TW202404615A - Compositions and methods for inhibiting xanthine dehydrogenase (XDH) - Google Patents

Abstract

The present invention relates to compositions and methods for inhibiting xanthine dehydrogenase (XDH) protein expression. Specifically, the present application provides compositions and methods useful for inhibiting xanthine dehydrogenase (XDH) gene expression and for treating xanthine dehydrogenase (XDH)-related diseases and disorders. The present invention also provides xanthine dehydrogenase (XDH) dsRNA reagents that can be used to reduce xanthine dehydrogenase (XDH) expression in cells and subjects, and xanthine dehydrogenase (XDH) antisense polynucleotide reagents and/or compositions of non-xanthine dehydrogenase (XDH) dsRNA therapeutics.

Description

Compositions and methods for inhibiting xanthine dehydrogenase (XDH)

The present invention relates to compositions and methods useful for inhibiting xanthine dehydrogenase (XDH).

Uric acid (also referred to as urate in this article) is the final metabolite of endogenous and dietary purine metabolism. Xanthine oxidase (also referred to herein as "XO") (EC 1.1.3.22) and xanthine dehydrogenase (also referred to herein as "XDH") (EC 1.17.1.4) respectively catalyze hypoxanthine Oxidation to xanthine and xanthine to uric acid. These enzymes are molybdopterin-containing flavoproteins composed of two identical subunits of approximately 145 kDa. These enzymes are derived from mammals, including humans, and are synthesized as dehydrogenases but can be readily converted to oxidase forms by oxidation or proteolysis of sulfhydryl residues. XDH is primarily expressed in the intestine and liver, but can also be expressed in other tissues, including adipose tissue.

Chronic elevation of serum uric acid (chronic hyperuricemia), usually defined as a serum urate level above 6.8 mg/dl (greater than 360 mmol/dl) above which the physiological saturation threshold is exceeded (Mandell, Cleve . Clin. Med. 75: S5-S8, 2008) is associated with many diseases, such as gout, which is characterized by recurrent attacks of acute inflammatory arthritis, often caused by insufficient renal clearance of uric acid or excessive uric acid production. Caused by an inflammatory reaction to uric acid crystals in the joints. Fructose-related gout is associated with variants of a transporter protein expressed in the kidneys, intestines and liver. Chronic elevated uric acid is also associated with nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), metabolic disorders, cardiovascular disease, type 2 diabetes, and conditions related to oxidative stress, chronic low-grade inflammation, and insulin Disease-related (Xu et al., J. Hepatol. 62:1412-1419, 2015; Cardoso et al., J. Pediatr. 89:412-418, 2013; Sertoglu et al., Clin. Biochem., 47:383 -388, 2014).

Allopurinol and febuxostat (Uloric®) are inhibitors of the enzyme in the form of XDH and are commonly used to treat gout. However, there are contraindications for use in patients with comorbidities of gout, especially in patients with reduced renal function (e.g. due to chronic kidney disease or hepatic insufficiency). Their use may be limited in patients with metabolic syndrome, hypertension, dyslipidemia, nonalcoholic steatohepatitis (NASH) or nonalcoholic fatty liver disease (NAFLD), cardiovascular disease, or diabetes (type 1 or 2) Restrictions in patients that result from limitations in organ function due to a disease or condition or an adverse interaction with drugs used to treat such conditions.

Current treatment options for XDH-related diseases or conditions do not fully meet the needs of patients. Therefore, there is a need for additional therapies for subjects who would benefit from reduced expression of the XDH gene, such as those with gout.

According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) reagent for inhibiting xanthine dehydrogenase (XDH) gene expression is provided. The dsRNA reagent includes a sense strand and an antisense strand, and a core in the antisense strand The nucleotide positions 2 to 18 contain a region complementary to the xanthine dehydrogenase (XDH) gene RNA transcript, where the complementary region contains a difference of 0, 1, and 2 from one of the antisense sequences listed in Table 1-3 or at least 15 consecutive nucleotides of 3 nucleotides, and optionally includes a targeting ligand.

In some embodiments, the region complementary to the xanthine dehydrogenase (XDH) gene RNA transcript includes at least 15, 16, 17, 18 or 19 consecutive nucleotides.

In some embodiments, the antisense strand of the dsRNA is at least substantially complementary to any target region of SEQ ID NO: 1 and is provided in one of Tables 1-3.

In some embodiments, the antisense strand of the dsRNA is fully complementary to any target region of SEQ ID NO: 1 and is provided in one of Tables 1-3.

In some embodiments, the dsRNA reagent includes any one of the sense strand sequences listed in Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA reagent.

In some embodiments, the dsRNA reagent includes any one of the sense strand sequences listed in Tables 1-3, wherein the sense strand sequence is completely complementary to the antisense strand sequence in the dsRNA reagent.

In some embodiments, the dsRNA reagent comprises any of the antisense strand sequences listed in Tables 1-3.

In some embodiments, the dsRNA agent comprises any of the sequences listed as duplex sequences in Tables 1-3.

In some embodiments, the dsRNA agent contains at least one modified nucleotide.

In some embodiments, all or substantially all of the nucleotides of the antisense strand are modified nucleotides.

In some embodiments, all or substantially all nucleotides of the sense and antisense strands are modified nucleotides.

In some embodiments, at least one modified nucleotide includes: 2'-methoxy nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2',3'-seco nucleoside Acid mimetics, locked nucleotides, unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), 2'-F-arabinose nucleotides , 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, reverse nucleotide, reverse abasic nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotides, isomannitol nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides and 3'-OMe nucleosides Acids, nucleotides including 5'-phosphorothioate groups, or terminal nucleotides linked to cholesterol derivatives or dodecanoic acid didecylamide groups, 2'-amino modified nucleotides, Phosphoramidates or unnatural bases containing nucleotides.

In some embodiments, the dsRNA agent includes an E-vinylphosphonate nucleotide at the 5' end of the guide strand.

In some embodiments, the dsRNA agent contains at least one phosphorothioate internucleoside linkage.

In some embodiments, the sense strand contains at least one phosphorothioate internucleoside linkage.

In some embodiments, the antisense strand contains at least one phosphorothioate internucleoside linkage.

In some embodiments, the sense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.

In some embodiments, the antisense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.

In some embodiments, the antisense strand contains at least 15 modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoronucleotides, of which less than 6 are 2'- Fluoronucleotide modified nucleotides. In certain embodiments, the antisense strand contains 3 or 5 2'-fluoronucleotides, preferably the antisense strand contains 5 2'-fluoronucleotides.

In some embodiments, the sense strand contains at least 15 modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoronucleotides, of which less than 4 are 2'-fluoronucleotides Nucleotide-modified nucleotides, in certain embodiments, the sense strand contains 3 2'-fluoronucleotides.

In some embodiments, the antisense strand is comprised in the direction from the 5' end to the 3' end, counting from the first paired nucleotide at the 5' end of the antisense strand, the 2nd, 7th, and 7th nucleotides of the antisense strand. Nucleotides at positions 12, 14, and 16 are 2'-fluoro modified nucleotides, and each nucleotide at other positions in the antisense strand is independently a non-fluoro modified nucleotide.

In some embodiments, the sense strand includes cores at positions 9, 11, and 13 of the sense strand in a direction from the 3' end to the 5' end, counting from the first paired nucleotide 3' of the sense strand. The nucleotide is a 2'-fluoro modified nucleotide, and each nucleotide elsewhere in the sense strand is independently a non-fluoro modified nucleotide.

In some embodiments, the antisense strand contains 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoronucleotides, wherein the antisense strand consists of 5 Positions 2, 7, 12, 14 and/or 16 from the ' end are 2'-fluoro nucleotide modified nucleotides, and the rest are 2'-O-methyl nucleotide modified nucleotides.

In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoronucleotides, wherein the sense strand begins at the 3' end Positions 9, 11 and/or 13 from the first matching position are 2'-fluoronucleotide-modified nucleotides, and the remainder are 2'-O-methyl nucleotide-modified nucleotides.

In some embodiments, the modified sense strand is a modified sense strand sequence listed in Table 2 and/or Table 3.

In some embodiments, the modified antisense strand is a modified antisense strand sequence listed in Table 2 and/or Table 3.

In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the complementary region is between 16 and 23 nucleotides in length. In some embodiments, the complementary region is 19-21 nucleotides in length. In some embodiments, the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

In some embodiments, each strand is no more than 40 nucleotides in length.

In some embodiments, each strand is no more than 30 nucleotides in length.

In some embodiments, each strand is no more than 25 nucleotides in length.

In some embodiments, each strand is no more than 23 nucleotides in length.

In some embodiments, each strand is no more than 21 nucleotides in length.

In some embodiments, a dsRNA agent contains at least one modified nucleotide and further contains one or more targeting or linking groups.

In some embodiments, one or more targeting groups or linking groups are conjugated to the sense strand. In some embodiments, the targeting group or linking group includes N-acetyl-galactosamine (GalNAc).

In some embodiments, the targeting group or linking group is a structure represented by formula (X), including a targeting moiety, a linker, and a linker W, wherein the targeting moiety is selected from N-acetyl-galactosamine Derivative (GalNAc), which is linked to the linker W through a linking bond. The linker W has a structure shown in formula (XI), X is selected from O, NH ₂ or S, Y ^- is selected from: O ^- , S ^- , A group or NR _a R _b , R _a and R _b are independently selected from hydrogen, substituted or unsubstituted C ₁ -C ₆ alkyl group, substituted or unsubstituted C ₃ -C ₆ cycloalkyl group, or R _a and R _b are linked together with the attached atoms to form a 3-12 membered heterocycloalkyl group containing 1-3 N, O, S heteroatoms. In some preferred embodiments, in the substituted or unsubstituted C ₁ -C ₆ alkyl group or the substituted or unsubstituted C ₃ -C ₆ cycloalkyl group, the substituent is selected from hydroxyl and amino. Formula (X) (Formula XI).

In some embodiments, the linkage in the targeting group is selected from polyethylene glycol, optionally substituted C ₂ -C ₁₂ alkyl, substituted or unsubstituted C ₃ -C ₁₂ cycloalkyl, substituted or unsubstituted Substituted C ₃ -C ₁₂ heterocycloalkyl, substituted or unsubstituted C ₃ -C ₁₂ amide. In some embodiments, substituted or unsubstituted C ₂ -C ₁₂ alkyl, substituted or unsubstituted C ₃ -C ₁₂ cycloalkyl, substituted or unsubstituted C ₃ -C ₁₂ heterocycloalkyl, substituted or In unsubstituted C ₃ -C ₁₂ amide, the substituent is selected from hydroxyl and carbonyl.

In some embodiments, the linkage in the targeting group is preferably from the following fragments: , , , , , and , where each m is independently an integer from 1 to 6, each n, o, p is independently 0 or 1, and each q ¹ and q ² are independently 0, 1 or 2.

In some embodiments, the linkage in the targeting group is more preferably from the following fragments: , , , , , .

In some embodiments, the targeting moiety in the targeting group has the following structural fragment, n' is 1 or 2.

In some embodiments, the targeting group has the following structure: GLO-1 GLS-1 GLO-2 GLS-2 GLO-3 GLS-3 GLO-4 GLS-4 GLO-5 GLS-5 GLO-6 GLS-6 GLO-7 GLS-7 GLO-8 GLS-8 GLO-9 GLS-9 GLO-10 GLS-10 GLO-11 GLS-11 GLO-12 GLS-12 GLO-13 GLS-13 GLO-14 GLS-14 GLO-15 GLS-15 GLO-16 GLS-16.

In some embodiments, the dsRNA agent comprises a targeting group conjugated to the 5'-end of the sense strand.

In some embodiments, the dsRNA agent comprises a targeting group conjugated to the 3'-end of the sense strand.

In some embodiments, the antisense strand contains an inverted abasic residue at the 3'-end.

In some embodiments, the sense strand contains one or two reverse abasic residues at the 3' or/and 5' end.

In some embodiments, the sense strand contains one or two imann residues at the 3' or/and 5' end.

In some embodiments, the 3' and 5' ends of the sense strand each independently comprise an imann residue.

In some embodiments, the dsRNA agent has two blunt ends.

In some embodiments, at least one strand includes a 3' overhang that is at least 1 nucleotide long. In some embodiments, at least one strand includes a 3' overhang that is at least 2 nucleotides long. In one embodiment, the sense strand has a 1-10 nucleotide overhang at the 3'-end and/or 5'-end, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or a 10-nucleotide overhang.

Another aspect of the present invention provides a double-stranded ribonucleic acid (dsRNA) reagent for inhibiting xanthine dehydrogenase (XDH) gene expression. The dsRNA reagent includes a sense strand and an antisense strand, wherein the length of each strand is 14 to 30 nucleotides, containing a region complementary to the xanthine dehydrogenase (XDH) gene RNA transcript at nucleotide positions 2 to 18 in the antisense strand, wherein the complementary region contains those listed in Formula I One of the double-stranded ribonucleic acid (dsRNA) reagent antisense sequences differs by at least 15 contiguous nucleotides by 0, 1, 2, or 3 nucleotides, and optionally includes a targeting ligand.

The antisense strand of the double-stranded ribonucleic acid (dsRNA) reagent is shown in formula I: 5'-N _a -(A ₁ A ₂ A ₃ A ₄ ) _i -N _b – (B ₁ B ₂ B ₃ B ₄ ) -N _b -(C ₁ C ₂ C ₃ C ₄ C ₅ ) _j -N _a - 3' (Formula I) Where: i and j are each independently selected from 0 or 1; each N _a and N _b are independently selected represents 0-17 oligonucleotide, the oligonucleotide is optionally modified by the chemical modification used herein; preferably, the chemical modification is selected from 2'-OMe or 2'-fluoro modification; A ₁ A ₂ A ₃ A ₄ represents a motif in which four consecutive nucleotides are sequentially modified by representing lower case 2'-OMe, upper case 2'-fluoro, lower case 2'-OMe, and lower case 2'-OMe. Preferred A ₁ and Between A ₂ and between A ₂ and A ₃ further contain phosphorothioate internucleoside linkages; B ₁ B ₂ B ₃ B ₄ means four consecutive nucleotides are successively replaced by 1 capital 2'-fluoro, and a motif modified by three consecutive lowercase 2'-OMe; C ₁ C ₂ C ₃ C ₄ C ₅ represents a motif in which five consecutive nucleotides are modified by lowercase 2'-OMe, preferably C Phosphorothioate internucleoside linkages are further included between ₃ and _C4 , and between _C4 and _C5 .

In some embodiments, N _a independently represents 0-2 oligonucleotides, and N _b independently represents 2-5 oligonucleotides with or without chemical modification as used herein.

In some embodiments, _Na each independently represents 0 oligonucleotides, and N _b each independently represents 2-5 oligonucleotides chemically modified as used herein.

In some embodiments, Na _each independently represents 0 oligonucleotides, and N _b each independently represents 2-5 oligonucleotides chemically modified with 2'-OMe or 2'-fluorine.

Further, in some embodiments, formula (I) is further represented by formula (II): 5’-xYxxxxYxxxxYxYxYxxxxx- 3’ (Formula II) x represents a lowercase 2'-OMe modified oligonucleotide, and Y represents an uppercase 2'-fluoro modified oligonucleotide. Preferably, x and Y and/or x and x further include a phosphorothioate internucleoside. Key link.

Further, in some embodiments, the sense strand of the double-stranded ribonucleic acid (dsRNA) reagent is represented by formula (III): 5′-(N′ _L ) _n′ N′ _L N′ _L N′ _L N′ _N1 N′ _N2 N′ _N3 N′ _L N′ _F N′ _L N′ _N4 N′ _N5 N′ _N6 N′ _L N′ _L N′ _L (N′ _L ) _m′ -3′ Formula (III) where, N' _F represents 2'-fluoro modified nucleotide; N' _N1 , N' _N2 , N' _N3 , N' _N4 , N' _N5 , and N' _N6 each independently represent a modified or unmodified nucleic acid N′ _N1 N′ _N2 N′ _N3 and N′ _N4 N′ _N5 N′ _N6 each independently represent a nucleotide fragment containing at least two different modifications; N′ _L each independently represents a modified or unmodified nucleotide fragment. Modified nucleotides that are not 2'-fluoro modified nucleotides; m' and n' each independently represent an integer from 0 to 7.

In some embodiments, n′ is 1 and m′ is 1, or n′ is 1 and m′ is 2, or n′ is 1 and m′ is 3, or n′ is 1 and m′ is 4, or n′ is 1 and m′ is 5, or n′ is 3 and m′ is 1, or n′ is 3 and m′ is 2, or n′ is 3 and m′ is 3, or n′ is 5 and m 'it's 1.

In some embodiments, the antisense strand of the dsRNA is at least substantially complementary to any target region of SEQ ID NO: 1. In some embodiments, the antisense strand of the dsRNA is completely complementary to any target region of SEQ ID NO: 1. In some embodiments, the sense strand sequence of any one of the dsRNAs is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the sense strand sequence of any one of the dsRNAs is completely complementary to the antisense strand sequence in the dsRNA agent.

In some embodiments, the region complementary to SEQ ID NO: 1 includes at least 15, 16, 17, 18, or 19 that differs by no more than 3 nucleotides from one of the antisense sequences listed in Tables 1-3 consecutive nucleotides.

In some embodiments, the antisense strand of the dsRNA is at least substantially complementary to any target region of SEQ ID NO: 1 and is provided in one of Tables 1-3.

In some embodiments, the antisense strand of the dsRNA is fully complementary to any target region of SEQ ID NO: 1 and is provided in one of Tables 1-3.

In some embodiments, the dsRNA reagent includes any one of the sense strand sequences listed in Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA reagent.

In some embodiments, the dsRNA reagent includes any one of the sense strand sequences listed in Tables 1-3, wherein the sense strand sequence is completely complementary to the antisense strand sequence in the dsRNA reagent.

In some embodiments, the dsRNA reagent comprises any of the antisense strand sequences listed in Tables 1-3.

In some embodiments, the dsRNA agent comprises any of the sequences listed as duplex sequences in Tables 1-3.

In some embodiments, the sense strand contains one or two reverse abasic residues at the 3' or/and 5' end.

In some embodiments, the sense strand contains one or two imann residues at the 3' or/and 5' end.

In some embodiments, the 3' and 5' ends of the sense strand each independently comprise an imann residue.

In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3' overhang that is at least 1 nucleotide long. In some embodiments, at least one strand includes a 3' overhang that is at least 2 nucleotides long. In one embodiment, the sense strand has a 1-10 nucleotide overhang at the 3'-end and/or 5'-end, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide overhang.

In some embodiments, a dsRNA agent contains at least one modified nucleotide and further contains one or more targeting or linking groups. In some embodiments, one or more targeting groups or linking groups are conjugated to the sense strand. In some embodiments, the targeting group or linking group includes N-acetyl-galactosamine (GalNAc). In some embodiments, the targeting group is as used herein, GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO- 6. Any one of GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16.

In some embodiments, the sense strand independently includes an imann residue at the 3' and 5' ends, wherein either of the 3' and 5' end residues is optionally further linked to a targeting group that targets The group is preferably the aforementioned GLS-15.

According to another aspect of the invention, there is provided a composition comprising any embodiment of the above-described dsRNA agent aspect of the invention.

In certain embodiments, the composition further includes a pharmaceutically acceptable carrier. In some embodiments, the composition further includes one or more additional therapeutic agents.

In certain embodiments, the compositions are packaged in a kit, container, wrapper, dispenser, prefilled syringe, or vial.

In some embodiments, the compositions are formulated for subcutaneous administration or are formulated for intravenous (IV) administration.

According to another aspect of the invention, there is provided a cell comprising any embodiment of the above-described dsRNA agent aspect of the invention.

In some embodiments, the cells are mammalian cells, optionally human cells.

According to another aspect of the present invention, a method for inhibiting xanthine dehydrogenase (XDH) gene expression in cells is provided, the method comprising: (i) preparing an effective amount of the above-mentioned dsRNA reagent or any implementation of the above-mentioned composition. Program cells.

In certain embodiments, the method further includes: (ii) maintaining the prepared cells for a period of time sufficient to obtain degradation of the mRNA transcript of the xanthine dehydrogenase (XDH) gene, thereby inhibiting xanthine dehydrogenase in the cell (XDH) gene expression.

In some embodiments, the cells are in the subject and the dsRNA agent is administered subcutaneously to the subject.

In some embodiments, the cells are in the subject and the dsRNA agent is administered to the subject by IV administration.

In certain embodiments, the method further includes assessing inhibition of the xanthine dehydrogenase (XDH) gene after administering the dsRNA agent to the subject, wherein the assessment includes: (i) determining the xanthine dehydrogenase (XDH) gene in the subject XDH)-related disease or condition, and (ii) compare the identified physiological characteristic to the baseline pre-treatment physiological characteristic and/or xanthine dehydrogenase A comparison is made between a control physiological characteristic of a xanthine dehydrogenase (XDH)-related disease or condition, where the comparison is indicative of the presence or absence of inhibition of xanthine dehydrogenase (XDH) gene expression in the subject.

In some embodiments, the physiological characteristic determined is uric acid levels in the blood;

In some embodiments, a decrease in uric acid levels in the blood indicates a decrease in xanthine dehydrogenase (XDH) gene expression in the subject.

According to another aspect of the present invention, there is provided a method for inhibiting xanthine dehydrogenase (XDH) gene expression in a subject, which includes administering to the subject an effective amount of an embodiment of the foregoing dsRNA agent or an embodiment of the foregoing composition.

In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In certain embodiments, the dsRNA agent is administered to the subject via IV administration. In some embodiments, the method further includes: assessing inhibition of the xanthine dehydrogenase (XDH) gene after administration of the dsRNA agent, wherein the assessing means includes: (i) determining a xanthine dehydrogenase (XDH)-related disease in the subject or one or more physiological characteristics of a condition; (ii) correlating the identified physiological characteristics with baseline pre-treatment physiological characteristics and/or XDH of the XDH-related disease or condition Control physiological characteristics of a disease or condition are compared; wherein the comparison indicates the presence or absence of inhibition of xanthine dehydrogenase (XDH) gene expression in the subject. In some embodiments, the physiological characteristic determined is the level of uric acid in the blood. A decrease in uric acid levels in the blood indicates a decrease in xanthine dehydrogenase (XDH) gene expression in the subject.

According to another aspect of the present invention, there is provided an application for preparing a medicament for treating diseases or conditions related to xanthine dehydrogenase (XDH) protein, the medicament comprising any embodiment of the aforementioned dsRNA reagent aspect of the invention or the present invention. In any embodiment of the aforementioned composition of the invention, the drug can inhibit xanthine dehydrogenase (XDH) gene expression.

According to another aspect of the present invention, there is provided a method of treating a disease or disorder associated with xanthine dehydrogenase (XDH) protein, comprising: administering to a subject an effective amount of any embodiment of the foregoing dsRNA agent aspect of the present invention. Or any embodiment of the aforementioned composition of the invention to inhibit xanthine dehydrogenase (XDH) gene expression.

In certain embodiments, the xanthine dehydrogenase (XDH)-related disease or disorder is selected from: hyperuricemia, gout, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), metabolic disorders, insulin resistance, cardiovascular disease, type 2 diabetes, Lesch Nyhan syndrome, glycogen storage disorders (GSD), such as GSD type I, and diseases related to oxidative stress, such as chronic low-grade inflammation; or other XDH-related diseases.

In certain embodiments, the disease associated with XDH is gout. In certain embodiments, the disease associated with XDH is hyperuricemia. In certain embodiments, the disease associated with XDH is NASH or NAFLD.

In some embodiments, the method further includes administering an additional treatment regimen to the subject.

In some embodiments, additional treatment options include treatment of xanthine dehydrogenase (XDH)-related diseases or conditions. In certain embodiments, additional treatment regimens include: administering to the subject one or more xanthine dehydrogenase (XDH) antisense polynucleotides of the invention; administering to the subject a non-xanthine dehydrogenase (XDH) dsRNA therapeutics; and effecting behavioral changes in subjects. In some embodiments, the non-xanthine dehydrogenase (XDH) dsRNA therapeutic is one of the following additional therapeutics: for example, allopurinol, hydroxypurine, febuxostat, or interleukin-1 beta (IL-1 beta) Antagonist, preferably the interleukin-1β antagonist is selected from canakinumab or rilonacept, thereby treating subjects with diseases that would benefit from a reduction in xanthine dehydrogenase (XDH).

In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In certain embodiments, the dsRNA agent is administered to the subject via IV administration. In some embodiments, the method further includes determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject. In some embodiments, means of determining the efficacy of a treatment in a subject includes: (i) determining one or more physiological characteristics of a xanthine dehydrogenase (XDH)-related disease or disorder in the subject; (ii) converting the determined The physiological profile is compared to a baseline pre-treatment physiological profile for a xanthine dehydrogenase (XDH)-related disease or condition, wherein the comparison indicates the presence, absence, and level of efficacy of a double-stranded ribonucleic acid (dsRNA) agent administered to the subject one or more. In some embodiments, the physiological characteristic determined is the level of uric acid in the blood. A decrease in uric acid levels in the blood indicates the effectiveness of the double-stranded ribonucleic acid (dsRNA) agent administered to the subject.

According to another aspect of the invention, there is provided a method of reducing xanthine dehydrogenase (XDH) protein levels in a subject as compared to baseline pre-treatment levels of xanthine dehydrogenase (XDH) protein in the subject, comprising administering to the subject An effective amount of any embodiment of the foregoing dsRNA agent aspect of the invention or any embodiment of the foregoing composition of the invention to reduce the level of xanthine dehydrogenase (XDH) gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by IV.

According to another aspect of the invention, there is provided a change in the physiology of a xanthine dehydrogenase (XDH)-related disease or disorder in a subject as compared to baseline pre-treatment physiological characteristics of the xanthine dehydrogenase (XDH)-related disease or disorder in the subject. A characterized method comprising administering to a subject an effective amount of any embodiment of the foregoing dsRNA agent aspect of the invention or any embodiment of the foregoing composition of the invention to alter a xanthine dehydrogenase (XDH)-related disease in the subject or Physiological characteristics of the disease. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by IV. In some embodiments, the physiological characteristic determined is a reduction in uric acid. Sequence description

Duplexes AV00206 to AV00292 are shown in Table 1 and their sense strand sequences are shown.

Duplexes AV00206 to AV00292 are shown in Table 1 and their antisense strand sequences are shown.

SEQ ID NO: 1 is human xanthine dehydrogenase (XDH) mRNA [NCBI reference sequence: NM_000379.4].

In the sequences shown in Table 2, chemical modifications are indicated as: uppercase: 2'-fluoro; lowercase: 2'-OMe; phosphorothioate: *.

In the sequences shown in Table 3, the delivery molecules used in the in vivo studies are designated "GLX-n" at the 3' or 5' end of each sense strand. Chemical modifications are represented as: uppercase: 2'-fluoro; lowercase: 2'-OMe; phosphorothioate: *; Invab = reverse abasic; imann: at the end of each chain: or when further coupled to a delivery molecule or targeting group: .

Some embodiments of the invention include RNAi agents capable of inhibiting xanthine dehydrogenase (XDH) gene expression, such as, but not limited to, double-stranded (ds) RNAi agents. The xanthine dehydrogenase (XDH) dsRNA reagent of the present invention can target xanthine dehydrogenase (XDH) transcripts, resulting in the inhibition of xanthine dehydrogenase (XDH) protein expression. Some embodiments of the invention also include compositions comprising xanthine dehydrogenase (XDH) gene RNAi agents and methods of using the compositions. The xanthine dehydrogenase (XDH) gene RNAi agents disclosed herein can be attached to a delivery compound for delivery to cells, including delivery to hepatocytes. Pharmaceutical compositions of the invention may comprise at least one xanthine dehydrogenase (XDH) dsRNA agent and a delivery compound. In some embodiments of the invention, the delivery compound is a GalNAc-containing delivery compound. The xanthine dehydrogenase (XDH) gene RNAi reagent delivered to cells can inhibit xanthine dehydrogenase (XDH) gene expression, thereby reducing the activity of the gene's xanthine dehydrogenase (XDH) protein product in cells. The dsRNAi agents of the present invention can be used to treat xanthine dehydrogenase (XDH)-related diseases and conditions. Such dsRNAi agents include, for example, duplexes AV00206 to AV00292 shown in Table 1. In some embodiments, preferred dsRNAi agents include, for example, duplexes AV00227, AV00260, AV00285, AV00266, AV00280, AV00238, AV00249, AV00289, AV00233, AV00225, AV00273, or AV00283. In other embodiments, preferred dsRNAi agents of Table 2 include, for example, duplexes AV00227, AV00260, AV00285, AV00266, or AV00280. In other embodiments, preferred dsRNAi agents in Table 3 include, for example, duplexes AD00353, AD00356, AD00358, AD00364, AD00365, AD00366, AD00368, AD00370, AD00430, AD00431, AD00432, AD00521, AD00521-1, AD00364-1 , AD00365-2, AD00366-1 and AD00432-1.

In some embodiments of the invention, reducing xanthine dehydrogenase (XDH) expression in a cell or subject treats a disease or disorder associated with xanthine dehydrogenase (XDH) expression in a cell or subject, respectively. Non-limiting examples of diseases and conditions that can be treated by reducing xanthine dehydrogenase (XDH) activity are: hyperuricemia, gout, NAFLD, NASH, metabolic disorders, insulin resistance, cardiovascular disease, type 2 diabetes, Lesch Nyhan syndrome, glycogen storage disorders (GSD), such as GSD type I, or diseases related to oxidative stress, such as chronic low-grade inflammation; or other XDH-related diseases.

Described below is how to prepare and use compositions containing xanthine dehydrogenase (XDH) single-stranded (ssRNA) and double-stranded (dsRNA) reagents to inhibit xanthine dehydrogenase (XDH) gene expression, and for treating symptoms caused by xanthine dehydrogenase (XDH). Compositions and methods for diseases and conditions caused or modulated by purine dehydrogenase (XDH) gene expression. As used herein, diseases and/or conditions caused or modulated by the presence and/or levels of xanthine dehydrogenase (XDH) gene expression are referred to as "xanthine dehydrogenase (XDH)-related diseases and/or conditions." The term "RNAi" is also known in the art and may be referred to as "siRNA".

As used herein, "G", "C", "A" and "U" generally each represent a nucleotide containing guanine, cytosine, adenine and uracil as bases, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" may also refer to modified nucleotides, as described in further detail below, or alternative replacement moieties. Those skilled in the art understand that guanine, cytosine, adenine and uracil can be replaced by other moieties without substantially altering the base pairing properties of the oligonucleotide containing the nucleotides of such replaced moieties. For example, but not limited to, a nucleotide containing inosine as its base may base pair with a nucleotide containing adenine, cytosine, or uracil. Therefore, in the nucleotide sequences of the present invention, nucleotides containing uracil, guanine or adenine may be replaced by nucleotides containing, for example, inosine. Sequences containing such replacement moieties are embodiments of the invention.

