TW509696B - Glial cell line-derived neurotrophic factor receptor - Google Patents

Abstract

The present invention relates to glial cell line-derived neurotrophic factor (GDNF), a potent neurotrophin that exhibits a broad spectrum of biological activities on a variety of cell types from both the central and peripheral nervous systems. The present invention involves the cloning and characterization of a high affinity receptor for GDNF. This molecule has been named GDNF receptor (GDNFR) since it is the first known component of a receptor system. Nucleic acid and amino acid sequences are described for GDNFR protein products. A hydrophobic domain with the features of a signal peptide is found at the amino terminus, while a second hydrophobic domain at the carboxy terminus is involved in the linkage of the receptor to the cell membrane. The lack of a transmembrane domain and cytoplasmic region indicates that GDNFR requires one or more accessory molecules in order to mediate transmembrane signaling. GDNFR mRNA is widely distributed in both nervous system and non-neural tissues, consistent with the similar distribution found for GDNF.

Description

509696 Printed A7 B7 by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention () 1. Inventive scope · The present invention is related to the receptors for the neurotrophic factor (GDNF) derived from the gel cell line and provides the GDNF receptor (GDNFR) nucleic acid and amino acid sequences. The present invention also relates to treatment techniques for treating GDNF-responsive conditions. 2. Background of the Invention ^ Glial cell line-derived neurotrophic factor GDNF was originally isolated and colonized from rat B 4 9 cells as an effective neurotrophic factor, which enhances midbrain dopamine Survival of capable neurons (Lin et al., Science, 260, 1130-1132, 1993). Initial research indicates that this molecule exhibits a variety of other biological activities, with roles in many neuron types from both the central and peripheral nervous systems. In the central nervous system (CNS), GDNF has been shown to prevent axial incision and demise of mammalian facial and spinal motor neurons (Li et al., Proceedings of the National Academy of Sciences, 92, 9771-9775, 1995;

Oppenheim et al., Nature, 373, 344-346, 1995; Yan et al., Nature, 373, 341-344, 1995; Henderson et al., Science, 266, 1062_1064, 1994; Zurn et al., Neurological Report, 6, 113 -118, 1994), and the rescue of cell death from the natural plan for the development of motor neurons (Oppenheim et al., 1995, supra). Local application of GDNF has been shown to protect the neurons of dopaminergic nigra induced by axotomy (Kearns and Gash, Brain Research, 672, 104-111, 1995; Beck et al., Nature, 373, 339-341, 1995) or degradation induced by neurotoxins (Sauer et al., Proceedings of the National Academy of Sciences, 92, 8935-8939, / 1995; Tomac et al., Nature, 373, 335-339, 1995). In addition, • 4- This paper size applies to Chinese National Standard (CNS) A4 specification (2 丨 0X297 mm) (Please read the precautions on the back before filling this page)

Printed on 509696 kl --------------- Local application of B7 5 ^ s gdnf by the Ministry of Economic Affairs' Consumer Co-operation, has been shown to deflect the extension of neurons induced by dopa Increasing the amount of dopamine, norepinephrine, and brain stimulants, and improving exercise behavior (Tomac et al., 1995, supra). Recently, GDNF has been reported as a potential nutritional factor for brain noradrenergic gods, Jingyuan and Pujin Ehrlich cells. Transplantation of ectopic GDNF-derived fibroblasts prevents 6-hydroxydopamine-induced degradation in vivo and promotes phenotypes to become noradrenergic neurons (Arenas et al. Neurons, 15 '1465-1473, 1995), and exogenously administered GDNF effectively promoted the survival and morphological differentiation of embryonic Pukin's cells in test tubes (Mount et al., Proceedings of the National Academy of Sciences, 92, 9092-9096, 1995). In the peripheral nervous system, GDNF has been shown to promote the survival of neurons in nodular, ciliary, and sympathetic ganglia, as well as small groups of embryonic sensory neurons in dorsal root ganglia (DRG) and trigeminal ganglia (TrUpp et al. , Journal of Cell Biology, 13〇,

137-148 '1995; Ebendal et al., Journal of Neuroscience Research, 40, 276-284' 1995; Oppenheim et al., 1995, supra; Yan et al. '1995', supra; Henderson et al, 1994, supra ). GDNF has also been reported to enhance the expression of vasoactive intestinal peptide and pro-tachygenin-A mRN A in cultured dominant cervical ganglia (SCG) neurons, and thus affect phenotypes of SCG neurons and deflecting bundles Stretching (Trupp et al., 1995, supra). The performance of gdnf has been seen in the nervous system of many different cell types and structures. In CNS, GDNF mRNA expression has been seen in both the striatum of growing and mature rats by reverse transcriptase polymerase chain reaction (RT-PCR), the main target of dopaminergic neuronal distribution in substantia nigra, and widely in other regions Including the sea '—_ -5- This paper size is based on the standard S (Home Standard (CNS) A4 (2 297 mm) " a' f Please read the precautions on the back before filling this page))

509696 A7 B7 V. Description of the invention (3) Horse, cortex, cerebrum, septum, cerebellum, spinal cord and medulla (Arenas et al., 1995; Poulsen et al., Neuron, 13, 1245-1252, 1994; Springer et al., Experimental Neurology, 127, 167-170, 1994; Stroemberg et al., Experimental Neurology, 124, 401-412, 1993; Schaar et al., Experimental Neurology, 124, 368-371, 1993). In humans, GDNF transcripts have also been detected in the striatum, with the highest amounts in the tail and lower amounts in the shell. Detectable amounts are also found in the hippocampus, cortex, and spinal cord, but not in the cerebellum (Schaar et al., Experimental Neurology, 130, 387-393, 1994. Springer Pan et al., 1994, before the mouth). GDNF mRNA expression was reported in DRG and SCG, primary cultures of sciatic nerve and neonatal Schwann cells in the first postpartum rat (Trupp et al., 1995, supra; Hoffer et al .; Neuroscience Letters, 182, 107 -111, 1994; Henderson et al., 1994) As before; printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before filling this page)

Springer et al., 1994, supra). In addition, recent studies have shown that GDNF transcripts are also widely expressed in peripheral non-neuronal organs, including postpartum pills and kidneys, embryo whisker pads, stomach and skin. Appearance was detected at lower levels in embryonic muscles, adrenal glands and limb buds, and postpartum lungs, livers, and ovaries (Trupp et al., 1995, supra; Henderson et al, 1994, supra). Currently, however, the biological significance of non-neuronal manifestations of GDNF is unclear. A detailed description of the preparation and characterization of GDNF protein products can be found in U.S. Patent Application Serial No. 08 / 182,183, May 23, 1994, and its parent application (see also PCT / US 92/07888, WO93 / 06116, 1992 September 17, 2010 and European Patent Application No. 92921022.7, Publication No. EP610, 254), the disclosure of which is hereby incorporated by reference. Additional GDNF protein production-6- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) A7 B7 (4) V. US Patent Application No. 08 / No. 535,681, I " filed on September 28, 5th, whose disclosure is incorporated herein for reference ^ For use herein, " GDNF protein product words include biologically active synthesis or recombinant

G 腑 proteins and compounds' and their chemically modified derivatives. GDNF analogs include professional variants such as truncated GDNF protein f, and GDNF inserted and substituted variants. Also included are GDNF proteins that are substantially homogeneous to human Ona protein. -GDNF Therapy GDNF therapy is expected to help treat # pathologically-induced neurological damage, which compromises the treatment and / or survival of polymorphic nerve cells and 7 or appropriate functions. Such as ^ Shen miles Damage can occur from many different reasons. Nerve injury can occur to i or polymorphic 4 nerve cells' by: ⑴ physical damage, which leads to the extraction process and / or degeneration of nerve cell bodies near the injury site; 短暂 transient or permanent blood flow 部份 part of the nervous system As in stroke; (3) intentional or accidental exposure to neurotoxins, such as chemotherapeutics (such as cisplatin) to treat cancer or dideoxythymidine (ddC) to treat AIDS; (4) chronic metabolic diseases, such as diabetes Or poor kidney function, or (5) neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, and amyotrophic sclerosis (ALS), which are caused by the degradation of specific neuron populations. Some studies have indicated that GDNF therapy specifically targets neurodegenerative disorders such as dopaminergic neurons in substantia nigra in Parkinson's disease. The only treatment currently for Parkinson's disease is a moderator, which targets the increased amount of dopamine in the striatum. The expected impact of GDNF therapy is not simply an increase in dopaminergic neurotransmission at the dopaminergic nerve endings in the striatum (the paper size applies the Chinese National Standard (CNS) A4 specification (21 × 297 mm) 509696 A7 B7 V. Description of the invention (5 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs will cause relief of symptoms), and delay or even stop the progress of the degradation process and ways to repair the injured nigrostriatal striatum and restore its function 〇〇1 ^? Can also be used to treat other forms of injury or inappropriate effects of dopaminergic nerve cells in patients. Such injuries or failures can occur in schizophrenia and other forms of psychosis. The only currently treated symptom of this condition And need drugs, which act on dopamine receptors or dopamine intake sites, the following points of view are consistent, and the inappropriate role of innervating these poly'paminergic neurons that carry a neuron population may involve Disease process. Receptors Many of the mediators that bind to and respond to protein factors have been characterized and molecularly selected. , Including the following receptors: insulin, platelet-derived growth factor, epidermal growth factor and related substances, fibroblast growth factor, various interleukins, hematopoietic growth factor, and ciliary neurotrophic factor (US Patent No. 5,426,177 No.). Research results indicate that some receptors can bind multiple (related) growth factors, and in some cases the same factor can bind and activate multiple (related) receptors (eg, Lupu et al., Science, 249: 1552-1555 , 1990; Dionne et al., EMBO J., 9: 2685-2692, 1990; Miki et al., Science, 251: 72-75, 1991). Most receptors can be widely characterized as having extracellular parts or functions Site, which specifically binds to protein factors, transmembrane penetrating membrane functional sites, and intracellular functional sites, which often involve the introductory introduction of information when protein factors bind to the extracellular part of the receptor. Although many receptors Consists of a single polypeptide chain, but other receptors obviously require 2 or more separate subunits in order to bind to their protein factors with high affinity and allow binding Responsive (for example, (please read the precautions on the back before filling this page). • I installed ·, 11 -8-Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 509696 A7 B7 V. Description of the invention (6)

Hempstead et al., Science, 243: 375-375, 1989; Hibi et al., Human, Cell, 63: 1149-1157, 1990). The extracellular and intracellular parts of a given receptor can share common structural elements in regions corresponding to other receptors, suggesting evolutionary and functional correlations between different receptors. These correlations can often be extremely alienated and can simply reflect the repeated use of some common functional site structures. For example, many different receptors that bind unrelated factors use "immunoglobulin" functional sites in their extracellular part, while other receptors use "cytokine receptor" functional sites in the region where their factors bind (eg, Akira Et al., The FASEB J., 4: 2860-2867, 1990). A large number of receptors with distinct extracellular binding functional sites (which therefore bind different factors) contain relevant intracytoplasmic functional sites that encode tyrosine-specific protein kinases that activate factor binding responses (eg, Ullrich and Schlessinger, Cell, 61 · · 203-212, 1990). The mechanism by which this factor binds to the "activation" information transduction process is unknown, even in the case of receptor tyrosine kinases. Other receptors, in which the functional site within the cell encodes a functional site with an unknown function or the binding component thereof is related to a second protein with an unknown function (eg, Hibi et al., Cell, 63: 1149-1157, 1990), information transfer Activation is not fully characterized. The role of GDNF in the body is not clearly explained in the art, partly because of the lack of data on GDNF receptors. Two groups of researchers independently found that [1251] -injected GDNF-injected striatum was transmitted retrogradely by dopaminergic neurons in the substantia nigra (Tomac et al., Proceedings of the National Academy of Sciences, 92,8274-8278, 1995; Yan et al., 1995, as before) & made up of spinal cord 'motor neurons, DRG sensory neurons, and B Guangzhi in retinal ganglia-9- This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 male %), (Please read the notes on the back before filling this page)

509696 A7 B7 V. Description of the invention (7) Retrograde neuron transmission [1 2 51]-QDNF was also observed. These retrograde transmission phenomena can be specifically inhibited by unlabeled GDNF at a concentration of 100 times or more, and a saturable receptor-mediated transmission process is suggested. In test tubes, recombinant ODNF has been shown to enhance the survival and uptake of cultured dopaminergic neurons at very low concentrations. The visual half-maximum effective concentration (EC50) of GDNF is 0.2 to 1.6 picomolar in these neurons (Lin et al., 1993, supra). GDNF has also been shown to support ‘remainder of motor neurons’ at low concentrations. GDNF has been reported in motor neurons with EC5G concentrations ranging from 5 to 10 femtomoles, even lower than those in dopaminergic neurons (Henderson et al., 1994, supra). Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page). In summary, these observations indicate that the GDNF receptor expressed in these cells has a very high ligand binding affinity. Similar to the members of the T G F-point family, the extensive and diverse tissue distribution and varying biological functions of GDNF in different cell populations suggest the existence of different types of receptors or receptor complexes for GDNF. [1251]-The saturated steady-state and competitive combination of GDNF and E 10 chick sympathetic neurons has shown that these neurons show GDNF binding sites, which are different from those seen in dopaminergic and motor neurons. The half-maximum saturation concentration and half-maximum inhibitory concentration of GDNF in these binding sites are in the range of 1 to 5 nanomolar (Trupp et al., 1995, supra). Similarly, EC5G supporting GDNF in the surviving sympathetic neurons of SCG from P 1 rats has also been reported in the nanomolar range (Trupp et al., 1995, supra). In order to better understand the mechanism through which GDNF activation information is transduced to affect the cells, it is advantageous to identify the receptors that mediate this protein factor and respond to it. It is also beneficial for GDNF therapy in the identification and possible production. -10- This paper size applies Chinese National Standard (CNS) A4 specification (210 X 297 mm) 509696 A 7 B7 5. Description of the invention (8) Provide or enhance GDNF Information transduction molecules. Furthermore, the identification of GDNF protein factors should provide a powerful use in diagnostic applications, such as ancillary work to determine whether individuals benefit from GDNF protein therapy. Furthermore, the protein receptor of GDNF can be a key component in the analysis of identifying additional molecules, which molecules bind to the receptor and cause the desired biological activity. SUMMARY OF THE INVENTION The present invention provides a nucleic acid sequence encoding a diploid factor receptor protein with an amino acid sequence (SEQ. ID. Nos. 2 and 4) and biologically equivalent analogues as described in Figures 2 and 4 . The neurotrophic factor receptor proteins and protein products of the present invention are designated herein as the neurotrophic factor receptor (GDNFR) proteins and protein products derived from the glial cell line. Novel GDNFRs are functionally characterized as specific and capable of binding to high-affinity GDNF, and function as molecular complexes that mediate or enhance the effects of GDNF information transduction. GDNFR protein products are typically provided as soluble acceptor proteins and in a substantially purified form. Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back before filling this page). In one element, the present invention provides the production of GDNFR protein products by recombinant genetic engineering technology. In alternative embodiments, GDNFR proteins are synthesized by chemical techniques, or a combination of recombinant and chemical techniques. In another element of the invention, the GDNFR protein can be made in a glycosylated or non-glycosylated form. Derivatives of GDNFR proteins typically include linking the GDNFR protein to a water-soluble polymer. For example, GDNFR protein can be conjugated with one or more polyethylene glycol molecules to reduce precipitation of the GDNFR protein product in an aqueous environment. # -11-This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 509696 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 ----------- B7 _ Q " ' _ I II 11 丨 · ............- 5. Explanation of the invention () Another element of the present invention includes different multi-cores encoding the GDNFR protein 4 This two-core red The sequence is used for the expression of GDNFR in nucleus or prokaryotic host cells, in which the performance product or its derivative is characterized by its ability to bind gdnf, and thus form a complex that mediates GDNF activity, such as dopaminergic cells increase dopamine uptake . Polynuclear acid can also be used in cell therapy or gene therapy applications. Suitable nucleic acid sequences include those specifically described in the figure, as well as degenerate sequences, variants of dual genes of natural origin, and modified genes based on the present invention. Exemplary nucleic acid sequences include sequences encoding neurotrophic factor receptor proteins, including amino acid sequences as described in Figures 2 and 4 (SEQ ID Nos. 2 and 4), capable of complexing GDNF-derived neurotrophic factor (GDNF) ) And mediator's cellular response to GDNF, and its biological analogs. Such sequences include: (a) the sequence illustrated in the figure, including nucleotides encoding Met1 to Ser4 65, or FIG. 3 (SEQ 10 No. 3), including the nucleotides encoding Met to Ser 8, Encodes a neurotrophic factor (GDNF) derived from a complex gel cell line and a neurotrophic factor receptor (GDNFR) that mediates the cellular response to GDNF; (b) a nucleic acid sequence that hybridizes (1) with the complementary sequence of (b) 2) Encoding amino acid sequence with GDNFR activity; and (c) Nucleic acid sequence, but it is a degradation of the genetic code. It should be hybridized with the complementary sequence of (a) and (2) Encoding amino acid with GDNFR activity sequence. A vector also disclosed herein is such a nucleic acid sequence, wherein the sequence is typically operably linked to one or more operating elements that can affect the amplification or performance of the nuclear sequence. Host cells with such vectors are also contemplated. Typically, the host cell line is selected from mammalian cells and bacteria / cells, such as COS-7 cells or E. coli, respectively. This paper size applies the Chinese National Standard (CNS) Λ4 specification (210 X 297 mm) (Please read the precautions on the back before filling out this page) • Binding-Binding * I-· Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Preparation 509696 A7 ____ B7_ 5. Description of the invention (1 (5) A further element of the present invention includes a polynucleotide-containing vector that encodes a GDNFR protein operatively linked to amplification and / or performance control sequences. Prokaryotic and prionate host cells Both can be stably transformed or transferred by such a vector to express GDNFR protein. The present invention further includes the recombinant production of GDNFR protein, wherein the host cell line so transformed or transferred to infection is longer than a suitable nutrient medium, and GDNFR expressed by the cell It is optionally isolated from the host if cells and / or nutrient medium. The present invention further includes the use of a polynucleotide encoding GDNFR and a vector having such a polynucleotide for gene therapy or cell therapy. The host cell can also be used for human transplantation. Adaptability is selected, in which the transplanted cells express and secrete the neurotrophic factor receptor of the present invention. It can also be installed in a semi-permeable membrane suitable for human transplantation. 痏 The main cells can be transformed or transferred in vitro. Exemplary devices for treating nerve injury include: (0 semi-permeable membrane suitable for human transplantation; Capsule-encapsulated cells, where the cells manifest and secrete neurotrophic factor receptors as disclosed herein. The membrane is selected from a substance that can penetrate God's operations, but does not penetrate the damaged capsule Cell material. A group of methods for producing the neurotrophic factor receptor of the present invention has also been disclosed. K's method includes: (a) culturing a host cell having a nucleic acid sequence encoding the neurotrophic factor receptor 1 of the present invention, as in The amino acid sequences described in Figures 2 and 4 (SEQ Nos. 2 and 4), can complex the cell response of GDNF derived from glial cell lines and mediators to GDNF, or their biological equivalents; b) < maintain the host cell under conditions suitable for the host cell to express the neurotrophic factor and mi; and, depending on the situation, isolate the host cell from the table _______ _ 13 This paper is oriented towards-(Please read the back first Note for refilling (This page)-Equipment-, 1T 509696 Printed by A7 B7, Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. 5. Description of the invention (11) The neurotrophic factor receptor is now available. The host cell can be a prokaryotic cell or a prion cell. When bacterial manifestations, the method may further include the step of refolding the neurotrophic factor receptor. The present invention includes isolated and purified proteins, including the amino acid sequence as described in Figure 2 * 4 (SEQ ID Nos. 2 and 4), Capable of complexing gel cell strains: GDNF and JDNF, and their biological equivalents. Exemplary analogs include, but are not limited to, FIG. 2 (DEQ ID No. 2) ) Protein, including amino acid sequences

Ser18 to Pro "6, Asp2 ^ Leu44 7 and Cys2icys 4 4 2 and the proteins described in Figure 4 (SEQ ID No. 4), including the amino acid sequences Met to Pro and Cys29 to Cys443. The protein of the present invention can be Adenylated or non-glycosylated and can be produced by recombinant technology or chemical synthesis. The invention further includes nucleic acid sequences encoding the receptor protein, including such amino acid sequences. Also disclosed herein are pharmaceutical compositions, including the present The protein receptor of the invention is combined with a pharmaceutically acceptable carrier. A variety of other formulation materials can be used to help manufacture, preserve, handle, deliver, and / or potency. Another element of the invention includes the medical use of the GDNFR gene and protein. For example, surrounding or soluble GDNFR protein products can be used alone or in conjunction with GDNF to treat diseases or injuries of the nervous system, by enhancing the ability of GDNF to penetrate the membrane. The protein and pharmaceutical compositions of the invention can therefore be used to treat Appropriate action of dopaminergic nerve cells, Parkinson's disease, Alzheimer's disease, and amyotrophic lateral sclerosis. Recombinant GDNFR gene can be inserted into cells of tissues, which should be from -14- This paper size applies Chinese National Standard (CNS) A4 specification (21 × 297 mm) (Please read the precautions on the back before filling this page) 1 '509696 Printed by A7 B7, Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs 5. Description of the Invention (12) Increased sensitivity to GDNF benefits, such as motor neurons in patients suffering from amyotrophic lateral sclerosis. In yet another embodiment, GDNFR can be used to block gdnF activity in instances where GDNF activity is considered harmful. GDNFR can be used to confirm that the GDNF effect seen is due to GDNFR. In another element of the invention, GDNFR Probes can be used to identify cells and tissues that are responsive to GDNF in normal or disease states. Alternatively, probes can be used to detect outliers in the performance of GDNFR in patients suffering from GDNF-related disorders. In the present invention In a further element, GDNFR probes include nucleic acids and antibody probes can be used to identify GDNFR-related molecules. For example, the present invention provides such molecules that form a complex with GDNFR and thus Functions with GDNFR. As another example, the present invention provides receptor molecules that are homogeneous or interact with antigens, but not completely GDNFR. The present invention also provides the development of receptor-based, GDNF binding and functional two Analysis. For example, an analysis system that detects GDNF activity may involve cells that exhibit high levels of GDNFR, and therefore are extremely sensitive to even very low concentrations of GDNF or GDNF-like molecules. In yet another embodiment, soluble GDNFR is available To bind or detect the presence of ODNF or GDNF-like molecules. In addition, the present invention provides an experimental mode system for studying the physiological role of GDNF. Such systems include analysis involving anti-GDNFR antibodies or oligonucleotide probes and animal models, such as animals introduced with foreign genes, which exhibit high levels of 'GDNFR' and are therefore allergic to GDNF or derived using embryonic stem cell technology-15 -This and our scales are in accordance with the Chinese National Standard (cNs) a4 specification (210X297 mm) (please read the precautions on the back before filling this page), 1.509696 A7 B7 V. Description of the invention (13) Animals, The endogenous GDNFR gene was deleted from the genome. Anti-GDNFR antibodies will bind to the peptide portion of the neurotrophin receptor protein. Antibodies include single and multiple antibodies. Alternatively, an immunotag already present in the antibody can be linked to the GDNFR protein to aid in the detection. Such tags include, but are not limited to, the flag (IB I / Eastman Kodak) and the my c sequence. Other tag series such as polyhistidine have also been used for detection and purification of metal chelation columns. Additional elements and advantages of the invention will be apparent to those skilled in the art in considering the following description, which details the implementation of the invention. BRIEF DESCRIPTION OF THE FIGURES Figure 1 depicts a nucleic acid sequence (SEQ ID No. 1) encoding a human glial cell line-derived neurotrophic factor receptor (GDNFR). The amino acid sequence of the full-length GDNFR protein is encoded by nucleic acids 540 to 1934. Figure 2 depicts the amino acid sequence of the full-length human GDNFR protein (SEQ ID No. 2). Figure 3 depicts a nucleic acid sequence (SEQ ID No. 3) encoding rat GDNFR. The amino acid sequence of the full-length GDNFR protein is encoded by nucleic acids 302 to 1705. 0 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page). Figure 4 depicts the amine of the full-length rat GDNFR protein. Amino acid sequence (SEQ ID No. 4). Figure 5 depicts the alignment and comparison of the GDNFR cDNA sequence portions and human GDNFR sympathetic sequences produced in different colonies. Figure 6 depicts the identification of neural-2A-derived cell lines expressing GDNFR. Figures 7A and 7B depict the equilibrium / binding results of [125I] GDNF and cells expressing GDNFR. -16- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 A7 B7 14 V. Description of the invention () Figure 8 depicts [1 2 51] GDNF and GDNFR expressed in cells expressing GDNFR and Ret's Chemical Interaction Bonding Results. Figure 9 depicts the results of c-Ret autophosphorylation induced by GDNF in cells expressing GDNFR. Figure 10 depicts the results of c-Ret autophosphorylation induced by GDNF and soluble GDNFR. Figure 11 depicts c-Ret autophosphorylation junction blocked by Ret-Fc fusion protein. Figure 12 depicts c-Ret autophosphorylation junction mediated by GDNF in motor neurons. Figure 13 depicts GDNF message sent by GDNFR and Ret. Of the model. Detailed description of the invention Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the notes on the back before filling this page). GDNF derived from glia cell line is an effective neurotrophic factor, which is in the central and The peripheral nervous system exhibits a wide range of biological activities on a variety of cell types. It is a glycosylated, disulfide-linked dimer that is alienated from the transforming growth factor- / 5 (TGF-々) family (less than 20% homogeneity). GDNF enhances the remaining ability of dopaminergic neurons and other neuronal populations to show their therapeutic potential to treat Parkinson's disease and other forms of neurological injury or disorder. Compared to the extensive research on the distribution and biological activity of GDNF, no report has identified the receptors or receptors that mediate the binding of GDNF to cells and thus mediate the occurrence of intracellular information and cellular responses. The present invention is based on the discovery / discovery of high-affinity receptors, and was first seen on the surface of cultured retinal cells in postnatal rats. -17- This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 509696 Printed by A7 B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (15) These receptors have estimated GDNF binding Affinity is equivalent to those seen by: dopaminergic and motor neurons; midbrain dopaminergic neurons (L i η et al., 1993, supra; Sauer et al., 1995, supra; Kearns and Gash, 1995, such as Before; Beck et al., 1995, as previously; Tomac et al., 1995a, as previously;), facial and spinal motor neurons (U et al., 1995, as previously; Oppenheim et al., 1995, as previously; Yan et al.) , 1995 'as before; Zurn et al.' 1994, as before; Henderson et al., 1994, as previously). The receptor molecule has been named GDNF receptor (GDNFR) because it is the first known GDNF receptor system. The present invention also provides the i-th description of the performance selection and characterization of GDNFR proteins. Cells modified to express recombinant receptors bind GDNF with high affinity. Using dopamine uptake analysis and [1 2 51] -GDNF binding in cultured cells, a high affinity receptor for GDNF was detected on the surface of rat photoreceptor cells. As further described in the examples, studies of light-receptor cells have resulted in the isolation of cDNA colonies from selections that express GDNF receptors. The nucleic acid sequence of GDNFR encodes a protein of 468 amino acids, with 31 cysteine residues and 3 potential N-glycosylation sites. The nucleic acid sequence of the rat cDNA clone was then used to isolate its human homogenate, which was found to be nearly identical to the rat receptor in the degree of amino acid. The human GDNFR cDNA sequence encodes a protein of 465 amino acids, while the positions of all cysteine residues and potential N-glycosylation sites are reserved relative to the rat receptor. This high first-order sequence retention indicates the important role of this receptor in the biological role of GDNF. As discussed above, many receptors have three major functional sites: extracellular or cell surface functional sites that are responsible for specific / binding protein factors; spanning cells-18-This paper size applies to China National Standards (CNS) A4 specifications (210X297 (Mm) (Please read the precautions on the back before filling in this page) Γ 509696 Printed by the Shellfish Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 ______ _B7 V. Description of the invention (W) The membrane's penetrating membrane functional part; and intracellular Or cytoplasmic functional sites, which typically involve initiation information reporting when protein factors bind to extracellular functional sites. However, it was determined that GDNFR is not related to the sequence or structural characteristics of any known protein (such as the sympathetic sequences seen in receptor kinases or cytokine receptors). It lacks cytoplasmic functional sites and lacks features that penetrate membrane functional sites. The c-terminal charged residues are immobilized on the cell membrane with a glycosyl phospholipid phosphoinositide (GPI) bond, as described in more detail below. Although the absence of intracellular catalytic functional sites precludes the direct role of transmembrane information, high binding affinity and strong evolutionary sequence retention further suggest that this receptor is important for the role of GDNF. Because GDNFR lacks cytoplasmic functional sites, this receptor is thought to have to be associated with one or more accessory molecules that play a role in transmembrane information generation. Then it was found that the foreign-introduced mice died and did not have kidneys, which lacked the GDNF gene. Introduction of foreign genes lacking the c_ret pro-oncogene gene in mice (Schuchardt et al., Nature, 367, 380_383, 1994) was found to have similar phenotypes. Proto-oncogene c-ret encodes receptor tyrosine kinase (RTK), whose normal function has not been determined. All rtKs have similar sites. Anatomy: they have extracellular ligand binding functional sites, membrane penetrating functional sites, and cytoplasmic fragments with catalytic protein-tyrosine kinase functional sites. The binding of the ligand results in the activation of the functional site of the kinase and the phosphorylation of specific substances in the cell, which mediates intracellular messages. The present invention relates to the discovery that the soluble form of GDNFR can be used to mediate the binding of GDnf to the c-ret-oncogene and thereby elicit a cellular response to GDNF and modify its cell / type specificity. -19- * This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) ~ " 一 " " " '' ~~ (Please read the precautions on the back before filling this page) -Pack -509696 Printed by A7 B7, Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the Invention (17) Similar species, called "receptor pan" components, provide ligand binding specificity but are not transduced by themselves Information ability. Such components are found in the ciliary neurotrophic factor (GNTF) and interleukin-6 (IL-6) receptor system. For example, GDNFR and GNTF receptors bind with high affinity relative to the IL-6 receptor Its ligand has a hydrophobic C-terminus, non-cytoplasmic functional sites, and solid GPI bonds immobilized on the cell membrane (Davis et al., 1991). With a view to mediating information transduction, CNTF binds to CNTF prior to CNTF, creating 4-binding gp 130 complex. This deactivated complex then binds to the LIF receptor to form a complex that sends an active message (Davis et al., Science, 260, 1805-1807, 1993). As with the present invention, CNTF is affected by The ligand (the specific binding component of the ligand) must be present Information occurs, but it does not have to be membrane-bound (Economides et al., Science, 270, 135 1-1353, 1995). As further described below, the GDNFR protein can be immobilized on the cell surface, or it can be provided in a soluble form. In one example, the GDNFR protein forms a ligand complex with GDNF, and the ligand complex binds to cell surface receptors to perform intracellular messaging. Therefore, a soluble form of GDNFR can be used to confer GDNF effects and / Or modify its cell-type specificity.. GDNFR is not related to any known receptors. There is no clear match for related sequences in GenBank and the University of Washington-Merck database. In the University of Washington-Merck EST database The performance sequence tag (EST) seen in the picture shows that 75% is homogeneous in a small portion of the GDNFR code region (approximately 340 nucleotides of the 521 nucleotide sequence generated from the 5 'end of the selected colony). This colony , (GenBank accession number # H12981) is a human infant brain bank of dT-dT primers-20- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) (Please read the note on the back first Please fill in this page again): Binding-Order 509696 A7 B7 V. Description of the invention () Select and colonize Lafmid BA vector (Hullier, L., et al., Unpublished data) in a guided and unguided manner. # H12981 选 群 的 3 The end has been sequenced, but does not show any part of homogeneity in GDNFR. Here # H12981 appears in a short region of homogeneity between the selected colony and GDNFR, and its homogeneity then disappears. It is recommended that # H12981 selected colonies represent unconjugated transgenic or cloned processed products, not solid cDNA. Transcript. Therefore, the present invention enables the selection of GDNFR-expressing target cells to allow the selection of GDNFR proteins. By providing a device for purifying the GDNFR coding sequence, the present invention further provides the purification of GDNFR protein and the direct selection of GDNFR-encoding DNA. The description of GDNFR nucleic acids and amino acids provides the information needed to reproduce these entities and various GDNFR analogs. With this information, GDNFR protein products can be isolated or produced by any means known to those skilled in the art. A variety of recombinant or synthetic methods for the preparation of GDNFR proteins have been disclosed. Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the notes on the back before filling this page). As used herein, the term "GDNFR protein product" includes biologically active, purified natural, synthetic or recombinant GDNFR, GDNFR and similar Substances (ie, GDNFR homogeneous substances and variants involving insertions, substitutions, and deletions) and their chemically modified derivatives. GDNFR analogs are substantially homologous to the GDNFR amino acid sequence and are illustrated in Figures 2 and 4 (SEQ ID Nos. 2 and 4). The term "biological activity", as used herein, refers to the high-affinity binding of GDNFR protein products to GDNF and to mediate or enhance GDNF-defamatory information transduction. Using this specification, it is entirely within the ability of those skilled in the art to determine whether GDNFR polypeptide analogs have substantially the same biological activity as the GDNFR protein product described in Figures 2 and 4. -21-This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (19) "Substantially homogeneous" amino acid sequence The term, as used herein, refers to an amino acid sequence that shares the "similarity" or homology sequence of the GDNFR amino acid sequence described in Figures 2 and 4, such that the homogeneous sequence has a similarity to that described as The biological activity or function of these GDNFR amino acid sequences. Those skilled in the art should know that a considerable number of individual or groups of amino acid residues can be changed in the amino acid sequence, exchanged in position (such as reverse alignment or rearrangement) or completely deleted without affecting the third molecule. Level configuration or activity. Such modification is entirely within the ability of those skilled in the art to follow this disclosure. Methods for identifying and providing such modified sequences are described in more detail below. Preferably, the degree of homogeneity of the substantially homogeneous protein (peptide) is equal to or more than 70% (that is, the range of homogeneity from 70% to 100%). Therefore, preferably, the "substantially homogeneous" GDNFR amino acid may have a homogeneity greater than or equal to 70% of the amino acid sequence described in SEQ ID Nos. 2 and 4. More preferably, the homogeneity may be equal to or more than 85%. Even more preferably, it is equal to or more than 90%, or most preferably, it is equal to or more than 95%. The percentage of homogeneity as described herein is calculated as the difference between the 1 protein sequence and the 1st protein sequence. The percentage of amino acid residues seen in the sequence of identical or similar amino acid residues in the two protein sequences. Therefore, in the case of GDNFR homogeneity, the sequence homogeneity can be determined by comparing the amino acid residues of the optimal alignment molecule with the Identical reference GDNFR polypeptides, as described in SEQ ID Nos. 2 and 4 or these are determined by the nucleic acid sequence coders described in the figure to maximize residue pairing between the two sequences. Those skilled in the art should It is known that such an arrangement may include appropriate substitution of retained residues and disregard of truncation and end deletions or insertions of the aligned sequences, by introducing gaps as required; see, for example, a diagram of protein sequences and structures, vol. 5 /, where An average of 3 to 4 cracks in 100 amino acids can pass through Import -22 »· This paper size is applicable to Chinese national standard ϋ CNS) A4 specification (21GX297 male p ^ — --- (Please read the precautions on the back before filling this page)

509696 A7 ------------- B7 V. Description of Invention (20) Printed by the Shellfish Consumer Cooperative of the Central Standards Bureau of the Ministry of Economy to help sort (124 pages, National Biochemical Foundation, Washington, 1972 '. Its disclosure is incorporated herein by reference). Once so ordered, the percentage is determined by dividing the number of residues aligned in the comparative polypeptide by the total number of residues in the comparative polypeptide. It is further contemplated that the GDNFR sequence of the present invention can be used to form a portion of a fusion protein or a chimeric * protein that has at least a portion of GDNFR activity. The alignment and homogeneity of such proteins should be determined using the fusion protein or chimeric protein of this part, which is related to * GDNFR activity. Sources of such substantially homogeneous GDNFR proteins include other mammalian GDNFR proteins, which are expected to have a high degree of homogeneity for human proteins. For example, the degree of homogeneity between rat and human GDNFR proteins is disclosed herein as about 93/0. The homogeneous gDNFR protein can be isolated from such mammals by the interaction of the antibody with the GDNFR amino acid sequences of SEQ ID Nos. 2 and 4. Alternatively, it may be expressed by a nucleic acid sequence, which is separated by hybridization with a fragment encoding a GDNFR gene or a homogeneous gene of Nos. 2 and 4, or a complementary sequence thereof to the nucleic acid sequence shown in SEQ ID Nos. 2 and 4 Cross. Suitable hybridization conditions are further detailed below. The novel GDNFR protein product is typically isolated and purified to form a GDNFR protein product, which is substantially free of unwanted substances that would impair the use of the polypeptide for its intended purpose. For example, the preferred < GDNFR protein product may be substantially free of other human (e.g., non-GDNFR) proteinaceous substances or pathological agents. Preferably, the GDNFR protein product is 8 ()% free of other proteins, which may exist because of the production technology used in the manufacture of the GDNFR protein product. More preferably, the GDNFR protein product is about 90% free of other proteins, particularly preferably about 95% free of other proteins, and optimally about > 98% -23-This paper size applies to China National Standard (CNS) A4 specifications (/ (Please read the precautions on the back before filling this page) • Binding · Order 4 509696 V. Description of the invention (21) Broadcast other proteins. In addition, the choice is secret; sister 1 made a deduction for polynucleotides Sequences have the unique advantage of making homogeneous GDNFR proteins. This GDNFR under-disparity system is expected to include additions, deletions, and substitution variants. For example, a series of deletion variants can be derived from the amine and / or carboxyl terminus of the gdnfr protein It is made by removing one or more amino acid residues. Using the rules for predicting information peptide cleavage as described by von Heijne (von Heijne, Nucleic Acids Research, 14,468_4690, 1986), GDNFI ^ The i-th printed amino acid residue of the Consumer Cooperative of the Central Standards Bureau of the Ministry of Amine Economy, which may involve GDNFR binding, is Ser18, as shown in the full-length amino acid sequence of human GDNFR in Figure 2 (SEQ ID No. 2) The amino acid residues Met1 to Ser18 are shown in The basal hydrophobic region, which appears to be part of the information peptide sequence, and is therefore not included in the mature form of the receptor protein. Likewise, the final amino acid residue of the GDNFR protein, which appears to be necessary for GDNF binding, is Ser4 4 6. The amino acid residues Leu4 4 7 to Se r 4 6 5 are in the hydrophobic region of the compound base, which involves the gp I bond of the protein to the cell surface. Therefore, it is expected that from Me t1 to Ser 18 And / or any or all of Leu 4 4 7 to Ser4 6 5 (as described in Figure 2 (SEQ ID No. 2)) can be removed from the protein without affecting GDNF binding to the GDNFR protein, thus leaving The "core" sequence of Ala19 to Pro 4 4 6. Using known analytical techniques, it is further expected that the N-terminal truncation may include removal of 1 or more amino acid residues up to and including Gly24. Therefore, GDNFR Truncation analogs may also include the deletion of one or more amino acid residues from the 1 or 2 ends such that the amino acid sequence of Asp25 to Pro446 or Leu447 forms the basis of the core molecule. Additional GDNFR analogs are expected Related to amino acid residues Ser18 to Pro449, as shown in Figure 4 (SEQ ID No. 4 No.) of GDNFR amino acid sequence-24- This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 509696 A7 B7 — —-* — V. Invention As shown in the description (), that is, one or more amino acid residues are deleted from the 1 or 2 terminal of the hydrophobic region, as shown in the amino acid residues Met1 to Ser18 and / or Pro 4 4 9 to Sei * 468. . Furthermore, it is expected that one or more amino acid residues may be removed from one or both of the amino and carboxyl termini until the first and last cysteine residues in the full-length ¥ column are reached. It is advantageous to retain the cysteine for proper intramolecular binding of the GDNFR protein. As shown in the full-length amino acid sequence of #human GDNFR in FIG. 2 (SEQ ID No. 2), any or all amino acid residues from Meti to Asp28 can be removed from the amino end without removing the first Cysteine, which appears as Cys29. Similarly, any or all of the amino acid residues from to Ser465 can be removed from the carboxy terminus without removing the final cysteine residue, which appears as Cys 44 2. Other GDNFR analogs can be made using the amino acid residues of Cys29 to Cys443, as described in the GDNFR amino acid sequence of Figure 4 (SEq ID No. 4), which deletes all or part of the terminal region, such as the amino acid Residues Met1 to Asp28 and / or Ser4 4 4 to Ser468 are shown. Those skilled in the art should be aware that, for the same reason, it is expected that these same amino acid residues can be substituted instead of deleted without affecting the function of the GDNFR protein. Alternatively, these same amino acid residues may be modified by insertion or terminal addition within the residues without affecting the function of the GDNFR protein. In yet another embodiment, a combination of one or more deletions, substitutions, or additions may be made. The GDNFR protein or nucleic acid can be used in a method of treatment or a method of preparing a therapeutic agent. Such treatment includes disorders characterized by the excessive production of gdnfr protein, where the GDNFRs, particularly soluble forms, -25- (210X 297 ^ 1:) '~ ·-(Please read the precautions on the back first (Fill in this page again)-Loading ·, ιτ 509696 A7 B7 In the Ministry of Economic Affairs: ^ Printed by the Bureau of Standards, Consumer Cooperatives V. Description of the invention () Can be used to compound and therefore deactivate such excess GDNF protein. This treatment can be accomplished by preparing soluble receptors (e.g., using GDNF-binding functional sites) or by preparing a cell population containing such GDNFR and transplanting such cells to individuals in need thereof. The GDNFR protein product can also be used to treat those with defective GDNF receptors. For example, we can treat people with defective GDNFR by preparing and delivering soluble receptors, or by preparing a population of cells containing such non-defective GDNFR and transferring such cells to individuals. Or (individuals may have an uncomfortable amount of GDNF receptors, and cells containing such receptors may be transplanted with a view to increasing the number of GDNF receptors available to the individual. Such a composition may be used in conjunction with GDNF delivery. It is also expected that GDNFR The protein product can be used to treat disorders that activate the c-ret receptor tyrosine kinase. In yet another element of the invention, a further advantage of the novel composition is the use of GDNFR to stabilize the GDNF protein pharmaceutical composition. Among other elements of the present invention, GDNFR can be used to screen compounds for antagonist activity. / Other elements and advantages of the present invention will be apparent to those skilled in the art. For example, additional applications include novel analysis systems, introduction of foreign genes Animal and antibody production. Research mode * The present invention provides an analysis system in which GDNF activity or activity similar to GDNF activity caused by exposure to peptides or non-peptide compounds can be detected by measuring cells expressing the GDNFR molecule of the invention Or the physiological response elicited in the cell line. The physiological response can include any biological effect of GDNF, including but not For dopamine intake, prolongation of neurites, increase in cell survival or growth-26- * This paper size applies to the Chinese National Standard (CNS) A4 specification (210X29? Mm) (Please read the precautions on the back before filling this page ) 509696 A7 ___ B7 V. Description of the invention (24) and transcriptional activation of certain nucleic acid sequences (such as promoter genes / promoting elements and structural genes), GDNF-related processing, translation or phosphorylation, and direct or indirect defamation by GDNF The response of the treatment to the second treatment is only a few. For example, a model system can be created, which is used to study the effect of excess GDNF activity. In such a system, the cell's response to GDNF can be increased, compared to The model system of cells that have not been treated in this way is designed to increase the amount of GDNFRs on the cells. The system can also be developed to selectively provide an increase in GDNFR on cells that normally display GDNFR. Placed under sequence control. GDNFR gene can be inserted as desired, and specific promoter genes (including but not limited to CNS nerves) Specific enolase, neurofilament, and tyramine '-acid hydroxylase promoter genes), defamable promoter genes (such as metal sulphur neoplasms), UV-activated promoter genes at the long terminal repeats of human immunodeficiency virus ( Valeri et al., 1988, Nature 333 · 78_81) or under the control of a CMV promoter (if included in pCMX 'below) or a developmentally regulated promoter. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the back first) Note: Please fill out this page again.) By increasing the number of GDNFR cells, you can increase the response to endogenous GDNF. If the model system contains little or no GDNF, GDNF can be added to the system. It is also desirable to evaluate the effect of excess GDNF activity by adding additional GDNF to the model system. Excessive expression of GDNF (or secreted GDNF) can be a method to study the effect of elevated GDNF on cells that have already exhibited GDNFR. GDNFR therapy ’In another element, certain conditions can benefit from increased GDNF responsiveness. -27- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) — — — Printed by the Consumers ’Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (hence 'can be beneficial in suffering from GDNF ^ Increase the number of GDNFRs or binding affinity in patients with responsive disease. This can be achieved by gene therapy, where selective expression of recombinant GdnFr is achieved in appropriate cells, such as by using tissue-specific or defamable promoter genes to control GDnfr Gene's or localized infections caused by replication-deficient virus containing a recombinant 0? ^ 1? Antigene. Conceivable conditions that would benefit from GDNFR or combined GDNF / GbNFR transmission include but are not limited to motor neuron disorders including Amyotrophic lateral sclerosis, diabetes-related neurological disorders, Parkinson's disease, Alzheimer's disease, and Tinton's disease. Additional instructions for GDNFR or combined GDNF / GDNFR transmission uses are described Above and beyond-treatment including the following: glaucoma or other diseases and conditions involving the degradation of retinal ganglion cells' injured and injured by sensory neurons Sensory neuropathy due to degeneration; disorders such as hereditary retinal degeneration and age, disease or injury-related retinopathy in which photoreceptor degradation occurs and causes vision loss; and damage or degradation of sensory cells in the inner ear such as ear cells and auditory nerves In order to prevent and / or treat hearing loss for a variety of reasons.

