TW202246269A - Dihydropyrimidine derivatives and uses thereof in the treatment of hbv infection or of hbv-induced diseases - Google Patents

Abstract

The application describes dihydropyrimidine derivatives which are useful in the treatment or prevention of HBV infection or of HBV-induced diseases, more particularly of HBV chronic infection or of diseases induced by HBV chronic infection, as well as pharmaceutical or medical applications thereof.

Description

Dihydropyrimidine derivatives and use thereof for treating HBV infection or HBV-induced diseases

The present application describes dihydropyrimidine derivatives useful for the treatment or prevention of HBV infection or HBV-induced diseases, more particularly HBV chronic infection or diseases induced by HBV chronic infection, and their pharmaceutical or medical applications.

Chronic hepatitis B virus (HBV) infection is a major global health problem, affecting more than 5% of the world's population (more than 350 million people worldwide and 1.25 million in the United States).

Despite the availability of a preventive HBV vaccine, the burden of chronic HBV infection remains a major global medical problem due to suboptimal treatment options and persistent rates of new infections in most parts of the developing world.

Current treatments are not curative and are limited to two classes of agents (interferon alfa and nucleoside analogs/viral polymerase inhibitors); resistance, low efficacy, and tolerability issues limit their impact. The low cure rate of HBV is due at least in part to the fact that it is difficult to completely suppress viral production with a single antiviral agent. However, sustained suppression of HBV DNA slowed the progression of liver disease and helped prevent hepatocellular carcinoma. The current goal of treatment in HBV-infected patients is to reduce serum HBV DNA to low or undetectable levels and ultimately reduce or prevent the development of cirrhosis and hepatocellular carcinoma.

HBV capsid protein plays an important role in the life cycle of the virus. HBV capsid/core proteins form metastable virus particles or protein shells that protect the viral genome during cell-to-cell passage and also play a central role in viral replication, including genome encapsidation, genome replication, and virion morphogenesis and go out.

The capsid structure also responds to environmental cues to allow uncoating after viral entry.

Consistently, proper timing of capsid assembly and disassembly, proper capsid stability and core protein function have been found to be critical for viral infectivity.

Background references on dihydropyrimidine derivatives in the treatment of HBV infection include WO 2014/029193, CN 103664899, CN 103664925, CN 103664897 and WO 2020/125730.

There is a need in the art for therapeutic agents that can increase the inhibition of viral production and can treat, ameliorate or prevent HBV infection. Administration of such therapeutic agents to HBV-infected patients as monotherapy or in combination with other HBV treatments or adjuvant treatments will result in significantly reduced viral load, improved prognosis, reduced disease progression and enhanced seroconversion rates.

(I) 包括其氘化的、立體異構或互變異構形式， 其中： R ¹、R ²和R ³各自獨立地選自由以下組成之群組：H、鹵素、CN和C _1-3烷基； R ⁴選自由以下組成之群組：噻唑基、咪唑基、㗁唑基和吡啶基，其各自能夠視需要被一或多個各自獨立地選自CH ₃或鹵素的取代基取代； R ⁵係C _1-4烷基， X選自CH ₂和O， R ⁶和R ⁷獨立地選自H和C _1-3烷基， R ⁸選自H和C _1-6烷基， L係被以下取代的C _1-6伸烷基 a) 一個選自OH和C _1-3烷基氧基的取代基，或 b) 一個或兩個鹵素， 以上C _1-3烷基、C _1-3烷氧基、C _1-4烷基和C _1-6烷基中之每一個能夠視需要被一個、兩個或三個鹵素取代； 或其藥學上可接受的鹽或溶劑化物。 In one aspect, there is provided a compound of formula (I)

(I) includes deuterated, stereoisomeric or tautomeric forms thereof, wherein: R ¹ , R ² and R ³ are each independently selected from the group consisting of H, halogen, CN and C _1-3 alkane base ^; R is selected from the group consisting of thiazolyl, imidazolyl, oxazolyl and pyridyl, each of which can be optionally substituted by one or more substituents independently selected from CH or halogen; _R ⁵ is C _1-4 alkyl, X is selected from CH ₂ and O, R ⁶ and R ⁷ are independently selected from H and C _1-3 alkyl, R ⁸ is selected from H and C _1-6 alkyl, L is C _1-6 alkylene substituted by a) a substituent selected from OH and C _1-3 alkyloxy, or b) one or two halogens, the above C _1-3 alkyl, C _1- Each of ₃ alkoxy, C _1-4 alkyl and C _1-6 alkyl can be optionally substituted by one, two or three halogens; or a pharmaceutically acceptable salt or solvate thereof.

In another aspect, provided herein are pharmaceutical compositions comprising at least one compound of formula (I) or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

In another aspect, provided herein are pharmaceutical compositions comprising at least one disclosed compound and a pharmaceutically acceptable carrier. In another aspect, provided herein is a method of treating HBV infection in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof. In another aspect, provided herein is any compound described herein, or a pharmaceutical composition of the invention, for use as a medicament. In a further aspect, provided herein is any compound described herein or a pharmaceutical composition of the invention for use in the prevention or treatment of HBV infection or HBV-induced disease in a mammal in need thereof.

In yet a further aspect, provided herein is a product comprising a first compound and a second compound as a combined preparation for the prophylaxis or treatment of HBV infection or HBV-induced disease in a mammal in need thereof. Simultaneous, separate or sequential use in therapy, wherein said first compound is different from said second compound, wherein said first compound is a compound having (I) as described herein or a pharmaceutical composition according to the invention, And wherein the second compound is an HBV inhibitor. The HBV inhibitor can be selected from: - Cytokines with HBV replication inhibitory activity, - antibodies with immune checkpoint modulating activity, - substituted pyrimidines with HBV capsid assembly inhibitory activity or with TLR agonist activity, - antiretroviral nucleoside analogues, and - its combination.

In another aspect, provided herein is a method for inhibiting or reducing the formation or presence of HBV DNA-containing particles or HBV RNA-containing particles of an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of the compound having formula (I) compound or a pharmaceutically acceptable salt thereof.

In one embodiment, any of the methods provided herein can further comprise administering to the individual at least one additional therapeutic agent selected from the group consisting of HBV polymerase inhibitors, immunomodulators, interfering Inhibitors, viral entry inhibitors, viral maturation inhibitors, capsid assembly modulators, reverse transcriptase inhibitors, cyclophilin/TNF inhibitors, TLR agonists, HBV vaccines, and any combination thereof.

(I-2) 其中R ¹-R ⁵如在式 (I) 中所定義，並且LG表示合適的離去基團（例如像溴）；與具有式 (V) 之化合物

(V) 其中R ⁶-R ⁸、X和L如在式 (I) 中所定義； 在合適的親核取代條件（例如，在合適的鹼（例如像三乙醇胺）的存在下）下反應。 In yet another aspect, there is provided a method for producing a compound of formula (I) as described herein, the method comprising: making a compound of formula (I-2)

(I-2) wherein R ¹ -R ⁵ are as defined in formula (I), and LG represents a suitable leaving group (such as bromine for example); with a compound of formula (V)

(V) wherein R ⁶ -R ⁸ , X and L are as defined in formula (I); reacting under suitable nucleophilic substitution conditions (eg in the presence of a suitable base like eg triethanolamine).

Provided herein are compounds useful for treating and preventing HBV infection in a subject, for example, a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof.

Without being bound by any particular mechanism of action, it is believed that these compounds modulate or disrupt HBV assembly and other HBV core protein functions necessary for HBV replication or infectious particle production and/or may disrupt HBV capsid assembly, producing Infectious or replication-competent empty shells. In other words, the compounds provided herein can act as modulators of capsid assembly.

There remains a need for compounds having HBV antiviral activity balanced with favorable properties (eg potent antiviral activity, favorable metabolic properties, tissue distribution, safety and pharmaceutical properties) and suitable for use in humans. It is therefore an object of the present invention to provide compounds which overcome at least some of these problems. The disclosed compounds can modulate (eg, accelerate, delay, inhibit, disrupt, or reduce) normal viral capsid assembly or disassembly, bind capsids or alter the metabolism of cellular polyproteins and precursors. Regulation can occur when capsid proteins mature or during viral infection. The disclosed compounds can be used in methods of modulating the activity or properties of HBV cccDNA, or the production or release of HBV RNA particles from infected cells.

In one embodiment, the compounds described herein may be suitable for monotherapy and may be effective against natural or natural HBV strains and HBV strains resistant to currently known drugs. In another embodiment, the compounds described herein may be suitable for use in combination therapy. definition

Definitions of various terms used to describe the present invention are listed below. These definitions apply to those terms used throughout the specification and claims, either alone or as part of a larger group, unless otherwise limited to a specific instance.

Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by those skilled in the art. Generally, the nomenclature and laboratory procedures in cell culture, molecular genetics, organic chemistry and peptide chemistry used herein are those well known and commonly used in the art.

As used herein, the articles "a and an" refer to one or more than one (ie, at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. Furthermore, the use of the term "including" as well as other forms such as "include", "includes" and "included" is not limiting.

As used herein, the term "about" will be understood by those skilled in the art and will vary somewhat depending on the context in which it is used. As used herein, the term "about" when referring to a measurable value such as amount, duration, etc., is intended to cover ± 20% or ± 10% (including ± 5%, ± 1% and ± 0.1% ) as such changes are appropriate for the method of carrying out the disclosure.

As used herein, the term "capsid assembly modulator" refers to disrupting or accelerating or inhibiting or hindering or delaying or reducing or modifying normal capsid assembly (e.g., during maturation) or normal capsid disassembly (e.g., during infection) Or compounds that perturb capsid stability thereby inducing abnormal capsid morphology and function. In one embodiment, a shell assembly modulator accelerates shell assembly or disassembly, thereby inducing abnormal shell morphology. In another embodiment, the capsid assembly modulator interacts with the major capsid assembly protein (CA) (e.g., binds to it at the active site, binds to it at the allosteric site, modifies or hinders folding, etc.), thereby disrupting Shell assembly or disassembly. In yet another embodiment, the capsid assembly modulator causes a perturbation in the structure or function of CA (e.g., the ability of CA to assemble, disassemble, bind to a substrate, fold into a suitable conformation, etc.), which attenuates viral infectivity or Deadly to viruses.

As used herein, the term "treatment" or "treating" is defined as the application or administration of a therapeutic agent, i.e., a disclosed compound (alone or in combination with another agent), to a patient, or to an isolated tissue or cell from a patient. is the application or administration of a therapeutic agent (e.g., for diagnosis or ex vivo application) to a patient suffering from HBV infection, symptoms of HBV infection, or likelihood of developing HBV infection, for the purpose of curing, curing, alleviating, alleviating, changing , remedy, ameliorate, improve or affect HBV infection, the symptoms of HBV infection, or the likelihood of developing HBV infection. Such treatments may be specifically tailored or modified based on knowledge gained from the field of pharmacogenomics.

As used herein, the term "prevent" or "prevention" means the absence of development of a disorder or disease, if the disorder or disease has not occurred, or the absence of further development of the disorder or disease, if the disorder or disease has already been developed. Also contemplated is the ability to prevent some or all of the symptoms associated with the disorder or disease.

As used herein, the term "patient", "individual" or "subject" refers to a human or non-human mammal. Non-human mammals include, for example, domestic animals as well as pets such as ovine, bovine, porcine, canine, feline, and murine mammals. Preferably, a patient, subject or individual.

As used herein, the terms "effective amount", "pharmaceutically effective amount" and "therapeutically effective amount" refer to a non-toxic but sufficient amount of a pharmaceutical to provide the desired biological result. The result may be a reduction or alleviation of a disease sign, symptom, or cause, or any other desired change in a biological system. The appropriate therapeutic amount in any individual case can be determined by one skilled in the art using routine experimentation.

As used herein, the term "pharmaceutically acceptable" refers to a material (such as a carrier or diluent) that does not abrogate the biological activity or properties of the compound and is relatively nontoxic, i.e., it can be administered to an individual without causing undesirable effects. biological effects or interact in a harmful manner with any component of the composition containing the material.

As used herein, the term "pharmaceutically acceptable salt" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety into its salt form. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali metal or organic salts of acidic residues such as carboxylic acids; and the like. Pharmaceutically acceptable salts of the present invention include, for example, conventional non-toxic salts of the parent compound formed from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound containing a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of the compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent or in a mixture of both; usually, non-aqueous Media like ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred. A list of suitable salts is found in Remington's Pharmaceutical Sciences [Remington Pharmaceutical Sciences], 18th Edition, Mack Publishing Company [Mark Publishing Company], Easton, Pa., 1990, p. 1445 and Journal of Pharmaceutical Science [Pharmaceutical Science Magazine ], 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety.

As used herein, the term "composition" or "pharmaceutical composition" refers to a mixture of at least one compound useful in the present invention and a pharmaceutically acceptable carrier. Pharmaceutical compositions facilitate administration of a compound to a patient or subject. Various techniques for administering compounds exist in the art, including but not limited to intravenous, oral, aerosol, parenteral, ophthalmic, pulmonary, and topical administration.

As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersant, suspending agent, diluent, excipient, Thickeners, solvents or encapsulating materials involved in carrying or transporting or transporting a compound useful in the present invention within a patient so that it can perform its intended function. Typically, such constructs are carried or transported from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation, including the compounds useful in this invention, and not injurious to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethyl Cellulose and cellulose acetate; powdered gum tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffers, such as magnesium hydroxide and hydrogen Alumina; surfactants; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; phosphate buffered saline; and other nontoxic compatible substances used in pharmaceutical formulations.

As used herein, "pharmaceutically acceptable carrier" also includes any and all coating agents, antibacterial agents, and antibacterial agents that are compatible with the activity of the compounds useful in this invention and that are physiologically acceptable to the patient. Fungal agents and absorption delaying agents, etc. Supplementary active compounds can also be incorporated into the compositions. "Pharmaceutically acceptable carrier" may further include pharmaceutically acceptable salts of the compounds that can be used in the present invention. Other additional ingredients that may be included in pharmaceutical compositions useful in the practice of the present invention are known in the art and described, for example, in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences) (Edited by Genaro, Mack Publishing Co. ], 1990, Easton, PA), which is incorporated herein by reference.

As used herein, unless otherwise stated, the term "alkyl" means by itself or as part _{of another substituent a straight or branched chain hydrocarbon (i.e., C 1-3 alkane} The radical means an alkyl group having one to three carbon atoms, the C _1-4 alkyl group means an alkyl group having one to _four carbon atoms and includes straight or branched chains, and the C _1-6 alkyl group means an alkyl group having one to _six Alkyl of carbon atoms and includes straight chain or branched chain, C ₁ -C ₉ alkyl means an alkyl group having one to nine carbon atoms and includes straight chain or branched chain). Examples include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl. _{Examples of alkyl include, but are not limited to, C 1-9 alkyl} , C _{1-6 alkyl} , and C _1-4 alkyl _.

As used herein, the term "alkylene" by itself or as part of another substituent refers to a divalent alkyl linking group. An alkylene group corresponds formally to an alkane in which two CH bonds are replaced by the point of attachment of the alkylene group to the rest of the compound. The term "C _nm alkylene" refers to an alkylene group having n to m carbon atoms. Examples of alkylene groups include, but are not limited to, eth-1,2-diyl, eth-1,1-diyl, prop-1,3-diyl, prop-1,2-diyl, prop-1 ,1-diyl, butan-1,4-diyl, butan-1,3-diyl, butan-1,2-diyl, 2-methyl-propan-1,3-diyl, etc.

As used herein, unless otherwise stated, the term "halo" or "halogen" by itself or as part of another substituent means a fluorine, chlorine, bromine or iodine atom, preferably fluorine, chlorine or bromine, more preferably Fluorine or chlorine is preferred.

Whenever the term "substituted" is used in the present invention, unless otherwise indicated or clear from the context, it is intended to indicate one or more hydrogens on the atom or group indicated in the expression using "substituted" (specifically is 1 to 3 hydrogens, preferably 1 or 2 hydrogens, more preferably 1 hydrogen) is replaced by an option from the indicated group, provided that the normal valences are not exceeded and the substitution results in A chemically stable compound (ie, a compound sufficiently robust to withstand isolation to a useful level of purity from a reaction mixture and formulate as a therapeutic agent) is obtained.

When two or more substituents are present on a moiety, unless otherwise indicated or clear from the context, those substituents may replace hydrogens on the same atom, or may replace different substituents on the moiety. hydrogen atoms on atoms.

As used herein, the term "selected from..." (for example, R1 is selected from ^A , B and C) is understood to be equivalent to the term "selected from the group consisting ^of : ..." (for example, "R1 is selected from group consisting of: A, B, and C").

A dashed line through a bond indicates where one part joins another.

(a) 其中 R ^a1選自OH和C _1-3烷基氧基，並且 R ^a2選自C _1-3烷基， 或 R ^a1選自鹵素，並且 R ^a2選自C _1-3烷基。 In one embodiment, L is a group of formula (a)

(a) wherein R ^a1 is selected from OH and C _1-3 alkyloxy, and R ^a2 is selected from C _1-3 alkyl, or R ^a1 is selected from halogen, and R ^a2 is selected from C _1-3 alkyl.

(a) 其中 R ^a1選自OH、CH ₃O和C ₂H ₅O，並且 R ^a2係CH ₃或C ₂H ₅， 或 R ^a1係F或Cl， R ^a2係CH ₃或C ₂H ₅。 In a particular embodiment, L is a group of formula (a)

(a) wherein R ^a1 is selected from OH, CH ₃ O and C ₂ H ₅ O, and R ^a2 is CH ₃ or C ₂ H ₅ , or R ^a1 is F or Cl, and R ^a2 is CH ₃ or C ₂ H ₅ .

(b) 其中 R ^b1選自鹵素、OH和C _1-3烷基氧基， R ^b2選自C _1-3烷基， R ^b3和R ^b4係H， 或 R ^b1和R ^b2獨立地選自H和C _1-3烷基； R ^b3選自鹵素、OH和C _1-3烷基氧基， R ^b4係H， 或 R ^b1和R ^b2獨立地選自H和C _1-3烷基； R ^b3選自鹵素， R ^b4選自鹵素和C _1-3烷基， 或 R ^b1和R ^b2獨立地選自H和C _1-3烷基； R ^b3選自OH和C _1-3烷基氧基， R ^b4係C _1-3烷基。 In one embodiment, L is a group of formula (b)

(b) wherein R ^b1 is selected from halogen, OH and C _1-3 alkyloxy, R ^{b2 is} selected from C _1-3 alkyl, R ^b3 and R ^b4 are H, or R ^b1 and R ^b2 are independently selected from H and C _1-3 alkyl; R ^b3 is selected from halogen, OH and C _1-3 alkyloxy, R ^b4 is H, or R ^b1 and R ^b2 are independently selected from H and C _1-3 alkyl; R ^b3 is selected from halogen, R ^b4 is selected from halogen and C _1-3 alkyl, or R ^b1 and R ^b2 are independently selected from H and C _1-3 alkyl; R ^b3 is selected from OH and C _1-3 alkyl Oxygen, R ^b4 is C _1-3 alkyl.

(b) 其中 R ^b1選自F、Cl、OH、CH ₃O和C ₂H ₅O， R ^b2係CH ₃或C ₂H ₅， R ^b3和R ^b4係H， 或 R ^b1和R ^b2獨立地選自H、CH ₃和C ₂H ₅， R ^b3選自F、Cl、OH、CH ₃O和C ₂H ₅O， R ^b4係H， 或 R ^b1和R ^b2獨立地選自H、CH ₃和C ₂H ₅， R ^b3係F或Cl， R ^b4選自F、Cl、CH ₃和C ₂H ₅， 或 R ^b1和R ^b2獨立地選自H、CH ₃和C ₂H ₅， R ^b3選自OH、CH ₃O和C ₂H ₅O， R ^b4係CH ₃或C ₂H ₅。 In a particular embodiment, L is a group of formula (b)

(b) wherein R ^b1 is selected from F, Cl, OH, CH ₃ O and C ₂ H ₅ O, R ^b2 is CH ₃ or C ₂ H ₅ , R ^b3 and R ^b4 are H, or R ^b1 and R ^b2 are independent is selected from H, CH ₃ and C ₂ H ₅ , R ^b3 is selected from F, Cl, OH, CH ₃ O and C ₂ H ₅ O, R ^b4 is H, or R ^b1 and R ^b2 are independently selected from H, CH ₃ and C ₂ H ₅ , R ^b3 is F or Cl, R ^b4 is selected from F, Cl, CH ₃ and C ₂ H ₅ , or R ^b1 and R ^b2 are independently selected from H, CH ₃ and C ₂ H ₅ , R ^b3 is selected from OH, CH ₃ O and C ₂ H ₅ O, R ^b4 is CH ₃ or C ₂ H ₅ .

(c) 其中 R ^c1選自鹵素、OH和C _1-3烷基氧基， R ^c2選自C _1-3烷基， R ^c3、R ^c4、R ^c5和R ^c6係H， 或 R ^c1和R ^c2獨立地選自H和C _1-3烷基； R ^c3選自鹵素、OH和C _1-3烷基氧基， R ^c4、R ^c5和R ^c6係H， 或 R ^c1和R ^c2獨立地選自H和C _1-3烷基； R ^c3和R ^c4係H， R ^c5選自鹵素、OH和C _1-3烷基氧基， R ^c6選自H和C _1-3烷基， 或 R ^c1和R ^c2獨立地選自H和C _1-3烷基； R ^c3和R ^c4係H， R ^c5和R ^c6係鹵素。 In one embodiment, L is a group of formula (c)

(c) wherein R ^c1 is selected from halogen, OH and C _1-3 alkyloxy, R ^c2 is selected from C _1-3 alkyl, R ^c3 , R ^c4 , R ^c5 and R ^c6 are H, or R ^c1 and R ^c2 is independently selected from H and C _1-3 alkyl; R ^c3 is selected from halogen, OH and C _1-3 alkyloxy, R ^c4 , R ^c5 and R ^c6 are H, or R ^c1 and R ^c2 are independent is selected from H and C _1-3 alkyl; R ^c3 and R ^C4 are H, R ^C5 is selected from halogen, OH and C _1-3 alkyloxy, R ^C6 is selected from H and C _1-3 alkyl, Or R ^c1 and R ^c2 are independently selected from H and C _1-3 alkyl; R ^c3 and R ^c4 are H, R ^c5 and R ^c6 are halogen.

(c) 其中 R ^c1選自F、Cl、OH、CH ₃O和C ₂H ₅O， R ^c2係CH ₃或C ₂H ₅， R ^c3、R ^c4、R ^c5和R ^c6係H， 或 R ^c1和R ^c2獨立地選自H、CH ₃和C ₂H ₅， R ^c3選自F、Cl、OH、CH ₃O和C ₂H ₅O， R ^c4、R ^c5和R ^c6係H， 或 R ^c1和R ^c2獨立地選自H、CH ₃和C ₂H ₅， R ^c3和R ^c4係H， R ^c5選自F、Cl、OH、CH ₃O和C ₂H ₅O， R ^c6選自H、CH ₃和C ₂H ₅， 或 R ^c1和R ^c2獨立地選自H、CH ₃和C ₂H ₅， R ^c3和R ^c4係H， R ^c5和R ^c6係F或Cl。 In a particular embodiment, L is a group of formula (c)

(c) wherein ^Rc1 is selected from F, _Cl , OH, ^CH3O and _C2H5O , ^Rc2 is _CH3 or _C2H5 , ^Rc3 , ^Rc4 , _Rc5 and _Rc6 ^are H, or R ^c1 and R ^c2 are independently selected from H, CH ₃ and C ₂ H ₅ , R ^c3 is selected from F, Cl, OH, CH ₃ O and C ₂ H ₅ O, R ^c4 , R ^c5 and R ^c6 are H, Or R ^c1 and R ^c2 are independently selected from H, CH ₃ and C ₂ H ₅ , R ^c3 and R ^c4 are H, R ^c5 is selected from F, Cl, OH, CH ₃ O and C ₂ H ₅ O, R ^c6 is selected from H, CH ₃ and C ₂ H ₅ , or R ^c1 and R ^c2 are independently selected from H, CH ₃ and C ₂ H ₅ , R ^c3 and R ^c4 are H, R ^c5 and R ^c6 are F or Cl.

(d) 其中 R ^d1和R ^d2獨立地選自C _1-3烷基， R ^d3、R ^d4、R ^d5和R ^d6係H， R ^d8選自鹵素、OH和C _1-3烷基氧基， R ^d9選自H和C _1-3烷基， 或 R ^d1和R ^d2獨立地選自H和C _1-3烷基， R ^d3、R ^d4、R ^d5和R ^d6係H， R ^d8和R ^d9係鹵素。 In one embodiment, L is a group of formula (d)

( ^d ) wherein Rd1 and ^Rd2 are independently selected from C _1-3 alkyl, ^Rd3 , ^Rd4 , ^Rd5 and ^Rd6 are H, and ^Rd8 is selected from halogen, OH and C _1-3 alkyloxy , R ^d9 is selected from H and C _1-3 alkyl, or R ^d1 and R ^d2 are independently selected from H and C _1-3 alkyl, R ^d3 , R ^d4 , R ^d5 and R ^d6 are H, R ^d8 and R ^d9 is a halogen.