As used herein, the term "RNAi" refers to agents that contain RNA and mediate targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi target region refers to a contiguous portion of the nucleotide sequence of an RNA molecule formed during gene transcription, which includes messenger RNA (mRNA), which is a processing product of the primary transcript RNA. The target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion. The target sequence can be 8-30 nucleotides long (inclusive), 10-30 nucleotides long (inclusive), 12-25 nucleotides long (inclusive), 15-23 nucleotides long (inclusive), 16 - 23 nucleotides long (inclusive), or 18 - 23 nucleotides long (inclusive), including all shorter within each specified range length. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleosides Sour and long. In certain embodiments, the target sequence is between 9 and 26 nucleotides in length, inclusive, including all subranges and integers therebetween. For example, although not intended to be limiting, in certain embodiments of the invention, the target sequences are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 , 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides long, the sequence is completely or at least substantially complementary to at least a portion of the RNA transcript of the xanthine dehydrogenase (XDH) gene.

Some aspects of the invention include pharmaceutical compositions comprising one or more xanthine dehydrogenase (XDH) dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the invention, xanthine dehydrogenase (XDH) gene RNAi as described herein inhibits the expression of xanthine dehydrogenase (XDH) protein.

In some embodiments of the invention, pharmaceutical compositions include one, two, three, or more independent antixanthine dehydrogenase (XDH) dsRNA agents, and may also include one or more independently selected delivery compounds. In some embodiments, two, three, four or more different positions/regions will be capable of targeting one, two, three, four or more different positions/regions of xanthine dehydrogenase (XDH) mRNA respectively. Multiple xanthine dehydrogenase (XDH) dsRNAs are administered to cells or subjects.

As used herein, a "dsRNA agent" refers to a composition comprising an RNA or RNA-like (eg, chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting translation of a target mRNA transcript. While not wishing to be bound to a particular theory, the dsRNA agents of the present invention may act through an RNA interference mechanism (i.e., induce RNA interference by interacting with the RNA interference pathway machinery of mammalian cells (RNA-induced silencing complex or RISC) ), or act through any alternative mechanism or pathway. Methods to achieve gene silencing in plant, invertebrate and vertebrate cells are well known in the art (see, e.g., Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188)), the disclosures of which are incorporated herein by reference in their entirety. Gene silencing means known in the art can be used in conjunction with the disclosure provided herein to achieve inhibition of xanthine dehydrogenase (XDH) expression.

The dsRNA reagent disclosed herein consists of a sense strand and an antisense strand, including but not limited to: short interfering RNA (siRNA), RNAi reagents, microRNA (miRNA), short hairpin RNA (shRNA) and Dicer. substrate. The antisense strand of the dsRNA reagents described herein is at least partially complementary to the targeted mRNA, and it is understood in the art that dsRNA duplex structures of various lengths can be used to inhibit target gene expression. For example, dsRNAs with duplex structures of 19, 20, 21, 22, and 23 base pairs are known to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). It is also known in the art that shorter or longer RNA duplex structures are also effective in inducing RNA interference. The xanthine dehydrogenase (XDH) dsRNA in certain embodiments of the invention may comprise at least one strand of at least 21 nt in length, or the duplex may have a sequence based on one of the sequences listed in Tables 1-3 Length minus 1, 2, 3 nt or less. It can also be effective to reduce 4 nucleotides at one or both ends compared to the dsRNA listed in Tables 1-3 respectively. In some embodiments of the invention, the xanthine dehydrogenase (XDH) dsRNA reagent may have at least 15, 16, 17, 18, 19, 20 or more of one or more sequences from Tables 1-3 A partial sequence of contiguous nucleotides and their ability to inhibit xanthine dehydrogenase (XDH) gene expression does not differ by more than 5 from the level of inhibition produced by a dsRNA containing the entire sequence (also referred to here as the "parental" sequence) %, 10%, 15%, 20%, 25% or 30%. The sense sequences, antisense sequences and duplexes disclosed in Tables 1-3 may be referred to as "parent" sequences herein, which means that the sequences disclosed in Tables 1-3 may be modified, shortened, extended, include substitutions, etc. , the resulting sequence retains all or at least part of the efficacy of its parent sequence in the methods and compositions of the invention, as described herein.

Certain embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and/or administer the single-stranded RNA to the subject. For example, the antisense strand listed in any of Tables 1-3 can be used as or within a composition that, when administered to a subject, reduces xanthine dehydrogenase (XDH) polypeptide activity and/or or the expression of the xanthine dehydrogenase (XDH) gene. Tables 1-3 show the antisense and sense strand core extension base sequences for certain xanthine dehydrogenase (XDH) dsRNA reagents. Single-stranded antisense molecules that may be included in certain compositions of the invention and/or administered in certain methods of the invention are referred to herein as "single-stranded antisense agents" or "antisense polynucleotide agents" . Single-stranded sense molecules that may be included in certain compositions and/or administered in certain methods of the invention are referred to herein as "single-stranded sense agents" or "sense polynucleotide agents." The term "base sequence" as used herein refers to a polynucleotide sequence without chemical modifications or delivery compounds. For example, the sense strand shown in Table 1 corresponds to the corresponding base sequence in Table 3; however, the corresponding sequence in Table 3 shows the respective chemical modifications and delivery compounds. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be identified with "sense strand SS#"; a single-stranded antisense sequence may be identified with "antisense strand AS#"; and a duplex containing a sense strand and an antisense strand may be identified with "duplex Chain AD#" to identify.

Table 1 includes the sense and antisense strands and provides the identification number of the duplex formed by the sense and antisense strands on the same row in Table 1. In certain embodiments of the invention, the antisense sequence contains nucleobase u or nucleobase a in position 1 thereof. In certain embodiments of the invention, the antisense sequence comprises nucleobase u at position 1 of the antisense sequence. As used herein, the term "matching position" refers in a sense to a position in each strand that "pairs" with each other when the two strands act as a duplex. For example, in a 21-nucleobase sense strand and a 21-nucleobase antisense strand, the nucleobase at position 1 of the sense strand is in a "matching position" with the nucleobase at position 21 of the antisense strand. In another non-limiting example, for a 23 nucleobase sense strand and a 23 nucleobase antisense strand, nucleobase position 2 of the sense strand is in a matching position with position 22 of the antisense strand. In another non-limiting example, in the 18-nucleobase sense strand and the 18-nucleobase antisense strand, the nucleobase at position 1 of the sense strand is in a matching position with the nucleobase at position 18 of the antisense strand; and the sense strand Nucleobase 4 in the strand matches nucleobase 15 in the antisense strand. The skilled person will understand how to identify matching positions between the sense and antisense strands of duplexes and paired strands.

The first column in Table 1 represents the duplex AV# of the duplex containing the sense and antisense sequences in the same row of the table. For example, Table 1 discloses a duplex designated "Duplex AV00206" which contains corresponding sense and antisense strand sequences. Thus, each row in Table 1 identifies a duplex of the invention, each containing the sense and antisense sequences shown in the same row, and the assigned identifier for each duplex is shown at the end of that row. in one column.

In some embodiments of the methods of the invention, an RNAi agent comprising the polynucleotide sequence set forth in Table 1 is administered to the subject. In some embodiments of the invention, the RNAi agent administered to the subject includes a duplex comprising at least one of the base sequences listed in Table 1 and comprising 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 sequence modifications. In some embodiments of the method of the present invention, it is also included in linking an RNAi agent of the polynucleotide sequence shown in Table 1 to a delivery molecule, a non-limiting example of which is a delivery compound comprising GalNAc.

Table 1: Unmodified xanthine dehydrogenase (XDH) gene RNAi reagent antisense and sense strand sequences Duplex AV# The base sequence of the sense strand is 5'→3' SEQ ID NO Antisense strand base sequence 5' → 3' SEQ ID NO AV00206 UCCAGAGACAACCCUUUUGGA 2 UCCAAAAGGGUUGUCUCUGGA 89 AV00207 CAAGUGAUGCUCUCCAAGUAA 3 UUACUUGGAGAGCAUCACUGU 90 AV00208 CAGUGAUGCCUCUCCAAGUAUA 4 UAUACUUGGAGAGCAUCACUG 91 AV00209 UGCUCUCCAAGUAUGAUCGUA 5 UACGAUCAUACUUGGAGAGCA 92 AV00210 CUCUCCAAGUAUGAUCGUCUA 6 UAGACGAUCAUACUUGGAGAG 93 AV00211 AACAAGAUCGUCCACUUUUCA 7 UGAAAAGUGGACGAUCUUGUU 94 AV00212 ACAAGAUCGUCCACUUUUCUA 8 UAGAAAAGUGGACGAUCUUGU 95 AV00213 ACCAUGUUGCAGUGACAACUA 9 UAGUUGUCACUGCAACAUGGU 96 AV00214 CCAUGUUGCAGUGACAACUGA 10 UCAGUUGUCACUGCAACAUGG 97 AV00215 GCAGGAGAGAAUUGCCAAAAA 11 UUUUUGGCAAUUCUCUCCUGC 98 AV00216 CAGGAGAGAAUUGCCAAAAGA 12 UCUUUUGGCAAUUCUCUCCUG 99 AV00217 UGGCAUCGUCAUGAGUAUGUA 13 UACAUACUCAUGACGAUGCCA 100 AV00218 GGCAUCGUCAUGAGUAUGUAA 14 UUACAUACUCAUGACGAUGCC 101 AV00219 GCAUCGUCAUGAGUAUGUACA 15 UGUACAUACUCAUGACGAUGC 102 AV00220 UCGUCAUGAGUAUGUACACAA 16 UUGUGUACAUACUCAUGACGA 103 AV00221 AACACGGAGAUUGGCAUUGAA 17 UUCAAUGCCAAUCUCCGUGUU 104 AV00222 GAGAUUGGCAUUGAGAUGAAA 18 UUUCAUCUCAAUGCCAAUCUC 105 AV00223 GAUGAAGUUCAAGAAUAUGCA 19 UGCAUAUUCUUGAACUUCAUC 106 AV00224 AUGAAGUUCAAGAAUAUGCUA 20 UAGCAUAUUCUUGAACUUCAU 107 AV00225 AGAAUAUGCUGUUUCCUAUGA twenty one UCAUAGGAAACAGCAUAUUCU 108 AV00226 UGCUUGCCCCCUGAGCAUUGA twenty two UCAAUGCUCAGGGGGCAAGCA 109 AV00227 GCUAAGCUUCCUGCCCAAAAA twenty three UUUUUGGGCAGGAAGCUUAGC 110 AV00228 CGUUGGAGGGAACAUCAUCAA twenty four UUGAUGAUGUUCCCUCCAACG 111 AV00229 GAGAUACUGCUCUCCAUAGAA 25 UUCUAUGGAGAGCAGUAUCUC 112 AV00230 GGGGAGUAUUUCUCAGCAUUA 26 UAAUGCUGAGAAAUACUCCCC 113 AV00231 AACCAGUGGCAUGAGAGUUUA 27 UAAACUCUCAUGCCACUGGUU 114 AV00232 GGCAUGAGAGUUUUAUUCAAA 28 UUUGAAUAAAACUCUCAUGCC 115 AV00233 UCAGCUUCUUCUUCAAGUUCA 29 UGAACUUGAAGAAGAAGCUGA 116 AV00234 CUUUCGCCAGUGCAACUUUAA 30 UUAAAGUUGCACUGGCGAAAG 117 AV00235 UUUCGCCAGUGCAACUUUACA 31 UGUAAAGUUGCACUGGCGAAA 118 AV00236 UACGAGAAUGAGCUGUCUCUA 32 UAGAGACAGCUCAUUCUCGUA 119 AV00237 GUUUGUUUGUUUCAUUUCCGA 33 UCGGAAAUGAAACAAACAAAC 120 AV00238 GUUACUUGUGUUGGGCAUAUA 34 UAAUUGCCCAACACAAGUAAC 121 AV00239 UACUUGUGUUGGGCAAUCAA 35 UUGAUAUGCCCAACACAAGUA 122 AV00240 ACUUGUGUUGGGCAAUCAUA 36 UAUGAUAUGCCCAACACAAGU 123 AV00241 UGUGUUGGGCAUAUCAUUGGA 37 UCCAAUGAUAUGCCCAACACA 124 AV00242 AGGGGUGAAAAUCACCUAUGA 38 UCAUAGGUGAUUUUCACCCCU 125 AV00243 AUCACCUAUGAAGAACUACCA 39 UGGUAGUUCUUCAUAGGUGAU 126 AV00244 GAAGAACUACCAGCCAUUAUA 40 UAUAAUGGCUGGUAGUUCUUC 127 AV00245 AAGAACUACCAGCCAUUAUCA 41 UGAUAAUGGCUGGUAGUUCUU 128 AV00246 CUACCAGCCAUUAUCACAUA 42 UAUUGUGAUAAUGGCUGGUAG 129 AV00247 ACCAGCCAUUAUCACAAUUGA 43 UCAAUUGUGAUAAUGGCUGGU 130 AV00248 AAAGAACAACUCCUUUUAUGA 44 UCAUAAAAGGAGUUGUUCUUU 131 AV00249 UUUUAUGGACCUGAGCUGAAA 45 UUUCAGCUCAGGUCCAUAAAA 132 AV00250 UAAAGAAGGGGUUUUCCGAAA 46 UUUCGGAAAACCCCUUCUUUA 133 AV00251 GGUUUUCCGAAGCAGAUAAUA 47 UAUUAUCUGCUUCGGAAAACC 134 AV00252 UUCCGAAGCAGAUAAUGUUGA 48 UCAACAUUAUCUGCUUCGGAA 135 AV00253 CACCAUUGCUGUUCCAAAAGA 49 UCUUUUGGAACAGCAAUGGUG 136 AV00254 GAUGGAGCUCUUUGUGUCUAA 50 UUAGACACAAAGAGCUCCAUC 137 AV00255 AUGGAGCUCUUUGUGUCUACA 51 UGUAGACACAAAGAGCUCCAU 138 AV00256 AGCUCUUUGUGUCUACACAGA 52 UCUGUGUAGACACAAAGAGCU 139 AV00257 GCUCUUUGUGUCUACACAGAA 53 UUCUGUGUAGACACAAAGAGC 140 AV00258 GUGUCUACACAGAACACCAUA 54 UAUGGUGUUCUGUGUAGACAC 141 AV00259 GUCUACACAGAACACCAUGAA 55 UUCAUGGUGUUCUGUAGAC 142 AV00260 GACCCAGAGCUUUGUUGCAAA 56 UUUGCAACAAAGCUCUGGGUC 143 AV00261 CUUUGUUGCAAAAAUGUUGGA 57 UCCAACAUUUUGCAACAAAG 144 AV00262 CGGAUUGUGGUUCGAGUGAAA 58 UUUCACUCGAACCACAAUCCG 145 AV00263 GUGGUUCGAGUGAAGAGAAUA 59 UAUUCUCUUCACUCGAACCAC 146 AV00264 GAUGAGGACAUGCUGAUAACA 60 UGUUAUCAGCAUGUCCUCAUC 147 AV00265 AGGACAUGCUGAUAACUGGUA 61 UACCAGUUAUCAGCAUGUCCU 148 AV00266 UCCUGGCCAGAUACAAGGUUA 62 UAACCUUGUAUCUGGCCAGGA 149 AV00267 GCCAGAUACAAGGUUGGCUUA 63 UAAGCCAACCUUGUAUCUGGC 150 AV00268 AGAUACAAGGUUGGCUUCAUA 64 UAUGAAGCCAACCUUGUAUCU 151 AV00269 CAGGAUCUCUCUCAGAGUAUA 65 UAUACUCUGAGAGAGAUCCUG 152 AV00270 AUCUCUCUCAGAGUAUUAUGA 66 UCAUAAUACUCUGAGAGAGAU 153 AV00271 UCUCUCUCAGAGUAUUAUGGA 67 UCCAUAAUACUCUGAGAGAGA 154 AV00272 CUCUCUCAGAGUAUUAUGGAA 68 UUCCAUAAUACUCUGAGAGAG 155 AV00273 CUCUCAGAGUAUUAUGGAACA 69 UGUUCCAUAAUACUCUGAGAG 156 AV00274 UUUAUUCCACAUGGACAACUA 70 UAGUUGUCCAUGUGGAAUAAA 157 AV00275 CCUGACACACUUCAACCAGAA 71 UUCUGGUUGAAGUGUGUCAGG 158 AV00276 CUGACACACUUCAACCAGAAA 72 UUUCUGGUUGAAGUGUGUCAG 159 AV00277 CUAGCAAGCUCUCAGUAUCAA 73 UUGAUACUGAGAGCUUGCUAG 160 AV00278 UAGCAAGCUCUCAGUAUCAUA 74 UAUGAUACUGAGAGCUUGCUA 161 AV00279 CAAGCUCUCAGUAUCAUGCUA 75 UAGCAUGAUACUGAGAGCUUG 162 AV00280 GCUCGGAAGAGUGAGGUUGAA 76 UUCAACCUCACUCUUCCGAGC 163 AV00281 GAAGAGUGAGGUUGACAAGUA 77 UACUUGUCAACCUCACUCUUC 164 AV00282 AAGAGUGAGGUUGACAAGUUA 78 UAACUUGUCAACCUCACUCUU 165 AV00283 GGUUGACAAGUUCAACAAGGA 79 UCCUUGUUGAACUUGUCAACC 166 AV00284 AAGUUCAACAAGGAGAAUUGA 80 UCAAUUCUCCUUGUUGAACUU 167 AV00285 AAGGAGAAUUGUUGGAAAAAA 81 UUUUUUCCAACAAUUCUCCUU 168 AV00286 CAUAAUUCCCACCAAGUUUGA 82 UCAAACUUGGUGGGAAUUAUG 169 AV00287 UCCCACCAAGUUUGGAAUAAA 83 UUUAUUCCAAACUUGGUGGGA 170 AV00288 CCACCACCAAGUUUGGAAUAAGA 84 UCUUAUUCCAAACUUGGGGG 171 AV00289 AGUUCCUUUUCUGAAUCAGGA 85 UCCUGAUUCAGAAAAGGAACU 172 AV00290 CCUACUUCAUGUGUACACAGA 86 UCUGUGUACACAUGAAAGUAGG 173 AV00291 CUACUUCAUGUGUACACAGAA 87 UUCUGUGUACACAUGAAGUAG 174 AV00292 UACUUCAUGUGUACACAGAUA 88 UAUCUGUGUACACAUGAAAGUA 175

All sequences in Table 1 are shown in the 5' to 3' direction. Duplex AV# is the number assigned to the duplex of both strands in the same row in the table. The "SEQ ID NO" in the third column of Table 1 is the sequence number of the sense sequence shown in the second column, and the "SEQ ID NO" in the fifth column of Table 1 is the sequence number of the antisense sequence shown in the fourth column. .

Table 2 shows the antisense and sense strand sequences of certain chemically modified xanthine dehydrogenase (XDH) gene RNAi agents of the present invention. In some embodiments of the methods of the invention, an RNAi agent having the polynucleotide sequence set forth in Table 2 is administered to the cell and/or subject. In some embodiments of the methods of the invention, an RNAi agent having the polynucleotide sequence set forth in Table 2 is administered to the subject. In some embodiments of the invention, the RNAi agent administered to the subject comprises the duplexes noted in the first column of Table 2, and comprises the sense and reverse duplexes shown in the third and sixth columns of the same row in Table 2, respectively. Sequence modifications in the sense strand sequence. In some embodiments of the methods of the invention, the sequences shown in Table 2 can be linked to (also referred to herein as "conjugated to") a compound capable of delivering an RNAi agent to cells and/or tissues of a subject. Non-limiting examples of delivery compounds useful in certain embodiments of the invention are GalNAc-containing compounds. In Table 2, the first column represents the duplex AV# of the base sequence and corresponds to Table 1. For the base sequence identified by duplex AV#, not only the base sequences contained in the sense and antisense strands are shown, but also with the specified chemical modifications shown in the same row of Table 2. For example, the first row of Table 1 shows the single-stranded sequences of sense and antisense bases, which together form a duplex, identified as: duplex AV# AV00206; and in the duplex AV# AV00206 listed in Table 2, As a duplex, it contains the base sequences of AV00206-SS and AV00206-AS, and contains chemical modifications in the sense and antisense sequences shown in the third and sixth columns, respectively. The "sense strand SS#" in the second column of Table 2 is the designated identifier for the sense sequence (including modifications) shown in the third column of the same row. "Antisense Strand AS#" in the fifth column of Table 2 is the designated identifier for the antisense sequence (including modifications) shown in the sixth column. The "SEQ ID NO" in the fourth column of Table 2 is the sequence number of the sense sequence (including modifications) shown in the third column of the same row. "SEQ ID NO" in the seventh column of Table 2 is the sequence number of the antisense sequence (including modifications) shown in the sixth column.

Table 2: Provides the antisense and sense strand sequences of chemically modified xanthine dehydrogenase (XDH) gene RNAi reagents. All sequences are shown 5' to 3'. These sequences were used in certain in vitro testing studies described herein. Chemical modifications are expressed as: uppercase: 2'-fluoro; lowercase: 2'-OMe; phosphorothioate: *.

Table 2: Antisense and sense strand sequences of chemically modified xanthine dehydrogenase (XDH) gene RNAi reagents Duplex AV# Chain of Justice SS# justice sequence SEQ ID NO Antisense strand AS# antisense sequence SEQ ID NO AV00206 AV00206-SS u*c*cagagaCaAcCcuuuugg*a 176 AV00206-AS u*C*caaaAggguUgUcUcug*g*a 263 AV00207 AV00207-SS a*c*agugauGcUcUccaagua*a 177 AV00207-AS u*U*acuuGgagaGcAuCacu*g*u 264 AV00208 AV00208-SS c*a*gugaugCuCuCcaaguau*a 178 AV00208-AS u*A*uacuUggagAgCaUcac*u*g 265 AV00209 AV00209-SS u*g*cucuccAaGuAugaucgu*a 179 AV00209-AS u*A*cgauCauacUuGgAgag*c*a 266 AV00210 AV00210-SS c*u*cuccaaGuAuGaucgucu*a 180 AV00210-AS u*A*gacgAucauAcUuGgag*a*g 267 AV00211 AV00211-SS a*a*caagauCgUcCacuuuuc*a 181 AV00211-AS u*G*aaaaGuggaCgAuCuug*u*u 268 AV00212 AV00212-SS a*c*aagaucGuCcAcuuuucu*a 182 AV00212-AS u*A*gaaaAguggAcGaUcuu*g*u 269 AV00213 AV00213-SS a*c*cauguuGcAgUgacaacu*a 183 AV00213-AS u*A*guugUcacuGcAaCaug*g*u 270 AV00214 AV00214-SS c*c*auguugCaGuGacaacug*a 184 AV00214-AS u*C*aguuGucacUgCaAcau*g*g 271 AV00215 AV00215-SS g*c*aggagaGaAuUgccaaaa*a 185 AV00215-AS u*U*uuugGcaauUcUcUccu*g*c 272 AV00216 AV00216-SS c*a*ggagagAaUuGccaaaag*a 186 AV00216-AS u*C*uuuuGgcaaUuCuCucc*u*g 273 AV00217 AV00217-SS u*g*gcaucgUcAuGaguaugu*a 187 AV00217-AS u*A*cauaCucauGaCgAugc*c*a 274 AV00218 AV00218-SS g*g*caucguCaUgAguaugua*a 188 AV00218-AS u*U*acauAcucaUgAcGaug*c*c 275 AV00219 AV00219-SS g*c*aucgucAuGaGuauguac*a 189 AV00219-AS u*G*uacaUacucAuGaCgau*g*c 276 AV00220 AV00220-SS u*c*gucaugAgUaUguacaca*a 190 AV00220-AS u*U*guguAcauaCuCaUgac*g*a 277 AV00221 AV00221-SS a*a*cacggaGaUuGgcauuga*a 191 AV00221-AS u*U*caauGccaaUcUcCgug*u*u 278 AV00222 AV00222-SS g*a*gauuggCaUuGagaugaa*a 192 AV00222-AS u*U*ucauCucaaUgCcAauc*u*c 279 AV00223 AV00223-SS g*a*ugaaguUcAaGaauaugc*a 193 AV00223-AS u*G*cauaUucuuGaAcUuca*u*c 280 AV00224 AV00224-SS a*u*gaaguuCaAgAauaugcu*a 194 AV00224-AS u*A*gcauAuucuUgAaCuuc*a*u 281 AV00225 AV00225-SS a*g*aauaugCuGuUuccuaug*a 195 AV00225-AS u*C*auagGaaacAgCaUauu*c*u 282 AV00226 AV00226-SS u*g*cuugccCcCuGagcauug*a 196 AV00226-AS u*C*aaugCucagGgGgCaag*c*a 283 AV00227 AV00227-SS g*c*uaagcuUcCuGcccaaaa*a 197 AV00227-AS u*U*uuugGgcagGaAgCuua*g*c 284 AV00228 AV00228-SS c*g*uuggagGgAaCaucauca*a 198 AV00228-AS u*U*gaugAuguuCcCuCcaa*c*g 285 AV00229 AV00229-SS g*a*gauacuGcUcUccauaga*a 199 AV00229-AS u*U*cuauGgagaGcAgUauc*u*c 286 AV00230 AV00230-SS g*g*ggaguaUuUcUcagcauu*a 200 AV00230-AS u*A*augcUgagaAaUaCucc*c*c 287 AV00231 AV00231-SS a*a*ccagugGcAuGagaguuu*a 201 AV00231-AS u*A*aacuCucauGcCaCugg*u*u 288 AV00232 AV00232-SS g*g*caugagAgUuUuauucaa*a 202 AV00232-AS u*U*ugaaUaaaaCuCuCaug*c*c 289 AV00233 AV00233-SS u*c*agcuucUuCuUcaaguuc*a 203 AV00233-AS u*G*aacuUgaagAaGaAgcu*g*a 290 AV00234 AV00234-SS c*u*uucgccAgUgCaacuuua*a 204 AV00234-AS u*U*aaagUugcaCuGgCgaa*a*g 291 AV00235 AV00235-SS u*u*ucgccaGuGcAacuuuac*a 205 AV00235-AS u*G*uaaaGuugcAcUgGcga*a*a 292 AV00236 AV00236-SS u*a*cgagaaUgAgCugucucu*a 206 AV00236-AS u*A*gagaCagcuCaUuCucg*u*a 293 AV00237 AV00237-SS g*u*uuguuuGuUuCauuuccg*a 207 AV00237-AS u*C*ggaaAugaaAcAaAcaa*a*c 294 AV00238 AV00238-SS g*u*uacuugUgUuGggcauau*a 208 AV00238-AS u*A*uaugCccaaCaCaAgua*a*c 295 AV00239 AV00239-SS u*a*cuugugUuGgGcauauca*a 209 AV00239-AS u*U*gauaUgcccAaCaCaag*u*a 296 AV00240 AV00240-SS a*c*uuguguUgGgCauaucau*a 210 AV00240-AS u*A*ugauAugccCaAcAcaa*g*u 297 AV00241 AV00241-SS u*g*uguuggGcAuAucauugg*a 211 AV00241-AS u*C*caauGauauGcCcAaca*c*a 298 AV00242 AV00242-SS a*g*gggugaAaAuCaccuaug*a 212 AV00242-AS u*C*auagGugauUuUcAccc*c*u 299 AV00243 AV00243-SS a*u*caccuaUgAaGaacuacc*a 213 AV00243-AS u*G*guagUucuuCaUaGgug*a*u 300 AV00244 AV00244-SS g*a*agaacuAcCaGccauuau*a 214 AV00244-AS u*A*uaauGgcugGuAgUucu*u*c 301 AV00245 AV00245-SS a*a*gaacuaCcAgCcauuauc*a 215 AV00245-AS u*G*auaaUggcuGgUaGuuc*u*u 302 AV00246 AV00246-SS c*u*accagcCaUuAucacaau*a 216 AV00246-AS u*A*uuguGauaaUgGcUggu*a*g 303 AV00247 AV00247-SS a*c*cagccaUuAuCacaauug*a 217 AV00247-AS u*C*aauuGugauAaUgGcug*g*u 304 AV00248 AV00248-SS a*a*agaacaAcUcCuuuuaug*a 218 AV00248-AS u*C*auaaAaggaGuUgUucu*u*u 305 AV00249 AV00249-SS u*u*uuauggAcCuGagcugaa*a 219 AV00249-AS u*U*ucagCucagGuCcAuaa*a*a 306 AV00250 AV00250-SS u*a*aagaagGgGuUuuccgaa*a 220 AV00250-AS u*U*ucggAaaacCcCuUcuu*u*a 307 AV00251 AV00251-SS g*g*uuuuccGaAgCagauaau*a 221 AV00251-AS u*A*uuauCugcuUcGgAaaa*c*c 308 AV00252 AV00252-SS u*u*ccgaagCaGaUaauguug*a 222 AV00252-AS u*C*aacaUuaucUgCuUcgg*a*a 309 AV00253 AV00253-SS c*a*ccauugCuGuUccaaaag*a 223 AV00253-AS u*C*uuuuGgaacAgCaAugg*u*g 310 AV00254 AV00254-SS g*a*uggagcUcUuUgugucua*a 224 AV00254-AS u*U*agacAcaaaGaGcUcca*u*c 311 AV00255 AV00255-SS a*u*ggagcuCuUuGugucuac*a 225 AV00255-AS u*G*uagaCacaaAgAgCucc*a*u 312 AV00256 AV00256-SS a*g*cucuuuGuGuCuacacag*a 226 AV00256-AS u*C*ugugUagacAcAaAgag*c*u 313 AV00257 AV00257-SS g*c*ucuuugUgUcUacacaga*a 227 AV00257-AS u*U*cuguGuagaCaCaAaga*g*c 314 AV00258 AV00258-SS g*u*gucuacAcAgAacaccau*a 228 AV00258-AS u*A*ugguGuucuGuGuAgac*a*c 315 AV00259 AV00259-SS g*u*cuacacAgAaCaccauga*a 229 AV00259-AS u*U*caugGuguuCuGuGuag*a*c 316 AV00260 AV00260-SS g*a*cccagaGcUuUguugcaa*a 230 AV00260-AS u*U*ugcaAcaaaGcUcUggg*u*c 317 AV00261 AV00261-SS c*u*uuguugCaAaAauguugg*a 231 AV00261-AS u*C*caacAuuuuUgCaAcaa*a*g 318 AV00262 AV00262-SS c*g*gauuguGgUuCgagugaa*a 232 AV00262-AS u*U*ucacUcgaaCcAcAauc*c*g 319 AV00263 AV00263-SS g*u*gguucgAgUgAagagaau*a 233 AV00263-AS u*A*uucuCuucaCuCgAacc*a*c 320 AV00264 AV00264-SS g*a*ugaggaCaUgCugauaac*a 234 AV00264-AS u*G*uuauCagcaUgUcCuca*u*c 321 AV00265 AV00265-SS a*g*gacaugCuGaUaacuggu*a 235 AV00265-AS u*A*ccagUuaucAgCaUguc*c*u 322 AV00266 AV00266-SS u*c*cuggccAgAuAcaagguu*a 236 AV00266-AS u*A*accuUguauCuGgCcag*g*a 323 AV00267 AV00267-SS g*c*cagauaCaAgGuuggcuu*a 237 AV00267-AS u*A*agccAaccuUgUaUcug*g*c 324 AV00268 AV00268-SS a*g*auacaaGgUuGgcuucau*a 238 AV00268-AS u*A*ugaaGccaaCcUuGuau*c*u 325 AV00269 AV00269-SS c*a*ggaucuCuCuCagaguau*a 239 AV00269-AS u*A*uacuCugagAgAgAucc*u*g 326 AV00270 AV00270-SS a*u*cucucuCaGaGuauuaug*a 240 AV00270-AS u*C*auaaUacucUgAgAgag*a*u 327 AV00271 AV00271-SS u*c*ucucucAgAgUauuaugg*a 241 AV00271-AS u*C*cauaAuacuCuGaGaga*g*a 328 AV00272 AV00272-SS c*u*cucucaGaGuAuuaugga*a 242 AV00272-AS u*U*ccauAauacUcUgAgag*a*g 329 AV00273 AV00273-SS c*u*cucagaGuAuUauggaac*a 243 AV00273-AS u*G*uuccAuaauAcUcUgag*a*g 330 AV00274 AV00274-SS u*u*uauuccAcAuGgacaacu*a 244 AV00274-AS u*A*guugUccauGuGgAaua*a*a 331 AV00275 AV00275-SS c*c*ugacacAcUuCaaccaga*a 245 AV00275-AS u*U*cuggUugaaGuGuGuca*g*g 332 AV00276 AV00276-SS c*u*gacacaCuUcAaccagaa*a 246 AV00276-AS u*U*ucugGuugaAgUgUguc*a*g 333 AV00277 AV00277-SS c*u*agcaagCuCuCaguauca*a 247 AV00277-AS u*U*gauaCugagAgCuUgcu*a*g 334 AV00278 AV00278-SS u*a*gcaagcUcUcAguaucau*a 248 AV00278-AS u*A*ugauAcugaGaGcUugc*u*a 335 AV00279 AV00279-SS c*a*agcucuCaGuAucaugcu*a 249 AV00279-AS u*A*gcauGauacUgAgAgcu*u*g 336 AV00280 AV00280-SS g*c*ucggaaGaGuGagguuga*a 250 AV00280-AS u*U*caacCucacUcUuCcga*g*c 337 AV00281 AV00281-SS g*a*agagugAgGuUgacaagu*a 251 AV00281-AS u*A*cuugUcaacCuCaCucu*u*c 338 AV00282 AV00282-SS a*a*gagugaGgUuGacaaguu*a 252 AV00282-AS u*A*acuuGucaaCcUcAcuc*u*u 339 AV00283 AV00283-SS g*g*uugacaAgUuCaacaagg*a 253 AV00283-AS u*C*cuugUugaaCuUgUcaa*c*c 340 AV00284 AV00284-SS a*a*guucaaCaAgGagaauug*a 254 AV00284-AS u*C*aauuCuccuUgUuGaac*u*u 341 AV00285 AV00285-SS a*a*ggagaaUuGuUggaaaaa*a 255 AV00285-AS u*U*uuuuCcaacAaUuCucc*u*u 342 AV00286 AV00286-SS c*a*uaauucCcAcCaaguuug*a 256 AV00286-AS u*C*aaacUugguGgGaAuua*u*g 343 AV00287 AV00287-SS u*c*ccaccaAgUuUggaauaa*a 257 AV00287-AS u*U*uauuCcaaaCuUgGugg*g*a 344 AV00288 AV00288-SS c*c*caccaaGuUuGgaauaag*a 258 AV00288-AS u*C*uuauUccaaAcUuGgug*g*g 345 AV00289 AV00289-SS a*g*uuccuuUuCuGaaucagg*a 259 AV00289-AS u*C*cugaUucagAaAaGgaa*c*u 346 AV00290 AV00290-SS c*c*uacuucAuGuGuacacag*a 260 AV00290-AS u*C*ugugUacacAuGaAgua*g*g 347 AV00291 AV00291-SS c*u*acuucaUgUgUacacaga*a 261 AV00291-AS u*U*cuguGuacaCaUgAagu*a*g 348 AV00292 AV00292-SS u*a*cuucauGuGuAcacagau*a 262 AV00292-AS u*A*ucugUguacAcAuGaag*u*a 349

