TW202411429A - Promoter library and application thereof in different bacteria - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, in particular to a promoter library and application thereof in different bacteria. The promoter library provided by the invention comprises a promoter with a nucleotide sequence as shown in SEQ ID NO.1, and n represents any one of a, t, c and g. The promoter library disclosed by the invention can cover a relatively wide intensity range and can play a role in different bacteria; the promoter can be applied to different bacteria to construct expression systems with different expression intensities, and an important biological element is provided for gene expression regulation and control of bacteria and construction of engineering bacteria, and the same promoter has relatively high consistency in intensity in different bacteria and has transportability among different bacteria.

Description

Starter library and its application in different bacteria

The present invention relates to the field of genetic engineering technology, and in particular to a promoter library and its application in different bacteria.

Synthetic biology is based on systematic design and engineering concepts, and aims to reduce the complexity of natural biological system research or reconstruct complex artificial biological systems through the principles of engineering science. In specific practice, the biosynthetic pathway can be controlled through the precise regulation of biological components to achieve the optimal production of target products; different biological components can also be connected in series, feedback or forward to form a biological system with expected functions. Among them, biological components are the core and most important foundation of synthetic biological systems.

Promoters are a type of biological element that can determine the start position of transcription and control the strength of gene expression. They are one of the core parts of the gene expression system. Controlling different gene activities by the strength of the promoter is a common biological regulation method. Therefore, a promoter library containing a series of promoters of different strengths is needed to meet the needs of different gene expression strengths.

Industrial microorganisms refer to a type of microorganisms that originate from nature and can be directly (or after being modified) used in actual production. Bacteria that have been successfully used in industrial production include Escherichia coli, Corynebacterium glutamicum, Streptomyces, etc. Some bacteria are considered potential industrial strains, such as Pseudomonas, Eutrophilia rosea, and Clostridium difficile. Precise regulation of genes through promoters can optimize the synthesis pathway of industrial microorganisms, thereby increasing yield and conversion rate and reducing production costs.

As a model organism for microbial research, Escherichia coli has a clear genetic background, and the development of related gene elements such as promoters is relatively mature. However, biological elements constructed in a certain bacterium (such as promoter libraries) may not be applicable to other bacteria, which to some extent restricts the expansion and application of biological elements.

Ralstonia eutropha (now renamed Cupriavidus necator) is a Gram-negative bacterium that can use a variety of carbon sources such as sugars and lipids as substrates. It is a model strain for PHA production and has high potential for industrial production and application. At present, basic research on Ralstonia eutropha is in its initial stage. Although some literature has reported some biological components that can be used in Ralstonia eutropha, most of them are attempts to migrate biological components in Escherichia coli to new chassis. In this process, the component test results often do not match the original chassis. The scarcity of biological components directly restricts the development and application of Ralstonia eutropha as an industrial microorganism. Therefore, it is crucial to develop biological components that can be stably transferred and used in different bacteria.

The present invention provides a promoter library and its application in different bacteria.

The present invention is based on an original promoter sequence, and changes the promoter strength by saturating the bases in the promoter sequence (changing n bases can obtain 4 ⁿ mutations), thereby obtaining a promoter library with a wider promoter strength range and higher strength consistency among different bacteria.

Specifically, the present invention provides the following technical solutions:

The present invention provides a promoter library, which includes a promoter having a nucleotide sequence as shown in SEQ ID NO.1, wherein n represents any one of a, t, c, and g.

The promoter sequence in the above promoter library is as follows (SEQ ID NO.1, 5'-3'): ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttat ttgctt agcccgacgcccgcggg nnnaat a gaattcactagtttaactttaagaa (wherein n represents any one of a, t, c, and g).

The above promoter sequence specifically includes the following parts: upstream sequence (Up-element, upstream sequence of underlined sequence), core region (sequence marked with underline, where -10 region and -35 region are marked with bold respectively), downstream sequence (Spacer, downstream sequence of underlined sequence). Among them, the core region is the part where the promoter plays the "on/off" function, the upstream sequence (UP-element) can affect the strength of the promoter by interacting with bacterial RNA polymerase, and the downstream sequence is the spacer sequence between the promoter and other sequences.

In the above activation subsequence, n can be any one of a, t, c, and g, so the above activation subsequence includes 64 different activation subsequences in total.

In some embodiments of the present invention, the promoter library includes 1-64 promoters.

