TW202315951A - Methods and kits for detecting severe acute respiratory syndrome coronavirus 2 - Google Patents

Abstract

Disclosed herein is a kit including at least one of five primer sets for use in the detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Also disclosed herein is a method for the detection of the presence of SARS-CoV-2 in a biological sample using at least one of the primer sets.

Description

Method and kit for detecting severe acute respiratory syndrome coronavirus type 2

The invention relates to a kit for detecting severe acute respiratory syndrome coronavirus 2 (Severe acute respiratory syndrome coronavirus 2, SARS-CoV-2). The present invention also relates to a method for detecting SARS-CoV-2 present in a biological sample using the kit.

Since the end of 2019, the outbreak of respiratory infection (respiratory infection) in the world has been named as coronavirus disease 2019 (coronavirus disease 2019, COVID-19) by the World Health Organization (WHO). The infectious disease caused by coronavirus, and the International Committee on Taxonomy of Viruses (ICTV) has designated the scientific name of this virus as severe acute respiratory syndrome coronavirus type 2 (Severe acute respiratory syndrome coronavirus 2, SARS-CoV-2).

SARS-CoV-2 is a positive-sense single-stranded RNA virus belonging to the Betacoronavirus genus of the Coronaviridae family. The genome of SARS-CoV-2 has 6 to 11 open reading frames (ORFs) located between the 5' and 3' flanking untranslated regions (UTRs) [5' and 3' flanking untranslated regions (UTRs)] ), in which there are two main transcriptional units, ORF1a and ORF1ab, which encode replicase polyprotein 1a (polyprotein 1a, PP1a) and polyprotein 1ab (polyprotein 1ab, PP1ab), respectively. The largest polyprotein, PP1ab, is cleaved into 16 nonstructural proteins (nsp) involved in transcription and viral replication (ie, Nsp1 to Nsp16). The remaining ORFs encode four major structural proteins, namely spike protein (S), envelope protein (E), membrane protein (Membrane protein) and nucleosheath protein (nucleocapsid protein) (N).

In SARS-CoV-2-infected COVID-19 patients, the main observed symptoms were respiratory symptoms, such as fever above 38°C, cough, shortness of breath, and dyspnea. In addition, symptoms such as loss of smell and taste, diarrhea, headache, chills, loss of appetite, general malaise, and impaired consciousness may be observed. Only through the observation of symptoms, it is not easy to communicate with other respiratory viruses. separated. In particular, more than 20% of COVID-19 patients are asymptomatic carriers of potential transmission sources, which is undoubtedly a major challenge to prevent the large-scale epidemic of COVID-19.

Nowadays, many molecular techniques (molecular techniques) have been used to detect SARS-CoV-2, including: reverse transcription-polymerase chain reaction (reverse transcription-polymerase chain reaction, RT-PCR), real-time quantitative RT-PCR (real- time quantitative RT-PCR, real-time qRT-PCR) and reverse transcription loop-mediated isothermal amplification (reverse transcription loop-mediated isothermal amplification, RT-LAMP), etc. For example, in Huang WE et al. (2020), Microb. Biotechnol. , 13:950-961, Huang WE et al. designed 4 sets of primers based on the N gene, S gene and orf1ab gene of SARS-CoV-2 (primer sets) N1, N15, S17 and O117 (each set includes 6 primers), and these primer sets are applied to RT-LAMP analysis for detecting SARS-CoV-2 in clinical samples.

Although the above-mentioned literature reports exist, relevant researchers in this field are still working hard to find more satisfactory nucleic acid molecules for the rapid and accurate detection of SARS-CoV-2.

Summary of the invention

Thus, in a first aspect, the present invention provides a method for the detection of severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) present in a biological sample, which reduces at least one of the disadvantages of the prior art . The method includes: subjecting nucleic acid in the biological sample to a nucleic acid amplification reaction using a reaction mixture comprising at least one primer set for amplifying a target nucleic acid of SARS-CoV-2; and detecting whether there is an amplification product obtained from the nucleic acid amplification reaction, wherein the presence of the amplification product indicates the presence of SARS-CoV-2 in the biological sample; Wherein the at least one primer set is selected from the group consisting of: (a) a first primer set for amplifying a region in the nsp2 gene of SARS-CoV-2, which comprises a first front-to-outside with a nucleotide sequence as shown in SEQUENCE IDENTIFICATION NO.: 1 primer, and a first reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 2; (b) a second primer set for amplifying a region in the nsp2 gene of SARS-CoV-2, which comprises a second forward outer portion having a nucleotide sequence as shown in Sequence Identification number: 7 primer, and a second reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 8; (c) a third primer set for amplifying a region in the nsp4 gene of SARS-CoV-2, which comprises a third front-to-outside with a nucleotide sequence as shown in Sequence Identification number: 13 primer, and a third reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 14; (d) a fourth primer set for amplifying a region in the nsp4 gene of SARS-CoV-2, which comprises a fourth forward outer portion having a nucleotide sequence as shown in Sequence Identification number: 19 primer, and a fourth reverse external primer having a nucleotide sequence as shown in Sequence Identification Number: 20; and (e) a fifth primer set for amplifying a region in the S gene of SARS-CoV-2, which comprises a fifth front-to-outside with a nucleotide sequence as shown in Sequence Identification number: 25 primer, and a fifth reverse external primer having a nucleotide sequence as shown in Sequence Identification Number: 26.

In a second aspect, the present invention provides a kit for the detection of SARS-CoV-2 which reduces at least one of the disadvantages of the prior art. The set includes at least one of the above-mentioned primer sets for amplifying a target nucleic acid of SARS-CoV-2.

Detailed Description of the Invention

It is to be understood that if any prior publication is cited herein, that prior publication does not constitute an acknowledgment that, in Taiwan or any other country, that prior publication forms a common practice in the art part of knowledge.

For the purposes of this specification, it will be clearly understood that the word "comprising" means "including but not limited to", and that the word "comprises" has a corresponding meaning.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Of course, the invention is in no way limited by the methods and materials described. For clarity, the following definitions are used herein.

As used herein, terms such as "nucleic acid", "nucleic acid sequence" and "nucleotide sequence" mean a sequence of nucleotides linked by phosphodiester linkages, and may be A deoxyribonucleotide (DNA) molecule or ribonucleotide (RNA) molecule in single- or double-stranded form. The nucleic acid may comprise naturally occurring nucleotides and their known analogues, as well as nucleotides modified at the sugar and/or phosphate moieties. The term also encompasses nucleic acids containing modified backbone residues or linkages, synthetic, naturally occurring and non-naturally occurring, which have the same properties as the reference nucleic acid. similar binding properties, and the nucleic acids are metabolized in a manner similar to the reference nucleotide. As used herein, the term "nucleic acid" is used interchangeably with the terms "gene", "cDNA", "mRNA", "oligo-nucleotide" and "polynucleotide" .

As used herein, the term "DNA fragment" means a DNA polymer (DNA polymer), which is in the form of a separate segment (separate segment) or as a larger DNA construct (DNA construct), which may be derived from isolated DNA or synthesized chemically or enzymatically, such as by methods disclosed elsewhere.

Unless otherwise indicated, a nucleic acid sequence, in addition to the specific sequence disclosed herein, also encompasses its complementary sequences (complementary sequences), as well as their conservative analogs (conservative analogs), related naturally occurring structural variants and and/or synthetic non-naturally occurring analogs.

Unless otherwise indicated, whenever a nucleic acid sequence is indicated, it will be understood that the nucleotides are in 5' to 3' order from left to right, and "A" means deoxyadenosine (deoxyadenosine) or Analogs, "C" for deoxycytidine or its analogs, "G" for deoxyguanosine or its analogs, and "T" for deoxythymidine or its analogs things.

The term "3'" means that a region or position in a polynucleotide or oligonucleotide is closer than another region or position in the same polynucleotide or oligonucleotide. 3' [ie, downstream]. The term "5'" means that a region or position in a polynucleotide or oligonucleotide is more 5' than another region or position in the same polynucleotide or oligonucleotide [i.e. , upstream]. The terms "3'-end (3'-end)" and "3'-terminus" as used herein for a nucleic acid molecule mean the end of the nucleic acid comprising a five-carbon The free hydroxyl group on the 3' carbon of a sugar (terminal pentose sugar). The terms "5'-end (5'-end)" and "5'-terminus" as used herein for a nucleic acid molecule mean the end of the nucleic acid comprising a five-carbon The free hydroxyl or phosphate group on the 5' carbon of a sugar.

As used herein, the term "primer" means an oligonucleotide of defined sequence, which is designed to be complementary to a target polynucleotide sequence (target polynucleotide sequence). The primer-specific portion is hybridized and subjected to primer extension. The primer can serve as the initiation point for enzymatic polymerization of nucleotides using a polymerase. The length of the primer should be sufficient to prevent itself from annealing to sequences other than the complementary portion. Typically, the primer is between 13 and 50 nucleotides in length. Preferably, the length of the primer is between 15 and 30 nucleotides.

The primers used herein can also be used in nucleic acid amplification. As used herein, the term "amplification" may mean the number of copies of a target sequence (such as a gene or a fragment of a gene) or a complementary sequence of the target sequence One increase. A "copy" or "amplicon" does not necessarily imply perfect complementarity or identity to a template sequence. For example, copies may include nucleotide analogs such as deoxyinosine, intentional sequence alterations (such as those introduced via a primer that includes a hybridizable but not complementary to the template), and/or sequence errors that occur during the amplification reaction. The products of an amplification reaction are called amplification products.

The nucleic acid amplification reaction can be carried out using any method known in the art, for example, a method using multiple heat cycles during the amplification reaction, or a method at a constant temperature (constant temperature) The method performed [ie, isothermal amplification]. An example of an in vitro amplification reaction ( in vitro amplification) that requires thermal cycling is the polymerase chain reaction (polymerase chain reaction, PCR), wherein a sample (such as a biological sample from an individual) and a pair of oligonuclear The nucleotide primers are contacted under conditions that allow the primers to hybridize to a nucleic acid molecule in the sample. The primers are extended under suitable conditions, dissociated from the template, then re-annealed, extended and dissociated to amplify the number of copies of the nucleic acid molecule. Another example of an in vitro amplification reaction technique includes, but is not limited to: quantitative polymerase chain reaction (qPCR), reverse transcription-polymerase chain reaction (RT-PCR), reverse transcription-polymerase chain reaction (qPCR), Transcription quantitative polymerase chain reaction (reverse transcription-quantitative polymerase chain reaction, RT-qPCR), nested polymerase chain reaction (nested polymerase chain reaction, nested PCR), hot-start polymerase chain reaction (hot-start polymerase chain reaction, hot-start PCR), multiplex polymerase chain reaction (multiplex polymerase chain reaction, multiplex PCR), ligase chain reaction (ligase chain reaction, LCR), gap ligase chain reaction (gap ligase chain reaction, gLCR), etc.

