TW570980B - Latent baculovirus expression system - Google Patents

Abstract

The invention relates to a baculovirus including a disruption in its endogenous p35 gene and its use in establishing latent baculovirus infections. In some embodiments, the baculovirus can also include a sequence encoding a non-baculovirus RNA and a baculovirus early gene promoter which drives expression of the non-baculovirus RNA.

Description

^ lyjyoyj A7 B7 V. Description of the invention (1) The former case of the iOLiLi case is based on priority claim No. 60 / 094,411 filed on July 28, 1998. Background of the 2 & patent application: Baculoviridae Viruses, commonly known as baculoviruses, are deadly pathogens of the order Lepidoptera. These viruses usually kill their hosts by infecting insect tissues. Hexaviruses usually contain The length is about π mjA 1 rw, 160 kb < covalently closed loop: gene, group. The genome can accommodate relatively long heterogeneous sequences = In addition, high levels of structural diseases can be reached during productive infections Parental protein synthesis. Results' The baculovirus / insect cell system has become a universal protein expression medium in academic research and industrial applications. However, because baculoviruses will lyse cells at the end of infection, genetically engineered proteins escape and are difficult to concentrate Sincerely, the invention is based on the discovery that latent infection can be established if the p35 gene of baculovirus is disrupted (during the infection, the virus Partial or all late gene expression is blocked 'but early gene expression is allowed). As a result, by having an interrupted < gene and by the baculovirus early promoter (i.e. any promoter that can promote baculovirus expression in av infection) ) A baculovirus promoted by an exogenous gene can infect any appropriate host cell to establish a persistent baculovirus expression culture system. 4 This paper is applicable to China National Standard (CNS) A4 specifications.)-570980 V. Description of the invention ( As a result, a permanent baculovirus expression culture system can be established by infecting any suitable host cell containing the interrupted p35 gene and a baculovirus derived from an early promoter of baculovirus. Cells, which are resistant to baculovirus repetitive susceptibility, that is, re-infection of the virus. Therefore, p35 interrupted caliciviruses can be used to protect insects, especially economically valuable insects (such as silkworms), Free from pathogenic baculovirus. Therefore, the present invention is characterized by the production of RNA and foreign proteins. # 35 virus with interrupted p35 gene. Child bacilli Virus can be further-contains encoding the first RN ^ (such as non-baculovirus RNA), and promote the expression of the first RNA: the genes of early genes promoters (such as immediate early & due to promoters) #, The first RNA of the sequence can be the mRNA encoding the first protein (such as the protein of the non-capillary disease patient), such as a detectable protein (such as lactosidase). The baculovirus can also contain a second non- rod if necessary. RNA of a baculovirus. A non-baculovirus can be the money for a second protein (such as non-baculo white matter), for example, its performance can be detected by fluorescent, luminescent, or chromogen. Protein. Protein expression can also be expressed as a phenotype. Examples of selectable phenotypes: 'Mitotic resistance, such as resistance to neomycin or G418 The virus can be used to drive the expression of a second protein from a rod-shaped promoter, Two eggs-5- This paper is of suitable size — (Please read the note on the back? Matters and then fill out this page), 丨 -install ----_! 丨 order -------. Ministry of Economic Affairs wisdom Printed by the Property Bureau's Consumer Cooperative (297 mm) 570980 A7

Printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs when white matter imparts drug resistance. Early baculovirus promoters (such as promoters derived from the baculovirus ^^ 丨 gene) are promoters that can promote performance early in the life history of the virus, that is, just after the virus enters and expresses the structure of most viruses A promoter previously expressed by a protein. Baculoviruses are composed of promoters (such as promoters derived from the gene for the protein of casual shock), and are promoters that promote their performance in all stages of the life cycle of the virus in the context of the baculovirus gene's electrical context. The baculovirus is activated early or the baculovirus promoter is not necessarily derived from the baculovirus genome. Promoters derived from the genomes of other organisms and viruses can be used in the baculovirus of the present invention. The present invention also includes a method for expressing non-baculovirus RNA and non-baculovirus protein by introducing the baculovirus of the present invention into human cells. The present invention is also characterized by a method for reinfecting a virus in a cell by introducing an interrupted first baculovirus cell in its endogenous state gene and exposing the cell to a second baculovirus. Cells come in contact with a second baculovirus, which means that the cell or an organism (such as a skirt) containing; = is placed in an environment suspected or known to contain baculovirus. The environment can be man-made (such as cultures with human baculovirus added) or in the wild (such as those known to have pathogenic baculovirus)

