TW202411427A - Nucleic acids for inhibiting expression of agt in a cell - Google Patents

Abstract

The invention relates to double-stranded nucleic acid molecules that interfere with or inhibit angiotensinogen (AGT) gene expression. It further relates to therapeutic uses of such inhibition such as for the treatment of AGT-mediated diseases, disorders or syndromes, such as hypertension, pregnancy-associated hypertension, borderline hypertension, diabetic hypertension, resistant hypertension, primary hypertension, secondary hypertension, chronic heart failure, stroke, non-alcoholic steatohepatitis (NASH), and/or non-alcoholic fatty liver disease (NAFLD).

Description

Nucleic acid for inhibiting AGT expression in cells

The present invention relates to double-stranded nucleic acid molecules that interfere with or inhibit the expression of the angiotensinogen (AGT) gene. It further relates to the therapeutic use of such inhibition, such as for the treatment of AGT-mediated diseases, conditions or syndromes, such as hypertension, pregnancy-related hypertension, critical hypertension, diabetic hypertension, refractory hypertension, primary hypertension, secondary hypertension, chronic heart failure, stroke, non-alcoholic steatohepatitis (NASH) and/or non-alcoholic fatty liver disease (NAFLD).

Double-stranded RNA (dsRNA) can bind to expressed mRNA via complementary base pairing and has been shown to block gene expression by a mechanism known as "RNA interference (RNAi)" (Fire et al., 1998, Nature. 1998 Feb 19;391(6669):806-11 and Elbashir et al., 2001, Nature. 2001 May 24;411(6836):494-8). Short dsRNAs induce gene-specific post-transcriptional silencing in many organisms, including vertebrates, and have become useful tools for studying gene function. RNAi is mediated by the RNA-induced silencing complex (RISC), a sequence-specific multicomponent nuclease that degrades messenger RNAs that are fully complementary to or homologous to the silencing triggers loaded into the RISC complex. Interfering RNAs such as siRNA, antisense RNA, and microRNA are oligonucleotides that prevent protein formation by gene silencing, i.e., inhibiting gene translation of proteins by degrading mRNA molecules. Gene silencers are becoming increasingly important for therapeutic applications in medicine.

According to Watts and Corey in the Journal of Pathology (2012; Vol. 226, pp. 365-379), algorithms are available for designing nucleic acid silencer triggers, but all of these algorithms have serious limitations. Various experimental approaches may be required to identify potent siRNAs because the algorithms do not consider factors such as the tertiary structure of the target mRNA or the involvement of RNA binding proteins. Therefore, the discovery of potent nucleic acid silencer triggers with minimal off-target effects is a complex process. For the pharmaceutical development of these highly charged molecules, it is necessary that they can be synthesized economically, distributed in the target tissue, enter the cell and exert their effects within acceptable toxicity limits.

The renin-angiotensin-aldosterone system (RAAS) is a key regulator of blood volume and systemic vascular resistance. The RAAS pathway begins with the release of proangiotensin (AGT) from the liver and renin from the kidneys into the bloodstream. Renin cleaves AGT into physiologically inactive angiotensin I, which is then converted to angiotensin II by angiotensin converting enzyme (ACE). Once angiotensin I is converted to angiotensin II, it has effects on the kidneys, adrenal cortex, arterioles, and brain by binding to angiotensin II type I (AT) and type II (AT) receptors. In the proximal tubules of the kidney, vasoconstriction II acts to increase sodium reabsorption, causing an increase in blood volume osmotic pressure, resulting in a shift of fluid into the blood volume and extracellular space. This in turn increases arterial pressure. In the adrenal cortex, vasoconstriction II stimulates the release of aldosterone, a steroid hormone that causes an increase in sodium reabsorption and potassium consumption at the distal tubules and collecting ducts of the nephron. In the arteries, vasoconstriction II binds to G protein-coupled receptors, causing arteriolar vasoconstriction, resulting in an increase in blood pressure. In addition, vasoconstriction II stimulates thirst and increases water intake via its action on the hypothalamus, and stimulates vasopressin in the pituitary gland to increase water reabsorption by the kidney. The consequences of this pathway are increases in total body sodium, total body water, and vascular tone. (Fountain JH, Lappin SL. Physiology, Renin Angiotensin System. [Updated July 22, 2021]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; January 2022).

Hypertension is the leading cause of morbidity and mortality worldwide and is associated with an increased risk of cardiovascular-related diseases, stroke, and chronic kidney disease (Al-Makki et al., Hypertension. 2022;79:293-301; Campbell et al. The Lancet Regional Health - Americas Vol. 9, May 2022, 100219). Inhibition of the RAAS system by classical antihypertensive drugs is the main approach to treating hypertension. However, many patients require the use of several antihypertensive agents from different drug classes. This complicates treatment strategies, increases the risk of side effects, and reduces patient compliance. In addition, many patients are diagnosed with intractable hypertension despite the simultaneous use of three antihypertensive agents from different classes, usually including calcium channel blockers, RAAS system blockers, and diuretics.

In addition, hypertensive patients with kidney disease should avoid taking certain antihypertensive drugs such as ACE inhibitors because they may damage the kidney function of these patients.

Therefore, there is a need to find alternative therapies that inhibit the RAAS pathway and treat hypertension. Therefore, it is an object herein to provide compounds, methods and (pharmaceutical) compositions for the treatment of AGT-mediated diseases, disorders or syndromes, such as hypertension.

WO2006021817 discloses siRNA targeting AGT for treating eye diseases. WO2015179724, WO2016196111, WO2019222166, CN114763547, CN113862268, WO2023014765, WO2023056446, WO2023066236 and WO2023278576 describe double-stranded siRNA, and WO2017062816, US2021348168, WO2022109139 and WO2022232650 describe single-stranded antisense oligonucleotides (=ASO) targeting AGT.

Olearczyk et al. (Hypertension Research 2014; 37: 405-412) developed chemically modified small interfering RNA (siRNA) to target rat hepatic proangiotensin (AGT) mRNA. Lu et al. (Arterioscler Thromb Vasc Biol. 2016; 36: 256-265) tested ASOs against AGT to determine whether AGT acts independently of angiotensin II. Mullick et al. (Hypertension. 2017; 70: 566-576) performed experiments to characterize a series of AGT ASOs and compared their efficacy and tolerability with traditional RAAS blockade. Uijl et al. evaluated the efficacy of a novel AGT siRNA in spontaneously hypertensive rats (Hypertension. 2019; 73: 1249-1257). Haase et al. (J Clin Invest. 2020;130(6):2928-2942) evaluated whether siRNA targeting maternal hepatic AGT could improve symptoms of preeclampsia in 2 rodent models without adverse effects on the placenta or fetus. Liwei et al. (Current Opinion in Nephrology and Hypertension: 2020 Mar;29(2):180-189) summarized the available data on targeting AGT with RNA-based therapeutics as a new tool to combat cardiovascular disease. Morgan et al. described the results of phase 1 and 2 studies of ASOs targeting hepatic AGT (J. Am. Coll. Cardiol. Basic Trans. Science 2021;6(6):485-496). A study published by Kukida et al. (Arterioscler Thromb Vasc Biol. 2021;41:2851-2853) determined whether liver-derived AGT regulates renal AGT accumulation by injecting an ASO targeting liver-derived AGT (GalNAc AGT ASO) into female cynomolgus macaques.

Preclinical mechanistic studies suggest that RNA interference-mediated off-target effects may be a driver of hepatotoxicity of GalNAc-siRNA conjugates. These off-target effects may be driven by binding of RISC-loaded siRNA to off-target transcripts mediated through base pairing between the seed region (nucleotides 2-8) of the siRNA guide strand and complementary sites in the 3'-untranslated region of the mRNA. This non-catalytic mechanism essentially mimics post-transcriptional silencing by endogenous miRNAs and can cause translational inhibition and/or mRNA destabilization at suprapharmacological levels of RISC-loaded siRNA, with mRNA level reduction accounting for the majority (66% to >90%) of miRNA-mediated post-transcriptional repression in mammals (Schlegel et al., Nucleic Acid Research 2022; 50(12), 6656-6670).

Therefore, an object of the present invention is to provide compounds and (pharmaceutical) compositions for treating AGT-mediated diseases, disorders or syndromes, such as hypertension, which are effective and safe.

One aspect of the present invention is a double-stranded nucleic acid for inhibiting the expression of proangiotensin (AGT), wherein the nucleic acid comprises a first strand and a second strand, wherein the unmodified equivalent of the first strand sequence comprises a sequence of at least 15 nucleotides, which differs from any of the first strand sequences shown in Table 5a, Table 1, Table 5b, Table 2 or Table 5c by no more than 3 nucleotides.

Therefore, the nucleic acids described herein are double-stranded nucleic acids that are capable of inhibiting AGT expression preferably in cells and can be used, for example, as therapeutic agents or diagnostic agents in the relevant treatment or diagnostic methods, respectively.

The nucleic acid of the present invention comprises or consists of a first strand and a second strand, and the first strand generally comprises a sequence that is sufficiently complementary to AGT mRNA, thereby mediating RNA interference.

One aspect relates to a composition comprising a nucleic acid as disclosed herein, and a solvent (preferably water), and/or a delivery vehicle, and/or a physiologically acceptable excipient, and/or a carrier, and/or a salt, and/or a diluent, and/or a buffer, and/or a preservative.

One aspect pertains to a composition comprising a nucleic acid as disclosed herein and another therapeutic agent selected from, for example, an oligonucleotide, a small molecule, a monoclonal antibody, a polyclonal antibody, and a peptide.

One aspect relates to a nucleic acid as disclosed herein or a composition comprising the nucleic acid for use as a therapeutic or diagnostic agent, e.g., in a method of use.

One aspect relates to a nucleic acid as disclosed herein or a composition comprising the nucleic acid for use in the prevention or treatment of a disease, disorder or syndrome.

One aspect relates to the use of a nucleic acid as disclosed herein or a composition comprising the nucleic acid in the prevention or treatment of a disease, disorder or syndrome.

One aspect relates to the use of a nucleic acid as disclosed herein or a composition comprising the nucleic acid for the preparation of a medicament for the prevention or treatment of a disease, disorder or syndrome.

One aspect relates to a composition as disclosed herein for use as a medicament.

One aspect relates to a method for preventing or treating a disease, disorder or syndrome comprising administering to a subject in need of treatment a pharmaceutically effective dose or amount of a nucleic acid or composition as disclosed herein.

One aspect relates to a method for preventing or treating a disease, disorder or syndrome, comprising administering to a subject in need of treatment a pharmaceutically effective dose or amount of a nucleic acid as disclosed herein or a composition comprising the nucleic acid, preferably wherein the nucleic acid or composition is administered to the subject subcutaneously, intravenously or orally, rectally, pulmonary, intramuscularly or intraperitoneally.

The present invention relates to a nucleic acid and a composition thereof, wherein the nucleic acid is double-stranded and comprises a sequence homologous to an expression RNA transcript of AGT. Such nucleic acids, their conjugates and compositions comprising the same can be used to prevent and treat a variety of diseases, disorders and syndromes requiring reduction of the expression of the AGT gene product.

The first aspect of the present invention is a double-stranded nucleic acid for preferably inhibiting AGT expression in a cell, wherein the nucleic acid comprises a first strand and a second strand, wherein the unmodified equivalent of the first strand sequence comprises a sequence of at least 15 nucleotides, which differs from any of the first strand sequences shown in Table 5a by no more than 3 nucleotides. These nucleic acids, as well as other nucleic acids, have the advantage of being active in various species relevant to preclinical and clinical development and/or having few relevant off-target effects. Having few relevant off-target effects means that the nucleic acid specifically inhibits the intended target and does not significantly inhibit other genes, or only inhibits one or a few other genes at therapeutically acceptable levels.

In this context, the expression "does not significantly inhibit other genes" means that the expression of one or more off-target genes, or the level of one or more off-target RNA molecules (e.g., mRNA) encoding one or more off-target proteins or one or more off-target protein subunits, or the activity of one or more off-target proteins or one or more off-target protein subunits is not reduced below that observed in the absence of the nucleic acid or binding nucleic acid of the present invention, or compared to the results obtained using siRNA molecules with no known homology to the human AGT transcript (referred to herein as non-silencing controls). Such controls can be bound and modified in a manner similar to the molecules of the present invention and delivered to the target cells by the same pathway. The expression of one or more off-target genes after treatment with the nucleic acid or nucleic acid combination of the present invention may be reduced by less than 30%, 25%, 20%, 15%, 10%, 8%, 5%, 3%, 2%, 1% compared to the expression of the off-target genes observed in the absence of the nucleic acid or nucleic acid combination of the present invention. The expression of cells to which the nucleic acid or nucleic acid combination is applied can be measured. Alternatively, in particular when the nucleic acid or nucleic acid combination of the present invention is administered to an individual, the amount of expression in different cell groups or in tissues or organs or in body fluids such as blood or plasma can be measured. It is preferred to measure the level of inhibition under selected conditions because these conditions show the maximum effect of nucleic acids on the content of target mRNA (herein: AGT mRNA) in cells treated with nucleic acids or nucleic acid combinations of the present invention in vitro or in vivo. The level of inhibition can be measured, for example, after treatment with the nucleic acid or binding nucleic acid of the invention at a concentration between 0.03 nM - 10 μM, preferably 0.1 nM, 0.5 nM, 1 nM, 10 nM, 100 nM or 1000 nM (for in vitro testing), or with an amount between 1 nmol - 100 μmol (for in vivo testing of mouse or non-human primate samples), or with an amount between 0.5 μmol - 100 μmol, preferably between 8 μmol - 80 μmol (for in vivo testing of human samples) for 24 hours, 48 hours, 1 week, 2 weeks, 4 weeks, 8 weeks or 12 weeks. These conditions may be different for different nucleic acids or binding nucleic acids of the invention. Examples of suitable conditions for determining the level of inhibition are described in the Examples section below.

For example, an unmodified equivalent of the first strand sequence may comprise a sequence of at least 15 nucleotides that differs from any of the first strand sequences listed in Table 1 by no more than 3 nucleotides: Table 1 First strand sequence (SEQ ID No.) Second strand sequence (SEQ ID No.) 401 308 307 308 229 230 289 290 231 232 115 116 315 316 73 74 323 324 345 346 113 114 871 316 872 232 873 116

For example, the unmodified equivalent of the first strand sequence may comprise a sequence of at least 16, preferably at least 17, even more preferably at least 18, and most preferably all 19 nucleotides, which differs from any of the first strand sequences listed in Table 1 or Table 5a by no more than 3 nucleotides, preferably no more than 2 nucleotides, more preferably no more than 1 nucleotide, and most preferably does not differ by any nucleotide.

Preferably, the unmodified equivalent of the first strand sequence of the nucleic acid consists of one of the first strand sequences shown in Table 1 or Table 5a. However, the sequence may be modified by a variety of nucleic acid modifications that do not change the identity of the nucleotides. For example, modifications of the backbone or sugar residues of the nucleic acid do not change the identity of the nucleotides, since the bases themselves remain the same as in the reference sequence.

For example, an unmodified equivalent of a first strand sequence of a nucleic acid may consist of one of the first strand sequences shown in Table 1 or Table 5a, optionally modified with one or more of the nucleic acid modifications.

A nucleic acid comprising a sequence according to a reference sequence herein means that the nucleic acid comprises a sequence of consecutive nucleotides in the order as defined in the reference sequence.

When reference is made herein to a reference sequence comprising, consisting essentially of, or consisting of nucleotides, this reference is not limited to sequences with unmodified nucleotides. The same reference also encompasses the same nucleotide sequence in which one, several, such as two, three, four, five, six, seven or more nucleotides, including all nucleotides, are modified, such as by 2'-OMe, 2'-F, ligands, linkers, 3'- or 5'-terminal modifications or any other modifications. It also refers to sequences in which two or more nucleotides are linked to each other by natural phosphodiester bonds or by any other bonds, such as phosphorothioate or phosphorodithioate bonds.

A double-stranded nucleic acid is a nucleic acid in which the first strand and the second strand hybridize to each other over at least a portion of their length and are thus capable of forming a duplex region under physiological conditions, such as at a concentration of 1 μM for each strand in PBS at 37°C. The first strand and the second strand are preferably capable of hybridizing to each other and thus forming a duplex region over a region of at least 15 nucleotides, preferably 16, 17, 18 or 19 nucleotides. This duplex region comprises nucleotide base pairing between the two strands, preferably based on Watson-Crick base pairing and/or pendulum base pairing (such as GU base pairing). All nucleotides of the two strands within the duplex region do not necessarily base pair to each other to form a duplex region. A certain number of mismatches, deletions or insertions between the nucleotide sequences of the two strands is acceptable. Overhangs on either end of the first or second strand or unpaired nucleotides at either end of the double-stranded nucleic acid are also possible. The double-stranded nucleic acid is preferably a double-stranded nucleic acid that is stable under physiological conditions and preferably has a melting temperature (Tm) of 45°C or higher, preferably 50°C or higher, and more preferably 55°C or higher, for example, in PBS at a concentration of 1 μM for each strand.

A double-stranded nucleic acid that is stable under physiological conditions is, for example, a double-stranded nucleic acid having a Tm of 45°C or higher, preferably 50°C or higher, and more preferably 55°C or higher in PBS at a concentration of 1 μM for each strand.

The first and second strands are preferably capable of forming a duplex region (i.e., complementing each other) over i) at least a portion of their length; preferably at least 15 nucleotides of their length; ii) the entire length of the first strand; iii) the entire length of the second strand; or iv) the entire length of the first strand and the second strand. The strands complement each other over a certain length means that the strands can base pair with each other over that length via Watson-Crick or perturbation base pairing. It is not necessary for each nucleotide of the length to be base-paired with its counterpart in the other strand over the entire given length, as long as a stable double-stranded nucleotide can be formed under physiological conditions. However, in certain embodiments, it is preferred if each nucleotide of the length can base pair with its counterpart in the other strand over the entire given length.

A certain number of mismatches, deletions or insertions between the first strand and the target sequence or between the first strand and the second strand can be tolerated in the context of the nucleic acids according to the invention and may even have the potential to increase RNA interference (e.g., inhibitory) activity in certain cases.

The inhibitory activity of the nucleic acid according to the present invention relies on the formation of a duplex region between all or a portion of the first strand and a portion of the target nucleic acid. The portion of the target nucleic acid that forms the duplex region with the first strand (defined as starting with the first base pair formed between the first strand and the target sequence and ending with the last base pair formed between the first strand and the target sequence, including the ends) is the target nucleic acid sequence or, in short, the target sequence. The duplex region formed between the first strand and the second strand is not necessarily the same as the duplex region formed between the first strand and the target sequence. That is, the second strand may have a sequence different from the target sequence; however, the first strand must be able to form a duplex structure with both the second strand and the target sequence, at least under physiological conditions.

The complementarity between the first strand and the target sequence can be perfect (ie, 100% identity with no nucleotide mismatches or insertions or deletions in the first strand compared to the target sequence).

The complementarity between the first strand of the target sequence and the complementary sequence can range from about 75% to about 100%. More specifically, the complementarity can be at least 75%, 80%, 85%, 90% or 95% and intermediate values, provided that the nucleic acid is capable of reducing or inhibiting AGT expression.

Nucleic acids with less than 100% complementarity between the first strand and the target sequence may be able to reduce AGT expression to the same level as nucleic acids with perfect complementarity between the first strand and the target sequence. Alternatively, they may be able to reduce AGT expression to 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% of the reduction achieved by nucleic acids with perfect complementarity.

The nucleic acid of the present invention may be an isolated nucleic acid.

The nucleic acid of the present invention may be the following nucleic acid, wherein: (a)    The unmodified equivalent of the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 5a by no more than 3 nucleotides, and where the unmodified equivalent of the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 5a by no more than 3 nucleotides; (b)    The unmodified equivalent of the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 5a by no more than 2 nucleotides, and where the unmodified equivalent of the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 5a by no more than 2 nucleotides; (c)  The unmodified equivalent of the first strand sequence comprises a sequence that differs from any of the first strand sequences of Table 5a by no more than 1 nucleotide, and where the unmodified equivalent of the second strand sequence comprises a sequence that differs from the corresponding second strand sequence of Table 5a by no more than 1 nucleotide; (d)    The unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 2 to 17 from the 5' end of any of the first strand sequences having a given SEQ ID No. shown in Table 5a, and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5a; (e)    The unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 2 to 17 from the 5' end of any of the first strand sequences having a given SEQ ID No. shown in Table 5a, and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5a. No., and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a; (f)    The unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. as shown in Table 5a, and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a; (g)    The unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a No., and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 1 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a; (h)    The unmodified equivalent of the first strand sequence comprises a sequence of any of the first strand sequences having a given SEQ ID No. as shown in Table 5a, and where the unmodified equivalent of the second strand sequence comprises a sequence of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a; (i)    The unmodified equivalent of the first strand sequence consists essentially of any of the first strand sequences having a given SEQ ID No. as shown in Table 5a, and where the unmodified equivalent of the second strand sequence consists essentially of a sequence of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a; (j)    The unmodified equivalent of the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5a, wherein the unmodified equivalent of the first strand sequence further consists of 1 (nucleotide 20 counting from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5a. and where the unmodified equivalent of the second strand sequence comprises or consists essentially of or consists of: a sequence corresponding to the second strand sequence having a given SEQ ID No. as shown in Table 5a; (k)    The unmodified equivalent of the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. as shown in Table 5a, where the unmodified equivalent of the first strand sequence is in the given SEQ ID No. as shown in Table 5a The 3' end of any of the first strand sequences of SEQ ID NO. No. further consists of 1 (nucleotide 20 counting from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides, and wherein the unmodified equivalent of the first strand sequence consists of a continuous region complementary to the AGT transcript of SEQ ID NO. 870 with a length of 17-25 nucleotides, preferably a length of 18-24 nucleotides; and whereby the unmodified equivalent of the second strand sequence comprises or consists essentially of or consists of: a sequence having the corresponding second strand sequence of a given SEQ ID No. shown in Table 5a; (l)    The unmodified equivalent of the first strand sequence consists of any one of the first strand sequences having a given SEQ ID No. shown in Table 5a, and where appropriate, the unmodified equivalent of the second strand sequence consists of the sequence corresponding to the second strand sequence having a given SEQ ID No. shown in Table 5a; (m)   The unmodified equivalent of the first strand and the unmodified equivalent of the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are present on a single strand, wherein the unmodified equivalent of the first strand and the unmodified equivalent of the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; or (n)  The unmodified equivalent of the first strand and the unmodified equivalent of the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are on two separate strands, and these unmodified equivalents are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length.

For example, the nucleic acid of the present invention may be the following nucleic acid, wherein: (a)    The unmodified equivalent of the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 1 by no more than 3 nucleotides, and where the unmodified equivalent of the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 1 by no more than 3 nucleotides; (b)    The unmodified equivalent of the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 1 by no more than 2 nucleotides, and where the unmodified equivalent of the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 1 by no more than 2 nucleotides; (c)  The unmodified equivalent of the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 1 by no more than 1 nucleotide, and where the unmodified equivalent of the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 1 by no more than 1 nucleotide; (d)    The unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of any of the first strand sequences having a given SEQ ID No. shown in Table 1, and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 2 to 17 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 1; (e)    The unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of any of the first strand sequences having a given SEQ ID No. shown in Table 1, and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 2 to 17 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 1 No., and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 1; (f)    The unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. as shown in Table 1, and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 1; (g)    The unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 1 No., and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 1 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 1; (h)    The unmodified equivalent of the first strand sequence comprises a sequence of any of the first strand sequences having a given SEQ ID No. shown in Table 1, and where the unmodified equivalent of the second strand sequence comprises a sequence of the corresponding second strand sequence having a given SEQ ID No. shown in Table 1; (i)    The unmodified equivalent of the first strand sequence consists essentially of any of the first strand sequences having a given SEQ ID No. shown in Table 1, and where the unmodified equivalent of the second strand sequence consists essentially of a sequence of the corresponding second strand sequence having a given SEQ ID No. shown in Table 1; (j)   The unmodified equivalent of the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 1, wherein the unmodified equivalent of the first strand sequence further consists of 1 (nucleotide 20 counting from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 1, and optionally wherein the unmodified equivalent of the second strand sequence comprises or consists essentially of or consists of: a given SEQ ID No. shown in Table 1 No.; (k)    The unmodified equivalent of the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any of the first strand sequences having a given SEQ ID No. shown in Table 1, wherein the unmodified equivalent of the first strand sequence further consists of 1 (nucleotide 20 counting from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any of the first strand sequences having a given SEQ ID No. shown in Table 1, and wherein the unmodified equivalent of the first strand sequence consists of a continuous region complementary to the AGT transcript of SEQ ID NO. 870 of 17-25 nucleotides in length, preferably 18-24 nucleotides in length; and Where appropriate, wherein the unmodified equivalent of the second strand sequence comprises or consists essentially of or consists of: a sequence corresponding to the second strand sequence of a given SEQ ID No. shown in Table 1; (l)    The unmodified equivalent of the first strand sequence consists of any one of the first strand sequences of a given SEQ ID No. shown in Table 1, and where appropriate, wherein the unmodified equivalent of the second strand sequence consists of a sequence corresponding to the second strand sequence of a given SEQ ID No. shown in Table 1; (m)  The unmodified equivalent of the first strand and the unmodified equivalent of the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are present on a single strand, wherein the unmodified equivalent of the first strand and the unmodified equivalent of the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; or (n) The unmodified equivalent of the first strand and the unmodified equivalent of the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are on two separate strands, and these unmodified equivalents are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length.

As the case may be, a "corresponding" second strand means a second strand that is present in the same duplex as a given first strand in Table 5a, 5b or 5c or is listed as a corresponding second strand sequence in Table 1 or Table 2. In other words, a first strand and its corresponding second strand are represented as strand "A" and strand "B", respectively, of a duplex having a given duplex ID in Table 5a, 5b or 5c, or as described in Table 1 and Table 2.

In one aspect, if the 5'-majority of nucleotides of the first strand are nucleotides other than A or U, then this nucleotide is replaced by A or U. Preferably, if the 5'-majority of nucleotides of the first strand are nucleotides other than U, then this nucleotide is replaced by U, and more preferably by U with a 5' vinylphosphonate.

In comparative experiments, when the nucleic acid of the present invention does not comprise the complete sequence of the reference first and/or second strand sequences (such as given in Tables 1, 2, 5a, 5b or 5c) or one or both strands differ from the corresponding reference sequence by one, two or three nucleotides, the nucleic acid preferably retains at least 30%, more preferably at least 50%, more preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, still more preferably at least 95%, and most preferably at least 100% of the AGT inhibitory activity compared to the inhibitory activity of the corresponding nucleic acid comprising the entire first and second strand reference sequences.

Nucleic acids capable of hybridizing under physiological conditions are nucleic acids capable of forming base pairs (preferably Watson-Crick or pendular base pairs) between at least a portion of the opposing nucleotides in the strands so as to form at least a double helical region. Such double-stranded nucleic acids are preferably stable double-stranded nucleic acids under physiological conditions (e.g., in PBS at 37°C at a concentration of 1 μM per strand), meaning that under such conditions, the two strands remain hybridized with each other. The Tm of the double-stranded nucleotide is preferably 45°C or higher, preferably 50°C or higher, and more preferably 55°C or higher.

One aspect of the present invention relates to a nucleic acid for inhibiting AGT expression, wherein the nucleic acid comprises at least 15, preferably at least 16, more preferably at least 17, and even more preferably at least 18 nucleotides, and preferably all nucleotides differ from any of the first strand unmodified equivalent sequences of Table 5a or Table 1 by no more than 3 nucleotides, preferably no more than 2 nucleotides, more preferably no more than 1 nucleotide, and preferably a first sequence that does not differ from any nucleotides, and the first sequence is capable of hybridizing with a target gene transcript (such as mRNA) under physiological conditions. Preferably, the nucleic acid further comprises at least 15, preferably at least 16, more preferably at least 17, and even more preferably at least 18 nucleotides, and most preferably all nucleotides differ from any of the corresponding second strand unmodified equivalent sequences in Table 5a or Table 1 by no more than 3 nucleotides, preferably no more than 2 nucleotides, more preferably no more than 1 nucleotide, and most preferably a second sequence that does not differ from any nucleotides, the second sequence is capable of hybridizing with the first sequence under physiological conditions, and preferably the nucleic acid is an siRNA capable of inhibiting AGT expression via an RNAi pathway.

One aspect relates to any double-stranded nucleic acid as disclosed in Table 1, 2, 5a, 5b or 5c, each of which can be referred to by a given duplex ID, which is preferably used to inhibit AGT expression, with the proviso that the double-stranded nucleic acid is capable of inhibiting AGT expression. These nucleic acids are siRNAs. Inhibition occurs by targeted degradation of the mRNA transcript of the target gene after transcription. The siRNA forms part of the RISC complex. The RISC complex specifically targets the target RNA by sequence complementarity of the first (antisense) strand and the target sequence.

One aspect relates to a double-stranded nucleic acid that is preferably capable of inhibiting AGT expression in a cell, which is used, for example, as a therapeutic or diagnostic agent in a related treatment or diagnostic method, wherein the nucleic acid preferably comprises or consists of a first strand and a second strand, and preferably wherein the first strand comprises a sequence that is sufficiently complementary to AGT mRNA to mediate RNA interference.

The nucleic acids described herein may be capable of inhibiting AGT expression. Inhibition may be complete, i.e., 0% expression remaining. Inhibition of AGT expression may be partial, i.e., it may be 15%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more, or an intermediate value, of the amount of AGT expression that would be inhibited in the absence of the nucleic acids of the invention. The level of inhibition may be measured by comparing the treated sample to an untreated sample or a sample treated with a control (such as an siRNA that does not target AGT). Inhibition may be measured by measuring the level of AGT mRNA and/or protein or the level of a biomarker or indicator associated with the presence or activity of AGT. It may be measured in cells that may have been treated in vitro with the nucleic acids described herein. Alternatively or additionally, inhibition can be measured in cells (such as hepatocytes) or tissues (such as liver tissue) or organs (such as liver) or in body fluids (such as blood, serum, lymph) or any other body part or fluid obtained from an individual previously treated with a nucleic acid disclosed herein. Preferably, inhibition of AGT expression is determined by comparing the level of AGT mRNA measured in cells expressing AGT after 24 or 48 hours in vitro treatment with double-stranded RNA disclosed herein under ideal conditions (see examples of appropriate concentrations and conditions) with the level of AGT mRNA measured in control cells treated or simulated with control double-stranded RNA under the same conditions.

One aspect of the invention relates to a nucleic acid wherein a first strand and a second strand are present on a single strand of a wraparound nucleic acid such that the first strand and the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid with the double helical region.

Preferably, the first and second strands of the nucleic acid are separate strands. The two separate strands are preferably 17 to 25 nucleotides in length each, more preferably 18 to 25 nucleotides in length. The two strands may be of the same or different lengths. The first strand may be 17-25 nucleotides in length, preferably 18-24 nucleotides in length, and may be 18, 19, 20, 21, 22, 23 or 24 nucleotides in length. Most preferably, the first strand is 19 nucleotides in length. The second strand may be independently 17-25 nucleotides in length, preferably 18-24 nucleotides in length, and may be 18, 19, 20, 21, 22, 23 or 24 nucleotides in length. More preferably, the second strand is 18 or 19 or 20 nucleotides in length, and most preferably, is 19 nucleotides in length.

Preferably, the first and second strands of the nucleic acid form a duplex region of 17-25 nucleotides in length. More preferably, the length of the duplex region is 18-24 nucleotides. The length of the duplex region may be 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. In a preferred embodiment, the length of the duplex region is 18 or 19 nucleotides. The duplex region is defined herein as the region between and including the 5'-most nucleotides of the first strand that form base pairs with nucleotides of the second strand to the 3'-most nucleotides of the first strand that form base pairs with nucleotides of the second strand. The duplex region may include nucleotides in either or both strands that are not base paired with nucleotides in the other strand. It may include one, two, three or four such nucleotides on the first strand and/or the second strand. However, preferably, the duplex region consists of 17-25 consecutive nucleotide base pairs. In other words, it preferably comprises 17-25 consecutive nucleotides on both strands, all of which are paired with nucleotides in the other strand. More preferably, the duplex region consists of 18 or 19, most preferably 18 consecutive nucleotide base pairs.

In various embodiments disclosed herein, the nucleic acid can be blunt at both ends; have an overhang at one end and a blunt end at the other end; or have overhangs at both ends.

The nucleic acid may have an overhang at one end and a blunt end at the other end. The nucleic acid may have overhangs at both ends. The nucleic acid may be blunt ended at both ends. The nucleic acid may be blunt ended at the 5' end of the first strand and the 3' end of the second strand or at the 3' end of the first strand and the 5' end of the second strand.

The nucleic acid may comprise an overhang at the 3' end or the 5' end. The nucleic acid may have a 3' overhang on the first strand. The nucleic acid may have a 3' overhang on the second strand. The nucleic acid may have a 5' overhang on the first strand. The nucleic acid may have a 5' overhang on the second strand. The nucleic acid may have an overhang at both the 5' and 3' ends of the first strand. The nucleic acid may have an overhang at both the 5' and 3' ends of the second strand. The nucleic acid may have a 5' overhang on the first strand and a 3' overhang on the second strand. The nucleic acid may have a 3' overhang on the first strand and a 5' overhang on the second strand. The nucleic acid may have a 3' overhang on the first strand and a 3' overhang on the second strand. The nucleic acid may have a 5' overhang on the first strand and a 5' overhang on the second strand.

The overhang at the 3' or 5' end of the second or first strand may consist of 1, 2, 3, 4 and 5 nucleotides in length. Optionally, the overhang may consist of 1 or 2 nucleotides, which may or may not be modified.

In one embodiment, the 5' end of the first strand is a single-stranded overhang of one, two or three nucleotides, preferably one nucleotide.

Nucleic Acid Modifications The nucleic acids discussed herein include unmodified RNA as well as RNA that has been modified, for example, to improve efficacy or stability. Unmodified RNA refers to molecules in which the components of the nucleic acid (i.e., sugar, base, and phosphate moieties) are identical or substantially identical to the components of nucleic acids found in nature (e.g., nucleic acid components naturally found in humans). As used herein, the term "modified nucleotides" refers to nucleotides in which one or more components of the nucleotide (i.e., sugar, base, and phosphate moieties) are different from the components of nucleotides found in nature. In certain instances, the term "modified nucleotides" also refers to molecules that are not nucleotides in the strict sense of the term because they lack or replace essential components of a nucleotide (e.g., sugar, base, or phosphate moieties). Even if one or more of the nucleotides of a nucleic acid have been replaced by a modified nucleotide that lacks or replaces essential components of a nucleotide, a nucleic acid comprising such modified nucleotides should still be understood as a nucleic acid.

Modification of the nucleic acids of the present invention generally provides a powerful tool to overcome potential limitations, including but not limited to the inherent in vitro and in vivo stability and bioavailability of natural RNA molecules. The nucleic acids according to the present invention can be modified by chemical modification. The modified nucleic acids can also minimize the possibility of inducing interferon activity in the human body. The modification can further enhance the functional delivery of nucleic acids to target cells. Preferably, the modified nucleic acids of the present invention may include one or more chemically modified ribonucleotides in either or both of the first or second strands. The ribonucleotides may include chemical modifications of base, sugar or phosphate moieties. Ribonucleic acids can be modified by substitution or insertion with analogs of nucleic acids or bases.

Throughout the specification of the present invention, "same or common modification" means the same modification of any nucleotide, which is A, G, C or U modified with a group such as methyl (2'-OMe) or fluoro (2'-F). For example, 2'-F-dU, 2'-F-dA, 2'-F-dC, 2'-F-dG are all considered the same or common modification, as are 2'-OMe-rU; 2'-OMe-rA; 2'-OMe-rC; 2'-OMe-rG. In contrast, 2'-F modification is a different modification than 2'-OMe modification.

Preferably, at least one nucleotide of the first and/or second strand of the nucleic acid is a modified nucleotide, preferably a non-naturally occurring nucleotide, such as a 2'-F modified nucleotide.

The modified nucleotides may be nucleotides with modified sugar groups. The 2' hydroxyl (OH) group may be modified or replaced by a variety of different "oxy" or "deoxy" substituents.

Examples of "oxy"-2'hydroxy modifications include alkoxy or aryloxy (OR, e.g., R═H, alkyl (e.g., methyl), cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), O(CH ₂ CH ₂ O) _n CH ₂ CH ₂ OR; "locked" nucleic acids (LNAs) in which the 2'hydroxyl is linked to the 4' carbon of the same ribose, e.g., via a methylene bridge; O-amines (amine═NH ₂ , alkylamine, dialkylamine, heterocyclo, arylamine, diarylamine, heteroarylamine, or diheteroarylamine, ethylenediamine, or polyamine) and aminoalkoxy, O(CH ₂ ) _namine (e.g., amine═NH ₂ , alkylamine, dialkylamine, heterocyclic group, arylamine, diarylamine, heteroarylamine or diheteroarylamine, ethylenediamine or polyamine).

"Deoxy" modifications include hydrogen, halogen, amine (e.g., _NH2 , alkylamine, dialkylamine, _heterocyclic , arylamine, diarylamine, heteroarylamine, diheteroarylamine, or amino acid); NH(CH2CH2NH)nCH2CH2 _- amine (amine = NH2 _, alkylamine, dialkylamine, heterocyclic, arylamine _, diarylamine, heteroarylamine, or diheteroarylamine) _, -NHC(O)R ₍ R = alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano; alkyl; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl groups, which may be optionally substituted, for example, with an amine functional group. Other substituents of certain embodiments include 2'-methoxyethyl, 2'-OCH ₃ , 2'-O-allyl, 2'-C-allyl, and 2'-fluoro.

The sugar group may also contain one or more carbons that have a stereochemical configuration opposite to the corresponding carbon in ribose. Thus, modified nucleotides may contain sugars such as arabinose.

Modified nucleotides may also include "abasic" sugars, which lack a nucleobase at C-1'. These abasic sugars may further contain modifications at one or more of the constituent sugar atoms.

The 2' modification can be used in combination with one or more phosphate internucleoside linker modifications (eg, phosphorothioate or phosphorodithioate).

One or more nucleotides of the nucleic acid of the present invention may be modified. The nucleic acid may comprise at least one modified nucleotide. The modified nucleotide may be in the first strand. The modified nucleotide may be in the second strand. The modified nucleotide may be in the duplex region. The modified nucleotide may be outside the duplex region, i.e., in the single strand region. The modified nucleotide may be on the first strand and may be outside the duplex region. The modified nucleotide may be on the second strand and may be outside the duplex region. The 3'-terminal nucleotide of the first strand may be a modified nucleotide. The 3'-terminal nucleotide of the second strand may be a modified nucleotide. The 5'-terminal nucleotide of the first strand may be a modified nucleotide. The 5'-terminal nucleotide of the second strand may be a modified nucleotide.

The nucleic acids of the invention may have 1 modified nucleotide or the nucleic acids of the invention may have about 2-4 modified nucleotides, or the nucleic acids may have about 4-6 modified nucleotides, about 6-8 modified nucleotides, about 8-10 modified nucleotides, about 10-12 modified nucleotides, about 12-14 modified nucleotides, about 14-16 modified nucleotides, about 16-18 modified nucleotides, about 18-20 modified nucleotides, about 20-22 modified nucleotides, about 22-24 modified nucleotides, about 24-26 modified nucleotides, or about 26-28 modified nucleotides. In each case, the nucleic acid comprising the modified nucleotides retains at least 50% of its activity compared to the same nucleic acid without the modified nucleotides, or vice versa. The nucleic acid may retain 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% and intermediate values of its activity compared to the same nucleic acid but without the modified nucleotides, or may have greater than 100% of the activity of the same nucleic acid without the modified nucleotides.

The modified nucleotides may be purines or pyrimidines. At least half of the purines may be modified. At least half of the pyrimidines may be modified. All purines may be modified. All pyrimidines may be modified. The modified nucleotides may be selected from the group consisting of: 3' terminal deoxythymine (dT) nucleotides, 2'-O-methyl (2'-OMe) modified nucleotides, 2' modified nucleotides, 2' deoxy modified nucleotides, locked nucleotides, abasic nucleotides, 2' amino modified nucleotides, 2' alkyl modified nucleotides, 2'-deoxy-2'-fluoro (2'-F) modified nucleotides, N-phenothioyl nucleotides, phosphoamido esters, non-natural bases containing nucleotides, nucleotides containing 5'-phosphorothioate groups, nucleotides containing 5' phosphates or 5' phosphate mimetics, and terminal nucleotides linked to cholesterol derivatives or dodecanoic acid didecylamide groups.

The nucleic acid may comprise a nucleotide comprising a modified base, wherein the base is selected from 2-aminoadenosine, 2,6-diaminopurine, inosine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethoxybenzene, 3-methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g., 5-methylcytidine), 5-alkyluridine (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine), 6-azapyrimidine, 6-alkylpyrimidine (e.g., 6-methyluridine), propyne, quesosine, 2-thiouridine, 4-thiouridine, wybutosine, wybutoxosine, 4-acetylcytidine, 5- (Carboxyhydroxymethyl)uridine, 5'-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, β-D-galactosylqueosine, 1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine, 3-methylcytidine, 2-methyladenosine, 2-methylguanosine, N6-methyladenosine, 7-methylguanosine, 5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylcarbonylmethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 2-methylthio-N6-isopentenyladenosine, β-D-mannosylqueosine, uridine-5-oxyacetic acid and 2-thiocytidine.

Many modifications described herein and occurring within nucleic acids will be repeated within a polynucleotide molecule, such as modifications of a base or phosphate moiety or non-linked O of a phosphate moiety. In some cases, modifications occur at all possible positions/nucleotides in a polynucleotide, but in many cases do not occur. Modifications may occur only at the 3' or 5' terminal position, may occur only in the terminal region, such as at a position on the terminal nucleotide or in the last 2, 3, 4, 5 or 10 nucleotides of a strand. Modifications may occur in double-stranded regions, single-stranded regions, or both. Modifications may occur only in double-stranded regions of a nucleic acid of the present invention, or may occur only in single-stranded regions of a nucleic acid of the present invention. Phosphorothioate or phosphorodithioate modifications at non-linked O positions may occur only at one or both ends, may occur only in the terminal region, for example at a position on the terminal nucleotide or in the last 2, 3, 4 or 5 nucleotides of a strand, or may occur in the duplex region and/or the single strand region, particularly at the terminus. The 5' end and/or the 3' end may be phosphorylated.

The stability of the nucleic acids of the present invention can be increased by including specific bases in the overhang or by including modified nucleotides in the single-stranded overhang, for example in the 5' or 3' overhang or in both. Purine nucleotides can be included in the overhang. All or some of the bases in the 3' or 5' overhang can be modified. Modifications can include the use of modifications at the 2' OH group of the ribose, the use of deoxyribonucleotides instead of ribonucleotides, and modifications in the phosphate group, such as phosphorothioate or phosphorodithioate modifications. The overhang does not need to be homologous to the target sequence.

Nucleases can hydrolyze nucleic acid phosphodiester bonds. However, chemical modification of nucleic acids can impart improved properties and can make oligonucleotides more stable to nucleases.

As used herein, a modified nucleic acid may include one or more of the following: (i)    an alteration, such as replacement of one or both of the non-linked phosphate oxygens and/or one or more of the linked phosphate oxygens (even though the 5' and 3' ends of the nucleic acids of the present invention are referred to as linked); (ii)   an alteration, such as replacement of a component of the ribose, such as the 2' hydroxyl group on the ribose; (iii)   replacement of the phosphate moiety with a "dephosphorylated" linker; (iv)   modification or replacement of a naturally occurring base; (v)   replacement or modification of the ribose-phosphate backbone; and (vi)   modification of the 3' or 5' end of the first and/or second strand, such as removal, modification or replacement of a terminal phosphate group or attachment of a moiety (such as a fluorescently labeled moiety) to the 3' or 5' end of one or both strands.

The terms "substituted," "modified," and "altered" indicate a molecule that is different from that occurring in nature.

Specific modifications are discussed in more detail below.

The nucleic acid may comprise one or more modified nucleotides on the second and/or first strand. Alternating nucleotides may be modified to form modified nucleotides.

As used herein, "alternating" means appearing one after another in a regular manner. In other words, alternating means appearing repeatedly in sequence. For example, if one nucleotide is modified, the next consecutive nucleotide is not modified, and the next consecutive nucleotide is modified, and so on. One nucleotide can be modified with a first modification, the next consecutive nucleotide can be modified with a second modification, and the following consecutive nucleotides can be modified with the first modification, and so on, wherein the first and second modifications are different.

Some representative modified nucleic acid sequences of the present invention are shown in the examples. These examples are intended to be representative and not limiting.

In one aspect of the nucleic acid, at least nucleotides 2 and 14 of the first strand are preferably modified by a first common modification, the nucleotides being numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand. The first modification is preferably 2'-F.

In one aspect, at least one, several or preferably all even-numbered nucleotides of the first strand are preferably modified by a first common modification, the nucleotides being numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand. The first modification is preferably 2'-F.

