3H), 2.3- 2.45 (m, 1H), 2.8-3.0 (m, 1H), 3.0-3.25 (m, 2H), 3.4-3.45 (m, 2H), 4.1-4.2 (m, 2H), 4.55-4.7 (m, 1H) ), 5.1-5.25 (m, 1H), 6.8 (s, 1H), 7.0 · 7.1 · 1 (m, 2H), 7.5 (t, 1H), 7.8 (t, 2H), 9.5 (s, 1H). Compounds 500 and 501 are shown in Table 23. These compounds were prepared in a similar manner to compound 4004-449 (see Example 11). -533-^ The paper size applies to China National Standard (CNS) A4 (210X 297 mm)

541309 A7 B7 V. Description of the invention (531 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs cn (N Μ + ι—ί cn CM L〇cn cn LD bu lt; 〇 CJ κΡ π · CD S Cut 0 ΓΟ rH τ- Η rH ο rH m-ι κ 3: s CvJ tH fH L〇CN &lt; \ J tn 00 L〇00 〇LD of 〇1 ~ 1 〇DU rH CJ sentence zs CO (NJ 04 X CNJ 3: CM 〇 &lt; NUX oWork_PXV 〇 = 0 = ° ^ ° &lt; &gt; 0 琮 O ^ O γ〇I Λ work 0 ° v ° production o ^ s ^ P jCt2 work M ο tH φ ο l〇〇m λ3 -534- This paper size is applicable to China National Standards (CNS) Α4 specifications (210 × 297 mm) Please read the precautions on the back and fill in J, please order on this page 541309 A7 B7 532 5. Description of the invention (under The described compounds (213m, 213η, 213o, 213p, 213q, 213r, 213s, 213t, 213u, 213v, 213w, 213x, and 214w) were prepared in a similar manner to the compounds 213b-f. Compounds 419, 415, 450, 456, 475, 404, 486, 487, 417, 408 and 418 can also be prepared as follows.

417, 418, 419, 450, 456, 475, 486, 487 Please read the precautions for δ before filling in this page. Compounds printed by employees' cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs- ^ 213m, 419 MeOC (〇)-213η, 415 CO1 -535-This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of Invention (533) Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 213, 450 0 HN Me Ϊ 213p, 456 213q, 475 213rf 404 Me O 213s, 486 0X0 ^ H 213t, 487 H 213u, 417 1: ^ OMe -536- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (210X 297 mm) ( Please read the notes on the back first, then this page) Order 541309 A7 B7 V. Description of the invention (S34) 213v, 408 213w, 214w ιχ / Me 213x, 418 &quot; A〆Η clothing-(Please read the notes on the back first Refill this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards, Ministry of Economic Affairs [1S, 9S (2RS, 3S)] N- (2-benzyloxy-5-ketotetrahydrofuran_3-yl) -6, lCu dione -9- (3,4-methoxydioxybenzylamino) -1,2,3,4,7,8,9,10-octahydro-6 ^ ] [l, 2] Diazepine-1-carboxamide (213n), a mixture of diastereoisomers was separated (i.e., i.e., isomeric ratio 6: 4) (1.43 g , 82%) as a white solid: mp. 206-10 ° C; IR (KBr) 3288, 1787, 1680, 1657, 1651, 1619, 1548, 1440, 1256, Π35; 4 NMR (D6-DMSO) d 8 · 75 (0.4H, d), 8.55 (0.6H, d), 8.45 and 8.43 (1H, 2 xd), 7.50 (1H, d), 7.42 (1H, s), 7.40-7.27 (5H, m) , 7.01 (1H, d), 6.11 (2H, s), 5.67 (0.6H, d), 5.43 (0.4H, s), 5.10-5.00 (1H, m), 4.90-4.59 ( 3.5H, m), 4.45-4.25 (1.5H, m), 3.47-3.20 (1H, m), 3.20-2.70 (2H, m), 2.65-2.35 (1H, m), 2.35-2.00 (3H, m), 2.00-1.75 (2H, m), 1.65-1.40 (2H, m). Analysis of C29h3 () N4〇9's plan -537-This paper size is applicable to the Chinese National Standard (CNTS) A4 specification (210X297 mm) 541309 A7 _ __B7 V. Description of the invention (535) Calculation: C, 60 · 20; No, 5.23; N, 9.68. Found 値 · C, 60.08; H, 5 32; N, 9.50. MS (ES +) 580 (M + + 2, 35%), 579 (M + +1, 100), 400 (5), 367 (5), 236 (7), 107 (5). [1S, 9S (2RS, 3S)] 9-[(3-Ethylaminoamine) -Ethylamine] -N_ (2-Ethyloxy-5. Ketotetrahydrofuran-3-yl) -6,10- Diketo-1,2,3,4,7,8,9,10, octahydro-611_ dageno [l, 2-a] [l, 2] diazepine-1-carboxamide ( 213.0), the contra-isomer was a white foam solid (0.73 g, 69%): mp. 135-40 ° C; [a] D2i -37 3. (c 0.1, CH2C12); IR (KBr) 3452, 3310, 1790, 1664, 1659, 1650, 1549, 1425, 1258, 1 121; 4 NMR (D6-DMSO) d 1〇.u (1Η, s), 8.77 (1H, d), 8.57 (1H, d), 8.01 (1H, s), 7.76 (1H, d), 7.55 (1H, d), 7.45-7.25 (6H , M), 5.43 (1H, s), 5.08-5.00 (1H m), 4.95-4.73 (1H, m), 4.76 and 4.68 (2H, dd), 3.40-3.20 (ih, m), 3.09 ( 1H, dd), 3.02-2.75 (1H, m), 2.45-2.06 (4H, m), 2.06 (3H, s), 2.00-1.75 (2H, m), 1.70-1.40 (2H , M). Analytical calculations for C3OH33N508 · 0.75 · 2 値: C, 59.54; H, 5.75; N, 11.57. Measured 値: c, 59.40; H, 5.62; N, 11.50, MS (ES +) 593 (M + + 2, 33%), 592 (M + + 1,100), 574 (7), 487 (7), 475 ( 6), 385 (9), 373 (26), 318 (14), 296 (11), 266 (10), 221 (22). Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs [1S, 9S (2RS, 3S) 1 N- (2-benzyloxy-5-ketotetrahydrofuran-3-yl) -6,10-difluorenyl-9- (4-Rotylpyridinyl) amino-1,2, *), 4,7,8,9,10-octachloro-61 ^ -Takenbo [l, 2-a] [l, 2 ] Diazepine-1-carboxamide (213P), isolated as a foam (1.2 g, 77%): [a] D20 -115. (C 0.20, CH2C12); IR (KBr) 3368, 2946, 1794, 1654, 1609, 1540, 1505, 1421, 1277, 1 175, 1 1 19, 980; 1H NMR (D6-DMSO) d 1〇 · 1 (1H, s), 8 · 80 (〇 · 5Η, -538-This paper size applies to China National Standard (CNS) A4 specifications (210X297 mm 公 541309) Printed by A7 _ _B7 five Description of the invention (536) d, J = 6.6), 8.60 (0.5Η, d, J = 7.2), 8.40-8.36 (1Η, 2d), 7.82 (2H, d, J = 8.0), 7.41 (5H , Bs), 6.86 (2H, d, J 8.6), 5.72 (0.5 Η, d, J = 5.0), 5.49 (0.5H, bs), 5.13-5.07 (1H, m ), 4.95-4.65 (2.5H, m), 4.49-4.38 (2.5H, m), 3.49-3.30 (2H, m), 3, 21, 2.79 (2H, m), 2.40-1.41 (7H, m) MS (ES +) 551. [1S, 9S (2RS, 3S)] N- (2-methoxy-5-ketotetrahydrocystan-3-yl) -6,10-diketo-9- (Indole-2-carboxamido) 1,2,3,4,7,8,9,10-octahydro-611-da-co- [1,2,3] [1,2] -1-Beramine (2134), a white glassy solid was isolated (80%): mp · 145-149 ° C; [a] D23 -56.0. (C 0,05, CH2C12); IR (KBr) 3399-3319, 1791, 1 657, 1543, 1420, 1253, 1119; lU NMR (CDC13) 9.54 (1H, s), 7.65 (1H, d, J = 7.9), 7.51 (1H, d, J = 6.9), 7.44-7.25 (7H, m), 7.18-7 · 06 (3H, m), 5.30-5.20 (1H, m), 5.27 (1H, s), 4.84 (1H, m), 4.79 (1H, d, J = 11.4), 4.56 (1H, d, J = 11.3), 4.47 (2H, m), 3.28 (1H, m), 3.10-2.97 (2H, m), 2.71 (1H, m), 2.47-2.37 (1H, m), 2.26 (1H, d, J = 17.9), 2.09 (1H, m), 1.83, 1.70, 1.51 (4H, 3m). [1S, 9S (2RS, 3S)] N- (2-benzyloxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-l, 2,3,4,7,8, 9,1 (^ octahydro-9- (2-toluidinemethylamino) -6H-da-pheno [1,24] [1,2] diazepine-1-carboxamide (213〇, Diastereoisomeric mixtures were separated (ipsilateral: isomeric ratio 5 5: 4 5) 'as a white foamy solid (1.46 g, 89%): mp · 106-HTC; IR (κΒΓ ) 3306, 2947, 1791, 1659, 1650, 1535, 1421, 1256, 1122; β NMR (D6-DMSO) θ 8.76 (0.45H, d), 8.56 (0.55H, d), 8.49 and 8.47 (1H , 2 xd), 7.41-7.19 (9H, m), 5.67 (0.55H, d), 5.43 -539- This paper size is applicable to China National Standard (CNTS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the Invention (5:37 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (0.45H, s), 5.110.02 (1H, m), 4.86-4.55 (3.5H, m), 4.45-4.25 (1 · 5Η, m), 3.40-3.20 (1H, m), 3.20-2.70 (2H, m), 2.65-2.40 (1H, m), 2.34 (3H, s), 2.30-1.70 (5H, m), 1.65-1.40 ( 2H, m). Analysis of the calculation of C29H32N407: C, 62.66; H, 5.95; N, 10.08. Test: C, 62 · 91; H, 6.00; N, 9.70. MS (ES +) 550 (M + + 2, 43%), 549 (M + + 1,100), 374 (3), 280 (4) , 279 (20) ·, 118 (5). [1S, 9S (2RS, 3S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo- 1,2,3,4,7,8,9,10-octahydro-9- (4- (phenylethylamido) amido] -6H-thalco [l, 2-a] [ l, 2] diazepine-1 · carboxamide (213s), which was isolated as a contralateral-isomer type, as a white foamy solid (0.64 g, 77%) ·· mp · 137-41 ° C ; (a) D21 -48 · 2〇 (c 0.05, CH3OH); IR (KBr) 3477, 3314, 1791, 1659, 1599, 1529, 1499, 1406, 1256, 1 122; lR NMR (D6-DMSO) ^ 10.45 (1H, s), 8.76 (1H, d)? 8.50 (1H, d), 7.86 (2H, d), 7.69 (2H, d), 7.41-7.20 (10H, m), 5.43 (1H, s) , 5.08-4.98 (1H, m), 4.90-4.73 (1H, m), 4,76 and 4.68 (2H, dd), 3.67 (2H, s), 3.40-3.20 (1H, m), 3.09 (1H, dd), 3.02-2.75 (1H, m), 2.39 (1H, dd), 2.30-2.00 (3H, m), 2.0-1.75 (2H, m), 1.70-1.40 (2H, m). Analysis (: calculation of 36Η37N5〇8 · 0 · 5Η20) 値: C, 63.90; Η, 5.66; N, 10.35. Found 値: C, 63.68; H, 5.67; N, 10.24. MS (ES +) 669 (M + + 2 , 40%), 668 (M + + 1,100), 640 (12), 435 (18), 425 (23), 403 (33), 328 (17), 302, (32), 274 (22), 197 (16), 138 (17). [1S, 9S (2RS, 3S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-9- [4- (3-methylbutane-1-methylamidoamino) amido] -1,2,3,4,7, -540- This paper size applies to China National Standard (CNS) A4 (210X 297mm) Please read the notice before filling in the fluorine page. Order %% 541309 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 ___B7 V. Description of the invention (538) 8,9,10-octahydro- 611-Da [1,24] [1,2] diaza leather-1-carboxamide (2131), as a white foamy solid (0.63 g, 80%): mp · 159-64 ° C; [a] D21 -37.0. (c 0.05, CH3OH); IR (KBr) 3463, 3321, 1790, 1680, 1658, 1650, 1644, 1595, 1525, 1501, 1408, 1251, 1 1 13, 933; 1H NMR (D6-DMSO) δ 10.13 (1H, s)? 8.76 (1H, d), 8.48 (1H, d), 7.85 (2H, d), 7.68 (2H, d), 7.40-7.25 (5H, m), 5.43 (1H, s), 5.08-4.95 (1H, m), 4.92-4.73 (1H, m), 4.76 and 4.68 (2H, dd), 3.40-3.20 (1H, m), 3.09 (1H, dd), 3.02-2.75 (1H, m), 2.39 (1H, dd), 2.35-2.00 (6H, m), 2.00-1.75 (2H, m), 1.70-1.40 (2H, m), 0.93 (6H, d). Analyze the calculation of C33H39N508 · 0.5H20: C, 61.67; H, 6.27; N, 10.90. Found: C, 61.49; H, 6.24; N, 10.86. MS (ES +) 635 (M + + 2, 39%), 634 (M + + 1,100), 484 (10), 427 (9), 274 (18), 268 (37), 204 (19), 117 (13). [1S, 9S (2RS, 3S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-1,2,3,4,7,8, 9,10-octahydro-9- (3,4,5-trimethoxyfluorenylamino) -611-dapono [1,24] [1,2] diazepine-1-carboxamide (21311), as a white solid (81%): mp · 120-132 ° C; IR (KB〇3361-3334, 1792, 1659, 1585, 1536, 1499, 1457, 1416, 1340, 1236, 1126, 989; 4 NMR (CDC13) d 7.39-7.29 (6H, m), 7.12 (1H, s), 7.03 (1H, s), 6.92, 6.83, 6.48 (approx 3H, 3d, J = 8.1, 7.5, 8.1), 5.57 (d, J = 5.3), 5.27 (1H, s), 5.23-5.06, 4.91-4.71, 4.64-4.43, (6H, 3m), 3.92, 3.91, 3.89, 3.88 (9H , 4s), 3.32-2.70, 2.52-2.08, 1.91, 1.63 (1H, 4m). [1S, 9S (2RS, 3S)] N- (2-Methoxy-5-ketotetrahydrofuran-3-yl) _6, 10- -541-(Please read the precautions on the reverse side before filling out this page) This paper size applies to Chinese national standard (CNS> A4 specification (2i × 297mm) 541309 A7 B7 V. Description of the invention (539 ) Monoketo-9- (Qin-1-methylamidoamino) -1,2,3,4,7,8,9,10-octahydro-61] ^ A well and [1,21 a 1 , 2] diaza leather-1- Amidine (213 ¥) as a white solid (78%): mp · 121-7 ° C; IR (KBr) 3534-333 1,1791, 1659, 1528, 1420, 1256, 1122; Gore NMR (CDC13) β 8.34-8.29 (1Η, m), 7.98-7.87 (2H, m), 7.68-7 · 45 (4H, m), 7.34-7.24 (5H, m), 7.04 (d, J = 6.8) , 6.78 (d, J = 7.8), 6.66 (d, J = 7.7), 6.48 (2H, d, J = 7.5), 5.56 (d, J = 5.4), 5.15 (1H, s), 5.30-5.14, 5.0, 4.89 (d, J = 11.2), 4.71-4.41 (6H), 3.18-2.80, 2.50-2.27, 2.08-1.60 (11H, 3m). [1S, 9S (2RS, 3S)] N- (2- ^ oxy-5-ketotetrahydrocran-3-yl) -6,10-diketo-9- (4-hydroxy-3, 5-Dimethylbenzylfluorenyl) amino-1,2,3,4,7,8,9,10-octahydro-6H-dalopano [l, 2-a] [l, 2] diazepine Hetero-1-carboxamide (213w), as a diastereoisomeric mixture (65/35), as a white solid (0.9 g, 65%): mp. 110-115. (: (Decomposition); IR (KB〇3409, 2945, 1792, 1658, 1606, 1534, 1486, 1420, 1330, 1276, 1209, 1 122, 980, 960; lR NMR (CDC13) 7.66 (0.35H, d , J = 6.9), 7.46-7.20 (7H, m), 6.93 (0.35H, d, J = 7.7), 6.85 (0.65H, d, J = 7.6), 6.73 (0.65H, d, J = 7.6), 5.96 (0.35H, bs), 5.85 (0.65H, bs), 5.56 (0.65H, d, J = 5.2), 5.28 (0.35H, bs), 5.20-4.98 (2H, m ), 4.96-4.40 (4H, m), 3.28-2.55 (3H, m), 2.53-2.32 (1H, m), 2.23 (6H, 2s), 2.03-1.40 (7H, m), MS (ES.) 577, (ES +) 579. [1S, 9S (2RS, 3S)] 9- [4- (Ethylamine) -N-aminoamine] -N- (2-Ethoxy-5-ketotetrahydrofuran-3 -Yl) -6,10-diketo-l, 2,3,4,7,8,9,10-octahydro-6H-thalco [l, 2-a] [l, 2] diazepine Miscellaneous leather-l-Fosmamine (213x), colorless powder-542- This paper size is applicable to China National Standard (CNS) A4 (210X 297 mm) Please read the notes on the back before filling in I Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs 541309 A7 __ B7 V. Description of Invention (540) (691 g, 86%): mp · 150-70X: [a] D21 -10.1. (c 0.10, Me2C〇); IR (KBr) 3313, 1791, 1679, 1654, 1597, 1528, 1501, 1457, 1407, 1371, 1315, 1255, 1184, 1122, 933; lU NMR (d6-DMSO) d 8.75 (1H, d), 8.47 (1H, d), 7.84 (2H, d)? 7.66 (2H, d), 7.35 (5H, m), 5.43 (1H, s), 5.06-5.00 (1H, m), 4.90-4.64 (3H, m), 4.46-4.26 (2H, m), 3.16-2.86 (2H, m), 2.45-2.05 (5H, m), 2.07 (3H , S), 2.00-1.84 (2H, m), 1.68-1.56 (2H, m); analysis of the calculation of C30H33N5〇8.h20 値: C, 59.11; H, 5.79; N, 11.49. Measured 値 ·· C, 59.38; H, 5.66; N, 11.31; MS (ES +) 614 (100%), 592 (M ++ 1.66) 〇 [3S (1S, 9S)] 3- [6,10- 二Keto-9- (3,4-methoxydioxybenzylamino) -1,2,3,4,7,8,9,10-octahydro-611-Da-Phen [1,24] [ 1,2] diazapyridine-carboxamido] -4-ketobutyric acid (415), prepared in a similar manner to the compound 214e, can produce a white solid (297 mg, 84%): mp. 158- 62X:; [pan] D24 -109.5. (C 〇 · ι, CH3OH); IR (KBr) 3700-2500 (br), 1783, 1659, 1650, 1538, 1486, 1439, 1257, 1037; lH NMR (CD3OD) Printed 7.48 (lH, dd), 7.35 (lH, d), 6.88 (lH, d), 6.03 (2H, s), 5.25-5.15 (1H, m), 5.02 · 4 · 90 (1H, m ), 4.63-4.45 (2H, m), 4.30-4.20 (1H, m), 3.57-3.30 (1H, m), 3.20-3.05 (1H, m), 2.75-2.10 (5H, m), 2.10 -1 · 60 (4H, m). MS (ES +) 488 (M +, 25%), 487 (M + -1, 100), 443 (8), 387 (3), 315 (5), 150 (6), 127 (5), 113 (8) . Accurate mass calculation for C22H25N409 (MH +) 値: 489 162i. Found 値 489.1648. [3s (is, 9s)] 3 · {9 · [(3 · Acetylamino) Characterized Amino Acid "ο ·: _ 基--543- This paper standard is suitable for financial affairs (CNS) A4 Specifications (21GX 297 ft) &quot; '~ 541309 A7 B7 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (541 1, 2, 3, 4, 7, 8, 9, 10-octahydro_611 -Dageno [1,24] [1,2] diazapyridine-1-epiaminopyridine 4-ketobutyric acid (450), prepared in a similar manner to compound 214e, yielding a white foamy solid (378 Mg, 94%): mp · 175-9 ° C; [q] d22 -91.70 (c 0.1, CH3OH); IR (ΚΒγ) 3700-2500 (br), 3319, 1659, 1590, 1553, 1427, 1260; 1U NMR (CD3OD) d 8.01 (1H, d), 7.74 (1H, dd), 7.58 (1H, d), 7.45-7.35 (1H, m), 5.25-5.15 (1H, m), 5.05 -4.90 (1H, m), 4.60-4.45 (2H, m), 4.30-4.20 (1H, m), 3.55-3.30 (1H, m), 3.20-3.00 (1H, m), 2.75-2 · 20 (5H, m), 2.14 (3H, s), 2.20-1.60 (4H). Analysis of the calculation of C23H27N508.1.5H20: C, 52.27; H, 5.72; N, 13.25. Measured C, 52.31; H, 5.86; N 12.85. MS (ES +) 501 (M +, 26%), 500 (M +-1,100), 328 (2), 14 9 (3), 113 (3). [3S (1S, 9S)] 3- [4- (Hydroxybenzyl) amino] -6,10-diketo 4 9,10-octahydro-6H -Dageno [l, 2-a] [l, 2] diaza leather- 丨 · Carboxamido'ketobutyric acid (456), prepared by a method similar to compound 214e, can produce a white solid (0.73 G, 72%): mp. &Gt; 260 ° C; [to] 02-66. (C 〇34

MeOH); IR (KBr) 3401, 2946, 1651, 1584, 1506, 1426, 1277, 1257, 1177; 1U NMR (D6-DMSO) ^ 10.2 (1H, very bs)? 9.17 (1H, bs), 8 · 65 (1H, s), 8.37 (1H, d, J 5.4), 7.81 (2H, d, J = 8.2), 6.87 (2H, d, J = 8.4), 5.24 (1H, m), 4.92-4.86 ( 1H, m), 4.41-4.32 (2H, m), 3.68-3.21 (3H, m), 3.12-2.79 (1H, m), 2.50-1.42 (7H, m). MS (ES +) 459.

[3S (1S, 9S) 3- [6,10-diketo-9- (oxindole-2-carboxamido) -12,3,4 7,8 9,1,10-octahydro-6Η- Da Geng [l, 2-a] [l, 2] diaza leather "edge amine group] I -544- This paper size is applicable to China National Standard (CNS) A4 size (210X297 mm) Read the note on the back ^ and then fill out this page] r Pack--Order 541309 A 7 _ ____B7_ V. Description of the Invention (542) Ketobutyric acid (475) 'is prepared by a method similar to compound 214e, which can produce a white solid (79 %): mp. 150 ° C (transformation) 190-210 ° C; [a] D23 -97 5. (c 0.1, CH3OH); IR (KBr) 3319, 1658, 1650, 1549, 1421, 1256; iH NMR (CD3OD) β 7 · 61 (1H, d, J = 8.0), 7.43 (1H, d, J = 8.1), 7.21 (2H, m), 7.05 (1H, m), 5.21 (1H, m), 5.07-4.77 (1H, m), 4.54 (2H, m), 4.23 (1H, m), 3.46 (1H, m), 3.14 (1H, m), 2.66-1.71 (9H, m). MS (ES +, m / z), 482 (M + -1, 1000/0). [3S (1S, 9S) 3 · [6,10_diketo-1,2,3,4,7,8,9,10-octahydro_9- (2-toluenylamino) -611 -Tower 17 and [1,2-3] [1,2] diazapyridine-1-chinoamino] -4 · ketobutyric acid (404), which is prepared in a similar manner to compound 214e, can be produced White solid (0.79 g, 86%): mp · 156-9 ° C; [a] D25 -119.7. (C 0.1, CH3OH); IR (KB〇3700-2500 (br), 3387, 3309, 2956, 1785, 1659, 1650, 1535, 1422, 1278; XH NMR (CD3OD) d 7.46-7.15 (4H, m) , 5.25-5.15 (1H, m), 5.02-4.90 (1H, m), 4.58-4.45 (2H, m), 4.30-4.20 (1H, m), 3.55-3.30 (1H, m), 3.20-3.05 ( 1H, m), 2.80-2.20 (4H, m), 2.41 (3H, s), 2.20-1.60 (5H, m). MS (ES +) 458 (M +, 27%), 457 (M + · 1,100) , 413 (13), 339 (8), 285 (5), 134 (6), 127 (11). Accurate mass calculation for C22H27N407 (MH +): 459.1880. Actual measurement: 459.1854. Employees of the Central Standards Bureau of the Ministry of Economic Affairs Printed by the consumer cooperative (please read the precautions on the back before filling this page) [3S (1S, 9S) 3- [6,10-diketo-1,2,3,4,7,8,9, 10-octahydro-9- (4- (phenylethylamidoamino) benzylamido] -6H-dapono [l, 2-a] [l, 2] diazapine-1-carboxamidine Amine] -4-ketobutyric acid (486), prepared in a similar manner to compound 214e, yielding a white solid (325 mg, 89%): mp · 165-9 ° C; [a] D22-69.1. (C (0.1, CH3OH); IR (KBr) 3700-2500 (br), 3318, 1658, -545- This paper size applies to China Domestic Standard (CNTS) A4 specification (210X297 mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Invention Description (543) 1599, 1530, 1505, 1407, 1258; 4 NMR (CD3OD) Θ 7.85 ( 2H, d), 7.69 (2H, d), 7.38-7.20 (5H, m), 5.25-5.15 (1H, m), 5.05-4.90 (1H, m), 4.57-4.45 (2H, m), 4.30- 4.20 (1H, m), 3.70 (2H, s), 3.55-3.30 (1H, m), 3.20-3.00 (1H, m), 2.75-1.60 (9H, m). Analysis C29H31N508.1.5H20 The calculation 値: C, 57.61 ;, H, 5.67; N, 11.58. Measured 値 · C, 57.81; H, 5.74; N, 11.47. MS (ES +) 577 (M +, 33%), 576 (M +-1,100), 502 (2). [3S (1S, 9S) 3- {6,10-diketo-9- [4- (3-methylbut-1-amidinoamino) benzylamido] -1,2,3,4 , 7,8,9,10-Octahydro-611-Da-Phen [1,24] [1,2] Diazapyridine • 1-Carboxamido] -4-ketobutanoic acid (487), Prepared by a similar method to compound 214e, which can produce a white foam solid (335 mg, 93%): mp. 176-80 ° C; [to] D22 -88.0 ° (c 0.1, CH3OH); IR (KBr) 3700 · 2500 (br), 3321, 2960, 1781, 1660, 1597, 1529, 1407, 1258, 1187; W NMR (CD3OD) d 7.86 (2H, d), 7.69 (2H, d), 5.25-5.15 (1H, m) , 5.05-4.90 (1H, m), 4.60-4.45 (2H, m), 4.30-4.20 (1H, m), 3.57-3.30 (1H, m), 3.20-3.00 (1H, m), 2.75-1.60 ( 12H, m), 1.00 (6H, d). Analyze the calculation of C26H33N508.H20: C, 55.61; H, 6.28; N, 12.45. Found 値: C, 56.00; H, 6.37; N, 12.15. MS (ES +) 543 (M +, 31%), 542 (M +-1,100), 498 (2), 468 (3). [3S (1S, 9S) 3- [6,10-diketo-1,2,3,4,7,8,9,10-octahydro-9- (3,4,5-trimethoxybenzyl (Amine group) -611-Da-Chen [1,24] [1,2] diaza-1-epiamido] · 4-ketobutyric acid (417), prepared by a method similar to compound 214e , Can produce a white solid (0.63 g, 92%): mp · 145-155 ° C (about 値, not clear); | &D;] D27 -114.6. (C 0 · 11, CH3OH); IR (KBr) 3327, 1658, -546-This paper size applies to China National Standard (CNS) A4 specification (2i0X 297 public director) (Please read the precautions on the back before filling this page )

541309 A7 B7 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs V. Invention Description (544) 1586, 1548, 1501, 1416, 1341, 1238, 1126; lH NMR (CD3〇D) d 7.22 (2H, s), 5.21 (1H, m), 5.00 (1H, m), 4.56, 4.49 (2H, 2m), 4.25 (1H, m), 3.88 (6H, s), 3.80 (3H, s), 3.55 .3.43 (1H, m), 3.12 (1H, m), 2.71-1.70 (9H, m). Analyze the calculation of C24H3ON401 * 2H, 0: C, 50.52; H, 6.01; N, 9.82. Found 値: c, 509; H, 6.05; N, 9.68. MS (ES +, m / z 533 (M +-1,100%) 〇 [3S (1S, 9S) 3- [6,10-diketo-9- (fluoren-1-methylfluorenylamino 9,10 -Octahydro-6H-da-phen [l, 2-a] [l, 2] diazapyridine-1-chitamineamino M · ketobutyric acid (408), prepared in a similar manner to compound 214e, Can produce white solid (73%) ·· mp · 157-165X: (unclear); [ubi] D27] 40. (C 0.1, CH3OH); IR (KBr) 3325, 1658, 1531, 1420, 1278, 1257; lR NMR (CD3OD) d 8.33-8.28 (1H, m), 8.01-7.78 (2H, m), 7.71 (lH, d, J = 6.0), 7.59-7.52 (3H, m), 5.27 (lH, m), 5.12-5.03 (1H, m), 4.55 (2H, m), 4.25 (1H, m), 3.64-3.43 (1H, m), 3.24-3.12 (1H, m), 2.80- 1.67 (9H, m). Analytical calculations for C25H26N407.2H2O: C, 56.60; H, 5.70; N, 10.56. Found: c, 56.70; H, 5.80; N, 10.33. MS (ES +, m / z), 493 (M +-1,100%). [3S (1S, 9S) 3- [6,10-diketo-4_ (hydroxy-3,5-dimethylfluorenyl) amino · 1,2,3,4,7,8,9,10_Octahydro-6 ^ 1-dageno [1,24] [1,2] diazapyridine-1-chiaminyl] · 4 -Copper-butyric acid (214w), prepared in a similar manner as compound 214e , Can produce 210 mg (62%) of a white solid: mp. &Gt; 26 (TC: [^] D20 -93 ° (c 0.20, MeOH); IR (KBr) 3401, 2948, 1651, 1604, 1559, 1486 , 1421, 1325, 1276, 1210; lR NMR (D6- DMSO) d 9 · 39 (1H, bs), 8.29 (1H, d, J = 5.9), 7.55 (2H, s), -547 -(Please read the notes on the back before filling this page) Order I · This paper size is applicable to China National Standard (CNS) A4 (2iOX29: 7mm) 541309 A7 B7 V. Description of the invention (545) 6.64 (lH , D, J = 6.1), 5.79 (lH, s), 5.25-5.21 (lH, m), 1.90-1.82 (1H, m), 4.41-3.69 (2H, m), 3.47-3.20 (3H, m) , 2.97-2.91 (1H, m), 2.23 (6H, s), 2.25-1.60 (7H, m).

O

213y R = Bn-[1S, 9S (2RS, 3S)] N- (2-ethoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-9- (isoquinoline- 1-formamidine) -1,2,3,4,7,8,9,10-octahydro-6-: «· Dageno [l, 2-a] [l, 2] diaza G--1-carboxamide (550q) can be synthesized by the method of preparing 213e to produce 550q. [1S, 9S (2RS, 3S)] N- (2-Methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-9- (isopyridin-1-amidine) Radical) -1,2,3,4,7,8,9,10_octahydro-6-11-dageno [l, 2-a] [l, 2] diazapyrene-1-carboxamidine Amine (213y) can be synthesized by the method of preparing 213e to produce 213y. Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 〇

f w -548- (Please read the notes on the back before filling this page)

This paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (546) [1S, 9S (2S, 3S)] N- (2-phenethoxy-5_fluorenyltetrahydrobital-3-yl) -6, ι ·· diketo · 9- (isoquinoline-methylformamide) -1,2,3 , 4,7,8,9,10-octahydro-6_; ^ Dagen and [l, 2-a] [l, 2] diazepine-carboxamide, (412a) using the preparation 5 5 0q In this way, 513a-1 can be used to generate 412a. [1S, 9S (2R, 3S)] N- (2-phenethoxy-5-fluorenyltetrahydroan-3-yl) -6, fluorene · diketo-9- (isoquinoline- Dimethylamido) -1,2,3,4,7,8,9,10-octahydro H-tower sigma [i, 2_a] [l, 2] diazepine-1- Compound S &amp; amine (4l2b) can be used to prepare 550q to produce 412b with 513a-2. [1S, 9S (2S, 3S)] N- (2-cyclopentyloxy-5-ketotetrahydrofuran-3-yl) -6,10, diketo-9- (isoquinoline-1-methyl Fluorenylamino) -1,2,3,4,7,8,9,10-octahydro-6-11, daphtho [l, 2-aHl, 2] diazepine-1-carboxamide (412c) is synthesized by the method of preparing 550q, and 513c can be generated by using 513b-1. [1S, 9S (2R, 3S)] N- (2-cyclopentyloxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-9- (isoquinoline-1-carboxamidine Aminoamino) -1,2,3,4,7,8,9,10-octahydro-6-H-daparo [l, 2-a] [l, 2] diazepine small carboxamide (412d) is synthesized by the method of preparing 550q. 513b-2 can be used to generate 412d: 4 NMR (CDC1,) β 9 · 5 (1H, d), 8 · 9 (1H, d), 8 · 5 (1H, d), 7.9-7.8 (2H, m), 7.8 · 65 (2H, m), 6.55 (1H, d), 5.55 (1H, d), 5.25-5.1 (2H, m), 4.75-4.65 (1H, m), 4.65-4.6 (1H, m), 4.4-4.3 (1H? M), 3.25 * 3.15 (1H, m), 3.15-3.05 (1H, m), 2.95-2.8 (2H , M), 2.55 · 2 · 4 (2H, m), 2.15-1.5 (14H, m). [1S, 9S (2S, 3S)] N- (2-Ethyllactyl-5-fluorenyltetrazolidine-3-yl) -6,10-diketo-9- (isofluorin-1 -Methylamido)) 1,2,3,4,7,8,9,10-octahydro-6-1 {· each α well and [l, 2_a] [l, 2] diazapine -1-Chitosamine, (4 * i2e) Preparation-549- The size of this paper mark applies to China National Standard (CNS) A4 (210X297 mm)

f Please read the notes on the back before filling this hundred C

541309 A7 B7 5 *, invention description (547) 55〇q synthesis, using 513f-1 to generate 412e. [1S, 9S (2R, 3S)] N- (2-ethoxy-5_ketotetrahydrofuran-3-yl) -6,10, diketo-9- (isoquinoline-1-carboxamidine Amino group) -1,2,3,4,7,8,9,10-octahydro-6 ... !! · Tagano [l, 2_a] [l, 2] diaza leather-1-carboxyl Amidine, (4Uf) is synthesized by a method of preparing 550q, and 513f-2 can be used to generate 412f. Compounds 410 and 412 were prepared using the method from 604 to 605.

502γ, 502ζ 410, 412 Compound R1 502γ, 410 502zf 412 Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs [3S (1S, 9S)] 3-[(6,10-diketo-1, 2, 3, 4,7,8,9,10-octahydro-611-daphtho [l, 2-a] [l, 2] diazafluorene-9- (fluoren-3-yl · carbonylamino)- 1-Carboxamidine-550- This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 _ --------- B7 V. Description of the invention (548) 4_ Fluorenyl butyric acid (410), purified by flash chromatography (5_25% methanol in dichloromethane), yielded 296 mg (94%) of a colorless solid: mp · 90-20 (TC; IR (KBr) 3338, 3096, 2950, 1787, 1726, 1657, 1546, 1420, 1279, 1258, 1125, 1092, 984, 933; 4 NMR (CD3OD) d 8.41 (1Η, d), 8.13 (1H, d), 7.54-7.41 (3H, m), 7.20 (1H, d), 5.19-5.11 (1H, m), 4.54-4.30 (1H, m), 3.27 (1H, m), 3.18-3.03 (1H, m), 2.81- 2.64 (2H, m), 2.56-1.59 (7H, m). Analysis of the calculation of C19H22N407S.2.5H20 値: C, 46.05; H, 5.49; N, 11.31. Found 値: C, 46.36; H, 5. · 25; N, 11.10. MS (ES +) 449 (M 1, 80%), 113 (100) Accurate mass calculation of c19H23N4〇7S (MH +) 値: 451.1287. Found 値: 451.12951.1, [3S (1S, 9S)] 3-[(6,10-diketo-9- (isoquinoline-1- (Methylamidoamino-amino) -1,2,3,4,7,8,9,10-octahydro-611-dapono [1,24] [1,2] diazabenzene-1 -Carboxamido] -4-ketobutyric acid (412), prepared by a method similar to compound 605, can produce a white glassy solid (69%): mp · 138-141 ° C; [a] D23 -105.5 (C 0.5, CH2C12); IR (KBr) 3375, 1787, 1659, 1515, 1421, 1278, 1256; lR NMR (CDC13) δ 9.32 (1H, m), 8.79 (1H, consumed by employees of the Central Standards Bureau of the Ministry of Economic Affairs Cooperative printed m), 8.47 (1H, m), 7.86-7 · 64 (4H, m), 5.31, 5.18, 4.59, 4.37 (4 or 5H, m), 3.55-2.76, 2.49-2.39, 2.05 , 1.65 (11H, 4m). Analyze the calculation of C24H25N507.1.5H20: C, 55.17; H, 5.40; N, 13.40. Found 値: C, 54 · 87; H, 5.22; N, 13.15. MS (ES +, m / z) 494 (M + -1, 100%) 0 [3S (1S, 9S)] 3-[(6,10-diketo-1,2,3,4,7,8, 9,10-octahydro-9- (thiophene-3_yl) -6H-dacrogen [l, 2-a] [l, 2] diazamus-carbonylamino) -1-carboxamido -551-This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (549)]-4-ketobutyric acid third-butyl hemi-carbazone (50%) 2y), synthesized by the method of preparing 604 from 603, which can produce a light cream powder. Mp. 120-180 Please read the precautions before filling in this page l &gt;] D23 -109 ° (c 0.18, CH2C12 ); IR (KBr) 3478, 3327, 1670, 1582, 1543, 1421, 1279, 1257, 1155; 4 NMR (CDC13, CD3〇D) Θ 8.04 (1H, m), 7.49 (1H, m), 7.38 (1H, m), 7.17 (1H, m), 5.17-5.01 (2H, m), 4.86 (1H, m), 4.61-4.50 (1H, m), 3.45-3.29 (2H, m), 3.21 · 3.03 (1H, m), 2.79-2.54 (3H, m), 2.43-2.33 (1H, m), 2.11-1.66 (5H, m), 1.44 (9H, s). Analysis of C24H33N707S * H20 calculation: c, 49 · 56; H, 6.07; N, 16.86; S, 5.51. Found 値: C, 49.51; H, 5.93; N, 16.31; S, 5.17. MS (ES +) 586 (100%), 564 (M + + 1, 1.59). Accurate mass calculation for C24H34N707S (MH +) 値: 564.2240. Found 値: 564.2267. [3S (1S, 9S)] 3-[(6,10-di_yl-9- (iso4-leached dimethylamino) -1,2,3,4,7,8,9,10-octahydro -611-Da Geng [1,24] [1,2] diaza leather_1-carboxyamido]-4-ketobutyric acid tertiary-butyl hemicarbazone (502z), as compound Prepared in a similar manner as described in 604, yielding a pale yellow solid (90%): 1111) .142-145. . [A] D24 -136.5. (C 0.06, CH2C12); 4 NMR (CDC13) d Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 9.51-9.46 (1H, m), 9 · 11 (1H, s), 8.83 (1H, d, J = 7.8), 8.53 (1H, d, J = 5.5), 7.89-7.83 (2H, m), 7.77-7.65 (2H, m), 7.55 (1H, d, J = 7.2), 7.18 ( 1H, d, J = 2.7), 5.26-5.12 (2H, m), 4.87 (1H, m), 4.59 (1H, m), 3.25-3 · 12 (2H, m), 2.95-2.76 (2H , M), 2.59-2.38, 2.18-1.94, 1.70 (5H, 3m), 1.44 (9H, s). -552 The paper size is applicable to Chinese National Standard (CNS) A4 specification (21 × 297 mm) 541309 A7 B7 V. Description of invention (550) Ο

Compound R4 R1 415a 415b 415c 214w-l CH3 214w-2 CHa 214w-3 CH3 214w-4 CH3 214w-5 CH3 -553- Printed compounds of China National Standards (CNS) A4 specification (210X 297 mm) 541309 A7 B7, description of the invention (known) compound R ·

R 2l4w ~ 6 Ο

, 〇Ό 214w—7 Ο

412g 412h Consumption cooperation by employees of the Central Bureau of Standards, Ministry of Economic Affairs [1S, 9S (2S, 3S)] N- (2_ = f oxy_5-ketotetrahydrofuran-3-yl) -6,10-dione -9- (methyldioxybenzylamino) 1,2,3,4,7,8,9,10-octahydro_61 ^ tapano [l, 2-a] [l, 2 ] Diazaepiquatamine, (415a) was synthesized by the method of preparing 550q to form 415a. [1S, 9S (2RS, 3S)] N- (2-ethoxy-5 · ketotetrahydrocran-3-yl) -6,10-diketo-9- (methyldioxyfluorene Amine) -1,2,3,4,7,8,9,10-Octahydro-611-Da-Pheno [l, 2_a] [l, 2] diazepine-1-carboxamide, ( 4i5b) Synthesis using the method of preparing 550q can generate 415b. [1S, 9S (2R, 3S)] N- (2-fluorenyl-5-5-ketotetrahydrofuran-3-yl) -6,10-diketo-9- (methyldioxyfluorenylamino) -1,2,3,4,7,8,9,10-octahydro-611-da-co- [1,2-a] [l, 2] diaza-1-carboxamide, (415c ) Synthesized by the method of preparing 550q to generate 415c. [1S, 9S (2RS, 3S)] N- (2-Methoxy-5-ketotetrahydrofuran-3-yl) -6,10- -554- The paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 ____B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (552) Difluorenyl-9- (3,5-dimethyl-4-hydroxybenzylamine) -1 , 2,3,4,7,8,9,10-octahydro-6H-daparo [l, 2-a] [l, 2] diazepine-1-carboxamide, (214w-l ) Synthesized by the method of preparing 550q to generate 214w-1. [1S, 9S (2R, 3S)] N- (2-fluorenyl-5-fluorenyltetrahydrofuran-3-yl) -6,10-diketo-9- (3,5-dimethyl-4 -Hydroxyamidinyl) -1,2,3,4,7,8,9,10-octahydro-6H_Dageno [l, 2-ani, 2] diaza leather-1-carboxamidine Amine, (214w-2) can be synthesized by the method of preparing 550q to produce 214w-2. [1S, 9S (2S, 3S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-9- (3,5-dimethyl-4 -Hydroxyamido)) 1,2,3,4,7,8,9,10-octahydro-6H-daphno [l, 2-ani, 2] diaza leather-1-carboxamidine Amine, (214W-3) is synthesized by the method of preparing 550q, which can produce 214W-3. [1S, 9S (2R, 3S)] N- (2-benethoxy-5-fluorenyltetrazol-3-yl) -6,10-diketo-9- (3,5-di Methyl-4-hydroxyamido)) 1,2,3,4,7,8,9,10-octahydro-6H-thalco [l, 2-a] [l, 2] di Aza leather-1-carboxamide, (214W-4) is synthesized by the method of preparing 550q, which can produce 214w-4. [1S, 9S (2S, 3S)] N- (2-phenethoxy-5-ketotetrahydrofuran-3 · yl) -6,10-diketo-9- (3,5-difluorenyl -4-Hydroxyamido))-1,2,3,4,7,8,9,10-octahydro-6H-daphtho [l, 2-a] [l, 2] diaza G--1-carboxamide, (214W-5) can be synthesized by the method of preparing 550q to produce 214w-5. [1S, 9S (2R, 3S)] N- (2 · cyclopentyloxy-5 · ketotetrahydrofuran-3-yl) -6,10-diketone-9- (3,5-dimethyl- 4-Hydroxybenzylamino) -1,2,3,4,7,8,9,10-Bali-6H-Da-Pheno [l, 2-a] [l, 2] diazepine Carboxamide, (2Mw-6) is synthesized by the method of preparing 550q, which can produce 214w-6. [1S, 9S (2S, 3S)] N- (2-Cyclopentyl-5-ketotetrahydrofuran-3-yl) -6,1 ___ 555- This paper size applies Chinese National Standard (CNS ) A4 size (210X 297 mm) 541309 A7

= Ketodon (3,5-dimethyl_4 · spanylamino), 2,3,4,7,8,9,1〇_octahydro 6Η-Ta Geng and [i, 2- a] [i, 2] Diaza leather_1-carboxamide, (214w_7) is synthesized by the method of preparing 550q, which can generate 214w_7. [1S, 9S (2R, 3S)] N- (2-fluorenyl-5-ketotetrahydrofuran-3-yl) · 6; 1 ·· diketo-9- (isoquinoline q · methaneamine Group) _1,2,3,4,7,8,9,1〇_octahydro_611_tageno [l, 2-a] [l, 2] diaza leather_1_carboxamide, (4Ug) was synthesized by the method of preparing 550q, and 412g was produced. [1S, 9S (2S,: S)] N- (2-Uryloxy-5-ketotetrahydro-3-anyl) -6,10-diketo-9- (isoquinoline-1 -Formamidine octahydro-6H-daphtho [1,2-a] [1,2] -aza leather-1-chitosamine, (412h) synthesized by the method of preparing 550q, which can generate 412h.