I In yet another element, the recombinant GDNFR gene can be used to deactivate or "direct" endogenous genes (such as homologous recombination) and thereby create cells, tissues or animals with insufficient gDNFR. For example, the recombinant GDNFR gene can be processed to contain An insertional mutation that deactivates (30) ^ 1711. Such a construct can be introduced into a cell such as an embryonic stem cell under the control of a suitable promoter gene by any conventional technique including transfer infection, transduction, injection, etc. Cells can then be made, for example, from -28- this paper size applies Chinese National Standard (CNS) A4 specifications (210X297 mm) (please read the precautions on the back before filling this page)-binding. Order 509696 A7 B7 V. Description of the invention (26) G418 resistance selected. Cells lacking intact GDNFR gene are then identified (eg, by Southern aspiration method or Northern aspiration method or performance analysis). Cells lacking intact GDNFR gene can then be fused to early embryonic cells to generate GDNFR-deficient animals introduced with foreign genes. Comparison of animals with animals that do not express endogenous GDNF reveals that the two phenotypes are perfectly matched or unmatched, meaning Plus the presence of GDNF-like factors or receptors. Such animals can be used to define specific neuronal groups 4 or other processes in vivo that normally rely on GDNF. Therefore, these groups or processes can be expected to be affected, and GDNFR and Therefore it does not respond to GDNF. Diagnostic applications According to the present invention, GDNFR probes can be used to identify cells and tissues that are responsive to GDNF in normal and disease states. The present invention provides a method for identifying cells that are responsive to GDNF by detecting GDNFR manifestations in such cells. GDNFR manifestations are evidenced by the transcription of GDNFR mRNA or the production of GDNFR proteins. GDNFR manifestations can be detected using probes that identify GDNFR nucleic acids or proteins or by artificially adding "tag" sequences to GDNFR proteins Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) A probe that can be used to detect the performance of GDNFR is a nucleic acid probe, which can be used to detect the RNA encoding GDNFR. Any method known in the art, including but not limited to in situ hybridization, northern blot analysis or PCR-related techniques. The present invention Nucleic acid products can be labeled with detectable labels (such as radioactive and non-isotopic labels such as biotin) and used in the hybridization process to locate the human GDNFR gene position and / or the position of any relevant gene family in the chromosome map. It can also be used to identify human GDNFR genetic disorders in the degree of DNA and -29- This paper size is applicable to China (CNS> A4 size (210X297 mm 1) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 509696 V. Description of invention (27 As a genetic marker to identify neighboring genes and their obstacles. What is contemplated here is a kit containing such a labeled substance. The polypeptide products of the present invention may be labeled with a detectable labeling substance or label (such as a radioisotope, fluorescent or chemiluminescent chemical, enzyme, or other label available to those skilled in the art), to provide a useful Reagent for detecting and determining gdnf in solid tissue and fluid samples such as blood and urine. This probe can also be used to detect and test cells and tissues, which are reactive to GDNF in normal or disease states. Another possible analysis for measuring the presence of GDNF in a test sample or screening for the presence of GDNF-like molecules involves contacting the test sample with GDNFR skin-immobilized on a solid phase, thereby generating GDNFR_bound gdnf. Gdnfr bound GDNF may be available Contact with detection reagents such as gdnf-specific labeled antibodies, thus forming detectable products. Such analysis can be developed in the form of analytical devices to analyze test samples. In the basic form, such devices include GDNFR containing or coated with solid The method of analyzing the presence of gdnf in a test sample may involve contacting the sample with an analytical reagent comprising a GDNFR protein, wherein the GDNFR protein The presence of a gdnf reaction in a test sample and the generation of a detectable reaction product are indicative of the presence of gdnf. The analytical reagents provided herein may also include parts of a kit or article of manufacture. It is expected to include packaging materials and one or more current Articles of manufacture that provide preparations of nucleic acid and amino acid sequences. Such packaging materials will include a label indicating that the preparation can be used to detect GDNF, GDNF ^, or GDNFR defects in biological samples. As such, the kit may include performing such tests as appropriate If the substance can be used for protein analysis in blood, urine, or tissue samples, 30- This paper size is applicable to China National Standard (CNS) A4 specification (fine > < 297 mm) (Please read the note on the back first (Fill in this page again)

509696 A7 B7 5. Description of the invention (28) DNA or RNA hybridization analysis or PCR analysis. Anti-GDNFR antibody According to the present invention, a GDNFR protein or a fragment or derivative thereof can be used as an immunogen to produce an anti-GDNFR antibody. In order to further improve the reliability of the anti-GDNFR immune response, the amino acid sequence of GDNFR can be analyzed in order to identify the molecular parts that can be related to increased immune production. For example, amino acid sequences can be computer analyzed to identify surface epitopes for the presence of computer-generated maps of GDNFR's hydrophobicity, surface likelihood, elasticity, antigenic indicators, amphoteric helix, amphoteric layer, and secondary structure. Alternatively, the amino acid sequences of GDNFR from different species can be compared, and relatively non-homogeneous. Regions can be identified; these non-homogeneous regions should be more likely to be immunogenic across different species. It can also be understood that the peptide segment is only copied in the GDNFR. The continuous amino acid sequence or the part of the secondary configuration, and the segment can possess one of the activities of mammalian GDNFR (such as immune activity) and non-others (such as GDNF Protein binding activity). Thus, the production of antibodies may include the production of anti-peptide antibodies. The peptides exemplified below are synthesized using the GDNFR sequence. 4 ^ Table 1 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) GDNFR peptide SJP-6 h2n-qscstkyrtl-cooh. Λ GDNFR, AA 40-49 (SEQ ID NO: 25) SJP-7 h2n-ckrgmkkekn-cooh human. GDNFR, AA 89-98 (SEQ ID NO: 26) SJP-8 h2n-lledspyepv-cooh human GDNFR, AA 115- 124 (SEQ ID No .: 27) SJP-9 h2n-csyeererpn-cooh rat GDNFR, AA 233-242 (SE (^ ID No: 28) jJP-10 h2n-pappvqtttatttt-cooh rat GDNFR, AA 356- 369 (SEQ ID NO: 29) ____- 31-^ 's scale is applicable to China ¥ standard (CNS) A4 specification (210X297 mm) 509696 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention () The peptides SJP-6, 7 and 8 are identical in rat and human GDNFR. The peptides SJP 9 and 10 are derived from rat sequences and each has an amino acid different from humans. Both multiple and single strains Antibodies can be made by methods known in the art using these peptides or other parts of GDNFR. Monoclonal antibodies directed against GDNFR can be made by any known technique, which is a continuous cell line The production of antibody molecules is provided in the culture medium. For example, the hybridoma technology originally developed by Kohler and Milstein produced < single-clonal antibody (Natural '256: 495-497, 1975) and the triple tumor technology, human B-cell hybridoma Technology (Kozbor et al., Immunology Today 4:72, 1983), EBV-Hybridoma Technology (Cole et al., In, Monoclonal Antibody and Cancer Therapy, "Alan R. Liss, 77-96, 1985) Similar techniques can be used. Human monoclonal antibodies or conjugated human-mouse (or other species) monoclonal antibodies can also be prepared for therapeutic use and can be made by any of a variety of techniques known in the art (e.g., Teng et al. , Proc · Natl · Acad · Sci · USA ·, 80: 7308_ 7312, 1983; Kozbor et al., Immunology Today, 4: 72_79, 1983; Olsson et al., Meth · Enzymol ·, 92 ·· 3-16, 1982 ). Chimeric antibody molecules can be prepared to contain mouse antigen-binding functions with human fixed regions (Morrison et al., Proc · Natl · Acad · Sci · USA ·, 81: 6851, 1984; Takeda et al., Nature, 314 · 452, 1985). A variety of procedures known in the art can be used to produce multiple antibodies. To produce antibodies, a variety of host animals, including but not limited to rabbits, mice, rats, etc., can be immunized by injection of GDNFR protein or its segments or derivatives. A variety of adjuvants can be used to increase the immune response, depending on the host species selected. / Available adjuvants include but are not limited to Freud's (complete or incomplete), mineral surface 32- 'This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) (Please read the note on the back first Please fill in this page again}. Packing · -Order 509696 A7 B7 V. Description of the invention (M) Glue such as Hydroxide, surface active substances such as lysolecithin, polyacid polyol, polyanion, peptide, oil emulsion, suppository The pores have hemocyanin, dinitrophenol, and human adjuvants BCG (BCG) and Corynebacterium. Molecular colonies of antibodies against GDNFR epitopes can also be prepared by known techniques. Recombinant DNA methodology ( (See, for example, Maniatis et al., Molecular Selection, Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982) can be used to construct a nucleic acid sequence that encodes a single antibody molecule or its antigen-binding region. Antibody molecules can be obtained by known techniques Purification, such as immunoadsorption or immunoaffinity chromatography, chromatographic methods such as high performance liquid chromatography or a combination thereof, etc. The present invention provides antibody molecules and segments of such antibody molecules. Antibodies containing hereditary molecules The slices can be produced by known techniques. For example, such slices include but are not limited to: F (a V) 2 slices, which can be produced by pepsin digestion of antibody molecules; Fab · section slices, which can be reduced by F (ab ') 2 Disulfide bridge generation of segments, and Fab segments, which can be generated by treating antibody molecules with papain and reducing agents. Such selective binding molecules can themselves be substitutes for GDNFR proteins, and can be formulated as pharmaceutical compositions. Ministry of Economic Affairs Printed by the Consumer Standards Cooperative of the Central Bureau of Standards (please read the notes on the back before filling this page) Recombinant expression of GDNFR protein The present invention provides a variety of polynucleic acids encoding GDNFR protein. The performance products or their derivatives are characteristically unique With the ability to bind GDNF with high affinity, further interaction with the molecules that send information can occur. Therefore, it provides or enhances GDNF activity, such as increasing dopaminergic cells / dopamine uptake, multinucleic acid can also be used Cell Therapy or Gene Therapy Should -33- This paper size applies to Chinese National Standard (CNS) A4 (210 X 297 mm) 509696 Central Ministry of Economic Affairs A7 B7 printed by quasi-station employee consumer cooperatives • Fifth, the invention description () is used. According to the present invention, a new | page GDNFR protein and DNA sequence encoding all or part of such a receptor is provided. The novel nucleic acid sequence of the present invention includes the available The sequence of the safe expression of the polypeptide product in prokaryotic or prionary nucleus host cells has at least one primary structural configuration of recombinant human GDNFI {and one or more biological properties. Nucleic acids can be purified and isolated to make the desired code region available To produce the polypeptide. Alternatively, the nucleic acid sequence can be used for diagnostic purposes, as described more fully below. The exemplary DNA sequence of the invention includes a nucleic acid sequence encoding a GDNFR amino acid sequence, depicted in Figures 2 and 4 and illustrated in SEQ IDs 2 and 4. In addition, the ONA sequence disclosed by the present invention specifically includes: (a) any of the DNA sequences (and complementary strands) described in Figures 1 to 3; (b) a DNA sequence, which is disclosed in the cDNA library screening section below Hybridization conditions, or equivalent conditions or more urgent conditions) with the DNA sequence in this part (a) or with its segments; and (c) DN A sequence, but it is a degradation of the genetic code, which should be compared with the following The DNA sequence of part (a) is hybridized. Particular understanding in parts (b) and (c) is the genomic d NA sequence, which encodes the human GDNFR of the dual variant form and / or the GDNFR encoded from other mammalian species, and the DN A sequence, which encodes the GDNFR, GDNFR sections And GDNFR analogues, whose DNA sequences can incorporate codons to promote the transcription and translation of messenger RNA in a microbial host. Such a manufacturing sequence can be easily constructed according to a method known in the art and a method described herein. Recombinant expression techniques, which are performed in accordance with the specification or other known methods described herein, can be used to generate these polynucleotides and to express GDNFR proteins with different expressions. For example, inserting a nucleic acid sequence encoding a GDNFR protein -34- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page):

1T 5. Invention Description (32 Α7 Β7 Printed on the appropriate carrier by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs. Those skilled in this art can easily generate a large number of desired nuclear fenamic acid sequences. The sequences can then be used to generate detection probes. Needle or amplified primers. Alternatively, a polynucleic acid encoding a GDNFR protein can be inserted into a expression vector. By introducing the expression vector into an appropriate host, the desired GDNFR protein can be produced in large quantities. ≫ As further described herein, 'Available Most hosts / vectors reproduce nucleic acid sequences and / or produce GDNFR proteins. These include, but are not limited to, plastids, viruses, and insertional vectors, as well as prokaryotic and prionate hosts. Those skilled in the art can adapt host / vector systems that can reproduce Or express heterogeneous D n A to generate or express the sequence of the present invention. By such a recombination technique, the GDNFR protein of the present invention can be easily produced in commercial quantities with higher purity. Furthermore, those skilled in the art should know that, According to the specification, the novel nucleic acid sequence includes the degraded nucleic acid sequence encoding the GDNFR protein specified in the figure, and the gdnFR protein. The sequence of the variant and these nucleic acid sequences, which preferably hybridize to the complement of this nuclear defeating sequence under urgent hybridization conditions (see, Maniatis et al., Molecular Selection (Laboratory Handbook); Cold Spring Harbor Laboratory, Pages 387 to 389, 1982). An urgent hybridization condition is exemplified by hybridization in 4 XSSC at 62-67 ° C, followed by washing for 1 hour in 62 x 7sc at 62-6 7 ° C. Alternatively, Exemplary urgent hybridization conditions are hybridization in 45-55% formamidine, 4XSSC, 40-45 ° C. DNA sequence, which complements the GDNFR protein's complementary sequence under relaxed hybridization conditions, and encodes the GDNFR protein of the present invention It is also included here. Examples of such relaxed hybridization conditions are 4 5 _ 5 5. 4 XSSC or hybridization with 30-40% formamidine at 40-45 Ό. Please read the 5 notes on the back first Matter Binding 35- This paper is suitable for financial use_ 家 县 (CNS) Α4 · (21 () > < 297 公 楚 509696

Preparation of Polynucleotide Encoding GDNFR Based on the disclosure of the present invention, a nucleic acid sequence encoding a full-length GDNFR polypeptide or a segment thereof can be easily prepared or obtained in a variety of ways, including but not limited to, chemical synthesis, cDNA or genomic library screening 3. Performance library screening and / or PCR amplification of cDNA. These methods and others useful for the preparation of nucleic acid sequences are known in the art and described by, for example, Sambrok et al. (Molecular Selection: Laboratory Manual, Published in Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989), Ausubel, et al. (Current Experimental Projects in Molecular Biology, Project Experimental Press, 1994) & Berger and Kimmel (Methods in Enzymology: A Guide to Molecular Colonization Techniques, Volume 152, Academic Press Company , San Diego, California, 1987). A preferred nucleic acid sequence encoding () 1) 1 ^ 1711 is a mammalian sequence. Chemical synthesis of a nucleic acid sequence encoding a GDNFR protein can be achieved using methods known in the art, as described by Engels et al. (Angew.

Chem. Inti. Ed., 28: 716-734, 1989). These methods include the phosphoric acid triester, phosphoramidate, and phosphonium-phosphonate methods synthesized by nucleic acid sequences printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. The preferred method for such chemical synthesis is polymer-supported synthesis using standard phosphoramidate chemistry. Typically, the DNA encoding the desired polypeptide will be hundreds of base pairs (bP) or nucleotides long. Nucleic acid sequences larger than about 100 nucleotides can be synthesized in several sections using these methods. The segments can then be joined together to form a sequence that represents the full-length GDNFR polypeptide or portion thereof. Alternatively, a 'suitable nucleic acid sequence can be obtained by screening an appropriate cDNa library (ie, a library prepared from one or more tissue sources believed to express proteins) or a genomic library (a library prepared from' Total Genomic 101 ^ A '). The source of the cDNA library is typically a group of ______________________________ 36-This paper size applies to the Chinese National Standard (CNS) M specifications (210 X 297 Gongchu) 509696 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 34) Weaving, which is considered to represent GDNFR in an understandable amount. Typically, the source of a genomic bank is any tissue or group of tissues from a mammalian species, and it is believed that the gene encoding the GDNFR is fixed. This library can screen for the presence of GDNFR cDNA / genes, using 1 or more nucleic acid probes (such as oligonucleotides, cDNA or genomic DNA segments, based on the currently disclosed sequences ^), which will be selectively linked to GDNFR cDNA or genes Gene hybridization exists in the library. Probes typically used for such library screening often encode the GDNFR nucleic acid sequence from a plot of the same or similar species, and the library is prepared from its species. Alternatively, the probes can be degraded, such as Discussed here. Library screening is typically performed by annealing oligonucleotide probes or cDNA to selected colonies in the library, which, under urgent conditions, prevents non-specific binding but allows binding of those selected clones ( (Hybridization), the clones and probes or primers have a significant degree of homogeneity. Typical hybridization and cleaning conditions depend in part on the size of the cDNA or oligonucleotide probe (that is, the number of nucleotides), and whether to detect Needles are degraded. The possibility of obtaining colonies is also considered in the design of hybridization solutions (for example, whether cDNA or genomics are screened; if it is a cDNA library, the possibility of important cDNA is present in high amounts). Among them DNA Section When using (such as cDNA) as a probe, typical hybridization conditions include Ausubel et al., Editors, as previously explained. After hybridization, the library suction is washed under appropriate urgency, according to some factors such as probe size, The expected homogeneity of probes and colonies depends on the type of library screened, the number of colonies selected, and similar factors. Examples of urgent cleaning solutions (which are often of low ionic strength and used at very high temperatures) The system is as follows. One such urgent / cleaning solution is 0.015 Molar concentration NaCl, 0.005 Molar concentration NaCl and _-37- _: _ This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) ) (Please read the notes on the back before filling this page)

1T 509696 35 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (0.1% SDS at 5 5-65 ° C. Another such urgent buffer is 1 millimolar Na2EDTA , 40 mM NaHP04, pH 7.2, and 1% SDS at about 40-50 ° C. Other urgent cleaning solutions are 〇2 X ssc and 〇 ″ 〇 / 0 808 at about 50-65〇 (: There are also exemplified experimental plans for urgent cleaning conditions, in which oligonucleotides are used to screen cDNA or genomic libraries. For example, the first experimental plan uses 6 χ SSC, with 0.05% sodium pyrophosphate in about 35 to temp, depending on the length of the probe. For example, 14 salt-based probes are washed at 3 5-40 ° C, 17 salt-based probes are at 45-50 ° C, and 20 Base-based probes at 52-57 ° C and 23 base-based probes at 5 7-6 3 ° C. The temperature can be increased by 2-3 ° C when the background non-specific binding is obvious. Two The experiment plans to use gasified tetramethylammonium (TMAC). For cleaning. The urgent cleaning solution is 3 mol TMAC, 50 millimolar Tris_HC1, ρΗ 8.0 and 0.2% SDS. The other obtains a protein encoding GDNFR A suitable method for nucleic acid sequences is polymerase chain reaction (PCR). In this method, poly (a) + RNA or total RN A is extracted from tissues expressing GDNFR. CdNA is then prepared from RN A using enzyme reverse transcriptase (Ie RT-PCR). 2 primers, typically complementary to the two separate regions of the GDNFR cDNA (oligonucleotide), and then cDNa is added with a polymerase such as T aq polymerase, and the polymerase is between the 2 primers Amplify the cDNA region. When the selection method for preparing the nucleic acid sequence encoding the desired GDNFR protein requires the use of oligonucleotide primers or probes (such as PCR, cdNA, or genomic library screening), 'select the oligonucleotides used as probes or primers The sequence should be of appropriate length and clear enough to minimize the amount of non-specific binding, which will be used in the library-38-Thai paper standard to apply the Zhongguanjia Standard (CNS) A4 specification (21Qx297 public celebration) (please read the back of the first (Please fill in this page again)

509696 A7 B7 _ 5. Description of the invention () Occurs during screening or PCR amplification. The probe or primer sequence is often based on a retained or highly homogeneous sequence or region of a similar gene from the same or from another organism, such as a rat nucleic acid sequence related to the invention. Optionally, the probes or primers may be all or partly degraded, that is, a probe / primer-containing mixture, all encoding the same amino acid sequence, but using different codons. An alternative method of preparing degenerate probes is to place glycosides at some or all of these codon positions that vary by species. Oligonucleotide probes or primers can be prepared by the chemical synthesis method of DNA as described above. Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before filling this page). GDNFR proteins based on these nucleic acid sequences encoding GDNFR and their mutations or variant sequences are also expected to fall within the scope of the present invention. Mutated or mutated sequences include such sequences with one or more nucleotide substitutions, deletions, and / or insertions, compared to wild-type sequences and their performance in causing amino acid sequence variations, compared to wild-type amino acids sequence. In some cases, GDNFR amino acid mutants or variants of natural origin may exist because of the presence of natural dual gene mutations. GDNFR proteins based on mutants or variants of such natural origin are also within the scope of the present invention. The preparation of synthetic mutant sequences is also well known in the art, and is described, for example, in Wells et al. (Gene, 34: 315, 1985) and in Sambrook et al., As previously described. In some cases, it is desirable to prepare GDNFR from natural sources. Nucleic acid and / or amino acid variants. Nucleic acid variants (in which one or more nucleotides are designed to be different from wild-type or naturally-derived GDNFR) can be generated using site-directed mutations or PCR amplification, where the primers have the desired point mutations (see Sambrook et al., Supra and Ausubel et al., Supra, the description of mutation generation techniques). Chemical synthesis using the method described by Engels et al. As described above is also possible. 39- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 A7 B7 V. Description of the invention () Used to prepare such a variation body. Other methods known to those skilled in the art can also be used. Preferred nucleic acid variants are those with nucleotide substitutions that become codon preferences in host cells whose cell lines are used to recombinantly produce GDNFR. Other preferred variants are those encoding retention amino acid changes (e.g., where the charge or polarity of the amino acid branch of a natural source is not substantially changed by substitution of a different amino acid), compared to the wild type, and Those who are designed to create a novel glycosylation and / or acidification site on GDNFR, those who are designed to delete a existing glycosylation and / or phosphorylation site on GDNFR. Vector cDNA or genomic DNA encoding the desired GDNFR protein is inserted into the vector for further selection (amplification of DNA) or for expression. Suitable carriers are commercially available, or carriers may be specially constructed. Possible vectors include, but are not limited to, adherent plastids, plastids, or modified viruses, but the vector system must be compatible with the host cell of choice. Such vectors include, but are not limited to, phages such as lambda derivatives or plastids such as pBR322, pUC, or Bluescript® plastid derivatives (Stratagene, La Jolla, California). Recombinant molecules can be introduced into host cells by transformation, metastatic infection, infection, electrotransformation, or other known techniques. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back before filling this page) For example, the nucleic acid sequence encoding the GDNFR is inserted into a selection vector, which is used to transform, transfer infection or infect appropriate host cells , So that many copies of the nucleic acid sequence were generated. This can be accomplished by joining DNA segments to a selection vector, which has complementary bonded ends. If the complementary restriction site used to cleave DNA does not exist in the selection vector, the ends of the DNA molecules can be modified enzymatically. Can also / prove beneficial to incorporate restriction endonuclease cleavage site for polymerase-40-This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Preparation 509696 A7 B7 V. Description of the invention (38) " ~~ One 'chain reaction nucleotide primers to promote the insertion of the generated nucleic acid sequence into the vector. Alternatively, any desired site may be generated by linking a nucleotide sequence (linker) to the DNA end; such linked linkers may include specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences甞 Acid. In an alternative method, the cleavage vector and the gJdnfr-nucleic acid sequence may be modified by homopolymeric tailing. In a specific embodiment, the host cell is incorporated to isolate the GDNFR gene, CDNA or synthetic DNA sequence: t, iLDNA molecule transformation can generate multiple copies of the gene. Therefore, a large number of GDNFR-encoding nucleic acid sequences can be obtained from the recombinant DNA molecule from the growth transformant, from the transformant and, if necessary, the inserted gene is retrieved from the isolated recombinant DNA. The selection and construction of the appropriate vector will depend on whether it is used for dNA amplification or DNA expression 2) the size of the DNA to be inserted into the vector, and 3) the host cell to be transformed with the vector (eg, mammals, insects, yeast , Fungus, plant or bacterial cell). Each vector contains different components, depending on its function (amplification of DNA or expression of DNA) and its compatibility with the intended host cell. For DNA expression, the vector composition may include, but is not limited to, one or more of the following: an information sequence, a source of replication, one or more selected or marker genes, an enhancement element, a promoter gene, a transcription termination sequence, and the like. These ingredients can be obtained from natural sources or synthesized by known techniques. The vector of the present invention is accompanied by a nucleic acid sequence, which encodes an important GDNFR protein, and is operatively linked to one or more elements for amplification, performance control, slalom or similar operations, which can be guided, controlled or otherwise in selected host cells. Affects the amplification or performance of the nucleic acid sequence encoding GDNFR-. / The expression vector with the GDNFR nucleic acid sequence insert can be divided into 3 kinds of ordinary research-41- This paper size applies to Chinese National Standard (CNS) Α4ΐ $ Γ (210X297 public splash)-(Please read the precautions on the back before filling in this Page) Binding · Order 509696 A7 ______ B7 39 '~ ------ 5. Description of the invention () Research method identification: (a) DNA-DNA hybridization; (b) "marking, the presence or absence of gene function; And (〇 Insertion sequence expression. In the first research method, the presence of a nucleic acid sequence outside the insertion expression vector can be detected by DNA-DNA hybridization, using a probe that includes a sequence homologous to the insertion of a nucleic acid sequence encoding gdnfr. In 2nd research method > Recombinant vector / host system can be identified and selected based on certain " tags, presence or absence of gene function (e.g., 'thymidine kinase activity, resistance to antibiotics: transformation Phenotype, formation of a block in a baculovirus, etc.), caused by the insertion of a foreign nucleic acid sequence into a vector. For example, if a nucleic acid sequence encoding a GDNFRi is inserted into a marker gene sequence of a vector, a recombinant containing the GDNFR insert may Identification of the function of the marker gene. In the third research method, the recombinant expression vector can be identified by detecting the foreign protein product expressed by the recombinant nucleic acid sequence. Thus, the analysis can be based on the physical or function of the expressed GDNFR protein product. Properties, such as the binding of GDNFR protein to GDNF or antibodies that directly recognize GDNFR. The information sequence printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Information Economy can be a component of the carrier, or it can be part of the gdnfr DNA inserted into the carrier. The natural GDNFR DNA encodes a t-message sequence on the amine end of the protein, which is cleaved after translation of the protein to form a mature GDNFR protein. Included in the scope of the present invention are GDNFR polynucleotides with natural information sequences and natural The information sequence has been deleted and replaced with a heterogeneous information sequence of GDNFR polynucleic acid. The selected heterogeneous information sequence should be recognized and processed by the major host cell enzyme, ie, lysed. It is non-woven and processed from natural GDNFR information Sequence of prokaryotic host cell, information sequence is -42- (CNS) A4 specifications (21 × 297 mm)-'-'------ 509696 A7 B7 V. Description of the invention (40 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Enzyme, penicillinase, or thermostable endotoxin Η guide gene prokaryotic information sequence replacement. For yeast secretion, the natural GDNFR information sequence can be replaced by yeast invertase, alpha factor or acid phosphoesterase guide gene. In mammalian cell expression, natural information The sequence is satisfactory, although other mammalian information sequences may be suitable. * 0 Replication source expression and selection vectors typically include nucleic acid sequences that enable, physically, to replicate in one or more selected host cells. In a breeding vector, this sequence is typically one that enables the vector to independently replicate host chromosomal DNA, and includes a source of replication or an autonomously replicating sequence. Such sequences are well known for a variety of bacteria, yeast, and viruses. The replication source of plastid PBR322 is suitable for most gram-negative bacteria and different origins (such as SV40, polyoma, adenovirus, vsv or βv). It can be used as a breeding vector for mammalian cells. In general, components of the source of replication are not necessary for mammalian expression vectors (for example, SV40 sources are often used because they contain early promoter genes). Compliance gene expression and selection vectors may contain selection genes. This gene encodes a "marker," a protein that is necessary for the survival or growth of transformed host cells when grown in a selective medium. Host cells that are not transformed by the vector will not contain the selection gene, and therefore they will not remain in the Medium. Typical selection genes encode the following < protein *, which (a) confer resistance to antibiotics or other toxins, such as ampicillin, neomycin, methotrexate, or tetracycline; (b) supplemental nutrition Lack of, or (c) supplementation of important nutrients that cannot be obtained from the culture medium. Other selected genes can be used to enlarge the genes that will be expressed. Amplify them (please read the precautions on the back before filling out this page): binding · order -43 -

509696 A7 B7 V. Description of the invention (41) process, in which the gene lines that are in great demand to produce important growth proteins are repeatedly arranged in the chromosomes of successive generations of recombinant cells. Examples of suitable selectable markers for mammalian cells include dihydrofolate reductase (DHFR) and thymidine kinase. Mammal cell transformants are placed under selective pressure, which uniquely adjusts the residual selection pressure only by the presence of markers in the vector of the transformants to force the culture of the transformed cells under conditions in which the concentration of the selective agent in the medium is continuously changed This leads to amplification of both the selection gene and bN A encoding GDNFR. As a result, increased amounts of GDNFR were synthesized from amplified DNA. For example, cells transformed with the DHFR selection gene were first identified by culturing all the transformants in a culture medium, which contained methotrexate, a competitive antagonist of DHFR. A suitable host cell is a hamster ovary cell line that lacks DHFR activity when using wild-type DHFR (see, for example, Urlaub and Chain, Proc. Natl. Acad. Sci., USA., 77 (7): 4216-4220, 1980) . The transformed cells are then exposed to an increased amount of methotrexate. This results in the synthesis and coexistence of multiple copies of DHFR genes, multiple copies of other DNA present in the expression vector, such as the DNA encoding the GDNFR protein. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Startup Gene Economy (please read the notes on the back before filling out this page) The expression and breeding vectors of the present invention will typically contain a starter gene that is recognized and operationally recognized by the host organism Linked to a nucleic acid sequence encoding a GDNFR protein. The starter gene is an untranslated sequence, located upstream (5,) upstream of the start codon of the structural gene (usually within about 100 to 1000 bp), which controls the transcription and translation of special nucleic acid sequences, such as those encoding GDNFR. Promoter genes are traditionally classified into one of two categories, which can deflect promoter genes and constitute promoter genes. Defamable-the increase in the amount of the promoter-initiated genes from the DNA turns green, and the culture is under its control -44- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 A7 B7 V. Description of the invention ( 42 Some changes in conditions, such as the presence or absence of nutrients or temperature changes. The large number of promoter genes recognized by a variety of potential host cells is well known. These promoter genes are operably linked to DNA encoding GDNFR, Restriction enzyme digestion removes the promoter gene from the source DNA and inserts the desired promoter gene into the vector. The natural GDNFR spring gene sequence can be used to guide the amplification and / or performance of the GDNFR DNA. A homogeneous promoter gene line is preferred 'However, only Larger * transcription and higher yields in which it allows expression of the protein compared to natural promoter genes, and only if it is compatible with the host cell system selected for use. Promoter genes suitable for use with prokaryotic hosts include Lu-Ne Transcriptase and lactose promoter gene systems; alkaline phosphatase, tryptophan (trp) promoter gene systems; and hybrid promoter genes such as tac promoter genes. Others have been Known bacterial promoters are also suitable. Their nucleotide sequences have been published, allowing those skilled in the art to link them to the desired DNA sequence, using a linker or adapting as needed to provide any desired constraints Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs and suitable starter genes used by yeast hosts are also well known in the art. Yeast enhancement genes are advantageously used with yeast starter genes. Suitable starter genes used with mammalian host cells are well known And including those obtained from virus-derived genomes, such as polyoma virus, refractory poxvirus, adenovirus (such as adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, rasavirus, Hepatitis B virus and best simian virus 40 (sv40). Other suitable mammalian promoter genes include heterologous mammalian promoter genes, such as heat shock promoter genes and actin promoter genes. It may be used to produce GDNFR protein in CHO cells The promoter gene is SRa (see Takebe et al., Mol. Cell -45-

509696 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 ____B7 V. Description of Invention (43)

Biol., 8 (1): 466-472, 1988). A suitable expression vector is pDSRa2. The pDSRa2 plastid with the appropriate GDNFR cDNA can be filed with the joint and co-examined US Patent No. 501,904, filed on March 29, 1990 (see also European Patent Application No. 90305433, Publication No. EP 398 753 , Filed on May 18, 1990 and the method described in WO 90/14363 (1990)) has been consistently and substantially prepared, the disclosure of which is incorporated herein by reference. Additional promoter genes important for controlling GDNFR performance include, but are not limited to: SV40 early promoter genes (Bernoist and Chambon, Nature, 290 · 304-310, 1981); CMV promoter genes; at the 3 'long end of Rous sarcoma virus Promoter genes contained in repeats (Yamamoto et al., Cell, 2 2: 7 8 7-797 ^ 1980); blister therapy breast proteases kinase promoter (Wagner et al., Proc. Natl. Acad · Sci · USA ·, 78: 144-1445, 1981); metal sulphur. Plasma groups (Brinster et al., Nature, 296: 39-42, 1982); prokaryotic expression vectors such as the /?-Lactamase promoter gene (Villa-Kamaroff et al. Human, proc. Natl. Acad. Sci. USA ·, 75: 3727-3731, 1978); or tac promoter (DeBoer et al., Proc. Natl. Acad. Sci. USA ·, 80: 21-25, 1983). Also important is the following animal transcriptional control region, which exhibits tissue specificity and has been used to introduce foreign genes to animals: the elastase I gene control region, which is effective for pancreatic vesicle cells (Swift et al., Cell, 38: 639 -646, 1984; Ornitz et al., Cold Spring Harbor Symp. Quant. Biol. 50 · 339-409, 1986;

MacDonald, Hepatology, 7: 425-515, 1987); insulin gene control region, which is effective for pancreatic cells (Hanahan, Nature, 3 15: 115, / 122, 1985); immunoglobulin gene control region, which is effective Yu-Lymphoid-46- This paper size is applicable to China National Standard (CNS) A4 (210X29 < 7 mm) (Please read the precautions on the back before filling this page)-Pack. Order 509696 A7 B7 V. Description of the invention (44) Cells (Grosschedl et al. Cells, 38: 647-658, 1984;

Adames et al., Nature, 381: 533_538, 1985; Alexander et al., Mol. Cell. Biol., 7: 1436-1444, 1987); mouse breast tumor virus control region, which is effective for testicles, breasts, lymphoid and Obese cells (Leder et al., Cell 45: 485-495, 1986), albumin gene-controlling regions, which are effective for the liver (Pinkert et al., Genes and Development, 1: 268-276, 1987); α-fetal protein genes Control region is eliminated, which is effective for liver (Krumlauf et al., Mol. Cell. Biol., 5: 1639-1648, 1985; Hammer et al., Science, 235: 53-58, 1987); no 1 _antitrypsin gene Control area, which is effective for liver (Kelsey et al., Gene and Development, Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page) 1: 161_ 171, 1987), · Lu- Hemoglobin gene control region, which is effective for myeloid cells (Mogram et al., Nature, 315: 338-340, 1985; Kollias et al., Cells, 46 · 89-94, 1986); Myelin basic protein gene control Area, which is effective for oligodendritic cells in the brain (Readhead et al. Cell, 48: 703-712, 1987); Myosin light chain-2 gene control region, which is effective for structural muscles (Sani, Nature, 314: 283-286, 1985); and gonad body release hormone gene control Region, which is effective in the lower optic mound (Mason et al., Science, 234: 1372-1378, 1986 ". Enhancement element enhancement sequences can be inserted into the vector to increase the transcription of the DNA sequence encoding the GDNFR protein of the present invention by higher nuclear prokaryotes. The enhanced sequence is The cis-acting element of DNA, usually about 10-300 bp long, acts on the promoter to increase its / transcription effect. The enhancement sequence is relatively localized and position-independent. Its warp-47- This paper size applies to China National Standard (CNS) A4 specification (21 ×: 297 mm) 509696 A7 B7 V. Description of the invention (45 Now 5 and 3 of the transcription unit, and some enhancement sequences can be known from mammalian gene acquisition lines (for example, Hemoglobin, elastase, albumin, fetal protein, and insulin). Typically, however, autologous virus enhancement sequences will be used. SV40 enhancement sequences, E-cell virus early starter gene enhancement sequences. Sequences and adenoviral enhancement sequences are exemplified enhancement elements to activate prion promoter genes. Although the enhancement sequence can be joined to the vector at position 5 or 3 of the gdnfr DNA, its & type position is at the position of the self-starter gene 5 'up. Transcription termination The expression vectors used in prion-nucleated host cells (yeast, bacillus, insects, plants, animals, humans or nucleated cells from other multicellular organisms) will also contain sequences necessary to terminate transcription and stabilize mRNA. Such sequences are usually obtained from the untranslated regions of nucleus 01 or cDNA 5 and 3. These regions contain nuclear fragments such as polyadenylated fragments transcribed in the untranslated portion of the mRNA encoding GDNFR. 'Suitable components with one or more of the components listed above to be coded with the GDNFR < construction < construction are performed by standard joining techniques. The separated plastids or DNA segments are split, cut, and reconnected in the desired order to generate the desired plastid. Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. To confirm that the correct sequence has been constructed, the ligation mixture can be used to transfer E. coli and successful transformants can be selected by known techniques, such as the aforementioned amines homotetracycline or tetracycline resistance. The plastids of the autotransformants can then be prepared and analyzed by restriction endonuclease digestion and / or sequencing to confirm the existence of the desired construct. "Carrier" which provides the DNA encoding GDNFR in mammalian cells -48- This paper is suitable for Guancai County (CNS) A4 · (21Qx297 Public Thin 509696 Printed by A7, Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Description of the invention (46) The expression 'can also be used. Generally, transient expression is accompanied by the use of expression vectors, which can effectively replicate in host cells, allowing host cells to accumulate many copies of expression vectors' and thus synthesize high amounts of expression vectors. Transient expression systems include suitable expression vectors and host cells, allowing convenient positive identification of proteins encoded by the selected DNA, and quick screening of the desired biological or physiological properties of such proteins. Therefore, short-term expression of dates Lineages are particularly useful for identifying protein variants. ^ Selection and transformation of host cells Host cells (eg, bacteria, mammals, insects, yeast, or plant cells) transformed with nucleic acid sequences and used to express recombinant GDNFR proteins are also derived from this The invention provides that transformed host cells are cultured under appropriate conditions that permit expression of the nucleic acid sequence. A suitable host cell and selection Transformation, culture, amplification, screening and product produced and purified based methods well known in the art. See e.g.,