In another aspect, an isothermal amplification reaction can be performed at a constant temperature, or the amplification reaction process occurs substantially at a constant temperature, ie, without significant temperature changes. Thus, substantially performed at about the same single temperature. In some examples, an isothermal amplification reaction is isothermal in nature, eg, can include slight temperature changes, such as no more than about 1°C to 3°C during the amplification reaction.

As used herein, the terms "target sequence" and "target nucleic acid" are used interchangeably and mean a specific nucleic acid sequence that is detected and/or amplified. Preferably, the target sequence includes a nucleic acid sequence that hybridizes to the primer in a PCR reaction. The target sequence may also include a probe hybridizing region, which will form a stable hybrid with a detection probe under desired conditions. A target sequence may be single-stranded or double-stranded, as will be recognized by those of ordinary skill in the art. In the present disclosure, the target sequence of interest may be in the nsp2 gene, nsp4 gene or S gene of SARS-CoV-2.

As used herein, the terms "hybridization" and "annealing" are used interchangeably and mean the reaction of mutually complementary strands of nucleic acid to form a "hybrid" or "double helix ( duplex)" which is stabilized via hydrogen bonds between the bases of the nucleotide residues. Hydrogen bonding can occur by Watson Crick base pairing, Hoogsteen binding, or any other sequence-specific means.

As used herein, the terms "hybrid" and "duplex" are used interchangeably and mean a structure formed by the hybridization of two nucleic acids of complementary sequence. This double helix can be formed by the complementary binding of two DNA segments to each other, the complementary binding of two RNA segments to each other, or the complementary binding of a DNA segment to an RNA segment. Either or both members of the duplex may include modified nucleotides and/or nucleotide analogs and nucleoside analogues. As disclosed herein, such duplexes are formed by the binding of one or more probes to a sample sequence.

The present invention provides a method for detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) present in a biological sample, comprising: subjecting nucleic acid in the biological sample to a nucleic acid reaction using a reaction mixture Amplification reaction, the reaction mixture includes at least one primer set (primer set) for amplifying a target nucleic acid of SARS-CoV-2; and detecting whether there is an amplification product obtained from the nucleic acid amplification reaction, wherein the The presence of the amplification product indicates the presence of SARS-CoV-2 in the biological sample; wherein the at least one primer set is selected from the group consisting of: (a) a first primer set for amplifying a region in the nsp2 gene of SARS-CoV-2, which comprises a first front-to-outside with a nucleotide sequence as shown in SEQUENCE IDENTIFICATION NO.: 1 primer, and a first reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 2; (b) a second primer set for amplifying a region in the nsp2 gene of SARS-CoV-2, which comprises a second forward outer portion having a nucleotide sequence as shown in Sequence Identification Number: 7 primer, and a second reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 8; (c) a third primer set for amplifying a region in the nsp4 gene of SARS-CoV-2, which comprises a third front-to-outside with a nucleotide sequence as shown in Sequence Identification number: 13 primer, and a third reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 14; (d) a fourth primer set for amplifying a region in the nsp4 gene of SARS-CoV-2, which comprises a fourth forward outer portion having a nucleotide sequence as shown in Sequence Identification number: 19 primer, and a fourth reverse external primer having a nucleotide sequence as shown in Sequence Identification Number: 20; and (e) a fifth primer set for amplifying a region in the S gene of SARS-CoV-2, which comprises a fifth front-to-outside with a nucleotide sequence as shown in Sequence Identification number: 25 primer, and a fifth reverse external primer having a nucleotide sequence as shown in Sequence Identification Number: 26.

According to the present invention, the nucleic acid (for example, viral genome RNA of SARS-CoV-2) in the sample can be extracted from the sample first, and then the amplification reaction is carried out. The operating procedures and conditions for nucleic acid extraction are within the expertise and routine skill of those skilled in the art, see, for example, Huang WE et al. (2020) (supra).

According to the present invention, the nucleic acid amplification reaction can be carried out by using at least one of the following methodologies: polymerase chain reaction (PCR), quantitative polymerase chain reaction (qPCR), reverse transcription polymerase chain reaction (RT- PCR), reverse transcription quantitative polymerase chain reaction (RT-qPCR), nested polymerase chain reaction (nested PCR), hot-start polymerase chain reaction (hot-start PCR), multiplex polymerase chain reaction (multiplex PCR), In situ polymerase chain reaction (in situ polymerase chain reaction, in situ PCR), single cell polymerase chain reaction (single cell polymerase chain reaction), touchdown polymerase chain reaction (touchdown polymerase chain reaction), ligase chain reaction (LCR ), gap ligase chain reaction (gLCR) and isothermal amplification.

In some embodiments, the nucleic acid amplification reaction is an isothermal amplification reaction using any of the various natural or genetically engineered enzymes available for this purpose, for example, using strong strand-displacement reactions under isothermal conditions DNA polymerase with strand-displacement activity, thereby eliminating the need for thermal cycling. Such polymerases are well known in the art and may include thermophilic bacteria [such as Bacillus stearothermophilus (Bst), Bacillus smithii (Bsm), Geobacillus The DNA polymerase long fragment (long fragment, LF) of Bacillus sp. M ( Geobacillus sp. M) (GspM) and Indian thermodesulfatator indicus (Tin)], and the engineered variants derived therefrom (engineered variants), like Taq DNA polymerase variants. Non-limiting examples of polymerases that can be used to perform the methods disclosed herein include Bst DNA polymerase (Bst DNA polymerase), Bst 2.0 DNA polymerase (Bst 2.0 DNA polymerase), Bst 2.0 WarmStart™ DNA polymerase (Bst 2.0 WarmStart™ DNA polymerase) (New England Biolabs, Ipswich, Mass.), GspM LF DNA polymerase (GspM LF DNA polymerase), GspSSD LF DNA polymerase (GspSSD LF DNA polymerase), Tin exo-LF DNA polymerase (Tin exo-LF DNA polymerase) and SD DNA polymerase (SD DNA polymerase), Phi29 DNA polymerase (Phi29 DNA polymerase), Bsu DNA polymerase (Bsu DNA polymerase), OmniAmp™ DNA polymerase (OmniAmp™ DNA polymerase) (Lucigen , Middleton, Mich.), Taq DNA polymerase (Taq DNA polymerase), Vent ^® and Deep Vent ^® DNA polymerases (Vent ^® and Deep Vent ^® DNA polymerases) (New England Biolabs), 9°Nm™ DNA polymerase ( 9°Nm™ DNA polymerase) (New England Biolabs), Klenow fragment of DNA polymerase I, PhiPRD1 DNA polymerase (PhiPRD1 DNA polymerase), phage M2 DNA polymerase (phage M2 DNA polymerase), T4 DNA polymerase (T4 DNA polymerase), and T5 DNA polymerase (T5 DNA polymerase), which are commonly used at 50-75°C, more commonly at 55 to 65°C. In some examples, about 1 to 20 U (such as about 1 to 15 U, about 2 to 12 U, about 10 to 20 U, about 2 to 10 U, or about 5 to 10 U) of DNA polymerase is included in Reacting. In some examples, the polymerase used has strand-displacing activity and lacks 5'-3' exonuclease activity. In a non-limiting example, the DNA polymerase used is Bst 2.0 WarmStart™ DNA polymerase, eg, about 8 U of Bst 2.0 WarmStart™ DNA polymerase per reaction.

Examples of such isothermal amplification reactions may include, but are not limited to: strand-displacement amplification (SDA), rolling-circle amplification (RCA), cross-primer amplification Cross-priming amplification (CPA), nucleic acid sequence-based amplification (NASBA), recombinase polymerase amplification (RPA), helicase-dependent Helicase-dependent amplification (HDA), transcription-mediated amplification, loop-mediated amplification (LAMP), and competitive binding-mediated isothermal amplification Reaction (competitive annealing mediated isothermal amplification, CAMP).

When the nucleic acid to be amplified or detected is RNA, a reverse transcription is performed prior to the isothermal amplification reaction of the target sequence. Reverse transcription can be performed using any suitable reverse transcriptase (RT). RTs are well known in the art and may include, but are not limited to, Avian Myeloblastosis Virus (AMV) RT and Moloney Murine Leukemia virus (MMLV) RT. Reverse transcription and DNA amplification reactions can be performed in the same reaction mixture containing functional DNA polymerase and RT enzymes. In addition, the method disclosed in the present invention can use a DNA polymerase having both strong displacement activity and RT activity, such as Pyrophage 3173 DNA polymerase (Pyrophage 3173 DNA polymerase).

In some embodiments, the nucleic acid amplification reaction is carried out by RT-LAMP or real-time qRT-LAMP (real-time qRT-LAMP). Since no denaturation reaction (denaturation) of the DNA template is required, these types LAMP can be carried out under isothermal conditions (for example, within the range of 60°C to 67°C), and the reaction temperature can be adjusted depending on the type of enzyme. For example, the reaction temperature of Bst 2.0 DNA polymerase is within 60°C ℃ to 65℃, while the reaction temperature of Pyrophage 3173 DNA polymerase can be higher.

The principle of LAMP is revealed in T. Notomi et al. (2000), Nucleic acids research , 28:E63. Briefly, the reaction is via a pair of "loop-forming" primers (i.e., a forward inner primer (FIP) and a backward inner primer (BIP)]. Adhesion and extension reactions (extension) are initiated, followed by a pair of flanking primers (ie, forward outer primer (F3) and reverse outer primer (B3)] for bonding and elongation reactions. The extension reaction of these primers causes strand-displacement of the loop-forming elements, which fold to form terminal hairpin-loop structures. Once these key structures are present, the amplification reaction process becomes self-sufficient and proceeds in a continuous and exponential fashion (rather than in a cyclic fashion like PCR) at a constant temperature. Optionally, an additional pair of loop primers [ie, forward loop primer (LF) and backward loop primer (LB)] can be included to speed up the reaction.

