TW558565B - The process for preparing the yeast containing recombinant lactoferrin - Google Patents

Abstract

This invention relates to production of yeast strains constructed to contain recombinant porcine lactoferrin, which includes construction of expression vectors of porcine recombinant lactoferrin and culturing of yeast containing lactoferrin. This invention process combines yeast fermentation and recombinant lactoferrin expression at the same time and need no purification of recombinant lactoferrin.

Description

558565 '~ ----- 5. Description of the invention (1) 1. Background: Lactoferrin is a protein that binds to iron, with a molecular weight of about 78 kDa. It can bind two irons, and its binding with iron is reversible. of. Therefore, iron can be provided to cells that require iron, and iron can also be grabbed, thereby inhibiting the survival of microorganisms (Vorland, L · Η · (1 9 9 9) APMIS 107, 9 7 1-9 8 1) Lactoferrin in milk The content is quite high, and lactoferrin can transfer iron to newborn mammals during breastfeeding. Lactating infants are less likely to cause anemia due to iron deficiency than infants who are fed cow milk. Piglets fed to lactoferrin-containing feeds can avoid shock death caused by endotoxin (Lee, W.J. et al. ( 1998) Infect. Immun. 66, 142, 1426 ·), and can increase the synthesis of hepatocyte proteins (Burrin, DC et al. (1996) Pediatr · Res · 40, 7 2-7 6) Protects the gastrointestinal tract of newborn mammals from microbial infection and promotes the growth of intestinal cells (Brooke, J. (1995) Immunol. Today 16, 417-419) 0 Lactoferrin is found in human milk and all mammal milk, It is also present in saliva, tears, trachea, nasal secretions, pancreatic fluid, and other body secretions (Masson, P.L. and Heremans, J.F. (1971) Comp. Biochem. Physiol. 39B, 119-129) It has bactericidal and bacteriostatic effects, so lactoferrin can be applied to daily food or livestock to prevent microbial infection, increase the amount of lactoferrin in milk or add lactoferrin to the feed of newborn mammals. Non-specific immunity and Avoid poverty

Page 4 558565 V. Description of the invention (2) The occurrence of subcutaneous pain j (Moreau, M.C. et al. (1983) Ann. Microbiol. 134, 429-441) o The highest content of lactoferrin in human milk, However, access to human milk is limited and there are potential risk factors such as viral infection. The content of other animals, such as cattle, sheep, and pigs, is relatively low, so using genetic engineering to mass produce lactoferrin is one of the solutions. In the past, some people used genetic engineering to mass-produce recombinant lactoferrin, such as the patents US 6 0 0 5 5 9, US 6 0 6 6 4 6 9 and US 6 1 0 0 0 5 4. The steps are therefore still quite time consuming and costly. The feature in our invention is that we use yeast to express recombinant lactoferrin, but do not purify lactoferrin, but use yeast as a carrier, and directly add lactoferrin-containing yeast as feed or food. Thing. Yeasts have been added to feeds for a long time. Yeasts added to feeds can increase milk production, daily weight gain and feed use efficiency (W i 1 1 iams, P.E. et al. (1991) J. Anim. Sci. 6 9, 3 0 1 6-3 0 2 6). In the past, intestinal discomfort caused by antibiotics in humans has often used yeast as a treatment or prevention agent. Yeast is not a resident flora of the gastrointestinal tract and will not adsorb to epithelial cells, but can adsorb pathogenic bacteria, such as Candida albicans, to prevent pathogenic bacteria from adsorbing to intestinal cells. In addition, the components of the cell wall of the yeast can also stimulate the immune response.

Page 5 55 Milk 65 5. Description of the invention (3) Often it is one of the components of healthy food. The invention combines the advantages of yeast and lactoferrin, and can be used as a feed or food additive, and can reduce the cost required for purifying lactoferrin. 2. Overview: The present invention relates to the preparation of a yeast with recombinant lactoferrin, and the transformed yeast has a lactoferrin-expressing carrier in it, which can successfully express lactoferrin. Can be added directly as feed or as a component of healthy food. There are many systems for expressing recombinant proteins genetically, ranging from lower bacteria to higher animal cells and transgenic animals. The difference is that eukaryotic systems have protein modification functions, such as saccharification, and prokaryotes. The system does not. The yeast system in the present invention belongs to the simplest eukaryotic system, and has considerable protein modification effect, so it can better simulate the modification effect of the original eukaryotic protein. After the lactoferrin is expressed by yeast, the lactoferrin The yeast can be directly added as food or feed, which can reduce the cost of purification and recovery. It can also combine the efficacy of yeast and lactoferrin to improve its effectiveness.