(d) 其中 R ^d1和R ^d2獨立地選自CH ₃和C ₂H ₅， R ^d3、R ^d4、R ^d5和R ^d6係H， R ^d8選自F、Cl、OH、CH ₃O和C ₂H ₅O， R ^d9選自H、CH ₃和C ₂H _{5 ，}或 R ^d1和R ^d2獨立地選自H、CH ₃和C ₂H ₅， R ^d3、R ^d4、R ^d5和R ^d6係H， R ^d8和R ^d9係F或Cl。 In a particular embodiment, L is a group of formula (d)

( ^d ) wherein Rd1 and ^Rd2 are independently selected from _CH3 and _C2H5 , ^Rd3 , ^Rd4 , _Rd5 and ^Rd6 are H, and ^{Rd8 is} selected from F, _Cl , OH, CH3O and C ₂ H ₅ O, R ^d9 is selected from H, CH ₃ and C ₂ H _{5 ,} or R ^d1 and R ^d2 are independently selected from H, CH ₃ and C ₂ H ₅ , R ^d3 , R ^d4 , R ^d5 and R ^d6 is H, ^Rd8 and ^Rd9 are F or Cl.

^In one embodiment, R is H.

In one embodiment, L-COOR ⁸ is selected from the group consisting of:

In one embodiment, X is O.

In one embodiment, R ¹ , R ² and R ³ are each independently selected from the group consisting of H, F, Cl, CN and CH ₃ .

^In one embodiment, R4 is selected from the group consisting of thiazolyl, imidazolyl and oxazolyl, each of which may optionally be substituted with one _CH3 .

In a particular embodiment, R is selected from the group consisting of thiazol- ² -yl, 1-methyl-imidazol-2-yl, and 5-methyl-oxazol-4-yl; more specifically, Thiazol-2-yl and 5-methyl-oxazol-4-yl.

_In one embodiment, _R5 is _CH3 or ^C2H5 .

_In other embodiments, R6 and ^R7 are independently selected from H and ^CH3 .

All combinations of the foregoing embodiments are expressly included.

Embodiments relate to compounds selected from the group consisting of:

Preferred compounds according to the present invention are compounds having formulas as represented in Compound Synthesis Section and Table 1 or stereoisomers or tautomeric forms thereof, and their activities are shown in Table 3.

The disclosed compounds may possess one or more stereocenters, and each stereocenter may independently exist in the R or S configuration. Although the compounds themselves have been isolated as single stereoisomers and are enantiomerically/diastereomerically pure, when the absolute stereochemistry of a stereocenter has not been determined, the stereoconfiguration at the indicated center may be assigned as (*).

In one embodiment, the compounds described herein exist in optically active or racemic forms. It is to be understood that the compounds described herein encompass racemic, optically active, regioisomeric and stereoisomeric forms or combinations thereof which possess the therapeutically useful properties described herein.

Preparation of the optically active form is accomplished in any suitable manner, including, by way of non-limiting examples, by resolution of the racemic form using recrystallization techniques, synthesis from optically active starting materials, chiral synthesis, or use of chiral stationary phases. Chromatographic separation. In one embodiment, a mixture of one or more isomers is used as a disclosed compound described herein. In another embodiment, the compounds described herein contain one or more chiral centers. Such compounds are prepared by any means including stereoselective synthesis, enantiomer-selective synthesis or separation of enantiomers or mixtures of diastereomers. Resolution of compounds and isomers thereof is achieved by any means including, by way of non-limiting examples, chemical methods, enzymatic methods, fractional crystallization, distillation, and chromatography.

When the absolute R or S stereochemistry of a compound cannot be determined, it can be determined by the retention time after chromatography under the specific chromatographic conditions as determined by the chromatography column, eluent, and the like.

For some compounds, although the compound itself has been split as a single stereoisomer and is enantiomerically/diastereomerically pure, the stereochemical configuration at the indicated center has been assigned when the absolute stereochemistry has not been determined For "R*", "S*".

In one embodiment, the disclosed compounds may exist as tautomers. All tautomers are included within the scope of the compounds provided herein.

Compounds described herein also include isotopically labeled compounds in which one or more atoms are replaced by an atom having the same atomic number but an atomic mass or mass number different from that normally found in nature. Examples of isotopes suitable for inclusion in the compounds described herein include, but are not limited to, ² H, ³ H, ¹¹ C, ¹³ C, ¹⁴ C, ³⁶ Cl, ¹⁸ F, ¹²³ I, ¹²⁵ I, ¹³ N, ¹⁵ N, ¹⁵ O, ¹⁷ O, ¹⁸ O, ³² P and ³⁵ S. In one embodiment, isotopically labeled compounds are useful in drug and/or substrate tissue distribution studies. In another embodiment, substitution with heavier isotopes such as deuterium provides greater metabolic stability (eg, increased in vivo half-life or reduced dosage requirements).

In yet another embodiment, substitution with positron emitting isotopes such as ¹¹ C, ¹⁸ F, ¹⁵ O and ¹³ N can be used in positron emission tomography (PET) studies examining substrate acceptor occupancy. Isotopically labeled compounds are prepared by any suitable method or by using an appropriate isotopically labeled reagent in place of an otherwise used unlabeled reagent.

In one embodiment, the compounds described herein are labeled by other means including, but not limited to, the use of chromophores or fluorescent moieties, bioluminescent or chemiluminescent labels.

The compounds described herein and other related compounds having various substituents are synthesized using the techniques and materials described herein as well as techniques known to those skilled in the art. General methods for the preparation of compounds described herein are modified by the use of appropriate reagents and conditions in order to introduce each moiety as shown in the formulas provided herein.

The compounds described herein are synthesized using any suitable procedure, starting from compounds available from commercial sources or prepared using the procedures described herein. General synthetic schemes are given in the Examples below.

(I-2) 其中R ¹-R ⁵如在式 (I) 中所定義，並且LG表示合適的離去基團（例如像溴）；與具有式 (V) 之化合物

(V) 其中R ⁶-R ⁸、X和L如在式 (I) 中所定義； 在合適的親核取代條件（例如，在合適的鹼（例如像三乙醇胺）的存在下）下反應。 方法及用途 Accordingly, there is provided a process for the preparation of a compound of formula (I), wherein said process comprises making a compound of formula (I-2)

(I-2) wherein R ¹ -R ⁵ are as defined in formula (I), and LG represents a suitable leaving group (such as bromine for example); with a compound of formula (V)

(V) wherein R ⁶ -R ⁸ , X and L are as defined in formula (I); reacting under suitable nucleophilic substitution conditions (eg in the presence of a suitable base like eg triethanolamine). Method and use

Provided herein are methods of treating HBV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of a disclosed compound.

Also provided herein is a method of eradicating HBV infection in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a disclosed compound.

Provided herein is a method of reducing viral load associated with HBV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of a disclosed compound.

Additionally, provided herein are methods of reducing recurrence of HBV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of a disclosed compound.

Provided herein are methods of inhibiting or reducing the formation or presence of HBV DNA-containing particles or HBV RNA-containing particles in an individual in need thereof, the methods comprising administering to the individual a therapeutically effective amount of a disclosed compound.

When the present invention is said to relate to a method of treating an individual, it should be understood that such a method should in some jurisdictions be construed as medical use, for example a compound or composition according to the invention for the treatment of an individual; or a method or Use of the composition for the manufacture of a medicament, in particular for the treatment of an individual. Thus, for example, the invention also relates to compounds or pharmaceutical compositions disclosed herein for use in the prevention or treatment of HBV infection. Also provided herein are compounds or pharmaceutical compositions disclosed herein for use in reducing viral load associated with HBV infection. Further provided herein is a compound or pharmaceutical composition disclosed herein for use in reducing recurrence of HBV infection in an individual. Also provided herein is a compound or pharmaceutical composition disclosed herein for use in inhibiting or reducing the formation or presence of HBV DNA-containing particles or HBV RNA-containing particles in an individual.

In certain aspects, the methods, uses, and/or compositions described herein have an effect on inhibiting or reducing in vitro or in vivo (e.g., in a cell, in a tissue, in an organ (e.g., in the liver), in a biological Body, etc.) The formation or presence of HBV-associated particles is valid. HBV-associated particles may contain HBV DNA (ie, linear and/or covalently closed circular DNA (cccDNA)) and/or HBV RNA (ie, pregenomic RNA and/or subgenomic RNA). Thus, HBV-associated particles include HBV DNA-containing particles or HBV RNA-containing particles.

As used herein, "HBV-associated particle" refers to both infectious HBV virions (ie, Dane particles) and non-infectious HBV subviral particles (ie, HBV filaments and/or HBV spheres). The HBV virion comprises an outer envelope comprising surface proteins, a nucleocapsid comprising a core protein, at least one polymerase protein and the HBV genome. HBV filaments and HBV spheres contain HBV surface proteins but lack core protein, polymerase and HBV genome. HBV filaments and HBV bodies are also collectively referred to as surface antigen (HBsAg) particles. HBV spheres contain neutralizing small HBV surface proteins. HBV filaments also include medium, small and large HBV surface proteins.

HBV subviral particles may include nonparticulate or secreted HBeAg, which serves as a marker of active HBV replication.

Provided herein are methods of reducing the adverse physiological effects of HBV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of a disclosed compound.

Also provided herein is a method of reducing, slowing or inhibiting HBV infection in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a disclosed compound.

Provided herein is a method of inducing reversal of liver injury from HBV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of a disclosed compound.

Provided herein are methods of reducing the physiological effects of long-term antiviral treatment of HBV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of a disclosed compound.

Provided herein are methods of prophylactically treating HBV infection in an individual in need thereof, wherein the individual has a latent HBV infection, the method comprising administering to the individual a therapeutically effective amount of a disclosed compound.

Also provided herein is a compound or pharmaceutical composition disclosed herein for use in reducing adverse physiological effects of HBV infection in an individual. Also provided herein is a compound or pharmaceutical composition disclosed herein for use in reducing, slowing down or inhibiting HBV infection in a subject. Also provided herein is a compound or pharmaceutical composition disclosed herein for use in inducing reversal of liver damage caused by HBV infection in an individual.

Also provided herein are compounds or pharmaceutical compositions disclosed herein for use in reducing the physiological impact of long-term antiviral therapy on HBV infection in an individual. Further provided herein is a compound or pharmaceutical composition disclosed herein for use in the prophylactic treatment of HBV infection in an individual, wherein the individual has a latent HBV infection.

In one embodiment, HBV drugs of other therapeutic classes (e.g., HBV polymerase inhibitors, interferons, viral entry inhibitors, viral maturation inhibitors, capsid assembly modulators described in the literature, different or unknown mechanism antiviral compounds, etc. or combinations thereof) refractory. In another embodiment, the disclosed methods or uses reduce the viral load in an individual with HBV infection to a greater extent or at a faster rate than other therapeutic classes of HBV drugs reduce the viral load in an individual with HBV infection. Viral load in an individual.

In one embodiment, the disclosed compound, or a pharmaceutically acceptable salt thereof, is compared to the administration alone of at least one additional therapeutic agent required to achieve similar results in the prophylactic treatment of HBV infection in an individual in need thereof. The administration of allows the at least one additional therapeutic agent to be administered at a lower dose or frequency.

In one embodiment, administration of a disclosed compound, or a pharmaceutically acceptable salt thereof, reduces in the subject to a greater extent or faster than administration of a compound selected from the group consisting of: Viral load, the group consisting of: HBV polymerase inhibitors, interferons, viral entry inhibitors, viral maturation inhibitors, different capsid assembly modulators, antiviral compounds of different or unknown mechanisms, and any combination thereof .

In one embodiment, the disclosed methods or uses reduce the viral load in an individual with HBV infection, thereby allowing the use of lower doses or different regimens of combination therapy.

In one embodiment, the disclosed methods or uses result in a lower incidence of viral mutation or viral resistance compared to other classes of HBV drugs, thereby allowing long-term treatment and minimizing the need for changes in treatment regimens.

In one embodiment, administration of a compound of the invention, or a pharmaceutically acceptable salt thereof, results in a lower incidence of viral mutation or viral resistance compared to administration of a compound selected from the group The group consists of: HBV polymerase inhibitors, interferons, viral entry inhibitors, viral maturation inhibitors, different capsid assembly modulators, antiviral compounds of different or unknown mechanisms, and combinations thereof.

In one embodiment, the disclosed methods or uses increase the rate of seroconversion from HBV infection to non-HBV infection or from detectable HBV viral load to undetectable HBV viral load beyond that of current treatment regimens. As used herein, "seroconversion" refers to the period of time during which HBV antibodies are produced and become detectable.

In one embodiment, the disclosed methods or uses increase or normalize or restore normal health, cause complete restoration of normal health, restore life expectancy, or resolve viral infection in an individual in need thereof.

In one embodiment, the disclosed methods or uses eliminate or reduce the number of HBV RNA particles released from HBV-infected cells, thereby enhancing, prolonging or increasing the therapeutic benefit of the disclosed compounds.

In one embodiment, the disclosed methods or uses eradicate HBV in an HBV-infected individual, thereby avoiding the need for long-term or life-long treatment, or shortening the duration of treatment, or allowing for reduced administration of other antiviral agents.

In another embodiment, the disclosed method or use further comprises monitoring or detecting the HBV viral load of the subject, and wherein the method is performed for a period of time, including until the HBV virus is undetectable.

Accordingly, in one embodiment, provided herein is a method of treating HBV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof.

Accordingly, in one embodiment, provided herein is a method of treating HBV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof.

In another embodiment, provided herein is a method of treating HBV infection in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of a compound according to the invention (such as those of Table 1) or a pharmaceutically acceptable amount thereof. Accepted salt.

In one embodiment of any of the methods provided herein, the method or use can further comprise monitoring the subject's HBV viral load, wherein the method is performed for a period of time such that HBV virus is undetectable. combination therapy

The disclosed compounds may be used in combination with one or more additional compounds useful in the treatment of HBV infection. Such additional compounds may include other disclosed compounds and/or compounds known to be useful in treating, preventing or reducing the symptoms or effects of HBV infection. Such compounds include, but are not limited to, HBV polymerase inhibitors, interferons, viral entry inhibitors, viral maturation inhibitors, capsid assembly modulators described in the literature, reverse transcriptase inhibitors, immunomodulatory agents, TLRs Agonists and other agents with different or unknown mechanisms that affect the HBV life cycle or affect the outcome of HBV infection, for example, additional compounds may include HBV combination drugs, HBV vaccines, HBV DNA polymerase inhibitors, immunomodulators , toll-like receptor (TLR) modulator, interferon α receptor ligand, hyaluronidase inhibitor, hepatitis B surface antigen (HBsAg) inhibitor, cytotoxic T lymphocyte-associated protein 4 (ipi4) inhibitor Cyclophilin inhibitors, HBV viral entry inhibitors, antisense oligonucleotides targeting viral mRNA, short interfering RNA (siRNA) and ddRNAi endonuclease modulators, ribonucleotide reductase inhibitors, HBV E antigen inhibitors, covalently closed circular DNA (cccDNA) inhibitors, farnesoid X receptor agonists, HBV antibodies, CCR2 chemokine antagonists, thymosin agonists, cytokines, nuclear protein regulation Retinoic acid-inducible gene 1 stimulator, NOD2 stimulator, phosphatidylinositol 3-kinase (PI3K) inhibitor, indoleamine-2,3-dioxygenase (IDO) pathway inhibitor, PD-1 inhibitor , PD-L1 inhibitors, recombinant thymosin α-1, Bruton's tyrosine kinase (BTK) inhibitors, KDM inhibitors, HBV replication inhibitors, arginase inhibitors and other HBV drugs.

In a non-limiting example, the disclosed compounds may be used in combination with one or more drugs (or salts thereof) selected from the group consisting of: HBV reverse transcriptase inhibitors, and DNA and RNA polymerase inhibitors.

In one embodiment, the additional therapeutic agent is an interferon. The term "interferon" or "IFN" refers to any member of a family of highly homologous species-specific proteins that inhibit viral replication and cellular proliferation and modulate immune responses. Human interferons are divided into three classes: Type I, Type II, and Type III. The term "interferon" as used herein includes recombinant forms of interferon that have been developed and are commercially available. The term "interferon" as used herein also includes subtypes of interferon, such as chemically modified or mutated interferon.

Thus, in one embodiment, a compound of formula (I) may be administered in combination with an interferon.

In another embodiment, the additional therapeutic agent is selected from immunomodulatory or immunostimulant therapy, including biological agents belonging to the interferon class.

Furthermore, the additional therapeutic agent can be an agent of a different or unknown mechanism, including an agent that disrupts the function of one or more other essential viral or host proteins required for HBV replication or persistence.

In another embodiment, the additional therapeutic agent is an antiviral agent that blocks viral entry or maturation or targets HBV polymerase, such as a nucleoside or nucleotide or non-nucleoside (nucleotide) polymerase inhibitor.

In one embodiment, the additional therapeutic agent is an immunomodulator that induces a natural limited immune response, resulting in the induction of an immune response against an unrelated virus. In other words, immunomodulators can affect the maturation of antigen-presenting cells, the proliferation of T cells, and the release of cytokines (eg, IL-12, IL-18, IFN-α, IFN-β, and IFN-γ and TNF-α Wait).

In another embodiment, the additional therapeutic agent is a TLR modulator or a TLR agonist, such as a TLR-7 agonist or a TLR-9 agonist.

In any of the methods provided herein, the method can further comprise administering to the individual at least one HBV vaccine, nucleoside HBV inhibitor, interferon, or any combination thereof.

In one embodiment, the methods described herein further comprise administering at least one additional therapeutic agent selected from the group consisting of nucleotide/nucleoside analogs, entry inhibitors, fusion inhibitors agents and any combination of these or other antiviral mechanisms.

In another aspect, provided herein is a method of treating HBV infection in an individual in need thereof, the method comprising reducing the HBV viral load by administering to the individual a therapeutically effective amount of a disclosed compound, alone or in combination with a combination of transcriptase inhibitors; and further administering to the individual a therapeutically effective amount of the HBV vaccine.

In another aspect, provided herein is a method of treating HBV infection in an individual in need thereof, the method comprising reducing the HBV viral load by administering to the individual a therapeutically effective amount of a disclosed compound, alone or in combination with a target Combining antisense oligonucleotides or RNA interfering agents to HBV nucleic acid; and further administering a therapeutically effective amount of HBV vaccine to the individual. The antisense oligonucleotide or RNA interfering agent has sufficient complementarity to the target HBV nucleic acid to inhibit replication of the viral genome, transcription of viral RNA, or translation of viral proteins.

In another embodiment, a disclosed compound and at least one additional therapeutic agent are co-formulated. In yet another embodiment, a disclosed compound and at least one additional therapeutic agent are co-administered.

For any combination therapy described herein, the synergistic effect can be calculated using a suitable method, for example, the Sigmoid-E _max equation (Holford and Scheiner, 19981, Clin. Pharmacokinet. [Clinical Pharmacokinet] 6: 429-453), Loewe et al. Additive equations (Loewe and Muischnek, 1926, Arch. Exp. Pathol Pharmacol. [According to Experimental Pathology and Pharmacology] 114: 313-326) and median-effect equations (Chou and Talalay, 1984, Adv. Enzyme Regul. [Research Advances in Enzyme Regulation] 22: 27-55). Each of the equations mentioned above can be applied to experimental data to generate corresponding graphs illustrating the effects of evaluating drug combinations. The corresponding graphs associated with the above equations are concentration-response curves, isobologram curves and joint index curves, respectively.

In one embodiment of any of the methods of administering a combination therapy provided herein, the method can further comprise monitoring or detecting the subject's HBV viral load, wherein the method is performed for a period of time, including until the HBV virus is rendered undetectable time until. Administration/Dose/Formulation

In another aspect, provided herein are pharmaceutical compositions comprising at least one disclosed compound, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied to obtain an amount of the active ingredient effective for a particular patient, composition and mode of administration to achieve the desired therapeutic response without being toxic to the patient.

In particular, the selected dosage level will depend on a variety of factors, including the activity of the particular composition utilized, time of administration, rate of excretion of the compound, duration of treatment, other drugs, compounds or materials used in combination with the compound, The age, sex, weight, condition, general health and previous medical history of the patient being treated and similar factors are well known in the medical art.

A physician of ordinary skill in the art (eg, a physician or veterinarian) can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start administering the pharmaceutical composition at levels lower than required to achieve the desired therapeutic effect to administer the disclosed compound and gradually increase the dosage until the desired effect is achieved.

In embodiments, it is especially advantageous to formulate compounds in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patient to be treated; each unit containing a predetermined quantity of a disclosed compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle combination. The dosage unit forms of the present invention are dictated by and directly dependent on (a) the unique characteristics of the disclosed compounds and the particular therapeutic effect to be achieved, and (b) compounding/formulation for the treatment of HBV infection in a patient. There are limitations inherent in the field of such disclosed compounds.

In one embodiment, the compositions of the invention are formulated with one or more pharmaceutically acceptable excipients or carriers. In one embodiment, the pharmaceutical composition of the present invention comprises a therapeutically effective amount of a disclosed compound and a pharmaceutically acceptable carrier. Thus, illustrative of the present invention is a method of preparing a pharmaceutical composition comprising admixing at least one pharmaceutically acceptable carrier with a therapeutically effective amount of a disclosed compound.

In some embodiments, the dosage of the disclosed compounds is from about 1 mg to about 2,500 mg. Similarly, in some embodiments, the dose of the second compound (ie, another drug for HBV treatment) as described herein is less than about 1,000 mg.

In one embodiment, the present invention pertains to packaged pharmaceutical compositions comprising a container containing a therapeutically effective amount of a disclosed compound, alone or in combination with a second agent; and the use of the compound for the treatment, prophylaxis or instructions for reducing one or more symptoms of HBV infection in a patient.

Routes of administration for any composition of the invention include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical. Compounds for use in the present invention may be formulated for administration by any suitable route, such as for oral or parenteral, e.g., transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans)urethral , vaginal (eg, transvaginal and perivaginal), nasal (intra) and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastric, intrathecal, subcutaneous, intramuscular, intradermal, intraarterial, intravenous Intrabronchial, intrabronchial, inhalation and topical administration.

Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, capsules, lozenges, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels , powders, pellets, serums, lozenges, creams, pastes, plasters, lotions, wafers, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation substances, compositions and formulations for intravesical administration, and the like. It should be understood that the formulations and compositions useful in the present invention are not limited to the specific formulations and compositions described herein.

For oral administration, particularly suitable are tablets, dragees, liquids, drops, suppositories or capsules, caplets and capsules. Compositions intended for oral administration may be prepared according to any method known in the art, and such compositions may contain one or more agents selected from the group consisting of: Inert, non-toxic pharmaceutical excipient. Such excipients include, for example, inert diluents, such as lactose; granulating and disintegrating agents, such as corn starch; binders, such as starch; and lubricants, such as magnesium stearate. The tablets may be uncoated or they may be coated by known techniques in order to refine or delay the release of the active ingredient. Formulations for oral administration may also be presented as hard gelatin capsules in which the active ingredient is admixed with an inert diluent.

For parenteral administration, the disclosed compounds can be formulated for injection or infusion, eg, intravenous, intramuscular or subcutaneous injection or infusion, or for administration as a bolus dose or continuous infusion. Suspensions, solutions or emulsions in oily or aqueous vehicles, optionally with other formulatory agents such as suspending, stabilizing or dispersing agents, may be employed.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific procedures, implementations, claims, and examples described herein. Such equivalents are considered to be within the scope of this invention and are covered by the appended claims. For example, it is to be understood that using routine experimentation only, art-recognized substitutes for reaction conditions (including but not limited to reaction time, reaction size/volume) and experimental reagents such as solvent, catalyst, pressure, atmospheric conditions such as nitrogen atmosphere and reducing agent/oxidizing agent) are within the scope of this application.

It should be understood that wherever values and ranges are provided herein, all values and ranges encompassed by such values and ranges are intended to be included within the scope of the invention. In addition, all values falling within these ranges, as well as the upper or lower limits of that range of values, are also contemplated herein.

The following examples further illustrate aspects of the invention. However, they are in no way limiting of the teachings or disclosures of the invention described herein. Examples Example 1 : Chemistry

Several methods for preparing the compounds of the invention are illustrated below. All starting materials were obtained from commercial suppliers and used without further purification unless otherwise noted.