In some embodiments, the first primer set for LAMP analysis includes the first forward and reverse external primers, and a first front primer having a nucleotide sequence as shown in Sequence Identification Number: 3 Inward internal primer and a first reverse internal primer having a nucleotide sequence as shown in Sequence Identification number: 4. The first primer set may further comprise one of the following: a first forward loop primer having a nucleotide sequence as shown in Sequence Identification Number: 5, a primer having a nucleotide sequence as shown in Sequence Identification Number: 6 The first reverse loop primer of the nucleotide sequence, and their combination, in order to accelerate the reaction of LAMP.

In some embodiments, the second primer set for LAMP analysis comprises the second forward and reverse outer primers, and a second front primer having a nucleotide sequence as shown in SEQUENCE IDENTIFICATION NO.: 9 Inward internal primer and a second reverse internal primer having a nucleotide sequence as shown in Sequence Identification number: 10. The second primer set may further include one of the following: a second forward loop primer having a nucleotide sequence as shown in Sequence Identification Number: 11, a primer having a nucleotide sequence as shown in Sequence Identification Number: 12 The second reverse loop primer of the nucleotide sequence, and their combination, so as to accelerate the reaction of LAMP.

In some embodiments, the third primer set for LAMP analysis includes the third forward and reverse external primers, and a third front primer having a nucleotide sequence as shown in Sequence Identification Number: 15 The inner primer and a third reverse inner primer having a nucleotide sequence as shown in Sequence Identification Number: 16. The third primer set may further include one of the following: a third forward loop primer having a nucleotide sequence as shown in Sequence Identification Number: 17, a primer having a nucleotide sequence as shown in Sequence Identification Number: 18 The third reverse loop primer of the nucleotide sequence, and their combination, so as to accelerate the reaction of LAMP.

In some embodiments, the fourth primer set for LAMP analysis includes the fourth forward and reverse external primers, and a fourth front primer having a nucleotide sequence as shown in Sequence Identification Number: 21 Inward internal primer and a fourth reverse internal primer having a nucleotide sequence as shown in Sequence Identification Number: 22. The fourth primer set may further comprise one of the following: a fourth forward loop primer having a nucleotide sequence as shown in Sequence Identification Number: 23, a primer having a nucleotide sequence as shown in Sequence Identification Number: 24 The fourth reverse loop primer of the nucleotide sequence, and their combination, so as to accelerate the reaction of LAMP.

In some embodiments, the fifth primer set for LAMP analysis comprises the fifth forward and reverse external primers, and a fifth front primer having a nucleotide sequence as shown in Sequence Identification Number: 27 The internal primer and a fifth reverse internal primer having a nucleotide sequence as shown in Sequence Identification Number: 28. The fifth primer set may further comprise one of the following: a fifth forward loop primer having a nucleotide sequence as shown in Sequence Identification Number: 29, a primer having a nucleotide sequence as shown in Sequence Identification Number: 30 The fifth reverse loop primer of the nucleotide sequence, and their combination, so as to accelerate the reaction of LAMP.

According to the present invention, the at least one primer set further includes a sixth primer set for amplifying a region in the S gene of SARS-CoV-2, and the sixth primer set includes a primer set with a sequence identification number: 31 A sixth forward outer primer with the nucleotide sequence shown, and a sixth reverse outer primer with a nucleotide sequence as shown in Sequence Identification Number: 32.

In some embodiments, the sixth primer set for LAMP analysis comprises the sixth forward and reverse external primers, and a sixth pre-primer having a nucleotide sequence as shown in Sequence Identification Number: 33 The internal primer and a sixth reverse internal primer having a nucleotide sequence as shown in Sequence Identification Number: 34. The sixth primer set may further include one of the following: a sixth forward loop primer having a nucleotide sequence as shown in Sequence Identification Number: 35, a primer having a nucleotide sequence as shown in Sequence Identification Number: 36 The sixth reverse loop primer of the nucleotide sequence, and their combination, so as to accelerate the reaction of LAMP.

In some embodiments, the reaction mixture for LAMP further includes a suitable buffer (such as phosphate buffer or Tris buffer). The buffer may also include additional components such as potassium and/or sodium salts (such as KCl or NaCl), magnesium and/or manganese salts (e.g., MgCl ₂ , MgSO ₄ , MnC ₁₂ , and/or or MnSO ₄ ), and/or ammonium salts [for example, (NH ₄ ) ₂ SO ₄ )], detergents (detergents) (for example, TWEEN ^® -20, TRITON ^® -X100), or other additives [such as betaine (betaine) or dimethylsulfoxide (dimethylsulfoxide)]. One skilled in the art can use routine methods to select an appropriate buffer and any additives. In a non-limiting example, the buffer (pH 8.6) contains 50 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 0.1% TWEEN ^® -20, 4 mM MgSO ₄ , and 0.8 M betaine. Exemplary commercially available reaction buffers include 1× Isothermal Amplification Buffer (New England Biolabs, Ipswich, Mass.), LoopAmp Reaction Mix (LoopAmp Reaction Mix) (Eiken Chemical Co. ., Ltd., Tokyo, Japan), and ILLUMIGENE reaction buffer (ILLUMIGENE reaction buffer) (Meridian Bioscience, Inc., Cincinnati, Ohio). The reaction mixture also contains nucleotides or nucleotide analogs. In some embodiments, an equimolar mixture of dATP, dCTP, dGTP, and dTTP (referred to as dNTPs) is included.

In some embodiments, a detectable label (detectable label) can be attached or combined to the primer(s) according to the present invention using techniques well known to those skilled in the art to quantitatively detect the target SARS-CoV- 2. Examples of detectable labels suitable for use in the present invention include, but are not limited to: a hapten label, such as biotin and digoxigenin; a chemiluminescent label , for example, acridinium esters, thioesters, orsulfonamides, luminols, isoluminols, phenanthridinium esters, and the like; A fluorescent label, for example, fluorescein, rhodamine, FAM, TET, HEX, JOE, TAMA, NTB, TAMRA, ROX, VIC, NED, cyanin ) dye, Texas Red (Texas Red), DABCYL, DABSYL, malachite green (malachite green), AlexaFluor dye, LC-Red dye, PromoFluor dye, and their derivatives; a radioactive label (radioactive label), for example, ³ H , ¹²⁵ I, ³⁵ S, ¹⁴ C, or ³² P; an enzyme label (enzymatic label), for example, horseradish catalase (horse radish peroxidase), alkaline phosphatase (alkaline phosphatase), and the like; A particle label, such as gold colloids, quantum dots, etc.; and a colorimetric label, such as colored glass or plastic beads beads) [eg, polystyrene, polypropylene, latex, etc.].

According to the present invention, by adding at least one nucleotide residue on the 5' and/or 3' ends of the primers, or by deleting at least one nucleoside from the 5' and/or 3' ends of the primers acid residues so that the primers can be modified to have a length of 15 to 35 nucleotides.

According to the present invention, the amplification product can be detected using at least one of the various methods well known in the art which can be used for this purpose. For example, the detection method may be turbidity measurement, fluorescence detection, bioluminescence detection, gel electrophoresis, colorimetric detection, Immunoenzymatic detection, electrochemical detection, and combinations thereof. The detection can be semi-quantitative or quantitative. The detection can also be a real-time detection, which measures the signal generated by the presence of the amplification product during the nucleic acid amplification reaction to monitor the accumulation of specific amplification products.

When the amplification reaction (such as LAMP) produces large amounts of magnesium pyrophosphate (a white precipitate) with dsDNA, a turbidity measurement can be used, which allows visual inspection of the results or using a nephelometer (turbidimeter).

The fluorescent detection can use DNA intercalating dyes, fluorescent molecular beacon probes or a fluorescent metal indicator (such as calcein).

The bioluminescent detection can be done by measuring the coupled conversion of inorganic pyrophosphate generated stoichiometrically during the synthesis of nucleic acid to ATP using the enzyme ATP sulfurylase. ) of bioluminescent output (bioluminescent output).

The colorimetric detection can use a colored indicator for alkaline metal ions, such as hydroxy naphthol blue (HNB) [see Goto et al . (2009), BioTechniques , 46(3):167-72] and/or a pH indicator having the ability of significant color change within the pH range of 7.5±1.1, such as phenol red (phenol red) (pH 6.8-8.2), neutral Neutral red (pH 6.8-8.0), cresol red (pH 7.2-8.8), etc.

The electrochemical detection can use a pH meter (pH meter) to directly measure the hydrogen ions released during the amplification reaction (such as LAMP), or use integrated electrodes (integrated electrodes) to measure the A decrease in current resulting from increased binding of electrochemically-active DNA-binding redox reporters (such as methylene blue) to amplified products.

The immunoenzyme assays include enzyme-linked immunosorbent assays (ELISA) and lateral flow immunoassays based on the use of specific probes [see, e.g., Hashimoto M. et al . (2018) , Malar J., 17(1):235; Sun Yu-Ling et al . (2014), J. Vet Med Sci. , 76(4):509-516].

As used herein, the "biological sample" is a sample obtained from an organism (such as an individual animal) or components of the organism (such as cells and tissues) . Examples of the biological sample include, but are not limited to: a blood sample, a plasma sample, a serum sample, a corneal tissue sample, a tear sample sample), a saliva sample, a cerebrospinal fluid sample, a feces sample, a tissue biopsy, a surgical specimen, a urine sample A urine sample, a fine needle aspirate, and combinations thereof.

The present invention also provides a kit for detecting SARS-CoV-2, which includes at least one of the above-mentioned primer sets.