Page 6 558565 V. Description of the invention (4) First, construct a lactoferrin expression vector that can be expressed in yeast cells. After the lactoferrin expression vector enters the yeast, it can exist in the form of plastids or be embedded in chromosomal DNA. The composition of the lactoferrin expression vector includes a promoter, a signal peptide, and c DNA of porcine lactoferrin. The timing of the expression of the recombinant protein is determined by the promoter's starting form and timing: (1) Induced type, which does not perform under normal growth conditions. Only after the inducer is added can the promoter be activated for gene expression, such as alcohol oxidase (alcohol oxidase) promoter (A0X) must be added to methanol (methanol) to start A0X; In addition, such as galactose-regulated promoter (GALi * GAL10), the gene will be expressed under the condition that φ galactose is used to replace glucose; Regulatory yeast metallothionein (copper responsive yeast metallothioneirOCUPl promoter will be expressed only after adding copper. (2) · continuous: another type of promoter is synchronized with the growth of bacteria = persistence, such as yeast with sugars Metabolites serve as a carbon source for growth, so > and bile metabolizing enzymes such as glyceraldehyde 3-phosphate dehydrogenase iLylerrld? Ydr3'Ph0SPhate dehydrogenase (GAP) will continue to perform 'so the GAP promoter Startup is continuous. The yeast used in the present invention, such as GAP, and galactose-regulated promoters, act as early ^ and vinegar metabolic enzymes, and the promoter of the white expression vector is yeast V: GAL1. Therefore, Lactoferritin ^ Glucose-containing growth medium or

55 ^ 5,65 5. Description of the invention (5) Growth of lactose-replaced glucose medium, that is, the performance of lactoferrin, there is no need to add some organic solution to reduce heavy metals, so the yeast with lactoferrin and the culture solution can be directly Co-recycling and adding to feed can also simplify the process of yeast with lactoferrin. The promoters used in the present invention, such as the GAP promoter or the GAL 1-regulated promoter and termination sequences such as the CYCI or A 0 X 1 termination sequences, are owned by the yeast cell itself, so the yeast ’s ability to recognize them will be better than other Exogenous start or stop sequences come in well. The medium used for preparing yeast with lactoferrin according to the present invention is a medium containing glucose in general, which can reach a saturated state in a laboratory-scale culture time of about 2 days, and 0-lOOuM gasified iron (FeCl3) can be added simultaneously. It does not affect the growth of yeast, but it can make yeast with lactoferrin to carry iron at the same time, as a feed supplement, it can reduce the chance of anemia in weaned piglets. At present, there is no effective and economical way to produce lactoferrin in Taiwan. Only transgenic pigs are used to mass produce lactoferrin in pigs, but they still face the cost-effectiveness of purification. The present invention expresses pig's lactoferrin by yeast, which can combine the dual advantages of yeast and lactoferrin, and can reduce the economic cost required for purification. _ Yeast with lactoferrin can be used directly as a feed supplement, especially

Page 8 55 ^ 565 V. Description of the invention (6) Death caused by anemia and diarrhea that often occurs in weaned piglets can be increased by adding lactoferrin yeast-plus its fertility rate. In addition, lactoferrin yeast is like Vitamin yeast can also be used as an additive to health foods.

Page 9 558565 V. Description of the invention (7) Brief description of the drawings:-Figure 1 shows the c D N A sequence of pig lactoferrin. Figure 2 is a schematic diagram of the construction of a lactoferrin expression vector in Pichia pastoris. Fig. 3 shows the construction of a lactoferrin expression vector in Saccharomyces cerevisiae. Figure 4 shows the results of Western blot analysis of Pichia pastoris yeast strain culture medium or intracellular recombinant lactoferrin. Figure 5 shows the expression of recombinant lactoferrin in the yeast strain Saccharomyces c e r e v i s i a yeast strain by Western blot analysis. Figure 6 S DS-acrylic acid gel electrophoresis results of purified lactoferrin and purified recombinant lactoferrin purified by Pichia pastoris culture medium using heparin affinity column chromatography. FIG. 7 is an absorption spectrum showing the binding of recombinant lactoferrin to iron.

Page 10 558565 V. Description of the invention (8) The yeast in the present invention contains pig lactoferrin, and the qualitative analysis of pig recombinant lactoferrin includes western blotting, two-dimensional electrophoresis analysis (2D), iron The binding test and N-terminal amino acid sequence analysis were similar to porcine lactoferrin. 〇 The yeast-bearing pig lactoferrin in the present invention was deposited with the Taiwan Hsinchu Food Industry Development Institute in accordance with the Patent Law of the Republic of China on July 11, 2000, and the designated deposit number was CCRC 9 4 0 3 1 0 and CCRC 920022 ° III. Detailed description: Preparation of yeast with lactoferrin. The selected yeasts include Pichia pastoris and Saccharomyces cerevisiae. (1) Preparation of Pichia pastoris with lactoferrin:

Page 11 558565 V. Description of the invention (9) First, select the appropriate expression ^ ^ A ^ aldehyde 3-phosphate dehydrogenase βAP ^ '/ present // including glycerol sequence. Polymerase chain reaction and alcohol oxidation, _ termination • λ ^ ^. ^ 'VPolymerase chain react 10) method to copy the DNA fragment containing the pig signal sequence and mature pig white c DNA, polymerase诖 @ 蛋蛋 子 I chain reaction replication used in the c-plate is a lactoferrin cDNA plastid-containing lactoferrin cDNA fragment from the porcine mammary gland cDNA library, and the expression vector is also cut by SfuI & XbaI enzyme for ligation reaction Then, send it to E. coli DH5a for replication and reproduction, and confirm whether the expression vector and the lactoferrin cDNA fragment are successfully joined by means of enzyme truncation and polymerase chain reaction. After confirmation, perform DNA sequence analysis on the expression vector containing lactoferrin cDna Confirm whether the sequence between the g AP promoter-lactoferrin-DNA-A 0 X ί termination sequence is correct, select the lactoferrin expression vector and send it to DH5 α for a large number of copies, then extract the plastid DNA and cut it with Avr Π 'Linear DNA was sent to Pichia pastoris by electric pulse (eiectrophophration), and a highly resistant yeast strain was selected in a medium containing Zeocine antibiotics. And cultured in 5 ml of γ p D culture solution. After 2 days of culture, the yeast cells and the culture solution were separated by centrifugation. After the cells were broken by glass beads, the supernatant was centrifuged to confirm the milk. The performance of ferritin was 10 times more concentrated in the culture medium, and the performance of lactoferrin was also confirmed by Western suction. (A) Preparation of Sacchoromyces cerevisiae, a baker's yeast with lactoferrin ...