415 214w Printed by [3S (lS, 9S)] 3- (9- (4,5-methyldioxybenzyl) amino-6,10-difluorenyl- 1,2,3,4,7,8,9,10-Octahydro-611-Da-Phen [1,24] [1,2] Diazapyridine-carboxamido) -4-one Butyric acid (415) was synthesized from 2001 to 2002 to produce 415. [3 3 (13,93)] 3- (9- (3,5-Digas_4-hydroxyfluorenyl) amino-6,10-diketo-1,2,3,4,7, 8,9,10-Octahydro-611-Da-Phen [1,24] [1,2] Diazapyridine-1-carboxamido) -4-ketobutanoic acid (214w), since 2001 The method for preparing 2002 is -556-A paper size is applicable to the Chinese National Standard (CNS) A4 specification (210 × 297 public love) 541309 A7 B7 5. The invention description (554) is formed to generate 214w.

Compound R 2100k 21001 2100m 2100η 2100ο &gt; 0T) printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs [13,93 (21 ^, 3 3) 9-benzylamido-6,10-diketo-1,2 , 3,4,7,8,9,10-octahydro-N- (2-phenethoxy-5-ketotetrahydrofuran-3 · yl) -6H-thalco [1,2-a] [ l, 2] diazepine-1-carboxamide (2100k), prepared in a similar manner as compound 213e to form a mixture of diastereoisomeric compounds (75/25), -557- Zhang scale is applicable to China National Standard (CNTS) A4 specification (210X 297 mm)-(Please read the precautions on the back before filling this page) Order 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (555 j white solid (258 mg, 83%) ·· mp · 101 ° C; · ["] D25 -96 ° (c 0.2, CH2C12); IR (KBr) 3328, 2935, 2978, 1732, 1669, 1603, 1483, 1450, 1414, 1237, 1155, 1082, 989, 755; 4 NMR (CDC13) 0, 7.84-7.80 (2H, m), 7,54-7.17 (8H, m), 7.06-6.99 (1H , M), 6,25 (1H, d, J = 7.9Η), 5.41 (0.75H, d, J = 5.4H), 5.31 (0.25H, bs), 5.23-5.09 (1H, m) 4.93-4.87 (1H, m), 4.68-4.51 (2H, m), 4.40-4.33 (0.25H, m), 4.24-4.14 (0.75H, m), 3.95-3.70 (1H, m), 3.30-3.13 (1H, m), 3.14-2.78 (5H, m), 2.47-2.21 (2H, m), 2.05-1.50 (5H, m). Analysis of the calculation of C29H32N4O7.0.5H2O2: C, 62 · 47; H, 5.97; N, 10.05 〇Measured fluorene: C, 62.17; H, 5.83; N, 9.97 OM (ES +) 549. [1S, 9S (2RS, 3S) 9-benzylamido-N- (2 -Cyclopentyloxy-5-keto-tetrahydrofuran-3-yl) -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H- 1,2-a] [l, 2] diazepine-carboxamide (21001), prepared in a similar manner as 213e, as a colorless solid: mp · 172-80 ° C; [to] D23 -91.5 . (C 0.1, CH2C12); IR (KBr) 3290, 1792, 1677, 1657, 1642, 1544, 1425, 1280, 1259, 1124, 977; 4 NMR (CDC13) (ί 7.80 (2H, m), 7.46 (3.5H, m), 7.00 (1H, d, J = 6.7), 6.48 (0.5H, d, J = 7.9), 5.55 (0.5H, d, J = 5.3), 5.19 (2H, s + m), 4.93 (0.5H, m), 4.62 (1.5H, m), 4.34 (1H, m), 4.18 (0.5Η, m), 3.28-2.70 (4H, m), 2.49-2.29 ( 2H, m), 205-1.48 (15H, m) 〇 [1S, 9S (2R, 3S) 9-benzylamido-6,10-diketo-N- [2- (2-hydroindene Alkoxy) -5-keto-tetrahydrofuran-3-yl] -1,2,3,4,7,8,9,10-octahydro-611-dapono [1,24] [1,2 ] Diazapyridine-1-carboxamide (21〇〇 !! 1), analogous to 213 6 • 558-This paper size applies to China National Standard (CNS) A4 specification (210X 297 public holidays) (Please (Read the notes on the back before filling out this page)

541309 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (S66) Preparation, (76%) is a colorless solid, mp. ~ 140 ° C, and then melted 187-9 ° C; -96.9. (C 0.11, CH2C12); IR (KBr) 3507, 3308, 3251, 1772, 1660, 1641, 1566, 1545, 1457, 1424, 1346, 1326, 1302, 1275, 1258, 1 136, 1085, 1018, 981; lR NMR (CDC13) d 7.78 (2H, m), 7.53 (3H, m), 7.19 (4H, m), 6.91 (1H, d, J = 7.4), 6.27 (1H, d, J = 7.6) , 5.66 (1H, d, J = 5.3), 5.10 (1H, m), 4.96 (1H, m), 4.75 (2H, m), 4.52 (1H, m), 3.08 (3H, m), 3.03 -2.71 (5H, m), 2.48-2.31 (2H, m), 1.90-1.40 (4H, m), 1.22 (1H, m). [1S, 9S (2S, 3S) 9-fluorenylamino-N- (2-fluorenyl-5-ketotetrahydrofuran-3-yl) -6,10-diketo-1,2,3, 4,7,8,9,10-octahydro-611-da-plow [152-3] [1,2] diazapyrene-bupropionamine (2100η), prepared in a similar manner to compound 213e, can be Generated a white glassy solid (76%); mp. 112-5X :; [沈] D23 -62.0 ° (c 0.1, CH2C12); IR (KBr) 3305, 1789, 1677, 1665, 1535, 1422, 1279, 1256 , 1119, 942, 700; β NMR (CDC13) d 7.84 (2H, s), 7.58-7.27 (9H, m), 6.99 (1H, d, J = 7.8), 5.23 (1H, s), 5.23-5.11 (1H, m), 4.89 (1H, m), 4.76 (1H, d, J = 11.3), 4.55 (1H, d, J = 11.4), 4.58-4.43 (2H, m), 3.30- 2.96, 2.81-2.69, 2.46-2.37, 2.16-1.66 (10H, 4m), 2.27 (1H, d, J = 17.8). Analysis of the calculation of C28H30N4O7.0.5H2O2: C, 61.87; H, 5.75; N, 10.32. Found 値: C, 61 · 88; H, 5.70; N, 10.33. MS (ES +, m / z) 535 (M + + 1,100%) 〇 [1S, 9S (2R, 3S) 9-fluorenylamino-N- (2-fluorenyl-5-ketotetrahydrofuran-3 -Yl) -6,10-diketo · 1,2,3,4,7,8,9,10-octahydro-6H-da-phen [l, 2-a] [l, 2] diazo Miscellane-1-carboxamide (2100) (containing about 7% (2S)), according to compound -559- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 _ _ B7 V. Description of the Invention (557) 213e is prepared by a similar method, which can produce a white glassy solid (81〇 / 〇); mp. 115-7. . [&Gt;] D23 -121.8. (C 0,11, CH2C12); IR (KBr) 3326, 1792, 1659, 1535, 1421, 1278, 1257, 1124, 978; 4 NMR (CDC13) d 7.82 (2H, m), 7.58-7.24 ( 8H, m), 6.90 (1H, d, J: 7.3), 6.49 (1H, d, J =: 7 · 7), 5 57 (m, d, J = 5.5), 5.11 (2H, m) , 4.91 (1H, d, J = 11.4), 4.57 (1H, d, J = 11.1), 4.81-4.68 (1H, m), 4.65-4.54 (1H, m), 3.18-2.71, 2.52-2.30, 2.05 -1.62 (1 1H, 3m). Analytical calculations for C28H3ON47.0.0.5H2O: C, 61.87; H, 5.75; N, 10.32. Found 値: C, 61.70; H, 5.71; N, 10.15. MS (ES +, m / z) 535 (M + 1, 94.3%), 557 (loo%). (Please read the notes on the back before filling this page)

[1S, 9S (2RS, 3S) 9- (3-Ethylamido) amido-6,10-diketo-N- (2-ethoxy-5-keto-tetrahydrofuran-3- Radical) _1,2,3,4,7,8,9,10_octahydro-6H-da p well and [l, 2-a] [l, 2] diaza leather-carboxamide (550η) , Prepared in a similar manner to compound 2Ue, producing a mixture of diastereoisomeric compounds (65/35) as a brown powder (390 mg, 28%); mp · 139-145X; [a] D23-104. , &Lt; 5

T Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (c 0.2, MeOH); IR (KBr) 3318, 2405, 2369, 1792, 1660, 1591, -560- This paper size applies to China National Standard (CNS) a4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (shed) 1549, 1484, 1422, 1257, 1117; 4 NMR (D6-DMSO) d 10.1 · 1 (1H, s), 8.80 (〇 · 65Η, d, J = 6.6), 8.58 (0.35H, d, J = 6.6), 8.59 (1H, d, J == 7), 8.06 (1H, bs), 7.83-7.79 (1H, m ), 7.61-7.57 (! H? M), 7.47-7.39 (1H, m), 5.61 (0.35H, d, J = 5.0), 5.37 (〇 · 65Η, bs), 5.17-5.14 (0.35H, m ), 5.08-5.06 (0.65H, m), (92-4.86 (1H, m), 4.67-4.61 (0.35H, m), 4.47-4.41 (0.65H, ni), 4.28-4 · 1ΐ ( 1H, 2m), 3.80-3.59 (2H, m), 3.23-2.75 (3H, m), 2.61-1.48 (7H, m), 2.10 (3H, s), 1.25 and 1.17 (3H, 2t, J = 5.8 ) ° MS (ES +) 528. Please read the precautions before reading

page

Order 5500 [1S, 9S (2RS, 3S) 6,10-diketo-N- (2-ethoxy-5-ketotetrahydrofuran-3-yl) -9- (2-indolinamide Acryl) -1,2,3,4,7,8,9,10-octahydro-611-da-co- [1,2-a] [l, 2] diazepine-1-carboxamide (550), prepared according to a similar method of compound 213e, which can produce a colorless solid (1.071 g, 80%); 11 ^, 155-70 ° C; [α] Ό22 -75.8 ° (c 0.26, CH2C12); IR (KBr) 3314, 2941, 1791, 1658, 1545, 1420, 1341, 1312, 1252, 1181, 1118, 939, 749; lR NMR (CDC13) ά 9.45 (0.5H, s), 9.34 (0.5H? S) , 7.68- 7.62 (1H, m), 7.49-7.39 (2H, m), 7.33-7.26 (1H, m), 7.18-7.03 561-This paper size applies to China National Standard (CNS) A4 specification (210 × 297 mm ) • Printed by the Consumers 'Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, printed 541309 Five printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7, Invention Description (559) (3H, m), 5, (0 · 5Η, d), 5 · 30 (0.5Η, s), 5.26-5.13 (1H, m), 4 90-4.83 (0.5 (, m), 4.76-4.49 (1H, m), 4.42-4.35 (0.5H, m): 3 97-3.74 (1H, m), 3.72-3.53 (1H, m)? 3.35-2.64 (4H, m ), 2.50-2.37 (1H? M), 2.20-1.82 (5H? M)? 1.69-1.50 (2H, m); [30-1.19 (3H, m) 〇 o

[1 S, 9S (2RS, 3 S) 6,10 --- benzyl-N- (2-ethoxy_5-steelyltetrachloro-3-anyl) -9- (4-merbenzylhydrazone Aminyl) amine group 1,2,3,4,7,8,9,10-octahydro-611-tago and [l, 2-a] [l, 2] diaza leather-ΐ · carboxyl Amine (550p) was prepared in a similar manner to compound 213e to give a mixture of diastereoisomeric forms as a white foam (820 mg, 47%): [a] D24 -75. (C 0.16, CH2C12); IR (KBr) 3401, 2937, 1791, 1657, 1609, 1539, 1505, 1423, 1277, 1177, 1118; in NMR (CDC13) ά 8.07-8.05 (1H? M), 7.67 ( 2H? D, J = 7.9), 7.38-7.29 (2H, m), 6.80 (2H, d, J = 8.5), 5.49 (0.5H, d, J =: 4.6), 5.23 (0.5H, bs), 5.24-5.20 (lH, m), 5.12-5 08 (1H, m), 4.68-4 · 29 (2H, m), 3.92-3.45 (3H, m), 3.32-2 · 30 (2H , M), 2.8CM.56 (11H, m), 1.21 (3H, t, J = 7.00Η). -562- The size of the paper method is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (560)

MeS〇2 ·

(Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

Compound R 503a 504a 286 00 503b 504b 505b Me 503c 504c 505c OPh 503d 504d 505d XT -563- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (561) 503e 504e 505e

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs [3S, 4R (1S, 9S) 3- (6,10_diketo-9-methane difluorenylamino-1,2,3,4,7, 8 , 9,10-octahydro-6113 and [1,24] [1,2] diazafluorene_1-quinolamino) -4, hydroxy-5- (1-fluorenylmethyloxy) ) Tertiary-butyl valerate (503a), prepared by (2l3e) from 212b and (3S, 4R) (N-allyloxycarbonyl) -3-amino-4-hydroxy-5- (1 -Stilbenemethyloxy) tert-butyl valerate, which can produce 533 mg (81%) of a white-doped foam: [PAN] 〇22_81 4. (C 05, ch2ci2); (KBr) 3342, 2976, 1719, 1664, 1328, 1278, 1246, 1153, 1137. NMR (CDC13) β 8.86 (1Η, d, J = 8.4), 8.21 (1Η, dd, J = 1.3, 7.3), 8.03 (1H, d5 J = 8.1), 7.88 (1H, d, J = 8.6), 7.66- 7.45 (3H, m), 7.23 (1H, d, J = 8.6), 5.96 (1H, d, J = 9.2), 5, 30 (1H, m), 4.59-4.33 (5H, m ), 4.24 (1H, m), 3.96 (1H, brd), 3.29 (1H, m), 2.95 (1H, m), 2.93 (3H, s), 2.69-2 · 50 (3H, m), 2.36 (1H, m), 1.96 (4H, m), 1.62 (1H, m), 1.41 (9H, s) a Analysis of C3iH40N4〇10S.0.25H2O Calculate 値: C, 55 · 97; H, 6.14; N, 8.42. Found 値: C, 55.90; H, 6.11; N, 8.23. M.S. (ES +) 683 (M + Na, 100%), 661 (M + 1, 39), 605 (78). [3S (1S, 9S) 3- (6,10-diketo-9-methylpyridinamine-1,2,3,4,7,8,9,10. And [i, 2-a] [l, 2] diazapyridine-carboxamido) -5_ (1 dioxomethyl lactyl) -4-amidopentyl di-d 5048) 'Using the method of preparing 210e from 2l5e, synthesized from 503a, it can produce 6 mg (91%) of colorless -564-This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) ¢ 41309 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the Invention (562) Bubbles: [a] D21 -111.6. (C 0.5, CH2C12); IR (KBr) 3319, 2978 2936, 1723, 1670, 1413, 1370, 1329, 1278, 1246, 1153. ljj NMR (CDC13) d 8.87 (1H, d, J = 8.9), 8.29 (1H, d, J = 7 2) 8.06 (1H, d, J = 8.3), 7.90 (1H, d, J = 8.2), 7.66-7.48 (3H,, 〇!), 7.37 (1H, d, J = 8.1), 5.61 (1H, d, J = 9.0), 5.31 (1H, m), 5 (1H, AB, J = 16.9), 5.09 (1H, AB, J = 16.92), 4.99 (1H, 4.65-4.43 (2H, m), 3.28 (1H, m), 2.96 (3H, s), 2.86 (2H, m) 2.59 (1H, m), 2.38 (1H, dd, J = 6.8, 13.2), 2.21-1.70 (6H,-, i, rn) 1.45 (9H, s). Analyze C31H38N4O10S * Calculation of 0.25H2O 値: c, 56 l4 H, 5.85; N, 8.45. Measured 値: C, 56.11; H, 5.83; N, 8.29 (ES +) 657 (Ml, 100%) 〇 [3S (1S ， 9S) j- (6,10-Difluorenyl-9-methylamine amino-1,2,3,4 7 ^ 10-octahydro-6H_Dageng [1,2-a] [1,2] Diazapyridine · 1-carboxyamidoamino 'stilbenemethyloxy) -4-ketopentanoic acid (286), prepared from 504 by the method of 217, can produce 356 mg ( 93%) of white powder: mp · 12 (M23 ° C; [PAN] 〇23 -121. (C 0.194, CH2C12); IR (KBr) 3314, 2937, 1722, 1663, 1412, 1328, 1278, 1245, 1195, 1132 〇 NMR (d6-DMSO) d 12.63 (1H, brs), 8.94 (1H, d, J = 7.4), 8.78 (1H, d, J = 8.6), 8.26 (2H, m), 8.11 (1H, d , J = 8.0), 7.77-7.62 (4H, m), 5.28 (2H, s), 5.21 (1H, m), 4.82 (1H, m), 4.44-4 · 29 (2H, m), 3.31 (1H, m), 2.98 (3H, s), 2.98-2 · 86 (2H, m), 2.72 (1H, dd, J = 7.3, 16.9), 2.40 (1H, m ), 2.24-1.84 (4H, m), 1.69 (2H, m). Analysis &lt;: 27: »3 () &gt; 1401 () 8.1120 Calculation 値: C, 52 · 25; H, 5 · 20; team 9.03. Found 値: C, 52 · 11; Η, 4.97; Ν, 8.89. M.S · (ES +) 601 (Μ-1, -565- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) f Please read the notes on the back first ¾ then fill out this page) Order

* nn I 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 _ ___ B7 V. Invention Description (563) 100%) 〇 [3S, 4RS (1S, 9S)] 3- [6,10-diketo- 1,2,3,4,7,8,9,10-Octahydro-611-Da-Chen [1,2- &amp;] [1,2] diazepine-9- (methanesulfonamido )-1-Carboxylamidine 4-hydroxy-5- (5-methyl-3-phenylisoxazolyloxy) tert-butyl valerate (5 03 b), similar to the compound 213e Synthesized by method to produce white powder (671 mg, 88%): mp. 90-120 ° C; IR (KBr) 3345, 2977, 1727, 1664, 1532, 1450, 1423, 1369, 1323, 1310, 1276, 1257 , 1 154, 1 101,990,766; 1HNMR (CDCl3) cy7.61-7.5 5 (2H, m), 7.51-7.42 (3H, m), 6.86 (lH, d), 5.69 (lH, d), 5,21 ( lH, m), 4.64-4.38 (2H, m), 4.15-4.05 (3H, m), 3.84 (1H, s), 3.31-3.14 (2H, m), 2.97-2.87 (1H, m), 2.94 ( 3H, s), 2.76 (3H, s), 2.64-2.48 (3H, m), 2.39-2.29 (1H, m), 2.04-1.61 (5H, m). Analysis of the calculation of CnHqNsOuS.i ^ O: C, 52.46; H, 6.11; N, 9.87; S, 4.52. Found 値: C, 52.34; H, 5.92; N, 9.56; S, 4.44. MS (ES +) 714 (47%), 692 (M + + 1,84), 636 (100). [3S (1S, 9S) 3- [6,10-diketo-9- (methanesulfonamido) -1,2,3,4,7,8,9, 10-octahydro-6H- Geng [1,2-a] [l, 2] Diazapyridine-1-carboxamido] -5- (5-methyl-3-phenylisoxazolyloxy) -4-one Tertiary-butyl valerate (504b), synthesized in a similar manner to compound 216b, can produce a colorless powder (601 mg, 93%). Mp. 75-115X:; [a] D23 · 104% ( c 0.26, CH2C12); IR (KBr) 3324, 2977, 2935, 1730, 1670, 1525, 1452, 1422, 1369, 1317, 1276, 1256, 1222, 1155, 1107, 990, 766; ^ NMR (CDC13) 7.68 -7.61 (2H, m), 7.47-7.38 (3H, m), 7.32-7.24 (1H, m), 5.56 (1H, d), 5.36-5.24 (1H, m), 5.04 (1H, d), 4.88 -566- (Please read the precautions on the back before filling this page) This paper size applies to Chinese National Standard (CN'S) A4 (210X297 mm) 541309 Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (564) (1H, d), (86-4.77 (1H, m), 4.64-4.39 (2H, m), 3.32-3.17 (1H, m), 2.97-2.85 (1H, m), 2.93 (3H, s), 2.76 (3H, s), 2.80-2 · 71 (1H, m), 2.65-2.49 (1H , M), 2.41-2.30 (1H, m), 2.12-1.61 (6H, m), 1.42 (9H, s). Analysis of the calculation of C31H39N50nS.H2O: C, 52.61;;, 5.84; N, 9.90; S, 4.53. Measured 値 · c, 52.94; Η, 5.69; N, 9.72; s, 4.51. MS (ES +) 712 (31%), 707 (100), 690 (M + + 1,41), 634 (55) 〇 [3S (1S, 9S) 3- [6,10-di-toluenesulfonylamino) -1,2,3,4,7,8,9, 10-Octahydro-6H-dalopano [l, 2-a] [l, 2] diazepine · 1-carboxamido] -5- (5-methyl-3-phenylisoxazole Alkoxy) -4-ketovaleric acid (505b), synthesized in a manner similar to compound 217, can produce a colorless powder (499 mg, 96%): mp 95-145 ° C; [a] D22 -137. (C 0.12, MeOH); IR (KB〇3323, 2936, 1732, 1665, 1529, 1452, 1421, 1312, 1275, 1256, 1221, 1 183, 1 153, 1 135, 1 101,990; 4 NMR ( CD3OD) d 7.67-7.56 (2H, m), 7.49-7.38 (4H, m), 5.23-5.12 (1H, m), 5.02 (1H, d), 4,79-4.73 (1H, m), 4.52- 4.34 (3H, m), 3.48-3.25 (2H, m), 3.03-2.85 (2H, m), 2.94 (3H, s), 2.74 (3H, s), 2.79-2.66 (1H, m), 2.52- 2.38 (1H, m), 2.29-2.14 (1H, m), 2.04-1.70 (4H, m). Calculations for analysis: C, 49.77; H, 5_18; N, 10.75; S, 4.92. Actual measurement : C, 49.83; H, 5.01; N, 10.27; S, 4.84. MS (ES +) 746 (42%), 632 (M-1,100), 386 (60). Accurate mass calculation 値: 634.1819 Measured thallium: 634.1807. L3S, 4RS (1S, 9S) 3- [6,10-diketo-9-pyranesulfonamido) -1,2,3,4,7,8, -567- This paper is again applicable to the Chinese National Standard (CNS) A4 specification (210X 297 mm) (please read the precautions on the back before filling out this page) Order 541309 A7 B7 Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Explanation (565) 9,10-octahydro-6H-Da Geng [l 2-a] [l, 2] diazepine-1-carboxyfluorenylamino] -4-peryl-5- (2-phenoxy-methyloxy) valeric acid c), synthesized in a similar manner to compound 213e, which can produce a colorless solid (446 mg, 84%): IR (KBr) 3345, 2976, 2935, 1727, 1664, 1603, 1535, 1483, 1451, 1416, 1395, 1369 , 1328, 1297, 1277, 1237, 1155 · 1135, 1076, 990; 755; lR NMR (CDC13) (ί 7.98-7.89 (1H, m), 7.55- 7.45 (1H, m), 7.39-7 · 18 (3H, m), 7.14-7.07 (1H, m), 7.00-6.90 (3H, m), 6.75 (1H, d), 5.57-5.50 (1H, m), 5.21-5.09 (1H, m ), 4.64-4.42 (2H, m), 4.36-4.12 (3H, m), 3.95-3 · 87 (1H, m), 3.39-3.18 (1H, m), 3.00-2.82 (1H, m), 2 95 (3H, s), 2.69-2.48 (3H, m), 2.42-2.28 (1H, m), 2.07-1.62 (6H, m), 1.42 (9H, s). Analyze the calculation of C ^ Hui ^ OuS.HzO: C, 54.99; H, 6.15; N, 7.77; S, 4.45. Found 値: C, 54.95; H, 5.95; N, 7.34; S, 4.20. MS (ES +) 725 (26%), 720 (47), 703 (M + + 1,34), 433 (100) to 403 (89). [3S (1S, 9S) 3- [6,10-diketo-9-methanesulfonylamino] · 1,2,3,4,7,8,9, 10-octahydro · 6Η-Da Geng [1,2-a] [l, 2] Diazepine-1-carboxyamido] -4-one-5- (2-phenoxyfluorenyloxy) pentanoic acid Butyl ester (504) is synthesized in a similar manner to compound 216e, and can produce a colorless powder: mp. 85-100 ° C; [汉] D22 -91.3. (C 〇52, CH2C12); IR (KBr) 3328, 2978, 2935, 1732, 1669, 1603, 1524, 1483, 1450, 1396, 1369, 1296, 1276, 1237, 1 155, 1 132, 1082, 989 , 755; lH NMR (CDC13) 8.03- 7.98 (1H, m), 7.52-7.44 (1H, m), 7.37-7.07 (5H, m), 7.01-6.92 (3H, m), 5.52 (1H, d) , 5.28-5.20 (1H, m), 5.06-4.84 (3H, m), _-568-This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) (Please read the notes on the back first Fill out this page again) 541309 A7 B7 V. Description of the invention (566) (64-4.39 (2H, m), 3.32-3.14 (1H, m), 2.99-2.88 (1H, m), 2.94 (3H, s), 2.65-2.45 (2H, m), 2.39-2.29 (1H, m), 2.12-1.58 (6H, m), 1.40 (9H, s). Analyze C33H40N4OuSt and calculate 値: C, 56.56; H, 5.75; N , 8.00; S, 4.58. Found 値: C, 56.37; H, 5.84; N, 7.69; S, 4.37. MS (ES +) 723 (30%), 718 (100), 701 (M + + 1,23 ), 645 (59). [3S (1S, 9S) 3- [6,10-diketo-9-methanesulfonylamino] -1, 2, 3, 4, 7, 8, 9, 10 -Octahydro-6H-da-phen [l, 2-a] [l, 2] diaza-l-carboxamido] -4-one-5- (2-phenoxy (Methoxy) valeric acid (505c), synthesized in a similar manner to compound 217, can produce a colorless foam (252 mg, 72%): mp. 90-125 ° C; [to] D23 -133 ° (c 0 · 11 , MeOH); IR (KBr) 3314, 2938, 1792, 1734, 1663, 1604, 1535, 1483, 1448, 1415, 1250, 1 132, 756; lR NMR (d6-DMSO) d 8.81-8.76 (1H? M ), 7.92 (1H, d), 7.68- Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

7.54 (2H, m), 7.41-7.25 (3H, m), 7.16-6.91 (4H, m), 5.13-4.98 (2H, m), 4.72-4.63 (1H, m), 4.37-4.21 (2H, m ), 2.92 (3H, s), 2.90-2.60 (3H, m), 2.35-2.26 (1H, m), 2.17-2.05 (2H, m), 1.99-1.08 (2H, m), 1.61-1.50 (1H, m). C29H32N4uS * 0.5H2O analysis: C, 53 · 29; H, 5.09; N, 8.57; S, 4.90. Found 値: C, 53 · 57; H, 5.18; N, 8.32; S, 4.75. MS (ES +) 643 (M-1,100%) 〇 [3S, 4RS (1S, 9S) 3- [6,10-diketo-9-methanesulfonamido) 12 3 4, 7,8 , 9,10-octahydro-6H-da-co- [l, 2-ani, 2] diazepine-1-carboxamido] · 4-hydroxy-5- (3-phenoxybenzyloxy] 3) Butyl valerate (503d), synthesized by a method similar to compound 213e, can produce a colorless solid (5 63 mg, -569-this paper is compliant with Chinese National Standard (CNS) A4 specifications (21 〇X 297 public directors) ^ &quot; 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (567) 90%) · IR (KBr) 3349, 2978, 2935, 1724, 1664, 1583, 1536, 1489, 1443, 1370, 1327, 1271, 1226, 1189, 1155, 1073, 990, 755;! H NMR (CDC13) ^ 7.77 (1H, d)? 7.67 (1H, m), 7.45- 7.10 (6H , M), 7.00 (2H, d), 5.93-5.80 (1H, m), 5.36-5.30 (1H, m), 4.63-4 · 24 (5H, m), 4.15-4.09 (1H, m) , 3.37-3.22 (1H, m), 2.98-2.74 (1H, m), 2.94 (3H, s), 2.70-2.47 (3H, m), 2.40-2.30 (1H, m), 2.15-1.60 (5H, m), 1.42 (9H, s). Analysis of C33H42N40iis * H2O calculation: C, 54 · 99; H, 6.15; N, 7.77; S, 4.45. Measured 値 ·· C, 54.60; H, 5.88; N, 7.49; S, 4.50. MS (ES +) 725 (19%), 720 (91), 703 (M + + 1,74), 647 (76), 629 (100), 433 (78). [3S (1S, 9S) 3- [6,10-diketo · 9-methanesulfonamido) -1,2,3,4,7,8,9, 10-octahydro-6H- Benzo [l, 2-a] [l, 2] diazepine-1-chitamido] -4-one- 5- (3-phenoxyhexyloxy) valeric acid tert-butyl § Purpose (504 d), synthesized in a similar manner to compound 216e, can produce a colorless powder (466 mg, 85%): mp. 175-160 ° C; [α] Ό22 -99.3 ° (c 0.60, CH2C12) ; IR (KBr) 3335, 2978, 2937, 1728, 1669, 1584, 1525, 1487, 1444, 1416, 1369, 1328, 1272, 1227, 1 188, 1155, 989, 754; 4 NMR (CDC13) θ 7 · 82-7 · 77 (1H, m), 7.66-7.65 (1H, m), 7.46-7.32 (4H, m), 7.26-7.10 (2H, m), 7.04-6.98 (2H, m), 5.68 (1H, d), 5.37-5.31 (1H, m), 5.11 (1H, d), 5.02-4.88 (2H, m), 4.66-4.42 (2H, m), 3.35-3 · 17 (1H, m), 2.98-2.89 (1H, m), 2.96 (3H, s), 2.84-2.78 (1H, m), 2,72-2.47 (1H, m), 2.42-2.32 (1H, m), 2 · 14-1 · 58 (6H, m), 1.43 (9H, s). Analyze the calculation of CnHwl ^ OnS 値 -570- This paper is applicable to the Zhongguanjia Standard (CNS) A4 specification (21GX297 public holiday) — — ~~~ (Read the precautions on the back before filling this page) 541309 A7 _____ B7_ ^ V. Description of the invention (568): C, 56.56; Η, 5.75; N, 8.00. Found 値: C, 56.36; H, 5.82; team 7.71. MS (ES +) 723 (56%), 718 (90), 701 (M + + 1,36), 645 (100). [35 (15,93) 3- [6,10-Diketo-9- (methanesulfonamido) -1,2,3,4,7,8,9,10-octahydro-611- Daphno [1,24] [1,2] diazepine-1-carboxamido] -4-_yl-5- (3-phenoxyfluorenyloxy) pentanoic acid (505 Xuan, synthesized by a method similar to compound 217, yielding a colorless foam (353 mg, 73%): mp · 80-115 [a] D23 -1 3 8 ° (c 0.11, MeOH); IR (KBr) 3327, 2937, 1728, 1666, 1584, 1529, 1487, 1443, 1413, 1328, 1273, 1227 · 1189, printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 1 155, 1 134, 989, 754; 4 NMR (D6-DMSO) θ 8.82 (1H, d), 7.76-7.72 (1H, m), 7.61-7.53 (2H, m), 7.48-7.32 (4H, m), 7.24-7.17 (1H, m), 7.11-7.06 (2H , M), 5.14-5.06 (3H, m), 4.73-4.64 (1H, m), 4.38-4.24 (2H, m), 2.92 (3H, s), 2.89-2, 61 (3H, m), 2.38 -2.27 (1H, m), 2.19-2.06 (2H, m), 2.02-1.79 (3H, m), 1.63-1.52 (1H, m). Analysis of the calculation of C29H32N40uS. 0.5H2O C: C, 53.29; H, 5.09; N, 8.57; S, 4.90. Measured 値 · c, 53.24; H, 5.14; N, 8.34; S, 4.86. MS (ES +) 643 (M-1, 100) / 0), 385 (62). [3S, 4R (1S, 9S)] 5- (3-Aminophen-2-methylfluorenyloxy) -3- (6,10-diketo-9- Methanesulfonylamino) -1,2,3,4,7,8,9,10-octahydro_611-Da? 1 well and [1,2_ a] [l, 2] diazapyridine-1 -Chloramine) · '-hydroxyvaleric acid third-butyl ester (503), prepared in a similar manner to compound 213e, yielding a white solid (700 / 〇): mp. 100-103 ° C; [ α) Ό25 -84.0 ° (c 0. 05? CH2C12); IR (KBr) 3459-3359, 1722, 1664, 1514, 1368, 1328, 1278, 1247, 1155; 4 NMR (CDC13) d 7.52 ( 1H, m), 7 · 06-6 · 99 (2H, m), 5.69 -571-This paper size is applicable to China National Standard (CNS) A4 (21〇xI97), --- ~~ Central Ministry of Economic Affairs Standard Bureau employee consumer cooperatives printed 541309 A7 _ B7 V. Description of invention (569) (1H, d, J = 9.0), 5.23 (1H, m), 4.61-4.16 (6H, m), 3.36-3.19 ( 1H, m), 2.96 (3H, s), 2.67-2.49, 2.42-2.32, 2.06-1.89, 1.69 (10H, 4m), 1.43 (9H, s). [3S (1S, 9S)] 5- (3-chlorothiophene-2-carboxamidooxy) -3- (6,10-diketo-9-methanesulfonamido) -1,2,3 , 4,7,8,9,10-Octahydro-611-Da-Phen [1,24] [1,2] Diazapyridine-1-carboxamido) · 4-ketovaleric acid third -Butyl ester (504e), prepared according to the method of compound 216e, yielding a white solid (98%): mp 91-98 ° C; [Pan] D25 -112.5. (C 0.06, CH2C12); IR (KBr) 3453-3364, 1727, 1668, 1513, 1420, 1368, 1245, 1 155; NMR (CDC13) 7.54 (1H, d, J = 5.3), 7.18 (1H , D, J = 7.18), 7.05 (1H, d, J = 5.4), 5.42 (lH, d, J = 8.9), 5.25 (lH, m), 5.02 (2H, m), 4.96-4.87 (1H, m), 4.65-4.42 (2H, m), 3.34-3.17 (1H, m), 2.97-2.93 (1H, m), 2.97 (3H, s), 2.87-2.78, 2.73-2.50, 2.38-2.32, 2.13 -1.88, 1.69-1.60 (9H, 5m), 1.44 (9H, s) 〇 [33 (13,95)] 5- (3-Chlorophen-2-methylmethyloxy) -3- (6 , 10-diketo-9-methanesulfonamido) -1,2,3,4,7,8,9,10-octahydro-6 ^ 1-tapano [1,24] [1, 2] Diazapyridine-1-carboxamido) -4-ketopentanoic acid (505e). A solution of 217 (0.33 g, 0.51 mmol) in anhydrous digas methane (3 ml) is cooled under water vapor (ice / water). Add trifluoic acid (2 ml) while stirring. The solution was kept at room temperature for 2 hours, after which the cooling bath was removed and concentrated under air. The residue was evaporated three times from dichloromethane, triturated with diethyl ether and filtered. The solid was purified by flash chromatography (silica gel, 0-6% methanol in dichloromethane) to give the product as a white glassy solid (0.296 g, 98%): mp · 100-122 ° C; [a] D2 ^- 163.5. (C 0.1, CH3OH); IR (KBr) 3514-3337, 1726, 1664, -572 · &quot; ^ The kill scale is applicable to China National Standard (CNS) A4 specification (210X 297 mm) '' ~~ (Please read first (Notes on the back then fill out this page)

541309 A7 B7 V. Description of the invention (57〇) 1513, 1420, 1245, 1152, 1134, 990; W NMR (CD3OD) Θ 7.79 (1H, d, J = 5.2), 7.12 (1H, d, J = 5.2), 5.20 (1H, m), 5.0 · 2-4 · 72 (2H, m, protected by H20), 4.59-4.3 2 (3H, m), 3.48-3.29, 3.08-2.75, 2.50 * 2.41, 2.31-2.22, 2.08-1.89, 1.72-1.63 (1 1H, 6m), 2; 95 (3H? S).

〇

(Please read the notes on the back before filling this page) Compounds printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. R1 506a PhC (O)-507a 506b MeS (0) 2- 507b 506c MeOC (O)-507c 506g CH3C (0)-507g [3S (1S, 9S)] 3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro- 6H-Diporphino [丨 meaning ^ 丨, 2] diaza-1-carboxamido) -5-azo-4-ketopentanoic acid tert-butyl ester (506a). 212e (321 mg, 0.929 millimoles) -573- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 ____B7__ 5. Description of the invention (571) and (3S) 3-amino -5-Azo-4-methylpentanoic acid tert-butyl (198 mg, 0.929¾ mole) was cooled to a solution of chloroform (3 ml), and then N, N-di Isopropylethylamine (0.16 μl, ι 86 μmol) and benzotriazol-1-yl) -1,1,3,3-tetramethylphosphonium tetrafluoroborate (328 mg, 102 mol). The solution was stirred overnight at room temperature, diluted with ethyl acetate and washed with 1M NaHS〇4 (x2), NaHC03 aqueous solution (x2), brine, dried over magnesium sulfate and evaporated. Chromatography on silica gel and dissociation with ethyl acetate gave 506a (425 mg, 85%) as a colorless foam ... ["] d23 · 124 9. (c 〇2, CH2C12); IR (KBr) 3332, 21 1 1,1728, 1658, 1532, 1421, 1392, 1367, 1279, 1256, 1 155; Go NMR (CDC13) d 7.82 (2Η, m), 7.49 (3H, m), 7.28 (1H, d, J = 9.3), 7.05 (1H, d, J = 7.3), 5.06 (1H, s), 5.18 (2H, m), 4.78 (1H, m), 4.62 (1H, m ), 3.29 (1H, m), 3.08-2.79 (3H, m), 2.58 (1H, dd, J = 16.8, 5.6), 2.20-1.85 (4H, m), 1.70 (1H, m), 1.45 (9H, s). MS (ES +) 539.58 (M-1, 97.9%) 529.59 (100). Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs [3S (1S, 9S)] 5-Azo-3- [6,10-diketo- (9-methanesulfonamido) -1,2,3,4,7,8,9,10-octahydro-611-dapyridine [1,2_3] [ 1,2] Diazapyridine-1-carboxyamidoamino] -4-ketopentanoic acid tert-butyl ester (506b) was prepared in a similar manner to compound 506a. 74% was a yellow-orange solid: mp. 75. (: (decomposition); [not] D20 -92.0 ° (c 0.036, CH2C12); IR (KBr) 3438, 2904, 21 13, 1728, 1669, 1523, 1368, 1328, 1155; 4 NMR (CDC13) β 7.48 (1H, d3 J = 8.1), 5.83-5.68 (1H, m,), 5.55-5.50 (1H, m), 5.43-5.14 (1H, m), 4.83-4.45 ( 3H, m), 3.40-3.19 (1H, m), 2.98 (3H, s), 2.92-2.30 (4H, m), 2.24-1.70 (6H, m), 1.43 (9H, s). __- 574- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 ________ B7 ^ _ 'V. Description of the invention (572) [3S (1S, 9S)] 5_Azo · 3_ [6, ι〇_diketo_ (9_methoxycarbonyl) amino · 1'2,7,4,7,8,9,10-octahydro-611- [1,24] [1,2] Diazapyridine-1-fermentamine &gt; tert-butyl 4-ketovalerate (506c) was prepared in a similar manner to compound 506a. A light yellow foam (405 mg, 82%) was formed: [a] D20 144. (C 0.2, CH2C12); IR (KBr) 3339, 2978, 2958, 21 12, 1728, 1674, 1530, 1459, 1415, 1367, 1274, 1252, 1 154, 1063; 4 NMR (CDC13) d 7.23 (1H , D, J = 8.2), 5.51-5.31 (2H, m), 5-21-5.16 (1H, m), 4.77-4.55 (3H, m), 3.68 (3H, s), 3.35-3.18 (1H, m), 3.04-2.51 (4H, m), 2.40-2.30 (1H, m), 2.09-1.66 (5H, m), 1.45 (9H, s). MS (ES +) 493. [38 (13,98)] 3- (9-Ethylamino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H-da [i, 2-a] [1,2] Diazepine-1-carboxamido) -5-azo-4-ketopentanoic acid tert-butyl ester (506 g), similar to Compound 506a was prepared by 8100 °. [A] D28 -146.7. (C 0.4, CH2C12); IR (KBr) 3438, 2904, 21 13, 1728, 1669, 1523, 1368, 1328, 1 155; 4 NMR (CDC13) d 7.32 (1H, d), 6.43 (1H, d) , 5.50 (1H, s), 5.22 (1H, m), 4.94 (1H, m), 4.77 (1H, m), 4.60 (1H, m), 3.24 (1H, m) , 3.03-2.52 (4H, m), 2.36 (1H, m), 2.10-1.64 (5H, m), 2.02 (3H, s), 1.45 (9H, s). Analysis of C21H20N6O7 calculations: C, 52.69; H, 6.32; N, 17.05. Found 値: C, 52.51; H, 6.27; N, 17.36. MS (ES +) 477 (M +-1,100%) 〇 [3S (1S, 9S) 5-bromo-3- (9-fluorenylamino-6,10-diketonyl-1,2,3,4 , 7,8,9,10-Octahydro-6H-Takeno [l, 2-a] [l, 2] diazepine-1-benzylamino) -4-ketovalerate -Butyl ester (507a). 506a (3.0 g, 5.55 mol) in anhydrous -575- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling this page) Order 541309 Α7 Β7 V. Description of the invention (573) Dichloromethane (40¾ liters) is cooled to OC ', and 30% gas bromic acid in acetic acid (1.1 ml, 5.55 mmol) is added dropwise over 4 minutes. Mixture 0. 〇 Stir the sand for 9 minutes, and then stop with aqueous sodium hydrogen acid solution. The product was extracted with ethyl acetate, washed with aqueous sodium bicarbonate solution, brine, dried (MgS04) and evaporated to give 2.97 g (92%) of a colorless foam ... [WD23-82.3. (C 0.23, CH2CU); IR (KB〇3333, 1726, 1659, 1530, 1458, 1447, 1422, 1395, 1368, 1279, 1256, 1222, 1 155, 728; NMR (CDC13) d 7.81 (2H , m), 7.50 (3H, m), 7.11 (1H: d, J = 8.0), 7.01 (1H, d, J =

7.4), 5.20 (2H, m), 5.00 (1H, m), 4.06 (2H, s), 3.28 (1H, m), 3.20-2.70 (4H, m), 2.42 (1H, m), 2 1 (M · 85 (4H, m), 1.72 (1H m), 1.44 (9H, s). Analysis of the calculation of C26H33N4O7Br. 0.7H2O 値: c, 51.35; H, 5.72; N, 9.24. Measured: C, 51.55; H, 5.52; N, 9.09 3 MS (ES +) 595, 593 (M + + 1). Printed by the consumer cooperation department of the Central Bureau of Standards of the Ministry of Economics (please read the notes on the back before filling in This page} [3S (1S, 9S) 5 · bromo-3- (6,10-diketo-9-methanesulfonamido], 2 3,4 7,8, 9,10-octahydro-611 -Da- [1,24] [1,2] diaza leather minor compound amino group) | tert-butyl ketovalerate (507b), prepared in a similar manner to compound 507a. (68%) Orange foam: [dD20 -135. (C 0.053, CH2C12); IR (KBr) 3429, 2944, 2935, 1723, 1670, 1458, 1408, 1327, 1225, 1154, 991; 4 NMR (CDC13 ) β 7 · 38 (1Η, d, J = 8.2), 5.69 (lH, d, J = 9.3), 5.43-5.34 (lH, m), 5.07-4.97 (lH, m), 4.70-4 · 42 (2H, m), 4.12 (2H, s), 3.35-3.17 (1H, m), 3.10-2.69 (4H, m), 2.98 (3H, s), 2.43-2.33 (1H, m), 2.15-1.65 (5H, m), 1.43 (9H, s). Analysis of the calculation of C20H31Bi * N4O8S 値: C, 42.33; H, 5.51; N, 9.87. Found 値: C, 42.69; H, 5.52; N, 9.97. -576-

This paper size applies to Chinese National Standard (CNS) A4 specifications (2 丨 OX297 male H 541309 A7 B7 V. Description of the invention (574) [3S (1S, 9S) 5-bromo-3- (6,10-diketo- 9- (fluorenyloxycarbonyl) amino-: 1,234 ^ 8,9,10-octahydro-611-0 answer &quot; 1 well and [1,2-3] [1,2] diazafluorene-1 -Amino amine group) 4. Ketovaleric acid third-butyric acid (507c) 'Prepared in a similar manner to compound 507a, which can produce a light yellow foam (320 mg, 78%): [to] 〇〇２〇_107 (C 〇2 CH2C12); IR (KBr) 3401, 2956, 1726, 1670, 1528, 1452, 1415, 1395, 1368, 1276, 1251, 1155, 1064; XH NMR (CDC13) d 7.07 (1H, d, J = 7.6), 5.47 (1H, d, J = 8.1), 5.21 · 5.16 (1H, m) 5.03-4.94 (1H, m), 4.75-4.56 (2 ends, m), 4.06 (2H, s ), 3.69 (3H s), 3.31-3.13 (1H, m), 3.03-2.92 (2H, m), 2.81-2.58 (2H, 2.41-2.31 (1H, m), 2.10-1.66 (5H, m ), 1.44 (9H, s) 〇 [33 (13,93)] 3- (9-acetamido-6,10-diketo-1,2,3,4,7,8,9,1 〇_octahydro-6H-da-phen [1,2-a] [l, 2] diazepine-1-carboxamidotrivaleric acid tert-butyl ester (507g), similar to compound 5 〇7a of Prepared by the method, can produce light yellow foam (84%): [a] D22 -109.6. (C 0.1, ch2Cm. IR (KBr) 3324, 1727, 1659, 1535, 1458, 1444, 1423, i369 1279, 1256, 1223 , 1155; 4 NMR (CDC13) d 7.12 (1H, dj = printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, 7.8), 6.33 (1H, d, J = 7.5), 5.19 (1H, m,), 4 97 (2H, m), 4 58 (1H, m), 4.06 (2H, s), 3.20 (1H, m), 3.05-2.69 (4H, m), 2 35 (1H, m), 2.14 1.68 (5H, m), 2.03 (3H, s), 1.44 (9H, s). Analysis of C21H31BrN4O7.0.3H2O calculation: C, 46.99; H, 5.93; N, ιο44. Found 値: C, 46.97; H, 5.90; N, 10.35. -577- This paper size applies Chinese National Standard (CNS) A4 specification (2 丨 〇 &lt; 297 mm) 541309 Α7 Β7 5. Description of the invention (575 0