In some embodiments of the present invention, the promoter library includes 2-64 promoters.

In some embodiments of the present invention, the promoter library includes 64 promoters.

In some embodiments of the present invention, the promoter library includes promoters with nucleotide sequences as shown in SEQ ID NO.2-41.

It has been verified that the dynamic range of the strength of the promoters in the above-mentioned promoter library is up to 10 ³ times (with green fluorescent protein as the reporter gene), and can function in different bacteria (for example, Escherichia coli and E. rhodesiae); and the strength of the same promoter in different bacteria has a high consistency, that is, the promoter library has portability between different bacteria.

The present invention provides a promoter, which is a promoter in the promoter library mentioned above.

In some embodiments of the present invention, the promoter provided above is any promoter in the promoter library.

The present invention provides an expression cassette, which comprises the promoter in the promoter library described above.

Preferably, the expression cassette comprises at least one promoter in the promoter library described above.

In the present invention, the expression cassette refers to a recombinant nucleic acid molecule obtained by connecting a promoter to a target gene.

The present invention provides a vector, which comprises the promoter in the promoter library described above, or comprises the expression box described above.

Preferably, the vector comprises at least one promoter from the promoter library described above.

The vector described in the present invention can be a plasmid vector or a viral vector, preferably an expression vector.

The present invention provides a host cell, wherein the host cell comprises the promoter in the promoter library described above, or comprises the expression box described above, or comprises the vector described above.

Preferably, the host cell comprises at least one promoter in the promoter library described above.

In the host cell, the promoter may be integrated into the chromosome of the host cell, or exist on a plasmid vector carried by the host cell.

The host cells mentioned above include microbial cells. The microorganisms include but are not limited to Escherichia (e.g., Escherichia coli), Coptis (e.g., E. rhodobacterium), Corynebacterium (e.g., Corynebacterium glutamicum), Brevibacterium, Arthrobacterium, Microbacterium, Bacillus, Pseudomonas, Streptomyces, etc.

In some embodiments of the present invention, the host cell is Escherichia coli.

In some embodiments of the present invention, the host cell is E. rosellae.

The present invention provides a recombinant engineered bacterium, wherein the recombinant engineered bacterium comprises the promoter in the promoter library described above.

Preferably, the recombinant engineered bacteria comprises at least one promoter in the promoter library described above.

The present invention provides any of the following applications of the promoter library or the promoter or the expression box or the vector or the host cell described above: (1) Application in regulating gene transcription and/or expression in microorganisms; (2) Application in microbial gene editing; (3) Application in microbial genetic engineering; (4) Application in the construction of engineered microorganisms for producing target products; (5) Application in producing target products by microbial fermentation.

In (1) and (2) above, the gene includes a nucleic acid molecule capable of encoding a peptide or a functional RNA. The type and sequence of the gene are not particularly limited in the present invention, and the gene may be any target gene that is desired to be transcribed and expressed.

In the above (4) and (5), the target product includes compounds, polymers or proteins, including but not limited to polyesters (such as polyhydroxy fatty acid esters), polyphenol compounds, amino acids or their derivatives, organic acids or their derivatives, etc.

In the above (1)-(5), the microorganisms include but are not limited to Escherichia (e.g., Escherichia coli), Cupricinus (e.g., E. rhodobacterium), Corynebacterium (e.g., Corynebacterium glutamicum), Brevibacterium, Arthrobacterium, Microbacterium, Bacillus, Streptomyces, Pseudomonas, etc.

Preferably, the microorganism is Escherichia coli or E.

The present invention provides a method for regulating gene transcription and/or expression, which comprises the step of operably linking the promoter in the promoter library described above to a target gene.

The above method for regulating gene transcription and/or expression further comprises the step of introducing the ligation product of the promoter in the above promoter library and the target gene into a host cell.

The present invention provides an expression system, which comprises the promoter in the promoter library described above.

The present invention provides a method for constructing a promoter library with different expression strengths in a microorganism, the method comprising the step of transferring the above-mentioned expression system containing the promoters in the promoter library into different bacteria.

Wherein, the microorganisms include Escherichia (such as Escherichia coli) and Cupricobacterium (such as E. rhodochii).

In some embodiments of the present invention, an expression system of the above promoter library is constructed by DNA assembly technology, and the expression system is transferred into different bacteria to quantitatively test the strength of the promoter.