Page 12 558565 V. Description of the invention (ίο) The expression vector composition includes the GAL1 promoter and the cytochrome-c-oxi (iase) CYCi termination sequence. It also reproduces the pig signal by polymerase chain reaction. Sequence and DNA fragment of mature porcine lactoferrin cDNA. This DNA fragment and expression vector are cut with SacI and then subjected to conjugation reaction. After transformation into E. coli DH5α, replication and reproduction are performed with enzyme cutting and polymerase chain reaction. The method was used to confirm whether the lactoferrin cDNA was successfully joined to the expression vector and whether the direction was correct, and DNA sequencing was performed to select the correct lactoferrin expression vector. The lactoferrin expression vector was sent to DH5a to replicate in large quantities, and plastid DnA was extracted. The expression vector was sent to baker's yeast Sacchromyces cerevisiae in the form of lithium acetate (LiAc), and then the urine strain σ was closely selected from the yeast strain of uracii auxotróphy using selective medium MMC (minimal medium plate). After picking up 10 to 12 transgenic plants, also cultivating them with glucose-containing MMC for 2 days, the yeast was precipitated, and the grapes were washed with secondary water The yeast was cultured in MMC to replace glucose with galactose, and the bacteria were collected and broken after about 12 to 18 hours. The performance of lactoferrin in the yeast was confirmed by Western blotting, and the yeast with lactoferrin was screened. Strains. (3) Purification of lactoferrin expressed by Pichiapast olis After cultivating Pichia pastoris with lactoferrin for two days, the culture solution was collected and concentrated ten times. Western blotting confirmed the presence of lactoferrin. After 30 to 40% ammonium sulfate precipitation, after dialysis, purification through a Sepharose-hepar i η column, and analysis of the N-terminal amino acid sequence

Page 13 558565 V. Description of the invention (π) Two-dimensional (2-D) electricity The N-terminus is the same as porcine lactoferrin. Qualitative analysis by iron binding and ice / knife analysis-lactoferrin-like in milk. Ferritin 2CDNA sequence; Figure 2 is a schematic diagram of the polymerase construction of Pichia pastolis plate; PIGLTF plastid was used as a model

Approximately 2.lkl of the DNA fragment were copied at the ends, 3, and 5, respectively, and 5, sfuI and XbaIi: ^ uI and XbaI identified the truncation site 'were subjected to a conjugation reaction with the same war-cut pGAPZ B vector. Figure 3 shows the construction of baker's yeast ..., cerevisiae lactoferrin eggs === vector; the PIGLTF plastid was used as a template to carry out the polymer chain reaction to copy the DNA fragment of about 2.ikb, 5, end and 3, Both ends have SacI to identify the cut site, and the splicing reaction with pYES2 vector also cut by SacI. Figure 4 shows the results of analyzing Pichia pastoris yeast strain culture medium or intracellular recombinant lactoferrin by Western suction; the cells of different transformed P i ch ia pas t oris yeast strains were centrifuged to obtain the supernatant. (A) or the culture solution was concentrated 10 times (B), and analyzed by 10% SDS-acrylic gel electrophoresis and then transferred to PVDF membrane, and rabbit anti-pig lactoferrin antiserum

Page 14 558565 V. Description of the invention (12) (rabbit ant i ~ porc ^ ne lactoferrin polyclonal antibody) and HRP-conjugate goat anti-rabbit ip with peroxidase-linked sheep anti-rabbit immunoglobulin antibody Results of Western sucking. MPLF stands for lactoferrin purified from pig milk, and (-) stands for transgenic strains without lactoferrin CDNA. ’

Figure 5 shows the expression of recombinant lactoferrin in the cells of Saccharomyces cerevisia yeast strains of baker's yeast by Western suction; different Saccharomyces cerevisiae yeast strains of different baker's yeast strains (1-7). The cells were centrifuged to obtain the supernatant.丨 〇% s D s _ acrylic gel electrophoresis analysis and then transferred to PVDF membrane (Millipore), rabbit anti-pig f-ferritin antiserum and peroxidase-containing sheep anti-rabbit immunoglobulin antibody The result of western suck. mPLF represents milk = protein purified from pig milk, and (-) represents transgenic strains without lactoferrin cDNA. Results of purification of recombinant lactoferrin by Heparin affinity column chromatography on the culture medium of Pichia pastoris of weaving transforming yeast and purified lactoferrin by SDS-propylene agglutination electrophoresis; the culture solution was subjected to 30-40% sulfuric acid After the ammonium precipitation and dialysis, it was washed and collected with different salt concentration gradients (0 · 2, 0 · 3, 0 · 4, 0 · 6 M sodium gasification) through a heparin column, and the collected solution of each salt concentration was ELIS Α To measure the relative immunity of recombinant lactoferrin. The collected portion of the 0.6 μN sodium vaporized solution was analyzed by 10% SDS-acrylic acid gel electrophoresis as shown in the illustration (i. MPLF represents lactoferrin purified from pig milk, and M represents protein standards of different molecular weights. From top to bottom: 200, 116, 97, 66,