R 508a, b 〇

R 284, 285 Compound R 508a 284 :) 5 508b 285 Me Λ Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs [3S (1S, 9S)] 5- (2,6-Digas oxooxydione group_ 9- (methoxycarbonyl) amino-1,2,3,4,7,8,9,10-octahydro_611-Da, Jing De [1,24] [1,2] diaza leather -1-Betaminyl] -4-ketobutyric acid tertiary-butyl g (508a). To a solution of 506c (547¾ g, 1 mol) in DMF (4 liters), add Fluorinated Ginger A (145 mg, 2.5 mmol, 2.5 equiv). After stirring at room temperature for 10 minutes, 2.6-dichlorobenzoic acid (229 mg, 12 mmol, 1.2 equiv) was added. In the chamber After reacting at room temperature for 3 hours, ethyl acetate (30 ml) was added. The solution was washed with a saturated aqueous solution of sodium hydrogen acid (30 ml) and brine, dried over MgS04 and concentrated in vacuo to give 590 mg (90%) of a light yellow color. Foam · [a] D22 -85〇 (c 0.20, CH2C12); IR (KBr) 3400, 2956, 1737, 1675, 1528, 1434, 1414, 1368, 1344, 1272, 1197, 1152, 1061; 4 -578 -This paper size applies to China National Standard (CNS) Α4 size (210 × 297 mm) 541309 Central Standard of the Ministry of Economic Affairs A7 _ B7 printed by Du Bureau's consumer cooperation V. Description of invention (576) NMR (CDC13) cy 7.36-7.33 (3H, m), 7.04 (1H, d, J = 8.0), 5.46 (1H, d, J -7.8), 5.19-5.16 (1H, m), 5.08 (2H, AB), 4.97-4.55 (1H? M), 4.69-4.55 (2H? M), 3.68 (3H, s), 3.30-3.10 (1H ? m), 3.01-2.50 (4H? m), 2.40-2.33 (1H, m), 2.15-1.60 (5H5 m)? 1.44 (9H, s). Analyze C28H34Cl2N4O10i Calculate 値: C, 51.15; H, 5.21; N, 8.52. Found 値: C, 51.35; H, 5.32; N, 8.56. [3S (1S, 9S)] 5- (2,6-dichlorobenzyloxy) -3- [6,10-di Keto-9- (methoxycarbonyl) amino-1,2,3,4,7,8,9,10-octahydro-611-dapono [1,24] [1,2] diaza箪 -1-Carboxylamido] -4-ketovaleric acid (284), synthesized from 508a, using the method of preparing 505 from 504, can produce 330 mg (65%) of a white solid: mp. 115 ° C (decomposition ); [A] D20 -107. (C 0.2, CH2C12); IR (KBr) 3340, 2954, 1738, 1664, 1530, 1434, 1272, 1 198, 1 148, 1060; 4 NMR (d6-DMSO) (ί 8.91 (1H, d, J = 7.2H), 7.67-7.63 (3H, m), 7.54 (lH, d, J = 8.0), 5.24 (2H, s), 5.20-5.15 (lH, m), 4.79-4.70 (1H, m) , 4.46-4.37 (2H, m), 3.58 (3H, s), 3.33-3.20 (1H, m), 2.94-2 · 55 (4H, m), 2.30-1.60 (6H, m). Analyze the calculation of C24H26C12N401 (^ H20: C, 46 · 54; H, 4.56; N, 9.05. Found: C, 46.36; H, 4.14; N, 8.88. [3S (1S, 9S)] 5- (2,6-dimethylfluorenyloxy) -3- [6,10-diketo-9- (fluorenyloxycarbonyl) amino-1,2,3,4,7,8,9,10 -Octahydro_611-thalco [1,24-1,2] diaza leather · 1 · carboxamido] -4-ketopentanoic acid tert-butyl ester (508b) uses a compound such as 508a Prepared by the method, can produce light yellow foam (460 mg, 82%): [a] D22 -115. (C 0.20, CH2C12); IR (KBr) 3413, 2960, 1729, 1675, 1528, 1514, 1461, 1421, 1368, 1265, 1 1 16, 1096; -579-This paper size applies to China National Standard (CNS) Α4 size (210X 297 mm) '(Please read the note on the back first Please fill in this page again for matters) 541309 A7 B7 V. Description of the invention (577) lH NMR (CDCI3) 7.27-7.03 (4H, m), 5.48 (1H, d, J = 8.2), 5.20-5.14 (lH, m), 5.04 (2H, AB), 4.93-4.86 (lH, m), 4.80-4.56 (2H, m), 3.77 (3H, s), 3.22-3.15 (1H, m), 3.00-2 · 56 (4H , M), 2.37 (6H, s), 2.19-1.77 (5H, m), 1.45 (9H, s), 2.41-125 (1H, m). MS (ES +) 617. [3S (1S , 9S)] 5- (2,6-dimethylfluorenyloxy) _3- [6,10_diketo-9_ (methoxycarbonyl) amino-1,2,3,4,7, 8,9,10-Octahydro-611-Da-Feng [1,2-3] [1,2] diaza-p-carboxamido] · 4 · ketovaleric acid (285), similar to Synthesized by compound 284, a white solid (303 mg, 78% p mp U (rc (decomposed); [a] D20 -128 ° (c 0.1, ch2C12); IR (KBr) 3339, 2958 , 1731, 1666, 1529, 1420, 1266, 1248, 1115, 1070; 4 NMR (d6-DMSO) β 8.90 (1H, d, J = 7.4), 7.54 (1H, d, J = 7.9), 7.36-7.28 (1H, m), 7.17-7.14 (2H, m), 5.19-5.15 (3H, m), 4.84-4.74 (1H? M), 4.45-4.37 (2H, m), 3.59 (3H, s), 3.45 -3.25 (1H, m), 2.95-2.64 (4H, m), 2.3 5 (6H, s), 2.30-1.60 (6H, m). Analytical calculations for C26H32N4O10.H2O: c, 53.98; h, 5.92; N, 9.68. Found 値: C, 53.50; H, 5.52; N, 9.49. MS (ES +) 559. Please read the back of the matter before filling in J MM. This page is printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. 0

〇

R 510a, 280, 283, 510d -580- This paper size is applicable. Chinese National Standard (CNS) A4 size (210x297 mm) 541309 A7 B7 V. Description of the invention (578 Compound R 509a 51〇a 509b Q 280 509c ^ ° ΥΊ 283 0 509d 51〇d (Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs [3S (1S, 9S)] 3_ (9_ 芊 醯 amino group · 6, 1〇-diketo_1,2,3,4,7,8,9,10-octahydro-6Η-dapono [l, 2-a] [l, 2] diaza leather-1- Carboxamido) -5- (2-mercapto17saial) -4-ketovaleric acid (51a). A solution of 506a (2.27 g, 4.2¾ mole) in anhydrous digas methane (50 ml) It was treated with 30% hydrobromic acid in acetic acid (1.84 ml, 9.2 mmol, 2.2 eq.) At 0 ° C under nitrogen. After stirring at 0 ° C for 10 minutes, the reaction was complete. A white solid crystallized in the medium. The solid was filtered off and washed with ethyl acetate and diethyl ether to produce 2.20 g (100%) of [3S (1S, 9S)] 5-mo_3_ (9 · benzylamine-6 ， 10-diketo · 1,2,3,4,7,8,9,10-octahydro-6Η · Ta Ping Ⅱ, 24Π1,2,]-diazafluorene- Carboxylamido) -4-ketovaleric acid, can be used without further purification: ^ ~ 1 ^ 11 (06-DMSO) β 8 · 87 (1H, MJ = 7.3), 8.63 (1H, d , J == 7.6), 7.91--581-M-scale standard suitable for financial affairs (CNS) A Zhenge (2IGX297 public holiday) 541309 A7 B7 V. Description of the invention (579) 7.87 (2H, m), 7.60 -7.44 (3H, m), 6.92 (1H, bs), 5.14-5.09 (1H, m), 4.92-4.65 (2H, m), 4.43 (2H, AB), 4.41-4.35 (1H, m), 3.33-3.22 (1H, m), 2.98-2.90 (1H, m), 2.89-2.57 (2H, m), 2.35-2.15 (3H, m), 1.99-1.91 (2H, m), 1.75- 1.60 (2H, m). A solution of Hanone (535 mg, 1 mmol) in anhydrous DMF (10 ml), treated with potassium fluoride (150 mg, 2.5 mmol, 2.5 equivalents) under nitrogen. After stirring for 5 minutes at room temperature, 2-amidoxazole (140 mg, 1.2 mmol, 1.2 equivalents) was added. After overnight reaction, ethyl acetate (150 ml) was added and the organic solution was washed with brine, dried over magnesium sulfate and emptied. The residue was crystallized in monoacetic acid and purified on silica gel using a gradient of MeOH in methane. Evaporation produces 344 mg (60%) of a white solid. Printed by the Consumer Cooperatives of the Central Standards Bureau, Ministry of Economic Affairs: mp. 90-95 ° C (decomposed); 〇] d2〇-82. (C 〇2, ch2C12); IR (KBr) 3328, 2941, 1745, 1659, 1535, 1422, 1276, 1255, 1223, 1072; iH NMR (D6-DMSO ”8.92 (1Η, d, J = 7.6 ), 8.68 (1Η, d, J = 7.6), 7.98-7.90 (2H, m), 7.75-7.67 (1H, m), 7.64-7.50 (4H, m), 5.22-5, 18 (1H, m), 4.95-4.74 (2H, m), 4.58-4.38 (3H, m), 3.52-3.19 (1H, m), 3.05-2.65 (4H, m), 2.40-1 · 50 (6H, m). Analysis of the calculation of C25H27N504S2 * H20: c, 50.75; H, 4.94; N, 11.84. Measured 値 ·· C, 51.34; H, 4.70; N, 11.58. MS (ES +) 572. [3S (1S, 9S)] 3- (9-Yepiamine-6,10-diketo_1,2,3,4,7,8,9,10-octahydro-6H-Hahopen [l, 2_a] [i, 2] Diazepine minor amine group) · 4 • keto small (1-phenyl-1Η-tetrazol-5-thio) valeric acid tert-butyl ester (5 〇9b). 507a (100 mg, 0.17 ¾ mole) in anhydrous dimethylformamidine (15 ml) to phenyl · 1H-tetrazole mercaptan (33 mg, 0.187%) Moore) and potassium fluoride (15 mg, _ -582- This paper size applies to China National Standard (CNS) A4 specification (210 × 297 mm 541309 A7 B7 ~ '------- ____ V. Description of the invention (580) (34.34 mmol). The mixture was stirred at room temperature for 2 hours, diluted with ethyl acetate, washed with aqueous sodium bicarbonate solution (x2), brine, and dried (MgS〇). And evaporated. The product was purified by flash chromatography on silica gel, and acetic acid, chopped, and v_ ~ were removed to form 103 mg (88%) of a colorless foam: [to] 1} 23 -92.2. (C 〇IR (KBr ) 3334, 1726, 1660, 1528, 1501, 1417, 1394, 1368 1279, 1253, 1155; 4 NMR (CDC13) d 7.82 (2Η, m), 7 6〇_

7.40 (8H, m), 7.39 (1H, d, J = 8 · 1), 7.05 (1H, d, J ”3) 5% (1H, m), 5.15 (1H, m), 4.99 (1H, m), 4.60 (2H, m), 4 30 (1H d, J = 17.2H), 3.32 (1H, m), 3.10-2.75 (4H, m), 2.40 (1H, m ) 2.24 (1H, m), 1.90 (3H, m), 1.75 (1H, m), 1.44 (9H, s), MS (ES +) 691.47 (M + + 1). Staff Consumer Cooperatives, Central Bureau of Standards, Ministry of Economic Affairs Printed [: &gt; 8 (13,93)] 3- (9-: ^ 8 Amino-6,10-diketonyl-1,2,3,4,7 8 9 10-octahydro- 6H-Da- [1,2-a] [l, 2] diazafluorene-1-carboxamido) ······· (1-phenyl-1Η-tetrazole-5- Thio) valeric acid (280), synthesized by the method of preparing 505 from 504. 509b (98 mg, 0.142 mmol) was cooled in diqijiakan (1 ml) to 0 ° C, and then trifluoroacetic acid (1 Ml). The mixture was scrambled for 15 minutes at 0, 30 minutes at room temperature, and evaporated under reduced pressure. The residue was triturated with anhydrous toluene and evaporated. Chromatographed on crushed gel and washed with 10% methanol in dichloromethane. Chlorine is dissolved and dissolved to form a colorless glass, which crystallizes from digas methane / diethylamidine to produce 62 mg (69%) of a colorless solid: mp · 145 ° C (decomposed); [a] d22 -80.9 ° (c 0.1, CH2C12); IR (KB〇3400, 1727, 1658, 1530, 1501, 1460, 1445, 1416, 1280, 1254; NMR (CDC13 ) ci 8.00 (1H, m), 7.79 (2H, d, J = 6.7), 7.58-7.30 (9H, m), 5.25 (2H, m), 4.94 (1H, m), 4.53 (2H , M), 4 · 35 (1H, m), 3.35 (1H, _-583-This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (581 m ), 3.01 (3H, m), 2.73 (1H, m), 2.38 (1H, m), 1.98 (4H, m), please read the notes on the back first and then page 1.64 (1H, m). Analytical calculations for c29h30N807S.0 2TFA: c, 53 71; H, 4.63; N, 17.04. Found 値: c, 53.97; H, 4.92; N, 16.77. MS (ES +) 633.55 (M +-1). [3S (1S, 9S)] 3- [9-fluorenylamino-6,10-difluorenyl-1,2,3,4,7,8,9,10-octahydro-6H " [1,2-a] [l, 2] Diazapyridin-1-chitamido] -4-keto-5- (3-pyridyloxy) valeric acid tert-butyl ester (50. 9c), prepared in a similar manner to compound 509b, which can produce a colorless glass (34%): [^] D22 -77. Γ (c 0.25, CH2C12); IR (thin film) 3311, 1724, 1658, 1603, 1578, 1536, 1488, 1458, 1426, 1368, 1340, 1279, 1256, 1231, 1 155, 707; lH NMR (CDC13) 8.29 (2H, m), 7.84 (2H, m), 7.48 (4H, m) , Order 7.22 (3H, m), 5.20 (2H, m), 4.90 (2H, m), 4.58 (1H, m), 3.29 (1H, m), 3.20-2 · 70 (4H , M), 2.38 (2H, m), 1.96 (4H, m), 1.68 (1H, m), 1.42 (9H, s). MS (ES +) 608.54 (M + 1). [3S (1S, 9S) ] 3- [9-fluorenylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-thalco [l, 2-a] [1,2] Diazepine-1-carboxamido] -4-one-5- (3-pyridyloxy) pentanoic acid (283), prepared in a similar manner to compound 280, can be produced Colorless foam, foam (100%): mp · ~ 125 ° C; [&lt; ^] D19 -84.1. (C 0.1, 20% MeOH / CH2Cl2); IR (KBr) 3401, 1736, 1663, 1538, printed by the Consumer Cooperatives of the Central Standards Bureau, Ministry of Economic Affairs, 1489, 1459, 1425, 1281, 1258, 1200, 1134; [H NMR (CD3OD / CDCI3) (ί 8.38 (2Η, m), 7.84-7.40 (8Η, m), 5.16 (4H, m), 4.80 (1H, m), 4.56 (1H, m), 3.50 (1H, m), 3.12 ( 2H, m), 2.82 (2H, m), 2.37 (1H, m), 2.10-1.65 (5H, m). Analysis of the calculation of C27H29N50-8-0.4H20: C, 51.77; H, 4.61; H, 4.61; N, • 584- This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs ) 10.41. Found 値 · C, 52.19; H, 4.93; N, 9.99. [3S (1S, 9S)] 3- [6,10-diketo-1,2,3,4,7,8,9,10-octahydro-9- (phenylcarbonylamino) -6H- Cultivated [1,2-a] [l, 2] diazapyridinylamino] aspartone — 5- {2- [4 (3H)-. Melonone]} Tertiary-butyric acid (5 09d), synthesized in a similar manner to compound 509b, yields a colorless solid (49.6 mg, 82%): ι ¥ ί NMR (CDCI3) 8.02 (1Η , s), 7.95-7.86 (1H, m), 7 84- 7.76 (2H, m), 7.62- 7.35 (4H, m), 7.22-7.07 (1H, m), 6.43 (1H, d), 5.26-5.08 (2H, m), 5.03-4.72 (3H, m), 4.66-4.50 (1H, m), 3.43-3.19 (1H, m), 3.15-2.97 (1H, m), 2.86-2.72 (3H , m), 2.48-2.31 (1H, m), 2.18-1.60 (6H, m), 1.43 (9H, s). [33 (15,93)] 3- [6,10-Diketo-1,2,3,4,7,8,9,10-octahydro-9- (phenyl-t-amino) -6H- [1,2-a] [l, 2] Diazapyridine-1_carboxylic acid group 4-keto-5 · {2- [4 (3 () _ pyrimidone]} valeric acid (510d) Synthesized by a similar method to compound 280, which can produce a colorless solid (25.7 mg, 57%). Mp. 140-80X:; IR (KBr) 3391, 2945, 1733, 1664, 1530, 1422, 1363, 1277, 1259, 1204; lR NMR (CD3OD) ci 8.23 (1H, s), 7.94 (1H, d), 7.87 (2H, d), 7.54 · 7 · 42 (3H, m), 6.48 (1H, d), 5.22 -5.15 (1H, m), 4.57-4.46 (1H, m), 3.62-3.41 (1H, m), 3.22-3.13 (1H, m), 3.02-2.81 (2H, m), 2.70- 1.80 (6H, m). Analytical calculations for C26H28N60.8 · 1.5Η20: C, 54 · 30; H, 5.35; N, 14.61. Found 値: c 54.14; Η, 5.35; N, 13.04. MS (ES +) 551 (M-1, 100%). Accurate mass calculation for C26H29N6 08 (ΜΗ +)): 553.2047. Measured: 553.2080 〇-585- This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) (Read the precautions on the back before filling in this page) Order and leave | (583) Ο Ο

504f-h 505f, 280b, 283b Compound R 504f 505f 504g 280b o, s person '504h 283b Or (Please read the precautions on the back before filling this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 9S)] 5- (3-Gas-2-oxy-4H-pyrido [l, 2-a] pyrimidin-4-one) -3- [6,10-diketo-9- (methylsulfonate Fluorenyl) amino-1,2,3,4,7,8,9,10-octahydro-6H-dacrogen [l, 2-ani, 2] diazepine-1-carboxamido ] -4-ketovaleric acid (505f), in a similar manner to compound 508a, using 507b and 3-chloro-2-hydroxy-4H-pyrido [l, 2-a] pyrimidin-4-one and directly Fluoroacetic acid hydrolyzes 504f to produce a brown powder (65 mg, 30%): [a] D20 -128 ° (c 0.10, -586 · This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the Invention (584) MeOH); IR (KB〇3414, 2928, 1667, 1527, 2459, 1407, 1328, 1274, 1153, 1134; 4 NMR (MeOH ) d 9.35 (1H, d, J = 6.6H), 8.34 (1H, t, J 2 7.2Η), 7.99-7.95 (1H, m), 7.76-7.69 (1H, m), 5.85-5.45 (3H m), 5.30-5.21 (1H, m), 4.93-4.66 (2H, m), 3.81-3.65 (1H, m), 3.66 (3H, m), 3.45-2.52 (4H, m), 2.52-1.71 ( 6H, m). DJ · Hlasta et al., J. Med. Chem. 1995, 38, 4687 · 4692. [3S (1S, 9S)] 3- (6,10-diketo-9-methanesulfonium Amine group 1,2,3,4,7,8,9, 10-octahydro-6H-da-phen [l, 2-a] [l, 2] diazepine small rebel amino group)- 4-keto-5- (1-phenyl-1H-tetrasial-5-thio) valeric acid tertiary-butyl g (504g), prepared in a similar manner to compound 509b, (83%) showed a colorless foam. [A] D23 -112.7. (C 0.2, CH2C12); IR (KBr) 3312, 1726, 1668, 1501, 1413, 1395, 1369, 1328, 1276, 1254, 1155; 4 NMR (CDC13) d 7.59 (5Η, m), 7.48 (1H, d, J = 8.0), 5.68 (1H, d, J = 9.0), 5.37 (1H, m), 4.95 (1H, m), 4.62-4.31 (4H, m), 3.36 (1H, m), 2.98 (3H, s), 2.88 (4H, m), 2.66 (1H, m), 2.42 (2H, m), 1 · 98 (1H, m), 1.75 (1H, m), 1.43 (9H, s) [[3S (1S, 9S)] 3- (6,10-diketo-9-methanesulfonamido- l, 2,3,4,7,8,9, 10-octahydro-6H-daphtho [l, 2-a] [l, 2] diaza leather-1-carboxamidine ) -4-keto-5- (1-phenyl-1H_tetrazol-5-thio) valeric acid (208b), prepared in a similar manner to compound 280 (100%), can produce colorless foam: 11 ^ .120-5. (3; ["]] [) 25 -112.4. (C 0.1, CH2C12); IR (KBr) 3328, 1730, 1664, 1529, 1501, 1410, 1328, 1277, 1219, 1 153, 1134, 991; 4 NMR (CDC13) β 8 · 07 (1H, d, J = 7.8), 7.58 (5H, s), 6.41 (1H, d, J-587- This paper size applies to China National Standard (CNTS) A4 specifications (210X 297mm) (Please read the notes on the back before filling out this page) 541309 Α7 Β7 585 V. Description of the invention = 9.5), 5.32 (1H, m), 5.04 (1H, m), 4.70 (1H, d, J = 17.5), please read the precautions for δ before filling in this page 4.60 (3H, m), 3.50-2.9 (3H, m), 2.98 (3H, s), 2.45 ( 2H, m), 2.06 (4H, m), 1.68 (1H, m). [3S (1S, 9S)] 3- (6,10-diketo-9-methanesulfonamido-1,2, 3,4,7,8,9,10-octahydro-6H-daphno [i, 2-a] [l, 2] diazapyridinylamino) -4-one-5- (3-Pyridyloxy) tert-butyl valerate (504 h), prepared in a similar manner to compound 509b, (24%) was a colorless foam: [a] D23 -101.0. (C 0.2, CH2C12 ); IR (KBr) 3330, 1727, 1669, 1425, 1396, 1369, 1328, 1276, 1256, 1231, 1 155, 1 137, 991; W NMR (CDC13) β 8 · 28 (2H, br d, J = 9.4), 7.71 (1H, d, J = 7.9), 7.22 (2H, s), 6.03 (1H, d , J = 9.4), 5.36 (1H, m), 4.95 (2H, m), 4.52 (2H, m), 3.29 (1H, m), 3.07 (3H, s), 3.23-2.75 (3H, m), 2.66-2.35 (2H, m), 2.30-1 · 60 (5H, m), 1.42 (9H, s). [3S (1S, 9S)] 3- (6,10-diketo- 9-methanesulfonamido-1,2,3,4,7,8,9,1 〇 &quot; &quot; Octa-6H-tower α wells and [1,2-a] [1,2]- Nitrogen> Zero-1-Benzylamino) -4-amidino-5- (3-pyridyloxy) valeric acid (283b), prepared in a similar manner to compound 280, (100%) was a colorless foam: mp. 120 ° C; [a] D25 -85.2. (C 0.1, CH30H / CH2C12); IR (KBr) 3337, 1738, 1667, 1560, 1457, the Consumer Cooperatives of the China Standards Bureau of the Ministry of Economic Affairs 1424, 1326, 1317, 1278, 1258, 1200, 1 189, 1 150, 1 133, 991; 1E NMR (CDCI3 / CD3OD) δ 8.35 (2H, m), 7.54 (2H, m), 5.32 (2H, m), 4.83 (2H, m), 4.45 (2H, m), 3.43-2.77 (4H, m), 2.97 (3H, s), 2.42 (2H, m), 2.05-1.72 (5H, m). -588- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (586) 〇

Ο

R 511c, 280c, 283c Compound 508c 511c 508d 280c 508e 283c

R

Q, s

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs [3S (1S, 9S)] 3- [6,10-diketo-9- (methoxycarbonyl) amino-1,2,3,4,7,8 , 9, 10-Octahydro-6H-da- [1,2-a] [l, 2] diazapyridine-carboxamido] -5- (2-Mirrorylpyridinone-pentyl Acid third-butyl ester (508c), prepared in a similar manner to compound 509b, yields 544 mg (97%) of a light yellow foam: [a] D20 -86. (C 0.19, CH2C12); IR (KBr) 3426 , 2947, 1725, 1669, 1551, 1418, 1383, 1253, 1155, 1064; XH NMR (CDC13) ά 8.49 (2H, d5 J = 4.8), 7.13 (1H, d, J = 7.9), 7.03-6.98 ( 1H, m), -589- (Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 7. Invention Description (587) 5 47 (1H, J = 7 · 9), 5.23-5.19 (1H, m), 5.09-5.01 (1H, m), 4 84-4.51 (2H, m), 4.04 (2H, AB), 3.69 (3H, s), 3.38-3.19 (1H, m) 3.06-2.64 (4H, m), 2.40-1.76 (6H, m), 1.43 (9H, s). Analyze the calculation of C ”H34N6〇8S: C, 51 · 89; H, 5.92; N, 14.52. Found: c 51.49; H, 6.04; N, 13.87. MS (ES +) 579. [3S (1S, 9S)] 3- [6,10-diketo-9- (methoxycarbonyl) amino-1,2,3,4,7,8,9, 10-octahydro-611- And [1,24] [1,2] diazepine-1-carboxamido] -5- (2-mercaptopyrimidine 1.4-ketovaleric acid (5 11 c), similar to compound 280 370¾g (79%) white foam produced by the method: mp · 105 ° C (decomposed); [• 94 ° (c 0 · 20, CH2C12); IR (KBr) 3316, 3057, 2957, 1724, 1664, 1252, 1416, 1384, 1254, 1 189, 1063; ^ NMR (D6-DMSO) ^ 8.85 (1H, d, J = 7.8), 8.62 (2H, d, J = 4.7), 7.53 (1H, d, J = 8.0), 7.28-7.23 (1H, m), 5.21-5.17 (1H, m), 4.87-4.79 (1H, m), 4.47-4.35 (2H, m), 4.23 (2H? AB), 3.58 (3H , s), 3.30-3.21 (1H, m), 2.95-2.50 (4H, m), 2.35-1.60 (6H, m). Analysis of the calculation of C21H26N608S.H20 値: c, 46.66; Η, 5.22; N, 15.55 Measured tritium: C, 46.66; H, 5.13; N, 15.07. MS (ES +) 523, (ES +) 52 [3S (1S, 9S)] 3- [6,10-diketo-9- (formaldehyde) Oxycarbonylamino group) 4,2,3,4,7,8,9,1 0-octahydro-6 sta _ [[1,2, called 1,2] diazapyrene amine group) _4_keto-5_ [5 · (ι · phenyltetrazolyl) sulfur] Tertiary-butyl valerate (508d) was synthesized in a similar manner to compound 509bi to produce a colorless solid (269 mg, 87 ° C / min: called .8 (M10 C; U) D23-108. (C 0.6 〇, CH2C12); IR (KBr) 3315, 2977, 1727, 1688, 1527, 1501, 1458, 1418, 1368, 1279, 125〇, _____-590-This paper standard applies to Chinese National Standard (CNS) A4% i ( 21〇χ297mm-(Please read the notes on the back before filling in this page)

541309 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs V. Invention Description (588) 1155, 1064; XH NMR (CDC13) 7.70 (1Η, d), 7.63-7.53 (5H, m), 5.84 (lH, d), 5.34-5.27 (lH, m), 5.05-4.92 (lH, m), 4.78-4.54 (3H, m), 4.38 (1H, d), 3.66 (3H, s), 3.37- 3.19 (1H, m), 3.07-2.94 (1H, m), 2.91-2.82 (2H, m), 2.71-2.56 (1H, m), 2.40-2.30 (1H, m), 2.19-2.13 (1H, m ), 2.08-1.68 (4H, m), 1.42 (9H, s). MS (ES +) 667 (31%), 645 (M + + 1,100), 589 (62). [3S (1S, 9S)] 3- [6,10_diketo-9- (methoxycarbonylamino) -1,2,3,4,7,8,9, 10-octahydro-6H- Tarpon [l, 2-a] [l, 2] diazapyridine-1-epiamino] -4-one-5- [5- (1-phenyltetrakisyl) -sulfur] Valeric acid (280c), synthesized in a similar manner to compound 280, can produce a light cream-colored solid (203 mg, 85%): 11 ^ 105-130 ° C; [a] D22-235. (C 0.11, MeOH); IR (KBr) 3342, 2951, 1727, 1667, 1529, 1501, 1459, 1416, 1276, 1252, 1 192, 1062; lR NMR (D6-DMSO) δ 8.89 (1H, d) 5 7.69 (5H, s), 7.50 (1H, d), 5.18-5.11 (lH, m), 4.79-4.69 (lH, m), 4.57 (2H, s), 4.42-4.32 (1H, m), 3 54 (3H, s), 2.92-2.63 (3H, m), 2.21-1.82 (5H, m), 1.65-1.57 (1H, m). MS (ES +) 587 (M-1,100%) 〇 [33 (13,95)] 3- [6,10-diketo-9- (methoxycarbonylamino) -1,2,3,4 , 7,8,9,10-Octahydro-611-Da-Phen [1,24] [1,2] Diazapyridine-1-carboxamido] -4-one-5- (3- Pyridyloxy) valeric acid tert-butyl ester (508e), synthesized in a similar manner to compound 509b, can produce a pale orange solid (199 mg, 25%): mp 80-120 ° C; [α] Ό23- 89 ° (c 0.51, CH2C12); IR (KBr) 3333, 2978, 1726, 1669, 1578, 1536, 1478, 1426, 1368, 1277, 1253, 1232, 1 155, 1064; lE NMR (CDC13) 8.41-8.18 (2H, m), 7.81 (1H, d), 7.26-7.20 (2H, s), 5.91 (1H, d), 5.24-5.16 (1H, -591-This paper size applies to the Chinese National Standard (CNS) A4 size (2lOX 297 mm) ^ 41309

5Instructions (589) m) '5.07-4.86 (3H, m), 4.81-4.51 (2H, m), 3.67 (3H, s), 3.34-3.16 (1Η, m), 3.10 -2.81 (3Η, m), 2.72-2.54 (1Η, m), 2.41-2.31 (1H, m), 2.07-1.62 (5H, m), 1.47 (9H s). MS (ES +) 562 (M + + 1, 100%), 506 (38). [3S (1S, 9S)] 3- [6,10-diketo-9- (methoxycarbonylamino) -1,2,3.4,7,8,9,10-octahydro-6 ^! -Taraben [1,24] [1,2] diazapyridine-1-carboxamido] 4-keto-5_ (3-pyridyloxy) valeric acid (283 c), with similar compounds Synthesized by 280 method, white powder (167 mg, 98%) can be generated: mp 90-105 ° C; [a] D22 -106 ° (c 0.11, MeOH); IR (KBr) 3325, 3070, 2956, 1669 , 1544, 1423, 1256, 1199, 1133, 1062; XH NMR (D6- DMSO) d 8.95 (1H, d), 8.45-8.20 (2H, m), 7.53-7.45 (3H, m), 5.19- 5.08 (3H? M)? 4.70-4.62 (1H, m), 4.41-4.30 (2H, m), 3.53 (3H, s), 2.92-2.68 (3H, m), 2.22-2.06 (2H, m), 1.95 · 1 · 82 (2H,: · m), 1.63-1.53 (1H, m). MS (ES +) 506 (M + + 1, 100%). (Please read the notes on the back before filling out this page)

ο ο Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

R -592- This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (59〇) Compound R 512a Q 280d 512b 283d (Please read the precautions on the back before filling in this Page) [3 3 (13,93)] 3- (9-Ethylamido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro_6H- ° Ano [l, 2-a] [l, 2] diazepine-1-carboxamido) -4-one-5- (1-phenyl-1H-tetrazolethio) valeric acid The third butyl ester (512a), prepared in a similar manner as compound 509b, yields (83%) a colorless foam: [a] D23 -129.6. (c 0.1, CH2C12); IR (KBr) 3326, 1726, 1664, 1531, 1501, 1444, 1415, 1394, 1369, 1279, 1254, 1156; 4 NMR (CDC13) d 7.59 (5H, s), 7.37 ( 1H, d, J = 7.9), 6.38 (1H, d, J = 7.4), 5.27 (1H, m), 4.98 (2H, m), 4.58 (2H, d, + m), 4.28 ( 1H, d, J = 17.2), 3.28 (1H, m), 3.10-2.65 (4H, m), 2.31 (2H, m), 2.03 (3H, s), 2.HM.72 (4H, m), 1.48 (9H, s). [3 3 (13,93)] 3- (9-Ethylamido-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H-Dagen Benzodiazepine- 丨 _carboxamido) -4 · keto-5- (1-phenyl-1fluorene-tetrazol-5-thio) valeric acid (280d), prepared in a similar manner as in compound 280 , Which can produce (77%) colorless foam: [a] D22 -93.3. (C 0.1, CH2C12); IR (KBr) 3316, 1728, 1659, 1531, 1501, 1415, 1341, -593- This paper applies the Chinese National Standard (CNS) A4 standard (210X 297 mm). Printed by the Consumers 'Cooperative of the Central Standards Bureau of the Ministry of Education 541309 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A 7 ___B7 V. Invention Description (591) 1278, 1253, 1222, 1185; 4 NMR (CDC13M 8.05 (1H, d, J = 7.9), 7.57 (5H, br s), 5.30 (1H, m), 5.01 (2H, m), 4.70-4.10 (4H, m), 3.40-2.85 (4H, m), 2.62 (lH, m), 2.33 (lH, m), 2.27- 1.65 (5H, m), 2.01 (3H, s) 〇 [3S (1S, 9S)] 3- (9-acetamido · 610- Diketo-12,3,4,7,8,91, octa-rat-611- each? Well and [1,2, &amp;] [1,2,] diazapyridine-1-chitosanamine Triphenyl) -4-netyl-5- (3-pyridyloxy) valeric acid tert-butyl ester (512b), prepared in a similar manner to compound 509b, which can form (9%) a colorless foam: IR ( KBr) 3333, 1727, 1661, 1542, 1427, 1369, 1279, 1257, 1232, 1 156; WNMR (CDC13) d 8 · 30 (2H, m), 7.20 (3H, m), 6.45 (1H ,, d , J = 7.4), 5.17 (lH, m), 4.91 (3H, m), 4.55 (l H, m), 3.27 (lH, m), 3.14-2.70 (4H, m), 2.41 (1H, m), 2.04 (3H, s), 2.HM.64 (6H, m), 1.44 ( 9H, s). [3 3 (15,93)] 3- (9-acetamido-6,10-diketo-1,2,3,4,7,8,9,10-octahydro -6H-da-pheno [l, 2-a] [l, 2] diazepine-1-carboxamido) -4-one-5- (3-pyridinyloxy) pentanoic acid ( 283d), prepared in a similar manner to compound 280, (100%) as a colorless foam: [a] D22 -106.0. (C 0.2, CH3OH / CH2C12); IR (ΚΒγ) 3312, 1735, 1664, 1549, 1426, 1279 , 1258, 1200, 1135; lR NMR (CDC13) d 8.27 (2H, m), 7.46 (2H, m), 5.09 (lH, m), 4.79 (3H, m), 4.47 (lH, m), 3.40 ( lH, m), 3.30-2.70 (3H, m), 2.54 (lH, m), 2.30 (lH, m), 1.98 (3H, s), 2.05- 1.65 (4H, m) 〇-594- This paper Standards apply to China National Standards (CNS) A4 (210X297 mm) 541309 A7 B7

245b V. Description of the invention (592) 24Sb [1S, 9S (2RS, 3S)] 9-Yeamine-N- (24oxy-5-ketotetrahydrofuran · 3-yl) -1,2,3, 4,7,8,9,10-Octahydro-10-keto-61-dioxo [12-^ [12] diazapyridamine (245b), prepared from (1S, 9R) 9-fluorenylamino1,2,3,4,7,8,9,10-octahydro-10-keto-61! -Thalco [1,24] [1,2] diazepine Heterofluorene small carboxylic acid, using method 245, can produce 416 mg (85%) of colorless foam and foam (~ 1: 1 diastereoisomeric mixture) · IR (KBr) 3392, 3302, 2942, 1792, 1642, 1529, 1520, 1454, 1119; XH NMR (CDC13) cj 7.79 (2H, m), 7.51-7.09 (10H, m), 5.52 (0.5H, d, J = 5.3), 5.51 ( 0.5H, s), 5.36 (1H, m), 4.84 (1H, m), 4.74-4.59 (1.5mm, m), 4.51 (1H, m), 4.38 (0.5H, m), 3.22-2.83 (5H, m), 2.51 (1H, m), 2.25 (2H, m), 2.01-1.46 (6H, m). Analysis for C28H32N406 0.775 Calculated Calculated 値 · C, 62.97; H, 6.32; N, 10.49. Found 値: C, 63.10; H, 6.16; N, 10.21. MS (ES +) 521 (M + 1, 100%). [3S (1S, 9S)] 3- (9-fluorenylamino1,2,3,4,7,8,9,10-octahydro-611-da-co- [1,2-a] [l ， 2] —Aza leather-1-jimonamine amino group) -4-ketobutyric acid (2 46b), prepared -595 This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) (please first (Read the notes on the back and fill out this page)

Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Description of the invention (593) Since 245b, the method of 246 can produce 104 mg (33%) of white powder: mp · 115-119Ό; [a] D24 -19.8 0 (c 0 · 2, MeOH); IR (KBr) 3293, 2944, 1786, 1639, 1578, 1537, 1489, 1450, 1329, 1162, 1124; lU NMR (CD3OD) δ 7.85 (2H, d, J = 7.0), 7.49 (3H, m), 5.49 (1H, m), 4.55 (1H, m), 4.30 (2H, m), 3.40 (1H, m), 3.19-2.89 (3H, m), 2 63 (2H, m), 2.16-1.81 (5H, m), 1.60 (3H, m). Analysis of the calculation of C21H26N406 * H20: C, 56.24; H, 6.29; N, 12.49. Found 値 · C, 56 · 54; H, 6.05; N, 12 · 29. MS (ES +) 429 (M-1, 100%). Compounds 513a-j were prepared as described below. Please read the notes of the back © before filling out this page 〇

Compound R 513a 513a-l 513a-2 513b 513b-l KD -596- Printed by the Central Bureau of Standards of the Ministry of Economic Affairs Consumer Cooperatives This paper is sized to the Chinese National Standard (CNS) A4 (210X 297 mm) Invention Description (594) 513b-2 513c. -CD 513d 513e 513f 513f-l 513f-2 &gt; ° v / (Please read the notes on the back before filling this page)

-597- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (595) 0 0 Λ

513h Ο

Ο

(Please read the precautions on the back before filling out this page) Printed by (2RS, 3S) 3- (allyloxycarbonyl) amino · 2 · (2_phenethoxy) _5 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs _ Ketotetrahydrofuran (513a), prepared by the method of compound 513d / e, can form a diastereoisomeric mixture (670 mg, 50%) as an oil: IR (KB〇3331, 2946, 1790, 1723 , 1713, 1531, 1329, 1257, 1164, 1 120, 1060, 977, 937, 701; lK NMR (CDC13) δ 7.36-7.18 (5H? M), -598 This paper size applies to Chinese National Standard (CNS) A4 specifications (210X 297 mm) 541309 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A 7. _ B7_ V. Description of the invention (596) 5.99.5.83 (1H, m), 5.41-5.34 (2H, m) , 5.28-5.18 (2H, m), 4.59-4.56 (2H, m), 4.32-3.96 (2H, m), 3.85-3.73 (1H, m), 3.02-2.76 (3H, m), 2.49-2.34 ( 1H, m). (2RS, 3S) 3- (fluorenylpropoxyzoyl) amino-2-cyclopentyloxy-5-fluorenyltetrahydroanhydrofuran (513b), prepared by the method of 513d / e 8 g (51%) of a diastereoisomeric mixture in the form of a clear oil ... [a] D20 -13 ° (c 0.25, CH2C1 ,). IR (ΚΒγ) 3325, 2959, 2875, 1790, 1723, 1535, 1420, 1328, 1257, 1 120, 1049, 973, 937; 4 NMR (CDC13) d 6.02〇.80 (1H, m), 5 · 53-5 · 46 (2H, m), 5.37-5 · 21 (2H, m), 4.58 (2H, d, J = 5.5), 4.50-4.46 (0.5H, m), 4.34 -4.25 (1H, m), 4.19-4.12 (0.5H, m), 3.06-2.77 (1H, m), 2.53-2.35 (1H, m), 1.85-1.50 (8H, m). Analysis of C13H19N05 Calculated 値: C, 57.98; H, 7.11; N, 5.20. Measured 値: C, 56.62; Η, 7.22; N, 4.95. MS (ES +) 270. (2R, 3S) 3-Association Propoxyalkylamino-2- (nitrogen though-2 -yloxy) -5-copper tetrahydrofuran (513c), synthesized by the method of compound 513d / e, can produce a single isomer (20%) is shallow Yellow oil. ["] D24 _63.1. (C 0.2, CH2C1,); IR (thin film) 3338, 2948, 1791, 1723, 1529, 1421, 1330, 1253, 1 122, 984, 929, 746; NMR (CDC13) ci 7.20 (4H? M), 5.87 (1H, m), 5.61 (1H, d, J = 5.4), 5.33-5.10 (2H, m), 4.70 (1H, m), 4.56 (3H, m), 3.33- 3.19 (2H, m), 3.10-2.94 (2H, m), 2.81 (1H, dd, J = 8.3, 17.3), 2.43 (1H, dd, J = 10.5, 17.3). (2R, 3S) 3 -Fluorenylpropoxycarbonylamino-2 · fluorenyl-5-ketotetrahydrofuran (513d) and (2S, jS) j -caproxylamino-2_fluorenyloxy-5 -fluorenyl-tetra To Zhi Nan (513d / e), after Chapman Biorg. &Amp; Med · Chem. Lett ·, 2, pp. 615 · _ -599- This paper scale is applicable to China National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. 5. Prepared by the method described in the invention description (597) 618 (1992). After extraction with ethyl acetate and washing with NaHC03, the product is dried (MgS04), filtered and evaporated to form Oil, which contains the product and methanol. Add hexane (200 ml) (use 200 ml of each compound in 56 g of AllocAsp (C02tBu) CH2OH) and mix The mixture was stirred; stirred and cooled overnight. This produced an oily solid. The water was decanted off and kept for chromatography. The oily residue was dissolved in ethyl acetate and evaporated to form an oil, which was obtained from 10% acetic acid. Crystallized from ethyl acetate / hexane (~ 500 ml). Solid filtration can produce 513d (12.2 g ^ 19%): mp. 108-110 ° C; [a] D24 + 75.72 ° (c 0.25, CH2C12); IR ( KBr) 3361, 1778, 1720, 1517, 1262, 1236, 1222, 1 135, 1 121, 944, 930, 760; Go NMR (CDC13) d 7.38 (5H, m), 5.90 (1H, m), 5.50 (1H? S), 5.37 (0.5H, m), 5.26 (2.5H, m), 4.87 (1H, ABq), 4.63 (3H, m), 4.31 (1H, m), 3.07 (1H, dd) , 2.46 (1H, dd). Analysis of C15H17N05: c: c, 61.85; H, 5.88; N, 4.81. Found 値: C, 61 · 85; H, 5.89; N, 4.80. The liquids were mixed and evaporated to give an alcohol (~ 200 g). Hexane / ethyl acetate (9: 1, 100 ml) was added and the product was purified by chromatography, and then dissolved with 100/0 ethyl acetate / hexane to remove excess methanol, and then again dichloride Methane / Hexane (1: 1 with 100/0 ethyl acetate). This produces 513e, which contains some 513d (20.5 g, 32%): mp · 45-48 ° C; [PAN] D24-71.26. (C 0.25, CH2C12); IR (KBr) 3332, 1804, 1691, 1536, 1279, 1252, 1 125, 976. 4 NMR (CDC13) β 7 · 38 (5Η, m), 5.91 (1Η, m), 5.54 (1H, d, J = 5.2), 5.38 (3H, m); 4.90 (1H, ABq); 4.60 (4H, m), 2.86 (1H, dd), 2.52 (1H, dd). Analyze the calculation of C15H17NO5S * 0.1H2O 値: C, 61 · 47; h, 5.91; N, (78. Measured 値: C, 61.42; H, 5.88; N, -600- (Please read the note on the back first Please fill in this page again for this matter.) This paper is suitable for Guancai County (CNS) A4 size (mx 297 mm) 541309 A7 — One _____B7 5. Description of the invention (598) 4.81 〇 (2RS, 3R) 3 · (晞Propoxycarbonylamino) -2-ethoxy-5-ketotetrahydrofuran (513f), prepared by the method of 513d / e, can produce a colorless oil (152 mg, 79%): IR (thin film) 3334, 2983 , 2941, 1783, 1727, 1713, 1547, 1529, 1422, 1378, 1331, 1313, 1164, 1122, 1060, 938; 4 NMR (CDC13) β 6.09-5.82 (2H, m), 5.50-5.18 (3H, m), 4.64-4.54 (2H, m), 4.27-4.16 (1H, m), 3.95-3.78 (1H, m)? 3.73-3.56 (1H, m), 3.05-2.77 (1H, m), 2.56- 2.37 (1H, m), 1.35-1.17 (4H, m). Analyze C10H15NO5i to calculate 値: C, 52.40 ;, 6.60; N, 6.11. Measured 値: C, 52.16; H, 6.62; N, 5.99 〇MS (ES + ) 229 (M + + 1,100%). (3S, 4RS) 3- (allyloxycarbonylamino) -4-hydroxy-5- (2-phenoxyfluorenyl chloride) tert-butyl valerate (5 13g). 4-dimethylamine Pyridine (76.0 mg, 622 mmol) was added to a solution of 2-phenoxybenzylhydrazone (579 mg, 2.49 mmol) and 517 (600 mg, 2.07 mmol) in pyridine (10 ml). The mixture was stirred at room temperature for 18 hours, then brine (25 ml) was added and extracted with ethyl acetate (30 X 25 ml). The combined organic extracts were 1 M brine (3 X 25 ml), saturated sodium bicarbonate Aqueous solution (2 X 25 ml) and brine (25 ml) were washed, dried (MgS04) and concentrated. The light orange oil was purified by flash column chromatography (1-Consumption cooperation by the Central Economic and Technical Bureau of the Ministry of Economic Affairs, Du printed 10% Acetone / digas methane) produces 447 mg (44%) of a colorless oil: IR (thin film) 3375, 2980, 1721, 1712, 1602, 1579, 1514, 1484, 1451, 1368, 1294, 1250, 1234, 1161, 1137, 1081,754; 4 NMR (CDC13) d 7.98-7.93 (1H, m), 7.50-7.41 (1H, m), 7.35-7.25 (2H, m), 7.22-7.03 (3H, m), 6.95 ( 3H, d), 5.95-5.76 (1H, m), 5.57 (1H, d), 5.30-5.13 (2H, m), 4.51 (2H, d), 4.25 (2H, d), -601-present Paper size applies Chinese National Standard (CNS) A4 Specifications (210X297 mm) 541309 Α7 Β7 V. Description of the invention (599) 4.18-4.04 (1H, m), 3.88 (1H, m), 3.50 (1H, m), 2.51 (2H, m), 1.41 (9H, s). MS (ES +) 508 (57%), 503 (76), 486 (M + + 1, 45), 468 (27), 412 (100). Accurate mass calculation for C26H32N08 (MH +) 値: 486.2128. Found 値: 486.2158.