The beneficial effects of the present invention are as follows: the promoter library of the present invention can cover a wide range of strengths and can function in different bacteria (e.g., Escherichia coli and E. rhodesiae); and the strength of the same promoter in different bacteria is highly consistent and portable between different bacteria, and can be applied to construct expression systems with different expression strengths in different bacteria, providing important biological elements for gene expression regulation of different bacteria and the construction of engineered bacteria.

In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present invention, but not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without excessive experiments are within the scope of protection of the present invention.

In the following examples, the enzyme reagents used were purchased from ThermoFisher and New England Biolabs (NEB), the reagent kits used for plasmid extraction were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the reagent kits for recovering DNA fragments were purchased from Omega Corporation in the United States. The corresponding operating steps were strictly carried out according to the product instructions, and all culture media were prepared with deionized water unless otherwise specified.

The culture medium formula used in the following examples is as follows:

1. E. coli culture medium

LB medium: 5g/L yeast extract, 10g/L peptone, 10g/L sodium chloride, the rest is water. Sterilize with high temperature and high pressure steam (121℃, 20min).

2. Eubacterium rosea culture medium

TYGA medium: 5g/L yeast extract, 10g/L peptone, 3g/L glucose, 3g/L ammonium sulfate, and the rest is water. Sterilize with high temperature and high pressure steam (121℃, 20min).

In the actual culture process, a certain concentration of antibiotics can be added to the above culture medium to maintain the stability of the plasmid, such as 100 μg/mL ampicillin or 20 μg/mL tetracycline.

In the following examples, the principle schematic diagram of the expression system containing the promoter library is shown in Figure 1. The promoter regulates the expression of green fluorescent protein, and the fluorescence intensity is detected by flow cytometry, and the fluorescence intensity value is used to quantitatively characterize the strength of the promoter.

Example 1 Construction and testing of an expression system containing a promoter library in Escherichia coli

The pBBR1 plasmid containing the original sequence of the promoter (numbered 0), the sfGFP gene and other test sequences was synthesized by WuXi AppTec (see Figure 2 for the plasmid structure). This plasmid was used as a template to obtain two fragments through PCR amplification. The primers and amplification product information are shown in Table 1.

Table 1 Introduction Name Sequence (5'→3') template Product size lib-F agccttcgtcactggtcccg pBBR1 plasmid 2706 bp lib-P1-R gcgggcgtcgggctaagcaa lib-P1-F ttgcttagcccgacgcccgcggg nnn aatagaattcactagtttaactttaagaaagta pBBR1 plasmid 2076 bp lib-R cgggaccagtgacgaaggct

Among them, lib-P1-F is a degenerate primer (n represents any one of a, t, c, and g). Through this design, a saturated mutation of three bases is introduced in the promoter-10 region to construct a promoter library. After the two fragments obtained by PCR are purified, pBBR1-promoter_lib1 is obtained by connecting by Gibson Assembly, and the plasmid is transformed into Escherichia coli to obtain a promoter library. The promoter sequence in the promoter library is as follows (SEQ ID NO.1): ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtg aaaaaatttat ttgctt agcccgacgcccgcggg nnnaat a gaattcactagtttaactttaagaa (where n represents any one of a, t, c, and g).

Each positive single clone of E. coli obtained after transformation contained a promoter, and its sequence corresponded to SEQ ID NO.1. The positive clones in the promoter library were randomly selected and sequenced to determine the sequence. A total of 40 different promoter sequences were obtained (Table 2).