558565 V. Description of the invention (13)-45, 31 and 21 kDa. From the results, it was found that the molecular weight of the recombinant lactoferrin was equivalent to that of the pig lactoferrin. The N-terminal amino acid composition analysis of the purified recombinant lactoferrin showed that the N-terminal amino acid of the recombinant lactoferrin was the same as that of porcine lactoferrin. & ° Figure 7 shows the absorption spectrum of the recombinant lactoferrin 'bound to iron purified from the culture medium of Pi Chi a past oris of transforming yeast; the binding of ferric iron to the recombinant lactoferrin at 465 nm has The highest absorption value. The inset shows the absorption spectrum from UQ to 680 n m. Example 1: Establishment of porcine mammary g DNA library. The guanidium isothiocyanate method (see Cathala, G. (1983) DNA, 2, 329-335) was used to extract RNA from all cells of the mammary gland of large white pigs, followed by oligo (dT). -Poly (A) + RNA was separated by cellulose column chromatography, and the Poly (A) + RNA and lambda gtll vector cut by Sfi I / Not I were used as the material source for constructing the library. Bacteriophages assembled to lambda gtl 1 were replicated in E. coli Y 1 0 8 (see Sambrook, J. et al. (19 8 9) Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.) O

Example 2: Screening of pig lactoferrin c D N A from the c D N A library

Page 16 558565 V. Description of the invention (14) ~ Screening of porcine lactoferrin cDNA according to generally known methods (Sambrook, J. et al. (1989) Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor , NY: Cold Spring Harbor Laboratory Press.). First design primers: primerl (primerl): equivalent to nucleic acid positions 278 -297, and primer 2: equivalent to nucleic acid positions 1 0 9 7-1 1 1 6; primer 3: equivalent to nucleic acid positions 1044-1063, primer 6: Corresponding to nucleic acid positions 2333-2353, using primer 1 / primer 2 and primer 3 / primer 6 as a group to copy a DNA fragment of about 8 3 and 1 309 base pairs in a polymerase chain reaction manner, This DNA fragment was used to perform α- [3 2 p] d CTP radioactive calibration as a probe to screen porcine mammary gland cDNA library. The selected positive clones were screened by polyethylene glycol (polyethylene glycol) method after three screenings, and the cDNA was cut with Sfi I / Not I and then connected to the PGEMIIZ (—) vector, named PLF3- 1-2. The PLF3-1-2 was sequenced in two directions using the dideoxy termination sequencing method, and the sequence of the pig lactoferrin protein contained in PLF3-1-2 was determined to be 2 3 6-2 3 42. After reverse transcription reaction with total RNA, polymerase chain reaction with primer 1 and primer 2 for replication, a DNA fragment of about 8 3 8 base pairs was obtained. This fragment was cut with Sma I and then inserted into the pBluescript IIKS vector, named PLF5. Sequence analysis determined that the PLF5 was connected with the porcine lactoferrin cDNA sequence: from 1 to 838. The full-length pig lactoferrin ScDNA was obtained by connecting the Bgl n / HindHI fragment on PLF3-1-2 to PLF5, and named it PIGLTF (Wang, S.R. et al. (199 7) AJVR, 58 (10),

Page 17 558565 V. Description of the invention (15) 1 1 5 2-1 1 5 8 ·). The sequence analysis results of PIGLTF are shown in Figure 1. The nucleic acid sequence of the inflammatory ferritin coding region (c o di ngregi ο η), a total of $ 1 of the nucleic acid, which can translate the signal sequence of pigs and the full-length pig lactoferrin 1 5 Example 3: The milk of the structure # of Pichiapast olis lactoferrin expression vector is shown in FIG. 2. The protein c D Ν Α fragments are first copied by a polymerase chain reaction. The reaction conditions are as follows: The body was used as a mold I, and the 5 'end and the 3' end primers were 0.5uM each, 〇2πιM dNTP and the most = plate 'sigh,' repeated ulcer is 1 times the reaction buffer, 5 U pfu DNA polymerase human

(polymerase) (Promega), and finally adjusted with deionized water to a final volume of 50 u 1. ^ Wood 5, end primer: 5, -GCTTCGAACAAAACACAATGAAGCT CTTCATCCCCGCCCTGCTGTT-3 ,. Primers at the 3 ′ end of the wood: 5, a GCTCTAGATTACCTCATCATGAAGGCACA-3, 5 ′ and 3 ′ end primers each contain positions recognizable by Sful and Xbal restriction enzymes. The polymerase chain reaction conditions are: first heating at 9 4 t for 2 minutes, and then performing 30 proliferation cycles, each cycle including 94 ° C, 30 seconds, 5 7 ° C, 40 seconds, 72 ° C, 4.5 Minutes, and finally reacted at 72 ° C for 10 minutes. After the completion of the polymerase chain reaction, all the reactants were added to the DNA analysis dye at a final concentration of 1 ', and the electrophoresis was performed with 1% azidose bromide containing ethidium bromide. Analyze and use commercially available DNA fragments as molecular weight markers. Cut out approximately 2.1 kb copies, and then use a commercial recovery kit (Viogene) to wash out the DNA and dissolve it in