(3S, 4R) (N-allyloxyphenyl) -3 · amino-4-hydroxy-5- (1-fluorenylmethyloxy) tert-butyl valerate (513h), prepared from ( 3S, 4R) (N-allyloxycarbonyl) -3-amino-4,5-dihydroxyvaleric acid tertiary-butyl ester produces 562 mg (85%) of a colorless oil in a manner such as 513 g. IR (thin film) 3418, 2980, 1722, 1711, 1512, 1368, 1278, 1245, 1 198, 1 157, 1 139; 2H NMR (CD3OD) cT 8.90 (1H, d, J = 8 · 6 &gt;, 8.21 (1H, dd, J = 1.2, 7.3), 8.04 (1H, d, J = 8.2), 7.89 (1H, dd, J = 1.5, 7.9), 7.67-7.46 (3H, m ), 5.88 (1H, m), 5.49 (1H, d, J = 9.0), 5.35-5.18 (2H, m), 4.57-4.46 (4H, m), 4.19 (2H, m), 2.67 (2H, m), 1.40 (9H, s). Analysis of the calculation of C24H29N07 ·· C, 65.00; H, 6.59; N, 3.16. Measured 値: C, 64.74; H, 6.56; N, 3.09 MS (ES +) 466 (M + Na, 100%), 444 (M + 1, 39), 388 (4). (3S, 4RS) 3- (allyloxycarbonylamino) -4-hydroxy-5 -(3-phenoxybenzyloxy) 3rd-butyric acid (5 13i), synthesized by the method of compound 513g, can produce colorless oil (569 mg, 85%): IR (thin film) 3400 , 1723, 1712, 1584, 1528, 1489, 1443, 1367, 1276, 1232, 1190, 1 161, 1098, 1074, 995, 755; lR NMR (CDC13) (ί 8.65-8.59 (1Η, d), 7.84-

7.66 (2H, m), 7.45-711 (5H, m)? 7.05-6.97 (2H, m), 6.00 ^ 5.78 (1H, m), 5.54-5.14 (2H, m), 4.62-4.52 (2H, m ), 4.42-4.32 (2H, m), 4.08-4.22 (2H, m), 2.78-2.47 (2H, m), 1.44 (9H, s). MS-602- This paper size applies to Chinese National Standard (CNS) Α4 specification (210 × 297 mm) Please read the precautions on the back first and then print 541309 Α7 Β7 printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 600) (ES +) 508 (100%), 486 (M + +1, 33. C26H32N08 (MH +) accurate mass calculation 値 · 486.2128. Found 値: 486.2121. (3S, 4RS) 3- (晞 propoxy Carboxamido) -4_hydroxy-5- (5-methyl-3-phenylisoxalysylhydratyloxy) tert-butyl valerate (513j), synthesized by the method of compound 513g, can be Generates light orange oil (905 mg, 91%): IR (thin film) 3418, 3383, 2980, 1722, 1711, 1601, 1517, 1450, 1424, 1368, 1308, 1252, 1154, 1 100, 994, 767, 698; lU NMR (CDC13) 7.62- 7.55 (2Η, m)? 7.51-7.42 (3Η, m), 5.98-5.76 (1H, m), 5.33-5.18 (2H, m), 4.53 (2H , D), 4.18 (2H, d), 3.91 (1H, m), 3.80 (1H, m), 2.76 (3H, s), 2.50 (2H, m), 1.43 (9H, s). Analyze the calculation of C24H3ON20.8.0.5H2020: C, 59 · 62; Η, 6.46; N, 5.79. Found 値: C, 59 · 46; Η, 6.24; Ν, 5.72. MS (ES +) 497 (100%), 475 (Μ + + 1,15), 419 (48) 〇 (Please read the notes on the back before filling out this page) Staff of the Central Bureau of Standards, Ministry of Economic Affairs Printed by Consumer Cooperatives

-603- This paper size applies to China National Standard (CNS) A4 specifications (210X 297 Gongcheng T 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Α7 Β7 V. Description of the invention (601) (3S, 4R) Tri-butyl 4,5- (dimethylmethyldioxy) valerate (514), prepared according to the method of H. Matsunaga, et al. Tetrahedron Letters 24. pp. 3009-3012 (1983), In pure diastereoisomeric form (60%), as an oil: [a] D23-36 9. (c 05, dichloromethane); IR (thin film) 2982, 2934, 1726, 1455 , 1369, 1257, 1214, 1157, 1068: 4 NMR (CDCl3) d7.31 (5H, m), 4.10 (lH, q, J = 6.0), 4.05- 3.7d (4H, m), 3.10 (1H, q, J = 6.0), 2.40 (2H, m), 1.42 (9H? s), 1.40 (3H, s), 1.34 (3H, s) 〇 (3S, 4R) 3- (allyloxycarbonyl amine ) _4,5- (dimethylmethyldioxy) valeric acid tertiary butyric acid (516). 514 (302 g, 9.00 mmol) and iOXPd / C (300 mg) in ethanol (30 ml) Stir under hydrogen for 2 hours. The suspension was filtered through ceiite (and 0.45 mm / membrane) 'and the mash was concentrated to form a colorless oil 515 (2.106 g, 95%), ready to use Repurification required. The oil (1933 g, 7 88 mmol) was dissolved in water (10 ml), and 1.4-dioxane and sodium bicarbonate (695 mg, 8.27 mmol) were added. The mixture was cooled to 0. Then, allyl chloroformate (1.04 g, 919 ml, 8.66 mmol) was added dropwise. After 3 hours, the mixture was extracted with ether (2 x 50 ml). The mixed ether extracts were taken with water. (2 x 25 ml) and brine (25 ml), washed (MgS04) and concentrated to give a colorless oil. Flash chromatography (10-35% ethyl acetate / hexane) gave a colorless solid (2.69 g, 95 %) ·· mp · 64_50 ° C; [a] D23 -21. (C 1.00, CH2C12); IR (KBr) 3329, 1735, 1702; NMR (CDC13) δ 6.00-5.82 (lH, m), 5.36- 5.14 (2H, m), 542 (lH, s), 4.56 (lH, d), 4.40-4.08 (2H, m), 4.03 (1H, m), 3.70 (1H, m), 2.52 (2H, m) , 1.44 (12H, 2 xs), 1.33 (3H, s); Analysis of cl6H27N06i calculation: C, 58.34; _-604 Vertical Paper Standard for Family Standards (CNS) M Specification * ΠΤ〇χ297 mm) (please first (Read the notes on the back and fill out this page)

541309 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (6Q2 Η, 8.26; N, 4.25 »Found: C, 58.12; H, 8.16; N, 4.19; MS (+ FAB) 320 (M ++ 1, 41%), 274 (70), 216 (100). (] S, 4R) 3- (allyloxycarboxyamino) -4,5-dimerylvaleric acid Ester (517). A solution of 516 (2.44 g, 7.41 mmol) in 80% aqueous acetic acid (25 ml) was stirred at room temperature for 24 hours, then concentrated and azeotroped with toluene (2 x 25 ml). Residue The material was treated with brine (25 mL) and extracted with ethyl acetate (2 X 25 mL). The organic fractions were dried (MgS04) and concentrated to give a colorless oil. Flash chromatography (20-80% ethyl acetate / diethyl ether) Gas methane) can produce a colorless solid (1,99 g, 90%): mp. 74-5X; [a] D25 -1.3. (C 1.0, CH2C12); IR (KBr) 1723, 1691; β NMR (CDC13 ) d 6.02-5.78 (2H, m), 5.35-5.16 (2H, m), 4.55 (2H, d), 4.16-4.04 (2H, m), 2.76 (2H, s), 3.56 (2H, m) ), 2.56 (2H, m), 1.43 (9H, s). Analysis of the calculation of C13H23N0 値: C, 53.97; H, 8.01; N, 4.84. Found 値 ·, C, 53.79; H 7.88; N, 4.81; MS (+ FAB) 290 (M ++ 1, 44%), 234 (100). Example 30 Compound 1 105-1 125 was prepared as follows. Physical data for these compounds are listed in Table 24. • 605- This paper size applies to Chinese National Standard (CNS) A4 (210X 297mm) (Please read the precautions on the back before filling in this page)

541309 A7 B7 V. Description of Invention (603) Printed by the Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs

-606- (Read the notes on the back of the first cabinet and fill in this page) This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of Invention Printed by the cooperative + cn ^ σ \ CsJ ο m VD m L〇〇4 ^-iH rH t-1 2 S; ro rH 3: bu cn CD, keep CNJ t-1 ID CO 00 〇tn rH CsJ K CTk r—lu CO s cvj X ro CM u 〇〇 = Q = om 工 工 d ^ Y ° o 〇 = 0 = ° m 工 〇〇cP 、 z 工 〇 ^ y &gt; ° m &lt; (α λ3 r- o rH rH ω o iH «Η -607- (Please read the precautions on the back before filling this page)

This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (605) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

+ 'C \] r— \ L〇 卜 CNJ L〇r- KD CM in Eh ^ ^ ow cu κ tH-^ CNi rH rH ΛΟ CNJ rH rH ^ -o rH 3: S i iH ld Γ 0 0 engine 〇 00 00 om lu o rH OL〇 Race CN X CNJ CM u 〇LO L〇CM K CN OJ o σ \ 〇in Zhi 04 D: CNJ CM UX 〇 = Q = °. Piece: Worker. ! R. 2-Z rSD 〇 ^ / \ ^ 〇 Z X 〇Q &gt; x λ3 ο ιΗ rH o rH rH fH rH rH rH rH rH Read the% items on the back side first

Completion I

i I Order Difficulty -608- This paper size applies to China National Standard (CNS) A4 (210X 297mm) 541309 A7 B7 V. Description of Invention (606) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

-I s $ CNJ Bu LD 1〇m cn L〇 Dun rH rH 1—1 rH Bu Dan KD iH 1 〇m cn cn L〇Γ0 r- 〇l〇CZ4 or—f 〇to 2 r- CNJ K ro CN 〇 卜 〇to • H CN X eg CM CJ competition. Alas. , Z work orders. , X. Masonry Z X o 04 ιΗ rH r-i m «—1 tH tH -609- (Please read the precautions on the back before filling this page)

This paper size applies to the Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of the invention (607) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

+ S $ X &lt; NJ LD ro VO L〇cu K CM rH CN (N rH 3: 〇in • rrH in ① 'Γ0 o in Ϊ × 4 s (Tk 〇in' Z CMCM 5: Γ0 CN U 〇〇 in 2; c \ i 〇ro CM KC \ J CNJ 〇. Net work \ X o work ZX \ o tH tH tH in rH rH iH -610- (Please read the precautions on the back before filling this page)

The paper scale is applicable to the Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (608) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

+ ^ IS $ X CD CD ΓΟ L〇00 Reference 00 cn in Let A 〇4 tH _ dP -s rH… rH CM fH r-1 S CO in tH in m L〇mt ~~ it〇U4 σ \ s § 04 Γ0 CM o CO 〇L〇σ \ CsJ X CsJ 〇 = 0 = ° Nz X \ X 〇〇 = q ^ 〇〇 ^^ D ° 2: X ♦ VO tH rH tH BU tH rH rH -611- This paper size applies to Chinese National Standard (CNS) A4 (2 丨 0X297mm) Please read the memorandum before reading

541309 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (609) ^ 1 σ \ • 00 00 σ »CNJ o in Η funeral sentence 〇 w σ; ^ ΓΟ rH CN-^ r-1 rH 1 γΗ m ΙΟ νο IT) σ \ buΪ × 4 ο ΙΓ) rH m ffi rH CM o Ο to the ΓΟ ΓΟ C \ J CNJ U and: 工 X 〇 工 ， 〇 = C ^ ° rw 工 〇 ^ ζ'ζ ^ 〇 ° 2 X c? 荽 ω ιΗ rH r-4 σ \ rH tl -612- (Please read the precautions on the back before filling out this page) This paper size applies Chinese National Standard (CNS) A4 specification (210X 297mm) (%) 541309 A7 B7 V. Description of the invention (610 Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

+ CO 3 ΓΟ mm σ \ VCVJ i〇α »x VD ^ VD rH rH t—1 3: S Η-Η σ \ CM CNJ m roro 〇LO t4 00 〇KO rH U CO CM K t-1 CNJ o C \ 〇L〇 芝 CM K CNJ CNJ 〇§x 〇 = 〇 = 〇m 工 ° \ ^ ° vz X o ^ y ^. AT1 O X o = ^ \ = o ΓΗ &quot; u O CM rH iH iH CM ▼ H rH -613- (Please read the precautions on the back before filling this page)

This paper size is applicable to China National Standards (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of Invention (611) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

-614- (Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Description of invention (612) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

+ CO $ S Γ ΟΟ m m VO VO lD piercing order ^ $ funeral ^ W 〇4-^ ΓΟ rH C \ L〇CTk CTi 00 o S ΓΟ LO ref. ΓΟ KD LO m CO inin ΪΧ4 X 1-1 rH 〇 ID CM CM ffi 04 u 00 .〇'Z CNJ iH 〇Γ0 CNJ X rH CNJ u Race ° &lt; h 0-0 ο i 0 o 0 = / V = o 0 o CVJ rH tH in C4 rH tH -615- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) (Please read the notes on the back before filling this page) Order. 541309 A7 B7 V. Description of Invention (613)

Step C Η N-kih 1103.乂 W ·

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 〇 Η

J C〇2t-Bu H N-kiu

O

1104

W · H

J CO ^ HrV 1105-1125 Step A. Synthesis of 401. TentaGelS®NH2 resin (0.25 millimoles / 616- (Please read the precautions on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 A7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (614 g '5.25 g) placed in a porous glass shaker container , And then washed with dimethyl ethyl amine (3 X 15 liters). Compound 400 (136 g, 23 mmol) / combined with DMA (10¾ liters), plus benzobenzotriazole_n, n, n ,, n, _tetramethyl hexafluoro Phosphate (HBTU; 0.88 g, 2.3 mmol) and DIEA (0.8 ml '4.6¾ Mol). The solution was transferred to the resin and $ ml 0 μα was added. The reaction mixture was agitated for 15 hours at 1: 1 using a wrist-arm shaker. Resin was washed / considered and washed with methyl ethyl amine (4 x 1 $ ml). Step B. Synthesis of 1102. Resin 401 was deprotected with 20% (ν / ν) hexahydropyridine / dimethylacetamide (15¾ liters) for 10 minutes (shock) and washed with fresh hexahydropyridine reagent (15 liters) 1 〇minutes. The resin was washed with dimethylacetamide (6 X 1:> t liter), and then with N-methylpyrrolidone (2 x 25 ml). Compound 1 101 (0.979 g, 2.11 mmol) was dissolved in dimethylacetamide (8¾ liters) 'followed by HBTU (0.81 g, 2.1 mmol) and DIEA (0.75 ml, 4.3¾ Mol), The solution was added to the resin, followed by dimethylacetamide (4 ml). The reaction mixture was stirred at room temperature for 2 hours, using a wrist-arm shaker. The resin was operated like 401 to produce 1102. Step C. Synthesis of 1103. This compound was prepared from Resin 10 2 (400 mol) using an Advanced ChemTech 396 Multiple Peptide Synthesizer. The automated cycle included resin, washed with dimethylformamide (2 X 1 ml), and deprotected with 25% (v / v) hexahydropyridine / dimethylformamide (1 ml) for 3 minutes. Fresh reagent (1 ml) was used for 10 minutes to form resin 1103. The resin was washed with dimethylformamide (3 X 1 ml) and N-methylpyrrolidone (3 X 1 ml). Resin 1103 with 0.4M carboxylic acid and 0.4M HOBT in N-methyl p Bihadian _ -617- Table paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) Read the back 5 ί Matters again

Page order spring 541309

615 (0.5¾ liters), 〇4M HBTU in N- 曱 μμ, T-base 17-pyrrolidone (0.5ml) solution, and 1.6M DIEA in N-methylpyrrolidone Γ〇 (Please read the back first Note: Please fill in this page again, and then separate the solution. The solution is triturated, and the reaction is shaken at room temperature for 2 hours. f Ji Bing servant soil reset S &amp; step. Finally, the resin was washed with -chloromethane (5 Xk liters) and dried under air. The aldehyde was dissociated from the resin and was gracefully deprotected with 95% TFA / 5% H20 (v / v, 15 ml) at room temperature for 30 minutes. After the resin was washed with a dissociation reagent (1 ml), the mixed filtrate was added to cold 1: 1 ether: hexane (10 ml), and the resulting precipitate was separated by centrifugation and decantation. The formed agglomerates were dissolved in 10% acetonitrile / 90% Η20 / 0.1% TFA (5¾ liters), and then cold-rolled to dry to obtain crude ιιι ·· 125, which was a white powder. Compounds were purified by semi-preparative RP-HPLC using a Rainin MicrOS OrbTMC18 column (5 microns, 21.4 x 250 mm) with a linear acetonitrile gradient (8% _48%) containing 0% / TFA (v / v) Dissolve at 12 ml / min for 30 minutes. Fractions containing the desired product were pooled and freeze-dried to yield 1105-1 125 (10.8 mg, 63%). Analytical HPLC method: Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (1) Waters DeltaPak C18, 300A (5 microns, 3.9 x 150 mm). A linear acetonitrile gradient (0% -25%) containing 0.1% TFA (v / v) at 1 ml / minute for 14 minutes. (2) Waters DeltaPak C18, 300A (5 microns, 3,9 X 150 mm). A linear acetonitrile gradient (5% _45%) containing 0.1% TFA (v / v) at 1 ml / minute for 14 minutes. -618- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210X297 male foot) 541309 V. Description of the invention 616 〇 tBu〇 n, NH2 Η ♦ tBuO into N Η 259b 〇 〆 〆 、 、, 8 WBn

v O… 〇Βπ tBuO person 0 ^, OtBu 261b 260b CXBu (Please read the precautions on the back before filling this page)

O

262b

O

3- (N'-Third-butoxycarbonylfluorenyl) propionate (250b) was printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs and synthesized by the method from 258 to 259 to produce a waxy solid (87 g , 51%): mp · 54-55eC; IR (thin film) 3324, 2978, 1732, 1713, 1455, 1367, 1277, 1254, 1171; Go NMR (CDC13) β 7.35 (5H, m), 6.15 ( 1H, bs), 5.13 (2H, s), 3.15 (2H, t, J = 6.5), 2.54 (2H, t, J = 6.5), 1.45 (9H, s). Analysis of the calculation of C15H22N203: C, 61.21; H, 7.53; N, 9.52. Found 値: C, 61.29; H, 7.51; N, 9.51. MS (ES +) 295 (M + 1). (3S) 2- (N-2-fluorenyloxyethyl-NI-2-butoxycarbonylhydrazino) carbonylhexahydrodiphenyl dicarboxylic acid 1-fluorenyl 3-third-butyl ester (206b), Synthesized by the method of preparing 260 from 259 to produce a gel (81 g), which can be used without purification for the next 619-This paper size applies Chinese National Standard (CNS) A4 (210X297 mm)

141309 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Description of Invention (617) Steps. Analytical data of pure samples · IR (thin film) 33 丨 8, 2976, 1733, 1451, 1412, 1393, 1366, 1256, 1 161; 4 NMR (CDC13) d 7.34 (10H, m), 6.68 (0.5H, bs), 5.11 (4H, m), 4.63 (0.5H, bs), 4.14 (lH, m), 3.53 (2H, m), 3.08 (lH, m), 2.63 (2H, m), 2.10- 1.60 (4H, m), 1.60-1.35 (19H, m + 2 xs). (38) 2-(&gt;! '-Third-butoxycarbonyl- &gt; 1-2-tetylethylhexyl) carbonyl hexahydrogenation 3-carboxylic acid third-butyl ester (261b), using 260 Synthesized by the method of preparation 261, which can form a gum, which can be purified by flash chromatography (1: 1 ethyl acetate / digas methane) to give the title compound 261b (36.0 g, 79.4% over 2 stages): IR (thin film) 3267, 2979 , 2937, 1728, 1668, 1394, 1369, 1245, 1 159; 4 NMR (CDC13) d 7.6 (1H, bs), 6.8 (1H, vbs), 4.47 (1H, bs), 3.73 (2H, bs), 2.98 (1H, bs), 2.66 (3H, m), 2.04 (1H, bs), 1.84 (1H, m), 1.6-1.2 (21H, m + s) 0 (43) 7-third -Butoxycarbonylamino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-611-dalopano [1,24] [1,2,4 ] Triazale-4-carboxylic acid third-butyl ester (2621)), synthesized by the method of preparing 262 from 261, can produce the title compound 262b, (18.6 g, 54%), as an oil: [沈] D20 +47.7. (C 0.236, CH2C12); IR (thin film) 3291, 2978, 1738, 1727, 1690, 1678, 1439, 1243, 1164; lR NMR (CDC13) ^ 6.59 (1H, s), 5.06 (1H, m), 4.47 (1H, m), 3.85 (3H, m), 2.82 (1H, m), 2.37 (1H, m), 2.22 (1H, m), 1.92 (1H, m), 1.63 (2H , M), 1.48 and 1.46 (18H, 2 xs). MS (ES +) 399 (M + + 1) 〇 (4S) 7-amino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-611- And [1,2-4 [1,2,4] triazafluorene-4-carboxylic acid tert-butyl ester (518). Compound 262 Dagger -620- This paper size is applicable to Chinese National Standard (CNS) A4 specification (2 丨 0X297). (Please read the precautions on the back before filling this page)

F41309 A7 B7 V. Description of the invention (618) (2.43 g, 6.1 mmol) dissolved in 1M hydrogen chloride in ethyl acetate (30 ml), and stirred at room temperature: drop for 20 hours, add solid sodium hydrogen dibasic acid ( 4 g, 46.5 mmol) and 20 ml of water, and the mixture was stirred for 5 minutes and then separated, and the aqueous portion was extracted with ethyl acetate. The combined organic solution was washed with water, saturated salt, dried (MgSO4) and concentrated. Purification by flash chromatography (50% ethyl acetate / dichloromethane to 100% ethyl acetate) gave pure product 518 (1.08 g, 59%) as an unstable oil: [a] D20 +82. (C 0.55, CH2C12); IR (thin film) 333 1 2977, 1731, 1680, 1664, 1439, 1420, 1315, 1158; iHNMR (CDC13) (T5 · 08 (1H, m), 4.48 (1H, m), 3.80 (2H, Abq), 3.70 (2H, bs, exchanged with D20), 3.53 (1H, m), 2.75 (1H, m), 2.30 (2H, m), 1.88 (1H, m), 1.71 ( 2H, m), 1.47 (9H, s).

519 OBn

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

O

This paper size applies to China National Standard (CNS) A4 (210X297 mm) o

-621-(Please read the notes on the back before filling this page)

541309 A7 B7 V. Description of the invention (619) (3S) 1-Phenoxycarbonyl-hexahydroda-phenylcarboxylic acid methyl ester (52). 519 (9.4 g, 35.6 mmol) was suspended in methanol (230 ml) and cooled in an ice bath. Thionyl chloride (3 ml, 4.89 g, 41.1 mmol) was added dropwise over 30 minutes and the mixture was stirred at ambient temperature for 48 hours. The solvent was removed under a vacuum at 30 ° C, and the oily residue was dissolved in ethyl acetate (500 ml). The organic solution was washed with saturated sodium bicarbonate, water, and brine, dried (as §304), and concentrated to give 520 (7.84 g, 79%) as an oil: [to] 02-25.9. (C 0.615, CH2C12); IR (thin film) 2953, 1739, 1703, 1694, 1440, 1403, 1357, 1261, 1241, 1174; XH NMR (CDC13) ^ 7.36 (5H, s), 5.18 (2H, s) , 4.00 (1H, bd), 3.73 (3H, s), 3.55 (1Η, dd), 3.12 (1Η, t), 2.06 (1Η, m), 1.73 (3Η, m). Analysis of the calculation of C14H17N2O4.0.25H2O2: C, 59 · 46; H, 6.59; N, 9.91. Found 値: C, 59.44; H, 6.46; N, 10.09. (3S) 2- (N-2-benzyloxycarbonylethyl.NI-tertiary-butoxycarbonylhydrazino) carbonylhexahydrodihydrodicarboxylic acid 1-fluorenyl 3-methyl ester (521). Using a similar method to 260 above, 521, 96% crude oil can be prepared: [to] D22 -22.16. (C 0 · 25, CH2C12); IR (thin film) 3316, 2976, 2953, 1738, 1726, 1714, 1690, 1367, 1260, 1167; XH NMR (CDC13) ^ 7.25 (10H, m), Central Standard of the Ministry of Economic Affairs Printed by the Bureau ’s Consumer Cooperatives (please read the precautions on the back before filling this page) 6.82 (1H, bs), 5.10 (4H, m), 4.80 (1H, bs), 4.3-3.4 (6H, m) , 3.10 (1H, m), 2.59 (2H, m), 1.95 (2H, m), 1.44 (10H, m + s). 2- (N, -Third-butoxycarbonyl-N-2-carboxyethylfluorenyl) carbonylhexahydroda-methyl 3.carboxylate (522). Using a similar method described in 261 above, it can be made into 522, 92% as a white solid: mp. 146-148 ° C (decomposed); [a] D22 +27.8. (C 0.25, CH2C12); IR (KBr) 3346, 1740, 1710, 1626, 1497, 1290, • 622- mound paper standards are applicable to China National Standard (CNS) A4 specifications (210X297) Printed by the cooperative 541309 A7 ____B7 ________ V. Description of the invention (620) 1250, 1206, 1179, 1159; 4 NMR (CDC13) θ 7.0.6 (1H, bs), 7.5-5.5 (1H, vbs), 4.64 (1H , Bs), 3.76 (5H, m + s), 3.00 (1H, m), 2.70 (3H, m), 2.16 (1H, m), 1.92 (1H, m), 1.56 ( 1H, m), 1.46 (11H, m + s). Analysis of the calculation of C15H26N407: C, 48 · 12; H, 7.00; N, 14.96. Found: C, 48.21; H, 6.96; N, 14.86 MS (ES +) 373 (M_ -1). (4S) 7-Third-butoxycarbonylamino-6,10-diketo-1,2,3,4,7,8,9,10 -Octahydro-611-Tower &quot; 1 well and [1,2-zhuang] [1,2,4] triaza leather-4-folic acid field vinegar (523). 522 (7.15 g, 19.1 mmol ) Dissolved in methane (loo ml) containing dimethylformamidine (0.5 ml) and cooled to 0 ° C. Add thionyl digas (116 ml, 2.61 g, 22 mmol) And N-ethylmorpholine (486 ml, 440 mg, 38.2 mmol) and the mixture was stirred for 2 hours. The organic mixture was washed with 2M sodium bisulfate (50 ml), saturated sodium bicarbonate (50 ml) and brine (50 ml), dried (MgS04) and concentrated .The residue was triturated with ether to produce 523 as a white solid (5.73 g, 84%): mp. 186-1 88 ° C (decomposed); [a] D22 + 65 · 3. (C 0.25, CH2C12); IR (KBr) 3298, 2978, 1750, 1720, 1682, 1658, 1455, 1423, 1369, 1316, 1241, 1212, 1160; 4 NMR (CDC13) β 6.56 (1Η, s), 5.17 (1Η, dd) , 4.48 (1H, bd), 3.81 (3H, m), 3.75 (3H, s), 2.83 (1H, dt), 2.40 (1H, m), 2.28 (1H, m), 1.95 (1H, m), 1.67 (1H, m), 1.47 (9H, s). Analysis of the calculation of C15H24N406.1 / 6H20: C, 50 · 13; H, 6.82; N, 15.59. Found 値: C, 50 · 12; H, 6.71; N, 15.58. MS (ES +) 357 (M +-1,46%), 301 (100%) 〇 (43) 7-amino-6,10_diketo-1,2,3,4,7,8,9, 10-Octahydro-611-Da Geng Bing-623- This &amp; Zhang scale is applicable to China National Standard (CNS) A4 specifications (210X297 mm) — (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (621) [1,2-a] [1,2,4] triazol-4-carboxylic acid methyl ester (524) was synthesized from 523 by the method of preparing 518. Compounds 262a-k can be synthesized by the method for preparing 211b-f. (Please read the notes on the back before filling out this page) Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

262a-k 263a-k compound R 262a 263a OCW 262b 263b 262c 263c or 0M «262d 263d oc 262e 263e CXa 262f 263f cxx H 〇 〇 〇 〇

-624- This paper size applies to China National Standard (CNS) A4 (2 丨 0X297mm)

262g 263g o 262h 263h JX / &quot; H 262i 263i jO1 262j 263j PhS〇2_ · _ 262k 263k cr ^ (4s) 6, i〇-Dibenzyl_7_ (2 · fluorenyl) sulfonamide base central standard Bureau's Consumer Cooperative Co., Ltd. printed hydrogen · 6Η · quoting and answering n, 2-ani, 2,4] triazol-4-carboxylic acid third-butyl ester (262a). 443¾ g (91%) of the title compound is available: called .56-7 ° C; [PAN] D25 + 76 ° (c 0 · 15, CH2C12); IR (KBr) 3429, 2979, 1734, 1675, 1418, 1369, 1339, 1323, 1244, 1164, 665; W NMR (CDC13) d8.45 (lH, s), 8.00-7.59 (7H, m), 4.69-4.65 (lH, m), 4.25-4 · 12 ( 1H, m), 4.10-3.99 (1H, m), 3.73-3.55 (2H, m), 2.40-2.30 (1H, m), 1.99-1.91 (1H, m), 1.82-1 · 62 (2H , M), 1.48-1.46 (2H, m), 1.37 (9H, s). Analyze the calculation of C23H28N406S * H20: c, 54.53; -625- This paper size is applicable to China National Standard (CNS) A4 (210X 297 mm) Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 _'_ 5 Description of the invention (623) H, 5.97; N, 11.06. Found 値: C, 54.60; H, 5.73; N, 10.95. MS (ES +) 489 〇 (43) 6,10-diketo-7- (3-methoxyphenylureido) -1,2,3,4 7,8 9,10-octahydro-6H -Dageno [124 [12,4] triazol-4-carboxylic acid tert-butyl ester (262c). UO mg (80%) of colorless foam can be obtained: ["] D22 +22.6. (C 0.1, CH2C12); IR (KBr) 3316, 1732, 1671, 1609, 1551, 1455, 1432, 1316, 1288, 1245, 1218 , 1 158, 1 122, 1023;! H NMR (CDC13) d 7.16 (4H, m), 6.79 (1H, m), 6.60 (lH, m), 5.11 (1H, m), 4.59 ( 1H, m), 3.89 (2H, m), 3.77 (3H, s), 3.72 (2H, m), 2.85 (1H, m). (4S) 6, 10-diketo-7 · ( 2-methoxyphenylureido) 1,2,3,4,7,8,9,10-octahydro-6Η-dapyridine [i, 2-a] [l, 2,4] tri Aza leather-4-carboxylic acid tert-butyl ester (262d), (81%) was a colorless foam: [none] 〇22 + 37. (C 〇 丄 ch2C12); IR (KBr) 3468, 3446, 3269 , 1734, 1698, 1667, 1609, 1555, 1490, 1461, 1433, 1423, 1296, 1246, 1215, 1 173, 1157, 1028, 756;! H NMR (CDC13) d 8 · 23 (1H, m), 7.95 (1H, s), 6.95 (4H, m), 5.15 (1H, m), 4.60 (1H, m), 3.98-3.65 (4H, m), 3.89 (3H, s), 2.90 ( 1H, m), 2.48 (1H, m), 2.25 (1H, m), 2.05-1.65 (2H, m), 1.48 (9H, s). (4S) 6,10-diketo-1,2, 3,4,7,8,9,10-Octahydro-7-phenylacetamido-6 ^ 1- [1,24] [1,2,4] Third-butyl 4-azatricarboxylic acid 4-carboxylic acid (2626), as a white foamy solid (155 mg, 53%). Mp. 53-7X: ; [a] D22 + 57.4 ° (c 0.1, CH2C12); IR (KBr) 3271, 2978, 1733, 1680, 1437, 1314, 1245, 1156, 4 NMR (CDC13) c? 7.46 (1H, s), _ -626- _ This paper size applies to China National Standard (CNS) A4 specifications (210X29? Mm Γ (Please read the precautions on the back before filling this page)

541309 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs A7 _ B7 V. Invention Description (624) 7.42-7.20 (5H, m), 5.03 (lH, dd), 4.52-4.40 (lH, m), 3.96-3 70 (2H, m), 3.70-3.49 (1H, m), 3.63 (2H, s), 2.92-2.75 (1H, m), 2.43-2.33 (1Η, m), 2.33-2 · 15 (1Η, m), 2.00 · 1 · 50 (3Η, m), 1.45 (9H, s). Analysis of the calculation of C21H28N4O5S.0.25H2O2: C, 59.91; H, 6.82; N, 13.31. Found 値: C, 60.19; H, 6.80; N, 13.30. MS (ES +) 418 (M + + 2, 25%), 417 (M + + 1,100), 362 (9), 361 (45) 〇 (43) 6,10-diketo-1,2,3, 4,7,8,9,10-Octahydro-7- (3-phenylureido) -611-dacrogen [l, 2-a] [l, 2,4] triazale-4- Tertiary-butyl carboxylic acid (262f) as a white solid (273 mg, 93%): mp. 102-6 ° C; [a] D22 +7.5. (C 0.07, CH2C12); IR (KBr) 3320, 2979, 1731, 1676, 1669, 1601, 1549, 1444, 1314, 1240, 1156; XH NMR (CDC13) ά 7.37-7.20 (6H, m), 7.08- 6.98 (1H, m), 5.12 (1H, dd), 4.64_4 · 55 (1H, m), 4.02-3.78 (2H, m), 3.75-3 · 65 (1H, m), 2.94-2.75 (1H, m), 2.57 earn 2.35 (1H, m), 2.35-2.20 (1H, m), 2.0-1.50 (3H, m), 1.48 (9H, s). Analyze the calculation of C20H27N5O5.0.4H2O 値: C, 56 · 56; H, 6.6Ό; N, 16.49. Found 値: C, 56.89; H, 6.58; N, 16.07. MS (ES +) 419 (M + + 2, 24%), 418 (M + + 1,100), 363 (15), 362 (81), 242 (10) 〇 (4S) 6,10_diketo-7 -(Oxindole-2-carboxamido) -1,2,3,4,7,8,9,10-octahydro-6 £ [-Dageno [1,24] [1,2,4 ] Terza-4-carboxylic acid tertiary-butyl ester (262§), (13 g) as a white solid (298 mg, 70%): mp. 138-43 ° C; [a] D23 +69 8 ° (c 0.1, CH2C12); IR (KBr) 3282, 2978, 1733, 1664, 1536, 1421, 1310, 1156, 748; 4 NMR (CDC13) d 9.67 (1H, s), 9.53 (1H, s ), 7.50 (1H, d), 7.30-7.15 (2H, m), 7.10-7.00 Please read the precautions before reading

Fill in ^ I page I order -627- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 5. Description of the invention (625) ( 1H, m), 6.93 (1H, s), 5.16-5.12 (1H, m), 4.60-4.50 (1H, m), 4.05-3.85 (2H, m), 3.85-3.70 (1H, m), 3.05-2.90 (1H, m), 2.55-2.35 (1H, m), 2.35-2.20 (1H, m), 2.00-1.85 (1H, m), 1.85-1.50 (2H, m), 1.47 (9H , S). Analysis of the calculation of C22H27N5O5.0.45H2O 値: C, 58 · 77; H, 6.36; N, 15.58. Measured 値 · C, 59.14; H, 6.24; N, 15.18. MS (ES +) 433 (M + + 2, 26%), 442 (M + + 1, 100), 387 (17), 386 (79), 285 (20), 229 (85), 211 (26), 185 ( 15), 183 (57), 139 (9) 〇 (4S) 7-[(4-acetamido) amido] -6,10-diketo-1,2,3,4,7 , 8,9,10-octaargon-611-daphtho [1,24] [1,2,4] triazapyrene-4-carboxylic acid tert-butyl ester (262h) as a white solid (325 (Mg, 73%): mp 209-12X; [a] D24 +62.4. (C 0.2, CH2C12); IR (KBr) 3513, 3269, 2980, 1731, 1680, 1653, 1599, 1531, 1314, 1158; ^ NMR (CDC13) 9.40 (lH, s), 8.75 (lH, s), 7.72 (2H, d), 7.47 (2H, d), 5.15-5.05 (1H, m), 4.55-4.45 (1H, m), 4.05-3.70 (3H, m), 3.00-2.80 (1H, m), 2.45-2.35 (1H, m), 2.30-2.15 (1H, m), 2.10 (3H, s), 2.00-1.80 (1H, m), 1.80-1.50 (2H, m), 1.48 (9H , S). Analysis of the calculation of C22H29N506: C, 57.51; H, 6.36; N, 15.24. Measured 値: C, 57.41; Η, 6.38; Ν, 15.12 〇MS (ES +) 461 (NT + 2, 26%), 460 (M + + 1,100), 405 (12), 404 (55 ), 354 (7), 285 (23), 229 (52), 183 (22) 〇 (4S) 6,10-diketo-7 · (4-methoxyamidoamino) _octahydro- 6H-Daphtho [l, 2-aHl, 2,4] triazine-carboxylic acid tert-butyl ester (262i), as a white glassy solid (76%): mp · 85-9 ° C; [a] D25 +66.4. (C 0.11, CH2C12);, -628- This paper size applies to China National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling this page)

i 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (626) IR (KBr) 1732, 1668, 1607, 1502, 1440, 1312, 1295, 1258, 1176, 1157, 1025;! H NMR (CDC13) (ί 8.25 (1H, s)? 7.77 (2H, m), 6.90 (2H, m)? 5.11-5.07 (1H, m), 4.55-4.48 (1H, m), 4.01-3.91 (2H, m), 3.86-3.78 (1H, m), 3.785 (3H, s), 2.98 (1H, m), 2.46-2.40 (1H, m), 2.26-2.20 (1H, m), 2.05-1.80 (1H, m), 1.70-1.64 (2H, m), 1.48 (9H, s). (43) 6,10-diketo-1,2,3,4,7,8,9,10-octahydro -7-Phenylsulfonylamino-6H-dalopano [l, 2-a] [l, 2,4] triazol-4-carboxylic acid tert-butyl ester (262j), white Crystalline solid (79%): mp · 182-3 ° C (decomposed); [a] D22 +92.1. (C 0.4, CH2C12); IR (KBr) 3283, 1732, 1684, 1448, 1430, 1404, 1369 , 1338, 1306, 1285, 1242, 1169, 1091,692; W NMR (CDC13) d 7.89 (2H, d, J = 7.4), 7.76 (1H, s), 7.64-7 · 49 (3H, m), 4.83 (1H, m), 4.35 (1H, brd, J = 13.0), 4.00 (1H, m), 3.74-3 · 63 (2H, m), 2.39- 2.26 (2H, m), 2.06 (1H, m), 1.50-1.41 (10 H, m). Analyze C19H26SN406i to calculate 値 · C, 52.04; H, 5.98; N, 12.78. Found 値: C, 52.11; H, 5.95; N, 12.71. MS (ES +) 437 (M +-1,100% ). (3S) (7- (4-Methoxyphenyl) carbonylamino-6,10-diketonyl-1,2,3,4,7,8,9,10-octahydro-6H- Dagen [l, 2-a] [l, 2,4] triazapyridin-4-carboxylic acid tert-butyl ester (262k), (83%): [a] D22 +42.3. (C 0.11 , CH2C12); IR (KBr) 3287, 2997, 2935, 1735, 1681, 1606, 1501, 1296, 1248, 1173, 1155. 4 NMR (CDC13) d 9.23 (1H, s), 7.73 (2H, d ), 7.38 (5H, m), 6.85 (2H, d), 5.08 (1H, m), 5.02 (2H, s), 4.48 (1H, bd), 4.15-3.65 (3H, m), 2.96 (1H, m), 2.45-2.10 (2H, m), 1.88 • 629- This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page) 541309 A 7 B7 V. Description of the invention (627) (1H, m), 1.63 (2H, m), 1.48 (9H, s). MS (ES + 509 (M ++ 1). Compounds 263a-k were synthesized by the method of preparing 212b-f. (43) 6,10-diketo-7- (2-fluorenylsulfonyl) amino-1, 2,3,4,7,8,9,10-Octahydro-611-Da-Feng [1,24] [1,2,4] triazafluorene-4-carboxylic acid (2633), 348 mg ( 94%) as a white foamy solid: mp. [A] D21 + 171 ° (c 0.056, CH2C12); IR (KBr) 3426, 3233, 2953, 1734, 1663, 1481, 1415, 1340, 1214, 1167, 1132 , 1075, 668; lR NMR (CDC13) d 8.44 (1H, s), 8.00-7.60 (7H, m), 4.85-4.83 (1H, m), 4.25-4.00 (1H, m), 4.07 surface 3.90 (1H , M), 3.70-3.46 (2H, m), 2.38-2.30 (1H, m), 2.12- 2.01 (1H, m), 1.91-1.83 (1H, m), 1.46-1.26 (1H, m), economic Printed by the Consumer Standards Cooperative of the Ministry of Standards and Standards (please read the precautions on the back before filling this page) 1.13- 1.06 (1H, m), 0 · 90-0 · 77 (1H, m). MS (ES +) 431 (43) 7- (Benzo [1)] phene-2-carbonyl) amino-6,10-diketo-1,2,3,4,7,8,9,10-octahydro- 6H-daparo [1,2- &amp;] [1,2,4] triazol-4-carboxylic acid (2631)). 200 mg (100%) as a white solid. mp · 155 ° C; [a] D20 -13. (C 0.07, CH2C12); IR (KBr) 3431, 2935, 1734, 1663, 1531, 1435, 1292, 1177; 1U NMR (CDC13) ci 9.73 (1H, bs), 7.73-7.27 (5H, m), 5 35-5 · 25 (1H, m), 4.56-4.48 (1H, m), 4.05-3.65 (3H, m), 3.12-3.00 (1H, m), 2.50-2.45 (1H, m), 2.30- 2.20 (1H, m), 2.10-2.00 (1H, m), 1.75-1.61 (2H, m). MS (ES +) 401. (43) 6,10-diketo-7- (3-methoxyphenylureido) -1,2,3,4,7,8,9,10-octahydro-6H-thalcoin [ 1,2-a] [1,2,4] triazol-4-carboxylic acid (263c), 216 mg (100 +%) was a colorless foam: [to] 〇23 32 · 5 ° (c 〇 · ι, CH2C12); IR (KBr) 3326, 1730, 1661, 1610, 1555, 1495, 1431, 1314, 1288, 1217, 1175, 1161; Go NMR (CDC13) d 7.87 (1H, s), 7.58 ( 1H, s), -630-This paper size applies to Chinese National Standard (CNS) A4 (210X 297mm) 541309 A7 B7 V. Description of the invention (628) 7.19 (2H, m), 6.82 (1H, m) , 6.62 (1H, m), 5.21 (1H, m), 4.55 (1H, m), 3.76 (3H, s), 4.0-3.65 (4H, m), 2.85 (1H, m), 2.35 (2H, m), 1.75 (1H, m), 1.71 (2H, m). (43) 6,10-diketo-7- (2-methoxyphenylureido) &gt; 1,2,3,4,7,8,9,10-octahydro-6H-da-bond [ l, 2-a] [1,2,4] triazol-4-carboxylic acid (263d), (100 +%) was a colorless foam: [to] D24 +11.7. (c 0.1, CH2C12); IR (KBr) 3394, 3325, 1666, 1603, 1543, 1490, 1463, 1438, 1329, 1311, 1292, 1249, 1214, 1176, 1119, 1024, 752; β NMR (CDC13) d 8 · 15 (1H, m ), 7.97 (2H, m), 7.15-6.84 (3H, m), 5.29 (1H, m), 4.62 (1H, m), 4.04-3.65 (4H, m), 3.89 (3H, s ), 2.92 (1H, m), 2.50 (1H, m), 2.30 (1H, m), 2.10-1.75 (2H, m). (43) 6,10-diketo-1,2,3,4 , 7,8,9,10-octahydro-7-phenylethylfluorenyl-amino-6H-dapono [1,2- &amp;] [1,2,4] triazale-4- Carboxylic acid (2636) as a white foamy solid (117 mg, 98%): 11 ^ .109-14 ° 0 :; [to] 1) 24 + 82.6 ° (. 0.06, CH2C12); IR (KBr) 3700 -2250 (br), 3437, 3274, 2959, 1733, 1664, 1481, 1437, 1310, 1177; lU NMR (CDC13) ά Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back first) Fill out this page) 7.99 (1H, s), 7.40-7.15 (5H, m), 5.15-5.10 (1H, m), 5.25-4.70 (1H, bs), 4.50-4.35 (1H, m), 3.95-3.50 (3H, m), 3.61 (2H, s), 2.93- 2.78 (1H, m), 2.40-2.20 (2H, m), 2.10 · 1 · 80 (1H, m), 1.80-1.60 (2H, m). Analysis of the calculation of C17H20N4O5S.lH2O 値: C, 53.96; Η, 5.86; N, 14.81. Found 値: C, 54.12; H, 5.50; N, 14.68. MS (ES +) 360 (M +, 21%), 359 (M +-1,100), 196 (14), 182 (14), 111 (7). (4S) 6,10-diketo-1,2,3,4,7,8,9,10-octahydro-7- (3-phenylureido) -6--631-paper size Applicable to China National Standard (CNS) A4 specification (210X 297 mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 _ B7__ V. Description of the invention (629) ] Triazol-4-carboxylic acid (263 °, to give a white foamy solid (199 mg, 92%): mp 149-52X :; [from] D24 +92.0. (C 0.01, CH3OH); IR ( KBr) 3700-2300 (br), 3319, 2956, 1726, 1664, 1600, 1548, 1500, 1444, 1313, 1238, 755; 4 NMR (D6-DMSO) β 8.90 (1H, s), 8.24 ( 1H, s), 7.42 (2H, d), 7.30-7.20 (2H, m), 7.00-6.90 (1H, m), 4.98-4.92 (1H, m), 4.32-4.22 (1H, m), 3.80-3.55 (3H, m), 2.85-2.70 (1H, m), 2.30-2.20 (1H, m), 2.20-2.00 (1H, m), 1.90-1.35 (3H, m). Analysis C16H19N505 · 0.75H2O Calculated 値: C, 51.26; H, 5.51; N, 18.68. Measured 値: C, 51.11; H, 5.23; N, 18.42 〇MS (ES +) 361 (M +, 20%), 360 (M X-1, 100), 241 (11), 240 (89), 196 (15), 175 (29), 111 (12). (4 S) 6,10-diketo-7- (pyridin-2-carboxamido) -1,2,3,4,7,8,9,10-octahydro- Jingbo [l, 2- a] [l, 2,4] Triaza-derivative-4-guinic acid (263g) as a white solid (259 mg, 92%): mp · 248-51X :; [a] D24 +94.0. (c 0.01 , CH3OH); IR (KBr) 3700-2300 (br) 3341, 2956, 1738, 1668, 1651, 1529, 1425, 1311, 1259, 751; lR NMR (D6-DMSO) d 13.29 (1H, bs), 11.72 (1H, s), 10.64 (1H, s), 7.65 (1H, d), 7.45 (1H, d), 7.26-7.15 (1H, m), 7.17 (1H, s), 7.10-7.00 (1H, m ), 5.05-4.95 (1H, m), 4.40-4.25 (1H, m), 3.90-3.50 (3H, m), 2.88-2.75 (1H, m), 2.38-2.20 (1H, m) , 2.20-2.00 (1H, m), 1.90-1.35 (3H). Analysis of C18H19N5O5.0.5H2O calculation: C, 53.59; H, 5.25; N, 17.35. Found 値: C, 53 · 66; H, 4.88; N, 17.11. MS (ES +) 385 (M +, 23%), 384 (M +-1,100), 298 (6), 253 (8), 227 (10), 199 (23), 196 (10), 173 (9) , 126 (21). -632- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297mm)