In some embodiments, the kit further includes a color indicator for basic metal ions, a pH indicator or a combination thereof. The kit may further include a nucleic acid dye for monitoring the DNA amplification product. Examples of the nucleic acid dye include, but are not limited to: ethidium bromide (EtBr), SYBR GREEN I, SYBR GREEN II, SYBR Orange, SYBR GOLD, propidium iodide (Phopidium Iodide, PI), SYTOX Blue and SYPRO Ruby et al. Detailed Description of the Preferred Embodiment

The present invention will be further described in terms of the following examples, but it should be understood that these examples are for illustration purposes only, and should not be construed as limitations on the implementation of the present invention. Examples General experimental materials: 1. The primers used in the following examples were synthesized by entrusting Genomics Co., Ltd. on behalf of them. 2. The 1 kb DNA RTU Ladder (DNA RTU Ladder) (100-3,000 bp) (Cat. No. BR332-500, Biomate ^TM ) used in the following examples was purchased from Rainbow Biotechnology Co., Ltd. 3. The following plastids were entrusted to GENEWIZ to prepare: (1) Plasmid p3.1-SARS2-nsp2 (1,914 bps), which has severe acute respiratory syndrome coronavirus 2 (severe acute respiratory syndrome coronavirus 2, SARS-CoV -2) the nonstructural protein 2 (nsp2) gene [nonstructural protein 2 (nsp2) gene]. (2) Plasmid p3.1-SARS1-nsp2 (1,914 bps), which has the nsp2 gene of severe acute respiratory syndrome coronavirus 1 (severe acute respiratory syndrome coronavirus 1, SARS-CoV-1). (3) Plasmid p3.1-MERS-nsp2 (1,980 bps), which has the nsp2 gene of Middle East respiratory syndrome coronavirus (middle east respiratory syndrome coronavirus, MERS-CoV). (4) Plasmid p3.1-OC43-nsp2 (1,815 bps), which has the nsp2 gene of human coronavirus OC43 (human coronavirus OC43 , HCoV-OC43). (5) Plasmid p3.1-SARS2-nsp4 (1,500 bps), which has the nonstructural protein 4 (nsp4) gene of SARS-CoV-2 [nonstructural protein 4 (nsp4) gene]. (6) Plasmid p3.1-SARS1-nsp4 (1,500 bps), which has the nsp4 gene of SARS-CoV-1. (7) Plasmid p3.1-MERS-nsp4 (1,521 bps), which has the nsp4 gene of MERS-CoV. (8) Plasmid p3.1-OC43-nsp4 (1,488 bps), which has the nsp4 gene of HCoV-OC43. (9) Plasmid pcDNA3.1 (5,428 bps), which has a cytomegalovirus (CMV) promoter [cytomegalovirus (CMV) promoter]. 4. The following plastids were entrusted to GenScript to prepare: (1) Plasmid pBS-SARS2-spike (3,822 bps), which has the Spike (S) gene of SARS-CoV-2 [Spike (S) gene]. (2) Plasmid pBS-SARS1-spike (3,768 bps), which has the S gene of SARS-CoV-1. (3) Plasmid pBS-MERS-spike (4,062 bps), which has the S gene of MERS-CoV. (4) Plasmid pBS-OC43-spike (4,062 bps), which has the S gene of HCoV-OC43. 5. The total RNA of the six respiratory viruses shown in Table 1 below was obtained from the Virology Laboratory (Department of Pathology, National Cheng Kung University Hospital) of the Department of Pathology, National Cheng Kung University Hospital. Laboratory). Table 1. Viruses belonging to total viral RNA virus type virus strain SARS-CoV-2 German strain (EPI_ISL_493198) United Kingdom strain (EPI_ISL_493201) French strain (EPI_ISL_493200) Influenza A virus (IAV) - Influenza B virus (IBV) - Human parainfluenza virus (HPIV) - Respiratory syncytial virus (RSV) - Adenovirus (ADV) - 6. The Respiratory Evaluation Panel 01 (Respiratory Evaluation Panel 01) (Qnostics, Cat. No. RESPEP01-C) used in the following examples was purchased from YUAN IN Group CO., Ltd. ), which contains the 6 respiratory viruses shown in Table 2 below. Table 2. Respiratory Viruses Contained in Respiratory Assessment Kit 01 virus type virus strain Influenza A virus (IAV) H1N1 H3N2 Influenza B virus (IBV) Victoria Yamagata Respiratory fusion cell virus (RSV) Type A Type B 7. Source and culture of human lung adenocarcinoma cell line A549:

The human lung adenocarcinoma cell line A549 (ATCC ^® CCL-185 ^TM ) used in the following examples was purchased from American Type Culture Collection (ATCC).

A549 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) (purchased from Corning) [added with 10% Fetal Bovine Serum (FBS), 50 U/mL Penicillin (penicillin) and 100 μg/mL streptomycin (streptomycin)] in 100-mm Petri dishes, and cultured in an incubator set at 37°C, 5% CO ₂ . After that, fresh medium was replaced every 4-5 days. When the cell density reached about 80% confluence, the cells were subcultured (subculture). General experimental methods: 1. Preparation of RNA transcript mixture:

Use one of the plastid p3.1-SARS2-nsp2 and p3.1-SARS2-nsp4 described in item 3 of the above "general experimental materials" as a template (template), and use the RiboMAX™ large Large Scale RNA Production System-T7 (RiboMAX™ Large Scale RNA Production System-T7) (Promega) for in vitro transcription ( in vitro transcription), thereby obtaining an RNA transcript with the nsp2 gene of SARS-CoV-2 and an RNA transcript with the nsp4 gene of SARS-CoV-2. Afterwards, the two obtained RNA transcripts are mixed to obtain an RNA transcript mixture. Example 1. Design of primer sets (primer sets) for detecting SARS -CoV-2

According to the conserved regions of nsp2 gene, nsp4 gene and S gene in the complete genome of SARS-CoV-2 isolate Wuhan-Hu-1 (NCBI accession number: NC_045512.2 and GenBank accession number: MN908947.3) (conserved region), and use PrimerExplorer V5 software (PrimerExplorer V5 software) to design primer pairs (primer pairs) and loop primer pairs (loop primer pairs) for detecting SARS-CoV-2. The specificity of these primer pairs and loop primer pairs was analyzed by the BLAST software (http://www.ncbi.nlm.nih.gov/BLAST) provided by GenBank of the NCBI website, and Jalview software and Bioedit were used Software to analyze different viruses with similar parentage as a reference.

In this way, five sets of primers for specific detection of SARS-CoV-2 were obtained, including primer sets nsp2-1, nsp2-2, nsp4-1, nsp4-2 and S-1. Each primer set includes an outer primer pair, an inner primer pair, and a ring primer pair.

In addition, a set of loop primer pairs (named S-2-LF / S-2-LB) for the specific detection of SARS-CoV-2 was also obtained, which is the same as Huang WE et al. (2020) (same 1 set of external primer pairs (named S-2-F3 / S-2-B3) and 1 set of internal primer pairs (named S-2-FIP / S-2-BIP) disclosed in the above) use. The combination of these 3 sets of primer pairs is hereinafter referred to as "primer set S-2".

For clarity, relevant information (including: nucleotide sequences and positions corresponding to target genes, etc.) of the 6 sets of primers according to the present invention has been integrated in Table 3 to Table 8 below. a : Nucleotide residues corresponding to nucleotides indicated in boxes. b : Nucleotide residues corresponding to nucleotides indicated by the bottom line. nsp2 gene (NCBI accession number NC_045512.2) target gene Table 3. Primer set nsp2-1 for detection of SARS-CoV-2 1517-1541 1465-1441 1491-1514 ^a 1573-1549 ^b 1488-1468 ^a 1418-1440 ^b 1596-1577 1396-1417 Corresponds to nucleotide residues within the target gene ring primer pair inner primer pair external primer pair Primer pair nsp2-1-LB nsp2-1-LF nsp2-1-BIP nsp2-1-FIP nsp2-1-B3 nsp2-1-F3 aacaagtgtgcctattgggttccac (SEQ ID NO: 6) acccttacgaagaatggttttcaag (SEQ ID NO: 5) gtgtgttctcttatgttggttgcc tgtatggttacaacctatgttagcg (SEQ ID NO: 4) cctccaaaggcaatagtgcga gccgaataccataatgaatctgg (SEQ ID NO: 3) tcggaaccttctccaacaac (SEQ ID NO: 2) agtaggacctgagcatagtctt (SEQ ID NO: 1) Nucleotide sequence (5'→3') a : Nucleotide residues corresponding to nucleotides indicated in boxes. b : Nucleotide residues corresponding to nucleotides indicated by the bottom line. nsp2 gene (NCBI accession number NC_045512.2) target gene Table 4. Primer set nsp2-2 for detection of SARS-CoV-2 1310-1332 1261-1241 1287-1307 ^a 1363-1342 ^b 1286-1264 ^a 1214-1238 ^b 1393-1372 1186-1207 Corresponds to nucleotide residues within the target gene ring primer pair inner primer pair external primer pair Primer pair nsp2-2-LB nsp2-2-LF nsp2-2-BIP nsp2-2-FIP nsp2-2-B3 nsp2-2-F3 ttgactaaagaaggtgccactac (SEQ ID NO: 12) ctgccatgaagtttcaccaca (SEQ ID NO: 11) gcgaattttgtggcactgaga aacaacagcattttggggtaag (SEQ ID NO: 10) aagtggctttaacaaaatcgccc ctttcaactctcatgaagtgtgatc (SEQ ID NO: 9) tgaattgtgacatgctggacaa (SEQ ID NO: 8) gtcaccaaatgaatgcaaccaa (SEQ ID NO: 7) Nucleotide sequence (5'→3') a : Nucleotide residues corresponding to nucleotides indicated in boxes. b : Nucleotide residues corresponding to nucleotides indicated by the bottom line. nsp4 gene (NCBI accession number NC_045512.2) target gene Table 5. Primer set nsp4-1 for detection of SARS-CoV-2 8846-8865 8794-8777 8822-8845 ^a 8904-8884 ^b 8821-8798 ^a 8759-8776 ^b 8934-8911 8729-8752 Corresponds to nucleotide residues within the target gene ring primer pair inner primer pair external primer pair Primer pair nsp4-1-LB nsp4-1-LF nsp4-1-BIP nsp4-1-FIP nsp4-1-B3 nsp4-1-F3 gaagtgggttttgtcgtgcc (SEQ ID NO: 18) accacccacgctggctaaa (SEQ ID NO: 17) ttgattgctgcagtcataacaaga tcacccattagttgtgcgtaat (SEQ ID NO: 16) tgggcaagctttgtcattagtata gctgattttgacacatgg (SEQ ID NO: 15) ctaaaaactctaggtaagaaatgc (SEQ ID NO: 14) tctacagatacttgttttgctaac (SEQ ID NO: 13) Nucleotide sequence (5'→3') a : Nucleotide residues corresponding to nucleotides indicated in boxes. b : Nucleotide residues corresponding to nucleotides indicated by the bottom line. nsp4 gene (NCBI accession number NC_045512.2) target gene Table 6. Primer set nsp4-2 for detection of SARS-CoV-2 8919-8943 8864-8845 8886-8908 ^a 8967-8946 ^b 8884-8865 ^a 8825-8844 ^b 8994-8976 8805-8822 Corresponds to nucleotide residues within the target gene ring primer pair inner primer pair external primer pair Primer pair nsp4-2-LB nsp4-2-LF nsp4-2-BIP nsp4-2-FIP nsp4-2-B3 nsp4-2-F3 tacctagagtttttagtgcagttgg (SEQ ID NO: 24) gcacgacaaaacccacttct (SEQ ID NO: 23) tacgcacaactaatggtgacttttttgatggtgtgtaacagatgt (SEQ ID NO: 22) tatcgtgccaggcaaaccaag attgctgcagtcataacaag (SEQ ID NO: 21) gttgcaaagtcagtgtact (SEQ ID NO: 20) atgacaaagcttgcccat (SEQ ID NO: 19) Nucleotide sequence (5'→3') a : Nucleotide residues corresponding to nucleotides indicated in boxes. b : Nucleotide residues corresponding to nucleotides indicated by the bottom line. S gene (NCBI accession number NC_045512.2) target gene Table 7. Primer set S-1 for detection of SARS-CoV-2 24825-24845 24770-24749 24796-24818 ^a 24878-24859 ^b 24795-24771 ^a 24730-24748 ^b 24913-24891 24711-24728 Corresponds to nucleotide residues within the target gene ring primer pair inner primer pair external primer pair Primer pair S-1-LB S-1-LF S-1-BIP S-1-FIP S-1-B3 S-1-F3 actttcctcgtgaaggtgtct (SEQ ID NO: 30) cagggacataagtcacatgcaa (SEQ ID NO: 29) tcctgccatttgtcatgatggaa gtgttacaaaccagtgtgtg (SEQ ID NO: 28) gcagttgtgaagttcttttcttgtg acctcatggtgtagtcttc (SEQ ID NO: 27) tgtagtaatgatttgtggttcat (SEQ ID NO: 26) tgtccttccctcagtcag (SEQ ID NO: 25) Nucleotide sequence (5'→3') a : Nucleotide residues corresponding to nucleotides indicated in boxes. b : Nucleotide residues corresponding to nucleotides indicated by the bottom line. S gene (NCBI accession number NC_045512.2) target gene Table 8. Primer set S-2 for detection of SARS-CoV-2 21796-21819 21732-21708 21772-21795 ^a 21855-21838 ^b 21761-21737 ^a 21677-21697 ^b 21885-21867 21653-21670 Corresponds to nucleotide residues within the target gene ring primer pair inner primer pair external primer pair Primer pair S-2-LB S-2-LF S-2-BIP S-2-FIP S-2-B3 S-2-F3 gtttgataaccctgtcctaccat (SEQ ID NO: 36) ggtaagaacaagtcctgagttgaat (SEQ ID NO: 35) ctctgggaccaatggtactaagag gacttctcagtggaagca (SEQ ID NO: 34) catggaaccaagtaacattggaaaa cctgacaaagttttcagatcc (SEQ ID NO: 33) gtaccaaaaatccagcctc (SEQ ID NO: 32) tctttcacacgtggtgtt (SEQ ID NO: 31) Nucleotide sequence (5'→3') Example 2. Evaluation of the detection utility of the primer set of the present invention for SARS-CoV-2 by loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) analysis