Hereinafter, ACN means acetonitrile, AcOH means acetic acid, Boc means tertiary butyloxycarbonyl, Bn means benzyl, calcd. means calculated, Cbz means benzyloxycarbonyl, col. means means column, conc. means concentrated, m-CPBA means 3-chloroperoxybenzoic acid, DAST means (diethylamino) sulfur trifluoride, DCM means dichloromethane, DEA means diethanolamine, DIEA means N,N-diisopropylethylamine, DMAP means 4-(dimethylamino)pyridine, DMF means dimethylformamide, DMP means Dess-Martin periodinane, EA means ethyl acetate, ee means excess enantiomer, ESI means electrospray ionization, HATU means 2-(7-azabenzotriazol-1-yl)-N,N,N', N'-tetramethyluronium hexafluorophosphate, Hex means hexane, HNMR means ¹ HNMR, HPLC means high performance liquid chromatography, IPA means isopropanol, LC-MS or LCMS means liquid Phase chromatography-mass spectrometry, LDA means lithium diisopropylamide, Ms means mesyl, PE means petroleum ether, PMB means 4-methoxybenzyl, prep. means prep, Prep - HPLC means preparative HPLC, _RT or Rt means retention time, _(s) or (s) means solid, sat. means saturation, TBAF means tetrabutylammonium fluoride, TBS means tertiary butylated ammonium fluoride Dimethylsilyl, TEA means triethylamine, THF means tetrahydrofuran, T or Temp means temperature, TsCl means 4-toluenesulfonyl chloride, t-BuOK means potassium tertiary butoxide, W means wavelength. Preparation of intermediates H series : general scheme 1

The preparation of compound 1-2 is shown in Scheme 1 above: Compound 1-1 can be prepared by condensation of aldehyde II , acetoacetate III and amidine IV in the presence of a base such as NaOAc. Using a brominating reagent (eg, like N-bromosuccinimide), in a suitable solvent (eg, carbon tetrachloride), under suitable reaction conditions (eg, like a temperature from about room temperature to about 60°C, Compound 1-2 is prepared from Compound 1-1 under an inert atmosphere (eg, nitrogen) for a sufficient period of time (typically 1 hour).

H1 （外消旋） H1A （ S 鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 8.22 (s, 0.5H), 7.82 (d, J= 3.2 Hz, 1H), 7.53 (s, 0.4H), 7.44 (s, 0.6H), 7.25 - 7.08 (m, 2.5H), 6.96 - 6.92 (s, 1H), 5.99 (s, 0.6H), 5.93 (s, 0.4H), 4.92 - 4.77 (m, 1.6H), 4.67 - 4.65 (m, 0.4H), 4.13 - 4.07 (m, 2H), 2.53 (s, 1.7H), 2.41 (s, 1.3H), 1.14 (t, J= 7.2 Hz, 3H)。

H2A （單一鏡像異構物） ¹HNMR (400 MHz, CD ₃OD) δ 7.92 (d, J= 3.2 Hz, 1H), 7.80 (d, J= 3.2 Hz, 0.5H), 7.70 (d, J= 3.2 Hz, 0.5H), 7.32 - 7.17 (m, 2H), 6.11 (s, 0.5H), 6.09 (s, 0.5H), 4.91 (d, J= 10.0 Hz, 0.5H), 4.81 (d, J= 10.0 Hz, 1H), 4.57 (d, J= 8.4 Hz, 0.5H), 3.64 (s, 1.5H), 3.62 (s, 1.5H)。

H3B （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 8.24 (s, 1H), 7.83 (d, J= 3.6 Hz, 1H), 7.54 - 7.45 (m, 1H), 7.00 - 6.93 (m, 2H), 5.91 (s, 1H), 4.94 - 4.80 (s, 21H), 3.66 (s, 3H), 2.56 - 2.45 (m, 3H)。

H4 （外消旋） H4A （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 8.25 (s, 0.3H), 7.85 (d, J= 3.2 Hz, 1H), 7.54 (d, J= 3.2 Hz, 0.6H), 7.47 -7.45 (m, 0.9H), 7.22 - 7.00 (m, 2.2H), 6.19 (s, 0.4H), 6.11 (d, J= 2.4 Hz, 0.6H), 4.97 (d, J= 11.2 Hz, 0.4H), 4.94 (d, J= 8.8 Hz, 0.6H), 4.73 (d, J= 11.2 Hz, 0.4H), 4.56 (d, J= 8.4 Hz, 0.6H), 4.16 - 4.04 (m, 2H), 1.19 - 1.13 (m, 3H)。  

H5A （單一鏡像異構物）  ¹HNMR (400 MHz, CDCl ₃) δ 7.83 (d, J= 2.8 Hz, 1H), 7.54 (d, J= 2.8 Hz, 0.4H), 7.44 (d, J= 2.8 Hz, 0.6H), 7.21 - 7.06 (m, 1H), 7.02 - 6.89 (m, 2H), 5.93 (s, 0.6H), 5.87 (d, J= 2.0 Hz, 0.4H), 4.93 (d, J= 11.6 Hz, 0.6H), 4.81 - 4.78 (m, 1H), 4.61 (d, J= 8.4 Hz, 0.4H), 4.11 - 4.06 (m, 2H), 2.56 (d, J= 2.0 Hz, 2H), 2.45 (d, J= 2.0 Hz, 1H), 1.19 - 1.13 (m, 3H)。

H6A （單一鏡像異構物） ¹HNMR (400 MHz, DMSO -d ₆ ) δ 8.15 - 7.91 (m, 2H), 7.41 - 7.31 (m, 2H), 7.26 - 7.24 (m, 1H), 6.03 (s, 1H), 4.99 - 4.68 (m, 2H), 3.56 (s, 3H)。

H7B （單一鏡像異構物） ¹HNMR (400 MHz, CD ₃OD) δ 8.13 (brs, 1H), 7.23-7.13 (m, 3H), 6.97-6.92 (brd, 1H), 5.97-5.91 (d, 1H),4.93-4.63 (m, 2H), 4.13-4.07 (m, 2H), 2.52-2.41 (m, 6H), 1.27-1.12 (m, 3H)

H8A ¹HNMR (400 MHz, CD ₃OD) δ 7.96 (s, 1H), 7.84 (d, J= 2.0 Hz, 0.5H), 7.76 (d, J= 2.4 Hz, 0.5H), 7.24 -7.12 (m, 3H), 6.04 (d, J= 6.0 Hz, 1H), 4.89 (s, 1H), 4.80 (d, J= 8.4 Hz, 0.5H), 4.65 (d, J= 8.4 Hz, 0.5H), 3.69 (s, 3H)。

H9A ¹HNMR (400 MHz, CDCl ₃) δ 8.30 (s, 0.5H), 7.86 - 7.84 (m, 1H), 7.55 - 7.48 (m, 1H), 7.38 (s, 0.5H), 7.19 - 6.99 (m, 3H), 6.10 - 6.07 (m, 1H), 4.85 - 4.79 (m, 1.5H), 4.64 - 4.61 (m, 0.5H), 4.17 - 4.09 (m, 2H), 1.19 (t, J= 7.2 Hz, 3H)。

H10A ¹HNMR (400 MHz, CDCl ₃) δ 7.16 - 6.86 (m, 4H), 6.03 - 6.00 (m, 1H), 4.85 (d, J= 10.0 Hz, 1H), 4.77 (d, J= 11.2 Hz, 0.5H), 4.57 (d, J= 8.4 Hz, 0.5H), 4.15 - 4.10 (m, 2H), 2.48 (s, 1.5H), 2.44 (s, 1.5H), 1.20 (t, J= 7.2 Hz, 3H)。

H11B （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 8.20 (br s, 1H), 7.22 - 6.92 (m, 4H), 6.03 - 5.92 (m, 1H), 4.91 - 4.64 (m, 2H), 3.64 (s, 3H), 2.53 - 2.43 (m, 6H)

H12B （單一鏡像異構物） ¹HNMR (300 MHz, CDCl ₃) δ 7.42 (s, 0.5H), 7.24 - 7.20 (m, 1.5H), 7.08 - 6.99 (m, 2H), 6.24 - 6.16 (m, 1H), 4.99 - 4.89 (m, 1H), 4.75 - 4.58 (m, 1H), 4.13 - 4.08 (m, 2H), 2.43 (s, 3H), 1.14 (t, J= 7.2 Hz, 3H)。

H13A （單一鏡像異構物） ¹HNMR (300 MHz, CDCl ₃) δ 7.51 (br s, 1H), 7.22 - 7.19 (m, 2H), 7.12 - 7.01(m, 2H), 6.24 - 6.15 (m, 1H), 4.96 - 4.91 (m, 1H), 4.70 - 4.54 (m, 1H), 3.65 (s, 3H), 2.44 (s, 3H)。

H15A （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 8.25 (br s, 1H), 7.79 (d, J= 2.4 Hz, 1H), 7.53 - 7.40 (m, 1H), 7.10 - 6.95 (m, 1H), 6.93 - 6.76 (m, 1H), 5.96 (s, 1H), 4.79 - 4.45 (m, 2H), 4.08 - 4.04 (m, 2H), 1.13 (t, J= 7.2 Hz, 3H)。

H16A （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 7.87 (d, J= 3.2 Hz, 1H), 7.53 - 7.52 (m, 1H), 7.12 - 7.06 (m, 1H), 6.95 - 6.89 (m, 1H), 6.02 (s, 1H), 4.87 - 4.84 (m, 1H), 4.75 - 4.65 (m, 1H), 3.69 (s, 3H)。  

H17A （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 8.26 (s, 0.3H), 7.84 (d, J= 2.8 Hz, 1H), 7.53 - 7.46 (m, 1.7H), 7.24 - 7.14 (m, 2H), 7.09 - 7.01 (m, 1H), 6.26 (s, 0.3H), 6.17 (s, 0.7H), 4.92 (d, J= 8.0 Hz, 1H), 4.76 (d, J= 11.2 Hz, 0.3H), 4.60 (d, J= 8.0 Hz, 0.7H), 4.12 (q, J= 7.2 Hz, 2H), 1.14 (t, J= 11.2 Hz, 3H)。  

H18 （外消旋） H18A （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 8.29 (br s, 0.3H), 7.84 (d, J= 3.2 Hz, 1H), 7.59 - 7.53 (m, 1.4H), 7.47 (br s, 0.3H), 7.41 - 7.31 (m, 1H), 7.14 (d, J= 8.4 Hz, 1H), 6.99 - 6.90 (m, 1H), 6.18 (s, 0.3H), 6.09 (d, J= 2.0 Hz, 0.7H), 4.93 (d, J= 8.4 Hz, 1H), 4.74 (d, J= 11.2 Hz, 0.3H), 4.58 (d, J= 8.4 Hz, 0.7H), 3.67 (s, 2.1H), 3.65 (s, 0.9H)。

H19 （單一鏡像異構物） H19A （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 8.29 (br s, 0.3H), 7.84 (d, J= 3.2 Hz, 1H), 7.59 - 7.53 (m, 1.4H), 7.47 (br s, 0.3H), 7.41 - 7.31 (m, 1H), 7.14 (d, J= 8.4 Hz, 1H), 6.99 - 6.90 (m, 1H), 6.18 (s, 0.3H), 6.09 (d, J= 2.0 Hz, 0.7H), 4.93 (d, J= 8.4 Hz, 1H), 4.74 (d, J= 11.2 Hz, 0.3H), 4.58 (d, J= 8.4 Hz, 0.7H), 3.67 (s, 2.1H), 3.65 (s, 0.9H)。

H20B （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) δ 8.23 (s, 1H), 7.82 (d, J= 3.2 Hz, 1H), 7.53 - 7.44 (m, 1H), 7.12 - 7.07 (m, 2H), 6.93 (s, 1H), 5.98 - 5.94 (m, 1H), 4.89 - 4.66 (m, 2H), 3.65 (s, 3H), 2.53 - 2.41 (m, 3H)。

H21A （單一鏡像異構物）  

H22B （單一鏡像異構物） ¹HNMR (300 MHz, CDCl ₃) δ 7.82 (d, J= 2.7 Hz, 1H), 7.48 (s, 1H), 7.20 - 7.12 (m, 2H), 6.96 - 6.92 (m, 1H), 4.89 - 4.76 (m, 2H), 4.09 (q, J= 6.9 Hz, 2H), 2.48 (s, 3H), 1.14 (t, J= 6.9 Hz, 3H)  

  H23A （單一鏡像異構物） ¹HNMR (400 MHz, CDCl ₃) 8.30 (s, 1H), 7.86 (d, J= 3.2 Hz, 1H), 7.62 - 7.32 (m, 3H), 7.18 - 7.09 (m, 1H), 6.11 - 6.08 (m, 1H), 4.92 (d, J= 11.6 Hz, 1H), 4.78 (d, J= 11.6 Hz, 1H), 4.19 - 4.08 (m, 2H), 1.22 - 1.16 (m, 3H)。 中間體 F 系列的製備：中間體F1的製備

中間體 F1-1 ： 2-(2-(( 三級丁基二甲基矽基 ) 氧基 ) 乙基 )-2,5- 二氫 -1H- 吡咯 -1- 甲酸三級丁酯 Using the same general procedure, the following intermediates were prepared starting from the corresponding starting materials by analogous reaction schemes as described in WO 2020125730. Brominated intermediate 1HNMR ^_

H1 (racemic) H1A ( S enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.22 (s, 0.5H), 7.82 (d, J = 3.2 Hz, 1H), 7.53 (s, 0.4H), 7.44 (s, 0.6H), 7.25 - 7.08 ( m, 2.5H), 6.96 - 6.92 (s, 1H), 5.99 (s, 0.6H), 5.93 (s, 0.4H), 4.92 - 4.77 (m, 1.6H), 4.67 - 4.65 (m, 0.4H) , 4.13 - 4.07 (m, 2H), 2.53 (s, 1.7H), 2.41 (s, 1.3H), 1.14 (t, J = 7.2 Hz, 3H).

H2A (single enantiomer) ¹ HNMR (400 MHz, CD ₃ OD) δ 7.92 (d, J = 3.2 Hz, 1H), 7.80 (d, J = 3.2 Hz, 0.5H), 7.70 (d, J = 3.2 Hz, 0.5H), 7.32 - 7.17 (m, 2H), 6.11 (s, 0.5H), 6.09 (s, 0.5H), 4.91 (d, J = 10.0 Hz, 0.5H), 4.81 (d, J = 10.0 Hz, 1H), 4.57 (d, J = 8.4 Hz, 0.5H), 3.64 (s, 1.5H), 3.62 (s, 1.5H).

H3B (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.24 (s, 1H), 7.83 (d, J = 3.6 Hz, 1H), 7.54 - 7.45 (m, 1H), 7.00 - 6.93 (m, 2H), 5.91 (s , 1H), 4.94 - 4.80 (s, 21H), 3.66 (s, 3H), 2.56 - 2.45 (m, 3H).

H4 (racemic) H4A (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.25 (s, 0.3H), 7.85 (d, J = 3.2 Hz, 1H), 7.54 (d, J = 3.2 Hz, 0.6H), 7.47 -7.45 (m, 0.9 H), 7.22 - 7.00 (m, 2.2H), 6.19 (s, 0.4H), 6.11 (d, J = 2.4 Hz, 0.6H), 4.97 (d, J = 11.2 Hz, 0.4H), 4.94 (d , J = 8.8 Hz, 0.6H), 4.73 (d, J = 11.2 Hz, 0.4H), 4.56 (d, J = 8.4 Hz, 0.6H), 4.16 - 4.04 (m, 2H), 1.19 - 1.13 (m , 3H).

H5A (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.83 (d, J = 2.8 Hz, 1H), 7.54 (d, J = 2.8 Hz, 0.4H), 7.44 (d, J = 2.8 Hz, 0.6H), 7.21 - 7.06 (m, 1H), 7.02 - 6.89 (m, 2H), 5.93 (s, 0.6H), 5.87 (d, J = 2.0 Hz, 0.4H), 4.93 (d, J = 11.6 Hz, 0.6H), 4.81 - 4.78 (m, 1H), 4.61 (d, J = 8.4 Hz, 0.4H), 4.11 - 4.06 (m, 2H), 2.56 (d, J = 2.0 Hz, 2H), 2.45 (d, J = 2.0 Hz, 1H), 1.19 - 1.13 (m, 3H).

H6A (single enantiomer) ¹ HNMR (400 MHz, DMSO -d ₆ ) δ 8.15 - 7.91 (m, 2H), 7.41 - 7.31 (m, 2H), 7.26 - 7.24 (m, 1H), 6.03 (s, 1H), 4.99 - 4.68 ( m, 2H), 3.56 (s, 3H).

H7B (single enantiomer) ¹ HNMR (400 MHz, CD ₃ OD) δ 8.13 (brs, 1H), 7.23-7.13 (m, 3H), 6.97-6.92 (brd, 1H), 5.97-5.91 (d, 1H), 4.93-4.63 (m , 2H), 4.13-4.07 (m, 2H), 2.52-2.41 (m, 6H), 1.27-1.12 (m, 3H)

H8A ¹ HNMR (400 MHz, CD ₃ OD) δ 7.96 (s, 1H), 7.84 (d, J = 2.0 Hz, 0.5H), 7.76 (d, J = 2.4 Hz, 0.5H), 7.24 -7.12 (m, 3H), 6.04 (d, J = 6.0 Hz, 1H), 4.89 (s, 1H), 4.80 (d, J = 8.4 Hz, 0.5H), 4.65 (d, J = 8.4 Hz, 0.5H), 3.69 ( s, 3H).

H9A ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.30 (s, 0.5H), 7.86 - 7.84 (m, 1H), 7.55 - 7.48 (m, 1H), 7.38 (s, 0.5H), 7.19 - 6.99 (m, 3H), 6.10 - 6.07 (m, 1H), 4.85 - 4.79 (m, 1.5H), 4.64 - 4.61 (m, 0.5H), 4.17 - 4.09 (m, 2H), 1.19 (t, J = 7.2 Hz, 3H).

H10A ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.16 - 6.86 (m, 4H), 6.03 - 6.00 (m, 1H), 4.85 (d, J = 10.0 Hz, 1H), 4.77 (d, J = 11.2 Hz, 0.5 H), 4.57 (d, J = 8.4 Hz, 0.5H), 4.15 - 4.10 (m, 2H), 2.48 (s, 1.5H), 2.44 (s, 1.5H), 1.20 (t, J = 7.2 Hz, 3H).

H11B (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.20 (br s, 1H), 7.22 - 6.92 (m, 4H), 6.03 - 5.92 (m, 1H), 4.91 - 4.64 (m, 2H), 3.64 (s, 3H) ), 2.53 - 2.43 (m, 6H)

H12B (single enantiomer) ¹ HNMR (300 MHz, CDCl ₃ ) δ 7.42 (s, 0.5H), 7.24 - 7.20 (m, 1.5H), 7.08 - 6.99 (m, 2H), 6.24 - 6.16 (m, 1H), 4.99 - 4.89 ( m, 1H), 4.75 - 4.58 (m, 1H), 4.13 - 4.08 (m, 2H), 2.43 (s, 3H), 1.14 (t, J = 7.2 Hz, 3H).

H13A (single enantiomer) ¹ HNMR (300 MHz, CDCl ₃ ) δ 7.51 (br s, 1H), 7.22 - 7.19 (m, 2H), 7.12 - 7.01(m, 2H), 6.24 - 6.15 (m, 1H), 4.96 - 4.91 (m , 1H), 4.70 - 4.54 (m, 1H), 3.65 (s, 3H), 2.44 (s, 3H).

H15A (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.25 (br s, 1H), 7.79 (d, J = 2.4 Hz, 1H), 7.53 - 7.40 (m, 1H), 7.10 - 6.95 (m, 1H), 6.93 - 6.76 (m, 1H), 5.96 (s, 1H), 4.79 - 4.45 (m, 2H), 4.08 - 4.04 (m, 2H), 1.13 (t, J = 7.2 Hz, 3H).

H16A (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.87 (d, J = 3.2 Hz, 1H), 7.53 - 7.52 (m, 1H), 7.12 - 7.06 (m, 1H), 6.95 - 6.89 (m, 1H), 6.02 (s, 1H), 4.87 - 4.84 (m, 1H), 4.75 - 4.65 (m, 1H), 3.69 (s, 3H).

H17A (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.26 (s, 0.3H), 7.84 (d, J = 2.8 Hz, 1H), 7.53 - 7.46 (m, 1.7H), 7.24 - 7.14 (m, 2H), 7.09 - 7.01 (m, 1H), 6.26 (s, 0.3H), 6.17 (s, 0.7H), 4.92 (d, J = 8.0 Hz, 1H), 4.76 (d, J = 11.2 Hz, 0.3H), 4.60 (d, J = 8.0 Hz, 0.7H), 4.12 (q, J = 7.2 Hz, 2H), 1.14 (t, J = 11.2 Hz, 3H).

H18 (racemic) H18A (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.29 (br s, 0.3H), 7.84 (d, J = 3.2 Hz, 1H), 7.59 - 7.53 (m, 1.4H), 7.47 (br s, 0.3H), 7.41 - 7.31 (m, 1H), 7.14 (d, J = 8.4 Hz, 1H), 6.99 - 6.90 (m, 1H), 6.18 (s, 0.3H), 6.09 (d, J = 2.0 Hz, 0.7H) , 4.93 (d, J = 8.4 Hz, 1H), 4.74 (d, J = 11.2 Hz, 0.3H), 4.58 (d, J = 8.4 Hz, 0.7H), 3.67 (s, 2.1H), 3.65 (s , 0.9H).

H19 (single enantiomer) H19A (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.29 (br s, 0.3H), 7.84 (d, J = 3.2 Hz, 1H), 7.59 - 7.53 (m, 1.4H), 7.47 (br s, 0.3H), 7.41 - 7.31 (m, 1H), 7.14 (d, J = 8.4 Hz, 1H), 6.99 - 6.90 (m, 1H), 6.18 (s, 0.3H), 6.09 (d, J = 2.0 Hz, 0.7H) , 4.93 (d, J = 8.4 Hz, 1H), 4.74 (d, J = 11.2 Hz, 0.3H), 4.58 (d, J = 8.4 Hz, 0.7H), 3.67 (s, 2.1H), 3.65 (s , 0.9H).

H20B (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.23 (s, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.53 - 7.44 (m, 1H), 7.12 - 7.07 (m, 2H), 6.93 (s , 1H), 5.98 - 5.94 (m, 1H), 4.89 - 4.66 (m, 2H), 3.65 (s, 3H), 2.53 - 2.41 (m, 3H).