In one aspect, at least one, several or preferably all odd-numbered nucleotides of the first strand are modified, said nucleotides being numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand. Preferably, they are modified by a second modification. If the nucleic acid also comprises a first modification, e.g. a first modification of nucleotides 2 and 14 or all even-numbered nucleotides of the first strand, this second modification is preferably different from the first modification. The first modification is preferably any 2'-ribose modification of the same size or smaller in size than a 2'-OH group, or a locking nucleic acid (LNA), or an unblocking nucleic acid (UNA) or a 2'-fluoroarabinoic acid (FANA) modification. A 2'-ribose modification of the same size or smaller in size than a 2'-OH group may be, for example, 2'-F, 2'-H, 2'-halogen or 2'-NH ₂ . The second modification is preferably any 2'-ribose modification that is larger in size than the 2'-OH group. A 2'-ribose modification that is larger in size than the 2'-OH group can be, for example, 2'-OMe, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-allyl or 2'-O-alkyl, provided that the nucleic acid is able to reduce the expression of the target gene under similar conditions to at least the same extent as the same nucleic acid without the modification. The first modification is preferably 2'-F and/or the second modification is preferably 2'-OMe.

In the context of the present invention, the size or volume of a substituent (such as a 2' ribose modification) is preferably measured in terms of van der Waals volume.

In one aspect, at least one, several or preferably all nucleotides of the second strand in positions corresponding to even-numbered nucleotides of the first strand are modified, preferably by a third modification. Preferably, nucleotides 2 and 14 of the first strand or all even-numbered nucleotides in the same nucleic acid are modified with the first modification. Additionally or alternatively, the odd-numbered nucleotides of the first strand are modified with the second modification. Preferably, the third modification is different from the first modification and/or the third modification is the same as the second modification. The first modification is preferably any 2' ribose modification of the same size or smaller in volume than a 2'-OH group, or a locking nucleic acid (LNA), or an unblocking nucleic acid (UNA) or a 2'-fluoroarabinoic acid (FANA) modification. A 2'-ribose modification of the same size or smaller than the 2'-OH group may be, for example, 2'-F, 2'-H, 2'-halogen or 2'-NH _2. The second and/or third modification is preferably any 2'-ribose modification that is larger than the 2'-OH group. A 2'-ribose modification that is larger than the 2'-OH group may be, for example, 2'-OMe, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-allyl or 2'-O-alkyl, provided that the nucleic acid is able to reduce the expression of the target gene under similar conditions to at least the same extent as the same nucleic acid without the modification. The first modification is preferably 2'-F and/or the second and/or third modification is preferably 2'-OMe. The nucleotides on the first strand are numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand.

A nucleotide of the second strand in a position corresponding to, for example, an even-numbered nucleotide of the first strand is a nucleotide of the second strand that base pairs with an even-numbered nucleotide of the first strand.

In one aspect, at least one, several or preferably all nucleotides of the second strand in positions corresponding to odd-numbered nucleotides of the first strand are modified, preferably by a fourth modification. Preferably, in the same nucleic acid, nucleotides 2 and 14 or all even-numbered nucleotides of the first strand are modified with the first modification. Additionally or alternatively, the odd-numbered nucleotides of the first strand are modified with the second modification. Additionally or alternatively, all nucleotides of the second strand in positions corresponding to even-numbered nucleotides of the first strand are modified with the third modification. The fourth modification is preferably different from the second modification and preferably different from the third modification, and the fourth modification is preferably the same as the first modification. The first and/or fourth modification is preferably any 2'ribose modification of the same size or smaller than the 2'-OH group, or a locked nucleic acid (LNA), or an unblocked nucleic acid (UNA) or a 2'-fluoroarabinoic acid (FANA) modification. A 2'ribose modification of the same size or smaller than the 2'-OH group may be, for example, 2'-F, 2'-H, 2'-halogen or 2'-NH ₂ . The second and/or third modification is preferably any 2'ribose modification of a larger size than the 2'-OH group. The 2'-ribose modification that is larger in size than the 2'-OH group can be, for example, 2'-OMe, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-allyl or 2'-O-alkyl, provided that the nucleic acid is capable of reducing the expression of the target gene under similar conditions to at least the same extent as the same nucleic acid without the modification. The first and/or fourth modification is preferably a 2'-OMe modification and/or the second and/or third modification is preferably a 2'-F modification. The nucleotides on the first strand are numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand.

In one aspect of the nucleic acid, one or more nucleotides of the second strand in a position corresponding to nucleotide 11 or nucleotide 13 or nucleotides 11 and 13 or nucleotides 11 to 13 of the first strand are modified by a fourth modification. Preferably, all nucleotides of the second strand except one or more nucleotides in a position corresponding to nucleotide 11 or nucleotide 13 or nucleotides 11 and 13 or nucleotides 11 to 13 of the first strand are modified by a third modification. Preferably, in the same nucleic acid, nucleotides 2 and 14 of the first strand or all even-numbered nucleotides are modified with the first modification. Additionally or alternatively, the odd-numbered nucleotides of the first strand are modified with the second modification. The fourth modification is preferably different from the second modification and preferably different from the third modification, and the fourth modification is preferably the same as the first modification. The first and/or fourth modification is preferably any 2'ribose modification of the same size or smaller than the 2'-OH group, or a locked nucleic acid (LNA), or an unblocked nucleic acid (UNA) or a 2'-fluoroarabinoic acid (FANA) modification. A 2'ribose modification of the same size or smaller than the 2'-OH group may be, for example, 2'-F, 2'-H, 2'-halogen or 2'-NH ₂ . The second and/or third modification is preferably any 2'ribose modification of a larger size than the 2'-OH group. The 2'-ribose modification that is larger in size than the 2'-OH group can be, for example, 2'-OMe, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-allyl or 2'-O-alkyl, provided that the nucleic acid is capable of reducing the expression of the target gene under similar conditions to at least the same extent as the same nucleic acid without the modification. The first and/or fourth modification is preferably a 2'-OMe modification and/or the second and/or third modification is preferably a 2'-F modification. The nucleotides on the first strand are numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand.

In one aspect of the nucleic acid, all even-numbered nucleotides of the first strand are modified by a first modification, all odd-numbered nucleotides of the first strand are modified by a second modification, all nucleotides of the second strand in positions corresponding to the even-numbered nucleotides of the first strand are modified by a third modification, and all nucleotides of the second strand in positions corresponding to the odd-numbered nucleotides of the first strand are modified by a fourth modification, wherein the first and/or fourth modification is 2'-F and/or the second and/or third modification is 2'-OMe.

In one aspect of the nucleic acid, all even-numbered nucleotides of the first strand are modified by a first modification, all odd-numbered nucleotides of the first strand are modified by a second modification, all nucleotides of the second strand in positions corresponding to nucleotides 11-13 of the first strand are modified by a fourth modification, and all nucleotides of the second strand except for the nucleotides corresponding to nucleotides 11-13 of the first strand are modified by a third modification, wherein the first and fourth modifications are 2'-F and the second and third modifications are 2'-OMe. In one embodiment of this aspect, the 3' terminal nucleotide of the second strand is a reverse RNA nucleotide (i.e., the nucleotide is attached to the 3' end of the strand via its 3' carbon rather than its 5' carbon as is usually the case). When the 3' terminal nucleotide of the second strand is a reverse RNA nucleotide, the reverse RNA nucleotide is preferably an unmodified nucleotide, meaning that it does not contain any modification compared to its natural nucleotide counterpart. Specifically, the reverse RNA nucleotide is preferably a 2'-OH nucleotide. Preferably, in this aspect, when the 3' terminal nucleotide of the second strand is a reverse RNA nucleotide, the nucleic acid is blunt-ended at least at the end including the 5' end of the first strand.

One aspect of the present invention is a nucleic acid for inhibiting the expression of an AGT gene in a cell as disclosed herein, wherein the first strand comprises modified nucleotides or unmodified nucleotides at a plurality of positions to facilitate processing of the nucleic acid by RISC.

In one aspect, "facilitating processing by RISC" means that the nucleic acid can be processed by RISC, e.g., any modifications present will permit the nucleic acid to be processed by RISC, and preferably will benefit from processing by RISC, thereby appropriately being able to generate siRNA activity.

A nucleic acid as disclosed herein, wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-OMe modification, and one or more nucleotides on the second strand corresponding to position 11 or position 13 or position 11 and 13 or position 11, 12 and 13 of the first strand are not modified with a 2'-OMe modification (in other words, they are unmodified or modified with a modification other than 2'-OMe).

In one aspect, the nucleotide on the second strand corresponding to position 13 of the first strand is a nucleotide that forms a base pair with position 13 (from the 5' end) of the first strand.

In one aspect, the nucleotide on the second strand corresponding to position 11 of the first strand is a nucleotide that forms a base pair with position 11 (from the 5' end) of the first strand.

In one aspect, the nucleotide on the second strand corresponding to position 12 of the first strand is the nucleotide that forms a base pair with position 12 (from the 5' end) of the first strand.

For example, in a double-stranded and blunt-ended 19-mer nucleic acid, position 13 (from the 5' end) of the first strand will pair with position 7 (from the 5' end) of the second strand. Position 11 (from the 5' end) of the first strand will pair with position 9 (from the 5' end) of the second strand. This nomenclature can be applied to other positions of the second strand.

In one aspect, in the case of partially complementary first and second strands, if a nucleotide on the second strand "corresponds to" a position on the first strand where there is a mismatch, that position does not necessarily form a base pair, but the nomenclature principles still apply.

One aspect is a nucleic acid as disclosed herein, wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-OMe modification, and the nucleotides on the second strand corresponding to positions 11 or 13 or 11 and 13 or 11 to 13 of the first strand are modified with a 2'-F modification.

One aspect is a nucleic acid as disclosed herein, wherein the nucleotides at positions 2 and 14 of the 5' end of the first strand are 2'-F modified, and the nucleotides on the second strand corresponding to positions 11 or 13 or 11 and 13 or 11-13 of the first strand are not 2'-OMe modified.

One aspect is a nucleic acid as disclosed herein, wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are modified with a 2'-F modification, and the nucleotides on the second strand corresponding to positions 11 or 13 or 11 and 13 or 11 to 13 of the first strand are modified with a 2'-F modification.

One aspect is a nucleic acid as disclosed herein, wherein more than 50% of the nucleotides of the first and/or second strand comprise a 2'-OMe modification, such as more than 55%, 60%, 65%, 70%, 75%, 80% or 85% or more of the first and/or second strand comprise a 2'-OMe modification, preferably measured as a percentage of the total nucleotides of both the first and second strands.

One aspect is a nucleic acid as disclosed herein, wherein more than 50% of the nucleotides of the first and/or second strand comprise a naturally occurring RNA modification, such as wherein more than 55%, 60%, 65%, 70%, 75%, 80% or 85% or more of the first and/or second strand comprise such a modification, preferably measured as a percentage of the total nucleotides of both the first and second strands. Suitable naturally occurring modifications include other 2' sugar modifications besides 2'-OMe, particularly 2'-H modifications, resulting in DNA nucleotides.

One aspect is a nucleic acid as disclosed herein, comprising no more than 20%, such as no more than 15%, such as no more than 10% of nucleotides having a 2' modification that is not a 2'-OMe modification on the first and/or second strand, preferably as a percentage of the total nucleotides of both the first and second strands.

One aspect is a nucleic acid as disclosed herein, wherein the number of nucleotides having a 2'-modification other than 2'-OMe modification in the first and/or second strand does not exceed 7, more preferably does not exceed 5 and most preferably does not exceed 3.

One aspect is a nucleic acid as disclosed herein, comprising no more than 20% (e.g. no more than 15% or no more than 10%) 2'-F modifications on the first and/or second strand, preferably as a percentage of the total nucleotides on both strands.

One aspect is a nucleic acid as disclosed herein, wherein the number of nucleotides having a 2'-F modification in the first and/or second strand is no more than 7, more preferably no more than 5 and most preferably no more than 3.

One aspect is a nucleic acid as disclosed herein, wherein all nucleotides except for positions 2 and 14 from the 5' end of the first strand and the nucleotides on the second strand corresponding to positions 11 or 13 or 11 and 13 or 11 to 13 of the first strand are modified with 2'-OMe modification. Preferably, the nucleotides not modified with 2'-OMe are fluorine-modified at the 2' position (2'-F modification).

In certain embodiments, a preferred aspect is a nucleic acid as disclosed herein, wherein all nucleotides of the nucleic acid are modified at the 2' position of the sugar. Preferably, these nucleotides are modified with a 2'-F modification, wherein the modification is not a 2'-OMe modification.

In one aspect, the nucleic acid is modified on the first strand to have alternating 2'-OMe and 2-F modifications, and positions 2 and 14 (starting from the 5' end) are 2'-F modified. Preferably, the second strand is modified with a 2'-F modification at the nucleotide on the second strand corresponding to position 11, or 13, or 11 and 13, or 11 to 13 of the first strand. Preferably, the second strand is modified with a 2'-F modification at positions 11 to 13 counting from the 3' end starting at the first position of the complementary (two-stranded) region, and the remaining modifications are naturally occurring modifications, preferably 2'-OMe. The complementary region, at least in this case, starts at the first position of the second strand that has a corresponding nucleotide in the first strand, regardless of whether the two nucleotides can base pair with each other.

In one aspect of the nucleic acid, each nucleotide of the first strand and the second strand is a modified nucleotide.

As used herein, the term "odd number" means a number that is not divisible by two. Examples of odd numbers are 1, 3, 5, 7, 9, 11, etc. As used herein, the term "even number" means a number that is divisible by two. Examples of even numbers are 2, 4, 6, 8, 10, 12, 14, etc.

Unless specifically stated otherwise, herein, the nucleotides of the first strand are numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand. The nucleotides of the second strand are numbered consecutively starting with nucleotide number 1 at the 3' end of the second strand.

One or more nucleotides on the first and/or second strand may be modified to form modified nucleotides. One or more of the odd-numbered nucleotides of the first strand may be modified. One or more of the even-numbered nucleotides of the first strand may be modified by at least a second modification, wherein at least the second modification is different from the modification on the one or more odd-numbered nucleotides. At least one of the one or more modified even-numbered nucleotides may be adjacent to at least one of the one or more modified odd-numbered nucleotides.

A plurality of odd-numbered nucleotides in the first strand may be modified in the nucleic acid of the present invention. A plurality of even-numbered nucleotides in the first strand may be modified by a second modification. The first strand may include adjacent nucleotides modified by a common modification. The first strand may also include adjacent nucleotides modified by a second, different modification (i.e., the first strand may include nucleotides that are adjacent to each other and modified by a first modification and other nucleotides that are adjacent to each other and modified by a second modification that is different from the first modification).

One or more of the odd-numbered nucleotides of the second strand (wherein the nucleotides are numbered consecutively starting with nucleotide number 1 at the 3' end of the second strand) may be modified by a modification different from the modification of the odd-numbered nucleotides on the first strand (wherein the nucleotides are numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand), and/or one or more of the even-numbered nucleotides of the second strand may be modified by the same modification as the odd-numbered nucleotides of the first strand. At least one of the one or more modified even-numbered nucleotides of the second strand may be adjacent to one or more modified odd-numbered nucleotides. A plurality of odd-numbered nucleotides of the second strand may be modified by a common modification and/or a plurality of even-numbered nucleotides may be modified by the same modification present on the odd-numbered nucleotides of the first strand. A plurality of odd-numbered nucleotides on the second strand may be modified by a modification that is different from the modification of the odd-numbered nucleotides on the first strand.

The second strand may comprise adjacent nucleotides modified by a common modification, which may be a modification that is different from the modification of the odd-numbered nucleotides of the first strand.

In some aspects of the nucleic acids of the invention, each of the odd-numbered nucleotides in the first strand and each of the even-numbered nucleotides in the second strand can be modified by common modification, and each of the even-numbered nucleotides can be modified by a different modification in the first strand, and each of the odd-numbered nucleotides can be modified by a different modification in the second strand.

The nucleic acid of the present invention can shift the modified nucleotides of the first strand by at least one nucleotide relative to the unmodified or differently modified nucleotides of the second strand.

In certain aspects, one or more or each of the odd-numbered nucleotides may be modified in the first strand, and one or more or each of the even-numbered nucleotides may be modified in the second strand. One or more or each of the alternating nucleotides on either or both strands may be modified by a second modification. One or more or each of the even-numbered nucleotides may be modified in the first strand, and one or more or each of the even-numbered nucleotides may be modified in the second strand. One or more or each of the alternating nucleotides on either or both strands may be modified by a second modification. One or more or each of the odd-numbered nucleotides may be modified in the first strand, and one or more of the odd-numbered nucleotides may be modified by a common modification in the second strand. One or more or each of the alternating nucleotides on either or both strands may be modified by a second modification. One or more or each of the even-numbered nucleotides may be modified in the first strand, and one or more of the odd-numbered nucleotides may be modified in the second strand by a common modification. One or more or each of the alternating nucleotides on either or both strands may be modified by a second modification.

The nucleic acids of the invention may comprise single-stranded or double-stranded constructs comprising at least two alternating modified regions in one or both strands. These alternating regions may comprise up to about 12 nucleotides, but preferably comprise about 3 to about 10 nucleotides. The regions of alternating nucleotides may be located at the ends of one or both strands of the nucleic acids of the invention. The nucleic acids may comprise alternating nucleotides of 4 to about 10 nucleotides at each of the ends (3' and 5'), and these regions may be separated by about 5 to about 12 consecutive unmodified or differently or co-modified nucleotides.

The odd-numbered nucleotides of the first strand may be modified and the even-numbered nucleotides may be modified with a second modification. The second strand may include adjacent nucleotides modified with a common modification, which may be the same as the modification of the odd-numbered nucleotides of the first strand. One or more nucleotides of the second strand may also be modified with a second modification. The one or more nucleotides with the second modification may be adjacent to each other and to a nucleotide with the same modification as the modification of the odd-numbered nucleotides of the first strand. The first strand may also include a phosphorothioate bond between two nucleotides at the 3' end and the 5' end or a phosphorodithioate bond between two nucleotides at the 3' end. The second strand may include a phosphorothioate or phosphorodithioate bond between two nucleotides at the 5' end. The second strand may also be bound to a ligand at the 5' end.

The nucleic acid of the present invention may comprise a first strand comprising adjacent nucleotides modified by a common modification. One or more such nucleotides may be adjacent to one or more nucleotides that may be modified by a second modification. One or more nucleotides with the second modification may be adjacent. The second strand may comprise adjacent nucleotides modified by a common modification, which common modification may be the same as one of the modifications of the one or more nucleotides of the first strand. One or more nucleotides of the second strand may also be modified with the second modification. One or more nucleotides with the second modification may be adjacent. The first strand may also comprise a phosphorothioate bond between two nucleotides at the 3' end and the 5' end or a phosphorodithioate bond between two nucleotides at the 3' end. The second strand may comprise a phosphorothioate or phosphorodithioate bond between two nucleotides at the 3' end. The second strand may also be bound to a ligand at the 5' end.

Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 and 25 from 5' to 3' on the first strand and from 3' to 5' on the second strand can be modified by the modification on the first strand. Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 can be modified by the second modification on the first strand. Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 can be modified by the modification on the second strand. Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 can be modified by the second modification on the second strand. For purposes of the nucleic acids of the present invention, nucleotides are numbered from 5' to 3' on the first strand and from 3' to 5' on the second strand.

Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 can be modified by a modification on the first strand. Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 can be modified by a second modification on the first strand. Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 can be modified by a modification on the second strand. Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 can be modified by a second modification on the second strand.

Obviously, if the first and/or second strand is shorter than 25 nucleotides, such as 19 nucleotides, there are no nucleotides 20, 21, 22, 23, 24 and 25 to be modified. Therefore, those skilled in the art will understand that the above description applies to shorter strands.

One or more modified nucleotides on the first strand may be paired with a modified nucleotide with a common modification on the second strand. One or more modified nucleotides on the first strand may be paired with a modified nucleotide with a different modification on the second strand. One or more modified nucleotides on the first strand may be paired with an unmodified nucleotide on the second strand. One or more modified nucleotides on the second strand may be paired with an unmodified nucleotide on the first strand. In other words, alternating nucleotides may be aligned on both strands, e.g., all modifications in the alternating region of the second strand are paired with the same modification in the first strand, or alternatively the modifications may be offset by one nucleotide, with a common modification in the alternating region of one strand paired with a different modification (i.e., a second or further modification) in the other strand. Another option is to have different modifications in each strand.

The modification on the first strand can be shifted by one nucleotide relative to the modified nucleotide on the second strand such that the co-modified nucleotides do not pair with each other.

The modification and/or one or more modifications can each and individually be selected from the group consisting of: 3' terminal deoxythymine, 2'-OMe, 2' deoxy modification, 2' amino modification, 2' alkyl modification, N-phenothioate modification, amidophosphoryl modification, 5'-phosphorothioate group modification, 5' phosphate or 5' phosphate mimetic modification, cholesterol derivative or dodecanoic acid didecylamide group modification and/or the modified nucleotide can be any of a locked nucleotide, a base-free nucleotide, or a non-natural base containing nucleotide.

At least one modification may be 2'-OMe and/or at least one modification may be 2'-F. Other modifications as described herein may be present on the first strand and/or the second strand.

The nucleic acid of the present invention may comprise a reverse RNA nucleotide at one or more of the ends of the strands. Such reverse nucleotides provide stability to the nucleic acid. Preferably, the nucleic acid comprises at least a reverse nucleotide at the 3' end of the first and/or second strand and/or at the 5' end of the second strand. More preferably, the nucleic acid comprises a reverse nucleotide at the 3' end of the second strand. Optimally, the nucleic acid comprises a reverse RNA nucleotide at the 3' end of the second strand and this nucleotide is preferably a reverse A. A reverse nucleotide is a nucleotide that is connected to the 3' end of the nucleic acid via its 3' carbon rather than via its 5' carbon as is usually the case, or a nucleotide that is connected to the 5' end of the nucleic acid via its 5' carbon rather than via its 3' carbon as is usually the case. The reverse nucleotide is preferably present at the end of the strand, not as a pendant, but opposite to the corresponding nucleotide in the other strand. Therefore, the nucleic acid is preferably blunt-ended at the end comprising the reverse RNA nucleotide. The reverse RNA nucleotide present at the end of a strand preferably means that the last nucleotide at this end of the strand is a reverse RNA nucleotide. Nucleic acids with such nucleotides are stable and easy to synthesize. The reverse RNA nucleotide is preferably an unmodified nucleotide, meaning that it does not contain any modification compared to the natural nucleotide counterpart. In particular, the reverse RNA nucleotide is preferably a 2'-OH nucleotide.

The nucleic acids of the invention may comprise one or more nucleotides modified with 2'-H at the 2' position and thus have DNA nucleotides within the nucleic acid. The nucleic acids of the invention may comprise DNA nucleotides at positions 2 and/or 14 of the first strand counting from the 5' end of the first strand. The nucleic acids may comprise DNA nucleotides located on the second strand corresponding to positions 11, or 13, or 11 and 13, or 11-13 of the first strand.

In one aspect, more than one DNA nucleotide is not present per nucleic acid of the invention.

The nucleic acid of the invention may comprise one or more LNA nucleotides. The nucleic acid of the invention may comprise LNA nucleotides at positions 2 and/or 14 of the first strand, counted from the 5' end of the first strand. The nucleic acid may comprise an LNA on the second strand corresponding to positions 11, or 13, or 11 and 13, or 11-13 of the first strand.

Some representative modified nucleic acid sequences of the present invention are shown in the examples. These examples are intended to be representative and not limiting.

In certain preferred embodiments, the nucleic acid may comprise a first modification and a second or further modification, each and independently selected from the group consisting of a 2'-OMe modification and a 2'-F modification. The nucleic acid may comprise a modification, the modification being 2'-OMe, which may be a first modification; and a second modification, which is 2'-F. The nucleic acids of the invention may also include phosphorothioate or phosphorodithioate modifications and/or deoxy modifications, which may be present in or between the terminal 2 or 3 nucleotides at each or any end of each or both strands.

In one aspect of the nucleic acid, at least one nucleotide of the first and/or second strand is a modified nucleotide, wherein if the first strand comprises at least one modified nucleotide: (i)    at least one or both of nucleotides 2 and 14 of the first strand are modified by a first modification; and/or (ii)   at least one, several or all even-numbered nucleotides of the first strand are modified by a first modification; and/or (iii)  at least one, several or all odd-numbered nucleotides of the first strand are modified by a second modification; and/or wherein if the second strand comprises at least one modified nucleotide: (iv)   at least one, several or all nucleotides of the second strand in positions corresponding to even-numbered nucleotides of the first strand are modified by a third modification; and/or (v)    at least one, several or all nucleotides of the second strand in positions corresponding to odd-numbered nucleotides of the first strand are modified by a fourth modification; and/or (vi)   At least one, several or all nucleotides of the second strand in the position corresponding to nucleotide 11 or nucleotide 13 or nucleotides 11 and 13 or nucleotides 11-13 of the first strand are modified by a fourth modification; and/or (vii)   At least one, several or all nucleotides of the second strand in the position other than the position corresponding to nucleotide 11, or nucleotide 13, or nucleotides 11 and 13, or nucleotides 11-13 of the first strand are modified by a third modification; wherein the nucleotides on the first strand are numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand; wherein the modifications are preferably at least one of the following: (a)    The first modification is preferably different from the second modification and the third modification; (b)    The first modification is preferably the same as the fourth modification; (c)    The second and third modifications are preferably the same modification; (d)  The first modification is preferably a 2'-F modification; (e)    The second modification is preferably a 2'-OMe modification; (f)    The third modification is preferably a 2'-OMe modification; and/or (g)    The fourth modification is preferably a 2'-F modification; and Wherein, as the case may be, the nucleic acid is bound to a ligand.

One aspect is a double-stranded nucleic acid for preferably inhibiting AGT expression in a cell, wherein the nucleic acid comprises a first strand and a second strand, wherein the unmodified equivalent of the first strand sequence comprises a sequence of at least 15 nucleotides, which differs from any of the first strand sequences shown in Table 5a or Table 1 by no more than 3 nucleotides, wherein all even-numbered nucleotides of the first strand are modified by a first modification, all odd-numbered nucleotides of the first strand are modified by a second modification, all nucleotides of the second strand in positions corresponding to the even-numbered nucleotides of the first strand are modified by a third modification, and all nucleotides of the second strand in positions corresponding to the odd-numbered nucleotides of the first strand are modified by a fourth modification, wherein the first and fourth modifications are 2'-F and the second and third modifications are 2'-OMe.

One aspect is a double-stranded nucleic acid for preferably inhibiting AGT expression in a cell, wherein the nucleic acid comprises a first strand and a second strand, wherein the unmodified equivalent of the first strand sequence comprises a sequence of at least 15 nucleotides, which differs from any of the first strand sequences shown in Table 5a or Table 1 by no more than 3 nucleotides, wherein all even-numbered nucleotides of the first strand are modified by the first modification, all odd-numbered nucleotides of the first strand are modified by the second modification, all nucleotides of the second strand in positions corresponding to nucleotides 11-13 of the first strand are modified by the fourth modification, and all nucleotides of the second strand except the nucleotides corresponding to nucleotides 11-13 of the first strand are modified by the third modification, wherein the first and fourth modifications are 2'-F and the second and third modifications are 2'-OMe.

The 3' and 5' ends of the oligonucleotide may be modified. Such modifications may be at the 3' end or the 5' end or both ends of the molecule. It may include modifying or replacing one or more of the atoms of the entire terminal phosphate or phosphate group. For example, the 3' and/or 5' ends of the oligonucleotide may be combined with other functional molecular entities, such as labeling moieties, such as fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes) or protective groups (based on, for example, sulfur, silicon, boron or esters). The functional molecular entity may be linked to the sugar via the phosphate group and/or linker. The terminal atom of the linker may be linked to or replace the linking atom of the C-3' or C-5' O, N, S or C group of the phosphate group or sugar. Alternatively, the linker may be linked to or replace the terminal atom of a nucleotide substitute (e.g., PNA). Such spacers or linkers may include, for example, -( _CH2 ) _n- , -( _CH2 ) _nN- , -( _CH2 ) _nO- , -( _CH2 ) _nS- , -( _{CH2CH2O ) nCH2CH2O-} (e.g., n=3 or 6), abatic sugars, amides, carboxyls, amines, oxamines, oximines, thioethers, disulfide bonds, thioureas, sulfonamides or N-pheno groups, or _biotin and fluorescein reagents. The ₃ ' end may be a -OH group.

Other examples of terminal modifications include dyes, intercalating agents (e.g., acridine), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., porphinium, dihydroporphinium), artificial endonucleases, EDTA, lipophilic carriers (e.g., cholesterol, bile acid, adamantane ethyl) acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl, palmitic acid, myristic acid, O3-(oleyl)cholestyric acid, O3-(oleyl)cholestyric acid, dimethoxytrityl or morpholino) and peptide conjugates (e.g., antennapedia peptide peptide), Tat peptide), alkylating agents, phosphate, amine, butyl, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamine, alkyl, substituted alkyl, radiolabel, enzyme, hapten (e.g., biotin), transport/absorption enhancer (e.g., aspirin, vitamin E, folic acid), synthetic ribonuclease (e.g., imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole conjugate, tetrazamacrocyclic Eu3+ complex).

Terminal modifications may also be used to monitor distribution, and in such cases, the group to be added may include a fluorophore, such as fluorescein or an Alexa dye. Terminal modifications may also be used to enhance uptake, and suitable modifications for this include cholesterol. Terminal modifications may also be useful for crosslinking the RNA agent to another moiety.

Terminal modifications may be added for a variety of reasons including modulating activity or modulating resistance to degradation. Terminal modifications useful for modulating activity include modification of the 5' end with a phosphate or phosphate analog. The nucleic acids of the invention on the first or second strand may be 5' phosphorylated or include a phospho group analog at the 5' prime terminus. 5'-Phosphate modifications include those that are compatible with RISC-mediated gene silencing. Suitable modifications for dehydration include: 5'-monophosphate ((HO) ₂ (O)PO-5');5'-diphosphate ((HO) ₂ (O)POP(HO)(O)-O-5');5'-triphosphate ((HO) ₂ (O)PO-(HO)(O)POP(HO)(O)-O-5');5'-guanosine cap (7-methylated or unmethylated) (7m-GO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5');5'-adenosine cap (Appp); and any modified or unmodified nucleotide cap structure (NO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5');5'-monothioate(phosphorothioate; (HO) ₂ any additional combination of oxygen/sulfur substituted monophosphates, diphosphates and triphosphates (e.g., 5'-α-thiotriphosphate, 5'-γ-thiotriphosphate, etc.); 5'-phosphoramidates ((HO) ₂ (O)P-NH-5', (HO)(NH ₂ )(O)PO-5');5'-alkylphosphonates (alkyl = methyl, ethyl, isopropyl, propyl, etc., e.g., RP(OH)(O)-O-5'- (wherein R is alkyl)); (OH) ₂ (O)P-5'- _{CH 2 -} ); 5'vinylphosphonates;5'-alkyl etherphosphonates (alkyl ether = methoxymethyl (MeOCH ₂ -), ethoxymethyl, etc., for example, RP(OH)(O)-O-5'- (wherein R is an alkyl ether)).

Certain moieties may be attached to the 5' terminus of the first or second strand. These include abaciribose moieties, abacideoxyribose moieties, modified abaciribose and abacideoxyribose moieties, including 2'-O alkyl modifications; inverted abaciribose and abacideoxyribose moieties and modifications thereof, C6-imino-Pi; mirror nucleotides, including L-DNA and L-RNA; 5'OMe nucleotides; and nucleotide analogs, including 4',5'-methylene nucleotides; 1-(β-D-erythrofuranosyl) nucleotides; 4'-thionucleotides, carbocyclic nucleotides; 5'-amino-phosphates; alkyl esters; 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate; 6-aminohexyl phosphate; 12-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotides; α-nucleotides; threo-pentofuranosyl nucleotides; acyclic 3',4'-open ring nucleotides; 3,4-dihydroxybutyl nucleotides; 3,5-dihydroxypentyl nucleotides, 5'-5'-reverse abasic moieties; 1,4-butanediol phosphate; 5'-amine; and bridged or non-bridged methylphosphonate and 5'-hydroxyl moieties.

In each of the sequences described herein, the C-terminal "-OH" moiety may be substituted with a C-terminal " _-NH2 " moiety, and vice versa.

The invention also provides a nucleic acid according to any aspect of the invention as described herein, wherein the first strand has a terminal 5' (E)-vinylphosphonate nucleotide at its 5' end. This terminal 5' (E)-vinylphosphonate nucleotide is preferably linked to the second nucleotide in the first strand by a phosphodiester bond. Preferably, the terminal 5' (E)-vinylphosphonate ("vp") nucleotide is uridine ("vp-U").

The first strand of the nucleic acid may comprise formula (I): (vp)-N _(po) [N _(po) ] _n - (I) wherein "(vp)-" is 5' (E)-vinyl phosphonate, "N" is a nucleotide, "po" is a phosphodiester bond, and n is 1 to (the total number of nucleotides in the first strand - 2), preferably wherein n is 1 to (the total number of nucleotides in the first strand - 3), and more preferably wherein n is 1 to (the total number of nucleotides in the first strand - 4).

Preferably, the terminal 5' (E)-vinylphosphonate nucleotide is an RNA nucleotide, preferably (vp)-U.

Terminal 5' (E)-vinylphosphonate nucleotides are nucleotides in which the phosphate group at the 5' end of the ribose has been replaced with an E-vinylphosphonate group: Nucleotides with a phosphate at the 5' end Nucleotides having a terminal 5' (E)-vinylphosphonate at the 5' end of the ribose

In one aspect, the first strand has a terminal 5'(E)-vinylphosphonate nucleotide at its 5' end, the terminal 5'(E)-vinylphosphonate nucleotide is linked to the second nucleotide in the first strand by a phosphodiester bond, and the first strand comprises a) more than 1 phosphodiester bond; b) a phosphodiester bond between at least the terminal three 5' nucleotides, and/or c) a phosphodiester bond between at least the terminal four 5' nucleotides.

In one aspect, the first strand and/or the second strand of the nucleic acid comprises at least one phosphorothioate (ps) and/or at least one phosphorodithioate (ps2) bond between two nucleotides.

In one aspect, the first strand and/or the second strand of the nucleic acid comprises more than one phosphorothioate and/or more than one phosphorodithioate bond.

In one aspect, the first strand and/or the second strand of the nucleic acid comprises a phosphorothioate or phosphorodithioate bond between the terminal two 3' nucleotides, or a phosphorothioate or phosphorodithioate bond between the terminal three 3' nucleotides. Preferably, the bonds between the other nucleotides in the first strand and/or the second strand are phosphodiester bonds.

In one aspect, the first strand and/or the second strand of the nucleic acid comprises a phosphorothioate bond between the terminal two 5' nucleotides, or a phosphorothioate bond between the terminal three 5' nucleotides.

In one aspect, the nucleic acids of the invention comprise one or more phosphorothioate or phosphorodithioate modifications to one or more of the termini of the first and/or second strands. Each or either terminus of the first strand may comprise one or two or three phosphorothioate or phosphorodithioate modified nucleotides (internucleoside bonds), as appropriate. Each or either terminus of the second strand may comprise one or two or three phosphorothioate or phosphorodithioate modified nucleotides (internucleoside bonds), as appropriate.

In one aspect, the nucleic acid comprises a phosphorothioate bond between the terminal two or three 3' nucleotides and/or 5' nucleotides of the first and/or second strands. Preferably, the nucleic acid comprises a phosphorothioate bond between each of the terminal three 3' nucleotides and the terminal three 5' nucleotides of the first and second strands. Preferably, all remaining bonds between nucleotides of the first and/or second strands are phosphodiester bonds.

In one aspect, the nucleic acid comprises a phosphorodithioate bond between each of the two, three or four terminal nucleotides at the 3' terminus of the first strand, and/or comprises a phosphorodithioate bond between each of the two, three or four terminal nucleotides at the 3' terminus of the second strand, and/or comprises a phosphorodithioate bond between each of the two, three or four terminal nucleotides at the 5' terminus of the second strand, and comprises bonds other than the phosphorodithioate bonds between the two, three or four terminal nucleotides at the 5' terminus of the first strand.

In one aspect, the nucleic acid comprises phosphorothioate bonds between the terminal three 3' nucleotides and the terminal three 5' nucleotides of the first and second strands. Preferably, all remaining bonds between nucleotides of the first and/or second strands are phosphodiester bonds.

In one aspect, the nucleic acid: (i)    has phosphorothioate bonds between the terminal three 3' nucleotides and the terminal three 5' nucleotides of the first strand; (ii)   is bound to a trianthrene ligand at the 3' terminal nucleotide or the 5' terminal nucleotide of the second strand; (iii)   has phosphorothioate bonds between the terminal three nucleotides of the second strand at the end opposite to the nucleic acid bound to the trianthrene ligand; and (iv)   all remaining bonds between nucleotides of the first strand and/or the second strand, as the case may be, are phosphodiester bonds.

In one aspect, the nucleic acid: (i)   has a terminal 5' (E)-vinylphosphonate nucleotide at the 5' end of the first strand; (ii)   has a phosphorothioate bond between the terminal three 3' nucleotides on the first and second strands and between the terminal three 5' nucleotides on the second strand, or has a phosphorodithioate bond between the terminal two 3' nucleotides on the first and second strands and between the terminal two 5' nucleotides on the second strand; and (iii)   all remaining bonds between nucleotides of the first strand and/or the second strand, as appropriate, are phosphodiester bonds.

The use of phosphorodithioate bonds in the nucleic acids of the present invention reduces the variation in the stereochemistry of the nucleic acid molecule population compared to molecules containing phosphorothioates in the same position. Phosphorothioate bonds introduce chiral centers, and it is difficult to control which non-linked oxygen replaces sulfur. The use of phosphorodithioates ensures that there are no chiral centers in the bond, and thus reduces or eliminates any variation in the nucleic acid molecule population, depending on the number of phosphorodithioate and phosphorothioate bonds used in the nucleic acid molecule.

In one aspect, the nucleic acid comprises a phosphorodithioate bond between the two terminal nucleotides at the 3' end of the first strand, and a phosphorodithioate bond between the two terminal nucleotides at the 3' end of the second strand, and a phosphorodithioate bond between the two terminal nucleotides at the 5' end of the second strand, and comprises bonds other than the phosphorodithioate bonds between the two, three or four terminal nucleotides at the 5' end of the first strand. Preferably, the first strand has a terminal 5' (E)-vinylphosphonate nucleotide at its 5' end. This terminal 5' (E)-vinylphosphonate nucleotide is preferably connected to the second nucleotide in the first strand by a phosphodiester bond. Preferably, all bonds between the nucleotides of the two strands except the bond between the two terminal nucleotides at the 3' end of the first strand and the bond between the two terminal nucleotides at the 3' end and 5' end of the second strand are phosphodiester bonds.

In one aspect, when phosphorodithioate bonds are absent at the termini, the nucleic acid comprises phosphorothioate bonds between each of the three terminal 3' nucleotides and/or between each of the three terminal 5' nucleotides on the first strand, and/or between each of the three terminal 3' nucleotides and/or between each of the three terminal 5' nucleotides on the second strand. The absence of phosphorodithioate bonds at the termini means that the bonds between the two terminal nucleotides, or preferably the three terminal nucleotides, at the termini of the nucleic acid in question are bonds other than phosphorodithioate bonds.

In one aspect, all bonds of the nucleic acid between nucleotides of the two strands except the bond between the two terminal nucleotides at the 3' end of the first strand and the bond between the two terminal nucleotides at the 3' end and the 5' end of the second strand are phosphodiester bonds.

Other phosphate bond modifications are possible.

Phosphate linkers can also be modified by replacing the linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylenephosphonates). The replacement can be made at the terminal oxygen. Replacement of non-linking oxygens with nitrogen is possible.

The phosphate groups can also be replaced individually with non-phosphorus-containing linkers.

Examples of moieties that can replace the phosphate group include siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformal, formaldehyde, oxime, methylene imino, methylene methyl imino, methylene hydrazine, methylene dimethyl hydrazine and methylene oxymethyl imino. In certain embodiments, the replacement may include methylene carbonyl amine and methylene methyl imino.

The phosphate linker and ribose can be replaced by nuclease-resistant nucleotides. Examples include morpholinyl, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside substitutes. In certain embodiments, PNA substitutes can be used.

In one embodiment, a nucleic acid (preferably siRNA, and preferably in a cell) that inhibits AGT expression by RNAi comprises one or more or all of the following: (i)    modified nucleotides; (ii)   modified nucleotides other than 2'-OMe modified nucleotides at positions 2 and 14 from the 5' end of the first strand having a given SEQ ID No., preferably 2'-F modified nucleotides; (iii)  each of the odd-numbered nucleotides of the first strand numbered starting from one of the 5' ends of the first strand having a given SEQ ID No. is a 2'-OMe modified nucleotide; (iv)   each of the even-numbered nucleotides of the first strand numbered starting from one of the 5' ends of the first strand having a given SEQ ID No. is a 2'-F modified nucleotide; (v)    corresponding to the nucleotide sequence of the first strand having a given SEQ ID No. The second strand nucleotides at positions 11 and/or 13 or 11-13 of the first strand of the given SEQ ID No. are modified with a modification other than a 2'-OMe modification, preferably wherein one or both or all of these positions comprise a 2'-F modification; (vi)   an inverted nucleotide, preferably a 3'-3' bond at the 3' end of the second strand having the given SEQ ID No.; (vii)  one or more phosphorothioate bonds; (viii) one or more phosphorodithioate bonds; and/or (ix)   the first strand having the given SEQ ID No. has a terminal 5'(E)-vinylphosphonate nucleotide at its 5' end, in which case the terminal 5'(E)-vinylphosphonate nucleotide is preferably a uridine and is preferably linked to the second nucleotide in the first strand by a phosphodiester bond.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 15 nucleotides which differs by no more than 3 nucleotides from any of the first strand sequences having a given SEQ ID No. shown in Table 5b.

The nucleic acid of the present invention may be the following nucleic acid, wherein: (a)    The first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 5b by no more than 3 nucleotides, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 5b by no more than 3 nucleotides; (b)    The first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 5b by no more than 2 nucleotides, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 5b by no more than 2 nucleotides; (c)    The first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 5b by no more than 1 nucleotide, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 5b by no more than 1 nucleotide; (d)    The first strand sequence comprises a sequence corresponding to a given SEQ ID shown in Table 5b No., and where the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5b; (e)    The first strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and where the second strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5b; (f)    The first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and where the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5b. No.; (g)    The first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and as the case may be, wherein the second strand sequence comprises a sequence corresponding to nucleotides 1 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5b; (h)    The first strand sequence comprises a sequence of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and as the case may be, wherein the second strand sequence comprises a sequence of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5b; or (i)    The first strand sequence consists essentially of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and as the case may be, wherein the second strand sequence consists essentially of a sequence of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5b; or (j)    The first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, wherein the first strand sequence further consists of 1 (nucleotide 20 counting from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and whereby the second strand sequence comprises or consists essentially of or consists of: a sequence corresponding to the second strand sequence having a given SEQ ID No. shown in Table 5b; (k)   The first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any of the first strand sequences having a given SEQ ID No. shown in Table 5b, wherein the first strand sequence further consists of 1 (nucleotide 20 counted from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any of the first strand sequences having a given SEQ ID No. shown in Table 5b, and wherein the first strand sequence consists of a continuous region complementary to the AGT transcript of SEQ ID NO. 870 with a length of 17-25 nucleotides, preferably a length of 18-24 nucleotides, and Optionally, wherein the second strand sequence comprises or consists essentially of or consists of: a sequence having a given SEQ ID No. shown in Table 5b corresponding to the second strand sequence; (l)    The first strand sequence consists of any of the first strand sequences having a given SEQ ID No. shown in Table 5b, and optionally wherein the second strand sequence consists of a sequence having a given SEQ ID No. shown in Table 5b corresponding to the second strand sequence; (m)   The first strand and the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are present on a single strand, wherein the first strand and the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region having a length of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides; or (n)   The first strand and the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are located on two separate strands, and the first strand and the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region with a length of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 15 nucleotides, which differs by no more than 3 nucleotides from any of the first strand sequences having a given SEQ ID No. shown in Table 2. Table 2 First strand sequence (SEQ ID No.) Second strand sequence (SEQ ID No.) 802 803 866 867 804 805 826 827 806 807 868 869 810 811 824 825 812 813 852 853 808 809 840 841 830 831 818 819 836 837

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 17 nucleotides which differs from any of the first strand sequences having a given SEQ ID No. shown in Table 2 by no more than 3 nucleotides.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 17 nucleotides which differs from any of the first strand sequences having a given SEQ ID No. shown in Table 2 by no more than 2 nucleotides.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 17 nucleotides which differs from any of the first strand sequences having a given SEQ ID No. shown in Table 2 by no more than 1 nucleotide.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 18 nucleotides which differs from any of the first strand sequences having a given SEQ ID No. shown in Table 2 by no more than 3 nucleotides.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 18 nucleotides which differs from any of the first strand sequences having a given SEQ ID No. shown in Table 2 by no more than 2 nucleotides.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 18 nucleotides which differs from any of the first strand sequences having a given SEQ ID No. shown in Table 2 by no more than 1 nucleotide.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 19 nucleotides which differs from any of the first strand sequences having a given SEQ ID No. shown in Table 2 by no more than 3 nucleotides.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 19 nucleotides which differs from any of the first strand sequences having a given SEQ ID No. shown in Table 2 by no more than 2 nucleotides.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence comprises a sequence of at least 19 nucleotides which differs from any of the first strand sequences having a given SEQ ID No. shown in Table 2 by no more than 1 nucleotide.