Gething and Sambrook, Nature, 293: 620-625 (1981), or alternatively, Kaufman et al., Mol. Cell. Biol., 5 (7): 1750-1759 (I985) or Howley et al., U.S. Patent No. No. 4,419,446. Additional examples Edge materials and methods are discussed here. The transformed host cells are cultured in a suitable medium and express the GDNFR protein and then optionally recovered, isolated, and purified from the medium (or from the cell, if expressed in a cell) by a suitable device known to those skilled in the art. Different host cells have the characteristics and specific mechanisms of protein translation and post-translational processing and modification (such as glycation, lysis). Appropriate cell lines or host systems can be selected to ensure the desired modification and processing of the foreign protein. '' For example, performance in bacterial systems can be used to produce unglycosylated core protein -49- ^ Zhang scale applicable to the Chinese National Standard (CNS) A4 specifications (21〇297297 mm) ------. -(Please read the notes on the back before filling this page), 1T -1¾ 509696 A7 B7 V. Description of the invention (47) Quality products. It can be used in yeast to produce glycosylated products. Performance in mammalian cells can be used to ensure the "natural" absence of heterogeneous GDNFR proteins. Furthermore, different vector / host performance systems can affect processing reactions, such as proteolytic cleavage to varying degrees. The suitable host cells for the selection and expression of the vectors disclosed herein are prokaryotic, yeast, or higher prion cells. Tritonic microorganisms such as filamentous fungi or yeast are suitable hosts for the expression of GDNFR proteins. Saccharomyces cerevisiae or Baker's Yeast is the most commonly used among lower triton host microorganisms, but most of the other genera, species, and strains are well known and commonly available. Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. Host cells used to express glycosylated GDNFR proteins are also derived from multicellular organisms. Such host cells have complex addition, engineering, and glycosylation activities. In principle, any higher triton nucleus cell culture can be used, regardless of whether the culture is accompanied by spinal or invertebrate cells, including plant and insect cells. Vertebrate cells are propagated in culture (tissue culture) as a well-known procedure. Examples of usable mammalian host cell lines include, but are not limited to, s V4 0 transformed monkey kidney C VI strain (COS 7), human embryo kidney strain (293 or sub-selected to grow in suspension culture of 293 cells), infant cells Cheek rat kidney cells and hamster ovary cells. Other suitable mammalian cell lines include, but are not limited to, HeLa, mouse 929 cells, Swiss-derived 3T3 strains, Balb_c or NIH mice, or H ak cheek rat cell lines. Suitable king cells also include prokaryotic cells. Prokaryotic host cells include, but are not limited to, bacterial cells such as Gram-negative or Gram-positive organisms, such as E. coli, Bacillus such as Bacillus subtilis, Pseudomonas such as Pseudomonas aeruginosa, Salmonella mucini . For example, different strains of Escherichia coli (for example, -50 μM scale appropriate financial _m ^ (cNs)) " Μ B7 invention description (48 Please read the precautions of the back © before you ^ 1 〇 Bu Cong a, DH1_MC) are well known as host cells in the field of biological women. Key strains of different strains and similar bacteria can also be used. It is better (host cells to produce GDNFR protein are bacterial cells (such as E. coli) and mammalian cells (such as hamster_nest cells, tadpole cells, etc.). Host cells are preferably infected by metastasis and expressed or colonized as described above Vector transformation and culture in traditional nutrient media. Culture can be modified locally to blame the promoter gene to select a transformant or amplify the gene encoding the desired sequence. Transfection infections and transformations are performed using standard techniques and are performed on Those skilled in the art are familiar with and appropriate selection of the host cells involved. For example, mammalian cells can be used without cell wall's acid feeding method. Electrotransformation, microinjection and other known techniques can also be used. Custom culture The transformed cells produced by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Host Cell Economy to produce the GDNFR protein of the present invention are cultured in a suitable medium. The medium can be supplemented with hormones and / or other growth factors (such as insulin, Ferritin or epidermal growth factor), salts (such as vaporized sodium, calcium, magnesium, and phosphate), buffers ( hEPES), nucleosides (such as adenosine and thymidine), antibiotics (such as gentamicin), trace elements (defined as inorganic compounds often present at final concentrations in the micromolar range), and glucose or other sources Other supplements can also be included at appropriate concentrations, as will be known to those skilled in the art. Suitable culture conditions such as temperature, pH, and similar conditions are suitable for those skilled in the art when used with selected host cells. Once known, GDNFR proteins are produced and can be separated and purified by standard methods, including chromatography (such as ion exchange, affinity, and particle size column chromatography), -51-this paper's Family Standard (CNS) A4 specification (BOX297 mm) 509696 Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (49) Standard technology of centrifugation, differential solubility, or any other purified protein. In particular, GDNFR protein can be bound by Separation to affinity columns that include GDNF or anti-GDNFR bound to the stationary phase. Homogeneous recombination Further conceivably, GDNFR proteins can be recombined homogeneously, or The preparation method uses a control element introduced into a cell that already contains DNA encoding GDNFR. For example, a homogeneous recombination method can be used to modify fine i, which contains a GDNFR gene that is quiet in transcription or under the expression gene and thus produces a cell that expresses GDNFR Homogeneous recombination is a technique that defame or corrects mutations in genes that are originally developed to be transcriptionally active in the target gene (Kucherlapati, Prog, in Nucl · Acid Res · and Mol · Biol ·, 36: 301, 1989). Basic techniques Developed to introduce specific mutations into specific regions of mammalian genomes (Thomas et al., Cell, 44 419-428, 1986; Thomas and Capecchi, Cell, 51: 503-512, 1987; Doetschman et al., Proc Natl. Acad. Sci., 85: 8583-8587, 1988) or to modify specific mutations in defective genes (Doetschman et al., Nature, 330: 576-578, 1987). Exemplary homogeneous recombination techniques are described in US Patent No. 5,272,071 (EP 91 90 3051, EP Publication No. 505 500; PCT / US 90/07642, International Publication No. WO 91/09955), the disclosures of which are incorporated herein by reference . After homologous recombination, the DNA sequence to be inserted into the genomic body can be directed to specific regions of important genes by linking it to the target DNA. The target DNA is DNA that is complementary (homogeneous) to the region of the gene DNA. Complementing specific regions of the genomic body ^ The patch-labeled DNA contacts the mother stock during the DNA replication process. Inserted -52- This paper size applies Chinese National Standard (CNS) A4 specification (210X297mm) (Please read the precautions on the back before filling this page) -1 · 509696 A7 B7 V. Description of the invention (50) The general nature of the DNA that enters the cell to hybridize is to recombine homogeneous regions shared with other endogenous DNA. If this complementary strand is an oligonucleotide containing mutations or different sequences of DNA, the result of recombination is also incorporated into the newly synthesized strand. As a result of the proofreading function, a novel DNA sequence may be used as a template. Therefore, the transferred DNA is incorporated into the genome. If the sequence of a particular gene is known, such as the pre-prototype or expression control sequence of the GDNFR expressed by the nucleic acid sequence, a DNA fragment complementary to the selected region of the gene may be synthesized, or other such as natural DNA in the binding Appropriate restrictions on the specific identification of important areas. This fragment is the target sequence when inserted into the cell and will hybridize with its homogeneous region within the gene. If this hybridization occurs during DNA replication, this piece of DNA and any additional sequences connected to it will be used as Okazaki Festival # and will be stitched back to the newly synthesized subunit DNA. 0 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. (Please read the notes on the back before filling out this page.) The DNA regions connected to these target DNA pieces are interactions with GDNFR protein expression. For example, a promoter / enhancement element, a repressor sequence, or an exogenous transcriptional regulatory element is inserted into the genome of a deliberate host cell at a point or location sufficient to affect transcription encoding the desired GDNFR protein. The control element does not encode GDNFR, but controls a portion of the DNA present in the host cell's genome. Therefore, the expression of the GDNFR protein can be achieved not only by the DNA transfer infection encoding the GDNFR gene itself, but also by using target DNA (having a region homogeneous with an important endogenous gene) coupled to a DNA regulatory fragment that provides transcription with GDNFR The endogenous gene sequence of a protein's identifiable information. A. GDNFR variant-53- This paper size applies Chinese National Standard (CNS) A4 specification (210 X 297 mm) 509696 Α7 Β7 5. Description of the invention (51) As discussed above, the term "" GDNFR analogue "is as As used herein, includes polypeptides in which amino acids have been deleted from ("deleted variants", insertions (" addition variants)) or substitutions (" substitution variants ") in natural sources of GDNFR polypeptides. Residues within the amino acid sequence, including those described in Figures 2 and 4 (SEQ ID Nos. 2 and 4). Such a mutation system is prepared by changing the appropriate nucleotide into the DNA encoding the polypeptide or by chemical synthesis of the desired polypeptide in a test tube. Many of the combinations known to those skilled in the art can be made on amino acid sequences such as mature human GDNFR, as long as the final molecule possesses GDNFR activity. Based on the GDNFR amino acid sequence printed on this manual by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, we can easily design and manufacture a variety of nucleic acid sequences suitable for recombinant (eg, microbial) expression polypeptides, which can be used in 1 or more residues. The essence or positioning of the base is different from the primary configuration described in the figure. Substitutions, insertions, or deletions of one or more selected amino acid residues encoded by the nucleic acid sequences described in Figures 2 and 4 are well known to those skilled in the art (for example, U.S. Patent No. 4,518,584, the disclosure of which is here (Incorporated for reference.) There are 2 main variables in constructing replacement variants: the location of the mutation site and the nature of the mutation. In designing GDNFR replacement variants, the choice of mutation site and the nature of the mutation will depend on the characteristics of the GDNFR to be modified. The mutation site can be modified individually or in series. For example, (1) the amino acid residue is modified first, and then more groups are selected for substitution according to the results achieved, (2) the target amino acid residue is deleted, or (3 ) Insert an amino acid residue adjacent to the site. Retention changes from 1 to 30 consecutive amino acids are preferred. & -C-terminal or C-terminal deletions of GDNFR protein variants can also be generated by proteolytic enzymes. —_ 54 · National Paper Standard (CNS) A4 size (ϋ 297 mm) of this paper ruler *---509696 A7 B7 V. Description of the invention (52 Printing bags of employees' cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

Deletion variants for GDNFR typically delete from about 1 to 30 consecutive residues, more often from about 1 to 10 consecutive residues, and typically from about 1 to 5 consecutive residues. N-terminal, C-terminal and internal sequence deletions were expected. Deletion of the region where the molecule can be introduced has a low non-human GDNFR homogeneity to modify the activity of GDNFR. Deletions in regions of substantially homogeneous non-human GDNFR sequences will more likely significantly modify GDNFR biological activity. Successive deletions will typically be selected to preserve the tertiary structure of the GDNFR protein product in the affected functional site, such as cysteine cross-linking. Non-limiting examples of deletion variants include truncated GDNFR protein products lacking N- or C-terminal amino acid residues. For example, we can prepare a soluble receptor that is immobilized to the peptide region of the cell membrane by eliminating the sugar-glycosylphosphatidylinositol (GPI) involved in the GDNFR receptor. GDNFR addition variants, amino acid sequence additions typically include N- and / or C-terminal fusions or terminal additions, with lengths ranging from 1 residue to polypeptides with one hundred or more residues, And internal or intermediate addition of mono or polyamino acid residues. The polypeptide of the present invention may also include the original methionine amino acid residue (at position -1 with respect to the first amino acid residue of the desired polypeptide). Internal additions typically range from about 1 to 10 consecutive residues, more typically from about 1 to 5 residues, and often from about 1 to 3 amino acid residues. Examples of N-terminal addition variants include GDNFRs containing heterogeneous N-terminal information sequences to N-terminal GDNFR to promote the secretion of mature GDNFR from recombinant host cells and thus promote adoption or bioavailability. Such information sequences are usually obtained from, and therefore homogenous to, the intended host cell species. Additions can also include amino acid sequences derived from sequences of other trophic factors. For example, it is expected that GDNF -55- this paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm)

Please read the notes on the back first, and then bind it to A7-B7 and 51. It is stated that (53) ~ 'and GDNFR fusion proteins can be produced, with or without binding sequences, and thus form a single-molecule therapeutic body. (Please read the notes on the back before filling this page.) GDNFR substitution variants have i or multiple amino acid residues in the GDNFR amino acid sequence removed and different residues inserted into their positions. Such replacement variants include dual gene variants which are characterized by changes in the nucleotide sequence of the natural source in the population ' which will or will not cause amino acid changes. Just as other variants are formed, substitutional variants are accompanied by the replacement of mono or continuous amino acid residues at one or more different positions. Specific mutations in the GDNFR amino acid sequence printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs may be accompanied by modification of glycosylation sites such as serine, threonine, or aspartic acid. Absence or only partial glycosylation of glycosylation arises from amine groups on any of the aspartate-linked glycosylation recognition sites or on any site of the molecule modified by the addition of 0-linked carbohydrates Acid substitution or deletion. The aspartate-linked glycosylation recognition site includes a dipeptide sequence ' which is specifically recognized by an appropriate cellular glycosylase. These tripeptide sequences are Asn-Xaa-Thr or Asn_Xaa-Ser, where Xaa can be any amino acid other than Pro. Multiple amino acid substitutions or deletions (and / or amino acid deletions at the second position) at one or both of the first or third amino acids at the glycosylation recognition site resulted in modification of the tripeptide sequence Non-glycosylated. Therefore, a suitably altered expression of the nucleotide sequence results in a variant that is not glycosylated at that site. Alternatively, the GDNFR amino acid sequence may be modified to add a glycosylation site. The method for identifying mutation generation of GDNFR amino acid residues or regions is called "alanine scanning mutation generation" as described by Cunningham and Wells (Science, / 244: 1081-1085, 1989). In this method, the amino acid of the target residue-56- This paper size applies to the Chinese National Standard (CNS) A4 (210 X 297 mm) 509696 A7 B7 V. Description of the invention (54) The residues or groups are Identification (eg, charged residues such as Arg, Asp, His, Lys, and Glu) and replacement with neutral or negatively charged amino acids (optimally alanine or polyalanine) to affect amino acids in cells Interaction of the water environment inside or outside. Functional sites that exhibit functional sensitivity to substitutions can then be refined by incorporating additional or alternative residues at the substitution site. Therefore, the target site of the amino acid sequence variation is determined, and alanine scanning or random mutation is performed on the relative winning codons or regions of the DNA sequence and shows the optimal combination of the desired activity and activity of the GDNFR variant. . The most important sites for substitution mutations include sites where the amine group seen in GDNFR proteins from different species is substantially different from the branch volume, charge, and / or hydrophobicity items. Other important sites are these, in which the special residues of GDNFR-like proteins obtained from different species are identical. Such a position is often important for the biological activity of the protein. Initially, these sites were replaced in a fairly reserved manner. Such reserved substitutions are shown in Table 2 under the preferred substitution heading. If such a substitution causes a change in biological activity, then more substantial changes (exemplified substitution) can be introduced, and / or other additions or deletions can be made, and the resulting product can be screened for activity. Printed by the Employees' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the notes on the back before filling this page) Table 2 Amino acid substitution Original residues Better substitutions Exemplary substitutions

Ala (A) Val Val; Leu; lie 'Arg (R) Lys Lys; Gin; Asn -57-' This paper size applies the Chinese National Standard (CNS) A4 specification (21 OX297 mm) 509696 A7 B7 V. Description of the invention (55)

Asn (N) Gin Gin; His; Lys; Arg Asp (D) Glu Glu Cys (C) Ser Ser Gln (Q) Asn Asn Glu (E) Asp Asp Gly (G) Pro Pro His (H) Arg Asn; Gin Lys; Arg Ile (I) Leu Leu; Val; Met; Ala; Phe; Leu (L) lie deleucine; lie; Val; Met; Ala; Phe Lys (K) Arg Arg; Gin ; Asn Met (M) Leu Leu; Phe; lie Phe (F) Leu Leu; Val; lie; Ala Pro (P) Gly Gly Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr Tyr Tyr ( Y) Phe Trp; Phe; Thr; Ser Val (V) Leu lie; Leu; Met; Phe; Ala; N-leucine The retention modification of the printed amino acid sequence (and the corresponding modification of the coding nucleic acid sequence) is expected to produce GDNFR protein products, with functional and chemical characteristics similar to those of GDNFR of natural origin. Conversely, substantial modification of the functional and / or chemical characteristics of GDNFR protein products can be achieved by selective substitution, which is significantly different from its role in maintaining (a) the peptide backbone in the region of substitution -58 · This paper applies Chinese national standards (CNS) A4 specification (210X297 mm) 509696 Printed by the Consumers 'Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs A7 ______ B7 V. Description of the structure of the invention (56)' For example, the layer or spiral configuration, (1)) The charge or hydrophobicity of the site 'or (C) the capacity of the branch. Residues of natural origin can be divided into the following groups based on the general branched nature: 1) Hydrophobicity: n-leucine, Met, Ala, Val, Leu, Ile; 2) Neutral hydrophilicity: Cys, Sei *, T "; 3) Acidic: Asp, Glu; 4) Verification · Asn, Gln, His, Lys, Ai * g; 5) Residues affecting chain localization: Oly, pro; and 6) Aromatic: Trp, Tyr Non-reserved substitutions of Phe 0 may accompany the exchange of members of one group with members of the other group. The residues thus substituted can be introduced into the region of the human GDNFR protein, which has the homogeneity of the non-human GDNFR protein, or the non Homogeneous regions. Therefore, GDNFR proteins, analogs, or derivatives thereof include, but are not limited to, biologically active molecules such as micrantha as primary amino acid sequences, containing all parts as shown in Figures 2 and 4 (SEQ ID Nos. 2 and 4) The amino acid sequence described in. Protein shells will include altered sequences in which biologically equivalent amino acids are substituted for residues within the sequence to cause quiet changes. For example, 1 or more amino acid residues within the sequence Can be substituted by another amino acid of similar polarity, which acts as a functional equivalent 'causing quietness The amino acid substitution in the sequence may be selected from other members of the group to which the amino acid belongs. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valerate Glycine, proline, amphetamine, tryptophan, and methionine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagus Amino acid and 'glutamic acid. Positively charged (basic) amino acids include arginine, lysine and group __-59-. This paper size applies Chinese National Standard (CNS) A4 specification (2 ^ 297 (Mm) --- (Please read the notes on the back before filling out this page): Packing, 1T ^ 09696 A7 B7 Printed by the Consumers' Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention () Amino acid. Negative charge (Acidic) amino acids include aspartic acid and glutamic acid. It is also expected that GDNFR proteins, analogs, or fragments or derivatives thereof can be phosphorylated, glycosylated, and cross-linked during or after translation. Linked, tritiated, proteolytically cleaved, linked to antibody molecules, membrane molecules or other ligands and modified differently., B GDNFR derivatives GDNFR and GDNFR analogues can be chemically modified and derived ^ can be prepared by those skilled in the art in accordance with the present invention. The chemical part most suitable for derivatization includes water-soluble polymers. Water-soluble polymers are desirable because they are The linked protein does not sink in an aqueous environment, such as a physiological environment. Preferably, the polymer will be pharmaceutically acceptable for the preparation of a therapeutic product or composition. Those skilled in the art will be able to select the desired polymer based on whether the polymer is / Protein co-consumables will be used therapeutically, and if so, the required dosage, circulation time, resistance to proteolysis, such as financial considerations and other considerations. The effectiveness of the derivative can be determined by administering the derivative in the desired form (for example, by an osmotic system or better by injection or perfusion, or by further formulating a donor, lung or other delivery route) and measuring its effectiveness. Suitable water-soluble polymers include, but are not limited to, polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, glucosan, vinyl alcohol, diethylene glycol pyrrolidone, poly-13 _Dioxin, poly- 丨 3 6-tri :: yuan, acetamidine / maleic acid liver copolymer, polyamino acid (homopolymer or random octamer), and glucosan or poly (n-ethyl) Stilbene)) polyethylene glycol, propylene: alcohol homopolymer, polypropylene oxide / ethylene oxide copolymer, polyoxyethylated (such as glycerol), polyethylene glycol and its Mixed liquid. Polyethylene glycol propionaldehyde -60- This paper is of the same size (CNS) A4 ^ ((Please read the precautions on the back before filling out this page)-Packing. Order 509696 Α7 Β7 V. Description of the invention (58) Tool manufacturing The advantage is because of its stability in water. The polymer can be of any molecular weight, and can be branched or unbranched. It is a polyethylene glycol. The preferred molecular weight is between about 2 kDa and about 100 kDa. Convenient handling and manufacturing (the word "about" indicates that in the preparation of polyethanol, some molecules will be heavier and some lower than the molecules ^). Other sizes can be used, depending on the profile of the desired treatment (for example, The duration of release to be continued; if sometimes, the effects of biological activity; ease of handling, the degree or lack of resistance and other known effects of polyethylene glycol in the treatment of proteins or variants). The number of linked polymer molecules will change, and those skilled in this art will fully influence the function of the moon. We can single-derived, or can provide two-, two-, four-derivatives or some combinations, with Same or different chemical moieties (e.g. poly (Such as polyethylene glycols of different weights). The ratio of polymer molecules to protein (or peptide) molecules will change, such as its concentration in the reaction mixture. Generally, the most appropriate ratio (in terms of reaction effectiveness, where the No excess of unreacted protein or polymer) will be determined by factors such as the desired degree of derivatization (eg mono-, di-, or tri-, etc.), the molecular weight of the selected polymer, whether the polymer is branched or unbranched and reacted Conditions. The polyethylene glycol molecules (or other chemical parts) printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs should be connected to the protein by considering the effects on the functional or antigenic functional parts of the protein. There are many connection methods for mastering this skill See, for example, EP 0401 384, the disclosure of which is incorporated herein by reference (coupling PEG to G_CSF), see also Malik et al.,

Exp. Hematol., 20: 1028-1035, 1992 (reported that GM-CSF was pinned with difluoroethanesulfonium gas). For example, polyethanol can be covalently bonded to amino residues __-61-i Paper size is applicable to Chinese National Standard (CNS) A4 size Υ7ι〇X 297 seam): --- 509696 A7 B7 OH ) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, via reactive groups such as free amine or carboxyl groups. Reactive groups are those to which these activated polyethylene glycol molecules can bind. The amino acid residue having a free amino group may include an lysine residue and an N-terminal amino acid residue. Those having a free carboxyl group may include aspartic acid residues, glutamic acid residues and. Amino acid residues. A hydrogen sulfide group can also be used as a reactive group for linking polyethylene glycol molecules. For therapeutic purposes, attachment to an amine group, such as to the N-terminus or lysine group, is preferred. Linking to important residues of the corpus callosum should be avoided when desired receptor binding is desired. We may specifically want N-terminally chemically modified proteins. The use of polyethylene glycol for the description of this composition, I am selected from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the ratio of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mixture, The type of pinning reaction to be performed and the method to obtain the selected N-terminal pinning protein week. The method of obtaining the N-terminal pinning preparation (i.e., separating this portion from other single-pinning portions when needed) can be purified from the N-terminal pinning material from the population of pinned protein molecules. Selective N-terminal chemical modification can be accomplished by reductive alkylation, which takes advantage of the different reactivity of different types of primary amino groups available in a particular protein (N-terminus from lysine). Under appropriate reaction conditions, a substantially selectively derivatized carbonyl-containing polymer of the protein at the N-terminus is achieved. For example, we can selectively pin the protein at the pH that benefits from the difference in pKa between oral amino acids and amino acids at the N-terminus of the protein. Perform the reaction. By such selective derivatization, the connection between water-falling polymers and proteins is controlled: the conjugate with the polymer is predominantly performed on the N-terminus of the protein and no significant modification of other reactive groups occurs, such as lysine branch Amine. Reductive alkylation, water-soluble polymerization

(Please read the precautions on the back before filling in this page) Binding and binding. 1¾ Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 509696 A7-«... ____B7_ cn I — — — — — --- — — V. Invention Note () can be of the above type and should have a single-reaction aldehyde coupled to the protein. Polyethylene glycol propionic acid, with a single reaction alcohol, can be used. The present invention contemplates the use of derivatives that are Gdnjtr or variants thereof that are prokaryotic, linked to at least one polyethylene glycol molecule, and GDNFR or variants that are linked to one or more polyethylene glycol molecules, via Alkyl or alkyl linkages. Pinning can be performed by any pinning reaction known in the art. See, for example: the focus is on growth factors, 3 (2) · 4_10, 1992; EP 0 154 316, the disclosure of which is incorporated herein by reference; EP 0401 384; and the related pegs cited here Other literature. Pinning can be carried out with tritiated or alkylated reactions with reactive polyethylene glycol molecules (or similar reactive water-soluble polymers). The pinning by acidification is usually accompanied by the reaction of an active ester derivative of polyethylene glycol (PEG) with a GDNFR protein or variant. Any known or later discovered reactive PEG molecule can be used for the pinning of GDNFR proteins or variants. A preferred activated PEG ester is PEG esterified with N-hydroxysuccinamide (nHS). As used herein, "halogenation" is intended to include, without limitation, the following types of linkages between therapeutic proteins and water-soluble polymers such as PEG: amines, carbamates, urethanes, and the like. See Bioconjugate Chemistry, 5: 133_140, 1994. The reaction conditions may be selected from any of those known in the art of pinning or such subsequent developers, but conditions such as temperature, solvent, and pH that would deactivate the GDNFR or variant to be modified should be avoided. Pinning by tritium usually results in many pinning GDNFR proteins or variants. Preferably, the linkage will be amidine. Also preferably, the resulting product " will essentially be (e.g.,> 95%) mono-, di-, or tri-pinned. However, with -63- This paper size applies Chinese National Standard (CNS) A4 specifications (210 parent 297 mm 1 '--- (Please read the precautions on the back before filling out this page) • Equipment · 509696 Central Standard of the Ministry of Economic Affairs Printed by the Consumer Cooperative of the Bureau A7 B7 V. Invention Description (61) Some species with higher pinning can be formed according to the amount of specific reaction conditions used. If desired, more purified pinned species can be separated from the mixture, Particularly unreacted species, by standard purification techniques including dialysis, salting out, ultrafiltration, ion exchange chromatography, colloidal filtration chromatography and electrophoresis among others. Pinning by alkylation is usually accompanied by PEG The terminal aldehyde derivative reacts with GDNFR protein shells or variants in the presence of a reducing agent. Pinning by tritiated can also cause multiple pinning of GDNFR proteins or variants. In addition, we can handle the reaction conditions to prefer the nailing of the substance Only on the a-amine group at the N-terminus of the GDNFR protein or variant (ie, single-pinned protein). In either case of single-pin or multiple-pin, the PEG group is preferably via the -CHrNH- group Linked to protein. In particular, reference is made to the -CHy group. This type of linkage is referred to herein as an "alkyl", linkage. Derivation by reductive alkylation to produce a single pinned product. Different types of primary amine groups available through derivatization Differential reactivity (N-terminus of lysine). The reaction is performed at a pH that allows us to benefit from the difference in pKa between the e-amino group of the lysine and the ^ amino group of the N-terminal residue of the protein. By Such selective derivatization controls the attachment of a water-soluble polymer containing a reactive group such as an aldehyde to a protein: conjugation with the polymer predominantly occurs on the N-terminus of the protein and significant modification of other reactive groups occurs, such as ionamine Acid branched amine group. In an important element, the present invention contemplates the use of a substantially homogeneous preparation of a monomer / GDNFR protein (or variant) co-molecule molecule (meaning that the polymer molecule is essentially only (ie > 95%) with a single-position linked protein or variant). More specifically, if polyethylene glycol is used, the present invention also covers the use of gdnfr (please read the precautions on the back before filling this page) )

509696 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs Α7 Β7 V. Description of the invention (62) Protein or variant lacks possible antigen-bonding groups and polyethylene glycol molecules with direct coupling to GDNFR protein or variant. Thus, a GDNFR protein product according to the present invention includes a pinned GDNFR protein or variant in which the PEG group is linked via a fluorenyl or alkyl group. As discussed above, 'such products can be single-pinned or multi-pinned (e.g., with 2-6 and preferably 2-5 PEG groups). The PEG group is usually attached to the protein on the a- or e-amino group of the amino acid, but it is also expected that the p E g group function can be attached to any amine group attached to the protein, which is sufficient under appropriate reaction conditions Reacts to become attached to a PEG group. The polymer molecules used in both the calcination and calcination research methods may be selected from among water-soluble polymers as described above. The selected polymer should be modified to have a single reactive group, such as a brewing activity or a burning route, preferably so that the degree of polymerization can be controlled as provided in this method. An exemplary reactive PEG aldehyde is polyethylene glycol propionic acid, which is water-stable or a mono-Ci_Cio alkoxy or aryloxy derivative (see US Patent No. 5,252,714). The polymer may be branched or unbranched. For tritiation, the polymer selected should have a single reactive ester group. For the purpose of reduction calcination, the selected polymer should have a single reactive aldehyde group. Often the ' water-soluble polymer will not be selected from sugar: y: group residues of natural origin, as it is often more conveniently made from mammalian recombinant expression systems. The polymer can be of any molecular weight and can be branched or unbranched. An exemplary water-soluble polymer used herein is polyethylene glycol. As used herein, polyethylene glycol refers to any form of p E G that has been used to derivatize other proteins, such as mono (C1-C10) alkoxy- or aryloxy-polyethylene glycol. '' In general, chemical derivatization can be used to react biologically active substances and activate poly ... ...... 65 Dimensions of this paper --- (Please read the precautions on the back before filling this page)

509696 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Description of the invention (3) Any suitable conditions for the compound molecules. The method for preparing a pinned GDNFR protein product will generally include the following steps: (a) GDNFR protein product and polyethylene glycol (such as a reactive ester or aldehyde derivative of PEG), whereby the protein becomes one or more PEG groups The reaction is carried out under the conditions of group bonding, and (b) a reaction product is obtained. In general, the optimum reaction conditions for the tritiation reaction will be determined on a case-by-case basis based on known parameters and the desired result. For example, the larger the p E g: protein ratio, the larger the percentage of the product that is pinned. _ Reductive alkylation of a monopolymer / GDNFR protein product that produces a substantially homogeneous population will generally include the following steps: (a) reacting a GDNFR protein or variant with a reactive PEG molecule under conditions of reductive alkylation, and Selectively modifying the pH of the amino group on the amino group end of the GDNFR protein or variant; and (b) obtaining a reaction product. Is a single polymer / GDNFR protein product of a substantially homogeneous population, and the reduction and calcination reaction conditions are these, which allow the water-soluble polymer moiety to be selectively connected to the N-terminus of the GDNFR protein or variant. Such reaction conditions are usually quite conducive to the difference in pKa between the lysine amino group and the a-amino group at the N-terminus (pKa is 50% of the amine matrix protonation and 50% of the absence of pH). pH also affects the ratio of polymer to protein used. Generally, if P Η is low, a polymer in excess of protein will be required (ie, the less reactive N-terminal a-amine group will require more polymers to achieve optimal conditions). At higher pH, the polymer: protein ratio need not be so large (ie, more reactive groups are available and therefore fewer polymer molecules are needed). For the purpose of the present invention, the pH generally falls within the range of 3-9 ', preferably 3-6. / Another important consideration is the molecular weight of the polymer. Generally, the higher polymer -66- this paper size is applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) I--~ (Please read the precautions on the back before filling this page): Pack-Order 6 9 6 9ο 5 A7 B7 V. Description of the invention (64) (Please read the precautions on the back before filling out this page) molecular weight, so fewer polymer molecules can be connected to the protein. Similarly, polymer branches should be considered when optimizing these variables. Generally, a higher molecular weight (or more branches) results in a higher polymer: protein ratio. Generally, for the pinning reaction expected here, the preferred average molecular weight is from about 2 kDa to about 100 kDa. A preferred average molecular weight is from about 5 kDa to about 50 kDa, particularly preferably from about 12 kDa to about 25 kDa. The ratio of water-soluble polymer to GDNF protein or variant usually ranges from 1: 1 to 100: 1, preferably (for multi-pinning) 1: 1 to 20: 1 and (for single-pinning) 1 : 1 to 5: 1. Printed using the conditions shown above by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economics, reductive alkylation will provide polymers with selective attachment to any GDNFR protein or variant with an a-amine group on the amine end, and provide a single polymer / Substantially homogeneous preparation of GDNFR protein (or variant) conjugates. The term "monopolymer / GDNFR protein (or variant) conjugate" is used herein to refer to a composition consisting of molecules that are linked to a GDNFR protein or a GDNFR variant protein by a single polymer molecule. Monopolymer / GDNFR protein (or variant) conjugates will typically have a polymer at the N-terminus rather than an amine branching group. Preparations are usually. More than 90% monopolymer / GDNFR protein (or variant) conjugates, and more often greater than 95% monopolymer / GDNFR protein (or variant) conjugates, while observable molecules The remainder is unreacted (ie, the protein lacking the polymer portion). It is also foreseen that GDNFR protein products can be accompanied by the preparation of pinning molecules, involving fusion proteins or .bonded GDNFR and GDNF molecules. · / For the purpose of reductive alkylation, the reducing agent should be stable and relatively stable in aqueous solution -67- This paper size is applicable to China National Standard (CNS) A4 (210X 297 mm) / c 9 6 09 5 A7 B7 V. Description of the invention (65 The Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs printed and reduced the Schiff base formed during the initial process of reductive alkylation. Suitable reducing agents can be selected from sodium borohydride, sodium cyanoborohydride, Dimethylamine borane, trimethylamine borane, and pyridylborane. A particularly suitable reducing agent is sodium cyanoborohydride. Other reaction parameters such as solvent, reaction time, temperature, etc. and the device for purifying the product can be based on relevant The published information of protein and water-soluble polymer derivatization is determined as usual (see publications cited herein). C. gDNFR protein product medical compounds · GDNFR protein product pharmaceutical compositions typically include a therapeutic or prophylactically effective amount of GDNFR The protein product is mixed with a variety of pharmaceutical and physiologically compatible formulations selected with the appropriateness of the mode of administration. Suitable formulations include, but are not limited to, antioxidants, preservatives, coloring , Flavors and diluents, emulsifiers, suspending agents, solvents, fillers, builder buffers, delivery vehicles, diluents, excipients and / or pharmaceutical adjuvants such as' the appropriate vehicle may be water for injection, Physiological saline solution or artificial cerebrospinal fluid can be supplemented with other common substances commonly used in parenteral compositions. Neutral buffered saline or saline mixed with serum albumin is a vehicle for further exemplification., A pharmaceutically acceptable carrier, or "physiologically acceptable" carrier, as used herein, refers to a substance suitable for the completion or enhancement of a wrist protein product (delivered as a formulation of a pharmaceutical composition. In a vehicle The main solvent can be aqueous or non-aqueous in nature. In addition, _ can contain other formulations to modify or maintain the pH, osmosis, dryness, clarity, sterility, stability, dissociation rate of the formulation Or = flavor. Similarly, the vehicle can contain additional formulations to modify or maintain the release rate of the protein product, or to promote protein production -68- This paper rule (CNS) (Please read the back first Precautions again Write this page)

* 1T-• ii 1 ------1-----Ifen · Printed A7 by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs s ^ _____57___ V. Description of the Invention (Qiu) The absorption of substances across the blood-brain barrier or penetration. -Once the pharmaceutical composition for treatment is formulated, it can be stored in sterile medicine bottles as solutions, suspensions, gels, emulsions, solids or dehydrated or freeze-dried powders. Such formulations can be stored in a ready-to-use form or in a form that requires reconstitution before application (e.g., freeze-drying). ^ The optimal pharmaceutical composition will be determined by those skilled in the art based on the intended route of administration and the desired dosage. See, for example, Remington's Medical Sciences' 18th Edition (1990, Mack Publishing Company, Easton, Pennsylvania 18040) pages 1435-1712, the disclosure of which is incorporated herein by reference reference. Such a composition can affect the physical state, stability, release rate in vivo and clearance rate in vivo of the protein and derivative. Effective application forms, such as (1) sustained release formulations, (2) inhaled aerosols, or (3) orally active, sexually formulated formulations are foreseeable. GDNFR protein product pharmaceutical compositions can also be formulated for parenteral administration. Such parenterally administered therapeutic compositions are typically in the form of pyrogen-free, parenterally acceptable aqueous solutions, including the GDNFR protein product in a pharmaceutically acceptable vehicle. A preferred vehicle is physiological saline. GDNFR protein product pharmaceutical compositions may also include granular preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or enter liposomes. Hyaluronic acid can also be used, and this can have a sustained role in promoting continued circulation. A particularly suitable vehicle for parenteral injection is sterile distilled water, and its * gdnfr protein product is formulated as a sterile, isotonic solution, which is suitably preserved. Yet another preparation can be accompanied by a formulation of GDNFR protein product and agents such as injectable microspheres or liposomes, which provide a slow or continuous release of the protein. However, -69-This paper size applies Chinese national standards CNS) A4 specification (2! 〇χ297 mm)

• Installation · (Please read the precautions on the back before filling out this page), 11 • · ... 2 1 I-—-1_ i Hi · A7 V. Description of the invention (67) and transfer it to the storage room for injection. Other suitable devices for introducing the gdnfr protein product include a portable drug delivery device containing a gdnfr substance. The preparation of the invention I may include other ingredients such as parenterally acceptable preservatives M, osmolytes, co-solvents, wetting agents, complexing agents, buffering agents, antimicrobial agents, antioxidants and surfactants, as in the art Well known. For example, suitable tonicity enhancers include alkali metal halides (| sodium or potassium vaporized gas), mannitol, sorbitol, and the like. Suitable preservatives include, but are not limited to, epicardial lice, thymosa, phenethyl alcohol, p = formic acid, propyl acetate, chlorohexidine (chl () rhexidine) , Sorbic acid and its analogs. Hydrogen peroxide can also be used as a preservative. Suitable co-solvents are, for example, glycerol, propylene glycol and polyethylene glycol. Suitable complexing agents are, for example, caffeine, polyvinylpyrrolidone, fluorene-cyclodextrin or hydroxypropylcyclodextrin. Suitable surfactants or humectants include sorbitan esters, polysorbates such as polysorbate 80, trimethylamine, lecithin, cholesterol, tyloxapai, and the like . The buffer may be a conventional buffer such as boric acid, citric acid, phosphoric acid, bicarbonate or Tris_Ha. Printed by the Economics and Consumers Cooperative of the Central Bureau of Standards. The ingredients of the formulation are present at an acceptable concentration at the application site. For example, a buffer is used to maintain the composition at a physiological pH or slightly lower pH, typically in a range from about 5 to about 8 p. The pharmaceutical composition can be formulated for inhalation. For example, GDNFR protein products can be formulated as inhaling dry powders. GDNFR protein f product inhalation solution can also be formulated for liquefied propellants for mist delivery. In yet another formulation, the solution may be in the form of a spray. -70- This paper size applies the Chinese National Standard (CNS) M specification (210 > < 297 mm) 509696 A7 B7 V. Description of the invention (68) It is also expected that certain formulations of GDNFR protein products are administered orally. GDNFR protein products administered in this form can be formulated with or without such carriers, such as lozenges and capsules, which are conventionally used in solid dosage form compounds. For example, capsules can be designed to release the active portion of the formulation at a point in the gastrointestinal tract with maximum bioavailability and minimal pre-systemic degradation. Additional formulation materials may be included to facilitate the absorption of the GDNFR protein product. Diluents, fragrances, low melting points, vegetable oils, lubricants, suspending agents, tablet disintegrating agents and binding agents can also be used. Another preparation may be accompanied by an effective amount of the GDNFR protein product in a mixture of non-toxic excipients suitable for preparing lozenges. Solutions can be prepared in unit dosage form by dissolving the lozenge in sterile water or other appropriate vehicle. Suitable excipients include, but are not limited to, inert diluents such as calcium carbonate, sodium carbonate or sodium bicarbonate, lactose or calcium phosphate; or binding agents such as starch, gelatin or gum arabic; or lubricants such as magnesium stearate, stearin Acid or talc. Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the notes on the back before filling this page) The additional GDNFR protein product formulations are obvious to those skilled in this art, including those involving the merger of GDNFR protein products and GDNF protein products Preparations. The deployment of a variety of other continuous or controlled delivery devices, such as liposome carriers, bioerodible particles or porous strains, and depot injections are also known to those skilled in the art. See, for example, Supersaxo et al., Transmitting a description of controlled release porous polymeric particles of a pharmaceutical composition (International Publication No. WO 93/15722; International Application No. PCT / US 93/00829), the disclosure of which is incorporated herein by reference. D. Application of GDNFR protein product, GDNFR protein product can be administered intestines, through a variety of routes, including skin-71-This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) ^ 509696 A7 B7 V. Invention Description (69) Intramuscular, intravenous, transpulmonary, percutaneous, intrathecal, and intracerebral transmission. In addition, protein factors that do not easily cross the blood-brain barrier can be given directly in the brain or otherwise linked to other elements that will transmit their factors through the barrier. For example, the GDNFR protein product can be administered intraventricularly or into the subarachnoid space of the brain or spinal hearing. The GDNFR protein product can also be administered directly to the cerebral jumbo tissue in the brain. The GDNFR protein product can be administered extra-brainly, which is chemically modified or packaged to pass through blood-brain barriers, or with one or more pairs that promote the penetration of GDNFR protein products across the barrier. For example, N GF and monoclonal antibodies against transfection The conjugate of the ferritin receptor antibody was shown to be transferred to the brain by binding to the transferrin receptor. To achieve the desired amount of GDNFR protein product, repeated daily or less frequent injections can be administered, or the GDNFR protein product Continuous or periodic perfusion from a constant or scheduled flow graft pump. Slow release implants with neurotrophic factors embedded in a biodegradable polymer matrix can also deliver GDNFR protein products. The frequency of dosage will depend on the GDNFR protein The product depends on the pharmacokinetic parameters and application route and location of the preparation. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) Regardless of the application method, the specific dosage can be based on weight, body Surface area or organ size calculations. Further calculations required to determine the appropriate therapeutic dose distinguish each of these formulations It is routinely made by those skilled in the art and within the scope of its routine duties. Appropriate dosages can be confirmed using appropriate dose-response data. Final dose therapy involves the treatment of a particular injury or condition. Practitioner's decision. Generally, the effective amount of the native GDNFR polypeptide will be determined by factors that consider various modifications and drug effects, such as age, status, weight, gender, and disease _ > 72-_ This paper standard applies Chinese National Standards (CNS) A4 specifications (210X297 mm) 509696 A7 B7 V. Description of the invention (7C)) ^ Human diet, severity of any infection, time of administration, and other clinical factors. See Remington. Medical Science, as previously, at 697-773 Page, hereby incorporated by reference. It is expected that if GDNFR is used to enhance the effect of GDNF, then the GDNFR dose is selected similar to that required for GDNF therapy; if GDNFR is used to antagonize the effect of GDNF, then the GDNFR dose should be several times the GDNF dose Dosage administration can be one or more times daily, or less, and can be combined with other compositions as described herein. It should be noted that the present invention is limited to the doses listed herein. It is envisaged that continuous administration or continuous delivery of the GDNFR protein product may be beneficial for a given treatment. Although continuous administration may be accomplished by a mechanical device, such as with an infusion pump, it is expected that other modes of continuous or near-continuous administration may be implemented. For example, chemical Derivatization or encapsulation can result in a sustained release form of the protein, which has a continuous presence in the blood vessels in predictable amounts based on the determined dose therapy. Therefore, GDNFR protein products include derivatization or other formulations to accomplish this Applied protein. GDNFR protein product in continuous release form will be formulated to provide the required daily or weekly effective dose. Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page) ) It is further expected that the GDNFR protein product may be administered in combination with GDNF. Alternatively, the GDNFR and GDNF protein products may be administered separately, serially, or simultaneously. The GDNFR protein product of the present invention can also be used alone or in combination with other growth factors to treat neurological diseases. In addition, other molecules or other molecules, including chemical compositions, can be used with GDNFR protein products. · In the treatment of Barking / Sheng's disease, the GDNFR protein product is expected to be used alone or in combination with -73- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 A7 B7 V. Description of the invention (71) In combination with administration of levodopa, GDNFR enhances the activity of endogenous GDNF and thus enhances neuron uptake that increases dopamine concentration. As mentioned above, it is also expected that additional neurotrophic or neurotrophic factors may be used or necessary to treat some neuronal cell populations or some types of injuries or diseases. Other factors that can be used in combination with GDNFR or a combination of GDNFR and GDNF include, but are not limited to: mitogens such as insulin, insulin-like growth factor, epidermal growth factor, vascular 4-growth factor, pituitary adenylate cyclization Enzyme-activated peptides, inhibitors of interferon and growth hormone release; neurotrophic factors such as nerve growth factor, brain-derived neurotrophic factor, neurotrophin-3, neurotrophin _ 4/5, neurotrophin-6, insulin-like growth Factor, ciliary neurotrophic factor, acidic or basic fibroblast growth factor, fibroblast growth factor-5, transformed growth factor- / ?, cocaine amphetamine-regulated transcript (CART); and Other growth factors such as epidermal growth factor, leukemia inhibitory factor, interleukin, interferon, and community stimulating factor; and molecules or substances with functional equivalents of these factors. GDNFR protein product cell therapy and gene therapy Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) GDNFR protein product cell therapy, such as cells that produce GDNFR protein products As expected. This embodiment should be accompanied by implantation into a patient of cells capable of synthesizing and secreting a biologically active form of the GDNFR protein product. Such GDNFR protein product-producing cells may be natural producers of GDNFR protein products or may be recombinant cells, and their ability to produce GDNFR protein products has been increased by the gene transformation / shape of the desired GDNFR protein product. This modification can be adapted to transmit genes and promote its performance. -74- This paper size is applicable to China National Standard (CNS) A4 (210 X 297 mm) 509696 Printed by A7 _B7_ 五Explanation of the invention (72) The secreted vector is completed. With a view to minimizing a potential immune response in patients to which a GDNFR protein product of a foreign species is to be administered, the natural cells that produce the GDNFR protein product are preferably human-derived and produce human GDNFR protein products. Likewise, the recombinant cell that produces the GDNFR protein product is preferably transformed with a expression vector having a + gene encoding the human GDNFR protein product. Implanted cells can be embedded to prevent infiltration of surrounding cells. Human or non-human animal cells can be implanted into patients with biocompatible, semi-permeable polymer envelopes or membranes, which allow the release of GDNFR protein products, but it prevents cells from being harmed by the patient's immune system or by other tissues from surrounding tissues The destruction of factors. Alternatively, the patient's own cells, which are transformed to produce GDNFR protein products in vitro, can be implanted directly into the patient without such embedding. The technique of embedding living cells is familiar to those skilled in the art, and the preparation of the embedding cells and their implantation can be completed by patients without undue experimentation. For example, Baetge et al. (International Publication No. WO / 95/05452; International Application No. PCT / US 94/09299, the disclosure of which is incorporated herein by reference) describes biocompatible capsules, genetically engineered cells to be effective Deliver bioactive molecules. See also U.S. Patent Nos. 4,892,53 8, 5,011,472, and 5,106,627, each of which is specifically incorporated herein by reference. A system for embedding living cells is described in PCT application WO 91/10425 by Aebischer et al., Which is specifically incorporated herein by reference. See also PCT application WO 91/10470 by Aebischer et al., Winn et al., Exper, Neurol., 113: 322-329, 1991; Aebischer et al., Exper, Neurol., 111: 269-275, 1991; Tresco et al. Human, ASAIO, 38: 17-23, 1992, each of which is hereby / specifically incorporated by reference. — -75- This paper size is applicable to China National Standard (CNS) A4 (210X297mm) (Please read the precautions on the back before filling out this page)-Binding · Order 4 Printed by the Central Consumers Association of the Ministry of Economic Affairs and Consumer Cooperatives System 509696 A7 —______ B7 jrt '--------—_____________ V. Description of the invention () Gene therapy in vivo or in test tubes that deliver GDNFR protein products is also visible. Gene therapy in a test tube can be accomplished by introducing a gene encoding the gdnfr protein product into the target cell, by injecting the nucleic acid construct or other appropriate delivery vector locally. (Hefti, J. Neurobiol., 25: 1418-1435, 1994). For example, a nucleic acid sequence encoding a ^ 1 ^ protein ^ product may be included in an adeno-associated viral vector for delivery to a target cell (eg, Johnsoon, International Publication No. WO 95/34670 ·, International Application pCT / us 95 / 〇7178, whose disclosure is incorporated herein by reference). Alternative viral vectors include, but are not limited to, retroviruses, adenoviruses, herpes simplex virus, and papilloma virus vectors. Physical transfer, where appropriate in vivo or in vitro, can also be mediated by liposome-mediated transfer, direct injection (naked DNA), receptor-mediated transfer (ligand-DNA complex), electrotransformation, calcium phosphate precipitation, or Particle Shock (Gene Gun) Reached. It is also expected that gene therapy or cell therapy of GDNFR protein products may further include delivery of GDNF protein products. For example, the host cell can be modified to express and release both the GDNFR protein product and the gdNF protein product. Alternatively, GDNFR and GONF protein products may be expressed as released from separate cells. Such cells can be introduced separately into the patient or the cells can be contained in a single implantable device, such as the embedding membrane described above. It should be noted that the GDNFR protein product formulations described herein may be used in veterinary as well as human applications and the term " patient " should not be construed in a limiting manner. In the case of veterinary applications, the dosage range can be determined as described above. Example / Example 1 -76㈣ The standard size of the financial institution (CNS) A4 (210x297 mm) '--- 1 (Please read the precautions on the back before filling this page) • Binding · Order 509696 A7 B7 V. Description of the invention (74) Identification of cells exhibiting high affinity GDNF binding sites shows that colonies are accompanied by selection of the mRNA source, which appears to contain a significant amount of the target transcript. Retinal photoreceptor cells have been identified to be responsive to very low concentrations of GDNF 'suggesting the presence of functional hydrazone affinity. To ensure that rat photoreceptor cells did not exhibit high affinity receptors for GDNF, [1 2 5 j] GDNF binding and photographic emulsion analysis were performed. Rat retinal cell culture ^ Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) 5-day-old C57B1 / 6 mice or 3-day-old Sprague-Dawley rats (Jack Bioreactor Laboratories, Bar Harbor, MA) carefully removed and dissected the un pigmented epithelial cells, cut into 1 mm square sections and placed in ice-cold phosphate buffered saline (PBS). The retina was then transferred to 10 ml of Hank's balanced salt solution (HBSS) with 120 units of papain and 2000 units of DNase, and cultured in a rotary plate shaker at about 200 rpm for 20 minutes at 37 ° C . The cells were then crushed and dispersed by a fire-polished Pasteur pipette, sieved through a 20 micron Nitex nylon sieve and centrifuged at 200 x g for 5 minutes. The resulting cell sheet was then introduced into HBSS with 1% ovalbumin and 500 units of DNase. The upper layer was centrifuged at 4% ovalbumin solution (in HBSS) for 10 minutes at 500 x g. The final piece was resuspended in complete medium (see below), adjusted to approximately 15,000 cells / ml and seeded in a tissue culture plate at 90 microliters, coated with polyguanine and laminin as previously described ( Louis et al., Journal of Pharmacology and Experimental Therapy, 262, 1274-1283, 1992) The culture medium contains Dulbecco's modified Eagle's medium (DMEM) and F12 medium 1: 1 Mixing liquid and supplement · 2.5% 'Heat deactivated horse serum (Hyclone, Logan, Utah), B 2 7 medium-77- * This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention () Supplement (GIBCO, Hiroshima, New York State), D_glucose (final concentration: 5 mg / ml), L-glutamine Final concentration (2 millimolar concentration), 20 mol concentration HEPES, bovine insulin and human transferrin (final concentrations: 25 and 0.1 mg / ml, respectively). Immunocytochemical identification of photoreceptors ^ The light k crude line was identified by immunostaining 4 as arrestjn, a rod-specific antigen. The photoreceptor culture was fixed with tritium paraformaldehyde in PBS, pH 7.4 for 30 minutes at room temperature, and then washed three times in PBS. The immobilized I culture was then cultured in ultra-blocking buffer (Pearl, Rockford, Illinois) containing 1% Nonidet P_40 to increase antibody penetration. Anti-retinin antibody (several rabbit antibodies against synthetic peptide sequence of detentionin: Val_