Page 18 558565 V. Description of the invention (16) Human water. Take a small amount of DNA and confirm the size and purity of dn A by slow ester sugar electrophoresis. 'The product of the lactoferrin c DNA fragment copied and purified from the polymerase-enzyme chain reaction described above was added to the enzyme reaction buffer at twice the final concentration. The restriction enzymes Sful and Xbal were placed in a 37 ° C water bath, and the enzyme reaction time was 1 to 2 hours. At the same time, the expression vectors pGApz.B (Invitrogen) were also cut with sful and X ba I. Express the carrier and confirm the completeness of the truncation reaction with agarose gel. Cut the linear expression carrier fragment that has completed the reaction and rinse it out. Then mix with the purified lactoferrin c DNA fragment that has also undergone the enzyme reaction and add the ligation enzyme. (T4 DNA ligase, Promega) at 16. (: 16 hours under reaction, and then placed at 4 ° C for 1 to 4 hours. The ligation reaction was sent to E. coli DH5α using a conventional method (Molecular cloning- A Laboratory Manual; Cold ψ Spring Harbor, 1989). Cells (Promega). Low-salt LB culture plates (1% tryptone, 0.5% sodium chloride, 0.5% yeast extract '1.5% agar gelatin) containing Zeocine (Invitrogen) were successfully transformed. The strain with Zeocine resistance was cultured in 3 ml of low-salt LB broth (containing 25ug / ml Zeocine) and cultured at 37 ° C with shaking for 12-16 hours, then the plastid DNA was extracted to limit the enzyme S fu I / After X ba I confirmed the truncation, it was confirmed that the expression vector DNA had 2.1k base-pair inserted DNA, and then the expression vector DNA was subjected to sequence analysis. The sequence analysis site included the junction between the GAP promoter and lactoferrin cDNA and milk The junction of ferritin cDNA and A0X1 termination sequence and the full-length lactoferrin cDNA. Screen the correct expression vector and name it PLF °

Page 19 558565 V. Description of the invention (17) Implementation Example 4: The expression of lactoferrin in Pichiapastoris. The carrier PLF was reacted with Avr Π enzyme at 37 ° C for 2 hours, and a small amount of DNA was taken to agar acetate colloid. After the analysis confirms that the linearization is complete, the linearized lactoferrin expression carrier DNA is extracted with phenol / aeroform (25: 2 4), purified and dissolved in secondary water and subjected to electrical pulses (616 (:: 1: 1 * 〇1 ^ (^ 3 1 ^ 〇11) (£ 01 ^ 600, 3 butyl) was fed into Pichia pastoris SMD1168 strain with defective protease, and then YPD (1% peptone) with different concentrations of Zeocine , 2% yeast extract, 2% glucose, 2% agar gelatin) culture plate (100 叩, 501 叩, 111 ^, 21112 / 111126〇 (^ 116) _selected transgenic plants. 0 / 26〇 丨 116 culture plate 30 ^: After 3-4 days of culture, select | Zeocine-resistant transgenic plants, culture in 5 ml of ypd medium and shake culture at 250 ° C and 30 ° C for two days, The bacterial solution was collected and centrifuged at 3000 rp for 10 minutes to separate the culture solution from the bacterial cells. The culture solution was concentrated by centrifugation (Amicon plus) about 10 times, and the bacterial cells were dissolved in the isosome. The volume of the breaking buffer (50mM NaH2P04, ImM PMSF, ImM EDTA, 5% glycerol) and the same volume of glass beads (425-600um, Sigma) were broken by 5 to 10 1-minute vortex breaks, and then i30. After centrifugation at 0 rpm for 10 minutes, the supernatant was added to an equal volume of sample buffer solution (62.5 mM Tris-HCl, pH 6.8 '25% glycerol, 2% SDS, 0.001% Bromophenol Blue) in a non-reducing ( under non-reducing) conditions with 10-12% SDS-acrylic acid gel _ electrophoretic analysis' Semi-dry (B i ο _ rad) method to transfer to Hybon-C-nitrocellulose Membrane (nitrocellulose membrane) with phosphate buffer solution containing 1% bovine serum albumin (BSA)

Page 20 558565 V. Description of the invention (18) (phosphate-buffered saline) Block overnight, then add rabbit anti-pig lactoferrin-white antiserum? £ 51 '(? "/ 05〇 / 〇

Tween20) diluted 2000-fold and reacted at room temperature for 1-2 hours. After washing with PBST for 5 minutes, the reaction was repeated three times, and then purified goat anti-rabbit immunoglobulin antibody was added. This antibody was linked with a peroxidase (diluted with pBST 2). 〇〇 倍), the same reaction at room temperature for 2 hours, washed with PBST for 5 minutes and repeated three times, and then DAB (diaminobenzidine) color reaction, Figure 4 shows that culture medium and cell extract (A) pig milk The performance of ferritin. The signal sequence representing pigs can be recognized by pichia pastoris, so the synthetic porcine lactoferrin can be secreted extracellularly. Example 2: Preparation of yeast (Pichia pastoris) with lactoferrin and

The fermented yeast (PiChia PaStoris) was cultured in YPD and 0-1 mM chlorine to 3 days eCl3), and the culture solution was shaken and cultured at 30 ° C and 250 rpm for about 2 hours. Centrifugation was depleted with culture medium and bacterial cells after centrifugation: μ supernatant and culture medium were concentrated 10 times, and the performance of iron seemed to be determined by Western blotting method. The results showed that compared with 0-100uM iron gasification Strong 7 can slightly promote the growth of yeasts, and the signal of western absorption is better. The iron concentration of more than 500 u M will inhibit the growth of yeast. The signal of western absorption of gasified iron is weak. . Therefore, yeasts with lactoferrin and iron can be prepared from YPD broth containing 0-10 0 u M mother bacteria in V. Fermentation P D (or gaseous iron-containing) broth after 2 to 3 days of cultivation to growth saturation