Table 2 Activation subnumber Serial Number Promoter sequence (5'→3') 0 SEQ ID NO.2 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg tat aatagaattcactagtttaactttaagaa 1 SEQ ID NO.3 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg gat aatagaattcactagtttaactttaagaa 2 SEQ ID NO.4 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg taa aatagaattcactagtttaactttaagaa 4 SEQ ID NO.5 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg tta aatagaattcactagtttaactttaagaa 5 SEQ ID NO.6 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg cac aatagaattcactagtttaactttaagaa 6 SEQ ID NO.7 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg tag aatagaattcactagtttaactttaagaa 7 SEQ ID NO.8 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg aat aatagaattcactagtttaactttaagaa 11 SEQ ID NO.9 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg ggc aatagaattcactagtttaactttaagaa 12 SEQ ID NO.10 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg cag aatagaattcactagtttaactttaagaa 13 SEQ ID NO.11 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg caa aatagaattcactagtttaactttaagaa 14 SEQ ID NO.12 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg tat aatagaattcactagtttaactttaagaa 16 SEQ ID NO.13 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg aga aatagaattcactagtttaactttaagaa twenty three SEQ ID NO.14 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg gaa aatagaattcactagtttaactttaagaa 26 SEQ ID NO.15 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg ata aatagaattcactagtttaactttaagaa 27 SEQ ID NO.16 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg gta aatagaattcactagtttaactttaagaa 28 SEQ ID NO.17 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg cta aatagaattcactagtttaactttaagaa 29 SEQ ID NO.18 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg agc aatagaattcactagtttaactttaagaa 30 SEQ ID NO.19 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg acg aatagaattcactagtttaactttaagaa 32 SEQ ID NO.20 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg aca aatagaattcactagtttaactttaagaa 35 SEQ ID NO.21 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg gga aatagaattcactagtttaactttaagaa 36 SEQ ID NO.22 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg att aatagaattcactagtttaactttaagaa 37 SEQ ID NO.23 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg agt aatagaattcactagtttaactttaagaa 38 SEQ ID NO.24 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg aaa aatagaattcactagtttaactttaagaa 40 SEQ ID NO.25 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg ctc aatagaattcactagtttaactttaagaa 44 SEQ ID NO.26 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg ctt aatagaattcactagtttaactttaagaa 45 SEQ ID NO.27 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg aac aatagaattcactagtttaactttaagaa 47 SEQ ID NO.28 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg gtt aatagaattcactagtttaactttaagaa 50 SEQ ID NO.29 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg cga aatagaattcactagtttaactttaagaa 51 SEQ ID NO.30 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg cgg aatagaattcactagtttaactttaagaa 52 SEQ ID NO.31 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg cca aatagaattcactagtttaactttaagaa 54 SEQ ID NO.32 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg gta aatagaattcactagtttaactttaagaa 56 SEQ ID NO.33 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg ctg aatagaattcactagtttaactttaagaa 60 SEQ ID NO.34 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg tca aatagaattcactagtttaactttaagaa 67 SEQ ID NO.35 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg gac aatagaattcactagtttaactttaagaa 69 SEQ ID NO.36 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg agg aatagaattcactagtttaactttaagaa 70 SEQ ID NO.37 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg tgg aatagaattcactagtttaactttaagaa 81 SEQ ID NO.38 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg atg aatagaattcactagtttaactttaagaa 86 SEQ ID NO.39 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg ttg aatagaattcactagtttaactttaagaa 90 SEQ ID NO.40 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg agg aatagaattcactagtttaactttaagaa 104 SEQ ID NO.41 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgtgaaaaaatttatttgct tagcccgacgcccgcggg act aatagaattcactagtttaactttaagaa

After activating and culturing the above-mentioned E. coli positive clones containing different promoters in LB medium, the fluorescence intensity was detected by flow cytometry, and the dynamic range of the fluorescence intensity reached 10 ³ , as shown in Figure 3. The fluorescence intensity values of E. coli containing the above-mentioned promoter sequences are shown in Table 3.

table 3 Start sub number Average fluorescence intensity (au) Fluorescence intensity standard deviation 0 197856.13 3961.95 1 28654.38 331.16 2 147343.88 3332.54 4 5255.38 87.36 5 29331.38 161.02 6 155948.38 1707.34 7 10688.88 154.37 11 30.7 2.05 12 22042.88 210.74 13 32442.63 278.6 14 178284.38 5424.48 16 40.65 1.17 twenty three 4664.63 59.56 26 214.63 11.59 27 420.63 6.55 28 748.63 21.14 29 31.03 1.12 30 69.88 0.58 32 301.63 9.22 35 31.58 0.96 36 70.13 1.5 37 108.63 4.43 38 1011.38 15.51 40 66.38 3.16 44 1029.88 14.82 45 1005.38 17.96 47 52.13 1.89 50 113.88 5.07 51 126.38 7.12 52 133.13 5.91 54 471.13 10.37 56 75.38 2.16 60 547.88 20.37 67 2907.88 134.95 69 65.38 2 70 287.63 11.35 81 42.93 2.42 86 349.38 18.38 90 63.63 2.22 104 64.63 3.5

Example 2 Construction and testing of an expression system containing a promoter library in E.