Table 3 shows the antisense and sense strand sequences of certain chemically modified xanthine dehydrogenase (XDH) gene RNAi reagents of the present invention. In some embodiments of the methods of the invention, an RNAi agent shown in Table 3 is administered to the cell and/or subject. In some embodiments of the methods of the invention, an RNAi agent having the polynucleotide sequence set forth in Table 3 is administered to the subject. In some embodiments of the invention, the RNAi agent administered to the subject comprises a duplex identified in the first column of Table 3, and comprises the sense and reverse duplexes, respectively, in the third and sixth columns of the same row of Table 3. The sequence shown in the sense strand sequence modifies and/or delivers the compound. This sequence was used in certain in vivo testing studies described elsewhere herein. In some embodiments of the methods of the invention, the sequences shown in Table 3 can be linked (also referred to herein as "conjugated") to a compound for delivery, a non-limiting example of which is a GalNAc-containing compound , that is, there is a delivery compound identified as “GLX-n” on the sense strand in the third column of Table 3. Certain embodiments of delivery compounds are identified as "GLS-5", "GLS-15" or "GLX-n" on the sense strand in the third column of Table 3. As used herein and as shown in Table 3, "GLS-5", "GLS-15" and "GLX-n" refer to GalNAc-containing compounds. As used herein, "GLX" is used to mean a "GLS" or "GLO" delivery compound ("X" can be "S" or "O"), and GLX-n can be any GLS and GLO that can be linked during synthesis Delivery compounds to the 3'- or 5'-end of the oligonucleotide. For example but not limited to this: GLX-13 and GLX-14 can be connected to the 3'-end of the oligonucleotide of the present invention during the synthesis process; GLX-5 and GLX-15 can be connected to the present invention during the synthesis process. the 5'-end of the oligonucleotide. In some embodiments, as used herein and as shown in Table 3, "GLX-n" is used to represent an attached GalNAc-containing compound, which is replaced with compounds GLS-1, GLS-2, GLS-3, GLS- 4. GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO- 13. Any one of GLO-14, GLO-15 and GLO-16. In some implementations, GLX-n is shown as an example but not limited to the ones disclosed in the prior art (Jayaprakash, et al., (2014) J. Am. Chem. Soc., 136, 16958−16961) that can be used to connect GalNAc-containing compounds used in certain in vivo testing studies described elsewhere herein. One skilled in the art will be able to prepare and use the dsRNA compounds of the invention, wherein attached delivery compounds include, but are not limited to: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO - 3. GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16. The structure of each of these is provided elsewhere in this article. The first column of Table 3 provides the duplex AD# assigned to the duplexes for the sense and antisense sequences in that row of the table. For example, duplex AD# AD00352 is a duplex composed of sense strand AD00352-SS and antisense strand AD00352-AS. Each row in Table 3 provides one sense strand and one antisense strand, and discloses the duplex consisting of the indicated sense strand and antisense strand. The "sense strand SS#" in the second column of Table 3 is the designated identifier for the sense sequence (including modifications) shown in the third column of the same row. "Antisense Strand AS#" in the fifth column of Table 3 is the designated identifier for the antisense sequence (including modifications) shown in the sixth column. The identifier for certain attached GalNAc-containing GLO compounds is shown as GLX-n, and it is understood that another of the GLO-n or GLS-n compounds may be substituted for the compound shown as GLX-n and the resulting compound is also included in the Compounds are included in embodiments of the methods and/or compositions of the invention. In Table 3, SEQ ID NO:350 to SEQ ID NO:397, SEQ ID NO:446 to SEQ ID NO:451 are the sequences of the sense strand and SEQ ID NO:398 to SEQ ID NO:445, SEQ ID NO:452 to SEQ ID NO:457 is the antisense strand sequence. In Table 3, the delivery molecules are represented as "GLS-5", "GLS-15" at the 3' or 5' end of the sense strand NO: 350 to SEQ ID NO: 397, SEQ ID NO: 446 to SEQ ID NO: 451 ” or “GLX-n”. Chemical modifications are expressed as: upper case: 2'-fluoro; lower case: 2'-methoxy; phosphorothioate: *; Invab: reverse abasic; imann: at the end of each chain: or when further coupled to a delivery molecule or targeting group: .

Table 3 provides antisense and sense strand sequences of chemically modified xanthine dehydrogenase (XDH) gene RNAi reagents for in vivo testing. All sequences are shown 5' to 3'. These sequences were used in certain in vivo testing studies described elsewhere herein. The delivery molecules used in in vivo studies are designated "GLX-n" at the 5' or 3' end of each sense strand. Chemical modifications are expressed as: uppercase: 2'-fluoro; lowercase: 2'-OMe; phosphorothioate: *; Invab: reverse abasic; imann: at the end of each chain: or when further coupled to a delivery molecule or targeting group: .

Table 3 Antisense and sense strand sequences of chemically modified xanthine dehydrogenase (XDH) gene RNAi reagents Duplex AD# Chain of Justice SS# justice sequence SEQ ID NO Antisense strand AS# antisense sequence SEQ ID NO AD00352 AD00352-SS g*a*cacggaGaUuGgcauuga*a(GLO-n) 350 AD00352-AS u*U*caauGccaaUcUcCgug*u*c 398 AD00353 AD00353-SS g*g*aauaugCuGuUuccuaug*a(GLO-n) 351 AD00353-AS u*C*auagGaaacAgCaUauu*c*c 399 AD00354 AD00354-SS c*c*uaagcuUcCuGcccaaaa*a(GLO-n) 352 AD00354-AS u*U*uuugGgcagGaAgCuua*g*g 400 AD00355 AD00355-SS c*a*gauacuGcUcUccauaga*a(GLO-n) 353 AD00355-AS u*U*cuauGgagaGcAgUauc*u*g 401 AD00356 AD00356-SS g*c*agcuucUuCuUcaaguuc*a(GLO-n) 354 AD00356-AS u*G*aacuUgaagAaGaAgcu*g*c 402 AD00357 AD00357-SS c*u*uacuugUgUuGggcauau*a(GLO-n) 355 AD00357-AS u*A*uaugCccaaCaCaAgua*a*g 403 AD00358 AD00358-SS g*u*uuauggAcCuGagcugaa*a(GLO-n) 356 AD00358-AS u*U*ucagCucagGuCcAuaa*a*c 404 AD00359 AD00359-SS g*a*aagaagGgGuUuuccgaa*a(GLO-n) 357 AD00359-AS u*U*ucggAaaacCcCuUcuu*u*c 405 AD00360 AD00360-SS c*a*cccagaGcUuUguugcaa*a(GLO-n) 358 AD00360-AS u*U*ugcaAcaaaGcUcUggg*u*g 406 AD00361 AD00361-SS c*u*gguucgAgUgAagagaau*a(GLO-n) 359 AD00361-AS u*A*uucuCuucaCuCgAacc*a*g 407 AD00362 AD00362-SS g*c*cuggccAgAuAcaagguu*a(GLO-n) 360 AD00362-AS u*A*accuUguauCuGgCcag*g*c 408 AD00363 AD00363-SS g*g*auacaaGgUuGgcuucau*a(GLO-n) 361 AD00363-AS u*A*ugaaGccaaCcUuGuau*c*c 409 AD00364 AD00364-SS g*u*cucucaGaGuAuuaugga*a(GLO-n) 362 AD00364-AS u*U*ccauAauacUcUgAgag*a*c 410 AD00365 AD00365-SS g*u*cucagaGuAuUauggaac*a(GLO-n) 363 AD00365-AS u*G*uuccAuaauAcUcUgag*a*c 411 AD00366 AD00366-SS g*u*uauuccAcAuGgacaacu*a(GLO-n) 364 AD00366-AS u*A*guugUccauGuGgAaua*a*c 412 AD00367 AD00367-SS g*c*ugacacAcUuCaaccaga*a(GLO-n) 365 AD00367-AS u*U*cuggUugaaGuGuGuca*g*c 413 AD00368 AD00368-SS c*c*ucggaaGaGuGagguuga*a(GLO-n) 366 AD00368-AS u*U*caacCucacUcUuCcga*g*g 414 AD00369 AD00369-SS c*g*uugacaAgUuCaacaagg*a(GLO-n) 367 AD00369-AS u*C*cuugUugaaCuUgUcaa*c*g 415 AD00370 AD00370-SS g*a*ggagaaUuGuUggaaaaa*a(GLO-n) 368 AD00370-AS u*U*uuuuCcaacAaUuCucc*u*c 416 AD00371 AD00371-SS g*c*caccaaGuUuGgaauaag*a(GLO-n) 369 AD00371-AS u*C*uuauUccaaAcUuGgug*g*c 417 AD00372 AD00372-SS g*g*uuccuuUuCuGaaucagg*a(GLO-n) 370 AD00372-AS u*C*cugaUucagAaAaGgaa*c*c 418 AD00373 AD00373-SS g*c*uacuucAuGuGuacacag*a(GLO-n) 371 AD00373-AS u*C*ugugUacacAuGaAgua*g*c 419 AD00374 AD00374-SS g*a*cuucauGuGuAcacagau*a(GLO-n) 372 AD00374-AS u*A*ucugUguacAcAuGaag*u*c 420 AD00421 AD00421-SS (GLS-5)*(Invab)*gucuccaaGuAuGaucgucua*(Invab) 373 AD00421-AS u*A*gacgAucauAcUuGgag*a*c 421 AD00422 AD00422-SS (GLS-5)*(Invab)*cgcaugagAgUuUuauucaaa*(Invab) 374 AD00422-AS u*U*ugaaUaaaaCuCuCaug*c*g 422 AD00423 AD00423-SS (GLS-5)*(Invab)*cuuuguuuGuUuCauuuccga*(Invab) 375 AD00423-AS u*C*ggaaAugaaAcAaAcaa*a*g 423 AD00424 AD00424-SS (GLS-5)*(Invab)*guaccagcCaUuAucacaaua*(Invab) 376 AD00424-AS u*A*uuguGauaaUgGcUggu*a*c 424 AD00425 AD00425-SS (GLS-5)*(Invab)*gccagccaUuAuCacaauuga*(Invab) 377 AD00425-AS u*C*aauuGugauAaUgGcug*g*c 425 AD00426 AD00426-SS (GLS-5)*(Invab)*gaccauugCuGuUccaaaaga*(Invab) 378 AD00426-AS u*C*uuuuGgaacAgCaAugg*u*c 426 AD00427 AD00427-SS (GLS-5)*(Invab)*cauggagcUcUuUgugucuaa*(Invab) 379 AD00427-AS u*U*agacAcaaaGaGcUcca*u*g 427 AD00428 AD00428-SS (GLS-5)*(Invab)*gggauuguGgUuCgagugaaa*(Invab) 380 AD00428-AS u*U*ucacUcgaaCcAcAauc*c*c 428 AD00429 AD00429-SS (GLS-5)*(Invab)*gucucucuCaGaGuauuauga*(Invab) 381 AD00429-AS u*C*auaaUacucUgAgAgag*a*c 429 AD00430 AD00430-SS (GLS-5)*(Invab)*guagcaagCuCuCaguaucaa*(Invab) 382 AD00430-AS u*U*gauaCugagAgCuUgcu*a*c 430 AD00431 AD00431-SS (GLS-5)*(Invab)*gaagcucuCaGuAucaugcua*(Invab) 383 AD00431-AS u*A*gcauGauacUgAgAgcu*u*c 431 AD00432 AD00432-SS (GLS-5)*(Invab)*caagagugAgGuUgacaagua*(Invab) 384 AD00432-AS u*A*cuugUcaacCuCaCucu*u*g 432 AD00511 AD00511-SS (GLS-15)*(Invab)*gugaaguuCaAgAauaugcua*(Invab) 385 AD00511-AS u*A*gcauAuucuUgAaCuuc*a*c 433 AD00512 AD00512-SS (GLS-15)*(Invab)*guccgaagCaGaUaauguuga*(Invab) 386 AD00512-AS u*C*aacaUuaucUgCuUcgg*a*c 434 AD00513 AD00513-SS (GLS-15)*(Invab)*guuuguugCaAaAauguugga*(Invab) 387 AD00513-AS u*C*caacAuuuuUgCaAcaa*a*c 435 AD00514 AD00514-SS (GLS-15)*(Invab)*caugaggaCaUgCugauaaca*(Invab) 388 AD00514-AS u*G*uuauCagcaUgUcCuca*u*g 436 AD00515 AD00515-SS (GLS-15)*(Invab)*cccagauaCaAgGuuggcuua*(Invab) 389 AD00515-AS u*A*agccAaccuUgUaUcug*g*g 437 AD00516 AD00516-SS (GLS-15)*(Invab)*gugacacaCuUcAaccagaaa*(Invab) 390 AD00516-AS u*U*ucugGuugaAgUgUguc*a*c 438 AD00517 AD00517-SS (GLS-15)*(Invab)*gagcaagcUcUcAguaucaua*(Invab) 391 AD00517-AS u*A*ugauAcugaGaGcUugc*u*c 439 AD00518 AD00518-SS (GLS-15)*(Invab)*gagagugaGgUuGacaaguua*(Invab) 392 AD00518-AS u*A*acuuGucaaCcUcAcuc*u*c 440 AD00519 AD00519-SS (GLS-15)*(Invab)*cgaggagaUuGaGaaugccua*(Invab) 393 AD00519-AS u*A*ggcaUucucAaUcUccu*c*g 441 AD00520 AD00520-SS (GLS-15)*(Invab)*guggcauuGaGaUgaaguuca*(Invab) 394 AD00520-AS u*G*aacuUcaucUcAaUgcc*a*c 442 AD00521 AD00521-SS (GLS-15)*(Invab)*gaagaauaUgCuGuuuccuaa*(Invab) 395 AD00521-AS u*U*aggaAacagCaUaUucu*u*c 443 AD00522 AD00522-SS (GLS-15)*(Invab)*gccauugcUgUuCcaaaagga*(Invab) 396 AD00522-AS u*C*cuuuUggaaCaGcAaug*g*c 444 AD00523 AD00523-SS (GLS-15)*(Invab)*cccuagcaAgCuCucaguaua*(Invab) 397 AD00523-AS u*A*uacuGagagCuUgCuag*g*g 445 AD00365-1 AD00365-1-SS (GLS-15)*(imann)*gucucagaGuAuuAuggaac*a*(imann) 446 AD00365-1-AS u*GuuCcauaauAcUcugAg*a*c 452 AD00521-1 AD00521-1-SS (GLS-15)*(imann)*gaagaauaUgCuGuuuccua*a*(imann) 447 AD00521-1-AS u*U*aggaAacagCaUaUucu*u*c 453 AD00364-1 AD00364-1-SS (GLS-15)*(imann)*gucucucaGaGuAuuaugga*u*(imann) 448 AD00364-1-AS a*U*ccauAauacUcUgAgag*a*c 454 AD00365-2 AD00365-2-SS (GLS-15)*(imann)*gucucagaGuAuUauggaac*a*(imann) 449 AD00365-2-AS u*GuuccAuaauAcUcUgag*a*c 455 AD00366-1 AD00366-1-SS (GLS-15)*(imann)*guuauucAcAuGgacaacu*a*(imann) 450 AD00366-1-AS u*A*guugUccauGuGgAaua*a*c 456 AD00432-1 AD00432-1-SS (GLS-15)*(imann)*caagagugAgGuUgacaagu*a*(imann) 451 AD00432-1-AS u*A*cuugUcaacCuCaCucu*u*g 457 Mismatch

It is known to those skilled in the art that mismatches are tolerated for the efficacy of dsRNA, especially if the mismatch is within the terminal region of the dsRNA. Certain mismatches are better tolerated, such as those with wobble base pairs G:U and A:C (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Doi: 10.1093/nar/gki312. Nucleic Acids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the invention, the xanthine dehydrogenase (XDH) dsRNA reagent may contain one or more mismatches to the xanthine dehydrogenase (XDH) target sequence. In some embodiments, the xanthine dehydrogenase (XDH) dsRNA reagents of the invention do not contain mismatches. In certain embodiments, the xanthine dehydrogenase (XDH) dsRNA reagents of the invention contain no more than 1 mismatch. In some embodiments, the xanthine dehydrogenase (XDH) dsRNA reagents of the invention contain no more than 2 mismatches. In certain embodiments, the xanthine dehydrogenase (XDH) dsRNA reagents of the invention contain no more than 3 mismatches. In some embodiments of the invention, the antisense strand of the xanthine dehydrogenase (XDH) dsRNA agent contains a mismatch to the xanthine dehydrogenase (XDH) target sequence that is not centered in the complementary region. In some embodiments, the antisense strand of the xanthine dehydrogenase (XDH) dsRNA agent contains 1, 2, 3, 4, or more mismatches located at one or both of the 5' or 3' ends of the complementary region within the last 5, 4, 3, 2 or 1 nucleotides. The methods described herein and/or methods known in the art can be used to determine whether a xanthine dehydrogenase (XDH) dsRNA reagent containing a mismatch to a xanthine dehydrogenase (XDH) target sequence is effective in inhibiting xanthine dehydrogenase (XDH) gene expression. complementarity

As used herein, unless otherwise stated, the term "complementary/complementary" is used when describing the first nucleotide sequence (e.g., xanthine dehydrogenase (XDH) dsRNA agent sense strand or target xanthine dehydrogenase (XDH)). XDH) mRNA) refers to the inclusion of the first nucleotide sequence when related to a second nucleotide sequence (e.g., xanthine dehydrogenase (XDH) dsRNA reagent antisense strand or single-stranded antisense polynucleotide) an oligonucleotide or polynucleotide that hybridizes to an oligonucleotide or polynucleotide comprising a second nucleotide sequence [which forms hydrogen bonds between base pairs under mammalian physiological conditions (or similar conditions in vitro)], and The ability to form a double helix or duplex structure under certain conditions. Other conditions may also apply, such as physiologically relevant conditions that may be encountered in living organisms. The skilled person will be able to determine the set of conditions most suitable for testing the complementarity of two sequences based on the ultimate application of the hybridizing nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics, so long as they are at least to the extent required for hybridization as described above. . Sequence identity or complementarity is independent of modification.

For example, the complementary sequence within a xanthine dehydrogenase (XDH) dsRNA as described herein includes an oligonucleotide or polynucleotide containing a first nucleotide sequence and an oligonucleotide containing a second nucleotide sequence. Base pairing of an acid or polynucleotide over the entire length of one or two nucleotide sequences. Such sequences may be referred to herein as "completely complementary" to each other. It will be understood that in embodiments where two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs are not considered herein to be mismatches based on complementarity. For example, the A sequence containing 19 nucleotides that is completely complementary to a shorter oligonucleotide may be referred to as "perfectly complementary" for the purposes described herein. Thus, as used herein, "perfect complementarity" means that all (100%) of the bases in the contiguous sequence of a first polynucleotide will hybridize to the same number of bases in the contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

As used herein, the term "substantially complementary" means that in hybrid pairs of nucleobase sequences, at least about 85% (but not all) of the bases in the contiguous sequence of the first polynucleotide will be with the second polynucleotide. The same number of bases in a contiguous sequence of nucleotides hybridize. If two sequences contain one or more mismatched base pairs when hybridized, for example at least 1, 2, 3, 4 or 5 mismatched base pairs, the term "substantially complementary" may be used to refer to the first The sequence forms a duplex of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) relative to the second sequence bodies while retaining the ability to hybridize under conditions most relevant to their end application, e.g., inhibition of xanthine dehydrogenase (XDH) gene expression via the RISC pathway. The term "partially complementary" may be used herein to refer to a hybrid pair of nucleobase sequences in which at least 75% (but not all) of the bases in the contiguous sequence of a first polynucleotide will be with those of a second polynucleotide. Hybridization of the same number of bases in a contiguous sequence. In some embodiments, "partially complementary" refers to at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases will match the Two polynucleotides hybridize to the same number of bases in a contiguous sequence.

The terms "complementary," "completely complementary," "substantially complementary," and "partially complementary" when used herein may be used to refer to the base matching between the sense and antisense strands of the Xanthine Dehydrogenase (XDH) dsRNA Reagent , xanthine dehydrogenase (XDH) Base matching between the antisense strand of the dsRNA reagent and the sequence of the target xanthine dehydrogenase (XDH) mRNA, or a single-stranded antisense oligonucleotide and the target xanthine dehydrogenase Base matching between enzyme (XDH) mRNA sequences. It should be understood that the term "antisense strand of xanthine dehydrogenase (XDH) dsRNA reagent" may refer to the same sequence as "xanthine dehydrogenase (XDH) antisense polynucleotide reagent".

As used herein, the terms "substantially identical" or "substantially identical" when referring to a nucleic acid sequence means that the nucleic acid sequence contains a sequence that has at least about 85% or greater sequence identity compared to a reference sequence, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical. Percent sequence identity is determined by comparing the best alignment of two sequences over an alignment window. The percentage is calculated by determining the number of positions where the same nucleic acid base occurs in both sequences to yield the number of matching positions; dividing the number of matching positions by the total number of positions in the alignment window, and multiplying the result by 100, resulting in percent sequence identity. The inventions disclosed herein include nucleotide sequences that are substantially identical to those disclosed herein (eg, in Tables 1-3). In some embodiments, the nucleotide sequence is identical to, or at least about 85%, 86%, 87%, 88%, 89%, 90% identical to, a sequence disclosed herein (e.g., in Tables 1-3). %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a strand of nucleotides described by a sequence referred to using standard nucleotide nomenclature. As used herein, the term "double-stranded RNA" or "dsRNA" refers to a sequence comprising an RNA molecule or a complex of RNAi molecules having a hybridized double-stranded nucleic acid strand comprising two antiparallel and substantially or completely complementary nucleic acid strands. The strand regions, which are respectively termed "sense" and "antisense" orientations relative to the target xanthine dehydrogenase (XDH) gene RNA. The double-stranded region can be of any desired length that allows specific degradation of the target xanthine dehydrogenase (XDH) gene RNA by the RISC pathway, but is typically 9 to 30 base pairs in length, e.g. 15-30 bases in length right. Considering duplexes between 9 and 30 base pairs, duplexes can be any length within this range, e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs, and any subrange therein, including but not limited to 15-30 base pairs, 15-26 base pairs; 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 Base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 bases pair, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20- 21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. The length of xanthine dehydrogenase (XDH) dsRNA reagents produced in cells by processing with Dicer and similar enzymes is typically in the range of 19-22 base pairs. One strand of the double-stranded region of the xanthine dehydrogenase (XDH) dsDNA agent contains a sequence that is substantially complementary to a region of the target xanthine dehydrogenase (XDH) gene RNA. The two strands forming a duplex structure can come from a single RNA molecule with at least one self-complementary region, or can be formed from two or more separate RNA molecules. In the case where the double-stranded region is formed from a single molecule, the molecule may have a duplex structure formed by one strand of the single-stranded nucleotide strand at the 3'-end and the corresponding other strand at the 5'-end (herein called a "hairpin loop"). In some embodiments of the invention, the hairpin configuration includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, 20 or more unpaired nucleotides. When the two substantially complementary strands of the xanthine dehydrogenase (XDH) dsRNA reagent consist of separate RNA molecules, these molecules need not be covalently linked, but may be covalently linked. When two strands are covalently connected by means other than a hairpin loop, the connecting structure is called a "linker." The term "siRNA" is also used herein to refer to a dsRNA agent as described herein.

In some embodiments of the invention, a xanthine dehydrogenase (XDH) dsRNA reagent can comprise sense and antisense sequences with unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA reagent. Ends without unpaired nucleotides are called "blunt ends" and have no nucleotide overhangs. If both ends of the dsRNA reagent are blunt-ended, the dsRNA is said to be "blunt-ended." In some embodiments of the invention, the first end of the dsRNA agent is blunt-ended, in some embodiments, the second end of the dsRNA agent is blunt-ended, and in certain embodiments of the invention, the xanthine Dehydrogenase (XDH) dsRNA reagent is blunt-ended on both ends.

In some embodiments of the dsRNA reagents of the invention, the dsRNA does not have one or two blunt ends. In this case, there is at least one unpaired nucleotide at the end of one strand of the dsRNA reagent. For example, nucleotide overhangs exist when the 3'-end of one strand of dsRNA extends beyond the 5'-end of the other strand, and vice versa. dsRNA can contain overhangs of at least 1, 2, 3, 4, 5, 6, or more nucleotides. Nucleotide overhangs may comprise or consist of nucleotide/nucleoside analogs, including deoxynucleotides/nucleosides. It will be appreciated that in some embodiments, the nucleotide overhangs are on the sense strand of the dsRNA reagent, on the antisense strand of the dsRNA reagent, or at both ends of the dsRNA reagent, and the nucleotides of the overhangs may be present on the antisense strand of the dsRNA reagent. sense strand or the 5' end, 3' end or both ends of the sense strand. In certain embodiments of the invention, one or more nucleotides in the overhang are replaced with nucleoside phosphorothioates.

As used herein, the term "antisense strand" or "guide strand" refers to the strand of a xanthine dehydrogenase (XDH) dsRNA agent that contains a region that is substantially complementary to a xanthine dehydrogenase (XDH) target sequence. As used herein, the term "sense strand" or "passenger strand" refers to a xanthine dehydrogenase (XDH) dsRNA reagent that includes a region that is substantially complementary to a region of the antisense strand of the xanthine dehydrogenase (XDH) dsRNA reagent. chain. Modify

In some embodiments of the invention, the RNA of the xanthine dehydrogenase (XDH) gene RNAi agent is chemically modified to obtain enhanced stability and/or one or more other beneficial properties. Nucleic acids in certain embodiments of the invention can be synthesized and/or modified by methods well known in the art, for example, see "Current protocols in Nucleic Acid Chemistry," Beaucage, S. L. et al. (Eds.), John Wiley & Sons , Inc., New York, N.Y., USA, which is incorporated herein by reference. Modifications that may be present in certain embodiments of the xanthine dehydrogenase (XDH) dsRNA reagents of the invention include, for example: (a) terminal modifications, such as 5' end modifications (phosphorylation, conjugation, reverse ligation, etc.) , 3' end modification (conjugation, DNA nucleotides, reverse ligation, etc.); (b) base modification, such as with stabilizing bases, destabilizing bases, or bases for base pairing with an expanded partner library base substitutions, missing bases (abasic nucleotides), or conjugated bases; (c) sugar modifications (e.g., at the 2' position or 4' position) or substitutions of sugars; and (d) backbone modifications, including Modification or replacement of phosphodiester bonds. RNAs useful in certain embodiments of the xanthine dehydrogenase (XDH) dsRNA reagents, xanthine dehydrogenase (XDH) antisense polynucleotides, and xanthine dehydrogenase (XDH) sense polynucleotides of the invention Specific examples of compounds include, but are not limited to, RNAs containing modified backbones or without native internucleoside linkages. As a non-limiting example, RNA with backbone modifications may not have phosphorus atoms in the backbone. RNA that does not have a phosphorus atom in its internucleoside backbone is called an oligonucleotide. In certain embodiments of the invention, the modified RNA has a phosphorus atom in its internucleoside backbone.

It will be understood that the term "RNA molecule" or "RNA" or "ribonucleic acid molecule" includes not only RNA molecules expressed or found in nature, but also analogs and derivatives of RNA, which include one or more species as described herein. Ribonucleotide/ribonucleoside analogs or derivatives described above or known in the art. The terms "ribonucleoside" and "ribonucleotide" are used interchangeably herein. RNA molecules may be modified in the nucleobase structure or ribose-phosphate backbone structure (eg, as described below), and molecules containing ribonucleoside analogs or derivatives must retain the ability to form duplexes. As non-limiting examples, the RNA molecule may also comprise at least one modified ribonucleoside, including, but not limited to, 2'-methoxy modified nucleosides, nucleosides containing a 5' phosphorothioate group, and cholesterol Derivatives or terminal nucleosides linked to dodecanoic acid didecamide groups, locked nucleosides, abasic nucleosides, 2'-deoxy-2'-fluoro modified nucleosides, 2'-amino modified nucleosides glycosides, 2'-alkyl modified nucleosides, morpholino nucleosides, phosphoramidates, or non-natural bases containing nucleosides, or any combination thereof. In some embodiments of the invention, the RNA molecule contains the following number of modified ribonucleosides: at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or up to the full length of the ribonucleoside of the xanthine dehydrogenase (XDH) dsRNA reagent molecule. The modifications need not be the same for each of the multiple modified ribonucleosides in such an RNA molecule.