As used herein, the term " inhibition " 咅 P. The interruption of two genes, M. quinquelus, and partial inhibition, is any deletion in the gene (for example, deletion of the starter gene.. ------- Order -------. 0, (Please read the notes on the back before filling this page)

The specifications of this paper are applicable to Zhongguanjia A4 specifications 〇χ 29 ~ 570980 A7 B7 4 V. Description of the invention (: column), insertion or other mutations, 丨 due to loss or error of transcription effect ㈢ loss or error indication of failure effect 'Or the loss of amino acid sequence of the protein function, making the gene non-functional. And the baculovirus and method of the present invention provide a novel eukaryotic protein expression system and system that can be used in both academic and industrial fields. Unlike previous baculovirus manifestations, it is characterized by a lytic infection. The baculovirus and the method of the present invention make it possible to perform the performance of the cultures prepared with #perennial dry virus infection. In addition, the baculovirus described in this article is repeatedly infected with cells that are resistant to baculovirus mothers. This is the first step in protecting an economically stable mollusk from baculovirus-infected disease. . Other features or advantages of the present invention can be clearly understood from the following pictures and detailed description, and from the scope of patent application. Ken ^ Brief description: Guwei / China has interrupted the 35 gene of the household and introduced the iacz and neo genes into the baculovirus genome region. The present invention relates to a baculovirus with a disrupted household 35 gene. These baculoviruses establish a latent viral infection in insect cells, leading to two important results. First, the latent state of baculoviruses can be used to express proteins in persistent cultures. Second, the latent state of baculovirus blocks subsequent calicivirus infections. The latter observations provide a way to protect economically valuable maggots from diseases that are flared by baculovirus. ----- ^ -------- t ---- (Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs

570980 A7 _ B7 V. Description of the invention () The homologous region of the nucleotide (+219 to +849) of the p35 ATG start codon was inserted into plastid pThsN90Z, so that both genes were located in the p94 and p35 gene sequences. Flanking to generate the transfer vector pTA35hsN90Z. These household-specific and household-specific 35-specific fragments were generated by PCR, and their sequences were confirmed by DNA sequencing. AcTNPV genomic DNA and plastid pTA35hsN90Z were co-transfected into TN368 cells for homologous recombination. The recombinant virus, called vAcZa p35, was selected by X-gal staining and transfected TN368 cells were screened by blue spots with inclusion bodies. In infected sf21 cells, the lack of inclusion body was further used to further colonize To confirm. The antibiotic G418 (2 g / ml) was used in all screenings to remove any wild-type virus. Recombinant viruses were further confirmed by their restriction maps of genomic DNA and by the withering of cells that they had defied when infecting Sf21 cells. The second AcMNPV used in this example is vAcAnh, also known as the fire reducer, as described in Clem et al., Science 254: 1388-1390, 1991. The virus contains a deletion of 754 base pairs in the H.35 gene, causing the truncated p35 protein to lose 132 amino acids from its carboxyl terminal. For complementary research, 735 were created for pKi35hN. This plastid contains the iel gene promoter driven by AcMNPV; the 735 gene has a complete open reading frame. A hr5 promoter sequence (Guarino et al., J Virol 60: 215-223, 1986) of 677 base pairs was introduced upstream of the 仏 / promoter. The neo gene is driven by the Drosophila promoter described above. If you want to produce performance;? 35 cell line, use CellFECYINTM (Life Technologies) to transfect pKi35hN to Kun-9- This paper size applies the Chinese National Standard (CNS) A4 specification (210 X 297 mm) (Please read the back Note 咅? Please fill in this page again.) ---- Order -------- · Printed by the Employees 'Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs Printed by the Employees' Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs Printed by 570980 A7 B7 (7) Intracellular of the insect. Neosemisinin-resistant pure germlines were cultured in the presence of 2 mg / ml G418 for two weeks, and three individual pure germlines were isolated. For infection experiments, & (fallarmyworm) cell lines Sf9 and Sf21AE, and Spodoptera litura (am ·) (cabbage looper) cell line TN368, TNM-FH medium (Life Technologies) supplemented with 8% fetal bovine serum was maintained at 26 ° C. Each virus was propagated in TN368 cells. Viral force was estimated by plaque analysis using TN368 cells. When Sf21 cells are infected with vAcAnh virus or vAcZAp35 virus, most of the cells are lysed by cell dying. Cells that survived 7 days after infection resulted in a purely germline of persistently infected cells. Infection with a wild-type virus or a rescued mutant vAsB6-l (BirnBaum et al., J Virol 68: 2521-2528, 1994) does not produce persistent pure lines. Therefore, suppression of persistent viral infections is not due to specific p35 function, but rather more likely to be due to general effects directly or indirectly related to the blocking of cell death. In order to confirm the blocking of persistent viral infection, 4 × 104 Sf21 cells were stably transfected after infection with pKih35hN with vAcAnh of infectivity (m0i) 50. Seven days after infection, virus inclusions were clearly seen, suggesting that functional p35 was produced in these cells sufficient to complement the content of the defect in vAcAnh. These cultures have never produced persistent pure germlines, indicating a lack of p35 function associated with persistent viral infection, rather than any cis (cb) effect on% gene positions in the viral genome. Evaluate various; 735 mutants establish long-lasting-10- This paper size applies to China National Standard (CNS) A4 specifications (210 X 297 mm) (Please read the precautions on the back before filling this page) ----- Binding ---- --- 570980 A7 B7 Printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs. 5. A description of the invention (Ability of pure germline of infected cells. At a density of 4xi04 cells per well, the parental cells (Sf9 or Sf21) Inoculate in 96-well culture plates and