Page 21 558565 V. Description of the invention (19) Period, the bacterial liquid (bacterial body plus culture liquid) can be directly recovered, because the culture liquid also contains lactoferrin, and the yeast-mother body and its culture liquid are used together The addition of feed will increase the breeding rate of the animal. It is also possible to recover only the bacterial cells as a feed addition preparation. Example 6: Construction of a bacteriophage (Saccharonyces cerevisiae) lactoferrin expression vector As shown in FIG. 3, a pig lactoferrin cDNA fragment was replicated using a polymerase chain reaction. The primer design was as follows: 5 'end primer: 5,- ACGAGCTCTAAAC.AAAATGAAGCTCTT ψ CATCCCCGCCCTGCTGTT-3 '°

3'-end primer: 5'-ACGAGCTCTTACCTCATCATGAGAGCACAGG CTT-3 '° 5' and 3'-end primers carry SacI recognition truncation sites. The polymerase chain reaction product was analyzed with 1% agarose colloid, and the colloid containing 2.1 k base pairs of DNA fragments was excised, and the DNA was washed down by a recovery kit (Viogene) to limit the enzyme SacI at 37 °. C was cut, and the expression vector YES 2 was also cut with Sac I. After the reaction, the YES2 and lactoferrin cDNA fragments were purified and then subjected to the splicing reaction, and transformed to DH 5 α (Reference Example 3). Several D Η 5 α strains were prepared and confirmed for plastids, and sequence analysis was performed. The plastids that correctly carried pig lactoferrin cDNA were named YLF. Β Implementation Example 7: Saccharomyces porcine lactoferrin

Page 22 558565 V. Description of invention (20) cerevisiae) The YLF plastid was transformed into protein in the manner of LiAc (Ito, H. et al. (19 8 3) Plant Bacteriol., 153: 163-186) Bacteria yeast Saccharonyces cerevisiae strains with defective enzymes. This strain can only grow under culture conditions that can provide leucine, uracil 1 and tryptophan. The expression vector has uracil screening. Markers, so it is possible to screen auxotrophy transgenic plants in a selective medium lacking uracil MMC (0.67% yeast nitrogen base, 0.5% casam i no acid, 2% glucose, 0 · 0 2% leucine, 0.002 ° /. Tryptophan, 2% agar gum) Screening of the transgenic < strain, the transformed bacterial solution was cultured in a MC dish for 3 to 4 days. 0 ° C culture medium, several strains were selected as templates for colony direct polymerase chain reaction (colony direct PCR) (Trower, M.K. et al. (196))

Mol · Biol ·, 58, 329-333), polymerase linked with a nucleic acid sequence of primer 8 corresponding to the coding region 1 2 8 6-1 3 1 8 and primer LF3 nucleic acid sequence corresponding to the coding region 2090-2115 In the reaction, the cells were destroyed in μ $ minutes, and then 30 cycles of proliferation were performed, each "cycle including M ° C> 1 minute, minute, 72 ° C, 2 minutes, and finally 72 minutes. (: Reaction for 10 minutes, the polymerase chain reaction product was analyzed with 丨% agarose colloid to confirm the presence of the secondary protein CDNA in the enzyme, PIGLTF plastid was used as a positive control group in the polymerase chain reaction (p〇siUve The DNA fragment of about 800 base pairs can be reproduced, causing the lack of the main host 1 Θ I® M — & The result of the synthase chain reaction is a positive strain, which is cultured in MMC culture solution for two days After receiving the bacteria

558565 V. Description of the invention (21) solution and centrifugation at 3, 000 r pm for 10 minutes to separate the culture solution and the bacterial cells. After the bacterial cells were washed twice with water twice, _ was added to 2 ° /. Galactose replaced 2% glucose in MMC (galactose) culture medium. The purpose of replacing galactose with glucose is to activate the promoter GAL1 promoter, which in turn drives the expression of the lactoferrin gene. After 12 to 18 hours of culture The bacterial solution was collected and centrifuged to separate the culture solution from the bacterial cells. The bacterial cells were broken with glass beads. The supernatant was centrifuged to obtain the cell extract. The cell extract was analyzed under non-reducing conditions by 10 to 12 ° / ◦ SDS-acrylic gel electrophoresis and transferred to Hyb ο η-C-nitrocellulose membrane. Rabbit anti-ferritin antiserum and purified goat anti-rabbit immunoglobulin I gG antibody (this antibody is linked to a peroxidase) were analyzed for Western blotting (see Example 4). The results are shown in Figure 4 and Figure 5. Randomly screened strains (1-7) have lactoferrin expression in their cells', but the presence of lactoferrin cannot be detected in the culture medium, indicating that the pig's signal sequence cannot be breaded Yeast (Saccharomyces cerevisiae) recognizes' so synthetic porcine lactoferrin cannot be secreted extracellularly. Example 8: Preparation of baker's yeast (saccharomyces cerevisiae) with lactoferrin