541309 A7 B7 V. Description of the invention (63〇) (4S) 7-[(4-Ethylamido) amido] -6,10-diketo-1,2,3,4,7,8 , 9, 10-octagas-6H-tahau [l, 2-a] [l, 2,4] triazol-4-metanoic acid (263h) as a white solid (282 mg; 99%) : mp 210-5 ° C; [WD24 +74.5. (c 0 · 01, CH3OH); IR (KBr) 3700-2300 (br), 3444, 3316, 2960, 1664, 1599, 1531, 1439, 1301, 1184; 4 NMR (D6-DMSO) d 13.30 (1H, bs), 10.50 (1H, s), 10.25 (1H, s), 7.80 (2H, d), 7.68 (2H, d), 5.00-4.90 (1H, m), 4.35-4.25 (1H, m), 3.90 -3.40 (3H, m), 2.88-2.70 (1H, m), 2.35-2.25 (1H, m), 2.25-1.95 (1H, m), 2.08 (3H, s), 1.95-1.35 (3H, m) . MS (ES +) 403 (M +, 10%), 402 (M +-1,100), 358 (10), 247 (10), 227 (16)), 219 (51), 198 (12), 184 (17 ). (4S) 6,10-diketo · 7_ (4-methoxybenzylamido) -octahydro-6H-dalopano [l, 2-a] [l, 2,4] triaza leather -Carboxylic acid (263i), a white glassy solid (about 100%), can be used without further purification: VH NMR (CDC13) d 9 · 23 (1H, s), 7.72 (2H, d, J = 8,8), 6.81 (2H, d, J = 8.9), 5.22 (1H, m), 4.51 (1H, m), 3.97-3.72 (2H, m), 3.81 (3H, s ), 3.03 (1H, m), 2.5 · 1-2 · 46 (1H, m), 2.3 · 1-2 · 25 (1H, m), 2.03 (1H, m), 1.72 (2H, m) 0

(4S) 6,10-diketo-l, 2,3,4,7,8,9,10-octahydro-7-phenylsulfonamido-6H-thalco [1,24] [ 1,2,4] triazol-4-carboxylic acid (263 ′) as a white solid (100%): mp · 73-83 ° C; [dD22 +104.7. (C 0.3, CH2C12); IR (KBr) 3600-2500 (br) 3208; 1734, 1666, 1481, 1448, 1416, 1338, 131 1, 1214, 1171, 1091, 729, 689; 4 NMR (CDC13) d 7.87 (3H, m), 7.70-7.50 (3H, m), 7.16 (1H, brs), 4.99 (1H, m), -633- This paper size applies to China National Standard (CNS) A4 specifications (210X 297 mm) Please read the notes on the back before printing on the page of the Consumers' Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs

Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Description of Invention (631) 4.37 (1H, brd, J = 12.8), 3.92 (1H, m), 3.67 (2H, m), 2,36 (2H, m), 2.13 (1H, brd, J = 12.2), 1.56 (3H, m). Analyze C15H18SN4O6 * 0.25CF3CO2Hi and calculate 45: C, 45.31; H, 4.48; N, 13.64. Found 値: C, 45.48; H, 4.71; N, 13.43. MS (ES +) 383 (MH +, 100%). C15H19SN4 06 (MH +) accurate mass calculation 値: 383.1025. Found 値: 383.1007 ° (4S) 7- (4-fluorenoxyphenyl) carbonyl-6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6H · Dageno [l, 2-a] [l, 2,4] triazafluorene-4-carboxylic acid (263k), (100%): mp130-142 ° C; IR (KBr) 3272, 2945, 1738, 1650, 161 1, 1501, 1445, 1309, 1255, 1171; XH NMR (CDC13) ^ 9.35 (1H, s), 7.74 (2H, d), 7.38 (5H, m), 6. · 85 (2H, d), 5.40 (1H, bs), 5.19 (1H, s), 5.02 (2H, s), 4.49 (1H, d), 3.92 (2H, m), 3.68 (1H, m) , 2.99 (1H, bs), 2.43 (1H, bs), 2.22 (1H, bs), 1.99 (1H, bs), 1.68 (2H, bs). O 〇

5251 2631

(4S) 6,10-diketo-7- (3,4-methoxydioxybenzylamino) -1,2,3,4,7,8,9, 10-octahydro-6H- Pyrene [i, 2-a] [1,2,4] triazine + acid methyl ester (SMI), synthesized by the method of preparation 211, can produce a white crystalline solid tincture (3.35 g, 83 %): mp · 214-5 ×:; ㈤D20 + 75 · 2. (C 〇.〇1, CH2C12); IR ___ -634- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling this page)

541309 Central Sample of Ministry of Economic Affairs _Printed by the Consumer Cooperatives of Bureau A7 ______B7_ ___ V. Description of Invention (632) (KBr) 3272, 2955, 1747, 1664, 1610, 1485, 1443, 1265, 1040; iH NMR (CDC13) β 8 66 (1Η, s), 7.32 (1Η, dd), 7.23 (1Η, d), 6.76 (1Η, d), 6.02 (2Η, s), 5.20 (1Η, dd), 4.55-4.45 (1Η , M), 4.03-3.70 (3H, m), 3.78 (3H, s), 3.05-2.88 (1H, m), 2.47_2.35 (1H, m), 2.35-2.20 (1H, m) , 2.10-1.90 (1H, m), 1.85-1.50 (2H? M). Analysis of the calculation of C18H20N4O7.0.5H2O O · C, 52.87; H, 5.06; N, 13.70. Found 値 · C, 52.84; H, 5.00; N, 13.66. MS (ES +) 406 (M + + 2, 20%), 405 (M + + 1,100), 391 (10), 162 (6), H8 (3), 105 (2) 〇 (4S) 6, 10- Diketo-7- (3,4-methoxydioxyamido) -l, 2,3,4,7,8,9,10-octahydro-6H-daphno [l, 2- a] A suspension of [l, 2,4] triazol-4-carboxylic acid (2631), 5251 (3.32 g, 8.2 mmol) in tetrahydrofuran (60 ml) with LiOH.H20 (0.69 g , 16.4 mmol, 2.0 equivalents) in water (20 ml). The resulting mixture was stirred; stirred for 1 hour, concentrated, and the residue was dissolved in water (50 ml). The solution was acidified with 2M NaHS04 and the product was extracted with Et0Ac (100 mL and 50 mL). The combined extracts were washed once with brine (2 x 50 mL), dried (MgS04) and concentrated to give 2631 as a white crystalline solid (2.87 g, 90/0): 11 ^ 154-4. (:; [To]] [) 20 +85.6. (.0′1, CH3OH); IR (KBr) 3700-2300 (br), 3248, 2942, 1733, 1681, 1658, 1648, 1536, 1486, 1440, 1297, 1255, 1037; iHNMR (D6-DMSO) d 13.23 (1H, bs), 10.45 (1H, s), 7.45 (1H, d), 7.35 (1H, s), 7.03 (1H, d), 6.12 (2H, s), 5.00-4 93 (1H, m), 4.35-4.25 (lH, m), 3.0-3.40 (3H, m), 2.95-2.70 (lH, m), 2.40-2.25 (1H, m), 2.15-2.00 (1Ή, m), 1.91-1.40 (3H, m). Analysis -635-___ This paper wave scale is applicable to China National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (633) (317Η18N4〇7 · 0 · 8Η20) calculation: C, 50．45; H, 4.88; N, 13.84. Found: C, 50.80; H, 4.95; N, 13.36. MS (ES +) 390 (M +, 19%), 389 (M +-1,100), 345 (9), 204 (31), 182 (27), 111 (12).

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 264a, c-1 265a, c, d, f 1015, 1018, 1027, 1052, 1056, 1075, 1095

Compound R1 264a 265a H 264c 265c ctV OM · 264d r ^ vV 265d kAcJ 264e 1095 cxx 264f C \ l 265f H -636- This paper size applies to China National Standard (CNS) A4 size (210X297 mm) 541309 Α7 Β7 Ministry of Economy Printed by the Consumer Standards Cooperative of the Central Bureau of Standards 5. Description of Invention (634) 264g 1075 264h 1018 H 264i 1052 264j 1027 cr 264k 1056 xr1 2641 1015 &lt; x / [4S (2S, 3S)] Ν- (2 · benzyloxy -5-keto-tetrahydrofuran-3-yl) -6,10-difluorenyl-7_ (2 · fluorenylsulfonyl) amino-1,2,3,4,7,8,9,10-eight Hydrogen-6! 1-Dagen and [l, 2-a] [l, 2,4] triazol-4-carboxamide (264a), synthesized by the method of compound 213e, can produce a white solid (240 (Mg, 82%) ·· IR (KBr) -637- This paper size applies to China National Standard (CNS) Α4 size (210X297 mm) (Please read the precautions on the back before filling this page) Printed by the Bureau's Consumer Cooperatives 541309 A7 _______ B7 _ ^ __ V. Invention Description (635) 3380, 3066, 2947, 1789, 1750, 1691, 1454, 1417, 1368, 1298, 1262, 1235, 1193, 11 18, 756, 696 ; ! H NMR (D6-DMSO) d 8.59 (m, d, J = 6.8), 8.48 (lH, s), 8.25-8.09 (3H, m), 7.85-7.75 (3H, m), 7.36 (5H, m ), 5.39 (1H, m), 4.21 (2H, AB, J = 14.2), 4.53-4.49 (1H, m), 4.25-4.10 (2H, m), 3.65-3,44 (3H, m), 3 · 13-2 · 99 (1H, m), 2.43-2.16 (1H, m), 1.72-0.72 (7H, m). Analyze C30H31N5008St to calculate 値: C, 57.96; H, 5.03; N, 11,27. Found 値: C, 57 · 28; H, 5.14; N, 10.48. MS (ES +) 622. [4S (2S, 3S)] N- (2-methoxy-5-keto-tetrahydrofuran-3-yl) -6,10-diketo-7- (3-methoxyphenylureido) -1,2,3,4,7,8,9,10-octahydro-611-da-peng [l, 2-a] [l, 2,4] triazafluorene-4-carboxamide ( 264c), prepared in a similar manner as 213e, (55%) showed a colorless foam: mp · 135-40Ό; [a] D22 +59.6. (c 0.1, CH2C12); IR (KBr) 3314, 1790, 1664, 1608, 1543, 1496, 1455, 1428, 1325, 1287, 1250, 1218, 1160, 1 1 18; 4 NMR (CDC13) d 8.00 (1H , D, J = 7.1), 7.66 (1H, s), 7.55 (1H, s), 7.28 (5H, m), 7.14 (2H, m), 6.87 (1H, d), J = 7.4 ), 6.59 (1H, m), 5.42 (1H, s), 4.66 (5H, m), 3.90-3.65 (4H, m), 3.73 (3H, s), 2.98 (2H , M), 2.38 (2H, m), 2.01-1.65 (3H, m). [4S (2S, 3S)] N- (2-methoxy-5-keto · tetrahydrofuran-3-yl) -6,10-diketo-7- (2-methoxyphenylureido) -1,2,3,4,7,8,9,10-octahydro-611-da-phen [l, 2-aHl, 2,4] triazol-1-carboxamide (264d), Prepared in a similar manner to 213e (72%) as a colorless foam: [a] D22 + 21.4. (C 0.1, CH2C12);

IR (KBr) 3302, 1791, 1689, 1678, 1664, 1602, 1536, 1489, 1461, 1437, 1420, 1249, 1119, 1023, 942, 751; 4 NMR _______- 638-_ This paper is applicable to China Standard (CNS) A4 specification (210X 297 mm) (Please read the precautions on the back before filling out this page) 丨 ¾ Order printed by the Central Consumers Bureau of the Ministry of Economic Affairs, Consumer Cooperatives 541309 A7 B7 V. Description of Invention (636) ( CDC13) (J 8.07 (1H, d, J = 7.7), 7.82 (1H, s). 7.68 (1H, d, J = 6. · 7), 7.49 (lH, s), 7.34 (5H, m) , 6.96 (3H, m), 5.47 (1H, s), 4.82 (2H, d + m, J = 11.5), 4.63 (1H, d, J-11.5), 4.49 (2H, m ), 3.85 (4H, s + m), 3.68 (2H, m), 3.01 (2H, m), 2.46 (2H, m), 1.95 (3H, m), 1.57 (1H, m). [4S (2RS, 3S)] N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo_1,2,3,4,7,8,9, 10-Octahydro-7-phenylethylamidoamino-611-dacro [1,2-ani, 2,4] triaza- 4-carboxamide (264e), similar to the preparation of 213e Synthesized by method, a mixture of diastereoisomers can be generated (isomeric · isomeric ratio 9: 1), which is white Glassy solid (128 mg, 78%) · · mp. 10-30. (:; IR (KBr) 3419, 3302, 1793, 1664, 1535, 1421, 1327,! 256, 1 123, 973; lR NMR (D6-DMSO) 10.20 (0.9Η, s), 9.35 (0.1H, s), 8.74 (0.1H, d), 8.49 (0.9H, d), 7.36-7.15 (10H, m), 5.67 (0.9H, d), 5.44 (0.1H, s), 4.85-4.75 (lH, m), 4.74-4.60 (1H, m), 4.77 &amp; 4.63 (2H, dd), 4.30-4.10 (lH, m ), 3.80-3.40 (3H, m), 3.43 (2H, s), 3.10-2 · 40 (3H, m), 2.25-2.15 (1H, m), 2.00-1.35 (4H, m). Analysis of C28H31N5O7 * 0.5H2O calculation: C, 60.21; H, 5.77; N, 12.53. Found 値: C, 60.38; H, 5.83; N, 12.13. MS (ES +) 551 (M + + 2, 33%), 550 (M + + 1, 100), 480 F, 343 (8), 279 (4) 〇 [4S (2RS, 3S)] N- (2 -Benzyloxy-5 · ketotetrahydrofuran-3-yl) -6,10-diketo · 1,2,3,4,7,8,9,10-octahydro-7- (3-benzene Ureido) -611-Da-Chen [1,2- &amp;] [1,2,4] triazol-4-epiamine (264), prepared in a similar manner to compound 213.6, can be produced Pure ipsilateral-isomers, white foam-like solids —___- 639 -_______ This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page )

541309 A7 _ B7 V. Description of the invention (637) (225 mg, 82%): mp. 130-50 ° C; [a] D24 +10.8. (C 0.1, CH2C12); IR (κΒγ) 3316, 1791, 1688, 1676, 1664, 1601, 1536, 1445, 1314, 1242, 973; 4 NMR (D6-DMSO) θ 8 · 84 (1H, s), 8.49 (1H, d), 8.19 (1H, s), 7.45-7 · 18 (9H, m), 7.00-6.90 (1H, m), 5.68 (1H, d), 4.90-4.81 (1H, m), 4.75-4.60 (1H, m), 4.78 and 4.63 (2H, dd), 4.30-4.20 (lH, m), 3.75-3.55 (3H, m), 2.85-2.55 (3H, m) , 2.25-2.15 (1H, m), 2.00-1.35 (4H, m). Analytical calculations for C27H300N607.0.5H20: C, 57.95; H, 5.58; N, 15.02. Found 値: C, 58.12; H, 5.64; N, 14.81. MS (ES +) 552 (M + + 2, 30%), 551 (M + + 1,100), 362 (19), 299 (10), 279 (4). [4S (2S, 3S)] N- (2-benzyloxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-7- (pyridin-2-carboxamido)- 1,2,3,4,7,8,9,10-octahydro-611-da-peng [1,2- &amp;] [1,2,4] diazepine-4-metamine ( 264 £), prepared in a similar manner as compound 213 €, which yields pure contra-isomers as a white solid (284 mg, 80%): mp · 148-53 ° C; 〇] D24 +72.0. (C 0.1, CH2C12); IR (KBr) IR (KBr) 3404, 3295, 1789, 1660, 1536, 1421, 1310, 1260, 1122, 749; lR NMR (D6-DMSO) d 11.72 Employees of Central Bureau of Standards, Ministry of Economic Affairs Printed by Consumer Cooperatives (1H, s), 10.58 (1H, s), 8.73 (1H, d), 7.65 (1H, d), 7.58-7.27 (6H, m), 7.27-7 · 10 (1H, m), 7.17 (1H, s), 7.10-7.00 (1H, m), 5.46 (1H, s), 4.90 · 4 · 85 (1H, m), 4.77 &amp; 4.68 ( 2H, dd), 4.35-4.25 (2H, m), 3.95-3.55 (3H, m), 3.09 (1H, d), 2.95-2.80 (1H, m), 2.47-2.25 (2H, m), 2.10-1.35 (4H, m). MS (ES +) 574 (M +, 35%), 573 (M +-1,100), 384 (16), 383 (69), 341 (23), 327 (12), 267 (13), 200 (22) . -640- The size of this paper is applicable to China National Standard (CNS) A4 (210X297g) 541309 A7 B7 V. Description of the invention (638) Please read the precautions on the back first and then the page [4S (2RS, 3S)] 7 -[(4-Ethylamino) -Ethylamino] -N- (2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10_diketo-1,2,3, 4,7,8,9,10-Octahydro-611-Da-Feng [l, 2-a] [l, 2,4] triazol-4_jimonamine (264h), similar to compound 213 Preparation by e method 'can produce a mixture of diastereoisomeric compounds (ipsilateral: isomeric ratio 9: 1), as a white solid (276 mg, 70%): Order mp. 147-52X :; IR (KBr) 3444, 3304, 1793, 1665, 1602, 1531, 1505, 1423, 1294, 1264, 1 181, 1 123, 966; 4 NMR (D6-DMS〇) d 10.41 (1H, s), 10.22 ( 1H, s), 8.71 (0.1H, d), 8.48 (0.9H, d), 7.78 (2H, d), 7.67 (2H, d), 7.35-7.30 (5H, m), 5.68 (0.9H , d), 5.45 (0 · 1Η, s), 4.88-4.80 (1H, m), 4.75-4.60 (1H, m), 4.77 and 4.63 (2H, dd), 4.30-4.20 (1H, m)? 3.90 -3.50 (3H, m), 3.10-2.50 (3H, m), 2.35-2.20 (1H, m) 5 2.07 (3H, s), 2.05-1.35 (4H, m) . Analysis of the calculation of C29H32N608.1H20: C, 57.04; Η, 5.61; N, 13.76. Found 値: C, 56.79; H, 5.50; N, 13.53. MS (ES +) 594 (M + + 2, 34%), 593 (M + + 1,100), 387 (8), 386 (38), 358 (8), 162 (9). Printed by [4S (2RS, 3S)] N- (2-benzyloxyketotetrahydrofuran-3-yl) -6,10 · diketo-7- (4-methoxy Amino group) -Octaazepine-6Η-4 p wells and [1,2, a] [1,2,4] triazapyrene-4 · carboxamide (264i), similar to the method of compound 213e Preparation, white solid (70)%: mp. 116-118 ° C; IR (KBr) 3315, 2951, 1793, 1664, 1607, 1502, 1258, 1177; ^ NMR (CDC13) d 8 · 07 (1H , S), 7.77 (2H, d, J = 8.6), 7.35 (5H, m), 6.94 (2H, d, J = 8.5), 6.74 (1H), 4.89 (1H, d J = 11.1), 4 · 74 (1H, m), 4.60 (1H, d, J = 11.0), 4.48, 4.41 (1H, 2m), 3.86 (3H, s), 3.79, -641-This paper size applies Chinese national standards ( CNS) A4 specification (2.0 × 297 mm) 541309 A7 B7_ V. Description of the invention (639) 3.71-3.53 (3H, 2m), 2.87 (2H, m), 2.44 (1H, m), 2.18, 1.91 , 1.68 (5H, 3m). [4S (2S, 3S)] N- (2.benzyloxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-1,2,3,4,7,8,9, 10-Octahydro-7-phenylsulfonamido-611-dalopano [1,2-a] [l, 2,4] triazapyridin-4-carboxamide (264j), with similar compounds Synthesized by 213e, it can form foam (88%): [ubi] 024 +74.2 (c 0.36, CH2C12); IR (KBr) 3332, 3235, 1793, 1664, 1537, 1448, 1416, 1337, 1 169, 118, 1092, 940, 690; iH NMR (CDC13) J 7.99 (1H, s), 7.88 (2H, d, J = 6.8), 7.64-7 · 48 (3H, m), 7.34 (5H, s ), 7.13 (1H, d, J = 6.9), 5.39 (1H, s), 4.81 (2H, m), 4.62 (1H, d, J = 11.5), 4.48 (1H, m), 4.33 (1H, m), 3.85 (1H, m), 3.59 (2H, m), 3.03 (1H, dd, J = 7.6, 18.2), 2.49-2.28 (3H, m), 1.94-1.40 (4H, m). Analyze the calculation of C26H29SN50... C, 54.63; H, 5.11; N, 12.25. Found 値: C, 54.42; H, 5.28; N, 11.62. MS (ES +) 572 (MH +, 100%). Accurate mass calculation of C26H30SN5O8 (MH +) 値: 572.1815. Found 値: 572.1802. Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the notes on the back before filling this page) [4S (2RS, 3S)] 7- (4-benzyloxyphenyl) carbonylamino-N- (2 -Benzyloxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-1,2,3,4,7,8,9,10-octahydro-6 only- l, 2-ani, 2,4] triazepine-4-carboxamide (264k), prepared by the method 213e (96%): IR (KBr) 3294, 2946, 1793, 1658, 1606, 1535, 1501, 1248, 1174, 1119. lU NMR (CDC13) (ί 8.91 (1Η, s), 7.85 (3H, m), 7.4 (10H, m), 7.02 (2H, d), 5.35 (1H, s), 5.10 (2H, s), 4 · 8-4 · 3 (5H, m), 4.00 (1H, bs), 3.78 (2H, m), 2.90 (2H, m), 2.5-1.5 (6H, m). ____- 642-_ This paper size applies to the national standard (CNS) A4 specifications (210X 297 mm) ~ 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention ([4S (2RS, 3S)] N -(2-methoxy-5-ketotetrahydrofuran-3-yl) -6,10-diketo-7- (3,4-methyldioxyamidoamine 3,4,7,8, 9,10-Octahydro-611-Tagano [1,24] [1,2,4] triazol-4-carboxamide (2641), prepared in a similar manner to compound 213e, can produce non- Mixture of enantiomeric stereoisomers (Isomeric · Isomeric ratio 1: 1) as a white solid (1.72 g, 71%): mp. 148-60Ό; IR (KBr) 3314, 1780, 1677 , 1658, 1651, 1550, 1485, 1439, 1258, 1 132, 1038, 943; NMR (D6-DMSO) δ 10.39 (1H, s), 8.71 (〇 · 5Η, d), 8. · 49 (0.5H , D), 7.44 (1H, d), 7.42-7.30 (6H, m), 7.03 (1H, d), 6.12 (2H, s), 5.68 (0.5H, d) , 5.45 (0.5H, s), 4.90-4.82 (1H, m), 4.82-4.58 (2.5H, m)? 4.40-4.10 (1.5H, m)? 3.90-3.65 (2H, m), 3.65-3.43 (1H, m), 3.09 (0.5H, dd), 2.90-2.55 (1.5H, m), 2.45-2.10 (2H, m), 2.10-1.35 (4H, m). C28H29N50.9 * 0.2H2 Calculated 値: C, 57.67; H, 5.08; N, 12.01. Found 値: C, 58.01; H, 5.33; N, 11.51. MS (ES +) 581 (M + + 2, 33%), 580 (M +, 100), 374 (9), 373 (48), 345 (12), 261 (4), 239 (7), 149 (9). [3S (4S)] 3- [6,10-diketo-7- (2-fluorenylsulfonyl) amino · 12,3; 4,7 8,9 10-octahydro-6H- [1,2-a] [1,2,4] triazapyrene-4-carboxyamidoketobutyric acid (265a), prepared in a similar manner to compound 265, yielded a white solid (37 mg, 17 %): mp. 126-30 ° C (decomposed); [α] 02 + 30. (C 0.05, MeOH); IR (KBr) 3371, 2935, 1785, 1663, 1538, 1418, 1339, 1 164, 669; 4 NMR (CD3OD) d 8.44 (1H, s), 8.06-7.50

(7H, m), 7.22 (1H, d, J = 8.4), 4.58-4.57 (1H, m), 4.46 · 42 (1H, m), 4.16-4.09 (2H, m), 3.85- 3.50 (3H, m), 2.84-2.78 (1H (Please read the precautions on the back before filling this page)

643- 541309

AT B7 V. Description of the invention (printed by the Consumer Cooperative of the Central Standard Bureau of the Ministry of Economic Affairs, m), 2.64-2.51 (1H, m), 2.44-2 · 15 (2H, m), 1.81-〇 · 89 (4H, m). Analyze the calculation of C23H25N508S.H20: C, 50.27; H, 4.95; N, 12.74. Found 値: C, 50.33; Η, 5.04; N, 12.60. MS (ES +) 530. [3S (4S)] 3- [6,10-diketo-7- (3-methoxyphenylureido) -1,2,3,4,7,8,9,10-octahydro- 6H-Da-Chen [l, 2-a] [l, 2,4] triazepine-4-carboxyamido] -4-ketobutanoic acid (265c), prepared in a similar manner to compound 265, (90%) was a colorless solid: mp · ~ 15CTC (decomposed); [a] D23 +94.8. (C 0.1, 20% MeOH / CH2Cl2); IR (KBr) 3330, 1780, 1660, 1610, 1550, 1495, 1428, 1326, 1287, 1251, 1223, 1160; 屮 NMR (CD3OD) d 7.16 (2H, m ), 6.89 (1H, d, J = 7.8), 4.58 (1H, m), 4.37 (2H, m), 3.76 (6H, s + m), 2.95 (1H, m), 2.67 (1H, m ), 2.33 (1H, m), 2.20-1.85 (3H, m), 1.66 (1H, m) 〇 [3S (4S)] 3- [6,10 · diketo-7- (2-form Oxyphenyladenosyl) _i, 2,3,4,7,8,9,10-octahydro · 6Η-dapyrido [l, 2-a] [l, 2,4] triazinecarboxyl Amido] -4-ketobutyric acid (265d), prepared in a similar manner to 265, (85%) was a colorless solid: mp. 176-85 ° C (decomposed); [a] D23 +11.0. (C 〇 ”, Me〇H); IR (KBr) 3392, 3328, 1784w, 1665, 1603, 1537, 1490, 1462, 1437, 1337, 1290, 1290, 1217, 1177, 1U9, 1〇23; 1HNMR ( CD3OD) ci 8.02 (2H, m), 6.95 (4H, m), 5.05 (1H, m), 4.60 (2H, m), 3.92 (4H, s + m), 3.00 (2H, m), 2 68 (1H, m), 2 39 (1H, m), 2.00 (4H, m), 1.69 (1H, m). [3S (4S)] 3- (6,10-Difluorenyl + 2,3,4,7,8,9 Cetyl octahydroiphenylacetamido-6H-tauh [1,2- &amp;] [1,2,4] Diazapyridine_4 side amine amino · ketobutyric acid (1095), prepared in a similar way to compound 265, can produce a white solid (please read the note on the back first) (Please fill in this page again)

1T #f 644- Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Description of Invention (642) Body (84 mg, 90%): 180-6 ° C; [a] D22 +22.3. (C 0.065, CH3OH); IR (ΚΒγ) 3700-2300 (br), 3287, 1664, 1536, 1425, 1261, 1181; 1U NMR (CD3OD) 7.35-7.20 (5H, m), 5.00-4.90 (1H, m), 4.60-4.50 (1H, m), 4.50-4.10 (2H, m), 3.90-3.50 (3H, m), 3.54 (2H, s), 3.00-2 · 80 (1H, m), 2.80-2.40 (2H, m), 2.35-2.20 (1H, m), 2.20-1.50 (4H, m), MS (ES +) 459 (M + 24%), 458 (M +. 1, 100), 358 (27 ), 175 (9), 149 (7), 137 (12). Accurate mass calculation for C21H26N507 (MH +) 832: 460.1832. Found 値: 460.1840. [3S (4S)] 3- [6,10-diketo-1,2,3,4,7,8,9,10-octahydro-7- (3-phenylureido) -6H- [1,2-a] [l, 2,4] triazapyrene-4-carboxyamido] -4-one-butyric acid (265f), prepared in a similar manner to compound 265, can be produced White foamy solid (130 mg, 88%): mp. 157-62 ° C; [a] D24 +41.7. (C 0 · 1, CH3OH); IR (KBr) 3700-2300 (br), 3325, 1782, 1663, 1547, 1443, 1315, 1242, 1181; 4 NMR (CD3〇D) d 7.40 (2H, dd), 7.35-7.20 (2H, m), 7.06-6.95 (1H, m), 5.05-4.95 (1H, m), 4.64-4.54 (1H, m), 4.50-4.35 (1H, m), 4.35- 4.15 (1H, m), 3.90-3.69 (3H, m), 3.00-2.85 (1H, m), 2.80-2.45 (3H, m), 3.40-1.50 (4H, m). MS (ES +) 460 (M +, 24%), 459 (M +-1, 100), 341 (9), 340 (54), 296 (6), 239 (9). [3 3 (43)] 3- [6,10-Diketo-7- (indole-2-chitamine) _1,2,3,4,7,8,9,10-octahydro- 6H-Da-Chen [l, 2_a] [l, 2,4] triazapyrene · 4_epiamino] ketobutyric acid (1075), prepared by the method of compound 265, can produce a white solid (184¾ G, 83%): mp. 210-5 ° C; | &gt;] D24 +43.9. (C 0.1, CH3OH); IR (KBr) 3700-2300 (br), 3309, 1660, 1537, 1423, 131 1, 1262, • 645 · This paper size applies to China National Standard (CNS) A4 (210X 297) ^) · ^ (Please read the notes on the back before filling in this page)

541309 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 V. Invention Description (643) 1184; 1HNMR (CD3OD) d7.61 (lH, d), 7.45 (lH, d), 7.28-7.15 (1H, m), 7.15-7.00 (1H, m), 7.13 (1H, s), 5.12-4.96 (1H, m), 4.62-4.55 (1H, m), 4.50-4.25 (2H, m), 4.00-3.69 (3H , M), 3.05-2 · 90 (1H, m), 2.80-2 · 30 (3H, m), 2.25-1.50 (4H, m). MS (ES +) 484 (M +, 26%), 483 (M +-1,100), 383 (25), 245 (12), 208 (1 1), 200 (21), 174 (31), 137 (18 ). [3S (4S)] 3- {7-[(4-Ethylamido) benzylamido] · 6, ΐ〇_diketo_i, 2,3,4, 7,8,9,10 -Octahydrop well and [l, 2-a] [l, 2,4] triazine lean amine group} -4-benzylbutyric acid (1018), prepared in a similar manner to compound 265, can produce white Solid (177 mg, 82%): mp. 235-40 ° C; [WD23 +27.3. (C 0.1, CH3OH); IR (KB〇3700-2300 (b0, 3311, 2957, 1662, 1599, 1531, 1318, 1266, 1 182; ^ NMR (CD3OD)) 7.83 (2H, d), 7.69 ( 2H, d), 5.10-4.95 (lH, m), 4.64-4.55 (lH, m), 4.50-4.35 (1H, m), 4.32-4.22 (1H, m), 4.00-3.65 (3H, m), 3.05-2.90 (1H, m), 2.80-2.30 (3H, m), 2.15 (3H, s), 2.15-1.50 (4H, m). Analysis of the calculation of C22H26N608.1.5H20 値: C, 49.90; H, 5.52 ; N, 15.87. Found: C, 50.21; H, 5.41; N, 15.49. MS (ES +) 502 (M +, 28%), 501 (M +-1,100), 401 (8), 218 (4) , 119 (2), 118 (5), 113 (16) 〇 [3S (4S)] 3- [6,10-diketo-7- (4-methoxybenzylamino) -octahydro- 6H-Dageno [1,24] [1,2,4] triazepine-4-carboxyamido] -4-ketobutanoic acid (1052), synthesized by the method of compound 265, can produce white Solid (0.194 g, 100%): mp · 138.142 ° C; | &gt;] D20 +36.3. (C 0.19, CH3OH); IR (KBr) 3434-2962, 1782, 1660, 1607, 1537, 1504, 1441, 1424, __ -646- This paper size applies to China National Standard (CNS) A4 (210X 297mm) (Please read the note on the back first Items and then Complete this page) Ministry of Economic Affairs Bureau of Standards employees consumer cooperatives printed 541309 A7 B7 V. Description (644 invention)

1313, 1293, 1258, 1177; XH NMR (CD3OD) ^ 7.11 (2H, d, J = 8.8), 6.90 (2H, d, J = 8.9), 4.48 (1H, m), 4.34, 4.28 (1H , 2m), 4.15 (1H, m), 3.75 (3H, s), 3.75, 3.70 (3H, m), 2.88, 2.49, 2.28, 2.23, 2.00, 1.86, 1.79, 1.58 (8H, m ).

[3S (4S)] 3- (6,10-diketo-1,2,3,4,7,8,9,10-octahydro-7-phenylsulfonylamino-6H-da Gengben [l, 2-a] [l, 2,4] triazapyridinylamino) · 4-butyric acid (1027), synthesized in a similar manner to compound 265, can form a white foam (88 %): [To] D24 + 22.6 ° (c0.17, MeOH); IR (KBr) 3349, 1789, 1663, 1537, 1448, 1337, 1 169, 1092, 690; 1U NMR (CD3OD) d 7.82 (2H, d, J = 7 · 8), 7.57 (3H, m), 4.74 (1H, m), 4.47 (1H, m), 4.24.4.10 (2H, m), 3.72-3.47 (4H, m) , 2.62-2.48 (3H, m), 2.20 (1H, m), 1.94-1.35 (3H, m). MS (ES +) 480 (M + -1, 100%). C19H24SN508 (MH +) accurate mass calculation 质量: 482.1346. Found 値: 482.1325. [3S (4S)] 3- [6,10-diketone-7- (4-hydroxybenzylamine group 7,8,9,10- octahydro-611-da-pene [1,24] [1, 2,4] triazapyrene-4-benzylamino] -4-ketobutyric acid (1056), prepared by the method of compound 265 (95%): mp. &Gt; 300 ° C; IR (KB〇 3392, 1660, 1610, 1507, 1442, 1280, 1171, 1149, 1133. iH NMR (CD3OD) d 7 · 74 (2H, d, J = 8.7), 6.84 (2H, d J = 8.7) , 4.58 (1H, m), 4.41 (1H, bd, J = 12.6), 4.28 (1H, m), 3.85 (3H, m), 2.98 (1H, m), 2.8-2.3 (3H, m) , 2.3-1.6 (4H, m). [3S (4S)] 3- [6,10-dione-7- (3,4-methyldioxyfluorenylamino) -1,2,3,4 , 7,8,9,10-Octahydro-611-Da-Phen [1,24] [1,2,4] triazol-4-carboxyamido] -4-ketobutanoic acid (1015 ), Prepared by the method of compound 265, to produce a white solid -647- This paper size applies to Chinese National Standard (CNS) A4 specifications (2 丨 0X 297 mm) (Please read the precautions on the back before filling this page)

o

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 B7 V. Description of the invention (645) (142 mg, 58%): mp · 170-5 ° C; [a] D25 +32.7. (C 0 · 1, CH3OH); IR (κΒγ) 3700-2500 (br), 3325, 2969, 1784, 1662, 1485, 1440, 1292, 1258, 1037; 4 NMR (CD3OD) β 7.45 (1H, dd) , 7.32 (lH, d), 6.90 (lH, d), 6.05 (2Hs), 5.10-4.90 (lH, m), 4.62-4.54 (1H, m), 4.45-4.35 (1H, m), 4.33-4.22 (1H, m), 3.95-3.65 (3H, m), 3.05-2.90 (1H, m), 2.80-2.30 (3H, m), 2.20-1.50 (4H, m).

OtBu 526

[3S (4S)] 3_ [7_ (Benzo [b &gt; Sphene-2-carbonyl) amino-6,10-diketo-1,2,3,4,7,8,9,10-eight Hydrogen-611-Da-Chen [1,24] [1,: 2,4] triaza leather] -4-ketobutyrate tertiary-butyl hemicarbazone (526), prepared by the method of compound 502 , Can produce glassy solids: [a] D20 + 34 ° (c 0.13, CH2C12); IR (KBr) 3437, 2929, 1670, 1530, 1428, 1288, 1156; iHNMR (CDC13) δ 10.0 (1H, bs) , 9.74 (1H, bs), 7.93 (1H, s), 7.80-

7.60 (2H, m)? 7.40-7.18 (3H, m), 6.15-5.30 (2H5 bs), 5.00-4.85 (2H, m), 4.50-4.25 (1H, m), 3.95-3.75 (3H, m) , 3.12-2.78 (2H, m), 2.73-1.60 (7H, m), 1.36 (9H, s). Analyze the calculation of C27H34N807SS: C, 52.76; H, 5.58; N, 18.23. Found 値: C, 52.25; H, 5.74; N, 16.30. MS (ES +) 615. [3S (4S)] 3- [7- (Benzo [b &gt; Sphene-2-carbonyl) amino-6,10-diketo- -648- This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) (Please read the notes on the back before filling in this page)

541309 A7 B7 V. Description of the invention Prepared by this method, a white solid (106 mg, π%) can be formed: Bu ^ 22.22.

Me〇H); IR (KBr) 3428, 2944, 1733, 1652, 1532, 1433, 1337, 1288, 1 186; iH NMR (CD3OD) δ 7.95 (1H, s), 7.90-7.85 (2H, m), 7.43-7.35 (2H, m), 4.98 (1H, m), 4.65-4.52 (1H, m), 4.40- 4.20 (2H, m), 3.85-3.70 (3H, m), 3.30-3.25 (3H, m ), 3.03-2.85 (1H, m), 2.70-2.31 (3H, m), 2.10-1.55 (4H, m). MS (ES +) 500 (as methyl acetal of aldehyde). -(Please read the precautions on the back, fill in this page) # · 〇

[4S (2RS, 3S)] 6,10-Difluorenyl-N_ (2-ethoxy · 5-_tetrahydrofuran-3-yl) -7- (3,4-methyldioxyfluorene Fluorenylamino) -1,2,3,4,7,8,9,10-octahydro-611-dajing [1,2-wang] [1,2,4] diaza-1hetero-4 -Betamine (528), prepared by the method of compound 213 €, which can generate a mixture of diastereoisomeric compounds (ipsilateral: isomeric ratio 1: 1), a milky white foamy solid 05 g, 58%): mp. 124-32 ° C; IR (ΚΒ〇3312, 2979, 1790, 1664, 1610, 1532, 1485, 1285, 1120, 1037, 932; 4 NMR (D6-DMSO) θ 10.39 Printed by the Consumer Standards Cooperative of the Central Bureau of Standards (1H, s), 8.71 (0.5H, d), 8.43 (0.5H, d), 7.45 (1H, d), 7.36 (1H, -649) China National Standard (CNS) A4 specification (210X 297 mm) &quot; ~ 541309 B7 V. Description of the invention (647) s), 7 · 04 (1H, d), 6.12 (2H, s), 5.58 (0.5H, d), 5.34 (0.5H, s), 4.95- 4.85 (1H, m), 4.70-4.52 (0.5H, m), 4.35-4.10 (1.5H, m), 3.95- 3.50 ( 5H, m), 3.03 (0.5H, dd), 2.90-2.55 (1.5H, m), 2.46-2.20 (2H, m), 2.10-2.40 (4H, m) 1.16-1.13 (3H, 2 xt). Analysis of C23H27N500.9.0.6H2O calculation: C, 52.29; H, 5.38; N, 13.26. Measured C: 52, 53; H, 5.35; N, 12.78 MS (ES +) 519 (M + + 2, 27%), 518 (M + + 1,100), 472 (7), 374 (12), 373 (53), 345 (14), 149 (12) 3 1 Compound 640,642,645,650,653,655,656,662,668,669,670,671,677,678,681,682,683,684,686, 688a, 688b, 689b, 689b, 690a 690b, 691a, 691b, 695a, 695b, 695c, 692a, 692b, 693 and 694 were prepared as follows. (Please read the notes on the back before filling this page)

OMe

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

OH Η -650- This paper size applies to Chinese National Standard (CNS) A4; ^ (210X 297 mm) 541309 A7 B7 V. Description of the invention (648) (3S) -2-keto-3-amino-5 -Methoxyacetamido-2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-acetic acid methyl ester (638), synthesized from 600a, with compound 60〇a The method of making 602m can produce 2.4 grams of 638 as a white solid. (3S) -2-keto-3- (2-fluorenylene) amino-5-methoxyethylfluorenyl-2,3,4,5-tetrahydro-1H-1,5 · benzo Methyldiaza-1-acetate (639). To a solution of 638 (630 mg, 1.76 mmoles) and 2-¾: methylfluorenyl bromide (428 mg, 1.94 mmoles) in CH3CN, add K2CO3 (608 mg, 4.4 mmoles to the mixture in the environment). Stir at temperature. After 18 hours, the reaction mixture is diluted with CH2C12, washed with water and then brine, dried over Na2S04 and concentrated in vacuo. Flash chromatography (Si02, 0 to 20% EtOAc / CH2Cl2) yields 450 mg of 639 (3S) -3-[(3S) -2-keto-3- (2-fluorenylmethylene) amino-5-methoxyethenyl-2,3,4,5-tetrahydro -111-1,5-Benzodiazepine-1-acetamidinyl] -4-keto-butanoic acid (640), synthesized by the method of 602v and 605v, can produce 205mg of 640, It is a white solid, iHNMR (CDC13) d 2.4-2.55 (m, lH), printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) 2.65-2.8 (m, 1H) , 3.2 (s, 3H), 3.72-3.78 (m, 1H), 3.85-4.0 (m, 2H), 4.22-4.28 (d, 1H), 4.26-4.5 (m, 4H), 4.58-4.75 (m, 1H), 4.78-4.85 (m, 1H), 5.0-5.08 (t, 1H), 7.35-7.65 (m, 7H), 7.85-8 · 02 (m, 4H).

-651-This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 V. Description of the invention (649) (3 5) -3-[(3 3) -2-keto-3- Fluorenylformamylamino-5-methoxyethenyl-2,3,4,5 · tetrahydro-1H-1,5-benzodiazepine-1-acetamidine]- 4-keto-butyrate was taken from (642) and synthesized from 638 by the method of 605m, which yielded 213 mg of 642, 1E NMR (CD3〇D) 2.5 (m, 1H), 2.68 (ddd, 1H), 3.25 ( s, 2H), 3.3 (s, 3H), 3.78 (m, 2H), 4.0 (d, 1H), 4.3 (m, 1H), 4.6 (m, 2H), 4.85 (br · s, 2H), 7.08 -7.22 (m, 2H), 7.35 (m, 1H), 7.4-7.65 (m, 4H), 7.7 (dd, 1H), 8.1 (dd, 1H).