The nucleic acid of the present invention may comprise a first strand and a second strand, wherein the first strand sequence consists essentially of or consists of a sequence from any one of the first strand sequences having a given SEQ ID No. shown in Table 2.

For example, the nucleic acid of the present invention may be the following nucleic acid, wherein: (a)    The first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 2 by no more than 3 nucleotides, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 2 by no more than 3 nucleotides; (b)    The first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 2 by no more than 2 nucleotides, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 2 by no more than 2 nucleotides; (c)    The first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 2 by no more than 1 nucleotide, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 2 by no more than 1 nucleotide; (d)    The first strand sequence comprises a sequence corresponding to a given SEQ ID shown in Table 2 No., and where the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2; (e)    The first strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, and where the second strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2; (f)    The first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, and where the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2; No.; (g)    The first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, and as the case may be, the second strand sequence comprises a sequence corresponding to nucleotides 1 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2; (h)    The first strand sequence comprises a sequence of any one of the first strand sequences in Table 2, and as the case may be, the second strand sequence comprises a sequence corresponding to the second strand sequence in Table 2; or (i)    The first strand sequence consists essentially of any one of the first strand sequences in Table 2, and as the case may be, the second strand sequence consists essentially of a sequence corresponding to the second strand sequence in Table 2; (j)    The first strand sequence consists of a sequence corresponding to a given SEQ ID No. shown in Table 2 No., wherein the first strand sequence further comprises 1 (nucleotide 20 counted from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any of the first strand sequences having a given SEQ ID No. shown in Table 2, and whereby the second strand sequence comprises or consists essentially of or consists of: a sequence corresponding to the second strand sequence having a given SEQ ID No. shown in Table 2; (k)    The first strand sequence consists of a sequence corresponding to the given SEQ ID No. shown in Table 2 No., wherein the first strand sequence further comprises 1 (nucleotide 20 counted from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any of the first strand sequences having a given SEQ ID No. shown in Table 2, and wherein the first strand sequence comprises a continuous region complementary to the AGT transcript of SEQ ID NO. 870 with a length of 17-25 nucleotides, preferably 18-24 nucleotides, and Optionally, wherein the second strand sequence comprises or consists essentially of or consists of: a sequence corresponding to the second strand sequence of a given SEQ ID No. shown in Table 2; (l)    The first strand sequence consists of any of the first strand sequences in Table 2, and optionally wherein the second strand sequence consists of the sequence corresponding to the second strand sequence in Table 2; (m)   The first strand and the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are present on a single strand, wherein the first strand and the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; or (n)   The first strand and the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are located on two separate strands, and the first strand and the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region with a length of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.

All features of nucleic acids can be combined with all other aspects of the invention disclosed herein.

Heterologous moieties The nucleic acids of the present invention may be conjugated to heterologous moieties. A heterologous moiety is any part of a nucleic acid molecule that is not capable of inhibiting the expression of AGT. A heterologous moiety may be or may comprise a peptide (or polypeptide), a carbohydrate (or polysaccharide), a lipid, a different nucleic acid or any other suitable molecule.

Any given nucleic acid may be conjugated to multiple heterologous moieties, which may be the same or different.

Each heterologous moiety may itself comprise one or more functional moieties (such as targeting agents as described in more detail below), each of which is covalently bound to the nucleic acid, optionally via a linker.

The heterologous moiety or its functional component can be used, for example, to modulate bioavailability or pharmacokinetics. For example, it can increase the half-life in vivo.

Alternatively, the heterologous moiety (or a functional component thereof) may comprise a targeting agent. Effective delivery of oligonucleotides, particularly double-stranded nucleic acids of the present invention, to cells in vivo is important and requires specific targeting and substantial protection from the extracellular environment, particularly serum proteins. One method of achieving specific targeting is to conjugate a targeting agent to the nucleic acid, wherein the targeting agent helps target the nucleic acid to a target cell that has a cell surface receptor to which the targeting agent binds.

In this context, the term "receptor" is used to include any molecule on the surface of the target cell that is capable of binding to the targeting agent, and should not be considered to imply any specific function of the cell surface receptor. The targeting agent can be considered a "ligand" for the cell surface receptor. The terms "targeting agent" and "ligand" are used interchangeably. Again, this term should not be considered to imply any specific function of the targeting agent or the cell surface receptor, or any specific relationship between the two molecules other than the ability of one to bind to the other.

Thus, the targeting agent can be any part that has affinity for the selected receptor. It can be, for example, an affinity protein (such as an antibody or fragment thereof that has affinity for the selected receptor), an aptamer, or any other suitable part. In some embodiments, the targeting agent can be a physiological ligand of the receptor.

Binding between the targeting agent and the receptor can promote the uptake of the bound nucleic acid by the target cell, for example, via internalization of the receptor or any other suitable mechanism. Thus, an appropriate ligand for the desired receptor molecule can be used as a targeting agent to allow the target cell to take up the bound nucleic acid by a mechanism such as a different receptor-mediated endocytosis pathway or a functionally similar process. In other embodiments, a ligand that can mediate the internalization of nucleic acids into target cells by mechanisms other than receptor-mediated endocytosis can alternatively be bound to the nucleic acids of the present invention for cell or tissue specific targeting.

One example of a ligand that mediates receptor-mediated endocytosis is the GalNAc moiety described herein, which has a high affinity for the asialoglycoprotein receptor complex (ASGP-R). The ASGP-R complex consists of polymers of membrane ASGR1 and ASGR2 receptors that are highly abundant on hepatocytes in varying ratios. One of the first disclosures of using trianthrene glycosides as binding ligands was in U.S. Patent No. 5,885,968. Conjugates with three GalNAc ligands and containing phosphate groups are known and described in Dubber et al. (Bioconjug. Chem. 2003 Jan-Feb; 14(1):239-46). The ASGP-R complex exhibits a 50-fold higher affinity for N-acetyl-D-galactosamine (GalNAc) than for D-Gal.

The ASGP-R complex specifically recognizes the terminal β-galactosyl biosubunit of glycosylated proteins or other oligosaccharides (Weigel, P.H. et al., Biochim. Biophys. Acta. 2002 Sep 19;1572(2-3):341-63) and can be used to deliver drugs to liver hepatocytes expressing the receptor complex by covalent coupling of galactose or galactamine sugars to the drug substance (Ishibashi, S. et al., J Biol. Chem. 1994 Nov 11;269(45):27803-6). In addition, binding affinity can be significantly increased by multivalency, which is achieved by repeating the targeting moiety (Biessen EA et al., J Med Chem. 1995 Apr 28;38(9):1538-46).

The ASGP-R complex is a mediator for the active uptake of glycoproteins containing terminal β-galactosides into cellular endosomes. Therefore, the ASGPR is highly suitable for drug candidates that bind to such ligands, for example, for targeted delivery of nucleic acids to cells expressing the receptor (Akinc et al., Mol Ther. 2010 Jul;18(7):1357-64).

More generally, the ligand may comprise a carbohydrate selected to have affinity for at least one type of receptor on a target cell. Specifically, the receptor is located on the surface of mammalian liver cells, such as the asialoglycoprotein receptor complex (ASGP-R) described above.

The carbohydrate may be selected from N-acetylgalactosamine, mannose, galactose, glucose, glucosamine and trehalose. The carbohydrate may be N-acetylgalactosamine (GalNAc). The heterologous part may comprise a plurality of such carbohydrates, for example two or in particular three such carbohydrates, for example three GalNAc groups.

The heterologous part may thus comprise (i) one or more functional components and (ii) a linker, wherein the linker binds the functional component to a nucleic acid as defined in any of the foregoing aspects. The linker may be a monovalent structure or a divalent, trivalent or tetravalent branched chain structure. The nucleotides may be modified as defined herein.

Thus, the functional component may be a ligand (or targeting agent). Where there are multiple functional components, the functional components may be the same or different. Where the functional component is a ligand, the functional component may be a carbohydrate and may therefore be (or include) GalNAc.

In one embodiment, the nucleic acid is conjugated to a heterologous portion comprising a compound of formula (II): [SX ¹ -PX ² ] ₃ -AX ³ - (II) wherein: S represents a functional component, such as a ligand, such as a sugar, preferably wherein the sugar is N-acetylgalactosamine; X ¹ represents a C ₃ -C ₆ alkylene group or (-CH ₂ -CH ₂ -O) _m (-CH ₂ ) ₂ -, wherein m is 1, 2 or 3; P is a phosphate or a modified phosphate, preferably a thiophosphate; X ² is an alkylene group or an alkylene ether of the formula (-CH ₂ ) _n -O-CH ₂ -, wherein n=1-6; A is a branching unit; X ³ represents a bridging unit; wherein the nucleic acid according to the present invention is conjugated to X ³ via a phosphate or a modified phosphate, preferably a thiophosphate.

In formula (II), the branching unit "A" is preferably branched into three to accommodate three carbohydrate ligands. The branching unit is preferably covalently linked to the ligand and the remaining tethered portion of the nucleic acid. The branching unit may comprise a branching aliphatic group comprising a group selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamide groups. The branching unit may comprise a group selected from alkyl and ether groups.

The branch unit A may have a structure selected from the following:

wherein each _A1 independently represents O, S, C=O or NH; and each n independently represents an integer from 1 to 20.

The branch unit may have a structure selected from the following: wherein each _A1 independently represents O, S, C=O or NH; and each n independently represents an integer from 1 to 20.

The branch unit may have a structure selected from the following: wherein _A1 is O, S, C=O or NH; and each n independently represents an integer from 1 to 20.

The branch unit can have the following structure: .

The branch unit can have the following structure: .

The branch unit can have the following structure: .

Alternatively, the branch unit A may have a structure selected from the following: , wherein: R ¹ is hydrogen or C1-C10 alkylene; and R ² is C1-C10 alkylene.

Optionally, the branching units consist only of carbon atoms.

The "X ³ " portion is a bridge unit. The bridge unit is linear and covalently bonds to the branch unit and the nucleic acid.

^X3 can be selected from _-C1 - _C20 alkylene-, _-C2 - _C20 alkenylene-, alkylene ether of the formula -( _C1 - _C20 alkylene)-O-( _C1 - _C20 alkylene)-, -C(O) _-C1 - _C20 alkylene-, _-C0 - _C4 alkylene(Cy) _C0 - _C4 alkylene-, wherein Cy represents a substituted or unsubstituted 5- or 6-membered cycloalkylene, arylene, heterocyclic group or heteroaryl ring, _-C1 - _C4 alkylene-NHC(O)-C1- _{C4 alkylene-} , _-C1 -C4 alkylene-C(O)NH- _C1 - _C4 alkylene-, _-C1 - _C4 alkylene-SC(O) _-C1 - _C4 alkylene-, _-C1 - _C -C 1 -C ₄ alkylene-C(O)SC ₁ -C ₄ alkylene-, -C ₁ -C ₄ alkylene-OC(O)-C ₁ -C ₄ alkylene-, -C ₁ -C ₄ alkylene-C(O)OC ₁ -C ₄ alkylene- and -C ₁ -C ₆ alkylene-SSC ₁ -C ₆ alkylene-.

^X3 may be an alkylene ether of the formula -( _C1 - _C20 alkylene)-O-( _C1 - _C20 alkylene)-. ^X3 may be an alkylene ether of the formula -( _C1 - _C20 alkylene)-O-( _C4 - _C20 alkylene)-, wherein the ( _C4 - _C20 alkylene) is linked to Z. ^X3 may be selected from the group consisting of _-CH2 - _{OC3H6- , -CH2 - OC4H8- , -CH2-OC6H12- and -CH2-OC8H16-, in particular -CH2-OC4H8-, -CH2-OC6H12- and -CH2 - OC8H16- , wherein in each case , the -CH2- group is linked} to A.

In one embodiment, the nucleic acid is conjugated to a heterologous moiety of formula (III): [SX ¹ -PX ² ] ₃ -AX ³ - (III) wherein: S represents a functional component, such as a ligand, such as a sugar, preferably GalNAc; X ¹ represents a C ₃ -C ₆ alkylene group or (-CH ₂ -CH ₂ -O) _m (-CH ₂ ) ₂ -, wherein m is 1, 2 or 3; P is a phosphate or a modified phosphate, preferably a thiophosphate; X ² is a C ₁ -C ₈ alkylene group; A is a branching unit selected from the following: ^X3 is a bridging unit; wherein the nucleic acid according to the present invention is bound to ^X3 via phosphate or modified phosphate, preferably phosphorothioate.

The branch unit A may have the following structure: .

The branch unit A may have the following structure: , wherein X ³ is connected to the nitrogen atom.

^X3 may be _{a C1} - _C20 alkylene group. Preferably, ^X3 is selected from the group consisting of _{-C3H6- , -C4H8- , -C6H12- and -C8H16-} , especially _{-C4H8- , -C6H12- and -C8H16- .}

In one embodiment, the nucleic acid is bound to a ligand comprising a compound of formula (IV): [SX ¹ -PX ² ] ₃ -AX ³ - (IV) wherein: S represents a functional component, such as a ligand, such as a sugar, preferably GalNAc; X ¹ represents a C ₃ -C ₆ alkylene group or (-CH ₂ -CH ₂ -O) _m (-CH ₂ ) ₂ -, wherein m is 1, 2 or 3; P is a phosphate or a modified phosphate, preferably a thiophosphate; X ² is an alkylene ether of the formula -C ₃ H ₆ -O-CH ₂ -; A is a branching unit; X ³ is an alkylene ether of the formula selected from the group consisting of: -CH ₂ -O-CH ₂ -, -CH ₂ -OC ₂ H ₄ -, -CH ₂ -OC ₃ H ₆ -, -CH ₂ -OC ₄ H ₈ -, -CH ₂ -OC ₅ H ₁₀ -, -CH ₂ -OC ₆ H ₁₂ -, -CH ₂ -OC ₇ H ₁₄ - and -CH ₂ -OC ₈ H ₁₆ -, wherein in each case the -CH ₂ - group is linked to A, and wherein X ³ is bound to the nucleic acid according to the invention via phosphate or modified phosphate, preferably phosphorothioate.

The branching unit may comprise carbon. Preferably, the branching unit is carbon.

^X3 may be selected from the group consisting of _{-CH2 - OC4H8- , -CH2} - _{OC5H10- , -CH2-OC6H12-, -CH2-OC7H14- and -CH2 - OC8H16- . Preferably ,} ^X3 is selected from the group consisting of _-CH2 - _{OC4H8- , -CH2} - _OC6H12- and _{-CH2 - OC8H16 .}

^X1 may be ( _-CH2 - _CH2 -O)(- _CH2 ) _2- . ^X1 may be ( _-CH2 - _CH2 -O) ₂ ( _-CH2 ) _2- . ^X1 may be ( _-CH2 - _CH2 -O) ₃ ( _-CH2 ) _2- . Preferably, ^X1 is ( _-CH2 - _CH2 -O) ₂ ( _-CH2 ) _2- . Alternatively, ^X1 represents a _C3 - _C6 alkylene group. ^X1 may be a propylene group. ^X1 may be a butylene group. ^{X1 may be a pentylene group. X1 may} be a hexylene group. Preferably, the alkyl group is a straight chain alkylene group. Specifically, ^X1 may be a butylene group.

^X2 represents _a group _{of the} formula _-C3H6 -O- _CH2 -alkylene ether, i.e. _C3 alkoxymethylene, _{or -CH2CH2CH2OCH2-} .

For any of the above aspects, when P represents a modified phosphate group, P can be represented by: wherein ^Y1 and ^Y2 each independently represent =O, =S, ^-O- , ^-OH , _-SH , _-BH3 , _-OCH2CO2 , _-OCH2CO2Rx ^, _-OCH2C (S) ^ORx and _-ORx , wherein ^Rx represents _C1 - _C6 alkyl and wherein Indicates the connection to the rest of the compound.

A modified phosphate means a phosphate group in which one or more of the non-linked oxygens are replaced. Examples of modified phosphate groups include phosphorothioates, phosphorodithioates, phosphoroselenoates, boranophosphates, boranophosphate esters, hydrophosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have two non-linked oxygens replaced by sulfur. One, each, or both of the non-linked oxygens in the phosphate group may independently be any of S, Se, B, C, H, N, or OR (R is alkyl or aryl).

Phosphates can also be modified by replacement of the linking oxygen with nitrogen (bridged phosphoramidates), with sulfur (bridged phosphorothioates), and with carbon (bridged methylenephosphonates). The replacement can be made at the terminal oxygen. Replacement of non-linking oxygens with nitrogen is possible.

For example, ^Y1 may represent -OH, and ^Y2 may represent =0 or =S; or ^Y1 may represent ^-O- , and ^Y2 may represent =0 or =S; ^Y1 may represent =0, and ^Y2 may represent _-CH3 , -SH, ^-ORx , or _-BH3; ^Y1 may represent =S, and ^Y2 may represent _-CH3 , ^ORx , or -SH.

Those skilled in the art will appreciate that in certain circumstances there will be delocalisation between ^Y1 and ^Y2 .

Preferably, the modified phosphate group is a thiophosphate group. Phosphorothioate groups include dithiophosphates (i.e., where Y ¹ represents =S and Y ² represents -S ^- ) and monothiophosphates (i.e., where Y ¹ represents -O ^- and Y ² represents =S, or where Y ¹ represents =O and Y ² represents -S ^- ). Preferably, P is a monothiophosphate. The inventors have found that conjugates having a thiophosphate group substituted for a phosphate group have improved in vivo potency and duration of action.

P may also be ethyl phosphate (ie, wherein Y ¹ represents ═O and Y ² represents OCH ₂ CH ₃ ).

The ligand, such as a carbohydrate, can be selected to have affinity for at least one type of receptor on the target cell. In particular, the receptor is located on the surface of mammalian liver cells, such as the hepatic asialoglycoprotein receptor complex (ASGP-R).

For any of the above or below aspects, the sugar may be selected from one or more of galactosamine, mannose, galactose, glucose, glucosamine and fructose having an N-acetyl group. Typically, the ligand used in the present invention may include N-acetylgalactosamine (GalNAc). Preferably, the compounds of the present invention may have three ligands, each of which preferably includes N-acetylgalactosamine.

"GalNAc" refers to 2-(acetylamino)-2-deoxy-D-galactopyranose, which is generally referred to as N-acetylgalactosamine in the literature. References to "GalNAc" or "N-acetylgalactosamine" include the following two: β-form: 2-(acetylamino)-2-deoxy-β-D-galactopyranose, and α-form: 2-(acetylamino)-2-deoxy-α-D-galactopyranose. In certain embodiments, β-form: 2-(acetylamino)-2-deoxy-β-D-galactopyranose, and α-form: 2-(acetylamino)-2-deoxy-α-D-galactopyranose, can be used interchangeably. Preferably, the compounds of the present invention comprise the β-form, 2-(acetamido)-2-deoxy-β-D-galactopyranose. 2-(Acetylamino)-2-deoxy-D-galactopyranose 2-(Acetylamino)-2-deoxy-β-D-galactopyranose 2-(Acetylamino)-2-deoxy-α-D-galactopyranose

In one aspect, the nucleic acid is a conjugated nucleic acid, wherein the nucleic acid is conjugated to a heterologous moiety having one of the following structures, which for ease of reference may be referred to as a "triterticular ligand": wherein Z is any nucleic acid as defined herein.

In certain embodiments, the nucleic acid Z is bound to the trianthrene ligand via a phosphate or phosphorothioate group, which links the trianthrene ligand to the 3' or 5' position of the sugar of the terminal nucleotide of the nucleic acid Z, particularly to the 3' or 5' position of the ribose sugar.

In certain embodiments, the heterologous moiety ("tritertial ligand") is bound to the 3' position of the ribose of the terminal nucleotide of the second (sense) strand of Z (also referred to as strand "B" in Tables 5a, 5b, 5c).

In other embodiments, the heterologous moiety ("tritertial ligand") is bound to the 5' position of the ribose of the terminal nucleotide of the second (sense) strand of Z (also referred to as strand "B" in Tables 5a, 5b, 5c).

In other embodiments, the heterologous moiety ("tritertial ligand") is bound to the 3' position of the ribose of the terminal nucleotide of the first (antisense) strand of Z (also referred to as strand "A" in Tables 5a, 5b, 5c).

Preferably, the nucleic acid is a conjugated nucleic acid, wherein the nucleic acid is conjugated to a tritertial ligand having one of the following structures: , wherein Z is any nucleic acid as defined herein.

In a preferred embodiment, the nucleic acid Z is bound to the triantral ligand via a phosphate or phosphorothioate group, which links the triantral ligand to the 3' or 5' position of the ribose of the terminal nucleotide of the nucleic acid Z.

Preferably, the "tritertial ligand" binds to the 5' position of the ribose of the terminal nucleotide of the second (sense) strand of Z (which is also referred to as strand "B" in Tables 5a, 5b, 5c).

The heterologous moiety of formula (II), (III) or (IV) or any of the trianthrene ligands disclosed herein may be linked to the 3'-end of the first (antisense) strand and/or to any of the 3' and/or 5' ends of the second (sense) strand. The nucleic acid may comprise more than one heterologous moiety of formula (II), (III) or (IV) or any of the trianthrene ligands disclosed herein. However, a single heterologous moiety of formula (II), (III) or (IV) or any of the trianthrene ligands disclosed herein is preferred, as a single such moiety is sufficient to efficiently target the nucleic acid to the target cell. Preferably, in that case, at least the last two, preferably at least the last three, and more preferably at least the last four nucleotides at the termini of the nucleic acid to which the ligand is linked are linked by phosphodiester bonds.

Preferably, the 5'-end of the first (antisense) strand is not linked to a heterologous moiety, as linkage at this position could potentially interfere with the biological activity of the nucleic acid.

Nucleic acids having a single heterologous moiety (e.g., a single heterologous moiety of formula (II), (III) or (IV) or any of the trianthrene ligands disclosed herein) at the 5' end of a strand are easier and therefore cheaper to synthesize than the same nucleic acid having the same group at the 3' end. It is therefore preferred that the single heterologous moiety (e.g., a single heterologous moiety of any of formula (II), (III) or (IV) or any of the trianthrene ligands disclosed herein) is covalently linked (bound to) the 5' end of the second strand of the nucleic acid.

In one embodiment, the first strand of the nucleic acid is a compound of formula (V): wherein b is preferably 0 or 1; and the second strand is a compound of formula (VI): ; wherein: c and d are preferably independently 0 or 1; _Z1 and _Z2 are the first and second strands of the nucleic acid, respectively; Y is independently O or S; n is independently 0, 1, 2 or 3; and _L1 is a linker linked to the ligand, wherein _L1 is the same or different in formula (V) and (VI), and when _L1 exists more than once in the same formula, it is the same or different in formula (V) and (VI), wherein _L1 preferably has formula (VII); and wherein b+c+d is preferably 2 or 3.

Preferably, _L1 in formula (V) and (VI) has formula (VII): wherein: L is selected from the group comprising or preferably consisting of: -( _CH2 ) _r -C(O)-, wherein r=2-12; -( _CH2 - _CH2 -O) _s - _CH2 -C(O)-, wherein s=1-5; -( _CH2 ) _t -CO-NH-( _CH2 ) _t -NH-C(O)-, wherein t is independently 1-5; -( _CH2 ) _u -CO-NH-( _CH2 ) _u -C(O)-, wherein u is independently 1-5; and -( _CH2 ) _v -NH-C(O)-, wherein v is 2-12; and wherein the terminal C(O) is connected to X (if present) of formula (VII), or if X is absent, to _W1 of formula (VII), or if _W1 is absent, to V of formula (VII); _W1 , _W3 and W ₅ is independently absent or selected from the group consisting of or preferably consisting of: -(CH ₂ ) _r -, wherein r=1-7; -(CH ₂ ) _s -O-(CH ₂ ) _s -, wherein s is independently 0-5; -(CH ₂ ) _t -S-(CH ₂ ) _t -, wherein t is independently 0-5; X is absent or selected from the group consisting of or preferably consisting of: NH, NCH ₃ or NC ₂ H ₅ ; V is selected from the group consisting of or preferably consisting of: CH, N, ; wherein B (if present) is a modified or natural nucleobase.

In one embodiment, the first strand is a compound of formula (VIII) wherein b is preferably 0 or 1; and the second strand is a compound of formula (IX): ; wherein c and d are independently preferably 0 or 1; wherein: Z ₁ and Z ₂ are the first and second strands of the nucleic acid, respectively; Y is independently O or S; R ¹ is H or methyl; n is preferably independently 0, 1, 2 or 3; and L is the same or different in formula (VIII) and (IX), and when L occurs more than once in the same formula, it is the same or different in formula (VIII) and (IX) and is selected from the group comprising or preferably consisting of: -(CH ₂ ) _r -C(O)-, wherein r=2-12; -(CH ₂ -CH ₂ -O) _s -CH ₂ -C(O)-, wherein s=1-5; -(CH ₂ ) _t -CO-NH-(CH ₂ ) _t -NH-C(O)-, wherein t is independently 1-5; -(CH ₂ ) _u -CO-NH-(CH ₂ ) _u -C(O)-, wherein u is independently 1-5; and -(CH ₂ ) _v -NH-C(O)-, wherein v is 2-12; and wherein the terminal C(O) (if present) is attached to the NH group (of the linker, not the targeting ligand); and wherein b+c+d is preferably 2 or 3.

In one embodiment, the first strand of the nucleic acid is a compound of formula (X): wherein b is preferably 0 or 1; and the second strand is a compound of formula (XI): ; wherein: c and d are independently preferably 0 or 1; Z ₁ and Z ₂ are the first and second RNA strands of the nucleic acid, respectively; Y is independently O or S; n is preferably independently 0, 1, 2 or 3; and L ₂ is the same or different in formula (X) and (XI) and the same or different in the part bracketed by b, c and d, and is selected from the group comprising or preferably consisting of: ; or n is 0, and L ₂ is: And the terminal OH group does not exist, so that the following parts are formed: wherein: F is a saturated branched or unbranched (e.g. unbranched) _C1-8 alkyl (e.g. _C1-6 alkyl) chain, wherein one of the carbon atoms is optionally replaced by an oxygen atom, provided that the oxygen atom is separated from another heteroatom (e.g. O or N atom) by at least 2 carbon atoms; L is the same or different in formula (X) and formula (XI) and is selected from the group comprising or preferably consisting of: -( _CH2 ) _r -C(O)-, wherein r=2-12; -( _CH2 - _CH2 -O) _s - _CH2 -C(O)-, wherein s=1-5; -( _CH2 ) _t -CO-NH-( _CH2 ) _t -NH-C(O)-, wherein t is independently 1-5; -( _CH2 ) _u -CO-NH-( _CH2 ) _u -C(O)-, wherein u is independently 1-5; and -(CH ₂ ) _v -NH-C(O)-, wherein v is 2-12; and wherein the terminal C(O) (if present) is attached to the NH group (of the linker, not the targeting ligand); and wherein b+c+d is preferably 2 or 3.

In one aspect, in any of the nucleic acids of formula (V) and (VI) or (VIII) and (IX) or (X) and (XI), b is 0, c is 1 and d is 1; b is 1, c is 0 and d is 1; b is 1, c is 1 and d is 0; or b is 1, c is 1 and d is 1. Preferably, b is 0, c is 1 and d is 1; b is 1, c is 0 and d is 1; or b is 1, c is 1 and d is 1. Most preferably, b is 0, c is 1 and d is 1.

In one embodiment, in any of the nucleic acids of formula (V) and (VI) or (VIII) and (IX) or (X) and (XI), Y is O. In another embodiment, Y is S. In a preferred embodiment, Y is independently selected from O or S at different positions in the formula.

In one aspect, in any of the nucleic acids of Formulae (VIII) and (IX), R ₁ is H or methyl. In one aspect, R ₁ is H. In another aspect, R ₁ is methyl.

In one aspect, in any of the nucleic acids of formula (V) and (VI) or (VIII) and (IX) or (X) and (XI), n is 0, 1, 2 or 3. Preferably, n is 0.

Examples of the F moiety in any of the nucleic acids of formula (X) and (XI) include ( _CH2 ) _1-6 , such as ( _CH2 ) _1-4 , such as _CH2 , ( _CH2 ) ₄ , ( _CH2 ) ₅ or ( _CH2 ) ₆ or _CH2O ( _CH2 ) _2-3 , such as _CH2O ( _CH2 ) _CH3 .

In one embodiment, _L2 in formula (X) and (XI) is: .

In one aspect, _L2 is: .

In one aspect, _L2 is: .

In one aspect, _L2 is: .

In one aspect, n is 0, and _L2 is: And the terminal OH group does not exist, so that the following parts are formed: ; Wherein Y is O or S.

In one embodiment, L in the nucleic acids of formula (V) and (VI) or (VIII) and (IX) or (X) and (XI) is selected from the group comprising or preferably consisting of: -( _CH2 ) _r -C(O)-, wherein r=2-12; -( _CH2 - _CH2 -O) _s - _CH2 -C(O)-, wherein s=1-5; -( _CH2 ) _t -CO-NH-( _CH2 ) _t -NH-C(O)-, wherein t is independently 1-5; -( _CH2 ) _u -CO-NH-( _CH2 ) _u -C(O)-, wherein u is independently 1-5; and -( _CH2 ) _v -NH-C(O)-, wherein v is 2-12; wherein the terminal C(O) is connected to the NH group.

Preferably, L is -(CH ₂ ) _r -C(O)-, wherein r=2-12, more preferably r=2-6, even more preferably, r=4 or 6, such as 4.

Preferably, L is: .

Within the portion bracketed by b, c, and d _{, L2} in the nucleic acids of Formula (X) and (XI) is generally the same. Between the portions bracketed by b, c, and d, _L2 may be the same or different. In embodiments, _L2 in the portion bracketed by c is the same as L2 in the portion bracketed by d. In embodiments, _L2 in the portion bracketed by c is different from _L2 in the portion bracketed by d. In embodiments, _L2 in the portions bracketed by b, c, and d is the same, for example when the linker moiety is a selenoic acid derived linker moiety.

The serotonin-derived linker moiety can be based on serotonin of any stereochemistry, i.e. derived from L-serotonin isomers, D-serotonin isomers, racemic serine or other isomer combinations. In a preferred embodiment of the present invention, the serotonin-GalNAc moiety (SerGN) has the following stereochemistry: That is, it is based on a solid-loaded building block of (S)-serine-amino acid ester or (S)-serine succinate derived from L-serine isomers.

In a preferred embodiment, the first strand of the nucleic acid is a compound of formula (VIII), and the second strand of the nucleic acid is a compound of formula (IX), wherein: b is 0; c and d are 1, n is 0, Z ₁ and Z ₂ are the first and second strands of the nucleic acid, respectively, Y is S, R ₁ is H, and L is -(CH ₂ ) ₄ -C(O)-, wherein the terminal C(O) of L is connected to the N atom of the linker (i.e., not a possible N atom of the targeting ligand).

In another preferred embodiment, the first strand of the nucleic acid is a compound of formula (V), and the second strand of the nucleic acid is a compound of formula (VI), wherein: b is 0, c and d are 1, n is 0, Z ₁ and Z ₂ are the first and second strands of the nucleic acid, respectively, Y is S, L ₁ has formula (VII), wherein: W ₁ is -CH ₂ -O-(CH ₂ ) ₃ -, W ₃ is -CH ₂ -, W ₅ is absent, V is CH, X is NH, and L is -(CH ₂ ) ₄ -C(O)-, wherein the terminal C(O) of L is connected to the N atom of X in formula (VII).

In another preferred embodiment, the first strand of the nucleic acid is a compound of formula (V), and the second strand of the nucleic acid is a compound of formula (VI), wherein: b is 0, c and d are 1, n is 0, Z ₁ and Z ₂ are the first and second strands of the nucleic acid, respectively, Y is S, L ₁ has formula (VII), wherein: W ₁ , W ₃ and W ₅ are absent, V is , X is absent, and L is -(CH ₂ ) ₄ -C(O)-NH-(CH ₂ ) ₅ -C(O)-, wherein the terminal C(O) of L is connected to the N atom of V in formula (VII).

In one aspect, the nucleic acid is bound to a tri-antennary ligand having the following structure: wherein the nucleic acid is bound to the trianthrene ligand via the phosphate group of the ligand to: a) the 3' position of the ribose of the terminal nucleotide of the second (sense) strand of Z (which is also referred to as strand "B" in Tables 5a, 5b, 5c), or b) the 5' position of the ribose of the terminal nucleotide of the second (sense) strand of Z (which is also referred to as strand "B" in Tables 5a, 5b, 5c), or c) the 3' position of the ribose of the terminal nucleotide of the first (antisense) strand of Z (which is also referred to as strand "A" in Tables 5a, 5b).

In one aspect of the nucleic acid, the cell targeted by the nucleic acid having a ligand is a hepatocyte.

In any of the above ligands, where GalNAc is present, the GalNAc may be replaced by any other targeting ligand, such as those mentioned herein, in particular mannose, galactose, glucose, glucosamine and trehalose.

In one aspect, the nucleic acid is conjugated to a heterologous moiety comprising a lipid, and preferably cholesterol.

In one aspect, the double-stranded nucleic acid used to inhibit AGT expression is one of the duplexes shown in Table 5c, which can be referred to by its duplex ID number.

In a preferred embodiment, the double-stranded nucleic acid used to inhibit AGT expression is a duplex having duplex ID numbers EM2203, EM2206, EM2207, EM2209, EM2212, EM2214, EM2220, EM2227, EM2228.

For example, EM2207, EM2227, and EM2228 are characterized by high in vivo potency and favorable safety (eg, off-target) profiles, as described in the Examples herein below.

Compositions, Uses and Methods The present invention also provides compositions comprising the nucleic acids of the present invention. The nucleic acids and compositions can be used alone or in combination with other agents as therapeutic or diagnostic agents. For example, one or more nucleic acids of the present invention can be combined with a delivery vehicle (e.g., liposomes) and/or a form (e.g., a carrier, a diluent). Other agents, such as preservatives and stabilizers, may also be added. Pharmaceutically acceptable salts or solvents of any of the nucleic acids of the present invention are also within the scope of the present invention. Methods for delivering nucleic acids are known in the art and are within the knowledge of those skilled in the art.

The compositions disclosed herein are particularly pharmaceutical compositions. Such compositions are suitable for administration to an individual.

In one aspect, the composition comprises a nucleic acid disclosed herein or a pharmaceutically acceptable salt or solvent thereof, and a solvent (preferably water), and/or a delivery vehicle, and/or a physiologically acceptable excipient, and/or a carrier, and/or a salt, and/or a diluent, and/or a buffer, and/or a preservative.

Pharmaceutically acceptable carriers or diluents include those used in formulations suitable for oral, rectal, nasal or parenteral (including subcutaneous, intramuscular, intravenous, intradermal and transdermal) administration. The formulation may be conveniently presented in unit dosage form and may be prepared by any method known in the art of pharmacy. Subcutaneous or transdermal modes of administration may be particularly suitable for the compounds described herein.

The prophylactic or therapeutically effective amount of the nucleic acid of the present invention will depend on the route of administration, the type of mammal being treated, and the physical characteristics of the particular mammal being considered. These factors and their relationships that determine this amount are well known to those skilled in the medical art. This amount and method of administration can be adjusted to obtain the best efficacy and can depend on factors well known to those skilled in the medical art, such as body weight, diet, concurrent medications, and other factors. The dosage size and dosing regimen most suitable for human use can be guided by the results obtained by the present invention and can be confirmed in appropriately designed clinical trials.

Effective doses and treatment regimens can be determined by empirical means, starting with low doses in experimental animals and subsequently increasing the dose while monitoring the effects and also systematically varying the dosing regimen. The clinician can consider many factors when determining the optimal dose for a given individual. Such considerations are known to those skilled in the art.

The nucleic acid or salt thereof of the present invention can be formulated into a pharmaceutical composition prepared for storage or administration, which generally comprises a preventively or therapeutically effective amount of the nucleic acid or salt thereof of the present invention in a pharmaceutically acceptable carrier.

The nucleic acids or conjugated nucleic acids of the present invention may also be administered in combination with other therapeutic compounds, for example, separately or simultaneously in a combined unit dose. The present invention also includes a composition comprising one or more nucleic acids according to the present invention in a physiologically/pharmaceutically acceptable formulation, such as stabilizers, preservatives, diluents, buffers and the like.

In one embodiment, the composition comprises a nucleic acid disclosed herein and another therapeutic agent selected from the group consisting of oligonucleotides, small molecules, monoclonal antibodies, polyclonal antibodies and peptides. Preferably, the other therapeutic agent is an agent that targets, preferably inhibits the expression or activity of AGT. Preferably, the other therapeutic agent is one of the following: a) a peptide that inhibits the expression or activity of AGT; b) an antibody that specifically binds to AGT under physiological conditions; or one of its subunits or proteolytic cleavage products.

In some embodiments, the additional therapeutic agent is selected from the group consisting of: diuretics, such as thiazides, thiazides, cyclic diuretics, and potassium-sparing diuretics; angiotensin converting enzyme (ACE) inhibitors, such as benazepril, captopril, enalapril, fosinopril, lisinopril, pril); angiotensin II receptor antagonists; beta-blockers such as acebutolol, alprenolol, atenolol, betaxolol, bisoprolol, bunolol, carteolol, carvedilol, arvedilol, celiprolol, esmolol, labetalol, levobunolol, metipranolol, metoprolol, nadolol, oxpreolol, pindolol, propranolol, sotalol, timolol; vasodilators, such as direct vasodilators, such as hydrazaline and minoxidil; calcium channel blockers (also called calcium channel antagonists), such as amlodipine ), diltiazem, verapamil, nifedipine, nisoldipine, felodipine, nimodipine, isradipine, levamlodipine, clevidipine, nicardipine; aldosterone antagonists such as spironolactone, eplerenone, finerenone; α2 agonists such as clonidine, methydopa, tizanidine, guanfacine, facine, lofexidine; renin inhibitors such as aliskiren; alpha-blockers such as doxazosin, prazosin, terazosin; centrally acting sympathetic nerve blockers such as methyldopa, clothianidin, guanabenz, or guanfacine; peripherally acting sympathetic nerve blockers; selective D1 receptor partial agonists such as clozapine and fenoldopam; nonselective alpha-adrenaline antagonists such as phenoxybenzamine; synthetic and steroidal antimineralocorticoids agents, such as spironolactone, eplerenone, canrenone, finereonone, mexrenone; vasopressin receptor neprilysin inhibitors (ARNi), such as sacubitril and sacubitril/valsartan; or endothelin receptor antagonists (ERAs), such as sitaxentan, ambrisentan, atrasentan, BQ-123, zibotentan, bosentan, macitentan, and tezosentan. entan); vasopressin inhibitors such as tolvaptan, conivaptan, lixivaptan, mozavaptan, stavaptan, relcovaptan; nitrates; potassium channel openers such as melamine, nicorandil, pinacidil, levcromakalim; imidazolines such as clothianidin, moxonidin, oxymetazolin; combinations of any of the foregoing; and hypertensive therapeutic agents formulated as combinations thereof.

Preferably, the additional therapeutic agent comprises an angiotensin II receptor antagonist selected from the group consisting of losartan, valsartan, olmesartan, eprosartan, irbesartan, temisartan, candesartan and azilsartan.

In certain embodiments, two or more nucleic acids of the invention having different sequences can be administered simultaneously or sequentially.

In another aspect, the present invention provides a composition, such as a pharmaceutical composition, comprising one or a combination of the different nucleic acids of the present invention and at least one pharmaceutically acceptable carrier.

The dosage content of the therapeutic agent and composition of the present invention can be determined by experiments by those skilled in the art. In one aspect, the unit dose may contain between about 0.01 mg/kg and about 100 mg/kg of nucleic acid or nucleic acid binding. Alternatively, the dose may be 10 mg/kg to 25 mg/kg of body weight, or 1 mg/kg to 10 mg/kg of body weight, or 0.05 mg/kg to 5 mg/kg of body weight, or 0.1 mg/kg to 5 mg/kg of body weight, or 0.1 mg/kg to 1 mg/kg of body weight, or 0.1 mg/kg to 0.5 mg/kg of body weight, or 0.5 mg/kg to 1 mg/kg of body weight. Alternatively, the dosage may be about 0.5 mg/kg to about 10 mg/kg body weight, or about 0.6 mg/kg to about 8 mg/kg body weight, or about 0.7 mg/kg to about 7 mg/kg body weight, or about 0.8 mg/kg to about 6 mg/kg body weight, or about 0.9 mg/kg to about 5.5 mg/kg body weight, or about 1 mg/kg to about 5 mg/kg body weight, or about 1 mg/kg body weight, or about 3 mg/kg body weight, or about 5 mg/kg body weight, wherein "about" is a deviation of up to 30%, preferably up to 20%, more preferably up to 10%, and more preferably up to 5%, and most preferably 0% from the indicated value. The dosage content may also be calculated by other parameters, such as body surface area.

The dosage unit of such nucleic acid preferably comprises about 1 mg/kg to about 5 mg/kg body weight, or about 1 mg/kg to about 3 mg/kg body weight, or about 1 mg/kg body weight, or about 3 mg/kg body weight, or about 5 mg/kg body weight. The AGT mRNA level in the liver and/or the AGT protein level in the plasma or blood of the subject treated with the dosage unit of nucleic acid is preferably reduced by at least 30%, at least 40%, at least 50%, at least 60% or at least 70% at the maximum effect time point compared to a control not treated with nucleic acid or treated with a control nucleic acid under similar conditions.

The dosage and frequency of administration may vary depending on whether the treatment is therapeutic or prophylactic (e.g., preventive), and may be adjusted during the course of treatment. In certain prophylactic applications, relatively low doses are administered at relatively infrequent intervals over a relatively long period of time. Some individuals may continue to receive treatment throughout their lifetime. In certain therapeutic applications, it is sometimes necessary to administer relatively high doses at relatively short intervals until the progression of the disease is reduced, or until the patient exhibits partial or complete improvement in the symptoms of the disease. Thereafter, the patient may be switched to an appropriate prophylactic dosing regimen.

The actual dosage amount of the nucleic acid of the present invention alone or in combination with one or more other active ingredients in the pharmaceutical composition of the present invention can be varied so as to obtain an effective amount of the active ingredient to achieve the desired therapeutic response for a particular patient, composition and mode of administration without causing harmful side effects to the individual or patient. The selected dosage amount will depend on a variety of factors, such as pharmacokinetic factors, including the activity of the specific nucleic acid or composition employed; the route of administration; the time of administration; the excretion rate of the specific nucleic acid to be employed; the duration of treatment; other drugs, compounds and/or materials used in combination with the specific composition employed; the age, sex, weight, condition, general health and previous medical history of the individual or patient to be treated; and similar factors well known in the medical art.

The pharmaceutical composition may be a sterile injectable aqueous suspension or solution, or in lyophilized form.

The pharmaceutical composition may be in unit dosage form. In such form, the composition is divided into unit doses containing appropriate amounts of the active ingredient. The unit dosage form may be a packaged preparation containing discrete amounts of the preparation, for example, a packet of tablets, a capsule, and a powder in a vial or ampoule. The unit dosage form may also be a capsule, cachet, or tablet itself, or it may be an appropriate number of any of these packaged forms. It may be provided in a single dose injectable form, for example in the form of a pen. The composition may be formulated for any suitable route and means of administration.

The therapeutic agents and pharmaceutical compositions of the present invention can be administered to a mammalian subject in a pharmaceutically effective dose. The mammal can be selected from humans, non-human primates, monkeys or prosimians, dogs, cats, horses, cows, pigs, goats, sheep, mice, rats, hamsters, hedgehogs and guinea pigs or other related species. On this basis, as used herein, "AGT" means a nucleic acid or protein in any of the above species (if naturally or artificially expressed therein), but preferably the term refers to a human nucleic acid or protein.

The pharmaceutical compositions of the invention may be administered alone or in combination with one or more other therapeutic agents or diagnostic agents. Combination therapy may include a nucleic acid of the invention in combination with at least one other therapeutic agent selected based on the specific patient, disease or condition to be treated. Examples of other such agents include, among others, therapeutically active small molecules or polypeptides, single chain antibodies, classical antibodies or fragments thereof, or nucleic acid molecules that modulate gene expression of one or more additional genes and similar modulating therapeutic agents that may supplement or otherwise benefit therapeutic or prophylactic treatment regimens.

Pharmaceutical compositions are generally sterile and stable under manufacturing and storage conditions. The composition can be formulated as a solution, microemulsion, liposome or other ordered structure suitable for higher drug concentrations. The carrier can be a solvent or dispersion medium containing, for example, water, alcohol (such as ethanol), polyols (such as glycerol, propylene glycol and liquid polyethylene glycol) or any suitable mixture. Suitable fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the desired particle size in the case of a dispersion, and by using a surfactant according to a formulation chemistry well known in the art. In certain embodiments, isotonic agents, such as sugars, polyols (such as mannitol, sorbitol) or sodium chloride may be desirable in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin.