In some embodiments, the dsRNA reagents, xanthine dehydrogenase (XDH) antisense polynucleotides and/or xanthine dehydrogenase (XDH) sense polynucleotides of the invention may comprise one or more independently selected Modify the nucleotide and/or one or more independently selected non-phosphodiester linkages. As used herein, the term "independently selected" is used to refer to selected elements, such as modified nucleotides, non-phosphodiester bonds, etc., meaning that two or more selected elements may be identical to each other but need not be identical to each other. As used herein, a "nucleotide base", "nucleotide" or "nucleobase" is a heterocyclic pyrimidine or purine compound that is a standard component of all nucleic acids and includes the bases that form nucleotides: adenine Purine (a), guanine (g), cytosine (c), thymine (t) and uracil (u). Nucleobases may be further modified to include, but are not intended to be limited to: universal bases, hydrophobic bases, hybrid bases, size-enlarged bases, and fluorinated bases. The term "ribonucleotide" or "nucleotide" may be used herein to refer to unmodified nucleotides, modified nucleotides, or alternative moieties. One skilled in the art will recognize that guanine, cytosine, adenine and uracil can be replaced by other moieties without significantly altering the base pairing of oligonucleotides containing nucleotides with such replaced moieties characteristic.

In one embodiment, the modified RNA contemplated for use in the methods and compositions described herein is a peptide nucleic acid (PNA) that has the specificity to form the desired duplex structure and allow or mediate the passage of the target RNA via the RISC pathway. ability to degrade. In certain embodiments of the invention, the xanthine dehydrogenase (XDH) gene RNA interference agent includes a target xanthine dehydrogenase (XDH) gene RNA sequence that interacts with the target xanthine dehydrogenase (XDH) gene to direct the target xanthine dehydrogenase (XDH) gene. RNA cleavage of single-stranded RNA.

Modified RNA backbones may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkyl phosphonates (including 3'- Alkylene phosphonates and chiral phosphonates), phosphinates, phosphoramidates (including 3'-aminophosphoramidates and aminoalkyl phosphoramidates), thiophosphates, thioalkyl Phosphonates, thioalkyl phosphate triesters, and boronic acid phosphates (which have the normal 3'-5' linkage, as well as the 2'-5' linkage analogs of these, and those with inverted polarity, where adjacent Pairs of nucleoside units are linked in a 3'-5' to 5'-3' or 2'-5' to 5'-2' format). Also included are various salts, mixed salts and free acid forms. Methods for preparing phosphorus-containing bonds are routine practices in the art, and such methods can be used to prepare certain modified xanthine dehydrogenase (XDH) dsRNA reagents, certain modified xanthine dehydrogenase (XDH) of the present invention ) antisense polynucleotides and/or certain modified xanthine dehydrogenase (XDH) sense polynucleotides.

Modified RNA backbones that do not contain a phosphorus atom have structures consisting of short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chains The backbone formed by the linkages between heteroatoms or heterocyclic nucleosides. They include those with morpholine bonds (formed in part from the sugar moiety of the nucleoside); siloxane skeletons; sulfide, triacetyl and triacetyl skeletons; methylacetyl and thiomethylacetyl skeletons; methylenemethacetyl and thiomethylacetyl skeletons Skeletons; skeletons containing olefins; sulfamate skeletons; methyleneimino and methylenehydrazino skeletons; sulfonate and sulfonamide skeletons; amide skeletons; and others mixed with N, O, S and CH ₂ ingredient portion. Methods of preparing modified RNA backbones that do not contain phosphorus atoms are routine practice in the art, and such methods can be used to prepare certain modified xanthine dehydrogenase (XDH) dsRNA reagents, certain modified xanthine dehydrogenases of the present invention. Purine dehydrogenase (XDH) antisense polynucleotides and/or certain modified xanthine dehydrogenase (XDH) sense polynucleotides.

In certain embodiments of the invention, RNA mimics are included in xanthine dehydrogenase (XDH) dsRNA, xanthine dehydrogenase (XDH) antisense polynucleotides, and/or xanthine dehydrogenase (XDH) In a sense polynucleotide, for example, but not limited to, the sugar and internucleoside linkages (ie, backbone) of the nucleotide units are replaced with new groups. In such embodiments, base units are maintained for hybridization to a suitable xanthine dehydrogenase (XDH) nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced by an amide-containing backbone, specifically an aminoethylglycine backbone. The nucleobase is retained and bound directly or indirectly to the aza nitrogen atom of the amide moiety of the backbone. Methods of preparing RNA mimetics are routinely practiced in the art, and such methods can be used to prepare certain modified xanthine dehydrogenase (XDH) dsRNA reagents of the invention.

Some embodiments of the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, particularly _-CH2- NH- _CH2- , _-CH2 -N( _CH3 )-O-CH ₂ -[called methylene (methylimino) or MMI skeleton], -CH ₂ -ON(CH ₃ )-CH ₂ -, -CH ₂ -N(CH ₃ )-N(CH ₃ )-CH ₂ - and -N(CH ₃ )-CH ₂ - [where the natural phosphodiester backbone is represented as -OPO-CH ₂ -]. Methods for preparing RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones are routinely practiced in the art, and such methods can be used to prepare certain modified xanthine dehydrogenase (XDH) dsRNAs of the invention Reagents, certain xanthine dehydrogenase (XDH) antisense polynucleotides and/or certain xanthine dehydrogenase (XDH) sense polynucleotides.

Modified RNA may also contain one or more substituted sugar moieties. The xanthine dehydrogenase (XDH) dsRNA, xanthine dehydrogenase (XDH) antisense polynucleotide and/or xanthine dehydrogenase (XDH) sense polynucleotide of the present invention may contain one of the following at the 2' position : OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, Wherein the alkyl group, alkenyl group and alkynyl group may be substituted or unsubstituted C ₁ to C ₁₀ alkyl group or C ₂ to C ₁₀ alkenyl group and alkynyl group. Exemplary suitable modifications include: O[(CH ₂ ) _n O] _m CH ₃ , O(CH ₂ ) _n OCH ₃ , O(CH 2 ) _n NH ₂ , O( _{CH 2 ) n} CH ₃ , O( CH ₂ ) _n ONH ₂ , and O(CH ₂ ) _n ON [(CH ₂ ) _n CH ₃ )] ₂ , where n and m range from 1 to about 10. In other embodiments, the dsRNA includes one of the following at the 2' position: C ₁ to C ₁₀ lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl, or O-aralkyl , SH, SCH ₃ , OCN, Cl, Br, CN, CF ₃ , OCF ₃ , SOCH ₃ , SO ₂ CH ₃ , ONO ₂ , NO ₂ , N ₃ , NH ₂ , heterocycloalkyl, heterocycloalkaryl , aminoalkylamino, polyalkylamino; substituted silyl group, RNA cleavage group, reporter group, intercalator; base used to improve the pharmacokinetic properties of xanthine dehydrogenase (XDH) dsRNA reagent group; or used to improve the pharmacodynamic properties of xanthine dehydrogenase (XDH) dsRNA reagents, xanthine dehydrogenase (XDH) antisense polynucleotides and/or xanthine dehydrogenase (XDH) sense polynucleotides groups, and other substituents with similar properties. In some embodiments, modifications include 2'-O-CH ₂ CH ₂ OCH ₃ , also known as 2'-O-(2-methoxyethyl) or 2' -MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), that is, alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminoethoxyethoxy, the O( _CH2 ) _2ON ( _CH3 ) ₂ group, also known as 2'-DMAOE, as described in the Examples below ; and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e. 2'-O-CH ₂ -O-CH ₂ -N(CH ₂ ) ₂ . Methods of preparing modified RNAs such as those described are routinely practiced in the art, and such methods can be used to prepare certain modified xanthine dehydrogenase (XDH) dsRNA reagents of the invention.

Other modifications include 2'-methoxy (2'-OCH ₃ ), 2'-aminopropoxy (2'-OCH ₂ CH ₂ CH ₂ NH ₂ ), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of the xanthine dehydrogenase (XDH) dsRNA reagent, xanthine dehydrogenase (XDH) antisense polynucleotide, and xanthine dehydrogenase (XDH) sense polynucleotide of the present invention. dsRNA, xanthine Dehydrogenase (XDH) antisense polynucleotide or xanthine dehydrogenase (XDH) sense polynucleotide at the 3' position of the sugar and the 5' position of the 5' terminal nucleotide. Xanthine Dehydrogenase (XDH) dsRNA Reagent, Xanthine Dehydrogenase (XDH) Antisense Polynucleotide and/or The cyclobutyl portion of sugar. Methods of preparing modified RNAs such as those described are routinely practiced in the art, and such methods can be used to prepare certain modified xanthine dehydrogenase (XDH) dsRNA reagents, xanthine dehydrogenase (XDH) of the invention ) antisense polynucleotide and/or xanthine dehydrogenase (XDH) sense polynucleotide.

In some embodiments, the xanthine dehydrogenase (XDH) dsRNA agent, the xanthine dehydrogenase (XDH) antisense polynucleotide, and/or the xanthine dehydrogenase (XDH) sense polynucleotide can include nucleobases (often referred to as "base" in the art) modification or substitution. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-Methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosan Pyrimidine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil ; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine; 5-halo, especially 5-bromo, 5- Trifluoromethyl and other 5-substituted uracil and cytosine; 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-azaguanine and 7-azaadenine and 3-azaguanine and 3-azaadenine. Additional nucleobases that may be included in certain embodiments of the xanthine dehydrogenase (XDH) dsRNA reagents of the invention are known in the art, see for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P . Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991 , 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Preparation of dsRNA, xanthine dehydrogenase (XDH) antisense strand polynucleotides and/or xanthine dehydrogenase (XDH) sense strand polynucleotides (such as those described herein) comprising nucleobase modifications and/or substitutions ) methods are routinely practiced in the art, and such methods can be used to prepare certain modified xanthine dehydrogenase (XDH) dsRNA reagents, xanthine dehydrogenase (XDH) sense polynucleotides and/or Xanthine dehydrogenase (XDH) antisense polynucleotide.

Certain embodiments of the xanthine dehydrogenase (XDH) dsRNA reagents, xanthine dehydrogenase (XDH) antisense polynucleotides, and/or xanthine dehydrogenase (XDH) sense polynucleotides of the invention include modifications to RNA that includes one or more locked nucleic acids (LNA). Locked nucleic acids are nucleotides with a modified ribose moiety that contains an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" ribose in the 3'-endostructural conformation. Adding locked nucleic acid to the xanthine dehydrogenase (XDH) dsRNA reagent, xanthine dehydrogenase (XDH) antisense polynucleotide and/or xanthine dehydrogenase (XDH) sense polynucleotide of the present invention can increase serum stability and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007)Mol Canc Ther 6( 3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods of preparing dsRNA reagents comprising locked nucleic acids, xanthine dehydrogenase (XDH) antisense polynucleotides, and/or xanthine dehydrogenase (XDH) sense polynucleotides are routinely practiced in the art, and such methods can be used For preparing certain modified xanthine dehydrogenase (XDH) dsRNA reagents of the invention. Certain embodiments of the xanthine dehydrogenase (XDH) dsRNA compounds, sense polynucleotides, and/or antisense polynucleotides of the invention include at least one modified nucleotide, wherein the at least one modified nucleotide Contains: 2'-methoxynucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-seco nucleotide mimetic, locked nucleotide, 2'-F- Arabinonucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides and 3'-Ome Nucleotides, nucleotides containing a 5'-phosphorothioate group, or terminal nucleotides linked to cholesterol derivatives or dodecyl dodecylamide groups, 2'-amino modified nucleosides Acids, phosphoramidates, or unnatural bases containing nucleotides. In some embodiments, the xanthine dehydrogenase (XDH) dsRNA compound contains an E-vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

In certain embodiments of the invention, at least one modified core is included in the xanthine dehydrogenase (XDH) dsRNA compound, the 3' and 5' ends of the sense polynucleotide, and/or the 3' end of the antisense polynucleotide. nucleotides, wherein at least one modified nucleotide includes: abasic nucleotide, ribitol, reverse nucleotide, reverse abasic nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide. It is known to those skilled in the art that the inclusion of abasic or reverse abasic nucleotides at the termini of oligonucleotides can enhance stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res . 2003;31(11):2705-2716. doi:10.1093/nar/gkg393).

In certain embodiments of the present invention, the xanthine dehydrogenase (XDH) dsRNA compound, antisense polynucleotide comprises at least one modified nucleotide, wherein the at least one modified nucleotide comprises an open-circuit nucleic acid nucleoside acid (UNA) or/and glycol nucleic acid nucleotide (GNA). Those skilled in the art know that UNA and GNA are thermally unstable chemical modifications that can significantly improve the off-target profile of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun 2018;9(1):723. doi:10.1038/s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010; 6:862–70).

In certain embodiments, the invention relates to open nucleic acid (UNA) oligomers for use in therapy. Unlocked nucleic acid (UNA) is an acyclic analog of RNA in which the bond between the C2' and C3' atoms of the ribose ring has been severed. It has been shown that incorporation of UNA is well tolerated by siRNA gene silencing activity and in some cases can even enhance its activity (Meghan A. et al. “Locked vs. unlocked nucleic acids (LNA vs. UNA): contrasting structures work towards common therapeutic goals”. Chem. Soc. Rev., 2011, 40 , 5680–5689 ).

UNA is a heat-labile modification, and replacing ribonucleotides with UNA will reduce base pairing strength and duplex stability. Strategic placement of UNA in the seed region of the siRNA antisense strand can reduce off-target activity in gene silencing mechanisms mediated by microRNA (miRNA). miRNA mainly recognizes the target gene through base pairing between the antisense seed region (positions 2-8 starting from the 5' end) and the target mRNA for gene suppression. Each miRNA has the potential to regulate a large number of genes. The siRNA antisense strand loaded by the RNA-induced silencing complex (RISC) can also potentially regulate a large number of unintended genes through a miRNA-mediated mechanism. Therefore, adding thermally unstable nucleotides, such as UNA, to the seed region of siRNA can reduce off-target activity (Lam JK, Chow MY, Zhang Y, Leung SW. siRNA Versus miRNA as Therapeutics for Gene Silencing. Mol Ther Nucleic Acids . 2015 Sep 15;4(9):e252. doi: 10.1038/mtna.2015.23. PMID: 26372022; PMCID: PMC4877448.). Specifically, such RNA oligonucleotides or complexes of RNA oligonucleotides contain at least one UNA nucleotide monomer in the seed region (Narendra Vaish et al. “Improved specificity of gene silencing by siRNAs containing unlocked nucleobase analog ”. Nucleic Acids Research, 2011, Vol. 39, No. 5 1823–1832 ).

According to this technical solution, potential advantages of incorporating UNA in RNA oligonucleotides or complexes of RNA oligonucleotides include, but are not limited to:

1. Reduce off-target activity. Adding UNA to the siRNA seed region will reduce the base pairing strength of the seed region, thereby reducing potential off-target activity caused by the micro-RNA mechanism.

2. UNA is well tolerated in terms of siRNA activity. In some cases, UNA can lead to increased activity.

Exemplary UNA monomers that can be used in this technical solution include, but are not limited to: .

Invab is the reverse abasic (deoxyribose) residue. For example, in some embodiments, the sense or antisense strand can include a "terminal cap," which as used herein is a non-nucleotide compound that can be incorporated at one or more ends of a strand of an RNAi agent disclosed herein or other moieties, and in some cases may provide certain advantageous properties to the RNAi agent, such as, for example, protection against exonuclease degradation. In some embodiments, an inverted abasic residue (Invab) is added as a terminal cap (see, eg, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Terminal caps are generally known in the art and, in some embodiments, are present at the 5' end, the 3' end, or both the 5' and 3' ends of the sense strand.

In certain embodiments of the invention, the xanthine dehydrogenase (XDH) dsRNA compound, antisense polynucleotide, comprises at least one modified nucleotide, wherein the at least one modified nucleotide comprises an isomannitol core glycosides. In certain embodiments, the sense strand contains an isomannitol residue and its stereoisomers at the 3' or 5' ends, respectively. Examples of specific nucleotides containing isomannitol residues and their stereoisomers include, but are not limited to: , , , , , , , , , ,and , where the phrase "Olig" each independently represents a polynucleotide moiety. Exemplary isomannitol residues (imann) include, but are not limited to, the following: or . In certain embodiments, the isomannitol residue (imann) can also be replaced by its stereoisomer. In certain embodiments, the sense strand includes an isomannitol residue (imann) at the 3' or 5' ends, respectively, and optionally further includes a 5'-end conjugated targeting group, e.g. , targeting group N-acetyl-galactosamine, preferably the above-mentioned GLS-15, the exemplary structure is as follows: , where the phrase "Olig" each independently represents a polynucleotide moiety.

The xanthine dehydrogenase (XDH) dsRNA reagents, xanthine dehydrogenase (XDH) antisense polynucleotides, and/or xanthine dehydrogenase (XDH) sense polynucleotides that can be used in certain embodiments of the invention The RNA contains another modification that includes enhancement of the xanthine dehydrogenase (XDH) dsRNA reagent, the xanthine dehydrogenase (XDH) antisense polynucleotide, and/or the xanthine dehydrogenase (XDH) sense polynucleotide, respectively. One or more ligands, moieties or conjugates chemically linked to RNA of one or more characteristics. Non-limiting examples of characteristics that can be enhanced are: xanthine dehydrogenase (XDH) dsRNA reagents, xanthine dehydrogenase (XDH) antisense polynucleotides, and/or xanthine dehydrogenase (XDH) sense polynucleotides Activity, cellular distribution, delivery of xanthine dehydrogenase (XDH) dsRNA reagent, pharmacokinetic properties of xanthine dehydrogenase (XDH) dsRNA reagent, and cellular uptake of xanthine dehydrogenase (XDH) dsRNA reagent. In some embodiments of the invention, the xanthine dehydrogenase (XDH) dsRNA reagents comprise one or more targeting groups or linking groups, in certain aspects of the xanthine dehydrogenase (XDH) dsRNA reagents of the invention. In some embodiments, it is conjugated to the sense strand. Non-limiting examples of targeting groups are compounds containing N-acetyl-galactosamine (GalNAc). The terms "delivery molecule", "targeting group", "targeting agent", "linker", "targeting compound" and "targeting ligand" are used interchangeably herein. In certain embodiments of the invention, the xanthine dehydrogenase (XDH) dsRNA reagent comprises a targeting compound conjugated to the 5'-end of the sense strand. In certain embodiments of the invention, the xanthine dehydrogenase (XDH) dsRNA reagent comprises a targeting compound conjugated to the 3'-end of the sense strand. In some embodiments of the invention, the xanthine dehydrogenase (XDH) dsRNA reagent comprises a GalNAc-containing targeting group. In certain embodiments of the invention, the xanthine dehydrogenase (XDH) dsRNA reagent does not comprise a targeting compound conjugated to one or both of the 3'-end and 5'-end of the sense strand. In certain embodiments of the invention, the xanthine dehydrogenase (XDH) dsRNA reagent does not comprise a GalNAc-containing targeting compound conjugated to one or both of the 5'-end and 3'-end of the sense strand.

Additional targeting and linking agents are well known in the art and, for example, targeting and linking agents useful in certain embodiments of the present invention include, but are not limited to, lipid moieties such as cholesterol moieties (Letsinger et al., Proc. . Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers, such as beryl- S-Tritylmercaptan (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biog. Med. Chem. Let., 1993, 3:2765- 2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, such as di- Hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651 -3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973) or Adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmitate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237) or octadecylamine or Hexamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

Certain embodiments of compositions comprising a xanthine dehydrogenase (XDH) dsRNA agent, a xanthine dehydrogenase (XDH) antisense polynucleotide, and/or a xanthine dehydrogenase (XDH) sense polynucleotide can comprise Ligands that change the distribution, targeting and other properties of xanthine dehydrogenase (XDH) dsRNA reagents. In some embodiments of compositions comprising a xanthine dehydrogenase (XDH) dsRNA agent of the invention, e.g., the ligand increases the response to a selected target (e.g., molecule, cell, or cell) compared to a species in which such ligand is not present. Type, compartment, such as a cell or organ compartment, tissue, organ, or body region) affinity. Ligands useful in the compositions and/or methods of the invention may be naturally occurring substances such as proteins (e.g. human serum albumin (HSA), low density lipoprotein (LDL) or globulin), carbohydrates (e.g. , dextran, amylopectin, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid) or lipids. Ligands may also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids or polyamines. Examples of polyamino acids are polylysine (PLL), polyL-aspartic acid, polyL-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) Copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane , poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendritic polyamines, arginine, amidine , protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines or α-helical peptides.

Ligands comprised in the compositions and/or methods of the present invention may comprise targeting groups, non-limiting examples of which are cell or tissue targeting agents such as lectins, glycoproteins, lipids or proteins, e.g. binding to specific cells Types of antibodies such as kidney cells or liver cells. Targeting groups can be thyrotropin, melanogen, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N- Acetyl-glucosamine polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamate, polyaspartic acid, lipids , cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin or RGD peptide or RGD peptide mimetic.

Other examples of ligands include dyes, intercalators (e.g., acridines), cross-linkers (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazines) , dihydrophenazine); artificial endonucleases (such as EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (ten Hexadecyl)glycerin, geranyloxyhexyl, cetylglycerin, borneol, menthol, 1,3-propanediol, heptadecyl, palmitic acid, myristic acid, O3-(oleyl)lithogallstone Acids, O3-(oleyl)cholic acid, dimethoxytrityl or phenoxazine and peptide conjugates (e.g., antennal peptide, Tat peptide), alkylating agents, phosphates, amino groups, thiol groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabel, enzyme, hapten (e.g., biotin), transport/absorption enhancer (e.g., aspirin, vitamin E, folic acid), synthetic ribonuclease (such as imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu3+ complex of tetraaza macrocycle), dinitrophenyl, HRP or AP .

Ligands included in the compositions and/or methods of the present invention may be proteins, such as glycoproteins or peptides, such as molecules with specific affinity for the co-ligand, or antibodies, such as with specific cell types such as cancer cells, endothelial cells, Antibodies that bind to cardiomyocytes or bone cells. Ligands useful in embodiments of the compositions and/or methods of the invention may be hormones or hormone receptors. Ligands useful in embodiments of the compositions and/or methods of the invention may be lipids, lectins, carbohydrates, vitamins, coenzymes, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine polyvalent mannose or polyvalent fucose. Ligands useful in embodiments of the compositions and/or methods of the present invention may be those that increase xanthine depletion, for example, by disrupting the cytoskeleton of the cell (e.g., by disrupting the microtubules, microfilaments, and/or intermediate filaments of the cell). Hydrogenase (XDH) uptake of dsRNA reagents into cells. Non-limiting examples of such agents are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine and myoservin.

In some embodiments, ligands linked to the xanthine dehydrogenase (XDH) dsRNA agents of the invention serve as pharmacokinetic (PK) modulators. Examples of PK modulators useful in the compositions and methods of the present invention include, but are not limited to: lipophilic agents, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, bile acids, Lithocholic acid, dialkyl glycerides, digyl glycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, aptamers that bind to serum proteins, etc. Oligonucleotides containing many phosphorothioate linkages are also known to bind to serum proteins, therefore short oligonucleotides containing multiple phosphorothioate linkages in the backbone, e.g. about 5 bases, 10 bases Base, 15 base or 20 base oligonucleotides may also be used as ligands in the compositions and/or methods of the invention. Xanthine Dehydrogenase ( XDH ) dsRNA Reagent Composition

In some embodiments of the invention, a xanthine dehydrogenase (XDH) dsRNA agent is in the composition. The composition of the present invention may comprise one or more xanthine dehydrogenase (XDH) dsRNA reagents and optionally one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, etc., Non-limiting examples of targeting agents useful according to some embodiments of the methods of the invention are agents that direct the xanthine dehydrogenase (XDH) dsRNA agent of the invention to and/or into the cells to be treated. The choice of targeting agent will depend on the nature of the xanthine dehydrogenase (XDH)-related disease or condition, and the target cell type. In one non-limiting example, in some embodiments of the invention, it may be desirable to target xanthine dehydrogenase (XDH) dsRNA agents to and/or into hepatocytes. It will be appreciated that in some embodiments of the present methods, the therapeutic agent comprises a xanthine dehydrogenase (XDH) dsRNA agent with only a delivery agent, such as a delivery agent comprising N-acetylgalactosamine (GalNAc), but not Any additional connecting elements. For example, in some aspects of the invention, a xanthine dehydrogenase (XDH) dsRNA agent can be linked to a GalNAc-containing delivery compound and included in a composition containing a pharmaceutically acceptable carrier, and without any linkage to the xanthine dehydrogenase (XDH) dsRNA agent. Purine dehydrogenase (XDH) dsRNA reagents, detectable labels or targeting agents, etc. are administered to cells or subjects.

Where the xanthine dehydrogenase (XDH) dsRNA reagents of the present invention are administered with and/or linked to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will be able to understand and Suitable reagents can be selected and used for use in the methods of the invention. Labeling reagents can be used in certain methods of the invention to determine the location of xanthine dehydrogenase (XDH) dsRNA reagents in cells and tissues, and can be used to determine the location of xanthine dehydrogenase-containing dsRNA reagents that have been administered in the methods of the invention. Cell, tissue or organ location of the therapeutic composition of the enzyme (XDH) dsRNA agent. Means for attaching and using labeling reagents such as enzyme labels, dyes, radioactive labels, etc. are well known in the art. It will be appreciated that in some embodiments of the compositions and methods of the invention, the labeling reagent is linked to one or both of the sense and antisense polynucleotides contained in the xanthine dehydrogenase (XDH) dsRNA reagent. . Delivery of Xanthine Dehydrogenase ( XDH ) dsRNA Reagents and Xanthine Dehydrogenase ( XDH ) Antisense Polynucleotide Reagents

Certain embodiments of the methods of the invention include delivering a xanthine dehydrogenase (XDH) dsRNA agent into the cell. As used herein, the term "delivery" means promoting or affecting cellular uptake or absorption. Absorption or uptake of the xanthine dehydrogenase (XDH) dsRNA agent can occur by independent diffusion or active cellular processes, or through the use of delivery agents, targets, which can be associated with the xanthine dehydrogenase (XDH) dsRNA agent of the invention. Proceed to the agent and so on. Modes of delivery suitable for use in the methods of the present invention include, but are not limited to, in vivo delivery, wherein the xanthine dehydrogenase (XDH) dsRNA agent is injected into a tissue site or administered systemically. In some embodiments of the invention, a xanthine dehydrogenase (XDH) dsRNA agent is linked to the delivery agent.

Non-limiting examples of methods that can be used to deliver xanthine dehydrogenase (XDH) dsRNA agents to cells, tissues and/or subjects include: xanthine dehydrogenase (XDH) dsRNA-GalNAc conjugates, SAMiRNA technology, based on LNP delivery methods and naked RNA delivery. These and other delivery methods have been used successfully in the art to deliver therapeutic RNAi agents to treat a variety of diseases and conditions, such as, but not limited to: liver disease, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, etc. . Detailed information on various delivery methods can be found in publications such as: Nikam, R.R. & K. R. Gore (2018) Nucleic Acid Ther, 28 (4), 209-224 Aug 2018; Springer A.D. & S.F. Dowdy (2018) Nucleic Acid Ther . Jun 1; 28(3): 109–118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; and Nair, J.K. et al., (2014) J. Am. Chem. Soc. 136:16958-16961, the contents of which are incorporated herein by reference.

Some embodiments of the invention include the use of lipid nanoparticles (LNPs) to deliver the xanthine dehydrogenase (XDH) dsRNA agent of the invention to cells, tissues and/or subjects. LNPs are commonly used to deliver xanthine dehydrogenase (XDH) dsRNA reagents in vivo, including therapeutic xanthine dehydrogenase (XDH) dsRNA reagents. One benefit of using LNP or other delivery agents is the increased stability of the xanthine dehydrogenase (XDH) gene RNA agent when delivered to a subject using LNP or other delivery agents. In some embodiments of the invention, the LNPs comprise cationic LNPs loaded with one or more xanthine dehydrogenase (XDH) gene RNAi molecules of the invention. LNP containing a xanthine dehydrogenase (XDH) gene RNAi molecule is administered to a subject. The LNP and its attached xanthine dehydrogenase (XDH) gene RNAi molecule are taken up by cells via endocytosis, and their presence results in RNAi triggering. release of molecules, thereby mediating RNAi.

Another non-limiting example of a delivery agent that may be used in embodiments of the invention to deliver the xanthine dehydrogenase (XDH) dsRNA agent of the invention to cells, tissues and/or subjects is an agent comprising GalNAc, with The xanthine dehydrogenase (XDH) dsRNA reagents of the invention ligate and deliver the xanthine dehydrogenase (XDH) dsRNA reagent to cells, tissues and/or subjects. Examples of certain other GalNAc-containing delivery agents that may be used in certain embodiments of the methods and compositions of the present invention are disclosed in PCT application WO2020191183A1. Non-limiting examples of GalNAc targeting ligands that can be used in the compositions and methods of the invention to deliver xanthine dehydrogenase (XDH) dsRNA agents to cells are targeting ligand clusters. Examples of targeting ligand clusters proposed here are: GalNAc ligands with phosphodiester linkages (GLO) and GalNAc ligands with phosphorothioate linkages (GLS). The term "GLX-n" may be used herein to refer to attached GalNAc-containing compounds. Examples are, but are not limited to, the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6 , GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO -3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, the structure of each is shown below. In the figure below, the connection position of the GalNAc targeting ligand and the RNAi agent of the present invention is on the rightmost side of each targeting ligand. It is understood that any RNAi and dsRNA molecules of the invention can be linked to GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9 , GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO -6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, the following are GLO-1 to Structure of GLO-16 and GLS-1 to GLS-16. GLO-1 GLS-1 GLO-2 GLS-2 GLO-3 GLS-3 GLO-4 GLS-4 GLO-5 GLS-5 GLO-6 GLS-6 GLO-7 GLS-7 GLO-8 GLS-8 GLO-9 GLS-9 GLO-10 GLS-10 GLO-11 GLS-11 GLO-12 GLS-12 GLO-13 GLS-13 GLO-14 GLS-14 GLO-15 GLS-15 GLO-16 GLS-16.