The plasmid of the promoter library constructed in Example 1 was transferred into E. rhodesi by conjugation transformation to obtain an expression system containing the promoter library. E. rhodesi containing different promoters were activated and cultured in TYGA medium, and the fluorescence intensity was detected by flow cytometry. The dynamic range of the fluorescence intensity reached 10 ³ times, as shown in Figure 4. The fluorescence intensity values of E. rhodesi containing the promoter sequence are shown in Table 4.

Table 4 Start sub number Average fluorescence intensity (au) Fluorescence intensity standard deviation 0 25007.61 290.79 1 1614.61 45.29 2 13381.86 192.77 4 134.86 3.92 5 2115.61 26.92 6 20588.36 746.37 7 372.11 15.56 11 29.41 2.83 12 1219.86 49.56 13 1275.36 58.16 14 30116.86 640.89 16 4.71 0.44 twenty three 289.86 5.48 26 19.28 1.24 27 32.88 2.02 28 37.38 1.99 29 29.28 1.67 30 40.73 3.23 32 40.43 2.4 35 22.06 2.17 36 11.23 2.58 37 51.81 6.13 38 54.33 3.11 40 19.98 1.24 44 39.73 1.69 45 111.86 5.72 47 12.23 1.41 50 27.06 0.7 51 52.53 3.55 52 24.83 0.42 54 32.16 1.23 56 22.46 1.17 60 65.83 4.63 67 513.86 8.41 69 61.26 3.52 70 137.86 4.76 81 25.53 1.47 86 44.61 2.7 90 59.96 1.96 104 23.28 2.81

A scatter plot was made with the expression intensity of the same promoter in the promoter library in Escherichia coli as the horizontal axis and the expression intensity in E. rhodesiae as the vertical axis, and a fitting curve was made for all the points. The coefficient of determination ^R2 reached 0.9183, as shown in Figure 5. The results show that the promoter library of the present invention has good consistency in expression intensity between E. coli and E. rhodesiae.

Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, ordinary technical personnel in this field should understand that they can still modify the technical solutions described in the above embodiments, or replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

without

In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technical personnel in this field, other drawings can be obtained based on these drawings without excessive experiments.

Figure 1 is a schematic diagram of the principle of construction and testing of the expression system containing the promoter library of the present invention. Figure 2 is a plasmid map in Example 1 of the present invention. Figure 3 is the expression intensity of the promoter library in Escherichia coli in Example 1 of the present invention. Figure 4 is the expression intensity of the promoter library in E. coli in Example 2 of the present invention. Figure 5 is the correlation of the expression intensity of the promoter library in E. coli and E. coli in Example 2 of the present invention.

TW202411429A_112144768_SEQL.xml

Claims (10)

A promoter library comprises a promoter whose nucleotide sequence is shown as SEQ ID NO.1, wherein n represents any one of a, t, c, and g. The promoter library as described in claim 1, wherein the promoter library comprises promoters whose nucleotide sequences are shown as SEQ ID NO.2-41. A promoter, which is a promoter in the promoter library as described in any one of claim 1 or 2. An expression cassette comprising a promoter in the promoter library as described in any one of claim 1 or 2. A vector comprising a promoter in the promoter library as described in any one of claim 1 or 2, or comprising an expression cassette as described in claim 4. A host cell comprising a promoter in the promoter library as described in any one of claim 1 or 2, or comprising the expression cassette as described in claim 4, or comprising the vector as described in claim 5. The host cell as described in claim 6, wherein the host cell is a microbial cell, and the microbial cell includes a microbial cell of the genus Escherichia, Cupricobacterium, Corynebacterium, Brevibacterium, Arthrobacter, Microbacterium, Bacillus, Pseudomonas, and Streptomyces. A recombinant engineered bacterium comprising a promoter in the promoter library as described in any one of claim 1 or 2. Any of the following uses of a promoter library as described in any one of claim 1 or 2, or a promoter as described in claim 3, or an expression box as described in claim 4, or a vector as described in claim 5, or a host cell as described in any one of claim 6 or 7: (1) Use in regulating gene transcription and/or expression in microorganisms; (2) Use in microbial gene editing; (3) Use in microbial genetic engineering; (4) Use in the construction of engineered microorganisms for producing target products; and (5) Use in producing target products by fermentation of microorganisms. A method for regulating gene transcription and/or expression, comprising the step of operably linking a promoter in the promoter library as described in any one of claim 1 or 2 to a target gene.