YuCI 600b

OBn

Printed by the Consumers' Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs, 2-Ethylamino-Ethyl Chloride (643). To a suspension of N-acetamidinylglycine (200 g, 1.7 mmol) in CH2C12 (2.5 ml) containing DMF (0.005 ml), grass-based base gas (0.450 ml, 5.1 mmol) was added. Moore). After stirring at ambient temperature for 30 minutes, the mixture was concentrated to give 643, which was a crude product of 0 (3S) -2-keto-3- (1-fluorenyl) amino-5- (2-acetamidine) ) Ethyl, 2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-benzyl acetate (644), to -652- This paper standard applies to China's national standard rate (CNS) A4 specification (210X297 mm) 541309 A7 B7 5. Description of the invention (650) 600b is made from 602d. It is synthesized from 600b, and 643 can be used to generate 112 mg of 644 〇 (3S) -3-[(3S) · 2-keto-3- (1-fluorenyl) amino-5- (2-acetamido) ethenyl-2,3,4,5-tetrahydro · 1fluorene-1,5-benzo Diazepine-1-acetamido] · 4-keto-butyric acid (645), synthesized from 644 by 602d to 605d, can produce 43 mg of 645 as a white solid, iH NMR (CD3 〇D) 0 '1.95 (s, 3H), 2.4 (m, 1Η), 2.65 (m, 1H), 3.4 (s, 1H), 3.55 (m, 1H), 3.85 (m, 1H) , 4.05 (d, 1H), 4.3 (m, 1H), 4.4-4.6 (m, 2H), 5.0 (m, 1H), 7.4-7.7 (m, 6H), 7.86-8.0 (m, 2H) . (Please read the notes on the back before filling this page)

Fmoc

O

Fmoc o

The Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs printed 2- (n · methyl, 643 ,, 'N • thimethoxycarbonyl) aminoacetylammonium chloride (646) to prepare from N-Fmoc -Creatine, which produces 646 as a crude product. w S) -2-Steel n (l-fluorenylmethyl) amino-5- [2- (N-methyl, N · fluorenylmethyl lattice (read 210X297)) 541309 A7 B7 V. Description of the invention (651 ) t II meaning k page oxycarbonyl) amino] ethyl ethyl-2,3,4,5-tetrahydro-111-1,5-benzodiazepine_1_ benzyl acetate (647), from 600b synthesis 6002d method is synthesized from 600b, using 646 can produce 481 mg of 647. (3S) -3-[(3S) -2-keto-3- (1-pentamyl) amino group 5- [2- (N-methyl, fluorenylmethoxycarbonyl) amino] ethyl Fluorenyl-2,3,4,5-tetrahydro-1fluorene-1,5-benzodiazepine-1-acetamidine &gt; 4-keto-butyric acid tert-butyl hemicarbamate ( 648), prepared from 647 by the method of preparing 602d from 602d, and can produce 409 mg of 648. (3S) -3-[(3S) -2 · keto-3- (1-methylformamido) amino-5_ (2-methylamino) ethenyl-2,3,4,5- Tetrahydro-1Η-1,5-Benzodiazepine-1-Ethylamido] 4_ Ketodin Printed base-Third-butyric acid semi-carbamate by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ( 649). A solution of 648 (409 mg, 0.465 mmol) in MeCNiEqNH (4: 1 'v / v) was stirred at ambient temperature. After 45 minutes, the reaction mixture was concentrated in the air. Flash chromatography (si02, 5% to 20% MeOH in CH2C12) yielded 241 mg of 649. (3S) -3-[(3S) -2-keto-3- (2-methylformamidinyl) amino-5- (2-methylamino) ethynyl-2,3,4,5- Tetrahydro-111-1,5-benzodiazepine-1-acetamidinyl] _4-keto-butanoic acid (650) 'is synthesized by the method of preparing 605d from 604 and 649, which can produce 179 mg 650, white solid, 1HNMR (CD3OD) (ί2.4-2.6 (m, 2H), 2.7 (s, 3H), 3.5 (q, 1H), 3.8 (m, 2H), 4.2-4.4 (m, 2H ), 4.3-4.45 (m, 1H), 5.0-5.1 (m, 2H), 7.4-7.7 (m, 6H), 7.85-7.9 (m, 2H), 8.2 (m, 1H).

This paper size applies to China National Standard (CNS) A4 (210X 297 mm)

A Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 ______B7____ V. Description of the invention (652) (3 3) -2-keto-3- (1-methylformyl) amino_5_methylformyl_ 2,3,4,5-Tetrahydro-111-1,5-benzodiazepine-1-acetamidine acetate (652) was synthesized from 600b by the method of preparing 6002 from 600b, using The reagent obtained by reacting DMF and 3 equivalents of grass gas in (: 112 (: 12 solution to R3X) can produce 404 mg of 652., (3S) -3-[(3S) -2-one-3- (1-fluorenylmethylamino) amino-5-methylfluorenyl · 2,3,4,5 · tetrahydro-1 fluorenyl-1,5-benzodiazepine-1-ethylfluorenyl] · 4-keto-butanoic acid (653), synthesized from 652 by the method of preparing 605d from 602d, can produce 84 mg of 653 as a white solid, 1H NMR (CD3OD) β 2.3 (m, 1H), 2.55 (dd, 1H), 3.75 (bi * · s, 1H), 4.25-4.6 (m, 5H), 5.15 (m, 1H), 7.2-7.45 (m, 6H), 7.8-7.9 (dd, 3H), 8.1 (s , 1H), 8.2 (m, 2H).

(jS) -2-_yl_3 · (3,5_diqiyridyl) aminoethylethyl _ 2,3,4,5 · tetrahydrobenzodiazepine- 丨 -acetic acid (654) According to the method for preparing 603d from 600b, 654mg of 654 can be produced from 600b. -655- E-size for CNS M4 (210X297)

(Read the notes on the back before filling in this page J

541309 A7 B7 V. Description of the invention (Fat 3) (3S) _2_keto_3_ (3,5-dioxy_4 · superyl group fluorenyl) amino group_5 · Ethyl-N-[(21 ^, 35) -fluorenyl-5-copperyl-tetrachlorosulfan-3-yl] -2,3,4,5-tetrachloro-111-I, 5-benzodiazepine-1- Acetylamine (655), synthesized from 654 by the method of preparing 213e, can generate 304 mg of 655, 4 NMR (CD3OD) d 2.4 (d, 1H), 2.6-2.75 (m, 2H), 3.0 (m, 1H ), 3.45 (m, 1H), 3.8 (d, 1H), 4.0 (t, 2H), 4.4 (m, 2H), 4.5-4.55 (m, 2H), 7.2-7.45 (m, 4H), 7.85 ( s, 2H) 〇 (3S) -3-[(3S) -2-keto-3- (3,5-digas, 4-hydroxyfluorenyl) amino-5-ethylfluorenyl-2,3 , 4,5-tetrahydro-1 fluorene-1,5-benzodiazepine-1-acetamido] -4-keto-butanoic acid (656), synthesized by a similar method to 2001-2002 Since 655. It produced 136 mg of 656 as a white solid. 4 NMR (CD3OD) β 1.85 (s, 3H), 2.5 (m, 1H), 2.65 (m, 1H), 3.7 (m, 1H), 4.3 (m, 1H), 4.55 (m, 2H), 7.4-7.6 (m, 4H), 7.85 (s, 2H). Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs-656- This paper size applies to the Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (654 HO, 0 Ο 0 0 FmocO- FmocO fl-- FmocO 丄 v 一 ^^ ΌΒη nu 657 658 659

u Ο n ^ Njh2 (Read the precautions on the back before you fill in this page) Printed by the Staff Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs -657 This paper size applies to Chinese National Standard (CNS) A4 (210X29 * 7 mm) 541309 Printed by A7 B7, Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. 5. Description of the invention (655) 2- (S-methoxycarbonyl) glyoxylic acid glycol (657). A solution of ethyl glycolate (6.0 g, 36.1 mmol) in CH2C12, cooled in an ice-water bath, added dimethoxymethoxy chloroformate (14 g, 1.5 equivalents), and diisopropylethyl Amine (9 ml, 1.5 eq). After 1 hour, the reaction mixture was poured into a saturated aqueous solution of vaporized ammonium, and extracted with CH2C12, dried over Na2S04, and then concentrated by air evacuating. The product was triturated from MeOH to give 2.2 g of 65 7 as the first white solid. 2- (S-methoxycarbonyl) acetic acid (658). To a solution of 657 (2.2 g, 5.93 mmol) in tetrahydrofuran was added 5% Pd / C (220 mg). The resulting suspension was stirred vigorously under a hydrogen atmosphere. After 90 minutes, the reaction mixture was filtered through Celite. The filtrate was poured into a saturated aqueous solution of NaHC03 and washed twice with EtOAc. The aqueous layer was reacidified, and the product was extracted twice with CH2C12, dried over Na2S04, and concentrated in vacuo to produce 1.46 g (88%) of 658 as a white solid. 2- (Retylmethoxycarbonyl) ethenyl chloride (659) is prepared from 658 by the method of 643, and can produce 659 as a crude product. (3 5) _3-[(3 5) -2-keto-3- (3,5-dichloro-4-hydroxyfluorenyl) amino-5- (2-mylmethoxycarbonyl) acetamidine 2-_2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-ethoxyamino] -4-keto-butanoic acid tert-butyl (660), synthesized from 660b, and using the method of preparing 604d from 600b, 659 can be used to generate 453 mg of 660 (3S) -3-[(3S) -2-keto-3- (3,5-digas) 4-Hydroxybenzylfluorenyl) amino-5- (2-hydroxy) ethynyl-2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-ethylamine A solution of amino] -4-keto-butyric acid tertiary-butyl hemicarbazone (661), 660 (423 mg) in MeOH: Et2NH (1: 1, v / v) was disturbed at ambient temperature. After a few minutes, the reaction mixture was concentrated under vacuum to produce a small volume. Add diethyl ether to precipitate -658- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (210X297). (Please read the precautions on the back before filling this page.) 丨 Order 541309 Α7 Β7 Employees of the Central Standards Bureau of the Ministry of Economic Affairs Printed by the cooperative V. Description of the invention (656) 230 mg of 661 can be produced. (3S) -3-[(3S) -2-keto-3- (3,5-dichloro-4-hydroxybenzylfluorenyl) amino-5- (2-hydroxy) ethynyl-2,3 , 4,5-tetrahydro-111-1,5-benzodiazepine-1-ethylamine amino] -4-keto-butanoic acid (662), synthesized from -604d by 604 661, yielding 37 mg of 662 as a white solid. OBn * T, PS〇 ^ ONa · 663 ′

〇 -659- This paper size applies Chinese National Standard (CNS), see the standard (210 × 297 mm) 〇 TPSO ^ J ^, 665

OtBu Η ΝΗ2 (Please read the notes on the back before filling out this page) 541309 Printed by A7 B7, Consumer Cooperatives of the China Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (657) 2_ (diisopropylsilyloxy) acetate (663). P-Glycolate (46.91 g, 0.282 mole) and diisopropylethylamine (74 ml, 0423 mole) in CH2C12, cooled in a water bath, and added TIpSOTf (95 g, 0.31 Mol) in CH2C12. The resulting mixture was warmed to ambient temperature and then poured into water, washed twice with a 100/0 NaHS04 aqueous solution, dried over Na2S04 and concentrated in vacuo. Flash chromatography (SiO2, 0 to 5% EtOAc in hexanes) yielded 71.6 g of 663. 2- (Triisopropylsilyloxy) acetic acid (664). To a solution of 663 (0.4 g, 1.2 mmol) in EtOAc was added 10% Pd / C (33 mg). The resulting suspension was stirred under a hydrogen atmosphere; After 15 hours, the reaction mixture was filtered through Celite, and the filtrate was concentrated under vacuum to yield 0.29 g of an oil. A solution of this oil in 1,4-dihumane was added to NaHC03 (0.5M, 2.4 ml). The resulting solution was concentrated from toluene in the air to give 664 a waxy solid. 2- (Triisopropylsilyloxy) acetamidine gas (665), synthesized from 664 by the method of preparing 643, can produce 665 as a crude product. (3S) -3-[(3S) -2-_yl-3-Usamine amino group 5- (2-triisopropylisocyanatooxy) ethynyl-2,3,4,5-tetrakis Hydrogen-1H-1,5-benzodiazepine-1-acetamidinyl] -4-keto-butyric acid tertiary-butyl hemicarbazone (666), synthesized from 600b, to be prepared from 600b The 604d method produces 131 mg of 666. (3 3) -3-[(3 3) -2-keto-3-wordamido-5- (2-hydroxy) ethylamido_2,3,4,5-tetrahydro-1H-1 , 5-Benzodiazepine-1-ethylamine amino 4- 4-keto-butyric acid tertiary-butyl ester half carbachol (667). To a solution of 666 (131 mg, op mmol) in tetrahydrofuran, cooled in an ice water bath, and added tetrabutylammonium fluoride (1M, 0.190 ml). After 2 hours, pour the reaction mixture into water and extract 2-660 with EtOAc.-This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling this page)-· & quot 541309 A7 B7 5. Description of the invention (658) times, dried on MgS04 and concentrated in vacuo to produce 63 mg of 667 as a white solid. (3 3) -3-[(3 8) -2-_yl-3-Ethylamino-5- (2- # toyl) ethenyl-2,3,4,5-tetrahydro-1H -1,5-benzodiazepine-1-acetamidinyl] -4-one-butyric acid (668), synthesized from 604d and 605d, synthesized from 667, 48 mg of 668 was white solid. 4 NMR (CD3OD) Θ 2.45 (m, 1H), 2.67 (dddd, 1H), 3.78 (d, 1H), 3.85 (br. M, 1H), 4.05 (d, 1H), 4.28 (m, 1H) ), 4.5 (m, 2H), 4.65 (m, 1H), 4.95 (br. S, 2H), 7.4-7.5 (m, 4H), 7.52-7.65 (m, 3H), 7.88 (d, 2H). (Please read the notes on the back before filling out this page)

(33) -3-[(33) -2-keto-3- (3,5-dichloro-4-methoxybenzylfluorenyl) amino-5-ethenyl-2,3,4, 5-tetrahydrobenzodiazepine-1-acetamidol · 4 · keto-butyric acid (669), synthesized from 600b by the method of preparing 605d from 600b, can produce 63 mg of 669, which is white Solid, 4 NMR (CD3OD) β 1.90 Order #f Printed by the Consumer Cooperative of the Central Sample Bureau of the Ministry of Economic Affairs (s, 3H), 2.4-2.7 (m, 2H), 3.6-3.7 (m, 2H), 3.9 (s , 3H), 4.2-4.4 (m, 2H), 4.4-4.6 (m, 3H), 7.4-7.8 (m, 4H), 7.9 (s, 2H). -661-Applicable to China National Standard (CNS) A4 specification (21 OX 297 mm 1 541309 A7 B7 V. Description of invention (659) 600b

0, Ο, Η Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (33) -2-keto-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino-5-ethynyl -1 ^ [(25 ^, 33) -benzyloxy-5-keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-111-1,5-benzodiazepine -1-acetamidamine (67〇), synthesized from 600b by the method of preparing 655 from 600b, can produce 218 mg of 670 as a white solid, 1h NMR (CD3OD) d 1.7, 1.75 (2s, 3H), 2.15, i2 (2s, 6H), 2.4.2.5 (m, 1Η), 2.6-2.75 (m, 1H), 3.65-3.75 (m, 2H), 4.2-4.3 (m, 2H), 4.45-4.6 (m, 3H), 7.35-7 · 6 (m, 4H), 7.5 (s, 2H). (3S) -3-[(3S) -2-keto-3- (3,5-dimethyl-4-hydroxybenzylfluorenyl) aminoethenyl-2,3,4,5-tetrahydro -1H-1,5-benzodiazepine-1-acetamido] -4-keto-butanoic acid (671), synthesized from 670 in 2001 and 2002, yielding 253 mg of 671 , As a white solid, 4 NMR (CD3OD) β 1.9 (s, 3Η), 2.25 (s, 6H), 2.4-2.5 (m, 1H); 2.6-2.75 (m, 1H), 3.65-3.75 (m? 2H ), 4.2-4.3 (m, 2H), 4.45-4.6 (m, 3H), 7.35-7.6 (m, 4H), 7.5 (s, 2H) 〇-662 (Please read the precautions on the back before filling this page )

This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (660)

(Please read the notes on the back before filling this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (3S) -2-keto-3-third-butoxycarbonylamino-5- (2-triiso Propylsilyloxy) Ethyl-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1-acetamidine acetate (672), a method for preparing 602ηη from 600b , Synthesized from 600b, using 665 can generate 1.08 grams of 672. (3S) -2-keto-3-amino-5- (2-triisopropylsilyloxy) ethenyl--663- This paper size applies to China National Standard (CNS) A4 (210X 297) (%) 541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A 7 _ ______B7_ V. Description of the Invention (661) 2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1 -Acetic acid acetate (673). To a solution of 072 (1.08 g, 1.69 mmol) in CH2C12 was added 26-dipyridyl (0.8 ml) followed by TMSOTf (1 ml, 5.1 mmol). &quot; After that, the reaction mixture is poured into NaHC03, extracted with CH2C12, dried on MgS0 and concentrated in the air to produce a small volume, which can be used directly in the down-reaction. (3S) -2-keto-3- (l, 6-dimethoxyfluorenylmethylamidino) amino-5 · (2 · triisopropylsilyloxy) ethenyl-2,3 , 4,5-tetrahydro-111-1,5-benzodiazepine · 1-acetic acid acetate (674), synthesized from 673 by the method of preparing 602b, can produce 0.91 g of 674. (3S) -2-keto-3- (1,6-dimethoxybenzylidenemethylamidino) amino-5- (2-triisopropylisocyanatooxy) ethylSi-2, 3,4,5-tetrahydro-1H-1,5-benzodiazepine 1-acetic acid (675). A solution of 674 (0.365 g, 0.5 mmol) in MeOH was mixed with INNaOH (1.2 ml, 1.2 mmol). After 16 hours, the reaction mixture was concentrated under vacuum, redissolved in water and washed twice with ether. The aqueous layer was acidified with 1N.HC1, and the product was extracted with EtOAc, dried over MgS04 and air-concentrated to yield 337 mg of 675 as a solid. (3S) -2-keto-3- (1,6-dimethoxyfluorenylmethylfluorenyl) amino-5- (2-triisopropylsilyloxy) ethenyl-N- [ (2RS, 3S) -Methoxy-5 · keto-tetrahydrofuran-3-yl] _2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-acetamidine (676), synthesized from 675 by the method of preparing 213e, can produce 166 mg of 6:76 as a white solid. (3S) -2-keto-3- (1,6-dimethoxybenzylidenemethylamidino) amino-5- (2-hydroxy) acetamido-N-[(2RS, 3S)- Benzyloxy-5-keto-tetrahydrofuran-3-yl]--664- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling this page) Economy Printed by the Consumers' Cooperative of the Ministry of Standards and Technology of the People's Republic of China 541309 A 7. _ B7_____ V. Description of the invention (662) 2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-B Lamine (677). A solution of hexane (6 ml, 3 mmol) in HOAc (0.46 ml, 8 mmol) was added to 676 (0.213 g, 0.256 mmol). After 16 hours, the reaction mixture was poured into EtOAc and washed twice with IN HC03, once with brine, then dried over MgS04 and concentrated in vacuo to yield 139 mg of 677 as a solid. 4 NMR (CDC13) ό '2.4 ( d, 1H), 2.5 (dd, 1H), 2.8 (dd, 1H), 2,92 (dd, 1H), 3.15 (m, 2H), 3.55-3.65 (m, 2H), 3.72 (s, 6H), 3.92 (m, 1H), 4.05 (m, 1H), 4.3 (m, 1H), 4.42 (d, 1H), 4.6 (dd, 1H), 4.65-4.8 (m, 2H), 4.88 (d , 1H), 5.55 (d, 1H), 6.55 (m, 2H), 6.75 (d, 1H), 7.25-7.55 (m, 8H), 7.75 (m, 2H). (3 8) -3-[(3 3) -2-keto-3- (3,5-dimethoxyfluorenylmethylamidino) amino-5- (2-hydroxy) ethenyl- 2,3,4,5_tetrahydro-1H-1,5-benzodiazepine-1-acetamido] -4-keto-butanoic acid (678), a method for preparing 667 from 666 Synthesis, 54 mg of 678 as a white solid, 4 NMR (CD3OD) β 2.45 (m, 1Η), 2.7 (m, 1Η), 3.5 (m, 2Η), 3.75 (br. S, 6Η), 4.05 ( d, 1H), 4.3 (m, 1H), 4.551-4 · 6 (m, 2H), 4.8 (br. m, 2H), 6.7 (d, 2H), 7.4-7.5 (br. m, 3H ), 7.6-7.65 (br. M, 2H). (Please read the notes on the back before filling in this ¥ .c

This paper size applies to China National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 A ---- B7 --------------~ --- V. Description of the invention (663) ( Please read the notes on the back before you fill in this page.) (3S) -2 · Ketodonylmethylmethylamidoamino hydroxyl) Ethyl-N- (2RS, 3S) -benzyloxy-5- Keto-tetrahydrofuran-3-yl 1,5-benzodiazepineacetamidine (68) was synthesized from 600b by the method of preparing 677 from 600b, and 140 mg of 680 was obtained as a white solid. '4 NMR (CDC13) δ 2.31 (d, 1Η), 2.4 (dd, 2H), 2.75 (dd, 2H), 2.85 (dd, 1H), 3.36 (br. S, 1H), 3.45 (br · s, 1H) , 3.6 (br · t, 2H), 3.82 (br · m, 2H), 3.95 (br · d, 2H), 4.35 (m, 2H), 4.42 (d, 1H), 4.55 (m, 1H), 4.70 (d, 1H), 4.82 (br. s, 2H), 5.5 (d, 1H), 6.91 (d, 1H), 7.25 (br · m, 5H), 7.35-7.46 (br. m, 3H), 7.5-7.6 (m, 2H), 8.15 (br · d, 2H). (JS) -3-[(3S) -2-fluorenyl-3-character S-methylamino-amino-5 (2-¾yl) ethyl-2.3-4.5-tetrahydrobenzodiazepine Ge-1-Ethylamino] -4-keto-butanoic acid (681), synthesized from 680 by the method of preparing 677 from 677, can produce 45 mg of 681 as a gray solid, 4 NMR (CD3OD) d 2.5 (m, 1H), 2 · 7 (dt, 1H), 3.65-3.85 (br. m, 3H), 4.05 (m, 1H), 4.3 (m, 1H), 4.5- 4.7 (br · m, 3H) , 4.85 (br. S, 2H), 7,3 (br. M, 2H), 7.4-7.7 (m, 5H), 8.15 (d, 2H). Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs

(3S) -2-keto-amino-amino group 5-5- (2-ethylamino) ethyl-amino-N-[(2RS, 3S) · methoxy-5-keto-tetrahydrofuran-3-yl ] -2,3,4,5-tetrahydro-1H- -666-This paper is again applicable to China National Standard (CNS) A4 specification (2 丨 〇 &gt; &lt; 297 mm) &quot; &quot; 541309 Ministry of Economic Affairs Printed by the Consumer Standards Cooperative of the Central Bureau of Standards A7 B7 V. Description of the invention (664) 1,5-benzodiazepine acetamide (682), synthesized from 600b by the method of 600b, can produce 495 682 mg as a white solid, NMR (CDC13) d 2.00 (S &gt; 3Η)? 2.05 (s, 3H), 2.47 (d, iH), 2.58 (dd, 1H), 2.85 (dd, 1H), 2.89 (dd, 1H), 3.9 (m, 2H), 4.05-4 · 15 (m, 2H), 4.19 (dd, 1H), 4.45 (m, 2H), 4.55-5 · 05 (m , 8H), 5 55 (d, 1H), 6.85 (d, 1H), 7.15 (d, 1H), 7.25-7.55 (m, 10H), 7.75 (d, 2H). '' (jS) -3-[(3S) -2-keto · 3 · famidinylamino-5_ (2-ethylamino) ethoxy-2,3,4,5 · tetrahydro- 1H-1,5-benzodiazepine-1-ethenylaminorenone-butyric acid (683) was synthesized from 682 by the method of 2001 and 2002, and 82 mg of 683 was obtained, which was white Solid, iH NMR (CD3OD) d 2.1 (s, 3H), 2.5 (m, 1H), 2.68 (m, 1H), 3.8 (m, 1H), 4.29 (dd, 1H), 4.31 (m, 1H) ), 4.45 (d, 1H), 4.55 (d, 1H), 4.6 (d, 1H), 4.72 (d, 1H), 4.95 (br. S, 2H), 7.45 (br. M, 2H), 7.52- 7.65 (br.m, 5H), 7.88 (d, 2H).

(3S) -3-[(3S) -2-keto-3- (3,5-dimethyl-4-methoxyfluorenyl) amino-5-ethenyl-2,3,4 , 5-tetrahydro-111-1,5-benzodiazepine-buethenylamino] -4-keto-butanoic acid (684) was synthesized from 600b by the method of preparing 605d from 600b. Generated 72 mg of 684 as a white solid, 4 NMR (CD3OD) β -667- This paper is compliant with China National Standard (CNS) Α4 specification (210x297 mm) (Please read the precautions on the back before filling out this page ) »-, Π 541309 A7 B7 V. Description of the invention (665) 19 (s, 3H), 2.25 (s, 6H), 2.45 (m, 1H), 2.6 (m, 1H), 3.3 (s, 1Η) ), 3.7 (s, 3η), 4.25 (m, 1Η), 4.45-4.6 (m, 3Η), 7.4 (br. S, 2H), 7.55 (br. D, 4H).

(Please read the precautions on the back before filling out this page} 1 «· Printed by (3S) -2-keto-3- (3-Ga-4-Aminopyridyl) ) Amino-5- (2-triisopropylsilanoyl) ethynyl-N-[(2RS, 3S) -fluorenyl-5-fluorenyl-tetrachlorosulfan-3 -yl]- 2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-acetamidine (685), synthesized from 600b by 600b method, yielding 165 Mg of 685. (3S) -3-[(3S) -2-keto-3- (3-Ga-4 · aminobenzylfluorenyl) amino-5- (2-triisopropylsilyloxy) ) Ethyl-2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-ethylamidino] -4-keto · butanoic acid (686). 685 ( 165 mg, 0.21 mmol) TBAF (1M, 0.21 ml) was added to a solution of THF. The product was precipitated in the reaction mixture and separated by filtration. Reverse phase chromatography (10% -80% MeCN in water / 0.1% TFA) can produce 25 mg of 686 as a white solid, 4 NMR (CD3OD) 2.37-2.42 (m), 2.59-2.70 (m), 3.60-3.89 (m), 4.01 (d), 4.20-4.31 ( m), 4.42-4.70 (m), 4.80-5.05 (m), 6.79 (d), -668- This paper size applies to the Chinese National Standard (CNS ) A4 specification (2l0x 297 mm),-&amp; Γ #? 541309 A7 B7 V. Description of the invention (7.32 · 7 · 65 (m), 7.81 (s)

MeO 〇 6〇〇b

MeO

688a, b Ο

(Please read the notes on the back of the first cabinet, and then fill out this page) »Consumption Cooperation of Employees of the Central Standards Bureau of the Ministry of Economic Affairs ) Aminomethoxyethoxy "2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-acetic acid (687 &amp;), using 654 from 600b The method is synthesized from 600b, which can produce 1.6g of 687a. (3S) -2-keto-3_ (3,5_diamidino · 4 · hydroxyfluorenyl) amino-5-methoxyethynyl -2,3,4,5 · tetrahydro-1Η-1,5-benzodiazepine-1-acetic acid (687b), synthesized from 600b by the method of preparing 654 from 60b, can produce 1.1 grams of 687b. (3S) -2-keto-3- (3,5-difluorohydroxyfluorenyl) amino is methoxyethenyl-N-[(2RS, 3S) -henyl- Tetrahydrofuran-3-yl] -2,3,4,5-tetrahydrobenzodiazepine-1-ethylamine (688a). P- (3S, 2R, S) -3-propoxycarbonylamino -2-Wordoxy-5 · ketotetrahydrofuran (Chapman, -669- Exactly applicable to China National Standard (CNS) A4 specifications (210X 297 public holidays) 541309 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A ______ B7 V. Description of Invention (667) Med. Chem. Le tt ^ 2, pp. 613-618 (1992)) (1.13 ^, 1.2 equivalents) To a solution of CH2C12 was added triphenylphosphine (423 mg, 0.5 equivalents), difluorenyl barbituric acid (1.26 G, 2.5 eq.) And triphenylphosphine palladium (0), 3 73 mg, 0.1 eq.) After 5 minutes, the reaction mixture was cooled in an ice bath, and 687a was added to DMF (1.6 g, 1 eq.), HOBT (480 mg, 1.1 equivalents) and EDC (681 mg, L1 equivalent). The resulting mixture was stirred at ambient temperature. After 16 hours the reaction mixture was poured into NaHS04 and extracted twice with EtOAc. The organic layer was NaHC03, brine Washed, dried over Na2S04 and concentrated in vacuo. Chromatography (SiO2, 20% to 100% EtOAc in CH2C12) yielded 880 mg of 688a as a white solid, 1H NMR (CD3OD) d 2.55 (dd, 1Η), 2 · 7 (dd, 1Η), 3.0 (m, 1Η), 3.6 (m, 1H), 3.75 (d, 1H), 3 · 9-4 · 0 (m, 2H), 4 · 3 · 4.45 (m, 3H), 4.5-4.6 (m, 3H), 4.7 (m, 2H), 5.35 (s, 1H), 5.55 (d, 1H), 7. · 7.5 (m, 4H), 7.85 (s, 2H) 〇 (3S) -2-fluorenyl-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino-5-methoxyacetamidine -N-[(2RS, 3S) _fecyl-5-keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-1H-1,5_benzodiazepine -Acetic acid (688b), synthesized from 687b by the method of preparing 688a from 6873, can produce 960 mg of 688b as a white solid, 1H NMR (CD30D) d 2.6 (dd, 1H), 2.7 (dd, 1H ), 3.0 (dd, 1H), 3.2 (s, 3H), 3.7 (m, 3H), 3.9 (m, 2H), 4 · 4-4 · 5 (m, 2H), 4.6 (m, 3H), 5.35 (s, 1H), 5.55 (d, 1H), 7.25 (m, 2H), 7.4-7.5 (m, 4H). (35) -3-[(38) -2-keto-3- (3,5-digas-4-hydroxyfluorenyl) amino-5-methoxyethenyl-2,3,4 , 5-Tetrahydro-1H-1,5-Benzodiazepine-1-Ethylamido-670- This paper scale towel_Home Standard (CNS) A4 Specification (21G X 297 mm) ( (Please read the notes on the back before filling out this page)

541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs. 5. Description of the invention (668) Butyric acid (689a), synthesized from 2001 and 2002. 688a can be produced as 184 mg of 689a. NMR (CD3OD) 2.45 (m, 1H), 2.6 (m, 1H), 3.3 (s, 3H), 3.7-3.85 (m, 2H), 4.0 (d, 1H), 4.3 (m, 1H), 4.5- 4.6 (m, 3H), 7.3-7.6 (m, 4H), 7.85 (s, 2H). (3 8) -3-[(3 3) -2-_yl-3- (3,5-dimethyl-4-acrylfluorenyl) amino-5_methoxyethenyl-2, 3,4,5-tetrahydro-1H-1,5-benzodiazepine-buethamidinyl] · 4-keto-butanoic acid (689b), synthesized from 688b using the method prepared from 2001 and 2002 , Can produce 412 mg of 689b as a white solid, 1h NMR (CD3OD) d 2.5 (m, 1H), 2.7 (m, 1H), 3.3 (s, 3H), 3.7-3.85 (m, 2H), 4.05 ( dd, 1H), 4.3 (m, 1H), 4.6 (m, 2H), 7.45-7.4 (m, 2H), 7.5 (s, 2H), 7.55 (m, 2H).

(3S) -2-keto-3- (3,5-difluorenyl_4-hydroxybenzylfluorenyl) amino-5-hydroxyacetamidine-671-This paper size applies to China National Standard (CNS) A4 specifications (210X29 * 7mm) (Please read the notes on the back before filling out this page) 541309 A7 B7 Printed by the Consumers' Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of Inventions (Ministry 9) Basic -N-[( 2RS, 3S) -Wordoxy-5, yl_tetrahydrosweeping_3_yl] 2,3,4,5_tetrahydro-1H-1 &gt; benzodiazepine-1-acetamidine ( 69〇a), # using the preparation of 676 from exposure, 687a from 687a, 677 from 676 to produce 863 mg of 690a, a white solid, nmr (cd3〇d) J 2.2 (s, 6Η), 2.45 (d, 0.5H), 2.6-2.9 (m, 1H), 3.05 (dd, 0.5H), 3.65-3.85 (m, 2H), 3.95-4.1 (m, ih), 4.35 · 5 〇 (m, 7H), 5 35 (s 0.5H), 5.65 (d, 0.5H), 7.2-7.4 (m, 4H), 7.4-7.7 (m, 7H) ° (3S) -2-one -3- (4- # yldonyl) amino_5_hyperacetylacetonyl_N_ [(2RS, 3S) -fluorenyl-5-keto-tetrahydrofuranyl] _2,3,4,5 -Tetrahydro-1,1,5-benzodiazepine_1_acetamide (690b), synthesized from 600b by the method of preparing 677 from 600b, can be produced 200 mg of 690b, NMR (CD3OD) δ 2.49 (d, 1H), 2.65 (d, 1H), 2.66 (d, 1H), 2.85 (d, 1H), 2.87 (d, 1H), 3.05 (dd, 1H) ), 3.35 (br. S, 1H), 3.72 (br. S, 2H), 4.01 (m, 2H), 4.45 (br. M, 1H), 4.6 (m, 1H), 4.7 (m, 1H), 4.8 (m, 1H), 4.95 (br.s, 2H), 5.65 (d, 1H), 6.8 (d, 2H), 7.2-7 · 35 (br · m, 3H), 7.45 (m, 2H), 7.75 (d, 2H). (3S) -3-[(3S) -2-keto-3- (3,5-dimethyl-4-hydroxybenzylfluorenyl) amino-5-hydroxyethylsulfanyl 2,3,4, 5-tetrahydro · 1Η-1,5-benzodiazepine-1-acetamido] 4-keto-butanoic acid (691a), synthesized from 690a by the method of 2001 and 2002, can be produced 560 mg of 691a as a white solid, 4 NMR (CD3〇D), 2.15 (s, 6H), 2.45 (m, 1H), 2.65 (m, 1H), 3.55 (m, 1H), 3.7 (d, 1H ), 4.0 (d, 1H), 4.25 (m, 1H), 4.5-4.6 (m, 3H), 7.3-7 · 5 (m, 6H). (3S) -3-[(3 (S) -2-keto-3- (4-hydroxybenzylfluorenyl) aminohydroxyethylsulfonyl- -672-__ This paper size applies to China National Standards (CNS) A4 specification (210X 297 mm) (read the first page and the notes on the back, then fill in this page) 丨 · ^. Order #f

541309 A 7 _ _ B7________ V. Description of the invention (67〇) 2,3,4,5-tetrahydro-1Η-1,5-benzodiazepine-1-acetamido] -4-one -Butyric acid (69ib), synthesized from 690b by the method of 2001 and 2002, yields 410 mg of 691b as a white solid, iH NMR (CD3OD) d 2.5 (m, 1H), 2.65 (m, 1H), 3. · 75 (m, 1H), 3.8 (d, 1H), 4.05 (d, 1H), 4/25 (m, 1H), 4.5 (m, 1H), 4.6 (m, 1H), 4.95 (br · s, 2H), 6.8 (d, 2H), 7.45 (m, 2H), 7.6 (m, 2H), 7.75 (d, 2H).

O r4 =

O o (Please read the notes on the back before filling out this page) ch3 ch3o

Order #! Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (38) -2-_yl-3-characterylamino-5-merylethyloxy-5-keto · tetrahydrofuran-3-yl ] -2,3,4,5-tetrahydro-1H_1,5-benzodiazepine-1-acetamidine (695a), synthesized from 600b by the method of preparing 677 from 600b, can produce 75 Mg of 695a, 4 NMR (CD3OD) d 2 · 2 (s, 6H) 2 · 45 (m, 1Η), 2.6 (m, 1Η), 3.65 (m, 1Η), 3.75 (d, 1Η) ), 4.0 (d, 1H), 4.28 (m, 1H), 4.5 (m, 3H), 7.4-7.6 (m, 6H). (jS) -2-Copperyl-Ethylamine aminomethylamine) Amino-5 · Ethylethoxytyl · ν · [(2RS, 3S) -Oxyl-5 · keto-tetrahydro Nan-3-yl] -2,3,4,5-tetrahydro-673- This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) ^ 413〇9 Α7 Β7 Fifth invention description (671 i 5. Benzodiazepine-1 · acetamide (695c), synthesized from 600b by the method of preparing 677 from 600b, can produce 880 mg of 695b, 4 NMR (CD3OD) d 2 · 1 (s, 3H ), 2.25-2.5 (m, 2H), 2.8-2.92 (m, 0.5H), 3.15-3.2 (melon, 0.5H), 3.45-3.6 (m, 2H), 3.75-3.95 (m , 2H), 4.15-4.25 (m, 1H), 4.35-4.6 (m, 2H), 4.6-4.88 (m, 3H), 5.22 (s, 0.25H), 5.33 (s, 0.25H), 5.52-5.58 (d, 0.5H), 7.15-7.45 (m, 9.5H), 7.5-7.75 (m, 5H), 8.3-8.35 (m, 0.5Η), 9.08-9.18 (m, 1H) 〇 (3S)- 2RS-copper-dimethyl-4-mercaptopyrimidyl) amino-5-carbamoyl-N- (2-fluorenyl-5-keto-tetrahydrofuran-3-yl) -2, 3,4,5-tetrahydro-111-1,5-benzodiazepine-1-acetamidine (695c), synthesized from 600b by the method of preparing 677 from 600b, can produce 840 mg of 695c, 4 NMR (CDC13) d 2.23 (s, 3H), 2.26 (s, 3H), 2.45-2.62 (m, 1H), 2.8-2.9 (dd, 0.5H), 2.9-3.05 (dd, 0.5H), 3.45-3.63 (τη, 1H), 3.64 (s, 1.5H), 3.68 (s, 1.5Η), 3.78-4.05 (m, 2H), 4.2-4.33 (m, 1H), 4.4-4.63 (m, 2H), 4.65-4.94 (m, 2H), 4.95 · 5 · 1 (m, 1H), 5.45 (s, 0.5H), 5.5-5.6 (d, 0.5H), 6.9-6.95 (d, 1H), 7 · 25 · 7 · 7 (m, 12H). Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

HO

(3S) -2-keto-3- (3,5-digas-4-¾yl-uranyl) amino group Acetylenyl-674- This paper size applies to Chinese National Standard (CNS) A4 specifications ( 210X297 mm) (Please read the notes on the back before filling in this page)

541309 Α7 Β7 V. Description of the invention (672) N-[(2RS, 3S) -Methoxy-5-one-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-1H-1, 5-Benzodiazepine-butyamide (692a), synthesized from 600b by the method of preparing 661 from 600b, with the exception of the step of preparing 688a from 603d, and replacing 688a by 687a can produce 854 mg 6,92a, lR NMR (CDC13) ^ 2.45 (d, 1H), 2.6 (m, 1H), 2.7 (m, 1H), 3.0 (m, 1H), 3.5-3.7 (m, 4H), 4.0 ( q, 2H), 4.45 (m, 3H), 4.55 (m, 4H), 5.35 (s, 1H), 5.6 (d, 1H), 7.2-7.5 (m, 9H), 7.85 (s, 2H). (3S) -2-keto-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino-5-hydroxyethylfluorenyl-N-[(2RS, 3S) -ethoxy- 5-keto · tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-1 · acetamidamine (692b), prepared using 600b 661 The method was synthesized from 600b, excluding the step of making 604d from 603d, and using the method of preparing 688a from 687a instead of 692b which can generate 207 mg. XH NMR (CD3OD) δ 1.05 (t, 3Η), 1.15 (t, 3H) , 2.45 (d, 1H), 2.55 (m, 1H), 2.7 (m, 1H), 3.55 (m, 2H), 3.6-3.75 (m, 5H), 4.0 (dd, 2H), 4.3 (d, 1H), 4.4-4.7 (m, 5H), 5.25 (s, 1H), 5.5 (d, 1H), 7.25 · 7 · 6 (m, 4H), 7.85 (s, 2H) 〇 (Please read the notes on the back before filling out this page) • Ordered by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

(3S) -2-keto-3-amidoamino-5-ethenyl-N-[(2RS, 3S) -benzyloxyketo-tetrahydrocranyl] -2,3,4, 5-Tetrahydro-1 ^ -1,5-Benzodiazepine_1-B-675- The standard of this paper is applicable to Chinese National Standard (CNS) A4 specification (210 × 297 mm) 541309 Α7 Β7 V. Description of the invention (673) Amidine (693), synthesized from 600b by the method of preparing 688a from 600b, can produce 30 mg of 693, iH NMR (CD3OD) d 1.7 (s, 3H), 1.8 (s, 3H), 2.51 (d, 1H), 2.6 (m, 1H), 2.85 (m, 1H), 3.0 (m, 1H), 3.75 (br. d, 2H), 4.0-4.1 (dd, 2H), 4.5 -5.0 (m, 6H), 5.45 (s, 1H), 5.55 (s, 1H), 7.15-7.85 (m, 14H).

(Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economy (3S) -3 _ [(3S) -2-keto-3- (3,5_dimethyl-4 -Methoxybenzylidene) aminohydroxyethylamido-2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-acetase amino] -4- Keto-butyric acid (694), synthesized from 691c by the method of 2001 and 2002, yields 380 mg of 694 as a white solid, 4 (CD3OD) d 2.25 (s, 6H), 2.45 (m, 1H), 2 65 (m, 1H), 3.65 (m 5H), 4.0 (d, 1H), 4.28 (m, 1H), 4.55 (d, 2H), 4.95 (m, 1H), 7 wood 7.6 ( m, 6H). Compounds 700-711 can be prepared in a similar manner to compounds 619-635 (see, Example 13). Physical data for compounds 700-711 are listed in Table 25. Compounds 910-915 and 918-921 are prepared as follows The physical data of these compounds are listed in Table 26. -676-This paper size applies to the Chinese National Standard (CNS) A4 specification (order 541309 A7 B7 V. Description of the invention (674) Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs + cn S s 5 ο ο νο CD 00 ro L〇Ling 々V α. κ (Ν Η f S-ι-Η rH lD rH 3: S rH iD m m CM i〇 • rH m CX4 s Ο Ο 'Z CNJ r— \ u C \ J $ CNi u cn CO 〇S CM CvJ K Γ〇 CM o 琮 5x ° = Q = 〇 \工 o = Q- ° ^ r 豸 λ3 oo Ο Ο r- Please read the following items before filling in the win. Page order -677- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of Invention

mN + w) SS

(Lost) Φ 墩 oldH

I

CT4S Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs

-678- This paper size is in accordance with Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (676) Printed by the Employees' Cooperatives of the China Standards Bureau of the Ministry of Economic Affairs + ^ $ t—1 • 04 VD ID t—1 • CsJ VO L〇 parameter &lt; NQ \ L〇a CU X s • 〇 t—I rH s ^ rH VO = s-rH 2 CNJ m • CO Γ0 L〇CM ID CO cn in 'mm 00 in ΪΧ4 X c \ 〇§ CM s CM U 〇§ CM s CN 〇o rH 〇CD CN X 卜 04 〇sai X pi o = C ^ °% —〇 X px ° v-. XP x -〇 = 〇A ο ΙΟ ο r- V £ &gt; 〇r- -679- This paper size applies to China National Standard (CNS) A4 (210X297 mm) (Please read the note on the back first Please fill in this page again) 541309 A7 B7 V. Description of Invention (677) Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs + cn $ CTi LD bu m VD Participate LO LO m Order S ί CU CN ^ LO tH CNJ-^ o rH CNJ 'cn rH 3: LO LO CM L〇IT) Γ0 om in bl LO o to uo σι 〇'ζΓ Ϊ2; 00 CN X bl CNJ ο cn 〇 § CNJ bl C \ J 〇00 o § cn D: 00 CVJ 〇 work. Department \ ° χ / ° j O 2 X \ ° N / ° X px -〇 = 〇 卜 ο r- 00 〇r- C \ 〇r- -680- (Please read the precautions on the back before filling this page )

This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 Instructions Note 5 78 6 + (eN + w) ss CNJ.sLn

6dLO

(Bereavement) ^ ίφΗΗ ITIdH

dp86 5 srCNlI dp66u) CN 卜 ο · ετ ss LO6 · buιος

Lnuee is 80SNT3l ^ HS3 See ------ IT (Please read the notes on the back before filling this page) o HO,

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

o

X

οτζ. -681-This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7B7 V. Description of Invention (679) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs + s 5 S • νο l 〇m 卜卜 in 〇DuDu CN CN ciP eg σ \ Γ 'rH CO eg όΡ σ \ o \ &lt; Ti VO S σι ο cut ID ro m cn L〇to X Ο rH 〇π CNJ CSJ Ο σ \ sc \ is CNJ u 叶 X ο 工 ο = 0 = ο Zn X r \ 〇 ^ / OX 0 = 0 = 0. Private 〇 乂 o. &Lt; 〇X ο «Η ο \« Η rH C \ -682- This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) (Please read the notes on the back before filling out This page) Order 541309 A7 B7 V. Description of the invention (Book 0) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs + cn 5 X 卜 ο to m lD CO VD L〇 黎 ^ 1 C Ή Ο DC 04 dP r- cn 00 00 CM dP CD G \ oo σι tn VD Σ2: SL〇KO CM L〇to 'L〇σ \ ro m Cu c \ 〇§ (NJ 5 C \ J CJ CO s 2; &lt; Ti CM X VD CVJ 〇 赛 5χ ° &lt; 2r workers? S §x. Points / 9; X CM as CO -683- (Please read the precautions on the back before filling in this page)

、 1T This paper size applies to China National Standards (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of invention (681 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs + X CNJ CNJ ri VD and VD Order A CNJ dP m σι rH CTj CD bu CNJ df &gt; O 00 CTk C7j bu 1 00 Γ ΟΟ ΙΟ &lt; N 'CM CNJ VD (X4 〇m γΗ ο VD &lt; Ν X νο Csi υ Q \ 〇L〇2; OJ rH U m CN D: VD &lt; N o Sai X Ο X ° &lt; ^ Γ φ: 〇 乂. CO X §x ° = Q = o 〇〇〇〇A〇 &lt; 〇X tH 〇 \ l〇iH C \ -684- (Please read the notes on the back before filling this page)

This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 Note 5 (Breakdown) φχΗοΊαιΗ Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

+ 2N + W) SW ΜΗ P4S

-685- (Please read 'Jiang Yi Matters on the back before filling this page)

I Revision This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 683 V. Description of the invention (+ 1ΪN + Η) ss ε · 6τ9

6LOLO Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 〇4 C \ i 1-1 rH &lt; N dP (Ti iH 〇o \ bu &lt; Tk 1 〇 • min (N IT) ID Γ0 l〇 (X (σ \ Ο CN u CNJ to Csi u 00 CM K VD CNJ u O o o o C = ° s% o § X ° = Q = o 〇 γ ^ o o 1 o ω o \ σ \? —1 a -686- (Please read the notes on the back and fill in this page) The size of the paper used for this edition is applicable to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 Printed by A7 ____B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Description of the invention (684) + ^ I VD 〇 \ 〇m rH bu L〇U ^ ^ ^ w 〇4 CM dP CO σ \ σ \ L〇 &lt; N cfP bu VD CsJ CTk CO bu S: S rH m VD ΓΟ in c \ j LD mm CX4 00 s 2 CsJ E if) &lt; NJ uot— &lt; 〇§ CVJ s CsJ U 琮 X 〇X ° ^ t ° γ 乂 工 工 X o 工. = 〇 = 〇9j 丫 4 §: 5 ° '0 oa rH 04 C \ (Please read this notice on the back before filling in this page) -687- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 Economy Ministry of Central Standards Bureau Prints Clothing for Consumer Cooperatives

AT _ B7 V. Description of the invention (685) MS (M + Na &gt; + 578.8 HPLC RT minutes (method) Purity 10.024 (2) 99% 554,56 C27H30N4O9 1 | Structure ______-_ §χ 〇 = / \ = 0 Ya- £ Compound 922/694 -688- (Please read the notes on the back before filling in this hundred (), ^ τ ceremony! This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 541309 A7 __ ^ _ B7 V. Description of the invention (686) -689- This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling this page)

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7 ______B7___ — V. Description of Invention (687) Step A. Synthesis of 401. TentaGel S® NH, resin (0.25 mmol / g '8 g) was placed in a glass shaker and washed with dimethylacetamide (3 X 20 亳 L). For 400 (1.70 g, 2.9 mol, prepared from (3S) 3- (thoxymethoxycarbonylbutyrate tertiary-butyl g), according to A M. Murphy et. Al * j ^ Am. Chem Soc., 114, 3 156_3 1 57 (1992)) in a solution of dimethylacetamide (15 liters), and 0-benzotrijun-N, N, N, N, _tetramethylfluorene was added. Hexafluorophosphoric acid (HBTU: 1.09 g, 2.9 mmol) and dieA (1.0 mL, 5.7 mmol). The solution was added to the resin, followed by dimethylacetamide (5 mL). The reaction mixture was at room temperature. Stir with a wrist-arm shaker for 3 hours. The resin was separated by suction filtration and washed with dimethylacetamide (6 x 20 ml). A sample of resin (2.4 mg) was dissolved in 50% methanol in digas. The oxane was washed thoroughly, and then dried under inhalation. The Fmoc group was deprotected with 20% hexahydropyridine / dimethylacetamidamine (10 (ml)), and the solution was analyzed by UV to show 019 mmol. / Grams of replacement. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page) Step B. Synthesis of 903. Resin 401 at 20% (v / v) hexahydro p ratio Dimethylacetamide (20 mmol L) deprotection for 10 minutes (shake), and then with fresh hexahydropyridine reagent (20 ¾ liter) for 10 minutes. The resin was washed with dimethylacetamide (6 X 20 ¾ liter). 902 (1.52 g '2.81 Mol) solution was treated with HBTU (1.07 g, 2.83 mol) &amp; DIEA (1.0 ml, 57 mol) and transferred to the tree moon day, and then with dimethylethyl Treated with ammonium (5 ml). The reaction mixture was stirred at room temperature using a wrist-arm shaker for 25 hours. The resin was separated by suction and filtered with dimethylacetamide (4 x 20 ml) and dichloromethane ( 4 X 20¾ liters), and then dried under nitrogen aeration. The resin was replaced as described in Sin 1. It was determined to be 169 millimoles per gram.

541309 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 _ _____ B7_____ V. Description of Invention (688) Step C. Synthesis of 905. Resin 903 (7.54 g, 1.27 mmol) and dimedone (2.19 g, 15.6 mmol) were placed in a 100-ml round-bottomed flask, and freshly distilled anhydrous tetrahydrofuran (ml) was added. Add triphenylphosphine (0) (0.32 g, 0.28 mmol) and stir with a nitrogen-covered and sealed reaction on the oscillating groove of the wrist for 5 hours. The resin was filtered and washed with dimethylethylamine (4 x 20 ml), methane (4 x 20 ml), and diethylethylamine (1 x 20 ml). Add sufficient dimethylacetamide to the resin to obtain a slurry. Add pyridine (1.5 mL, 185 mmol) and a solution of 904 (5.5 mmol) in dichloromethane (10 mL). . The reaction was shaken for 8 hours under nitrogen. The resin was washed with dimethylacetamide (5 X 20 ml) and dichloromethane (5 X 20 ml). Step D. Synthesis of 906. This compound was prepared from resin 905 (0.02 g, 0.0038 mmol) using the Advanced ChemTech 396 Multiple Peptide Synthesizer. Automated cycling consists of washing with dimethylformamide (3 x 1 ml), deprotection with 25% (v / v) hexahydropyridine / dimethylformamide (1 ml) for 10 minutes, and then Fresh reagent (0 ml) over 20 minutes to produce resin 906. The resin was washed with dimethylformamide (3 X 1 ml) and N-methylpyrrolidine (3 X 1 ml). Steps £. (910-922) Resin 906 with a solution of 0.4 g of formic acid and 0.41 g of acetone in 1 [[-methylpyrrolidone (0.5 ml), and 6 M g of 1 g of gallium pyrrolidine A solution of ketone (0.25 ml) was tritiated, and the reaction was shaken at room temperature for one hour. The resin was washed with N-methylpyrrolidone (1 x ml), dimethylformamidine (4 x 1¾ liters), 50% methanol in methane (5 x j ml), and air-dried. The aldehyde dissociates from the resin and is 95% TFA / 5% η2〇 (ν / ν, 15 ml) at (please read the note on the back before filling this page)

-691-The paper size is suitable for financial protection (Grid (210X297mm) 541309 A7 B7 V. Description of the invention (689) General deprotection after processing at room temperature for 30 minutes. Dissociation reagent (2 X i 亳 L ) After washing the resin, the mixed filtrate was added to cold 1: 1 ether: hexane (35 ml), and the resulting precipitate was separated by centrifugation and decantation. The resulting pellet was dissolved in acetonitrile (0.5 ml) and 1120 (0.5 ml) and filtered through a 0.45 micron microcentrifuge filter. Compounds were purified by semi-preparative RP-HPLC using a Rainin MicrosorbTM C18 column (5 micron, 21.4 x 250 mm) to contain 0.1% TFA (v / v) The linear acetonitrile gradient (10% -50%) dissolves, 12 ml / min. Fractions containing the desired product are collected and cold beam dried to produce 910-922. Analytical HPLC methods: (1) Waters DeltaPak C18, 300A (5 microns , 3 · 9 X 150 mm). Linear acetonitrile gradient (0% -25%) contains 0.1% TFA (v / v) for 14 minutes, 1 l / min. (2) Waters DeltaPak C18, 300A (5 microns, 3 · 9 X 150 mm). The linear acetonitrile gradient (5% -45%) contains 0.1% TFA (v / v) for 14 minutes at 1 ml / min.

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page) — (3 8) -3-[(3 3) -2-Copper-based-3- (Iso 4: Lin- 1-Bromo) Amino-5-quinylethyl-branzyl, 2,3,4,5-tetrahydro-111-1,5-benzodiazepine-1-ethylbranyl] -4_ Keto-butyric acid (696), synthesized from 600b by the method of preparing 691a from 600b, can produce 696. NMR (CD3OD) d 2.45 (m, 1H), 2.7 (m, 1H), 3.75 (d, -692-) This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) 541309 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (690) 1H), 3.95 (q, 1H), 4.05 (d, 1H), 4.3 (m, 1H), 4.45-4.65 (m, 2H) , 5.05 (m, 1H), 7.5-7.76 (m, 3H), 7.7 (t, 1H), 7.8 (t, 1H), 7.98 (t, 1H), 8.55 (d, 1H), 9.1 (d, 1H) ).

696a R1-, 〇Bn 696c R1 *% fz = \ 696b R1- ^ OB, 696dRl- Ό 6% eRl- (3S) -2-keto-3- (isoquinolin-1-amidino) amino- 5-Hydroxyacetamido-N-[(2RS, 3S) -benzyloxy-5-keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-1H-1,5-benzene Benzodiazepine-1-acetamidine (696a) is synthesized from 600b by the method of preparing 690a from 600b, and can generate 696a. iH NMR (CDC13) β 0.95 (t, 2Η), 1.25 (t, 1Η), 1.4 (m, 2Η), 1.55 (m, 1Η), 2.55 (m, 1Η), 2.85 (m, 1H), 2.95 ( dd, 1H), 3.15 (m, 1H), 3.55 (m, 1H), 3.9 (m, 2H), 4.35 (t, 1H), 4.4-4.55 (m, 2H), 4.75 (m, 1H), 4.8 -5.05 (m, 2H), 5.45 (s, 1H), 5.55 (d, 1H), 6.85 (d, 1H), 7.15 (d, 1H), 7.2-7.5 (m, 5H)? 7.6-7.8 (m , 3H), 8.45 (d, 1H), 9.05 (d, 1H), 9.35 (d, 1H). (3S) -2-keto-3- (isoquinolin-1-fluorenyl) amino-5-hydroxyacetamidine-N- -693-This paper size applies to China National Standard (CNS) A4 specification (2I0X 297 (Mm) (Please read the notes on the back before filling out this page)-Rarely-

、 TT 541309 A7 ___________ B7 _'___ V. Description of the invention (691) (Read the precautions on the back before filling in this page) [(-RS, jS) -ethoxy-5-keto-tetrahydrooctane-3 -Yl] -2,3,4,5-tetrahydro · ιη_1,5-benzodiazepine microchloramine (696a), synthesized from 600b by the method of preparing 69〇a from 600b, Generates 696b. 4 NMR (CDC13) d 0 9 (m? 3H), 1.15 (q, 3H), 1.15 (m, 1H), 1.65 (m, 1H), 2.5 (m? IH), 2.8 (m, 1H), 2 · 95 · 3 · 0 (m, 2H), 3.6 (m, 2H), 3 · 7-3 · 85 (m, 4H), 4.0 · (m, 2H), 4.3 (m, 1H), 4.55 ( m, 1H), 4.65 (m, 1H), 4.85-4.95 (m, 1H), 5.05 (m, 1H), 5.35 (s, 1H), 5.45 (d, 1H), 6.85 (d, 1H) , 7.25 (d, 1H), 7.35-7.85 (6H), 8.85 (dd, 2H), 9.05 (m, 1H), 9.35 (dd, 2H). (3 5) -2-keto-3- (isoquinolin-1-fluorenyl) amino-5-hydroxyethylfluorenyl- [21 ^-(4-air + yl) lactyl-5-fluorenyl -Tetraazepine-3 -yl] -2,3,4,5-tetrachloro-1H-1,5-benzodiazepine-1-carboxamide (696c), using 690a from 600b The method is synthesized from 600b, which can generate 696c. 4 NMR (CD3OD) d 1.25 (t, 1H), 1.65 (q, 1H), 1.9 (m, 1H), 2.9 (m, 1H), 3.05 (m, 1H), 3.9 (d, 1H), 4.2 (m, 1H), 4.3 (d, 1H), 4.7-5.0 (m, 3H), 5.25 (m, 1H), 5.7 (s, 1H), 5.9 (d, 1H), 7.5 (d, 2H) , 7.7-7.9 (m, 3H), 8.0 (t, 1H), 8.2 (m, 2H), 8.75 (d, 1H), 9.35 (d, 1H). Printed by (3S) -2-keto-3- (isoquinoline-1-fluorenyl) amino-5-hydroxyethylfluorenyl- (2RS-cyclopentyloxy-5) -Keto-tetrahydrofuran-3-yl) · 2,3,4,5-tetrahydrobenzodiazepine-1-carboxamide (696d), synthesized from 600b by the method of preparing 690a from 600b, which can be produced 696d. 4 NMR (CDC13) d 0.9 (t, 1H), 1.2 (t, 1H), 1.3-1.45 (m, 2H), 1.6-1.8 (m, 4H), 2.45 ( m, 1H), 2.8 (m, 1H), 3.0 (m, 1H), 3.4 (q, 1H), 3.5 (d, 1H), 4.0 (m, 2H), 4.2-4.3 (m, 2H), 4.55 (d, 1H), 4.65 (m, 1H), 4.9 (m, 1H), 5.05 -694- This paper size is applicable to China National Standards (CNS) A4 specifications (2 丨 〇 &lt; 297 mm) 541309 A7 B7 'V. Description of the invention (692) (m, 1H), 5.4 (s, 1H), 5.5 (d, 1H), 6.8 (d, 1H), 7.3-7.9 (m, 6H), 8.5 (d 1H), 9.05 (d, 1H), 9.4 (d, 1H). (3S) -2-copperyl-3- (isojunyl-1-Ssyl) amino-5--5-ylethoxyl-N _ [(2RS, 3S) -epiethoxy-5-fluorenyl -Tetrachlorobiran-3 -yl] -2,3,4,5-tetrachloro-1H-1,5-benzodiazepine-1-acetamidamine (696e), using 690a from 600b The method is synthesized from 600b and generates 696e. 4 NMR (CDC13) d 1.2 (t, 1H), 2.4 (m, 1H), 2.8 (m, 2H), 3.6 (d, 1H), 3.7 (q, 1H), 4.0 (m, 2H), 4.3 (d, 2H), 4.65 (m, 1H), 4.85 (t, 1H), 5.0 (m, 1H), 5.35 (d, 1H), 6.5 (d, 1H), 7.15-7.85 (m, 8H) , 8.45 (d, 1H), 9.05 (d, 1H), 9.4 (d, 1H). (Please read the precautions on the reverse side before filling out this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs -695- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 5 、 Inventive note (693) Example 32 Table 27 Compounds printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs UV-Visible Ki (nM) Cell PBHC avg. IC50 (nM) Human whole blood IC50 (nM) Rat clearance, iv · ml / Min / kg rat clearance, rate, iv · ml / min / kg 688c 200% 689b-l 3.5 2700 696-1 0.5 696-2 0.5 697 1.8 5000 698 18 13500 699 1.1 699a-2 720 2.7 721 1.3 5000 722 5 5000 723 2.3 2000 724 2 1800 725 3.7 3000 726 300 727 50 2300 728 300 729 28 2800 730 90 8000 731 150 732 5 1800 733 5 1500 734 9 6000 735 6 10000 (Please read the notes on the back before filling in this Page) Order #! -696- This paper size applies to China National Standard (CNS) A4 (210X297 mm). Printed by Fei Cooperative 541309 A7 B7 V. Description of the Invention (694) Example 33 Compound 684a '688b-1' 688c, 689b-1, 690a-1, 696-1, 696-2, 696a-2, 696a-1, 697 697a, 698, 698a, 699, 699a, 699a-1, 699a-2, 800 and 801 were prepared as follows. , R5

CIP # R4 R3 R5 R1 684a CH3 Yayou H 〇OAc 688b-l CH3 MeO ^^ F 688c CH3 o H 0 XoH Λτ8 p 689b-1 CH3 Meaning CH3 MeO ^^ F Λοη V 690a-l CH3 and HO ^ 〇b 〇Η〇_1 ^ H o 々OEt X \ -OEt OEt -697- This paper size applies to China National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling this page)

541309 A7 B7 V. Description of the invention (ship) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economy CIP # R4 R3 R5 R1 696-1 〇H〇_l ^ F Aoh &quot; V 696-2 0 H〇4 Cl Aon &quot; Vh 696a-2 o Cl 696a-l 0 Η〇4 F 4: n 697 ao H Aoh V 697a ao H〇_l ^ H 4 698 hA HX〇H &quot; V 698a hA HA ° OBn 699 MeO ^^ H XoH V 699a MeO ^^ H 4: -698- (Please read the notes on the back before filling this page)

This paper size is applicable to China National Standard (CNS) A4 specification (210X 297 mm) 541309 A7 B7 V. Inventive Notes • Explanation (696)

CIP # R4 R3 R5 R1 699a-l 〇MeO ^ F 4: 699a-2 〇FX〇HV 800 0 Η〇 | H 801 〇 H XoH V (Please read the precautions on the back before filling this page). Order (3S ) -3-[(3S) -2-keto-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino-5-hydroxyethylsulfanyl-2,3,4,5- Tetrahydro-1H-1,5-benzodiazepine-buethamidinyl] 4,4-diethoxybutyric acid ethyl ester (690a-1), which can be synthesized by the method of 690a and 2100b 690a-l. 4 NMR (CDC13) β 1.15 (t, 6H), 1.3 (t, 3H), 2.25 (s, 6H), 2.60 (d, 2H), 3.50 (m, 2H), 3.70 (m, 4H ), 4.05 (m, 2H), 4.15 (m, 2H), 4.30 (d, 1H), 4.45 (m, 1H), 4.50 (d, 1H), 4.55 (d, 1H), 4.70 (t, 1H) 5.05 (m, 1H), 5.30 (s, 1H), 6.70 (d, 1H), 7.10 (d, 2H), 7.30-7.50 (m, 7H) (3S) -2-fluorenyl-3- (3 , 5-Diamino-4-amino radical) Amino-5-¾ethylethenyl radical N-[(2RS, 3S) 2-Methoxy-5-keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro · 1H-1,5-benzodiazepineacetamidine (697a), synthesized by the method of 677, can produce 840 mg of 697a, 4 NMR (CD3OD) d 1 · 78 (br. _ -699- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) Daddy! Printed by the Consumer Cooperative of the Central Standards Bureau, Ministry of Economic Affairs, Consumer Cooperatives, 541309 A7 B7, employees of the Zhongli Standards Bureau, Ministry of Economic Affairs Printed by Consumer Cooperatives V. Description of Invention (697 s, 2H), 2.48-3.58 (d, 0.5H), 2.6-2.7 (m, 0.5H), 2.8-2.9 (m 0.5H), 2.92-3.03 (m , 0.5H), 3.55-3.8 (m, 2H), 3.92-4.02 (d 1H), 4.25 · 4 · 3 (d, 0.5Η), 4.37-4 · 42 (d, 0 · 5Η ), 4.4 3-4.48 (m 0.5H), 4.55-4.65 (m, 1.5H), 4.7-5.12 (m, 5H), 5.44 (s, 0.5H) 5.58-5.63 (d, 0.5H), 6.95-8.1 ( m, 13H). (3S) -3-[(3S) -2-keto_3- (3,5-digas-4-aminofluorenyl) amino · 5 · Ethyl-2,3,4,5 -Tetrahydro-1H-1,5-benzodiazepine-1-ethylamidineamino] · 4 · ketobutyric acid (697), synthesized by the method of 2001 and 2002, yielding 14 mg of 697, lU NMR (CD3OD), 238-2.5 (m, 1H), 2.55.2 75 (m, 1H), 3.68-3 · 9 (m, 3H), 3.95-4.03 (m, 1H), 4 · 2-4 · 3 (m, 1H) 4.4-4.7 (m, 4H), 7.35-7.8 (m, 6H). (3S) -3-[(3S) -2-keto-3- (3,5-dimethyl-4-methoxybenzylfluorenyl) amino group 0 ′ hydroxyethylfluorenyl-2,3,4 , 5-tetrahydro-1H-1,5-benzodiazepine-fluorene · ethyl ethylamine] · 4-ethylacetoxy-3-butenoic acid ethyl ester (684a), synthesized by the method of 2100j , 684a, 4 NMR (500 MHz, CDC13 diastereoisomeric mixture) d 1 · 3 (s, 9H), 1.8 (s, 3H), 2.1 (s, 3H), 2.15 (s , 3H), 2.3 (s, 6Η), 3.3-3.5 (m, 3Η), 3.65 (s, 3Η), 3.9 (m, 1Η), 4.1 (d, 1H), 4.3 (d, 1H), 4.6-4.8 (m, 3H), 5.0 (m, 1H), 6.7 (s, 1H), 70 (d, 1H), 7.1 (d, 1H), 7.2-7.5 (m, 6H). (3S) -2-copperyl-3-isojunline-1-aminoamino-5-methylamino-N- [(2RS, 3 methoxy-5-keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-1fluorene-1,5 · benzodiazepine-1-acetamidine (698a), synthesized by the method of 652, can produce 795 mg of 698a, W NMR (500 MHz, CDC13 diastereoisomeric mixture) d 2.8 (m, 2H), 4.0 (m, 1H), 4.5-4.8 (m, 4H), 5.2 700- This paper is applicable to China National Standards (CNS) A4 specification (2IOX297mm) (Please read the notes on the back before filling this page} Order 541309 A7 _ _______B7_______ V. Description of the invention (698) (m, 1H), 5.5 (s, 1H), 5.75 (d , 1H), 7.3-7.85 (m, 11H), 7.9 (t, 1H), 8.2 (d, 1H), 8.6 (m, 1H), 9.3 (m, 1H). (3S) -3- [ (3S) -2-keto-3-isoquinolin-1-amidinoamino-5-methylamidino-2,3,4,5-tetrahydro-1H-1,5-benzodiazepine Leather-1-ethylamine amino] ketobutyric acid (698), synthesized by the method of 653, can produce 225 mg of 698,4 NMR (500 MHz, CD3OD) d 2.4 (m, 1Η), 2.6 (m, 1Η), 3.9 (m, 1Η), 4.2 (m, 1H), 4.3-4.7 (m, 4H), 5.1 (m, 1H), 7.3-7.5 (m, 4H), 7 .6-7.8 (m, 2H), 7.8 (m, 2H), 8.2 (d, 1H), 8.5 (d, 1H), 9.0 (d, 1H) 〇 (3S) -2-keto-3-iso Quinolin-1-amidinoamino-5-methoxyethylfluorenyl-N-[(2RS, 3S) 2-fluorenyl-5-keto-tetrahydrofuran-3-yl) -2,3,4 , 5-tetrahydro-1H-1,5-benzodiazepine-1-acetamidine (699a), synthesized by the method, can produce 820 mg of 699a as a brown solid, 4 NMR (500 MHz, CDC13) d 2.60 (ddd, 1H), 2.90 (ddd, 1H), 3.20 (s, 3H), printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) 3 25 (s, 3H), 3.70 (t, 1H), 3.90 (m, 2H), 4.20 (dd, 1H), 4.60 (m, 2H), 4.70-5.00 (m, 5H) , 5.55 (d, 1H), 7.0 (d, 1H), 7.20-7.50 (m, 7H), 8.45 (dd, 1H), 9.0 (dd, 1H), and 9.35 ppm (dd , 1H). (3S) -2-keto-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino-5-methoxyethenyl-N-[(2RS, 3S) 2-benzyl Oxy · 5 · keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydrofuran-7-fluoro-1Η-1,5-benzodiazepine-buethamine (688b-l ), Which can be synthesized by the method of 655 to produce 600 mg of 688b-1, 4 NMR (CDC13; a mixture of diastereoisomers) β 2.21 (s, 3H), 2.28 (s, 3Η), 2.42-2.50 ( m, 0.5 Η), 2.58-2.65 (m, 0.5H), 2.83-2.91 (m, 0.5Η), 2.98-3.1 (m, 0.5H), 3.18 (s, 1.5Η), 3.22 (s, 1 · 5Η), -701-This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 Printed by the Consumer Cooperatives of the Central Standardization Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (699) 3.72-3.78 ( d, lH), 3.78-3.9 (m, 2H), 4.08-4.15 (d, lH), 4.5-4.69 (m, 3H), 4.7-4.85 (m, 1H), 4.88-5.1 (m, 2H), 5.45 (s, 0.5H), 5.55-5.65 (d, 0.5H), 6.85-6.92 (m, 1H), 7.02-7.13 (m9 2H), 7.24-7.55 (m, 9H). (3S) -3-[(3S) -2-keto-3- (3,5-dimethyl-4-hydroxyfluorenyl) amino-5-methylethylfluorenyl-2,3,4 , 5-tetrahydro-7-fluoro-111-1,5-benzodiazepine-acetylacetamino] -4-ketobutanoic acid (689b-1), synthesized by the method of 2001 and 2002 , Can generate 689b-1, 1HNMR (CD3OD) θ2 · 18 (s, 6H), 2.36- 2.47 (m, 1H), 2.6-2.72 (m, 1H), 3.34 (s, 3H), 3.66-3.88 (m , 2H), 3.95-4.05 (m, 1H), 4.2-4.78 (m, 5H), 4.9 (m, 1H), 7.3-7.41 (m, 2H), 7.48 (s, 2H), 7.5-7.63 (m , 1H). (3S) -3-[(3S) -2-keto-3-isoquinolin-1-amidinoamino-5-methoxyethenyl-2,3,4,5-tetrahydro-1 -1,5-benzodiazepine-1-ethylamidoamino] -4-ketobutanoic acid (699), synthesized by the method of 2001 and 2002, can produce 699 as a white solid, 4 NMR (500 MHz, CD3OD) d 2.50 (m, 1H), 2.70 (m, 1H), 3.25 (s, 3H), 3.80 (bd, 1H), 3.90 (bd, 1H), 4.00 (bd, 1H), 4.30 (m, 1H), 4.50-4.70 (m, 3H), 4.80-4.85 (bt, 1H), 5.00 (bm, 1H), 7.40-7.55 (m, 5H), 7.70 (bm, 1H), 7.85 (bm, 1H), 8.00 (bm, 1H), 8.55 (bd, 1H), and 9.05 ppm (bd, 1H). (3S) -2-keto-3-isoquinolin-1-amidinoamino-5-hydroxyethylfluorenyl-N-[(2RS, 3S) 2-methoxy-5-keto-tetrahydrofuran- 3-yl] _2,3,4,5-tetrahydro-7-fluoro-1H-1,5-benzodiazepine-1-acetamidine (696a-1), which can be synthesized by the method of 656. 800 as a yellow solid, 4 NMR (500, MHz, CDC13) (ί 2.55 (ddd, 1H), 2.85 (ddd, 1H), 3.70-3.80 (m, 2H), -702-Applicable to this paper size China National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page)

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 541309 A7-B7 V. Description of Invention (TOO)] 95 (bm, 1H), 4.05 (d, 1H), 4.30 (d, 1H), 4.40-4.60 (m , 4H), 4,70.5 · 05 (m, 4H), 5.55 (d, 1H), 7.10 (d, 1H), 7.20-7.35 (m, 0H), 7.40-7 · 50 ( m, 1H), 7.60-7.85 (m, 3H), 8.40 (dd, 1H), 9.10 (m, 1H), and 9.30 pp (m, ih). (3S) -2-keto-3-isoquinoline; [-fluorenylaminohydroxyethylfluorenyl-N-[(2RS, 3S) 2-wordoxy-5. , 3,4,5 · tetrahydro-7-chloro-1Η-1,5-benzodiazepine q · acetamidine (696a-2), synthesized by the method of 677, can produce 204 mg of 696a- 2. It is a white solid, with the following exceptions: reducing the nitro group as follows: p-nitro compound (72 g, 20 mmol) in a solution of MeOH, add ANh4C1 (2 "g, 39 mmol) and zn ( 17 grams' 260 millimoles). The resulting mixture was heated at reflux for one hour and then cooled and filtered through Celite. The filtrate was concentrated under vacuum and treated with cold in HC1 to produce 3.6 grams of light red solid. iH NMR (CDC13) β 1.85 (s, 1Η), 2.45 (d, 0.5Η), 2.50-2.65 (m, 0.5Η), 2.80-2.90 (m, 0.5H), 2.90-3.00 (m, 0.5H ), 3.45 (s, 0.5H), 3.55-3.75 (m, 1H), 3.85-4.15 (m, 2H), 4.25 (d, 1H), 4.40-4.65 (m, 2H), 4.70-4.80 (m, 0.5H), 4.85-5.15 (m, 3H), 5.40 (s, 0.5Η), 5.60 (d, 0.5H), 7.00 (d, 0.5H), 7.15-7.90 (m, 12.5H), 8.35 8.45 (m, 1H), 9.00-9.10 (m, 1H), 9.25-9.40 (m, 1H) (3S) -3-[(3S) -2-one-3-isoquinolin-1-fluorenyl Amino-5-hydroxyethylfluorenyl-2,3,4,5-tetrahydro-7-fluoro-1H-1,5-benzodiazepine-1-acetamidine] -4-one Butyric acid (696-1), synthesized by the method of 2001 and 2002, can produce 140 mg of 696_1 as a white solid, 4 NMR (500, MHz, CD3OD) d 2.50 (m, 1H), 2.70 (m, 1H ), 3.85 (d, 1H), 3.95 (m, -703-) This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page) Order ^ __w! 541309 A7 B7 V. Description of the invention (701) 1H), 4.10 (d, 1H), 4.35 (m, 1H), 4.50-4.60 (m, 2H), 4.80 (bm, 1H), 5.00 (m , 1H), 7.40-7.48 (m, 3H), 7.65 (m, 1H), 7.75 (t, 1H), 7.85 (t, 1H), 8.00 (d, 1H), 8.55 (d, 1H), and 9.05 ppm (d, 1H) 〇 (3S) -3-[(3S) -2-keto-3-iso4 π lin-l-fluorenylamino-5-mercaptoethyl · 2.3.4.5- Tetrahydro-7-chloro-111-1,5-benzodiazepine_1-acetamido 4-ketobutanoic acid (696-2), synthesized by the method of 2001 and 2002, can be produced 250 mg of 696-2 as a white solid, 1HNMR (CD3OD) β 2.40- 2.55 (m, 1H), 2.60-2.75 (m, 1H), 3.80-4.00 (m, 2H), 4.05 (d 1H), 4.20-4.35 (m, 1H), 4.45-4.65 (m, 3H), 4.80-5.10 (m, 2H) (3S) -2-keto-3-isoquinolin-1-amidinoamino-5- Methoxyethenyl-N-[(2RS, jS) 2_Methoxy-5-fluorenyl-tetrachlorotetra-3-yl] -2,3,4,5-tetrahydro-7 · chloro -1H-1,5 · Benzodiazepine-1-Ethylamine (6 &quot;a-; i), synthesized by the method of preparation 655, can generate 699a-1, 4 NMR (500 MHz, CDC13) β 2.55 (ddd, 1Η), 2.90 (ddd, 1Η), 3.25 (s, 3Η), 3.28 (s, 3Η), printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back first) (Fill in this page) 3.80 (bt, 2H), 3.95 (bm, 2H), 4.25 (dd, 1H), 4.45-4.90 (m, 3H), 5.60 (d, 1H), 7.05-7.40 (m, 8H), 7.50 (bm, lH), 7.65-7.85 (m, 2H), 8.45 (d, 1H), 9.1 (m, 1H), and 9.35 ppm (m, 1H) (3S) -3-[(3S) -2-one -Iso-3-iso4line-1-amidinoamino-5-methoxyoxyethylfluorenyl-2.3.4.5- tetrahydro-7-chloro-1H-l, 5-benzodiazepine-1 Acetylamino] -4-ketobutanoic acid (699a-2), synthesized by the method of 2001 and 2002, can generate 699a-2, 1U NMR (500 MHz, CD3OD) δ 2.51 (m, 1H), 2.70 (dt, 1H), 3.31 (bs, 3H), 3.90 (bdt, 1H), 3.95 (bm, 1H), 4.05 (d, 1H), 4.35 (m, 1H), 4.50 (d, 1H), 4.60 (dd, 1H), 4.65 -704- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the invention (702) (dt, 1H), 4.80 (m, 1H) , 5.05 (m, 1H), 7.35-7.48 (m, 3H) 7.65 (bm, 1H), 7.75 (t, 1H), 7.82 (t, 1Η), 8.05 (d, 1H), 8 · 55 (d, 1H), and 9.05 ppm (d, 1H). (3S) -3-[(3S) -2-keto-3- (3,5-dimethyl-4-hydroxybenzylfluorenyl) amino is -methoxyethenyl-2,3,4 , 5-tetrahydro-111-1,5-benzodiazepine-1-ethenylamino] ylbutanoic acid, 0-2,6-dichlorofluorenyl oxime (688c), using 308d Synthesis method, 800,1HNMR (CD3OD) d2 · 2 (s, 6H), 2 58- 2.83 (m, 2H), 3.28 (s, 3H), 3.29: 3 · 34 (m, 1H) , 3.68-3.80 (m, 2H), 3.95-4.05 (dd, 1H), 4.38-4.48 (dd, 1H), 4.82-5.00 (m, 2H), 5.26-5.36 (m, 2H), 722-7.65 (m, 10H). (3S) -2-keto- (2,4-dimethyl, sedazol-5-yl) amino-5-hydroxyethylfluorenyl-N-[(2RS, 3S) 2-neoxy-5 -Keto-tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-1H-1,5 · benzodiazepine-l-ethylamine (800), prepared by using 696 a-1 Synthesized by this method, it can produce 800 mg of 204 mg as a yellow solid, ιΗ (CDC13) (a mixture of diastereoisomeric) β ι · 70 (s, 1Η), 2.40 employees of the Central Standards Bureau of the Ministry of Economy Consumption cooperative prints 2.8Ό (m, 7Η), 2.80-2.90 (m, 0.5Η), 2.95-3.05 (m, 0.5 ·), 3.30-3.35 (m, 0.5Η), 3.45- 3.55 (m, 0.5Η), 3.55-3.65 (m, 1Η), 3.80-4.05 (m, 2H), 4.30-4 · 50 (m, 2H), 4.55-4.65 (m, 1H) , 4.75-4.95 (m, 3H), 5.45 (s, 0.5H), 5.55 (d, 0.5H), 6.70 (d, 0.5H), 6.90 (d, 0.5H), 7.15-7.80 (m, 10H) (3S) -3-[(3S) -2-keto-3- (2,4-dimethyloxazolyl-1-fluorenyl) amino-5-anhydroethylacetamyl -2,3,4,5-tetrahydro-1H-1,5-benzodiazepine-acetylacetamino] -4-ketobutanoic acid (801), synthesized by the method of 2001 and 2002 ， 矸 炎 成 80 卜 __ -705- This paper ruler Applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A7 B7 V. Description of the invention (703 Example 34 Compound 720-73 was prepared in a similar manner to compound 619-635 (see, Example 13). Compound 720-73 The physical data are listed in Table 29. (Please read the notes on the back before ^^ this page) Ordered by the Consumers Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs to print 706 This paper size applies to China National Standard (CNS) A4 specifications (210X 297 mm) 541309 A7B7 V. Description of Invention (704) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 6Z4 + S CO CO VD m ο Η € Φn dP σ \ CTi CM Bu • ο tH dP σ \ σ \ τΉ &lt; N ΓΟ r—1 1 ro CTk VD cut L〇ΓΟ νο νο r—1 κο 〇5 O CO cvj ru CM Ό σ »cn CM m UX 〇i. = ^ = 〇. 择 丫 工 Ο.介 z 工 Λ ° Xr 1 2: X ό ° V Ο 04 Γ- rH CM (Please read the precautions on the back first and then this page) -707- This paper size is applicable to China National Standard (CNS) A4 specifications ( 210X mm) 541309 A7 B7 V. Description of the invention (705) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economy S $ eg 卜 00 LO LO L〇XI VD LD Η CU dP σ \ rH drH dP σ \ 卜L〇L〇KO o rH s οο Shou ΙΟ LO ro LO 〇LO ΪΧ4 Ο ο ro X bu CN Ο (Tk 〇CO CN; x VO CM 〇 ♦ γ ^ Γχ '. Female δ x 0 = C ^ = or &lt; N CM r- cn 04 Bu (please read the notes on the back again, please read 1¾ ^ this page) -708- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 A7 B7 V. Description of the Invention (7〇6) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs + S rH ΓΟ VO L〇CNJ Bubo ID Η re dP σι Cut CO L〇o rH dP σ \ σ \ σ \ CNJ 00 rH rH S : S VO L0000 cn in 'l〇C \ i L〇m ΪΧ4 CO 〇 CO CO CVJ 〇00 〇CM Γ0 E 00 CM o δ x and Xi Gong. Let X CM r- l〇CM r- -709- Paper size applies to China National Standard (CNS) A4 (210X297 mm) Please read the notes on the back before this page): Binding and ordering 541309 A7 B7 V. Description of invention (707 employees of the Central Bureau of Standards, Ministry of Economic Affairs Printed by the cooperative + X 00 〇CM VO VD VD Ο m Η CU dP σ \ σ \ VVD KD ο r—l dP cvj cn m 00 ο • σι Ο VD σ \ L〇Ο 'LO CNJ 00 ο rH Ο of CsJ ΓΟ Κ σι C \ J Ο 卜 Ο § CM Κ CVJ 〇 X Ρ χ. ^: Ρ. 七 ο χ δ: work. Yi ± VD &lt; Ν r- bu CM r- -710- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) (Please read the notes on the back before filling out this page) 541309 A7B7 V. Description of Invention (708 Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs + CO ^ σ &gt; • ΓΟ VO ro • Bu ο VD Η X VO LO LT) τ-Η tH όΡ CTk τ-Η rH VD rH rH S 00 〇T-1 VD r- 'lD c \ j CO L〇U4 2 〇rH 〇Γ〇 〇ΓΟ U o rH o • ^ r 2; 〇on K CO CM u X X ρ X. Finally, the factory X X 'p x factory. &amp; ox ί ω (Ν r- σ \ o \ r- -711) This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before ordering 541309 A7B7 on this page. Description of the invention (709 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs + U1 S, X CSJ CVJ Bu LO Γ ΟΟ LO 〇4 dP VD σ \ σ \ ΓΟ σ \ ΓP dP C \ J σ \ 00 &lt; NJ ο LO σ \ LO ΓΟ -L〇ΓΟ KD ιη h4 2 rH γΗ Ο ιΓ &gt; 'ZZ bu CVJ Κ ΓΟ CNJ υ rH rH 〇LO 奈 CVJ ac ^ 3 · CM u Sai Λ. Let Γ XP x af 8 9 &gt; X ο C0 r- rH CO r- 712- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the notes on the back before filling this page) 541309 A7 B7 V. Description of the invention ( 710 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs + X σ \ m σ \ to c \ • to VO L〇dP 00 (Ti o kD • oo &gt; P 00 σ \ LD Γ- ΓΟ • 卜 Γ0 i〇 • (NJ Γ ΙΟ rH If) • CM L〇Ϊχ4 X rH rH 〇00 00 CsJ 5C VD CVJ 〇oi-1 〇§ CN 5 CM o Race 〇x! &Gt; 5 x. CM cn r- 00 cn r- -713- This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) Please read the notes on the back before reading

541309 A7 B7 V. Description of the invention (Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs +711 VO 〇〇〇 VD r—1 CM Γ〇 Eh Second network P-ι dP σ \ VD lD κο • σ \ o &gt; P CNJ σι Bu 00 00 ο τ-Η 3: S CNJ KD CD o VD &lt; N VD σ \ ο CX4 Bu g § CM X CM CO o CTk ο in Bu C \ J κ οο CNJ CJ 褰 工 px 0 = ^ r at ρ X cn r- m cn -714- This paper size is applicable to China National Standard (CNS) A4 (210X 297 mm) Please read the notes on the back first

541309 A7 B7 V. Description of the Invention (712) Example 35 Compound 736-767 was prepared in a similar manner to compound 619-635 (see Example 13). The physical data for compounds 736-767 are listed in Table 30.