"Heterocycloalkyl" means a nonaromatic partially saturated or fully saturated ring (e.g., 3-10 or 3-7 membered heterocycloalkyl) having the specified number of ring atoms consisting of one or Composed of multiple heteroatoms (eg, 1, 2, 3, or 4 heteroatoms) selected from N, O, and S, and the remaining ring atoms are carbon. 5-membered heterocycloalkyl is a heterocycloalkyl group with 5 ring atoms. 6-membered heterocycloalkyl is a heterocycloalkyl group with 6 ring atoms. Heterocycloalkyl groups may be monocyclic or polycyclic (eg, bicyclic, tricyclic). Examples of heterocycloalkyl groups include oxanyl, aziridyl, azetidinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, pyridinyl, pyridazinyl, morpholinyl and Thiomorpholinyl. Additionally, one ring of a polycyclic heterocycloalkyl group may be aromatic (eg, aryl or heteroaryl) so long as the polycyclic heterocycloalkyl group is bonded to the parent structure via a nonaromatic carbon or nitrogen atom. For example, 1,2,3,4-tetrahydroquinolin-1-yl (where the moiety is bonded to the parent structure via a non-aromatic nitrogen atom) is considered a heterocycloalkyl group, while 1,2,3,4 - Tetrahydroquinolin-8-yl (where the moiety is bonded to the parent structure via an aromatic carbon atom) is not considered a heterocycloalkyl group. Lower heterocycloalkanes generally refer to C3-6 monocyclic rings. Unless otherwise specified, lower heterocycloalkyl groups can generally be preferably fully saturated carbocyclic rings. In some embodiments of the invention, in vivo delivery may also be by beta-glucan delivery systems, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, the entire contents of which are incorporated by reference. Incorporated herein. The xanthine dehydrogenase (XDH) gene RNAi agent can also be introduced into cells in vitro using methods known in the art such as electroporation and lipofection. In certain embodiments of the methods of the invention, the xanthine dehydrogenase (XDH) dsRNA is delivered without a targeting agent. These RNAs can be delivered as "naked" RNA molecules. As a non-limiting example, the xanthine dehydrogenase (XDH) dsRNA of the present invention can be administered to a subject in a pharmaceutical composition containing an RNAi agent but not a targeting agent (e.g., a GalNAc targeting compound) to treat xanthine in the subject. Purine dehydrogenase (XDH)-related diseases or conditions, such as gout.

It will be appreciated that in addition to certain delivery modalities described herein, other RNAi delivery modalities may be used in conjunction with embodiments of the xanthine dehydrogenase (XDH) gene RNAi agents and therapeutic methods described herein, such as, but not limited to, those described herein. those and those used in the field.

The xanthine dehydrogenase (XDH) dsRNA agents of the invention can be administered to a subject in an amount and in a manner effective to reduce the level and activity of the xanthine dehydrogenase (XDH) polypeptide in the cell and/or subject. In some embodiments of the methods of the invention, one or more xanthine dehydrogenase (XDH) dsRNA agents are administered to cells and/or subjects to treat diseases associated with xanthine dehydrogenase (XDH) expression and activity or illness. In some embodiments, methods of the invention include administering to a subject in need of such treatment one or more xanthine dehydrogenase (XDH) dsRNA agents to alleviate symptoms associated with xanthine dehydrogenase (XDH) expression in the subject. Disease or illness. The xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention can be administered to reduce xanthine in one or more of cells in vitro, ex vivo, and in vivo Dehydrogenase (XDH) expression and/or activity.

In some embodiments of the invention, xanthine dehydration in the cell is reduced by delivering (eg, introducing) a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent into the cell. Hydrogenase (XDH) polypeptide levels and therefore reduce its activity. Targeting agents and methods can be used to facilitate the delivery of xanthine dehydrogenase (XDH) dsRNA agents or xanthine dehydrogenase (XDH) antisense polynucleotide agents to specific cell types, cell subtypes, organs, spaces within a subject regions, and/or subcellular regions within cells. The xanthine dehydrogenase (XDH) dsRNA agent can be administered in certain methods of the invention alone or in combination with one or more additional xanthine dehydrogenase (XDH) dsRNA agents. In some embodiments, 2, 3, 4, or more independently selected xanthine dehydrogenase (XDH) dsRNA agents are administered to the subject. In certain embodiments of the invention, a xanthine dehydrogenase (XDH) dsRNA agent is administered in combination with one or more additional treatment regimens for the treatment of xanthine dehydrogenase (XDH)-related diseases or conditions. Targeted for the treatment of xanthine dehydrogenase (XDH) related diseases or conditions. Non-limiting examples of additional treatment regimens are: administration of one or more xanthine dehydrogenase (XDH) antisense polynucleotides of the invention, administration of non-xanthine dehydrogenase (XDH) dsRNA therapeutics, and behavioral modification . Additional treatment regimens may be administered at one or more of the following times: before, simultaneously with, and after administration of the xanthine dehydrogenase (XDH) dsRNA agent of the invention. It should be understood that "simultaneously" used in this article refers to within 5 minutes of zero time, within 10 minutes of zero time, within 30 minutes of zero time, within 45 minutes of zero time, and within 60 minutes of zero time, where "zero time" "Time" is the time at which the xanthine dehydrogenase (XDH) dsRNA agent of the invention is administered to the subject. Non-limiting examples of non-xanthine dehydrogenase (XDH) dsRNA therapeutics are: additional therapeutics such as allopurinol, hydroxypurine, febuxostat or interleukin-1β (IL-1β) antagonists, preferably , the interleukin-1β antagonist is selected from canakinumab or rilonacept, thereby treating a subject with a disease that would benefit from a reduction in xanthine dehydrogenase (XDH) expression, or any of the above Combinations, and pharmaceutical combinations for the treatment of hyperuricemia, gout, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), metabolic disorders, insulin resistance, cardiovascular disease, type 2 A therapeutic agent for diabetes, Lesch Nyhan syndrome, glycogen storage disease (GSD), and diseases related to oxidative stress or other XDH-related diseases. Non-limiting examples of behavior modification are: dietary programs, counseling, and exercise programs. These and other therapeutic agents and behavior modification agents are known in the art and may be used to treat xanthine dehydrogenase (XDH) diseases or conditions in a subject and may also be combined with one or more xanthine dehydrogenase enzymes of the invention (XDH) dsRNA agent combinations for administration to a subject to treat xanthine dehydrogenase (XDH) diseases or conditions. The xanthine dehydrogenase (XDH) dsRNA agents of the invention that are administered to cells or subjects to treat xanthine dehydrogenase (XDH)-related diseases or conditions can act in a synergistic manner with one or more other therapeutic agents or active ingredients. act, thereby increasing the effectiveness of one or more therapeutic agents or active ingredients and/or increasing the effectiveness of xanthine dehydrogenase (XDH) dsRNA agents in treating xanthine dehydrogenase (XDH)-related diseases or conditions.

The treatment methods of the present invention include the administration of a xanthine dehydrogenase (XDH) dsRNA agent, which may precede the onset of a xanthine dehydrogenase (XDH)-related disease or condition and/or when a xanthine dehydrogenase (XDH)-related disease or condition is present or Use during the early, middle, late stages of a disease or condition, and at all times before and after any of these stages. The methods of the present invention may also treat subjects who have been previously treated for xanthine dehydrogenase (XDH)-related diseases or conditions with one or more other therapeutic agents and/or therapeutic active ingredients, wherein one or more other therapeutic agents The agent and/or therapeutically active ingredient is unsuccessful, minimally successful, and/or no longer successful in treating the subject's xanthine dehydrogenase (XDH)-related disease or condition. vector-encoded dsRNA

In certain embodiments of the invention, a carrier can be used to deliver the xanthine dehydrogenase (XDH) dsRNA agent into the cell. The xanthine dehydrogenase (XDH) dsRNA reagent transcription unit can be contained in a DNA or RNA vector. The preparation and use of such transgene-encoding vectors for delivering sequences into cells and/or subjects is well known in the art. Vectors that result in transient expression of xanthine dehydrogenase (XDH) dsRNA, for example, for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours or more can be used in the methods of the invention. hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks. The length of transient expression can be determined using conventional methods based on factors such as, but not limited to, the specific vector construct selected and the target cells and/or tissues. Such transgenes can be introduced as linear constructs, circular plasmids or viral vectors, which can be integrating or non-integrating vectors. Transgenes can also be constructed so that they are inherited as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

One or more single strands of the xanthine dehydrogenase (XDH) dsRNA reagent can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to produce, for example, dsRNA, the two separate expression vectors can be co-introduced into the cell using, for example, transfection or infection. In certain embodiments, each individual strand of the xanthine dehydrogenase (XDH) dsRNA agent of the invention can be transcribed from a promoter contained on the same expression vector. In certain embodiments of the invention, the xanthine dehydrogenase (XDH) dsRNA agent is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence such that the xanthine dehydrogenase (XDH) dsRNA agent has Stem-loop structure.

Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. Expression vectors useful in embodiments of the invention may be compatible with eukaryotic cells. Eukaryotic expression vectors are routinely used in the art and are available from many commercial sources. Delivery of the xanthine dehydrogenase (XDH) dsRNA expression vector can be systemic, such as by intravenous or intramuscular administration, by administration to target cells removed from the subject and then reintroduced to the subject, or by allowing Any other means of introducing the desired target cells is performed.

Viral vector systems that may be included in embodiments of the method include, but are not limited to: (a) adenoviral vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, and the like; ( c) Adeno-associated virus vector; (d) Herpes simplex virus vector; (e) SV 40 vector; (f) Polyomavirus vector; (g) Papillomavirus vector; (h) Picornavirus vector; (i) ) poxvirus vectors, such as orthopoxvirus vectors, such as vaccinia virus vectors or fowlpox virus vectors, such as canarypox or fowlpox virus vectors; (j) helper-dependent or gutless adenovirus vectors. Constructs for recombinant expression of xanthine dehydrogenase (XDH) dsRNA reagents can contain regulatory elements such as promoters, enhancers, etc., which can be selected to provide constitutive or regulated/inducible expression. Viral vector systems and the use of promoters and enhancers, etc. are routine in the art and can be used in conjunction with the methods and compositions described herein.

Certain embodiments of the invention include the use of viral vectors to deliver xanthine dehydrogenase (XDH) dsRNA agents into cells. A number of adenovirus-based delivery systems are routinely used in the art for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that may be used in the methods of the invention are: AAV vectors, poxviruses such as vaccinia virus, modified Ankara virus (MVA), NYVAC, fowlpox such as fowlpox or canarypox virus.

Certain embodiments of the present invention include methods of delivering a xanthine dehydrogenase (XDH) dsRNA agent into a cell using a carrier, and such carrier may be in a pharmaceutically acceptable carrier, which may, but need not include, A sustained-release matrix embedded in a gene delivery vector. In some embodiments, vectors for delivering xanthine dehydrogenase (XDH) dsRNA can be produced by recombinant cells, and pharmaceutical compositions of the invention can include one or more xanthine dehydrogenase (XDH) dsRNA-producing delivery system to cells. Pharmaceutical compositions containing xanthine dehydrogenase ( XDH ) dsRNA or ssRNA reagents

Certain embodiments of the invention include the use of pharmaceutical compositions containing a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing xanthine dehydrogenase (XDH) dsRNA agents or xanthine dehydrogenase (XDH) antisense polynucleotide agents can be used in the methods of the invention to reduce xanthine dehydrogenase (XDH) in cells Gene expression and xanthine dehydrogenase (XDH) activity, and can be used to treat xanthine dehydrogenase (XDH)-related diseases or conditions. Such pharmaceutical compositions can be formulated based on the mode of delivery. Non-limiting examples of formulations for delivery modes are: compositions formulated for subcutaneous delivery, compositions formulated for systemic administration by parenteral delivery, compositions formulated for intravenous (IV) delivery, compositions formulated for Compositions for intrathecal delivery, compositions formulated for direct delivery into the brain, and the like. The pharmaceutical compositions of the present invention may be administered using one or more means to deliver the xanthine dehydrogenase (XDH) dsRNA agent or the xanthine dehydrogenase (XDH) antisense polynucleotide agent into the cell, for example: the surface (e.g., via a transdermal patch); pulmonary, e.g., by inhalation or insufflation of a powder or aerosol, including via a nebulizer; intraairway, intranasal, epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subcutaneous, for example by an implanted device; or intracranial, for example by intraparenchymal; intrathecal or intraventricular administration. Xanthine dehydrogenase (XDH) dsRNA agents or xanthine dehydrogenase (XDH) antisense polynucleotide agents can also be delivered directly to target tissues, such as directly to the liver and the like. It will be understood that "delivering a xanthine dehydrogenase (XDH) dsRNA reagent" or "delivering a xanthine dehydrogenase (XDH) antisense polynucleotide reagent" into a cell respectively includes delivering xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide agents, expression of xanthine dehydrogenase (XDH) dsRNA reagents directly in cells, and expression of xanthine dehydrogenase (XDH) from encoding vectors delivered into cells ) dsRNA reagent, or any suitable manner of causing the xanthine dehydrogenase (XDH) dsRNA or xanthine dehydrogenase (XDH) antisense polynucleotide reagent to appear in the cell. The preparation and use of formulations and means for delivering inhibitory RNA are well known and routinely used in the art.

As used herein, a "pharmaceutical composition" includes a pharmacologically effective amount of a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention and a pharmaceutically acceptable carrier . The term "pharmaceutically acceptable carrier" refers to a carrier used to administer a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. This term specifically excludes cell culture media. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients, such as inert diluents, disintegrating agents, binders, lubricants, sweeteners, flavoring agents, and coloring agents. and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate and lactose, while cornstarch and alginic acid are suitable disintegrants. Binders may include starches and gelatin, while lubricants, if present, are usually magnesium stearate, stearic acid, or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. Agents included in the pharmaceutical formulations are described further below. As used herein, terms such as "pharmacologically effective amount,""therapeutically effective amount," and "effective amount" refer to the xanthine dehydrogenase (XDH) dsRNA reagent or xanthine dehydrogenase (XDH) reagent of the invention. An amount of a polynucleotide agent that produces the desired pharmacological, therapeutic or prophylactic result. For example, a given clinical treatment is considered effective if it reduces a measurable parameter associated with the disease or disorder by at least 10%, then a therapeutically effective amount of a drug used to treat that disease or disorder is the amount that reduces that parameter by at least 10%. required amount. For example, a therapeutically effective amount of a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent can reduce xanthine dehydrogenase (XDH) polypeptide levels by at least 10%. Pharmaceutical compositions may comprise dsRNAi agents including, for example, duplexes AV00206 to AV00174 shown in Table 1. Preferred dsRNAi agents include, for example, duplexes AV00227, AV00260, AV00285, AV00266, AV00280, AV00238, AV00249, AV00289, AV00233, AV00225, AV00273, or AV00283. In certain embodiments, preferred dsRNAi agents of Table 2 include, for example, duplexes AV00227, AV00260, AV00285, AV00266, or AV00280. In certain embodiments, preferred dsRNAi agents of Table 3 include, for example, duplexes AD00353, AD00356, AD00358, AD00364, AD00365, AD00366, AD00368, AD00370, AD00430, AD00431, AD00432, AD00521, AD00521-1, AD00364-1 , AD00365-2, AD00366-1 and AD00432-1. effective amount

In some aspects, methods of the invention include contacting a cell with an effective amount of a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent to reduce xanthine in the contacted cell Dehydrogenase (XDH) gene expression. Certain embodiments of the methods of the present invention include administering xanthine dehydrogenase (XDH) to a subject in an amount effective to reduce xanthine dehydrogenase (XDH) gene expression and treat a xanthine dehydrogenase (XDH)-related disease or disorder in the subject ) dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent. With respect to reducing the expression of xanthine dehydrogenase (XDH) and/or for treating xanthine dehydrogenase (XDH)-related diseases or conditions, an "effective amount" used is that which is necessary to achieve the desired biological effect or Sufficient amount. For example, an effective amount of a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent that treats a xanthine dehydrogenase (XDH)-related disease or disorder can be: (i) An amount required to slow or stop the progression of a disease or condition; (ii) reverse, reduce or eliminate one or more symptoms of a disease or condition. In some aspects of the invention, an effective amount is xanthine dehydrogenase (XDH) that, when administered to a subject in need of treatment of a xanthine dehydrogenase (XDH)-related disease or condition, results in a therapeutic response in the prevention and/or treatment of the disease or condition. (XDH dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide agent. According to some aspects of the invention, an effective amount is the xanthine dehydrogenase (XDH) dsRNA reagent or Enzyme (XDH) antisense polynucleotide agents, when combined or co-administered with another therapeutic treatment for a disease or condition associated with xanthine dehydrogenase (XDH), result in a therapeutic response that prevents and/or treats the disease or condition The amount. In some embodiments of the invention, the biological effect of treating a subject with the xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention can be Improvement and/or complete elimination of symptoms caused by xanthine dehydrogenase (XDH)-related diseases or conditions. In some embodiments of the invention, the biological effect is complete elimination of xanthine dehydrogenase (XDH)-related diseases or conditions. Elimination, for example, as demonstrated by a diagnostic test indicating that the subject does not have a xanthine dehydrogenase (XDH)-related disease or condition. Non-limiting examples of detectable physiological symptoms include clinical symptoms in the subject's blood or urine after administration of an agent of the invention Reduction in uric acid levels. Other art-known means of assessing xanthine dehydrogenase (XDH)-related diseases or condition states may be used to determine the effect of the reagents and/or methods of the present invention on xanthine dehydrogenase (XDH)-related diseases or conditions. The impact of disease.

Xanthine Dehydrogenase (XDH) dsRNA agents or enzyme (XDH) antisense polynucleotide reagent, such clinical trials establish effective doses for test and control populations in a blinded study. In some embodiments, an effective amount is an amount that results in a desired response, such as a reduction in xanthine dehydrogenase (XDH)-related disease or disorder in cells, tissues, and/or subjects suffering from the disease or disorder. Accordingly, xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase ( An effective amount of an antisense polynucleotide agent for ) the amount of dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent that will be present in the cell, tissue and/or subject. In certain aspects of the invention, cells, tissues and/or cells that have not been exposed to or administered the xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention The level of xanthine dehydrogenase (XDH) polypeptide activity and/or xanthine dehydrogenase (XDH) gene expression in a subject is referred to as the "control" amount. In some embodiments of the methods of the invention, the subject's control amount is the subject's pre-treatment amount; in other words, the subject's level prior to administration of the xanthine dehydrogenase (XDH) agent can be the subject's control level and used to compare it to Comparison of xanthine dehydrogenase (XDH) polypeptide activity and/or xanthine dehydrogenase (XDH) gene expression levels following administration of siRNA to a subject. In the case of treating a xanthine dehydrogenase (XDH)-related disease or disorder, the desired response may be to reduce or eliminate one or more symptoms of the disease or disorder in cells, tissues, and/or subjects. Reduction or elimination can be temporary or permanent. It is understood that xanthine dehydrogenase (XDH)-related diseases or conditions may be monitored using methods for determining xanthine dehydrogenase (XDH) polypeptide activity, xanthine dehydrogenase (XDH) gene expression, symptom assessment, clinical testing, etc. status. In some aspects of the invention, a desired response to treating a xanthine dehydrogenase (XDH)-related disease or condition is to delay the onset of the disease or condition or even prevent the onset of the disease or condition.

The effective amount of a compound that reduces the activity of a xanthine dehydrogenase (XDH) polypeptide can also be determined by evaluating the administration of a xanthine dehydrogenase (XDH) dsRNA reagent or a xanthine dehydrogenase (XDH) antisense polynucleotide reagent. A physiological effect on a cell or subject, such as a reduction in a xanthine dehydrogenase (XDH)-related disease or condition following administration. Subject assays and/or symptom monitoring may be used to determine the efficacy of the xanthine dehydrogenase (XDH) dsRNA agents or xanthine dehydrogenase (XDH) antisense polynucleotide agents of the invention (which may be used in the pharmaceutical compounds of the invention administration) and determine whether there is a response to treatment. Another non-limiting example is that before and after treating a subject with a xanthine dehydrogenase (XDH) dsRNA agent of the invention, one or more serum uric acid level tests known in the art can be used to determine the subject's xanthine level. The status of a purine dehydrogenase (XDH) related disease or condition. In another non-limiting example, one or more uric acid level tests known in the art are used to determine the status of a xanthine dehydrogenase (XDH)-related disease in a subject. In this example, diseases include hyperuricemia, gout, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), metabolic disorders, insulin resistance, cardiovascular disease, type 2 diabetes, Lesch Nyhan syndrome, glycogen storage disease (GSD), and diseases related to oxidative stress or other XDH-related diseases, and this test is used to determine whether a subject is treated with the xanthine dehydrogenase (XDH) dsRNA agent of the invention and uric acid levels in the subjects afterwards.

Some embodiments of the invention include determining the administration of a xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention to a subject to treat xanthine dehydrogenase (XDH) Methods of treating diseases or conditions by assessing and/or monitoring one or more "physiological characteristics" of a xanthine dehydrogenase (XDH)-related disease or condition in a subject. Non-limiting examples of physiological features of xanthine dehydrogenase (XDH)-related diseases or conditions are that many patients also experience elevated levels of uric acid in the blood and urine, increased pain (such as that caused by gout), risk of inflammation Add events. Standard methods for determining this physiological profile are known in the art and include, but are not limited to, blood tests, imaging studies, physical examinations, etc. The syndrome is defined by the presence of decreased uric acid levels in the blood and urine, decreased pain ( such as pain caused by gout), reduction of inflammation.

It will be appreciated that the xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase agent administered to the subject may be modified based at least in part on the results of such determination of the subject's determined disease and/or disorder state and/or physiological characteristics. Amount of hydrogenase (XDH) antisense polynucleotide agent. The therapeutic amount may be varied, for example, by varying the composition of the xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent administered, by varying the route of administration, by varying the Increase or decrease the amount of xanthine dehydrogenase (XDH) dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent according to the medication time, etc. The effective amount of the xanthine dehydrogenase (XDH) dsRNA agent or the xanthine dehydrogenase (XDH) antisense polynucleotide agent will vary depending on the specific condition being treated, the age and physical condition of the subject being treated, and the severity of the condition. Varies with the extent, duration of treatment, the nature of co-treatments (if any), the specific route of administration, and other factors within the health practitioner's knowledge and expertise. For example, the effective amount may depend on the desired level of xanthine dehydrogenase (XDH) polypeptide activity and/or xanthine dehydrogenase (XDH) gene expression effective in treating xanthine dehydrogenase (XDH)-related diseases or conditions. . The skilled artisan can empirically determine the effective amount of a particular xanthine dehydrogenase (XDH) dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent for use in the methods of the invention without undue experimentation. In conjunction with the teachings provided herein, by selecting from a variety of xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagents of the invention and weighing, for example, potency, relative bioavailability , patient weight, severity of adverse side effects, and preferred mode of administration, an effective preventive or therapeutic treatment regimen can be planned to effectively treat a specific subject. As used in embodiments of the invention, an effective amount of the xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention can be The amount in cells that produces the desired biological effect.

It should be appreciated that xanthine dehydrogenase (XDH) gene silencing can be performed constitutively or by genome engineering in any cell expressing xanthine dehydrogenase (XDH) and determined by any suitable assay. In some embodiments of the invention, by administering the xanthine dehydrogenase (XDH) dsRNA agent of the invention, xanthine dehydrogenase (XDH) gene expression is reduced by at least 5%, 6%, 7%, 8%, 9 %, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%. In some embodiments of the invention, by administering the xanthine dehydrogenase (XDH) dsRNA reagent of the invention, xanthine dehydrogenase (XDH) gene expression is reduced by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100% or 50% to 100%. Give medication

The xanthine dehydrogenase (XDH) dsRNA agent and the xanthine dehydrogenase (XDH) antisense polynucleotide agent are delivered in a pharmaceutical composition in a dosage sufficient to inhibit xanthine dehydrogenase (XDH) gene expression. In certain embodiments of the invention, the dosage of the xanthine dehydrogenase (XDH) dsRNA agent or the xanthine dehydrogenase (XDH) antisense polynucleotide agent is 0.01 to 200.0 mg per kilogram of recipient body weight per day, typically 1 to 50 mg/kg body weight, 5 to 40 mg/kg body weight, 10 to 30 mg/kg body weight, 1 to 20 mg/kg body weight, 1 to 10 mg/kg body weight, 4 to 15 mg/kg body weight per day, inclusive. For example, each single administration of a xanthine dehydrogenase (XDH) dsRNA reagent or a kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 1 mg/kg, 1.1 mg/kg, 1.2 mg/kg, 1.3 mg/kg, 1.4 mg/kg, 1.5 mg/ kg, 1.6 mg/kg, 1.7 mg/kg, 1.8 mg/kg, 1.9 mg/kg, 2 mg/kg, 2.1 mg/kg, 2.2 mg/kg, 2.3 mg/kg, 2.4 mg/kg, 2.5 mg/ kg, 2.6 mg/kg, 2.7 mg/kg, 2.8 mg/kg, 2.9 mg/kg, 3.0 mg/kg, 3.1 mg/kg, 3.2 mg/kg, 3.3 mg/kg, 3.4 mg/kg, 3.5 mg/ kg, 3.6 mg/kg, 3.7 mg/kg, 3.8 mg/kg, 3.9 mg/kg, 4 mg/kg, 4.1 mg/kg, 4.2 mg/kg, 4.3 mg/kg, 4.4 mg/kg, 4.5 mg/ kg, 4.6 mg/kg, 4.7 mg/kg, 4.8 mg/kg, 4.9 mg/kg, 5 mg/kg, 5.1 mg/kg, 5.2 mg/kg, 5.3 mg/kg, 5.4 mg/kg, 5.5 mg/ kg, 5.6 mg/kg, 5.7 mg/kg, 5.8 mg/kg, 5.9 mg/kg, 6 mg/kg, 6.1 mg/kg, 6.2 mg/kg, 6.3 mg/kg, 6.4 mg/kg, 6.5 mg/ kg, 6.6 mg/kg, 6.7 mg/kg, 6.8 mg/kg, 6.9 mg/kg, 7 mg/kg, 7.1 mg/kg, 7.2 mg/kg, 7.3 mg/kg, 7.4 mg/kg, 7.5 mg/ kg, 7.6 mg/kg, 7.7 mg/kg, 7.8 mg/kg, 7.9 mg/kg, 8 mg/kg, 8.1 mg/kg, 8.2 mg/kg, 8.3 mg/kg, 8.4 mg/kg, 8.5 mg/ kg, 8.6 mg/kg, 8.7 mg/kg, 8.8 mg/kg, 8.9 mg/kg, 9 mg/kg, 9.1 mg/kg, 9.2 mg/kg, 9.3 mg/kg, 9.4 mg/kg, 9.5 mg/ kg, 9.6 mg/kg, 9.7 mg/kg, 9.8 mg/kg, 9.9 mg/kg, 10 mg/kg, 11 mg/kg, 12 mg/kg, 13mg/kg, 14 mg/kg, 15 mg/kg , 16 mg/kg, 17 mg/kg, 18 mg/kg, 19 mg/kg, 20 mg/kg, 21 mg/kg, 22 mg/kg, 23mg/kg, 24 mg/kg, 25 mg/kg, 26 mg/kg, 27 mg/kg, 28 mg/kg, 29 mg/kg, 30 mg/kg, 31 mg/kg, 32 mg/kg, 33mg/kg, 34 mg/kg, 35 mg/kg, 36 mg/kg, 37 mg/kg, 38 mg/kg, 39 mg/kg, 40 mg/kg, 41 mg/kg, 42 mg/kg, 43mg/kg, 44 mg/kg, 45 mg/kg, 46 mg /kg, 47 mg/kg, 48 mg/kg, 49 mg/kg to 50 mg/kg body weight.

Various factors may be considered in determining the dosage and timing of delivery of the xanthine dehydrogenase (XDH) dsRNA reagents of the invention. The absolute amount of xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent delivered will depend on a variety of factors, including co-treatment, number of doses, and individual subject parameters, including age, Physical condition, size and weight. These factors are well known to those of ordinary skill in the art and can be addressed through routine experimentation. In some embodiments, the maximum dose may be used, ie, the highest safe dose based on sound medical judgment.

In some embodiments, methods of the invention may comprise administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of a xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent. In some cases, a pharmaceutical compound (e.g., a dsRNA agent containing xanthine dehydrogenase (XDH) or a dsRNA agent containing xanthine dehydrogenase (XDH)) may be administered to the subject at least daily, every other day, weekly, every other week, monthly, etc. ( The pharmaceutical composition of the present invention can be administered once a day; or the xanthine dehydrogenase (XDH) dsRNA reagent or the xanthine dehydrogenase (XDH) antisense polynucleotide reagent can be administered twice a day at appropriate intervals. Three or more sub-doses are administered, or even using continuous infusion or delivered via a controlled release formulation. In some embodiments of the methods of the invention, a pharmaceutical composition of the invention is administered to the subject once or more daily, once or more weekly, once or more monthly, or once or more annually.

In certain aspects, methods of the invention include administering a pharmaceutical compound alone; in combination with one or more other xanthine dehydrogenase (XDH) dsRNA agents or xanthine dehydrogenase (XDH) antisense polynucleotide agents; and /or in combination with other drug therapies or therapeutic activities or regimens administered to subjects with xanthine dehydrogenase (XDH)-related diseases or conditions. Pharmaceutical compounds can be administered in the form of pharmaceutical compositions. The pharmaceutical composition used in the method of the present invention can be sterile and contain an amount of xanthine dehydrogenase (XDH) dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent, which will convert xanthine The activity of the dehydrogenase (XDH) polypeptide is reduced to a level sufficient to produce a desired response in units of weight or volume suitable for administration to a subject. The dosage of a pharmaceutical composition comprising a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent administered to a subject to reduce xanthine dehydrogenase (XDH) can be selected based on different parameters. The activity of the protein is particularly selected based on the mode of administration used and the state of the subject. Other factors include the length of treatment required. If the subject's response at the initial dose is insufficient, a higher dose may be administered (or the dose may be effectively increased via a different, more local delivery route) as tolerated by the patient. treatment

As used herein, the term "prevent" or "prevent," when used to refer to a disease, disorder, or condition thereof that would benefit from reduced expression of the xanthine dehydrogenase (XDH) gene, refers to the occurrence of a disease in a subject associated with such disease Reduced likelihood of symptoms associated with, for example, a disease or condition caused by or associated with xanthine dehydrogenase (XDH) activation , such as gout. The likelihood of developing gout is reduced when, for example, an individual with one or more risk factors for gout fails to develop gout relative to a population with the same risk factors who does not receive treatment as described herein. Reduced progression (e.g., a reduction of at least approximately 10% on a scale of clinically having the disease or condition), or delayed symptoms of a related disease, condition, or condition, or of symptoms associated with such disease, condition, or condition manifestation (e.g., delayed by days, weeks, months, or years), prevention is considered effective.

For xanthine dehydrogenase (XDH) related diseases and conditions, in which a reduction in the level and/or activity of the xanthine dehydrogenase (XDH) polypeptide is effective in treating the disease or condition, the methods of the present invention and xanthine dehydrogenation can be used. Hydrogenase (XDH) dsRNA reagent was used to treat xanthine dehydrogenase (XDH) expression. Examples of diseases and conditions that may be treated with the xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagents of the invention and the treatment methods of the invention include, but are not limited to: Hyperuricemia Gout, NAFLD, NASH, metabolic disorders, insulin resistance, cardiovascular disease, type 2 diabetes, Lesch Nyhan syndrome, glycostorage disorders (GSD), such as GSD type I, and diseases related to oxidative stress, such as chronic Low-grade inflammation; or other XDH-related diseases. Such diseases and conditions may be referred to herein as "xanthine dehydrogenase (XDH)-related diseases and conditions" and "diseases and conditions caused and/or modulated by xanthine dehydrogenase (XDH)."