Hz-1, AcMNPV, vAcAnh, vAcZAp35, or VAsB6_l infection. Seven to 10 days after infection, the number of viable cells was determined by trypan blue exdusion. A pure cell line containing more than five cells is registered as a viable pure line. These cells are propagated to form a possible monolayer. Although some pure germlines die during reproduction, the number of primary colonies formed by infection with a certain concentration of a virus can still effectively measure the formation potential of individual mothers. Only vAcAnh and vAcZAp35 were able to produce purely germline with persistent infection. No such pure germline was observed in cells infected with wild type or VAsB6-l virus at a wide range of potency. In these experiments, the higher the m0i, the more colonies were generated, suggesting that the specific viral gene product (s) promoted the formation of pure germline of persistent infection. This result is consistent with the conclusion that p35 blocks entry into the virus.

Π · Jie_The long-infected pure germline has preserved the disease-loving DNA. To establish a unique pure germline culture that is persistently infected with baculovirus, in a 24-well culture plate, use vAcAnh and vAcZAp35 for 50 $. Moi was seeded into 2 x 105 cells in the mother well. Two weeks after the inoculation, a pure line of viable cells became visible. The pure germline was isolated, transferred to a 96-well culture plate, and allowed to grow for 7-10 days, and the medium was changed every 3-4 days. Move the surviving pure germline to a 24-well culture plate, if still alive -11-This paper size applies the Chinese National Standard (CNS) A4 specification (210 X 297 mm) " ----- ----- (Please read the notes on the back before filling this page)

Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs 570980 V. Description of Invention (9) The length is moved to a larger culture dish or flask. These transporters, on average, have about 3-6 pure germlines per 10 original pure lines. At the time of passage, 'the apparent loss of the pure germline was due to the withering of the cells. These pure germlines are grown on a medium consisting of 50% fresh medium and 50% adjusted medium. Two groups of persistently infected cell lines were established and used in subsequent experiments. Derived from four persistently infected cell lines infected with vAcAnh, called