As shown in Figure 5, lactoferrin is present in the bacteria, but the presence of lactoferrin cannot be detected in the culture medium, which indicates that the signal sequence of pigs cannot be recognized in the bread yeast CSacchairomyces cereviSiae. Lactoferrin is synthesized but cannot be released. This result does not affect the process of yeast with lactoferrin, because

Page 558565

V. Description of the invention (22) Lactoferrin. After baker's yeast (S ▼ —,-accharomyces cerevisia ^ x selectivity = cultured MMC culture solution was cultured for 3 days, the bacteria were collected by centrifugation, and the remaining glucose was washed with deionized water by one person, and then galacin bran was used. Lactose-induced lactoferrin expression. After selective culture of MM containing galactose (^ Continue to incubate the culture medium for 12 to 18 hours, directly recover the bacterial cells by centrifugation or add the bacterial solution (bacterial cells plus culture solution) as feed. Example 9: Purification of lactoferrin by P 1 chiapast olis. For the method of purifying lactoferrin, refer to Chu, L. F. et al. (1993)

Am · J · Vet · Res · 54, 1 1 54-1 1 5 8. GLF1 was cultured at 250 milliliters of 4 liters of YPD. After overnight culture at 30 ° C, it was diluted with fresh YPD culture solution 100- to 200-fold. After 2 days of incubation, the culture solution was collected and centrifuged. Collect the supernatant 'After collecting the supernatant with 30-40% sulfuric acid, dissolve the precipitate with 5 μM Tris (p Η 7. 9) and dialyze with a dialysis membrane (MWCO: 10kD). Then, the sample was chromatographed on a Heparin-Sepharose column, and step-gradient separation was performed with 0.2 to 0.6 M sodium gaseous phase. The washing liquid collected at different salt concentrations was measured for the relative immunity of the recombinant lactoferrin by the EL ISA method. The recombinant lactoferrin will be washed down under the condition of about 0.6 M sodium gaseous solution. The purified recombinant lactoferrin was analyzed for its purity by SDS-acrylic acid gel electrophoresis, and transferred to a PVDF membrane (Millipore) and stained with amido black to cut out the lactoferrin portion, and perform sequence analysis of the amino terminus. The analysis results confirmed that the amino acid ten amino acid sequence was the same as that of lactoferrin in pig milk.

P.25 558565 V. Description of the invention (23) Example 10: Recombination of recombinant lactoferrin-iron with iron Refer to Chu, L. F. et al. (1 9 9 3) Am · J · Vet · Res · 54, 1 1 54-1 1 5 8 The purified recombinant lactoferrin was dissolved in an iron-binding buffer solution (25mM Tris ρ7.5, 10mM NaHC03, 0.1M sodium chloride, 100uM iron chloride) and reacted at 37 ° C for 30 minutes, followed by Bio-gel P-6 column removes the trivalent iron ions that are not bound to the recombinant lactoferrin). This recombinant lactoferrin was measured with a spectrophotometer and its absorption spectrum was 350 to 700 nm. The results are shown in Figure 7 at 4 6 5 nm has an absorption value and is the same as the lactoferrin ratio in pig milk. Example 11: Purification of recombinant lactoferrin by ELISA analysis. Each washing solution washed with a gaseous sodium salt gradient was washed with oooo1. After being adsorbed to a 96-well plate for 30 minutes, PBST (pBS / 005% Tweerl) was used. 20) Φ Wash three times for 5 minutes each, add rabbit anti-pig lactoferrin antiserum (diluted 2000 times with pBST) and react for 1-2 hours, wash three times with pBST for 5 minutes each, then add and purify the goat antibody Rabbit immunoglobulin IgG antibody (diluted 2 ^ 0 0 0 times with pBST) 'This antibody is linked to a peroxidase reaction for 2 hours, washed three times with pBST for 5 minutes each' and added a TMB peroxidase substrate (Kirkeguard an (i P Erry Laboratories) color, measured its absorption value at 63nm, as shown in Figure 6. The collection solution of 0.6M sodium chloride has the highest value, taking the highest value

Page 26 5585, 65 V. Description of the invention (24) The collected liquid was analyzed by SDS-acrylic acid gel electrophoresis. The inset of Fig. 6 can confirm that the collected liquid of the recombinant lactoferrin was quite pure at 0.6 M sodium chloride. And the molecular weight is equivalent to porcine milk lactoferrin, and the purified recombinant lactoferrin is used for qualitative analysis. According to the foregoing, the present invention provides two recombinant protoplasts including the c D Ν Α coding region of porcine lactoferrin, and these two recombinant protoplasts can be used for expression in transformed yeasts, which will allow yeasts to carry pigs. Lactoferrin. In addition, the present invention provides two yeasts that can be transformed by recombinant protoplasts. One of the two recombinant protoplasts includes a plastid-type performance vector or the other includes an embedded-type performance vector. Lactoferrin egg f white c D Ν A coding region. Furthermore, the present invention also provides a method for producing a yeast with recombinant porcine lactoferrin, the method comprising culturing a yeast with a recombinant plastid, the recombinant plastid comprising a plastid-type expression vector or an embedded expression vector, Both are embedded with a cDNA encoding region of porcine lactoferrin. The yeast is cultured in a suitable nutrient medium, and the recombinant lactoferrin is isolated from the culture medium, and its biochemical characteristics are the same as that of porcine lactoferrin. The invention can provide a method for directly using yeast or yeast culture liquid as a carrier of lactoferrin and iron, and adding lactoferrin and iron to feed to prevent the occurrence of analgesia 1 in piglets and increase the growth rate of piglets. . This yeast with recombinant porcine lactoferrin can also be used as an ingredient in health foods