In certain aspects of the invention, a xanthine dehydrogenase (XDH) dsRNA agent of the invention can be administered to a subject at one or more times before or after diagnosis of a xanthine dehydrogenase (XDH)-related disease or condition or Xanthine dehydrogenase (XDH) antisense polynucleotide reagent. In some aspects of the invention, the subject is at risk of suffering from or developing a xanthine dehydrogenase (XDH)-related disease or disorder. A subject at risk of developing a xanthine dehydrogenase (XDH)-related disease or condition who is at risk of developing a xanthine dehydrogenase (XDH)-related disease or condition compared to a control risk of developing a xanthine dehydrogenase (XDH)-related disease or condition Objects with increased likelihood of illness. In some embodiments of the invention, the level of risk is statistically significant compared to a control level of risk. A subject at risk may include, for example, a subject who is or will be a subject with a pre-existing disease and/or genetic abnormality that renders the subject more susceptible to xanthine dehydrogenase than a control subject without the pre-existing disease or genetic abnormality ( XDH)-related diseases or conditions; subjects with a family and/or personal history of xanthine dehydrogenase (XDH)-related diseases or conditions; and subjects who have been previously treated for xanthine dehydrogenase (XDH)-related diseases or conditions. It will be understood that a pre-existing disease and/or genetic abnormality that predisposes a subject to a xanthine dehydrogenase (XDH)-related disease or disorder may be a disease or genetic abnormality that, when present, has been previously identified as being associated with There is an association with a higher likelihood of developing xanthine dehydrogenase (XDH)-related diseases or conditions.

It will be appreciated that a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent may be administered to a subject based on the individual subject's medical condition. For example, health care provided to a subject may assess xanthine dehydrogenase (XDH) levels measured in a sample obtained from the subject and determine the xanthine dehydrogenase (XDH) dsRNA reagent or xanthine dehydrogenase by administering the present invention It is desirable to use antisense polynucleotide reagents to reduce xanthine dehydrogenase (XDH) levels in a subject. In one non-limiting example, a biological sample, such as a blood or serum sample, can be obtained from a subject and the subject's uric acid level determined in the sample. administering a xanthine dehydrogenase (XDH) dsRNA reagent or a xanthine dehydrogenase (XDH) antisense polynucleotide reagent to a subject, and obtaining a blood or serum sample from the subject after administration, and using the sample to determine uric acid levels, This result is compared to the result determined in the subject's pre-dose (previous) sample. A decrease in the subject's uric acid levels in subsequent samples compared to pre-dose levels indicates that the administered Xanthine Dehydrogenase (XDH) dsRNA Reagent or Efficacy in terms of xanthine dehydrogenase (XDH) levels. In one non-limiting example, elevated uric acid levels may be considered a physiological signature of a xanthine dehydrogenase (XDH)-related disorder, even if the subject has not been diagnosed with a xanthine dehydrogenase (XDH)-related disorder, such as herein Public disease. A healthcare provider can monitor changes in a subject's uric acid levels as a measure of the efficacy of an administered xanthine dehydrogenase (XDH) dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention. In a non-limiting example, xanthine dehydrogenase (XDH) related diseases are hyperuricemia, gout, NAFLD, NASH, metabolic disorders, insulin resistance, cardiovascular disease, type 2 diabetes, Lesch Nyhan syndrome, glycogen Storage disorders (GSD), such as GSD type I and diseases related to oxidative stress, such as chronic low-grade inflammation; or other XDH-related diseases.

Certain embodiments of the methods of the present invention include modifying a treatment based, at least in part, on an assessment of a change in one or more physiological characteristics of a xanthine dehydrogenase (XDH)-related disease or disorder in a subject caused by the treatment , to administer the dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent of the invention to a subject. For example, in some embodiments of the invention, the effects of a dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention administered to a subject can be determined and used to help modulate subsequent administration of the agent to the subject. Invent the amount of dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent. In one non-limiting example, a dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention is administered to a subject, and the subject's uric acid level is determined after administration; and based at least in part on the determined level, Determine whether higher amounts of dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent are required to enhance the physiological effects of the administered reagent, such as reducing or further reducing the subject's uric acid levels. In another non-limiting example, a dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention is administered to a subject, and the subject's uric acid level is determined following administration, and is based at least in part on the At the determined levels, it is expected that subjects will be administered lower amounts of dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent.

Accordingly, some embodiments of the invention include assessment of changes in one or more physiological characteristics resulting from prior treatment of the subject, including reduction in uric acid levels in blood and urine, reduction in pain (e.g., pain caused by gout), inflammation reduction, etc., to adjust the amount of the dsRNA agent or xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention subsequently administered to the subject. Some embodiments of the methods of the present invention include 1, 2, 3, 4, 5, 6 or more determinations of physiological characteristics of xanthine dehydrogenase (XDH)-related diseases or disorders; assessing and/or monitoring administered the efficacy of the inventive xanthine dehydrogenase (XDH) dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent; and optionally use the results of the assay to adjust one or more of the following: Dosages, dosing regimens and/or dosing frequencies of the inventive dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagents for treating xanthine dehydrogenase (XDH)-related diseases or conditions in subjects. In some embodiments of the methods of the invention, the desired outcome of administering to a subject an effective amount of a dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention is: compared to previously determined for the subject, Subjects were reduced xanthine dehydrogenase (XDH) transcript levels, plasma uric acid levels, and xanthine dehydrogenase (XDH) gene expression.

As used herein, the terms "treat," "therapeutic," or "therapeutic" when used in reference to a xanthine dehydrogenase (XDH)-related disease or condition may refer to preventive treatment, reducing the development of xanthine dehydrogenase (XDH) in a subject ) related disease or condition, and may also refer to the elimination or reduction of the level of xanthine dehydrogenase (XDH)-related disease or condition after the subject has developed the xanthine dehydrogenase (XDH)-related disease or condition Treatment to prevent a xanthine dehydrogenase (XDH)-related disease or condition from becoming more severe, and/or be associated with a subject in the absence of therapy that reduces the activity of the xanthine dehydrogenase (XDH) polypeptide in the subject Ratio, slows the progression of a xanthine dehydrogenase (XDH)-related disease or condition in a subject.

Certain embodiments of the agents, compositions, and methods of the invention can be used to inhibit xanthine dehydrogenase (XDH) gene expression. As used herein, with respect to the expression of the xanthine dehydrogenase (XDH) gene, the terms "inhibit,""silence,""reduce,""down-regulate" and "knock-down" mean, for example, alteration by one or more of the following Expression of the xanthine dehydrogenase (XDH) gene: respectively compared with the control level of RNA transcribed by the xanthine dehydrogenase (XDH) gene, the activity control level of the expressed xanthine dehydrogenase (XDH) or translated by When a cell, cell population, tissue, organ or subject is reacted with a xanthine dehydrogenase (XDH) dsRNA reagent or a The level of RNA transcribed from the gene, the level of xanthine dehydrogenase (XDH) activity expressed by the cell, cell population, tissue, organ or subject when exposed to (e.g., treated with) a polynucleotide reagent Decreased levels of xanthine dehydrogenase (XDH) polypeptides, proteins, or protein subunits translated from the mRNA. In some embodiments, the control level is a cell, tissue, organ or subject that has not been exposed to (e.g., treated with) a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent. medium level. Application method

A variety of routes of administration of xanthine dehydrogenase (XDH) dsRNA agents or xanthine dehydrogenase (XDH) antisense polynucleotide agents can be used in the methods of the invention. The selection of a particular delivery mode will depend, at least in part, on the specific condition being treated and the dosage required for therapeutic efficacy. In general, the methods of the present invention may be practiced using any mode of administration that is medically acceptable, meaning that producing effective therapeutic levels of xanthine dehydrogenase (XDH)-related diseases or conditions without causing clinically unacceptable Any pattern of side effects. In some embodiments of the invention, a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent can be administered by oral, enteral, mucosal, subcutaneous, and/or parenteral routes Apply. The term "parenteral" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., via gastronasal tube), transdermal, vaginal, rectal, sublingual, and inhalation. Delivery routes of the present invention may include intrathecal, intraventricular, or intracranial. In some embodiments of the invention, a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent can be placed in a sustained release matrix and administered by placing the matrix in a subject. Apply. In some aspects of the invention, xanthine dehydrogenase (XDH) dsRNA agents or xanthine dehydrogenase (XDH) antisense polynucleotide agents can use nanoparticles coated with a delivery agent that targets specific cells or organelles. Delivered to target cells. A variety of delivery modes, methods, and reagents are known in the art. Non-limiting examples of delivery methods and delivery agents are provided elsewhere herein. In some aspects of the invention, the term "delivery" with respect to a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent may refer to administering to a cell or subject one or more Multiple "naked" xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagent sequences. In certain aspects of the invention, "delivery" means administering to a cell or subject by transfection a substance that will contain a xanthine dehydrogenase (XDH) dsRNA reagent or a xanthine dehydrogenase (XDH) antisense polynucleotide reagent. Cells are delivered to a subject, a vector encoding a xanthine dehydrogenase (XDH) dsRNA reagent or a xanthine dehydrogenase (XDH) antisense polynucleotide reagent is delivered to a cell and/or a subject, etc. Delivery of a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent using transfection may include administering a vector to a cell and/or subject.

In some methods of the invention, one or more xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagents can be administered in the form of a preparation, or can be administered pharmaceutically It is administered in an acceptable solution, which may generally contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the invention, a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent can be formulated with another therapeutic agent for simultaneous administration. According to the methods of the present invention, the xanthine dehydrogenase (XDH) dsRNA agent or the xanthine dehydrogenase (XDH) antisense polynucleotide agent can be administered in the form of a pharmaceutical composition. Typically, pharmaceutical compositions comprise a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent and optionally a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those of ordinary skill in the art. As used herein, a pharmaceutically acceptable carrier refers to a cell or subject that does not interfere with the biological activity of the active ingredient (e.g., a xanthine dehydrogenase (XDH) dsRNA agent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent). A non-toxic material that has the ability to express xanthine dehydrogenase (XDH) genes). Various methods of administering and delivering xanthine dehydrogenase (XDH) dsRNA agents or xanthine dehydrogenase (XDH) antisense polynucleotide agents for therapeutic use are known in the art and can be used in the methods of the invention .

Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and other carriers are known to those skilled in the art. Such preparations may generally contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts thereof, which are not excluded from the scope of the present invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, propionic acid. Diacid, succinic acid, etc. Furthermore, pharmaceutically acceptable salts may be prepared as alkali metal salts or alkaline earth metal salts, such as sodium, potassium or calcium salts.

Some embodiments of the methods of the invention include administering one or more xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagents directly to the tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which a xanthine dehydrogenase (XDH)-related disease or disorder is present or likely to occur, non-limiting examples of which are the liver or kidneys. Direct tissue drug delivery can be achieved by direct injection or other means. Many orally delivered compounds naturally enter and pass through the liver and kidneys, and some embodiments of the treatment methods of the present invention include orally administering to a subject one or more xanthine dehydrogenase (XDH) dsRNA agents. The xanthine dehydrogenase (XDH) dsRNA agent or the xanthine dehydrogenase (XDH) antisense polynucleotide agent, alone or in combination with other therapeutic agents, can be administered once, or they can be administered multiple times. If administered multiple times, the xanthine dehydrogenase (XDH) dsRNA agent or the xanthine dehydrogenase (XDH) antisense polynucleotide agent can be administered by different routes. For example, although not intended to be limiting, the first (or first several) administrations may be administered subcutaneously, and one or more additional administrations may be oral and/or systemic.

For embodiments of the invention in which it is desired to systemically administer a xanthine dehydrogenase (XDH) dsRNA reagent or a xanthine dehydrogenase (XDH) antisense polynucleotide agent, a xanthine dehydrogenase (XDH) dsRNA reagent or Xanthine dehydrogenase (XDH) antisense polynucleotide agents are intended for parenteral administration by injection, such as by bolus injection or continuous infusion. Injectable preparations may be presented in unit dosage form such as ampoules or multi-dose containers, with or without added preservatives. Xanthine Dehydrogenase (XDH) dsRNA reagent preparations (also known as pharmaceutical compositions) may take the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulating agents such as suspending agents, stabilizers and/or dispersants.

Formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose solution, dextrose and sodium chloride solution, lactated Ringer's solution, or fixed oils. Intravenous excipients include fluid and nutritional supplements, electrolyte supplements (such as those based on Ringer's dextrose solution), and the like. Preservatives and other additives such as antimicrobials, antioxidants, chelating agents, inert gases, etc. may also be present. Other forms of administration, such as intravenous administration, will result in lower doses. If the subject's response at the initial dose is inadequate, a higher dose may be administered (or the dose may be effectively increased via a different, more local delivery route) as tolerated by the patient. Multiple daily doses may be used as needed to achieve appropriate systemic or local levels of one or more xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagents and to achieve xanthine dehydrogenase (XDH) antisense polynucleotide reagents. Appropriate reduction in purine dehydrogenase (XDH) activity.

In other embodiments, the methods of the present invention include the use of a delivery vehicle, such as a biocompatible microparticle, nanoparticle, or implant suitable for implantation in a recipient, such as a subject. Exemplary biodegradable implants that may be used according to this method are described in PCT Publication WO 95/24929 (incorporated herein by reference), which describes biocompatible, biodegradable implants containing biological macromolecules. Polymer matrix.

Both non-biodegradable and biodegradable polymeric matrices can be used in the methods of the present invention to incorporate one or more xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynuclear The glycoside reagent is delivered to the subject. In some embodiments, the matrix can be biodegradable. Matrix polymers can be natural or synthetic polymers. The polymer can be selected based on the period of time for which release is desired, typically on the order of a few hours to a year or more. Typically, releases for periods ranging from a few hours to three to twelve months are available. The polymer is optionally in the form of a hydrogel, which can absorb up to about 90% of its weight in water, and is optionally also cross-linked with multivalent ions or other polymers.

Typically, xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagents may be used in some embodiments of the invention via diffusion or through polymers using biodegradable implants. delivery through degradation of the matrix. Exemplary synthetic polymers for this purpose are well known in the art. Biodegradable polymers and non-biodegradable polymers can be used to deliver xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagents using methods known in the art. Bioadhesive polymers such as bioerodible hydrogels (H. S. Sawhney, C. P. Pathak and J. A. Hubell in Macromolecules, 1993, 26, 581-587) can also be used to deliver xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase Hydrogenase (XDH) antisense polynucleotide reagents for the treatment of xanthine dehydrogenase (XDH)-related diseases or conditions. Other suitable delivery systems may include timed release, delayed release, or sustained release delivery systems. Such systems improve convenience for subjects and healthcare professionals by eliminating the need for repeated administration of xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide agents. Many types of release delivery systems are available and known to those of ordinary skill in the art. See, for example, U.S. Patent Nos. 5,075,109, 4,452,775, 4,675,189, 5,736,152, 3,854,480, 5,133,974, and 5,407,686. Additionally, pump-based hardware delivery systems are available, some of which are also suitable for implantation.

The use of long-term sustained release implants may be suitable for prophylactic treatment of subjects and subjects at risk of developing recurrent xanthine dehydrogenase (XDH)-related diseases or conditions. As used herein, long-term release refers to implants constructed and arranged to deliver therapeutic levels of yellow for at least up to 10 days, 20 days, 30 days, 60 days, 90 days, six months, one year, or longer. Purine Dehydrogenase (XDH) dsRNA Reagent or Xanthine Dehydrogenase (XDH) Antisense Polynucleotide Reagent. Long-term sustained release implants are well known to those of ordinary skill in the art and include some of the release systems described above.

Therapeutic formulations of xanthine dehydrogenase (XDH) dsRNA reagents or xanthine dehydrogenase (XDH) antisense polynucleotide reagents can be obtained by combining the molecule or compound with the desired purity and optionally a pharmaceutically acceptable carrier, Excipients or stabilizers [Remington's Pharmaceutical Sciences 21st edition, (2006)] are prepared for storage by mixing in a lyophilized formulation or aqueous solution. Acceptable carriers, excipients or stabilizers are non-toxic to the recipient at the doses and concentrations employed and include buffering agents such as phosphates, citrates and other organic acids; antioxidants including ascorbic acid and methionine ; Preservatives (e.g. stearyldimethylbenzyl ammonium chloride; hexamethylammonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butanol or benzyl alcohol; parabens, e.g. Methyl or propyl hydroxybenzoate; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) peptides; proteins, e.g. Serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; simple sugars, Disaccharides and other carbohydrates, including glucose, mannose or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g. , zinc-protein complexes); and/or non-ionic surfactants such as TWEEN®, PLURONICS® or polyethylene glycol (PEG). cells, objects and controls

The methods of the invention can be used in conjunction with cells, tissues, organs and/or subjects. In some aspects of the invention, the subject is a human or vertebrate mammal, including but not limited to dogs, cats, horses, cattle, goats, mice, rats, and primates, such as monkeys. Accordingly, the present invention may be used to treat xanthine dehydrogenase (XDH)-related diseases or conditions in humans and non-human subjects. In some aspects of the invention, the subject may be a farm animal, a zoo animal, a domesticated animal, or a non-domesticated animal, and the methods of the invention may be used in veterinary preventive and therapeutic regimens. In some embodiments of the invention, the subject is a human and the methods of the invention can be used in human prophylactic and therapeutic regimens.

Non-limiting examples of subjects to which the present invention may be applied are subjects diagnosed with, suspected of having, or at risk of having a disease or condition associated with: Greater than desired xanthine dehydrogenase (XDH) expression and/or activity, also known as "elevated xanthine dehydrogenase (XDH) expression levels." Non-limiting examples of diseases and conditions associated with higher than desired levels of xanthine dehydrogenase (XDH) expression and/or activity are described elsewhere herein. The methods of the present invention may be applied to subjects who have been diagnosed with the disease or condition at the time of treatment, are associated with higher than expected xanthine dehydrogenase (XDH) expression and/or activity, or are thought to be suffering from the disease or condition. or a subject at risk of developing a disease or condition associated with higher than expected xanthine dehydrogenase (XDH) expression and/or activity. In some aspects of the invention, the disease or condition associated with higher than desired xanthine dehydrogenase (XDH) expression and/or activity levels is an acute disease or condition; Diseases or conditions associated with xanthine dehydrogenase (XDH) expression and/or activity levels are chronic diseases or conditions.

In a non-limiting example, the xanthine dehydrogenase (XDH) dsRNA reagent of the invention is administered to patients diagnosed with XDH-related diseases, including but not limited to: hyperuricemia, gout, NAFLD, NASH, metabolic disorders, insulin resistance, cardiovascular disease, type 2 diabetes, Lesch Nyhan syndrome, glycogen storage disorders (GSD), such as GSD type I, and diseases related to oxidative stress, such as chronic low-grade inflammation; or other XDH-related diseases. The methods of the present invention may be applied to subjects who, at the time of treatment, have been diagnosed as having the disease or condition, or who are considered to be at risk of developing or developing the disease or condition.

In another non-limiting example, a xanthine dehydrogenase (XDH) dsRNA agent of the invention is administered to treat a disease or disorder caused by or associated with activation of xanthine dehydrogenase (XDH), or a symptom thereof or a disease or disorder that progresses in response to inactivation of xanthine dehydrogenase (XDH). The term "xanthine dehydrogenase (XDH)-related disease" includes diseases, disorders, or conditions that benefit from reduced expression of xanthine dehydrogenase (XDH). Such diseases include, but are not limited to: hyperuricemia, gout, NAFLD, NASH, metabolic disorders, insulin resistance, cardiovascular disease, type 2 diabetes, Lesch Nyhan syndrome, glycogen storage disorders (GSD), such as GSD type I and diseases related to oxidative stress, such as chronic low-grade inflammation; or other XDH-related diseases.

Cells to which the method of the present invention can be applied include in vitro, in vivo, and ex vivo cells. The cells may be in a subject, in culture and/or in suspension, or in any other suitable state or condition. The cells to which the method of the present invention can be applied may be: liver cells, hepatocytes, heart cells, pancreatic cells, cardiovascular cells, kidney cells or other types of vertebrate cells, including human and non-human mammalian cells. animal cells. In certain aspects of the invention, cells to which the methods of the invention can be applied are healthy normal cells that are not known to be disease cells. In certain embodiments of the invention, the methods and compositions of the invention are applied to cells of the liver, hepatocytes, heart cells, pancreatic cells, cardiovascular cells, and/or renal cells. In certain aspects of the invention, control cells are normal cells, but it should be understood that cells having a disease or disorder may also be used as control cells in certain circumstances, such as when comparing treated cells having a disease or disorder to cells having a disease or disorder. In the case of other diseases that result from untreated cells.

According to the methods of the present invention, the level of xanthine dehydrogenase (XDH) polypeptide activity can be determined and compared to a control level of xanthine dehydrogenase (XDH) polypeptide activity. The control can be a predetermined value, which can take many forms. It can be a single cutoff value, such as the median or mean. It can be established based on comparing groups, for example in a group with normal levels of xanthine dehydrogenase (XDH) polypeptide and/or xanthine dehydrogenase (XDH) polypeptide activity and with increased xanthine dehydrogenase (XDH) peptide and/or xanthine dehydrogenase (XDH) peptide activity levels in the group. Another non-limiting example of a comparison group may be a population with one or more symptoms or diagnosis of a xanthine dehydrogenase (XDH)-related disease or disorder versus a population without one or more symptoms or diagnosis of the disease or disorder. Population; a subject group to which the siRNA treatment of the present invention has been administered and a subject group to which the siRNA treatment of the present invention has not been administered. Typically, controls can be based on apparently healthy normal individuals or apparently healthy cells in an appropriate age group. It will be understood that, in addition to predetermined values, a control according to the present invention may be a material sample tested in parallel with the experimental material. Examples include samples from control populations or control samples generated through manufacturing for parallel testing with experimental samples. In some embodiments of the invention, controls may include cells or subjects that have not been contacted or treated with the xanthine dehydrogenase (XDH) dsRNA reagents of the invention, in which case the xanthine dehydrogenase (XDH) dsRNA reagents of the invention may be compared. ) polypeptide and/or xanthine dehydrogenase (XDH) polypeptide activity control levels and contact with the xanthine dehydrogenase (XDH) dsRNA reagent or xanthine dehydrogenase (XDH) antisense polynucleotide reagent of the invention The level of xanthine dehydrogenase (XDH) polypeptide and/or xanthine dehydrogenase (XDH) polypeptide activity in a cell or subject.

In some embodiments of the invention, the control level may be a xanthine dehydrogenase (XDH) polypeptide level determined for a subject, wherein a xanthine dehydrogenase (XDH) polypeptide level determined for the same subject at a different time is compared with the Compare to control levels. In one non-limiting example, xanthine dehydrogenase (XDH) levels are determined in biological samples obtained from subjects who have not received xanthine dehydrogenase (XDH) treatment of the present invention. In some embodiments, the biological sample is a serum sample. The uric acid level measured in the sample obtained from the subject may serve as the subject's baseline or control value. After one or more administrations of a xanthine dehydrogenase (XDH) dsRNA agent to a subject in a treatment method of the invention, one or more additional serum samples can be obtained from the subject, and the subsequent one or more The uric acid levels in each sample are compared to the subject's control/baseline levels. Such comparisons may be used to evaluate the onset, progression, or regression of xanthine dehydrogenase (XDH)-related diseases or conditions in a subject. For example, the level of a xanthine dehydrogenase (XDH) polypeptide in a baseline sample obtained from a subject is higher than when the subject is administered a Levels obtained from the same subject after a glycoside reagent are indicative of resolution of a xanthine dehydrogenase (XDH)-related disease or disorder and are indicative of administration of a xanthine dehydrogenase (XDH) dsRNA reagent of the invention to treat xanthine dehydrogenase (XDH) Efficacy caused by related diseases or conditions.

In certain aspects of the invention, the biological sample is a hepatocyte sample. One or more of the xanthine dehydrogenase (XDH) polypeptide and/or xanthine dehydrogenase (XDH) polypeptide activity levels determined for a subject can serve as a control value and be used to later compare xanthine dehydrogenase (XDH) polypeptide in the same subject. Purine dehydrogenase (XDH) polypeptide and/or xanthine dehydrogenase (XDH) activity levels, thereby allowing assessment of changes in "baseline" xanthine dehydrogenase (XDH) polypeptide activity in a subject. Therefore, the initial xanthine dehydrogenase (XDH) polypeptide level and/or the initial xanthine dehydrogenase (XDH) polypeptide activity level may be used to display and/or determine where the initial level is used as a control level for that subject. The methods and compounds of the present invention are capable of reducing the level of xanthine dehydrogenase (XDH) polypeptide and/or xanthine dehydrogenase (XDH) polypeptide activity in the subject.

Using the methods of the invention, a xanthine dehydrogenase (XDH) dsRNA agent and/or a xanthine dehydrogenase (XDH) antisense polynucleotide agent of the invention can be administered to a subject. Such dsRNAi agents include, for example, duplexes AV00206 to AV00292 shown in Table 1. In some embodiments, preferred dsRNAi agents include, for example, duplexes AV00227, AV00260, AV00285, AV00266, AV00280, AV00238, AV00249, AV00289, AV00233, AV00225, AV00273, or AV00283. In other embodiments, preferred dsRNAi agents of Table 2 include, for example, duplexes AV00227, AV00260, AV00285, AV00266, or AV00280. In other embodiments, preferred dsRNAi agents in Table 3 include, for example, duplexes AD00353, AD00356, AD00358, AD00364, AD00365, AD00366, AD00368, AD00370, AD00430, AD00431, AD00521, AD00521-1, AD00364-1, AD00365 -2, AD00366-1 and AD00432-1. The efficacy of administration and treatment of the present invention may be assessed as compared to pre-dose levels of uric acid in serum samples obtained from the subject at previous time points, or compared to non-exposure control levels (e.g., uric acid levels in control serum samples) , when administered and treated, the level of uric acid in serum samples obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80 %, 90%, 95% or more. It should be understood that the level of uric acid is related to the level of xanthine dehydrogenase (XDH) gene expression. Certain embodiments of the methods of the invention include administering to the subject the xanthine dehydrogenase (XDH) dsRNA and/or xanthine dehydrogenase (XDH) of the invention in an amount effective to inhibit xanthine dehydrogenase (XDH) gene expression. An antisense agent, thereby reducing the level of xanthine dehydrogenase (XDH) polypeptide and reducing the level of xanthine dehydrogenase (XDH) polypeptide activity in a subject. In some embodiments of the methods of the invention, contacting a cell with an siRNA agent of the invention (also referred to herein as treatment) results in an inhibition of xanthine dehydrogenase (XDH) gene expression in the cell by at least about 1%, 2% , 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19 %, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52% ,53%,54%,55%,56%,57%,58%,59%,60%,61%,62%,63%,64%,65%,66%,67%,68%,69 %, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or about 100%, for example, to as low as At the level of laboratory testing.

Some embodiments of the invention include determining the presence, absence, and/or amount (also referred to herein as levels) of a xanthine dehydrogenase (XDH) polypeptide in one or more biological samples obtained from one or more subjects. . This assay can be used to assess the efficacy of the treatment methods of the invention. For example, the methods and compositions of the invention can be used to determine the level of a xanthine dehydrogenase (XDH) polypeptide in a biological sample obtained previously using a xanthine dehydrogenase (XDH) dsRNA reagent of the invention and/or or subjects treated with xanthine dehydrogenase (XDH) antisense agents. Compare to predose levels of xanthine dehydrogenase (XDH) polypeptide in hepatocyte samples obtained from the subject at previous time points, or to non-exposure control levels (e.g., xanthine dehydrogenase (XDH) in control hepatocyte samples ) polypeptide levels), when administered and treated, the levels of xanthine dehydrogenase (XDH) polypeptides in hepatocyte samples obtained from the subject are reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30 %, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more indicates the level of efficacy of the treatment administered to the subject.

In some embodiments of the present invention, the physiological characteristics of xanthine dehydrogenase (XDH)-related diseases or conditions determined for a subject can be used as a control result, and the determination results of the physiological characteristics of the same subject at different times are compared with the control results. compare. In one non-limiting example, pathological characteristic uric acid levels are measured from subjects who have never been administered xanthine dehydrogenase (XDH) treatment of the present invention, which can be used as a baseline or control value for the subject. After one or more administrations of a xanthine dehydrogenase (XDH) dsRNA agent to a subject in a treatment method of the invention, uric acid levels are compared to the subject's control/baseline levels, respectively. Such comparisons may be used to evaluate the onset, progression, or regression of xanthine dehydrogenase (XDH)-related diseases or conditions in a subject. For example, a baseline uric acid level obtained from a subject is higher than uric acid measured from the same subject after administration of a xanthine dehydrogenase (XDH) dsRNA reagent or a xanthine dehydrogenase (XDH) antisense polynucleotide reagent of the invention to the subject level, it represents the regression of xanthine dehydrogenase (XDH)-related diseases or disorders and represents the efficacy of the administered xanthine dehydrogenase (XDH) dsRNA agent of the present invention in treating xanthine dehydrogenase (XDH)-related diseases or disorders. .

Some embodiments of the invention include determining the presence, absence, and/or changes in physiological characteristics of xanthine dehydrogenase (XDH)-related diseases or conditions using methods such as, but not limited to: (1) measuring a subject's uric acid levels; 2) evaluate the physiological characteristics of one or more biological samples obtained from one or more subjects; (3) or perform a physical examination of the subject. This assay can be used to assess the efficacy of the treatment methods of the invention. pill box

Kits containing one or more xanthine dehydrogenase (XDH) dsRNA reagents and/or xanthine dehydrogenase (XDH) antisense polynucleotide reagents and instructions for their use in the methods of the invention are also subject to the invention. within the range. The kit of the present invention may include a xanthine dehydrogenase (XDH) dsRNA reagent useful for treating xanthine dehydrogenase (XDH)-related diseases or disorders, a xanthine dehydrogenase (XDH) sense polynucleotide and a xanthine dehydrogenase One or more of the hydrogenase (XDH) antisense polynucleotide reagents. Kits containing one or more xanthine dehydrogenase (XDH) dsRNA reagents, xanthine dehydrogenase (XDH) sense polynucleotide, and xanthine dehydrogenase (XDH) antisense polynucleotide reagents can be prepared to For use in the treatment methods of the present invention. The components of the kit of the invention may be packaged in an aqueous medium or in lyophilized form. Kits of the present invention may comprise a carrier divided to receive therein one or more container means or a series of container means (eg test tubes, vials, flasks, bottles, syringes, etc.). The first container device or series of container devices may contain one or more compounds, such as a xanthine dehydrogenase (XDH) dsRNA reagent and/or a xanthine dehydrogenase (XDH) sense or antisense polynucleotide reagent. The second container device or series of container devices may contain targeting agents, labeling agents, delivery agents, etc., which may serve as xanthine dehydrogenase (XDH) dsRNA agents and/or administered in embodiments of the treatment methods of the invention. A portion of the xanthine dehydrogenase (XDH) antisense polynucleotide is included.

The kit of the present invention may also contain instructions. Instructions are usually in written form and will provide guidance for performing the treatment embodied by the kit and for making decisions based on that treatment.