One aspect of the present invention is a nucleic acid or composition disclosed herein for use as a therapeutic agent. The nucleic acid or composition is preferably used to prevent or treat a disease, condition or syndrome.

The present invention provides a nucleic acid for use alone or in combination with one or more additional therapeutic agents in a pharmaceutical composition to treat or prevent conditions, diseases and disorders responsive to inhibition of AGT expression.

One aspect of the invention is the use of a nucleic acid or composition as disclosed herein for the prevention or treatment of a disease, disorder or syndrome.

The nucleic acids and pharmaceutical compositions of the present invention can be used to treat a variety of conditions, disorders or diseases. Treatment with the nucleic acids of the present invention preferably causes AGT depletion in vivo (preferably in the liver and/or in the blood). Therefore, the nucleic acids of the present invention and compositions comprising the same will be suitable for use in methods for treating a variety of pathological conditions, in which inhibition of AGT expression may be beneficial. The present invention provides a method for treating a disease, disorder or syndrome, comprising the step of administering a preventive or therapeutically effective amount of the nucleic acid of the present invention to an individual in need thereof.

Therefore, the present invention provides a method for preventing or treating a disease, disorder or syndrome, comprising the step of administering a therapeutically effective amount of a nucleic acid or a pharmaceutical composition comprising the nucleic acid of the present invention to a subject in need thereof (eg, a patient).

The optimal therapeutically effective amount is that amount that will produce the desired effect for a particular treatment, which is selected by one skilled in the art for a given individual in need thereof. This amount will vary depending on a variety of factors understood by one skilled in the art, including, but not limited to, the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the individual (including age, sex, disease type and stage, general physical condition, responsiveness to a given dose, and type of drug), the nature of one or more pharmaceutically acceptable carriers in the formulation, and the route of administration. One skilled in clinical and pharmacological techniques will be able to determine the therapeutically effective amount experimentally, i.e., by monitoring the individual's response to the administered compound and adjusting the dosage accordingly. See, e.g., Remington: The Science and Practice of Pharmacy 21st ed., Univ. of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, PA, 2005.

In certain embodiments, the nucleic acids and pharmaceutical compositions of the invention can be used to treat or prevent diseases, disorders or syndromes.

In certain embodiments, the present invention provides a method for preventing or treating a disease, disorder or syndrome in a mammalian subject (such as a human), the method comprising administering to a subject in need thereof a preventive or therapeutically effective amount of a nucleic acid as disclosed herein.

Administration of a "therapeutically effective amount" of the nucleic acid of the present invention can reduce the severity of disease symptoms, increase the frequency or duration of disease symptom-free periods, or prevent damage or disability caused by disease ailments.

The nucleic acids of the invention may be useful in treating or diagnosing a disease, disorder or syndrome that can be diagnosed or treated using the methods described herein. Treatment and diagnosis of other diseases, disorders or syndromes are also contemplated as being within the scope of the invention.

One aspect of the present invention is a method for preventing or treating a disease, disorder or syndrome, comprising administering to a subject in need of treatment a pharmaceutically effective dose or amount of a nucleic acid or composition disclosed herein, preferably wherein the nucleic acid or composition is administered to the subject subcutaneously, intravenously, or orally, rectally, pulmonary, intramuscularly or intraperitoneally. Preferably, it is administered subcutaneously.

The disease, disorder or syndrome is typically an AGT-mediated disease, disorder or syndrome associated with abnormal activation and/or overactivation (hyperactivation) of AGT and/or overexpression or ectopic expression or localization or accumulation of AGT.

The AGT-mediated disease, disorder or syndrome may be a) selected from the group comprising and preferably consisting of: high blood pressure; hypertension; critical hypertension; essential hypertension; primary hypertension; secondary hypertension; isolated systolic or diastolic hypertension; pregnancy-related hypertension; diabetic hypertension; intractable hypertension; refractory hypertension; paroxysmal hypertension; renovascular hypertension; Goldblatt's hypertension hypertension); hypertension associated with low plasma renin activity or plasma renin concentration; malignant hypertension; hypertension associated with obesity; ocular hypertension; glaucoma; pulmonary hypertension; portal hypertension; systemic venous hypertension; systolic hypertension; unstable hypertension; hypertensive heart disease; hypertensive nephropathy; hypertensive urgency; hypertensive emergency emergency); hypertensive encephalopathy; reversible posterior encephalopathy syndrome; atherosclerosis; peripheral arterial disease; vascular lesions; diabetic nephropathy; diabetic retinopathy; chronic heart failure; cardiomyopathy; diabetic cardiomyopathy; glomerulosclerosis; aortic stenosis; aortic aneurysm; ventricular fibrosis; heart failure; heart failure with preserved ejection fraction (HFpEF); heart failure with reduced ejection fraction (HFrEF); ischemic heart disease; myocardial infarction; angina; stroke; nephropathy; renal failure; systemic sclerosis; intrauterine growth restriction (IUGR); fetal growth restriction; obesity; hepatic steatosis/ Fatty liver; nonalcoholic steatohepatitis (NASH); nonalcoholic fatty liver disease (NAFLD); glucose intolerance; type 2 diabetes mellitus (non-insulin-dependent diabetes mellitus); migraine prevention; nephrotic syndrome; proteinuria; polycystic ovary syndrome; fibromuscular dysplasia; hyperthyroidism; hypothyroidism; acromegaly; sleep apnea; drug-induced hypertension; iatrogenic hypertension; athlete's hypertension; perioperative hypertension; pheochromocytoma; Conn's syndrome (primary hyperaldosteronism); secondary hyperaldosteronism; hypercortisolism (Cushing's syndrome) syndrome and Cushing's disease); left ventricular hypertrophy; aortic stenosis; aortic regurgitation; mitral regurgitation; dilated cardiomyopathy; hypertension in children; hypertension in adolescents; COVID-19; chronic kidney disease; nephritic syndrome (distinct from nephrotic); scleroderma renal crisis; lupus nephritis; C3-glomerulopathy; IgA nephropathy; polycystic nephropathy; minimal change disease; primary membranous nephropathy; secondary membranous nephropathy; focal segmental glomerulosclerosis; immune complex membranoproliferative glomerulonephritis; sickle cell nephropathy; HIV nephropathy; amyloidosis; aortic lesions associated with pathogenic TGF-b signaling; Marfan syndrome; Loeys-Dietz syndrome; hereditary hemorrhagic telangiectasia; familial thoracic aortic aneurysm and anatomic and metabolic syndrome.

In one embodiment, the AGT-mediated disorder is hypertension in a patient with uncontrolled blood pressure.

In one embodiment, the AGT-mediated disease, disorder or syndrome is selected from essential hypertension, childhood hypertension, chronic heart failure, chronic kidney disease, ischemic heart disease, angina, myocardial infarction, refractory hypertension, nonalcoholic fatty hepatitis, nephrotic syndrome, aortic stenosis and HIV nephropathy.

In one embodiment, the AGT-mediated disease, disorder or syndrome is selected from essential hypertension, childhood hypertension, chronic heart failure, chronic kidney disease, ischemic heart disease, angina and myocardial infarction.

The nucleic acid or composition disclosed herein can be used in a regimen comprising once or twice a week, every week, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, every eight weeks, every nine weeks, every ten weeks, every eleven weeks, every twelve weeks, every three months, every four months, every five months, every six months, or a regimen with different dosing frequencies (such as a combination of the above intervals). The nucleic acid or composition can be administered subcutaneously, intravenously, or using any other application route, such as orally, rectally, pulmonary or intraperitoneally. Preferably, it is administered subcutaneously.

In cells and/or individuals treated with or receiving nucleic acids or compositions as disclosed herein, the inhibition of AGT expression may range from 15% to 100% compared to untreated cells and/or individuals, but is at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 100% or intermediate values. The inhibitory level may allow treatment of diseases associated with AGT expression or overexpression or complement overactivation, or may be used to further study the function and physiological effects of the AGT gene product. The level of inhibition is preferably measured in the liver or blood or kidney of an individual treated with the nucleic acid or composition, preferably in the blood.

One aspect is the use of a nucleic acid or composition as disclosed herein in the manufacture of a medicament for treating a disease, disorder or syndrome, such as those listed above or other pathologies associated with elevated AGT levels (preferably in the blood or kidney) or overactivation of the tonic pathway; or other treatments requiring inhibition of AGT expression. The medicament is a pharmaceutical composition.

Each of the nucleic acids and pharmaceutically acceptable salts and solvents of the present invention constitutes an individual embodiment of the present invention.

The invention also includes a method of preventing or treating a disease, condition or syndrome (such as those listed above) comprising administering to a subject in need thereof a composition comprising a nucleic acid or composition as described herein. The nucleic acid or composition can be administered, for example, in a regimen comprising twice a week, once a week, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, or every eight weeks to twelve weeks or more of treatment, or in a regimen of different dosing frequencies (such as a combination of the above intervals). The nucleic acid or conjugated nucleic acid can be administered subcutaneously or intravenously, or other routes of application, such as oral, rectal or intraperitoneal.

The nucleic acids of the invention may be administered by any suitable route of administration known in the art, including but not limited to aerosol, enteral, nasal, ophthalmic, oral, parenteral, rectal, vaginal, or transdermal (e.g., topical administration of a cream, gel, or ointment, or by means of a transdermal patch). "Parenteral administration" generally involves injection at or in communication with the intended site of action, including infraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, intracapsular, subcutaneous, transmucosal, or transtracheal administration.

The use of chemically modified patterns of nucleic acids confers nuclease stability in serum and enables, for example, subcutaneous administration routes.

Solutions or suspensions for intradermal or subcutaneous application typically include one or more of the following: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerol, propylene glycol or other synthetic solvents; an antibacterial agent such as benzyl alcohol or methyl paraben; an antioxidant such as ascorbic acid or sodium bisulfite; a chelating agent such as ethylenediaminetetraacetic acid; a buffer such as acetates, citrates or phosphates; and/or a tonicity adjusting agent such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide, or with buffers such as citrates, phosphates, acetates and the like. Such preparations can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Sterile injectable solutions can be prepared by incorporating the desired amount of nucleic acid into an appropriate solvent, optionally with one or a combination of ingredients described above, followed by sterilization microfiltration. Dispersions can be prepared by incorporating the active compound into a sterile vehicle containing a dispersion medium and, if appropriate, other ingredients (such as those described above). In the case of sterile powders for the preparation of sterile injectable solutions, the preparation methods are vacuum drying and freeze drying (lyophilization), which produce a powder of the active ingredient and any additional desired ingredients from a sterile filtered solution thereof.

When a prophylactically or therapeutically effective amount of the nucleic acid of the present invention is administered, for example, by intravenous, cutaneous or subcutaneous injection, the nucleic acid will be in the form of a pyrogen-free, parenterally acceptable aqueous solution. Methods for preparing parenterally acceptable solutions, taking into account appropriate pH, isotonicity, stability and the like, are within the skill of the art. Preferred pharmaceutical compositions for intravenous, cutaneous or subcutaneous injection may contain, in addition to the nucleic acid, an isotonic vehicle such as sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection or other vehicles known in the art. The pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants or other additives known to those skilled in the art.

The amount of nucleic acid that can be combined with a carrier material to produce a single dosage form will vary depending on a variety of factors, including the individual being treated and the particular mode of administration. In general, the amount of the composition will produce an appropriate therapeutic effect in a particular situation. In general, as a percentage, this amount combined with a pharmaceutically acceptable carrier is usually in the range of about 0.01% to about 99% nucleic acid, about 0.1% to about 70%, or about 1% to about 30% nucleic acid.

The nucleic acid can be prepared with a carrier that will protect the compound from rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Many methods for preparing such formulations are patented or are known to those skilled in the art. See, for example, Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.

The dosage regimen may be adjusted to provide the optimal desired response (e.g., a therapeutic response). For example, a dose may be administered, a number of divided doses may be administered over time, or the dose may be proportionally reduced or increased as indicated by the particular circumstances of the therapeutic situation (in each case). When administered to an individual or patient, it is particularly advantageous to formulate parenteral compositions in unit dosage form for ease of administration and uniformity of dosage. As used herein, a unit dosage form refers to physically discrete units suitable for use as a unit dosage for the individual to be treated; each unit contains a predetermined amount of active compound calculated to produce the desired therapeutic effect. The specifications for the unit dosage forms of the present invention depend on the specific characteristics of the active compound and the specific therapeutic or prophylactic effect to be achieved and the treatment and sensitivity of any individual patient.

The nucleic acids or compositions of the invention can be produced using conventional methods in the art, including chemical synthesis, such as solid phase chemical synthesis.

The nucleic acids or compositions of the invention can be administered with one or more of a variety of medical devices known in the art. For example, in one embodiment, the nucleic acids of the invention can be administered with a needle-free subcutaneous injection device. Examples of well-known implants and modules suitable for use with the invention are in the art, including, for example, implantable microinfusion pumps for controlled rate delivery; devices for transdermal administration; infusion pumps for delivery at precise infusion rates; variable flow implantable infusion devices for continuous drug delivery; and osmotic drug delivery systems. These and other such implants, delivery systems, and modules are known to those skilled in the art.

In certain embodiments, the nucleic acids or compositions of the invention may be formulated to ensure desired distribution in vivo. To target the therapeutic compounds or compositions of the invention to specific in vivo locations, they may be formulated, for example, in liposomes, which may contain one or more moieties that are selectively transported to specific cells or organs, thereby enhancing targeted drug delivery.

The present invention is characterized by high specificity at the molecular and tissue-directed delivery levels. The sequences of the nucleic acids of the present invention are highly specific for their targets, meaning that they do not inhibit the expression of genes that are not designed for targeting, or only minimally inhibit the expression of genes that are not designed for targeting, and/or only inhibit the expression of low numbers of genes that are not designed for targeting. Another degree of specificity is obtained when the nucleic acid is linked to a ligand that is specifically recognized and internalized by a particular cell type. For example, when the nucleic acid is linked to a ligand comprising a GalNAc moiety, these moieties are specifically recognized and internalized by hepatocytes. This results in the nucleic acid inhibiting the expression of its target only in cells targeted by the ligand to which it is linked. These two degrees of specificity potentially confer a better safety profile than currently available treatments. In certain embodiments, the invention thus provides a nucleic acid of the invention linked to a ligand comprising one or more GalNAc moieties, or comprising one or more other moieties that confer cell type or tissue specific internalization of the nucleic acid, thereby conferring additional specificity for target gene knockdown by RNA interference.

Nucleic acids as described herein can be formulated with lipids in the form of liposomes. Such formulations may be described in the art as lipoplexes. Compositions with lipids/liposomes can be used to aid in the delivery of nucleic acids of the invention to target cells. The lipid delivery systems described herein can be used as an alternative to binding ligands. When using the nucleic acids of the invention with a lipid delivery system or with a ligand conjugate delivery system, the modifications described herein may be present.

The lipid complex may comprise a lipid composition comprising: i) a cationic lipid or a pharmaceutically acceptable salt thereof; ii) a steroid; iii) a phospholipid ester; and/or iv) a pegylated lipid.

The cationic lipid may be an amine cationic lipid.

The cationic lipid may have the formula (XII): or a pharmaceutically acceptable salt thereof, wherein: X represents O, S or NH; ^R1 and ^R2 each independently represent a _C4 - _C22 straight or branched alkyl chain or a _C4 - _C22 straight or branched alkenyl chain having one or more double bonds, wherein the alkyl or alkenyl chain contains an intermediate ester, amide or disulfide bond as the case may be; when X represents S or NH, ^R3 and ^R4 each independently represent hydrogen, methyl, ethyl, monoamine or polyamine moiety, or ^R3 and ^R4 together form a heterocycle; when X represents O, ^R3 and ^R4 each independently represent hydrogen, methyl, ethyl, monoamine or polyamine moiety, or ^R3 and ^R4 together form a heterocycle, or ^R3 represents hydrogen and ^R4 represents C(NH)( _NH2 ).

The cationic lipid may have the formula (XIII): or their pharmaceutically acceptable salts.

The cationic lipid may have formula (XIV): or their pharmaceutically acceptable salts.

The content of the cationic lipid component may be about 55 mol% to about 65 mol% of the total lipid content of the composition. Specifically, the cationic lipid component is about 59 mol% of the total lipid content of the composition.

The composition may further comprise a steroid. The steroid may be cholesterol. The content of the steroid may be about 26 mol% to about 35 mol% of the total lipid content of the lipid composition. More specifically, the content of the steroid may be about 30 mol% of the total lipid content of the lipid composition.

The phospholipid ethanolamine phospholipid can be selected from the group consisting of: 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE), 1,2-dioleoyl- sn -glycero-3-phosphoethanolamine (DOPE), 1,2-distearyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dilauryl-sn-glycero-3-phosphoethanolamine (DLPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-dimaltoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dilinoleyl-sn-glycero-3-phosphoethanolamine (DPE), 1,2-diol-1-ol-1-ol-1-ol-1-ol-1-ol-1-ol-1-ol-1-ol-1-ol The phospholipids may be present in an amount of about 10 mol% of the total lipid content of the composition.

The pegylated lipid may be selected from the group consisting of 1,2-dimyristyl-sn-glycerol, methoxypolyethylene glycol (DMG-PEG) and C16-ceramide-PEG. The content of the pegylated lipid may be about 1 to 5 mol% of the total lipid content of the composition.

The content of the cationic lipid component in the composition may be about 55 mol% to about 65 mol% of the total lipid content of the lipid composition, preferably about 59 mol% of the total lipid content of the lipid composition.

The composition may have a molar ratio of components selected from the following i):ii):iii):iv): 55:34:10:1; 56:33:10:1; 57:32:10:1; 58:31:10:1; 59:30:10:1; 60:29:10:1; 61:28:10:1; 62:27:10:1; 63:26:10:1; 64:25:10:1; and 65:24:10:1.

The composition may comprise a cationic lipid having the following structure: Steroids with the following structure: Phospholipids having the following structure: phospholipid acylethanolamine and a PEGylated lipid having the following structure .

Neutral liposome compositions can be formed, for example, from dimyristoylphosphatidylcholine (DMPC) or dimyristoylphosphatidylcholine (DPPC). Anionic liposome compositions can be formed from dimyristoylphosphatidylglycerol, and anionic fusogenic liposomes can be formed from dioleoylphosphatidylethanolamine (DOPE). Another type of liposome composition is formed from phosphatidylcholine (PC) (such as soy PC and egg PC). Another type is formed from a mixture of phospholipids and/or phosphatidylcholine and/or cholesterol.

The positively charged synthetic cationic lipid N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that spontaneously interact with nucleic acids to form lipid-nucleic acid complexes that are capable of fusing with negatively charged lipids of the cell membrane of tissue culture cells. DOTMA analogs can also be used to form liposomes.

Derivatives and analogs of the lipids described herein can also be used to form liposomes.

Liposomes containing nucleic acids can be prepared by a variety of methods. In one example, the lipid component of the liposome is dissolved in a detergent so that micelles are formed from the lipid component. For example, the lipid component can be a zwitterionic lipid or a lipid conjugate. The detergent can have a high critical micelle concentration and can be non-ionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The nucleic acid preparation is then added to the micelles including the lipid component. The cationic groups on the lipid interact with the nucleic acid and condense around the nucleic acid to form liposomes. Following condensation, the detergent is removed, such as by dialysis, to produce a liposomal preparation of the nucleic acid.

If necessary, a carrier compound that aids condensation can be added during the condensation reaction, for example by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (such as spermine or spermidine). The pH can also be adjusted to promote condensation.

The nucleic acid formulation of the present invention may include a surfactant. In one embodiment, the nucleic acid formulation is an emulsion including a surfactant.

Non-ionized surfactants are non-ionic surfactants. Examples include non-ionic esters, such as ethylene glycol esters, propylene glycol esters, glycerol esters, etc.; non-ionic alkanolamides; and ethers, such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers.

Surfactants that carry a negative charge when dissolved or dispersed in water are anionic surfactants. Examples include carboxylates such as soaps; acyl lactylates; amides of amino acids; sulfates such as alkyl sulfates and ethoxylated alkyl sulfates; sulfonates such as alkyl benzenesulfonates, acyl hydroxyethylsulfonates, acyl taurates, and sulfosuccinates; and phosphates.

Surfactants that carry a positive charge when dissolved or dispersed in water are cationic surfactants. Examples include quaternary ammonium salts and ethoxylated amines.

Surfactants that have the ability to carry positive or negative charges are amphoteric surfactants. Examples include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phospholipids.

"Micelles" are defined herein as a specific type of molecular assembly in which amphiphilic molecules are arranged in a spherical structure such that all hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding water. If the environment is hydrophobic, the opposite arrangement exists. Micelles can be formed by mixing an aqueous solution of nucleic acids, an alkali metal alkyl sulfate, and at least one micelle-forming compound.

Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linolenic acid, linolenic acid, monoenal, monooleate, monolaurate, borage oil, evening primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerol, polyglycerol, lysine, polylysine, triolein, polyoxyethylene ethers and analogs thereof, polyether alcohol alkyl ethers and analogs thereof, deoxycholate, deoxycholate, and mixtures thereof.

Phenol and/or m-cresol may be added to the mixed micelle composition to act as a stabilizer and preservative. Isotonic agents such as glycerol may be added.

The nucleic acid formulation can be incorporated into particles such as microparticles. Microparticles can be produced by spray drying, freeze drying, evaporation, fluidized bed drying, vacuum drying, or a combination of these methods.

Definitions As used herein, the term "inhibit", "downregulate" or "reduce" relative to gene expression means that the expression of the gene, or the level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits (e.g., mRNA), or the activity of one or more proteins or protein subunits is reduced to below that observed in the absence of the nucleic acid or bound nucleic acid of the invention or compared to the results obtained using siRNA molecules with no known homology to human transcripts (referred to herein as non-silencing controls). Such controls can be combined and modified in a manner similar to the molecules of the invention and delivered to the target cells by the same pathway. Expression after treatment with the nucleic acids of the invention may be reduced to 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 15%, 10%, 5% or 0% or to an intermediate value, or below that observed in the absence of nucleic acid or in the presence of bound nucleic acid. Expression may be measured in cells to which the nucleic acid is applied. Alternatively, especially if the nucleic acid is administered to an individual, the levels may be measured in different cell groups or in tissues or organs or in body fluids such as blood or plasma. The level of inhibition is preferably measured under selected conditions because such conditions show the maximum effect of the nucleic acid on the target mRNA level in cells treated with nucleic acid in vitro. The level of inhibition can be measured, for example, after treatment with a nucleic acid at a concentration between 0.038 nM-10 μM, preferably 0.5 nM, 1 nM, 10 nM or 100 nM for 24 hours or 48 hours. These conditions may be different for different nucleic acid sequences or for different types of nucleic acids, such as for nucleic acids that are unmodified or modified or bound to a ligand or not. Examples of suitable conditions for determining the level of inhibition are described in the Examples.

Nucleic acid means a nucleic acid comprising two strands, which are capable of interfering with gene expression, the strands comprising nucleotides. The inhibition may be complete or partial and may cause downregulation of gene expression in a targeted manner. The nucleic acid comprises two separate polynucleotide strands; a first strand, which may also be a guide strand; and a second strand, which may also be a passenger strand. The first strand and the second strand may be part of the same polynucleotide molecule, which is self-complementary and can "fold" to form a double stranded molecule. The nucleic acid may be a siRNA molecule.

Nucleic acids may include ribonucleotides, modified ribonucleotides, deoxynucleotides, deoxyribonucleotides, or nucleotide analog non-nucleotides that can mimic nucleotides so that they can "pair" with corresponding bases based on a target sequence or on a complementary strand. Nucleic acids may further include a double-stranded nucleic acid portion or duplex region formed by all or a portion of a first strand (also referred to in this art as a leader strand) and all or a portion of a second strand (also referred to in this art as a following strand). A duplex region is defined as starting with the first base pair formed between the first strand and the second strand and ending with the last base pair formed between the first strand and the second strand (including the termini).

A duplex region means a region in two complementary or substantially complementary oligonucleotides that form base pairs with each other by Watson-Crick base pairing or any other means that allows a duplex between complementary or substantially complementary oligonucleotide strands. For example, an oligonucleotide strand having 21 nucleotide units can base pair with another oligonucleotide strand having 21 nucleotide units, with only 19 nucleotides on each strand being complementary or substantially complementary, such that the "duplex region" consists of 19 base pairs. The remaining base pairs may be present in the form of 5' and 3' overhangs, or in the form of a single-stranded region. Furthermore, within a duplex region, 100% complementation is not required; substantial complementation may be allowed within a duplex region. Substantially complementary refers to complementation between strands such that they are able to adhere under biological conditions. Techniques for empirically determining whether two strands can adhere under biological conditions are well known in the art. Alternatively, the two strands can be synthesized under biological conditions and added together to determine whether they adhere to each other. The portions of the first and second strands that form at least one double helical region can fully complement each other and at least partially complement each other. Depending on the length of the nucleic acid, a perfect match between the first and second strands in terms of base complementation is not necessarily required. However, the first and second strands must be able to hybridize under physiological conditions.

As used herein, the term "non-paired nucleotide analog" means a nucleotide analog including a non-alkaline pairing moiety, including but not limited to: 6-deaminoadenosine (Nebularine), 4-Me-indole, 3-nitropyrrole, 5-nitroindole, Ds, Pa, N3-Me ribose U, N3-Me ribose T, N3-Me dC, N3-Me-dT, N1-Me-dG, N1-Me-dA, N3-ethyl-dC and N3-Me dC. In some embodiments, the non-alkaline pairing nucleotide analog is a ribonucleotide. In other embodiments, it is a deoxyribonucleotide.

As used herein, the term "terminal functional group" includes, but is not limited to, halogen, alcohol, amine, carboxylic acid, ester, amide, aldehyde, ketone and ether groups.

As used herein, "overhang" has its normal and customary meaning in this art, namely, a single-stranded portion of a nucleic acid that extends beyond the terminal nucleotide of the complementary strand in a double-stranded nucleic acid. The term "blunt end" includes double-stranded nucleic acids in which both strands terminate at the same position, regardless of whether the terminal nucleotides are base-paired. The terminal nucleotides of the first and second strands at the blunt end may be base-paired. The terminal nucleotides of the first and second strands at the blunt end may be unpaired. The terminal two nucleotides of the first and second strands at the blunt end may be base-paired. The terminal two nucleotides of the first and second strands at the blunt end may be unpaired.

The term "seriamine-derived linker moiety" means a linker moiety comprising the following structure:

The O atom of the structure is typically attached to the RNA strand and the N atom is typically attached to the targeting ligand.

The terms "patient," "subject," and "individual" are used interchangeably and refer to humans or non-human animals. These terms include mammals, such as humans, primates, domestic animals (e.g., bovines, swine), companion animals (e.g., canines, felines), and rodents (e.g., mice and rats).

As used herein, "treating" or "treatment" and grammatical variations thereof refer to an approach for obtaining beneficial or desired clinical results. The term may refer to slowing the rate of onset or progression of a condition, disorder or disease, reducing or alleviating symptoms associated therewith, producing complete or partial regression of symptoms, or a combination of any of the above. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to: reduction or alleviation of symptoms, reduction in severity of disease, stabilization of disease conditions (i.e., not worsening), slowing or reduction in disease progression, improvement or alleviation of disease conditions, and relief (whether partial or complete), whether detectable or undetectable. "Treatment" may also mean prolonging survival relative to expected survival if not receiving treatment. Thus, an individual (e.g., a human) in need of treatment may be an individual already suffering from the disease or disorder in question. The term "treating" includes inhibiting or reducing the increase in severity of a pathological state or symptom compared to not receiving treatment, and is not necessarily meant to imply complete cessation of the relevant disease, disorder, or condition.

As used herein, the term "prevention" and its grammatical variants refer to a method for inhibiting or preventing the development, progression or frequency or rate of onset of a condition, disease or disorder, and may relate to pathological changes and/or symptoms. For the purposes of the present invention, beneficial or desired clinical results include, but are not limited to, preventing, inhibiting or slowing symptoms, progression or development of a disease, whether detectable or undetectable. Thus, an individual (e.g., a human) in need of prevention may be an individual who does not yet suffer from the disease or disorder in question. The term "prevention" includes slowing the onset of a disease compared to not undergoing treatment, and is not necessarily meant to imply permanent prevention of the relevant disease, disorder or condition. Thus, in certain instances, "prevention" of a condition refers to reducing the risk of developing the condition, or preventing, inhibiting or delaying the development of symptoms associated with the condition. It should be understood that prevention can be considered treatment or therapy.

As used herein, an "effective amount," "prophylactically effective amount," "therapeutically effective amount," or "effective dose" is an amount of a composition (e.g., a therapeutic composition or medicament) that produces at least one desired therapeutic effect in a subject, such as preventing or treating a target condition or beneficially alleviating symptoms associated with a condition.

As used herein, the term "pharmaceutically acceptable salt" refers to a salt that is not harmful to the patient or individual to whom the salt in question is administered. It can be, for example, a salt selected from acid addition salts and alkaline salts. Examples of acid addition salts include chloride salts, citrate salts and acetate salts. Examples of alkaline salts include salts in which the cation is selected from alkali metal cations, such as sodium or potassium ions; alkali earth metal cations, such as calcium or magnesium ions; and substituted ammonium ions, such as ions of the type N( ^R1 )( ^R2 )( ^R3 )( ^R4 ) ⁺ , where ^R1 , ^R2 , ^R3 and ^R4 will independently typically represent hydrogen, optionally substituted C1-6-alkyl or optionally substituted C2-6-alkenyl. Examples of relevant C1-6 alkyl include methyl, ethyl, 1-propyl and 2-propyl. Examples of C2-6 alkenyl that may be relevant include vinyl, 1-propenyl and 2-propenyl. Other examples of pharmaceutically acceptable salts are described in "Remington's Pharmaceutical Sciences", 17th edition, Alfonso R. Gennaro (ed.), Mark Publishing Company, Easton, PA, USA, 1985 (and updated editions); "Encyclopaedia of Pharmaceutical Technology", 3rd edition, James Swarbrick (ed.), Informa Healthcare USA (Inc.), NY, USA, 2007; and J. Pharm. Sci. 66: 2 (1977). "Pharmaceutically acceptable salts" qualitatively retain the desired biological activity of the parent compound without imparting any undesirable effects to the compound. Examples of pharmaceutically acceptable salts include acid addition salts and base addition salts. Acid addition salts include salts derived from non-toxic inorganic acids such as hydrochloric acid, nitric acid, phosphorous acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid and the like; or salts derived from non-toxic organic acids such as aliphatic monocarboxylic acids and aliphatic dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like. Base addition salts include salts derived from alkaline earth metals such as sodium, potassium, magnesium, calcium and the like; and salts derived from non-toxic organic amines such as N,N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine and the like.

The term "pharmaceutically acceptable carrier" includes any of the standard pharmaceutical carriers. Pharmaceutically acceptable carriers for therapeutic use are well known in the pharmaceutical art and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro, ed. 1985). For example, sterile saline and phosphate-buffered saline at slightly acidic or physiological pH can be used. Exemplary pH buffers include phosphates, citrates, acetates, tris(hydroxymethyl)aminomethane (TRIS), N-tris(hydroxymethyl)methyl-3-aminopropanesulfonic acid (TAPS), ammonium bicarbonate, diethanolamine, histidine (which is a preferred buffer), arginine, lysine or acetate or mixtures thereof. The term further encompasses any agent listed in the US Pharmacopeia for use in animals (including humans). "Pharmaceutically acceptable carriers" include any and all physiologically acceptable, i.e., compatible solvents, dispersion media, coatings, antimicrobial agents, isotonic agents and absorption delaying agents and the like. In certain embodiments, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Depending on the route of administration chosen, the nucleic acid may be coated in one or more materials designed to protect the compound from the action of acids and other natural inactivating conditions to which the nucleic acid may be exposed when administered to a subject via a particular route of administration.

In the context of the present invention, the term "solvoplex" refers to a defined stoichiometric complex formed between a solute (in this case, a nucleic acid compound according to the present invention or a pharmaceutically acceptable salt thereof) and a solvent. In this regard, the solvent may be, for example, water or another pharmaceutically acceptable (usually) small molecule organic species, such as, but not limited to, acetic acid or lactic acid. When the solvent is water, such a solvate is usually referred to as a hydrate.

The present invention will now be described with reference to the following non-limiting drawings and examples.

Examples Example 1 In vitro studies in Hep3B cells demonstrated the AGT knockdown efficacy of the tested siRNAs after transfection with 0.5 nM or 10 nM siRNA.

The AGT attenuation efficacy of siRNA EM2001-EM2200 (Table 5b) was determined after transfection of 0.5 or 10 nM siRNA in Hep3B cells. The results are depicted in Table 3 below. At 10 nM, the remaining AGT level after attenuation reached a minimum of 8%, and at 0.5 nM the remaining AGT level reached a minimum of 22%. At 10 nM, the most potent siRNAs were EM2115, EM2107, EM2032, EM2108, and EM2109.

To transfect Hep3B cells with siRNA, cells were seeded at 20,000 cells/well in 96-well tissue culture plates (TPP, catalog number 92096, Switzerland). Immediately before seeding, siRNA transfection was performed using Lipofectamine RNAiMax (Invitrogen/Life Technologies, catalog number 13778-500, Germany) according to the manufacturer's instructions. Double-dose screening was performed in triplicate using AGT-siRNA at 10 nM and 0.5 nM, with scrambled siRNA and siRNA targeting luciferase as nonspecific controls. After 24 hours (h) incubation with siRNA, the medium was removed and cells were lysed in 250 µL of lysis buffer (InviTrap RNA Cell HTS96 Kit/C (Stratec, Cat. No. 7061300400, Germany)) and subsequently frozen at -80°C. RNA was isolated using the InviTrap RNA Cell HTS96 Kit/C (Stratec, Cat. No. 7061300400, Germany). RT-qPCR was performed in a single-plex 384-well format on a QuantStudio6 apparatus from Applied Biosystems using AGT and PPIB specific primer probe sets and Takyon™ One-Step Low Rox Probe 5X MasterMix dTTP. Expression differences were calculated using the ΔΔCt method and the relative expression of AGT normalized to the housekeeping gene PPIB was determined. Results are presented as % of remaining AGT mRNA after siRNA transfection in Table 3. Table 3: Results of dual dose screening (10 nM and 0.5 nM) of siRNA targeting AGT . The identities of the single strands forming each of the siRNA duplexes as well as their sequences and modifications are found in Tables 5a and 5b. Double helix Remaining mRNA% at 10 nM Remaining mRNA% at 0.5 nM average value SD average value SD EM2001 44 7 100 11 EM2002 26 1 51 1 EM2003 twenty four 2 30 2 EM2004 33 5 81 1 EM2005 twenty three 3 49 3 EM2006 twenty four 4 62 7 EM2007 25 1 67 7 EM2008 35 3 67 9 EM2009 78 5 106 5 EM2010 twenty two 2 32 4 EM2011 46 2 101 6 EM2012 16 1 52 8 EM2013 twenty three 4 67 3 EM2014 29 2 78 7 EM2015 40 1 92 2 EM2016 38 2 82 5 EM2017 twenty three 1 61 2 EM2018 47 4 87 4 EM2019 73 2 94 2 EM2020 29 4 42 3 EM2021 42 7 91 10 EM2022 11 3 40 1 EM2023 12 1 29 7 EM2024 35 7 77 17 EM2025 twenty two 3 72 17 EM2026 twenty four 3 64 12 EM2027 14 2 41 5 EM2028 26 3 62 10 EM2029 64 5 68 5 EM2030 43 3 84 4 EM2031 twenty two 4 57 1 EM2032 9 0 48 4 EM2033 17 3 43 2 EM2034 twenty one 2 61 12 EM2035 48 6 80 12 EM2036 15 2 39 10 EM2037 11 0 43 11 EM2038 16 3 41 7 EM2039 34 1 79 2 EM2040 64 2 98 8 EM2041 50 4 98 10 EM2042 69 4 95 14 EM2043 twenty one 6 55 11 EM2044 19 2 40 10 EM2045 44 8 89 11 EM2046 64 6 87 6 EM2047 58 8 78 9 EM2048 twenty one 4 43 4 EM2049 62 3 85 4 EM2050 55 5 90 8 EM2051 26 5 91 7 EM2052 31 4 67 5 EM2053 twenty two 3 70 3 EM2054 twenty four 3 62 3 EM2055 40 5 68 8 EM2056 16 3 28 3 EM2057 17 1 26 1 EM2058 14 3 twenty two 1 EM2059 16 1 44 7 EM2060 56 3 99 2 EM2061 29 5 86 2 EM2062 27 6 69 14 EM2063 18 1 70 2 EM2064 41 2 88 7 EM2065 15 1 51 4 EM2066 twenty one 0 66 6 EM2067 42 4 85 10 EM2068 50 2 91 8 EM2069 11 1 35 8 EM2070 30 4 78 2 EM2071 twenty one 1 83 2 EM2072 61 4 100 6 EM2073 26 2 70 3 EM2074 95 16 95 6 EM2075 19 1 56 4 EM2076 54 2 79 10 EM2077 12 2 37 3 EM2078 26 2 85 15 EM2079 17 1 45 8 EM2080 14 3 32 3 EM2081 65 12 75 17 EM2082 32 4 72 18 EM2083 31 4 62 5 EM2084 18 3 41 9 EM2085 75 15 99 20 EM2086 18 5 42 10 EM2087 twenty four 3 52 5 EM2088 26 6 51 4 EM2089 36 10 57 0 EM2090 46 4 97 19 EM2091 25 4 55 0 EM2092 12 2 28 1 EM2093 17 3 41 8 EM2094 16 3 33 2 EM2095 20 3 52 7 EM2096 80 15 73 10 EM2097 12 2 38 7 EM2098 25 3 55 0 EM2099 37 3 70 2 EM2100 93 17 95 14 EM2101 twenty three 4 56 1 EM2102 31 2 62 8 EM2103 12 2 34 3 EM2104 10 3 42 10 EM2105 14 4 49 10 EM2106 twenty two 5 53 7 EM2107 8 2 28 0 EM2108 9 3 32 1 EM2109 9 3 79 1 EM2110 38 5 64 9 EM2111 11 0 46 5 EM2112 45 2 87 18 EM2113 10 1 36 3 EM2114 31 5 73 17 EM2115 8 2 35 7 EM2116 13 3 29 1 EM2117 45 2 96 25 EM2118 30 7 86 8 EM2119 10 2 45 9 EM2120 12 1 44 10 EM2121 20 3 50 5 EM2122 56 6 100 36 EM2123 11 2 40 11 EM2124 19 3 55 18 EM2125 19 5 82 twenty two EM2126 9 0 46 9 EM2127 14 2 50 10 EM2128 49 12 99 27 EM2129 twenty four 5 63 17 EM2130 16 1 59 14 EM2131 16 5 51 5 EM2132 32 6 90 15 EM2133 18 3 74 6 EM2134 31 7 80 3 EM2135 29 2 86 4 EM2136 16 3 58 5 EM2137 11 1 47 6 EM2138 18 3 76 15 EM2139 52 3 86 3 EM2140 19 1 41 10 EM2141 13 0 40 2 EM2142 18 2 63 12 EM2143 twenty three 4 69 3 EM2144 twenty two 2 69 13 EM2145 10 1 38 7 EM2146 17 4 76 32 EM2147 15 2 66 6 EM2148 10 1 49 14 EM2149 11 1 53 12 EM2150 106 2 92 4 EM2151 41 3 94 38 EM2152 63 3 83 18 EM2153 14 1 42 11 EM2154 14 3 30 11 EM2155 15 2 55 18 EM2156 9 1 47 8 EM2157 67 2 112 16 EM2158 19 2 40 14 EM2159 42 2 93 10 EM2160 26 2 82 19 EM2161 17 2 64 9 EM2162 20 1 74 12 EM2163 twenty one 2 53 11 EM2164 52 3 96 7 EM2165 39 3 75 4 EM2166 25 2 66 10 EM2167 62 5 73 2 EM2168 20 2 47 10 EM2169 25 4 57 9 EM2170 48 8 45 7 EM2171 twenty two 3 57 3 EM2172 14 3 42 8 EM2173 12 1 31 9 EM2174 45 2 83 9 EM2175 twenty two 2 59 2 EM2176 75 7 85 6 EM2177 26 1 69 6 EM2178 twenty one 2 50 4 EM2179 13 0 35 3 EM2180 twenty two 3 54 7 EM2181 54 6 105 13 EM2182 twenty one 2 66 5 EM2183 53 3 82 7 EM2184 89 4 82 6 EM2185 18 2 40 1 EM2186 15 1 37 3 EM2187 56 4 83 3 EM2188 14 2 twenty three 1 EM2189 11 1 38 4 EM2190 96 4 111 9 EM2191 102 12 104 9 EM2192 16 3 58 3 EM2193 16 2 40 1 EM2194 40 4 70 5 EM2195 44 3 100 8 EM2196 13 2 42 5 EM2197 twenty two 5 46 6 EM2198 20 1 56 2 EM2199 38 4 83 7 EM2200 37 1 100 9

Example 2 In vitro studies in Hep3B cells demonstrated the AGT attenuation efficacy of the tested siRNAs after transfection with 20, 4, 0.8, 0.16, 0.032 or 0.006 nM siRNA.

The AGT attenuation efficacy of selected siRNAs (Table 4 and Table 5b) was determined after transfection of 20, 4, 0.8, 0.16, 0.032 or 0.006 nM siRNA in Hep3B cells. The results are depicted in Table 4 below. At 20 nM, the remaining AGT level after attenuation reached a minimum of 5%, and at 4 nM reached a minimum of 7%. At 20 nM, the most potent siRNAs were EM2154, EM2168 and EM2092.

To transfect Hep3B cells with siRNA, cells were seeded at 20,000 cells/well in 96-well tissue culture plates (TPP, catalog number 92096, Switzerland). Immediately before seeding, siRNA transfection was performed using Lipofectamine RNAiMax (Invitrogen/Life Technologies, catalog number 13778-500, Germany) according to the manufacturer's instructions. Dose response screening was performed in triplicate with AGT siRNA at 20, 4, 0.8, 0.16, 0.032, or 0.006 nM, with scrambled siRNA and siRNA targeting luciferase as nonspecific controls. After 24 hours of incubation with siRNA, the medium was removed and cells were lysed in 250 µL of lysis buffer (InviTrap RNA Cell HTS96 Kit/C (Stratec, Cat. No. 7061300400, Germany)) and subsequently frozen at -80°C. RNA was isolated using the InviTrap RNA Cell HTS96 Kit/C (Stratec, Cat. No. 7061300400, Germany). RT-qPCR was performed in a single-plex 384-well format on a QuantStudio6 apparatus from Applied Biosystems using AGT and PPIB specific primer probe sets and Takyon™ One-Step Low Rox Probe 5X MasterMix dTTP. Expression differences were calculated using the ΔΔCt method and the relative expression of AGT normalized to the housekeeping gene PPIB was determined. Results are presented as % of remaining AGT mRNA after siRNA transfection in Table 4. Table 4: Results of dose response screening of siRNA targeting AGT (20, 4, 0.8, 0.16, 0.032 or 0.006 nM). The identities of the individual strands forming each of the siRNA duplexes as well as their sequences and modifications are found in Tables 5a and 5b. Double helix Concentration (nM) Remaining mRNA% average value SD EM2036 20 8 1 4 10 2 0.8 15 2 0.16 26 2 0.032 39 9 0.006 55 6 EM2119 20 11 1 4 13 2 0.8 18 2 0.16 34 1 0.032 41 5 0.006 64 5 EM2113 20 11 2 4 13 2 0.8 17 2 0.16 35 7 0.032 39 15 0.006 67 12 EM2077 20 7 1 4 11 1 0.8 17 2 0.16 twenty four 2 0.032 40 3 0.006 61 10 EM2108 20 9 2 4 9 2 0.8 14 5 0.16 twenty three 7 0.032 38 9 0.006 59 10 EM2069 20 8 3 4 9 2 0.8 13 6 0.16 19 5 0.032 39 3 0.006 68 7 EM2103 20 12 3 4 11 1 0.8 18 8 0.16 25 6 0.032 49 12 0.006 74 7 EM2188 20 7 0 4 8 2 0.8 13 4 0.16 20 6 0.032 34 6 0.006 57 4 EM2057 20 9 1 4 11 1 0.8 11 3 0.16 twenty one 3 0.032 28 7 0.006 50 3 EM2168 20 6 2 4 8 2 0.8 11 2 0.16 twenty two 7 0.032 29 10 0.006 53 13 EM2158 20 7 1 4 10 2 0.8 13 4 0.16 twenty three 9 0.032 35 10 0.006 56 13 EM2065 20 7 0 4 10 0 0.8 20 9 0.16 34 10 0.032 54 14 0.006 69 16 EM2126 20 7 2 4 8 0 0.8 18 5 0.16 30 7 0.032 47 8 0.006 51 12 EM2154 20 5 0 4 7 2 0.8 12 1 0.16 20 4 0.032 28 6 0.006 44 11 EM2092 20 6 0 4 7 0 0.8 16 3 0.16 31 3 0.032 38 13 0.006 70 10 EM2027 20 9 3 4 9 0 0.8 15 1 0.16 26 12 0.032 40 12 0.006 57 12 EM2037 20 7 3 4 9 1 0.8 14 0 0.16 30 9 0.032 36 9 0.006 64 15 EM2095 20 11 5 4 14 2 0.8 28 5 0.16 51 8 0.032 72 9 0.006 79 17 EM2189 20 8 1 4 8 1 0.8 12 1 0.16 27 3 0.032 49 7 0.006 75 6 EM2153 20 9 3 4 10 1 0.8 12 3 0.16 25 4 0.032 51 3 0.006 68 2 EM2032 20 8 2 4 9 1 0.8 15 5 0.16 twenty three 3 0.032 47 13 0.006 70 5 EM2059 20 10 2 4 12 3 0.8 14 6 0.16 twenty three 7 0.032 43 11 0.006 65 6 EM2058 20 7 2 4 9 2 0.8 11 3 0.16 20 5 0.032 36 11 0.006 62 3 EM2025 20 14 6 4 13 1 0.8 28 8 0.16 48 9 0.032 72 8 0.006 97 5 EM2023 20 8 3 4 11 3 0.8 11 3 0.16 28 5 0.032 44 4 0.006 70 5 EM2145 20 8 1 4 10 2 0.8 14 3 0.16 27 5 0.032 37 7 0.006 62 7 EM2107 20 9 3 4 9 2 0.8 13 3 0.16 twenty four 2 0.032 50 7 0.006 69 9

Example 3 In vitro studies in primary cynomolgus macaque hepatocytes demonstrated the AGT attenuation efficacy of the tested GalNAc-siRNA conjugates.