H21A (single enantiomer)

H22B (single enantiomer) ¹ HNMR (300 MHz, CDCl ₃ ) δ 7.82 (d, J = 2.7 Hz, 1H), 7.48 (s, 1H), 7.20 - 7.12 (m, 2H), 6.96 - 6.92 (m, 1H), 4.89 - 4.76 (m, 2H), 4.09 (q, J = 6.9 Hz, 2H), 2.48 (s, 3H), 1.14 (t, J = 6.9 Hz, 3H)

H23A (single enantiomer) ¹ HNMR (400 MHz, CDCl ₃ ) 8.30 (s, 1H), 7.86 (d, J = 3.2 Hz, 1H), 7.62 - 7.32 (m, 3H), 7.18 - 7.09 (m, 1H), 6.11 - 6.08 ( m, 1H), 4.92 (d, J = 11.6 Hz, 1H), 4.78 (d, J = 11.6 Hz, 1H), 4.19 - 4.08 (m, 2H), 1.22 - 1.16 (m, 3H). Preparation of Intermediate F series: Preparation of Intermediate F1

Intermediate F1-1 : tertiary butyl 2-(2-(( tertiary butyldimethylsilyl ) oxy ) ethyl )-2,5- dihydro- 1H- pyrrole- 1 - carboxylate

To a solution of tert-butyl 2,5-dihydro-1H-pyrrole-1-carboxylate (50 g, 296 mmol) in THF (500 mL) was added LDA (384 mL, 1 M in THF, 384 mmol). After the addition, the mixture was stirred at -78 °C for 1 h. Then, (2-bromoethoxy)(tert-butyl)dimethylsilane (77 g, 325 mmol) was added at -78°C, and the mixture was stirred at -78°C for 30 min. The mixture was poured into water (500 mL) and extracted with EtOAc (500 mL x 2). The combined organic layers were washed with brine (300 mL), dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography (PE/EtOAc = 50/1) to give the product (51 g, 53%) as a yellow oil. LC-MS (ESI): calculated mass for C ₁₇ H ₃₃ NO ₃ Si 327.2 m/z; found 228 [M+H-100] ⁺ . Intermediate F1-2 : tertiary butyl 2-(2- hydroxyethyl )-2,5- dihydro- 1H- pyrrole- 1 -carboxylate

2-(2-((tertiary butyldimethylsilyl)oxy)ethyl)-2,5-dihydro-1H-pyrrole-1-carboxylic acid tertiary butyl ester Intermediate F1-1 (77 g, 235 mmol) in TBAF/THF (1 M, 258 mL) was stirred at room temperature for 1 hour. The mixture was poured into water (300 mL) and extracted with EtOAc (1000 mL). The organic layer was washed with brine (300 mL × 4), dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography (PE/EtOAc = 10/1 ) to give the product (47 g, 94%) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.78-5.73 (m, 2H), 4.74-4.73 (m, 1H), 4.26-4.22 (m, 1H), 4.01-3.97 (m, 1H), 3.66-3.64 ( m, 2H), 1.95-1.87 (m, 1H), 1.51-1.47 (m, 10H). Intermediate F1-3 : tertiary butyl 2-(2-(( methylsulfonyl ) oxy ) ethyl )-2,5- dihydro- 1H- pyrrole- 1 -carboxylate

To tertiary butyl 2-(2-hydroxyethyl)-2,5-dihydro-1H-pyrrole-1-carboxylate Intermediate F1-2 (37 g, 174 mmol) and TEA (52.6 g, 521 mmol) To the mixture in DCM (400 mL) was added MsCl (29.8 g, 261 mmol). The mixture was then stirred at 0°C for 1 hour. The mixture was poured into water (300 mL) and extracted with DCM (500 mL). The organic layer was washed with brine (300 mL), dried over Na ₂ SO ₄ , concentrated to give the product (50 g, 100%) as a colorless oil. LC-MS (ESI): The calculated mass of C ₁₂ H ₂₁ NO ₅ S is 291.1 m/z, and the measured value is 192 [M+H-100] ⁺ . Intermediate F1-4 : tertiary butyl 2-(2- azidoethyl )-2,5- dihydro- 1H- pyrrole- 1 -carboxylate

2-(2-((methylsulfonyl)oxy)ethyl)-2,5-dihydro-1H-pyrrole-1-carboxylic acid tertiary butyl ester Intermediate F1-3 (24.6 g, 67.6 mmol ) and NaN ₃ (25 g, 338 mmol) in DMF (200 mL) was stirred at 50 °C under N ₂ for 5 h. The mixture was poured into EtOAc (800 mL). The organic layer was washed with water (200 mL*5). The organic layer was concentrated to give the crude product (20 g, 100%) as a yellow oil. LC-MS (ESI): The calculated mass for C ₁₁ H ₁₈ N ₄ O ₂ is 238.1 m/z, and the found value is 139 [M+H-100] ⁺ . Intermediate F1-5 : tertiary butyl 2-(2 -aminoethyl )-2,5- dihydro- 1H- pyrrole- 1 -carboxylate

The crude 2-(2-azidoethyl)-2,5-dihydro-1H-pyrrole-1-carboxylic acid tertiary butyl ester intermediate F1-4 (20 g, 84 mmol) and PPh ₃ (22 g , 84 mmol) in THF/H ₂ O (200 mL/20 mL) was stirred at 45 °C under N ₂ for 3 h. The mixture was concentrated to give the crude product (40 g, 100%) as a yellow oil. LC-MS (ESI): Calculated mass for C ₁₁ H ₂₀ N ₂ O ₂ is 212.2 m/z, found value is 213.2 [M+H] ⁺ . Intermediate F1-6 : tertiary butyl 2-(2-((( benzyloxy ) carbonyl ) amino ) ethyl )-2,5- dihydro- 1H- pyrrole- 1 -carboxylate

2-(2-Aminoethyl)-2,5-dihydro-1H-pyrrole-1-carboxylic acid tert-butyl ester Intermediate F1-5 (40 g crude, 84 mmol) and To a mixture of Na ₂ CO ₃ (23 g, 168 mmol) in di㗁𠮿/H ₂ O (180 mL/40 mL) was added CbzCl (17.2 g, 100 mmol) dropwise. The mixture was then stirred overnight at room temperature. The mixture was poured into water (300 mL), extracted with EtOAc (800 mL). The organic layer was washed with brine (300 mL), dried over Na ₂ SO ₄ and concentrated. The crude product was purified by column chromatography (PE/EtOAc = 3/1 ) to give the product (19 g, 63%) as a yellow oil. ¹ HNMR (400 MHz, CDCl3) δ 7.37-7.26 (m, 6H), 5.80-5.73 (m, 2H), 5.13-5.08 (m, 2H), 4.64-4.54 (m, 1H), 4.23-4.16 (m , 1H), 4.00-3.95 (m, 1H), 3.37-3.09 (m, 2H), 1.89-1.77 (m, 1H), 1.69-1.64 (m, 1H), 1.46 (s, 9H). Intermediate F1-7 : 2-(2-((( benzyloxy ) carbonyl ) amino ) ethyl )-6 -oxa- 3 -azabicyclo [3.1.0] hexane - 3 - carboxylic acid tris grade butyl ester

To 2-(2-(((benzyloxy)carbonyl)amino)ethyl)-2,5-dihydro-1H-pyrrole-1-carboxylic acid tertiary butyl ester Intermediate F1-6 (19 g, 54.8 mmol) in DCM (200 mL) was added mCPBA (19 g, 109 mmol). The mixture was stirred overnight at room temperature. The mixture was poured into water (300 mL) and extracted with EtOAc (300 mL). _The organic solution was washed with _Na2CO3 solution (saturated, 300 mL) and concentrated. The residue was purified by column chromatography (PE/EtOAc = 2/1 ) to give the product (19.8 g, 100%) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.39-7.26 (m, 6H), 6.00-5.74 (m, 1H), 5.15-5.05 (m, 2H), 4.20-2.96 (m, 7H), 1.82-1.77 ( m, 1H), 1.46 (s, 9H). Intermediate F1-8 : tertiary butyl 3- hydroxyhexahydropyrrolo [3,2-b] pyrrole- 1(2H) -carboxylate

2-(2-(((Benzyloxy)carbonyl)amino)ethyl)-6-oxa-3-azabicyclo-[3.1.0]hexane-3-carboxylic acid tertiary butyl ester intermediate A mixture of solid F1-7 (31 g, 85.6 mmol) and Pd/C (10%, 6.2 g) in EtOH (600 mL) was stirred overnight at 30° C. under H ₂ (1 atm). The mixture was filtered and the filtrate was concentrated to give the crude product (19 g, 97%) as a colorless oil. LC-MS (ESI): The calculated mass for C ₁₁ H ₂₀ N ₂ O ₃ is 228.1 m/z, and the found value is 129 [M+H-100] ⁺ . Intermediate F1-9 : 4- benzyl 1-( tertiary butyl ) 3- hydroxyhexahydropyrrolo [3,2-b] pyrrole -1,4 - dicarboxylate

To tertiary-butyl 3-hydroxyhexahydropyrrolo[3,2-b]pyrrole-1(2H)-carboxylate Intermediate F1-8 (19 g, 83.3 mmol) and Na ₂ CO ₃ at 0°C (23 g, 167 mmol) CbzCl (172 g, 100 mmol) was added dropwise to a mixture in di㗁𠮿/H ₂ O (190 mL/50 mL). The mixture was then stirred at room temperature for 3 hours. The mixture was poured into water (500 mL) and extracted with EtOAc (300 mL×2). The organic solution was concentrated and the residue was purified by column chromatography (PE/EtOAc = 2/1 ) to give the product (20.5 g, 68%) as a colorless oil. ¹ HNMR (400 MHz, DMSO-d ₆ ) δ 7.37-7.30 (m, 5H), 5.30-5.26 (m, 1H), 5.13-5.03 (m, 2H), 4.33-4.32 (m, 1H), 4.16- 4.13 (m, 1H), 4.04-4.00 (m, 1H), 3.66-3.61 (m, 1H), 3.46-3.40 (m, 1H), 3.16-3.01 (m, 2H), 2.03-1.84 (m, 2H ), 1.40 (s, 9H). Intermediate F1-10 : 3- oxohexahydropyrrolo [3,2-b] pyrrole -1,4 -dicarboxylate 4- benzyl 1-( tertiary butyl ) ester

To 3-hydroxyhexahydropyrrolo[3,2-b]pyrrole-1,4-dicarboxylate 4-benzyl 1-(tertiary butyl) ester Intermediate F1-9 (220 mg, 0.61 mmol) in di To a solution in methyl chloride (8 mL) was added Dess-Martin periodinane (580 mg, 0.57 mmol). The mixture was stirred overnight at room temperature. The reaction mixture was quenched with saturated sodium thiosulfate solution (20 mL) and saturated sodium bicarbonate solution (20 mL), then extracted twice with ethyl acetate (50 mL). The combined organic layers were washed with brine (50 mL), dried over Na ₂ SO ₄ and filtered. The filtrate was concentrated under reduced pressure to obtain a crude product. The crude product was purified by silica gel column chromatography (dichloromethane:methanol=30:1) to obtain the desired product (170 mg, 70% yield, 90% purity according to HNMR) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.44 - 7.29 (m, 5H), 5.18 (d, J = 5.2 Hz, 2H), 4.80 - 4.22 (m, 2H), 4.13 - 3.85 (m, 1H), 3.74 - 3.55 (m, 1H), 3.49 - 3.22 (m, 2H), 2.35 - 2.19 (m, 1H), 2.10 - 1.81 (m, 1H), 1.49 - 1.46 (m, 9H). Intermediate F1-11 : 3,3 -difluorohexahydropyrrolo [3,2-b] pyrrole -1,4- dicarboxylic acid 4- benzyl 1-( tertiary butyl ) ester

To a solution of diethylaminosulfur trifluoride (820 mg, 5.09 mmol) in dichloromethane (40 mL) was added 3-oxahydropyrrolo[3,2-b]pyrrole-1, 4-Benzyl 1-(tert-butyl) 4-dicarboxylate Intermediate F1-10 (500 mg, 1.25 mmol, 90% purity). After the addition, the mixture was stirred at room temperature for 12 hours. The reaction mixture was quenched with saturated sodium bicarbonate solution (50 mL) and extracted twice with ethyl acetate (50 mL). The combined organic layers were washed with brine (50 mL), dried over Na ₂ SO ₄ and filtered. The filtrate was concentrated under reduced pressure to obtain a crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=2:1) to obtain the desired product (260 mg, 49% yield, 90% purity by HNMR) as a white solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.46 - 7.30 (m, 5H), 5.17 (s, 2H), 4.70 - 4.45 (m, 2H), 4.05 - 3.75 (m, 2H), 3.60 - 3.44 (m, 1H), 3.38 - 3.25 (m, 1H), 2.21 - 1.94 (m, 2H), 1.47 (s, 9H). Intermediate F1-12 : tertiary butyl 3,3 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H) -carboxylate

To 3,3-difluorohexahydropyrrolo[3,2-b]pyrrole-1,4-dicarboxylic acid 4-benzyl 1-(tertiary butyl) ester Intermediate F1-11 (260 mg, 0.61 mmol , 90% purity) in isopropanol (15 mL) was added palladium acetate (100 mg) and activated carbon (15 mg). The mixture was stirred overnight at 50 °C under hydrogen (50 psi). The reaction mixture was filtered and the filtrate was concentrated under reduced pressure to give the desired product (260 mg, 95% yield, 90% purity by LCMS) as a colorless oil. The crude product was used in the next step without purification. ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.50 - 4.35 (m, 1H), 3.96 - 3.63 (m, 4H), 3.61 - 3.38 (m, 1H), 3.11 - 3.06 (m, 1H), 2.98 - 2.91 ( m, 1H), 2.10 - 1.98 (m, 1H), 1.40 (s, 9H).

Intermediate F1-12 (1.8 g, 4.472 mmol, 95% purity) was subjected to chiral prep.HPLC (column: Chiralpak IB 5 μm 4.6 * 250 mm; mobile phase: Hex: EtOH = 80: 20, 20 mL/ min; temperature: 30 °C; wavelength: 214) to obtain Intermediate F1-12A (780 mg, 46% yield, 100% pure by LCMS) as a yellow oil.

中間體 S1-2 ： 2,2- 二甲基丁 -3- 烯酸苄酯 Intermediate F1-12A : LC-MS (ESI): The calculated mass of C ₁₉ H ₂₄ F ₂ N ₂ O ₄ is 382.4, the measured value of m/z is 383.2 [M+H] ⁺ ; chiral HPLC: chiralpak IB 5 um , 4.6*250 mm; Phase: Hex : EtOH = 80 : 20; F: 1 mL/min; W = 230 nm; T = 30°C; Rt = 4.839 min, 100% ee. Preparation of Intermediates : Preparation of Intermediates S1 and S2 :

Intermediate S1-2 : Benzyl 2,2 -dimethylbut- 3 - enoate

To a solution of 2,2-dimethylbut-3-enoic acid S1-1 (20.0 g, 175 mmol) in N,N-dimethylformamide (200 mL) was added potassium carbonate (48.0 g, 347 mmol) and (bromomethyl)benzene (21 mL, 176 mmol). After stirring at 40 °C for 1 h, the mixture was poured into water (600 mL) and extracted twice with ethyl acetate (400 mL). The organic layer was washed with brine (300 mL), dried over sodium sulfate and concentrated to give the desired product (33.3 g, 95% purity by ¹ H NMR, 88% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.37 - 7.29 (m, 5H), 6.09 - 6.02 (m, 1H), 5.12 - 5.05 (m, 4H), 1.33 (s, 6H). Intermediate S1-3 : Benzyl 2- methyl -2-( oxiran -2- yl ) propionate

2,2-Dimethylbut-3-enoic acid benzyl ester S1-2 (20 g, 93 mmol, 95% purity) and edetate disodium dihydrate (7.00 g, 18.8 mmol ) in acetonitrile (400 mL) and water (200 mL) was added 1,1,1-trifluoroacetone (75 mL, 837 mmol). The mixture was stirred at 0°C for 10 minutes. Sodium bicarbonate (62.5 g, 744 mmol) and potassium peroxomonosulfonate (117 g, 696 mmol) were then added. The mixture was stirred overnight at room temperature. The mixture was filtered and the filtrate was extracted three times with ethyl acetate (200 mL). The organic layer was washed with brine (300 mL), dried over sodium sulfate and concentrated to give a crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10:1) to give a colorless oil (18.6 g, 90% pure by ¹ HNMR, 81% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.38 - 7.30 (m, 5H), 5.16 (s, 2H), 3.21 - 3.19 (m, 1H), 2.72 - 2.65 (m, 2H), 1.23 (s, 3H) , 1.15 (s, 3H). Intermediate S1-4 : ( cis )-4-(4-( benzyloxy )-2- hydroxy -3,3 -dimethyl- 4 -oxobutyl )-3,3 -difluoro Hexahydropyrrolo [3,2-b] pyrrole- 1(2H) -carboxylic acid tertiary butyl ester

To (cis)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrole-1(2H)-carboxylic acid tertiary butyl ester F1 (1.5 g, 85% purity, 5.14 mmol ) in a solution of benzyl 2-methyl-2-(oxiran-2-yl)propionate S1-3 (2.5 g, 90% purity, 10.2 mmol) was added vanadium(III) chloride (200 mg, 1.27 mmol). After stirring overnight at 40°C under a nitrogen atmosphere, the reaction mixture was quenched slowly with water (30 mL) and extracted three times with ethyl acetate (50 mL). The separated organic layer was washed with brine (50 mL), dried over Na ₂ SO _4(s) , filtered and concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5 :1 to 3:1) to afford the title compound (2.1 g, 90% purity by ¹ H NMR, 79% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.36 - 7.30 (m, 5H), 5.18 (d, J = 12.4 Hz, 1H), 5.10 (d, J = 12.4 Hz, 1H), 4.52 - 4.40 (m, 1H ), 3.95 - 3.79 (m, 2H), 3.65 - 3.55 (m, 1H), 3.26 - 3.05 (m, 2H), 3.05 - 2.82 (m, 2H), 2.38 - 2.20 (m, 3H), 1.88 - 1.80 (m, 1H), 1.46 (s, 9H), 1.26 (s, 3H), 1.17 (s, 3H). Intermediate S1-5 : ( cis )-4-((S*)-4-( benzyloxy )-2- fluoro -3,3 -dimethyl- 4 -oxobutyl )-3 ,3 -Difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H) -carboxylic acid tertiary butyl ester

(cis)-4-(4-(benzyloxy)-2-hydroxy-3,3-dimethyl-4-oxobutyl)-3,3-di Solution of tert-butyl fluorohexahydropyrrolo[3,2-b]pyrrole-1(2H)-carboxylate S1-4 (2.1 g, 90% purity, 4.03 mmol) in anhydrous dichloromethane (20 mL) Diethylaminosulfur trifluoride solution (1.6 mL, 12.1 mmol) was added dropwise in . After the addition, the mixture was warmed to room temperature and stirred for 2 hours. The reaction mixture was quenched with saturated sodium bicarbonate solution (40 mL) to pH = 7-8 at 0 °C and extracted twice with ethyl acetate (50 mL). The combined organic phases were washed with brine (50 mL), dried over sodium sulfate and filtered. The filtrate was concentrated in vacuo. The residue was subjected to silica gel column chromatography (petroleum ether: ethyl acetate = 20: 1 to 15: 1) and chiral Prep.SFC (column: Chiralpak IE 10 µm 30 * 250 mm, mobile phase: CO ₂ : IPA = 85:15, purified at 60 g/min, temperature: 40 °C, wavelength: 214 nm) to give the title compound as a yellow oil (220 mg, 90% pure by ¹ HNMR, 73% yield ). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.38 - 7.31 (m, 5H), 5.18 - 5.10 (m, 2H), 4.80 (dd, J = 50.0, 8.0 Hz, 1H), 4.47 - 4.36 (m, 1H) , 3.90 - 3.61 (m, 2H), 3.23 - 3.07 (m, 3H), 2.61 - 2.44 (m, 1H), 2.32 - 2.20 (m, 2H), 1.91 - 1.82 (m, 1H), 1.46 (s, 9H), 1.30 (s, 3H), 1.20 (s, 3H). Intermediate S1 : (S*)-4-(( cis )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-3 - fluoro -2, Benzyl 2 -dimethylbutyrate

To (cis)-4-((S*)-4-(benzyloxy)-2-fluoro-3,3-dimethyl-4-oxobutyl)-3 at room temperature, 3-Difluorohexahydropyrrolo[3,2-b]pyrrole-1(2H)-carboxylic acid tert-butyl ester S1-5 (220 mg, 90% purity, 0.421 mmol) in dichloromethane (2 mL) Trifluoroacetic acid (2 mL) was added dropwise to the solution. After stirring at this temperature for 0.5 h, the reaction was quenched with saturated sodium bicarbonate (10 mL) and extracted three times with dichloromethane (10 mL). The organic phase was washed three times with brine (10 mL), dried over Na ₂ SO _4(s) , filtered and evaporated to give the title compound (280 g, 72% purity, 99% yield) as a pale yellow oil. Intermediate S1-6 : ( cis )-4-(4-( benzyloxy )-2- methoxy- 3,3 -dimethyl- 4 -oxobutyl )-3,3- Difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H) -carboxylic acid tertiary butyl ester

(cis)-4-(4-(benzyloxy)-2-hydroxy-3,3-dimethyl-4-oxobutyl)-3,3-difluoro Hexahydropyrrolo[3,2-b]pyrrole-1(2H)-carboxylic acid tertiary butyl ester S1-4 (800 mg, 100% purity, 1.71 mmol) in N,N-dimethylformamide (10 mL) was added 60% by weight sodium hydride in mineral oil (205 mg, 5.12 mmol). The mixture was stirred for 10 minutes. To this system was added iodomethane (363 mg, 2.56 mmol). The mixture was then stirred at room temperature for 2 hours. The mixture was poured into water (50 mL) and extracted three times with ethyl acetate (50 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue. The residue was purified by Prep-TLC (petroleum ether:ethyl acetate=6:1) to give the title compound S1-6 (270 mg, 29.5% yield, 90% purity by LCMS) as a colorless oil .

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.36 - 7.35 (m, 5H), 5.15 - 5.03 (m, 2H), 4.44 - 4.30 (m, 1.5H), 4.15 - 4.08 (m, 0.5H), 3.77 ( m, 1H), 3.59 - 3.57 (m, 2H), 3.52 (s, 1.5H), 3.46 (s, 1.5H), 3.10 - 2.91 (m, 2H), 2.52 - 2.18 (m, 4H), 1.86 - 1.76 (m, 1H), 1.46 (s, 9H), 1.21 (t, J = 8.0 Hz, 3H), 1.14 (t, J = 12.0 Hz, 3H). LC-MS (ESI): RT = 2.02 min, calculated mass for C _{25 H 36} F ₂ N ₂ O ₅ is 482.3, found m/z is 483.3 [M+H] ⁺ . Intermediate S2 : 4-(( cis )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-3 -methoxy- 2,2 -di Benzyl methyl butyrate

To (cis)-4-(4-(benzyloxy)-2-methoxy-3,3-dimethyl-4-oxobutyl)-3,3-difluorohexahydropyrrole Trifluoroacetic acid was added to a solution of a[3,2-b]pyrrole-1(2H)-carboxylic acid tert-butyl ester S1-6 (170 mg, 90% purity, 0.352 mmol) in dichloromethane (2 mL) (1 mL). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water (10 mL) and basified to pH = 8 - 9 with saturated aqueous sodium bicarbonate solution. The mixture was then extracted three times with ethyl acetate (10 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the title compound S2 (130 mg, 96.5% yield, 90% purity by LCMS) as a brown oil, which was used directly in the next step.

中間體 S3-2 ： 2,2- 二甲基 -3- 側氧基丁酸苄酯 LC-MS (ESI): RT = 1.71 min, calculated mass for C _{20 H 28} F ₂ N ₂ O ₃ is 382.2, found m/z is 383.2 [M+H] ⁺ . Preparation of intermediate S3 :

Intermediate S3-2 : Benzyl 2,2 -dimethyl- 3 -oxobutanoate

To a solution of benzyl 3- oxobutyrate S3-1 (20.0 g, 104 mmol) in N , N -dimethylformamide (250 mL) was added 60 wt% hydrogenated Sodium (7.50 g, 313 mmol). After stirring at 0°C under nitrogen atmosphere for 2 hours, iodomethane (73.8 g, 520 mmol) was added at 0°C under nitrogen atmosphere and the mixture was stirred at room temperature overnight. It was then poured into water (500 mL) and extracted twice with tert-butyl methyl ether (500 mL). The combined organic layers were washed with brine (500 mL), dried over Na ₂ SO _4(s) , filtered and concentrated to give the crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 100 : 1 ) to give the desired compound (12.1 g, 90% purity by ¹ H NMR, 42% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.37 - 7.32 (m, 5H), 5.16 (s, 2H), 2.04 (s, 3H), 1.38 (s, 6H). Intermediate S3-3 : Benzyl 4- bromo -2,2 -dimethyl- 3 -oxobutanoate

To a solution of 2,2-dimethyl-3-oxobutyric acid benzyl ester S3-2 (12.1 g, 90% purity, 49.5 mmol) in N , N -dimethylformamide (100 mL) 1-Bromopyrrolidine-2,5-dione (42.4 g, 238 mmol) was added to . The mixture was heated to 80°C and stirred overnight. It was then poured into water (100 mL) and extracted twice with tert-butyl methyl ether (100 mL). The combined organic layers were washed with brine (150 mL), dried over Na ₂ SO _4(s) , filtered and concentrated to give the crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 100 : 1 ) to afford the desired compound (6.30 g, 50% purity by ¹ H NMR, 24% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.37 - 7.32 (m, 2H), 5.17 (m, 2H), 4.03 (s, 2H), 1.47(s, 6H). Intermediate S3-4 : ( cis )-4-(4-( benzyloxy )-3,3 -dimethyl -2,4 -dioxobutyl )-3,3 -difluorohexa Tertiary butyl hydropyrrolo [3,2-b] pyrrole- 1(2 H ) -carboxylate

To (cis)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrole-1(2 H )-carboxylic acid tertiary butyl ester S3-3 (1.80 g, 95 % purity, 6.89 mmol) to a solution in N , N -dimethylformamide (20 mL) was added benzyl 4-bromo-2,2-dimethyl-3- oxobutanoate S3-3 (5.25 g, 50% purity, 8.78 mmol), N -ethyl- N -isopropylpropan-2-amine (2.70 g, 20.9 mmol) and sodium iodide (230 mg, 0.809 mmol). After stirring overnight, the mixture was poured into water (50 mL) and extracted three times with ethyl acetate (50 mL). The combined organic layers were washed with brine (100 mL), dried over Na ₂ SO _4(s) , filtered and concentrated to give the crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10 : 1 ) to afford the desired compound (1.83 g, 90% purity by ¹ H NMR, 51% yield) as a light yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.35 - 7.32 (m, 5H), 5.20 - 5.12 (m, 2H), 4.52 - 4.39 (m, 1H), 3.87 - 3.51 (m, 4H), 3.41 - 3.31 ( m, 1H), 3.17 - 3.09 (m, 1H), 2.57 - 2.43 (m, 1H), 2.31 - 2.22 (m, 1H), 2.00 - 1.83 (m, 1H), 1.45 (s, 9H), 1.39 ( s, 3H), 1.38 (s, 3H). Intermediate S3-5 : ( cis )-4-(( S *)-4-( benzyloxy )-2- hydroxy -3,3 -dimethyl- 4 -oxobutyl )-3 ,3 -Difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2 H ) -carboxylic acid tertiary butyl ester

To (cis)-4-(4-(benzyloxy)-3,3-dimethyl-2,4-dioxobutyl)-3,3-difluorohexahydropyrrolo[3 ,2-b] To a solution of pyrrole-1( 2H )-tert-butyl carboxylate S3-4 (1.87 g, 90% purity, 3.61 mmol) in methanol (20 mL) was added sodium borohydride (145 mg, 3.83 mmol). After stirring at 0 °C for 1 h, the mixture was poured into water (50 mL) and extracted twice with tertiary butyl methyl ether (50 mL). The combined organic layers were washed with brine (50 mL), dried over Na ₂ SO _4(s) , filtered and concentrated to give the crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10 : 1 ) to afford the desired compound (1.10 g, 95% purity by ¹ H NMR, 62% yield) as a yellow solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.38 - 7.30 (m, 5H), 5.20 - 5.09 (m, 2H), 4.53 - 4.39 (m, 1H), 3.95 - 3.79 (m, 2H), 3.65 - 3.54 ( m, 1H), 3.30 - 3.25 (m, 1H), 3.18 - 3.13 (m, 1H), 3.08 - 2.99 (m, 1H), 2.90 - 2.84 (m, 1H), 2.42 - 2.18 (m, 3H), 1.92 - 1.79 (m, 1H), 1.45 (s, 9H), 1.27 (s, 3H), 1.17 (s, 3H). Intermediate S3-6 : ( S *)-4-(( cis )-4-( tertiary butoxycarbonyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1 (2 H ) -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid

To (cis)-4-(( S *)-4-(benzyloxy)-2-hydroxy-3,3-dimethyl-4-oxobutyl)-3, 3-Difluorohexahydropyrrolo[3,2-b]pyrrole-1( 2H )-carboxylic acid tert-butyl ester S3-5 (1.51 g, 90% purity, 2.90 mmol) in isopropanol (15 mL) Palladium acetate (150 mg) and activated carbon (20 mg) were added to the mixture. The mixture was stirred at 50°C for 4 hours under a balloon of hydrogen. It was then filtered and the filtrate was concentrated under reduced pressure to give the desired product (1.12 g, 70% purity, 71% yield) as a yellow oil. LC-MS (ESI): calculated mass for C ₁₇ H ₂₈ F ₂ N ₂ O ₅ is 378.4, found m/z is 379.4 [M+H] ⁺ . Intermediate S3-7 : ( cis )-4-(( S *)-4-( allyloxy )-2- hydroxy -3,3 -dimethyl- 4 -oxobutyl )-3 ,3 -Difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2 H ) -carboxylic acid tertiary butyl ester

To ( S *)-4-((cis)-4-(tertiary butoxycarbonyl)-6,6-difluorohexahydropyrrolo[3,2-b]pyrrole-1(2 H )- base)-3-hydroxy-2,2-dimethylbutanoic acid S3-6 (1.12 g, 70% purity, 2.07 mmol) and potassium carbonate (860 mg, 6.22 mmol) in N , N -dimethylformyl To the mixture in the amine (5 mL) was added 3-bromoprop-1-ene (0.3 mL, 3.47 mmol). The mixture was stirred at room temperature for 3 hours. It was then concentrated under reduced pressure to obtain a crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 4: 1) to obtain the desired product as a yellow oil (910 mg, according to ¹ HNMR 90% purity, 94% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.89-5.80 (m, 1H), 5.29-5.23 (m, 1H), 5.18-5.14 (m, 1H), 4.54-4.52 (m, 2H), 4.50-4.35 ( m, 1H), 3.89 - 3.73 (m, 2H), 3.60 - 3.48 (m, 1H), 3.28 - 3.24 (m, 1H), 3.17 - 3.12 (m, 1H), 3.01 - 2.99 (m, 1H), 2.87 - 2.81 (m, 1H), 2.43 - 2.38 (m, 1H), 2.30 - 2.21 (m, 2H), 1.86 - 1.77 (m, 1H), 1.39 (s, 9H), 1.18 (s, 3H), 1.10 (s, 3H). Intermediate S3 : ( S *)-4-(( cis )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2 H ) -yl )-3 -hydroxyl- 2 , Allyl 2-dimethylbutyrate dihydrochloride

中間體 S4-2 ： (S)-2-( 甲氧基甲氧基 ) 丙酸乙酯 To (cis)-4-(( S *)-4-(allyloxy)-2-hydroxy-3,3-dimethyl-4-oxobutyl)-3,3-difluoro Hexahydropyrrolo[3,2-b]pyrrole-1( 2H )-carboxylic acid tert-butyl ester S3-7 (750 mg, 82% purity, 1.47 mmol) in ethyl acetate (3 mL) A 4 M solution of hydrochloric acid in ethyl acetate (3 mL, 12 mmol) was added. The mixture was stirred at room temperature for 1 hour. It was concentrated to give the desired product (670 mg, 80% purity by ¹ H NMR, 93% yield) as a yellow solid. LC-MS (ESI): Mass calculated for C ₁₅ H ₂₆ Cl ₂ F ₂ N ₂ O ₃ is 390.1, found m/z is 319.3 [M-2HCl+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 5.91 - 5.82 (m, 1H), 5.27 - 5.22 (m, 1H), 5.15 - 5.13 (m, 1H), 4.78 - 4.77 (m, 1H), 4.53 - 4.46 (m, 3H), 4.08 - 3.88 (m, 3H), 3.84 - 3.79 (m, 1H), 3.34 - 3.28 (m, 1H), 3.22 - 3.14 (m, 2H), 2.67 - 2.59 (m, 1H) , 2.34 - 2.26 (m, 1H), 1.15 (s, 3H), 1.14 (s, 3H). Preparation of Intermediate S4 :

Intermediate S4-2 : (S)-2-( methoxymethoxy ) ethyl propionate

To a solution of 60% sodium hydride (6.70 g, 168 mmol) in tetrahydrofuran (150 mL) in mineral oil was added ethyl (S)-2-hydroxypropionate S4-1 at 0°C under nitrogen atmosphere (10.0 g, 84.7 mmol). After stirring at 0°C for 1 hour, bromo(methoxy)methane (12.7 g, 102 mmol) was added dropwise at 0°C. The resulting solution was stirred overnight at room temperature under nitrogen atmosphere, then it was quenched with water (30 mL) and extracted with ethyl acetate (200 mL). The organic layer was washed with brine (100 mL), dried over anhydrous Na ₂ SO _4(s) , filtered and concentrated under reduced pressure to afford the title compound as a pale yellow oil (10.5 g, 90% pure by ¹ HNMR, 69% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.69 - 4.65 (m, 2H), 4.21 - 4.15 (m, 3H), 3.37 (s, 3H), 1.41 (d, J = 6.8 Hz, 3H), 1.26 (t , J = 7.2 Hz, 1H). Intermediate S4-3 : ethyl 2-( methoxymethoxy )-2 -methylpent- 4 - enoate

Add (S)-2-(methoxymethoxy)propionate ethyl ester S4-2 (10.5 g, 90% purity, 58.3 mmol) in tetrahydrofuran (210 mL) at -78°C under nitrogen atmosphere A 2 M solution of lithium diisopropylamide in tetrahydrofuran (47 mL, 94.0 mmol) was added dropwise to the solution. After stirring at -78°C for 1 h, allyl bromide (11 mL, 127 mmol) was added dropwise at -78°C under nitrogen atmosphere. The resulting solution was stirred at room temperature overnight, then it was quenched with water (100 mL) and extracted with ethyl acetate (300 mL). The organic layer was washed with brine (150 mL), dried over anhydrous Na ₂ SO _4(s) , filtered and concentrated. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=1:0 to 20:1) to obtain the title compound (5.26 g, 90% purity according to ¹ HNMR, 40 %Yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.85 - 5.71 (m, 1H), 5.11 (s, 1H), 5.07 (s, 1H), 4.75 (s, 2H), 4.20 - 4.11 (m, 2H), 3.37 (s, 3H), 2.51 (d, J = 9.2 Hz, 2H), 1.27 (t, J = 8.4 Hz, 3H). Intermediate S4-4 : 2-( methoxymethoxy )-2- methyl- 4 -oxobutyric acid ethyl ester

2-(Methoxymethoxy)-2-methylpent-4-enoic acid ethyl ester S4-3 (5.26 g, 90% purity, 23.4 mmol) in dichloromethane (100 mL) of the solution in the introduction of ozone to blue. The reaction solution was quenched with dimethylsulfane (4.2 mL, 57.2 mmol) at -78 °C. After stirring overnight at room temperature under a nitrogen atmosphere, the mixture was concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10:1 to 2:1) to obtain a yellow oil The title compound was obtained as a solid (2.0 g, 90% pure by ¹ HNMR, 30% yield). ¹ HNMR (300 MHz, CDCl ₃ ) δ 9.77 (s, 1H), 4.80 (s, 2H), 4.24 - 4.16 (m, 2H), 3.36 (s, 3H), 2.83 (d, J = 2.1 Hz, 2H ), 1.55 (s, 3H), 1.30 - 1.28 (m, 3H). Intermediate S4-5 : ( cis )-4-(4- ethoxy - 3-( methoxymethoxy )-3 -methyl- 4 -oxobutyl )-3,3- di Tertiary butyl fluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H) -carboxylate

(cis)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrole-1(2H)-carboxylic acid tert-butyl ester F1 (2.00 g, 95% purity, 7.65 mmol) and ethyl 2-(methoxymethoxy)-2-methyl-4-oxobutanoate S4-4 (2.00 g, 90% purity, 8.81 mmol) in dichloromethane ( 30 mL) was added with 1 M triisopropoxytitanium(IV) chloride in hexane (2 mL, 2 mmol), and stirred at -60°C for 3 minutes. Sodium cyanoborohydride (1.00 g, 15.9 mmol) was then added. The mixture was stirred at -60°C for 30 minutes. The mixture was diluted with dichloromethane (100 mL). The mixture was washed with saturated aqueous sodium bicarbonate (100 mL), dried over anhydrous sodium sulfate(s) and filtered. The filtrate was concentrated to give a residue. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=5:1) to obtain the desired compound (2.5 g, 71.1% yield, 95% purity according to ¹ HNMR) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 4.80 - 4.73 (m, 2H), 4.47 - 4.37 (m, 1H), 4.17 (q, J = 7.2 Hz, 2H), 3.91 - 3.56 (m, 2H), 3.39 (s, 3H), 3.28 - 2.21 (m, 1H), 3.13 - 2.92 (m, 2H), 2.49 - 2.21 (m, 3H), 2.04 - 1.96 (m, 2H), 1.89 - 1.73 (m, 1H) 1.48 (s, 3H), 1.45 (s, 9H), 1.31 - 1.27 (m, 3H). Intermediate S4-6 : 4-(( cis )-4-( tertiary butoxycarbonyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2-( methoxymethoxy )-2 -methylbutanoic acid

To (cis)-4-(4-ethoxy-3-(methoxymethoxy)-3-methyl-4-oxobutyl)-3,3-difluorohexahydropyrrolo To a solution of [3,2-b]pyrrole-1(2H)-carboxylic acid tert-butyl ester S4-5 (2.50 g, 95% purity, 5.44 mmol) in methanol (30 mL) and water (10 mL) was added Lithium hydroxide monohydrate (800 mg, 19.1 mmol) and the reaction mixture was stirred at 25°C for 6 hours. The mixture was poured into 1 N aqueous hydrochloric acid (20 mL), and extracted three times with dichloromethane (100 mL). The combined organic phases were washed with brine (100 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue as a white solid (2.3 g, 98.3% yield, 95% pure by ¹ H NMR).

1HNMR (400 MHz, CDCl ₃ ) δ 4.83 - 4.78 (m, 2H), 4.57 - 4.38 (m, 1H), 3.92 - 3.66 (m, 2H), 3.43 (s, 3H), 3.34 - 2.11 (m, 3H ), 2.59 - 2.15 (m, 4H), 1.93 - 1.77 (m, 2H), 1.54 (s, 3H), 1.45 (s, 9H). Intermediate S4 : 4-(( cis )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2- hydroxy -2 -methylbutyryl Propyl ester

Step 1: To 4-((cis)-4-(tertiary butoxycarbonyl)-6,6-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)- 2-(Methoxymethoxy)-2-methylbutanoic acid S4-6 (2.30 g, 95% purity, 5.35 mmol) and potassium carbonate (1.50 g, 10.9 mmol) in N,N-dimethylformaldehyde To a solution in amide (10 mL) was added 3-bromoprop-1-ene (700 mg, 5.79 mmol), and the reaction mixture was stirred at 25°C overnight. The mixture was poured into water (50 mL) and extracted three times with ethyl acetate (50 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate(s) and filtered. The filtrate was concentrated to give a residue. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=10:1) to obtain the desired compound (1.7 g, 67.3% yield, 95% purity according to HNMR) as a colorless oil .

¹ HNMR (400 MHz, CDCl ₃ ) δ 5.98 - 5.88 (m, 1H), 5.36 - 5.24 (m, 2H), 4.80 - 4.73 (m, 2H), 4.65 - 4.55 (m, 2H), 4.49 - 4.35 ( m, 1H), 3.90 - 3.57 (m, 2H), 3.38 (s, 3H), 3.27 - 3.20 (m, 1H), 3.12 - 2.96 (m, 2H), 2.47 - 2.20 (m, 3H), 2.08 - 1.93 (m, 2H), 1.89 - 1.71 (m, 1H), 1.50 (s, 3H) 1.45 (s, 9H).

Step 2: Add (cis)-4-(4-(allyloxy)-3-(methoxymethoxy)-3-methyl-4-oxobutyl)-3,3- Difluorohexahydropyrrolo[3,2-b]pyrrole-1(2H)-carboxylic acid tert-butyl ester (900 mg, 95% purity, 1.91 mmol) in 2 M hydrochloric acid in 1,4-di㗁𠮿 solution (50 mL, 100 mmol) was stirred at room temperature for 6 hours. The mixture was poured into saturated aqueous sodium bicarbonate (50 mL) and extracted twice with ethyl acetate (50 mL). The combined organic phases were washed with brine (50 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to afford the title compound (640 mg, 99.3% yield) as a colorless oil.

中間體 S5-2 ： 2- 甲基環氧乙烷 -2- 甲酸三級丁酯 ¹ HNMR (400 MHz, CDCl ₃ ) δ 6.09 - 5.95 (m, 1H), 5.45 - 5.30 (m, 2H), 4.84 - 4.63 (m, 2H), 4.22 - 4.04 (m, 1H), 3.71 - 3.04 ( m, 8H), 2.94 - 2.83 (m, 1H), 2.60 - 2.50 (m, 1H), 2.38 - 2.16 (m, 2H), 2.03 - 1.65 (m, 3H), 1.52 - 1.50 (m, 3H). Preparation of intermediates S5 , S6 and S7 :

Intermediate S5-2 : tertiary butyl 2- methyloxirane -2- carboxylate

To a solution of tert-butyl methacrylate S5-1 (10.0 g, 70.3 mmol) in 1,2-dichloroethane (100 mL) was added 4,4'-thiobis (2-Methyl-6-tert-butylphenol) (1.26 g, 3.51 mmol) followed by the addition of 3-chloroperoxybenzoic acid (18.2 g, 106 mmol). After stirring at 70 °C for 20 h, the mixture was quenched with saturated aqueous sodium bicarbonate (100 mL), and extracted twice with dichloromethane (100 mL). The combined organic layers were washed twice with saturated aqueous sodium bicarbonate (200 mL), twice with brine (200 mL), dried over Na ₂ SO _4(s) and filtered. The filtrate was concentrated under reduced pressure to obtain a crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 100: 1 to 20: 1) to obtain the title compound (6.0 g, according to ¹ H NMR purity 90%, 49% yield). ¹ HNMR (300 MHz, CDCl ₃ ) δ 3.04 (d, J = 6.3 Hz, 1H), 2.70 (d, J = 6.0 Hz, 1H), 1.53 (s, 3H), 1.48 (s, 9H). Intermediate S5-3 : ( S *, R *)-4-(3-( tertiary butoxy )-2- hydroxy -2- methyl- 3 -oxopropyl )-3,3- di Tertiary butyl fluorohexahydropyrrolo [3,2-b] pyrrole- 1(2 H ) -carboxylate

To ( R *, S *)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrole-1( 2H )-carboxylic acid tertiary butyl ester F1 (500 mg, 90% purity, 1.81 mmol ) in a solution of tertiary-butyl 2-methyloxirane-2-carboxylate S5-2 (1.50 g, 90% purity, 8.53 mmol). After stirring overnight at 120°C, the reaction mixture was directly purified by silica gel column chromatography (petroleum ether: ethyl acetate = 20: 1 to 4: 1) to obtain the title compound (530 mg , 90% purity according to ¹ HNMR, 65% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.47 - 4.29 (m, 1H), 3.88 - 3.76 (m, 1H), 3.69 - 3.44 (m, 2.5H), 3.34 - 3.08 (m, 2H), 3.00 - 2.87 (m, 1H), 2.61 - 2.41 (m, 1.5H), 2.27 - 2.17 (m, 1H), 1.93 - 1.76 (m, 1H), 1.48 (s, 9H), 1.46 (s, 9H), 1.33 ( d, J = 12.8 Hz, 3H). Intermediate S5 : 3-(( cis )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2- hydroxy -2- methylpropionic acid tris grade butyl ester

To (cis)-4-(3-(tertiary butoxy)-2-hydroxy-2-methyl-3-oxopropyl)-3,3-difluorohexahydro To a mixture of pyrrolo[3,2-b]pyrrole-1(2H)-carboxylic acid tert-butyl ester S5-3 (500 mg, 90% purity, 1.11 mmol) in dichloromethane (3 mL) was added trifluoro Acetic acid (0.6 mL). The mixture was stirred at 0-10°C for 8 hours. To the mixture was added saturated aqueous sodium bicarbonate (20 mL). The mixture was extracted with ethyl acetate (20 mL), and the organic phase was washed with brine (10 mL) and concentrated in vacuo. The residue was purified by silica gel column chromatography (ethyl acetate:petroleum ether=1:2) to obtain the desired compound S5 (200 mg, 53% yield, 90% purity according to HNMR) as a yellow oil ).

¹ HNMR (400 MHz, CDCl ₃ ) δ 4.08 - 3.93 (m, 1H), 3.40 - 2.91 (m, 5H), 2.50 - 2.33 (m, 1H), 2.26 - 2.05 (m, 2H), 1.80 - 1.61 ( m, 1H), 1.48 (s, 9H), 1.39 - 1.36 (m, 3H). Intermediate S6 : 3-(( S *, R *)-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2 H ) -yl )-2- hydroxy -2- methanol trifluoroacetic acid

To ( S *, R *)-4-(3-(tertiary butoxy)-2-hydroxy-2-methyl-3-oxopropyl)-3, 3-Difluorohexahydropyrrolo[3,2-b]pyrrole-1( 2H )-carboxylic acid tert-butyl ester S5-3 (530 mg, 90% purity, 1.17 mmol) in dichloromethane (10 mL) To the solution in was added trifluoroacetic acid (2 mL). After stirring overnight at room temperature, the reaction mixture was concentrated under reduced pressure to afford the title compound (450 mg, 90% purity by ¹ H NMR, 95% yield) as a brown solid. ¹ HNMR (400 MHz, DMSO- d ₆ ) δ 9.70 (br s, 1H), 4.39 - 4.35 (m, 1H), 4.24 - 4.13 (m, 1H), 3.81 - 3.74 (m, 1.5H), 3.62 - 3.48 (m, 1.5H), 3.39 - 3.30 (m, 1H), 3.06 (d, J = 13.6 Hz, 0.5H), 2.94 (d, J = 13.2 Hz, 0.5H), 2.76 (d, J = 13.2 Hz, 0.5H), 2.64 (d, J = 12.8 Hz, 0.5H), 2.56 - 2.53 (m, 0.6H), 2.47 - 2.44 (m, 0.4H), 2.27 - 2.16 (m, 1H), 2.04 - 2.01 (m, 0.3H), 1.95 - 1.90 (m, 0.7H), 1.25 (d, J = 11.6 Hz, 3H). Intermediate S5-4 : ( cis )-4-(3-( tertiary butoxy )-2- fluoro -2- methyl- 3 -oxopropyl )-3,3 -difluorohexahydro Pyrrolo [3,2-b] pyrrole- 1(2H) -carboxylic acid tertiary butyl ester

To (cis)-4-(3-(tertiary butoxy)-2-hydroxy-2-methyl-3-oxopropyl)-3,3-difluorohexahydropyrrolo[3, 2-b] Pyrrole-1(2H)-carboxylic acid tert-butyl ester S5-3 (100 mg, 0.25 mmol) in DCM (20 mL) was added DAST (0.098 mL, 0.74 mmol). The mixture was then heated and stirred at 40°C for 1.5 hours. After cooling to room temperature, 15 mL of saturated aqueous _NaHCO3 was added to the solution. After extraction, the organic layer was washed with brine, dried _over anhydrous _Na2SO4 , filtered and concentrated under reduced pressure. 116 mg of product were obtained as an oil.

LCMS: m/z = 409.1 [M+H] ⁺ ; Method: 5%-95% acetonitrile in water (0.05% TFA) in 3.5 min. Intermediate S7 : 3-(( cis )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2- fluoro -2- methylpropanoic acid

To (cis)-4-(3-(tertiary butoxy)-2-fluoro-2-methyl-3-oxopropyl)-3,3-difluorohexahydropyrrolo[3, 2-b] Pyrrole-1(2H)-carboxylic acid tert-butyl ester S5-4 (116 mg, 0.24 mmol) in DCM (1 mL, 15.66 mmol) was added TFA (1.5 mL, 19.6 mmol). The mixture was then stirred at 19 °C for 1 h. The mixture was concentrated under reduced pressure. The residue was used directly in the next step without further purification.

中間體 S8-2 ： 4- 溴 -2,2- 二甲基 -3- 側氧基丁酸甲酯 LCMS: m/z = 253.1 [M+H] ⁺ ; Method: 40% to 95% acetonitrile in water (0.05% TFA) in 3.5 min. Preparation of Intermediate S8 :

Intermediate S8-2 : methyl 4- bromo -2,2 -dimethyl- 3 -oxobutanoate

To a solution of methyl 2,2-dimethyl-3-oxobutanoate S8-1 (2.00 g, 13.9 mmol) in N , N -dimethylformamide (20 mL) was added N- Bromosuccinimide (2.72 g, 15.3 mmol). The mixture was heated to 80 °C and stirred overnight under nitrogen atmosphere. The mixture was diluted with ethyl acetate (20 mL) and washed with water (50 mL). The aqueous layer was extracted three times with ethyl acetate (20 mL). The combined organic layers were then dried over anhydrous Na ₂ SO _4(s) , filtered and concentrated to give a crude product, which was purified by silica gel column chromatography (petroleum ether:ethyl acetate=20:1) to give The title compound (1.00 g, 32% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.15 (s, 2H), 3.78 (s, 3H), 1.49 (s, 6H). Intermediate S8-3 : ( cis )-3,3 -difluoro - 4-(4 -methoxy- 3,3 -dimethyl -2,4 -dipentoxybutyl ) hexahydropyrrolo [3,2-b] pyrrole- 1(2 H ) -tertiary butyl carboxylate

To a solution of methyl 4-bromo-2,2-dimethyl-3-oxobutanoate S8-2 (534 mg, 2.42 mmol) in acetonitrile (10 mL) was added N , N -diisopropyl Ethylamine (624 mg, 4.84 mmol), (cis)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrole-1(2 H )-tertiary butyl carboxylate Intermediate F1 ( 600 mg, 2.42 mmol) and sodium iodide (50 mg). The mixture was stirred overnight at 30°C. The mixture was cooled to room temperature, quenched with water (50 mL), and extracted three times with ethyl acetate (20 mL). The combined extracts were washed with brine (50 mL), dried over Na ₂ SO _4(s) , filtered and concentrated to give a residue, which was purified by silica gel column chromatography (petroleum ether:ethyl acetate=5: 1) Purification afforded the desired compound (640 mg, 68% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.58 - 4.41 (m, 1H), 3.93 - 3.76 (m, 2H), 3.73 (s, 3H), 3.70 - 3.58 (m, 2H), 3.54 - 3.40 (m, 1H), 3.32 - 3.20 (m, 1H), 2.78- 2.64 (m, 1H), 2.40 - 2.28 (m, 2H), 2.06 - 1.87 (m, 2H), 1.46 (s, 9H), 1.38 (s, 6H). Intermediate S8-4 : ( cis )-3,3 -difluoro - 4-(2- hydroxy- 4 -methoxy- 3,3 -dimethyl- 4 -oxobutyl ) hexahydropyrrole A[3,2-b] pyrrole - 1(2 H ) -carboxylate tertiary butyl ester

To (cis)-3,3-difluoro-4-(4-methoxy-3,3-dimethyl-2,4-dioxobutyl)hexahydropyrrolo[3,2- b] To a solution of pyrrole-1( 2H )-carboxylic acid tert-butyl ester S8-3 (1.20 g, 90% purity, 2.77 mmol) in methanol (10 mL) was added sodium borohydride (106 mg, 2.80 mmol) . The mixture was stirred at room temperature for 20 minutes. The mixture was poured into water (30 mL), extracted twice with ethyl acetate (20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate(s) and filtered. The filtrate was concentrated to give the desired compound (1.10 g, 90% purity by ¹ H NMR, 91% yield) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.57 - 4.46 (m, 1H), 3.98 - 3.75 (m, 2H), 3.68 - 3.57 (m, 1H), 3.34 - 3.25 (m, 2H), 2.92 - 2.86 ( m, 1H), 2.71 - 2.59 (m, 1H), 2.39 - 2.30 (m, 2H), 1.94 - 1.83 (m, 1H), 1.46 (s, 9H), 1.28 - 1.26 (m, 3H), 1.21 - 1.20 (m, 3H). Intermediate S8-5 : 4-(( cis )-4-( tertiary butoxycarbonyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-3 -Hydroxy- 2,2 -dimethylbutanoic acid