Sf9_vAc-1, Sf9-vAc-2, Sf9-vAc-3, and Sm-vAc-1. Derived from three persistently infected cell lines infected with vAcZ △ p35, called Sf9_vAcZAp35_1, Sf9-vAcZAp35-2, and Sf9-vAcZZXp35-3. To detect very low levels of viral DNA in permanently infected cells, by PCR directly amplifies DNA from cultured cells. The cells were washed twice with phosphate-buffered saline (PBS) and diluted to 106 cells / ml. By adding 90 microliters of a detergent buffer solution (50mM KQ, 10mM Tris-HCl (pH8.3), 0.1 mg / ml gelatin, 0.45% NP-40, 0.45% Tween-20, 0.6 mg / Liter proteinase κ), solubilize 10 microliters of the diluted suspension. The diluted suspension was then incubated at 60t for 1 hour. After incubation, protease K was inactivated at 95 ° C for 15 minutes. Ten microliters of this lysate was amplified by PCR and analyzed by agarose gel electrophoresis. A serial 10-fold dilution of plastid pThsN90Z was used as the molecular standard. At the same time, plastid DNA was amplified with a lysate to determine the amount of viral DNA in cells that were permanently infected with VAcAnh. Two negative control groups, including the reaction mixture without template DNA, and anti-12 containing only lysing of Sf9 cells-this paper size applies to China National Standard (CNS) A4 (210 X 297 mm) (Please read first Note on the back, please fill out this page again) Factory-installation --- Order · 570980 A7 B7 10 V. Description of the invention () The application should be used to determine the template without contamination in the reagent. The primers are complementary to the 5 'and 3' regions of the 801-base pair fragment of the 〆 ^ gene. The PCR products were fractionated on a 1.5% agarose gel and transferred to a nylon membrane by means of a vacuum blotter (Vacu GeneXL; Pharmacia LKB Biotechnology). The membrane was probed with a p94 gene fragment marked by [a-32P] dCTP by random primers (Berhringer-Mannheim). To determine the presence of viral DNA in cell culture, total genomic DNA was purified from uninfected and persistently infected cells and stained with nylon dots on a nylon membrane using Hydri-Dot Manifold (Bio-Rad Laboratories). The membrane was detected by random DNA primers with viral DNA labeled with [a-32P] dCTP. Ink dots were imaged by autoradiography and further quantified using a Phosphor Imager (Molecular Dynamics). Finally, virus transcripts were detected as follows. Ultraspec RNA Isolation Reagent (Biotecx) was used to prepare total cellular RNA from different cell pure lines. To test the expression of various early-onset genes, 10 micrograms of total RNA was reverse transcribed using oligod (T) primers and moleoney mouse leukemia virus (MMLV) -reverse transcriptase. By PCR, the same primers of the virus ieO, iel, and ie2 genes and the cell gapp gene were used to amplify the same amount of cDNA. The primers used for PCR are as follows: ieO, GGCAACGCAACATGATAAGAC (sequence U 1 line and J 1) and GTTCAAGGGTTGCACAGCTT (sequence U 2 and U 2), which correspond to -11 to + of the ATG start codon relative to ieO The sequence of 720 is talented; and iel, ATCGTGAACAACCAAGTGA (in order to identify the other 4 3) and -13- ^ ^ standards are applicable to China National Standard (CNS) A4 specifications (210 X 297 mm) (Please read the back Note: Please fill out this page again!) Binding --------- Printed by the Employees 'Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs and printed by the Consumers' Cooperatives of the Ministry of Economics and Intellectual Property Bureau printed by 570980 A7 B7 11 V. Description of Invention () GTTCAAGGGTTGCACAGCTT ( Sequence number J identification number 4), which is complementary to the sequence of -22 to +520 of the ATG start codon relative to iel (Chisolm et al., J Virol 62: 3193-3200, 1988); ie2, AACAGTATCCTACCAGCCCA (Sequence number J 1 line M 5) and CCTCTACTTCTTCTTCGGGT (sequence J 1 line another U 6), which are complementary to the sequence of -23 to +612 of the ATG start codon for ie2 (Carson et al., Virology 182: 279-286, 1991); and GAPDH, GACGGACCCTCTGGAAAA (Preface J No. 7) and ACCAGCTGATGAGCTTGAC (sequence recognition number 8), which are equivalent to amino acid residues 195 to 310 of the chimpanzee fruitworm ⑽g (xs ^ er) gapdh gene (Lu et al., J_ Virol 69: 975- 982, 1995). 30 cycles were performed per PCR. Samples without MMLV-reverse transcriptase were also tested to ensure that the fragment was amplified from mRNA. RT-PCR products were separated on a 1.2% agarose gel by electrophoresis and transferred to a MAGNA nylon transfer membrane (MSI) using a vacuum blotter (Vacu GeneXL; Pharmacia LKB Biotechnology). The membrane was probed with P-labeled anti-ieO, iel, ie2, and gapdh genes, respectively, at 60 ° C at 0.25M Na2HP04 (pH7.2), ImM EDTA, 7% SDS, 1% BSA. Eluate V and hybridize in 10% formamidine in a hybridization buffer solution overnight. In all persistently infected cells infected with vAcAnh, viral DNA was detected by PCR, followed by southern hybridization after 80 passages. After extended serial passages, when done with vAcAnh-infected cells -14- This paper size applies the Chinese National Standard (CNS) A4 specification (210 X 297 mm) ------------ -------- Order -------- 1 (Please read the precautions on the back before filling this page) 570980 Printed clothing A7 B7 of the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs Explanation () In the comparison, by Southern analysis, a higher content of viral DNA content was detected in Sf9-vAcZZ \ p35-1, Sf9-vAcZZ \ p35-2 and Sf9_vAcZAp35-3 cell lines. The hybridization of dots on dots confirms this common trend. In addition, RT-PCR was used to monitor the expression of early viral genes. The expression of these early genes can be detected in Sf9 cells originally infected with wild-type AcMNPV. Early gene expression was also apparent in newly infected cells with annibilator vAcAnh before establishing latency. No early gene expression was detected in cells permanently infected with vAcAnh. In contrast, most of the early viral gene lines of the virus appear in the durable cell lines Sf9-vAcZAp35-1 and Sf9-vAcZAp35-2 established by vAcZAp35. The performance of all the early genes tested in these two cell lines was relatively strong and indistinguishable from the early genes of cells infected with the wild-type virus in a productive manner, suggesting that the In the cell, the virus' genome is maintained in an inactive state. It is believed that the performance of exogenous p35 may release the barriers that produce sex; test this hypothesis as follows. No early gene expression was detected in Sf9-vAcZZ \ p35-3 cells. m. Protein expression of non-baculovirus in baculovirus latency