After incubation with 100 nM, 10 nM, 1 nM, 0.1 nM and 0.01 nM of GalNAc-siRNA conjugates EM2201, EM2202, EM2203, EM2204, EM2205, EM2205, EM2206, EM2207, EM2208, EM2209, EM2210 or EM2211 (further described in Table 5c), the expression of AGT mRNA was assessed. The mRNA level of the housekeeping gene PPIB served as a control.

To test the attenuation efficacy of GalNAc-conjugated siRNA targeting AGT in primary cynomolgus macaque hepatocytes, 45,000 cells/well (supplier: Life Technologies) were added to siRNA in plate medium (Life Technologies) in collagen-coated 96-well plates (Life Technologies) to a final concentration between 100 nM and 0.01 nM. 24 h after treatment, cells were lysed using the InviTrap RNA Cell HTS96 Kit/C (Stratec). RT-qPCR was performed using mRNA-specific primers and probes for AGT and PPIB . Expression differences were calculated using the ΔΔCt method, and the relative expression of AGT normalized to the housekeeping gene PPIB was determined. The results are expressed as the ratio of AGT and PPIB mRNA relative to untreated levels and can be seen in FIG1 .

Dose-dependent reduction of AGT mRNA was observed for the nine GalNAc conjugates tested. At 100 nM, the remaining AGT content after reduction ranged from 3% to 85%. The strongest reduction at 100 nM was observed for EM2203, EM2204, EM2207, and EM2209, with remaining AGT content of 7%, 7%, 3%, and 5%, respectively.

Results are expressed as the remaining AGT mRNA % after siRNA transfection in Table 8. Table 8: Results of dose response screening (100, 10, 1, 0.1 or 0.01 nM) of siRNA targeting AGT in primary cynomolgus monkey hepatocytes. Double helix Concentration (nM) Remaining mRNA% average value SD EM2201 100 14 1 10 twenty four 2 1 64 1 0.1 92 0 0.01 92 2 EM2202 100 39 6 10 62 2 1 85 8 0.1 98 6 0.01 109 10 EM2203 100 7 0 10 14 1 1 36 2 0.1 74 5 0.01 99 1 EM2204 100 7 1 10 17 1 1 48 2 0.1 85 3 0.01 101 8 EM2205 100 5 0 10 12 1 1 39 4 0.1 76 8 0.01 108 8 EM2206 100 10 1 10 19 4 1 41 1 0.1 93 10 0.01 94 3 EM2207 100 3 0 10 5 0 1 16 1 0.1 50 2 0.01 89 15 EM2208 100 60 2 10 74 6 1 75 14 0.1 94 10 0.01 99 12 EM2209 100 5 1 10 9 2 1 twenty one 3 0.1 64 6 0.01 98 14 EM2210 100 28 4 10 42 3 1 70 1 0.1 86 9 0.01 98 5 EM2211 100 85 7 10 91 3 1 84 4 0.1 92 5 0.01 108 7

Example 4 In vitro studies in primary cynomolgus macaque hepatocytes demonstrated the AGT attenuation efficacy of the tested GalNAc-siRNA conjugates.

After incubation with 100 nM, 10 nM, 1 nM, 0.1 nM and 0.01 nM of GalNAc-siRNA conjugates EM2212, EM2213, EM2214, EM2215, EM2206, EM2216, EM2217, EM2218, EM2207, EM2219, EM2220, M2221, EM2222, EM2223, EM2224, EM2225, EM2226, EM2227 or EM2228 (further described in Table 5c), the expression of AGT mRNA was assessed. The mRNA level of the housekeeping gene PPIB served as a control.

To test the attenuation efficacy of GalNAc-conjugated siRNA targeting AGT in primary cynomolgus macaque hepatocytes, 45,000 cells/well (supplier: Life Technologies) were added to siRNA in plate medium (Life Technologies) in collagen-coated 96-well plates (Life Technologies) to a final concentration between 100 nM and 0.01 nM. 24 h after treatment, cells were lysed using the InviTrap RNA Cell HTS96 Kit/C (Stratec). RT-qPCR was performed using mRNA-specific primers and probes for AGT and PPIB . Expression differences were calculated using the ΔΔCt method, and the relative expression of AGT normalized to the housekeeping gene PPIB was determined. The results are expressed as the ratio of AGT and PPIB mRNA relative to the untreated levels and can be seen in FIG2 .

Dose-dependent reduction of AGT mRNA was observed for all GalNAc conjugates tested. At 100 nM, the remaining AGT levels after reduction ranged from 2% to 16%. The strongest reduction was observed for EM2207, EM2219, and EM2227 at 100 nM, with a remaining AGT level of 2%.

Results are expressed as the remaining AGT mRNA % after siRNA transfection in Table 9. Table 9: Results of dose response screening (100, 10, 1, 0.1 or 0.01 nM) of siRNA targeting AGT in primary cynomolgus monkey hepatocytes. Double helix Concentration (nM) Remaining mRNA% average value SD EM2212 100 3 0 10 4 0 1 10 1 0.1 43 3 0.01 85 12 EM2213 100 4 1 10 5 0 1 11 0 0.1 52 4 0.01 78 8 EM2214 100 6 0 10 7 1 1 twenty two 2 0.1 63 7 0.01 100 2 EM2215 100 13 2 10 19 3 1 56 2 0.1 97 14 0.01 96 13 EM2206 100 5 0 10 11 1 1 38 3 0.1 72 3 0.01 106 28 EM2216 100 5 1 10 8 0 1 26 5 0.1 72 7 0.01 92 4 EM2217 100 5 0 10 9 0 1 34 4 0.1 77 4 0.01 95 4 EM2218 100 26 0 10 38 4 1 61 0 0.1 83 9 0.01 89 14 EM2207 100 2 1 10 4 3 1 15 12 0.1 45 19 0.01 74 6 EM2219 100 2 1 10 5 3 1 16 14 0.1 51 twenty one 0.01 81 2 EM2220 100 3 1 10 6 5 1 twenty three 17 0.1 64 twenty three 0.01 82 9 EM2221 100 16 1 10 28 4 1 68 9 0.1 80 10 0.01 98 7 EM2222 100 3 0 10 5 1 1 18 1 0.1 55 9 0.01 78 1 EM2223 100 5 0 10 8 0 1 26 2 0.1 63 7 0.01 85 4 EM2224 100 3 0 10 6 1 1 20 1 0.1 62 8 0.01 88 10 EM2225 100 6 0 10 11 1 1 27 4 0.1 69 4 0.01 86 7 EM2226 100 5 0 10 12 2 1 34 2 0.1 70 4 0.01 81 4 EM2227 100 2 0 10 5 0 1 19 2 0.1 57 9 0.01 83 8 EM2228 100 3 0 10 6 1 1 twenty one 1 0.1 68 7 0.01 106 19

Example 5 Primary in vitro studies in human hepatocytes demonstrated the AGT attenuation efficacy of the tested GalNAc-siRNA conjugates.

After incubation with 100 nM, 20 nM, 4 nM, 0.8 nM and 0.16 nM of GalNAc-siRNA conjugates EM2201, EM2202, EM2203, EM2204, EM2205, EM2205, EM2206, EM2207, EM2208, EM2209, EM2210 or EM2211 (further described in Table 5c), the expression of AGT mRNA was assessed. The mRNA level of the housekeeping gene PPIB served as a control.

To test the attenuation efficacy of GalNAc-conjugated siRNA targeting AGT in primary human hepatocytes, 35,000 cells/well (supplier: Primacyt Cell Culture Technology) were added to siRNA in plate medium (Life Technologies) in collagen-coated 96-well plates (Life Technologies) to a final concentration between 100 nM and 0.16 nM. 24 h after treatment, cells were lysed using the InviTrap RNA Cell HTS96 Kit/C (Stratec). RT-qPCR was performed using mRNA-specific primers and probes for AGT and PPIB . Expression differences were calculated using the ΔΔCt method, and the relative expression of AGT was normalized to that of the housekeeping gene PPIB . The results are expressed as the ratio of AGT and PPIB mRNA relative to the untreated levels and can be seen in FIG3 .

Dose-dependent reduction of AGT mRNA was observed for nine of the GalNAc conjugates tested. At 100 nM, the remaining AGT levels after reduction ranged from 14% to 49%. The strongest reductions at 100 nM were observed for EM2203, EM2204, EM2207, and EM2209, with remaining AGT levels of 17%, 18%, 14%, and 16%, respectively.

Results are expressed as the remaining AGT mRNA % after siRNA transfection in Table 10. Table 10: Results of dose response screening (100, 20, 4, 0.8 or 0.16 nM) of siRNA targeting AGT in primary human hepatocytes. Double helix Concentration (nM) Remaining mRNA% average value SD EM2201 100 28 4 20 44 3 4 60 10 0.8 81 11 0.16 110 6 EM2202 100 51 7 20 62 8 4 87 5 0.8 94 19 0.16 103 14 EM2203 100 17 2 20 28 4 4 52 11 0.8 65 2 0.16 83 7 EM2204 100 18 2 20 27 9 4 50 4 0.8 55 13 0.16 89 8 EM2205 100 twenty one 1 20 28 1 4 51 6 0.8 67 2 0.16 96 5 EM2206 100 twenty two 1 20 39 1 4 55 3 0.8 74 6 0.16 101 6 EM2207 100 14 1 20 19 3 4 37 6 0.8 50 3 0.16 80 4 EM2208 100 77 8 20 78 8 4 92 3 0.8 77 3 0.16 108 12 EM2209 100 16 2 20 twenty three 3 4 41 5 0.8 56 6 0.16 88 43 EM2210 100 49 1 20 62 8 4 76 3 0.8 89 8 0.16 119 7 EM2211 100 93 7 20 105 13 4 93 2 0.8 90 13 0.16 109 16

Example 6 Primary in vitro studies in human hepatocytes demonstrated the AGT attenuation efficacy of the tested GalNAc-siRNA conjugates.

After incubation with 100 nM, 20 nM, 4 nM, 0.8 nM and 0.16 nM of GalNAc-siRNA conjugates EM2212, EM2213, EM2214, EM2215, EM2206, EM2216, EM2217, EM2218, EM2207, EM2219, EM2220, M2221, EM2222, EM2223, EM2224, EM2225, EM2226, EM2227 or EM2228 (further described in Table 5c), the expression of AGT mRNA was assessed. The mRNA level of the housekeeping gene PPIB served as a control.

To test the attenuation efficacy of GalNAc-conjugated siRNA targeting AGT in primary human hepatocytes, 35,000 cells/well (supplier: Primacyt Cell Culture Technology) were added to siRNA in plate medium (Life Technologies) in collagen-coated 96-well plates (Life Technologies) to a final concentration between 100 nM and 0.16 nM. 24 h after treatment, cells were lysed using the InviTrap RNA Cell HTS96 Kit/C (Stratec). RT-qPCR was performed using mRNA-specific primers and probes for AGT and PPIB . Expression differences were calculated using the ΔΔCt method, and the relative expression of AGT was normalized to that of the housekeeping gene PPIB . The results are expressed as the ratio of AGT and PPIB mRNA relative to the untreated levels and can be seen in FIG4 .

Dose-dependent reduction of AGT mRNA was observed for all GalNAc conjugates tested. At 100 nM, the remaining AGT levels after reduction ranged from 5% to 26%. The strongest reduction was observed for EM2212, EM2220, EM2227, and EM2228 at 100 nM, with remaining AGT levels of 5%, 6%, 6%, and 7%, respectively.

Results are expressed as the remaining AGT mRNA % after siRNA transfection in Table 11. Table 11: Results of dose response screening (100, 20, 4, 0.8 or 0.16 nM) of siRNA targeting AGT in primary human hepatocytes. Double helix Concentration (nM) Remaining mRNA% average value SD EM2212 100 5 1 20 5 1 4 9 1 0.8 twenty four 1 0.16 44 2 EM2213 100 8 1 20 8 1 4 14 2 0.8 32 8 0.16 45 5 EM2214 100 9 1 20 10 1 4 19 1 0.8 33 3 0.16 52 2 EM2215 100 twenty two 1 20 30 4 4 48 6 0.8 71 5 0.16 86 5 EM2206 100 10 2 20 16 4 4 32 2 0.8 53 6 0.16 74 8 EM2216 100 9 1 20 16 2 4 27 4 0.8 46 3 0.16 70 3 EM2217 100 9 2 20 15 2 4 26 4 0.8 49 6 0.16 63 10 EM2218 100 26 1 20 39 2 4 55 1 0.8 77 6 0.16 81 8 EM2207 100 7 2 20 9 1 4 16 3 0.8 33 5 0.16 53 11 EM2219 100 7 0 20 10 2 4 16 3 0.8 37 5 0.16 62 5 EM2220 100 6 1 20 12 1 4 28 5 0.8 43 1 0.16 60 12 EM2221 100 twenty two 1 20 30 1 4 52 8 0.8 67 6 0.16 90 1 EM2222 100 11 1 20 17 2 4 29 4 0.8 47 7 0.16 70 8 EM2223 100 14 0 20 twenty three 3 4 36 5 0.8 60 6 0.16 89 6 EM2224 100 11 1 20 19 3 4 36 2 0.8 57 7 0.16 65 5 EM2225 100 10 0 20 13 3 4 28 2 0.8 47 3 0.16 64 3 EM2226 100 11 1 20 twenty one 5 4 33 4 0.8 61 2 0.16 75 5 EM2227 100 6 1 20 9 1 4 twenty three 1 0.8 41 2 0.16 57 3 EM2228 100 7 2 20 15 1 4 29 4 0.8 48 3 0.16 59 8

Example 7 In vivo studies demonstrated attenuation of human AGT mRNA in mouse liver tissue and human AGT serum protein following AAV-mediated expression and a single subcutaneous administration of 1 or 5 mg/kg GalNAc-conjugated siRNA.

Recombinant AAV particles were purchased from VectorBuilder (Chicago, USA). Briefly, the sequence encoding human AGT including the adjacent UTR region (NM_001384479.1) was cloned into the pAAV[Exp] vector downstream of the apoE/hAAT promoter. Serotype 8 AAV was packaged in HEK293T cells and purified by PEG precipitation and CsCl gradient ultracentrifugation.

Animal experiments were performed at Experimental Pharmacology & Oncology Berlin-Buch GmbH (Berlin, Germany) according to the guidelines of the German Protection of Animals Act (July 2013 edition). AAV was diluted to 4E11 GC/ml in phosphate-buffered saline (PBS) and injected intravenously into male C57BL/6 mice aged 8-10 weeks. All animals were dosed at 2E12 GC/kg. As determined in previous experiments, stable expression of human AGT was observed two weeks after injection.

Two weeks after AAV administration, mice were treated with GalNAc-siRNA conjugates EM2203, EM2204, EM2206, EM2207, or EM2209 (further described in Table 5c). Mice were randomly divided into 5 groups and received a single subcutaneous dose of 1 or 5 mg/kg siRNA dissolved in PBS or PBS alone as a control. The viability, weight, and behavior of the mice were monitored during the study, and no pathological findings were observed.

Serum samples were collected 2 weeks after siRNA administration and analyzed by ELISA using the Human Total Proangiotensin Assay Kit (IBL, Minneapolis, USA) (Figure 5). Briefly, samples were diluted 1:5000 in EIA buffer and further processed according to the manufacturer's protocol. The absorbance values were determined using a plate SpectraMAX plate reader (Molecular Devices, San Jose, USA) and the total AGT content was calculated using a standard curve ranging from 0.31-20 ng/ml. At 5 mg/kg, the remaining hAGT protein content after attenuation ranged from 8% to 28%. The strongest protein attenuation at 5 mg/kg was observed for EM2207 and EM2209, with 9% and 8% remaining protein, respectively.

The study was terminated 2 weeks after siRNA administration. All animals were euthanized, and liver samples were snap-frozen and stored at -80°C until further analysis. In brief, total RNA was isolated using the InviTrap Spin Tissue RNA Mini Kit (Invitek Molecular, Berlin, Germany) according to the manufacturer's recommendations. To assess the integrity of the isolated RNA, automated electrophoresis was performed using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, USA). 100 ng of total RNA per reaction was used for RT-qPCR with the amplicon group specific for human AGT and mouse ApoB as a housekeeping gene. The ∆∆Ct method was used to calculate expression differences, and the relative expression of hAGT versus ApoB normalized with the PBS group was used to compare different siRNAs (Figure 6). At 5 mg/kg, the remaining hAGT mRNA levels after attenuation ranged from 1% to 20%. The strongest attenuation was observed for EM2207 and EM2209 at 5 mg/kg, with the remaining hAGT levels being 1%.

Example 8 In vivo studies demonstrated attenuation of human AGT mRNA in mouse liver tissue and human AGT serum protein following AAV-mediated expression and a single subcutaneous administration of 1 or 5 mg/kg GalNAc-conjugated siRNA.

Recombinant AAV particles were purchased from VectorBuilder (Chicago, USA). Briefly, the sequence encoding human AGT including the adjacent UTR region (NM_001384479.1) was cloned into the pAAV[Exp] vector downstream of the apoE/hAAT promoter. Serotype 8 AAV was packaged in HEK293T cells and purified by PEG precipitation and CsCl gradient ultracentrifugation.

Animal experiments were performed at Experimental Pharmacology & Oncology Berlin-Buch GmbH (Berlin, Germany) according to the guidelines of the German Protection of Animals Act (July 2013 edition). AAV was diluted to 4E11 GC/ml in phosphate-buffered saline (PBS) and injected intravenously into male C57BL/6 mice aged 8-10 weeks. All animals were dosed at 2E12 GC/kg. As determined in previous experiments, stable expression of human AGT was observed two weeks after injection.

Two weeks after AAV administration, mice were treated with GalNAc-siRNA conjugates EM2207 EM2212, EM2214, EM2227, EM2217, EM2220, or EM2228 (further described in Table 5c). Mice were randomly divided into 5 groups and received a single subcutaneous dose of 1 or 5 mg/kg siRNA dissolved in PBS or PBS alone as a control. The viability, weight, and behavior of the mice were monitored during the study, and no pathological findings were observed.

Serum samples were collected 2 weeks after siRNA administration and analyzed by ELISA using the Human Total Proangiotensin Assay Kit (IBL, Minneapolis, USA) (Figure 7). Briefly, samples were diluted 1:5000 in EIA buffer and further processed according to the manufacturer's protocol. The absorbance values were determined using a plate SpectraMAX plate reader (Molecular Devices, San Jose, USA) and the total AGT content was calculated using a standard curve ranging from 0.31-20 ng/ml. At 5 mg/kg, the remaining hAGT protein content after attenuation ranged from 0.9% to 12%. The strongest protein reduction was observed at 5 mg/kg for EM2212, EM2214, EM2227, and EM2220, with the remaining hAGT protein ranging from 0.9% to 1.6%.

The study was terminated 2 weeks after siRNA administration. All animals were euthanized and liver samples were snap frozen and stored at -80°C until further analysis. In brief, total RNA was isolated using the InviTrap Spin Tissue RNA Mini Kit (Invitek Molecular, Berlin, Germany) according to the manufacturer's recommendations. To assess the integrity of the isolated RNA, automated electrophoresis was performed using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, USA). 100 ng of total RNA per reaction was used for RT-qPCR with the amplicon group specific for human AGT and mouse ApoB as a housekeeping gene. The ∆∆Ct method was used to calculate the expression difference, and the relative expression of hAGT versus ApoB normalized with the PBS group was used to compare the different siRNAs (Figure 8). At 5 mg/kg, the remaining hAGT mRNA levels after attenuation ranged from 1% to 28%. The strongest attenuation was observed for EM2212, EM2214, and EM2220 at 5 mg/kg, with remaining hAGT mRNA at 2%, 3%, and 1%, respectively.

Example 9 The synthesis of (vp)-mU-phos was carried out as described in Prakash, Nucleic Acids Res. 2015, 43(6), 2993-3011 and Haraszti, Nucleic Acids Res. 2017, 45(13), 7581-7592. The synthesis of phosphoramidite derivatives of ST41 (ST41-phos) and ST23 (ST23-phos) can be carried out as described in WO2017/174657. The synthesis of thiophosphoamidites was carried out as described in Caruthers, J. Org. Chem. 1996, 61, 4272-4281.

Example 10 Example compounds were synthesized according to methods described below and known to those skilled in the art. Assembly of the oligonucleotide chain and linker building blocks was performed by solid phase synthesis using the phosphoamidate method.

Downstream cleavage, deprotection and purification follow standard procedures well known in the art.

Oligonucleotide synthesis was performed on an AKTA oligopilot 10 using commercially available 2'O-methyl RNA and 2'fluoro-2'deoxy RNA base-loaded CPG solid supports and phosphoamidates (all standard protections, ChemGenes, LinkTech).

Auxiliary reagents were purchased from EMP Biotech and Biosolve. Synthesis was performed using 0.1 M phosphoamido solutions in anhydrous acetonitrile (<20 ppm H ₂ O) and phenylmethylthiotetrazolium (BTT) was used as activator (0.3 M in acetonitrile). Coupling time was 10 min. If thiophosphoamido was used to introduce phosphorodithioate linkages (PS2), repeated coupling wash cycles were performed for 60 min. Cap/OX/Cap or Cap/Thio/Cap cycles were applied (Cap: Ac ₂ O/NMI/lutidine/acetonitrile, oxidant: 0.05 M I ₂ in pyridine/H ₂ O). Phosphorothioates and phosphorodithioates were introduced using the commercial thiolation reagent 50 mM EDITH in acetonitrile (Link technologies). DMT cleavage was achieved by treatment with 3% dichloroacetic acid in toluene. At the end of the programmed synthesis cycle, a diethylamine (DEA) wash was performed. All oligonucleotides were synthesized in DMT-off mode.

The triantennary GalNAc cluster (ST23/ST41) was introduced by sequential coupling of a branching trebler amidite derivative (C4XLT-phos) followed by a GalNAc amidite (ST23-phos). The attachment of the (vp)-mU moiety was achieved by using (vp)-mU-phos in the last synthetic cycle. (vp)-mU-phos does not provide a hydroxyl group suitable for further synthetic extension and therefore does not have a DMT-group. Coupling of (vp)-mU-phos therefore terminates the synthesis.

To remove the methyl ester masking the vinylphosphonate, the CPG with fully assembled oligonucleotides was dried under reduced pressure and transferred to a 20 ml PP syringe reactor for solid phase peptide synthesis equipped with a glass slide (Carl Roth GmbH). The CPG was then contacted with a solution of 250 µL TMSBr and 177 µL pyridine in CH ₂ Cl ₂ (0.5 ml/µmol solid support bound oligonucleotide) at room temperature and the reactor was sealed with a Luer cap. The reaction vessel was slightly agitated during 2×15 min periods, excess reagent was discarded, and residual CPG was washed twice with 10 ml acetonitrile. Other downstream treatments did not change any of the other example compounds.

The single strands were cleaved from the CPG by treatment with 40% aqueous methylamine (in the presence of 20 mM DTT if dithiophosphate bonds were present) at room temperature for 90 minutes. The resulting crude oligonucleotides were purified by ion exchange chromatography (Resource Q, 6 ml GE Healthcare) on an AKTA Pure HPLC system using a sodium chloride gradient. The fractions containing the product were pooled, desalted on a size exclusion column (Zetadex, EMP Biotech), and lyophilized until further use.

All final single products were analyzed by AEX-HPLC to confirm their purity. The identity of each single product was confirmed by LC-MS analysis.

Example 11 The individual strands were dissolved in H ₂ O at a concentration of 60 OD/ml. The two individual oligonucleotide solutions were added together in a reaction vessel. For easier reaction monitoring, titration was performed. The first strand was added in 25% excess compared to the second strand as determined by UV absorption at 260 nm. The reaction mixture was heated to 80°C for 5 minutes and then slowly cooled to room temperature. The formation of the double strand was monitored by ion pairing reverse phase HPLC. The required amount of the second strand was calculated from the UV area of the residual strand and added to the reaction mixture. The reactants were heated to 80°C again and slowly cooled to room temperature. This procedure was repeated until less than 10% of the residual strand was detected.

Example 12 In vitro studies of primary human hepatocytes identified differentially expressed genes after treatment with GalNAc-siRNA conjugates.

Differentially expressed genes (DEGs) were assessed in primary human hepatocytes using RNA sequencing (NovaSeq PE150) after 24 h incubation with 100 nM of GalNAc-siRNA conjugates EM2214, EM2206, EM2217, EM2207, EM2220, EM2227, and EM2228 and compared to untreated controls.

GalNAc-conjugated siRNA targeting AGT was added to primary human hepatocytes in plating medium (Life Technologies) in collagen-coated 6-well plates (Life Technologies) at 900,000 cells/well (Life Technologies) for a final concentration of 100 nM. 20 hours after treatment, the medium was changed to maintenance medium (Life Technologies). Four hours later, cells were lysed using the NucleoSpin RNA kit (Macherey-Nagel). After confirming AGT mRNA attenuation by RT-qPCR, DEGs were identified based on gene expression data generated by RNA sequencing using the DESeq2 R package and plotted as a volcano plot depicting statistical significance (p _adj ≤ 0.05) versus the magnitude of expression change relative to untreated controls (fold change ≤ 0.5 = ≥ 50% attenuation) (Figure 9).

Table 6 depicts significant fold changes in mRNA expression relative to untreated controls (fold change ≤ 0.5, p _adj ≤ 0.05) and the mean base reads representing the overall expression of the target in the samples.

Table 6. Differentially expressed genes identified in human primary hepatocytes incubated for 24 hours with 100 nM of EM2214, EM2206, EM2217, EM2207, EM2220, EM2227, or EM2228. Those marked with an asterisk are pseudogenes or RNA genes considered irrelevant for the prediction of potential off-target effects. EM2214 EM2206 EM2217 Gene Change multiple Base average Gene Change multiple Base average Gene Change multiple Base average AGT 0.13 12978.86 MT-TI* 0.13 34.91 MT-TI* 0.11 36.8 MT-TI* 0.14 32.71 AGT 0.26 15688.06 AGT 0.2 16091.06 S100A4 0.38 38.86 AL450124.1* 0.36 41.06 EIF3CL 0.3 243.39 LINC01612* 0.4 21.54 CRSP8P* 0.39 22.63 RPL35P5* 0.43 35.89 BAALC-AS1* 0.42 25.98 AP000695.1* 0.41 41.74 C1DP1 0.45 35.37 AC100800.1* 0.45 24.73 RPL35P5* 0.44 33.72 AC016596.1* 0.47 73.69 SERF1B 0.47 41.15 PTMAP2* 0.49 34.64 MT-TS2* 0.49 116.51 MT-TS2* 0.49 99.75 RPL35P1* 0.49 69.82 AL450124.1* 0.49 48.44 PNMA6B* 0.5 49.2 EM2207 EM2220 EM2227 Gene Change multiple Base average Gene Change multiple Base average Gene Change multiple Base average AGT 0.1 14004.6 MT-TI* 0.12 34.93 AGT 0.16 14786.3 MT-TI* 0.11 35.1 AGT 0.15 14488.75 FP236383.1* 0.12 10 MT-TD* 0.16 11.23 EM2228 EIF3CL 0.28 227.1 AC090164.4* 0.24 10.99 Gene Change multiple Base average COMMD9 0.35 986.3 SLC4A1APP1* 0.29 13.85 AGT 0.19 14747.14 MTND4P12* 0.35 14 URI1 0.33 1984.34 TTC1 0.27 1788.77 URI1 0.36 2055 MTND4P12* 0.33 13.64 LINC00864* 0.36 13.4 COMMD9 0.33 965.35 RPS26P3* 0.37 16.4 LINC01612* 0.38 23.29 AP004609.3* 0.4 17.9 HBA2 0.39 23.36 SRP9P1* 0.42 22.4 CCDC58P3* 0.4 20.67 PTMAP2* 0.42 33.8 ERVMER34-1 0.4 20.94 RPL12P4* 0.46 39 EIF3C 0.43 765.14 AC016596.1* 0.46 69.9 PTMAP2* 0.44 33.77 XPOTP1* 0.48 25.7 LOX 0.48 34.67 AL590867.2* 0.5 141.2 AC016596.1* 0.48 69.6 SH3BGR 0.49 28.55

EM2227 showed no additional (other than AGT ) DEGs in hepatocytes (cutoff: fold change ≤ 0.5, p _adj ≤ 0.05). Cells treated with EM2228 showed downregulation of a single gene: Tetratricopeptide Repeat Domain 1 ( TTC1 ). The encoded protein plays a role in protein-protein interactions and binds to the Gα subunit of GPCRs to activate the Ras signaling pathway. However, downregulated TTC1 expression, especially in the liver, is not expected to cause major safety issues. For EM2207, in addition to a single tRNA (the RNA sequencing method used only measures mRNA and is not suitable for detecting tRNA genes, so it is considered an artifact) and several pseudogenes (DNA segments that are structurally similar to genes but cannot encode proteins), three genes, COMMD9 , URI1 and EIF3CL, showed reduced expression in the liver. Literature analysis revealed that mice carrying constitutive heterozygous knockout of the COMM Domain Containing 9 ( COMMD9 ) gene showed several phenotypes related to metabolic and blood parameters, however, the liver-specific attenuation may not be relevant to product safety, especially in the case of downregulation in developed liver. URI1 Prefoldin Like Chaperone gene ( URI1 ) encodes a protein that functions as a scaffold protein and plays a role in ubiquitination and transcription. Mice carrying a global knockout of URI1 display a mild phenotype with increased fasting blood glucose in male mice, but this may not produce a phenotype in the case of liver targeting. Eukaryotic Translation Initiation Factor 3 Subunit C Like ( EIF3CL ), a component of the eIF-3 complex required for several steps in the initiation of protein synthesis, is a gene with low expression in the liver, and in vitro hybridized mice lacking EIF3CL are relatively healthy and have a mild skeletal muscle phenotype. Treatment with the other four GalNAc-siRNA conjugates resulted in reduced expression of genes involved in cell cycle regulation ( S100A4 in EM2214), genes that induce apoptosis in a p53-dependent manner ( C1DP1 in EM2217), tumor suppressors or genes involved in oxygen transport ( LOX and HBA2 in EM2220). The identified genes ( S100A4 , C1DP1 , LOX , and HBA2 ) play important biological functions and their continued attenuation in the liver may have profound implications for safety. Therefore, due to potential important long-term safety issues associated with the identified DEGs, the GalNAc-siRNA conjugates EM2214, EM2217, and EM2220 were not selected for study in NHPs (Example 13).

Based on the data from in vivo studies demonstrating attenuation of human AGT mRNA and human AGT serum protein in mouse liver tissue (Examples 7 and 8) and analysis of potential off-target effects (DEGs in human primary hepatocytes), three extremely potent GalNAc-siRNA conjugates with favorable off-target profiles were selected to assay for protein attenuation efficacy in non-human primates (Example 13): EM2207, EM2227, EM2228.

Example 13 shows an in vivo study of attenuation of AGT mRNA in non-human primates (NHPs). The goal of this experiment was to determine the protein attenuation efficacy of siRNA GalNAc conjugates targeting AGT in non-human primates (NHPs) in vivo.

Purpose-bred cynomolgus macaques (naive females aged 7 to 18 years) were assigned to different treatment groups (4 animals per group). On day 1, each group was treated with a single dose of 3 mg GalNAc siRNA per kg body weight by subcutaneous injection, while control animals received vehicle, 0.9% saline by subcutaneous injection. Serial bleeding was performed before dosing (day -7 and day 1), 2, 8, 15, 22, 29, 43, 57, 71 and 85 days. The expression of AGT protein was measured in serum using a specific ELISA assay (IBL America 27412).

The results of the reduction of AGT protein levels within 12 weeks after a single subcutaneous administration of GalNAc-conjugated siRNA EM2207, EM2227, and EM2228 are shown in Figure 10. The AGT protein level in the serum of cynomolgus macaques collected 3 weeks after a single treatment with EM2207 was reduced by an average of 90%, 78% after 8 weeks, and 56% after 12 weeks. The AGT protein level in the serum of cynomolgus macaques collected 3 weeks after a single treatment with EM2227 was reduced by an average of 82%, 54% after 8 weeks, and 28% after 12 weeks. AGT protein levels in cynomolgus macaque sera collected after a single treatment with EM2228 were reduced by an average of 78% 3 weeks, 56% after 8 weeks, and 48% after 12 weeks.

Example 14 In vitro studies in Hep3B cells demonstrated the AGT attenuation efficacy of the tested siRNAs after transfection with 10, 1 or 0.1 nM siRNA.

The AGT attenuation efficacy of the selected siRNAs was determined after transfection of 10, 1 or 0.1 nM siRNA in Hep3B cells. The results are depicted in Table 7 below. At 10 nM, the remaining AGT level after attenuation reached a minimum of 2% for the three tested molecules EM2229, EM2230 and EM2231.

To transfect Hep3B cells with siRNA, cells were seeded at 20,000 cells/well in 96-well tissue culture plates (TPP, catalog number 13778-075, Switzerland). Immediately before seeding, siRNA transfection was performed using Lipofectamine RNAiMax (Invitrogen/Life Technologies, catalog number 13778-500, Germany) according to the manufacturer's instructions. Dose response screening was performed in triplicate with AGT siRNA at 10, 1, or 0.1 nM, with scrambled siRNA and siRNA targeting luciferase as nonspecific controls. After 24 hours of incubation with siRNA, the medium was removed, cells were washed with 250 µL PBS and lysed in 250 µL lysis/binding buffer (Dynabeads mRNA Direct Kit (Thermo Fisher, Cat. No. 61012, Germany)) and then frozen at -80°C. RNA was isolated using the KingFisher Flex system (Thermo Fisher, Cat. No. 5400630, Germany). RT-qPCR was performed in a single-plex 96-well format on a StepOnePlus apparatus from Applied Biosystems using AGT and PPIB specific primer probe sets and Takyon™ One-Step Rox Probe 5X MasterMix dTTP. Expression differences were calculated using the ΔΔCt method and the relative expression of AGT normalized to the housekeeping gene PPIB was determined. Results are presented as % of remaining AGT mRNA after siRNA transfection in Table 7. Table 7: Results of dose response screening (10, 1, 0.1 nM) of siRNA targeting AGT . The identities of the individual strands forming each of the siRNA duplexes as well as their sequences and modifications are found in Tables 5a and 5b. Double helix Concentration (nM) Remaining mRNA% average value SD EM2229 10 2 0 1 2 0 0.1 2 1 EM2230 10 2 0 1 2 0 0.1 3 0 EM2231 10 2 0 1 2 0 0.1 3 1

Example 15 shows an in vivo study of attenuation of AGT mRNA in non-human primates (NHPs).

The goal of this experiment was to determine the attenuation efficacy of siRNA GalNAc conjugates at various doses of protein targeting AGT in non-human primates (NHPs) in vivo.

Purpose-bred monkeys (naive females aged 8 to 16 years) were assigned to different treatment groups (4 animals per group). On day 1, animals were treated with a single dose of 1, 3 or 9 mg GalNAc siRNA/kg body weight by subcutaneous injection, while control animals received vehicle, 0.9% saline by subcutaneous injection. Serial bleeding was performed before dosing (day -7 and day 1), 2, 8, 15, 22, 29, 43, 57, 71 and 85 days. The expression of AGT protein was measured in serum using a specific ELISA assay (IBL America 27412).

The results of the reduction of AGT protein levels over 12 weeks following subcutaneous administration of GalNAc-conjugated siRNA EM2207 are shown in Figure 11. In monkeys treated with a single dose of 1 mg/kg, serum levels of AGT protein were reduced by an average of 66% after 4 weeks, 42% after 8 weeks, and 26% after 12 weeks. Treatment with a single dose of 3 mg/kg reduced AGT levels by 80% after 4 weeks, 59% after 8 weeks, and 53% after 12 weeks. A single dose of 9 mg/kg reduced AGT protein levels by 84% after 4 weeks, 73% after 8 weeks, and 63% after 12 weeks. Summary Abbreviations - Table 4 Abbreviation Meaning mA, mU, mC, mG 2'-O-methyl RNA nucleotides 2'-OMe 2'-O-methyl modification fA, fU, fC, fG 2'deoxy-2'-F RNA nucleotide 2'-F 2'-Fluoro modification (ps) Phosphorothioate (vp) Vinyl-(E)-phosphonate (vp)-mU (vp)-mU-phos ivA, ivC, ivU, ivG Reverse RNA (3'-3') nucleotides ST23 ST23-phos ST41 (or C4XLT) ST41-phos (or C4XLT-phos) Ser(GN) (When at the end of the chain, one of the O---s is OH) [ST23 (ps)]3 ST41 (ps) [ST23]3 ST41