In this example, the 6 sets of primers nsp2-1, nsp2-2, nsp4-1, nsp4-2, S-1 and S-2 designed according to the present invention were used for LAMP analysis to evaluate The detection utility of these primer sets for SARS-CoV-2. Experimental method: A. Specificity test of the primer group:

Take the 12 plastids described in items 3 and 4 of the above "General Experimental Materials" as a template, and use the primer set shown in Table 9 below and the reaction conditions shown in Table 10 below to Perform LAMP analysis. Table 9. The primer set used for each plastid plastid Primer group p3.1-SARS2-nsp2 nsp2-1 or nsp2-2 p3.1-SARS1-nsp2 p3.1-MERS-nsp2 p3.1-OC43-nsp2 p3.1-SARS2-nsp4 nsp4-1 or nsp4-2 p3.1-SARS1-nsp4 p3.1-MERS-nsp4 p3.1-OC43-nsp4 pBS-SARS2-spike S-1 or S-2 pBS-SARS1-spike pBS-MERS-spike pBS-OC43-spike Table 10. Reaction conditions of LAMP LAMP reaction mixture (final concentration) Volume (µL) LAMP Premix dNTPs (1.4 mM) 3.50 Minimal LAMP buffer (Minimal LAMP buffer) [contains 50 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 0.1% Tween 20, and 4 mM MgSO ₄ ; pH 8.6] 2.50 Betaine (0.8 M) 5.00 Phenol red (0.063 mM, pH 8.6-8.8) 0.75 external primer pair F3 (0.1 μM) 0.25 B3 (0.1 μM) 0.25 inner primer pair FIP (0.8 μM) 2.00 BIP (0.8 μM) 2.00 ring primer pair LF (0.4 μM) 1.00 LB (0.4 μM) 1.00 Bst 2.0 DNA Polymerase (8 U) (NEB, M0538L) 1.00 DEPC-treated water (DEPC-treated water) 0.75 Plastid DNA (10 ng/μL) 5.00 Operating conditions: isothermal-amplification reaction at 63°C for 60 minutes, termination at 80°C for 10 minutes, followed by cooling to room temperature.

The color of the reaction mixture changes from red to yellow-orange due to the pH change during the nucleic acid amplification reaction. Therefore, after the amplification reaction is completed, the color change of the resulting amplification product is observed with the naked eye [i.e., compared to Colorimetric assay], if it is yellow-orange, it means that the DNA of SARS-CoV-2 has been successfully amplified.

In order to confirm whether the color change was due to the amplification of the target DNA, the resulting amplified product was subjected to 1.5% agarose gel electrophoresis (agarose gel electrophoresis) to confirm the presence of the amplified product. B. Sensitivity test of primer group:

First, the plasmids p3.1-SARS2-nsp2, p3.1-SARS2-nsp4, and pBS- The concentration of SARS2-spike was respectively subjected to 10-fold serial dilution (10-fold serial dilution), thereby obtaining different concentrations [5×10 ⁵ , 5×10 ⁴ , 5×10 ³ , 5×10 ² , 5 ×10 ¹ and 5×10 ⁰ copies (copy)/rxn] DNA dilution solution.

Afterwards, the above obtained DNA dilution solutions containing different concentrations were used as templates, and the primer sets shown in Table 9 above and the reaction conditions shown in Table 10 above were used for LAMP analysis.

After completion of the amplification reaction, the presence of the amplification product was confirmed by 1.5% agarose gel electrophoresis. Results: A. The specificity test of the primer group:

Figures 1 to 6 show the detection specificity of the primer sets nsp2-1, nsp2-2, nsp4-1, nsp4-2, S-1 and S-2 for SARS-CoV-2, respectively. As can be seen from Figure 1, when using the primer set nsp2-1 to carry out LAMP analysis, the results of agarose gel electrophoresis analysis found that for the corresponding target plastid (that is, plastid p3.1-SARS2-nsp2) A ladder-like banding pattern was observed, and in the results of colorimetric analysis, a yellow-orange color change of the amplified product was observed for the plastid p3.1-SARS2-nsp2. For the non-target plastids (ie, p3.1-SARS1-nsp2, p3.1-MERS-nsp2 and p3.1-OC43-nsp2), no ladder-type band pattern and color change were observed. In addition, similar results were also observed when the primer sets nsp2-2, nsp4-1, nsp4-2, S-1 and S-2 were used for LAMP (see FIG. 2 to FIG. 6 ).

These experimental results show that using the 6 primer sets of the present invention and utilizing LAMP analysis to detect SARS-CoV-2 can show high specificity. B. Sensitivity test of primer group:

According to the results of LAMP analysis, the detection limits of the primer groups nsp2-1, nsp2-2, nsp4-1, nsp4-2, S-1 and S-2 for SARS-CoV-2 are all 5×10 ⁰ replicas/rxn. The results of this experiment show that the detection of SARS-CoV-2 by using the 6 sets of primer sets of the present invention and utilizing LAMP analysis can show high sensitivity. Example 3. Evaluation of the detection utility of the primer set of the present invention for SARS-CoV-2 by reverse transcription loop- mediated isothermal amplification (reverse transcription loop-mediated isothermal amplification, RT-LAMP) analysis

In this embodiment, 6 sets of primer sets nsp2-1, nsp2-2, nsp4-1, nsp4-2, S-1 and S-2 designed according to the present invention were used for RT-LAMP analysis, so that To evaluate the detection utility of these primer sets for SARS-CoV-2. experimental method:

First, adjust the concentration of the total RNA of SARS-CoV-2 (German strain) described in item 5 of the above "General Experimental Materials" with DEPC-treated water and perform 10-fold serial dilutions, thereby obtaining RNA dilution solutions with different concentrations (5×10 ⁵ , 5×10 ⁴ , 5×10 ³ , 5×10 ² , 5×10 ¹ and 5×10 ⁰ copies/rxn).

After that, use the RNA dilution solutions with different concentrations obtained above as templates, and use the 6 sets of primer sets shown in Table 3 to Table 8 above and the reaction conditions shown in Table 11 below to perform RT-LAMP analyze. Table 11. Reaction conditions of RT-LAMP RT-LAMP reaction mixture (final concentration) Volume (µL) RT-LAMP Premix dNTPs (1.4 mM) 3.50 Minimal LAMP buffer [contains 50 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 0.1% Tween 20, and 4 mM MgSO ₄ ; pH 8.6] 2.50 Betaine (0.8M) 5.00 Phenol red (0.063 mM, pH 8.6-8.8) 0.75 external primer pair F3 (0.1 μM) 0.25 B3 (0.1 μM) 0.25 inner primer pair FIP (0.8 μM) 2.00 BIP (0.8 μM) 2.00 ring primer pair LF (0.4 μM) 1.00 LB (0.4 μM) 1.00 Bst 2.0 DNA Polymerase (8 U) (NEB, M0538L) 1.00 AMV Reverse Transcriptase (2.5 U) (Promega, M5101) 0.25 DEPC-treated water 0.50 RNA (10 ng/μL) 5.00 Operating conditions: isothermal amplification reaction at 63°C for 60 minutes, terminated at 80°C for 10 minutes, followed by cooling to room temperature.