To (cis)-3,3-difluoro-4-(2-hydroxy-4-methoxy-3,3-dimethyl-4-oxobutyl)hexahydropyrrolo[3,2 -b] To a solution of pyrrole-1(2 H )-tertiary butyl carboxylate S8-4 (1.10 g, 90% purity, 2.52 mmol) in methanol (20 mL) was added 2 M aqueous sodium hydroxide (6 mL, 12 mmol). The mixture was heated to 50°C and stirred for 1 hour. The mixture was poured into water (10 mL) and acidified to pH 4-5 with 1 M aqueous hydrochloride solution. It was then extracted twice with ethyl acetate (20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate(s) and filtered. The filtrate was concentrated to give the desired compound (1.00 g, 90% purity by ¹ H NMR, 94% yield) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.57 - 4.46 (m, 1H), 3.98 - 3.75 (m, 2H), 3.68 - 3.57 (m, 1H), 3.34 - 3.25 (m, 2H), 2.92 - 2.86 ( m, 1H), 2.71 - 2.59 (m, 1H), 2.39 - 2.30 (m, 2H), 1.94 - 1.83 (m, 1H), 1.46 (s, 9H), 1.28 - 1.26 (m, 3H), 1.21 - 1.20 (m, 3H). Intermediate S8-6 : ( cis )-4-(4-( allyloxy )-2- hydroxyl -3,3 -dimethyl- 4 -oxobutyl )-3,3 -difluoro Hexahydropyrrolo [3,2-b] pyrrole- 1(2 H ) -carboxylic acid tertiary butyl ester

To 4-((cis)-4-(tertiary butoxycarbonyl)-6,6-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2 H )-yl)-3- To a solution of hydroxy-2,2-dimethylbutyric acid S8-5 (1.00 g, 90% purity, 2.38 mmol) in N , N -dimethylformamide (10 mL) was added potassium carbonate (657 mg , 4.75 mmol) and 3-bromoprop-1-ene (316 mg, 2.61 mmol). The mixture was stirred overnight at room temperature. The mixture was poured into water (30 mL), extracted twice with ethyl acetate (20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate(s) and filtered. The filtrate was concentrated to give the desired compound (900 mg, 90% purity by ¹ H NMR, 81% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.96 - 5.88 (m, 1H), 5.35 - 5.22 (m, 2H), 4.53 - 4.44 (m, 1H), 3.96 - 3.81 (m, 2H), 3.70 - 3.56 ( m, 1H), 3.35 - 3.22 (m, 2H), 2.96 - 2.88 (m, 1H), 2.51 - 2.27 (m, 3H), 1.96 - 1.85 (m, 1H), 1.46 (s, 9H), 1.26 ( s, 3H), 1.18 (s, 3H). Intermediates S8-7A and S8-7B : ( cis )-3,3 -difluoro -4-(( R *)-2- fluoro - 4 -methoxy- 3,3 -dimethyl- 4- Oxybutyl ) hexahydropyrrolo [3,2-b] pyrrole- 1( 2H ) -tertiary butyl carboxylate and ( cis )-3,3 -difluoro -4-(( S *) -2- fluoro - 4 -methoxy- 3,3 -dimethyl- 4 -oxobutyl ) hexahydropyrrolo [3,2-b] pyrrole- 1(2 H ) -carboxylic acid tertiary butyl ester

(cis)-4-(4-(allyloxy)-2-hydroxy-3,3-dimethyl-4-oxobutyl)-3,3-di Solution of fluorohexahydropyrrolo[3,2-b]pyrrole-1(2 H )-carboxylic acid tert-butyl ester S8-6 (900 mg, 90% purity, 1.94 mmol) in dichloromethane (15 mL) Diethylaminosulfur trifluoride (1.00 g, 6.20 mmol) was added. After stirring at -70°C for 10 minutes, the mixture was allowed to warm to room temperature and stirred for 1 hour. To the mixture was added saturated aqueous sodium bicarbonate (10 mL) and stirred for 20 minutes. The mixture was extracted twice with dichloromethane (20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate(s) and filtered. The filtrate was concentrated to give a residue, which was purified by silica gel chromatography (petroleum ether:ethyl acetate=20:1 to 10:1) to give the title compound S8-7A (300 mg, according to ¹ HNMR purity 90%, 33% yield) and S8-7B (100 mg, ¹ HNMR purity 90%, 11% yield).

Intermediate S8-7A : ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.95 - 5.86 (m, 1H), 5.35 - 5.24 (m, 2H), 4.95 - 4.78 (m, 1H), 4.62 - 4.52 (m, 3H ), 4.40 - 4.31 (m, 1H), 3.87 - 3.69 (m, 2H), 3.64 - 3.44 (m, 2H), 3.16 - 2.91 (m, 2H), 2.09 - 1.97 (m, 2H), 1.46 (s , 9H), 1.31 - 1.97 (m, 6H).

Intermediate S8-7B : ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.95 - 5.86 (m, 1H), 5.35 - 5.23 (m, 2H), 4.90 - 4.76 (m, 1H), 4.64 - 4.55 (m, 2H ), 4.50 - 4.41 (m, 1H), 3.89 - 3.62 (m, 2H), 3.34 - 3.11 (m, 3H), 2.70 - 2.46 (m, 2H), 2.34 - 2.22 (m, 1H), 1.98 - 1.82 (m, 1H), 1.45 (s, 9H), 1.30 (s, 3H), 1.21 (s, 3H). Intermediate S8-8 : 4-((3aS*,6aR*)-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-3-(RS)- Hydroxy- 2,2 -dimethylbutanoic acid

To 4-((3aS*,6aR*)-4-(tertiary butoxycarbonyl)-6,6-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)- To a solution of 3-hydroxy-2,2-dimethylbutanoic acid (32 mg, 0.085 mmol) in DCM (2 mL, 31.32 mmol) was added TFA (2 mL, 26.13 mmol). The mixture was then stirred at 19°C for 2 hours. The solution was concentrated under reduced pressure. Obtained 23 mg of product as a colorless oil. It was used directly in the next step without further purification.

LCMS: MS m/z 279.3 [M+H] ⁺ intermediate S8B : ( S *)-4-(( cis )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1 (2 H ) -yl )-3 - fluoro -2,2 -dimethylbutanoic acid allyl bis-trifluoroacetate

中間體 S9-1 ： (3aR,6aS)-4-(2,2- 二氟 -4- 甲氧基 -3,3- 二甲基 -4- 側氧基丁基 )-3,3- 二氟六氫吡咯并 [3,2-b] 吡咯 -1(2H)- 甲酸三級丁酯 To (cis)-4-(( S *)-4-(allyloxy)-2-fluoro-3,3-dimethyl-4-oxobutyl)-3,3-difluoro Hexahydropyrrolo[3,2-b]pyrrole-1( 2H )-carboxylic acid tert-butyl ester S8-7B (90 mg, 90% purity, 0.19 mmol) in dichloromethane (4 mL) Add trifluoroacetic acid (2 mL). The mixture was stirred at room temperature for 1 hour. It was then concentrated to give the desired compound (110 mg, 90% purity by ¹ H NMR, 93% yield) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.95 - 5.85 (m, 1H), 5.35 - 5.24 (m, 2H), 4.88 - 4.74 (m, 1H), 4.61 - 4.60 (m, 2H), 4.56 - 4.52 ( m, 1H), 3.87- 3.76 (m, 1H), 3.64 - 3.60 (m, 1H), 3.47 - 3.43 (m, 2H), 3.24 - 3.13 (m, 1H), 2.80 - 2.60 (m, 2H), 2.47 - 2.38 (m, 1H), 2.29 - 2.20 (m, 1H), 1.30 (s, 3H), 1.21 (s, 3H). Preparation of Intermediate S9 :

Intermediate S9-1 : (3aR,6aS)-4-(2,2 -difluoro - 4 -methoxy- 3,3 -dimethyl- 4 -oxobutyl )-3,3- di Tertiary butyl fluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H) -carboxylate

To (cis)-3,3-difluoro-4-(4-methoxy-3,3-dimethyl-2,4-dioxobutyl)hexahydropyrrolo[3,2- b] Pyrrole-1(2H)-carboxylic acid tert-butyl ester (single diastereomer) (83 mg, 0.21 mmol) was added with stirring at 0°C while BAST (0.2 mL, 1.06 mmol) and EtOH (0.0012 mL). The mixture was then heated and stirred at 50 °C for 16 h.

After cooling to room temperature, EtOAc and saturated aqueous NaHCO ₃ were added to the mixture. After extraction, the organic layer was collected, washed with brine, dried _over anhydrous _Na2SO4 , filtered, and concentrated under reduced pressure. The residue was purified by flash silica gel column chromatography (eluting with 0-10% EtOAc in hexane).

Obtained 32 mg of product as a colorless oil.

LCMS: MS: m/z 413.3 [M+H] ⁺ intermediate S9-2 : 4-(( cis )-4-( tertiary butoxycarbonyl )-6,6 -difluorohexahydropyrrolo [ 3,2-b] pyrrol- 1(2H) -yl )-3,3 -difluoro -2,2 -dimethylbutanoic acid (single diastereomer)

To (cis)-4-(2,2-difluoro-4-methoxy-3,3-dimethyl-4-oxobutyl)-3,3-difluorohexahydropyrrolo[ 3,2-b]Pyrrole-1(2H)-carboxylic acid tert-butyl ester (single diastereomer) (32 mg, 0.078 mmol) in MeOH (3 mL, 73.97 mmol) was added NaOH (13.03 mg, 0.33 mmol) in distilled water (1 mL). The mixture was then stirred at 20 °C for 16 h and then heated at 60 °C for an additional 4 h.

The pH of the solution was adjusted to 5 using 1 N aqueous HCl. The mixture was concentrated under reduced pressure to remove MeOH. It was extracted with EtOAc. The organic layer was collected, washed with brine, dried _over anhydrous _Na2SO4 , filtered and concentrated under reduced pressure.

Obtained 19 mg of product as a pale yellow oil. It was used directly in the next step without further purification.

LCMS: m/z 399.2 [M+H] ⁺ intermediate S9 : 4-(( cis )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) -3,3 -Difluoro -2,2 -dimethylbutanoic acid (single diastereomer)

To 4-((cis)-4-(tertiary butoxycarbonyl)-6,6-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)-3,3 - To a solution of difluoro-2,2-dimethylbutanoic acid (single diastereomer) (19 mg, 0.048 mmol) in DCM (1.5 mL, 23.49 mmol) was added TFA (1.5 mL, 19.6 mmol) . The mixture was then stirred at 20 °C for 2 h. The solution was concentrated under reduced pressure. 14 mg of product were obtained as a colorless oil. It was used directly in the next step without further purification.

中間體 1-1 ： (4S*)-6-((( 順式 )-4-(4-( 苄基氧基 )-2- 甲氧基 -3,3- 二甲基 -4- 側氧基丁基 )-3,3- 二氟六氫吡咯并 [3,2-b] 吡咯 -1(2H)- 基 ) 甲基 )-4-(3- 氟 -2- 甲基苯基 )-2-(4- 甲基噻唑 -2- 基 )-1,4- 二氫嘧啶 -5- 甲酸乙酯 LCMS: MS m/z 299.2 [M+H] ⁺ Preparation of Compounds 1A and 1B :

Intermediate 1-1 : (4S*)-6-((( cis )-4-(4-( benzyloxy )-2- methoxy- 3,3 -dimethyl- 4 -oxo butyl )-3,3 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )- 2-(4 -Methylthiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

To 4-((cis)-6,6-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)-3-methoxy-2,2-dimethylbutane To a solution of benzyl ester S2 (130 mg, 90% purity, 0.310 mmol) in N,N-dimethylformamide (2 mL) was added triethanolamine (171 mg, 1.14 mmol). After the mixture was stirred at room temperature for 10 minutes, (S*)-6-(bromomethyl)-4-(3-fluoro-2-methylphenyl)-2-(4-methylthiazole-2 -Ethyl)-1,4-dihydropyrimidine-5-carboxylate intermediate H7B (180 mg, 95.8% purity, 0.38 mmol). The mixture was then heated to 40°C and stirred overnight. After cooling to room temperature, the mixture was poured into water (20 mL) and extracted three times with dichloromethane (20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and the residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 6: 1 to 3: 1) to obtain the title compound 1-1 (130 mg, 45.2% yield) as a yellow solid , 100% pure by LCMS).

LC-MS (ESI): calculated mass for C ₃₉ H ₄₆ F ₃ N ₅ O ₅ S 753.3, found m/z 754.4 [M+H] ⁺ . Intermediates 1-2A and 1-2B : (S*)-6-((( cis )-4-((R*)-4-( benzyloxy )-2- methoxy- 3,3 -Dimethyl - 4 -oxobutyl )-3,3 - difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-(4 -methylthiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester and (S*)-6-((( cis ) -4-((S*)-4-( Benzyloxy )-2- methoxy- 3,3 -dimethyl- 4 -oxobutyl )-3,3 -difluorohexahydropyrrole And [3,2-b] pyrrol- 1(2H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-(4 -methylthiazol- 2- yl )- Ethyl 1,4 -dihydropyrimidine- 5 -carboxylate ( single diastereomer )

(4S*)-6-(((cis)-4-(4-(benzyloxy)-2-methoxy-3,3-dimethyl-4-oxobutyl)- 3,3-Difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)-2-(4- A racemic mixture of methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate 1-1 (130 mg, 98% purity, 0.17 mmol) was analyzed by preparative chiral HPLC (Chiralpak IG 5 um 4.6 * 250 mm; mobile phase: Hex: EtOH = 90: 10, with 30 mL/min; temperature: 30 ° C; wavelength: 214 nm) to obtain (S*)- 6-(((cis)-4-((R*)-4-(benzyloxy)-2-methoxy-3,3-dimethyl-4-oxobutyl)-3 ,3-Difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)-2-(4-methyl Ethylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate (single diastereomer) 1-2A (50 mg, 0.06 mmol, 96.9% purity) and as yellow oil (S*)-6-(((cis)-4-((S*)-4-(benzyloxy)-2-methoxy-3,3-dimethyl-4-oxo Butyl)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)-2 -Ethyl(4-methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate (single diastereomer) 1-2B (45 mg, 0.05 mmol, 91.1% purity).

Intermediate 1-2A : chiral analysis (column: Chiralpak IG 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 90 : 10, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 12.920 min). ¹ HNMR (300 MHz, CDCl ₃ ) δ 9.46 (brs, 1H), 7.42 - 7.38 (m, 5H), 7.12 - 6.94 (m, 4H), 6.05 (s, 1H), 5.18 - 5.17 (m, 2H) , 4.30 (d, J = 18.0 Hz, 1H), 4.16 - 4.07 (m, 3H), 3.77 - 3.75 (m, 1H), 3.69 - 3.65 (m, 1H), 3.49 (s, 3H), 3.44 - 3.37 (m, 1H), 3.32 - 3.25 (m, 2H), 2.98 - 2.85 (m, 2H), 2.83 - 2.69 (m, 1H), 2.66 - 2.59 (m, 1H), 2.58 (s, 3H), 2.46 (s, 3H), 1.91 - 1.89 (m, 2H), 1.30 (s, 3H), 1.24 (s, 3H), 1.17 (t, J = 7.2 Hz, 3H).

Intermediate 1-2B : chiral analysis (column: Chiralpak IG 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 90 : 10, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 15.102 min). ¹ HNMR (300 MHz, CDCl ₃ ) δ 9.45 (s, 1H), 7.41 - 7.38 (m, 5H), 7.11 - 6.94 (m, 4H), 6.04 (s, 1H), 5.16 - 5.15 (m, 2H) , 4.33 - 4.27 (m, 1H), 4.11 - 4.05 (m, 3H), 3.77 - 3.74 (m, 1H), 3.66 - 3.63 (m, 1H), 3.53 (s, 3H), 3.43 - 3.29 (m, 3H), 3.07 - 2.72 (m, 4H), 2.58 (s, 3H), 2.46 (s, 3H), 1.88 - 1.86 (m, 2H), 1.30 (s, 3H), 1.20 (s, 3H), 1.16 (t, J = 7.2 Hz, 3H). Compound 1A : (R*)-4-(( cis )-4-(((S*)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2 -(4 -methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1( 2H) -yl )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

To (S*)-6-(((cis)-4-((R*)-4-(benzyloxy)-2-methoxy-3,3-dimethyl-4-oxo butyl)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)- 2-(4-Methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl ester (single diastereomer) 1-2A (50 mg, 96.9% purity, 0.12 mmol) in To a solution in dichloromethane (2 mL) was added trifluoromethanesulfonic acid (1 mL). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water (50 mL), and saturated aqueous sodium bicarbonate was added to adjust pH 5-6. The mixture was extracted three times with ethyl acetate (50 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate and filtered. The residue was purified by C18 column ((acetonitrile:water (+0.1% ammonium bicarbonate) = 30% to 50%)) to give the title compound 1A as a yellow solid (24.3 mg, 56.7% yield, according to LCMS purity is 99.5%).

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.32 (s, 1H), 7.06 - 7.03 (m, 1H), 6.98 - 6.96 (m, 2H), 6.89 (t, J = 9.2 Hz, 1H), 6.00 (s , 1H), 4.34 (d, J = 17.2 Hz, 1H), 4.05 - 4.02 (m, 3H), 3.72 - 3.70 (m, 1H), 3.68 - 3.65 (m, 1H), 3.53 (s, 3H), 3.31 - 3.27 (m, 4H), 3.06 - 3.03 (m, 2H), 2.88 - 2.84 (m, 1H), 2.53 (s, 3H), 2.44 (s, 3H), 1.96 - 1.92 (m, 2H), 1.32 (s, 3H), 1.23 (s, 3H), 1.10 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₃₂ H ₄₀ F ₃ N ₅ O ₅ S is 663.3, found m/z is 664.3 [M+H] ⁺ . Compound 1B : (S*)-4-(( cis )-4-(((S*)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2 -(4 -methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1( 2H) -yl )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

To (S*)-6-(((cis)-4-((S*)-4-(benzyloxy)-2-methoxy-3,3-dimethyl-4-oxo butylbutyl)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)- 2-(4-Methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate ethyl ester (single diastereomer) 1-2B (45 mg, 91.1% purity, 0.05 mmol) in To a solution in dichloromethane (2 mL) was added trifluoromethanesulfonic acid (1 mL). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water (50 mL), and saturated aqueous sodium bicarbonate was added to adjust pH = 5-6. The mixture was extracted three times with ethyl acetate (50 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate and filtered. The residue was purified by C18 column ((acetonitrile:water (+0.1% ammonium bicarbonate) = 30% to 50%)) to give the title compound 1B as a yellow solid (9.3 mg, 25.7% yield, purity by LCMS: 99.7%).

化合物 2B ： (S*)-4-(( 順式 )-6,6- 二氟 -4-(((S*)-6-(3- 氟 -2- 甲基苯基 )-5-( 甲氧基羰基 )-2-(4- 甲基噻唑 -2- 基 )-3,6- 二氫嘧啶 -4- 基 ) 甲基 ) 六氫吡咯并 [3,2-b] 吡咯 -1(2H)- 基 )-3- 氟 -2,2- 二甲基丁酸 （ 單一非鏡像異構物 ） ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.34 (s, 1H), 7.06 - 7.04 (m, 1H), 6.98 - 6.95 (m, 2H), 6.88 (t, J = 8.4 Hz, 1H), 6.00 (s , 1H), 4.29 (d, J = 17.2 Hz, 1H), 4.05 - 4.02 (m, 3H), 3.78 - 3.75 (m, 1H), 3.61 - 3.57 (m, 1H), 3.53 (s, 3H), 3.51 - 3.50 (m, 1H), 3.29 - 3.27 (m, 2H), 3.19 - 3.16 (m, 1H), 3.09 - 3.06 (m, 1H), 2.97 - 2.88 (m, 1H), 2.72 - 2.70 (m , 1H), 2.53 (s, 3H), 2.44 (s, 3H), 1.96 - 1.89 (m, 2H), 1.32 (s, 3H), 1.26 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₃₂ H ₄₀ F ₃ N ₅ O ₅ S is 663.3, found m/z is 664.2 [M+H] ⁺ . Preparation of compound 2B :

Compound 2B : (S*)-4-(( cis )-6,6 -difluoro -4-(((S*)-6-(3- fluoro -2 -methylphenyl )-5-( Methoxycarbonyl )-2-(4 -methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl ) hexahydropyrrolo [3,2-b] pyrrole- 1( 2H) -yl )-3 - fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 2B was prepared starting from S1 and intermediate H11B using the same procedure as described for compound 1A .

Purification with C18 column (acetonitrile: water (5% ammonium bicarbonate) = 5% to 100%) afforded the desired product (40.3 mg, 98.8% purity, 66% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₀ H ₃₅ F ₄ N ₅ O ₄ S is 637.2, found m/z is 638.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 9.40 (s, 1H), 7.08 - 7.03 (m, 1H), 6.97 - 6.95(m, 2H), 6.91 - 6.87 (m, 1H), 5.98 (s, 1H ), 4.89 - 4.75 (m, 1H), 4.28 (d, J = 17.2 Hz, 1H), 4.03 (d, J = 17.2 Hz, 1H), 3.83 - 3.77 (m, 1H), 3.61 - 3.53 (m, 4H), 3.38 - 3.14 (m, 3H), 3.09 - 2.89 (m, 2H), 2.78 - 2.71 (m, 1H), 2.53 (s, 3H), 2.43 (s, 3H), 1.95 - 1.90 (m, 2H), 1.33 (s, 3H), 1.26 (s, 3H). Preparation of compound 3B : (S*)-4-(( cis )-4-(((S*)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl ) -2-(4 -Methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b ] pyrrole- 1(2H) -yl )-3 - fluoro -2,2 -dimethylbutanoic acid (single diastereomer)

Compound 3B was prepared starting from S1 and intermediate H7B using the same procedure as described for 1A .

Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 20% to 95%) afforded the title compound (58.2 mg, 97.2% purity, 77% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₁ H ₃₇ F ₄ N ₅ O ₄ S is 651.3, found m/z is 652.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.36 (br s, 1H), 7.08 - 7.03 (m, 1H), 6.99 - 6.95 (m, 2H), 6.91 - 6.87 (m, 1H), 5.99 (s, 1H) ), 4.80 (dd, J = 46.8, 6.0 Hz, 1H), 4.28 (d, J = 17.6 Hz, 1H), 4.06 - 3.99 (m, 3H), 3.83 - 3.78 (m, 1H), 3.60 - 3.53 ( m, 1H), 3.39 - 3.14 (m, 3H), 3.08 - 2.93 (m, 2H), 2.78 - 2.72 (m, 1H), 2.52 (d, J = 2.0 Hz, 3H), 2.44 (s, 3H) , 1.95 - 1.90 (m, 2H), 1.33 (s, 3H), 1.27 (s, 3H), 1.11 (t, J = 6.8 Hz, 3H). Preparation of compound 4B : ( S *)-4-(( cis )-4-(((S)-6-(2- chloro- 3 - fluorophenyl )-5-( ethoxycarbonyl )-2 -(4 -methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1( 2H) -yl )-3 - fluoro -2,2 -dimethylbutanoic acid (single diastereomer)

Compound 4B was prepared starting from S1 and intermediate H12B using the same procedure as described for compound 1A.

The compound was purified by C18 column (acetonitrile: water = 60% to 80%) to obtain the desired compound (30 mg, 98.0% purity, 62% yield) as a yellow solid. LC-MS (ESI): calculated mass for C ₃₀ H ₃₄ ClF ₄ N ₅ O ₄ S 671.2, found m/z 672.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.41 (br s, 1H), 7.19 - 7.11 (m, 2H), 7.05 - 6.98 (m, 2H), 6.25 (s, 1H), 4.88 - 4.74 (m, 1H ), 4.26 (d, J = 17.2 Hz, 1H), 4.05 - 3.99 (m, 3H), 3.84 - 3.79 (m, 1H), 3.61 - 3.54 (m, 1H), 3.39 - 3.14 (m, 3H), 3.08 - 2.94 (m, 2H), 2.79 - 2.73 (m, 1H), 2.45 (s, 3H), 1.94 - 1.90 (m, 2H), 1.33 (s, 3H), 1.27 (s, 3H), 1.10 ( t, J = 7.2 Hz, 3H). Preparation of compound 5A : (S*)-4-(( cis )-4-(((R*)-6-(2- chloro- 3 - fluorophenyl )-5-( methoxycarbonyl )- 2-(4 -Methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1 (2H) -yl )-3 - fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 5A was prepared starting from S1 and intermediate H13A using the same procedure as described for compound 1A .