(Please read the Caution Sheet on the back of the page 30-on this page printed compounds R4 R3 736 Ο ηο ^ λ. 737: ο 738 H3CO 〇 Η〇4 739 〇H3C 0 Η〇 ^ Ί40 0 741 Ο 715- This paper size applies to China National Standard (CNS) A4 (210X 297 mm)

1T k 541309 A7 B7 V. Description of the invention (713) Compound R4 R3 742 printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economy 742 〇 〇_l ^ 743 0 ηο ^ Λ. 744 0 745 〇 Η〇4 746 Ο Η〇 4 747 OCH3 0 748 eC .0 749 0 HjCCrOCcHs 0 Η〇4 750 Ο Η〇4 751 0 Η〇 ^ 752 0CH3 0 Η〇_1 ^ (Please read the precautions on the back before writing this page) I # 装· Order-716- This paper size applies to Chinese National Standard (CNS) A4 specification (2I0X 297 mm) 541309 A7 B7 V. Description of invention (714) Compound R4 R3 753 H3C printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 0 H〇4 754 • 0 0 H〇4 755 0 756 OHO 0 ΗΟ ^ Λ. 757 OH 0 0 H〇4 758 o 759 0 Η〇_1 ^ 760 0 761 OC 0 762 0 H〇 ^ 763 0 (Please Read the notes on the back first _ 舄 this page)

、 1T -717- This paper size is applicable to China National Standard (CNS) A4 specification (210X 297mm) 541309 'Invention Note (715)

The data from the above example printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs of IL-10 thousand can clearly show that the compound-converting enzyme according to the present invention exhibits inhibitory activity. The chelating substance of the present invention can inhibit tritium in a test tube, and can further be sent to mammals, and has a small clinical track, and the cells are expected to die-GIF and IFN-Bu Zhoujie <there are obvious clinical uses in disease ... this test The compounds have been shown to inhibit ICE in vivo. ^ 2: We have described many specific examples of the present invention, and the basic idea can be changed to propose other specific examples, the products of ′ :: and their production methods. Because &amp; 'It is very clear: The scope of the present invention by the company directly, such as r ge K A order Zanyue, is defined by the scope of the attached patent application, rather than by way of example. Only what can't be found in the paper (specific and specific paper size suitable financial g _ Pi (-718-

Claims (1)

Male 8 8 8 8 A B c D 92.4. 23 or 541309 Patent Application No. 085115799 Chinese Application for Patent Scope Replacement (April 1992) VI. Application for Patent Scope 1. A compound represented by the formula (VI) r1-n-r2 'I Η where: 1 is ... (elO) (w2) C is benzo, optionally -F, -Cl, -NCCCOCu straight or branched alkyl, -Cu straight or branched alkyl, -OCu straight or branched alkyl, straight or branched alkyl) 2, -tri Fluoromethyl, -S (0) 2Cu straight or branched alkyl, or mono and multiple substitutions: R2 is ·: a) The paper size applicable to the Chinese National Standard (CNS) A4 specifications (210X297 mm) 'Scope of patent application, or (b) 〇 Each ruler 5 is independently selected from the following: -C (0) -R10, where R10 is phenyl, optionally, indolyl, fluorenyl, isofluorinyl, Cl-6 straight or branched alkyl (depending on It may be substituted by phenyl), monomethyl p-stilbene, p-pyridyl, benzotrisynyl or Weijun-Yodo_; -C (O) -N (R10) (R10) 'where R1〇 is fluorene or phenyl, which may be substituted by _ ^^^ straight or branched alkyl, as required; -S (0) 2-R9 'where Rio is phenyl or benzoyl, -C (0) C ( 0) _Ri〇 ′ where is phenyl, optionally substituted by -〇Cu straight or branched alkyl; x5 is CH or N; Y2 is H2 or 0; Han 8 is: -H, -C (0) -R1〇, where ri〇 is η, -Cl_6 straight or branched alkyl group, if necessary, -2- = Zhang scale is applicable to Chinese national standard (Ca ^^), 541309 A8 B8 C8 _ D8 ________ 6. Scope of patent application. It can be N-morpholinyl, aminothiazolyl, tetrazolyl, methyltriazolyl, N-yridyl, 4-yridyl-N _yridyl, N_ Harbinyl, N-thiomorphinyl, N-methyl-N-piperazinyl, dioxypyrazine, N-phenylmorpholinyl, ketoketo, or N-acetyl p Substituted by -C (O) -CH2-OR10, where R10 is fluorene, -C1-6 straight or branched alkyl, -CCCOCu straight or branched alkyl, triisopropylsilyl, or phenyl,- C (0) CH2CN, -CN, -C (O) -CH2N (R10) OR10, where R10 is -Cu straight or branched alkyl, or -C (O) CH2S-R10, where R1 is methylimidazole R13 is -Cl-6 straight or branched alkyl; each R51 is independently -Cw straight or branched alkyl, -C ^ straight or branched alkylphenyl where phenyl If necessary, it may be -Cl,-straight or branched alkyl, or a saturated 4-8 member carbocyclic ring, which may be benzo-fused as required; each R21 is independently selected from the following including -H or -Cw straight or branched Alkyl; Qi is -N (Ci_6 straight or branched alkyl) 2, -NH2, -Cl, -OCu straight or branched alkyl, which may be substituted by N-morpholinyl, _OH, -OCCCOCu straight Or branched alkyl, -C &quot; straight or branched alkyl, straight or branched alkyl, -NCIDCCCOCw straight or branched alkylphenyl, or 〇 / \ ch2 \ / 0; -3- This paper size applies to Chinese national standards (CNS ) A4 size (210X 297 mm) 541309 8 8 8 8 A BCD Proviso that when R 2 is: square R21 is Η; and γ2 is 〇, R5 cannot be _C (O) R10, where R10 is _CH2CH2 Ah and Ar3 is unsubstituted phenyl; or -S〇2R9, in which the foot 9 is methyl; and when Y2 For H2, R5 cannot be -C (O) R10, where R10 is -CH2CH2 Ar3 and Ar3 is unsubstituted phenyl. 2_ The compound according to item 1 of the scope of patent application, wherein: R13 is a C 1-4 straight or branched alkyl group; R21 is -H or -CH3; R51 is a C1-6 straight or branched alkyl group or Ci_6 straight or Branched alkylphenyl, optionally substituted by -C 1; and Ql is -NH2 '-Cl'-OCu straight or branched alkyl, -OH, -Cu straight or branched alkyl, alkyl, NiHjCCCOCu straight or Branched alkylphenyl, or, 0,. -4- This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) The compound according to item 1 of the scope of patent application, wherein Ri is (w2). 4. The compound according to item 2 of the scope of patent application, wherein ring c is a substituted benzo. The compound according to item 1 of the patent application scope has _c (〇) _Ri〇 or -C (〇) -CH2-〇R10. • The compound according to item 5 of the scope of patent application, wherein 8 is _c (〇) -CHy 〇Ri0, and 111 () is -Η or -CH3. 7. The compound according to item 1 of the patent application, whose center is Bu 10), and is CH 〇8. The compound according to item 1 of the patent application, whose center is Bu 10), and \ is 9. The compound of any one of claims 1-8 in the scope of patent application, the center of which is _C (0) -R104-C (0) _C (0) _R1〇. 10. The compound according to item 9 of the scope of the patent application, wherein Ri0 is phenyl, and thus may be single or multiple substitutions of Qi, indyl, fluorenyl, isostrenyl, or dimethyl p-septamyl. U. The compound according to item 10 of the scope of patent application, wherein: Han 10 is a phenyl group, which may be mono- or multi-substituted as required by Qi; and Qi is a straight or branched alkyl group) 2, _Nh2, _C1, · (: Bu 4 straight or branched alkyl, _ 0 Η, _ C 1-4 straight or branched alkyl, _ N (H) C (0;) C i alkyl, or N (H) C (0) Cb6 Alkyl phenyl. 12. The compound according to item 11 of the scope of patent application, wherein 0 is phenyl, which is -C1 at the 3- or 5-position or -NH2, -oc ^ or-at the 4-position. 5- 541309 8 8 8 8 AB c D VI. Single or multiple substitutions of branched alkyl, -OH, alkyl, or NOHXXCOCu alkylphenyl groups in the scope of patent application. 13. Compounds according to item 1 of the scope of patent application, which are Selected from the following: η 688a 692a And 692b CH, Cl H -6-This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 541309 8 8 8 8 ABCD VI. Application scope of patent 14. The compound according to item 1 of the scope of patent application, which is Selected from the following including 213k 550k : And 550m 15. The compound according to item 11 of the scope of patent application, wherein R1Q is a phenyl group, which is a single or multiple substitution of a Ci_4 straight or branched alkyl group at the 3- or 5-position; ) A4 specification (210 X 297 mm) 541309 8 8 8 8 AB c D 6. The scope of the patent application is replaced by -0-R5 at the 4-position, where R5 is fluorene or -C ^ straight or branched alkyl. 16. The compound according to item 1 of the scope of patent application, which is selected from the group consisting of: η 690a ; And 695c This paper size applies the Chinese National Standard (CNS) A4 specification (210 X 297 mm) 541309 8 8 8 8 A B c D Patent application scope 17. The compound according to item 1 of the patent application scope is selected from the following including 〇 214W-4 214W-5 H3C. CH, 〇 This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 8 8 8 8 A B c D :and 18. The compound according to item 1 of the scope of patent application, wherein R1Q is vermidolyl or isoquinolyl. 19. The compound according to item 18 of the application, wherein R1Q is isoquinolinyl. 20. The compound according to item 1 of the scope of patent application, which is selected from the group consisting of: 696a This paper size is in accordance with Chinese National Standard (CNS) A4 (210 X 297 mm) 541309 8 8 8 8 A B c D Patent Application 696a-l Η HO, 〇 Λ b 696a-2 HO, 0 Cl Μ Η b HO / 0 696b N H ^ 〇 \ / CH3 696C Cl -11 This paper size applies to Chinese National Standard (CNS) A4 (210 X 297 mm) 541309 A8 B8 C8 This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 VI. Scope of Patent Application 21. This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 8 8 8 8 A B c D 6. Scope of patent application 〇 22. The compound according to item 1 of the scope of patent application, where the compound is -14- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 541309 A8 B8 C8 D8 6. Application scope of patent 23. A compound according to item 1 of the scope of patent application, wherein R1Q is phenyl substituted with 〇 I \ ch2 \ / 0. 24. The compound according to item 1 of the scope of patent application, wherein the compound is: 〇 25. The compound according to item 1 of the scope of patent application, which is selected from the following including: -15- This paper size applies the Chinese National Standard (CNS) A4 specification (210 X 297 mm) 541309 6. The scope of patent application 8 8 8 8 AB c D 264d 264e -16- This paper size is in accordance with China National Standard (CNS) A4 (210 x 297 mm) 541309 8 8 8 8 A BCD patent application scope 264f ufi η a 264g H h a 264h 〇 X H 〇 〇 N, Λ H 〇 〇 264j • 17- This paper size is in accordance with Chinese National Standard (CNS) A4 (210 x 297 mm) 541309 8 8 8 8 A BCD 々 Scope of patent application 〇 26. The compound according to item 1 of the scope of patent application, which is selected from the group consisting of: 213e 〇; • 18- This paper size applies to China National Standard (CNS) A4 (210X297 mm) 541309 8 8 8 8 A B c D Patent Application 〇 304a 2001 2100a 2100b 2100C -19- This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 8 8 8 8 A B c D Patent Application Scope 2100d 2100e 213c 213f H NIC / H3C -20- This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 々, patent application scope 2l3g 213h 213i 213j 2131 This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 541309 8 8 8 8 ABCD patent application scope 213〇 213ρ 213g 213r 213s -22- This paper size applies to China National Standard (CNS) A4 specification (210 X 297 mm) 541309 6. Scope of patent application 213t 213u 213v 213w 8 8 8 8 A BCD -23- This paper size applies Chinese National Standard (CNS) A4 specification (210 X 297 mm) 541309 A8 B8 C8 D8 Patent application scope 〇 213x 245 245b 256 550f -24- This paper size applies Chinese National Standard (CNS) A4 specification (210X 297mm) 541309 々, patent application scope 550h 550i 5501 550η 550〇 550ρ -25- This paper size applies Chinese National Standard (CNS) A4 specification (210 X 297 mm) 541309 VI. Patent application scope 21001 2io〇g 2100h 2100j 2100k 8 8 8 8 A B c D -26- This paper size is applicable to Chinese National Standard (CNS) A4 (210 X 297 mm) 541309 A8 B8 C8 D8 Patent application scope 21001 2100m 2100η 2100ο 27. The compound according to item 1 of the scope of patent application, which is selected from the following including: -27- This paper size applies the Chinese National Standard (CNS) A4 specification (210 X 297 mm) 541309 6. The scope of patent application 8 8 8 8 A BCD -28- This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 A8 B8 C8 D8 541309 VI.Scope of patent application 8 8 8 8 Α Β c D 6 9 0 3. ~ 1 697a Cl 〇 h2n Cl N 〇 6 ο 698a -30 This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 8 8 8 8 A B c D 6. Scope of patent application -31-This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 A8 B8 C8 D8 541309 A8 B8 C8 D8 541309 A8 B8 C8 This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 8 8 8 8 A B c D This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 541309 A8 B8 C8 D8 541309 A8 B8 C8 D8 541309 8 8 8 8 A B c D Application scope 3036 3037 s, 〇 〇 〇 H3c-s 〇 3038 〇 ^ -P〇I; II H3C—ο 3040 H3c-0, 3041 CH3 n, ch3 0 3042 -38- This paper size applies to Chinese National Standard (CNS) A4 (210 X 297 mm) 541309 A8 B8 28. 29. 30. A pharmaceutical composition for the treatment of the ten attacks, the disease, or the prevention of the disease of 1L_, which is based on the effective amount of any of the items in the scope of claims 1-27 A chemical compound and a pharmaceutically acceptable carrier. A &amp; pharmaceutical composition &apos; that treats or prevents cell death-mediated diseases &apos; includes an effective amount of a compound according to any one of the scope of application patents No. 17 and 27 and a pharmaceutically acceptable carrier. The pharmaceutical composition according to item 28 of the application, wherein the IL-1-mediated disease is an inflammatory disease selected from the following including osteoarthritis, acute pancreatitis, chronic pancreatitis, asthma, and respiratory pain in adults Syndrome group. -39- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (21 × 297 cm) 541309 A8 B8 C8 D8 Patent application scope 31 • According to the pharmaceutical composition No. 30 of the patent application scope, the inflammatory disease is Osteoarthritis or acute pancreatitis. The pharmaceutical composition according to item 28 of Shenyan's patent scope, wherein the il-1 -mediated disease is an autoimmune disease selected from the group consisting of angioglobulonephritis, rheumatoid arthritis, systemic lupus erythematosus, hard Dermatosis, chronic thyroiditis' Grave's disease, autoimmune gastritis, insulin-dependent diabetes mellitus (type I), autoimmune hemolytic anemia, autoimmune neutropenia, thrombocytopenia , Chronic active hepatitis, myasthenia gravis, inflammatory bowel disease, Crohn's disease, and graft-to-host disease. 33. The pharmaceutical composition according to item 32 of the application, wherein the autoimmune disease is rheumatoid arthritis, inflammatory bowel disease, or Crohn's disease, or psoriasis. 34. The pharmaceutical composition according to item 28 of the application, wherein the disease is a destructive gastro-skeletal disorder selected from the following including osteoporosis or skeletal disorders associated with multiple myeloma. 35. The pharmaceutical composition according to item 28 of the scope of application for patent, wherein the disease mediated by 是-丨 is a proliferative disorder selected from the following including acute myeloid leukemia, chronic myelogenous leukemia, metastatic melanoma, Kaposi 'S sarcoma' and multiple myeloma. 36. The pharmaceutical composition according to item 28 of the scope of patent application, wherein the disease mediated by IL "is an infectious disease selected from the following including sepsis, septic shock, and Shigella disease. 37. The pharmaceutical composition according to item 28 of the application, wherein the mediated disease is a degenerative or necrotic disease selected from the following including Az Pack -40- 541309 A B c D 6. Scope of patent application Haimer's disease, Parkinson's disease, cerebral hemorrhage and myocardial infarction. 38. The pharmaceutical composition according to item 37 of the application, wherein the degenerative disease is Alzheimer's disease. 39. The pharmaceutical composition according to item 29 of the application, wherein the disease mediated by the expected cell death is a degenerative disease selected from the group consisting of Alzheimer's disease, Parkinson's disease, and cerebral hemorrhage, Myocardial infarction, spinal muscular atrophy, multiple sclerosis, AIDS-related encephalitis, HIV-related encephalitis, aging, baldness, and neurological damage due to stroke. 40. A pharmaceutical composition for inhibiting a caspase-mediated function, comprising an effective amount of a compound according to any one of claims 1-27 of the scope of patent application and a pharmaceutically acceptable The carrier. 41. The pharmaceutical composition according to item 40 of the application, wherein the cysteine protease is ICE. 42. A pharmaceutical composition for treating or preventing an IL-1 -mediated disease, comprising an effective amount of a compound according to any one of claims 1-27 of the scope of patent application and a pharmaceutically acceptable carrier . 43. A pharmaceutical composition for treating or preventing an IFN-r-mediated disease, comprising an effective amount of a compound according to any one of claims 1 to 27 of the scope of patent application and a pharmaceutically acceptable carrier . 44. The compound according to any of claims 1-27 of the scope of patent application, for the manufacture of a medicament for the treatment or prevention of a disease selected from the group consisting of: IL-1 mediated disease, cell death mediated disease, inflammation Disease, autoimmune disease, destructive osteodystrophy, proliferative disorder, infectious disease, degenerative disease, necrotic disease, osteoarthritis, pancreatitis, qi-41-This paper wave scale is applicable to China Standard (CNS) A4 (210X297 mm) 541309 A8 B8 C8 ------------ Pβ scope of patent application, two adults with respiratory distress syndrome, glomerulonephritis, rheumatoid arthritis, systemic lupus erythematosus, scleroderma, chronic thyroid Inflammation, Gram's disease autoimmune Θ inflammation, insulin-dependent diabetes mellitus (type I), autoimmune hemorrhagic anemia, autoimmune neutropenia, thrombocytopenia, chronic active hepatitis, severe Myasthenia, inflammatory bowel disease, Crohn's disease, psoriasis, graft-to-host disease, osteoporosis sclerosis associated with multiple myeloma, acute myeloid leukemia, chronic myeloid leukemia, metastatic melanoma, card Percy's sarcoma, multiple myeloma, septicemia, septic shock, Shigella, disease, Alzheimer's disease, Parkinson's disease, cerebral hemorrhage, myocardial infarction, spinal muscular atrophy, Multiple sclerosis, Ams-associated encephalitis, HIV-associated encephalitis, aging, baldness, or neurological damage due to stroke. An effective dose of the drug is administered to the patient. Science composition.化合物 Compound No. 44 of the patent claim 'wherein the disease is selected from the group consisting of osteoarthritis, acute pancreatitis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, psoriasis, and Alzheimer's Moore's disease.化合物 The compound according to any one of the scope of application patent No. 丨 _27, which is used for the manufacture of a medicament for the treatment or prevention of a disease selected from the following diseases: igif-mediated diseases' IFN_r-mediated diseases, inflammation_ Immune diseases, infectious diseases, proliferative diseases, neurodegenerative diseases, necrotic diseases 'osteoarthritis, acute pancreatitis', chronic pancreatitis, asthma, rheumatoid arthritis, inflammatory bowel disease, Crohni_ , Colon ulcer, cerebral hemorrhage 'myocardial infarction' adult respiratory pain syndrome, septic hepatitis, failure -42- 541309 47 .: Symptomatic septic shock, Shigella disease, scleroderma, chronic thyroid urine type), juvenile diabetes, autoimmune, immune neutropenia, thrombocytopenia, myasthenia None, Multiple Sclerosis 'Psoriasis' Lichen Planus Graft for Host Disease, Acute Dermatomyositis, Eczema, Primary Liver Cirrhosis, Hepatitis, Uveitis, Behcet, Disease, Acute Dermatomyositis Skin *, pure: blood: hypoplasia, hypoplasia anemia, amyotrophic lateral sclerosis or symptoms of nephropathy 'is an effective dose of the pharmaceutical composition administered to the patient. The compound according to item 46 of the application, wherein the disease is selected from the group consisting of inflammatory diseases, autoimmune diseases, infectious diseases, rheumatoid arthritis, colon ulcers, Crohn's disease, hepatitis, adult respiratory distress syndrome, Globululonephritis, insulin-dependent diabetes mellitus (type 1), juvenile diabetes, psoriasis, graft-to-host disease, and hepatitis. A method for preparing an N-fluorenylamino compound, the method includes ... Charge η # a) Mix carboxylic acid with N-alloc (alloc) -protected amine, and in the presence of inert solvent 'triphenylphosphine, nucleophilic scavenger, and tri-triphenylphosphine palladium (〇) 'At ambient temperature and inert atmosphere; and b) add HOBT and EDC to a) mixture; and if necessary contain the following further steps 骡: c) hydrolysis b) the mixture of step ，, and in a solution containing acid and 1120 In the presence of 'where step B) the mixture is concentrated as needed. 49. The method according to claim 48, wherein the inert solvent is CH2C12, DMF, or a mixture of CH2C12 &amp; DMF. -43- This paper size applies to China National Standard (CNS) A4 (210X 297mm) 41309 50. According to the method in the 48th scope of the application for patents, the nucleophilic master contained dimedone, Morphine, trimethyl stilbene. One will know】] methyl barbituric acid. Trimethyamine or di-51. The method according to item 50 of the scope of patent application, wherein the nucleophilic main is dimethyl dimethyl arsenyl dimethylamine or dimethyl barbituric acid. Yes_ • According to the method in the scope of patent application No. 50, in which the cu 1 inert solvent is lw2C12, DMF, or a mixture of CH2C12 and DMF. ^ According to method 52 of the scope of the patent application, wherein the nucleophilicity is dimethyl barbituric acid. … According to the method in the scope of patent application No. 53 Acetic acid, about 1-90 / 0 weight. • Acid method according to item 54 of the scope of patent application, about 20-50% by weight. According to the method of claim 53 of the patent application, the acid 'is about 0.1-30% by weight. According to the method of claim 56 of the patent application, the acid 'is about 5-15% by weight. 58. According to the method of any one of claims 48 to 57 of the scope of application for a patent, the base amino compound is represented by formula (VIII): (VIII) RrN-R2 I Η where: Ri is: 53 54 56 57 Solution including three gases, including trifluorine, falling liquid including trichloromethane, solution including hydrochloride, N-brewing -44- This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm)-~ '- ---------- — 541309 A8 B8 C8 D8 541309 A8 B8 C8 The patent application scope m is 1 or 2; each 115 is: -C (O) -R10, -C (O) -N (R10) (R10), -s (o) 2-r9, or -C (O) C (O) -R10; X5 is CH or N; ¥ 2 is 112 or 0; R6 is · Η;-trans 8 is: -C (0) -R1〇, -C (O) -N (H)- R10, -C (O) -CH2-OR10, or -C (O) C (O) -R10; each R9 is independently selected from the following including _ Ar3 and -Ci_6 straight or branched alkyl groups, as required by -Ar3 Substitution, where the -Cw alkyl group is unsaturated as desired; each R10 is selected from the following including -H, -Ar3, -C3-6 cycloalkyl, and -Cu straight or branched alkyl, as required -Ar3 is substituted, in which -Cw alkyl is unsaturated as desired; Han 13 is-&lt; ^ 1-6 straight or branched alkyl, as needed is _4,-(:: (^ 112, · 〇R5 , -OH, -〇R9 or -c〇2H; each R5 丨 is independently R9 or -C (〇) -R9, or each together form a saturated 4-8 member carbocyclic ring or contains · 0-, -S -Or -NH- heterocyclic ring; each Rn is independently -H or -Cw straight or branched agile; -46- This paper size applies Chinese National Standard (CNS) A4 specification (210 X 297 mm) 541309 Each Ah is a cyclic group, independently selected from the group consisting of: aromatic groups containing $, ι〇, ^ or 碳 carbon atoms and aryl rings, and aromatic heterocyclic groups containing 5 to 15 ring atoms and 1 to 3 rings A heterocyclic group, the heterocyclic group containing at least one heteroatom selected from the group consisting of S'S〇2'-N &quot; and _NH-, and the heterocyclic group optionally containing one or more double bonds, the heterocyclic group The base view needs to contain one or more wan zai, and the Weihuan base view needs to be a single or multiple substitution of _ Q 1; each Ql child is selected from the following including 4112,40211,-(: 1, _ ?,-: ^, -NHR5, -〇R9, = N (R9) (u, _R9, C (〇) _R1〇, and 〇, 〇 The restriction is that when -Ars is replaced by Ql, it contains one or A plurality of additional -Ah groups, the additional -Ar3 group is not replaced by another -Ar3. 59. The method according to any one of claims 48-57 of the scope of the claimed patent, wherein the N-allo-protected The amine is: Wherein: R51 is independently selected from the following including R9, _C (〇) _R9, -C (0) -N (H) _R9, or R5i together to form a saturated 4-8 member carbocyclic ring or contain -〇-, _S -Or 47- 541309 A8 B8 C8 D8 Six, the scope of patent application -NH- heterocyclic ring. 60. The method according to item 58 of the scope of patent application, the center of which is: (A-elO) ( 〇 〇 61. According to the method of patent application No. 58, the center is: (A-W2) -48- This paper size is in accordance with Chinese National Standard (CNS) A4 size (210 X 297 mm) 541309 8 9 · _ Chinese Patent Supplement No. 085115799 Patent Application (September 91) Table Ϊ The dimples are used in Table 2. Architecture StructureA Η〇〇 人 〇H OR5i GH OR51 B _〇1 f &quot; 0H H η 〇HN = \ rNi3 f H OR51 C 〇r-nWV λ Η H OR51 I R8 H OR51 D R5, N0? H 〇〇 ^ n ^ y &quot; 〇r51 H 〇r51 J R5 / 1¾ A〇R51 (mV ^ nVrsi H OR51 E ^ CO in〇H〇〇 人 N ^ (H 〇R51 K n1 / ^ \ 0 H 〇Ac 541309 Architecture structure Architecture structure F 〇A Η 〇cAN \ Η 〇Ac L An ° oAn &quot; S Η 0R51 Μ 〇◦η3_ &lt; Γ ^ 〇 j H〇〇 people ask people ^ ㈠ Η 〇541309 213e 213c | 2100e ί 1 2100d 2100c 2100b 2100a 2001 304a 264 Compound Number &gt; &gt; &gt; ο σ σ &gt; &gt; &gt; o c6H5c ⑼-, CH3C (0)-C6H5C (〇)-c6H5c (〇)-C6H5C (〇)-C6H5C (〇 )-C6h5c (〇)-C6H5C (〇) C (〇)-c6H5c (〇)-c6h5c (〇)-XI cn c6H5CH2- c6h5ch2- CH3CH2-(ch3) 2ch- ο X LJ 1 ch3ch2- (ch3) 2ch- c6h5ch2 ~ on: UJ c6h5ch2-LH 1 1 1 1 1 1 1 1 I 1 1 1 1 1 1 1 1 1 1 1 1 XI 00 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 X 390-391 390 531 530-531 529- 530 529 528- 529 527 441-442 432-433 Data pages (English) (Pages) &gt; 2 潞 A 嫜 crane 丨 Minus -3- 541309 550k 550i 550h 550f 213m 2131 213k 213j 213i 213h _ 213g 213f. &Gt; &gt; &gt; &gt; &gt; &gt; &gt; &gt; &gt; &gt; &gt; &gt; Miscellaneous • 3,5— Cl2-4—H0C6H2C (〇) —4—CH3〇C6H4C (〇) —3-C1 -4-H2NC6H3C (〇)-4- (CH3) 2NC6H4C (〇)-3,5-Cl2-4-CH3OC6H2C (0)-3-Cl-4 4-CH3C (〇) N (H) C6H3C (〇) -3, 5 — Cl2 — 4-Hoc 6H2C (〇) 3,5-Cl2C6H3C (0) to 4-CH3 〇C6H4C (〇) -3-Cl-4-H2NC6H3C (〇)-3- (CH3) 2NC6H4C (〇)-4- (CH3) 2NC6H4C (〇)-CH3CH2- ch3ch2- n X rr N? 1 ch3ch2-c6h5ch2 -c6h5ch2- c6h5ch2- c6h5ch2-c6h5ch2- C6H5CH2- c6h5ch2- c6h5ch2- cn 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 CO 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 X 556- 557 en cn 555- 556 (jn Cn cn 554- 555 cn Cn Cn 553-554 Cn cn UJ 552- 553 CJ1 cn ΓΟ 551-552 Data Pages (English pages) -4- 541309 N) ίο ro ΓΟ ro ΓΟ N5 ro M ro K &gt; (J1 cn cv Μ U) ω Μ ω H Η * LO Λ Η ω Η1 ω 0 Η1 ω 〇〇H * 〇〇tr 〇oo H) ui o 3 cn o H Lifeline # &gt; &gt; &gt; &gt; &gt; &gt; 2: &gt; &gt; &gt; &gt; &gt; 1 Ο ο π: ϋΟ 1 ο U) 1 彐 U), CJ1 OJ I 0 H · 1 en Π: Ν &gt; 1 π: LJ CD ft 1 〇1- · 1 o ΓΟ Ο ο X ΟΝ X ΓΟ 1 Η * μ I π: 〇〇ο CD 〇a \ X oc \ D: o cn X o σ \ X ro 1 j X 2: α 〇σ \ X two ζ π: D CD py ^ -V —s. o Engineering o Ln X 〇!-* 〇ο ο UL P · Q o 〇oo 〇 z ο σ \ π: ο '^ · — ^ 1 Η1 ο 1 common ο x Φ 1 1 1 1 VJ cn XN) ϋπ o cr »工 ο 〇1 ο 1 DN o · &lt; 〇1 Ο 1 ο cr» χ ο σ \ αζ Ο σ% Π: ο X ο σ \ X 〇CTi Π: o X o X o X 1 o r &gt; io X ο rr cn cr »οι LJ \ ja \ η: ro tc ΡΟ Π: Μ X ISJ π: ΓΟ XN) ΠΠ N &gt; J o 9 ^ -L «cn Π: | X N &gt; | 1 1 1 1 1 1 1 1 2 ro! II 1 1 1! 1! 1 1 1 1 1 1 1 1 1 1 1 I 1 1 1 1 PoCD 1 1 I 1 1 1 1 1 ι 1 1 1 1 1 1 1 I 1 1 1 1 II 1 X CJ1 κ &gt; 571-572 en η 57 0 -571 〇ι -J 〇569 -57 0 cn &lt; Ti cn σ \ U) 562 -563 CJl CT \ N3 557-558 cn; -j Number of data pages (English pages) -5- 541309 412f 412e 412d 412c 412b 412a 213y 550q 213x 213w 213v 213u 213t Teach cv life parameters >> '1-isoquinolinoyl 1-isoquinolinoyl 1-isoquinolinoyl 1-isoquinolinoyl 1-isoquinolinoyl 1-isoquinolinoyl 1-isoquinolinoyl 4-CH3C (〇) N (H) C6H4C (〇)-4-H〇3, 5 — ( CH3) 2C6H2C (〇)-1-naphthylC (〇)-3,4,5- (CH3〇) 3C6H2C (〇)-4-(CH3) 2CHCH2C (〇) N (H) C6H4C (〇)-Ln CH3CH2- CH3CH2- cyclopentyl cyclopentyl C6H5CH2CH2-C6H5CH2CH2- C6H5CH2- CH3CH2- c6h5ch2- 1 _ C6H5CH2-j c6h5ch2- c6h5ch2- C6H5CH2- XI cn 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 ρα GO 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 l 1 1 1 1 1 1 1 X vn &gt;: &gt; 1 1 Cn 00 h-1 X &gt; &gt; X &gt; Π &gt; X &gt; 574 -57 5 en 573- 574 en -JU) 57 2 -57 3 Number of data pages (English pages) -6- 541309 2100ο 2100η 2100m 21001 2100k 2100j 412h 412g 214w-7 214w-6 214w-5 214w-4 214w-3 214w-2 214w_l Miscellaneous cv line icon &gt; &gt; &gt; &gt; &gt; • η &gt; &gt; &gt; &gt; &gt; &gt; &gt; &gt; &gt; Lacquer C6H5C (〇)-. C6H5C (〇)-, C6H5C (〇)-c6H5c (〇)-c6H5c (〇)-c6H5c (〇)- l-isoquinolinoyl l-isoquinolinoyl 3, 5 — (CH3) 2 — 4—HOC6H2C (〇) —3, 5 — (CH3) 2-4 — HOC6H2C (〇) —3,5 — (CH3) 2 — 4—HOC6H2C (〇) —3f 5- (CH3) 2-4-HOC6H2C (0) — 3, 5 — (CH3) 2-4 — H〇C6H2C (〇) —3, 5 — (CH3) 2-4 — H〇C6H2C (〇) -3, 5 — (CH3) 2 — 4-Hoc 6H2C (〇)》 Xf C6H5CH2- c6h5ch2- 2-indanyl cyclopentyl c6h5ch2ch2- 0 vz OJ Π: ro 1 c6h5ch2- C6H5CH2 -cyclopentyl cyclopentyl C6H5CH2CH2-C6H5CH2CH2-C6H5CH2- c6h5ch2- c6h5ch2- P0 1 1 1 1 1 1 1 1! 1! 1 1 1 1! 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 OD 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 I 1 1 I 1 1 1 1 1 1 1 1 X cn ro CJI h-1 CJi VD h-1 cn VO 〇Cn 〇564-565 173 X &gt; X &gt; π X &gt; X &gt; η &gt; π &gt; 173 &gt;: &gt; X &gt; tn X &gt; data pages (English pages) 541309-, 264h J 264g i 264f 264e 1 264d 264c. 264a 245b ro in 550p 550〇550n teach CV command oo 〇n 〇〇o π &gt; &gt; &gt; hybrid 4-CH3C (〇) N (H) C6H4C (〇)-2-indoloyl '1 C6H5N (H) C (〇)-, C6H5CH2C (〇)-1 2-CH30C6H4N (H) C (0)-3-CH3〇C6H4N (H) C (〇) _ 2-naphthylsulfonyl- c6h5c (〇)-c6H5c (〇)- 4-HocC6H4C (〇) -2-indoloyl 3-CH3C (〇) N (H) C6H4C (〇) -cn c6h5ch2- c6H5CH2-c6h5ch2- c6h5ch2- c6h5ch2- c6h5ch2- C6H5CH2-c6h5ch2- c6h5ch2- 0 ro 1 CH3CH2-ch3ch2-U * »1 1 1 1 I 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 CO 1 1 1 1 1 1 1 1 l 1 1 1 1 I 1 I 1 1 1 1 1 1 1 1 X -j N3 671-672. (T \ 670-671 〇669-67 0 Ch σ \ KD Ch K) Office Cn 593- 594 592-593 Number of data pages (English pages) -8- 541309 688b 688a σ &gt; 00 in σ &gt; 00 ro σ »CD o • -J 〇σ \ CJl U1 cn ro 00 2641 264k 264j 264i Life Ci CD a CD a 〇a 〇o ο OOO Miscellaneous 3, 5 — (CH3) 2—4—HocC6H2C (〇) —3,5-—Cl2 — 4—HocC6H2C (〇) —3-C1-4-NH2-C6H3C (〇)-c6H5c (〇)-C6H5C ( 〇) C (〇)-2, 6— (CH3〇) 2C6H3C (〇) C (〇) 4—H〇 3,5- (CH3) 2C6H2C (〇) —3, 5—Cl2 — 4—H 〇One C6H2C (〇) One 3,4-methylenedioxybenzoyl 3,4-methylenedioxybenzoyl 4 One HOC6H4C (〇) One phenylsulfonyl- 4 One CH3〇C6H4C (〇) One P0 c6h5ch2- C6H5CH2-c6h5ch2-c6h5ch2- c6h5ch2- c6h5ch2- CH3CH2-C6H5CH2- c6h5ch2- C6H5CH2- c6h5ch2- cn ch3och2c (〇) -CH3〇CH2C (〇) -tipso-ch2c (〇) -ch3c (〇) 〇ch2c (〇)-hOch2c ( 〇) -h2ch2c (〇) -ch3c (〇)-ch3c (〇)-1 1 1 1 1 1 1 1 1 1 0D 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 X o 703 -7 04 ο ro 〇o CTv VD VD σ \ CO (Tk LP σ \ OD 00 680 -681 Ch 673- 674 U) 67 2 -67 3 Data Pages (English Pages) -9- 541309 696e 696d 696c 696b 696a 691c 693 692b 692a 695c 695b 695a 690b 690a Compound No. ο οo CD 〇〇oooo G) Stick 1-isoquinolinoyl 1-isoquinolinoyl 1 ρ ω ωc 〇I- * H * D 〇 * &lt; 1-isoquinolinoyl 3,5- — (CH3) 2-4 — CH3〇C6H2C (〇) -c6h5c (〇)-3, 5-C1- 4—H〇C6H2C (〇 )-3, 5-C1 — 4—H0C6H2C (〇) —3, 5— (CH3) 2 — 4—CH3OC6H2C (〇) —4-CH3C (〇) N (H) C6H4C (〇)- c6H5c (〇)-j 4-HOC6H4C (〇)-3, 5 — (CH3) 2 — 4-H〇C6H2C (〇) -1 丨 C6H5CH2CH2-cyclopentyl 4-ClC6H5CH2 ~ ch3ch2- c6h5ch2- c6h5ch2- c6h5ch2- CH3CH2-c6h5ch2- c6h5ch2- C6H5CH2-c6H5CH2-C6H5CH2- η: 〇ο 工 NJ 〇 Ο 1 〇ο Du to 0 1 h〇ch2c (〇) -h〇ch2c (〇) -hoch 2c (〇)- h〇ch2c (〇) -CH3C (〇)-H〇CH2C (〇)-h〇ch2c (〇)-h〇ch2c (〇)-X 〇〇N) 〇〇1 H〇CH2C (〇) -h. ch2c (〇)-h〇 ch2c (〇)-00 1 1 I 1 1 1 1 1 1 1 1 1 1 I 1 II 1 1 1 1 I 1 1 1 1 1 1 X! .729 729 728-729 7 28 728 710 7 09 709 7 08 7 08 7 07 707 705-7 06 7 05 iNumber of data pages (English page Number) -10- 541309 3001 CD 〇〇699a-l 699a 698a 697 a 696a-l 696a-2 690a-l 688b-1 684a Difficult cv life ο CD M CD (D o MM 1-1 Miscellaneous 1-isoquinolinoyl work 1-isoquinolinoyl 1-isoquinolinoyl 1-isoquinolinoyl 3, 5-Cl2 ~ 4-NH2C6H2C (0)-1-isoquinolinoyl 1-isoquinolinoyl 3, 5— (CH3〉 2 — 4 — H〇C6H2C (〇) —3,5- (CH3) 2—4—H0C6H2C (〇) —3, 5 — (CH3) 2 — 4—CH3OC6H2C (〇) —cn c6h5ch2- c6h5ch2- c6h5ch2- c6h5ch2- c6h5ch2- c6h5ch2- C6H5CH2-c6h5ch2- CH3CH2 -C6H5CH2- (CH3) 3C-cn N-morpholinyl CH2C (〇) h〇ch2c (〇)-ch3〇ch2c (〇)-ch3〇ch2c (〇)-HC⑼-h〇ch2c (〇)-HOCH2C ( 〇) -h〇ch2c (〇) -h〇ch2c (〇) -ch3〇ch2c (〇)-1 CH3C (〇)-OD 1 1 I 1 1 1 1 1 1 1 〇1 1 I 1 X π X CD UJ U) CO 00 en 7 34-7 35 7 33-7 34 7 36-7 37 U) U) U) 7 35 -7 36 CJ Data Sheet Number (English pages) -11-541309 -12- 541309 -13- 541309 -14- 541309 U) ω ω ω fo ui N3 CJl o office o • u 〇o office life Ch (J1 CO t- · w Μ CD CD O 2: 1 彐 〇T5 zr U) cn H * l ·-» 1 1 〇Ui 3 H- α 0) O σ »X n Π: π ω 〇Λ 广 〇1— * P- D ro 1 male! N 〇H * D 〇 cn ^ O Η * D 〇I— · 1 —J n P: PO 〇VC o 〇〇Ρ Ο D CD (-Π 1 1 P * D 〇JL, ro ^ | 1 on: 1 o (Ti D: o crv D: ro o N) oo »·» 〇0 1 1 ο CT »ΡΠ 〇cr» D: o ΟΛ X o σ \ 工 oc \ X CP X Γ〇 J 1 1 X ro! LT »^ Π: N &gt; 1 X ro 1 X NJ 1 o D: ox U) 〇〇oo X 1 1 1 1 o 3: N) rr fO 〇o rr ✓— o CD 〇o ro 1 1 1 0 1 1 1 1 1 cn P ox UJ 1 I 1 1 1 1 X 426- 427 426-42 7 X w X CD X cn 1 1 Data pages (English pages) 541309 Compound 214w -1 lH NMR (ppm, CDC13): 7.66 (0.35H, d, J = 6.9Hz), 7.46-7.20 (7H, m), 6.93 (0.35H, d, J = 7.7Hz), 6.85 (0.65H, d, J = 7.6Hz) / 6.73 (0.65H, d, J = 7.6Hz), 5.96 (0.35H, bs), 5.85 (0.65H, bs), 5.56 (0.65H, d, J = 5.2Hz), 5.28 (0.35H, b s), 5.20-4.98; (2H, m), 4.96-4.40 (4H, m>, 3.28-2.55 (3H, m), 2.53-2.32 (1H, m), 2.23 (6H, s), and 2.0 · 3-1 · 40 (7H, m) · Compound 214w-2 lH NMR (ppm, CDC13): 7.42 (2H, s), 7.38 — 7.26 (5H, m), 6.85 (1H, d), 6.74 (1H, d), 5.95 (1H, bs), 5.57 (1H, d), 5.17- 5.03 (2H, m), 4.88 (1H, d), 4.77-4: 47 (3H, m), 3.25 -3.09 (1H, m), 3.04-2.66 (3H, m), 2.54-2.29 (2H, m), 2.23 (6H, s) f \ \ and 2.06-1.50 (5H, m).! I compound 214w- 3 j lH NMR (ppm, CDC13): 7.78 (1H, d), 7.47 (2H, s), 7.37 — 7 · 24 | (5H, m), 6.94 (1H, d), 5.31-5.07 (2H, m), 4.91-4.83 (1H, m), i 4.7 5 (1H, d), 4.57-4 · 40 (3H, m), 3.35-3 · 21 (1Η, γπ), 3. · 18- 2.90 (2H, m ;, 2.72-2.32 (2H, m), 2.22 (6H, s), and 2.11-1.51!-+ I (5H, m). J 'j compound 214w-4 (lH NMR ( ppm, CDC13): 9.53-9 · 48 (1H, m), 8.88 (1H, d), 8.51! (1H, d), 7.89-7.81 (2H, m), 7.76-7.65 (2H, m) , 7.37-7.20 (5H, m), 6.22 (1H, d), 5.41 (1H, d), 5.24-5.12 (1H, m), 4.95-4 · 89 (1H, m), 4.70- 4.55 (2H, m), 4.22-4.14 (1H, m), 3.87-3.75 (1H, m), 3.20-2.80 (6H, m), 2.47-2.33 (2H, m), and 2.04-1.61 (5H, m). 16- 541309 Compound 214w-5 lH NMR (ppm, CDC13): 7.55 (1H, d) f 7.48 (2H, s) r 7.34-7.15 (5H, m), 6.80 (1H, d), 5.37 (1H, bs), 5.20 -5.04 (1H, m), 5.08 (1H, s), 4.85-4.79 (1H, m) &gt; 4.56-4.46 (1H, m), 4.40- 4.34 (1H, m), 3.96-3.84 (1H, m ), 3.74-3.62 (1H, m), 3.32- 3.06 (2H, m), 2.98-2.85 (3H, m), 2.78-2.64 (1H, m), 2.45- 2.35 (1H, m), 2 23 (6H, s), 2.20-1.97 (1H, m), and 1.92-1.54 (5H, m). Compound 214w-6 XH NMR (ppm, DMSO-d6): 8.84 (1H, bs), 8.48 ( 1H, bd), 8.23 (1H, bd), 7.50 (2H, s), 5.58 (d, 1H, J = 5Hz), 5.09 (t, 1H, J = 4.8Hz), 4.75 (m ,, lH), 4.60 (m, 1H), 4.42 (1H, m), 4.18 (1H, m), 3.34 (s, 4H), 2.96-2.65 (m, 2H), 2.40-2 · 05 (m, 8H), 2.00- 1.80 (m, 2H), and 1.80-1.50 (m, 8H). 4D compound 214w-1 XH NMR (ppm, DMS〇-d6): 8.84 (1H, s), 8.69 (1H, d), 8.24 (1H, d), 7.50 (2H, s), 5.34 (d, 1H, J = 5Hz), 5.00 (t, 1H, J = 4.9Hz), 4.78 (m, 1H), 4.32 ( m, 1H) f 4.20 (2H, m), 3.3 5 (s, 4H), 3.10-2 · 80 (2H, m), 2.40-2.05 (m, 8H), 2.00-1.80 (m, 2H), and 1.80-1.50 (m, 8H) lH NMR (ppm, DMSO-d6) 1: 1 syn / anti: 9.10-9.00 (2H, m), 8.78 (0.5H, d, J = 6.8Hz), 8.62-8.50 (1.5H, m), 8.10- 8.00 (2H, m), 7.90-7.65 (2H, m), 7.45-7 · 25 (5H, m), 5.68 (0.5H, d, J = 5.0Hz), 5.45 (0.5H, s ), 5.20-5.00 (m, 1H), 5.00-4.85 (m, 1H), 4.85-4.60 (m, 2.5H), 4.50-4.30 (m, 1.5H), 3.50-3.35 (m, 4H), 3.20 -2.50 (3H, m), 2.50-2,00 (m, 3H), 2.01: U75 (m, 2H), and 1.75-1.40 (π \ Λ 2H). Compound 412a lH NMR (ppm, CDC13): 9.47 (1H, d), 8.80-8.69 (1H, m), 8.51-8.46 (1H, m) f 7.90-7.75 (2H, m), 7.73-7.63 (2H, m), 7.34- -17 -541309 7 · 16 (6H, m), 5.31 (1H, s), 5.21-5.06 (1H, m), 5.03-4.97 (m, 1H), 4.61-4.47 (m, 1H), 4.42-4.35 (m , 1H), 4.02-3.91. (1H, m) r 3-82-3.69 (1H, m), 3.20-2.70 (6H, m), 2.48-2.29 (m, 2H), 2.18-2.02 (1H, m ), and 1.98-1.50 (6H, m). Compound 412b lH NMR (ppm, CDCI3 4 CD3OD): 7.48-7.43 (m, 3H), 7.33-7.17 (m, 6H), 5.51 (d, 1H), 5.12 - 4.90 (m, 2H), 4.72-4.47 (m, 2H), 4.18-4.07 (m, 1H), 3.89-3.76 (m, 1H), 3.42-3.28 (m, 1H), 3.14-3.05 (m, 1H ), 2.97-2.90 (m, 1H), 2.86-2.62 (m, 2H), 2,59-2.45 (m, 1H), 2.42-2.32 (m, 1H), 2.26 (s, 6H), and 2.01- 1.58 (m, 5H). Compound 412c χΗ NMR (ppm, CDCI3): 9.45 (1H, d), 8.76; (1H, d), 8.5C 丨 (1H, d), 7.85-7.60 (m, 4H), 7.25 (1H, d), 5.39 (1H, s), 5 • 40-5.00 (2H, m), 4.60-4.50 (1H, m), 4.35 (1H, t), 4.24 (1H, m), 3.30-2.70 (4H, m), 2.42 (2H, m), 2.10 (1H, m), and 2.00-1.40 (12H, m) · Compound 412q lH NMR (ppm, CDCI3): 9.53-9.47 (1H, m), 8.83 (1H, d), 8.54 (1H, d), 7.90-7.82 (2H, m), 7.78-7.64 (2H, m), 7.46-7 · 32 · (5H, m), 6.54 (1H, d), 5.58 (1H, d), 5. .23-5.09 (2H, m), 4.91 (1H, d), 4.78-4.54 (3H, m), 3.15-2.70 (4H, m), 2.53-2.31 (2H, m), and 2 • 06-1 • 58 (5H, m). Compound 412h XH NMR (ppm, CDC13): 9.46 (1H, d, J = 8.6Hz), 8.74 (1H, d , J = 7.9Hz), 8.44 (1H, d, J = 5.5Hz), 7.88-7.66 (4H, m), 7.34 (5H, s), 7.19 (1H, d, J = 6. 8Hz), 5.43 (1H, s), 5.16 (1H, m), 5.01 (1H, m), 4.83 (1H, d, J = 11.6Hz), 4.63 (1H, d ,. J = ll.6Hz ), 4.63-4.45 (2H, m) f 3.23-2.99 (3H, m) f 2.80 (1H, m), 2.48-2.35 (2H, m), 2.20-2.08 (1H, m), and 1.85-1 · 53 (4H, m). -18- 541309 Compound 550α XH NMR (ppm, DMS〇-d6) 1: 1 syn / anti: 9.10-9.00 (2H, m), 8.77 (〇5H, d, J = 6.6 Hz), 8.60-8.50 (1.5H, iu), 8.10-8.00 (2H, m), 7.90-7 · 60 (2H, m), 5.58 (0.5H, d, J = 5.0Hz), 5.34 (0.5 ·, s), 5.20-5.00 (1H, m), 5.00-4.80 (1H, m), 4.70-4.50 (0.5H, m), 4.50- 4.30 (1H, m), 4.30- 4.15 (0.5H, m), 3.80-3.50 (m, 2H), 3.50- 3.25 (1H, m), 3.15-2.40 (3H, m), 2.35-2 · 00 (5H, m), 1.90-1.50 (2H, m), and 1.21-1.10 (3H, t). Compound 4i2f NMR (ppm, CDC13): 9.53-9,48 (1H, m), 8.88 (1H, d), 7.89-7.80 ( 2H, m), 7.78-7 · 63 (2H, m), 6.49 (1H, d>, 5.49 (1H, d) 5.24-5.08 (2H, m), 4.79-4 · 54 (2H, m) A 4.00-3.86 (1H, 3.75-3 · 62 (1H, m), 3.22-2.80 (4H, m), 2.52-2.38 (2H, m), 2.16-1.90 (8H, m), and 1.33-1.17 (3H, m). -19- 541309 3001 541309 541309 I 541309 Jinming # 3004 23 541309 -24- 541309 541309 Immortal Ginseng 3007 ° Γ -26- 541309 4b life match 3008 οσωοσ r, -A -27- 541309 -28- 541309 541309 541309 -31-541309 -32- 541309 4CV life ginseng 3014 CD30D 541309 34- 541309 \ J 000s Cold Purine 3016 -35- 541309 Life command 3017 u〇 &gt; 'D -36- 541309 -37- 541309 -38- 541309 -39- 541309 ΙΊ 今 命 # 3022 sc] 3 5 Han Luo 4 -40- 541309 541309 Hop Ming # 3024 S30D 4. r 42 541309 -43- 541309 -44- 541309 Cold life # 3027 541309 Cold Ginseng 3028 541309 Hop Ming 3029 oio sen 541309 Y ° oMO 4CT 3S3 sc 13 -48- 541309 ^^ # 3S5 541309 -50- 541309 541309 Destiny 3S8 ΟΓΓ CDC13 -52- 541309 j -53- 541309 -54- 541309 55 541309 -56- 541309 -57- 541309 -58-