The following examples are provided to illustrate specific examples of the practice of the invention and are not intended to limit the scope of the invention. It will be apparent to one of ordinary skill in the art that the present invention is applicable to a variety of compositions and methods. EXAMPLES Example 1. Synthesis of RNAi reagents

The xanthine dehydrogenase (XDH) gene RNAi reagent duplexes shown in Table 1-3 above were synthesized according to the following general procedure:

siRNA sense and antisense strand sequences are synthesized on an oligonucleotide synthesizer using a well-established solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain growth is achieved through a 4-step cycle: deprotection, condensation, capping, and an oxidation or sulfation step for the addition of each nucleotide. The synthesis was performed on a solid support made of controlled porous glass (CPG, 1000 Å). Monomeric phosphoramidite was purchased from commercial sources. Phosphoramidites with GalNAc ligand clusters (GLPA1, GLPA2, and GLPA15 as non-limiting examples) were synthesized according to the procedures of Examples 2-3 herein. For siRNA for in vitro screening (Table 2), synthesis was performed at a 2 μmol scale; for siRNA for in vivo testing (Table 3), synthesis was performed at a scale of 5 μmol or larger. In the case where a GalNAc ligand (GLO-n as a non-limiting example) is attached to the 3'-end of the sense strand, a CPG solid support to which the GalNAc ligand is attached is used. In the case where a GalNAc ligand (GLPA1 or GLS-2 as a non-limiting example) is attached to the 5'-end of the sense strand, a GalNAc phosphoramidite (GLPA1 or GLPA2 as a non-limiting example) is used at the end coupling reaction. Trichloroacetic acid (TCA) in 3% dichloromethane was used for deprotection of the 4,4'-dimethoxytrityl protecting group (DMT). 5-Ethylthio-1H-tetrazole was used as the activator. I in THF/Py/H ₂ O and phenylacetyl disulfide (PADS) in pyridine _/ MeCN were used for the oxidation and sulfidation reactions, respectively. After the final solid-phase synthesis step, the solid support-bound oligomers were cleaved and protecting groups were removed by treatment with a 1:1 volume of 20 wt% aqueous methylamine and 28% ammonium hydroxide solution. To synthesize siRNA for in vitro screening, the crude mixture was concentrated. The remaining solid was dissolved in 1.0 M NaOAc and ice-cold EtOH was added to precipitate the single-chain product as a sodium salt, which was used for annealing without further purification. To synthesize siRNA for in vivo testing, the crude single-stranded product was further purified by ion pair reversed-phase HPLC (IP-RP-HPLC). Convert the purified single-stranded oligonucleotide product from IP-RP-HPLC to its sodium salt by dissolving it in 1.0 M NaOAc and precipitating it by adding ice-cold EtOH. Annealing of sense and antisense strand oligonucleotides is performed by equimolar complementation in water to form a double-stranded siRNA product, which is lyophilized to provide a fluffy white solid. Example 2. Preparation of Intermediate -A and Intermediate -B

Intermediate-A was synthesized by treating commercially available galactosamine pentaacetate with trimethylsilyl triflate (TMSOTf) in dichloromethane (DCM) as shown in Scheme 1 below. Glycosylation with Cbz-protected 2-(2-aminoethoxy)ethan-1-ol then provided compound II. The Cbz protecting group is removed by hydrogenation to provide Intermediate-A as the trifluoroacetate (TFA) salt. Intermediate B was synthesized based on the same protocol except using Cbz protected 2-(2-(2-aminoethoxy)ethoxy)ethan-1-ol as starting material. Intermediate-A Intermediate-B plan 1

To a solution of compound I (20.0 g, 51.4 mmol) in 100 mL 1,2-dichloroethane (DCE) was added TMSOTf (17.1 g, 77.2 mmol). The resulting reaction solution was stirred at 60°C for 2 hours and then at 25°C for 1 hour; Cbz-protected 2-(2-aminoethoxy)ethan-1-ol (13.5 g, 56.5 mmol) was dissolved in DCE (100 mL), dried with 4 Å powdered molecular sieve (10 g), and added dropwise to the above reaction solution at 0 °C under _N2 atmosphere. The resulting reaction mixture was stirred at 25 °C for 16 h under _N2 atmosphere. The reaction mixture was filtered and washed with saturated _NaHCO3 (200 mL), water (200 mL) and saturated brine (200 mL). The organic layer was dried over _{anhydrous Na2SO4} , filtered and concentrated under reduced pressure to obtain the crude product, which was triturated with 2-methyltetrahydrofuran/heptane (5/3, v/v, 1.80L) for 2 hours. The resulting mixture was filtered and dried to obtain compound II as a white solid (15.0 g, yield 50.3%).

10% Pd/C (1.50 g) was carefully added to a dry and argon-purged hydrogenation flask, followed by 10 mL of tetrahydrofuran (THF), followed by compound II (15.0 g, 26.4 mmol) in THF (300 ml) and TFA (trifluoroacetic acid, 3.00 g, 26.4 mmol). The resulting mixture was degassed and purged 3 times with _H2 and stirred at 25 °C for 3 h under a _H2 (45 psi) atmosphere. Thin layer chromatography (TLC, solvent: DCM:MeOH = 10:1) showed complete consumption of compound II. The reaction mixture was filtered and concentrated under reduced pressure. The residue was dissolved in anhydrous DCM (500 mL) and concentrated. This process was repeated three times to obtain Intermediate-A as a foamy white solid (14.0 g, yield 96.5%). 1H NMR (400 MHz DMSO-d6): δ ppm 7.90 (d, J = 9.29 Hz, 1 H), 7.78 (br s, 3 H), 5.23 (d, J = 3.26 Hz, 1 H), 4.98 (dd , J = 11.29, 3.26 Hz, 1 H), 4.56 (d, J = 8.53 Hz, 1 H), 3.98 - 4.07 (m, 3 H), 3.79 - 3.93 (m, 2 H), 3.55 - 3.66 (m , 5 H), 2.98 (br d, J = 4.77 Hz, 2 H), 2.11 (s, 3 H), 2.00 (s, 3 H), 1.90 (s, 3 H), 1.76 (s, 3 H) .

Intermediate-B was synthesized using a similar procedure to the synthesis of Intermediate-A. 1H NMR (400 MHz DMSO-d6): δ ppm 7.90 (br d, J = 9.03 Hz, 4 H), 5.21 (d, J = 3.51 Hz, 1 H), 4.97 (dd, J = 11.1 Hz, 1 H ), 4.54 (d, J = 8.53 Hz, 1 H), 3.98 - 4.06 (m, 3 H), 3.88 (dt, J = 10.9 Hz, 1 H), 3.76 - 3.83 (m, 1 H), 3.49 - 3.61 (m, 9 H), 2.97 (br s, 2 H), 2.10 (s, 3 H), 1.99 (s, 3 H), 1.88 (s, 3 H), 1.78 (s, 3 H). Calculate Mass spectrum C20H34N2O11: 478.22; measured: 479.3 (M+H+). Example 3. Synthesis of GalNAc ligand cluster phosphoramidites GLPA1 , GLPA2 and GLPA15

Prepare GLPAl and GLPA2 according to Scheme 2 below. Starting from benzyl-protected propane-1,3-diamine, alkylation with tert-butyl 2-bromoacetate affords triester compound I. Removal of the benzyl protecting group by hydrogenation affords secondary amine compound II. Coupling of amide with 6-hydroxycaproic acid affords compound III. The tert-butyl protecting group is then removed upon treatment with HCl in dioxane to yield triacid compound IV. Amide coupling between triacid compound IV and Intermediate-A or Intermediate-B is performed to provide compound Va or Vb. Phosphoramidite GLPA1 or GLPA2 is synthesized by phosphorylation of compound Va or Vb with 2-cyanoethyl N,N-diisopropyl chloride phosphoramidite and a catalytic amount of 1H-tetrazole. Scenario 2

To a solution of N-benzyl-1,3-propanediamine (5.00 g, 30.4 mmol) in dimethylformamide (DMF, 100 mL) was added tert-butyl 2-bromoacetate (23.7 g, 121 mmol); then add diisopropylethylamine (DIEA, 23.61g, 182mmol) dropwise. The resulting reaction mixture was stirred at 25-30°C for 16 hours. LCMS showed complete consumption of N-benzyl-1,3-propanediamine. The reaction mixture was diluted with H ₂ O (500 mL) and extracted with EtOAc (500 mL × 2). The combined organic matter was washed with saturated brine (1L), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure to obtain a crude product; purified by silica gel column chromatography (gradient: petroleum ether: ethyl acetate 20:1 to 5: 1). Compound I was obtained as colorless oil (12.1 g, yield 78.4%). 1H NMR (400 MHz, CDCl ₃ ): δ ppm 7.26 - 7.40 (m, 5 H), 3.79 (s, 2 H), 3.43 (s, 4 H), 3.21 (s, 2 H), 2.72 (dt, J = 16.9, 7.34 Hz, 4 H), 1.70 (quin, J = 7.2 Hz, 2 H), 1.44 - 1.50 (m, 27 H).

The dry hydrogenation bottle was purged three times with argon. Pd/C (200 mg, 10%) was added, followed by MeOH (5 mL), then compound I (1.00 g, 1.97 mmol) in MeOH (5 mL). The reaction mixture was degassed under vacuum and refilled with _H2 . This process is repeated 3 times. The mixture was stirred at 25°C for 12 hours under an atmosphere of _H2 (15 psi). LCMS showed that Compound I was completely consumed. The reaction mixture was filtered under reduced pressure under _N2 atmosphere. The filtrate was concentrated under reduced pressure to obtain compound II (655 mg, yield 79.7%) as a yellow oil, which was used in the next step without further purification. 1H NMR (400 MHz, CDCl ₃ ): δ ppm 3.44 (s, 4 H), 3.31 (s, 2 H), 2.78 (t, J = 7.1 Hz, 2 H), 2.68 (t, J = 6.9 Hz, 2 H), 1.88 (br s, 1 H), 1.69 (quin, J = 7.03 Hz, 2 H), 1.44 - 1.50 (s, 27 H).

Compound II (655mg, 1.57mmol), 6-hydroxycaproic acid (249mg, 1.89mmol), DIEA (1.02g, 7.86mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide A mixture of hydrochloride (EDCI, 904 mg, 4.72 mmol) and 1-hydroxybenzotriazole (HOBt, 637 mg, 4.72 mmol) in DMF (6 mL) was degassed and purged ₃ times with N; then incubated under _N atmosphere Stir for 3 hours at 25°C. LCMS indicated the desired product. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc 20 mL (10 mL × 2). The organics were combined and washed with saturated brine ₍ 20 mL), dried over anhydrous _Na2SO4 , filtered and concentrated to give the crude product; this was passed through silica gel column chromatography (gradient: petroleum ether: ethyl acetate from 5:1 to 1:1 ) was purified to obtain compound III (650 mg, yield 77.8%) as yellow oil. 1H NMR (400 MHz, CDCl ₃ ): δ ppm 3.90 - 3.95 (s, 2 H), 3.63 (t, J = 6.40 Hz, 2 H), 3.38 - 3.45 (m, 6 H), 2.72 (t, J = 6.65 Hz, 2 H), 2.40 (t, J = 7.28 Hz, 2 H), 1.55 - 1.75 (m, 8 H), 1.44 (s, 27 H). Calculated mass spectrum C27H50N2O8: 530.36; measured: 531.3 (M +H ⁺ ).

A mixture of compound III (5.5 g, 10.3 mmol) in HCl/dioxane (2M, 55 mL) was stirred at 25 °C for 3 h. LCMS showed complete consumption of compound III. The reaction mixture was filtered, washed with EtOAc (50 mL), and dried under reduced pressure to obtain crude product. Dissolve this in CH3CN (50 mL) and remove volatiles in vacuo. This process was repeated three times to obtain compound IV as a white solid (2.05 g, yield 54.5%). ¹ H NMR (400 MHz, D ₂ O): δ ppm 4.21 (s, 1 H), 4.07 (d, J = 4.5 Hz, 4 H), 3.99 (s, 1 H), 3.45 - 3.52 (m, 3 H), 3.42 (t, J = 6.5 Hz, 1 H), 3.32 - 3.38 (m, 1 H), 3.24 - 3.31 (m, 1 H), 2.37 (t, J = 7.4 Hz, 1 H), 2.24 (t, J = 7.4 Hz, 1 H), 1.99 (dt, J = 15.5, 7.53 Hz, 1 H), 1.85 - 1.94 (m, 1 H), 1.85 - 1.94 (m, 1 H), 1.39 - 1.56 (m, 4 H), 1.19 - 1.31 (m, 2 H).

Compound IV (500 mg, 1.05 mmol), Intermediate-A (2.02 g, 3.67 mmol), DIEA (813 mg, 6.30 mmol), EDCI (704 mg, 3.67 mmol) and HOBt in DMF (10 mL) (496 mg, 3.67 mmol) was degassed and purged 3 times with _N2 , and then the mixture was stirred at 25 °C under _N2 atmosphere for 3 h. LCMS indicated the desired product. The reaction mixture was quenched by adding H ₂ O (10 mL) and extracted with DCM (10 mL × 2). The combined organics were extracted with 10% citric acid (20 mL). The aqueous phase was neutralized with saturated _NaHCO solution and re-extracted with DCM (10 mL x 2). The organics were dried over sodium sulfate, filtered and concentrated under reduced pressure to give compound Va as a white solid (570 mg, 0.281 mmol, 26.8% yield). ¹ H NMR: (400 MHz, CDCl ₃ ) ppm δ 7.84 - 8.12 (m, 3 H), 6.85 - 7.15 (m, 2 H), 6.66 - 6.81 (m, 1 H), 5.36 (br d, J = 2.7 Hz, 3 H), 5.11 - 5.27 (m, 3 H), 4.63 - 4.85 (m, 3 H), 3.90 - 4.25 (m, 18 H), 3.37 - 3.75 (m, 28 H), 3.15 - 3.28 (m, 4 H), 2.64 (br d, J = 6.53 Hz, 2 H), 2.30 - 2.46 (m, 2 H), 2.13 - 2.18 (m, 9 H), 2.05 (s, 9 H), 1.94 - 2.03 (m, 18 H), 1.68 (br s, 2 H), 1.45 (br s, 2 H), 1.12 (br t, J = 7.0 Hz, 2 H).

To a solution of compound Va (260 mg, 0.161 mmol) in anhydrous DCM (5 mL) was added tetrazole diisopropylammonium (30.3 mg, 0.177 mmol); then ₃ -bis(diisopropylammonium) was added dropwise at ambient temperature and N Isopropylamino)phosphonyloxypropionitrile (194 mg, 0.645 mmol). The reaction mixture was stirred at 20 to 25°C for 2 hours. LCMS showed that compound Va was completely consumed. After cooling to -20°C, the reaction mixture was added to a stirred brine/saturated NaHCO ₃ (1:1, 5 mL) solution at 0°C. After stirring for 1 minute, DCM (5 mL) was added. Stratification occurs. The organic layer was washed with brine/saturated _aqueous NaHCO solution (1 _: 1, 5 mL), dried over _Na2SO4 , filtered and concentrated to a volume of approximately 1 mL. The remaining solution was added dropwise to 20 mL of methyl tert-butyl ether (MTBE) while stirring. This resulted in the precipitation of a white solid. The mixture was centrifuged and the solids were collected. The solid was redissolved in 1 mL DCM and precipitated by adding MTBE (20 mL). The solid was separated again by centrifugation. The collected solid was dissolved in anhydrous _CH3CN . Remove volatiles. This process was repeated two more times to obtain the GalNAc ligand phosphoramidite compound GLPA1 (153 mg, 84.4 μmol) as a white solid. 1H NMR (400 MHz, CDCl ₃ ): ppm δ 7.71 - 8.06 (m, 2 H), 6.60 - 7.06 (m, 3 H), 5.37 (br d, J = 3.0 Hz, 3 H), 5.18 - 5.32 ( m, 3 H), 4.70 - 4.86 (m, 3 H), 3.92 - 4.25 (m, 18 H), 3.42 - 3.85 (m, 30 H), 3.25 (m, 4 H), 2.59 - 2.75 (m, 4 H), 2.27 - 2.44 (m, 2 H), 2.15 - 2.20 (s, 9 H) 2.07 (s, 9 H), 1.96 - 2.03 (m, 18 H), 1.65 (br s, 4 H), 1.44 (br d, J = 7.28 Hz, 2 H), 1.14 - 1.24 (m, 12 H). 31P NMR (CDCl ₃ ): ppm δ 147.15.

The GalNAc ligand phosphoramidite compound GLPA2 was synthesized using the same procedure except that Intermediate-B was used. 1H NMR (400 MHz, CDCl ₃ ): ppm δ 7.94 - 8.18 (m, 1 H), 7.69 (br s , 1 H), 6.66 - 7.10 (m, 3 H), 5.35 (d, J = 3.5 Hz, 3 H), 5.07 - 5.25 (m, 3 H), 4.76 - 4.86 (m, 3 H), 4.01 - 4.31 (m, 10 H), 3.91 - 4.01 (m, 8 H), 3.74 - 3.86 (m, 4 H), 3.52 - 3.71 (m, 30 H), 3.42 - 3.50 (m, 6 H), 3.15 - 3.25 (m, 4 H), 2.52 - 2.70 (m, 4 H), 2.22 - 2.45 (m, 2 H), 2.15 - 2.22 (s, 9 H), 2.06 (s, 9 H), 1.95 - 2.03 ( m, 18 H), 1.77 (br s, 2 H), 1.58-1.66 (m, 4 H), 1.40 (m, 2 H), 1.08-1.24 (m, 12 H). 31P NMR (CDCl ₃ ): ppm δ 147.12.

Prepare GLPA15 following Scheme 3 below.

To a solution of intermediate compound II (275 g, 660 mmol, 1.00 equivalents (eq)) in dichloromethane (2.75 L) was added triethylamine (133 g, 1.32 mol, 2.00 eq.), and then Cbz-Cl was added dropwise. (169 g, 990 mmol, 1.50 eq.). The reaction solution was stirred at 25°C for 2 hours, and LCMS showed that compound II was completely converted. The reaction solution was washed with a saturated solution of NaHCO ₃ (800 mL) and saturated brine (500 mL) in sequence, and the organic phase was dried over anhydrous Na ₂ SO ₄ . After filtering to remove the desiccant, the filtrate was concentrated to dryness. The crude product was subjected to column chromatography (SiO ₂ , PE/EA=100/1 to 5/1) to obtain colorless oily compound III-1 (290 g, 527 mmol, yield 75.7%). ¹ H NMR (400 MHz in DMSO-d6): δ ppm 7.23 - 7.40 (m, 5 H), 5.00 - 5.12 (m, 2 H), 3.86 - 3.95 (m, 2 H), 3.23 - 3.39 (m, 6 H), 2.55 - 2.67 (m, 2 H), 1.56 - 1.64 (m, 2 H), 1.31 - 1.46 (m, 27 H). MS (ESI) [M+H] ⁺ m/z: 551.6.

HCOOH (2.9 L) was added to compound III-1 (145 g, 263 mmol, 1.00 eq ), and the solution was stirred at 60 °C for 12 hours. LCMS showed that compound III-1 was completely converted. Add 1.5 L toluene and 1.5 L acetonitrile to the reaction solution, concentrate under reduced pressure to about 500 mL, then add toluene/acetonitrile (1:1, ~750 mL) and concentrate to about 500 mL, then add acetonitrile (~1000 mL) And concentrated to dryness, the crude product was pulverized with 700 mL acetonitrile at 60°C for 2 hours and filtered. The solid was collected and dried to obtain compound IV-1 as a white solid (105 g, quantitative). 1H NMR (400 MHz in DMSO-d6): δ ppm 7.26 - 7.40 (m, 5H), 5.02 - 5.10 (m, 2H), 3.89 - 4.00 (m, 2H), 3.36 - 3.45 (m, 4H), 3.24 - 3.34 (m, 2H), 2.59 - 2.72 (m, 2H), 1.40 (s, 2H). MS (ESI) [M+H] ⁺ m/z: 383.0.

To a solution of compound IV-1 (100 g, 261 mmol . ) and Intermediate-A (502 g, 915. mmol, 3.50 eq. ) in DMF (1.0 L) was added TBTU (327 g, 1.02 mol, 3.90 eq. ), triethylamine (212 g, 2.09 mol, 8.00 eq. ), the reaction was carried out at 25°C for 1 hour, and LCMS showed that the conversion of compound IV-1 was completed. The reaction solution was added to 4000 mL of water, and extracted with methyl tert-butyl ether (2000 mL twice) to remove impurities. The remaining aqueous phase was extracted with dichloromethane (3000 mL twice). The dichloromethane phase was washed successively with 10% citric acid aqueous solution (2000 mL divided into two times), saturated NaHCO ₃ (2.0 L divided into two times), saturated brine (2.0 L), and dried over anhydrous Na ₂ SO ₄ . The filtrate was filtered and concentrated under reduced pressure to obtain compound V-1 as a white solid (260 g, 159 mmol, yield 60.9%). ¹ H NMR (400 MHz in DMSO-d6): δ ppm 7.99 - 8.08 (m, 2 H), 7.93 (br d, J=5.50 Hz, 1 H), 7.79 - 7.86 (m, 3 H), 7.26 - 7.39 (m, 5 H), 5.22 (d, J=3.13 Hz, 3 H), 4.95 - 5.08 (m, 5 H), 4.54 (br d, J=8.38 Hz, 3 H), 4.03 (s, 9 H), 3.81 - 3.93 (m, 5 H), 3.76 (br d, J=4.88 Hz, 3 H), 3.44 - 3.62 (m, 10 H), 3.34 - 3.43 (m, 6 H), 3.24 (br d, J=6.13 Hz, 7 H), 3.02 - 3.09 (m, 4 H), 2.40 - 2.47 (m, 2 H), 2.10 (s, 9 H), 1.99 (s, 9 H), 1.89 (s , 9 H), 1.77 (s, 9 H), 1.57 - 1.68 (m, 2 H). MS (ESI) [M+H] ⁺ m/z: 816.4.

Inert the 2 L hydrogenation kettle with argon and carefully add dry Pd/C (9 g), add MeOH (50 mL) to moisten the Pd/C, and then slowly add compound V-1 (90 g, 55.1 mmol, 1.00 eq. ) and trifluoroacetic acid (6.29 g, 55.1 mmol, 1.00 eq. ) in MeOH (850 mL). The mixture was replaced with hydrogen atmosphere by degassing/adding H ₂ three times, and stirred at 25°C for 10 hours. LCMS showed that compound V-1 was completely converted. Pd/C was removed by filtration, and the filtrate was concentrated under reduced pressure to obtain compound VI-1 (80 g, yield 90.2%). ¹ H NMR (400 MHz in DMSO-d6): δ ppm 9.12 (br s, 2 H), 8.50 (br t, J=5.19 Hz, 1 H), 8.10 (br t, J=5.50 Hz, 2 H), 7.85 - 7.91 (m, 3 H), 5.22 (d, J=3.25 Hz, 3 H), 4.95 - 5.01 (m, 3 H), 4.52 - 4.58 (m, 3 H), 4.03 (s, 9 H), 3.84 - 3.93 (m, 3 H), 3.75 - 3.83 (m, 3 H), 3.39 - 3.61 (m, 16 H), 3.23 - 3.32 (m, 6 H), 3.15 - 3.18 (m, 3 H), 2.97 - 3.05 (m, 2 H), 2.54 - 2.61 (m, 2 H), 2.10 (s, 9 H), 2.00 (s, 9 H), 1.89 (s, 9 H), 1.77 - 1.80 (m, 9 H), 1.70 - 1.76 (m, 2 H) . MS (ESI) [M+H] ⁺ m/z: 749.3.

To a solution of compound VI-1 (270 g, 168 mmol, 1.00 eq. ) and glutaric anhydride (28.6 g, 252 mmol, 1.50 eq. ) in dichloromethane (2.7 L) was added triethylamine (67.8 g, 672 mmol , 4.00 eq ), the solution was stirred at 25°C for 1 hour, and LCMS showed that compound VI-1 was completely converted into compound VII. 4-Hydroxypyridine (42.4 g, 420 mmol, 2.50 eq. ) and TBTU (107 g, 335 mmol, 2.00 eq. ) were added to the reaction solution, and stirring was continued at 25°C for 1 hour. LCMS showed complete conversion of compound VII. The reaction was quenched by slowly adding saturated NH ₄ Cl (3.0 L), the layers were separated, and the aqueous phase was extracted with dichloromethane (2 x 1000 mL) and combined with the previous organic phase. The combined organic phases were washed with a 1:1 mixture of saturated NaHCO ₃ (aq) and saturated brine (3.0 L), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure. The crude product was dissolved in 1.5 L of methylene chloride and added dropwise to methyl tert-butyl ether (7.5 L). A translucent white precipitate gradually formed during the dropping process. The precipitate was filtered under vacuum, and the solid was collected and dried under vacuum to obtain compound VIII as a white solid (207 g, yield 72.8%). ¹ H NMR (400 MHz in DMSO-d6): δ ppm 8.05 (br d, J=2.00 Hz, 2 H), 7.82 (br d, J=7.38 Hz, 3 H), 5.21 (br s, 3 H) , 4.98 (br d, J=10.26 Hz, 3 H), 4.72 (br s, 1 H), 4.54 (br d, J=7.88 Hz, 3 H), 4.03 (br s, 9 H), 3.74 - 3.94 (m, 9 H), 3.45 - 3.71 (m, 12 H), 3.40 (br s, 6 H), 3.24 (br s, 7 H), 3.07 (br d, J=14.13 Hz, 5 H), 2.91 - 3.01 (m, 1 H), 2.24 - 2.44 (m, 5 H), 2.20 (br s, 1 H), 2.10 (s, 9 H), 1.96 - 2.04 (m, 9 H), 1.89 (br s , 9 H), 1.74 - 1.81 (m, 9 H), 1.51 - 1.73 (m, 6 H), 1.07 - 1.36 (m, 3 H). MS (ESI) [M+H] ⁺ m/z: 848.0 .

To a solution of compound VIII (200 g, 118 mmol, 1.00 eq. ) and tetrazole diisopropylammonium (8.08 g, 47.2 mmol, 0.40 eq. ) in dichloromethane (2.0 L) was added 3-bis(diisopropyl ammonium) (53.3 g, 177 mmol, 1.50 eq.), the reaction solution was stirred at 40°C for 2 hours, and LCMS showed that the conversion of compound VIII was completed. The reaction solution was washed with a 1:1 mixture of saturated NaHCO ₃ and saturated brine (2.0 L), dried over anhydrous Na ₂ SO ₄ , and the filtrate was concentrated. The crude product obtained was dissolved in dichloromethane (1.2 L) and added dropwise to the stirring solution. Filter the suspension in methyl tert-butyl ether (6.0 L), rinse the filter cake with methyl tert-butyl ether, collect the solid and dry it under vacuum, dissolve the product in dichloromethane (1.0 L) and concentrate to dryness. Repeat the operation 4 times to remove residual tert-butyl ether to obtain GLPA15 (164 g, yield 73.3%). ¹ H NMR (400 MHz in DMSO-d6): δ ppm 8.05 (br d, J = 6.50 Hz, 2 H) , 7.81 (br d, J=9.01 Hz, 3 H), 5.22 (d, J=3.25 Hz, 3 H), 4.98 (dd, J=11.26, 3.25 Hz, 3 H), 4.55 (br d, J= 8.50 Hz, 3 H), 4.03 (s, 9 H), 3.64 - 3.97 (m, 12 H), 3.55 - 3.63 (m, 6 H), 3.50 (br s, 5 H), 3.40 (br d, J =6.13 Hz, 6 H), 3.17 - 3.30 (m, 9 H), 3.07 (br d, J=14.26 Hz, 4 H), 2.76 (t, J=5.82 Hz, 2 H), 2.18 - 2.47 (m , 6 H), 2.10 (s, 9 H), 1.99 (s, 9 H), 1.89 (s, 9 H), 1.78 (s, 9 H), 1.52 - 1.74 (m, 6 H), 1.12 - 1.19 (m, 12 H). 31P NMR (DMSO-d6): ppm δ 145.25. MS (ESI) [M+H] ⁺ m/z: 1895.7.

In some studies, methods are provided for attaching a targeting group containing GalNAc (also referred to herein as a GalNAc delivery compound) to the 5'-end of the sense strand, which involves the last coupling in the solid phase synthesis Steps using GalNAc phosphoramidite (e.g. GLPA1) are linked using a synthetic process such as that used in oligonucleotide chain extension (i.e. adding nucleotides to the 5' end of the sense strand). to the 5'-end of the sense strand.

In some studies, methods to attach a GalNAc-containing targeting group to the 3'-end of the sense strand include the use of a GLO-n-containing solid support (CPG). In some studies, methods to connect a GalNAc-containing targeting group to the 3'-end of the sense strand include: connecting the GalNAc targeting group to a CPG solid support via an ester bond and using it when synthesizing the sense strand. The resulting CPG has a GalNAc targeting group attached, which results in the GalNAc targeting group being attached to the 3'-end of the sense strand. Other GalNAc phosphoramidite compounds (GLPAn) can also be obtained using methods similar to this article or well-known in the art after using reasonably corresponding intermediates, and can be connected to the appropriate position of the siRNA duplex as a targeting group. Example 4. Synthesis of isomannitol phosphoramidite (compound 2 )

DMTrCl (232 g, 684 mmol, 1.0 equiv) in pyridine (400 mL) was added to a solution of Compound A isomannitol (100 g, 684 mmol, 1.0 equiv) in pyridine (600 mL). The mixture was stirred at 25°C for 16 hours. LC-MS showed that compound A was completely consumed and a main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 ml), extracted with dichloromethane (500 ml* ₂ ), the combined organic phases were washed with brine (500 ml), dried over _Na2SO4 and concentrated in vacuo to obtain the residue things. The residue was purified by column chromatography (DCM/MeOH=100/1 to 50/1, 0.1% Et ₃ N) to obtain compound B (150 g, yield 48.9%) as a yellow solid. ¹ H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63 Hz, 2 H) 7.28 - 7.37 (m, 6 H) 7.19 - 7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4 H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 - 4.09 (m, 6 H) 3.88 - 3.96 (m, 2 H) 3.83 (br dd, J= 7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1 H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1H).

To a solution of compound B (80.0 g, 178 mmol, 1.0 equiv) in dichloromethane (5.0 mL) under _N2 atmosphere, 2H-tetrazole (0.45 M, 436 mL, 1.1 equiv), then add dropwise compound C (2-cyanoethyldiisopropylphosphoramidite chloride, 80.6 g, 267 mmol, 85.0 ml, 1.5 equiv) in dichloromethane (200 ml) solution; the reaction mixture was stirred at 25°C for 1.0 hours; LC-MS showed that compound B was completely consumed, and a main peak with the desired mass was detected. Cool the resulting reaction mixture to -20°C and pour into ice-cold saturated NaHCO ₃ (500 ml), extract with dichloromethane (500 ml * 3), and combine the organic layers with NaHCO ₃ /brine = 1:1 (3 00 ml _/ 300 ml), dried over _Na2SO4 , and concentrated in vacuo (35 °C) to obtain a residue (100 ml). The residue was purified by column chromatography (Al ₂ O ₃ , DCM/MeOH=100/1 to 50/1, 0.1% Et ₃ N) to obtain compound 2 (77 g, 119 mmol, yield 66.5%) as white solid.

1H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6)

δ ppm 7.22 (br d, J=7.50 Hz, 2 H) 7.05 - 7.14 (m, 6 H) 6.96 - 7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81 Hz, 4 H) 3.95 - 4.07 (m, 2 H) 3.73 - 3.83 (m, 1 H) 3.62 - 3.72 (m, 2 H) 3.48 - 3.53 (m, 6 H) 3.27 - 3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 - 2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 - 1.00 (m, 13 H).