Abbreviations as shown in the above abbreviation table may be used herein. The list of abbreviations may not be exhaustive and other abbreviations and their meanings may be found throughout this document. Summary Sequence Listing Table 5a - Unmodified Duplex Double Helix ID Stock Name (*) Sequence (5 ' à 3 ' ) SEQ ID No. EM2001 EM2001-A ACUAAAAUAAACCCAGCGU 1 EM2001 EM2001-B ACGCUGGGUUUAUUUUAGU 2 EM2002 EM2002-A AGUCAAUCUUCUCAGCAGG 3 EM2002 EM2002-B CCUGCUGAGAAGAUUGACU 4 EM2003 EM2003-A UUACACAGCAAACAGGAGC 5 EM2003 EM2003-B GCUCCUGUUUGCUGUGUAA 6 EM2004 EM2004-A UCACUUAGACCAAGGAGGG 7 EM2004 EM2004-B CCCUCCUUGGUCUAAGUGA 8 EM2005 EM2005-A UGUUUCUUCAUCCAGUUCC 9 EM2005 EM2005-B GGAACUGGAUGAAGAAACA 10 EM2006 EM2006-A AGUUUCACAAACAAGCUCC 11 EM2006 EM2006-B GGAGCUUGUUUGUGAAACU 12 EM2007 EM2007-A UGUUUCUUCAUCCAGUUGC 13 EM2007 EM2007-B GCAACUGGAUGAAGAAACA 14 EM2008 EM2008-A UAAAAAAAUGCUGUUCAGG 15 EM2008 EM2008-B CCUGAACAGCAUUUUUUUA 16 EM2009 EM2009-A UCGCAAUGCAACAAUGUAC 17 EM2009 EM2009-B GUACAUUGUUGCAUUGCGA 18 EM2010 EM2010-A UUAGACCAAGGAGAAACGG 19 EM2010 EM2010-B CCGUUUCUCCUUGGUCUAA 20 EM2011 EM2011-A ACUGUGUGGUCCAAGGCAU twenty one EM2011 EM2011-B AUGCCUUGGACCACACAGU twenty two EM2012 EM2012-A ACAAACAAGCUGGUCGGUU twenty three EM2012 EM2012-B AACCGACCAGCUUGUUUGU twenty four EM2013 EM2013-A ACUAAAAUAAACCCAGCAU 25 EM2013 EM2013-B AUGCUGGGUUUAUUUUAGU 26 EM2014 EM2014-A UACCUGUCAAUCUUCUCCU 27 EM2014 EM2014-B AGGAGAAGAUUGACAGGUA 28 EM2015 EM2015-A GUCUUCCAUCCUGUCACAG 29 EM2015 EM2015-B CUGUGACAGGAUGGAAGAC 30 EM2016 EM2016-A AUUUAAAACCCAAUUUUUC 31 EM2016 EM2016-B GAAAAAUUGGGUUUUAAAU 32 EM2017 EM2017-A AUUGCCUGUAGCCUGUCAG 33 EM2017 EM2017-B CUGACAGGCUACAGGCAAU 34 EM2018 EM2018-A ACUCAAUCUUCGCAGCAGU 35 EM2018 EM2018-B ACUGCUGCGAAGAUUGAGU 36 EM2019 EM2019-A ACUUAAAACCCCAUUUUUC 37 EM2019 EM2019-B GAAAAAUGGGGUUUUAAGU 38 EM2020 EM2020-A AAGCUCACUGUGCAUGCGG 39 EM2020 EM2020-B CCGCAUGCACAGUGAGCUU 40 EM2021 EM2021-A AUAGAGAGGCCAGGGUG 41 EM2021 EM2021-B CACCCUGGCCUCUCUCUAU 42 EM2022 EM2022-A UAUUUUUGUUCUCAACUUC 43 EM2022 EM2022-B GAAGUUGAGAACAAAAAUA 44 EM2023 EM2023-A AUGUUUCACAAACAAGCUC 45 EM2023 EM2023-B GAGCUUGUUUGUGAAACAU 46 EM2024 EM2024-A ACUGAUCAUACGCAGCAAG 47 EM2024 EM2024-B CUUGCUGCGUAUGAUCAGU 48 EM2025 EM2025-A ACCACAAACAACCUGGUCA 49 EM2025 EM2025-B UGACCAGGUUGUUUGUGGU 50 EM2026 EM2026-A ACAUUGUGGAUGACGAGAG 51 EM2026 EM2026-B CUCUCGUCAUCCACAAUGU 52 EM2027 EM2027-A UAACACUGGUUCUUGCCUG 53 EM2027 EM2027-B CAGGCAAGAACCAGUGUUA 54 EM2028 EM2028-A AGGCAAUGCAAAAAUGUAU 55 EM2028 EM2028-B AUACAUUUUUGCAUUGCCU 56 EM2029 EM2029-A UAAUACAAACCGAAGGCAU 57 EM2029 EM2029-B AUGCCUUCGGUUUGUAUUA 58 EM2030 EM2030-A CUUGUGCGCAUCCAGCCGG 59 EM2030 EM2030-B CCGGCUGGAUGCGCACAAG 60 EM2031 EM2031-A UUGUUUCACAAACAAGCUG 61 EM2031 EM2031-B CAGCUUGUUUGUGAAACAA 62 EM2032 EM2032-A AUUGGAAUUCUUUUUGGGC 63 EM2032 EM2032-B GCCCAAAAAGAAUUCCAAU 64 EM2033 EM2033-A GUUGAGGGAGUUUUGCUGG 65 EM2033 EM2033-B CCAGCAAAACUCCCUCAAC 66 EM2034 EM2034-A AUUAAAACCCAAUUUUUCG 67 EM2034 EM2034-B CGAAAAAUUGGGUUUUAAU 68 EM2035 EM2035-A AGUUCUUACAUUCAAGAGU 69 EM2035 EM2035-B ACUCUUGAAUGUAAGAACU 70 EM2036 EM2036-A AGUCAAUCUUCUCAGCAAA 71 EM2036 EM2036-B UUUGCUGAGAAGAUUGACU 72 EM2037 EM2037-A UAACACUGGUUCUUGCCCG 73 EM2037 EM2037-B CGGGCAAGAACCAGUGUUA 74 EM2038 EM2038-A AUACGGAAGCCCAAGAAGU 75 EM2038 EM2038-B ACUUCUUGGGCUUCCGUAU 76 EM2039 EM2039-A ACUGAGGGAGUCUUGCUGC 77 EM2039 EM2039-B GCAGCAAGACUCCCUCAGU 78 EM2040 EM2040-A ACCUUCCAUCCAGUCACAC 79 EM2040 EM2040-B GUGUGACUGGAUGGAAGGU 80 EM2041 EM2041-A ACUGUGUGGUCCAAGGCUA 81 EM2041 EM2041-B UAGCCUUGGACCACACAGU 82 EM2042 EM2042-A ACAUUGUGGAUUACGAGGC 83 EM2042 EM2042-B GCCUCGUAAUCCACAAUGU 84 EM2043 EM2043-A AUUGUGCGCAUCCAGCCUA 85 EM2043 EM2043-B UAGGCUGGAUGCGCACAAU 86 EM2044 EM2044-A UCAAACAAGCUGGUCGGAG 87 EM2044 EM2044-B CUCCGACCAGCUUGUUUGA 88 EM2045 EM2045-A ACUGUGUGGUCGAAGGCUU 89 EM2045 EM2045-B AAGCCUUCGACCACACAGU 90 EM2046 EM2046-A ACUUCUUACAUCCAAGACC 91 EM2046 EM2046-B GGUCUUGGAUGUAAGAAGU 92 EM2047 EM2047-A UCGAACCUGUCCAUCUUCC 93 EM2047 EM2047-B GGAAGAUGGACAGGUUCGA 94 EM2048 EM2048-A AAAGGUGGGAGACUGGGGG 95 EM2048 EM2048-B CCCCCAGUCUCCCACCUUU 96 EM2049 EM2049-A UCACACUGAGGGGCUGUUC 97 EM2049 EM2049-B GAACAGCCCCUCAGUGUGA 98 EM2050 EM2050-A ACGCUCACUGUUCAUGCCG 99 EM2050 EM2050-B CGGCAUGAACAGUGAGCGU 100 EM2051 EM2051-A UUACGGAAGCCCAAGAAUC 101 EM2051 EM2051-B GAUUCUUGGGCUUCCGUAA 102 EM2052 EM2052-A AAGUUGGCCAGCAUCCCGA 103 EM2052 EM2052-B UCGGGAUGCUGGCCAACUU 104 EM2053 EM2053-A UAAAAAAAUGCUGUUCACG 105 EM2053 EM2053-B CGUGAACAGCAUUUUUUUA 106 EM2054 EM2054-A UGGCAAUGCAAAAAUGUGC 107 EM2054 EM2054-B GCACAUUUUUGCAUUGCCA 108 EM2055 EM2055-A UAGUUGGCCAGCAUCCCGU 109 EM2055 EM2055-B ACGGGAUGCUGGCCAACUA 110 EM2056 EM2056-A AUUUGUUCUCAACUUGAAG 111 EM2056 EM2056-B CUUCAAGUUGAGAACAAAU 112 EM2057 EM2057-A UCAUUAGAAGAAAAGGUGG 113 EM2057 EM2057-B CCACCUUUUCUUCUAAUGA 114 EM2058 EM2058-A AUCACAAACAAGCUGGUAC 115 EM2058 EM2058-B GUACCAGCUUGUUUGUGAU 116 EM2059 EM2059-A AUCACAAACAAGCUGGUCA 117 EM2059 EM2059-B UGACCAGCUUGUUUGUGAU 118 EM2060 EM2060-A UCACACAGCAAUCAGGAAG 119 EM2060 EM2060-B CUUCCUGAUUGCUGUGUGA 120 EM2061 EM2061-A UUUGCCUGUAGCCUGUCAC 121 EM2061 EM2061-B GUGACAGGCUACAGGCAAA 122 EM2062 EM2062-A ACACUUAGACCAAGGAGAA 123 EM2062 EM2062-B UUCUCCUUGGUCUAAGUGU 124 EM2063 EM2063-A UCUCUCAUUGUGGAUGACA 125 EM2063 EM2063-B UGUCAUCCACAAUGAGAGA 126 EM2064 EM2064-A UCCAUACACAGUAAACAGC 127 EM2064 EM2064-B GCUGUUUACUGUGUAUGGA 128 EM2065 EM2065-A ACAUUAGAAGACAAGGUGC 129 EM2065 EM2065-B GCACCUUGUCUUCUAAUGU 130 EM2066 EM2066-A UUACGGAAGCCCAAGAAGC 131 EM2066 EM2066-B GCUUCUUGGGCUUCCGUAA 132 EM2067 EM2067-A UCGUUGGCCAGUAUCCCGU 133 EM2067 EM2067-B ACGGGAUACUGGCCAACGA 134 EM2068 EM2068-A ACUGGAAUUCUCUUUGGAC 135 EM2068 EM2068-B GUCCAAAGAGAAUUCCAGU 136 EM2069 EM2069-A UUUGAUCAUACACAGCAAA 137 EM2069 EM2069-B UUUGCUGUGUAUGAUCAAA 138 EM2070 EM2070-A UGACACUGAGGUGCUGUUC 139 EM2070 EM2070-B GAACAGCACCUCAGUGUCA 140 EM2071 EM2071-A AACCUGUCAAUCUUCUCAG 141 EM2071 EM2071-B CUGAGAAGAUUGACAGGUU 142 EM2072 EM2072-A UCACGGAAGCCUAAGAAGC 143 EM2072 EM2072-B GCUUCUUAGGCUUCCGUGA 144 EM2073 EM2073-A UUAGAGAGAGGCCAGGGAU 145 EM2073 EM2073-B AUCCCUGGCCUCUCUCUAA 146 EM2074 EM2074-A UCUCAUUAGAACAAAAGGC 147 EM2074 EM2074-B GCCUUUUGUUCUAAUGAGA 148 EM2075 EM2075-A AUUGUGCGCAUCCAGCCGU 149 EM2075 EM2075-B ACGGCUGGAUGCGCACAAU 150 EM2076 EM2076-A UGUUCUUACAUUCAAGACA 151 EM2076 EM2076-B UGUCUUGAAUGUAAGAACA 152 EM2077 EM2077-A AGUUUCUUCAUCCAGUUGA 153 EM2077 EM2077-B UCAACUGGAUGAAGAAACU 154 EM2078 EM2078-A ACUUGUUCUCAUCUUGAAG 155 EM2078 EM2078-B CUUCAAGAUGAGAACAAGU 156 EM2079 EM2079-A UUUAAAACCCAAUUUUUGU 157 EM2079 EM2079-B ACAAAAAUUGGGUUUUAAA 158 EM2080 EM2080-A AUUGAUCAUACACAGCACG 159 EM2080 EM2080-B CGUGCUGUGUAUGAUCAAU 160 EM2081 EM2081-A UCGAAAAGGUGCGAGACUA 161 EM2081 EM2081-B UAGUCUCGCACCUUUUCGA 162 EM2082 EM2082-A CCUGUCAAUCUUCUCAGCA 163 EM2082 EM2082-B UGCUGAGAAGAUUGACAGG 164 EM2083 EM2083-A AAUUUUUGCAGGUUCAGCU 165 EM2083 EM2083-B AGCUGAACCUGCAAAAAUU 166 EM2084 EM2084-A AUACACAGCAAACAGGAAU 167 EM2084 EM2084-B AUUCCUGUUUUGCUGUGUAU 168 EM2085 EM2085-A ACUUUGCAGGUACAGCUCU 169 EM2085 EM2085-B AGAGCUGUACCUGCAAAGU 170 EM2086 EM2086-A AUAGACCAAGGAGAAACGC 171 EM2086 EM2086-B GCGUUUCUCCUUGGUCUAU 172 EM2087 EM2087-A ACUUAGACCAAGGAGAAAC 173 EM2087 EM2087-B GUUUCUCCUUGGUCUAAGU 174 EM2088 EM2088-A ACGUUUCACAAGCAAGCUC 175 EM2088 EM2088-B GAGCUUGCUUGUGAAACGU 176 EM2089 EM2089-A ACUGUCAAUCUGCUCAGCU 177 EM2089 EM2089-B AGCUGAGCAGAUUGACAGU 178 EM2090 EM2090-A UCACAAACGGCAGCUUCAU 179 EM2090 EM2090-B AUGAAGCUGCCGUUUGUGA 180 EM2091 EM2091-A AGACACUGAGGUGCUGUUG 181 EM2091 EM2091-B CAACAGCACCUCAGUGUCU 182 EM2092 EM2092-A UCUUAGACCAAGGAGAAAU 183 EM2092 EM2092-B AUUUCUCCUUGGUCUAAGA 184 EM2093 EM2093-A AUUUAAAACCCAAUUUUGC 185 EM2093 EM2093-B GCAAAAUUGGGUUUUAAAU 186 EM2094 EM2094-A UGUUUCACAAACAAGCUGG 187 EM2094 EM2094-B CCAGCUUGUUUGUGAAACA 188 EM2095 EM2095-A UCACACUGGUUGUUGCCUG 189 EM2095 EM2095-B CAGGCAACAACCAGUGUGA 190 EM2096 EM2096-A UCAAAAAAUGCGGUUCAGU 191 EM2096 EM2096-B ACUGAACCGCAUUUUUUGA 192 EM2097 EM2097-A UAGAAAAGGUGGGAGACAU 193 EM2097 EM2097-B AUGUCUCCCACCUUUUCUA 194 EM2098 EM2098-A UUUGCCUGUAGCCUGUCGC 195 EM2098 EM2098-B GCGACAGGCUACAGGCAAA 196 EM2099 EM2099-A UCACUUAGACCUAGGAGAG 197 EM2099 EM2099-B CUCUCCUAGGUCUAAGUGA 198 EM2100 EM2100-A UCGACGAGGUGCAAGGGGG 199 EM2100 EM2100-B CCCCCUUGCACCUCGUCGA 200 EM2101 EM2101-A UCUAAAAUAAACCCAGCAA 201 EM2101 EM2101-B UUGCUGGGUUUAUUUUAGA 202 EM2102 EM2102-A UCUUUCUUCAUUCAGUUGC 203 EM2102 EM2102-B GCAACUGAAUGAAGAAAGA 204 EM2103 EM2103-A UAAGGUGGGAGACUGGGAA 205 EM2103 EM2103-B UUCCCAGUCUCCCACCUUA 206 EM2104 EM2104-A AGUUUCACAAACAAGCUGU 207 EM2104 EM2104-B ACAGCUUGUUUGUGAAACU 208 EM2105 EM2105-A AAGCUCACUGUGCAUGCCG 209 EM2105 EM2105-B CGGCAUGCACAGUGAGCUU 210 EM2106 EM2106-A ACUGUCAAUCUUCUCAGAC 211 EM2106 EM2106-B GUCUGAGAAGAUUGACAGU 212 EM2107 EM2107-A AAUUUUAAAACCCAAUUUU 213 EM2107 EM2107-B AAAAUUGGGUUUUAAAAUU 214 EM2108 EM2108-A UUACACAGCAAACAGGAAC 215 EM2108 EM2108-B GUUCCUGUUUGCUGUGUAA 216 EM2109 EM2109-A UUCAUACACAGCAAACACU 217 EM2109 EM2109-B AGUGUUUGCUGUGUAUGAA 218 EM2110 EM2110-A AUGUCCACCCAGAACUCGC 219 EM2110 EM2110-B GCGAGUUCUGGGUGGACAU 220 EM2111 EM2111-A UUCAUACACAGCAAACAGC 221 EM2111 EM2111-B GCUGUUUGCUGUGUAUGAA 222 EM2112 EM2112-A ACGUCCACCCAUAACUCCG 223 EM2112 EM2112-B CGGAGUUAUGGGUGGACGU 224 EM2113 EM2113-A UUGAACCUGUCAAUCUUCG 225 EM2113 EM2113-B CGAAGAUUGACAGGUUCAA 226 EM2114 EM2114-A ACAGACCAAGGUGAAACGC 227 EM2114 EM2114-B GCGUUUCACCUUGGUCUGU 228 EM2115 EM2115-A UUCACAAACAAGCUGGUCG 229 EM2115 EM2115-B CGACCAGCUUGUUUGUGAA 230 EM2116 EM2116-A AAACACUGGUUCUUGCCUC 231 EM2116 EM2116-B GAGGCAAGAACCAGUGUUU 232 EM2117 EM2117-A ACUUGUUUCACGAACAAGA 233 EM2117 EM2117-B UCUUGUUCGUGAAACAAGU 234 EM2118 EM2118-A UCUUUUUGUUCACAACUUC 235 EM2118 EM2118-B GAAGUUGUGAACAAAAAGA 236 EM2119 EM2119-A AUGAACCUGUCAAUCUUCU 237 EM2119 EM2119-B AGAAGAUUGACAGGUUCAU 238 EM2120 EM2120-A UCUCAUUAGAAGAAAAGGC 239 EM2120 EM2120-B GCCUUUUCUUCUAAUGAGA 240 EM2121 EM2121-A ACUCAAUUUUUGCAGGUCG 241 EM2121 EM2121-B CGACCUGCAAAAAUUGAGU 242 EM2122 EM2122-A UCUGUGCGCAUUCAGCCGA 243 EM2122 EM2122-B UCGGCUGAAUGCGCACAGA 244 EM2123 EM2123-A AUUGAGGGAGUUUUGCUGC 245 EM2123 EM2123-B GCAGCAAAACUCCCUCAAU 246 EM2124 EM2124-A UAGCUCACUGUGCAUGCCA 247 EM2124 EM2124-B UGGCAUGCACAGUGAGCUA 248 EM2125 EM2125-A UCACAAACGGCUGCUUCUU 249 EM2125 EM2125-B AAGAAGCAGCCGUUUGUGA 250 EM2126 EM2126-A ACUCAUUAGAAGAAAAGGU 251 EM2126 EM2126-B ACCUUUUCUUCUAAUGAGU 252 EM2127 EM2127-A AUGACGAGGUGGAAGGGGU 253 EM2127 EM2127-B ACCCCUUCCACCUCGUCAU 254 EM2128 EM2128-A UCUUUUUGCAGUUUCAGCA 255 EM2128 EM2128-B UGCUGAAACUGCAAAAAGA 256 EM2129 EM2129-A AUCUUCCAUCCUGUCACUC 257 EM2129 EM2129-B GAGUGACAGGAUGGAAGAU 258 EM2130 EM2130-A UCUCAUUAGAAGAAAAGUC 259 EM2130 EM2130-B GACUUUUCUUCUAAUGAGA 260 EM2131 EM2131-A AUUGAUCAUACACAGCAAG 261 EM2131 EM2131-B CUUGCUGUGUAUGAUCAAU 262 EM2132 EM2132-A UCAGGUGGGAGGCUGGGGA 263 EM2132 EM2132-B UCCCCAGCCUCCCACCUGA 264 EM2133 EM2133-A GCAAACAAGCUGGUCGGUC 265 EM2133 EM2133-B GACCGACCAGCUUGUUUGC 266 EM2134 EM2134-A AUUUGUUUCACAAACAAGG 267 EM2134 EM2134-B CCUUGUUUGUGAAACAAAU 268 EM2135 EM2135-A UCUUAGACCAACGAGAAAU 269 EM2135 EM2135-B AUUUCUCGUUGGUCUAAGA 270 EM2136 EM2136-A AUUUUGCAGGUUCAGCUUC 271 EM2136 EM2136-B GAAGCUGAACCUGCAAAAU 272 EM2137 EM2137-A AUUGAGGGAGUUUUGCUAC 273 EM2137 EM2137-B GUAGCAAAACUCCCUCAAU 274 EM2138 EM2138-A UUAGAGAGAGGCCAGGGUC 275 EM2138 EM2138-B GACCCUGGCCUCUCUCUAA 276 EM2139 EM2139-A AAAUACAAACCGAAGGCAA 277 EM2139 EM2139-B UUGCCUUCGGUUUGUAUUU 278 EM2140 EM2140-A ACUCUCAUUGUGGAUGACG 279 EM2140 EM2140-B CGUCAUCCACAAUGAGAGU 280 EM2141 EM2141-A UAUUUUAAAACCCAAUUGC 281 EM2141 EM2141-B GCAAUUGGGUUUUAAAAUA 282 EM2142 EM2142-A UUGACGAGGUGGAAGGGGG 283 EM2142 EM2142-B CCCCCUUCCACCUCGUCAA 284 EM2143 EM2143-A UUUUAAAACCCAAUUUUUG 285 EM2143 EM2143-B CAAAAAUUGGGUUUUAAAA 286 EM2144 EM2144-A UGACACUGAGGUGCUGUAA 287 EM2144 EM2144-B UUACAGCACCUCAGUGUCA 288 EM2145 EM2145-A UAUUUUUGUUCUCAACUGC 289 EM2145 EM2145-B GCAGUUGAGAACAAAAAUA 290 EM2146 EM2146-A UCUCUCAUUGUGGAUGAAC 291 EM2146 EM2146-B GUUCAUCCACAAUGAGAGA 292 EM2147 EM2147-A UCACAAACGGCUGCUUCAU 293 EM2147 EM2147-B AUGAAGCAGCCGUUUGUGA 294 EM2148 EM2148-A UCUUAGACCAAGGAGAACU 295 EM2148 EM2148-B AGUUCUCCUUGGUCUAAGA 296 EM2149 EM2149-A GCUCAAUUUUUGCAGGUUC 297 EM2149 EM2149-B GAACCUGCAAAAAUUGAGC 298 EM2150 EM2150-A UCUUUUUAAAACUCAAUUUG 299 EM2150 EM2150-B CAAAUUGAGUUUUAAAAGA 300 EM2151 EM2151-A UCUGCCUGUAGUCUGUCAC 301 EM2151 EM2151-B GUGACAGACUACAGGCAGA 302 EM2152 EM2152-A UAAUACAAACCGAAGGCGU 303 EM2152 EM2152-B ACGCCUUCGGUUUGUAUUA 304 EM2153 EM2153-A AUUGGAAUUCUUUUUGGAC 305 EM2153 EM2153-B GUCCAAAAAGAAUUCCAAU 306 EM2154 EM2154-A AUAGACCAAGGAGAAACAC 307 EM2154 EM2154-B GUGUUUCUCCUUGGUCUAU 308 EM2155 EM2155-A UAUUUUUGCAGGUUCAGAA 309 EM2155 EM2155-B UUCUGAACCUGCAAAAAUA 310 EM2156 EM2156-A UAUUUUAAAACCCAAUUUG 311 EM2156 EM2156-B CAAAUUGGGUUUUAAAAUA 312 EM2157 EM2157-A UCAAACAAGCUCGUCGGUA 313 EM2157 EM2157-B UACCGACGAGCUUGUUUGA 314 EM2158 EM2158-A ACAUUAGAAGAAAAGGUCC 315 EM2158 EM2158-B GGACCUUUUCUUCUAAUGU 316 EM2159 EM2159-A UCAUUGUGGAUGACGAGGU 317 EM2159 EM2159-B ACCUCGUCAUCCACAAUGA 318 EM2160 EM2160-A AUGUCCACCCAGAACUCCG 319 EM2160 EM2160-B CGGAGUUCUGGGUGGACAU 320 EM2161 EM2161-A ACUCAAUUUUUGCAGGUUU 321 EM2161 EM2161-B AAACCUGCAAAAAUUGAGU 322 EM2162 EM2162-A UGUCAAUCUUCUCAGCAGC 323 EM2162 EM2162-B GCUGCUGAGAAGAUUGACA 324 EM2163 EM2163-A AUUUGUUCUCAACUUGACU 325 EM2163 EM2163-B AGUCAAGUUGAGAACAAAU 326 EM2164 EM2164-A UUUUGUUUCACAAACAAGC 327 EM2164 EM2164-B GCUUGUUUGUGAAACAAAA 328 EM2165 EM2165-A AUCUUCCAUCCUGUCACAC 329 EM2165 EM2165-B GUGUGACAGGAUGGAAGAU 330 EM2166 EM2166-A AUUAAAACCCAAUUUUUGC 331 EM2166 EM2166-B GCAAAAAUUGGGUUUUAAU 332 EM2167 EM2167-A AGUUCUUACAUUCAAGACG 333 EM2167 EM2167-B CGUCUUGAAUGUAAGAACU 334 EM2168 EM2168-A ACAUUAGAAGAAAAGGUGC 335 EM2168 EM2168-B GCACCUUUUCUUCUAAUGU 336 EM2169 EM2169-A AUGUUUCACAAACAAGCGC 337 EM2169 EM2169-B GCGCUUGUUUGUGAAACAU 338 EM2170 EM2170-A UUGUCCACCCAGAACUCCU 339 EM2170 EM2170-B AGGAGUUCUGGGUGGACAA 340 EM2171 EM2171-A AAUUUUUGUUCUCAACUUG 341 EM2171 EM2171-B CAAGUUGAGAACAAAAAUU 342 EM2172 EM2172-A AUUUUGCAGGUUCAGCUCU 343 EM2172 EM2172-B AGAGCUGAACCUGCAAAAU 344 EM2173 EM2173-A UUUUGUUCUCAACUUGAAA 345 EM2173 EM2173-B UUUCAAGUUGAGAACAAAA 346 EM2174 EM2174-A GCUGUGUGGUCCAAGGCUC 347 EM2174 EM2174-B GAGCCUUGGACCACACAGC 348 EM2175 EM2175-A UUGACGAGGUGGAAGGGAC 349 EM2175 EM2175-B GUCCCUUCCACCUCGUCAA 350 EM2176 EM2176-A UCUCUCAUUGUUGAUGACA 351 EM2176 EM2176-B UGUCAUCAACAAUGAGAGA 352 EM2177 EM2177-A GCACAAACGGCUGCUUCAG 353 EM2177 EM2177-B CUGAAGCAGCCGUUUGUGC 354 EM2178 EM2178-A UUUUUGCAGGUUCAGCUCG 355 EM2178 EM2178-B CGAGCUGAACCUGCAAAAA 356 EM2179 EM2179-A UCACUUAGACCAAGGAGAG 357 EM2179 EM2179-B CUCUCCUUGGUCUAAGUGA 358 EM2180 EM2180-A AAAAAAAAUGCUGUUCAGC 359 EM2180 EM2180-B GCUGAACAGCAUUUUUUUU 360 EM2181 EM2181-A UCAGAGAGAGGUCAGGGUA 361 EM2181 EM2181-B UACCCUGACCUCUCUCUGA 362 EM2182 EM2182-A ACAUUGUGGAUGACGAGGG 363 EM2182 EM2182-B CCCUCGUCAUCCACAAUGU 364 EM2183 EM2183-A ACUAAAAUAAAGCCAGCAU 365 EM2183 EM2183-B AUGCUGGCUUUAUUUUAGU 366 EM2184 EM2184-A ACUCAAUUUUUCCAGGUUG 367 EM2184 EM2184-B CAACCUGGAAAAAUUGAGU 368 EM2185 EM2185-A UAUUUUUGCAGGUUCAGCG 369 EM2185 EM2185-B CGCUGAACCUGCAAAAAUA 370 EM2186 EM2186-A AUCAUACACAGCAAACAGG 371 EM2186 EM2186-B CCUGUUUGCUGUGUAUGAU 372 EM2187 EM2187-A AUUUGUUUCACAAACAACG 373 EM2187 EM2187-B CGUUGUUUGUGAAACAAAU 374 EM2188 EM2188-A UAGAAAAGGUGGGAGACUC 375 EM2188 EM2188-B GAGUCUCCCACCUUUUCUA 376 EM2189 EM2189-A GUUGGAAUUCUUUUUGGAA 377 EM2189 EM2189-B UUCCAAAAAGAAUUCCAAC 378 EM2190 EM2190-A UCAUACAAACCUAAGGCAG 379 EM2190 EM2190-B CUGCCUUAGGUUUGUAUGA 380 EM2191 EM2191-A ACUAAAACCCACUUUUUUGC 381 EM2191 EM2191-B GCAAAAAGUGGGUUUUAGU 382 EM2192 EM2192-A UACCUGUCAAUCUUCUCAC 383 EM2192 EM2192-B GUGAGAAGAUUGACAGGUA 384 EM2193 EM2193-A UAAGGUGGGAGACUGGGGA 385 EM2193 EM2193-B UCCCCAGUCUCCCACCUUA 386 EM2194 EM2194-A UAGUUGGCCAGCAUCCCUG 387 EM2194 EM2194-B CAGGGAUGCUGGCCAACUA 388 EM2195 EM2195-A ACUUUCACAAAGAAGCUGC 389 EM2195 EM2195-B GCAGCUUCUUUGUGAAAGU 390 EM2196 EM2196-A AAGAAAAGGUGGGAGACUG 391 EM2196 EM2196-B CAGUCUCCCACCUUUUCUU 392 EM2197 EM2197-A UUGAACCUGUCAAUCUUUC 393 EM2197 EM2197-B GAAAGAUUGACAGGUUCAA 394 EM2198 EM2198-A ACUGUCAAUCUUCUCAGCU 395 EM2198 EM2198-B AGCUGAGAAGAUUGACAGU 396 EM2199 EM2199-A UCCCUGUCAAUUUUCUCAC 397 EM2199 EM2199-B GUGAGAAAAUUGACAGGGA 398 EM2200 EM2200-A UGGCAAUGCAAAAAUGUAC 399 EM2200 EM2200-B GUACAUUUUUGCAUUGCCA 400 EM2229 EM2229-A UUAGACCAAGGAGAAACAC 401 EM2229 EM2229-B GUGUUUCUCCUUGGUCUAU 308 EM2232 EM2232-A UCAUUAGAAGAAAAGGUCC 871 EM2232 EM2232-B GGACCUUUUCUUCUAAUGU 316 EM2233 EM2233-A UAACACUGGUUCUUGCCUC 872 EM2233 EM2233-B GAGGCAAGAACCAGUGUUU 232 EM2234 EM2234-A UUCACAAACAAGCUGGUAC 873 EM2234 EM2234-B GUACCAGCUUGUUUGUGAU 116