Phe-Glu-Glu-Phe-Ala-Arg-Gln-Asn-Leu-Lys-Cys) was then applied in the same buffer at a dilution of j ·· 2000, and the culture was incubated at 37T: Incubate in a rotary shaker for 1 hour. After 3 washings with pBSi, the cultures were incubated with goat anti-rabbit IgG (Vectastain kit, self-loaded to isointestine, Buriingame, California) at 37 ° C for 1 hour at a dilution of 5 · ⑼. After 3 washes in PBS, the secondary antibodies were then labeled with the foot avidin_biotin_peroxidase complex diluted at ι: 500 (45 minutes at 37 ° C). After 3 more washes in PBS, the labeled cell culture was reacted for 5-20 minutes in a solution of ο · mol molar concentration of d-HC1, pH 74, with 0.04% 3,3, _diamine Benzidine_ (HC1) 4, 0,06%, 12 and 0.02% chlorine peroxide. Based on the immunoreactivity of detainin, approximately 90% of the cells in culture are rod photoreceptors. Residual photoreceptors are cultures stained with detainin at 200X (please read the precautions on the back before filling this page)

509696 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (76) Big _ ^ Inspection and determination. The number of detainin-positive photoreceptors was counted in a 1 x 6 mm diameter bar, representing approximately 20% of the total surface area of 6 mm. The characteristics of living light receptors are normal-shaped cell bodies, which often resemble short axis processes. Photoreceptors showing degenerate h, such as neurites with irregular, vacuolated outer nucleus or nodule, were excluded from counting (most degenerate ‘receptors, however, separated from the lower layer of the culture). Cell number or cell number / 6_mm #. Cultured rat photoreceptor-enhanced rat retinal cells (10, 00 & 6/6 mm #) Recombinant human GDNF (range from 10 μg / ml to i picogram / ml is a full 10-fold series Dilution) processing. The cultures were fixed and immunostained after 6 days with respect to retin, a photoreceptor-specific antigen. In cultures not treated with GDNF, the number of photocarcasses continued to decrease over time, reaching approximately 25% of the original number after 6 days in the culture. The culture was treated with GDNF for 6 days in the culture, and the number of viretin-positive photoreceptors was approximately doubled. The effect of gDNF is about 200 picograms / ml, and ED5g is about 30 picograms / g. In addition to promoting the survival of photoreceptors, the addition of GDNF also stimulates the prolongation of its axon-like process, thus exhibiting the effect on the morphological development of photoreceptors (referring to the length of photoreceptor neurites in GDNF · 68 microns, compared to "Soil" micrometers in control group cultures). In order to confirm that rat retinal cells showed high affinity gdnf receptors, [1] GDNF binding and photographic emulsion analysis were performed. Postpartum rat photoreceptor cells were seeded in plastic sheet flasks (Nunc) at a density of 2800 cells / mm 2 and performed 3 to 4 days before the experiment. Cells were washed once with ice-cold washing buffer (Dabco's Modified Eiger's Medium (DMEM), containing 25 亳 mole N-2-hydroxyethylhexahydropyridine_N, _2_acetic acid (hEPES ), ------ · 1 pack— (Please read the precautions on the back before filling in this page) Order d -79- K paper size applies Chinese National Standard (CNS) A4 specification (210 × 297 mm) I- = I — 509696 A7 B7 printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (77) pH 7.5). For competitive binding, cells were also bound with [125I] GDNF in binding buffer (DMEM, containing 25 mM HEPES, pH 7.5, and 2 mg / ml bovine serum albumin (BSA)) at 500 mM. Incubate at 4 ° C for 4 hours in the presence or absence of unlabeled GDNF. Cells were washed 4 times with ice-cold washing buffer, dissociated in 1 molar NaOH and the cell-related radioactivity was measured in a 7 * counter. A significant amount of binding to photoreceptor cells [1 2 51] GDNF is even at low ligand concentrations (down to 30 picomolar concentrations), and this binding is completely inhibited by the presence of excess unlabeled GDNF. For photographic emulsion detection, cells were incubated with 50 picomolar concentration of [125I] GDNF in binding buffer at 500 nanomolar concentration without the presence or absence of GDNF for 4 hours at 4 ° C. Cells were washed 6 times with ice-cold washing buffer, fixed with 2.5% glutaraldehyde, and continuously dehydrated with 50% and 70% ethanol, and immersed in N TB-2 photographic emulsion (Eastman Kodak, Rochester, New York state). After 5 days of exposure, the slides were unrolled and inspected. The analysis of the photographic emulsion revealed the correlation between [1 2 51] GDNF and some photoreceptor cells, thus pointing out the existence of GDNF receptors. However, this correlation is effectively blocked by unlabeled GDNF. Example 2 Performance of GDNFR from photoreceptor cells Colonized rat photoreceptor cells have been selected as a possible source of high affinity receptors for GDNF, and GDNF binding and their ability to recognize very low concentrations of ligands are based on their cell surface radiation The reaction capacity is as described in Example 1. With a view to identifying the receptors, the size of the cDNA library selected for approximately 50,000 independent colonies uses a mammalian / like expression vector (derivatives of pSR, Takebe et al., 1988, supra) and -80- This paper size applies Chinese national standards (CNS) A4 size (210 X 297 mm) (Please read the precautions on the back before filling this page)

509696 A7 B7 V. Description of the invention (78) The mRNA isolated from the photoreceptor cells of the postpartum rats was constructed by the following method. The gene bank is divided into approximately 1,500 to 2,000 independent colony pools and screened using established performance selection research methods (Gearing et al., EMBO Journal, 8, 3667-3676, 1989). The plastid DNA of each pool representing the gene bank was prepared and transformed into COS7 cells (Nunc, Naperville, Yilizhou) grown in plastic microflask flasks. The transferred infected cells were treated with [125I] GDNF, fixed with glutaraldehyde, dehydrated and immersed in irradiated emulsion for autoradiography. After 5 days of exposure, the slides were unrolled and examined for the presence of cells covered by silver particles, which indicated that the cells exhibited GDNF receptors [1 2 51] the binding of GDNF to the cell surface. [125I] EGF-treated EGF-transfected cell lines were used as the positive control group. · Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page). One of the 27 pools (F 8-1 1) screened in this way showed 19 positive cells after metastasis infection. . Therefore, a single cDNA library pool was identified that contained cDNA clones expressing GDNFR. This pool was divided into 60 subgroups of less than 100 colonies / pools, which were re-screened by the same procedure described above. Five of these pools were identified as positive and two of the five pools were further subdivided to produce single colonies responsible for GDNF binding. Transfer of plastid DNA from single colonies to COS 7 cells resulted in [1 2 51] GDNF binding to approximately 15% of cells. This binding is specifically inhibited by an excess of unlabeled GDNF competition. Construction of performance cDNA library Rat retinal cells were harvested from the rats 3-7 days after delivery and seeded at a density of about 5700 cells / mm squared to culture dishes coated with laminin and polyguanine. After 3-4 days in the culture, the population is estimated to contain about 80% of the photoreceptor fine -81-This paper size applies to the Chinese National Standard (CNS) A4 specification (210X29 * / mm) 509696 Staff Consumption of the Central Bureau of Standards Cooperatives printed A7 B7 V. Description of invention (79) cells. Total RNA was prepared from this culture by standard methods, and poly A + RNA was purified using a poly A kit (promega, Medison, Wisconsin). The cDNA library was constructed from rat photoreceptor poly A + RNA using the Gibco superscript selection system (Gibco / BRL, Gaithersburg, Maryland). 2 micrograms of poly A + RNA was mixed with 50 nanograms of random hexamers, heated to 7 (rCl0 minutes and then quickly cooled in ice. 1st strand synthesis and 400 units superscript 11 r τ at 3 7 C It is performed for 1 hour. The second strand is synthesized after adding dNTPs, 10 units of E. coli ligase, 40 units of E. coli DNa polymerase I, and 2 units of E. coli RNase in the same test tube. After 2 hours, the cDNA end was inactivated by 10 units of T4 polymerase at 16 ° C for another 5 minutes. Then isopropyl alcohol was precipitated, the EcoRI colony site was added with cdNA, and 10 μg of terminal phosphorylated EcoRI took over the oligonucleotide Connect overnight.

EcoRI-mediated coonA was then phosphorylated and applied to a Sephacryl S-500 HR particle size separation column. After loading, the column was washed with 100 μl of ten buffer (10 mM Tris-HC1, pH 7.5, 0.1 mM EDTA, 25 mM NaCl) and collected in 30 μL. liquid. Divisions 6 to 8 contain about 34 nanograms of high molecular weight cDNA and are concentrated and precipitated. The recovered EcoRI-tuned cDNA was ligated with 50 nanograms of EcoRI cleavage vector PBJ5 overnight. An amount of about 15 nanograms of cDNA ligation mix was transformed into competent cells by electrotransformation (E. coli strain DH10B; GIBCO / BRL 'Gaithersburg, Maryland). The transformed mixture was titrated and 27 Amp / LB plates were coated at a density of 1500 colonies / plate. The colonies were scraped from each plate and collected to 10 ml of Luria culture medium (LB) to make 27 pools each of '1500 independent colonies. Some cells from each pool are frozen in glycerol. __-82-__ This paper size applies the Chinese National Standard (CNS) A4 (210X297 mm) (please read the precautions on the back before filling this page); Book and order 509696 Ministry of Economic Affairs Printed by the Central Bureau of Standards Consumer Cooperative A7 B7 V. Description of Invention () and the rest are used to isolate plastid DNA, using Qiagen Tip-500 Kit (Qiagen, Chatsworth, California). C 0 S cell metastasis infection and photographic emulsion analysis. COS7 cells were seeded one day before metastasis infection (220,000 cells / slice) in a plastic tablet flask coated with ProNectin (10 μg / ml in phosphate buffered saline (PBS)) ( Nunc). To transfer infection, 700 μl of light MEMI (GIBCO / BRL, Gaithersburg, Maryland) with 2 μg of cDNA and 35 μl of DEAE glucosan solution (10 g / ml, Sigma 'St. Louis, Missouri) ) Gently mix in an Eppendorf tube. Cells were washed twice with P B S and incubated with metastatic infection mixture at 3 71 at 5% CO 2 for 30 minutes. After incubation, 3 ml of DMEM medium with 10% bovine fetal serum (FCS) and 80 nanomolar Chloroquine (Sigma, St. Louis, Missouri) was added to each bottle. The cells were further cultured for 3.5 hours with 100 /. Dimethyl sulfene was shocked in DMEM for 2 minutes at room temperature, washed once with PBS, and allowed to grow in 0% 01% with 10%? € 8. After 48 hours, transfer the infected cells (0087 cells to ice-cold wash buffer (DMEM, 25 mM HEPES, pH 7.5) once and wash them at 50 picomolar concentration [1 2 51] GDNF Supplemented with ice-cold binding buffer (DMEM, 25 mM HEPES, pH 7.5, and 2 mg / φL BSA) and cultured at 4 ° C for 4 hours. Cells were washed 6 times in ice-cold washing buffer and 2.5 % Glutaraldehyde was fixed at room temperature for 5 minutes, continuously dehydrated with 50% and 70% ethanol and then immersed in NTB-2 photographic emulsion (Eastman Kodak). Exposure to dark for 4-5 days at 4 ° C Afterwards, the slides were opened and screened by light-field and dark-field microscopes. __-83 · This G long-range standard for financially appropriate households (CNS) 8 secrets (21GX297 Gongjun 1 ^-(Please read the back Note: Please fill in this page again)-Packing. Order 509696 A7 ______B7 V. Description of the invention (81) The secondary cell of the positive cell is determined by the furnace, which contains the putative GDNF receptor colony. From this tank, the turtle body is selected by 100 The density of each colony / plate was spread on 60 plates. Cells were scraped from each plate, collected in LB and allowed to grow at 37 ° C for 4-5 hours. Freezing The DNA and DNA preparations were prepared from each pool as before, and 60 pools of 100 independent colonies were generated. Two groups of these 60 pools were identified as positive by the methods described above and from these pools. The colonies were plated with low density to allow the separation of a single community. A single community (384) was selected in 2 sub-pools and grown in a plate of 90 # in 200 microliters of lb. In order to select a single community showing GDNFR, 4 Each 96 # plate was arranged into a single large matrix with 16 rows and 24 columns. The cells from # were combined in each row and column to generate a total of 40 mixtures. These mixtures were mixed in 10 ml LB / Amp (100 (G / ml) overnight, and DNA preparation of Qiagen tip-20 set. When analyzing putative gdnF receptor colonies, 3 mixtures and 3 columns of mixtures were given positive information, and 9 potential positives were suggested. Colonies. Dn A from each potentially positive single colony was prepared and digested with EcoRI and PstI. Three DNAs from nine single colonies showed the same restriction pattern, while the other were unrelated. Recommendation 3 Represented reliable colonies with GDNFR. Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (Please read the notes on the back before filling this page) Example 3 DNA sequencing and sequence analysis DNA from self-positive single colonies was prepared and used an automated aBI 373A DNA sequencer (Perkin / Elmer Applied Biological System, Shan The Santa Clara, California) and dideoxy dye termination sequences were sequenced according to the manufacturer's instructions. Comparison of GDNF receptor sequences with all available public databases makes -84- This paper size applies to Chinese National Standard (CNS) A4 specification 1 210X297 mm) ~-509696 A7 B7 V. Description of the invention (82) Use FASTA ( Pearson and Lipman, National Academy of Sciences J, 85, 2444-2448, 1988) program cross division, as described in the Genetics Computer Group Software at the University of Wisconsin (Program Manual for Wisconsin Software, 8th edition, September 1994, Genetics Computer Group, Madison, Wisconsin). Sequence characterization of rat GDNFR The plastid DNA from the selected colonies described in Example 2 above was prepared and delivered for DNA sequence analysis. Nucleotide sequence analysis of the selected 2 138 bp rat cDNA revealed a single large open code encoding a translation protein encoding 468 amino acid residues (Figure 3). The coding sequence is flanked by a 5'-untranslated region of 301 bp and a 3 · -untranslated region of 430 bp, which does not contain a potential polyadenylation site. The presence of a stop codon in and around the first ATG codon in the base pair 3 02 indicates that the methionine codon is the most likely translation initiation site (Kozak, Nucleic Acids Research 15 , 8125-8148, 1987). Polyadenylation-free information was found in the cDNA of 3, 430 nucleotides of the untranslated sequence in rat cDNA clones. This is not surprising, as the northern aspirate data indicate that the shortest mRNA transcript is approximately 3.6 kb. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) GDNFR peptide sequence: N-terminal hydrophobic region with about 19 residues (methylthio • amine-1 To alanine-1, Figure 3), with the characteristics of secreted information peptides (von Heijne, Protein Sequence and Data Analysis, 1, 41-42, 1987; von Heijne, Nucleic Acid Research, 14, 4683-4690, 1986). No hydrophobic functional site was found within the functional site of the transmembrane. Instead, there are 21-residue carboxy-terminal hydrophobic regions (leucine-448 to serine-468, Figure 3) / and glycosylphospholipid phosphoinositide (GPI) immobilization that may involve the receptor To Cell-85- This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 6 9 6 9ο 5 A7 B7 V. Description of the invention (83) (Please read the precautions on the back before filling this page) membrane. Except for the presence of three potential N-linked glycosylation sites, no retained sequence or structural elements were found. The protein is extremely rich in cysteine (31 of 468 amino acid residues), but its spacing is not shared with the polycysteine functional sites seen in the intracellular part of known receptors. The GDNFR sequence is equivalent to using FASTA in a publicly available database. Exploration does not reveal significant homogeneity / quality with other published sequences. Once a rat cDNA clone was obtained, it was radiolabeled and i was used to detect a cDNA library prepared from the human brain substantia nigra as described in Example 5 below. Example 4 Binding of GDNF to cells expressing GDNFR Binding analysis was performed in accordance with the analysis method previously described by Jing et al. (Journal of Cell Biology, 110, 283-294, 1990). The assay was accompanied by [1 2 51] GDNF binding to rat photoreceptor cells, COS.7 cells, or 293 T cells that had metastasized to express GDNFR. Recombinant GDNFR expressed on the surface of 293 T cells specifically binds GDNF and has an affinity comparable to that seen in GDNF binding sites on rat retinal cells. Rat photoreceptor cells printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs were prepared as described above in Example 1 and analyzed in a 24 # Costar tissue culture plate pre-coated with polyguanine and laminin The first 2 to 3 days were seeded at a density of 5.7 X 105 cells / cm2. COS7 cells at a density of 2.5 X 104 cells / cm 2 were inoculated and infected with 10-20 μg plastid DNA 1 day before analysis, using the DEAE-polyglucose-aeroquinone method (Aruffo and Seed, National Academy of Sciences |] , 84, 8573-8577, 1987). Cells were removed from each plate 24 hours after transfer infection and re-inoculated into 30 # of Costar tissue culture dish # 30, and allowed to grow -86- This paper size applies Chinese National Standard (CNS) A4 specification (210X297) (%) 509696 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs V. Invention Description (84) for another 48 hours. Cells were then allowed to stand in ice for 5 to 10 minutes, washed once with ice-cold wash buffer and combined with 0.2 liters of binding buffer with different concentrations [125 n GDNF and with or without unlabeled GDNF in 4. (: Incubate for 4 hours. Cells were washed 4 times with 0.5 strokes of ice-cold washing buffer and dissociated with 0.5 moles of 1 Molar NaOH. Isolates were counted in a counter from a chemical laboratory at 1470. For some binding experiments, transiently transferred 293T cells were used (see 293T cell metastasis infection below). 2 days after transfer infection / cells were removed from the disc by versine. The cells were pelleted to Wash once with ice-cold binding buffer and resuspend in ice-cold binding buffer at a density of 3 X 105 cells / ml. The cell suspension is divided into sections with 1.5 X 105 cells / sample The cells were then pelleted and incubated with different concentrations of [i25I] GDNF in the presence or absence of 500 nanomolar concentrations of unlabeled GDNF for 4 hours at 4 X: with gentle agitation. Cells were washed with ice-cold * buffer solution 4 And resuspended in 0.5 ml of wash buffer. Two 0.2 ml suspensions were counted in an r counter to determine the amount of [1 2 5 j] GDNF associated with the cells. In all analyses, non-specific binding was used by Two replicate samples were tested, one containing 500 nanomolar Concentration of unlabeled GDNF. The amount of non-specific binding varies from 10% to 20% in the absence of specific labeled gdNF and is subtracted from specific binding. Analytical methods show that cells do not bind GDNF unless the cells have been treated with GDNFR cDNA Colony metastasis infection. Example 5 The tissue distribution of GDNFR mRNA is expressed in mouse embryos, adult mice, rats, and human tissues. The pattern of GDNFR / mRNA was detected by northern aspiration analysis. GDNFR of selected rats -87- (Please read the precautions on the back before filling this page).

、 1T d This paper size applies Chinese National Standard (CNS) A4 (210 X 297 mm) 509696 A7 B7 V. Description of invention (85 Printed cDNA using random primer DNA labeling kit printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs ( Boehringer Mannheim, Indianapolis, Indiana) Labeled according to manufacturer's procedures. Rat, mouse, and human tissue DNA aspiration (available from Clontech, Palo Alto, California) was hybridized with probes and the ExpressHyb kit (Clontech) was used. The reagents were cleaned according to the manufacturer's instructions. Tissue northern aspiration method prepared from adult rat, mouse, and human tissues indicated that GDNFR mRNA was highest expressed in liver, brain, and kidney. High! IRNA performance was also detected in the lung, compared with Low or undetectable amounts in the spleen, intestine, testes, and skeletal muscle. In aspirations made from mRNA isolated from mouse embryos, it was not detectable on the 7th day of the embryo, and became apparent on the 11th day of E1, and E 1 was extremely high at 7 days. GDNFR mRNA was expressed in fairly equal amounts in tissues isolated from many subregions of the adult brain. GDNFR mRNA performance in the adult brain showed little specificity for any particular region In most tissues, two transcripts of different sizes exist. In stingy and human tissues, 8.5 and 4.4 kb transcripts were found, while in rats, transcripts were 8.5 and 3.6 kb. Larger and The relative amount of smaller transcripts varies with tissue type, smaller transcripts have advantages over liver and kidney, and larger ones are more abundant in the brain. GDNF binds to 293 T cells infected with GDNFR cDNA clones transferred in the pBKRSV vector Scatchard analysis and detection. Two types of binding sites were detected, one with a binding affinity in the low picomolar range and another with an affinity of about 500 picomolar. Example 6 Recombinant GDNFR Adult substantia nigra cDna library (5, _elongation-88-

(Please read the notes on the back before filling in this page) -Installation * 11 .----.....—.......... —1 _ = li I --... 509696 A7 B7 V. Description of the invention (86 + cDNA library, Clontech, Palo Alto, California) The rat GDNFR cDNA clones of Example 1 were used as probes. Probes were labeled with [32P] -dNTPs using a random primer DNA labeling kit (Boehringer Mannheim, Indianapolis, Indiana) using the manufacturer's instructions. Approximately 1.2 x 106 gt10 phages from the human nigrosin cDNA library were coated with a 15-centimeter agarose plate and repeated on two replicates of nitrocellulose filter paper. Filter paper is then screened by hybridization with radiolabeled probes. Filter paper in 200 ml of 6 X SSC, 1 X Denhardts, 0.5% SDS, 50 μg / ml salmon sperm DNA pre-hybridized for 3.5 hours at 55 ° C. After adding 2 X 108cpm radiolabeled probe, hybridization continues 1 8 hours. The filter paper was then washed with 0.5 X SSC, 0.1% SDS at 55t for 30 minutes twice and exposed to X-ray film overnight to strengthen the screening. 5 positive spots were separated, and the cDNA insert showed human GDNFR cDNA part. In comparing the rat GDNFR nucleic acid sequences (bp 0 to 2140) described in Figure 3, five human GDNFR clones were found to contain the following sequences: (Please read the notes on the back before filling (This page) Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. Selector 2 Selector 9 Selector 21-A Selector 21-B Selector 2 9 Table 3 1247 to 2330 (SEQ ID No. 21) 1270 to 2330 (SEQ ID No. 23) -235 to 1692 (SEQ ID No. 9) -237 to 1692 (SEQ ID No. 11) 805 to 2971 (SEQ ID No. 15) -89- This paper size applies China National Standard (CNS) A4 specification (210X297 mm) 509696 A7 B7 〇7 5. Description of the invention () Sequence arrangement For comparison, the sympathetic sequence of human GDNFR is provided as described in Figure 5. The translation product predicted from the human cDNA sequence includes 465 amino acids and is 93% identical to rat GDNFR. To generate humans encoding full-length GDNFR cDNA, parts of clones 21B and 2 are ligated together at the inner BgIII site and under-selected to mammalian expression vector pBKRSV (Stratagene, La Jolla, Likouzhou). Recombinant human GDNFR expression vector can be prepared in mammal Expression in cells. As shown above, expression can also be in non-mammalian cells, such as bacterial cells. The nucleic acid sequences disclosed herein can be placed in commercially available mammalian vectors (eg, CEP 4, Invitrogen) for expression in mammalian cells, including Commercially available human embryonic kidney cell line, " 293 H. For performance in bacterial cells, we will typically eliminate this portion of the coding leader sequence (e.g., nucleic acid 1-'590 in Figure 1). We may add additional Methionamine is available at the N-terminus for bacterial expression. In addition, we can replace the natural leader sequence with a different leader sequence or other easily expressed cleavage sequence. Example 7 Soluble GDNFR construct Ministry of Economy Central Bureau of Standards Employees Co-op print (Read the back of the precautions to fill out this page) Soluble human GDNFR protein products were made. The following examples provide 4 different forms, differing only from the carboxy terminus, as indicated by the residue numbers provided in Figure 2. Two are soluble forms and are truncated at different points that are positively upstream of the hydrophobic tail and downstream of the last cysteine residue. The other two are the same truncated, but with the addition of the "FLAG" sequence, to which an octapeptide of commercial antibodies (Eastman Kodak) can be obtained. The FLAG sequence is H2N-DYKDDDDK -〆 COOH. -90 _ This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297mm) 509696 A7 B7 V. Description of Invention (88) Method Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (Fill in this page) Lambda phage selection # 21, which contains almost all human GDNFR coding regions, was digested with EcoRI to excise cDNA inserts. This segment was purified and ligated to EcoRI-cleaved pBKRSV vector (Stratagene, La Jolla, California) to generate clone 21-B-3 / pBKRSV. Primers 1 and 2 shown below were used in PCR reactions with human GDNFR clone 21-B-3 / pBKRSV as a template. The PCR conditions were 9 4 ° C, 5 minutes, followed by 25 4 cycles of 9 4 ° C, 1 minute; 55 ° C, 1 minute; 72 ° C, 2 minutes, and 5 minutes of final extension at 72 ° C. This resulted in a segment that included nucleotides 1265-1868 of human GDNFR clones, plus a stop codon provided by primer 2 and a Hind III restriction site. This segment was digested with the restriction enzymes Hind III (contained in primer 2) and Bglll (position 1304 in human GDNFR), and the 572 nucleoside 'acid segments generated were separated by gel electrophoresis. This section contains hGDNFR-coding regions from isoleucine-255 to glycine-443. A similar strategy was used with primers 1 and 3 to generate a segment with Bglll and Hind III ends, which encodes isoleucine-255 to proline-446. Primers 4 and 5 were designed to generate segments encoding the same region of hGDNFR and primers 1 and 3, but with an additional flag peptide coding sequence (IB 1 / Kodak, New Paradise, Connecticut). The flag peptide sequence includes 8ESc ^ (H2N-Asp-Tyr-Lys-Asp-Asp-Asp-As-Lys-COOH), and the above-mentioned anti-system is commercially available. Primers 1 and 4 or 1 and 5 were used in the PCR reaction with the same template as before, and digested with Hind III and Bglll as before. This procedure produces segments encoding isoleucine-255 to glycine-443 and isoleucine-255 to proline-446, but with the added flag peptide on the carboxyl terminus. -91-. This paper size applies Chinese National Standard (CNS) A4 (210X297mm) 509696 A7 __B7 gg " ~~~ --- * — V. Description of the invention () Primer 1) 5 丨 -CTGTTTGAATTTGCAGGACTC-3丨 (SEQ ID NO: 30> 2) 51-CTCCTCTCTAAGCTTCTAACCACAGCTTGGAGGAGC-3 '"SEQ ID NO: 31) 3) 5 丨 -CTCCTCTCTAAGCTTCTATGGGCTCAGACCACAGCTT · 3 · (SEQ ID NO: 32)

4) 5'-CTCCTCTCTAAGCTTCTACTTGTCATCGTCGTCCTTGTAGTCACCACAGCTTGGA GGAGC-3 '(SEQ ID NO: 33)

5) 5'-CTCCTCTCTAAGCTTCTACTTGTCATCGTCGTCCTTGTAGTCTGGCTCAGACCAC t AGCTT-3 '(S? JQ ID NO: 34) ··. • and all 4 segments were generated as described above and were transferred back to 2 1 B 3 / pBKRSV by metastasis. 2 1B3 / pBKRSV colonies were digested with Bglll and Hind III and treated with bovine intestinal alkaline phosphatase (CCIAP). Large sections with carrier and human GDNFR coding regions up to the Bglll position are gel purified and self-coagulated. The four Bglll / Hindlll segments were generated as described above. After being connected to this carrier, the following constructs were generated in the pBKRSV carrier: (Please read the precautions on the back before filling out this page}-Order for staff consumption by the Central Standards Bureau Cooperative prints 4.

1) GDNFR / gly-443 / pBKRSV

2) GDNFR / pro-446 / pBKRSV

3) GDNFR / gly-443 / flag / pBKRSV

4) GDNFR / Pro-446 / flag / pBKRSV hGDNFR ends at glycine 443, then the stop codon 4 hGDNFR ends at proline 446, then the stop codon hGDNFR ends at glycine 443, with a C-terminal flag tag Then, the stop codon hGDNFR terminates in proline 446, with a C- ^ flag flag iron stopper codon-92- A7 B7 V. Description of the invention ((Please read the precautions on the back before filling this page) All The correct construction of the colony is confirmed by the DNA sequence. The insert from the colony of pBKRSV is transferred to other expression vectors using the enzyme site present in the pBKRS V polylinker sequence, as described below. Soluble GDNFR (eg, GDNFR / gly and s GDNFR / pr 〇) were also transferred to the vector for transient expression and to p DSR -2 for || fixed expression in C 定 0 cells. pDSR a 2 + PL clones: appropriate pBKRSV clones to XbaI and Sail digestion. The insert is connected to pDSR pan2 + PL, cut with the same enzyme and treated with CIAP. This construct can be used for stable performance of GDNFR in C Η 0 cells. PCEP4 colonies: appropriate pBKRSV colonies The body is digested with Spel and Xhol. The insert is connected to pCEP4 (Invitrogen, San Diego, California), digested with NheI (SpeI end) and Xhol, and processed with CIAP. This structure can be used for the short-term performance of GDNFR. The Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs prints the plastid structure pDSR-2 It is essentially prepared according to the method described in the joint and co-examined US patent application serial number 501,904, March 29, 1990 (see also European Patent Application No. 90305433, Publication No. EP 398 753, Filed May 18, 1990 and WO 90/14363 (1990)), the disclosure of which is incorporated herein by reference. As those skilled in the art will recognize, a variety of nucleic acid sequences encoding GDNFR analogs can be used. Another The structure is pDSR pan2, a derivative of plastid p CD (Okayama and Berg, Mol · Cell · Biol · 3: 280-289, 1983), with 3 major modifications: (i) S V40 polyadenylation information It has been replaced with information from the α-subunit of -bFSH from bovine follicle-stimulating hormone (Goodwin et al., Nucleic Acids Research-93) This paper is in accordance with Chinese National Standard (CNS) A4 (2i0X297 mm) 509696 Central Ministry of Economic Affairs Printed by the Bureau of Standards Consumer Cooperatives A7 B7 V. Description of the invention (1): 6873-6882, 1983); (ii) Mouse dihydrofolate reductase mini gene (Gasser et al., Proc. Natl. Acad. Sci. 79: 6522-6526, 1982) Inserted downstream of the expression cassette to allow selection and amplification of the transformants; and (iii) a 267 bp segment with the "R" of the long-term repeat (LTR) of human T-cell leukemia virus type I (HTLV-I) -Element t and part of the "U5" sequence have been cloned and inserted between the SV40 promoter and the junction information, as previously described (Takebe et al., Mol. Cell. Biol. 8: 466-472, 1988). The expression of GDNFR in CΗO cells has been confirmed by the expression of degraded GDNF bound to cells. As discussed above, recombinantly expressed soluble GDNFR protein products can be used to confer GDNF activity or cell specificity. Soluble GDNFR linked to a detectable label can also be used for diagnostic applications as discussed above. Example 8 'Chemical cross-linking of GDNF and GDNFR In order to study its binding properties and molecular characteristics, GDNFR was transiently expressed on the surface of 293 T cells infected by rat cDNA selection. 293 T cell metastasis infection was performed using a calcium phosphate metastasis infection system (GIBCO / BRL, Gaithersburg, Maryland) according to the manufacturer's instructions. Two days after transfer infection, cells were removed by 2X version of amino acid treatment, washed once with washing buffer and resuspended in washing buffer at a density of 2 X 106 cells / ml. Cells of the duplicate group were cultured for 30 minutes at 37 C before binding with [1 2 51] GDNF at 37 C. These cells were washed 3 times with ice-cold binding buffer and then with a concentration of 1 to 3 millimolar [125I ] GDNF is incubated with other cells at 4 ° C for 4 hours. The cells were cleaned / washed 4 times with ice-cold washing buffer, and resuspended in supplemented with 1 millimolar concentration of suberic acid bisulfate for cross-linking-94- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling out this page)-Binding · Order 509696 A7 B7 Printed by the Employees' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of Invention ((B S3 Pierce, Rockford, Illinois) Cleaning Buffer And incubate at room temperature for 30 minutes. After washing with TBS 3. times, the samples of the duplicate group were processed by 0.5 unit PI-PLC at 37 C for 30 minutes. These cells were formed into a nose and The supernatant was collected. The cells were then washed with washing buffer and dissociated with all other cells in 2 XSDS-PAGE sample buffer. The cell dissociates and the collected supernatant were resolved on 7.5% SDS-PAGE. It is divided into parts with 1.5 × 105 cells / sample. The cells are then sliced and compared with different concentrations of [12) I] GDNF in the presence or absence of 500. See Moore Cultivate gently for 4 hours. Cells were washed 4 times with ice-cold wash buffer and resuspended in 0.5 ml wash buffer. Two 0.2-liter volumes of suspension were counted in an r counter to determine the amount of [125i] gdnf associated with the cells. Although 293 T cells that were pseudo-transfected did not exhibit any gDNF-binding capacity, GDNFR-transfected cells strongly bound [i25I] GDNF, even at picomolar concentrations. This binding is almost completely inhibited by 500 nanomolar concentrations of unlabeled GDNF, indicating a specific binding of natural GDNF to the expressing receptor. " GDNFR expressed by 293T cells can be released from the cells and processed by phospholipid inositol-specific phospholipase C (PPLC, Boehringer Mannheim, Indianapolis, Indiana). The treatment of transferred infected cells and ρ_PLC before ligation and binding almost completely eliminated the GDNF binding capacity of the cells. In addition, post-crosslinking treatment of transferred infected cells releases most of the crosslinked products into the culture medium. These results strongly suggest that GDNFR is immobilized on the cell membrane via the GP1 bond / link. (Please read the precautions on the back before filling in this page) Binding and binding 4 -95- This paper size is applicable to Chinese National Standard (CNS) M specification (2 丨 〇 > < 297 Gongchu) 509696

7 R Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs --93 '~' — ~ —-________ V. Description of the invention () The cross-linking data further indicates that the molecular weight of GDNFR is about 50-65 kD. Glycation. Although the primary cross-linked species has a molecular mass that is consistent with the acceptor monomer ', a secondary species expected to be about dimer mass has been discovered. Example 9 ^ GDNFR information generation is mediated by a complex of GDNFR and rat receptor protein tyrosine kinase-Introduction Mice bearing the marked empty mutation in the GDNF gene exhibit different disadvantages in tissues derived from neural spinal cells In the autonomic nervous system and in the three nerves and spinal motor neurons. The most serious disadvantages are the lack of kidneys and complete intestinal neurons in the digestive tract. The phenotype of GDNF knockdown mice is strikingly similar to that of c-ret knockdown animals (Schuchardt et al., 1994), suggesting a possible linkage between GDNF and c-ret information transduction pathways. Tumor gene c-ret was identified using probes derived from isolated tumor genes in gene transfer experiments (Takahashi et al., Cells 42,581-588, 1985; Takahashi and Cooper, Mol · Cell · Biol ·, 7, 1378- 1385, 1987). Sequence analysis of the c-ret cDNA revealed a large open code encoding a novel receptor protein, tyrosine kinase (PTK). The receptor ρ τ K group has been grouped into subgroups, based on the sequence homogeneity of extracellular functional sites and intracellular kinase functional sites (van der Geer et al., 1994). Ret's unique extracellular functional site structure is located outside any other known receptor P τ K subfamily; it includes information peptides, cadherin-like elements, and cysteine-rich: acidic regions, Domain (van Heyningen, Nature, 367, 319_ 320, 1994; -96-(Please read the notes on the back before filling out this page) • H—… two one ==-........... ....... ........__ II— I ----- Layer-Order ---- 4 This paper size applies to Chinese national standards ( CNS) A4 specification (210X297 mm) 509696 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs A7 94 ------------------ 5. Description of the invention () Iwamoto et al. '1993). In situ hybridization and immunohistochemical analysis revealed high levels of ret mRNA and protein in the developing central and peripheral nervous systems and in the mouse embryonic excretory system (Paehnis et al., 1993; Tsuzuki et al., Tumor genes, 1 (191, 198, 1995), suggesting that the role of the Ret receptor in the development or role of these organizations. The functional ligands of the Ret receptor have not been identified 'and the molecular mechanism that limits the transmission of Ret messages is further understood. Mutations in the c-ret gene are related to the hereditary qualities of cancer in family myeloid thyroid carcinoma (FMTC) and multiple endocrine neoplasias (MEN2 A) and 2B (MEN2B). These diseases may be caused by "functions, mutations, which constitutively activate Ret kinase (Donis-Keller et al., Hum. Molec. Genet. 2,851-856, 1993; Hofstra et al., Nature 367, 375-376 '1994; Mulligan et al., Nature, 363, 458-460, 1993; Santoro et al., Science 267, 381-383, 1995). It specifically imparts malignancy in tissues derived from neural spines, where ret is usually expressed in Early development. Another ret-related genetic disorder, Hirschsprung's disease (HSCR), is characterized by a congenital lack of parasympathetic nerve distribution in the lower intestine (Edery et al., Nature 367, 378-380, 1994; Romeo et al., 1994). HSCR is most likely due to non-sensory mutations, which result in non-sensory mutations that produce truncated Ret proteins lacking kinase functional sites or deactivated Ret kinases. As noted above, retinal tumor gene genes are repressed in mouse centers. Targeted schizophrenia results in renal dysplasia or severe fertility and a lack of intestinal neurons throughout the digestive tract (Schuchardt et al., 1994). This phenotype is similar to that of mice knocked down by GDNF. Together These data / suggest that both Ret and GDNF are important for the development of the kidney and enteric nervous system -97 丨 * This paper size applies to Chinese national standards (CNsTa4 specification (210X297 mm) ~-(Please read Please note this page before filling in this page) --- install ------ order ----- 4 f 11 ------------- seal of employee cooperation of the Central Bureau of Standards of the Ministry of Economic Affairs System 509696 A7 B7 95 V. Information Transduction Pathway of the Invention Description (However, how et and GDNF are involved is unknown 0 GDNFR eDNA is isolated and characterized by colonization as described above resulting in the transformation of GDNFR The expression in human embryonic kidney cell line 293 T. The transformation caused the appearance of two high-affinity binding sites (about 2 picomolar concentrations of Kd) and low (about 200 picomolar concentrations of K d). High-affinity binding sites can be determined by GDNFR itself is a homodimer or homooligomer, or GDNFR is composed of heterodimers or heterooligomers with other molecules. As discussed above, because GDNFR lacks cytoplasmic functional sites, it must undergo one or more additional Molecular role in order to play a role in GDNF information transduction. In this study, we It was confirmed that in the presence of GDNFR, GDNF is related to the Ret protein tyrosine kinase receptor and rapidly induces Ret autophosphorylation. 'Results

Neuron-2a cells expressing GDNFR bind GDNF nerve-2a with high affinity as a mouse neuroblastoma cell line, which endogenously expresses high amounts of Ret protein (Ikeda et al., Tumor genes 5, 1291-1296, 1990; Iwamoto et al., Tumor genes 8, 1087-1091, 1993; Takahashi and Cooper, 1987), but do not show detectable amounts of GDNFR mRNA, as judged by the northern aspiration method. With a view to determining whether Ret can be associated with GDNF in the presence of GDNFR, the research can be reviewed [12 51] GDNF and the neural-2 a cell engineered to express GDNFR. Nerve-2a cells were infected with mammalian expression vectors (such as the expression plastids described above) with rat GDNFR cDNA. Three selections of NGR-16, NGR-33, and NGR-38 were tested for their ability to bind [125I] GDNF. -98- This paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) (Please read the precautions of ^ ¾ before filling out this page)

509696 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention () Combined [1 2 51] GDNF was taken out at the end of the culture and the amount of radioactivity related to the cells was determined as described in the experimental procedure. All three strains were able to specifically bind [12:> I] GDNF, while maternal nerve-2a cells exhibited little or no [125I] GDNF binding (Figure 6). Binding can be effectively competed by adding 500 nanomolar concentrations of unlabeled GDNF. These results show that Ret receptors expressed in neural 2a cells cannot bind GDNF in the absence of GDNFR, and are consistent with previous observations that GDNFR does not manifest in a sensible amount in the nerve. 2a sprint. [1 2 51] The balanced binding of GDNF and NGR-3 38 cells is based on the ligand concentration in Guangfanyuan (0.5 picomolar concentration to / nanomolar concentration [125I] GDNF in the presence or absence of 500 Nanomolar concentration is not indicated under GDNF) (see Figure 7A). After incubation, unbound [1 2 51] GDNF was removed and the cell-related radioactivity was determined as described in the experimental procedure. The results are illustrated in Figure 7: (A) [125I] GDNF and NGR-3 8 cells (circles) and nerve-2 a cells (squares) in the presence (open circles and open squares) or the absence (filled circles and filled squares) Balanced binding under GDNF is not indicated; (B) Scachad analysis of [i25I] GDNF binding to NGR_38 cells. Nerve-2a cells exhibited a slight binding, even at a concentration of 1 nanomolar [125I] GDNF, and this binding was not affected by the addition of excess unlabeled GDNF. The 38 cell lines bound to the NGR surface were analyzed by Scachaard as shown in Figure 7B. Two types of binding sites were detected, one with Kd = 1.5 soil 0.5 picomolar concentration and the other with Kd = 332 ± 53 picomolar concentration. These dissociation constants are very similar to those obtained for high and low affinity binding sites in 293T cells that transiently exhibit GDNFR, as described above. -99- This paper size applies to Chinese National Standard (CNS) A4 (2 丨 0 X 297 mm) (Please read the precautions on the ^ side before filling out this page} ¾.