Other phosphoramidite compounds can be prepared according to methods well known to those skilled in the art, such as but not limited to the methods in the prior art US426,220 and WO02/36743. Example 5. Preparation of solid carrier containing isomannitol monomer Represents the macroporous amine methyl polyethylene resin carrier part.

Place a 50 L glass kettle under nitrogen protection. Add methylene chloride (19.50kg) into the glass kettle and start stirring. Control the temperature at 20~30°C, add DMTr-imann (1.47 kg) to the glass kettle, add triethylamine (1.50 kg), 4-dimethylaminopyridine (0.164 kg) to the reaction kettle, and add succinic anhydride ( 1.34 kg). The system was kept at 20~30°C for 18 hours and then samples were taken to end the reaction. Add saturated sodium bicarbonate solution (22.50 kg) to the reaction system, stir for 10 to 20 minutes and then let it stand until the layers separate. Separate the lower organic phase. Extract the upper aqueous phase twice with dichloromethane. Combine the organic phases and use anhydrous Dry over sodium sulfate, filter the filtrate, and then transfer to a rotary evaporator and concentrate until there is no fraction, forming a solid gray to off-white solid of 1.83 kg.

Add N,N-dimethylformamide (23.50 kg) to the 100L glass kettle and start stirring. Control the temperature at 20~30°C and under nitrogen protection, add the product of the previous step, O-benzotriazole-tetramethylurea hexafluorophosphate (0.33 kg) into the above 100L glass kettle through a solid addition funnel, and add N, N-Diisopropylethylamine (0.13kg), after adding, stir for 10 to 30 minutes and then release into a 50 L galvanized bucket for later use. Add macroporous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Hecheng Technology Co., Ltd., batch number HA2X1209, loading capacity 0.48mmol/g) into the above 100 L solid phase synthesis kettle through the solid addition funnel, and control the temperature at 20~ 30°C, add N,N-dimethylformamide (21.00kg+21.00 kg) to the solid-phase synthesis kettle, and the reaction solution in the galvanized barrel from the previous step. The system was kept warm and reacted until the solid loading was ≥250umol/g. The loading detection method was UV. The system was filtered with nitrogen pressure, the filter cake was rinsed three times with N,N-dimethylformamide (26.00kg+26.10kg+26.00 kg), and the filter cake was left in the kettle. Add CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40kg+4.42kg+4.30kg) and CAP.B (20% pyridine and 30% N-methylimidazole and 50% acetonitrile, 4.40) to the 80L glass kettle. kg+4.40kg+4.47kg), stir for 3~8 minutes and set aside. Repeat this operation three times for capping, add acetonitrile (18.00 kg+18.00 kg+18.00 kg +17.50 kg+17.50 kg) to the solid-phase synthesis kettle, bubble nitrogen for 10 to 30 minutes and then press filter. Repeat this operation four times. The filter cake is purged with nitrogen in the solid phase synthesis kettle for 2 to 4 hours and then transferred to a 50 L pressure filter tank. The temperature is controlled at 15 to 30°C and continues to dry. The dried yellow to white solid product , Weight: 3.516 kg.

The isomannitol residue (imann) can be added to the 5' end or 3' end of the oligonucleotide chain through methods well known to those skilled in the art, such as the same process as reverse abasic (invab), and Further targeting groups are added. Example 6. In vitro screening of xanthine dehydrogenase ( XDH ) siRNA duplexes

CAL27 cells were trypsinized and adjusted to an appropriate density, then seeded into a 24-well plate at 1 × 10 ⁵ cells/well. While inoculating, cells were transfected with siRNA to be tested or control siRNA using Lipofectamine RNAiMax (Invitrogen -13778-150) at 2 μL per well. Nonsense control-2 (CON) and test siRNA were tested at two concentrations (0.2 nM and 5 nM). Wells transfected with nonsense control-2(CON) siRNA were also used as negative controls.

Twenty-four hours after transfection, the medium was removed and cells were harvested for RNA extraction. Total RNA was extracted using TRIzol™ Reagent (Invitrogen - 15596018) according to the manual.

cDNA was synthesized using PrimeScript™ RT Reagent Kit and gDNA Eraser (Perfect Real Time) (TaKaRa-RR047A) according to the manual. Detection of xanthine dehydrogenase (XDH) cDNA by qPCR. GAPDH cDNA was detected in parallel as an internal control. PCR was performed as follows: 95°C for 30 seconds, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds. data analysis

The expression of the target gene in each sample was determined by relative quantification (RQ) using the comparative Ct (ΔΔCt) method; this method measures the Ct difference (ΔCt) between the target gene and a housekeeping gene (ACTIN).

The equations are listed below: ΔCT = average Ct of target gene – average Ct of ACTIN; ΔΔCT=ΔCT (sample) –ΔCT (nonsense siRNA control); Relative quantification of target gene mRNA = 2-ΔΔCT; Inhibition % = (relative quantification of control – relative quantification of sample)/relative quantification of control × 100%.

Table 4 provides experimental results from in vitro studies using various XDH RNAi reagents to inhibit XDH expression; the double-stranded sequences used correspond to the compounds shown in Table 2.

Table 4 Experimental results of in vitro studies using XDH RNAi reagents to inhibit XDH expression Duplex ID Average inhibition % 0.2 nM SD 5 nM SD AV00206 25.1 6.1 25.1 6.7 AV00207 51.7 3.5 33.4 7.8 AV00208 19.6 5.9 3.1 6.4 AV00209 10.8 2.8 -19.3 9.0 AV00210 20.5 7.3 20.2 5.6 AV00211 22.0 6.7 42.2 11.9 AV00212 18.1 6.7 3.6 4.0 AV00213 45.5 8.9 67.1 6.3 AV00214 21.0 6.5 38.5 5.4 AV00215 47.6 2.0 57.3 6.7 AV00216 42.9 1.4 30.3 7.4 AV00217 47.2 5.1 57.3 3.5 AV00218 19.3 4.2 40.2 4.4 AV00219 32.5 3.7 49.0 0.3 AV00220 39.4 2.9 67.7 1.8 AV00221 45.5 3.2 72.3 5.1 AV00222 33.8 1.2 20.9 3.1 AV00223 48.0 2.4 61.1 5.7 AV00224 38.5 7.3 41.7 1.2 AV00225 63.7 2.1 67.4 1.8 AV00226 36.5 4.6 63.1 4.5 AV00227 93.1 2.3 95.8 0.3 AV00228 50.9 1.8 69.0 1.1 AV00229 56.5 1.9 65.0 3.1 AV00230 53.4 4.3 63.5 6.4 AV00231 32.1 0.9 50.8 6.7 AV00232 35.2 2.1 62.2 1.8 AV00233 65.7 2.3 83.8 2.0 AV00234 9.5 2.8 28.1 4.1 AV00235 18.4 3.7 42.3 0.1 AV00236 50.7 2.2 61.5 3.1 AV00237 54.2 4.9 64.0 3.4 AV00238 66.9 6.3 74.1 2.2 AV00239 10.2 11.1 11.9 3.0 AV00240 -8.9 8.2 -5.9 11.3 AV00241 34.9 2.8 42.6 2.7 AV00242 34.2 6.4 48.0 4.6 AV00243 38.4 4.6 52.4 4.3 AV00244 32.8 5.1 43.0 1.2 AV00245 53.9 1.7 60.4 3.3 AV00246 35.6 3.8 50.0 1.2 AV00247 30.3 19.5 65.7 5.7 AV00248 41.2 9.2 49.2 8.7 AV00249 66.7 4.3 74.4 0.7 AV00250 56.6 9.6 55.9 3.6 AV00251 8.4 9.3 -4.1 8.4 AV00252 40.4 5.1 46.3 3.0 AV00253 34.7 3.5 34.0 1.9 AV00254 33.8 8.4 39.1 5.1 AV00255 22.1 5.2 18.3 10.1 AV00256 30.4 1.7 50.4 5.9 AV00257 26.0 3.7 43.4 5.6 AV00258 9.5 3.7 8.8 2.7 AV00259 30.6 3.6 51.4 0.6 AV00260 73.4 3.9 76.8 4.3 AV00261 44.8 5.6 59.2 1.7 AV00262 44.7 4.2 51.8 3.1 AV00263 58.3 3.9 66.6 2.2 AV00264 24.1 6.9 35.3 4.9 AV00265 29.7 4.2 34.9 10.4 AV00266 68.0 1.1 80.2 1.1 AV00267 29.0 0.5 46.4 5.0 AV00268 35.1 3.2 59.1 2.6 AV00269 36.3 2.1 66.1 2.0 AV00270 32.1 6.2 56.5 9.3 AV00271 43.9 4.4 63.5 3.2 AV00272 59.4 2.8 64.1 0.8 AV00273 63.5 0.5 78.3 2.5 AV00274 54.3 1.9 72.1 3.5 AV00275 56.0 1.6 70.3 2.0 AV00276 38.8 4.8 68.1 3.0 AV00277 50.2 3.3 54.4 3.4 AV00278 34.0 4.7 42.5 4.2 AV00279 46.3 3.3 51.6 7.2 AV00280 67.4 0.1 82.4 1.3 AV00281 51.9 5.4 60.5 2.5 AV00282 42.7 3.3 61.6 1.9 AV00283 59.8 4.5 87.9 1.1 AV00284 32.1 3.9 35.8 5.9 AV00285 69.2 2.4 78.5 2.3 AV00286 40.6 3.6 49.0 7.9 AV00287 52.8 3.0 60.0 3.0 AV00288 56.6 2.8 61.0 4.6 AV00289 66.5 2.1 83.1 2.9 AV00290 45.0 6.7 72.9 3.8 AV00291 43.6 1.1 69.0 2.8 AV00292 39.8 6.4 69.5 4.6 Example 7. In vivo testing of xanthine dehydrogenase ( XDH ) siRNA duplexes

To evaluate the in vivo activity of xanthine dehydrogenase (XDH) siRNA, mice infected with AAV encoding human xanthine dehydrogenase (XDH) and luciferase genes were used (4 mice per group). Fourteen days before siRNA administration, female C57BL/6J mice were intravenously injected with 1x10^11 or 2x10^11 viral particles of adeno-associated virus 8 encoding human xanthine dehydrogenase (XDH) and luciferase genes ( AAV8) vector stock solution for infection. On day 0, mice were injected subcutaneously with a single dose of 3 mg/kg, 6 mg/kg, or 9 mg/kg xanthine dehydrogenase (XDH) siRNA reagent or PBS. Blood samples were collected before siRNA administration on day 0 and at the end of days 7 and 14. Measure luciferase activity. By comparing the luciferase activity of blood samples before administration in the siRNA-treated group and the luciferase activity of blood samples collected on days 7 and 14 and normalized based on the luciferase activity changes in serum samples from the PBS-treated group , to calculate the knockdown percentage.

Example 7 uses compounds corresponding to the sequence, chemical modification, and delivery shown in Table 3, GLO-n in Jayaprakash, et al., (2014) J. Am. Chem. Soc., 136, 16958-16961 Delivery compounds represented by GalNAc3.

XDH siRNA single 3 mpk subcutaneous dose screening in AAV-XDH-luciferase transduced mice. The luciferase activity of the pre-dose blood sample (day 0) of the siRNA-treated group was compared with the luciferase activity of the blood sample collected on day 7 and normalized based on the change in luciferase activity in the serum sample from the PBS-treated group to calculate percent knockdown. The data are listed in Table 5.

Table 5 XDH siRNA single 3 mpk subcutaneous dose screening in AAV-XDH-luciferase transduced mice Duplex ID Percent reduction in luciferase activity AD00352 24.2% AD00353 58.9% AD00354 34.5% AD00355 28.2% AD00356 44.2% AD00357 37.1% AD00358 49.2% AD00359 40.8% AD00360 33.4% AD00361 18.9% AD00362 23.4% AD00363 36.6%

XDH siRNA single 6 mpk subcutaneous dose screening in AAV-XDH-luciferase transduced mice. The luciferase activity of the pre-dose blood sample (day 0) of the siRNA-treated group was compared with the luciferase activity of the blood sample collected on day 7 and normalized based on the change in luciferase activity in the serum sample from the PBS-treated group to calculate percent knockdown. The two experimental data are listed in Table 6 and Table 7 respectively.

Table 6 XDH siRNA single 6 mpk subcutaneous dose screening in AAV-XDH-luciferase transduced mice Duplex ID Percent reduction in luciferase activity AD00364 65.4% AD00365 57.9% AD00366 50.0% AD00367 37.8% AD00368 55.6% AD00369 3.7% AD00370 55.6% AD00371 8.9% AD00372 48.0% AD00373 32.6% AD00374 23.4%

Table 7 XDH siRNA single 6 mpk subcutaneous dose screening in AAV-XDH-luciferase transduced mice Compound Percent reduction of luciferase activity AD00421 37.5% AD00429 53.0% AD00430 66.8% AD00431 66.0% AD00432 74.5%

XDH siRNA single 9 mpk subcutaneous dose screening in AAV-XDH-luciferase transduced mice. The luciferase activity of the pre-dose blood sample (day 0) of the siRNA-treated group was compared with the luciferase activity of the blood sample collected on day 14 and normalized based on the change in luciferase activity in the serum sample from the PBS-treated group. to calculate percent knockdown. The data are listed in Table 8.

Table 8 XDH siRNA single 9 mpk subcutaneous dose screening in AAV-XDH-luciferase transduced mice Duplex ID Percent reduction in luciferase activity AD00364 86.0% AD00365 74.3% AD00366 81.0% AD00368 58.3% AD00370 68.3% AD00430 59.8% AD00431 73.5% AD00432 55.5% Example 8. In vivo testing of xanthine dehydrogenase ( XDH ) siRNA duplexes

In order to evaluate the in vivo activity of siRNA, a total of 18 male cynomolgus monkeys (13-22 years old, weighing 7-9 kg) were selected in this study, with 3 animals in each group. Each animal was given a subcutaneous injection of 7.5 mg/kg test product. , the test samples used correspond to the compounds shown in the table below.

After fasting overnight, the animals were anesthetized (ketamine, SC, 10 mg/kg) on D-14, D21, D42, and D78, and ultrasonic-guided biopsy was used to obtain about 10 mg of liver samples, which were stored in RNAlater ( After the samples were fixed at 4°C overnight, they were transferred to -80°C for storage) for subsequent RT-qPCR detection. The results are shown in Table 9.

Table 9 Remaining percentage of XDH mRNA in monkey liver measured by qPCR Duplex ID Percentage remaining relative to baseline (mean ± SD) Day 21 Day 42 Day 78 AD00521-1 0.31±0.05 0.33±0.08 0.39±0.25 AD00364-1 0.35±0.04 0.35±0.04 0.27±0.03 AD00365-2 0.29±0.06 0.32±0.02 0.35±0.14 AD00366-1 0.37±0.03 0.25±0.08 0.39±0.02 AD00432-1 0.54±0.03 0.62±0.07 0.56±0.00 equivalent

Although several embodiments of the invention have been described and illustrated herein, those of ordinary skill in the art will readily appreciate that various other methods may be used to perform the functions described herein and/or to obtain the results and/or one or more advantages. Each of these changes and/or modifications, means and/or structure, and such changes and/or modifications are deemed to be within the scope of the invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are exemplary and that actual parameters, dimensions, materials, and/or configurations will depend on the specific use of the teachings of the present invention. Application. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is to be understood, therefore, that the foregoing embodiments are presented by way of example only and within the scope of the appended claims and their equivalents, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material and/or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials and/or methods is also included in the invention provided that such features, systems, articles, materials and/or methods are not inconsistent with each other. within the range.

All definitions, as defined and used herein, should be understood against dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.

Where a quantitative limitation is not used in the description and patent application, it shall be understood as "at least one" unless explicitly stated to the contrary.

The phrase "and/or" as used in the specification and claims should be understood to mean "one or both" of the elements so combined that such elements appear in combination in some cases and separately in other cases. . In addition to elements specifically identified by "and/or", other elements may optionally be present, whether related or unrelated to those specifically identified elements, unless expressly stated to the contrary.

All references, patents and patent applications and publications cited or referenced in this application are hereby incorporated by reference in their entirety.

without

without

without.

Claims (69)

A double-stranded ribonucleic acid (dsRNA) reagent for inhibiting the expression of xanthine dehydrogenase (XDH), wherein the dsRNA reagent includes a sense strand and an antisense strand, and nucleotides 2 to 18 in the antisense strand contains a region complementary to the xanthine dehydrogenase (XDH) gene RNA transcript, where the complementary region contains a region that differs by 0, 1, 2, or 3 nuclei from one of the antisense sequences listed in one of Tables 1-3 at least 15 contiguous nucleotides of the nucleotide, and optionally includes a targeting ligand. The dsRNA reagent of claim 1, wherein the region complementary to the xanthine dehydrogenase (XDH) gene RNA transcript includes at least 15, 16, 17, 18 or 19 consecutive nucleotides, which are consistent with Table 1 Any antisense sequence listed in one of -3 differs by no more than 3 nucleotides. The dsRNA reagent of claim 1 or 2, wherein the antisense strand of the dsRNA is at least substantially complementary to any target region in SEQ ID NO: 1, and is provided in any one of Tables 1-3. The dsRNA reagent of claim 3, wherein the antisense strand of the dsRNA is completely complementary to any target region in SEQ ID NO: 1 and is provided in any one of Tables 1-3. The dsRNA reagent according to claim 1, wherein the dsRNA reagent includes the sense strand sequence described in any one of Tables 1-3, wherein the sense strand sequence is at least substantially the same as the antisense strand sequence in the dsRNA reagent. complement each other. The dsRNA reagent according to claim 1, wherein the dsRNA reagent includes the sense strand sequence described in any one of Tables 1-3, wherein the sense strand sequence is completely complementary to the antisense strand sequence in the dsRNA reagent. . The dsRNA reagent according to claim 1, wherein the dsRNA reagent contains the antisense strand sequence listed in any one of Tables 1-3. The dsRNA reagent of claim 1, wherein the dsRNA reagent includes a sequence listed as a duplex sequence in any one of Tables 1-3. The dsRNA reagent of claim 1, wherein the dsRNA reagent contains at least one modified nucleotide. The dsRNA reagent of claim 1, wherein all or substantially all nucleotides in the antisense strand are modified nucleotides. The dsRNA reagent of claim 9 or 10, wherein the at least one modified nucleotide includes: 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide , 2'3'-seco nucleotide mimics, locked nucleotides, open nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), 2'-F-arabinose nucleotides, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, reverse nucleotide, reverse abasic nucleotide, reverse 2'-OMe nucleotide, reverse 2 '-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide and 3'-OMe nucleotide, containing 5'-phosphorothioate group group of nucleotides, or terminal nucleotides linked to cholesterol derivatives or dodecyl dodecylamide groups, 2'-amino modified nucleotides, phosphoramidates, or non-nucleotide-containing nucleotides. Natural base. The dsRNA reagent of claim 9 or 10, wherein E-vinyl phosphonate nucleotide is included at the 5' end of the guide strand. The dsRNA reagent of claim 1, wherein the dsRNA reagent contains at least one phosphorothioate internucleoside linkage. The dsRNA reagent of claim 1, wherein the sense strand comprises at least one phosphorothioate internucleoside linkage. The dsRNA reagent of claim 1, wherein the antisense strand comprises at least one phosphorothioate internucleoside linkage. The dsRNA reagent of claim 1, wherein the sense strand comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages. The dsRNA reagent of claim 1, wherein the antisense strand comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages. The dsRNA reagent of claim 1, wherein all or substantially all nucleotides of the sense strand and antisense strand are modified nucleotides. The dsRNA reagent of claim 1, wherein the modified sense strand is a modified sense strand sequence listed in one of Tables 2-3. The dsRNA reagent of claim 1, wherein the modified antisense strand is a modified antisense strand sequence listed in one of Tables 2-3. The dsRNA reagent of claim 1, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the length of the complementary region is 16 to 23 nucleotides. The dsRNA reagent of claim 21, wherein the length of the complementary region is 19 to 21 nucleotides. The dsRNA reagent as described in claim 1, wherein the length of each strand is no more than 30 nucleotides. The dsRNA reagent of claim 1, wherein the length of each strand is no more than 25 nucleotides. The dsRNA reagent of claim 1, wherein the length of each strand is no more than 23 nucleotides. The dsRNA reagent of claim 1, wherein the dsRNA reagent contains at least one modified nucleotide, and further contains one or more targeting groups or linking groups. The dsRNA reagent of claim 26, wherein the one or more targeting groups or linking groups are conjugated to the sense strand. The dsRNA reagent of claim 26 or 27, wherein the targeting group or linking group includes N-acetyl-galactosamine (GalNAc). The dsRNA reagent according to claim 28, wherein the targeting group or linking group has a structure represented by formula (X), including a targeting moiety, a linking bond and a linker W, wherein the targeting moiety is selected from N- Acetyl-galactosamine derivative (GalNAc), which is linked to the linker W through a linking bond, the linker W has a structure shown in formula (XI), X is selected from O, NH ₂ or S, Y ^- is selected from: O ^﹣ , S ^﹣ , methyl or NR _a R _b , R _a and R _b are independently selected from hydrogen, substituted or unsubstituted C ₁ -C ₆ alkyl, substituted or unsubstituted C ₃ -C ₆ cycloalkyl, or R _a and R _b are linked together with the attached atoms to form a 3-12 membered heterocycloalkyl group containing 1-3 N, O, S heteroatoms, preferably substituted or unsubstituted C ₁ -C ₆ alkyl group, substituted or unsubstituted C ₃ -C ₆ cycloalkyl group, the substituent is selected from hydroxyl group and amino group; Formula (X) (Formula XI). The dsRNA reagent of claim 29, wherein the link in the targeting group is selected from polyethylene glycol, substituted or unsubstituted C ₂ -C ₁₂ alkyl, substituted or unsubstituted C ₃ -C ₁₂ ring Alkyl, substituted or unsubstituted C ₃ -C ₁₂ heterocycloalkyl, substituted or unsubstituted C ₃ -C ₁₂ amide. The dsRNA reagent of claim 30, wherein the substituted or unsubstituted C ₂ -C ₁₂ alkyl, substituted or unsubstituted C ₃ -C ₁₂ cycloalkyl, substituted or unsubstituted C ₃ -C ₁₂ In heterocycloalkyl, substituted or unsubstituted C ₃ -C ₁₂ amide, the substituent is selected from hydroxyl and carbonyl. The dsRNA reagent according to claim 30, wherein the linking bond in the targeting group is preferably from the following fragments: , , , , , and , where each m is independently an integer from 1 to 6, each n, o, p is independently 0 or 1, and each q ¹ and q ² are independently 0, 1 or 2. The dsRNA reagent as claimed in claim 32, wherein the linking bond in the targeting group is more preferably from the following fragments: , , , , , . The dsRNA reagent as described in claim 29, wherein the targeting part in the targeting group has the following structural fragment, n' is 1 or 2. The dsRNA reagent as described in claim 29, wherein X is selected from O or S, and Y ^- is selected from: O ^- or S ^- . The dsRNA reagent according to claim 26 or 27, wherein the targeting group has the following structure: GLO-1 GLS-1 GLO-2 GLS-2 GLO-3 GLS-3 GLO-4 GLS-4 GLO-5 GLS-5 GLO-6 GLS-6 GLO-7 GLS-7 GLO-8 GLS-8 GLO-9 GLS-9 GLO-10 GLS-10 GLO-11 GLS-11 GLO-12 GLS-12 GLO-13 GLS-13 GLO-14 GLS-14 GLO-15 GLS-15 GLO-16 GLS-16. The dsRNA reagent according to any one of claims 1-36, wherein the dsRNA reagent comprises a targeting group conjugated to the 5'-end of the sense strand. The dsRNA reagent according to any one of claims 1-36, wherein the dsRNA reagent comprises a targeting group conjugated to the 3'-end of the sense strand. The dsRNA reagent according to any one of claims 1-38, wherein the antisense strand contains a reverse abasic residue at the 3'-end. The dsRNA reagent according to any one of claims 1-38, wherein the sense strand contains one or two reverse abasic residues at the 3' or/and 5' end, and/or, the sense strand is at 3 The ' and/or 5' end each independently contains one or two isomannitol residues, preferably the isomannitol residue imann. The dsRNA reagent according to any one of claims 1-40, wherein the dsRNA reagent has two blunt ends. The dsRNA reagent according to any one of claims 1-40, wherein at least one strand includes a 3' overhang of at least 1 nucleotide. The dsRNA reagent according to any one of claims 1-40, wherein at least one strand includes a 3' overhang of at least 2 nucleotides. The dsRNA reagent according to any one of claims 1-43, wherein the sense strand has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide overhang. A double-stranded ribonucleic acid (dsRNA) reagent that inhibits xanthine dehydrogenase (XDH) expression, wherein the dsRNA reagent contains a sense strand and an antisense strand, wherein the length of each strand is 14 to 30 nucleotides, A region complementary to the xanthine dehydrogenase (XDH) gene RNA transcript is included at nucleotide positions 2 to 18 in the antisense strand, wherein the complementary region includes a double-stranded ribonucleic acid (dsRNA) listed in Formula I ) one of the reagent antisense sequences differs by at least 15 consecutive nucleotides by 0, 1, 2 or 3 nucleotides, and optionally includes a targeting ligand, the double-stranded ribonucleic acid (dsRNA) reagent antisense sequence The sense chain is as described in formula I: 5'-Na -(A ₁ A ₂ A ₃ A ₄ )i-Nb –(B ₁ B ₂ B ₃ B ₄ ) -Nb -(C ₁ C ₂ C ₃ C ₄ C ₅ ) j -Na - 3' (Formula I) wherein: i and j are each independently selected from 0 or 1; each Na and _{N b independently} represent 0-17 oligonucleotides, and the oligonucleotide The acid is optionally chemically modified; preferably, the chemical modification is selected from 2'-OMe or 2'-fluoro modification; A ₁ A ₂ A ₃ A ₄ represents four consecutive nucleotides represented in turn by lowercase 2' -OMe, upper case 2'-fluoro, lower case 2'-OMe, lower case 2'-OMe - a motif modified, preferably between A ₁ and A ₂ , and between A ₂ and A ₃ further include phosphorothioate Internucleoside linkage; B ₁ B ₂ B ₃ B ₄ represents a motif in which four consecutive nucleotides are modified by one uppercase 2'-fluoro and three consecutive lowercase 2'-OMe; C ₁ C ₂ C ₃ C ₄ C ₅ represents a motif in which five consecutive nucleotides are all modified with lowercase 2'-OMe, preferably between C ₃ and C ₄ , and between C ₄ and C ₅ , further containing phosphorothioate Ester internucleoside linkage. The dsRNA reagent as described in claim 45, wherein _Na each independently represents 0 oligonucleotides, N _b each independently represents 2-5 chemically modified oligonucleotides, and i and j each independently represent 1; The chemical modification is selected from 2'-OMe or 2'-fluorine. The formula (I) described in any one of claims 45-46 is characterized in that it is further represented by formula (II): 5’-xYxxxxYxxxxYxYxYxxxxx- 3’ (Formula II) Wherein, x represents a lowercase 2'-OMe modified oligonucleotide, and Y represents an uppercase 2'-fluorine modified oligonucleotide. Preferably, x and Y and/or x and x further contain a phosphorothioate core. Interglycoside linkage. The dsRNA reagent according to any one of claims 45-47, wherein the antisense strand of the dsRNA is at least substantially complementary to any target region of SEQ ID NO: 1. The dsRNA reagent according to any one of claims 45-47, wherein the antisense strand of dsRNA is completely complementary to any target region of SEQ ID NO: 1. The dsRNA reagent according to any one of claims 45-47, wherein the sense strand sequence of any one of the dsRNA is at least substantially complementary to the antisense strand sequence in the dsRNA reagent. The dsRNA reagent according to any one of claims 45-47, wherein the sense strand sequence of any one of the dsRNA is completely complementary to the antisense strand sequence in the dsRNA reagent. The dsRNA reagent according to any one of claims 45-47, wherein the dsRNA sense strand contains one or two reverse abasic residues at the 3' or/and 5' end, and/or the sense strand is at The 3' and/or 5' end each independently contains one or two isomannitol residues, preferably the isomannitol residue imann. The dsRNA reagent according to any one of claims 45-47, wherein the dsRNA has two blunt ends. The dsRNA reagent according to any one of claims 45-47, wherein the dsRNA sense strand has a 1, 2, 3, 4, 5, 6, 7, 8 at the 3'-end and/or 5'-end , 9, or 10 nucleotide overhangs. A composition comprising the dsRNA agent of any one of claims 1 to 54. The composition of claim 55, further comprising a pharmaceutically acceptable carrier. The composition of any one of claims 55-56, further comprising one or more additional therapeutic agents. The composition of any one of claims 55-57, wherein the composition is packaged in a kit, container, wrapper, dispenser, prefilled syringe or vial. The composition of any one of claims 55-57, wherein the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration. A cell comprising the dsRNA agent of any one of claims 1 to 54. The cell of claim 60, wherein the cell is a mammalian cell, optionally a human cell. A method for inhibiting xanthine dehydrogenase (XDH) gene expression in cells, comprising: (i) Preparing cells comprising an effective amount of the double-stranded ribonucleic acid (dsRNA) agent as described in any one of claims 1 to 54 or the composition as described in any one of claims 55 to 59; (ii) Maintain the cells prepared in (i) for a sufficient period of time to obtain degradation of the mRNA transcript of the xanthine dehydrogenase (XDH) gene, thereby inhibiting the expression of the xanthine dehydrogenase (XDH) gene in the cells . The method of claim 62, wherein the cells are in a subject and the dsRNA agent is administered subcutaneously to the subject. A method of treating a disease or condition associated with xanthine dehydrogenase (XDH) protein, wherein the method comprises administering to a subject an effective amount of the double-stranded ribonucleic acid (dsRNA) of any one of claims 1 to 54 ) reagent or the composition according to any one of claims 55 to 59, to inhibit xanthine dehydrogenase (XDH) gene expression. The method of claim 64, wherein the disease or condition is associated with xanthine dehydrogenase (XDH) expression, and the disease is selected from one or more of the following: hyperuricemia, gout, non-alcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), metabolic disorders, insulin resistance, cardiovascular disease, type 2 diabetes, Lesch Nyhan syndrome, glycogen storage disease (GSD), and diseases related to oxidative stress or other XDH-related diseases; preferably, the glycogen storage disease (GSD) is selected from type I GSD, and the disease related to oxidative stress is selected from chronic low-grade inflammation. The method of any one of claims 64-65, wherein said method reduces serum uric acid levels. The method of any one of claims 64-65, further comprising administering an additional treatment regimen to the subject. The method of claim 67, wherein the additional treatment regimen includes administering to the subject one or more xanthine dehydrogenase (XDH) antisense polynucleotides or administering to the subject a non-xanthine dehydrogenase (XDH) antisense polynucleotide. Purine dehydrogenase (XDH) dsRNA therapeutic. The method of claim 68, wherein the non-xanthine dehydrogenase (XDH) dsRNA therapeutic agent is selected from one or more of the following: allopurinol, hydroxypurine, febuxostat or interleukin-1β (IL -1β) antagonist, preferably, the interleukin-1β antagonist is selected from canakinumab or rilonacept.