To determine whether β-galactosidase was expressed in cells infected with vAcZAp35, the cells were fixed in a solution containing 2% formaldehyde, 2% glutaraldehyde, i50mM NaCl, and 15mM NaaHPO4 for 5 minutes at room temperature. . The cells were then washed twice with 150 mM NaCl and 15 mM Na2HP04, and contained 1 mg / ml 5-bromo-4-chloro-3_Θbutoryl-β-D_ρ galactan: y :, 5mM -15- This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) ------- Ί ----- installation -------- order -------- 1 (Please read the notes on the back before filling this page) 570980

Description of the invention (Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs at the moi of 0.1, there is a significant reduction in the percentage of dead cells relative to Sf9 and Sf2i. Obviously observed in cells persistently infected with vAcZAp35 In general, less than 5% of the cells died at any of the above three days after the challenge. It is clear that baculoviruses with a disrupted "gene" can inhibit Repeated infection with lytic baculovirus. V · b_35 can reactivate virus production in persistently infected cells and can be detected in Sf21-vAc-1, Sf9_vAc-1, Sf9_vAc-2 or Sf9-vAc-3 Non-infectious virus. Available in two persistent cell lines Sf9-VAcZZ \ p35-l

Low virions were detected in Sf9-vAcZ \ p35-2, but not in Sf9-vAcZA p35-3 cells. To further investigate whether infectious viruses could be reactivated from these persistently infected cells, we transfected the p35 expression vector pKih35hN into a persistently infected cell line. As described above, persistently infected cell lines (2 x 105 cells / well in a 24-well plate) were transfected with 1 microgram of pKih35hN. The parental Sf9 cells transfected with pKih35hN were used as a control group. 24 hours after transfection, these cells were infected with vAcZZ \ p35 at 10 moi. The culture medium was harvested 6 days after transfection and the viability of the released virus was determined by plaque assay using TN368 cells. Positive control cultures produced abundant infectious viruses. The yield of virus progeny from Sf9-vAcZZ \ p35-1 and Sf9-vAcZAp35-2 cells transfected with P35-expressing plastids increased, although it did not increase dramatically to a logarithmic scale. -17- I paper size applies to China National Standard (CNS) A4 specification (210 X 297 mm t) '---------- installation -------- order ------- -1 (Please read the notes on the back before filling this page) 15570980 A7 Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs

On the other hand, virus production from Sf9_vAcZZVp35-3 cells transfected with p35 expressing plastids dramatically increased to several logarithmic values. Other non-virus · produced persistent cell lines' sf9-vAcZ Δp35-4 (established at a later date than the first three pure germline lines) produced a wealth of virus after transfection of p35-expressing plastids. These observations indicate that long-lasting baculovirus-infected cells are truly latent 'because the production of the virus can be slandered by the expression of p35, thereby releasing obstacles from latent to producing a sexual infection. Other specific embodiments will understand that while describing the present invention, together with its detailed description, the previous description is intended to explain rather than limit the scope of the invention, which is defined by the scope of the appended patent application. Other viewpoints, advantages, and modifications are also within the scope of the present invention. For example, although the interruption of the p35 gene and the introduction of one or more non-baculovirus genes are achieved by a single replacement of the baculovirus genome sequence, other genomic modifications are also within the scope of patent applications. A guide encoding non-baculovirus RNA or a sequence of the present invention can be anywhere in the genome that already has a disrupted positive gene. 18 MHZ scale is applicable to Chinese standard (CNS) A4 g grid Q 挪 Nogley love)--------- 丨 -installation -------- order ------ --- ·· (Please read the notes on the back before filling this page)

Claims (1)

Patent No. 08911187〇 Chinese patent application scope replacement 3 years) Scope of application for patents 570980 1 .: A baculovirus expression system containing a p35 endogenous gene-like virus, which is used to establish a continuous protein expression system. 2. According to the patent scope of the request! The item-defense virus expression system, in which the sample virus additionally includes the first RNA sequence. 3. «Patented Patent» Item 2 of the defending virus expression system, wherein the first RNA is non-baculovirus RNA. 4. According to the defending virus expression system of item 3 of the patent application scope, including the early gene promoter of the like virus, its secret performance. Promote a non-virus-like virus 5. Please call for the protection of virus-like virus expression system in item 4 of the patent, in which the interruption is part of the deletion. ′, Among which 6. A part of the 35 gene of the defending virus expression system according to item 5 of the scope of patent application includes the household% promoter. 7. According to the scope of the patent application No. 4 of the protection of the virus Gan Gan-the first non-like virus is detected as encoding the first protein ^ 'where the 8. According to the scope of the patent application No. 7 of the rod-shaped mRNA Protein is detectable. ^ Performance system, where 9. The first protein according to claim 8 of the scope of patent application is the β_richlactose # enzyme. Among them, 10. The bacilli disease subject according to item 7 of the scope of the patent application, the first protein is a non-baculovirus protein; the expression system, wherein the η. According to the baculo disease of the fourth scope of the patent application ^ table Xi Yi system, in addition to the paper size suitable financial Sa Family (CNS) domain grid (21GX 29: ^) Code the second sequence of viral RNA. The baculovirus expression system of item 11 of the patent / scope of patents, in which mRN; a non-baculovirus is encoded as a second protein 13. According to the application of claim 3, the baculovirus expression of the baculovirus of the patent scope of project 3 is 12. System ^ Two proteins are optional. 14. According to the investigation, the baculovirus expression system according to item 13 of the patent scope of the + and μ_π patents, of which two proteins are neomycin resistance genes. 15. = The baculovirus expression system according to item 12 of the patent application, wherein the two proteins are non-baculovirus proteins. 16. According to the sample-like virus expression system of the scope of application patent No. 10, a continuous calicivirus promoter is also included, which promotes the expression of a second non-like virus RNA. 17. The baculovirus expression system according to item 16 of the scope of application for patents, wherein the 忒 continuous defender virus promoter is the 仏 70 promoter. 18. The baculovirus expression system according to item 4 of the scope of patent application, wherein the calicivirus early gene promoter is a virion-like promoter. 19. A method of expressing non-baculovirus RNA in a cell, the method comprising introducing a baculovirus according to item 4 of the scope of the patent application into the cell. 2〇 · —A method for expressing non-baculovirus protein in a cell, the method includes introducing a baculovirus according to item 7 of the patent application into the cell 0 -2-Chinese paper standard (CNS) Α4 is applied to this paper Specifications (210 X 297 mm) 8 8 8 8 AB c D 570980 々, patent application scope 21.-A method for inhibiting repeated infection of baculovirus in cells, the method includes A baculovirus is introduced into the cell and the cell is exposed to a second baculovirus. 22. The method according to item 21 of the patent application, wherein the interruption is part of deletion of a gene. 23. The method according to item 22 of the patent application, wherein a part of the 35 gene of the household includes a promoter. This paper size applies to China National Standard (CNS) A4 (210 X 297 mm)