After completion of the amplification reaction, the presence of the amplification product was confirmed by 1.5% agarose gel electrophoresis. result:

Table 12 below shows the sensitivity test results of the primer sets nsp2-1, nsp2-2, nsp4-1, nsp4-2, S-1 and S-2. It can be seen from Table 12 that the detection limit of primer group S-1 for SARS-CoV-2 is 5× ¹⁰² copies/rxn, and the detection limit of primer groups nsp2-1, nsp4-1 and S-2 for SARS-CoV-2 Both are 5×10 ¹ copies/rxn, and the detection limit of the primer sets nsp2-2 and nsp4-2 for SARS-CoV-2 can reach 5×10 ⁰ copies/rxn. Table 12. The detection limit of each primer set for SARS-CoV-2 Primer group Detection limit (replica/rxn) nsp2-1 5×10 ¹ nsp2-2 5×10 ⁰ nsp4-1 5×10 ¹ nsp4-2 5×10 ⁰ S-1 5×10 ² S-2 5×10 ¹

The results of this experiment show that the detection of SARS-CoV-2 by using the 6 primer sets of the present invention and utilizing RT-LAMP analysis can show high sensitivity, especially the primer sets nsp2-2 and nsp4-2. Example 4. The combination of the primer set of the present invention is used for the evaluation of SARS-CoV-2 detection utility

In order to evaluate whether the 6 sets of primers designed according to the present invention still have excellent detection utility for SARS-CoV-2 when used in combination, the following experiments were carried out. Experimental method: A. Specificity test of combination of primer groups:

First, the A549 cells that were subcultured according to item 7 "Source and culture of human lung adenocarcinoma cell line A549" in the above "General Experimental Materials" were divided into 6 groups, including 1 blank control group (blank control group). ), 1 negative control group (negative control group), and 4 experimental groups (ie, experimental groups 1 to 4). The A549 cells of each group were cultured in a 35-mm culture dish containing 3 mL of DMEM (supplemented with 10% FBS) with a quantity of 2.7× ¹⁰⁵ cells, and kept in an incubator (37°C, 5% CO ₂ ) for 24 hours. Next, the cell cultures of experimental groups 1 to 4 were co-transfected using TurboFect Transfection Reagent (2 μL) (TurboFect Transfection Reagent) (Cat. No. R5031, Thermo Fisher Scientific Inc.) as shown in Table 13 below. Combinations (2 μg) of two specific plastids are shown.

In addition, the negative control cell culture was transfected with the plasmid pcDNA3.1 (2 μg) described in item 3 of “General Experimental Materials” above using TurboFect Transfection Reagent (2 μL). As for the cell culture of the blank control group, no treatment was performed.

After the cell cultures of each group were cultured in the incubator (37°C, 5% CO ₂ ) for 6 hours, they were replaced with 3 mL of fresh DMEM (supplemented with 10% FBS, 50 U/mL penicillin and 100 μg/mL mL streptomycin), and then cultured in an incubator (37°C, 5% CO ₂ ) for 18 hours. Table 13. Transfected plastids of each group of cell cultures group plastid Blank control group - negative control group pcDNA3.1 Experimental group 1 p3.1-SARS2-nsp2 and p3.1-SARS2-nsp4 Experimental group 2 p3.1-SARS1-nsp2 and p3.1-SARS1-nsp4 Experimental group 3 p3.1-MERS-nsp2 and p3.1-MERS-nsp4 Experimental group 4 p3.1-OC43-nsp2 and p3.1-OC43-nsp4 NOTE: The replicate ratio of the two specific plasmids used for each experimental group is 1:1.

Next, RNA was extracted from the obtained transfected cell cultures using the Direct-zol ^TM RNA MiniPrep kit (Cat. No. R2052, Zymo Research) according to the manufacturer's instructions, thereby obtaining each Group total RNA. Afterwards, RT-LAMP analysis was performed using the obtained total RNA of each group as a template, using the primer sets nsp2-2 and nsp4-2 and the reaction conditions shown in Table 14 below. Table 14. Reaction conditions for RT-LAMP RT-LAMP reaction mixture (final concentration) Volume (µL) RT-LAMP Premix dNTPs (1.4 mM) 3.500 Minimal LAMP buffer [contains 50 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 0.1% Tween 20, and 4 mM MgSO ₄ ; pH 8.6] 2.500 Betaine (0.8M) 5.000 Phenol red (0.063 mM, pH 8.6-8.8) 0.750 nsp2-2 external primer pair F3 (0.1 μM) 0.125 B3 (0.1 μM) 0.125 inner primer pair FIP (0.8 μM) 1.000 BIP (0.8 μM) 1.000 ring primer pair LF (0.4 μM) 0.500 LB (0.4 μM) 0.500 nsp4-2 external primer pair F3 (0.1 μM) 0.125 B3 (0.1 μM) 0.125 inner primer pair FIP (0.8 μM) 1.000 BIP (0.8 μM) 1.000 ring primer pair LF (0.4 μM) 0.500 LB (0.4 μM) 0.500 Bst 2.0 DNA Polymerase (8 U) (NEB, M0538L) 1.000 AMV Reverse Transcriptase (2.5 U) (Promega, M5101) 0.250 DEPC-treated water 0.500 RNA (10 ng/μL) 5.000 Operating conditions: isothermal amplification reaction at 63°C for 60 minutes, terminated at 80°C for 10 minutes, followed by cooling to room temperature.

After completing the amplification reaction, the presence of the amplification product was confirmed by 1.5% agarose gel electrophoresis and colorimetric analysis, respectively. B. Sensitivity test of combination of primer groups:

First, three kinds of plasmid mixtures (ie, plasmid mixtures 1 to 3) were prepared according to the formula shown in Table 15 below. Table 15. Plastids contained in each plastid mixture plastid mixture plastid 1 pBS-SARS2-spike and p3.1-SARS2-nsp4 2 3 p3.1-SARS2-nsp2 and p3.1-SARS2-nsp4 NOTE: The replicate ratio of the two plastids used for each plastid mixture is 1:1.

Next, the concentrations of plastid mixtures 1 to 3 were respectively adjusted with DEPC-treated water and serially diluted by 10 times, thereby each having different concentrations (5×10 ⁵ , 5×10 ⁴ , 5×10 ³ , 5×10 ² , 5×10 ¹ and 5×10 ⁰ copies/rxn) DNA dilution solutions.

Afterwards, each of the DNA dilution solutions obtained above containing different concentrations was used as a template, and the combination of the primer sets shown in Table 16 below and the reaction conditions shown in Table 17 below were used for LAMP analysis. Table 16. Combination of primer sets used for each plastid mixture plastid mixture combination of primers Primer set 1 Primer set 2 Plastid Mixture 1 S-1 nsp4-1 Plastid Mixture 2 S-1 nsp4-2 Plastid Mixture 3 nsp2-2 nsp4-2 Table 17. Reaction conditions for LAMP LAMP reaction mixture (final concentration) Volume (µL) LAMP Premix dNTPs (1.4 mM) 3.500 Minimal LAMP buffer [contains 50 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 0.1% Tween 20, and 4 mM MgSO ₄ ; pH 8.6] 2.500 Betaine (0.8M) 5.000 Phenol red (0.063 mM, pH 8.6-8.8) 0.750 Primer set 1 external primer pair F3 (0.1 μM) 0.125 B3 (0.1 μM) 0.125 inner primer pair FIP (0.8 μM) 1.000 BIP (0.8 μM) 1.000 ring primer pair LF (0.4 μM) 0.500 LB (0.4 μM) 0.500 Primer set 2 external primer pair F3 (0.1 μM) 0.125 B3 (0.1 μM) 0.125 inner primer pair FIP (0.8 μM) 1.000 BIP (0.8 μM) 1.000 ring primer pair LF (0.4 μM) 0.500 LB (0.4 μM) 0.500 Bst 2.0 DNA Polymerase (8 U) (NEB, M0538L) 1.000 DEPC-treated water 0.750 Plastid DNA (10 ng/μL) 5.000 Operating conditions: isothermal amplification reaction at 63°C for 60 minutes, terminated at 80°C for 10 minutes, followed by cooling to room temperature.

After completion of the amplification reaction, the presence of the amplification product was confirmed by 1.5% agarose gel electrophoresis. Results: A. The specificity test of the combination of primer groups:

Figure 7 shows the detection specificity of the combination of primer sets nsp2-2 and nsp4-2 for SARS-CoV-2. As can be seen from Figure 7, when using the combination of primer sets nsp2-2 and nsp4-2 to carry out RT-LAMP analysis, in the results of agarose gel electrophoresis analysis, it was found that a ladder-type band pattern was observed in experimental group 1, And in the results of colorimetric analysis, it was found that in the experimental group 1, a yellow-orange color change of the amplified product was observed. In the experimental groups 2 to 4, no ladder-shaped band pattern and color change were observed.

In addition, the applicant also used the combination of primer set S-1 and nsp4-1 and the combination of primer set S-1 and nsp4-2 and generally referred to the combination of primer set nsp2-2 and nsp4-2 above. Similar results were also observed (data not shown).

These experimental results show that the primer set of the present invention can exhibit high specificity when used in combination to detect SARS-CoV-2. B. Sensitivity test of combination of primer groups:

According to the results of the LAMP analysis, the combination of the three primer sets (ie, S-1/nsp4-1, S-1/nsp4-2, and nsp2-2/nsp4-2) has a detection limit for SARS-CoV-2 All are 5×10 ⁰ replicas/rxn. This experimental result shows that the primer set of the present invention can exhibit high sensitivity when used in combination to detect SARS-CoV-2. Example 5. The combined use of the primer set nsp2-2 and nsp4-2 of the present invention for the evaluation of the detection utility of SARS-CoV-2 and other respiratory viruses

In order to assess whether the primer set designed according to the present invention can effectively distinguish SARS-CoV-2 from other respiratory viruses, the applicant selected these five common respiratory viruses of IAV, IBV, HPIV, RSV and ADV for testing and used The combination of the primer sets nsp2-2 and nsp4-2 of the present invention is used for RT-LAMP. experimental method:

First, use the RNA transcript mixture obtained in item 1 of the above "General Experimental Methods" and the total RNA of IAV, IBV, HPIV, RSV, and ADV as described in item 5 of the above "General Experimental Materials" As a template, RT-LAMP analysis was performed using the combination of primer sets nsp2-2 and nsp4-2 and the reaction conditions shown in Table 14 above, respectively.

In addition, the QIAamp Viral RNA Mini Kit (QIAGEN) was used according to the manufacturer's instructions to extract RNA from the six respiratory viruses described in item 6 of the "General Experimental Materials" above. Afterwards, the obtained total RNA of each virus and the RNA transcript mixture obtained in item 1 of the above "general experimental method" were used as templates, and the combination of primer sets nsp2-2 and nsp4-2 and The reaction conditions shown in Table 14 above were used for RT-LAMP analysis. In addition, total RNA extracted from A549 cells transfected with the plasmid pcDNA3.1 described in item 3 of "General Experimental Materials" above was used as a negative control.