Page 27 558565 V. Description of the invention (25)

I1HI Page 28

Claims (1)

558565 / 々 · -.1? · ^ Lean version 6. Scope of patent application Patent scope: 1. A type of Saccharomyces cerevisiae YES15 (CCRC 9403 10), which includes a plastid YLF, which contains a code The sequence of the polydeoxyribonucleic acid (c DNA) of porcine lactoferrin is as follows: ATGAAGCTCT TCATCCCCGC CCTCCTGm CTCTGGACAC nGGACTGTG TCTCaTCrCC 60 CCTk \ Q ^ \ G CCOTTCGATG GTGTGTCATA TCCACACCAG AGTAHC.UA ATCCCCTCAG 120 TGGC.ATCACT ACT ACT ACT UAC <..} AGGGC nCTCCCACT 180 GACTGTATCC GGGCCATCGC GGCAA \ AAGG GCAGATGCTG TGACCCITGA TGGTGGTITG 240 GTGTTTC ^ G CAGCCCAGTA CUACTGCGG CCGGTAGCAG CGGAGATCTA CGGGACAGM 300 GAGMTCCCC .AAACCTACTA nATCCTGTG GCTGTAGTGA AG.UAGGTTT CAACITTCAG 360 CTG, ^ CCAGC TAC ^ GGTCG \ AAGTCCIGC CAQCAGGCC nGGCAGGTC TGCCGGGTGG 420. ^ TATCCCTA TAGGCITACT TCGCCCGTTC nGGACTGGG CAGGCCCACC TGAGCCCCTC 480 C \ QAAACa〇Ί〇Χλλλ \ ΊΊ dTCTCTCAG AGCTGTGTGC CCTCCGC \ GA TO.UATGCG 540 TA 丁 CCCAACC TGTGTCAGCT GTGCATAGGG AAACCGGTGTG nCGACT naACTGTC TGCACUACG GAnGGAGAT 660 GTGGCTITTG TCAAGGAGAG TACACTGTTT GAGAACCTGC QCAG.AAGGC TGACCGGGAC 720 < UATACGACC TACTCTGCCC AGACUTACT CGAAAGCCAG TGG.A.AGCATT CAGGGAGTGC 730 CACCTTGCCC GGGTCCCTTC TCATGCTCTlT GTGGCCCGAA GTGTC.UTGG CUGGAGMC 840 TCCATCTGGG AGCTTCrCTA CCAGTCACAG kAAAAGmG βλλ \ λ \ Χλλ TCCACAGGAG 900 nCCAGCTCT nGGCTCTCC TGGTCAGCAG. ^ GGACCTCC TGTITAGAGA TGCTACCATC 960 GCGTITITGA AGATCCCCTC AAAGATAGAT TCTAAGCTGT ACCTGGGCCT CCCGTACCTT 1020 ACTGCCATCC ACGGCCTGAG GGAAACCGCA GCGGAGGTGG AGGCGCGGCA GGCGAAGGTC 1080 GTGTGGTGCG CCGTCGGTCC AGACGAGCTG CGCMGTGCC GGCAGTGGAG CAGCCAGAGC 1140 AGCCAG ^ ACC TGMCTGCAG CCTGGCCTCC ACCACCGACG ACTGC \ TCGT CCAGGTGCTG 1200 AAAGGAGAAG CTGATGCTAT GACCTTCGA butoxy GGAGGATm TCTACACTGC GGGCAAGTGT 1260 GGnTGGTGC CTGTCCTGGC AGAGAACCAA AAATCTCGCC AAAGCAGTAG CTaGACTGT 1320 GTGCATAGAC CMC \ CMGG GTATTITGCC GTGGCGGITG TCACGAA ^ GC ^ AATGGTGGT 1380 ATCACCTGGA ACTCTGTGAG AGGCACGMG TCCTGCCAa CTGCTGTGGA CACGAQGCA i440 GOTGGMCA TCCCCATGGG CCTGOTGTC AACCGOAACAGAG TTGACGAA 1500 TTCTTTAGTC AAACCTGTCC TCCTGGGTCT CAGCCGGGAT CCA.ATCTCTG TGCACTGTGT 1560 CTTGCC.A.ATG ACCAGGGCGT GGACMGTGT GTCCCC.AACA GmTGAGAG ATACTATGGT 1620 TACACCGCGG OTTCAGGTG CCTGGCTGAG AATGCTGGGG ATGTGGCGTT TGTGMAGAT 1680 GTCACTGTCT TGGACAACAC GAATCGACAG ^ ACACAG. ^ AC ACTGGGCCAG GGMnGAGG 1740 TCAGATGACT nGAGCTCCT GTCCCTT.A.AT GGCACCACGA ACCCTCTGAC TGACGCTCAG 1800 .A.ACTGTCACC TGGCTGTGGC CCCCAGTCAT GCTGTCGTCT CTCGC. ^ AGGA .UACGCAGCA I860 CACGTGG.A.AC ACGTGCrACT CACTGAGCAG GCTCAGTTTGGAAGCACCCACCACCGGCCAC ATCAGAGTAT 2040 OTCACACCCA TCOTAACCT GAAACAGTGC TCAOTCTCCC CCaTCTGGA AGCCTGTGCC 2100 HCATCATGA GGTAA 2115 Page 29