-、 1T 509696 Printed by A7 B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention () Ret connection of GDNF plaques in nerve_2a cells expressing GDNFR in order to determine whether the R et receptor PTK can interact with cells expressing GDNFR GDNF was used in this study. Cross-linking experiments were performed using NGR-3 8 and maternal nerve-2 a cells. NGR-3 8 cells are cultured with [125I] GDNF, treated with a cross-linking agent, and then dissociated directly in the SDS-PAGE sample buffer or in Triton X-100 dissociation buffer and further immunoprecipitated with anti-Ret antibody, such as Described in the experimental procedure. Immunoprecipitates were analyzed from 808 to 80 £ in the absence of (NR) or the presence of (R) 2-hydrothiothioethanol. Dissociates were treated with Ret-specific antibodies, immunoprecipitated, and analyzed by SDS-PAGE under reducing conditions (see Figure 8, the lines are labeled as follows: ~ 75 kD, solid triangle; ~ 150 kD, hollow triangle; ~ 185 kD , Solid arrows; ~ 250 kD, star; ~ 400 kD, hollow arrow). The main cross-linked species are at ~ 75 kD and ~ 185 kD, while the lighter lines are at ~ 150 kD and ~ 250 kD. Very thin lines of ~ 400 kD are also visible (Figure 8, line 2). When the immunoprecipitate was analyzed by non-reducing SDS-PAGE, ~ 75 kD, ~ 150, and ~ 185 kD lines existed at about the same intensity as in the reduced gel, but the amount of ~ 400 kD lines increased dramatically (Figure 8, line 4). It also became more important in the ~ 250 kD line. Under reduced and non-reduced conditions, a similar molecular weight but greatly reduced intensity line was seen when maternal nerve_2a cells were used instead of NGR-38 (Figure 8, lines 1 and 3). The ~ 75 kD and ~ 150 kD specialty seem to represent cross-linked complexes of GDNF and GDNFR, because species of the same molecular weight are produced by cross-linking in 293T cells, which do not exhibit Ret. Furthermore, because the molecular weight of Ret is 170 kD, any compound that includes Ret must be at least this size. 100- This paper size is applicable to Chinese national standards (Eii7l ^ Fr21〇X297 mm1 ---- (Please first Read the precautionary note before filling out this page) -nn «4.; Packing-Order d 509696 A7 B7 V. Description of the Invention ^ These composites are printed by the Consumer Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs >- The fact that the R et anti body is immunized to the Shen Dian points out that it is the product of the connection between Ret and the GDNF / GDNFR complex, which splits under the conditions of gel analysis. It is foreseeable that the wide line at ~ 185 kD may include a The molecule Ret (170 kD) is cross-linked with a molecule of carcass recombinant GDNF (15 kD), although some dimer GDNF can be included. The presence of Ret in this species is confirmed by separate experiments, where the same molecular weight? When unlabeled GDNF and NGR-3 8 cells were cross-linked, the product was seen and examined by Western blot method with anti-ret antibody (data not shown). The ~ 400 kD line is not credible, in part because Difficulty in estimating its molecular weight. It is mainly only in non-reducing conditions The facts below indicate that it is a disulfide-linked dimer of i or more species seen under reducing conditions. The most likely explanation is that it represents a dimer of the 185 kD species, although it may be composed of two Ret, 1 Or a high molecular weight mixture of 2 GDNFR and 1 or 2 GDNF molecules. The correct nature of the ~ 250 kD line has not been determined. One may represent ~ 75 kD (GDNF + GDNFR) and ~ 185 kD (GDNF + Ret) ) Complex of cross-linked heterodimers. 〃. ': Ling GPNF stimulates the ability of Ret's autophosphorylated Ret protein tyrosine kinase receptor to associate with GDNF in the presence of GDNFR in GDNFRi neural-2a cells Studies that lead to GDNF-stimulated Ret autophosphorylation. NGR-38 cells were treated with GDNF, dissociated and the dissociated products were immunoprecipitated with anti-R et antibodies. Immunoprecipitates were analyzed by Western blotting method, using as described in the experimental procedure Anti-phosphotyrosine antibodies. When NGR-38 cells (Figure 9A, lines 2-4) are present in mammals (CΗ0 cells; Figure 9A, line 4) or E. coli (Figure 9A, -101) Standards are applicable to China National Standard (CNS) A4 specifications (2 丨 0X297 mm) ------ (Please read f Please note this page and fill in this page). ··· Order 4 509696 A7 B7 V. Description of the invention () Lines 1 and 3) Purified recombinant GDNF produced in the process, the strong line is seen at 170 kD Self-acidification of amino acid residues. The weaker corresponding line is seen in GDNF-treated nerve 2a cells (Figure 9A, line 1). No phosphorylation is seen in Ret, which replaces the 150 kD precursor form of glycosylation (Figure 9A). Ret autophosphorylation is dose-dependent by GDNF. The dose-response and kinetics of GDNF to Ret glutamate phosphorylation in N G R-38 cells are shown in plates B and C. In all plates, tyrosine phosphorylated no kD R e t lines are shown by solid arrows. The re-probe determination of the ret protein mass contained in each row, such as anti-Ret antibody (Santa Cruz, C-19, Cat · # sc-167), is shown on the right side of plate A. A line at ~ 150 kD represents a substitute for the unreacted form of Ret ', which does not self-scale. As shown in Figure 9B, stimulation of Ret autophosphorylation in NG R-38 cells can be detected and reacted at 50 picograms / ml GDNF and saturated at 20-50 nanograms / ml GDNF. Ret autophosphorylation in N G R-38 cells was stimulated by purified recombinant GDNF. 0-20 minutes after treatment are shown in Figure 9C. Increased amounts of Ret autophosphorylation can be seen within 1 minute of GDNF treatment and up to 10 minutes after treatment (Figure 9C). gDNF and Soluble GDNFR are defamated on the nerve-2A fine face, P households, white silks, printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs Ί Ί Ί Ί Ί-(Please read the precautions on the back before filling out this page) as above In question, GDNFR is immobilized on the cell membrane via a GP 1 bond and can be released by treatment with phospholipid inositol-specific phospholipase C (PI-PLC). When NGR-38 cells were cultured with PI-PLC, the GDNF-defying receptor autophosphorylation of Ret in these cells was abolished (Fig. 10A; PLC treatment (line 1) or untreated (line 2) And 3) NGR-3 8 cells were cultured with (lines i and 3) or not (line 2) with GDNF and immunosucked by as described in the experimental procedure -102- 509696 Employees of Central Standards Bureau, Ministry of Economic Affairs Printed by Consumer Cooperative A7 B7 --- ^ QQ--*-V. Description of the Invention I) Analysis of Ret autophosphorylation). Figure 10 B depicts the maternal cell_ 2 a cell with (lines 2, 4, 6, 8) or not (lines 1, 3, 5, 7) with GDNF present (lines 5-8) or missing (1 Line -4) PI-PLC / CM treatments obtained from nerve-2a or NGR-38 cells were analyzed for Ret autophosphorylation by immunostaining as described in the experimental procedure. NGR-38 cells were treated with GDNF as the positive control group. In plates A and B, autophosphorylated 170 kD Ret lines are marked by solid arrows. When maturation medium with soluble GDNFR released from PI-PLC treatment (PI-PLC / CM) of NGR-38 cells is added to maternal nerve-2 a cells, it is equivalent to GDNF treatment of NGR-38 cells Ret receptor autophosphorylation was visible in the obtained (Figure 10B, lines 2 and 8). When no GDNF was added, or when maturation medium derived from PI-PLC treatment of nerve_2a cells was tested, only background amounts of Ret autophosphorylation were seen (Figure 10B, lines 3-7).

Ret-Fc fusion protein blocked by GDNF and soluble GDNFR

Ret phosphorylation is the result of confirming the phosphorylation of Ret by GDNF in the presence of GDNFR as the autophosphorylation of the receptor. The study was conducted to determine whether the extracellular function of Ret is fused to the epithelium / immunoglobulin Fc (Ret-Fc) fusion. Proteins can block activation. Because of the technical difficulties in blocking a large number of gdNF ubiquitin receptors expressed in NGR-3 38 cells, Ret phosphorylation analysis was performed using neural_ 2 a as the target cell and NGR-3 8 processed by PI-PLC The medium from which the cells were removed served as a source of GDNFR. Cells are treated with a mixture, including a combination of different GDNF (50 ng / ml), soluble GDNFR (for example, -103- This paper size applies to China National Standard (CNS) A4 size (210X297 mm) (Please read first ^ Please note this page before filling out this page) -Installation-, 11 101509696 A7 B7 Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

Culture medium of PI-PLC / CM) derived from NGR-38 cells and Ret-Fc fusion proteins at different concentrations, either alone or in different combinations, as shown in Figure 1i. Nerve_2a cells were treated with GDNF, culture medium with soluble GDNFR, Ret-Fc or pre-cultured mixture. Cells were then dissociated, and the dissociates were analyzed for C-Ret autophosphorylation by immunoprecipitation using anti-Ret antibodies, as described in the experimental procedure. Immunoprecipitates were analyzed by Western blot method using anti-phosphotyrosine antibodies. The pre-cultured mixture of J GDNF and a medium with soluble GDNFR mediates the phosphorylation of the R et receptor tyrosine expressed in Nerve-2a in an amount equivalent to that of the cells of the NGR_38 control group treated with GDNF (Figure 11, page 7 and 2). The positions of the autophosphorylated 170 kD Ret lines are marked by solid arrows. When the Ret-Fc fusion protein is contained in a pre-cultured GDNF / GDNFR mixture, Re t phosphorylation is inhibited in a dose-dependent manner (Figure 11, lines 8_i 0). This indicates that Ret phosphorylation is a result of the GDNF / Ret reaction mediated by GDNFR. In untreated nerve-2 a cells or in cells treated with any combination of any GDNF or Re 1> F c fusion protein in the absence of GDNFR, only background amounts of Ret phosphorylation were seen (Figure 1 1, Section 3- 6 lines). gDNF defies c-RET expressed in embryonic motor neurons. Autophosphorylated spinal motor neurons are the main targets of GDNF in vivo (Henderson et al. Science 266, 1062 嶋 1064, 1994; Li et al. , Proceedings of the National Academy of Sciences 92, 9771-9775, 1995; Oppenheim et al., Nature 373, 344-346, 1995; Yan et al., Nature 373, 34 1-344, 1995; Zurn et al., Neurological Report 6,113 -118, 1995). In order to test GDNF in these cells, Ret autophosphoric acid-104- This paper size is applicable to Chinese National Standard (CNS) A4 specifications (210X 297 mm) (Please read the precautions on the back before filling this page) 17 509696 Economy Printed by A7 B7 of the Consumer Cooperatives of the Ministry of Standards of the People's Republic of China V. Description of invention (102) The ability to spinal motor neurons in embryonic rats with (lines 2 and 4) or not (lines 1 and 3) 20 nanograms GDNF treatment per ml, followed by dissociation of cells, immunoprecipitation with anti-Ret antibody, and analysis with anti-phosphotyrosine antibody by Western blotting method, as described in the experimental procedure. A line of tyrosine phosphorylated protein with a molecular mass of ~ 170 kD can be seen in the dissociated cells of cells treated with GDNF (Figure 12, line 2). No information was found on cells treated with binding buffer only (Figure 12, line 1). When the same western blotting filter paper is peeled off and re-detected with anti-R et antibody (that is, the quality of the c-ret protein contained in each row is determined by re-detection with anti-R et antibody immunosucking method), the same Lines of molecular weight mass and similar intensity appear on both samples (Figure 12, lines 3 and 4). Phosphotyrosine lines co-migrate with Ret protein stripes in GDNF-treated cells, indicating that GDNF stimulates autorephosphorylation of Ret. The autophosphorylated Ret lines (lines 1 and 2) and the corresponding protein lines (lines 3 and 4) are marked by solid arrows. Discussion Peptide growth factors cause biological effects by binding to their cognate cell expression receptors. Receptors can be divided into several classes based on their structure and mechanism of action. D These classes include protein tyrosine activators (PTKs), serine / threonine kinases, and cytokine receptors. Receptor PTK information generation is initiated by direct interaction with the ligand, which defies receptor dimerization or oligomerization, which in turn leads to receptor autophosphorylation. Recipients of the living body then recruit and phosphorylate intracellular receptors' to eventually reach the event cascade of biological responses (Schlessinger and Ullrich, Neuron 9, 383-391, 1992). Conversely, the transduction of information by serine threonine kinase or cytokine receptor is often accompanied by multicomponent receptors. -105- This paper size applies to China National Standard (CNS) A4 (210X297 mm) (please read the back first) (Notes on this page, please fill out this page) ¾ clothing. 4 509696 A7 B7 1103 V. Description of the invention () The formation of complexes, in which the ligand and information transduction components are different. Examples are T G F -receptor complexes, including serine / threonine kinase receptors and the CNTF family, which separately bind (type 11) and messaging (type I) components. CNTF, interleukin-6 (IL-6) and leukocyte inhibitory factor (LIF) share common information-generating components, gpl30 and / or L > IFR, in their individual receptor complexes. Although the ligand specificity of these complexes is determined by specific binding subunits with individual ligands, information transduction requires the base complex's original complex and the ligand subunit to be indirectly coordinated with others Association of receptor subunits in the body (Ip et al., Cells 69, 1121-1132, 1992). In the CNTF receptor complex, the ligand-binding component is the CNTF receptor (CNTFR), which, like GDNFR, is a GPI-immobilized membrane protein. The first example of the inclusion receptor P T K of the present invention is described, and its autophosphorylation is determined by binding to a specific binding component of a separate ligand. Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the notes on the back before filling this page) This study confirms that GDNFR, a GPI-bonded conjunctival protein that binds GDNF with high affinity, is effective for GDNF and Ret receptor PTK What is needed for connection. In the absence of GDNFR, GDNF cannot bind to Ret or stimulate Ret receptor autophosphorylation. In the presence of GDNFR, GDNF is associated with Ret and rapidly defies Ret autophosphorylation in a dose-dependent manner. GDNFR can act in a membrane-bound or soluble form (Figure 11), as discussed above. A GDNF concentration of 50 picograms per milliliter (1.7 picomolar concentration) activates Ret tyrosine kinase in cells expressing GDNFR. This is consistent with the dissociation constant (1.5 picomolar concentration) seen at the high-affinity GDNF binding site on NGR-38 cells. Ret phosphorylation is rapidly defamated by GDNF (detectable within 1 minute after processing) / and the ability of Ret-Fc to block autophosphorylation. It is recommended that Ret be activated directly instead of one -106- This paper size applies Chinese national standards ( CNS) A4 specification (210X297 mm) 509696 A7 B7 printed by the consumer cooperation of the Central Bureau of Standards of the Ministry of Economic Affairs ._— ^ ~ '' ~ " V. Description of the invention () Downstream results of phosphorylation of some other receptors. Cross-linking studies support the hypothesis that effective connection between Ret and GDNF relies on GDNFR. GDNF cross-linked to NGR-38 cells showing high levels of GDNFR. Ret lines are strong, but cross-linked product lines are difficult to detect in maternal nerve-2a cells. Although the knot-type identification of the cross-linked complexes is difficult, the data clearly show the connection of Ret to GDNF, which relies on the presence of GDNFR, and that GDNF R is included in some cross-linked products. The reason for the existence of the secondary 妾 cross-linked species in neurons-2a cells is unclear. Although the expression of GDNFR mRNA in neural-2a cells cannot be detected by the northern aspiration method, it is possible that ODNFR is expressed in extremely low amounts in these cells. The fact that Ret can be activated by GDNF in cultured rat embryonic spinal motor neurons further reveals the biological relevance of the Ret / GDNF interaction. These cells are the primary targets of GDNF in vivo and have been shown to respond to low doses of GDNF in test tubes (Henderson et al., 1994). Ret 嶙 acidification stimulation is abolished when motor neuron cells are pretreated with PI-PLC (data not shown). It is suggested that GDNFR is required for Ret activation by GDNF. Although the binding of the ligand to the extracellular functional site of the receptor is the first step in activating other known receptor PTKs, this data shows that this is not the case for GDNF and Ret. Figure 13 depicts the pattern of GDNF binding to GDNFR and Ret, and subsequent activation of GDNF by Ret PTK. The initial event in this process was the combination of a disulfide-linked dimer GDNF and a monomer or dimer GDNFR. Although there is no direct evidence for the existence of the dimer GDNFR, when 293T cells were infected with GDNFR cDNA transfer, two types of / binding sites appeared. The simplest interpretation of this observation is -107 of the monomer or dimer GDNFR-* This paper size is applicable to the Chinese National Standard (CNS) A4 specification (21 × 297 mm) (Please read the precautions on the back before filling this page ) • Equipment ·, ιτ -1¾ 509696 A7 Printed by the Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs, printed B7 V. Description of the invention (^ Exists, each with its own ligand binding affinity. This binding affinity with GDNF is obviously not R The findings affected by the existence of et are consistent. Because this experiment does not state whether the dimer GDNFR is in equilibrium with the monomer in the absence of GDNF or whether dimerization is a problem that is vilified by the combination of GDNF, these may The sexual system emerges in an alternative way. The complex including the dimer GDNFR and the dimer GDNF can combine 2 molecules of Ret to form an active information sending complex. For example, other PTK, the catalytic function site in the flat cell of 2 Ret molecules The close contact between them seems to cause receptor autophosphorylation. This concept is that the role of Ret by this mechanism is supported by the fact that mutations in MEN2A that cause steady-state dimerization of Ret cause the activation of Ret kinase (Sant Roo et al., 1995). Motor neurons are reported to respond to GDNF, while ED5G is as low as 5 femtomoles (Henderson et al., 1994). Although it is difficult to compare biological responses with the binding affinity of ED50, it is possible Extremely high affinity GDNF binding sites are present on these cells. Other cells such as embryonic chicken sympathetic neurons have been reported to bind GDNF with K d at a concentration of 1 to 5 nanomolar (Trupp et al., Journal of Cell Biology 130, 137-148, 1995). Not necessarily staggering, GDNFR involves the receptor complex at such a low affinity site, but there may be a weak direct interaction between GDNF and Ret. The manifestation of c-ret is seen in development during embryogenesis Many cell arrangements of the central and peripheral nervous system, including cells of the enteric nervous system (pachnis et al., Development, 119, 1005-1017, 1993; Tsuzuki et al., 1995). Outside the nervous system, c-ret manifestations have been examined Out of the kidney, the renal tube, ureteral epidermis and collection tube (Pachnis et al., As before; Tsuzuki et al. -108-) This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) ~ '( Please read first Note to fill out the back of this page) ¾ clothes · Order

JAW 509696 A7 B7 V. Description of Invention (106) People, 1995). Ret manifestations were also detected in all neuroblastoma cell lines derived from light ridges (Ikeda et al., 199) and surgically excised neuroblastomas (Nagao et al., 1990; Takahashi and Cooper, 1987). GDNF manifestations have been seen in both CNS and PNS and non-neuronal tissues during embryonic development. The expression of GDNF in many non-neuronal tissues is higher than that of the nervous system (Choi-Lundberg * Bohn, BrainRes. Dev. BrainRes 85, 80-88, 1995). Although the performance of GDNFR has not been extensively studied, a high level of GDNFR mRNA was detected in the liver, brain, and kidney of adult rats and mice by primary northern suction analysis. The similarity of ret, GDNF, and GDNFR in the development of the nervous system and kidneys is consistent with the role of merger during development. 0 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back before filling in this Page} The development of mammalian kidneys has been assumed to originate from the interaction between the metanephros and the developing ureters, a branch that develops from the tail of the mesial duct (Saxen, Organogenesis of the Kidney. Development and Cell Biology Series, Cambridge University) Press, Cambridge, UK, 1987). Although Ret's performance has been seen in ureteral buds, but not in the surrounding mesenchyme of developing embryos, GDNF performance was detected in undifferentiated but non-kidney adult kidney covers. These observations suggest GDNF The interaction with Ret is responsible for initiating the development of the ureteral structure. Further support for this hypothesis is provided by the breakdown of the GDNF and ret genes, which cause very similar phenotypic defects in the kidney (Schuchardt et al., Nature 367, 380-383, 1994; Sanchez, in publication). Another major phenotypic shortcoming seen in GDNF (-/-) and ret (-/-) knockout animals is the complete loss of the digestive tract. Intestinal neurons. Hirschsprung * s disease, a genetic disorder characterized by a congenital lack of distribution in the lower intestine / parasympathetic nerves, also linked to ret "-109- This paper is for China National Standard (CNS) A4 specification (210X297 mm) 9 6 09 5 β Α7 _____ Β7 V. Description of the invention (W) (Please read the precautions on the back before filling this page) Loss of function "mutation (Romeo et al., Nature 367 , 377-378, 1994; Edery et al., 1994). Subsequent reports (Angrist et al., Hum Mol Genet. 4,821-83 0, 1995) point out that, in contrast to earlier observations, some of the The patient did not carry mutations in ret. It is foreseeable that patients can carry mutations in GDNF, GDNFR, or some other important component of this message. The experimental procedure " L125H GDNF and nerves expressing GDNFR_ 2 a-cell printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

Nerve-2a cells (AT CC # CCL 131) were transfected to express plastids as described above, and the calcium phosphate transfer infection system (GIBCO / BRL) was performed according to the manufacturer's guidelines. The transferred infected cells were selected to grow in 400 μg / ml G418 antibiotic (Sigma) to show plastids. G418-resistant colonies were expanded and analyzed for GDNFR performance by combining with [125I] GDNF (Amersham, company, customer iodination, catalog #IMQ 1057). Cells from each selected colony were seeded at a density of 3 × 104 cells / cm 2 in 24- # tissue culture plate (Becton Dickinson) two repeat #, which was precoated with poly ornithine. Cells were washed once with ice-cold washing buffer (DMEM with 25 mM HEPES, pH 7.5) and then with 50 picomoles [125I] GDNF in binding buffer (wash buffer plus 0.2% BSA) Incubate for 4 hours at 4 ° C in the presence or absence of 500 millimolar concentrations of unlabeled GDNF. The cells were then washed 4 times with ice-cold wash buffer, dissociated in 1 Molar NaOH, and the radioactivity of the cell junctions was quantified in a 1470 Witch Automation r counter (Wallac). The amount of GDNFR expressed by individual colonies is, [125I] The ratio of GDNF binding to cells. In the absence or presence of GDNF-110- This paper size applies to Chinese national g (CNS) A4 specifications (210X297 mm 1 Ministry of Economic Affairs) Printed by A7, Consumer Standards Cooperative of the Central Bureau of Standards --------- B7 V. Description of Invention (108) * 1 ~--Estimated below. Three types of colonies were selected for use in combination experiments. Representatives of low-, medium-, and high-volume performers. In the absence or presence of unlabeled gdnf, the ratio of these selected colonies I] GDNF ratio is NGR_38) i6: i, NGR-16) 12.8: i, and NGR_33) 8: i. The equilibrium binding of [125i] g bile and N G R-j 8 cells was performed as described above, and the concentration range for labeling was from 0.5 picomolar concentration to! Nanomolar concentration. In all analyses, non-specific bindings estimated from the amount of radiolabeled binding to stubs at 500 nanomolar concentrations of unlabeled GDNF were subtracted from binding in the absence of unlabeled GDNF. The combined data were plotted and analyzed by Scarlett. Chemically cross-linked nerve-2 a or NGR-3 8 cells were washed once with trans-buffered saline (bps, pfj 7.1), and then were present in binding buffer at 1 or 3 nanomolar concentrations in Missing 500 nanomolar concentrations of unlabeled gdnf for 4 hours at 4 C. After binding, the cells were washed 4 times with ice-cold wash buffer and incubated at room temperature with 1 millimolar hydrogen suberate (BS3, Pierce) in the wash buffer for 4 5 minutes. The cross-linking reaction was stopped by washing the cells 3 times with Tds-buffered saline (T B S, pH 7.5). Cells were then directly dissociated in SDS-P AGE sample buffer (80 mM Tris HC1 [pH 6.8], 10% glycerol, 1% SDS, 0.025% bromophenol blue) or in Triton X-100 dissociation buffer (50 Hems, pH 7.5, 1% Triton X-100, NaCM at 50 mmol, NaF at 50 mmol, Sodium pyrophosphate at 10 mmol, 1% non-proteinin (Sigma, Cat. # A-6279), 1 mM PMSF (Sigma, Cat. # Ρ-7626), 0.5 mM. Ear concentration / Na3V04 (Fisher Cat # S454-50). The dissociation was clarified by centrifugation, and 5 -111- This paper size applies to Chinese National Standard (CNS) Α4 specification (210 × 297 mm) (Please read the precautions on the back before filling this page). 1--

1.1509 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 _______ B7 V. Description of the invention (109) micrograms / liter anti-1111: antibody (8 & 1 ^ (31: 1 ^ antibody, (^ 19, 〇 &{# 8〇167) The cultured and generated immune complexes were collected by precipitation with the protein A_Sepharose CL_4B (Pharmacia). Immunoprecipitates were washed 3 / person with dissociation buffer to 50 milliohms Concentrations of NaCl and 20 μmol of Tris-Cl 0.5% NP-40, pH 7.5 once, and then the plate was resuspended in sdS-PAGE sample buffer. Both whole cell dissociates and immunoprecipitates were prepared by 7.5% SDS-PAGE differentiation with Bis: acrylamide at 1: 200. Western blot analysis The autophosphorylation system of Ret receptors was examined by Western blot analysis. Briefly, cells were analyzed 24 hours before analysis. Inoculate 6 _ # tissue culture plates at a density of 1 · 5 X 106 cells / #. Cells are washed once with binding buffer and with different concentrations of different reagents (including GDNF, PI-PLC, PI-PLC / CM and Ret-Fc fusion protein), alone or in combination, at different times in the binding buffer. Treated cells and untreated The control group was dissociated in Triton X-100 dissociation buffer and immunoprecipitated with anti-Re t antibody (Santa Cruz, C_19, Cat. # SC-167) and protein-A Sepharose as described above. The immunoprecipitate was subjected to SDS-PAGE Differentiate and transfer to nitrocellulose membranes as described by Harlow and Lane (Antibodies · Laboratory Manuals. Cold Spring Harbor Laboratory: Cold Spring Harbor, New York, 1988). The membranes are pre-blocked with 5% BSA (Sigma) and The amount of tyrosine phosphorylation of the receptor was determined by sucking the membrane with a phosphotyrosine monoclonal antibody 4G10 (UBI, Cat. # 05_321) at room temperature for 2 hours. The amount of protein included in each row was removed by peeling and The anti-R et antibody was then detected on the same membrane. Finally, the membrane was treated with chemiluminescence agents (ECL, Amersham) and exposed to X-rays and negatives (Hyperfilm-ELC, Amersham) according to the manufacturer's instructions. -112- This standard applies China National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page)

509696 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs. 5. Description of the invention (110) The generation of maturation medium treated with PI-P LC and PI-PLC to release GPI-linked GDNFR from the cell surface Cells were washed once with washing buffer and then cultured with 1 unit / ml phospholipids inositol-specific phospholipase C (PI-PLC, Boehringer Mannheim, Cat · # 1143069) in binding buffer at 37 ° C 4 5 minutes > minutes. Cells were then washed 3 times with washing buffer and further processed for Ret autophosphorylation analysis or cross-linking. To generate a PI-PLC-treated maturation medium (PI-PLC / cTm), 8 X 106 cells were removed from the tissue culture plate, and the cells were treated with PBS with EDTA at a concentration of 2 mmoles at 37 ° C for 5 to 10 minutes. Cells were washed i times with washing buffer, resuspended in 1 ml of binding buffer with 1 unit / ml PI-PLC 'and incubated at 37 C for 45 minutes. Cells were pelleted, and pi · PLC-CM was collected.

Preparation of the Ret_Fc fusion protein covering the entire c-R et coding region c > nA was isolated from the rat placental cDNA library on day 17 'using oligonucleotides corresponding to the first 20 amino acids of mouse c_Ret Probes (Iwamoto et al., 1993; van Heyningen, 1994). The region encoding the extracellular functional site of the Ret receptor (ending with the final amino acid, R636) is on the backbone and encodes the human IgG (Ig (} 1) iFc region (DNA fusion and cloned into the expression vector as before pDSR2 (Bartley et al., Nature 368, 558-560, 1994). "Buy / pDSRa2 plastids were transferred to bin f, ovarian (c HQ) cells, and recombined

The Ret-Fc fusion protein was purified by affinity chromatography using a Ni ++ column. Some—Yuesetai IL's spinal auditory motor neuron baby "Qin Wu's storage (please read the precautions on the back before filling out this page) Order d _ -113- · · One public 509696 A7 111 V. Description of the invention ( Purified embryonic rat spinal motor neuron cultures were prepared from e15 Sprague-Dawley rat fetuses 24 hours before the experiment. The spinal cord was dissected and the membrane and lateral root nerves (DRGs) were removed. The spinal cord was cut into smaller segments Tablets and digestion with papain in L15 medium (papaya enzyme kit, Worcington). Motor neurons, which are larger than other types of cells encapsulated in a dissociated cell suspension, use 6.8%. (Metdzamide) gradient (Camu and Henders On, J Neuroscience 44, 5 9-70, 1992). Purified and lack of movement of God's inhabitants in the interface between the Metamine mat and collect cell suspensions, wash and use Inoculated in a tissue culture plate pre-coated with poly-L-ornithine and laminin at a density of ~ 9 x 100 cells / cm2 and cultured at 37 ° C. Different references cited here, The disclosure thereof is hereby incorporated by reference in its entirety. The examples and the way to exemplify nucleic acids and amino acids are described, of course, mutations and modifications will occur to those skilled in the art. Therefore, intentionally, the scope of the accompanying patent application covers all such equivalent mutations' which are covered in, for example, Revealed inside the fan bee of the present invention. 1 -------- · Install-(Please read the precautions on the back before filling this page), 1T i Printed 114-sheets by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Zhang scale is applicable to China National Standard (CNS) A4 specification (2ί〇χ297 mm

Zero I--I .....- I 509696 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 · 112 V. Description of the invention () Sequence Listing (1) General Information · (i) Applicant ·· Fox, Gary M. Gold, Shu Qiangwen, Dan Zhi (Π) Title of Invention: Receptors of Neurotrophic Factors Obtained from Glia Cell Lines (iii) Sequence 歹 Number of J: 34 ^ (iv) Address: (A) Correspondent: AMGEN Corporation (B) Street: 1840 DeHavilland Avenue (C) City · Thousand Oaks (D) State: California (E) Country: United States (F) Postal Code: 91320-1789 (v) Computer-readable form: (A) Media type: Disk (B) Computer: IBMPC compatible (C) Operating system: PC-DOS / MS-DOS (D) Software: Patentln Release # 1 · 0, # 1 · 30 version (vi ) Current application information ... (A) Application written: US unknown (B) Date of filing: 14-4-1997 (C) Category: (Please read the precautions on the back before filling this page) 1 · Pack.

、 1T I # -115- This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 509696 A 7 B7 113 V. Description of the invention () (vii) Previous application materials: (A) Application No. ·· US 60 / 017,221 (B) filing date: 09-5-1996 (vii) prior application information: (A) application number: US 60/015: 907 (B) filing date: 22-4_ 1996 (viii) lawyer / Agency Information: (A) Name ·· Churi, Daniel R · (B) Registration Number: 32,727

(C) Reference / Memorandum No. A-401A (2) Information of SEQ ID No. 1: '(i) Sequence characteristics: (A) Length: 2568 base pairs (B) Type: Nucleic acid (C) strand Sex: Single

(D) Phase: Linear (ii) Molecular type: Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (Please read the notes on the back before filling this page) (ix) Features:

(A) Name / Key: CDS (B) Location: 540..1934 (xi) Sequence description: SEQ ID No. 1: -116- This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) ) 509696 A7 B7 V. invention is described in (114 AATCTGGCCT CGGAACACGC CATTCTCCGC GCCGCTTCCA ATAACCACTA ACATCCCTAA 60 CGAGCATCCG AGCCGAGGGC TCTGCTCGGA AATCGTCCTG GCCCAACTCG GCCCTTCGAG 120 CTgTCGAAGA TTACCGCATC TATTTTTTTT TTCTTTTTTT TCTTTTCCTA GCGCAGATAA 180 AGTGAGCCCG GAAAGGGAAG GAGGGGGCGG GGACACCATT GCCCTGAAAG AATAAATAAG 240 TAAATAAACA AACTGGCTCC TCGCCGCAGC TGGACGCGGT CGGTTGAGTC CAGGTTGGGT 300 CGGACCTGAA CCCCTAAAAG CGGAACCGCC TCCCGCCCTC GCCATCCCGG aGCTGAGTCG 360 CCGGCGGCGG TGGCTGCTGC CAGACCCGGA GTTTCCTCTT TCACTGGATG GAGCTGAACT 420 TTGGGCGGCC AGAGCAGCAC AGCTGTCCGG GGATCGCTGC ACGCTGAGCT CCCTCGGCAA 480 GACCCAGCGG CGGCTCGGGA TTTTTTTGGG GGGGCGGGGA CCAGCCCCGC GCCGGCACC 539 ATG TTC CTG GCG ACC CTG TAC TTC GCG CTG CCG CTC TTG GAC TTG CTC. 587 Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 1 5 10 15 CTG TCG GCC GAA GTG AGC GGC GGA GAd CGC CTG GAT TGC GTGAAA GCC 635 Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp ^ Cys Val Lys Ala, 20 25 30 AGT GAT CAG TGC CTG AAG GAC3 CAG AGC TGC AGC ACC AAG TAC CGC ACG 683 Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 '40 45: BindingCTA AGG CAG TGC GTG GCG GGC AAG GAG ACC AAC TTC AGC CTG GCA TCC Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Ala Ser 50 55 60 * 731 4 GGC CTG GAG GCC AAG GAT GAG TGC CGC AGC GCC ATG GAG GCC CJG AAG 779 Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 75 80 CAG AAG TCG CTC TAC AAC TGC CGC TGC AAG CGG GGT ATG AAG AAG GAG 827 I Gin Lys Ser Leu .Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 85 90 95 jAAG AAC TGC CTG CGC ATT TAC TGG AGC ATG TAC CAG AGC CTG CAG GGA 875 | Lys Asn Cys Leu Arg lie Tyr .Trp Ser Met Tyr Gin Ser Leu Gin Gly 100 105 110 lAAT GAT CTG CTG GAG GAT TCC CCA TAT GAA CCA GTT AAC AGC AGA TTG 923 | Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leu '115 12 0 125 * m HI J i- -117- t ^ ni ml m 1 ^ 1 ml This paper size is applicable to the Chinese National Standard (CNS) A4 specification (21 〇X 297 mm) 509696 Employee consumption cooperation of the Central Standards Bureau of the Ministry of Economic Affairs Printed A7 B7 115 V. Description of Invention () TCA GAT ATA TTC CGG GTG GTC CCA TTC ATA TCA GAT GTT TTT CAG CAA 971 Ser Asp He Phe Arg Val Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 135 140 GTG GAG CAC ATT CCC AAA GGG AAC AAC TGC CTG GAT GCA GCG AAG GCC 1019 Val Glu His He Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala 145 150 155 160 TGC AAC CTC GAC GAC ATT TGC AAG AAG TAC AGG TCG GCG TAC ATC ACC 1067 Cys Asn Leu Asp Asp lie Cys Lys Lys Tyr Atg Ser Ala Tyr lie Thr 165 170 '· * 175 CCG TGC ACC ACC AGC GTG TCC AAC GAT GTC TGC AAC CGC CGC AAG TGC 1115 Pro Cys Thr Thr Ser Val Ser Asn Asp Val Cys Asn Arg Arg Lys Cys 180 185 19 0- CAC AAG GCC CTC CGG CAG TTC TTT GAC AAG GTC CCG GCC AAG CAC AGC 1163 His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 195 200 205 TAC GGA ATG CTC TTC TGC TCC TGC CGG GAC ATC GCC TGC ACA GAG CGG1211 Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp lie Ala Cys Thr Glu Arg 210 215 220 AGG CGA CAG ACC ATC GTG CCT GTG TGC TCC TAT GAA GAG AGG GAG AAG 1259 Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Lys 225 230 235 240 CCC AAC TGT TTG AAT TTG CAG GAC TCC TGC AAG ACG AAT TAC ATC TGC 1307 Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lys Thr Asn Tyr He Cys • · 245 250 255 AGA TCT GGC CTT GCG GAT TTT TTT ACC AAC TGC CAG CCA GAG TCA AGG 1355 Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260 265 270 t TCT GTC AGC AGC TGT CTA AAG GAA AAC TAC GCT GAC TGC CTC CTC GCC 1403 Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 TAC TCG GGG CTT ATT GGC ACA GTC ATG ACC CCC AAC TAC ATA GAC TCC 1451 Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr lie Asp Ser 290 295 300 AGT AGC CTC AGT GTG GCC CCA TGG TGT GAG · TGC AGC AGT AGG GGG AAC 1499 Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 '310 315 320 GAC CTA GAA GAG TGC TTG AAA Lys TTT TTG AAT TTC TTC AAG GAC AAT ACA 1547 Asp Leu Glu Glu Cys Leu Phe Leu Asn Phe Phe Lys Asp Asn Thr '325 330 335 TGT CTT AAA AM1 GCA ATT CAA GCC TTT GGC AAT GGC TCC GAT GTG ACC 1595 Cys Leu Lys As Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 (Please read the notes on the back before filling this page)

、 1T -118- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm j Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 509696 A7 B7-1 ^ 0! 5. Description of the invention () GTG TGG CAG CCA GCC TTC CCA GTA CAG ACC ACC ACT GCC ACT ACC ACC 1643

Val Trp Gin Pro Ala Pho Pro Vol Gin Thr Thr Thr Λία Tlir Thr The 355 360 365 'ACT GCC CTC CGG GTT AAG AAC AAG CCC CTG GGG CCA GCA GGG TCT GAG 1691

Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370 375 380 AAT GAA ATT CCC ACT CAT GTT TTG CCA CCG TOT GCA AAT TTA CAG GCA 1739

Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 400 CAG AAG CTG AAA TCC AAT GTG TCG GGC AAT ACA CAC CTC TGT ATT TCC 1787

Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser 405 410 415 AAT GGT AAT TAT GAA AAA GAA GGT CTC GGT GCT TCC AGC CAC ΑΤΛ ACC 1835

Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His lie Thr 420 425 430 ACA AAA TCA ATG GCT GCT CCT CCA AGC TGT GGT CTG AGC CCA CTG CTG 1883

Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu 435 440 445 GTC CTG GTG GTA ACC GCT CTG TCC ACC CTA TTA TCT TTA ACA * GAA ACA 1931

Val Leu'Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu Thr 450 455 460 TCA TAGCTGCATT AAAAAAATAC AATATGGACA TGTAAAAAGA CAAAAACCAA 1984

Ser 465 GTTATCTGTT TCCTGTTCTC TTGTATAGCT GAAATTCCAG TTTAGGAGCT CAGTTGAGAA 2044% ACAGTTCCAT TCAACTGGAA CATTTTTTTT TTTNCCTTTT AAGAAAGCTT CTTGTGATCC 2104 TTNGGGGCTT CTGTGAAAAA CCTGATGCAG TGCTCCATCC AAACTCAGAA GGCTTTGGGA 2164 TATGCTGTAT TTTAAAGGGA CAGTTTGTAA CTOJGGGCTGT AAAGCAAACT GGGGCTGTGT 2224 TTTCGATGAT GATGATNATC ATGATNATGA TNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 2284 Ι ^ ΝΝΝΝΝΝΝΝ GATTTTAACA GTTTTACTTC TGGCCTTTCC TAGCTAGAGA AGGAGTTAAT 2344 ATTTCTAAGG TAACTCCCAT ATCTCCTTTA ATGACATTGA TTTCTAATGA TATAAATTTC 2404 ^ AGCCTACATT GATGCCAAGC TTTTTTGCCA CAAAGAAGAT TCTTACCAAG AGTGGGCTTT 2464 GTGGAAACAG CTGGTACTGA TGTTCACCTT TATATATGTA CTAGCATT1-China National Standard ATGAAACAGT ----- iJP " (Please read the notes on the back before filling this page) • Binding-Order 4 509696 A7 B7 V. Description of the invention (1.17 (2) SEQ ID No. 2 Information: · (i) Sequence Features: (A) Length: 465 amines Acid (B) Type: Amino Acid (D) Phase: Linear (ii) Molecular Type · Protein (xi) Sequence Description · SEQ ID No. 2: Met Phe Leu Ala Thr Leu Tyr Phe .Ala Leu Pro Leu Leu Asp Leu Leu 1 5 10. 15 Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys Ala 20 25 30

Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 40 45 Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Ala Ser 5〇55 60 Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 75 80 I Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 85 90 95 Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly 100 10.5 110 Asn Asp Leu Leu Glu Asp Ser Pro Tyr, Glu Pro Val Asn Ser Arg Leu 115 120 125 Please read the precautions before reading %% Member of Central Standards Bureau of the Bookkeeping Department X Printed by Consumer Cooperative

Ser Asp He Phe Arg Val Val Pro Phe He Ser Asp Val Phe Gin Gin 130 135 140 Val Glu His lie Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala I ^ s Ala 145 150 155 160 Cys Asn Leu Asp Asp lie Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 ... 170 175 Pro Cys Thr Thr Ser Val Ser Asn Asp Val Cys Asn Arg Arg Lys Cys, 180 185 190 120 This paper size applies to the Chinese National Standard (cns) A4 (210x297 mm) ) 509696 A7 B7 V. Description of the invention (118)

His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 195 200 205 Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp lie Ala Cys Thr Glu Arg 210 215 220 Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Lys 225 230 235 · 240 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs

Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys 245 250 255 Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260 265 270 Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 «Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr lie Asp Ser 290 295 300 Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 315 320 Threat 'Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys .Asp Asn Thr 325 330. 335 Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 365 Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370 375 '380 Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 400 Gin Lys Leu Lys Ser Asn Val Ser Gly ^ sn Thr His Leu Cys lie Ser 405 410, 415 Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His lie Thr 420 425 430 Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Le u 435 440 445 Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu Thr 450 455 460 Ser 465 * -121- This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read first Note on the back, please fill in this page again) ¾ Clothing-Order d Printed by the Central Consumers Bureau of the Ministry of Economy Staff Consumer Cooperative 509696 A7 B7 " ~ TJg ......... ........... 5. Description of the invention () (2) Information of SEQ ID No. 3 (i) Sequence characteristics: (A) Length: 2138 base pairs (B) Type: Nucleic acid (C) stranded ·· Single '(D) phase ·· Linear (ii) Molecular type: cDNA (ix) Features ··

(A) Name / Key: CDS (B) Position: 302 ·· 1705 (xi) Sequence description: SEQ ID No. 3: AGCTCGCTCT CCCGGGGCAG TGGTGTGGAT GCACCGGAGT TCGGGCGCTG GGCAAGTTGG 60 GTCGGTiACTG AACCCCGGAA CCGGGCGCG CCTCCCGCCC TCGCGCGCGCGCCTCGGGCGCGCGCG GGATGGAGCT 180 GAACTTTGAG TGGCCAGAGG AGCGCAGTCG CCCGGGGATC GCTGCACGCT GAGCTCTCTC 240 CCCGAGACCG GGCGGCGGCT TTGGATTTTG GGGGGGCGGG GAqCAGCTGC GCGGCGGCAC 300 C ATG TTC CTA GCC ACT CTG TAC TTC GCG CTG CCG CCA

Met Phe Leu Ala Thr Leu Tyr Phe Ala Lep ’Pro Leu Leu Asp Leu 1 5 10 15 CTG ATG TCC GCC GAG GTG AGT GGT GGA GAC CGT CTG GAC TGT GTG AAA 394

Leu Met Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys * 20 25 30 GCC AGC GAT CAG TGC CTG AAG GAA CAG AGC TGC AGC ACC AAG TAC CGC 442

Ala Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg '35 40 45 AC A CTA AGG CAG TGC GTG GCG GGC AAG GAA ACC AAC TTC AGC CTG AC A 490

Thr Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Thr. 50 55 60 * TCC GGC CTT GAG GCC AAG GAT GAG TGC * CGT AGC GCC ATG GAG GCC TTG 538

Ser Gly Leu Θΐμ Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu 65 70 75 -122- This paper size applies to China National Standard (CNS) A4 specifications (210: X 297 after) (Please read the notes on the back first (Fill in this page again)

1T 509696 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of Invention (12C)) AAG CAG AAG TCT CTG TAC AAC TGC CGC TGC AAG CGG GGC ATG AAG AAA 586

Lys Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys 80 85 90 '95 GAG AAG AAT TGT CTG CGT ATC TAC TGG AGC ATG TAC CAG AGC CTG CAG 634

Glu Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin 100 105 110 GGA AAT GAC CTG CTG GAA GAT TCC CCG TAT GAG CCG GTT AAC AGC AGG 682

Gly Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg 115 120 " 125 * TTG TCA GAT ATA TTC CQG GCA GTC CCG TTC ATA TCA GAT GTT TTC CAG 730

Leu Ser Asp lie Phe Arg Ala Val Pro Phe lie Ser Asp Val Phe Gin 130 135 140-CAA GTG GAA CAC ATT TCC AAA GGG AAC AAC TGC GTG GAC GCA GCC AAG 778

Gin Val Glu His lie Ser Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys 145 150-155 GCC TGC AAC CTG GAC GAC ACC TGT AAG AAG TAC AGG TCG GCC TAC ATC 826

Ala Cys Asn Leu Asp Asp Thr Cys Lys Lys Tyr Arg Ser Ala Tyr lie- 160 165 170 175 # ACC CCC TGC ACC ACC AGC ATG TCC AAC GAG GTC TGC AAC CGC CGT AAG 874

Thr Pro Cys Thr Thr Ser Met Ser Asn Glu Val Cys Asn Arg. Arg Lys. 180 .185 *-190 TGC CAC AAG GCC CTC AGG CAG TTC TTC GAC AAG GTT CCG GCC AAG CAC 9 "

Cys ^ His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His 195 200 205 • * AGC TAC GGG ATG CTC TTC TGC TCC TGC CGG, GAC ATC GCC TGC ACC GAG 970

Ser Tyr Gly Met Leu Phe Cys Ser Cys Arg Asplie Ala Cys, Thr Glu 210 215 220 CGG CGG CGA CAG ACT ATC GTC CCC GTG TGC TCC TAT GAA GAA CGA GAG 1018

Arg Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr Glu Glu Arg Glu 225 230 235 AGG CCC AAC TGC CTG AGT CTG CAA GAC TCC TGC AAG ACC AAT TAC ATC 1066

Arg Pro Asn Cys Leu Ser Leu Gin Asp Ser Cys Lys Thr Asn Tyr Tie240 245 250 255 TGC AGA TCT CGC CTT GCA GAT TTT TTT ACC AAC TGC CAG CCfA GAG TCA 1114

Cys Arg Ser Arg Leu Ala Asp Phe Phe, Thr Asn Cys Gin Pro Glu Ser 260. # 265 270 AGG TCT GTC AGC AAC TGT CTT AAG GAG AAC TAC GCA GAC TGC CTC CTG. 1162

Arg Ser Val Ser Asn Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu / 275 280 285 -123- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before (Fill in this page) • Binding · 509696 A7 B7 121 V. Description of the invention () GCC TAC TCG GGA CTG ATT GGC ACA GTC ATG ACT CCC AAC TAC GTA GAC Ala Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr Val Asp 290 295 300 TCC AGC AGC CTC AGC GTG GCA CCA TGG TGT GAC TGC AGC AAC AGC GGC Ser Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly 305 310 '· 315.? AAT GAC CTG GAA GAC TGC TTG AAA TTT CTG AAT TTT TTT AAG GAC AAT Asn Asp Leu Glu Asp Cys Leu Lys Phe Leu Asn Phe.Phe Lys Asp Asn 320 325 330-ACT TGT CTC AAA AAT GCA ATT CAA GCC TTT GGC AAT GGC TCA GAT GTG Thr Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val 340 345. * 350. ACC ATG TGG CAG CCA GCC CCT CCA GTC CAG ACC ACC ACT GCC ACC ACT Thr Met Trp Gin Pro Ala Pro Pro Val Gin Thr Thr Thr Ala Thr Thr 355 360 365 1210 1258 1306 13 54 1402-Packing-ACC ACT GCC TTC CGG GTC AAG AAC AAG CCT CTG GGG CCA GCA GGG TCT Thr Thr Ala Phe Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser 370 375, 380 1450 Order GAG AAT GAG ATC CCC ACA CAC GTT TTA CCA CCC TGT GCG AAT TTG CAG Glu Asn Glu He Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin '385 390. 395 * GCT CAG AAG CTG AAA TCC AAT GTG TC'G GGT AGC ACA CAC CTC TGT CTT Ala Gin Lys Leu Lys Ser Asn Val Ser Gly Ser Thr His Leu Cys Leu 400 405 410 415 TCT GAT AGT GAT TTC GGA AAG GAT GGT CTC GCT GGT GGC TCC AGC CAC Ser Asp Ser Asp Phe Gly Lys Asp Gly Leu Ala Gly Ala Ser Ser His 420 425 430 ATA ACC ACA AAA TCA ATG GCT GCT CCTiCCC AGC TGC AGT CTG AGC TCA lie Thr Thr Lys Ser Met Ala Ala Pr0 Pro Ser Cys Ser Leu Ser Ser 435 440 · 445 CTG CCG GTG CTG ATG CTC ACC GCC CTT GCT GCC GCC CTG TTA TCT GTA TCG Leu Pro Val Leu Met Leu Thr Ala Leu Ala Ala Leu Leu Ser Val Ser 450 455 460 TTG GCA GAA ACG TCG TAGCTGCATC CGGGAAAACA GTATGAAAAG ACAAAAGAGA Leu Ala Glu Thr Ser / 465 1498 1546 1594 1642 1690 1690 1 124- This paper size applies to China National Standard (CNS) A4 specification (2 丨 〇X 297 mm) 509696 A7B7 V. Description of the invention () ACCAAGTATT CTGTCCCTGT CCTCTTGTAT ATCTGAAAAT CCAGTTTTAA AAGCTCCGTT 1805 GAGAAGCCCC TCGACCACAC TGGAACTCTT TCCTCTCTAGAGAC ACCCATAAGG CTCTGGGGCG 1925 TGGTGCGGCT TAAGGGGACC ATTTGCACCA TGTAAAGC ^ A GCTGGGCTTA TCATGTGTTT 1985 GATGGTGAGG ATGGTAGTGG TGATGATGAT GGTAATTTTA ACAGCTTGAA CCCTGTTCTC 2045 TCTACTGGTT AGGAACAGGA GATACTATTG ATAAAGATTC TTCCATGTCT if TACTCAGCAG 2105 CATTGCCTTC TGAAGACAGG CCCGCAGCCG TCG * 2138 Ministry of economic Affairs Bureau of the central Su prospective employees of consumer cooperation, social printing (2) SEQ Information of ID No. 4: (i) Sequence characteristics: (A) Length: 468 amino acids (B) Type: amino acid '(D) Phase: linear · (ii) molecular type · protein * (xi ) Sequence description: SEQ ID No. 4: Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 15 10 15 Met Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys Ala 20, 25 3 0 Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 40 45 Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Thr Ser 50 55 60 Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70. 75 80 Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 〆85 90 95 Lys Asn Cys Leu Arg lie Tyr Trp Ser Mefc Tyr Gin Ser Leu Gin Gly 100 105 110 125 -• _ 4 IS scales are applicable to China National Standard (CNS) A4 specifications (210X297 mm) ^ —j IJm (Please read the precautions on the back before filling this page)-Packing.

1T 4 509696 A7 B7 123 V. Description of the invention () Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leu 115 120 125 Ser Asp lie Phe Arg Ala Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 135 140 Val Glu His lie Ser Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala 145 150 155 * 160 Cys Asn Leu Asp Asp Thr Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 170 175 Pro Cys Thr Thr Ser Met Ser Asn Glu Val Cys Asn Arg Arg Lys Cys 180 185 190 His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro tAla Lys His Ser 195 200 205 4 Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp He Ala Cys Thr Glu Arg 210 215 220 Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Arg 225 230 235 * 240 Pro Asn Cys Leu Ser Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys 245 * 250 * 255 Arg Ser Arg Leu Ala A? P Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260 * 265 270 Ser Val Ser Asn Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr Val Asp Ser 290 295 300 Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 # 315 320 Asp Leu Glu Asp Cys Leu Lys Phe Leli Asn Phe Phe Lys Asp Asn Thr ’325 .. 330 '335

Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 · Met Trp Gin Pro Ala Pro Pro Val Gin Thr Thr Thr Ahr Tla Thr Thr Thr 355 360 365 -126- This paper is in accordance with Chinese national standards ( CNS) A4 size (210 × 297 mm) (Please read the precautions on the back before filling in this tribute): Packing ·

、 1T 509696 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs: A7 _ B7 V. Description of Invention (124)

Thr Ala Phe Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370 375 380

Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 t 400

Gin Lys Leu Lys Ser Asn Val Ser Gly Ser Thr His Leu Cys Leu Ser 405 410 415

Asp Ser Asp Phe Gly Lys Asp Gly Leu Ala ‘. Gly Ala Ser Ser His lie 420 425 430

Thr Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Ser Leii Ser Ser Leu 435 440 * 445 ^

Pro Val Leu Met Leu Th ^ Ala Leu Ala Ala Leu Leu Ser Val Ser Leu 450 455 460 • Ala Glu, Thr Ser 465 (2) Information of SEQ ID No. 5: (i) Sequence characteristics:. '(A) Length: 3209 base pairs (B) Type: Nucleic acid (C) Strand: Single (D) Phase: Linear (ii) Molecular type: cDNA (ix) Features: (A) Name / Key: misc one feature ( B) Location: 1 · .539 (D) Other information: / Injected soil "1 to 539 are shown in Figure 5Gdnfr, of-237 to 301" (ix) Features ·, (A) Name / Key: CDS. -127 -· This paper size applies to Chinese National Standard (CNS) A4 (2Η) X 297mm) 磬 (Please read the precautions on the back before filling out this page); Binding · Order 509696 A7 B7 125 V. Description of the invention (( B) Position 540..1937 (xi) Sequence description SEQ ID No. 5:

AATCTGGCCT CGGAACACGC CATTCTCCGC GCCGCTTCCA ATAACCACTA ACATCCCTAA CGAGCATCCG AGCCGAGGGC TCTGCTCGGA AATCGTCCTG GCCCAACTCG GCCCTTCGAG CTCTCGAAGA TTACCGCATC TATTTTTTTT TTCTTTTTTT TCTTTTCCTA GCGCATA

AGTGAGCCCG GAAAGGGAAG GAGGGGGCGG GGACACCATT GCCCTGAAA & ΛΑΤΑΑΛΤ / UVG

TAAATAAACA AACTGGCTCC TCGCCGCAGC TGGACGCGGT CGGTTGAGTC CAGGTTGGGT

CGGACCTGAA CCCCTAAAAG CGGAACCGCC TCCCGCCCTC GCCATCCCGG AGCTGAGTCG

CCGGCGGCGG TGGCTGCTGC CAGACCCGGA GTTTCCTCTT TCACTGGATG GAGCTGAACT *

TTGGGC-GGCC AGAGCAGCAC AGCTGTCCGG GGATCGCTGC ACGCTGAGCT CCCTCGGCAA GACCCAGCGG CGGCTCGGGA TTTTTTTGGG GGGGCGGGGA CCAGCCCCGC GCCGGCACC ATG TTC CTG GCG ACC CTG TAC TTC GCG CTG CCG CTG TTG GAP Tu Leu Tu Cu Tu Cu 15 CTG TCG GCC GAA GTG AGC GGC GGA GAC CGC CTG GAT TGC GTG AAA GCC Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cye Val Lys Ala 20 25 30 AGT GAT CAG TGC CTG AAG GAG CAG AGC TGC AGC ACC AAG TAC CGC ACG Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 40 45 CTA AGG CAG TGC GTG GCG GGC AAG-GAG ACC AAC TTC AGC CTG GCA TCC Leu Arg Gin Cvs Val Ala Gly Lys Glu Thr Asn Phfe Ser Leu Ala Ser 50 55 60

GGC CTG GAG GCC AAG GAT GAG TGC CGC AGC GCC ATG GAG GCC CTG AAG

Gly Leu Glu Ala Lys. Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 * 75 80 CAG AAG TCG CTC TAC AAC TGC CGC TGC AAG CGG GGT ATG AAG AAG GAG Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu * 85 90 95 AAG AAC TGC CTG CGC ATT TAC TGG AGC ATG TAC CAG AGC CTG CAG GGA Irys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly 100 105. 110 -128- Paper size Applicable to Chinese National Standards (Oyang) 8-4 specifications (210 fathers, 297 males) 509696 Employees' Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs printed A7 B7 126 V. Invention Description () AAT GAT CTG CTG GAG GAT TCC CCA TAT GAA CCA GTT AAC AGC AGA TTG 923 Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro. Val Asn Ser Arg Leu 115 120 125 TCA GAT ATA TTC CGG GTG GTC CCA TTC ATA TCA GAT GTT TTT CAG CAA 971 Ser Asp lie Phe Arg Val Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 135 140 GTG GAG CAC ATT CCC AAA GGG AAC AAC TGC CTG GAT GCA GCG AAG GCC 1019 Val Glu His lie Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Al? 145 150 155 160 TGC AAC CTC GAC GAC ATT TGC AAG AAG TAC AGG TCG GCG TAC ATC ACC 1067 Cys Asn Leu Asp Asp lie Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 170 '175 CCG TGC ACC ACC AGC GTG TCC AAN GAT GTC TGC AAC CGC CGC AAG TGC 1115 Pro Cys Thr Thr Ser Val Ser Xaa Asp Val Cys Asn Arg Arg Lys Cys 180 185 190 CAC AAG GCC CTC CGG CAG TTC TTT GAC AAG GTC CCG GCC AAG CAC AGC 1163 His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 195 200 205 TAC GGA ATG CTC TTC TGC TCC TGC CGG GAC ATC GCC TGC ACA GAG CGG 1211 Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp lie Ala Cys Thr Glu Arg 210 215 220. 1 AGG CGA CAG ACC ATC GTG CCT GTG TGC TCC TAT GAA GAG AGG GAG AAG 1259 Arg Arg Gin Thr He Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Lys 225 230 235 240 CCC AAC TGT TTG AAT TTG CAG GAC TCC TGC AAG ACG AAT TAC ATC TGC 1307 Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lye Thr Aen T yr lie Cys 245 250 255 AGA TCT CGC CTT GCG GAT TTT TTT ACC AAC TGC CAG CCA GAG TCA AGG .1355 Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260 265 270 TCT GTC AGC AGC TGT CTA AAG GAA AAC TAC GCT GAC TGC CTC CTC GCC 1403 Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 TAC TCG GGG CTT ATT GGC ACA GTC ATG ACC CCC AAC TAC ATA GAC TCC 1451 • Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr lie Asp Ser 290 295 300 AGT AGC CTC AGT GTG GCC CCA TGG TGT GAC TGC AGC AAC AGT GGG AAC 1499 Ser Ser Leu Ser Val Ala Pro Trp Cys • Asp Cys Ser Asn Ser Gly Asn 305 〆310 315 320 GAC CTA GAA GAG TGC TTG AAA TTT TTG AAT TTC TTC < AAG j GAC. AAT ACA 1547 Asp Leu GXu Glu Cys Leu Lys Phe Leu Asn Phe Phe: Lys. Asp, Asn 1 Thr 325 330 335 ( (Please read the notes on the back before filling this page) -129- This paper size applies to China National Standard (CNS) A4 210X297 mm) 509696 A7 B7 V. Description of the invention (127 TGT CTT AAA AAT GCA ATT CAA GCC TTT GGC AAT GGC TCC GAT GTG ACC Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 1595 GTG TGG CAG CCA GCC TTC CCA GTA CAG ACC ACC. ACT GCC ACT ACC ACC Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 365 1643 ACT GCC CTC CGG GTT AAG AAC AAG CCC CTG GGG CCA GCA GGG TCT GAG Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370 375 * 380 1691 AAT GAA ATT CCC ACT CAT GTT TTG CCA CCG TGT GCA AAT TTA CAG GCA Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 400 1739 CAG AAG CTG AAA TCC AAT GTG TCG GGC AAT ACA CAC CTC TGT ATT TCC Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser 405 410 415 1787-AAT GGT AAT TAT GAA AAA GAA GGT CTC GGT QCT TCC AGC CAC ATA ACC Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His He Thr 420 425 · 430 · 1835 ACA AAA TCA ATG GCT GCT CCT CCA AGC · TGT GGT CTG AGC CCA CTG CTG 1883 Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu 435 440 445. GTC CTG GTG GTA ACC GCT CTG TCC ACC CTA ΤΤΛ TCT TTA ACA GAA ACA 1931 Val Leu Val Val Thr Ala Ley Ser Thr Leu Leu Ser Leu Thr Glu.Thr 450 455 460 TCA TAG CTGCATTAAA AAAATACAAT · ATGGACATGT AAAAAGACAA AAACCAAGTT 1987 Ser ★ 465 ATCTGTTTCC TGTTCTCTTG TATAGCTGAA ATTCCAGTTT AGGAGCTCAG TTGAGAAACA 2047 GTTCCATTCA ACTGGAACAT TTTTTTTTTT NCCTTTTAAG AAAGCTTCTT GTGATCCTTC 2107 GGGGCTTCTG · TGAAAAACCT GATGCAGTGC TCCATCCAAA CTCAGAAGGC TTTGGGATAT 2167 Order Shu GCTGTATTTT AAAGGGACAG TTTGTAACTT GGGCTGTAAA GCAAACTGGG GCTGTGTTTT 2227 CGATGATGAT GATCATCATG ATCATGATNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 2287 NNNNNNNGAT TTTAACAGTT TTACTTCTGG CCTTTCCTAG CTAGAGAAGG AGTTAATATT 2347 TCTAAGGTAA CTCCCATATC TCCTTTAATG ACATTGATTT CTAATGATAT AAATTTCAGC 2407 CTACATTGAT GCCAAGCTTT TTTGCCACAA AGAAGATTCT TACCAAGAGT GGGCTTTGTG 2467 GMACAGCTG GTACTGATGT TCACCTTTAT ATATGTAGTA GCATTTTCCA CGCTGATGTT 2527 TATGTACTGT AAACAGTTCT GCACTCTTGT ACAAAAGAAA AAACACCTGT CACATCCAAA 2587 TATAGTATCT GTCTTTTCGT CAAAATAGAG AGTGGGGAAT GAGTGTGCCG ATTCAATACC 2647 -130- This paper size applies to Chinese national standards (CNS) A4 specifications (210X297mm) 509696 A7 B7 128 Five, invention description () ATCGATCCCTCCTCACTCCCTC CCAATATAGC TGAAATGTCG CTCTAATACT CTTTACACAT ATGAGGTTAT 2767 ATGTAGAAAA AAATTTTACT ACTAAATGAT TTCAACTATT GGCTTTCTAT ATTTTGAAAG 2827 TAATGATATT GTCTCATTTT TTTACTGATG GTTTAATACA AAATACACAG AGCTTGTTTC 2887 CCCTCATAAG TAGTGTTCGC TCTGATATGA ACTTCACAAA TACAGCTCAT 1 CAAAAGCAGA 2947 CTCTGAGAAG CCTCGTGCTG TAGCAGAAAG TTCTGCATCA TGTGACTGTG GACAGGCAGG 3007 AGGAAACAGA ACAGACAAGC ATTGTCTTTT GTCATTGCTC GAAGTGCAAG CGTGCATACC 3067 TGTGGAGGGA ACTGGTGGCT GCTTGTAAAT GTTCTGCAGC ATCTCTTGAC ACACTTGTCA 3127 TGACACAATC CAGTACCTTG GTTTTCAGGT TATCTGACAA AGGCAGCTTT GATTGGGACA 3187 TGGAGGCATG GGCAGGCCGG AA 3209 (Please read the precautions on the back before filling this page). (2) SEQ ID No. 6 Information: (i) Sequence characteristics: (A) Length: 466 amino acids,. (B) Type: Amino acid (D) Phase: Linear (ii) Molecular type · Protein (xi) Sequence description: SEQ ID No. 6:

Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu .15 10 15

Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys Ala 20 25 30

Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 40 45 ...

Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Ala Ser 50 55 * 60 ·

Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 .. 75 80

Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 85 90 95 -131-This paper size applies to China National Standard (CNS) A4 (.210 X 297 mm) Order 4 Central Bureau of Standards, Ministry of Economic Affairs Printed by employee consumption cooperation 509696 A7 B7

This paper size applies to China National Standard (CNS) A4 (210X297 mm). Packing 13 ^ -509696 A7 B7 V. Description of the invention () Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 365 * Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro -Ala Gly Ser Glu 370 375 380 Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 400 Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser 405 410 415 Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His lie Thr 420 425 430 Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu 435 440 445 Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu Thr 450 455 460-Ser * 465 (2) Information of SEQ ID No. 7: (i) Sequence characteristics: · (A) Length: 508 base pairs (B) Type: Nucleic acid · (C) Share property: Single (D) phase ·· Linear (ii) Molecular type ·· cDNA (ix) Features: (A) Name / Key: misc_Features (B) Position: 1..508 (D) Other information: / Note = "1 to 508 are -133- of Figure 5 Hsgr-21af (Please read the precautions on the back before filling this page) I 1. · r ------ Order. 噃Paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 509696 V. Description of the invention (131) -237 to 272 ', (xi) Sequence description: SEQID No. 7: TCTGGCCTCG GAACACGCCA TTCTCCGCGC CGCTTCCAAT AACCACTAAC ATCCCTAACG 60 AGCATCCGAG CCGAGGGCTC TGCTCGGAAA TCGTCCTGGC CCAACTCGGC CCTTCGAGCT 120 CTCGAAGATT ACCGCATCTA IJIIJI iJt IJIIJI fjl IJIIJI CTTTTTTTTC TTTTCGTAGC (GCAGATAAAG 180 TGAGCCCGGA AAGGGAAGGA GGGGGCGGGG ACACCATTGC CCTGAAAGAA TAAATAAGTA 240 AATAAACAAA CTGGCTCCTC GCCGCAGCTG GACGCGGTCG GTTGAGTCCA GGTTGGGTCG 300 GACCTGAACC CCTAAAAGCG GAACCGCCTC CCGCCCTCGC CATCCCGGAG CTGAGTCGCC 360 GGCGGCGGTG GCTGCTGCCA GACCCGGAGT TTCCTCTTTC ACTGGATGGA GCTGAACTTT 420 GGGCGGCCAG AGCAGCACAG CTGTCCGGGG ATCGCTGCAC GCTGAGCTCC CTCGGCAAGA 480 CCCAGCGGCG GCTCGGGATT TTTTTGGG 508 (2) Information of SEQ ID No. 8: (i) Sequence characteristics: (A) Length: 510 bases printed on the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (B) Type: Nucleic acid

(C) Stock: (D) Phase: (ii) Molecular type (ix) Features: (A) Name / Key: misc_features-134- This paper size applies Chinese National Standard (CNS) A4 specifications (210X 297) (Centimeter) 509696 A7 _B7_ V. Description of the invention (132) (B) Location: 1 · 510 4 (D) Other information · / Note = " 1 to 510 are -237 to 272 of Figure 5 Hsgr-21bf ,, (xi) sEQUENCE dESCRIPTION: SEQ ID No. 8: AATCTGGCCT CGGAACACGC CATTCTCCGC GCCGCTTCCA ATAACCACTA ACATCCCTAA 60 CGAGCATCCG AGCCGAGGGC TCTGCTCGGA AATCGTCCTG GCCCAACTCC GCCCTTCGAG * 120 CTCTCGAAGA TTACCGCATC TATTTTTTTT TTCTTTTTTT TCTTTTCCTA GCGCAGATAA 180 AGTGAGCCCG GAAAGGGAAG GAGGGGGCGG GGACACCATT GCCCTGAAAG AATAAATAAG 240 TAAATAAACA AACTGGCTCC TCGCCGCAGC TGGACGCGGT CGGTTGAGTC CAG ^ rTGGGT 3ϋ0 CGGACCTGAA CCCCTAAAAG CGGAACCGCC TCCCGCCCTC GCCATCCCGG AGCTGAGTCG 360 CCGGCGGCGG TGGCTGCTGC CAGACCCGGA GTTTCCTCTT TCACTGGATG GAGCTGAACT 420 TTGGGCGGCC AGAGCAGCAC AGCTGTCCGG GGAGAGCTGC ACGCTGAG CTCGCGCCCTCGCG Column characteristics: (A) Length: 1927 pcs printed on the basis of consumer cooperation with the Central Bureau of Standards of the Ministry of Economic Affairs (please read the notes on the back before filling this page) (B) Type · Single (D) phase: linear · (ii) Molecular type: cDNA, (ix) Features:-(A) Name / Key: CDS · -135- This paper size applies to China National Standard (CNS) A4 specifications (21 〇X297mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 509696 A7 ____B7 _ V. Description of Invention (133) (B) Location: 538.1.9262 (ix) Features: (A) Name / Key: misc (B) Location: 1.537 (D) Other information: / Note = " ί to 537 is -235 to 301 of 21acon in Fig. 5, (xi) Sequence description ·· SEQ ID No. 9 ··-TCTGGCCTCG GAACACGCCA TTCTCCGCGC CGCTTCCAAT AACCACTAAC ATCCCTAACG 60 AGCATCCGAG CCGAGGGCTC TGCTCGGAAA TCGTCCTGGC CCAACTCGGC CCTTCGAGCT 120 CTCGAAGATT ACCGCATCTA TTTTTTTTTT CTTTTTTTTC TTTTCCTAGC GCAGATAAAG 180 TGAGCC CTCG AGAGGAAGGAGA GGGGGCGGGCGCCGACC GGTTGGGTCG 300 GACCTGAACC CCTAAAAGCG GAACCGCCTC CCGCCCTCGC CATCCCGGAG CTGAGTCGCC 360 GGCGGCGGTG GCTGCTGCCA GACCCGGAGT TTCCTCTTTC ACTGGATGGA GCJTGAACTTT 420 GGGCGGCCAG AGCAGCACAG CTGTCCGGGG ATCGCTGCAC GCTGAGCTCC CTCGGCAAGA 480 CCCAGCGGCG GCTCGGGATT TTTTTGGGGG GGCGGGGACC AGCCCCGCGC CGGCACC 537 ATG TTC CTG GCG NCC CTG TAC TTC GCG CTG CCG CTC TTG GAC TTG CTC 585

Met Phe Leu Ala Xaa Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 1 5 10., 15 t CTG TCG GCC GAA GTG AGC GGC GGA GAC CGC CTG GAT TGC GTG AAA GCC 633

Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys Ala 20.. '25 30 * AGT GAT CAG TGC CTG AAG GAG CAG AGC TGC AGC ACC AAG TAC CGC ACG 681

Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 40 45 *. CTA AGG CAG TGC GTG GCG GGC AAG GAG ACC AAC TTC AGC CTG GCA TCC 729 ^ he \ i Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Ala Ser 50 55 * 60 GGC CTG GAG GCC AAG GAT GAG TGC CGC AGC GCC ATG GAG GCC CTG AAG 777

Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 75 80 -136- This paper size applies to China National Standard (CNS) A4 size (210X297 mm) (Please read the notes on the back before filling in (This page)

、 1T 509696 A7 B7 134 V. Description of the invention (CAG AAG TCG CTC TAC AAC TGC CGC TGC AAG CGG GGT ATG AAG AAG GAG 825 —ml · pack — (Please read the precautions on the back before filling this page)

Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu · 85 · 90 95 AAG AAC TGC CTG CGC ATT TAC TGG AGC ATG TAC CAG AGC CTG CAG GGA 873

Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly '100 105 110 AAT GAT CTG CTG GAG GAT TCC CCA TAT GAA CCA GTT AAC AGC AGA TTG 921

Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leu 115 120 125 Ref. TCA GAT ATA TTC CGG GTG GTC CCA TTC ATA TCA GAT GTT TTT CAG CAA 969

Ser Asp lie Phe Arg Val Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 135 140 GTG GAG CAC ATT CCC AAA GGG AAC AAC TGC CTG GAT. GCA GCG AAG GCC 1017

Val Glu His lie Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala 145 150 155 160 TGC AAC CTC GAC GAC ATT TGC AAG AAG TAC AGG TCG GCG TAC ATC ACC 1065

Cys Asn Leu Asp Asp lie Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 170 175 CCG TGC ACC ACC AGC GTG TCC AAC GAT GTC TGC AAC CGC CGC AAG TGC 1113

Pro Cys Thr Thr Ser Val Ser Asn Asp Val Cys Asn Arg Arg Lys Cys 180 185 190 'CAC AAG GCC CTC CGG CAG TTC TTT GAC AAG GTC CCG GCC AAG CAC AGC 1161

His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 4 195 200 205% TAC GGA ATG CTC TTC TGC TCC TGC .CGG GAC ATC GCC TGC ACA GA (3 CGG 1209

Tyr Gly Met Leu Phe Cys Ser Cys Arg Asplie Ala Cys Thr Glu Arg 210 215 · 220 AGG CGA CAG ACC ATC GTG CCT GTG TGC TCC TAT GAA GAG AGG GAG AAG 1257

Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Lys 225 230 235 240 CCC AAC TGT TTG AAT TTG CAG GAC TCC TGC AAG ACG AAT TAC, ATC TGC 1305

Pro Asn Cys Leu Asn Leu Gin Asp Ser Cya Lys Thr Asn Tyr lie Cys 245 250 1 255 AGA TCT CGC CTT GCG GAT TTT TTT ACC AAC TGC CAG CCA GAG TCA AGG 1353

Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260 265 · 270 TCT GTC AGC AGC TGT CTA AAG GAA AAG TAC GCT GAC TGC CTC CTC GCC 1401

Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280/285 -137- This paper size applies to Chinese national standards (CNS> A4 specification (210X297 mm) 509696 A7 B7 V. Description of the invention (135 Economy Printed by TCC TCG GGG CTT ATT GGC ACA GTC ATG ACC CCC AAC TAC 'ATA GAC TCC Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyrlle Asp Ser 290 295 300 AGT AGC CTC AGT GTG GCC CCA TGG TGT GAC TGC AGC AAC AGT GGG AAC Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 315 320 GAC CTA GAA GAG TGC TTG AAA TTT TTG AAT TTC TTC AAG GAC AAT ACA Asp Leu, Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr 325 330 335 • -V TGT CTT AAA AAT GCA ATT CAA GCC TTT GGC AAT GGC TCC GAT GTG ACC Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 GTG TGG CAG CCA GCC TTC CCA GTA CAG ACC ACC ACT GCC ACT ACC ACC Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 365 ACT GCC CTC CGG GTT AAG AAC AAG CCC CT G GGG CCA GCA GGG TCT GAG Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu * 370 375 380 AAT GAA ATT CCC ACT CAT GTT TTG CCA CCG TGT GCA AAT TTA CAG GCA Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 · 395 400 CAG AAG CTG AAA TCC AAT GTG TCG GGC AAT ACA CAC CTC TGT ATT TCC Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser 405 410, 415 AAT GGT AAT TAT GAA AAA GAA GGT CTC GGT GCT TCC AGC CAC ATA ACC Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His He Thr 420 '425 430 r ACA AAA TCA ATG GCT GCT CCT CCA AGC TGT GGT CTG AGC CCA CTG CTG Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu 435 440 445 GTC CTG GTG GTA AGC GCT CTG TCC ACC C ^ A TTA TCT TTA ACA GAA Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu 450 455 460, 138 This paper size applies to Chinese National Standard (CNS) A4 size (210X297 mm) 1449 1497 1545 1593 1641 1689 1737 1785 1833 1881 1926 1927 (Please read the precautions on the back before filling this page ) -Jill HI ^ i pack. Order-I # 509696 Printed by A7 B7 — 136 " '5. Invention description () (2) Information of SEQ ID No. 10: (i) Sequence characteristics:, (A) Length: 463 amino acids (B) Type: amino acid (D) Phase: linear

Cii) molecular type: protein (xi) sequence description: SEQ ID No. 10: a

Met Phe Leu Ala Xaa Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 1 5 10 15

Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lye Ma 20 25 30

Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lysi Tyr Arg Thr 35 40 45

Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Ala Ser 50 55 60 ►

Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 75 ‘· 80

Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 85 90 95

Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly 100 105 110

Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leu 11.5 12b 125

Ser Asp lie Phe Arg Val Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 135 ·· 140

Val Glu His lie Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala 145 150 155 160

Cys Asn Leu Asp Asp lie Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 170 175 -139- This paper size applies to China National Standard (CNS) A4 (21 OX297 mm) ϋ vm In Hal 1_1 ^ * ivl_l— n (Please read the precautions on the back before filling out this page) Order 509696 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention

Pro Cys Thr Thr Ser Val Ser Asn Asp Val Cys Asn Arg Arg Lys Cys 180 185 190

His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 195200 200 205

Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp lie Ala Cys Thr Glu Arg 210 215 220 Orders

Arg Arg Gin Thr lie Val Pro * Val Cys Ser Tyr Glu Glu Arg Glu Lys 225 230 · 235 240 9

Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys 245 250 255

Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260 265 270

Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285

Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr He Asp Ser 290 2.95300

Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 315 320

Asp Leu Glii Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr 325 330 335

Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350

Val Trp G.ln Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 365

Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370 375 380

Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 400

Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser 405 410 415

Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His lie Thr 420 425 430 r

Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu 435 440 445

Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu 450 455 460 · -140- This paper size applies to China National Standard (CNS) A4 size (210 X 297 mm) (Please read the precautions on the back before (Fill in this page)

1T 509696 A7 B7 V. Description of the invention (138) (2) Information of SEQ ID No. 11: (i) Sequence characteristics: (A) Length · 1929 base pairs (B) Type · Nucleic acid · ( C) Straightness · Single · · (D) Phase · · Linear * (ii) Molecular type: cDNA · ^ (ix) Features:

(A) Name / Key: CDS (B) Location: 540..1928 (ix) Features: (A) Name / Key: misc-features. (B) Location: 1. · 539 (D) Other information: / Note = "1 to 539 are -237 to 301 of 21bcon in Figure 5. (xi) Sequence description: SEQ ID No. 11 ... (Please read the precautions on the back before filling this page) One pack-

, 1T 4 Ministry of Economic Affairs Bureau of Standards staff consumer cooperative printed AATCTGGCCT CGGAACACGC CATTCTCCGC GCCGCTTCCA ATAACCACTA ACATCCCTAA 60 CGAGCATCCG AGCCGAGGGC TCTGCTCGGA AATCGTCCTG GCCCAACTCG GCCCTTCGAG 120 CTCTCGAAGA TTACCGCATC ΤΑΤΤΤΤΤΤΤΤ TTCTTTTTTT TCTTTTCCTA GCGCAGATAA. 180 AGTGAGCCCG GAAAGGGAAG GAGGGGGCGG GGACACCATT GCCCTGAAAG AATAAATAAG 240 TAAATAAACA AACTGGCTCC TCGCCGCAGC TGGACGCGGT CGGTTGAGTC CAGGTTGGGT 300 CGGACCTGAA CCCCTAAAAG CGGAACCGCC TCCCGCCCTC GCCATCCCGG aGCTGAGTCG 360 CCGGCGGCGG TGGCTGCTGC CAGACCCGGA GTTTCCTCTT TCACTGGATG GAGCTGAACT 420 TTGGGCGGCC AGAGCAGCAC AGCTGTCCGG GGATCGCTGC ACGCTGAGCT CCCTCGGCAA 480 GACCCAGCGG CGGCTCGGGA TTTTTTTGGG GGGGCGGGGA CCAGCCCCGC GCCGGCACC 539 -141- this paper scales applicable Chinese national standard (CNS) A4 size (21〇 'fire 297 mm ) 509696 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7. V. Invention Description (139) ^ ATG TTC CTG GCG ACC CTG TAC TTC GCG CTG CCG CTC TTG GAC TTG CTC 587 Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 1 5 10 15 CTG TCG GCC GAA GTG AGC GGC GGA GAC CGC • CTG GAT TGC GTG AAA GCC 635 Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys Ala, 20 25 4 30 AGT GAT CAG TGC CTG AAG GAG CAG AGC TGC AGC ACC AAG TAC CGC ACG 683 S.er Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 40 45 $ CTA AGG CAG TGC GTG GCG GGC AAG GAG ACC AAC TTC AGC • s # CTG GCA TCC 7 31 Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Ala Ser 50 55 60 GGC CTG GAG GCC AAG GAT GAG TGC CGC AGC GCC ATG GAG GCC CTG AAG 779 Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 75 80 CAG AAG TCG CTC TAC AAC TGC CGC TGC AGC CAG GGG ATG AAG AAG GAG 827 Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 85 90 90 95 AAG AAC TGC CTG CGC ATT TAC TGG AGC ATG TAC CAG AGC CTG CAG GGA 875 Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin 'Gly 100 105 110 AAT GAT CTG CTG GAG GAT TCC CCA TAT GAA CCA GTT AAC AGC AGA TTG 923 Asn Asp Leu Leu Glu Asp Ser Pro Tyr, Glu Pro Val Asn Ser Arg Leu 115 120 «125 TCA GAT ATA TTC CGG GTG GTC CCA TTC ATA TCA GAT GTT TTT CAG CAA 971 Ser Asp lie Phe Arg Val Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 135 140 GTG GAG CAC ATT CCC AAA GGG AAC AAC TGC CTG GAT GCA GCG AAG GCC 1019 Val Glu His lie Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala 145 150 155 160 TGC AAC CTC GAC GAC ATT TGC AAG AAG TAC AGG TCG GCG TAC ATC ACC 1067 Cys Asn Leu Asp Asp lie Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr. 165 170 * 175 CCG TGC ACC ACC AGC GTG TCC AAC GAT GTC TGC AAC CGC CGC AAG TGC 1115 Pro Cys Thr Thr Ser Val Ser Asn Asp Val Cys Asn Arg Arg Lys Cys 180 185 190 142 λ (Please read the notes on the back before filling out (This page) Order it This paper size is applicable to China National Standard (CNS) A4 specification (210X297 Gong ) 509696 A7 B7 V. Description of the invention (14C)) -143- This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page)