After completing the amplification reaction, the presence of the amplification product was confirmed by 1.5% agarose gel electrophoresis and colorimetric analysis, respectively. result:

Figure 8 and Figure 9 respectively show the detection utility of the combination of the primer sets nsp2-2 and nsp4-2 for SARS-CoV-2 and other respiratory viruses. As can be seen from Figures 8 and 9, when using the combination of the primer sets nsp2-2 and nsp4-2 for RT-LAMP analysis, the results of agarose gel electrophoresis analysis found that there was a certain observed for SARS-CoV-2 A ladder-type band pattern, and in the results of colorimetric analysis, it was found that for SARS-CoV-2, a yellow-orange color change was observed in the amplified product. For other respiratory viruses from different sources, no ladder-type band patterns and color changes were observed.

These experimental results show that the primer sets nsp2-2 and nsp4-2 of the present invention can show high specificity when used in combination to detect SARS-CoV-2, and can effectively distinguish SARS-CoV-2 from other respiratory viruses. Example 6. The combination of the primer set nsp2-2 and nsp4-2 of the present invention is used for the evaluation of the detection utility of different virus strains of SARS-CoV-2

In order to assess whether the primer set designed according to the present invention has detection utility for different virus strains of SARS-CoV-2, the applicant selects 3 kinds of SARS-CoV-2 virus strains (that is, the German strain, the British strain and the French strain) strain) for testing and using the combination of the primer sets nsp2-2 and nsp4-2 of the present invention for real-time qRT-LAMP (real-time qRT-LAMP) analysis. experimental method:

First, the concentrations of the total RNA of the three SARS-CoV-2 strains described in item 5 of the above "General Experimental Materials" were respectively adjusted with DEPC-treated water and serially diluted by 10 times, thereby And RNA dilution solutions having different concentrations (5×10 ⁶ , 5×10 ⁵ , 5×10 ⁴ , 5×10 ³ , 5×10 ² , 5×10 ¹ and 5×10 ⁰ copies/rxn) were respectively obtained.

Afterwards, each RNA dilution solution containing different concentrations obtained above was used as a template, and the combination of primer sets nsp2-2 and nsp4-2 and the reaction conditions shown in Table 18 below were used in a StepOnePlus™ real-time PCR system ( StepOnePlus™ real-time PCR system) (Applied Biosystems) for real-time qRT-LAMP analysis. Table 18. Reaction conditions for instant qRT-LAMP Instant qRT-LAMP reaction mix (final concentration) Volume (µL) Instant qRT-LAMP Premix dNTPs (1.4 mM) 3.500 Minimal LAMP buffer [contains 50 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 0.1% Tween 20, and 4 mM MgSO ₄ ; pH 8.6] 2.500 Betaine (0.8M) 5.000 Phenol red (0.063 mM, pH 8.6-8.8) 0.750 SYTO™ 82 Dye (5 mM) 0.100 nsp2-2 external primer pair F3 (0.1 μM) 0.125 B3 (0.1 μM) 0.125 inner primer pair FIP (0.8 μM) 1.000 BIP (0.8 μM) 1.000 ring primer pair LF (0.4 μM) 0.500 LB (0.4 μM) 0.500 nsp4-2 external primer pair F3 (0.1 μM) 0.125 B3 (0.1 μM) 0.125 inner primer pair FIP (0.8 μM) 1.000 BIP (0.8 μM) 1.000 ring primer pair LF (0.4 μM) 0.500 LB (0.4 μM) 0.500 Bst 2.0 DNA Polymerase (8 U) (NEB, M0538L) 1.000 AMV Reverse Transcriptase (2.5 U) (Promega, M5101) 0.250 DEPC-treated water 0.400 RNA (10 ng/μL) 5.000 Operating conditions: Amplification reaction was performed at 63°C (1 minute per cycle, preset cycle number was 60, up to 120), terminated at 80°C for 10 minutes, followed by cooling to room temperature. result:

Table 19 below shows the detection utility of the combination of primer sets nsp2-2 and nsp4-2 for different virus strains of SARS-CoV-2. It can be seen from Table 19 that the combination of primer sets nsp2-2 and nsp4-2 has a detection limit of 5×10 ¹ copies/rxn for each SARS-CoV-2 virus strain, and the SARS-CoV-2 German strain, British strain and The average maximum cycle threshold ( Ct ) values of French strains were 41.27±4.42, 43.48±2.57 and 40.49±3.10 (mean±SD). Because the set amplification reaction is 1 minute per cycle, it shows that when the combination of the primer sets nsp2-2 and nsp4-2 of the present invention is used for real-time qRT-LAMP analysis, the virus can be detected within 40 to 45 minutes Any of these 3 SARS-CoV-2 strains at a concentration of 50 copies/rxn. Based on the above results, the applicant proposes to use a maximum cut-off Ct value corresponding to 55 minutes [inferred from the upper limit of the maximum confidence interval (99.7%) of the normal distribution within "mean ± 3SD"] To determine whether an RNA sample is positive or negative, that is, when the Ct value is less than or equal to 55 minutes, the test result is judged as positive, and when the Ct value is greater than 55 minutes, the test result is judged as negative. Table 19. Cycle Thresholds Measured at Different Concentrations for Each SARS-CoV-2 Strain German strain British strain French strain RNA concentration (replica/rxn) C _t value RNA concentration (replica/rxn) C _t value RNA concentration (replica/rxn) C _t value 5×10 ¹ 41.27±4.42 5×10 ¹ 43.48±2.57 5×10 ¹ 40.49±3.10 5×10 ² 35.17±3.89 5×10 ² 38.98±5.10 5×10 ² 35.54±2.86 5×10 ³ 31.69±3.51 5×10 ³ 34.35±3.91 5×10 ³ 32.59±2.17 5×10 ⁴ 28.64±2.79 5×10 ⁴ 29.69±2.71 5×10 ⁴ 29.34±2.17 5×10 ⁵ 25.93±2.50 5×10 ⁵ 27.16±2.15 5×10 ⁵ 26.78±2.24 5×10 ⁶ 23.08±1.98 5×10 ⁶ 24.12±1.28 5×10 ⁶ 24.16±1.89 Note: Since each cycle is set to 1 minute, the C _t value can also be regarded as the detection time (unit: minute).

Based on the above experimental results, it can be known that using the combination of the primer sets nsp2-2 and nsp4-2 of the present invention to detect SARS-CoV-2 can show high sensitivity and is suitable for clinical prediction of viral load (viral load).

Based on the above experimental results, whether the primer sets nsp2-1, nsp2-2, nsp4-1, nsp4-2, S-1, S-2 of the present invention are used alone or in combination, SARS can be detected quickly and accurately -CoV-2.

All patents and literature cited in this specification are hereby incorporated by reference in their entirety. In case of conflict, the detailed description of the case (including definitions) will prevail.

While the invention has been described with reference to specific examples thereof, obviously many modifications and variations can be made without departing from the scope and spirit of the invention. It is therefore intended that the present invention be limited only as indicated by the claims attached hereto.

The above and other objects, features and advantages of the present invention will become apparent after referring to the following detailed description and preferred embodiments and the accompanying drawings, wherein: Figure 1 shows the detection of SARS-CoV-2 using the primer set nsp2-1 and using loop-mediated isothermal amplification (LAMP), in which: the upper figure is a digital image of agarose gel electrophoresis analysis, The diameter M represents the DNA RTU ladder (100-3,000 bp), and the diameter NTC represents the non-template control (water); and the figure below is the digital image of the colorimetric analysis; Figure 2 shows the detection of SARS-CoV-2 using the primer set nsp2-2 and using LAMP, in which: the upper figure is a digital image of agarose gel electrophoresis analysis, wherein the diameter M represents the DNA RTU ladder (100-3,000 bp), and NTC indicates no template control (water); and the lower panel is a digital image of the colorimetric analysis; Figure 3 shows the use of primer set nsp4-1 and LAMP to detect SARS-CoV-2, in which: the upper figure is a digital image of agarose gel electrophoresis analysis, wherein the diameter M represents the DNA RTU ladder (100-3,000 bp), and NTC indicates no template control (water); and the lower panel is a digital image of the colorimetric analysis; Figure 4 shows the use of primer set nsp4-2 and LAMP to detect SARS-CoV-2, wherein: the upper figure is a digital image of agarose gel electrophoresis analysis, wherein the diameter M represents the DNA RTU ladder (100-3,000 bp), and NTC indicates no template control (water); and the lower panel is a digital image of the colorimetric analysis; Figure 5 shows the detection of SARS-CoV-2 using primer set S-1 and using LAMP, wherein: the upper figure is a digital image of agarose gel electrophoresis analysis, wherein the diameter M represents the DNA RTU ladder (100-3,000 bp), and NTC indicates no template control (water); and the lower panel is a digital image of the colorimetric analysis; Figure 6 shows the detection of SARS-CoV-2 using primer set S-2 and using LAMP, wherein: the upper figure is a digital image of agarose gel electrophoresis analysis, wherein the diameter M represents the DNA RTU ladder (100-3,000 bp), and NTC indicates no template control (water); and the lower panel is a digital image of the colorimetric analysis; Figure 7 shows the combination of primer sets nsp2-2 and nsp4-2 and the use of reverse transcription loop-mediated isothermal amplification (reverse transcription loop-mediated isothermal amplification, RT-LAMP) to detect SARS-CoV-2, wherein: The picture is a digital image of agarose gel electrophoresis analysis, where the diameter M represents the DNA RTU ladder (100-3,000 bp), the diameter NTC represents the no template control (water), and the blank control group, negative control group and each experimental group represent respectively was transfected with a plastid as shown in Table 13 below; and the figure below is a digital image of the colorimetric analysis; Figure 8 shows the combination of primer sets nsp2-2 and nsp4-2 and the use of RT-LAMP to detect SARS-CoV-2, wherein: the upper figure is a digital image of agarose gel electrophoresis analysis, and the diameter M represents the DNA RTU ladder (100-3,000 bp), and the path NTC indicates no template control (water); and the figure below is a digital image of the colorimetric analysis; and Figure 9 shows the combination of primer sets nsp2-2 and nsp4-2 and the use of RT-LAMP to detect SARS-CoV-2, wherein: the upper figure is a digital image of agarose gel electrophoresis analysis, wherein the diameter M represents the DNA RTU ladder (100-3,000 bp), and the diameter NTC indicates no template control (water); and the lower panel is a digital image of the colorimetric analysis.