The duplexes listed in Table 5b have various modifications as indicated, with reference to Table 4 for an explanation of the abbreviations used. Where appropriate, the sequence of the equivalent unmodified strand of Table 5a is also indicated. surface 5b- Modified double helix Double Helix ID Stock Name (*) Sequence (5 ' à 3 ' ) SEQ ID No. Unmodified equivalent SEQ ID No. EM2001 EM2001-A mA (ps) fC (ps) mU fA mA fA mA fU mA fA mA fC mC fC mA fG mC (ps) fG (ps) mU 402 1 EM2001 EM2001-B mA (ps) mC (ps) mG mC mU mG fG fG fU mU mU mA mU mU mU mU mA (ps) mG (ps) mU 403 2 EM2002 EM2002-A mA (ps) fG (ps) mU fC mA fA mU fC mU fU mC fU mC fA mG fC mA (ps) fG (ps) mG 404 3 EM2002 EM2002-B mC (ps) mC (ps) mU mG mC mU fG fA fG mA mA mG mA mU mU mG mA (ps) mC (ps) mU 405 4 EM2003 EM2003-A mU (ps) fU (ps) mA fC mA fC mA fG mC fA mA fA mC fA mG fG mA (ps) fG (ps) mC 406 5 EM2003 EM2003-B mG (ps) mC (ps) mU mC mC mU fG fU fU mU mG mC mU mG mU mG mU (ps) mA (ps) mA 407 6 EM2004 EM2004-A mU (ps) fC (ps) mA fC mU fU mA fG mA fC mC fA mA fG mG fA mG (ps) fG (ps) mG 408 7 EM2004 EM2004-B mC (ps) mC (ps) mC mU mC mC fU fU fG mG mU mC mU mA mA mG mU (ps) mG (ps) mA 409 8 EM2005 EM2005-A mU (ps) fG (ps) mU fU mU fC mU fU mC fA mU fC mC fA mG fU mU (ps) fC (ps) mC 410 9 EM2005 EM2005-B mG (ps) mG (ps) mA mA mC mU fG fG fA mU mG mA mA mG mA mA mA (ps) mC (ps) mA 411 10 EM2006 EM2006-A mA (ps) fG (ps) mU fU mU fC mA fC mA fA mA fC mA fA mG fC mU (ps) fC (ps) mC 412 11 EM2006 EM2006-B mG (ps) mG (ps) mA mG mC mU fU fG fU mU mU mG mU mG mA mA mA (ps) mC (ps) mU 413 12 EM2007 EM2007-A mU (ps) fG (ps) mU fU mU fC mU fU mC fA mU fC mC fA mG fU mU (ps) fG (ps) mC 414 13 EM2007 EM2007-B mG (ps) mC (ps) mA mA mC mU fG fG fA mU mG mA mA mG mA mA mA (ps) mC (ps) mA 415 14 EM2008 EM2008-A mU (ps) fA (ps) mA fA mA fA mA fA mU fG mC fU mG fU mU fC mA (ps) fG (ps) mG 416 15 EM2008 EM2008-B mC (ps) mC (ps) mU mG mA mA fC fA fG mC mA mU mU mU mU mU mU (ps) mU (ps) mA 417 16 EM2009 EM2009-A mU (ps) fC (ps) mG fC mA fA mU fG mC fA mA fC mA fA mU fG mU (ps) fA (ps) mC 418 17 EM2009 EM2009-B mG (ps) mU (ps) mA mC mA mU fU fG fU mU mG mC mA mU mU mG mC (ps) mG (ps) mA 419 18 EM2010 EM2010-A mU (ps) fU (ps) mA fG mA fC mC fA mA fG mG fA mG fA mA fA mC (ps) fG (ps) mG 420 19 EM2010 EM2010-B mC (ps) mC (ps) mG mU mU mU fC fU fC mC mU mU mG mG mU mC mU (ps) mA (ps) mA 421 20 M2011 EM2011-A mA (ps) fC (ps) mU fG mU fG mU fG mG fU mC fC mA fA mG fG mC (ps) fA (ps) mU 422 twenty one EM2011 EM2011-B mA (ps) mU (ps) mG mC mC mU fU fG fG mA mC mC mA mC mA mC mA (ps) mG (ps) mU 423 twenty two EM2012 EM2012-A mA (ps) fC (ps) mA fA mA fC mA fA mG fC mU fG mG fU mC fG mG (ps) fU (ps) mU 424 twenty three EM2012 EM2012-B mA (ps) mA (ps) mC mC mG mA fC fC fA mG mC mU mU mG mU mU mU (ps) mG (ps) mU 425 twenty four EM2013 EM2013-A mA (ps) fC (ps) mU fA mA fA mA fU mA fA mA fC mC fC mA fG mC (ps) fA (ps) mU 426 25 EM2013 EM2013-B mA (ps) mU (ps) mG mC mU mG fG fG fU mU mU mA mU mU mU mU mA (ps) mG (ps) mU 427 26 EM2014 EM2014-A mU (ps) fA (ps) mC fC mU fG mU fC mA fA mU fC mU fU mC fU mC (ps) fC (ps) mU 428 27 EM2014 EM2014-B mA (ps) mG (ps) mG mA mG mA fA fG fA mU mU mG mA mC mA mG mG (ps) mU (ps) mA 429 28 EM2015 EM2015-A mG (ps) fU (ps) mC fU mU fC mC fA mU fC mC fU mG fU mC fA mC (ps) fA (ps) mG 430 29 EM2015 EM2015-B mC (ps) mU (ps) mG mU mG mA fC fA fG mG mA mU mG mG mA mA mG (ps) mA (ps) mC 431 30 EM2016 EM2016-A mA (ps) fU (ps) mU fU mA fA mA fA mC fC mC fA mA fU mU fU mU (ps) fU (ps) mC 432 31 EM2016 EM2016-B mG (ps) mA (ps) mA mA mA mA fU fU fG mG mG mU mU mU mU mA mA (ps) mA (ps) mU 433 32 EM2017 EM2017-A mA (ps) fU (ps) mU fG mC fC mU fG mU fA mG fC mC fU mG fU mC (ps) fA (ps) mG 434 33 EM2017 EM2017-B mC (ps) mU (ps) mG mA mC mA fG fG fC mU mA mC mA mG mG mC mA (ps) mA (ps) mU 435 34 EM2018 EM2018-A mA (ps) fC (ps) mU fC mA fA mU fC mU fU mC fG mC fA mG fC mA (ps) fG (ps) mU 436 35 EM2018 EM2018-B mA (ps) mC (ps) mU mG mC mU fG fC fG mA mA mG mA mU mU mG mA (ps) mG (ps) mU 437 36 EM2019 EM2019-A mA (ps) fC (ps) mU fU mA fA mA fA mC fC mC fC mA fU mU fU mU (ps) fU (ps) mC 438 37 EM2019 EM2019-B mG (ps) mA (ps) mA mA mA mA fU fG fG mG mG mU mU mU mU mA mA (ps) mG (ps) mU 439 38 EM2020 EM2020-A mA (ps) fA (ps) mG fC mU fC mA fC mU fG mU fG mC fA mU fG mC (ps) fG (ps) mG 440 39 EM2020 EM2020-B mC (ps) mC (ps) mG mC mA mU fG fC fA mC mA mG mU mG mA mG mC (ps) mU (ps) mU 441 40 EM2021 EM2021-A mA (ps) fU (ps) mA fG mA fG mA fG mA fG mG fC mC fA mG fG mG (ps) fU (ps) mG 442 41 EM2021 EM2021-B mC (ps) mA (ps) mC mC mC mU fG fG fC mC mU mC mU mC mU mC mU (ps) mA (ps) mU 443 42 EM2022 EM2022-A mU (ps) fA (ps) mU fU mU fU mU fG mU fU mC fU mC fA mA fC mU (ps) fU (ps) mC 444 43 EM2022 EM2022-B mG (ps) mA (ps) mA mG mU mU fG fA fG mA mA mC mA mA mA mA mA (ps) mU (ps) mA 445 44 EM2023 EM2023-A mA (ps) fU (ps) mG fU mU fU mC fA mC fA mA fA mC fA mA fG mC (ps) fU (ps) mC 446 45 EM2023 EM2023-B mG (ps) mA (ps) mG mC mU mU fG fU fU mU mG mU mG mA mA mA mC (ps) mA (ps) mU 447 46 EM2024 EM2024-A mA (ps) fC (ps) mU fG mA fU mC fA mU fA mC fG mC fA mG fC mA (ps) fA (ps) mG 448 47 EM2024 EM2024-B mC (ps) mU (ps) mU mG mC mU fG fC fG mU mA mU mG mA mU mC mA (ps) mG (ps) mU 449 48 EM2025 EM2025-A mA (ps) fC (ps) mC fA mC fA mA fA mC fA mA fC mC fU mG fG mU (ps) fC (ps) mA 450 49 EM2025 EM2025-B mU (ps) mG (ps) mA mC mC mA fG fG fU mU mG mU mU mU mG mU mG (ps) mG (ps) mU 451 50 EM2026 EM2026-A mA (ps) fC (ps) mA fU mU fG mU fG mG fA mU fG mA fC mG fA mG (ps) fA (ps) mG 452 51 EM2026 EM2026-B mC (ps) mU (ps) mC mU mC mG fU fC fA mU mC mC mA mC mA mA mU (ps) mG (ps) mU 453 52 EM2027 EM2027-A mU (ps) fA (ps) mA fC mA fC mU fG mG fU mU fC mU fU mG fC mC (ps) fU (ps) mG 454 53 EM2027 EM2027-B mC (ps) mA (ps) mG mG mC mA fA fG fA mA mC mC mA mG mU mG mU (ps) mU (ps) mA 455 54 EM2028 EM2028-A mA (ps) fG (ps) mG fC mA fA mU fG mC fA mA fA mA fA mU fG mU (ps) fA (ps) mU 456 55 EM2028 EM2028-B mA (ps) mU (ps) mA mC mA mU fU fU fU mU mG mC mA mU mU mG mC (ps) mC (ps) mU 457 56 EM2029 EM2029-A mU (ps) fA (ps) mA fU mA fC mA fA mA fC mC fG mA fA mG fG mC (ps) fA (ps) mU 458 57 EM2029 EM2029-B mA (ps) mU (ps) mG mC mC mU fU fC fG mG mU mU mU mG mU mA mU (ps) mU (ps) mA 459 58 EM2030 EM2030-A mC (ps) fU (ps) mU fG mU fG mC fG mC fA mU fC mC fA mG fC mC (ps) fG (ps) mG 460 59 EM2030 EM2030-B mC (ps) mC (ps) mG mG mC mU fG fG fA mU mG mC mG mC mA mC mA (ps) mA (ps) mG 461 60 EM2031 EM2031-A mU (ps) fU (ps) mG fU mU fU mC fA mC fA mA fA mC fA mA fG mC (ps) fU (ps) mG 462 61 EM2031 EM2031-B mC (ps) mA (ps) mG mC mU mU fG fU fU mU mG mU mG mA mA mA mC (ps) mA (ps) mA 463 62 EM2032 EM2032-A mA (ps) fU (ps) mU fG mG fA mA fU mU fC mU fU mU fU mU fG mG (ps) fG (ps) mC 464 63 EM2032 EM2032-B mG (ps) mC (ps) mC mC mA mA fA fA fA mG mA mA mU mU mC mC mA (ps) mA (ps) mU 465 64 EM2033 EM2033-A mG (ps) fU (ps) mU fG mA fG mG fG mA fG mU fU mU fU mG fC mU (ps) fG (ps) mG 466 65 EM2033 EM2033-B mC (ps) mC (ps) mA mG mC mA fA fA fA mC mU mC mC mC mU mC mA (ps) mA (ps) mC 467 66 EM2034 EM2034-A mA (ps) fU (ps) mU fA mA fA mA fC mC fC mA fA mU fU mU fU mU (ps) fC (ps) mG 468 67 EM2034 EM2034-B mC (ps) mG (ps) mA mA mA mA fA fU fU mG mG mG mU mU mU mU mA (ps) mA (ps) mU 469 68 EM2035 EM2035-A mA (ps) fG (ps) mU fU mC fU mU fA mC fA mU fU mC fA mA fG mA (ps) fG (ps) mU 470 69 EM2035 EM2035-B mA (ps) mC (ps) mU mC mU mU fG fA fA mU mG mU mA mA mG mA mA (ps) mC (ps) mU 471 70 EM2036 EM2036-A mA (ps) fG (ps) mU fC mA fA mU fC mU fU mC fU mC fA mG fC mA (ps) fA (ps) mA 472 71 EM2036 EM2036-B mU (ps) mU (ps) mU mG mC mU fG fA fG mA mA mG mA mU mU mG mA (ps) mC (ps) mU 473 72 EM2037 EM2037-A mU (ps) fA (ps) mA fC mA fC mU fG mG fU mU fC mU fU mG fC mC (ps) fC (ps) mG 474 73 EM2037 EM2037-B mC (ps) mG (ps) mG mG mC mA fA fG fA mA mC mC mA mG mU mG mU (ps) mU (ps) mA 475 74 EM2038 EM2038-A mA (ps) fU (ps) mA fC mG fG mA fA mG fC mC fC mA fA mG fA mA (ps) fG (ps) mU 476 75 EM2038 EM2038-B mA (ps) mC (ps) mU mU mC mU fU fG fG mG mC mU mU mC mC mG mU (ps) mA (ps) mU 477 76 EM2039 EM2039-A mA (ps) fC (ps) mU fG mA fG mG fG mA fG mU fC mU fU mG fC mU (ps) fG (ps) mC 478 77 EM2039 EM2039-B mG (ps) mC (ps) mA mG mC mA fA fG fA mC mU mC mC mC mU mC mA (ps) mG (ps) mU 479 78 EM2040 EM2040-A mA (ps) fC (ps) mC fU mU fC mC fA mU fC mC fA mG fU mC fA mC (ps) fA (ps) mC 480 79 EM2040 EM2040-B mG (ps) mU (ps) mG mU mG mA fC fU fG mG mA mU mG mG mA mA mG (ps) mG (ps) mU 481 80 EM2041 EM2041-A mA (ps) fC (ps) mU fG mU fG mU fG mG fU mC fC mA fA mG fG mC (ps) fU (ps) mA 482 81 EM2041 EM2041-B mU (ps) mA (ps) mG mC mC mU fU fG fG mA mC mC mA mC mA mC mA (ps) mG (ps) mU 483 82 EM2042 EM2042-A mA (ps) fC (ps) mA fU mU fG mU fG mG fA mU fU mA fC mG fA mG (ps) fG (ps) mC 484 83 EM2042 EM2042-B mG (ps) mC (ps) mC mU mC mG fU fA fA mU mC mC mA mC mA mA mU (ps) mG (ps) mU 485 84 EM2043 EM2043-A mA (ps) fU (ps) mU fG mU fG mC fG mC fA mU fC mC fA mG fC mC (ps) fU (ps) mA 486 85 EM2043 EM2043-B mU (ps) mA (ps) mG mG mC mU fG fG fA mU mG mC mG mC mA mC mA (ps) mA (ps) mU 487 86 EM2044 EM2044-A mU (ps) fC (ps) mA fA mA fC mA fA mG fC mU fG mG fU mC fG mG (ps) fA (ps) mG 488 87 EM2044 EM2044-B mC (ps) mU (ps) mC mC mG mA fC fC fA mG mC mU mU mG mU mU mU (ps) mG (ps) mA 489 88 EM2045 EM2045-A mA (ps) fC (ps) mU fG mU fG mU fG mG fU mC fG mA fA mG fG mC (ps) fU (ps) mU 490 89 EM2045 EM2045-B mA (ps) mA (ps) mG mC mC mU fU fC fG mA mC mC mA mC mA mC mA (ps) mG (ps) mU 491 90 EM2046 EM2046-A mA (ps) fC (ps) mU fU mC fU mU fA mC fA mU fC mC fA mA fG mA (ps) fC (ps) mC 492 91 EM2046 EM2046-B mG (ps) mG (ps) mU mC mU mU fG fG fA mU mG mU mA mA mG mA mA (ps) mG (ps) mU 493 92 EM2047 EM2047-A mU (ps) fC (ps) mG fA mA fC mC fU mG fU mC fC mA fU mC fU mU (ps) fC (ps) mC 494 93 EM2047 EM2047-B mG (ps) mG (ps) mA mA mG mA fU fG fG mA mC mA mG mG mU mU mC (ps) mG (ps) mA 495 94 EM2048 EM2048-A mA (ps) fA (ps) mA fG mG fU mG fG mG fA mG fA mC fU mG fG mG (ps) fG (ps) mG 496 95 EM2048 EM2048-B mC (ps) mC (ps) mC mC mC mA fG fU fC mU mC mC mC mA mC mC mU (ps) mU (ps) mU 497 96 EM2049 EM2049-A mU (ps) fC (ps) mA fC mA fC mU fG mA fG mG fG mG fC mU fG mU (ps) fU (ps) mC 498 97 EM2049 EM2049-B mG (ps) mA (ps) mA mC mA mG fC fC fC mC mU mC mA mG mU mG mU (ps) mG (ps) mA 499 98 EM2050 EM2050-A mA (ps) fC (ps) mG fC mU fC mA fC mU fG mU fU mC fA mU fG mC (ps) fC (ps) mG 500 99 EM2050 EM2050-B mC (ps) mG (ps) mG mC mA mU fG fA fA mC mA mG mU mG mA mG mC (ps) mG (ps) mU 501 100 EM2051 EM2051-A mU (ps) fU (ps) mA fC mG fG mA fA mG fC mC fC mA fA mG fA mA (ps) fU (ps) mC 502 101 EM2051 EM2051-B mG (ps) mA (ps) mU mU mC mU fU fG fG mG mC mU mU mC mC mG mU (ps) mA (ps) mA 503 102 EM2052 EM2052-A mA (ps) fA (ps) mG fU mU fG mG fC mC fA mG fC mA fU mC fC mC (ps) fG (ps) mA 504 103 EM2052 EM2052-B mU (ps) mC (ps) mG mG mG mA fU fG fC mU mG mG mC mC mA mA mC (ps) mU (ps) mU 505 104 EM2053 EM2053-A mU (ps) fA (ps) mA fA mA fA mA fA mU fG mC fU mG fU mU fC mA (ps) fC (ps) mG 506 105 EM2053 EM2053-B mC (ps) mG (ps) mU mG mA mA fC fA fG mC mA mU mU mU mU mU mU (ps) mU (ps) mA 507 106 EM2054 EM2054-A mU (ps) fG (ps) mG fC mA fA mU fG mC fA mA fA mA fA mU fG mU (ps) fG (ps) mC 508 107 EM2054 EM2054-B mG (ps) mC (ps) mA mC mA mU fU fU fU mU mG mC mA mU mU mG mC (ps) mC (ps) mA 509 108 EM2055 EM2055-A mU (ps) fA (ps) mG fU mU fG mG fC mC fA mG fC mA fU mC fC mC (ps) fG (ps) mU 510 109 EM2055 EM2055-B mA (ps) mC (ps) mG mG mG mA fU fG fC mU mG mG mC mC mA mA mC (ps) mU (ps) mA 511 110 EM2056 EM2056-A mA (ps) fU (ps) mU fU mG fU mU fC mU fC mA fA mC fU mU fG mA (ps) fA (ps) mG 512 111 EM2056 EM2056-B mC (ps) mU (ps) mU mC mA mA fG fU fU mG mA mG mA mA mC mA mA (ps) mA (ps) mU 513 112 EM2057 EM2057-A mU (ps) fC (ps) mA fU mU fA mG fA mA fG mA fA mA fA mG fG mU (ps) fG (ps) mG 514 113 EM2057 EM2057-B mC (ps) mC (ps) mA mC mC mU fU fU fU mC mU mU mC mU mA mA mU (ps) mG (ps) mA 515 114 EM2058 EM2058-A mA (ps) fU (ps) mC fA mC fA mA fA mC fA mA fG mC fU mG fG mU (ps) fA (ps) mC 516 115 EM2058 EM2058-B mG (ps) mU (ps) mA mC mC mA fG fC fU mU mG mU mU mU mG mU mG (ps) mA (ps) mU 517 116 EM2059 EM2059-A mA (ps) fU (ps) mC fA mC fA mA fA mC fA mA fG mC fU mG fG mU (ps) fC (ps) mA 518 117 EM2059 EM2059-B mU (ps) mG (ps) mA mC mC mA fG fC fU mU mG mU mU mU mG mU mG (ps) mA (ps) mU 519 118 EM2060 EM2060-A mU (ps) fC (ps) mA fC mA fC mA fG mC fA mA fU mC fA mG fG mA (ps) fA (ps) mG 520 119 EM2060 EM2060-B mC (ps) mU (ps) mU mC mC mU fG fA fU mU mG mC mU mG mU mG mU (ps) mG (ps) mA 521 120 EM2061 EM2061-A mU (ps) fU (ps) mU fG mC fC mU fG mU fA mG fC mC fU mG fU mC (ps) fA (ps) mC 522 121 EM2061 EM2061-B mG (ps) mU (ps) mG mA mC mA fG fG fC mU mA mC mA mG mG mC mA (ps) mA (ps) mA 523 122 EM2062 EM2062-A mA (ps) fC (ps) mA fC mU fU mA fG mA fC mC fA mA fG mG fA mG (ps) fA (ps) mA 524 123 EM2062 EM2062-B mU (ps) mU (ps) mC mU mC mC fU fU fG mG mU mC mU mA mA mG mU (ps) mG (ps) mU 525 124 EM2063 EM2063-A mU (ps) fC (ps) mU fC mU fC mA fU mU fG mU fG mG fA mU fG mA (ps) fC (ps) mA 526 125 EM2063 EM2063-B mU (ps) mG (ps) mU mC mA mU fC fC fA mC mA mA mU mG mA mG mA (ps) mG (ps) mA 527 126 EM2064 EM2064-A mU (ps) fC (ps) mC fA mU fA mC fA mC fA mG fU mA fA mA fC mA (ps) fG (ps) mC 528 127 EM2064 EM2064-B mG (ps) mC (ps) mU mG mU mU fU fA fC mU mG mU mG mU mA mU mG (ps) mG (ps) mA 529 128 EM2065 EM2065-A mA (ps) fC (ps) mA fU mU fA mG fA mA fG mA fC mA fA mG fG mU (ps) fG (ps) mC 530 129 EM2065 EM2065-B mG (ps) mC (ps) mA mC mC mU fU fG fU mC mU mU mC mU mA mA mU (ps) mG (ps) mU 531 130 EM2066 EM2066-A mU (ps) fU (ps) mA fC mG fG mA fA mG fC mC fC mA fA mG fA mA (ps) fG (ps) mC 532 131 EM2066 EM2066-B mG (ps) mC (ps) mU mU mC mU fU fG fG mG mC mU mU mC mC mG mU (ps) mA (ps) mA 533 132 EM2067 EM2067-A mU (ps) fC (ps) mG fU mU fG mG fC mC fA mG fU mA fU mC fC mC (ps) fG (ps) mU 534 133 EM2067 EM2067-B mA (ps) mC (ps) mG mG mG mA fU fA fC mU mG mG mC mC mA mA mC (ps) mG (ps) mA 535 134 EM2068 EM2068-A mA (ps) fC (ps) mU fG mG fA mA fU mU fC mU fC mU fU mU fG mG (ps) fA (ps) mC 536 135 EM2068 EM2068-B mG (ps) mU (ps) mC mC mA mA fA fG fA mG mA mA mU mU mC mC mA (ps) mG (ps) mU 537 136 EM2069 EM2069-A mU (ps) fU (ps) mU fG mA fU mC fA mU fA mC fA mC fA mG fC mA (ps) fA (ps) mA 538 137 EM2069 EM2069-B mU (ps) mU (ps) mU mG mC mU fG fU fG mU mA mU mG mA mU mC mA (ps) mA (ps) mA 539 138 EM2070 EM2070-A mU (ps) fG (ps) mA fC mA fC mU fG mA fG mG fU mG fC mU fG mU (ps) fU (ps) mC 540 139 EM2070 EM2070-B mG (ps) mA (ps) mA mC mA mG fC fA fC mC mU mC mA mG mU mG mU (ps) mC (ps) mA 541 140 EM2071 EM2071-A mA (ps) fA (ps) mC fC mU fG mU fC mA fA mU fC mU fU mC fU mC (ps) fA (ps) mG 542 141 EM2071 EM2071-B mC (ps) mU (ps) mG mA mG mA fA fG fA mU mU mG mA mC mA mG mG (ps) mU (ps) mU 543 142 EM2072 EM2072-A mU (ps) fC (ps) mA fC mG fG mA fA mG fC mC fU mA fA mG fA mA (ps) fG (ps) mC 544 143 EM2072 EM2072-B mG (ps) mC (ps) mU mU mC mU fU fA fG mG mC mU mU mC mC mG mU (ps) mG (ps) mA 545 144 EM2073 EM2073-A mU (ps) fU (ps) mA fG mA fG mA fG mA fG mG fC mC fA mG fG mG (ps) fA (ps) mU 546 145 EM2073 EM2073-B mA (ps) mU (ps) mC mC mC mU fG fG fC mC mU mC mU mC mU mC mU mC mU (ps) mA (ps) mA 547 146 EM2074 EM2074-A mU (ps) fC (ps) mU fC mA fU mU fA mG fA mA fC mA fA mA fA mG (ps) fG (ps) mC 548 147 EM2074 EM2074-B mG (ps) mC (ps) mC mU mU mU fU fG fU mU mC mU mA mA mU mG mA (ps) mG (ps) mA 549 148 EM2075 EM2075-A mA (ps) fU (ps) mU fG mU fG mC fG mC fA mU fC mC fA mG fC mC (ps) fG (ps) mU 550 149 EM2075 EM2075-B mA (ps) mC (ps) mG mG mC mU fG fG fA mU mG mC mG mC mA mC mA (ps) mA (ps) mU 551 150 EM2076 EM2076-A mU (ps) fG (ps) mU fU mC fU mU fA mC fA mU fU mC fA mA fG mA (ps) fC (ps) mA 552 151 EM2076 EM2076-B mU (ps) mG (ps) mU mC mU mU fG fA fA mU mG mU mA mA mG mA mA (ps) mC (ps) mA 553 152 EM2077 EM2077-A mA (ps) fG (ps) mU fU mU fC mU fU mC fA mU fC mC fA mG fU mU (ps) fG (ps) mA 554 153 EM2077 EM2077-B mU (ps) mC (ps) mA mA mC mU fG fG fA mU mG mA mA mG mA mA mA (ps) mC (ps) mU 555 154 EM2078 EM2078-A mA (ps) fC (ps) mU fU mG fU mU fC mU fC mA fU mC fU mU fG mA (ps) fA (ps) mG 556 155 EM2078 EM2078-B mC (ps) mU (ps) mU mC mA mA fG fA fU mG mA mG mA mA mC mA mA (ps) mG (ps) mU 557 156 EM2079 EM2079-A mU (ps) fU (ps) mU fA mA fA mA fC mC fC mA fA mU fU mU fU mU (ps) fG (ps) mU 558 157 EM2079 EM2079-B mA (ps) mC (ps) mA mA mA mA fA fU fU mG mG mG mU mU mU mU mA (ps) mA (ps) mA 559 158 EM2080 EM2080-A mA (ps) fU (ps) mU fG mA fU mC fA mU fA mC fA mC fA mG fC mA (ps) fC (ps) mG 560 159 EM2080 EM2080-B mC (ps) mG (ps) mU mG mC mU fG fU fG mU mA mU mG mA mU mC mA (ps) mA (ps) mU 561 160 EM2081 EM2081-A mU (ps) fC (ps) mG fA mA fA mA fG mG fU mG fC mG fA mG fA mC (ps) fU (ps) mA 562 161 EM2081 EM2081-B mU (ps) mA (ps) mG mU mC mU fC fG fC mA mC mC mU mU mU mU mC (ps) mG (ps) mA 563 162 EM2082 EM2082-A mC (ps) fC (ps) mU fG mU fC mA fA mU fC mU fU mC fU mC fA mG (ps) fC (ps) mA 564 163 EM2082 EM2082-B mU (ps) mG (ps) mC mU mG mA fG fA fA mG mA mU mU mG mA mC mA (ps) mG (ps) mG 565 164 EM2083 EM2083-A mA (ps) fA (ps) mU fU mU fU mU fG mC fA mG fG mU fU mC fA mG (ps) fC (ps) mU 566 165 EM2083 EM2083-B mA (ps) mG (ps) mC mU mG mA fA fC fC mU mG mC mA mA mA mA mA (ps) mU (ps) mU 567 166 EM2084 EM2084-A mA (ps) fU (ps) mA fC mA fC mA fG mC fA mA fA mC fA mG fG mA (ps) fA (ps) mU 568 167 EM2084 EM2084-B mA (ps) mU (ps) mU mC mC mU fG fU fU mU mG mC mU mG mU mG mU (ps) mA (ps) mU 569 168 EM2085 EM2085-A mA (ps) fC (ps) mU fU mU fG mC fA mG fG mU fA mC fA mG fC mU (ps) fC (ps) mU 570 169 EM2085 EM2085-B mA (ps) mG (ps) mA mG mC mU fG fU fA mC mC mU mG mC mA mA mA (ps) mG (ps) mU 571 170 EM2086 EM2086-A mA (ps) fU (ps) mA fG mA fC mC fA mA fG mG fA mG fA mA fA mC (ps) fG (ps) mC 572 171 EM2086 EM2086-B mG (ps) mC (ps) mG mU mU mU fC fU fC mC mU mU mG mG mU mC mU (ps) mA (ps) mU 573 172 EM2087 EM2087-A mA (ps) fC (ps) mU fU mA fG mA fC mC fA mA fG mG fA mG fA mA (ps) fA (ps) mC 574 173 EM2087 EM2087-B mG (ps) mU (ps) mU mU mC mU fC fC fU mU mG mG mU mC mU mA mA (ps) mG (ps) mU 575 174 EM2088 EM2088-A mA (ps) fC (ps) mG fU mU fU mC fA mC fA mA fG mC fA mA fG mC (ps) fU (ps) mC 576 175 EM2088 EM2088-B mG (ps) mA (ps) mG mC mU mU fG fC fU mU mG mU mG mA mA mA mC (ps) mG (ps) mU 577 176 EM2089 EM2089-A mA (ps) fC (ps) mU fG mU fC mA fA mU fC mU fG mC fU mC fA mG (ps) fC (ps) mU 578 177 EM2089 EM2089-B mA (ps) mG (ps) mC mU mG mA fG fC fA mG mA mU mU mG mA mC mA (ps) mG (ps) mU 579 178 EM2090 EM2090-A mU (ps) fC (ps) mA fC mA fA mA fC mG fG mC fA mG fC mU fU mC (ps) fA (ps) mU 580 179 EM2090 EM2090-B mA (ps) mU (ps) mG mA mA mG fC fU fG mC mC mG mU mU mU mG mU (ps) mG (ps) mA 581 180 EM2091 EM2091-A mA (ps) fG (ps) mA fC mA fC mU fG mA fG mG fU mG fC mU fG mU (ps) fU (ps) mG 582 181 EM2091 EM2091-B mC (ps) mA (ps) mA mC mA mG fC fA fC mC mU mC mA mG mU mG mU (ps) mC (ps) mU 583 182 EM2092 EM2092-A mU (ps) fC (ps) mU fU mA fG mA fC mC fA mA fG mG fA mG fA mA (ps) fA (ps) mU 584 183 EM2092 EM2092-B mA (ps) mU (ps) mU mU mC mU fC fC fU mU mG mG mU mC mU mA mA (ps) mG (ps) mA 585 184 EM2093 EM2093-A mA (ps) fU (ps) mU fU mA fA mA fA mC fC mC fA mA fU mU fU mU (ps) fG (ps) mC 586 185 EM2093 EM2093-B mG (ps) mC (ps) mA mA mA mA fU fU fG mG mG mU mU mU mU mA mA (ps) mA (ps) mU 587 186 EM2094 EM2094-A mU (ps) fG (ps) mU fU mU fC mA fC mA fA mA fC mA fA mG fC mU (ps) fG (ps) mG 588 187 EM2094 EM2094-B mC (ps) mC (ps) mA mG mC mU fU fG fU mU mU mG mU mG mA mA mA mA (ps) mC (ps) mA 589 188 EM2095 EM2095-A mU (ps) fC (ps) mA fC mA fC mU fG mG fU mU fG mU fU mG fC mC (ps) fU (ps) mG 590 189 EM2095 EM2095-B mC (ps) mA (ps) mG mG mC mA fA fC fA mA mC mC mA mG mU mG mU (ps) mG (ps) mA 591 190 EM2096 EM2096-A mU (ps) fC (ps) mA fA mA fA mA fA mU fG mC fG mG fU mU fC mA (ps) fG (ps) mU 592 191 EM2096 EM2096-B mA (ps) mC (ps) mU mG mA mA fC fC fG mC mA mU mU mU mU mU mU (ps) mG (ps) mA 593 192 EM2097 EM2097-A mU (ps) fA (ps) mG fA mA fA mA fG mG fU mG fG mG fA mG fA mC (ps) fA (ps) mU 594 193 EM2097 EM2097-B mA (ps) mU (ps) mG mU mC mU fC fC fC mA mC mC mU mU mU mU mC (ps) mU (ps) mA 595 194 EM2098 EM2098-A mU (ps) fU (ps) mU fG mC fC mU fG mU fA mG fC mC fU mG fU mC (ps) fG (ps) mC 596 195 EM2098 EM2098-B mG (ps) mC (ps) mG mA mC mA fG fG fC mU mA mC mA mG mG mC mA (ps) mA (ps) mA 597 196 EM2099 EM2099-A mU (ps) fC (ps) mA fC mU fU mA fG mA fC mC fU mA fG mG fA mG (ps) fA (ps) mG 598 197 EM2099 EM2099-B mC (ps) mU (ps) mC mU mC mC fU fA fG mG mU mC mU mA mA mG mU (ps) mG (ps) mA 599 198 EM2100 EM2100-A mU (ps) fC (ps) mG fA mC fG mA fG mG fU mG fC mA fA mG fG mG (ps) fG (ps) mG 600 199 EM2100 EM2100-B mC (ps) mC (ps) mC mC mC mU fU fG fC mA mC mC mU mC mG mU mC (ps) mG (ps) mA 601 200 EM2101 EM2101-A mU (ps) fC (ps) mU fA mA fA mA fU mA fA mA fC mC fC mA fG mC (ps) fA (ps) mA 602 201 EM2101 EM2101-B mU (ps) mU (ps) mG mC mU mG fG fG fU mU mU mA mU mU mU mU mA (ps) mG (ps) mA 603 202 EM2102 EM2102-A mU (ps) fC (ps) mU fU mU fC mU fU mC fA mU fU mC fA mG fU mU (ps) fG (ps) mC 604 203 EM2102 EM2102-B mG (ps) mC (ps) mA mA mC mU fG fA fA mU mG mA mA mG mA mA mA (ps) mG (ps) mA 605 204 EM2103 EM2103-A mU (ps) fA (ps) mA fG mG fU mG fG mG fA mG fA mC fU mG fG mG (ps) fA (ps) mA 606 205 EM2103 EM2103-B mU (ps) mU (ps) mC mC mC mA fG fU fC mU mC mC mC mA mC mC mU (ps) mU (ps) mA 607 206 EM2104 EM2104-A mA (ps) fG (ps) mU fU mU fC mA fC mA fA mA fC mA fA mG fC mU (ps) fG (ps) mU 608 207 EM2104 EM2104-B mA (ps) mC (ps) mA mG mC mU fU fG fU mU mU mG mU mG mA mA mA (ps) mC (ps) mU 609 208 EM2105 EM2105-A mA (ps) fA (ps) mG fC mU fC mA fC mU fG mU fG mC fA mU fG mC (ps) fC (ps) mG 610 209 EM2105 EM2105-B mC (ps) mG (ps) mG mC mA mU fG fC fA mC mA mG mU mG mA mG mC (ps) mU (ps) mU 611 210 EM2106 EM2106-A mA (ps) fC (ps) mU fG mU fC mA fA mU fC mU fU mC fU mC fA mG (ps) fA (ps) mC 612 211 EM2106 EM2106-B mG (ps) mU (ps) mC mU mG mA fG fA fA mG mA mU mU mG mA mC mA (ps) mG (ps) mU 613 212 EM2107 EM2107-A mA (ps) fA (ps) mU fU mU fU mA fA mA fA mC fC mC fA mA fU mU (ps) fU (ps) mU 614 213 EM2107 EM2107-B mA (ps) mA (ps) mA mA mU mU fG fG fG mU mU mU mU mA mA mA mA (ps) mU (ps) mU 615 214 EM2108 EM2108-A mU (ps) fU (ps) mA fC mA fC mA fG mC fA mA fA mC fA mG fG mA (ps) fA (ps) mC 616 215 EM2108 EM2108-B mG (ps) mU (ps) mU mC mC mU fG fU fU mU mG mC mU mG mU mG mU (ps) mA (ps) mA 617 216 EM2109 EM2109-A mU (ps) fU (ps) mC fA mU fA mC fA mC fA mG fC mA fA mA fC mA (ps) fC (ps) mU 618 217 EM2109 EM2109-B mA (ps) mG (ps) mU mG mU mU fU fG fC mU mG mU mG mU mA mU mG (ps) mA (ps) mA 619 218 EM2110 EM2110-A mA (ps) fU (ps) mG fU mC fC mA fC mC fC mA fG mA fA mC fU mC (ps) fG (ps) mC 620 219 EM2110 EM2110-B mG (ps) mC (ps) mG mA mG mU fU fC fU mG mG mG mU mG mG mA mC (ps) mA (ps) mU 621 220 EM2111 EM2111-A mU (ps) fU (ps) mC fA mU fA mC fA mC fA mG fC mA fA mA fC mA (ps) fG (ps) mC 622 221 EM2111 EM2111-B mG (ps) mC (ps) mU mG mU mU fU fG fC mU mG mU mG mU mA mU mG (ps) mA (ps) mA 623 222 EM2112 EM2112-A mA (ps) fC (ps) mG fU mC fC mA fC mC fC mA fU mA fA mC fU mC (ps) fC (ps) mG 624 223 EM2112 EM2112-B mC (ps) mG (ps) mG mA mG mU fU fA fU mG mG mG mU mG mG mA mC (ps) mG (ps) mU 625 224 EM2113 EM2113-A mU (ps) fU (ps) mG fA mA fC mC fU mG fU mC fA mA fU mC fU mU (ps) fC (ps) mG 626 225 EM2113 EM2113-B mC (ps) mG (ps) mA mA mG mA fU fU fG mA mC mA mG mG mU mU mC (ps) mA (ps) mA 627 226 EM2114 EM2114-A mA (ps) fC (ps) mA fG mA fC mC fA mA fG mG fU mG fA mA fA mC (ps) fG (ps) mC 628 227 EM2114 EM2114-B mG (ps) mC (ps) mG mU mU mU fC fA fC mC mU mU mG mG mU mC mU (ps) mG (ps) mU 629 228 EM2115 EM2115-A mU (ps) fU (ps) mC fA mC fA mA fA mC fA mA fG mC fU mG fG mU (ps) fC (ps) mG 630 229 EM2115 EM2115-B mC (ps) mG (ps) mA mC mC mA fG fC fU mU mG mU mU mU mG mU mG (ps) mA (ps) mA 631 230 EM2116 EM2116-A mA (ps) fA (ps) mA fC mA fC mU fG mG fU mU fC mU fU mG fC mC (ps) fU (ps) mC 632 231 EM2116 EM2116-B mG (ps) mA (ps) mG mG mC mA fA fG fA mA mC mC mA mG mU mG mU (ps) mU (ps) mU 633 232 EM2117 EM2117-A mA (ps) fC (ps) mU fU mG fU mU fU mC fA mC fG mA fA mC fA mA (ps) fG (ps) mA 634 233 EM2117 EM2117-B mU (ps) mC (ps) mU mU mG mU fU fC fG mU mG mA mA mA mC mA mA (ps) mG (ps) mU 635 234 EM2118 EM2118-A mU (ps) fC (ps) mU fU mU fU mU fG mU fU mC fA mC fA mA fC mU (ps) fU (ps) mC 636 235 EM2118 EM2118-B mG (ps) mA (ps) mA mG mU mU fG fU fG mA mA mC mA mA mA mA mA (ps) mG (ps) mA 637 236 EM2119 EM2119-A mA (ps) fU (ps) mG fA mA fC mC fU mG fU mC fA mA fU mC fU mU (ps) fC (ps) mU 638 237 EM2119 EM2119-B mA (ps) mG (ps) mA mA mG mA fU fU fG mA mC mA mG mG mU mU mC (ps) mA (ps) mU 639 238 EM2120 EM2120-A mU (ps) fC (ps) mU fC mA fU mU fA mG fA mA fG mA fA mA fA mG (ps) fG (ps) mC 640 239 EM2120 EM2120-B mG (ps) mC (ps) mC mU mU mU fU fC fU mU mC mU mA mA mU mG mA (ps) mG (ps) mA 641 240 EM2121 EM2121-A mA (ps) fC (ps) mU fC mA fA mU fU mU fU mU fG mC fA mG fG mU (ps) fC (ps) mG 642 241 EM2121 EM2121-B mC (ps) mG (ps) mA mC mC mU fG fC fA mA mA mA mA mU mU mG mA (ps) mG (ps) mU 643 242 EM2122 EM2122-A mU (ps) fC (ps) mU fG mU fG mC fG mC fA mU fU mC fA mG fC mC (ps) fG (ps) mA 644 243 EM2122 EM2122-B mU (ps) mC (ps) mG mG mC mU fG fA fA mU mG mC mG mC mA mC mA (ps) mG (ps) mA 645 244 EM2123 EM2123-A mA (ps) fU (ps) mU fG mA fG mG fG mA fG mU fU mU fU mG fC mU (ps) fG (ps) mC 646 245 EM2123 EM2123-B mG (ps) mC (ps) mA mG mC mA fA fA fA mC mU mC mC mC mU mC mA (ps) mA (ps) mU 647 246 EM2124 EM2124-A mU (ps) fA (ps) mG fC mU fC mA fC mU fG mU fG mC fA mU fG mC (ps) fC (ps) mA 648 247 EM2124 EM2124-B mU (ps) mG (ps) mG mC mA mU fG fC fA mC mA mG mU mG mA mG mC (ps) mU (ps) mA 649 248 EM2125 EM2125-A mU (ps) fC (ps) mA fC mA fA mA fC mG fG mC fU mG fC mU fU mC (ps) fU (ps) mU 650 249 EM2125 EM2125-B mA (ps) mA (ps) mG mA mA mG fC fA fG mC mC mG mU mU mU mG mU (ps) mG (ps) mA 651 250 EM2126 EM2126-A mA (ps) fC (ps) mU fC mA fU mU fA mG fA mA fG mA fA mA fA mG (ps) fG (ps) mU 652 251 EM2126 EM2126-B mA (ps) mC (ps) mC mU mU mU fU fC fU mU mC mU mA mA mU mG mA (ps) mG (ps) mU 653 252 EM2127 EM2127-A mA (ps) fU (ps) mG fA mC fG mA fG mG fU mG fG mA fA mG fG mG (ps) fG (ps) mU 654 253 EM2127 EM2127-B mA (ps) mC (ps) mC mC mC mU fU fC fC mA mC mC mU mC mG mU mC (ps) mA (ps) mU 655 254 EM2128 EM2128-A mU (ps) fC (ps) mU fU mU fU mU fG mC fA mG fU mU fU mC fA mG (ps) fC (ps) mA 656 255 EM2128 EM2128-B mU (ps) mG (ps) mC mU mG mA fA fA fC mU mG mC mA mA mA mA mA mA (ps) mG (ps) mA 657 256 EM2129 EM2129-A mA (ps) fU (ps) mC fU mU fC mC fA mU fC mC fU mG fU mC fA mC (ps) fU (ps) mC 658 257 EM2129 EM2129-B mG (ps) mA (ps) mG mU mG mA fC fA fG mG mA mU mG mG mA mA mG (ps) mA (ps) mU 659 258 EM2130 EM2130-A mU (ps) fC (ps) mU fC mA fU mU fA mG fA mA fG mA fA mA fA mG (ps) fU (ps) mC 660 259 EM2130 EM2130-B mG (ps) mA (ps) mC mU mU mU fU fC fU mU mC mU mA mA mU mG mA (ps) mG (ps) mA 661 260 EM2131 EM2131-A mA (ps) fU (ps) mU fG mA fU mC fA mU fA mC fA mC fA mG fC mA (ps) fA (ps) mG 662 261 EM2131 EM2131-B mC (ps) mU (ps) mU mG mC mU fG fU fG mU mA mU mG mA mU mC mA (ps) mA (ps) mU 663 262 EM2132 EM2132-A mU (ps) fC (ps) mA fG mG fU mG fG mG fA mG fG mC fU mG fG mG (ps) fG (ps) mA 664 263 EM2132 EM2132-B mU (ps) mC (ps) mC mC mC mA fG fC fC mU mC mC mC mA mC mC mU (ps) mG (ps) mA 665 264 EM2133 EM2133-A mG (ps) fC (ps) mA fA mA fC mA fA mG fC mU fG mG fU mC fG mG (ps) fU (ps) mC 666 265 EM2133 EM2133-B mG (ps) mA (ps) mC mC mG mA fC fC fA mG mC mU mU mG mU mU mU (ps) mG (ps) mC 667 266 EM2134 EM2134-A mA (ps) fU (ps) mU fU mG fU mU fU mC fA mC fA mA fA mC fA mA (ps) fG (ps) mG 668 267 EM2134 EM2134-B mC (ps) mC (ps) mU mU mG mU fU fU fG mU mG mA mA mA mC mA mA (ps) mA (ps) mU 669 268 EM2135 EM2135-A mU (ps) fC (ps) mU fU mA fG mA fC mC fA mA fC mG fA mG fA mA (ps) fA (ps) mU 670 269 EM2135 EM2135-B mA (ps) mU (ps) mU mU mC mU fC fG fU mU mG mG mU mC mU mA mA (ps) mG (ps) mA 671 270 EM2136 EM2136-A mA (ps) fU (ps) mU fU mU fG mC fA mG fG mU fU mC fA mG fC mU (ps) fU (ps) mC 672 271 EM2136 EM2136-B mG (ps) mA (ps) mA mG mC mU fG fA fA mC mC mU mG mC mA mA mA (ps) mA (ps) mU 673 272 EM2137 EM2137-A mA (ps) fU (ps) mU fG mA fG mG fG mA fG mU fU mU fU mG fC mU (ps) fA (ps) mC 674 273 EM2137 EM2137-B mG (ps) mU (ps) mA mG mC mA fA fA fA mC mU mC mC mC mU mC mA (ps) mA (ps) mU 675 274 EM2138 EM2138-A mU (ps) fU (ps) mA fG mA fG mA fG mA fG mG fC mC fA mG fG mG (ps) fU (ps) mC 676 275 EM2138 EM2138-B mG (ps) mA (ps) mC mC mC mU fG fG fC mC mU mC mU mC mU mC mU (ps) mA (ps) mA 677 276 EM2139 EM2139-A mA (ps) fA (ps) mA fU mA fC mA fA mA fC mC fG mA fA mG fG mC (ps) fA (ps) mA 678 277 EM2139 EM2139-B mU (ps) mU (ps) mG mC mC mU fU fC fG mG mU mU mU mG mU mA mU (ps) mU (ps) mU 679 278 EM2140 EM2140-A mA (ps) fC (ps) mU fC mU fC mA fU mU fG mU fG mG fA mU fG mA (ps) fC (ps) mG 680 279 EM2140 EM2140-B mC (ps) mG (ps) mU mC mA mU fC fC fA mC mA mA mU mG mA mG mA (ps) mG (ps) mU 681 280 EM2141 EM2141-A mU (ps) fA (ps) mU fU mU fU mA fA mA fA mC fC mC fA mA fU mU (ps) fG (ps) mC 682 281 EM2141 EM2141-B mG (ps) mC (ps) mA mA mU mU fG fG fG mU mU mU mU mA mA mA mA mA (ps) mU (ps) mA 683 282 EM2142 EM2142-A mU (ps) fU (ps) mG fA mC fG mA fG mG fU mG fG mA fA mG fG mG (ps) fG (ps) mG 684 283 EM2142 EM2142-B mC (ps) mC (ps) mC mC mC mU fU fC fC mA mC mC mU mC mG mU mC (ps) mA (ps) mA 685 284 EM2143 EM2143-A mU (ps) fU (ps) mU fU mA fA mA fA mC fC mC fA mA fU mU fU mU (ps) fU (ps) mG 686 285 EM2143 EM2143-B mC (ps) mA (ps) mA mA mA mA fU fU fG mG mG mU mU mU mU mA mA (ps) mA (ps) mA 687 286 EM2144 EM2144-A mU (ps) fG (ps) mA fC mA fC mU fG mA fG mG fU mG fC mU fG mU (ps) fA (ps) mA 688 287 EM2144 EM2144-B mU (ps) mU (ps) mA mC mA mG fC fA fC mC mU mC mA mG mU mG mU (ps) mC (ps) mA 689 288 EM2145 EM2145-A mU (ps) fA (ps) mU fU mU fU mU fG mU fU mC fU mC fA mA fC mU (ps) fG (ps) mC 690 289 EM2145 EM2145-B mG (ps) mC (ps) mA mG mU mU fG fA fG mA mA mC mA mA mA mA mA (ps) mU (ps) mA 691 290 EM2146 EM2146-A mU (ps) fC (ps) mU fC mU fC mA fU mU fG mU fG mG fA mU fG mA (ps) fA (ps) mC 692 291 EM2146 EM2146-B mG (ps) mU (ps) mU mC mA mU fC fC fA mC mA mA mU mG mA mG mA (ps) mG (ps) mA 693 292 EM2147 EM2147-A mU (ps) fC (ps) mA fC mA fA mA fC mG fG mC fU mG fC mU fU mC (ps) fA (ps) mU 694 293 EM2147 EM2147-B mA (ps) mU (ps) mG mA mA mG fC fA fG mC mC mG mU mU mU mG mU (ps) mG (ps) mA 695 294 EM2148 EM2148-A mU (ps) fC (ps) mU fU mA fG mA fC mC fA mA fG mG fA mG fA mA (ps) fC (ps) mU 696 295 EM2148 EM2148-B mA (ps) mG (ps) mU mU mC mU fC fC fU mU mG mG mU mC mU mA mA (ps) mG (ps) mA 697 296 EM2149 EM2149-A mG (ps) fC (ps) mU fC mA fA mU fU mU fU mU fG mC fA mG fG mU (ps) fU (ps) mC 698 297 EM2149 EM2149-B mG (ps) mA (ps) mA mC mC mU fG fC fA mA mA mA mA mU mU mG mA (ps) mG (ps) mC 699 298 EM2150 EM2150-A mU (ps) fC (ps) mU fU mU fU mA fA mA fA mC fU mC fA mA fU mU (ps) fU (ps) mG 700 299 EM2150 EM2150-B mC (ps) mA (ps) mA mA mU mU fG fA fG mU mU mU mU mA mA mA mA mA (ps) mG (ps) mA 701 300 EM2151 EM2151-A mU (ps) fC (ps) mU fG mC fC mU fG mU fA mG fU mC fU mG fU mC (ps) fA (ps) mC 702 301 EM2151 EM2151-B mG (ps) mU (ps) mG mA mC mA fG fA fC mU mA mC mA mG mG mC mA (ps) mG (ps) mA 703 302 EM2152 EM2152-A mU (ps) fA (ps) mA fU mA fC mA fA mA fC mC fG mA fA mG fG mC (ps) fG (ps) mU 704 303 EM2152 EM2152-B mA (ps) mC (ps) mG mC mC mU fU fC fG mG mU mU mU mG mU mA mU (ps) mU (ps) mA 705 304 EM2153 EM2153-A mA (ps) fU (ps) mU fG mG fA mA fU mU fC mU fU mU fU mU fG mG (ps) fA (ps) mC 706 305 EM2153 EM2153-B mG (ps) mU (ps) mC mC mA mA fA fA fA mG mA mA mU mU mC mC mA (ps) mA (ps) mU 707 306 EM2154 EM2154-A mA (ps) fU (ps) mA fG mA fC mC fA mA fG mG fA mG fA mA fA mC (ps) fA (ps) mC 708 307 EM2154 EM2154-B mG (ps) mU (ps) mG mU mU mU fC fU fC mC mU mU mG mG mU mC mU (ps) mA (ps) mU 709 308 EM2155 EM2155-A mU (ps) fA (ps) mU fU mU fU mU fG mC fA mG fG mU fU mC fA mG (ps) fA (ps) mA 710 309 EM2155 EM2155-B mU (ps) mU (ps) mC mU mG mA fA fC fC mU mG mC mA mA mA mA mA mA (ps) mU (ps) mA 711 310 EM2156 EM2156-A mU (ps) fA (ps) mU fU mU fU mA fA mA fA mC fC mC fA mA fU mU (ps) fU (ps) mG 712 311 EM2156 EM2156-B mC (ps) mA (ps) mA mA mU mU fG fG fG mU mU mU mU mA mA mA mA mA (ps) mU (ps) mA 713 312 EM2157 EM2157-A mU (ps) fC (ps) mA fA mA fC mA fA mG fC mU fC mG fU mC fG mG (ps) fU (ps) mA 714 313 EM2157 EM2157-B mU (ps) mA (ps) mC mC mG mA fC fG fA mG mC mU mU mG mU mU mU (ps) mG (ps) mA 715 314 EM2158 EM2158-A mA (ps) fC (ps) mA fU mU fA mG fA mA fG mA fA mA fA mG fG mU (ps) fC (ps) mC 716 315 EM2158 EM2158-B mG (ps) mG (ps) mA mC mC mU fU fU fU mC mU mU mC mU mA mA mU (ps) mG (ps) mU 717 316 EM2159 EM2159-A mU (ps) fC (ps) mA fU mU fG mU fG mG fA mU fG mA fC mG fA mG (ps) fG (ps) mU 718 317 EM2159 EM2159-B mA (ps) mC (ps) mC mU mC mG fU fC fA mU mC mC mA mC mA mA mU (ps) mG (ps) mA 719 318 EM2160 EM2160-A mA (ps) fU (ps) mG fU mC fC mA fC mC fC mA fG mA fA mC fU mC (ps) fC (ps) mG 720 319 EM2160 EM2160-B mC (ps) mG (ps) mG mA mG mU fU fC fU mG mG mG mU mG mG mA mC (ps) mA (ps) mU 721 320 EM2161 EM2161-A mA (ps) fC (ps) mU fC mA fA mU fU mU fU mU fG mC fA mG fG mU (ps) fU (ps) mU 722 321 EM2161 EM2161-B mA (ps) mA (ps) mA mC mC mU fG fC fA mA mA mA mA mU mU mG mA (ps) mG (ps) mU 723 322 EM2162 EM2162-A mU (ps) fG (ps) mU fC mA fA mU fC mU fU mC fU mC fA mG fC mA (ps) fG (ps) mC 724 323 EM2162 EM2162-B mG (ps) mC (ps) mU mG mC mU fG fA fG mA mA mG mA mU mU mG mA (ps) mC (ps) mA 725 324 EM2163 EM2163-A mA (ps) fU (ps) mU fU mG fU mU fC mU fC mA fA mC fU mU fG mA (ps) fC (ps) mU 726 325 EM2163 EM2163-B mA (ps) mG (ps) mU mC mA mA fG fU fU mG mA mG mA mA mC mA mA (ps) mA (ps) mU 727 326 EM2164 EM2164-A mU (ps) fU (ps) mU fU mG fU mU fU mC fA mC fA mA fA mC fA mA (ps) fG (ps) mC 728 327 EM2164 EM2164-B mG (ps) mC (ps) mU mU mG mU fU fU fG mU mG mA mA mA mC mA mA (ps) mA (ps) mA 729 328 EM2165 EM2165-A mA (ps) fU (ps) mC fU mU fC mC fA mU fC mC fU mG fU mC fA mC (ps) fA (ps) mC 730 329 EM2165 EM2165-B mG (ps) mU (ps) mG mU mG mA fC fA fG mG mA mU mG mG mA mA mG (ps) mA (ps) mU 731 330 EM2166 EM2166-A mA (ps) fU (ps) mU fA mA fA mA fC mC fC mA fA mU fU mU fU mU (ps) fG (ps) mC 732 331 EM2166 EM2166-B mG (ps) mC (ps) mA mA mA mA fA fU fU mG mG mG mU mU mU mU mA (ps) mA (ps) mU 733 332 EM2167 EM2167-A mA (ps) fG (ps) mU fU mC fU mU fA mC fA mU fU mC fA mA fG mA (ps) fC (ps) mG 734 333 EM2167 EM2167-B mC (ps) mG (ps) mU mC mU mU fG fA fA mU mG mU mA mA mG mA mA (ps) mC (ps) mU 735 334 EM2168 EM2168-A mA (ps) fC (ps) mA fU mU fA mG fA mA fG mA fA mA fA mG fG mU (ps) fG (ps) mC 736 335 EM2168 EM2168-B mG (ps) mC (ps) mA mC mC mU fU fU fU mC mU mU mC mU mA mA mU (ps) mG (ps) mU 737 336 EM2169 EM2169-A mA (ps) fU (ps) mG fU mU fU mC fA mC fA mA fA mC fA mA fG mC (ps) fG (ps) mC 738 337 EM2169 EM2169-B mG (ps) mC (ps) mG mC mU mU fG fU fU mU mG mU mG mA mA mA mC (ps) mA (ps) mU 739 338 EM2170 EM2170-A mU (ps) fU (ps) mG fU mC fC mA fC mC fC mA fG mA fA mC fU mC (ps) fC (ps) mU 740 339 EM2170 EM2170-B mA (ps) mG (ps) mG mA mG mU fU fC fU mG mG mG mU mG mG mA mC (ps) mA (ps) mA 741 340 EM2171 EM2171-A mA (ps) fA (ps) mU fU mU fU mU fG mU fU mC fU mC fA mA fC mU (ps) fU (ps) mG 742 341 EM2171 EM2171-B mC (ps) mA (ps) mA mG mU mU fG fA fG mA mA mC mA mA mA mA mA (ps) mU (ps) mU 743 342 EM2172 EM2172-A mA (ps) fU (ps) mU fU mU fG mC fA mG fG mU fU mC fA mG fC mU (ps) fC (ps) mU 744 343 EM2172 EM2172-B mA (ps) mG (ps) mA mG mC mU fG fA fA mC mC mU mG mC mA mA mA (ps) mA (ps) mU 745 344 EM2173 EM2173-A mU (ps) fU (ps) mU fU mG fU mU fC mU fC mA fA mC fU mU fG mA (ps) fA (ps) mA 746 345 EM2173 EM2173-B mU (ps) mU (ps) mU mC mA mA fG fU fU mG mA mG mA mA mC mA mA (ps) mA (ps) mA 747 346 EM2174 EM2174-A mG (ps) fC (ps) mU fG mU fG mU fG mG fU mC fC mA fA mG fG mC (ps) fU (ps) mC 748 347 EM2174 EM2174-B mG (ps) mA (ps) mG mC mC mU fU fG fG mA mC mC mA mC mA mC mA mC mA (ps) mG (ps) mC 749 348 EM2175 EM2175-A mU (ps) fU (ps) mG fA mC fG mA fG mG fU mG fG mA fA mG fG mG (ps) fA (ps) mC 750 349 EM2175 EM2175-B mG (ps) mU (ps) mC mC mC mU fU fC fC mA mC mC mU mC mG mU mC (ps) mA (ps) mA 751 350 EM2176 EM2176-A mU (ps) fC (ps) mU fC mU fC mA fU mU fG mU fU mG fA mU fG mA (ps) fC (ps) mA 752 351 EM2176 EM2176-B mU (ps) mG (ps) mU mC mA mU fC fA fA mC mA mA mU mG mA mG mA (ps) mG (ps) mA 753 352 EM2177 EM2177-A mG (ps) fC (ps) mA fC mA fA mA fC mG fG mC fU mG fC mU fU mC (ps) fA (ps) mG 754 353 EM2177 EM2177-B mC (ps) mU (ps) mG mA mA mG fC fA fG mC mC mG mU mU mU mG mU (ps) mG (ps) mC 755 354 EM2178 EM2178-A mU (ps) fU (ps) mU fU mU fG mC fA mG fG mU fU mC fA mG fC mU (ps) fC (ps) mG 756 355 EM2178 EM2178-B mC (ps) mG (ps) mA mG mC mU fG fA fA mC mC mU mG mC mA mA mA mA (ps) mA (ps) mA 757 356 EM2179 EM2179-A mU (ps) fC (ps) mA fC mU fU mA fG mA fC mC fA mA fG mG fA mG (ps) fA (ps) mG 758 357 EM2179 EM2179-B mC (ps) mU (ps) mC mU mC mC fU fU fG mG mU mC mU mA mA mG mU (ps) mG (ps) mA 759 358 EM2180 EM2180-A mA (ps) fA (ps) mA fA mA fA mA fA mU fG mC fU mG fU mU fC mA (ps) fG (ps) mC 760 359 EM2180 EM2180-B mG (ps) mC (ps) mU mG mA mA fC fA fG mC mA mU mU mU mU mU mU (ps) mU (ps) mU 761 360 EM2181 EM2181-A mU (ps) fC (ps) mA fG mA fG mA fG mA fG mG fU mC fA mG fG mG (ps) fU (ps) mA 762 361 EM2181 EM2181-B mU (ps) mA (ps) mC mC mC mU fG fA fC mC mU mC mU mC mU mC mU (ps) mG (ps) mA 763 362 EM2182 EM2182-A mA (ps) fC (ps) mA fU mU fG mU fG mG fA mU fG mA fC mG fA mG (ps) fG (ps) mG 764 363 EM2182 EM2182-B mC (ps) mC (ps) mC mU mC mG fU fC fA mU mC mC mA mC mA mA mU (ps) mG (ps) mU 765 364 EM2183 EM2183-A mA (ps) fC (ps) mU fA mA fA mA fU mA fA mA fG mC fC mA fG mC (ps) fA (ps) mU 766 365 EM2183 EM2183-B mA (ps) mU (ps) mG mC mU mG fG fC fU mU mU mA mU mU mU mU mA (ps) mG (ps) mU 767 366 EM2184 EM2184-A mA (ps) fC (ps) mU fC mA fA mU fU mU fU mU fC mC fA mG fG mU (ps) fU (ps) mG 768 367 EM2184 EM2184-B mC (ps) mA (ps) mA mC mC mU fG fG fA mA mA mA mA mU mU mG mA (ps) mG (ps) mU 769 368 EM2185 EM2185-A mU (ps) fA (ps) mU fU mU fU mU fG mC fA mG fG mU fU mC fA mG (ps) fC (ps) mG 770 369 EM2185 EM2185-B mC (ps) mG (ps) mC mU mG mA fA fC fC mU mG mC mA mA mA mA mA mA (ps) mU (ps) mA 771 370 EM2186 EM2186-A mA (ps) fU (ps) mC fA mU fA mC fA mC fA mG fC mA fA mA fC mA (ps) fG (ps) mG 772 371 EM2186 EM2186-B mC (ps) mC (ps) mU mG mU mU fU fG fC mU mG mU mG mU mA mU mG (ps) mA (ps) mU 773 372 EM2187 EM2187-A mA (ps) fU (ps) mU fU mG fU mU fU mC fA mC fA mA fA mC fA mA (ps) fC (ps) mG 774 373 EM2187 EM2187-B mC (ps) mG (ps) mU mU mG mU fU fU fG mU mG mA mA mA mC mA mA (ps) mA (ps) mU 775 374 EM2188 EM2188-A mU (ps) fA (ps) mG fA mA fA mA fG mG fU mG fG mG fA mG fA mC (ps) fU (ps) mC 776 375 EM2188 EM2188-B mG (ps) mA (ps) mG mU mC mU fC fC fC mA mC mC mU mU mU mU mC (ps) mU (ps) mA 777 376 EM2189 EM2189-A mG (ps) fU (ps) mU fG mG fA mA fU mU fC mU fU mU fU mU fG mG (ps) fA (ps) mA 778 377 EM2189 EM2189-B mU (ps) mU (ps) mC mC mA mA fA fA fA mG mA mA mU mU mC mC mA (ps) mA (ps) mC 779 378 EM2190 EM2190-A mU (ps) fC (ps) mA fU mA fC mA fA mA fC mC fU mA fA mG fG mC (ps) fA (ps) mG 780 379 EM2190 EM2190-B mC (ps) mU (ps) mG mC mC mU fU fA fG mG mU mU mU mG mU mA mU (ps) mG (ps) mA 781 380 EM2191 EM2191-A mA (ps) fC (ps) mU fA mA fA mA fC mC fC mA fC mU fU mU fU mU (ps) fG (ps) mC 782 381 EM2191 EM2191-B mG (ps) mC (ps) mA mA mA mA fA fG fU mG mG mG mU mU mU mU mA (ps) mG (ps) mU 783 382 EM2192 EM2192-A mU (ps) fA (ps) mC fC mU fG mU fC mA fA mU fC mU fU mC fU mC (ps) fA (ps) mC 784 383 EM2192 EM2192-B mG (ps) mU (ps) mG mA mG mA fA fG fA mU mU mG mA mC mA mG mG (ps) mU (ps) mA 785 384 EM2193 EM2193-A mU (ps) fA (ps) mA fG mG fU mG fG mG fA mG fA mC fU mG fG mG (ps) fG (ps) mA 786 385 EM2193 EM2193-B mU (ps) mC (ps) mC mC mC mA fG fU fC mU mC mC mC mA mC mC mU (ps) mU (ps) mA 787 386 EM2194 EM2194-A mU (ps) fA (ps) mG fU mU fG mG fC mC fA mG fC mA fU mC fC mC (ps) fU (ps) mG 788 387 EM2194 EM2194-B mC (ps) mA (ps) mG mG mG mA fU fG fC mU mG mG mC mC mA mA mC (ps) mU (ps) mA 789 388 EM2195 EM2195-A mA (ps) fC (ps) mU fU mU fC mA fC mA fA mA fG mA fA mG fC mU (ps) fG (ps) mC 790 389 EM2195 EM2195-B mG (ps) mC (ps) mA mG mC mU fU fC fU mU mU mG mU mG mA mA mA (ps) mG (ps) mU 791 390 EM2196 EM2196-A mA (ps) fA (ps) mG fA mA fA mA fG mG fU mG fG mG fA mG fA mC (ps) fU (ps) mG 792 391 EM2196 EM2196-B mC (ps) mA (ps) mG mU mC mU fC fC fC mA mC mC mU mU mU mU mC (ps) mU (ps) mU 793 392 EM2197 EM2197-A mU (ps) fU (ps) mG fA mA fC mC fU mG fU mC fA mA fU mC fU mU (ps) fU (ps) mC 794 393 EM2197 EM2197-B mG (ps) mA (ps) mA mA mG mA fU fU fG mA mC mA mG mG mU mU mC (ps) mA (ps) mA 795 394 EM2198 EM2198-A mA (ps) fC (ps) mU fG mU fC mA fA mU fC mU fU mC fU mC fA mG (ps) fC (ps) mU 796 395 EM2198 EM2198-B mA (ps) mG (ps) mC mU mG mA fG fA fA mG mA mU mU mG mA mC mA (ps) mG (ps) mU 797 396 EM2199 EM2199-A mU (ps) fC (ps) mC fC mU fG mU fC mA fA mU fU mU fU mC fU mC (ps) fA (ps) mC 798 397 EM2199 EM2199-B mG (ps) mU (ps) mG mA mG mA fA fA fA mU mU mG mA mC mA mG mG (ps) mG (ps) mA 799 398 EM2200 EM2200-A mU (ps) fG (ps) mG fC mA fA mU fG mC fA mA fA mA fA mU fG mU (ps) fA (ps) mC 800 399 EM2200 EM2200-B mG (ps) mU (ps) mA mC mA mU fU fU fU mU mG mC mA mU mU mG mC (ps) mC (ps) mA 801 400 EM2229 EM2229-A (vp)-mU fU mA fG mA fC mC fA mA fG mG fA mG fA mA fA mC (ps) fA (ps) mC 802 401 EM2229 EM2229-B mG mU mG mU mU mU fC fU fC mC mU mU mG mG mU mC mU (ps) mA (ps) mU 803 308 EM2230 EM2230-A (vp)-mU fU mC fA mC fA mA fA mC fA mA fG mC fU mG fG mU (ps) fC (ps) mG 804 229 EM2230 EM2230-B mC mG mA mC mC mA fG fC fU mU mG mU mU mU mG mU mG (ps) mA (ps) mA 805 230 EM2231 EM2231-A (vp)-mU fA mU fU mU fU mU fG mU fU mC fU mC fA mA fC mU (ps) fG (ps) mC 806 289 EM2231 EM2231-B mG mC mA mG mU mU fG fA fG mA mA mC mA mA mA mA mA (ps) mU (ps) mA 807 290 EM2232 EM2232-A (vp)-mU fC mA fU mU fA mG fA mA fG mA fA mA fA mG fG mU (ps) fC (ps) mC 808 871 EM2232 EM2232-B mG mG mA mC mC mU fU fU fU mC mU mU mC mU mA mA mU (ps) mG (ps) mU 809 316 EM2233 EM2233-A (vp)-mU fA mA fC mA fC mU fG mG fU mU fC mU fU mG fC mC (ps) fU (ps) mC 810 872 EM2233 EM2233-B mG mA mG mG mC mA fA fG fA mA mC mC mA mG mU mG mU (ps) mU (ps) mU 811 232 EM2234 EM2234-A (vp)-mU fU mC fA mC fA mA fA mC fA mA fG mC fU mG fG mU (ps) fA (ps) mC 812 873 EM2234 EM2234-B mG mU mA mC mC mA fG fC fU mU mG mU mU mU mG mU mG (ps) mA (ps) mU 813 116 *: A = 1st share; B = 2nd share