CAC AAG GCC CTC CGG CAG TTC TTT GAC AAG GTC CCG GCC AAG CAC AGC 1163 His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 195 200 205 TAC GGA ATG CTC TTC TGC TCC TGC CGG GAC ATC GCC TGC ACA GAG CGG 1211 Tyr Gly Met Leu Phe Cys Ser Cys Arg Asplie Ala Cys Thr Glu Arg 210 215 such as 220 AGG CGA CAG ACC ATC GTG CCT GTG TGC TCC TAT GAA GAG AGG GAG AAG 1259 Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Lys 225 230 235 240 CCC AAC TGT TTG ΑΛΤ TTG CAG GAC TCC TGC AGC ACG ΛΛΤ TAC ATC TGC 1307 Pro Asn Cys Leu Asn Leu Gin Asp Sex Cys Lys Thr Asn Tyr lie Cys 245 250 255 CGA TCT CGC GCG GAT TTT TTT ACC AAC TGC CAG CCA GAG TCA AGG 1355 Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260 265 270 TCT GTC AGC AGC TGT CTA AAG GAA AAC TAC GCT GAC TGC CTC CTC GCC 1403 Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 * TAC TCG G GG CTT ATT GGC ACA GTC ATG ACC CCC AAC TAC ATA GAC TCC 1451 Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr lie Asp Ser 290 295 300-AGT AGC CTC AGT GTG GCC CCA * TGG TGT GAC TGC AGC AAC AGT GGG AAC 1499 Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 315 320 GAC CTA GAA GAG TGC TTG AAA TTT TTG AAT TTC TTC ATC GAC AAT ACA 1547 Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr 325 330 335 TGT CTT AAA AAT GCA ATT CAA GCC TTT GGC AAT GGC TCC GAT GTG ACC 1595 Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr '' 340 345 350 GTG TGG CAG CCA GCC TTC CCA GTA CAG ACC ACC ACT GCC ACT ACC ACC 1643 Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 * 365 ACT GCC CTC CGG GTT AAG AAC AAG CCC CTG GGG CCA GCA GGG TCT GAG 1691 Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370 375 380 AAT GAA ATT CCC ACT C AT GTT TTG CCA CCG TGT GCA AAT TTA CAG GCA 1739 Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala · 385 390 395 400 Printed by A7B7 CAG AAG CTG AAA TCC AAT GTG TCG GGC AAT ACA CAC CTC TGT ATT TCC Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser 405 410 415 AAT GGT AAT TAT GAA AAA GAA GGT CTC GGT GCT TCC AGC CAC ATA ACC Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His He Thr 420 '425 430 ACA AAA TCA ATG GCT GCT CCT CCA AGC TGT GGT CTG AGC CCA CTG CTG Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu 5er Pro Leu Leu 435 440 445 . GTC CTG GTG GTA ACC GCT CTG TCC ACC CTA TTA TCT'TTA ACA GAA Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu .450 455 460 1787 1835 1883 1928

A 1929 Yin Gong Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs said (2) the information of SEQ ID No. 12: (i) sequence characteristics:. (A) length: 463 amino acids (B) type: amino acids. (D) Phase: Linear '(ii) Molecular type: Protein (xi) Sequence description— 丄 SEQ ID No. 12; Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 1 5 10 15 Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys Ala 20 25 .. 30 Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 40 · 45 *. Leu Arg Gin Cys Val Ala Gly Lys G1U Thr Asn Phe Ser Leu Ala Ser 50 55 60 Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 75 80 Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 85 90 95 Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly 100 105. 110 Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leu 115 120 125 -144- CNS) A4 size (210X297mm) (Please read the precautions on the back before filling this page) 50 9696 A7 B7 142 V. Description of the invention ()

Ser Asp lie Phe Arg Val Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 135 140 Val Glu His lie Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala 145 · 150 155 160 Cys Asn Leu Asp Asp lie Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 170. 175 * »Pro Cys Thr Thr Ser Val Ser Asn Asp Val Cys Asn Arg Arg Lys Cys 180 185 190, His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala liys His Ser 195 200 205 Tyr Gly Met Leu Phe Cys Ser Cys Arg Asplie Ala Cys Thr Glu Arg 210 215 220 Arg Arg Gin Thr He Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Lys 225 230 235 240 Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys 245 250 255 Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260. ^ 265 270 Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 · • · Tyr Ser Gly Leu lie Gly Thr Val Met, Thr Pro Asn Tyr lie Asp Ser 290 295 300, (Please read the notes on the back before filling out this page)

Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 315 320 Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr 325 330 335 Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 ..... 350 * Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 365 -145- This paper size applies to China National Standard (CNS) A4 specification (2 丨 OX297 (Mm) 509696 Α7 Β7 143 V. Description of the invention ()

Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser * Glu 370 375 * 380

Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 400

Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser 405 410 415

Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly'Ala Ser Ser His lie Thr · 420 425 430 • *

Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu 435 440 445 ^

Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu 450 455. · 460 1%% (2) Information of SEQ ID No. 13: (i) Sequence characteristics: (A) Length: 699 bases Yes. (B) Type ·· Nucleic acid (C) Strand: Single (D) Phase: Linear (ii) Molecular Type: cDNA · (ix) Features: * (A) Name / Key, misc-Featured Central Ministry of Economic Affairs 榡Printed by the staff of the quasi-bureau for cooperation (please read the notes on the back before filling out this page) (B) Position · 1 .. 699 (D) Other information: / Note = " 1 to 699 are shown in Figure 5 Hsgr- 29a of 814 to 1512 ·, (ix) Features: (A) Name / Key: CDS '(B) Location: 2 ·· 697 -146-This paper size applies to China National Standard (CNS) Α4 specification (210 × 297 mm) 509696 Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 —— 144 ^ 1 V. Description of the invention () (xi) Sequence description · SEQ ID No. 13: G TCG GCG TAC ATC ACC CCG TGC ACC ACC AGC GTG TCC AAT GAT GTC Ser Ala Tyr lie Thr Pro Cys Thr Thr Ser Val Ser Asn Asp Val 1 5 10 > 15 TGC AAC CGC CGC AAG TGC CAC AAG GCC CTC CGG C AG TTC TTT GAC AAG 94 Cys Asn Arg Arg Lys Cys His Lyo Ala Lou Arg Gin Pho Phd Aop Lyo 20 25 30 GTC CCG GCC AAG CAC AGC TAC GGA ATG CTC TTC TGC TCC TGC CGG GAC 142 Val Pro Ala Lys I: Is Ser Tyr Gly Met Leu Phe Cys Ser Cys Arg Acp 35 40 45 ATC GCC TGC ACA GAG CGG AGG CGA CAG ACC ATC GTG CCT GTG TGC TCC 190 lie Ala Cys Thr Glu Arg Arg Arg Gin Thr • lie Val Pro Val Cys Ser 50 55 60 TAT GAA GAG AGG GAG AAG CCC AAC TGT TTG AAT TTG CAG GAC TCC TGC 238 Tyr Glu Glu Arg Glu Lys Pro Asn Cys Leu Asn Leu G.ln Asp Ser Cys 65 70 75 AAG ACG AAT TAC ATC TGC AGA TCT CGC CTT GCG GAT TTT TTT ACC AAC 286 hya Thr Asn Tyr lie Cys Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn 80 85 90 95 TGC CAG CCA GAG TCA AGG TCT GTC AGC AGC TGT CTA AAG GAA AAC TAC. 334 Cys Gin Pro Glu Ser Arg Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr 100 105 110 GCT GAC TGC CTC CTC GCC TAC TCG GGG CTT ATT GGC ACA GTC ATG ACC 382 Ala Asp C ys Leu Leu Ala Tyr Ser Gly Leu He Gly Thr Val Met Thr 115 120 125 CCC AAC TAC ATA GAC TCC AGT AGC CTC AGT GTG GCC CCA TGG TGT GAC 430 Pro Asn Tyr lie Asp Ser Ser Ser Leu Ser Val Ala Pro Trp Cys Asp : 130 135 140 TGC AGC AAC AGT GGG AAC GAC CTA GAA GhG TGC 'TTG AAA Lys TTT TTG AAT 478 Cys Ser Asn Ser Gly Asn Asp Leu Glu. · Qlu Cys Leu Phe Leu Asn 145 150 < 155 TTC TTC AAG GAC AAT ACA TGT CTT AAA AAT GCA ATT CAA GCC TTT GGC 526 Phe Phe Lys Asp Asn Thr Cys Leu Lys Asn Ala He Gin Ala Phe Gly 160 165 170 175 -147- (Please read the notes on the back before filling this page) · The size of the paper is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 kl B7 V. Description of the invention (145) AAT GGC TCC GAT GTG ACC GTG TGG CAG CCA GCC TTC CCA GTA CAG ACC Asn Gly Ser Asp Val Thr Val Trp Gin Pro Ala Phe Pro Val Gin Thr 180 185 190 ACC ACT GCC GCT ACC ACC ACT GCC CTC.CGG GTT AAG AAC AAG CCC CTG Thr Thr Ala Ala Thr T hr Thr Ala Leu Arg Val Lys Asn Lys Pro Leu 195 200 ^ 205 GGG CCA GCA GGG TCT GAG AAT GAA ATT CCC ACT CAT GTT TTG CCA CCG Gly Pro Ala Gly Ser Glu Asn Glu He Pro Thr His Val Leu Pro Pro 210 215. 220 TGT GCA AAT TTA CAG GCA CAG AAG CTG AA Cys Ala Asn Leu Gin Ala Gin Lys Leu * 225 230 ^ (2) Information of SEQ ID No. 14: (i) Sequence characteristics: (A) Length: 232 amino groups Acid (B) Type: Amino Acid (D) Phase: Linear (ii) Molecular Type: Protein (xi) Sequence Description · SEQ ID No. 14: (Please read the notes on the back before filling this page)

In —m I * I in, · i binding · bookbinding: t Central Standards Bureau. Staff, printed by the Industrial and Consumer Cooperatives

Ser Ala Tyr lie Thr Pro Cys Thr Thr Ser Val Ser Asri Asp Val Cys 1 5. 10 15

Asn Arg Arg Lys Cys His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val 20 25 30

Pro Ala Lys His Ser Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp lie 35. 4 5

Ala Cys Thr Glu Arg Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr 50 55

Glu Glu Arg Glu Lys Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lys 65 70 75 80

* I

Thr Asn Tyr lie Cys Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys 85 90 95

Gin Pro Glu Ser Arg Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala 100 105 110 -148 This paper size is applicable to China National Standard (CNS) 8 4 specifications (210 X 297 mm) 4 509696 A7B7 V. Description of the invention (146 )

Asp Cys Leu Leu Ala Tyr Ser Gly Leu He Gly Thr Val Met Thr Pro 115 120 125

Asn Tyr lie Asp Ser Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys 130 135 140

Ser Asn Ser Gly Asn Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe 145 150 155 160

Phe Lys Asp Asn Thr Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn 165 170 175

Gly Ser Asp Val Thr Val Trp Gin Pro Ala Phe Pro Va ^ l Gin Thr Thr 180 185 190 1 '

Thr Ala Ala Thr Thr Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly 195 200 205

Pro Ala Gly Ser Glu Asn Glu lie Pro Thr His Val Leu Pro Ρχ · 〇 Cys 210 215 220.

Ala Asn Leu Gin Ala Gin Lys Leu 225 230 (Please read the precautions on the back before filling out this page); order · (2) the information of SEQ ID No. 15: (i) sequence characteristics: (A) length ·· 2157 base-pair (B) types · Nucleic acid (C) Strand: single '(D) phase · Linear (ii) Molecular type: cDNA * (ix) Features:

(A) Name / Key ·· CDS (B) Location: 2 ·· 886 -149- This paper size applies to Chinese National Standard (CNS) Α4 specification (210X297 ^^ · d Printed by the Central Consumers Bureau of the Ministry of Economic Affairs Consumer Cooperatives 509696 A7 B7 V. Description of the invention (147 (ix) Features: (A) Name / Key: misc-features (B) Location: 1. .2157 # (0) Other information: / Note =, '1 to 2157 are shown in Figure 5 29 1) 1 ^ of 814 to 2971, (·) (xi) sequence description: SEQ ID No. 15: (Please read the note on the back to print G TCG GCG TAC ATC ACC CCG TGC ACC ACC AGC GTG TCC AAT GAT GTC Ser Ala Tyr lie Thr Pro Cys Thr Thr Ser Val Ser Asn Asp Val 1 '5 10 15 TGC AAC CGC CGC AAG TGC CAC AAG GCC CTC CGG CAG TTC TTT GAC AAG Cys Asn Arg Arg Lys Cys His Lys Ala Leu Arg Gin Phe Phe Asp Lys 20 25 30 GTC CCG GCC AAG CAC AGC TAC GGA ATG CTC TTC TGC TCC TGC CGG GAC Val Pro Ala Lys His Ser Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp 35 40 · 45% -ATC GCC TGC ACA GAG CGG AGG CGA CAG ACC ATC GTG CCT GTG TGC TCC lie Ala Cys Thr Glu Arg Arg Arg Gin Thr lie Val Pro Val Cys Ser 50 55 60 TAT GAA GAG AGG GAG AAG CCC AAC TGT TTG AAT TTG CAG GAC TCC TGC Tyr Glu Glu Arg Glu Lys Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys 65 70 75 AAG: ACG AAT TAC ATC TGC AGA TCT CGC CTT GCG GAT TTT TTT ACC AAC Lys Thr Asn Tyr lie Cys Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn 80 85 .90 95 TGC CAG CCA GAG TCA AGG TCT GTC AGC AGC TGT CTA AAG GAA AAC TAC Cys Gin: Pro Glu Ser Arg Ser Val ^ Ser Ser Cys Leu Lys Glu Asn Tyr 100 '· 105 110 GCT GAC TGC CTC CTC GTC TAC TCG GGG CTT ATT GGC ACA GTC ATG ACC Ala Asp Cys Leu Leu Ala Tyr Ser Gly Leu lie Gly Thr Val Met Thr 115 120, · 125 CCC AAC TAC ATA GAC TCC AGT AGC CTC AGT GTG GCC CCA TGG TGT GAC 'Pro Asn Tyr lie Asp Ser Ser Ser Leu Ser Val Ala Pro Trp Cys Asp, 130 135 140 46 94 142 190 238 286 334 382 430 —0 • Refill the items. Loading-: write this page), ιτ • input · -150 This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 A7 B7 V. Description of invention () Staff consumption of Central Bureau of Standards, Ministry of Economic Affairs Printed by the cooperative TGC AGC AAC AGT GGG AAC GAC CTA GAA GAG TGC TTG AAA TTT TTG AAT 47 8 Cys Ser A ^ n Ser Gly Asn Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn 145 150 155, TTC TTC AAG GAC AAT ACA TGT CTT AAA AAT GCA ATT CAA GCC TTT GGC 526 Phe Phe Lys Asp Asn Thr Cys Leu Lys Asn Ala lie Gin Ala Phe Gly 160 165 170 175 AAT GGC TCC GAT GTG ACC GTG TGG CAG CCA GCC TTC CGA GTA CAG ACC 574 Asn Gly Ser Asp Val Thr Val Trp Gin Pro Ala Phe Pro Val Gin Thr 180 185 190 ACC ACT GCC GCT ACC ACT ACT GCC CTC CGG GTT AAG AAC AAG CCC CTG 622 Thr Thr Ala Ala.Thr Thr Thr Ala Leu Arg Val Lys Asn Lys Pro Leu 195 200 205 GGG CCA GCA GGG TCT GAG AAT GAA ATT CCC ACT CAT GTT TTG CCA CCG 670 Gly Pro Ala Gly Ser Glu Asn Glu lie Pro Thr His Val Leu Pro, Pro210 210 215, 220 * TGT GCA AAT TTA CAG GCA CAG AAG CTG AAA TCC AAT GTG TCG GGC AAT 718 Cys Ala Asn Leu Gin Ala Gin Lys Leu Lys Ser Asn Val Ser Gly Asn 225 230 235 ACA CAC CTC TGT ATT TCC AAT GGT AAT TAT4GAA AAA * GAA GGT * CTC GGT 766 Thr His Leu Cys lie Ser Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly 240 245 250 255 GCT TCC AGC CAC ATA ACC. ACA AAA TCA ATG GCT GCT CCT CCA AGC TGT 814 Ala Ser Ser His lie Thr Thr Lys Ser Met Ala Ala Pro Pro Ser Cys 260 265. 270 GGT CTG AGC CCA CTG CTG GTC CTG GTG GTA ACC GCT CTG TCC ACC CTA 862 Gly Leu Ser Pro Leu Leu Val Leu Val Val Thr Ala Leu Ser Thr Leu 275 .280, 285 • TTA TCT TTA ACA GAA ACA TCA TAG CTGCATTAAA AAAATACAAT ATGGACAT 916 Leu Ser Leu Thr Glu Thr Ser * 290 295 · AAAAAGACAA AAACCAAGTT ATCTGTTTCC TGT ^ TCTCTTG TATAGCTGAA ATTCCAGTTT 976 AGGAGCTCAG * TTGAGAAACA GTTCCATTCA ACTGGAACAT TTTTTTTTTT CCTTTTAAGA 1036 AAGCTTCTTG TGATCCTTCG GGGCTTCTGT GAAAAACCTG ATGCAGTGCT CCATCCAAAC 1096 'TCAGAAGGCT TTGGGATATG CTGTATTTTA AAGGGACAGT TTGTAACTTG GGCTGTAAAG 1156 CAAACTGGGG CTGTGTTTTC GATGATGATG ATCATCATGA TCATGATNNN ΝΝΝΙ ^ ΝΝΝΝΝΝ 1216 WNNNNNNNN NNNNNNNNNN NNNNNNGATT TTAAGAGTTT TACTTCTGGC CTTTCCTAGC 1276 -151-This paper size applies to the Chinese National Standard (CNS) A4 specification (21 OX297 mm) (please read the back first) Note then fill page) 509696 Α7Β7 invention described five (149) TAGAGAAGGA GTTAATATTT CTAAGGTAAC TCCCATATCT CCTTTAATGA CATTGATTTC 1336 TAATGATATA AATTTCAGCC TACATTOATC CCAAGCTTTT TTCCCACAAA ClAACiATTCTT 1.39 6 ACCAAGAGTG GGCTTTGTGG AAACAGCTGG TACTGATGTT CACCTTTATA TATGTACTAG 1456 CATTTTCCAC GCTGATGTTT ATGTACTGTA AACAGTTCTG CACTCTTGTA CAAAAGAAAA 1516 AACACCTGTC ACATCCAAAT ATAGTATCTG TCTTTTCGTC AAAATAGAGA GTGGGGAATG 1576 AGTGTGCCGA TTCAATACCT CAATCCCTGA ACGACACTCT CCTAATCCTA AGCCTTACCT 1636 GAGTGAG ^ JVG CCCTTTACCT AACAAAAGTC CAATATAGCT GAAATGTeGC TCTAATACTC 1696 TTTACACATA TGAGGTTATA TGTAGAAAAA AATTTTACTA CTAAATGATT TCAACTATTG 1756 GCTTTCTATA TTTTGAAAGT AATGATATTG TCTCATTTTT TTACTGATGG TTTAATACAA 1816 AATACACAGA GCTTGTTTCC CCTCATAAGT AGTGTTCGCT CTGATATGAA CTTCACAAAT 1876 * ACAGCTCATC AAAAGCAGAC TCTGAGAAGC CTCGTGCTGT AGCAGAAAGT TCTGCATCAT 1936 GTGACTGTGG ACAGGCAGGA GGAAACAGAA CAGACAAGCA TTGTCTTTTG TCATTGCTCG 1996 AAGTGCAAGC GTGCATACCT GTGGAGGGAA CTGGTGGCTG CTTGTAAATG TTCTGCAGCA 2056 T CTCTTGACA CACTTGTCAT GACACAATCC AGTACCTTGG TTTTCAGGTT ATCTGACAAA 2116 GGCAGCTTTG ATTGGGACAT GGAGGCATGG GCAGGCCGGA A, 2157 (2) SEQ ID No. 16 Information: (i) Sequence characteristics · (A) Length · 295 amino acids (B) Type: Basic acid '(D) phase: linear (ii) molecular type · protein · (xi) sequence description: SEQ ID No. 16: Ser Ala Tyr lie Thr Pro Cys Thr Thr Ser Val Ser Asn Asp Val Cys 1 5 10 15 ·· * I Asn Arg Arg Lys Cys His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val 20 25 30 0 vm ——I— mm One Pack · Order-152- * 11! 1 m This paper size applies to Chinese national standards ( CNS) A4 specification (2ί〇 × 297 mm) 509696 Printed by A7 B7 150 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

Pro Ala Lys His Ser Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp lie 35 40 45

Ala Cys Thr Glu Arg Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr 50 55 * 60

Glu Glu Arg Glu Lys Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lys 65 70. 75 80

Thr Asn Tyr lie Cys Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys 85 .90 95

Gin Pro Glu Ser Arg Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala 100 '105 ^ 110

Asp Cys Leu Leu Ala Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro 115 120 125 ， Asn Tyr He Asp Ser Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys 130 135 140

Ser Α3Π Ser Gly Asn Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe 145 150 * 155 160

Phe Lys Asp Asn Thr Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn 165 170 〃 175%

Gly Ser Asp Val Thr Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr 180 185 190

Thr Ala Ala Thr Thr Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly 195 200 205

Pro Ala Gly Ser Glu Asn Glu lie Pro Thr His Val Leu Pro Pro Cys 210 215 220 *

Ala Asn Leu Gin Ala Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr 225 230 * 235 240

His Leu Cys lie Ser Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala 245. 250 255

Ser Ser His lie Thr Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly 260 26 * 5 270

Leu Ser Pro Leu Leu Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu 275 280 285

Ser Leu Thr Glu Thr Ser ★ 290 295 -153- This paper size applies to China National Standard (CNS) A4 (210X297 mm) --- β ^ II (Please read the precautions on the back before filling this page), 1T 509696 A7 B7 151 V. Description of the invention () (2) Information of SEQ ID No. 17: (i) Sequence characteristics · (A) Length: 659 base pairs (B) Type: Nucleic acid (C) Stock: Single and (D) phases: linear (ii) Molecular type: cDNA " (ix) Features:

(A) Name / Key: CDS% (B) Location: 2..658. (Ix) Features:, (A) Name / Key: misc_ Features · '(B) Location · 1 · 659 (D ) Other information: / Note =, 1 to 659 are Figures 1033 to 1691 of Hsgr-21ar "(xi) Sequence description · SEQ ID 17f tiger: • G AAT TTG CAG GAC TCC TGC AAG ACG * AAT TAC ATC TGC AGA TCT CGC 46

Asn Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys Arg Ser Arg 1 5 .10 15 Printed by the Central Consumers' Association of the Ministry of Economic Affairs # Associate Bureau (Please read the notes on the back before filling out this page) CTT GCG GAT TTT TTT ACC AAC TGC CAG CCA GAG TCA AGG TCT GTC AGC 94

Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg Ser Val Ser 20 25 30 AGC TGT CTA AAG GAA AAC TAC GCT GAC TGC CTC CTC GCC TAC TCG GGG 142

Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala Tyr Ser Gly 35 40 45 -154- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 male thin) 509696 A7B7 V. Description of the invention (1-52 CTT ATT GGC ACA GTC ATG ACC CCC AAC TAC * ΑΤΑ GAC TCC AGT AGC CTC Leu lie Gly Thr Val Met Thr Pro Asn Tyr lie Asp Ser, Ser Ser Leu 50 55 60 AGT GTG GCC CCA TGG TGT GAC TGC AGC AAC AGT GGG AAC GAC CTA GAA Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn Asp Leu niu. 65 70 75 GAG TGC TTG AAA TTT TTG AAT TTC TTC AAG GAC AAT * ACA TGT CTT AAA Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr Cys Leu Lys 80 85 * 90 95 AAT GCA ATT CAA GCC TTT GGC AAT GGC TCC GAT GTG ACC'GTG TGG CAG Asn. Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr Val Trp Gin 100 105 110 CCA GCC TTC CCA GTA CAG ACC ACC ACT GCC ACT ACC ACC ACT GCC CTC Pro Ala Phe Pro Val Gin. Thr Thr Thr Ala Thr Thr Thr Thr Ala Leu 115 120 CGG GTT AAG AAC AAG CCC CTG GGG CCA GCA GGG TCT GAG AAT GAA ATT Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu Asn Glu lie 130 135 * 140 «'.CCC ACT CAT GTT TTG CCA CCG TGT GCA AAT TTA CAG GCA CAG AAG CTG Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala Gin Lys Leu 145; -150 .. 155 AAA AAA TCC AAT GTG TCG GGC AAT ACA CAC CTC TGT ATT TCC AAT GGT AAT Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser Asn Gly Asn 160 165 170 175 190 238 286 334 382 430 478 526 Read the note on the back and reprint it printed by TAT GAA AAA GAA GGT CTC GGT GCT TCC AGC CAC ATA ACC ACA AAA TCA Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His Worker Thr Thr Lys Ser 180 185 190 ATG GCT GCT CCT CCA AGC TGT GGT CTG AGC CCA CTG CTG GTC CTG GTG Me Ala Ala Pro Pro Ser Cys Gly Leu * Ser Pro Leu Leu Val Leu Val 195 200 t 205 GTA ACC GCT CTG TCC \ CC CTA TTA TCT TTA ACA GAA A Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu 210 215 574 622 659

I -155- This paper size applies to Chinese National Standard (CNS) A4 (210 X 297 mm) 509696 A7 B7 V. Description of the invention (153) (2) Information of SEQ ID No. 18: (i) Sequence characteristics: (A) Length: 219 amino acids (B) Type: amino acid (D) Phase: linear ~ (ii) Molecular type: protein (xi) Sequence description: SEQ ID No. 18 · Central Bureau of Standards, Ministry of Economic Affairs Printed by Employee Consumer Cooperative

Asn Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys Arg Ser Ajl ^ Leu 1 5 10 15 Ala Asp Phe Phe Thr Asn Cys Gin Pro Olu Ser Arg Ser Val Ser Ser 20 25 30 Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala Tyr Ser Gly Leu 35 40 45 lie Gly Thr Val Met Thr Pro Asn Tyr lie Asp Ser Ser Ser Leu Ser 50 55 60 Val * Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn Asp Leu Glu Glu 65 70. 75 * 80 Cys Leu Lys Phe Leu Asn Phe Phe Lys * Asp Asn Thr Cys Leu Lys Asn 85 90 '95 Ala lie Gin Ala Phe Gly Asn Qly Ser Asp Val Thr Val Trp Gin Pro 100 105 110 t Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr Thr Ala Leu Arg 115 120 125 Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu Asn Glu lie Pro 130 135 140 Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala Gin Lys Leu Lys 145 150 155 160 Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser Asn Gly Asn Tyr 165 170 175 (Please read the notes on the back before filling this page)

、 1T it -156- This paper size is applicable to 5 national standards (CNS) A4 specifications (210X297 mm) 509696 A7 * B7 " 154 V. Description of the invention ()

Glu Lys Glu Gly Leu Gly Ala Ser Ser His lie Thr Thr Lys Ser Met 180 185 190

Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu Val Leu Val Val 195 200 20S% Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu 210 215 (2) Information of SEQ ID No. 19: '(i) Sequence characteristics : &Quot; (A) Length: 63 ℃ bases. (B) Type: Nucleic acid (C) Stranded. · Single. (D) Phase: Linear (ii) Molecular type: cDNA. (Ix) Features ·· (A) Name / Key: CDS.:, (B) Location: 3. .629 · (ix) Features: (A) Name / Key: miscj ^ color (B) Location: 1. .630 Central Bureau of Standards, Ministry of Economic Affairs Printed by the employee's consumer cooperative (please read the precautions on the back before filling this page) (D) Other information ·· / Note = “1 to 630 are shown in Figure 5 Hsgr-21b: r from 1062 to 1691” (xi) Sequence description : SEQID No. 19: AC ATC TGC AGA TCT CGC CTT GCG GAT TTT TTT ACC AAC TGC CAG CCA 47 lie Cys Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro 1 5 10 15 " " GAG TCA AGG TCT GTC AGC AGC TGT CTA AAG GAA AAC TAC GCT GAC TGC 95

Glu Ser Arg Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys 20 25 30 -157 · This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) · 509696 A7 B7 Employees of the Central Bureau of Standards, Ministry of Economic Affairs ♦ Consumer cooperation 衽 Printing V. Description of invention () CTC CTC GCC TAC TCG GGG CTT ATT GGC ACA GTC ATG ACC CCC AAC TAC 143

Leu Leu Ala Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr 35 40 45 ATA GAC TCC AGT AGC CTC AGT GTG GCC CCA TGG TGT GAC TGC AGC AAC 191 lie Asp Ser Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn 50 55 60 AGT GGG AAC GAC CTA GAA GAG TGC TTG AAA TTT TTG AAT TTC TTC AAG 239

Ser Gly Asn Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys 65 70 75 * 'GAC AAT AC A TGT CTT AAA AAT GCA ATT CAA GCC TTT GGC ΑΛΤ GGC TCC 2 87

Asp Asn Thr Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser 80 85. 90 95 GAT GTG ACC GTG TGG CAG CCA GCC TTC CCA .GTA CAG ACC ACC ACT GCC 335

Asp Val Thr Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala 100 105 110 ACT ACC ACC ACT GCC CTC CGG GTT AAG AAC AAG CCC CTG GGG CCA GCA 3 83

Thr Thr Thr Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala 115 120 125 GGG TCT GAG AAT GAA ATT CCC ACT · CAT GTT TTG CCA CCG TGT GCA AAT 431

Gly Ser Glu Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn, 130 · 135 140 TTA CAG GCA CAG AAG CTG AAA TCC AAT GTG TCG GGC AAT ACA CAC CTC 479

Leu Gin Ala Gin Lys Leu Lys Ser Asn -Val Ser Gly Asn Thr His Leu 145 150 '155 TGT ATT TCC AAT GGT AAT TAT .GAA AAA GAA GGT CTC GGT GCT TCC AGC 527

Cys lie Ser Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser 160 165 170 175 r · CAC ATA ACC ACA AAA TCA ATG GCT GCT CCT CCA AGC TGT GGT CTG AGC '575

His Worker Thr Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser 180 185 190 * CCA CTG CTG GTC CTG GTG GTA ACC GCT CTG TCC ACC CTA TTA TCT TTA 623

Pro Leu Leu Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu .195 200, 205 ACA GAA A * 630 z Thr Glu -158- This paper size applies to China National Standard (CNS) A4 (210X297 mm)- ---. 1.- ----- Approved clothing _ II-......... I ding ______ (Please read the precautions on the back before filling This page) 509696 A7 B7 V. Description of the invention (156 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (2) Information of SEQ ID No. 20: (i) Sequence characteristics · (A) Length · 209 amines Basic acid '(B) Type: Amino acid (D) Phase: Linear (ii) Molecular type: Protein (xi) Sequence description: SEQ ID No. 20: β Cyle Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu 1 5 10 15 Ser Arg Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu 20 25 '30 Leu Ala Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr lie 35 40 45 Asp Ser Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser 50 55 60, Gly Asn Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp 65 70 75 80 Asn Thr Cys Leu Lys AsnAla lie Gin Ala Phe Gly Asn Gly Ser Asp 85 90 95 Val Thr Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr 100 105 110, Thr Thr Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly 115 120 125 Ser Glu Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu: 130 135. 140 Gin Ala Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys 145 150 .. 155 160 lie Ser Asn Gly Asn Tyr Glu Lys Glu .Gly Leu Gly Ala Ser Ser His 165 170 175% lie Thr Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro 180 185 · 190 Leu Leu Val Leu Val Val Thr Ala Leu * Ser Thr Leu Leu Seru Leu Thr 195 200 205 '

Glu -159- This paper size is in accordance with Chinese National Standard (CNS) A4 (210 X 297 mm) (Please read the precautions on the back before filling out this page) i Packing · 4 509696 A7B7 Staff Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs Print i «; 7 V. Description of the invention (). (2) Information of SEQ ID No. 21: (i) Sequence characteristics: (A) Length: 1075 base pairs (B) Type: Nucleic acid (C) (D) Phase: Linear (ii) Molecular type · cDNA (ix) Features: (A) Name / Key · CDS (B) Location · 2..445. (Ix) Features : (A) Name / Key: misC-features · (B) Location: 1 ·· 1075 1 (D) Other information: / Note = " 1 to 1075 is from Fig. 5 Hsgr-2 to 1255 to 2333 " (xi) Sequence description · SEQ ID No. 21: T GGG AAC GAC CTA GAA GAG TGC TTG AAA TTT TTG AAT TTC TTC AAG Gly Asn Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys 1 5 10 15 GAC AAT.ACA TGT CTT AAA AAT GCA ATT CAA GCC TOT * GGC AAT GGC TCC Asp Asn Thr Cys Leu Lys Asn Ala lie Gin Ala Phe, Giy Asn Gly, Ser 20 25 s 30 GAT GTG ACC GTG TGG CAG CCA GCC TTC CCA GTA CAG AC C ACC ACT GCC Aspt Val Thr Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala 35 40 45 ACT ACC ACC ACT GCC CTC CGG GTT AAG AAC ^ AAG CGC CTG GGG CCA GCA JThr Thr Thr Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly, Pro Ala 50 * 55 60 -160-46 94 190 (Please read the notes on the back before filling out this page) 1-1-- 1-B- 三-I mi n 1- ^ .. .... Jn. 1 ^ 1 mjm · The size of the paper for binding and binding is applicable to the Chinese National Standard (CNS) Α4 specification (210X297 male and thin) 509696 Printed by A7 ______B7 of the Consumer Cooperatives of the Central Procurement Bureau of the Ministry of Economic Affairs 158) GGG TCT GAG AAT GAA ATT CCC ACT CAT GTT TTG CCA CCG TGT GCA AAT 4 238

Gly Ser Glu Asn Glu lie Pro Thr His Val 'Leu Pro.Pro Cys Ala. Asn 65 70 75 TTA CAG GCA CAG AAG CTG AAA TQC AAT GTG TCG GGC AAT ACA CAC CTC 286

Leu Gin Ala Glri Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu 80 85 90 95, TGT ATT TCC AAT GGT AAT TAT GAA AAA GAA GGT CTC GGT GCT TCC AGC JJ4

Cys lie Ser Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser 100 105 110 CAC ATA ACC ACA ΛΛΛ TCA ATG GCT GCT t: CT CCA AGC TGT GGT CTG Eight GC 302

His lie Thr Thr Lys Sei Met Ala Ala Pro Pro Ser Cys Gly Leu Ser 115. 120 125 CCA CTG CTG GTC CTG GTG GTA ACC GCT CTG · TCC ACC CTA TTA TCT TTA 430

Pro Leu Leu Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu 130 135 '140. ACA GAA ACA TCA TAG CTGCATTAAA AAAATACAAT ATGGACATGT AAAAAGACAA 485

Thr Glu Thr Ser ★ 145. * · AAACCAAGTT ATCTGTTTCC TGTTCTCTTG TATAGCTGAA ATTCCAGTTT AGGAGCTCAG 545 TTGAGAAACA GTTCCATTCA ACTGGAACAT TTTTTTTTTT CCTTTTAAGA AAGCTTCTTG 605 TGATCCTTCG GGGCTTCTGT GAAAAACCTG ATGCAGTGCT. CCATCCAAAC TCAGAAGGCT 665 TTGGGATATG CTGTATTTTA AAGGGACAGT TTGTAACTTG GGCTGTAAAG CAAACTGGGG 725 CTGTGTTTTC GATGATGATG ATCATCATGA TCATGATNNN NNNNNNNNNN NNNNNNNNNN 785 NNNNNNNNNN NNNNNNGATT TTAACAGTTT TACTTCTGGC CTTTCCTAGC TAGAGAAGGA 845 GTTAATATTT CTAAGGTAAC TCCCATATCT CCTTTAATGA CATTGATTTC TAATGATATA 905 AATTTCAGCC TACATTGATG CCAAGCTTTT TTGCCACAAA GAAGATTCTT ACCAAGAGTG 965 miscellaneous 〆GGCTTTGTGG AAACACCTGG TACTGATGTT CACCXTTATA TATGTACTAG * CATTTTCCAC 1025% GCTGATGTTT ATGTACTGTA AACAGTTCTG CACTCTTGTA CAAAAGAAAA 1075 -161 - this paper scale applicable Chinese national standard (CNS) A4 size (210X297 Mm) 丨 ------------------------- IT ------ Φ (Please read the notes on the back before filling this page) 509696 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs V. Invention Description (159) (2 ) Information of SEQ ID No. 22: (i) Sequence characteristics ... (A) Length: 148 amino acids (B) Type: amino acid (D) Phase: linear ^ (ii) Molecular type: protein (xi ) Sequence description: SEQID No. 22:

Gly Asn Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp 1 5 10 15

Asn Thr Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp 20. 25 30 ·

Val Thr Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr 35 40 45

Thr Thr Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly 50 55, 60

Ser Glu Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu 65 70 75 80

Gin Ala Gin Lys Leu Lys Ser Asn Val 3er Gly Asn Thr His Leu Cys 85 r '90 95 lie Ser Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His 100 105 110 Worker Thr Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro .115 120 125

Leu Leu Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr • 130 135 140

Glu Thr Ser * ·, 145 -162,-This paper size applies to China National Standard (CNS) (210X297mm) ............... 璗 | .i ----- 1 1— ..................... lili 1 .......----- ...... I--== === ----.......: iii ..................---I I-===-I— .... ............ 1 ...... (Please read the notes on the back before filling in this Page) 509696 A7 B7 V. Description of the invention (16) (2) Information of SEQ ID No. 23 (i) Sequence characteristics:

(A) Length: 1059 base pairs (B) Type: Nucleic acid (C) Strand: Single (D) Phase: Linear (ii) Molecular type:: cDNA (ix) Features: (A) Name / Key: CDS, · (B) Location ·· 3 · .428. (Ix) Features: (A) Name / Key: misc_ Features, (B) Location: 1. .1059 (D) Other information: / Note = & quot 1 to 1059 are shown in Figure 5 Hsgr-9 • 1272 to 2330 "(xi) Sequence description · SEQID No. 23: (Please read the precautions on the back before filling this page)

Printed by AG TGC TTG AAA TTT TTG AAT TTC TTC AAG GAC AAT ACA TGT CTT AAA 47% Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr Cys Leu Lys 1 5 *. 10 15 鬌 • 4 AAT GCA ATT CAA GCC TTT GGC AAT GGC TCC * GAT GTG ACC 'GTG TGG CAG 95 Asn Ala lie Gin Ala Phe Gly .Asn Gly Ser Asp Val Thr Val Trp Gin. 20 25 30 CCA GCC TTC CCA GTA CAG ACC ACC ACT GCC ACT ACC ACC ACT GCC CTC Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr Thr Ala Leu 35 40 45 CGG GTT AAG AAC AAG CCC CTG GGG CCA GCA GGG TCT GAG AAT GAA ATT Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu Asn Glu lie 50 55 60 143 191 163 This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X: 297 mm) 509696 A7 __B7 V. Description of the invention (161) Economy Printed by CCC ACT CAT GTT TTG CCA CCG TGT GCA AAT TTA CAG GCA CAG AAG CTG 239 Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala Gin Lys Leu 65 70 75 AAA TCC AAT GTG TCG GGC ΛΑΤ ACA CAC CT C TGT ATT TCC AAT GGT AAT 2 87 Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser Asn Gly Asn 80 85-90 95 TAT GAA AAA GAA GGT CTC GGT GCT TCC AGC CAC ATA ACC ACA AAA TCA 335 Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His lie Thr Thr Lys Ser 100 105 '110. _ ATG GCT GCT CCT CCA AGC TGT GGT CTG AGC CCA CTG CTG GTC CTG GTG 383 Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu.Leu Val Leu Val 115 120 125 GTA ACC GCT CTG TCC ACC CTA TTA TCT TTA ACA GAA ACA TCA TAG 428 Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu Thr Ser ★ 130 135 140. CTGCATTAAA AAAATACAAT ATGGACATGT AAAAAGACAA AAACCACTTT TACT ATTCCAGTTT AGGAGCTCAG TTGAGAAACA GTTCCATTCA 548 ACTGGAACAT TTTTTTTTTT TCCTTTTAAG AAAGCTTCTT GTGATCCTTT GGGGCTTCTG 608 TGAAAAACCT GATGCAGTGC TCCATCCAAA * CTCAGAAGGC TTTGGGATAT GCTGTATTTT 668 AAAGGGACAG TTTGTAACTT GGGCTGTAAA GCAAACTGGG GCTGTGTTTT CGATGATGAT 728 GATGATCATG ATGATGATCA TCATGATCAT GATGATGATC ATCATGATCA TGATGATGAT 788 * / * · ·. · TTTAACAGTT TTACTTCTGG CC TTTCCTAG CTAGAGAAGG AGI ^ TAATATT TCTAAGGTAA 848 • * · h CTCCCATATC TCCTTTAATG ACATTGATTT CTAATGATAT AAATTTCAGC CTACATTGAT 908 GCCAAGCTTT TTTGCCACAA AGAAGATTCT TACCAAGAGT GGGCTTTGTG GAAACAGCTG 968 ·· · · GTACTGATGT TCACCTTTAT ATATGTACTA GCATTTTCCA CGCTGATGTT TATGTACTGT 1028 AAACAGTTCT GCACTCTTGT ACAAAAGAAA A 1059 -164- This paper applies China National Scale Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page) ¾ Order I · V. Description of the invention (162 Β7 U) SEQ iD No. 24: (Please Read the notes on the back before filling this page) (0 sequence features: (A) Length · 142 amino acids (B) Type: Amino acid (D) Phase: Linear & (ϋ) Molecular type: Protein Ui) Sequence description: SEQ ID No. 24

Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr Cys Leu Lys Asn 1 5 10 15

Ala He Gin Ala Phe Gly Asn Gly Ser Asp Val Thr. Val Trp Gin Pro 20 25 * 30

Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr Thr Ala Leu Arg 35 40 45

Val Lys Asn Lys ProLeu Gly Pro Ala Gly Ser Glu Asn G1U lie Pro 50 55 60

Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala G3.n Lys Leu Lys 65 70 75 80

Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser Asn Gly Asn Tyr 85 90 95

Glu Lys Glu Gly Leu Gly Ala Ser Ser His lie Thr Thr Lys Ser Met 100 105 110 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu Val Leu Val Val 115 120 125

Thr Ala Leu Ser Thr Leu Leu Ser-Leu Thr Glu Thr Ser * 130 135 140 -165- This paper size applies to Chinese National Standard (CNS) A4 specification (2 × 〇 × 297 mm) 509696 A7 B7 V. Description of the invention (163) (2) Information of SEQ ID No. 25: (i) Sequence characteristics: (A) Length · 10 amino acids (B) type · amino acids (C) Strand: single '(D) phase: Linear (ii) molecular type · peptide (xi) sequence description: SEQ ID No. 25:

Gin Ser Cys Ser Thr Lys Tyr Arg Thr Leu 1 5 10 (2) Information of SEQ ID No. 26: (i) Sequence characteristics: (A) Length · 10 amino acids (B) Type: Amino Acid (C) Stranded · Single (D) Phase: Linear (ii) Molecular Type: Peptide (xi) Sequence Description: SEQ ID No. 26: Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the first (Please fill in this page again)

Cys Lys Arg Gly Met Lys Lys Glu Lys Asn 1 5 10 (2) Information of SEQ ID No. 27: (i) Sequence characteristics: ^ (A) Length · 10 amino acids -166- This paper is for China National Standard (CNS) A4 specification (21 × 29 < 7 mm) 509696 A7 B7 164 V. Description of the invention () (B) Type: Amino acid (C) Share property · · Single (D) Phase: Linear (ii) ) Molecular Type: Peptide (xi) Sequence Description: SEQ ID No. 27 |

Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val 1 5 10 (2) Information of SEQ ID No. 28: (i) Sequence characteristics: (A) Length: 10 amino acids (B) Type: amino acid, ( C) strand property: single. (D) phase: linear (ii) molecular type: peptide (xi) sequence description: SEQ ID No. 28:

Cys Ser Tyr Glu Glu Arg Glu Aig Pro Asn 1 5 10 (2) Information of SEQ ID No. 29: Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page) (i) Sequence features: (A) Length: 14 types of amino acids (B) · · amino acids (C) pliability: mono / (D) phase: linear -167- · This paper size applies Chinese National Standard (CNS) A4 specifications (210X: 297 mm) 509696 A7 B7 165 V. Description of the invention () (ii) Molecular type: peptide (xi) Sequence description: SEQ ID No. 29:

Pro Ala Pro Pro Val Gin Thr Thr Thr Ala Thr Thr Thr Thr 1 5 10 (2) Information of SEQ ID No. 30: (i) Sequence characteristics:, (A) Length · 2 1 base pairs (B) Type: Nucleic acid (C) Strand: Single (D) Phase ·· Linear

(ii) Molecular type · cDNA. (xi) Sequence description: SEQ ID No. 30: CTGTTTGAAT TTGCAGGACT C 21 (2) Information of SEQ ID No. 31: (i) Sequence characteristics: (A) Length · 3 6 base pairs (B) Type: Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Nucleic Acid Economy (please read the precautions on the back before filling this page) (C) Stocks ·· Single (D) Phase ·· Linear

(ii) Molecular type · cDNA (xi) sequence description: SEQ ID No. 31: CTCCTCTCTA AGCTTCTAAC CACAGCTTGG AGGAGC 36 -168- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 Central Standard of the Ministry of Economic Affairs A7 B7 printed by the Bureau ’s Consumer Cooperatives V. Invention Description (166) (2) Information of SEQ ID No. 32: (i) Sequence characteristics: (A) Length: 37 base pairs (B) Type: Nucleic acid ( C) Pseudosexual (D) Phase: Linear (ii) Molecular Type · cDNA-(xi) Sequence Description · SEQ ID No. 32: CTCCTCTCTA AGCTTCTATG GGCTCAGACC ACAGCTT 37 (2) Information of SEQ ID No. 33 : (I) Sequence characteristics · (A) Length: 60 base pairs · (B) Type: Nucleic acid (C) Strand: Single (D) Phase: Linear (ii) Molecular type: cDNA (xi) sequence Description: SEQ ID No. 33: CTCCTCTCTA AGCTTCTACT TGTCATCGTC GTCCTTGTAG TCACCACAGC TTGGAGGAGC 60 (2) Information of SEQ ID No. 34: (i) Sequence characteristics: (A) Length · 60 base pairs (B) Type · Nucleic acid '(C) shares: single-169-. This paper size applies to China National Standard (CNS) A4 specifications (210X297 (Please read the notes on the back before filling this page). ··· 11 d, 509696 A7 B7 V. Description of the invention (167) (D) Phase: linear (ii) molecular type ·· cDNA (xi) sequence Description: SEQID No. 34: CTCCTCTCTA AGCTTCTACT TGTCATCGTC GTCCTTGTAG TCTGOCTCAG ACCACAGCTT 60 (Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economics-170- This paper size applies to Chinese National Standards (CNS) A4 specifications (210X297 mm)

Claims (1)

509696 A8 B8 C8 D8 Patent Application No. 086105161 Amended Chinese Patent Application Scope (August 91) Lisi Garden 1. An isolated and purified protein consisting of the amino acid sequence described in SEQ ID No. 2, wherein the protein is capable of complexing with the neurotrophic factor (GDNF) derived from the glial cell line and thus the mediation of GDNF by intermediary cells Reaction, SEQ ID No. 2: Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 1 5 · 10 15 20 Leu Ser Ala Glu Val Ser Gly Gly ^ Asp Arg Leu Asp Cys Val Lys Ala 30 Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 40 45 Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Ala Ser 50 55 60 Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 75 80 Gin Lys Ser: Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 85 90 95 Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly 100. 105 110 Asn Asp Leu Xeu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leue _ 115 120 125 · \ Ser Asp 工 le Phe Arg Vai Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 '135 140 Val Glu His lie Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys A la 145 150. 155 160 Cys Asn Leu Asp Asp Engineer Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 170 175 Pro Cys Thr Thr Ser Val Ser Asn Asp Val Cys Asn Arg Arg Lys Cys 180 185 190 His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 19S 200 205 Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp A Ala Cys Thr Glu Arg 210 215 220 .., Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Lys 225 230 235 240 This paper size is applicable to Chinese National Standard (CNS) A4 size (210 x 297 mm) 509696 A8 B8 C8 D8 VI. Patent Application Fan Garden Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys' 245 250 255 Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg \ I.. 260 265 270 Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr lie Asp Ser 290 295 300 • Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 31S 320 Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr 325 330 335 Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Thr Ala Thr Thr Thr 3.55 360 365 Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370 375 380 Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 ·· 390 395 400 Gin Lys Leu Lys Ser 'Asn Val Ser Gly Asn Thr His Leu Cys lie Ser * 405 410 415 Asn. Gly Asn Tyr Glu Lys Glu. ^ Gly * lieu Gly Ala Ser Ser His lie Thr 420 425 430 Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly,, Leu Ser Pro Leu Leu 435 440 445 Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu Thr 450 455 460 Ser 465 2. An isolated and purified protein, its line Amino acid sequence described by SEQ. ID No. 4 Composition, wherein the protein capable of cell line-derived glue and spirit -2-- This applies China National Standard Paper Scale (CNS) A4 size (210 X 297 mm) Ding Xin AB c D 6. The scope of the patent application is compounded by nutritional factor (GDNF) and thus the response of intermediary cells to GDNF; SEQ ID No. 4: Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 1 5 10 15 ·, ... Met Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys Ala 20 25 30 Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr! 35 40 45 I. · ** I Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Thr Serj 50 55 60 1 '· 1 Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 6¾ 70 75 80 Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 85 90 95 Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly 100 105 110 Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leu 115 120 . 125 Ser Asp lie Phe Arg Ala Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 135 140 Val Glu His lie Ser Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala; 145 150 155 160! Cys Asn Leu Asp Asp Thr Cys Lys Cut Tyr Arg Ser Ala Tyr lie Thr 165 ·, 170 175: _ I Pro Cys Thr Thr Ser Met Ser Asn Glu Val Cys Asn Arg Arg Lys Cys! 180 185 190 His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 195 200 205 Tyr Gly Met Leu Phe Cys Ser Cys Arg Asplie Ala Cys Thr Glu Arg 210 215 220 Arg Arg Gin Thr Le Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Arg; 225 230 235 240; Pro Asn Cys Leu Ser Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys' 245 250, ·, ". 255 This paper size is applicable to the Chinese National Standard (CNS) A4 size (210 x 297 mm) 509696 A8 B8 C8 D8 6. Application scope Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260 265 270 Ser Val Ser Asn Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu-* Ala 275 280 285 Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr Val Asp Ser 290 295 300 i Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 315 320 Asp Leu Glu Asp Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr 325 330 335 Cys Leu'Lys Asn Ala lie Gin Ala Phe, Gly Asn Gly Ser Asp Val Thr • 340 345 350 Met Trp Gin Pro Ala Pro Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 * 365 Thr Ala Phe Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370. 375 380 Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 丨 385 390 395 400 丨 Gin Lys Leu Lys Ser Asn Val Ser Gly Ser Thr His Leu Cys Leu Ser 405 410 415 5 Asp Ser Asp Phe Gly Lys Asp Gly Leu Ala Gly Ala Ser Ser His lie i 420 425 430 ii Thr Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Ser Leu Ser Ser! Leu 1 435 '440. 445 丨 Pro Val Leu Met Leu Thr Ala Leu Ala Ala Leu Leu Ser Val Ser Leu 450 455 460 Ala Glu Thr Ser * 465 Q 3. According to the protein in the first scope of the patent application, It is an amino group as described in SEQ ID No. 2 The acid sequence is composed of Ser18 to Pro 446 〇 4. According to the first patent application scope of the protein, which is composed of SEQ ID No. 2 4- This paper size applies the Chinese National Standard (CNS) A4 specification (210x 297 mm) Binding Φ C8 —---—__; __D8 Patent application range The amino acid sequence Asp25 to acetamidine 447 is described. • The protein according to item i of the patent claim, which consists of the amino acid sequences Cys29 to Cys442 described in seq①No. 2. 6. The protein according to item 2 of the scope of patent application, which is composed of the amino acid sequences Ala19 to Val45G described in 8 £ (^ 10) No. 4. According to the protein in item 2 of scope of patent application, It is composed of the amino acid sequences Cys29 to Cys 443 described in SEq m No. 4. 8. According to the scope of the patent application, the protein is glycosylated. 9. According to the scope of the patent application, No. 2 The protein is glycosylated. 10. The protein according to item i of the scope of patent application is non-glycosylated. The protein according to item 2 of the scope of patent application is non-glycosylated. U · The protein according to any one of claims 1 to 丨 丨, which is produced by recombinant technology or chemical analysis. A dopaminergic nerve cell pharmaceutical composition for treating inappropriate effects, including according to claims 1 to 1 The protein of any one of 丨 丨 is combined with a pharmaceutically acceptable carrier. An isolated nucleic acid sequence encoding a neurotrophic factor receptor protein, the protein is selected from any of items 1 and 3 to 5 according to the scope of patent application. One 15 · —An isolated nucleic acid sequence encoding a neurotrophic factor receptor protein, the protein comprising an amino acid sequence according to any one of the claims 2, 6, and 7 of the patent application scope. 16 · An isolated nucleic acid sequence encoding a neurotrophic factor receptor protein, the protein is composed of the amino acid sequence described in SEQ ID No. 2 and sleeps " 丨 丨 丨 丨 丨 丨 丨 丨 丨 ·· 5- This paper scale is applicable to Chinese National Standard (Cns) A4 specification (210X297 public director) 509696 6. Scope of patent application where the protein can compound with the neurotrophic factor (GDNF) derived from the gel cell line and thus the response of intermediary cells to GDNF; SEQ ID No. 2 Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 1 5 10 15 Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys Ala 20 25 30 Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys $ er Thr Lys Tyr Arg Thr 35 40 45 Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Ala Ser 50 55 60 Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser \ Ala Met * Glu Ala Leu Lys 6-5 70 75 80 Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu 85 90-95 Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly 100 105 110 Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leu 115 120 125 Ser Asp lie Phe Arg Val Val Pro Phe lie Ser Asp Val Phe Gin Gin. 130 135 140 Val Glu His lie Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala 145 150 155 160 Cys Asn Leu Asp Asp lie Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 V ~ V / 170 175 Pro Cys Thr Thr Ser Val Ser Asn Asp Val Cys Asn Arg Arg Lys Cys 180 185 190 His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 195 200 205, ·, Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp lie Ala Cys Thr Glu Arg 210 215 220 Arg Arg Gin Thr He Val Pro Val Cys Ser Tyr Glu Glu Arg G lu Lys 225 230 235 240 ， Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lys.Thr Asn Tyr lie Cys 245 -6-250 255 This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) A8 B8 C8 _______D8 VI. Patent Application Fan Garden hrg Ser Arg; Leu Ala Asp Phe Fhe Thr Asn Cys Gin Pro GXu Ser Arg -2 | S0 265 270 Ser Val Ser Ser Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 Tyr Ser Gly Leu Gly Thr Val Met Thr Pro Asn Tyr lie Asp Ser 290 295 300 Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser GXy Asn 305 310 '.. 315 320 Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn. Thr 325 330 335 Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr Thr 355 360 '365 Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370 375 380 Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 400 Gin Lys Lfeu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys lie Ser; 405 410 415 Asn Gly Asn Tyr Glu Lys -Glu Gly Leu Gly Ala Ser Ser His lie Thr 420 425 430 Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu 435 440 445 Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu Thr 450 455 460 Ser 4S5 ° 17 · An isolated nucleic acid sequence encoding a neurotrophic factor receptor protein, the protein is described in SEQ ID No. 4 It is composed of amino acid sequences, in which the protein can be complexed with the glial cell line-derived neurotrophic factor (GDNF) and thus the response of the intermediary cells to GDNF; SEQ ID No. 4: This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 509696 A8 B8 C8 D8 VI. Patent Application Range Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu Leu 1 5 10 · 15 Met Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys Ala: 20 25 30; Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr * 35 40 45 Leu Arg ”Glri Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Thr Ser 50 55: 60 Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 75 80 Gin Lys Ser Leu Tyr Asn Cys Arg Cys L ys Arg Gly Met Lys Lys Glu; 85 90 95 | Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly 100 105 110 Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leu 115 120 125 .- Ser Asp lie Phe Arg Ala Val Pro Phe lie Ser Asp Val Phe Gin Gin 130 135 \ 140 i Val Glu His He Ser Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala L45 150 155 160 Cys Asn Leu Asp Asp Thr Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 170 175 | ί Pro Cys Thr Thr Ser Met Ser Asn Glu Val Cys Asn Arg Arg Lys f Cys j 180 185 190 His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 195 200 205: Tyr Gly Met Leu Phe Cys Ser Cys Arg Asplie Ala Cys Thr Glu Arg 210 215 220 Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Arg 丨 225 230-235 240: Pro Asn Cys Leu Ser Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys 245 * vc / 250 255 Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg 260 265 270 Ser Val Ser Asn Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 -8 ·· Binding • Thread paper size applies to Chinese National Standard (CNS) A4 size (210 X 297 mm) ABCD VI. Patent application scope Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr Val Asp Ser 290 295 300 V Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 315 320 Asp Leu Glu Asp Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr 325 330 335.. Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 Met Trp Gin Pro Ala Pro Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 365. Thr Ala Phe Arg Val Lys Asn Lys Pro Leu Gly 'Pro Ala Gly Ser Glu 370 375 380 Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 400: Gin Lys Leu Lys Ser Asn Val Ser Gly Ser Thr His Leu Cys Leu · Ser 405 410 415 Asp Ser Asp Phe Gly Lys Asp Gly Leu Ala Gly Ala Ser Ser His lie | 420 425 '430-Thr Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Ser Leu Ser Ser Leu 435 440 445 Pro Val Leu Met Leu Thr Ala Leu Ala Leu Leu Ser Val Ser Leu j 450 45 5 460 Ala Glu Thr Ser 465 · 〇18 ·-an isolated nucleic acid sequence consisting of the sequence described in SEQ ID No. 1, which consists of the core encoding Met1 to Ser465: y: acid ' The sequence encodes a neurotrophic factor receptor protein (GDNFR) that is capable of complexing with the neurotrophic factor (GDNF) derived from the glial cell line and thus the response of the mesenchymal cells to GDNF, SEQ ID No. 1: -9-This paper is applicable to China China National Standard (CNS) A4 (210 X 297 mm) 509696 AB c D ATAACCACTA ACATCCCTAA GCCCAACTCG GCCCTTCGAG TCTTTTCCTA GCGCAGATAA GCCCTGAAAG AATAAATAAG CGGTTGAGTC CAGGTTGGGT CGCCCUCAGAGCTCGGTCG TCACTGGATGC GAGCTAGAC TGC GTG AAA GCC Asp Cys Val Lys Ala 30 Scope of patent application CGGACCTGAA CCCCTAAAAG CGGAACCGCC TCCCGCCCTC CCGGCGGCGG TGGCTGCTGC CAGACCCGGA GTTTCCTCTT TTGGGCGGCC AGAGCAGCAC AGCTGTCCGG GGATCGCTGC GACCCAGCGG CGGCTCGGGA TTTTTTTGGG GGGGCGGGGA ATG TTC CTG GCG ACC CTG TAC TTC GCG CTG CCG Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro 15 10 CTG TCG GCC GAA GTG AGC GGC GGA GAC CGC .CTG Leu Ser Ala Glu Val Ser Gly Gly Asp Arg Leu 20 25 AGT GAT CAG TGC CTG AAG GAG CAG AGC TGC AGC ACC AAG TAC CGC ACG Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg Thr 35 40 * 45 CTA AGG CAG TGC GTG GCG GGC AAG GAG ACC AAC TTC AGC CTG GCA TCC Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Ala Ser 50 55 60 GGC CTG GAG GCC AAG GAT GAG TGC CGC AGC GCC ATG GAG GCC CTG AAG Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu Lys 65 70 75 80 CAG AAG TCG CTC TAC AAC TGC CGC TGC AAG CGG GGT ATG AAG AAG GAG Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys Glu. 85 90 95 AAG AAC TGC CTG CGC ATT TAC TGG AGC ATG TAC CAG AGC CTG CAG GGA Lys Asn Cys Leu Arg lie Tyr Trp Ser Met Tyr Gin Ser Leu Gin Gly 100 * 105 110 AAT GAT CTG CTG CTG GAG GAT TCC CCA TAT GAA CCA GTT AAC AGC AGA TTG Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg Leu 115 120 125 TC ^ GAT ATA TTC CGG GTG GTC CCA TTC ATA TCA GAT GTT TTT CAG CAA Ser Asp He Phe Arg Val Val Pro Phe He Ser Asp Val Phe Gin Gin n〇135 140 -10-Applicable to this paper size China National Standard (CNS) A4 specification (210X 297 mm) 60 120 180 240 300 300 420 480 539 587 635 683 731 731 779 827 875 923 971 509696 A8 B8 C8 D8 VI. Application scope of patents GTG GAG CAC ATT CCC AAA GGG AAC AAC TGC CTG GAT GCA GCG AAG GCC 1019 Val Glu His lie Pro Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys Ala 145 150 155 160 TGC AAC CTC GAC GAC GAC ATT TGC AAG AAG TAC AGG TCG GCG TAC ATC ACC 1067 Cys Asn Leu Asp Asp He Cys Lys Lys Tyr Arg Ser Ala Tyr lie Thr 165 170 175 CCG TGC ACC ACC AGC GTG TCC AAC GAT GTC TGC AAC CGC CGC AAG TGC 1115 Pro Cys Thr Thr Ser Va l Ser Asn Asp Val Cys Asn Arg Arg Lys Cys 180 185 190 CAC AAG GCC CTC CGG CAG TTC TTT GAC AAG GTC CCG GCC AAG CAC AGC 1163 His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His Ser 195 200 〜 V / 205 TAC GGA ATG CTC TTC TGC TCC TGC CGG GAC ATC GCC TGC ACA GAG CGG '1211 Tyr Gly Met Leu Phe Cys Ser Cys Arg Asp lie Ala Cys Thr Glu Arg 210 215 220 • AGG CGA CAG ACC ATC GTG CCT GTG TGC TCC TAT GAA GAG AGG GAG AAG 1259 Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr Glu Glu Arg Glu Lys 225 230 235 240 CCC AAC TGT TTG AAT TTG CAG GAC TCC TGC AAG ACG AAT TAC ATC TGC 1307 Pro Asn Cys Leu Asn Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie Cys. 245 250 255 AGA TCT CGC CTT GCG GAT TTT TTT ACC AAC TGC CAG CCA GAG TCA AGG 1355 Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser Arg-260 265 270 TCT GTC AGC AGC TGT CTA AAG GAA AAC TAC GCT GAC TGC CTC CTC GCC 1403 Ser Val Ser Ser Cys Leu .Lys Glu Asn Tyr Ala Asp Cys Leu Leu Ala 275 280 285 TAC TCG GGG CTT ATT GGC ACA GTC ATG ACC CCC AAC TAC ATA GAC TCC 1451 Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr lie Asp Ser 290 295 300 AGT AGC CTC AGT GTG GCC CCA TGG TGT GAC TGC AGC AAC AGT GGG AAC 1499 Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly Asn 305 310 315 320 GAC CTA GAA GAG TGC TTG AAA TTT TTG AAT_ TTC TTC AAG GAC AAT ACA 1547 Asp Leu Glu Glu Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn Thr · * 325 330 335 TGT CTT AAA .AAT 1 GCA .ATT CAA • GCC TTT GGC AAT GGC TCC GAT GTG ACC · 1595 Cys Leu .Lys > Asn .Ala .lie ； Gin .Ala, Phe Gly Asn Gly Ser Asp Val Thr 340 345 350 -11-This paper size applies to China National Standard (CNS) A4 (210 X297) Binding A8 B8 C8 __D8_ 1. Scope of patent application — GTG TGG CAG CCA GCC TTC CCA GTA CAG ACC ACC ACT GCC ACT ACC ACC 1643 Val Trp Gin Pro Ala Phe Pro Val Gin Thr Thr Thr Ala Thr Thr Thr 355 360 365 ACT GCC CTC GGG GTT AAG AAC AAG CCC CTG GGG CCA GCA GGG TCT GAG 1691 Thr Ala Leu Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser Glu 370 375 380 AAT GAA ATT CCC ACT CAT GTT TTG CCA CCG TGT GCA AAT TTA CAG GCA 1739 Asn Glu lie Pro Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin Ala 385 390 395 400 CAG AAG CTG AAA TCC AAT GTG TCG GGC AAT ACA CAC CTC TGT ATT TCC 1787 Gin Lys Leu Lys Ser Asn Val Ser Gly Asn Thr His Leu Cys Engineering Ser 405 .41,0 415 AAT GGT AAT TAT GAA AAA GAA GGT CTC GGT GCT TCC AGC CAC ATA ACC 1835 Asn Gly Asn Tyr Glu Lys Glu Gly Leu Gly Ala Ser Ser His Engineering Thr 420 425 430 ACA AAA TCA ATG GCT GCT CCT CCA AGC TGT GGT CTG AGC CCA CTG CTG1883 Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Gly Leu Ser Pro Leu Leu 435 440 445 GTC CTG GTG GTA ACC GCT CTG TCC ACC CTA TTA TCT TTA A CA GAA ACA 1931 Val Leu Val Val Thr Ala Leu Ser Thr Leu Leu Ser Leu Thr Glu Thr 450 455 460 'TCA TAGCTGCATT AAAAAAATAC AATATGGACA TGTAAAAAGA CAAAAACCAA .... 19 84 465… GTTATCTGTCCATCTCCATCTTCACATTCCAGTTCCAGTTCCTT 2104 TTNGGGGCTT CTGTGAAAAA CCTGATGCAG TGCTCCATCC AAACTCAGAA GGCTTTGGGA 2164 TATGCTGTAT TTTAAAGGGA CAGTTTGTAA CTTGGGCTGT AAAGCAAACT GGGGCTGTGT 2224 TTTCGATGAT GATGATNATC ATGATNATGA TNNHNNNNNN NNNNNNNNNN NNNNNNNNNN 2284 NNNNNNNNNN GATTTTAACA GTTTTACTTC TGGCCTTTCC TAGCTAGAGA AGGAGTTAAT 2344 ATTTCTAAGG TAACTCCCAT ATCTCCTTTA ATGACATTGA TTTCTAATGA TATAAATTTC 2404 \ AGCCTACATT GATGCCAAGC TTTTTTGCCA CAAAGAAGAT TCTTACCAAG AGTGGGCTTT 2464 GTGGAAACAG CTGGTACTGA TGTTCACCTT TATATATGTA CTAGCATTTT CCACGCTGAT 2524 GTTTATGTAC TGTAAACAGT TCTGCACTCT TGTACAAAAG AAAA. 2568 O _________- 12 -_._ This paper size applies to China National Standard (CNS) A4 (210X297 mm) 509696 A8 B8 C8 D8 Scope of patent application 19. An isolated nucleic acid sequence composed of the sequence described in SEQ ID No. 3, the sequence is composed of nucleotides encoding Met1 to Ser468, wherein the sequence encodes Strain-derived neurotrophic factor (GDNF) complex and thus mediator cell response to GDNF neurotrophic factor receptor protein (GDNFR), SEQ ID No. 3: AGCTCGCTCT CCCGGGGCAG TGGTGTGGAT GCACCGGAGT TCGGGCGCTG GGCAAGTTGG 60 GTCGGAACTG AACCCCTGAA AGCGGGTCCGCGCTCTCCGCCCCCGCGCGCGC GCGGTGGGCG GCAGAGCGAC GGGGAGTCTG CTCTCACCCT GGATGGAGCT 180 GAACTTTGAG TGGCCAGAGG AGCGCAGTCG CCCGGGGATC GCTGCACGGT GAGCTCTCTC 240 CCCGAGACCG GGCGGCGGCT TTGGATTTTG GGGGGGCGGG GACCAGCTGC GCGGCGGCAC 300 C ATG TTC CTA GCC ACT CTG TAC TTC GCG CTG CCA CTC CTG GAT TTG 346 Met Phe Leu Ala Thr Leu Tyr Phe Ala Leu Pro Leu Leu Asp Leu 15 10 15 CTG ATG TCC GCC GAG GTG AGT GGT GGA GAC CGT CTG GAC TGT GTG AAA 39 ~ 4 ~ Leu.Met Ser Ala Glu Val Ser Gly Gly Asp Arg Leu Asp Cys Val Lys' .20 25 30 GCC AGC GAT CAG ^ GC CTG AAG GAA CAG AGC TGC AGC ACC AAG TAC CGC 442 Ala Ser Asp Gin Cys Leu Lys Glu Gin Ser Cys Ser Thr Lys Tyr Arg 35, 40 45 ACA CTA AGG CAG TGC GTG GCG GGC AAG GAA ACC AAC TTC AGC CTG AC A 490 Thr Leu Arg Gin Cys Val Ala Gly Lys Glu Thr Asn Phe Ser Leu Thr 50 55 60 TCC GGC CTT GAG GCC AAG GAT GAG TGC CGT AGC GCC ATG GAG GCC TTG 53 8 Ser Gly Leu Glu Ala Lys Asp Glu Cys Arg Ser Ala Met Glu Ala Leu 65 70 75 AAG CAG AAG TCT CTG TAC AAC TGC CGC TGC AGC CGG GGC ATG AAG AAA 586; Lys Gin Lys Ser Leu Tyr Asn Cys Arg Cys Lys Arg Gly Met Lys Lys 80 85 90 95 GAG AAG AAT TGT CTG CGT ATC TAC TGG AGC ATG TAC'CAG AGC CTG CAG · 634 Glq Lys Asn Cys Leu Arg Gong Tyr Trp Ser Met Tyr Gin Ser Leu Gin '100 105 110 _ -13- This paper is applicable to China Standard (CNS) A4 (210x 297 mm) Assembly line 509696 AB c D Patent application Fan GGA AAT GAC CTC CTG GAA GAT TCC CCG TAT GAG CCG GTT AAC AGC AGG Gly Asn Asp Leu Leu Glu Asp Ser Pro Tyr Glu Pro Val Asn Ser Arg 115 120 125 TTG TCA GAT ATA TTC CGG GCA GTC CCG TTC ATA TCA GAT GTT TTC CAG Leu Ser Asp Worker Phe Arg Ala Val Pro Phe lie Ser Asp Val Phe Gin 130 135 140 CAA GTG GAA CAC ATT TCC AAA GGG AAC AAC TGC CTG GAC GCA GCC AAG Gin Val Glu His lie Ser Lys Gly Asn Asn Cys Leu Asp Ala Ala Lys 145 150 155 682 730 778 GCC TGC AAC CTG GAC GAC ACC TGT AAG AAG TAC AGG TCG GCC TAC ATC Ala Cys Asn Leu Asp Asp Thr Cys Lys Lys Tyr Arg Ser Ala Tyr lie 160 165 ~ V / 17〇175 ACC CCC TGC ACC ACC AGC ATG TCC AAC GAG GTC TGC AAC CGC CGT AAG Thr Pro Cys Thr Thr Ser Met Ser Asn Glu Val Cys Asn Arg Arg Lys 180 185 190 TGC CAC AAG GCC CTC AGG CAG TTC TTC GAC AAG GTT CCG GCC AAG CAC Cys His Lys Ala Leu Arg Gin Phe Phe Asp Lys Val Pro Ala Lys His 195 200 205 AGC TAC GGG ATG CTC TTC TGC TCC TGC CGG GAC ATC GCC TGC ACC GAG Ser Tyr Gly MetLeu Phe Cys Ser Cys Arg Asp lie Ala Cys Thr Glu 210 215 220 826 874; 922 970 Binding CGG CGG CGA CAG ACT ATC GTC CCC GTG TGC TCC TCC Arg Arg Arg Gin Thr lie Val Pro Val Cys Ser Tyr 225 230 235 GAA GAA Glu Glu CGA GAG Arg Glu 1018 AGG CCC AAC TGC CTG AGT CTG CAA GAC TCC TGC AAG ACC AAT TAC ATC Arg Pro Asn Cys Leu Ser Leu Gin Asp Ser Cys Lys Thr Asn Tyr lie 240 245 250 255 TGC AGA TCT CGC CTT GCA GAT TTT TTT ACC AAC TGC CAG CCA GAG TCA Cys Arg Ser Arg Leu Ala Asp Phe Phe Thr Asn Cys Gin Pro Glu Ser 260 265 270 AGG TCT GTC AGC AAC TGT CTT AAG GAG AAC TAC GCA GAC TGC CTC CTG Arg Ser Val Ser Asn Cys Leu Lys Glu Asn Tyr Ala Asp Cys Leu Leu 275 280 285 GCC TAC TCG GGA CTG ATT GGC ACA GTC ATG. ACT CCC AAC TAC GTA GAC Ala Tyr Ser Gly Leu lie Gly Thr Val Met Thr Pro Asn Tyr Val Asp 290 295 300 TCC AGC AGC CTC AGC GTG GCA CCA TGG TGT GAC TGQ AGC AAC AGC GGC Ser Ser Ser Leu Ser Val Ala Pro Trp Cys Asp Cys Ser Asn Ser Gly ^ 30,5 310 315 1066 1114 1162 1210 1258 Φ -14- This paper Standards apply to Chinese National Standard (CNS) A4 specifications (210 X 297 mm) ____ £ 8509696 A8 B8 C8 ^, patent application scope AAT GAC CTG GAA GAC TGC TTG AAA TTT CTG AAT TTT TTT AAG GAC AAT 1306 Asn Asp Leu Glu Asp Cys Leu Lys Phe Leu Asn Phe Phe Lys Asp Asn 320 325 330 335 ACT TGT CTC AAA AAT GCA ATT CAA GCC TTT GGC AAT GGC TCA GAT GTG 1354 Thr Cys Leu Lys Asn Ala lie Gin Ala Phe Gly Asn Gly Ser Asp Val '340 345 350 ACC ATG TGG CAG CCA GCC CCT CCA GTC CAG ACC ACC ACT GCC ACC ACT .1402; Thr Met Trp Gin Pro Ala Pro Pro Val Gin Thr Thr Thr Ala Thr Thr 355 360 365 ACC ACT GCC TTC CGG GTC AAG AAC AAG CCT CTG GGG CCA GCA GGG TCT 1450 Thr Thr Ala Phe Arg Val Lys Asn Lys Pro Leu Gly Pro Ala Gly Ser 370 375 380GAG AAT GAG ATC CCC ACA CAC GTT TTA CCA CCC TGT GCG AAT TTG CAG 1498 Glu Asn Glu Pro Le Thr His Val Leu Pro Pro Cys Ala Asn Leu Gin 385 390 395 'GCT CAG AAG CTG AAA TCC AAT GTG TCG GGT AGC ACA CAC CTC TGT CTT * 1546 Ala Gin Lys Leu Lys Ser Asn Val Ser Gly Ser Thr His Leu Cy s Leu 400 405 410 415 TCT GAT AGT GAT TTC GGA AAG GAT GGT CTC GCT GGT GCC TCC AGC CAC 1594 Ser Asp Ser Asp Phe Gly Lys Asp Gly Leu Ala Gly Ala Ser Ser His 420 .425 430 ATA ACC ACA AAA TCA ATG GCT GCT CCT CCC AGC TGC * AGT CTG AGC TCA. 1642 Gong Thr Thr Lys Ser Met Ala Ala Pro Pro Ser Cys Ser Leu Ser Ser 435 440 445 CTG CCG GTG CTG ATG CTC ACC GCC CTT GCT GCC CTG TTA TCT GTA TCG 1690 Leu Pro Val Leu Met Leu Thr Ala Leu Ala Ala Leu Leu Ser Val Ser '450 455 460 TTG GCA GAA ACG TCG TAGCTGCATC CGGGAAAACA GTATGAAAAG ACAAAAGAGA 1745 Leu Ala Glu Thr Ser' 465, AC £ AAGTATT CTGTCCCTGT CCTCTTGTAGTT ATCTATCATCAATC TAAGAAAGCT TGTGGCCCTC 1865 AGGGGCTTCT GTTGAAGAAC TGCTACAGGG CTAATTCCAA ACCCATAAGG CTCTGGGGCG 1925 TGGTGCGGCT TAAGGGGACC ATTTGCACCA TGTAAAGCAA GCTGGGCTTA TCATGTAGTCTCAGTCCTAGCTAC CAG 2105 V ‘CATTGCCTTC TGAAGACAGG CCCGCAGCCG TCG 2138 ____- 15- This paper size applies to China National Standard (CNS) A4 (210X297 mm) Binding 509696 A8 B8 C8 ------------ 6. Scope of patent application 20. The protein according to item 丄 of the scope of patent application is used for the preparation of pharmaceutical compositions. 21. The protein according to item 2 of the scope of patent application is used for preparing a pharmaceutical composition. 22. The pharmaceutical composition according to item 13 of the scope of patent application, which is a method for treating Parkinson's disease. 23. The pharmaceutical composition according to item 13 of the scope of patent application, which is a method for treating Alzheimer's disease. 24. The pharmaceutical composition according to item 13 of the scope of patent application, which is used for treating amyotrophic lateral sclerosis. 25 · —Analytical device for analyzing the existence of a neurotrophic factor derived from a glial cell line in a test sample, comprising: a solid phase having or coated with a protein according to any one of items 丨 to 丨 丨 in the scope of patent application, wherein the protein Presence in test samples (GDNF reaction and production indicates the presence of GDNF and detectable counter-products .. 26 · —A method to analyze the presence of neurotrophic factors derived from gel cell lines in test samples, including: Contact the analytical reagent for a protein according to any one of items 1 to 11, wherein the protein reacts with the GDNF present in the test sample and produces a detectable reaction product referring to the presence of #GDNF. (Quasi (⑽) A4 specification, Qiao Gang, Norm) Supplementary Specification for Chinese Patent Application No. 86105161 (11, 509,696, 1987) PBJ5 vector: pBJ5 vector was manufactured by Stanford University. The vector is as described in Elliott et al., 1990. PNAS. 87: 6363-6367 Modified from the pJFE14 vector. 293T cells are human embryonic kidney cell lines, such as 293 cells, ATCC deposit number: CRL-1573. · Phage gtlO: purchased from Clontech (Palo Alto 'CA), As described in the instruction sheet "" Using adult substantia nigra selected in bacteriophage gtl0) 1 ^ 8 library (5,-sequence plus cDNA library, Clontech, Palo Alto 'CA) The rat GDNFR cDNA selection plant of Example 1 was used as a probe for screening. NGR_38: It was prepared using Neuro-2a cells as described in the instructions. The cell line named Neuro-2a cells was deposited with ATCC: CCL -131 is used to transfect Neuro-2a cells with rat GDNFR cDNA-deficient mammalian expression vectors (such as the expression vectors described above). Three clones (NGR-Xiu 16, NGR-33 and NGR-38) were tested for their ability to combine with [i25I] GDNF. "2 1- B-3 / βBKRSV: purchased from Stratagene Corporation (La Jolla, CA), as described in the instruction sheet" "A plant that will contain almost complete human GDNFR coding regions, selected as plant # 21 The CDNA insert was cut out by digestion with EcoRI. This fragment was purified and incorporated into a pBKRSV vector (Stratagene, La Jolla, CA) cleaved by EcoRI to obtain a selected plant 21-B. U: \ TYPE \ HYC \ G \ 2084G-l.DOC \ HYC \ 7 509696 3 / pBKRSV. pDSR = 2 ..... is pDSRa2— "pDSRa2 plastid structure containing appropriate GDNFR CDNA, which can be substantially based on pending US patent application series No. 501,904 filed by the same patentee, and the application is 1990 March 29, 2014 (see also, European Patent Application No. 903 05433, Publication No. EP 398 7 53, the filing date is May 18, 1990, and WO 90/14363 (1990)), the disclosures of which are incorporated herein This article is prepared as a reference, prepared by the method described. "0 pDSRa2 •• As mentioned above, and further cited in the description—" Another structure is pDSRa2, which is a plastid pCD (Okayama and Cypress Derivative of Berg (Molecular Cell Biology 3: 280-289, 1983) with three main modifications: (i) SV40 polyadenylation signal has been replaced to obtain a-time from bovine follicle stimulating hormone Unit (a-bFSH) signal (Goodwin et al., Nucleic Acids Research 1: 1: 6873-6822, 1983); (ii) the mouse dihydrofolate reductase minigene (Gasser et al.) (Proc. Natl. Acad. Sci. 79: 6522-6526, 1982) inserted downstream of the performance cassette to enable the sieve And amplified transgenic strains; and (iii) 267 bp that have been selected to contain elements "and, part of the WU5" sequence of the long terminal repeat region (LTR) of type I human T-cell leukemia virus (HTLV-I) Fragment and insert it between the SV40 promoter and the splicing signal previously described (Takebe et al., Molecular Cell Biology 8: 466-472, 1988). "Obtained from the patent application concerning pDSR Revealed as follows: U: \ TYPE \ HYC \ G \ 2684G-1.DOC. HYC \ 7 .2-509696 The pD SRa2 has the following important characteristics (in a clockwise direction, along the map shown in Figure 12): (a) SV40 early promoter / enhancer and origin of replication; consisting of the S V40 sequence between pvun (SV40 nucleotide map coordinate # 272) and Hind III (map coordinate # 1 7 2). [HPPNA tumor virus, J. Tooze, eds., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1981), 801_804]. (b) A 267 bp fragment containing the "U5" sequence of RI "and part of the human T-cell leukemia virus (HTLV_I) Changchun terminal repeat (LTR). This fragment map is located at the 5th end of" RI "(from the end) (Position 354) to the Sau3A site (position 620) in the U5 sequence [Seiki et al., Proc. Natl. Acad. Sci. Face: 3618_3622, (1983)] 0 (c) spliced by SV40 16S, 19S Donor / recipient signals (graph coordinates # 502-560 and # 1410_1498, joined by the BamHI linker). The structural combination containing the above three fragments (a), (... and ㈠), and published The vector pCD_SRa [Takebe et al., Molecular Cell Biology and: 466-⑩ 472, (1988)] is the same, but with the following modifications: (丨) in the fragment (about 51 'end of the' Hindlll site has been borrowed Destroyed by the end-fill junction effected by the Kluyver fragment of ONA polymerase I; the Xhol site, which was originally between fragments (a) and (c), has been destroyed by the insert (b) (3) The original PstI site at the 31 end of the fragment ((:) was changed to a HindIII site. (D) Existed in Sail BamHI has a 2.4 kb fragment, transcription termination / polyUAUA \ HYC \ G \ 2684G.lDOC \ HYC \ 7 509696 adenylation signal. This fragment is derived from bovine pituitary glycoprotein hormone a-subunit The 31 part of A-FSH (Follicle Stimulating Hormone). The BstXI site located at the beginning of the last expressed sequence is mutated to the Sail site. The 1 end of this fragment is continuously connected to the nearest downstream BamHI site. This 2.4 The kb fragment was sub-selected into the pUC vector, and then recovered as a Sail to Smal fragment for further construction of the expression vector. (e) First from the plastid pMg 1 [Gasser et al., Proc. Natl. Acad · Sci. 79: 6 522-6526 (1982)] Restored mouse dihydrofolate reductase (DHFR) containing endogenous mouse DHFR promoter, cDNA coding sequence, and DHFR transcription termination / polyadenylation signal The small genes all showed 2.5 kb EcoRI to Hindlll fragments. The restriction enzyme sites at the two terminals (ie, 5. EcoRI and 31 HlMIIi) were all destroyed while constructing the expression vector. (F) From the HiMUI site (Map coordinate # 2448) extends to the EcoRI site (map coordinate # 4362) and contains amines Penicillin resistance marker gene, and a plastid exist in E. coli origin of replication "non-toxic" of pBR322 sequences. After multiple steps of colonization, these six DNA fragments [(a)-(f)] were finally ligated to generate the expression vector pDSRa2; during this process, several original restriction enzyme sites were damaged or changed. . Therefore, the final structure of the plastid pDSRa2-MI is illustrated in Figure 12 with its circular configuration with these clearly described changes. For plastid pCD, the molecules U; \ TYPE \ HYC \ G \ 2 & 84G-lDOC \ HYC \ 7 509696 Cell biology 3: 280-289 were used by Okayama and Berg. References cited in 1983. As mentioned previously, it contains three major modifications: (i) the SV40 polyadenylation signal has been replaced with a signal derived from bovine follicle stimulating hormone a-subunit (a_3FSH) (Goodwin et al. 'Nucleic Acid Research 1 1: 6873-6822, 1983); (ii) the mouse dihydro leaf fei reductase minigene (Gasser et al., Proc. Natl. Acad. Sci. 79: 6522-6526, 1982) inserted downstream of the expression cassette to enable selection and expansion of transformants; and (lii) have been cloned to contain "R · element" and, type I human T-cell leukemia virus (HTLV-I) A 267 bp fragment of the "U5" sequence of a long terminal repeat region (LTR) and inserted into the SV40 promoter and the splicing signal previously described (Takebe et al., Molecular Cell Biology 8: 466-472 , 1988). U: \ TYPE \ HYC \ G \ 2684G-l.DOC \ HYC \ 7