Claims (37)

A method for detecting severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) present in a biological sample comprising: subjecting nucleic acid in the biological sample to a nucleic acid amplification reaction using a reaction mixture comprising at least one primer set for amplifying a target nucleic acid of SARS-CoV-2; and detecting whether there is an amplification product obtained from the nucleic acid amplification reaction, wherein the presence of the amplification product indicates the presence of SARS-CoV-2 in the biological sample; Wherein the at least one primer set is selected from the group consisting of: (a) A first primer set for amplifying a region in the nonstructural protein 2 (nonstructural protein 2, nsp2) gene of SARS-CoV-2, which includes a sequence identification number as shown in: 1 A first forward outer primer of the nucleotide sequence, and a first reverse outer primer with a nucleotide sequence as shown in Sequence Identification number: 2; (b) a second primer set for amplifying a region in the nsp2 gene of SARS-CoV-2, which comprises a second forward outer portion with a nucleotide sequence as shown in SEQUENCE IDENTIFICATION NO.: 7 primer, and a second reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 8; (c) a third primer set for amplifying a region in the nonstructural protein 4 (nonstructural protein 4, nsp4) gene of SARS-CoV-2, which includes a sequence identification number: 13 A third forward outer primer of the nucleotide sequence, and a third reverse outer primer with a nucleotide sequence as shown in Sequence Identification number: 14; (d) a fourth primer set for amplifying a region in the nsp4 gene of SARS-CoV-2, which comprises a fourth forward outer portion having a nucleotide sequence as shown in Sequence Identification Number: 19 primer, and a fourth reverse external primer having a nucleotide sequence as shown in Sequence Identification Number: 20; and (e) a fifth primer set for amplifying a region in the spike protein (spike protein, S) gene of SARS-CoV-2, which includes a nucleotide with a sequence identification number: 25 A fifth forward external primer of the sequence, and a fifth reverse external primer having a nucleotide sequence as shown in Sequence Identification Number: 26. The method of claim 1, wherein the nucleic acid amplification reaction is carried out by using at least one of the following methodology: polymerase chain reaction, quantitative polymerase chain reaction (qPCR), reverse transcription polymerase chain reaction (RT -PCR), reverse transcription quantitative polymerase chain reaction (RT-qPCR), nested PCR, hot start PCR, multiplex PCR, in situ PCR, single cell PCR , step-down polymerase chain reaction, ligase chain reaction (LCR), gap ligase chain reaction (gLCR), and isothermal amplification reactions. The method according to claim 1, wherein the reaction mixture further comprises a reverse transcriptase and a DNA polymerase. The method according to claim 3, wherein the nucleic acid amplification reaction is performed by using a loop-mediated isothermal amplification reaction (LAMP). The method of claim 4, wherein the first primer set further comprises a first forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 3, and a first forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 4 The first reverse internal primer of the indicated nucleotide sequence. The method of claim item 5, wherein the first primer set further includes one of the following: one has a first forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 5, one has a Sequence identification number: the first reverse loop primer of the nucleotide sequence shown in 6, and their combinations. The method of claim 4, wherein the second primer set further comprises a second forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 9, and a second forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 10 The second reverse internal primer of the indicated nucleotide sequence. The method of claim item 7, wherein the second primer set further comprises one of the following: one has a second forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 11, one has a Sequence identification number: the second reverse loop primer of the nucleotide sequence shown in 12, and their combinations. The method of claim 4, wherein the third primer set further comprises a third forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 15, and a third forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 16 The third reverse internal primer of the nucleotide sequence shown. The method of claim item 9, wherein the third primer set further includes one of the following: one has a third forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 17, one has a Sequence identification number: the third reverse loop primer of the nucleotide sequence shown in 18, and their combinations. The method of claim 4, wherein the fourth primer set further comprises a fourth forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 21, and a fourth forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 22 The fourth reverse internal primer of the nucleotide sequence shown. The method of claim item 11, wherein the fourth primer set further includes one of the following: one has a fourth forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 23, one has a Sequence identification number: the fourth reverse loop primer of the nucleotide sequence shown in 24, and their combinations. The method of claim 4, wherein the fifth primer set further comprises a fifth forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 27, and a fifth forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 28 The fifth reverse internal primer of the indicated nucleotide sequence. The method of claim item 13, wherein the fifth primer set further includes one of the following: one has a fifth forward loop primer having a nucleotide sequence as shown in Sequence Identification Number: 29, one has a Sequence identification number: the fifth reverse loop primer of the nucleotide sequence shown in 30, and their combinations. The method of claim 1, wherein the at least one primer set further includes a sixth primer set for amplifying a region in the S gene of SARS-CoV-2, the sixth primer set includes a sequence identification No.: the sixth forward outer primer with the nucleotide sequence shown in 31, and a sixth reverse outer primer with the nucleotide sequence shown in Sequence Identification No.: 32. The method according to claim 15, wherein the reaction mixture further comprises a reverse transcriptase and a DNA polymerase, and the nucleic acid amplification reaction is performed by using a loop-mediated isothermal amplification reaction (LAMP). The method of claim 16, wherein the sixth primer set further comprises a sixth forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 33, and a sixth forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 34 The sixth reverse internal primer of the nucleotide sequence shown. The method of claim item 17, wherein the sixth primer set further includes one of the following: one has a sixth forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 35, one has a Sequence identification number: the sixth reverse loop primer of the nucleotide sequence shown in 36, and their combinations. The method according to any one of claims 1 to 18, wherein the detection of the amplification product is carried out by using at least one of the following methodologies: turbidity measurement, fluorescence detection, bioluminescent detection, coagulation Gel electrophoresis, colorimetric detection, immunoenzyme detection, electrochemical detection, and combinations thereof. The method of any one of claims 1 to 18, wherein at least one of the primers in at least one primer set is marked with a detectable marker. The method of claim 1, wherein the biological sample is selected from the group consisting of: a blood sample, a plasma sample, a serum sample, a corneal tissue sample, a tear sample, a saliva sample, a brain sample A spinal fluid sample, a stool sample, a biopsy, a surgical specimen, a urine sample, a fine needle aspirate, and combinations thereof. A kit for detecting severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2), comprising at least one of the following primer sets for amplifying a target nucleic acid of SARS-CoV-2: (a) a first primer set for amplifying a region in the nsp2 gene of SARS-CoV-2, which comprises a first front-to-outside with a nucleotide sequence as shown in SEQUENCE IDENTIFICATION NO.: 1 primer, and a first reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 2; (b) a second primer set for amplifying a region in the nsp2 gene of SARS-CoV-2, which comprises a second forward outer portion with a nucleotide sequence as shown in SEQUENCE IDENTIFICATION NO.: 7 primer, and a second reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 8; (c) a third primer set for amplifying a region in the nsp4 gene of SARS-CoV-2, which comprises a third front-to-outside with a nucleotide sequence as shown in Sequence Identification Number: 13 primer, and a third reverse external primer with a nucleotide sequence as shown in Sequence Identification number: 14; (d) a fourth primer set for amplifying a region in the nsp4 gene of SARS-CoV-2, which comprises a fourth forward outer portion having a nucleotide sequence as shown in Sequence Identification Number: 19 primer, and a fourth reverse external primer having a nucleotide sequence as shown in Sequence Identification Number: 20; and (e) A fifth primer set for amplifying a region in the S gene of SARS-CoV-2, which includes a fifth forward outer part having a nucleotide sequence as shown in Sequence Identification Number: 25 primer, and a fifth reverse external primer having a nucleotide sequence as shown in Sequence Identification Number: 26. The set of claim 22, wherein at least one of the primers in each primer set is marked with a detectable mark. The set of claim 22, wherein the first primer set further comprises a first forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 3, and a first forward internal primer having a nucleotide sequence such as Sequence Identification Number: 4 The first reverse internal primer of the indicated nucleotide sequence. The set of claim item 24, wherein the first primer set further includes one of the following: one has a first forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 5, one has a The first reverse loop primer of the nucleotide sequence shown in Sequence Identification Number: 6, and combinations thereof. The set of claim 22, wherein the second primer set further comprises a second forward internal primer with a nucleotide sequence as shown in Sequence Identification Number: 9, and a second forward internal primer with a sequence identification number: 10 The second reverse internal primer of the indicated nucleotide sequence. The set of claim item 26, wherein the second primer set further includes one of the following: one has a second forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 11, one has a The second reverse loop primer of the nucleotide sequence shown in Sequence Identification Number: 12, and combinations thereof. The set of claim 22, wherein the third primer set further comprises a third forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 15, and a third forward internal primer having a nucleotide sequence such as Sequence Identification Number: 16 The third reverse internal primer of the indicated nucleotide sequence. As the set of claim item 28, wherein the third primer set further includes one of the following: one has a third forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 17, one has a The third reverse loop primer of the nucleotide sequence shown in Sequence Identification Number: 18, and combinations thereof. The set of claim 22, wherein the fourth primer set further comprises a fourth forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 21, and a fourth forward internal primer having a nucleotide sequence such as Sequence Identification Number: 22 The fourth reverse internal primer of the indicated nucleotide sequence. The set of claim item 30, wherein the fourth primer set further includes one of the following: one has a fourth forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 23, one has a The fourth reverse loop primer of the nucleotide sequence shown in Sequence Identification Number: 24, and combinations thereof. The set of claim 22, wherein the fifth primer set further comprises a fifth forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 27, and a fifth forward internal primer having a nucleotide sequence such as Sequence Identification Number: 28 The fifth reverse internal primer of the indicated nucleotide sequence. The set of claim item 32, wherein the fifth primer set further includes one of the following: one has a fifth forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 29, one has a The fifth reverse loop primer of the nucleotide sequence shown in Sequence Identification Number: 30, and combinations thereof. As the set of claim 22, it further includes a sixth primer set for amplifying a region in the S gene of SARS-CoV-2, the sixth primer set includes a sequence identification number: 31 A sixth forward outer primer with the nucleotide sequence shown, and a sixth reverse outer primer with a nucleotide sequence as shown in Sequence Identification Number: 32. The set of claim 34, wherein the sixth primer set further comprises a sixth forward internal primer having a nucleotide sequence as shown in Sequence Identification Number: 33, and a sixth forward internal primer having a nucleotide sequence such as Sequence Identification Number: 34 The sixth reverse internal primer of the indicated nucleotide sequence. As the set of claim item 35, wherein the sixth primer set further includes one of the following: one has a sixth forward loop primer with a nucleotide sequence as shown in Sequence Identification Number: 35, one has a The sixth reverse loop primer of the nucleotide sequence shown in Sequence Identification Number: 36, and combinations thereof. The set according to any one of claims 22 to 36, further comprising one of the following: a color indicator for basic metal ions, a pH indicator, and combinations thereof.

Images