The conjugated duplexes listed in Table 5c have various modifications as indicated, with reference to Table 4 for an explanation of the abbreviations used. Where appropriate, the sequence of the equivalent unmodified strand of Table 5a is also indicated. Table 5c - Modified GalNAc conjugated duplexes Double Helix ID Stock Name (*) Sequence (5 ' à 3 ' ) SEQ ID No. Unmodified equivalent SEQ ID No. EM2201 EM2201-A (vp)-mU fU mA fC mG fG mA fA mG fC mC fC mA fA mG fA mA (ps) fG (ps) mU 814 75 EM2201 EM2201-B [ST23 (ps)]3 ST41 (ps) mA mC mU mU mC mU fU fG fG mG mC mU mU mC mC mG mU (ps) mA (ps) mU 815 76 EM2202 EM2202-A (vp)-mU fU mA fG mA fG mA fG mA fG mG fC mC fA mG fG mG (ps) fU (ps) mG 816 41 EM2202 EM2202-B [ST23 (ps)]3 ST41 (ps) mC mA mC mC mC mU fG fG fC mC mU mC mU mC mU mC mU (ps) mA (ps) mU 817 42 EM2203 EM2203-A (vp)-mU fG mU fC mA fA mU fC mU fU mC fU mC fA mG fC mA (ps) fG (ps) mC 818 323 EM2203 EM2203-B [ST23 (ps)]3 ST41 (ps) mG mC mU mG mC mU fG fA fG mA mA mG mA mU mU mG mA (ps) mC (ps) mA 819 324 EM2204 EM2204-A (vp)-mU fA mU fU mU fU mU fG mC fA mG fG mU fU mC fA mG (ps) fC (ps) mU 820 165 EM2204 EM2204-B [ST23 (ps)]3 ST41 (ps) mA mG mC mU mG mA fA fC fC mU mG mC mA mA mA mA mA (ps) mU (ps) mU 821 166 EM2205 EM2205-A (vp)-mU fC mU fU mA fG mA fC mC fA mA fG mG fA mG fA mA (ps) fA (ps) mC 822 173 EM2205 EM2205-B [ST23 (ps)]3 ST41 (ps) mG mU mU mU mC mU fC fC fU mU mG mG mU mC mU mA mA (ps) mG (ps) mU 823 174 EM2206 EM2206-A (vp)-mU fA mA fC mA fC mU fG mG fU mU fC mU fU mG fC mC (ps) fU (ps) mC 824 231 EM2206 EM2206-B [ST23 (ps)]3 ST41 (ps) mG mA mG mG mC mA fA fG fA mA mC mC mA mG mU mG mU (ps) mU (ps) mU 825 232 EM2207 EM2207-A (vp)-mU fU mC fA mC fA mA fA mC fA mA fG mC fU mG fG mU (ps) fC (ps) mG 826 229 EM2207 EM2207-B [ST23 (ps)]3 ST41 (ps) mC mG mA mC mC mA fG fC fU mU mG mU mU mU mG mU mG (ps) mA (ps) mA 827 230 EM2208 EM2208-A (vp)-mU fU mU fU mG fU mU fU mC fA mC fA mA fA mC fA mA (ps) fG (ps) mC 828 327 EM2208 EM2208-B [ST23 (ps)]3 ST41 (ps) mG mC mU mU mG mU fU fU fG mU mG mA mA mA mC mA mA (ps) mA (ps) mA 829 328 EM2209 EM2209-A (vp)-mU fU mU fU mG fU mU fC mU fC mA fA mC fU mU fG mA (ps) fA (ps) mA 830 345 EM2209 EM2209-B [ST23 (ps)]3 ST41 (ps) mU mU mU mC mA mA fG fU fU mG mA mG mA mA mC mA mA (ps) mA (ps) mA 831 346 EM2210 EM2210-A (vp)-mU fG mG fC mA fA mU fG mC fA mA fA mA fA mU fG mU (ps) fA (ps) mU 832 55 EM2210 EM2210-B [ST23 (ps)]3 ST41 (ps) mA mU mA mC mA mU fU fU fU mU mG mC mA mU mU mG mC (ps) mC (ps) mU 833 56 EM2211 EM2211-A (vp)-mU fA mA fU mA fC mA fA mA fC mC fG mA fA mG fG mC (ps) fA (ps) mA 834 277 EM2211 EM2211-B [ST23 (ps)]3 ST41 (ps) mU mU mG mC mC mU fU fC fG mG mU mU mU mG mU mA mU (ps) mU (ps) mU 835 278 EM2212 EM2212-A (vp)-mU fC mA fU mU fA mG fA mA fG mA fA mA fA mG fG mU (ps) fG (ps) mG 836 113 EM2212 EM2212-B [ST23 (ps)]3 ST41 (ps) mC mC mA mC mC mU fU fU fU mC mU mC mU mC mU mA mA mU (ps) mG (ps) mA 837 114 EM2213 EM2213-A (vp)-mU fC mA fU mU fA mG fA mA fG mA fA mA fA mG fG mU (ps) fG (ps) mC 838 335 EM2213 EM2213-B [ST23 (ps)]3 ST41 (ps) mG mC mA mC mC mU fU fU fU mC mU mC mU mC mU mA mA mU (ps) mG (ps) mU 839 336 EM2214 EM2214-A (vp)-mU fC mA fU mU fA mG fA mA fG mA fA mA fA mG fG mU (ps) fC (ps) mC 840 315 EM2214 EM2214-B [ST23 (ps)]3 ST41 (ps) mG mG mA mC mC mU fU fU fU mC mU mC mU mC mU mA mA mU (ps) mG (ps) mU 841 316 EM2215 EM2215-A (vp)-mU fC mA fU mU fA mG fA mA fG mA fC mA fA mG fG mU (ps) fG (ps) mC 842 129 EM2215 EM2215-B [ST23 (ps)]3 ST41 (ps) mG mC mA mC mC mU fU fG fU mC mU mC mU mC mU mA mA mU (ps) mG (ps) mU 843 130 EM2216 EM2216-A (vp)-mU fA mA fC mA fC mU fG mG fU mU fC mU fU mG fC mC (ps) fU (ps) mG 844 53 EM2216 EM2216-B [ST23 (ps)]3 ST41 (ps) mC mA mG mG mC mA fA fG fA mA mC mC mA mG mU mG mU (ps) mU (ps) mA 845 54 EM2217 EM2217-A (vp)-mU fA mA fC mA fC mU fG mG fU mU fC mU fU mG fC mC (ps) fC (ps) mG 846 73 EM2217 EM2217-B [ST23 (ps)]3 ST41 (ps) mC mG mG mG mC mA fA fG fA mA mC mC mA mG mU mG mU (ps) mU (ps) mA 847 74 EM2218 EM2218-A (vp)-mU fC mA fC mA fC mU fG mG fU mU fG mU fU mG fC mC (ps) fU (ps) mG 848 189 EM2218 EM2218-B [ST23 (ps)]3 ST41 (ps) mC mA mG mG mC mA fA fC fA mA mC mC mA mG mU mG mU (ps) mG (ps) mA 849 190 EM2219 EM2219-A (vp)-mU fU mC fA mC fA mA fA mC fA mA fG mC fU mG fG mU (ps) fC (ps) mA 850 117 EM2219 EM2219-B [ST23 (ps)]3 ST41 (ps) mU mG mA mC mC mA fG fC fU mU mG mU mU mU mG mU mG (ps) mA (ps) mU 851 118 EM2220 EM2220-A (vp)-mU fU mC fA mC fA mA fA mC fA mA fG mC fU mG fG mU (ps) fA (ps) mC 852 115 EM2220 EM2220-B [ST23 (ps)]3 ST41 (ps) mG mU mA mC mC mA fG fC fU mG mU mU mU mG mU mG (ps) mA (ps) mU 853 116 EM2221 EM2221-A (vp)-mU fC mC fA mC fA mA fA mC fA mA fC mC fU mG fG mU (ps) fC (ps) mA 854 49 EM2221 EM2221-B [ST23 (ps)]3 ST41 (ps) mU mG mA mC mC mA fG fG fU mU mG mU mU mU mG mU mG (ps) mG (ps) mU 855 50 EM2222 EM2222-A (vp)-mU fU mU fG mG fA mA fU mU fC mU fU mU fU mU fG mG (ps) fA (ps) mA 856 377 EM2222 EM2222-B [ST23 (ps)]3 ST41 (ps) mU mU mC mC mA mA fA fA fA mG mA mA mU mU mC mC mA (ps) mA (ps) mC 857 378 EM2223 EM2223-A (vp)-mU fU mU fG mG fA mA fU mU fC mU fU mU fU mU fG mG (ps) fA (ps) mC 858 305 EM2223 EM2223-B [ST23 (ps)]3 ST41 (ps) mG mU mC mC mA mA fA fA fA mG mA mA mU mU mC mC mA (ps) mA (ps) mU 859 306 EM2224 EM2224-A (vp)-mU fU mU fG mG fA mA fU mU fC mU fU mU fU mU fG mG (ps) fG (ps) mC 860 63 EM2224 EM2224-B [ST23 (ps)]3 ST41 (ps) mG mCmC mC mA mA fA fA fA mG mA mA mU mU mC mC mA (ps) mA (ps) mU 861 64 EM2225 EM2225-A (vp)-mU fG mU fC mA fA mU fC mU fU mC fU mC fA mG fC mA (ps) fA (ps) mA 862 71 EM2225 EM2225-B [ST23 (ps)]3 ST41 (ps) mU mU mU mG mC mU fG fA fG mA mA mG mA mU mU mG mA (ps) mC (ps) mU 863 72 EM2226 EM2226-A (vp)-mU fA mG fA mA fA mA fG mG fU mG fG mG fA mG fA mC (ps) fU (ps) mC 864 375 EM2226 EM2226-B [ST23 (ps)]3 ST41 (ps) mG mA mG mU mC mU fC fC fC mA mC mC mU mU mU mU mC (ps) mU (ps) mA 865 376 EM2227 EM2227-A (vp)-mU fU mA fG mA fC mC fA mA fG mG fA mG fA mA fA mC (ps) fA (ps) mC 866 307 EM2227 EM2227-B [ST23 (ps)]3 ST41 (ps) mG mU mG mU mU mU fC fU fC mC mU mU mG mG mU mC mU (ps) mA (ps) mU 867 308 EM2228 EM2228-A (vp)-mU fA mU fU mU fU mU fG mU fU mC fU mC fA mA fC mU (ps) fG (ps) mC 868 289 EM2228 EM2228-B [ST23 (ps)]3 ST41 (ps) mG mC mA mG mU mU fG fA fG mA mA mC mA mA mA mA mA (ps) mU (ps) mA 869 290 *: A = strand 1; B = strand 2 SEQ ID No. 870 >NM_001384479.1 Homo sapiens proangiotensin (AGT), transcript variant 1, mRNA

Statements The following statements represent aspects of the present invention. 1. A nucleic acid for inhibiting AGT expression, wherein the nucleic acid comprises a first strand and a second strand, wherein the unmodified equivalent of the first strand sequence comprises a sequence of at least 15 nucleotides, which sequence differs from any of the first strand sequences shown in Table 5a, Table 1, Table 5b, Table 2 or Table 5c by no more than 3 nucleotides. 2. The nucleic acid as in statement 1, wherein the first strand and the second strand are separate strands and each is 18-25 nucleotides in length. 3. The nucleic acid as in any of the foregoing statements, wherein the first strand and the second strand form a duplex region of 17-25 nucleotides in length. 4. The nucleic acid as in any of the foregoing statements, wherein the first strand and the second strand form a duplex region of 19 nucleotides in length. 5. A nucleic acid as described in any of the preceding statements, wherein the duplex region consists of 17-25 consecutive nucleotide base pairs. 6. A nucleic acid as described in any of the preceding statements, wherein the nucleic acid: a) is blunt at both ends; b) has an overhang at the 5' end of the first strand and a blunt end at the 3' end of the first strand; c) has an overhang at the 3' end of the first strand and a blunt end at the 5' end of the first strand; d) has an overhang at the 5' end of the second strand and a blunt end at the 3' end of the second strand; e) has an overhang at the 3' end of the second strand and a blunt end at the 5' end of the second strand; f) has an overhang at the 5' end of the first strand and at the 3' end of the first strand; or g) has an overhang at the 5' end of the second strand and at the 3' end of the second strand. 7. A nucleic acid as described in any of the preceding statements, wherein the nucleic acid is siRNA. 8. A nucleic acid as described in any of the preceding statements, wherein the nucleic acid mediates RNA interference. 9. A nucleic acid as described in any of the preceding statements, wherein: (a) the unmodified equivalent of the first strand sequence comprises a sequence that differs from any of the first strand sequences shown in Table 5a or Table 1 by no more than 3 nucleotides, and, as the case may be, the unmodified equivalent of the second strand sequence comprises a sequence that differs from the corresponding second strand sequence shown in Table 5a or Table 1 by no more than 3 nucleotides; (b) the unmodified equivalent of the first strand sequence comprises a sequence that differs from any of the first strand sequences shown in Table 5a or Table 1 by no more than 2 nucleotides, and, as the case may be, the unmodified equivalent of the second strand sequence comprises a sequence that differs from the corresponding second strand sequence shown in Table 5a or Table 1 by no more than 2 nucleotides; (c) The unmodified equivalent of the first strand sequence comprises a sequence that differs from any of the first strand sequences shown in Table 5a or Table 1 by no more than 1 nucleotide, and where the unmodified equivalent of the second strand sequence comprises a sequence that differs from the corresponding second strand sequence shown in Table 5a or Table 1 by no more than 1 nucleotide, as the case may be; (d) the unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 2 to 17 from the 5' end of any of the first strand sequences having a given SEQ ID No. shown in Table 5a or Table 1, and where the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5a or Table 1; (e) the unmodified equivalent of the first strand sequence comprises a sequence corresponding to nucleotides 1 to 2 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5a or Table 1 No., and as the case may be, wherein the unmodified equivalent of the second strand sequence comprises the sequence corresponding to nucleotides 2 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a or Table 1; (f) the unmodified equivalent of the first strand sequence comprises the sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. as shown in Table 5a or Table 1, and as the case may be, wherein the unmodified equivalent of the second strand sequence comprises the sequence corresponding to nucleotides 2 to 19 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a or Table 1; (g) the unmodified equivalent of the first strand sequence comprises the sequence corresponding to nucleotides 2 to 19 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a or Table 1 No., and optionally wherein the unmodified equivalent of the second strand sequence comprises a sequence corresponding to nucleotides 1 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a or Table 1; (h) the unmodified equivalent of the first strand sequence comprises a sequence of any one of the first strand sequences having a given SEQ ID No. as shown in Table 5a or Table 1, and optionally wherein the unmodified equivalent of the second strand sequence comprises a sequence corresponding to the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5a or Table 1; or (i) the unmodified equivalent of the first strand sequence consists essentially of any one of the first strand sequences having a given SEQ ID No. as shown in Table 5a or Table 1, and optionally wherein the unmodified equivalent of the second strand sequence consists essentially of a sequence corresponding to the given SEQ ID No. as shown in Table 5a or Table 1. (j) the unmodified equivalent of the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5a or Table 1, wherein the unmodified equivalent of the first strand sequence further consists of 1 (nucleotide 20 counting from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5a or Table 1, and wherein the unmodified equivalent of the second strand sequence comprises or consists essentially of or consists of a sequence corresponding to the second strand sequence having a given SEQ ID No. as shown in Table 5a or Table 1, as the case may be; (k) the unmodified equivalent of the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. as shown in Table 5a or Table 1, wherein the unmodified equivalent of the first strand sequence is in the given SEQ ID No. as shown in Table 5a or Table 1. The 3' end of any of the first strand sequences of SEQ ID NO. No. further consists of 1 (nucleotide 20 counting from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides, and wherein the unmodified equivalent of the first strand sequence consists of a continuous region complementary to the AGT transcript of SEQ ID NO. 870 with a length of 17-25 nucleotides, preferably a length of 18-24 nucleotides; and optionally wherein the unmodified equivalent of the second strand sequence comprises or consists essentially of or consists of: a sequence having the corresponding second strand sequence of a given SEQ ID No. shown in Table 5a or Table 1; (l) The unmodified equivalent of the first strand sequence consists of any one of the first strand sequences having a given SEQ ID No. shown in Table 5a or Table 1, and where appropriate, the unmodified equivalent of the second strand sequence consists of the sequence corresponding to the second strand sequence having a given SEQ ID No. shown in Table 5a or Table 1; (m) the unmodified equivalent of the first strand and the unmodified equivalent of the second strand of any one of the nucleic acid molecules of the above subsections (a) to (l) are present on a single strand, wherein the unmodified equivalent of the first strand and the unmodified equivalent of the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; or (n) The unmodified equivalent of the first strand and the unmodified equivalent of the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are on two separate strands, and these unmodified equivalents are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. 10. A nucleic acid as in any of the preceding statements, wherein at least one nucleotide of the first and/or second strand is a modified nucleotide, preferably a modified nucleotide that is non-naturally occurring, such as a 2'-F modified nucleotide. 11. The nucleic acid of any of the preceding statements, wherein at least nucleotides 2 and 14 of the first strand are modified by a first modification, said nucleotides being numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand sequence having a given SEQ ID No. 12. The nucleic acid of any of the preceding statements, wherein each of the even-numbered nucleotides of the first strand are modified by a first modification, said nucleotides being numbered consecutively starting with nucleotide number 1 at the 5' end of the first strand sequence having a given SEQ ID No. 13. The nucleic acid of any of the preceding statements, wherein the odd-numbered nucleotides of the first strand having a given SEQ ID No. are modified by a second modification, wherein the second modification is different from the first modification. 14. The nucleic acid of any of the preceding statements, wherein the nucleotides of the second strand with a given SEQ ID No. in the positions corresponding to the even-numbered nucleotides of the first strand with a given SEQ ID No. are modified by a third modification, wherein the third modification is different from the first modification. 15. The nucleic acid of any of the preceding statements, wherein the nucleotides of the second strand with a given SEQ ID No. in the positions corresponding to the odd-numbered nucleotides of the first strand with a given SEQ ID No. are modified by a fourth modification, wherein when the second and/or third modification is present, the fourth modification is different from the second modification and different from the third modification. 16. A nucleic acid as in any of the preceding statements, wherein one or more nucleotides of the second strand with a given SEQ ID No. in a position corresponding to nucleotide 11, or nucleotide 13, or nucleotides 11 and 13, or nucleotides 11-13 of the first strand with a given SEQ ID No. are modified by the fourth modification, and preferably wherein the nucleotides of the second strand not modified by the fourth modification are modified by the third modification. 17. A nucleic acid as in any of the preceding statements, wherein if the first modification and the fourth modification are both present in the nucleic acid, the two modifications are identical, and preferably wherein if the second modification and the third modification are both present in the nucleic acid, the two modifications are identical. 18. A nucleic acid as described in any of the preceding statements, wherein the first modification is a 2'-F modification; the second modification, if present in the nucleic acid, is preferably a 2'-OMe modification; the third modification, if present in the nucleic acid, is preferably a 2'-OMe modification; and the fourth modification, if present in the nucleic acid, is preferably a 2'-F modification. 19. A nucleic acid as described in any of the preceding statements, wherein each nucleotide of the first strand and the second strand is a modified nucleotide. 20. A nucleic acid as described in any of the preceding statements, wherein the first strand having a given SEQ ID No. has a terminal 5' (E)-vinylphosphonate nucleotide at its 5' end, and optionally wherein the terminal 5' (E)-vinylphosphonate nucleotide is preferably linked to the second nucleotide in the first strand by a phosphodiester bond. 21. A nucleic acid as in any of the preceding statements, wherein the nucleic acid comprises a phosphorothioate bond between the terminal two or three 3' nucleotides and/or 5' nucleotides of the first strand having a given SEQ ID No. and/or the second strand having a given SEQ ID No., and where appropriate the bonds between the remaining nucleotides are phosphodiester bonds. 22. A nucleic acid as in any of the preceding statements, wherein the nucleic acid comprises a phosphorothioate bond between each of the terminal three 3' nucleotides of the first strand. 23. A nucleic acid as in any of the preceding statements, wherein the nucleic acid comprises a phosphorothioate bond between each of the terminal three 3' nucleotides of the second strand. 24. A nucleic acid as described in any of the preceding statements, comprising a phosphorodithioate bond between each of the two, three or four terminal nucleotides at the 3' end of the first strand having a given SEQ ID No., and/or comprising a phosphorodithioate bond between each of the two, three or four terminal nucleotides at the 3' end of the second strand having a given SEQ ID No., and/or comprising a phosphorodithioate bond between each of the two, three or four terminal nucleotides at the 5' end of the second strand having a given SEQ ID No., and comprising bonds other than the phosphorodithioate bonds between the two, three or four terminal nucleotides at the 5' end of the first strand. 25. A nucleic acid as in any of the preceding statements, wherein the nucleic acid comprises phosphorothioate bonds between each of the two, three or four terminal nucleotides at the 3' end of the first strand having a given SEQ ID No. and/or between each of the two, three or four terminal nucleotides at the 5' end of the first strand having a given SEQ ID No. and/or between each of the two, three or four terminal nucleotides at the 3' end of the second strand having a given SEQ ID No. and/or between each of the two, three or four terminal nucleotides at the 5' end of the second strand having a given SEQ ID No. 26. A nucleic acid as in any of the preceding statements, wherein all bonds between nucleotides of the two strands except the bond between the two terminal nucleotides at the 3' end of the first strand and the bonds between the two terminal nucleotides at the 3' end and the 5' end of the second strand are phosphodiester bonds. 27. A nucleic acid as described in any of the preceding statements, wherein: (a) the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 5b by no more than 3 nucleotides, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 5b by no more than 3 nucleotides; (b) the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 5b by no more than 2 nucleotides, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 5b by no more than 2 nucleotides; (c) the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 5b by no more than 1 nucleotide, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 5b by no more than 1 nucleotide; (d) the first strand sequence comprises a sequence corresponding to a given SEQ ID NO: 1 in Table 5b. No., and optionally wherein the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5b; (e) the first strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of any one of the first strand sequences having a given SEQ ID No. as shown in Table 5b, and optionally wherein the second strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5b; (f) the first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. as shown in Table 5b, and optionally wherein the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. as shown in Table 5b. (g) the first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and as the case may be, wherein the second strand sequence comprises a sequence corresponding to nucleotides 1 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5b; (h) the first strand sequence comprises a sequence of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and as the case may be, wherein the second strand sequence comprises a sequence of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5b; (i) the first strand sequence consists essentially of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and as the case may be, wherein the second strand sequence consists essentially of a sequence of the corresponding second strand sequence having a given SEQ ID No. shown in Table 5b. (j) the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, wherein the first strand sequence further consists of 1 (nucleotide 20 counted from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b, and optionally wherein the second strand sequence comprises or consists essentially of or consists of a sequence corresponding to the second strand sequence having a given SEQ ID No. shown in Table 5b; (k) the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 5b No., wherein the first strand sequence further consists of 1 (nucleotide 20 counted from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any of the first strand sequences having a given SEQ ID No. shown in Table 5b, and wherein the first strand sequence consists of a sequence of nucleotides 1 to 19 from the 5' end of any of the first strand sequences having a given SEQ ID No. 870 AGT transcript complement; and optionally wherein the second strand sequence comprises or consists essentially of or consists of: a sequence having a given SEQ ID No. as shown in Table 5b corresponding to the second strand sequence; (l) the first strand sequence consists of any of the first strand sequences having a given SEQ ID No. as shown in Table 5b, and optionally wherein the second strand sequence consists of a sequence having a given SEQ ID No. as shown in Table 5b corresponding to the second strand sequence; (m) the first strand and the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are present on a single strand, wherein the first strand and the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; or (n) The first strand and the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are located on two separate strands, which are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region with a length of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. 28. A nucleic acid as described in any of the preceding statements, wherein: (a) the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 2 by no more than 3 nucleotides, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 2 by no more than 3 nucleotides; (b) the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 2 by no more than 2 nucleotides, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 2 by no more than 2 nucleotides; (c) the first strand sequence comprises a sequence that differs from any of the first strand sequences in Table 2 by no more than 1 nucleotide, and optionally wherein the second strand sequence comprises a sequence that differs from the corresponding second strand sequence in Table 2 by no more than 1 nucleotide; (d) the first strand sequence comprises a sequence corresponding to a given SEQ ID NO shown in Table 2 No., and optionally wherein the second strand sequence comprises a sequence corresponding to nucleotides 3 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2; (e) the first strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, and optionally wherein the second strand sequence comprises a sequence corresponding to nucleotides 2 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2; (f) the first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, and optionally wherein the second strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2; (g) The first strand sequence comprises a sequence corresponding to nucleotides 2 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, and optionally wherein the second strand sequence comprises a sequence corresponding to nucleotides 1 to 18 from the 5' end of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2; (h) the first strand sequence comprises a sequence of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, and optionally wherein the second strand sequence comprises a sequence of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2; (i) the first strand sequence consists essentially of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, and optionally wherein the second strand sequence consists essentially of a sequence of the corresponding second strand sequence having a given SEQ ID No. shown in Table 2. (j) the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, wherein the first strand sequence further consists of 1 (nucleotide 20 counted from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 2, and optionally wherein the second strand sequence comprises or consists essentially of or consists of a sequence corresponding to the second strand sequence having a given SEQ ID No. shown in Table 2; (k) the first strand sequence consists of a sequence corresponding to nucleotides 1 to 19 from the 5' end of any one of the first strand sequences having a given SEQ ID No. shown in Table 2 No., wherein the first strand sequence further consists of 1 (nucleotide 20 counted from the 5' end), 2 (nucleotides 20 and 21), 3 (nucleotides 20, 21 and 22), 4 (nucleotides 20, 21, 22 and 23), 5 (nucleotides 20, 21, 22, 23 and 24) or 6 (nucleotides 20, 21, 22, 23, 24 and 25) additional nucleotides at the 3' end of any of the first strand sequences having a given SEQ ID No. shown in Table 2, and wherein the first strand sequence consists of a sequence of nucleotides 1 to 19 from the 5' end of any of the first strand sequences having a given SEQ ID No. 870; and optionally wherein the second strand sequence comprises or consists essentially of or consists of: a sequence having a given SEQ ID No. as shown in Table 2 corresponding to the second strand sequence; (l) the first strand sequence consists of any of the first strand sequences having a given SEQ ID No. as shown in Table 2, and optionally wherein the second strand sequence consists of a sequence having a given SEQ ID No. as shown in Table 2 corresponding to the second strand sequence; (m) the first strand and the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are present on a single strand, wherein the first strand and the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; or (n) The first strand and the second strand of any of the nucleic acid molecules of the above subsections (a) to (l) are located on two separate strands, and the first strand and the second strand are capable of hybridizing with each other and thereby forming a double-stranded nucleic acid having a duplex region of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. 29. A nucleic acid as in any of the preceding statements, wherein the nucleic acid is bound to a heterologous portion. 30. A nucleic acid as in statement 29, wherein the heterologous portion comprises (i) one or more N-acetylgalactosamine (GalNAc) moieties or derivatives thereof, and (ii) a linker, wherein the linker binds at least one GalNAc moiety or derivative thereof to the nucleic acid. 31. The nucleic acid of claim 29 or claim 30, wherein the nucleic acid is conjugated to a heterologous portion comprising a compound of formula (II): [SX ¹ -PX ² ] ₃ -AX ³ - (II) wherein: S represents a functional component, such as a ligand, such as a sugar, preferably wherein the sugar is N-acetylgalactosamine; X ¹ represents a C ₃ -C ₆ alkylene group or (-CH ₂ -CH ₂ -O) _m (-CH ₂ ) ₂ -, wherein m is 1, 2 or 3; P is a phosphate or a modified phosphate, preferably a thiophosphate; X ² is an alkylene group or an alkylene ether of the formula (-CH ₂ ) _n -O-CH ₂ -, wherein n=1-6; A is a branching unit; X ³ represents a bridging unit; The nucleic acid of any one of items 1 to 28 is conjugated to ^X3 via a phosphate or a modified phosphate, preferably a thiophosphate. 32. The nucleic acid of any one of items 29 to 31, wherein the first strand of the nucleic acid is a compound of formula (V): wherein b is 0 or 1; and wherein the second strand is a compound of formula (VI): ; wherein: c and d are independently 0 or 1; _Z1 and _Z2 are the first and second strands of the nucleic acid, respectively; Y is independently O or S; n is independently 0, 1, 2 or 3; and _L1 is a linker to which a ligand is attached, wherein _L1 is the same or different in formula (V) and (VI), and when _L1 occurs more than once in the same formula, it is the same or different in formula (V) and (VI); and wherein b+c+d is 2 or 3. 33. A nucleic acid as described in any one of items 29 to 32, which is one of the duplexes having a given duplex ID number shown in Table 5c. 34. A composition comprising a nucleic acid as described in any of the preceding statements, and a solvent, and/or a delivery vehicle, and/or a physiologically acceptable excipient, and/or a carrier, and/or a salt, and/or a diluent, and/or a buffer, and/or a preservative. 35. A composition as described in claim 34, comprising a nucleic acid as described in any of the preceding statements and another therapeutic agent selected from the group consisting of an oligonucleotide, a small molecule, a monoclonal antibody, a polyclonal antibody, and a peptide. 36. A nucleic acid as described in any of the preceding statements or a composition as described in claim 34 or 35, suitable for use as a therapeutic agent. 37. A nucleic acid as described in any one of items 1 to 33 or a composition as described in item 34 or 35, which is used for preventing or treating a disease, disorder or syndrome. 38. A nucleic acid or composition as described in item 37, wherein the disease, disorder or syndrome is an AGT-mediated disease, disorder or syndrome. 39. A nucleic acid or composition as described in item 37 or 38, wherein the disease, disorder or syndrome is associated with abnormal activation or overactivation of AGT and/or overexpression or ectopic expression or localization or accumulation of AGT. 40. A nucleic acid or composition as described in any one of items 37 to 39, wherein the disease, disorder or syndrome is selected from: High blood pressure; Hypertension; Critical hypertension; Primary hypertension; Secondary hypertension; Simple systolic or diastolic hypertension; Pregnancy-related hypertension; Diabetic hypertension; Intractable hypertension; Refractory hypertension; Paroxysmal hypertension; Renovascular hypertension; High Brad's hypertension; Ocular hypertension; Glaucoma; Pulmonary hypertension; Portal hypertension; Systemic venous hypertension; Systolic hypertension; Unstable hypertension; Hypertensive heart disease; Hypertensive nephropathy; Atherosclerosis; Atherosclerosis; Vascular disease; Diabetic nephropathy; Diabetes Diabetic retinopathy; chronic heart failure; cardiomyopathy; diabetic cardiomyopathy; glomerulosclerosis; aortic stenosis; aortic aneurysm; ventricular fibrosis; heart failure; myocardial infarction; angina pectoris; stroke; nephropathy; renal failure; systemic sclerosis; intrauterine growth restriction (IUGR); fetal growth restriction; obesity; hepatic steatosis/fatty liver; non-alcoholic steatohepatitis (NASH); non-alcoholic fatty liver disease (NAFLD); glucose intolerance; type 2 diabetes (non-insulin-dependent diabetes mellitus); and metabolic syndrome. 41. Use of a nucleic acid as described in any one of claims 1 to 33 or a composition as described in claim 34 or 35 for the preparation of a medicament for the prevention or treatment of a disease, disorder or syndrome. 42. A method for preventing or treating a disease, disorder or syndrome, comprising administering to a subject in need of treatment a pharmaceutically effective amount of a nucleic acid of any one of claims 1 to 33 or a composition of claim 34 or 35, wherein the nucleic acid or composition is administered to the subject subcutaneously, intravenously or orally, rectally or intraperitoneally, as the case may be.

Figure 1. Relative AGT mRNA expression normalized to PPIB mRNA in primary cynomolgus macaque hepatocytes after treatment with five different concentrations of GalNAc-siRNA conjugate targeting AGT at 100 nM, 10 nM, 1 nM, 0.1 nM, and 0.01 nM. Mean values are relative to untreated (ut). Cells treated with AGT nonspecific siRNA were used as controls (Ctr). Figure 2. Relative AGT mRNA expression normalized to PPIB mRNA in primary cynomolgus macaque hepatocytes after treatment with five different concentrations of GalNAc-siRNA conjugate targeting AGT at 100 nM, 10 nM, 1 nM, 0.1 nM, and 0.01 nM . Mean values are relative to untreated (ut). Cells treated with AGT nonspecific siRNA were used as control (Ctr). Figure 3. Relative AGT mRNA expression normalized to PPIB mRNA in primary human hepatocytes after treatment with five different concentrations of GalNAc-siRNA conjugate targeting AGT at 100 nM, 20 nM, 4 nM, 0.8 nM, and 0.16 nM. Mean values are relative to untreated (ut). Cells treated with AGT nonspecific siRNA were used as control (Ctr). Figure 4. Relative AGT mRNA expression normalized to PPIB mRNA in primary human hepatocytes after treatment with five different concentrations of GalNAc -siRNA conjugate targeting AGT at 100 nM, 20 nM, 4 nM, 0.8 nM, and 0.16 nM. Mean values are relative to untreated (ut). Cells treated with AGT nonspecific siRNA were used as control (Ctr). Figure 5. Mean AGT protein expression in plasma samples isolated at day 29 after injection of AAV vectors carrying the human AGT gene and at day 15 after subcutaneous injection of GalNAc-siRNA conjugate targeting AGT (at two concentrations of 1 or 5 mg/kg). Figure 6. Relative AGT mRNA expression normalized to Apob mRNA in liver samples isolated at day 29 after injection of AAV vectors carrying the human AGT gene and at day 15 after subcutaneous injection of GalNAc-siRNA conjugate targeting AGT (at two concentrations of 1 or 5 mg/kg). Mean values are relative to PBS-treated controls. Figure 7. Average AGT protein expression in plasma samples isolated at day 29 after injection of AAV9 vectors carrying the human AGT gene and at day 15 after subcutaneous injection of GalNAc-siRNA conjugates targeting AGT (at two concentrations of 1 or 5 mg/kg). Figure 8. Relative AGT mRNA expression normalized to Apob mRNA in liver samples isolated at day 29 after injection of AAV vectors carrying the human AGT gene and at day 15 after subcutaneous injection of GalNAc -siRNA conjugates targeting AGT (at two concentrations of 1 or 5 mg/kg). Mean values are relative to PBS-treated controls. FIG9. Volcano plot depicting differentially expressed genes in primary human hepatocytes incubated with 100 nM of EM2214, EM2206, EM2217, EM2207, EM2220, EM2227, or EM2228 for 24 hours. Dark grey areas indicate statistical significance (padj≤0.05) versus magnitude of expression change (fold change≤0.5). FIG10. Changes in AGT protein levels in sera of cynomolgus macaques isolated on days 2, 8, 15, 22, 29, 43, 57, 71, and 85 following a single subcutaneous injection of vehicle or GalNAc-conjugated siRNA EM2207, EM2227, or EM2228 at 3 mg/kg, normalized to pre-drug values. Means and SEMs are shown. Figure 11. Changes in AGT protein levels in cynomolgus macaque serum isolated on days 2, 8, 15, 22, 29, 43, 57, 71, and 85 after a single injection of GalNAc-conjugated siRNA EM2207 or vehicle, normalized to the average pre-dose values on days -7 and 1. Single doses of 1, 3, or 9 mg/kg were administered on day 1. Means and SEMs are shown.

TW202411427A_112126345_SEQL.xml

Claims (11)

A double-stranded nucleic acid for inhibiting AGT expression, wherein the nucleic acid comprises a first strand and a second strand, wherein the first strand consists of the following nucleotide sequence: (vp)-mU fU mC fA mC fA mA fA mC fA mA fG mC fU mG fG mU (ps) fC (ps) mG (SEQ ID NO: 826), and wherein the second strand consists of the following nucleotide sequence: [ST23 (ps)] ₃ ST41 (ps) mC mG mA mC mC mA fG fC fU mU mG mU mU mU mG mU mG (ps) mA (ps) mA (SEQ ID NO: 827); wherein fA, fC, fG and fU represent 2'-deoxy-2'-fluoro ribonucleotides; mA, mC, mG and mU represent 2'-O-methyl ribonucleotides; (ps) represents a phosphorothioate linkage; (vp) represents a vinyl-(E)-phosphonate group; and [ST23 (ps)] ₃ ST41 (ps) represents: . The nucleic acid of claim 1, wherein the nucleic acid mediates RNA interference. A composition comprising the nucleic acid of any one of claims 1 to 2, and a solvent, and/or a delivery vehicle, and/or a physiologically acceptable excipient, and/or a carrier, and/or a salt, and/or a diluent, and/or a buffer, and/or a preservative. The composition of claim 3, wherein the solvent is water. The composition of any one of claims 3 to 4, comprising another therapeutic agent selected from the group consisting of an oligonucleotide, a small molecule, a monoclonal antibody, a polyclonal antibody and a peptide. The nucleic acid according to any one of claims 1 to 2, which is used as a therapeutic agent. A composition according to any one of claims 3 to 5, for use as a medicament. The nucleic acid of any one of claims 1 to 2 or the composition of any one of claims 3 to 5, for use in preventing or treating a disease, disorder or syndrome, wherein the disease, disorder or syndrome is an AGT-mediated disease, disorder or syndrome. The nucleic acid or pharmaceutical composition of claim 8, wherein the AGT-mediated disease, disorder or syndrome is selected from high blood pressure; hypertension; critical hypertension; primary hypertension; secondary hypertension; isolated systolic or diastolic hypertension; pregnancy-related hypertension; diabetic hypertension; stubborn hypertension; refractory hypertension; paroxysmal hypertension; renal vascular hypertension; Goldblatt's hypertension hypertension); high intraocular pressure; glaucoma; pulmonary hypertension; portal hypertension; systemic venous hypertension; systolic hypertension; unstable hypertension; hypertensive heart disease; hypertensive nephropathy; atherosclerosis; atherosclerosis; vascular disease; diabetic nephropathy; diabetic retinopathy; chronic heart failure; cardiomyopathy; diabetic cardiomyopathy; glomerulosclerosis; aortic stenosis; aortic aneurysm ; ventricular fibrosis; heart failure; ischemic heart disease; myocardial infarction; angina; stroke; nephropathy; renal failure; systemic sclerosis; intrauterine growth restriction (IUGR); fetal growth restriction; obesity; hepatic steatosis/fatty liver; nonalcoholic steatohepatitis (NASH); nonalcoholic fatty liver disease (NAFLD); glucose intolerance; type 2 diabetes mellitus (non-insulin-dependent diabetes mellitus); and metabolic syndrome. A use of a nucleic acid as in any one of claims 1 to 2 or a composition as in any one of claims 3 to 5 for preparing a medicament for preventing or treating a disease, disorder or syndrome, wherein the disease, disorder or syndrome is an AGT-mediated disease, disorder or syndrome. The use of a nucleic acid or composition as claimed in claim 10, wherein the AGT-mediated disease, disorder or syndrome is selected from high blood pressure; hypertension; critical hypertension; primary hypertension; secondary hypertension; simple systolic or diastolic hypertension; pregnancy-related hypertension; diabetic hypertension; intractable hypertension hypertension; refractory hypertension; paroxysmal hypertension; renal vascular hypertension; high Brad's hypertension; ocular hypertension; glaucoma; pulmonary hypertension; portal hypertension; systemic venous hypertension; systolic hypertension; unstable hypertension; hypertensive heart disease; hypertensive nephropathy; atherosclerosis; arteriosclerosis sclerosis; vascular disease; diabetic nephropathy; diabetic retinopathy; chronic heart failure; cardiomyopathy; diabetic cardiomyopathy; glomerulosclerosis; aortic stenosis; aortic aneurysm; ventricular fibrosis; heart failure; ischemic heart disease; myocardial infarction; angina; stroke; nephropathy; renal failure; systemic sclerosis; intrauterine growth restriction (IUGR); fetal growth restriction; obesity; hepatic steatosis/fatty liver; nonalcoholic steatohepatitis (NASH); nonalcoholic fatty liver disease (NAFLD); glucose intolerance; type 2 diabetes mellitus (non-insulin-dependent diabetes mellitus); and metabolic syndrome.