The compound was purified by C18 column (acetonitrile:water (0.1% ammonium bicarbonate) = 5% to 95%) to afford the title compound (50.0 mg, 97.7% purity, 79% yield) as a yellow solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.45 (br s, 1H), 7.18 - 7.09 (m, 2H), 7.05 - 7.01 (m, 1H), 6.98 (s, 1H), 6.24 (s, 1H), 4.80 (dd, J = 46.4, 6.0 Hz, 1H), 4.26 (d, J = 17.6 Hz, 1H), 4.01 (d, J = 18.0 Hz, 1H), 3.83 - 3.79 (m, 1H), 3.60 - 3.53 (m, 4H), 3.40 - 2.93 (m, 5H), 2.78 - 2.72 (m, 1H), 2.45 (s, 3H), 1.95 - 1.90 (m, 2H), 1.33 (s, 3H), 1.27 (s , 3H). Preparation of compound 6A : (S*)-4-(( cis )-4-(((R*)-5-( ethoxycarbonyl )-2-(4 -methylthiazol- 2- yl )- 6-(2,3,4- Trifluorophenyl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b ] pyrrole- 1(2H) -yl )-3 - fluoro -2,2 -dimethylbutanoic acid (single diastereomer)

Compound 6A was prepared starting from S1 and intermediate H10A using the same procedure as described for compound 1A .

中間體 7-1 ： (4S*)-6-((( 順式 )-4-(3-( 三級丁氧基 )-2- 羥基 -2- 甲基 -3- 側氧基丙基 )-3,3- 二氟六氫吡咯并 [3,2-b] 吡咯 -1(2H)- 基 ) 甲基 )-4-(3- 氟 -2- 甲基苯基 ) 嘧啶 -5- 甲酸乙酯 The compound was purified by C18 column (acetonitrile:water (0.1% ammonium bicarbonate) = 5% to 95%) to give the title compound (58.8 mg, 97.8% purity, 82% yield) as a yellow solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.50 (br s, 1H), 7.05 - 6.98 (m, 2H), 6.91 - 6.85 (m, 1H), 6.01 (s, 1H), 4.80 (dd, J = 46.8 , 9.6 Hz, 1H), 4.20 (d, J = 17.6 Hz, 1H), 4.06 (q, J = 14.0, 6.8 Hz, 2H), 3.97 (d, J = 17.6 Hz, 1H), 3.81 - 3.76 (m , 1H), 3.59 - 3.52 (m, 1H), 3.38 - 3.14 (m, 3H), 3.07 - 2.90 (m, 2H), 2.77 - 2.72 (m, 1H), 2.47 (s, 3H), 1.92 - 1.91 (m, 2H), 1.33 (s, 3H), 1.27 (s, 3H), 1.17 (t, J = 7.2 Hz, 3H). Preparation of Compounds 7A and 7B :

Intermediate 7-1 : (4S*)-6-((( cis )-4-(3-( tertiary butoxy )-2- hydroxyl -2- methyl- 3 -oxopropyl ) -3,3 -Difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl ) pyrimidine -5- carboxylic acid ethyl ester

3-((cis)-6,6-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)-2-hydroxy-2-methylpropionic acid at room temperature Tertiary butyl ester S5 (200 mg, 90% purity, 0.588 mmol) and (S*)-6-(bromomethyl)-4-(3-fluoro-2-methylphenyl)-2-(4- Methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate intermediate H7B (355 mg, 90% purity, 0.706 mmol) in N,N-dimethylformamide (5 mL ) was added 2,2',2"-nitrilotriethanol (350 mg, 2.35 mmol). After the addition, the reaction mixture was stirred overnight at 40°C. The mixture was poured into water (10 mL) and extracted three times with dichloromethane (10 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to obtain a residue. The residue was subjected to silica gel column chromatography ( Petroleum ether:ethyl acetate=10:1) Purification gave the title compound 7-1 (380 mg, 91.6% yield, 96% purity by LCMS) as a yellow solid.

LC-MS (ESI): Calculated mass for C ₃₃ H ₄₂ F ₃ N ₅ O ₅ S is 677.3, found m/z is 678.8 [M+H] ⁺ . Intermediate 7-2 : (4S*)-6-((( cis )-4-(3-( tertiary butoxy )-2- fluoro -2- methyl- 3 -oxopropyl ) -3,3 -Difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-5- ethyl formate

(4S*)-6-(((cis)-4-(3-(tertiary butoxy)-2-hydroxy-2-methyl-3-oxopropyl )-3,3-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)-2-( 4-Methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate ethyl ester 7-1 (200 mg, 90% purity, 0.266 mmol) in a mixture of dichloromethane (4 mL) Diethylaminosulfur trifluoride (214 mg, 1.33 mmol) was added, and the mixture was stirred at -78°C for 2 hours. Sodium bicarbonate solution (20 mL) was added to the reaction mixture. The mixture was extracted with ethyl acetate (50 mL), and the organic phase was washed with brine (30 mL) and concentrated in vacuo. The residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10: 1) to obtain the desired compound 7-2 (150 mg, 77.3% yield according to LCMS purity as yellow oil) 93%).

LC-MS (ESI): calculated mass for C ₃₃ H ₄₁ F ₄ N ₅ O ₄ S 679.3, found m/z 680.8 [M+H] ⁺ . Intermediates 7-2A and 7-2B : (S*)-6-((( cis )-4-((R*)-3-( tertiary butoxy )-2- fluoro -2- methyl -3 -oxopropyl )-3,3 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) methyl )-4-(3- fluoro -2- methyl (S*)-6 - ((( cis ) -4-((S* ) - 3- ( tertiary butoxy Base )-2- fluoro -2- methyl- 3 -oxopropyl )-3,3 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) methyl ) -4-(3- fluoro -2 -methylphenyl )-2-(4 -methylthiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer )

Racemic (4S*)-6-(((cis)-4-(3-(tertiary butoxy)-2-fluoro-2-methyl-3-oxopropyl)-3 ,3-Difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)-2-(4-methyl Ethyl thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate 7-2 (150 mg, 93% purity, 0.205 mmol) was analyzed by chiral Prep.HPLC (column: ChiralPak IF 10 μm 250 *30 mm; mobile phase: Hex:EtOH = 85:15 at 30 g/min; temperature: 30 °C; wavelength: 254 nm) to obtain the title compound (S*)-6-(( (cis)-4-((R*)-3-(tertiary butoxy)-2-fluoro-2-methyl-3-oxopropyl)-3,3-difluorohexahydropyrrole And[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)-2-(4-methylthiazol-2-yl)- Ethyl 1,4-dihydropyrimidine-5-carboxylate (single diastereomer) 7-2A (50 mg, 34% yield, 95% pure by HNMR) and (S*)- 6-(((cis)-4-((S*)-3-(tertiary butoxy)-2-fluoro-2-methyl-3-oxopropyl)-3,3-di Fluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)-2-(4-methylthiazol-2 -Ethyl)-1,4-dihydropyrimidine-5-carboxylate (single diastereomer) 7-2B (50 mg, 34% yield, 95% pure by HNMR).

Intermediate 7-2A : chiral analysis (column: Chiralpak IF 5 µm 4.6 * 250 mm; mobile phase: Hex: IPA = 85: 15, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 5.523 min). ¹ HNMR (300 MHz, CDCl ₃ ) δ 9.44 (s, 1H), 7.10 - 6.86 (m, 4H), 6.00 (s, 1H), 4.31 (d, J = 17.7 Hz, 1H), 4.09 - 3.97 (m , 3H), 3.72 - 3.59 (m, 2H), 3.30 - 3.18 (m, 4H), 3.00 - 2.80 (m, 2H), 2.53 (d, J = 1.8 Hz, 3H), 2.44 (s, 3H), 1.89 - 1.81 (m, 2H), 1.57 (s, 3H), 1.50 (s, 9H), 1.11 (t, J = 7.2 Hz, 3H).

Intermediate 7-2B : chiral analysis (column: Chiralpak IF 5 µm 4.6 * 250 mm; mobile phase: Hex: IPA = 85: 15, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 6.630 min). ¹ HNMR (300 MHz, CDCl ₃ ) δ 9.40 (s, 1H), 7.07 - 6.86 (m, 4H), 5.99 (s, 1H), 4.24 (d, J = 17.4 Hz, 1H), 4.09 - 4.00 (m , 3H), 3.81 - 3.73 (m, 1H), 3.47 - 3.37 (m, 3H), 3.30 - 3.14 (m, 2H), 3.02 - 2.88 (m, 2H), 2.53 (d, J = 1.8 Hz, 3H ), 2.44 (s, 3H), 1.92 - 1.81 (m, 2H), 1.54 (s, 2H), 1.50 (s, 9H), 1.47 (s, 1H), 1.11 (t, J = 7.2 Hz, 3H) . Compound 7A : (R*)-3-(( cis )-4-(((S*)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2 -(4 -methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1( 2H) -yl )-2- fluoro -2- methylpropanoic acid ( single diastereomer )

To (S*)-6-(((cis)-4-((R*)-3-(tertiary butoxy)-2-fluoro-2-methyl-3-oxo propyl)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)- 2-(4-Methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl ester (single diastereomer) 7-2A (50 mg, 95% purity, 0.07 mmol) in To the mixture in dichloromethane (2 mL) was added trifluoroacetic acid (1 mL). The mixture was stirred at room temperature for 1 hour. The mixture was concentrated in vacuo. The residue was purified by C18 column (acetonitrile: water = 40% to 50%) to give the desired compound (30 mg, 68.7% yield, 99.8% purity by LCMS) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.35 (s, 1H), 7.09 - 6.87 (m, 4H), 6.00 (s, 1H), 4.33 (d, J = 21.6 Hz, 1H), 4.07 - 3.96 (m , 3H), 3.75 - 3.65 (m, 2H), 3.40 - 3.20 (m, 4H), 3.04 - 2.79 (m, 2H), 2.52 (s, 3H), 2.44 (s, 3H), 1.94 - 1.87 (m , 2H), 1.64 (d, J = 22.0 Hz, 3H), 1.11 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₄ S is 623.2, found m/z is 624.2 [M+H] ⁺ . Compound 7B : (S*)-3-(( cis )-4-(((S*)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2 -(4 -methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1( 2H) -yl )-2- fluoro -2- methylpropanoic acid ( single diastereomer )

To (S*)-6-(((cis)-4-((S*)-3-(tertiary butoxy)-2-fluoro-2-methyl-3-oxo propyl)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)- 2-(4-Methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl ester (single diastereomer) 7-2B (50 mg, 95% purity, 0.07 mmol) in To the mixture in dichloromethane (2 mL) was added trifluoroacetic acid (1 mL). The mixture was stirred at room temperature for 1 hour. The mixture was concentrated in vacuo. The residue was purified by C18 column (acetonitrile: water = 40% to 50%) to give the desired compound 7B (32 mg, 73% yield, 99.7% purity by LCMS) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.27 (s, 1H), 7.11 - 6.87 (m, 4H), 5.99 (s, 1H), 4.33 - 4.19 (m, 1H), 4.07 - 3.96 (m, 3H) , 3.77 - 3.47 (m, 3H), 3.39 - 3.06 (m, 3H), 2.93 - 2.73 (m, 2H), 2.51 (s, 3H), 2.44 (s, 3H), 1.99 - 1.86 (m, 2H) , 1.56 (d, J = 22.0 Hz, 3H), 1.10 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₄ S is 623.2, found m/z is 624.2 [M+H] ⁺ . Preparation of Compounds 8A and 8B : ( R *)-3-(( cis )-4-((( S )-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2 H ) -yl )-2- hydroxy -2- methylpropanoic acid ( single diastereomer ) and ( S *)-3-(( cis )-4-((( S )-5-( B Oxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6- Difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2 H ) -yl )-2- hydroxy -2- methylpropanoic acid ( single diastereomer )

To 3-((cis)-6,6-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2 H )-yl)-2-hydroxy-2-methylpropanoic acid trifluoroacetic acid To a solution of intermediate S6 (180 mg, 90% purity, 0.445 mmol), triethanolamine (700 mg, 4.69 mmol) in dichloromethane (5 mL) was added ( S )-6-(bromomethyl)-4 -(3-Fluoro-2-methylphenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl ester Intermediate H1A (200 mg, 95% purity, 0.433 mmol ). After stirring overnight at 40°C, the mixture was concentrated under reduced pressure. The residue was diluted with water (10 mL), acidified to pH 5~6 with 1 M aqueous hydrochloride solution at 0°C, and extracted twice with ethyl acetate (20 mL). The combined organic layers were dried over _{Na2SO4 (s)} and filtered. The filtrate was concentrated under reduced pressure to obtain a residue, which was analyzed by Prep.HPLC (column: Xbridge C18 (5 µm 19 * 150 mm), mobile phase A: water (+ 0.1% trifluoroacetic acid), mobile phase B: acetonitrile , UV: 214 nm, flow rate: 15 mL/min, gradient: 25% - 55% (%B)) purification to obtain the isolated title compound, which was further purified by C18 (acetonitrile: water (+ 0.1% ammonium bicarbonate ) = 30% to 40%) to give the title compounds 8A (31.1 mg, 98.8% purity, 12% yield, 100% stereopure) and 8B (22.1 mg, 98.2% purity, 8% yield) as yellow solids , 97.2% stereopure).

Compound 8A : LC-MS (ESI): RT = 3.592 min, calculated mass for C _{28 H 32} F ₃ N ₅ O ₅ S is 607.6, found m/z is 608.2 [M+H] ⁺ . Chiral analysis (column: Chiralpak IE 5 µm 4.6 * 250 mm; Hex : EtOH : TFA = 80 : 20 : 0.2, at 1 mL/min; temperature: 30°C; wavelength: 254 nm, RT = _12.402 min) . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.93 (d, J = 3.2 Hz, 1H), 7.72 (d, J = 3.2 Hz, 1H), 7.16 - 7.09 (m, 2H), 6.96 - 6.92 (m, 1H), 5.98 (s, 1H), 4.29 (d, J = 17.2 Hz, 1H), 4.11 - 4.04 (m, 3H), 3.80 - 3.72 (m, 2H), 3.39 - 3.35 (m, 1H), 3.30 - 3.23 (m, 2H), 2.99 - 2.84 (m, 3H), 2.52 (d, J = 1.6 Hz, 3H), 1.91 - 1.88 (m, 2H), 1.38 (s, 3H), 1.15 - 1.12 (m , 3H).

Compound 8B : LC-MS (ESI): The calculated mass for C ₂₈ H ₃₂ F ₃ N ₅ O ₅ S is 607.6, and the found m/z is 608.3 [M+H] ⁺ . Chiral analysis (column: Chiralpak IE 5 um 4.6 * 250 mm; Hex : EtOH : TFA = 80 : 20 : 0.2, at 1 mL/min; temperature: 30°C; wavelength: 254 nm, RT = _10.713 min) . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.94 (d, J = 3.2 Hz, 1H), 7.72 (d, J = 3.2 Hz, 1H), 7.16 - 7.11 (m, 2H), 6.96 - 6.92 (m, 1H), 5.98 (s, 1H), 4.28 (d, J = 16.8 Hz, 1H), 4.12 - 4.04 (m, 3H), 3.83 - 3.79 (m, 1H), 3.66 - 3.59 (m, 1H), 3.39 - 3.36 (m, 0.5H), 3.28 - 3.18 (m, 2.5H), 3.04 - 2.96 (m, 2H), 2.87 - 2.81 (m, 1H), 2.52 (d, J = 2.0 Hz, 3H), 1.97 - 1.91 (m, 2H), 1.40 (s, 3H), 1.15 - 1.12 (m, 3H). Preparation of Compounds 9A and 9B : (S*)-3-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H ) -yl )-2- fluoro -2- methylpropanoic acid ( single diastereomer ) and (R*)-3-(( cis )-4-(((S)-5-( ethoxy ylcarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -di Fluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2- fluoro -2- methylpropanoic acid ( single diastereomer )

Compounds 9A and 9B were prepared starting from S7 and intermediate H1A using the same procedure as described for compounds 8A and 8B .

Compound 9A : chiral analysis (column: Chiralpak IE 5 um 4.6 * 250 mm; mobile phase: Hex : EtOH : TFA = 85 : 15 : 0.2, at 1 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 7.344 min). ¹ HNMR (400 MHz, CD ₃ OD) δ 7.90 - 7.89 (m, 1H), 7.71 - 7.69 (m, 1H), 7.17 - 7.07 (m, 2H), 6.96 - 6.89 (m, 1H), 5.96 - 5.94 (m, 1H), 4.30 - 4.24 (m, 1H), 4.12 - 4.01 (m, 3H), 3.81 - 3.76 (m, 1H), 3.61 - 3.53 (m, 1H), 3.32 - 3.12 (m, 4H) , 3.00 - 2.90 (m, 1H), 2.83 - 2.76 (m, 1H), 2.50 (s, 3H), 1.95 - 1.87 (m, 2H), 1.59 - 1.52 (m, 3H), 1.14 - 1.09 (m , 3H). LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₄ S is 609.2, found m/z is 610.3 [M+H] ⁺ .

中間體 10-1 ： (4S*)-6-((( 順式 )-4-(4-( 烯丙氧基 )-3- 羥基 -3- 甲基 -4- 側氧基丁基 )-3,3- 二氟六氫吡咯并 [3,2-b] 吡咯 -1(2H)- 基 ) 甲基 )-4-(3,4- 二氟 -2- 甲基苯基 )-2-( 噻唑 -2- 基 )-1,4- 二氫嘧啶 -5- 甲酸甲酯 Compound 9B : chiral analysis (column: Chiralpak IE 5 um 4.6 * 250 mm; mobile phase: Hex : EtOH : TFA = 85 : 15 : 0.2, at 1 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 8.581 min). ¹ HNMR (400 MHz, CD ₃ OD) δ 7.92 (d, J = 3.6 Hz, 1H), 7.71 (d, J = 3.2 Hz, 1H), 7.17 - 7.08 (m, 2H), 6.95 - 6.91 (m, 1H), 5.96 (s, 1H), 4.26 (d, J = 17.2 Hz, 1H), 4.13 - 4.02 (m, 3H), 3.85 - 3.77 (m, 1H), 3.62 - 3.55 (m, 1H), 3.41 - 3.11 (m, 4H), 2.99 - 2.90 (m, 1H), 2.74 - 2.67 (m, 1H), 2.50 (s, 3H), 1.95 - 1.89 (m, 2H), 1.52 (d, J = 21.2 Hz , 3H), 1.13 (t, J = 6.8 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₄ S is 609.2, found m/z is 610.3 [M+H] ⁺ . Preparation of Compounds 10A and 10B :

Intermediate 10-1 : (4S*)-6-((( cis )-4-(4-( allyloxy )-3 -hydroxyl- 3 -methyl- 4 -oxobutyl )- 3,3 -Difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) methyl )-4-(3,4 -difluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-1,4- dihydropyrimidine -5- carboxylic acid methyl ester

To allyl 4-((cis)-6,6-difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)-2-hydroxy-2-methylbutyrate 10 To a solution of -1 (180 mg, 90% purity, 0.387 mmol) in dimethylformamide (2 mL) was added triethanolamine (300 mg, 2.01 mmol). The mixture was stirred at room temperature for 10 minutes. Then add (S*)-6-(bromomethyl)-4-(3,4-difluoro-2-methylphenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidine -Methyl 5-carboxylate Intermediate H3B (200 mg, 90% purity, 0.407 mmol) and the mixture was stirred at 40 °C for 15 h. After cooling to room temperature, the mixture was poured into water (10 mL) and extracted twice with dichloromethane (10 mL). The combined organic phases were washed with brine (10 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue. The residue was purified by C18 column (acetonitrile: water = 70% to 90%) to give the desired compound (200 mg, 77.6% yield, 100% purity by LCMS) as a yellow solid.

LC-MS (ESI): Calculated mass for C ₃₁ H ₃₅ F ₄ N ₅ O ₅ S is 665.2, found m/z is 666.2 [M+H] ⁺ . Intermediates 10-1A and 10-1B : (S*)-6-((( cis )-4-((S*)-4-( allyloxy )-3 -hydroxy- 3 - methyl- 4 -oxobutyl )-3,3 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) methyl )-4-(3,4 -difluoro -2 -Methylphenyl )-2-( thiazol- 2 - yl )-1,4- dihydropyrimidine- 5- carboxylate (single diastereomer) and (S*)-6-((( cis Formula ) -4-((R*)-4-( allyloxy )-3 -hydroxy- 3 -methyl- 4 -oxobutyl )-3,3 -difluorohexahydropyrrolo [3 ,2-b] pyrrol- 1(2H) -yl ) methyl )-4-(3,4 -difluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- Methyl dihydropyrimidine- 5- carboxylate (single diastereomer)

(S*)-6-(((cis)-4-(4-(allyloxy)-3-hydroxy-3-methyl-4-oxobutyl)-3,3-di Fluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3,4-difluoro-2-methylphenyl)-2-(thiazol-2- base)-1,4-dihydropyrimidine-5-carboxylic acid methyl ester racemic mixture (200 mg, 0.300 mmol, 100% purity) by preparative chiral HPLC (Chiralpak IB 5 μm 20 * 250 mm; flow Phase: Hex:EtOH = 80:20 at 15 mL/min; temperature: 30 °C; wavelength: 254 nm) to give (S*)-6-(((cis)-4- ((S*)-4-(allyloxy)-3-hydroxy-3-methyl-4-oxobutyl)-3,3-difluorohexahydropyrrolo[3,2-b] Pyrrol-1(2H)-yl)methyl)-4-(3,4-difluoro-2-methylphenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidine-5 - Methyl formate (single diastereomer) (88 mg, 95% pure by HNMR, 41.8% yield) and (S*)-6-(((cis)-4-( (R*)-4-(allyloxy)-3-hydroxy-3-methyl-4-oxobutyl)-3,3-difluorohexahydropyrrolo[3,2-b]pyrrole -1(2H)-yl)methyl)-4-(3,4-difluoro-2-methylphenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidine-5- Methyl formate (single diastereomer) (70 mg, 95% pure by HNMR, 33.3% yield).

Intermediate 10-1A : chiral analysis (column: Chiralpak IA 5 µm 4.6 * 250 mm; mobile phase: Hex: IPA = 85: 15, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 9.365 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.24 (br s, 1H), 7.84 (d, J = 2.0 Hz, 1H), 7.46 (d, J = 3.2 Hz, 1H), 7.00 - 6.83 (m, 2H) , 6.03 - 5.90 (m, 2H), 5.40 - 5.28 (m, 2H), 4.74 - 4.66 (m, 2H), 4.52 - 4.09 (m, 2H), 3.96 - 3.83 (m, 1H), 3.60 (s, 3H), 3.51 - 3.07 (m, 4H), 3.03 - 2.91 (m, 1H), 2.58 (s, 3H), 2.45 - 2.30 (m, 1H), 2.42 - 1.90 (m, 3H), 1.82 - 1.75 ( m, 1H), 1.68 - 1.60 (m, 2H), 1.48 (s, 3H).

Intermediate 10-1B : chiral analysis (column: Chiralpak IA 5 µm 4.6 * 250 mm; mobile phase: Hex: IPA = 85: 15, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 10.794 min). 1HNMR (400 MHz, CDCl ₃ ) δ 9.38 (br s, 1H), 7.85 (s, 1H), 7.38 (s, 1H), 6.95 - 6.83 (m, 2H), 6.03 - 5.89 (m, 2H), 5.37 - 5.25 (m, 2H), 4.71 - 4.62 (m, 2H), 4.30 - 4.06 (m, 2H), 3.92 - 3.78 (m, 1H), 3.60 (s, 3H), 3.45 - 3.24 (m, 3H) , 3.12 - 2.93 (m, 2H), 2.79 - 2.66 (m, 1H), 2.58 (s, 3H), 2.49 - 2.38 (m, 1H), 2.11 - 1.95 (m, 3H), 1.71 - 1.59 (m, 2H), 1.46 (s, 3H). Compound 10A : (R*)-4-(( cis )-4-(((R*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H ) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

To (S*)-6-(((cis)-4-((R*)-4-(allyloxy)-3-hydroxy-3-methyl-4-oxobutyl)- 3,3-Difluorohexahydropyrrolo[3,2-b]pyrrol-1(2H)-yl)methyl)-4-(3,4-difluoro-2-methylphenyl)-2- Methyl (thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate (single diastereomer) 10-1B (85 mg, 95% purity, 0.12 mmol) in dichloromethane (3 mL ) were added pyrrolidine (70 mg, 0.98 mmol) and tetrakis(triphenylphosphine) palladium (20 mg, 0.017 mmol). The mixture was stirred at room temperature under nitrogen atmosphere for 2 hours. The mixture was poured into water (10 mL) and extracted three times with dichloromethane (10 mL). The combined organic phases were washed with brine (5 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue. The residue was subjected to Prep.HPLC (column: Waters Xbrige C18 (5 um 19 * 150 mm), mobile phase A: water (+ 0.02% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min, gradient: 20% - 50% (%B)) to afford the desired compound (60 mg, 77.0% yield, 97.4% pure by LCMS) as a yellow solid.

¹ HNMR (400 MHz, CD ₃ OD) δ 7.90 (d, J = 3.2 Hz, 1H), 7.71 (d, J = 3.2 Hz, 1H), 7.09 - 7.01 (m, 2H), 5.90 (s, 1H) , 4.30 - 4.12 (m, 2H), 3.94 - 3.89 (m, 1H), 3.60 (s, 3H), 3.52 - 3.45 (m, 1H), 3.40 - 3.34 (m, 1H), 3.30 - 3.25 (m, 1H), 3.10 - 2.94 (m, 2H), 2.88 - 2.82 (m, 1H), 2.68 - 2.62 (m, 1H), 2.55 (s, 3H), 2.14 - 1.86 (m, 4H), 1.41 (s, 3H).

LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₅ S is 625.2, found m/z is 626.3 [M+H] ⁺ . Compound 10B : (S*)-4-(( cis )-4-(((S*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H ) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compound 10B was synthesized using the same procedure as described for Compound 10A . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.91 (d, J = 3.2 Hz, 1H), 7.71 (d, J = 3.2 Hz, 1H), 7.06 - 6.98 (m, 2H), 5.90 (s, 1H) , 4.26 - 4.09 (m, 2H), 3.91 - 3.86 (m, 1H), 3.60 (s, 3H), 3.49 - 3.33 (m, 2H), 3.29 - 3.21 (m, 1H), 3.10 - 3.00 (m, 2H), 2.71 - 2.58 (m, 2H), 2.55 (s, 3H), 2.12 - 1.84 (m, 4H), 1.40 (s, 3H).

LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₅ S is 625.2, found m/z is 626.2 [M+H] ⁺ . Preparation of compounds 11A and 11B : (R*)-4-(( cis )-4-(((R*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( Ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole -1(2H) -yl )-2- hydroxy -2 -methylbutanoic acid (single diastereomer) and (S*)-4-(( cis )-4-(((R*)- 6-(3,4 -difluoro -2 -methylphenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methanol yl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2- hydroxy -2 -methylbutanoic acid (single diastereomer)

Compounds 11A and 11B were prepared starting from S4 and intermediate H5A using the same procedure as described for 10A and 10B .

Compound 11A : ¹ HNMR (400 MHz, CD ₃ OD) δ 7.81 (d, J = 3.2 Hz, 1H), 7.61 (d, J = 3.2 Hz, 1H), 6.99 - 6.89 (m, 2H), 5.81 (s , 1H), 4.16 (d, J = 16.8 Hz, 1H), 4.02 (d, J = 16.8 Hz, 1H), 3.98 - 3.93 (m, 2H), 3.82 - 3.76 (m, 1H), 3.40 - 3.33 ( m, 1H), 3.28 - 3.21 (m, 2H), 2.98 - 2.81 (m, 2H), 2.77 - 2.68 (m, 1H), 2.58 - 2.51 (m, 1H), 2.45 (s, 3H), 2.03 - 1.72 (m, 4H), 1.32 (s, 3H), 1.03 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₅ S is 639.2, found m/z is 640.3 [M+H] ⁺ .

Compound 11B : ¹ HNMR (400 MHz, CD ₃ OD) δ 7.81 (d, J = 3.2 Hz, 1H), 7.61 (d, J = 3.2 Hz, 1H), 6.99 - 6.89 (m, 2H), 5.81 (s , 1H), 4.15 (d, J = 16.8 Hz, 1H), 4.02 (d, J = 16.8 Hz, 1H), 3.98 - 3.93 (m, 2H), 3.83 - 3.77 (m, 1H), 3.43 - 3.26 ( m, 3H), 3.04 - 2.91 (m, 2H), 2.67 - 2.51 (m, 2H), 2.45 - 2.44 (m, 3H), 2.03 - 1.92 (m, 2H), 1.88 - 1.76 (m, 2H), 1.32 (s, 3H), 1.03 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₅ S is 639.2, found m/z is 640.3 [M+H] ⁺ . Preparation of Compounds 12A and 12B : (R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H ) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer ) and (S*)-4-(( cis )-4-(((S)-5-( ethoxy ylcarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -di Fluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compounds 12A and 12B were prepared starting from S4 and intermediate H1A using the same procedure as described for 10A and 10B .

Compound 12A : ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.92 (d, J = 3.2 Hz, 1H), 7.73 (d, J = 3.2 Hz, 1H), 7.19 - 7.10 (m, 2H), 6.97 - 6.93 ( m, 1H), 5.98 (s, 1H), 4.28 - 4.13 (m, 2H), 4.07 (q, J = 7.2 Hz, 2H), 3.94 - 3.89 (m, 1H), 3.53 - 3.47 (m, 1H) , 3.40 - 3.34 (m, 2H), 3.10 - 2.96 (m, 2H), 2.89 - 2.82 (m, 1H), 2.70 - 2.63 (m, 1H), 2.52 (s, 3H), 2.14 - 1.86 (m, 4H), 1.44 (s, 3H), 1.14 (t, J = 7.2 Hz, 3H). LCMS (ESI): mass calculated for C ₂₉ H ₃₄ F ₃ N ₅ O ₅ S 621.2, found m/z 622.2 [M+H] ⁺ .

Compound 12B : ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.93 (d, J = 3.2 Hz, 1H), 7.73 (d, J = 3.2 Hz, 1H), 7.19 - 7.10 (m, 2H), 6.97 - 6.93 ( m, 1H), 5.98 (s, 1H), 4.28 - 4.12 (m, 2H), 4.07 (q, J = 7.2 Hz, 2H), 3.94 - 3.89 (m, 1H), 3.50 - 3.44 (m, 1H) , 3.41 - 3.36 (m, 2H), 3.14 - 3.03 (m, 2H), 2.77 - 2.61 (m, 2H), 2.52 (d, J = 2.0 Hz, 3H), 2.14 - 1.88 (m, 4H), 1.43 (s, 3H), 1.14 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₅ S is 621.2, found m/z is 622.2 [M+H] ⁺ . Preparation of compounds 13A and 13B : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( methyl Oxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b ] pyrrole- 1(2H) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer ) and (R*)-4-(( cis )-4-(((S*)-6 -(2- Chloro -3,4 -difluorophenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl ) -6,6 -Difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compounds 13A and 13B were prepared starting from S4 and intermediate H2A using the same procedure as described for 10A and 10B .

Compound 13A : ¹ HNMR (400 MHz, CD ₃ OD) δ 7.92 (d, J = 3.2 Hz, 1H), 7.73 (d, J = 3.2 Hz, 1H), 7.24 - 7.21 (m, 2H), 6.15 (s , 1H), 4.25 (d, J = 16.8 Hz, 1H), 4.11 (d, J = 16.8 Hz, 1H), 3.92 - 3.87 (m, 1H), 3.59 (s, 3H), 3.51 - 3.42 (m, 1H), 3.37 - 3.31 (m, 2H), 3.09 - 2.93 (m, 2H), 2.86 - 2.78 (m, 1H), 2.67 - 2.59 (m, 1H), 2.11 - 1.84 (m, 4H), 1.42 ( s, 3H). LC-MS (ESI): calculated mass for C ₂₇ H ₂₈ ClF ₄ N ₅ O ₅ S 645.1, found m/z 646.2 [M+H] ⁺ .

Compound 13B : ¹ HNMR (400 MHz, CD ₃ OD) δ 7.93 (d, J = 2.8 Hz, 1H), 7.73 (d, J = 3.2 Hz, 1H), 7.25 - 7.22 (m, 2H), 6.15 (s , 1H), 4.25 (d, J = 16.8 Hz, 1H), 4.11 (d, J = 16.8 Hz, 1H), 3.93 - 3.87 (m, 1H), 3.59 (s, 3H), 3.50 - 3.32 (m, 3H), 3.12 - 3.01 (m, 2H), 2.75 - 2.59 (m, 2H), 2.13 - 1.86 (m, 4H), 1.42 (s, 3H). LC-MS (ESI): calculated mass for C ₂₇ H ₂₈ ClF ₄ N ₅ O ₅ S 645.1, found m/z 646.2 [M+H] ⁺ . Preparation of Compounds 14A and 14B : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( B Oxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b ] pyrrole- 1(2H) -yl )-2- hydroxy -2 -methylbutanoic acid (single diastereomer) and (S*)-4-(( cis )-4-(((R*)-6 -(2- Chloro -3,4 -difluorophenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl ) -6,6 -Difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2- hydroxy -2 -methylbutanoic acid (single diastereomer)

Compounds 14A and 14B were prepared starting from S4 and intermediate H4A using the same procedure as described for 10A and 10B .

Compound 14A : ¹ HNMR (400 MHz, CD ₃ OD) δ 7.82 (d, J = 2.8 Hz, 1H), 7.63 (d, J = 3.2 Hz, 1H), 7.14 - 7.11 (m, 2H), 6.06 (s , 1H), 4.17 - 3.99 (m, 2H), 3.96 - 3.91 (m, 2H), 3.82 - 3.77 (m, 1H), 3.39 - 3.32 (m, 1H), 3.27 - 3.24 (m, 1H), 3.19 - 3.16 (m, 1H), 2.98 - 2.83 (m, 2H), 2.76 - 2.69 (m, 1H), 2.56 - 2.52 (m, 1H), 2.01 - 1.73 (m, 4H), 1.32 (s, 3H) , 1.02 (t, J = 7.2 Hz, 3H). LC-MS (ESI): calculated mass for C ₂₈ H ₃₀ ClF ₄ N ₅ O ₅ S 659.2, found m/z 660.2 [M+H] ⁺ .

Compound 14B : ¹ HNMR (400 MHz, CD ₃ OD) δ 7.82 (d, J = 3.2 Hz, 1H), 7.63 (d, J = 3.2 Hz, 1H), 7.14 - 7.11 (m, 2H), 6.05 (s , 1H), 4.17 - 3.99 (m, 2H), 3.96 - 3.91 (m, 2H), 3.82 - 3.77 (m, 1H), 3.38 - 3.29 (m, 1H), 3.28 - 3.25 (m, 1H), 3.18 - 3.16 (m, 1H), 3.01 - 2.94 (m, 2H), 2.64 - 2.47 (m, 2H), 2.02 - 1.75 (m, 4H), 1.31 (s, 3H), 1.02 (t, J = 7.2 Hz , 3H). LC-MS (ESI): RT = 3.446 min, calculated mass for C _{28 H 30} ClF ₄ N ₅ O ₅ S is 660.1, found m/z is 661.2 [M+H] ⁺ . LC-MS (ESI): calculated mass for C ₂₈ H ₃₀ ClF ₄ N ₅ O ₅ S 659.2, found m/z 660.2 [M+H] ⁺ . Preparation of Compound 15A : (R*)-3-(( cis )-4-(((R*)-6-(2,3 -difluorophenyl )-5-( methoxycarbonyl )-2 -( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-2- Hydroxy -2- methylpropanoic acid ( single diastereomer )

Compound 15A was prepared starting from S6 and intermediate H8A using the same procedure as described for compounds 8A and 8B .

LC-MS (ESI): Calculated mass for C ₂₆ H ₂₇ F ₄ N ₅ O ₅ S is 597.5, found m/z is 598.2 [M+H] ⁺ . Chiral analysis (column: Chiralpak IG 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH : TFA : DEA = 70 : 30 : 0.1 : 0.1, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm , R _T = 10.192 min). ¹ HNMR (400 MHz, CD ₃ OD) δ 7.97 (d, J = 3.2 Hz, 1H), 7.76 (d, J = 3.2 Hz, 1H), 7.18 - 7.13 (m, 3H), 6.05 (s, 1H) , 4.23 (d, J = 16.8 Hz, 1H), 4.07 (d, J = 17.2 Hz, 1H), 3.81 - 3.77 (m, 1H), 3.64 (s, 3H), 3.60 - 3.57 (m, 1H), 3.27 - 3.25 (m, 2H), 3.16 (d, J = 13.2 Hz, 1H), 3.03 - 2.96 (m, 2H), 2.82 - 2.79 (m, 1H), 1.95 - 1.89 (m, 2H), 1.39 ( s, 3H). Preparation of Compounds 16A and 16B : (R*)-4-(( cis )-4-(((R*)-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-6- (2,3,4 -trifluorophenyl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1( 2H) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer ) and (S*)-4-(( cis )-4-(((R*)-5-( Ethoxycarbonyl )-2-( thiazol- 2- yl )-6-(2,3,4- trifluorophenyl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -Difluorohexahydropyrrolo [3,2-b] pyrrol - 1(2H) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compounds 16A and 16B were prepared starting from S4 and intermediate H15A using the same procedure as described for 10A and 10B .

Compound 16A : LC-MS (ESI): The calculated mass for C ₂₈ H ₃₀ F ₅ N ₅ O ₅ S is 643.2, and the found m/z is 644.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.83 (d, J = 3.2 Hz, 1H), 7.65 (d, J = 3.2 Hz, 1H), 7.10 - 6.94 (m, 2H), 5.89 (s, 1H) , 4.12 - 3.94 (m, 4H), 3.80 - 3.75 (m, 1H), 3.38 - 3.30 (m, 1H), 3.25 - 3.22 (m, 1H), 3.17 - 3.12 (m, 1H), 2.97 - 2.80 ( m, 2H), 2.75 - 2.67 (m, 1H), 2.54 - 2.47 (m, 1H), 2.00 - 1.74 (m, 4H), 1.31 (s, 3H), 1.07 (t, J = 6.8 Hz, 3H) .

Compound 16B : LC-MS (ESI): The calculated mass for C ₂₈ H ₃₀ F ₅ N ₅ O ₅ S is 643.2, and the found m/z is 644.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.84 (d, J = 3.2 Hz, 1H), 7.65 (d, J = 2.8 Hz, 1H), 7.10 - 6.94 (m, 2H), 5.89 (s, 1H) , 4.12 - 3.94 (m, 4H), 3.80 - 3.75 (m, 1H), 3.38 - 3.30 (m, 1H), 3.27 - 3.24 (m, 1H), 3.20 - 3.13 (m, 1H), 3.03 - 2.90 ( m, 2H), 2.63 - 2.49 (m, 2H), 2.01 - 1.75 (m, 4H), 1.31 (s, 3H), 1.07 (t, J = 7.2 Hz, 3H). Preparation of Compounds 17A and 17B : (R*)-4-(( cis )-4-(((R*)-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-6- (2,3,4 -trifluorophenyl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1( 2H) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer ) and (S*)-4-(( cis )-4-(((R*)-5-( Methoxycarbonyl )-2-( thiazol- 2- yl )-6-(2,3,4- trifluorophenyl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -Difluorohexahydropyrrolo [3,2-b] pyrrol - 1(2H) -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compounds 16A and 16B were prepared starting from S4 and intermediate H16A using the same procedure as described for 10A and 10B . Compound 17A :

LC-MS (ESI): Calculated mass for C ₂₇ H ₂₈ F ₅ N ₅ O ₅ S is 629.2, found m/z is 630.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.83 (d, J = 3.2 Hz, 1H), 7.65 (d, J = 3.2 Hz, 1H), 7.08 - 6.93 (m, 2H), 5.89 (s, 1H) , 4.12 - 3.97 (m, 2H), 3.80 - 3.75 (m, 1H), 3.52 (s, 3H), 3.38 - 3.32 (m, 1H), 3.26 - 3.25 (m, 1H), 3.19 - 3.17 (m, 1H), 2.97 - 2.81 (m, 2H), 2.74 - 2.68 (m, 1H), 2.54 - 2.48 (m, 1H), 2.00 - 1.72 (m, 4H), 1.31 (s, 3H). Compound 17B :

中間體 T1-2 ： 2-( 羥基甲基 )-2,5- 二氫 -1H- 吡咯 -1- 甲酸三級丁酯 LC-MS (ESI): Calculated mass for C ₂₇ H ₂₈ F ₅ N ₅ O ₅ S is 629.2, found m/z is 630.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.84 (d, J = 3.2 Hz, 1H), 7.65 (d, J = 3.2 Hz, 1H), 7.08 - 6.96 (m, 2H), 5.89 (s, 1H) , 4.12 - 3.96 (m, 2H), 3.80 - 3.75 (m, 1H), 3.52 (s, 3H), 3.38 - 3.28 (m, 1H), 3.24 - 3.23 (m, 1H), 3.18 - 3.13 (m, 1H), 3.03 - 2.89 (m, 2H), 2.60 - 2.46 (m, 2H), 2.01 - 1.73 (m, 4H), 1.30 (s, 3H). Preparation of intermediate T1 :

Intermediate T1-2 : tertiary butyl 2-( hydroxymethyl )-2,5- dihydro- 1H- pyrrole- 1 -carboxylate

Add 1-tert-butyl 2-methyl 1H-pyrrole-1,2(2H,5H)-dicarboxylate Intermediate T1-1 (30 g, 90% purity, 119 mmol) in THF under ice/water bath (300 mL) was added lithium borohydride (7.80 g, 358 mmol). After stirring at room temperature for 12 hours, the mixture was poured into water (800 mL) and extracted three times with ethyl acetate (350 mL). The combined organic layers were washed with brine (550 mL) and concentrated to give the desired compound (23 g, 100% purity by LCMS, 97% yield) as a yellow oil. LC-MS (ESI): calculated mass for C ₁₀ H ₁₇ NO ₃ is 199.12, found m/z is 144.3 [M+H-56] ⁺ . Intermediate T1-3 : 2-(((1,3 -Dioxoisoindolin- 2- yl ) oxy ) methyl )-2,5- dihydro- 1H- pyrrole- 1 - carboxylic acid tris grade butyl ester

Under ice/water bath, add tertiary butyl 2-(hydroxymethyl)-2,5-dihydro-1H-pyrrole-1-carboxylate Intermediate T1-2 (23.0 g, 100% purity, 115 mmol), To a solution of 2-hydroxyisoindoline-1,3-dione (19.0 g, 117 mmol) and triphenylphosphine (45.0 g, 172 mmol) in tetrahydrofuran (450 mL) was added diethyl azodicarboxylate Esters (30.0 g, 173 mmol). After stirring at 25°C for 12 hours, the mixture was poured into water (950 mL) and extracted three times with ethyl acetate (450 mL). The combined organic layers were washed with brine (550 mL), and concentrated to give crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=4:1) to obtain the desired compound as a yellow oil (40 g, 95% purity according to ¹ HNMR, 94.6% yield) . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.90 - 7.76 (m, 4H), 6.20 - 6.14 (m, 1H), 6.00 - 5.94 (m, 1H), 4.91 - 4.80 (m, 1H), 4.69 - 4.54 ( m, 1H), 4.36 - 4.10 (m, 3H), 1.49 -1.48 (m, 9H). Intermediate T1-4 : tertiary butyl 2-(( aminooxy ) methyl )-2,5- dihydro- 1H- pyrrole- 1 -carboxylate

Under ice/water bath, add 2-(((1,3-dioxoisoindolin-2-yl)oxy)methyl)-2,5-dihydro-1H-pyrrole-1-carboxylic acid Tertiary butyl ester To a solution of intermediate T1-3 (40.0 g, 95% purity, 109 mmol) in dichloromethane (600 mL) was added 40% aqueous methylhydrazine (19.0 g, 165 mmol). After stirring at 0°C for 1 hour, the mixture was filtered and the filtrate was poured into water (450 mL) and extracted three times with dichloromethane (150 mL). The combined organic layers were washed with brine (550 mL) and concentrated to give the desired compound (27 g, 80% purity by LCMS, 92.3% yield) as a yellow oil. LC-MS (ESI): Calculated mass for C ₁₀ H ₁₈ N ₂ O ₃ is 214.1, found m/z is 215.4 [M+H] ⁺ . Intermediate T1-5 : tertiary butyl 2-((((( benzyloxy ) carbonyl ) amino ) oxy ) methyl )-2,5- dihydro- 1H- pyrrole- 1 -carboxylate

Under ice/water bath, to tertiary butyl 2-(2-aminoethyl)-2,5-dihydro-1H-pyrrole-1-carboxylate Intermediate T1-4 (36.0 g, 80% purity, 134 mmol), sodium carbonate (28.0 g, 264 mmol) in tetrahydrofuran (400 mL) and water (100 mL) was added dropwise benzyl chloroformate (26.0 g, 152 mmol). After stirring at 25°C for 4 hours, the mixture was poured into water (600 mL) and extracted three times with ethyl acetate (200 mL). The combined organic layers were washed with brine (400 mL), and concentrated to give crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=5:1) to obtain the desired compound (53 g, 86% purity according to LCMS, 97.3% yield) as a yellow oil. LC-MS (ESI): calculated mass for C ₁₈ H ₂₄ N ₂ O ₅ is 348.2, found m/z is 349.4 [M+H] ⁺ . Intermediate T1-6 : 2-((((( benzyloxy ) carbonyl ) amino ) oxy ) methyl )-6 -oxa- 3 -azabicyclo [3.1.0] hexane - 3- Tertiary butyl formate

To 2-(((((benzyloxy)carbonyl)amino)oxy)methyl)-2,5-dihydro-1H-pyrrole-1-carboxylic acid tertiary butyl ester Intermediate T1-5 (15.0 g, 86% purity, 37.0 mmol) in dichloromethane (300 mL) was added 3-chloroperoxybenzoic acid (16.0 g, 85% purity, 74.1 mmol). The mixture was stirred at room temperature for 16 hours. The reaction mixture was quenched by 2 M aqueous sodium bicarbonate (150 mL) and 2 M aqueous sodium thiosulfate (150 mL). The mixture was extracted three times with dichloromethane (300 mL). The combined organic layers were washed with brine (200 mL), and concentrated to give crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=3:1) to obtain the desired compound (13 g, 90% purity according to LCMS, 86.7% yield) as a yellow oil. LC-MS (ESI): Calculated mass for C ₁₈ H ₂₄ N ₂ O ₆ is 364.2, found m/z is 265.3 [M+H-100] ⁺ . Intermediate T1-7 : 6 -Hydroxytetrahydro - 1H- pyrrolo [3,2-c] isoxazole- 1,4(5H) -dicarboxylic acid 1- benzyl 4- tertiary butyl ester

To tertiary butyl 2-(((((benzyloxy)carbonyl)amino)oxy)methyl)-6-oxa-3-azabicyclo[3.1.0]hexane-3-carboxylate To a solution of intermediate T1-6 (26.0 g, 90% purity, 71.4 mmol) in acetonitrile (520 mL) was added potassium carbonate (40.0 g, 289 mmol). After stirring at 25°C for 12 hours, the mixture was poured into water (200 mL) and extracted three times with ethyl acetate (200 mL). The combined organic layers were washed with brine (200 mL), and concentrated to give crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=3:1) to obtain the desired compound as a yellow oil (20 g, 90% purity according to ¹ HNMR, 76% yield) . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.39 - 7.32 (m, 5H), 5.22 (s, 2H), 4.87 - 4.72 (m, 1H), 4.62 - 4.55 (m, 1H), 4.37 - 4.36 (m, 1H), 4.27 - 4.24 (m, 0.5H), 3.75 - 3.69 (m, 2H), 3.62 - 3.57 (m, 0.5H), 3.52 - 3.48 (m, 1H), 1.46 (s, 9H). Intermediate T1-8 : tertiary butyl 6- hydroxytetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylate

6-Hydroxytetrahydro-1H-pyrrolo[3,2-c]isoxazole-1,4(5H)-dicarboxylic acid 1-benzyl 4-tertiary butyl ester intermediate T1-7 (20 g, A mixture of 90% purity, 55 mmol) and 10 wt% palladium on carbon (2 g) in ethanol (400 mL) was stirred under a balloon of hydrogen at 0 °C for 1.5 h. The mixture was filtered and the filtrate was concentrated to give the desired compound (12 g, 90% purity by ¹ H NMR, 95% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.69 - 4.59 (m, 1H), 4.17 - 4.01 (m, 3H), 3.93 - 3.87 (m, 2H), 3.49 - 3.29 (m, 3H), 1.38 - 1.35 ( m, 9H). Intermediate T1-9 : 6 -Hydroxytetrahydro - 1H- pyrrolo [3,2-c] isoxazol- 1,4(5H) -dicarboxylic acid 1-((9H- oxa -9- yl ) methyl )4- tertiary butyl ester

To tertiary butyl 6-hydroxytetrahydro-1H-pyrrolo[3,2-c]isoxazole-4(5H)-carboxylate Intermediate T1-8 (12.0 g, 90% purity, 47.0 mmol), carbonic acid To a mixture of sodium hydrogen (22.0 g, 226 mmol) in tetrahydrofuran (180 mL) and water (70 mL) was added methyl (9H-fluorene-9-yl)chloroformate (13.0 g, 52.1 mmol). After stirring at 25°C for 4 hours, the mixture was poured into water (200 mL) and extracted three times with ethyl acetate (200 mL). The combined organic layers were washed with brine (200 mL), and concentrated to give crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=4:1) to obtain the desired compound (21 g, 100% purity according to LCMS, 98% yield) as a yellow oil. LC-MS (ESI): Calculated mass for C ₂₅ H ₂₈ N ₂ O ₆ is 452.2, found m/z is 397.3 [M+H-56] ⁺ . Intermediate T1-10 : 6 - oxotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 1,4(5H) -dicarboxylic acid 1-((9H- oxa -9- yl ) Methyl ) 4- tertiary butyl ester

To 6-hydroxytetrahydro-1H-pyrrolo[3,2-c]isoxazole-1,4(5H)-dicarboxylic acid 1-((9H-fen-9-yl)methyl)4-tertiary Butyl esters To a solution of intermediate T1-9 (21.0 g, 100% purity, 46.5 mmol) in dichloromethane (420 mL) was added Dess-Martin periodinane (39.4 g, 92.9 mmol). After stirring at 25 °C for 5 h, the reaction mixture was quenched with 2 M aqueous sodium bicarbonate (500 mL) and 2 M aqueous sodium thiosulfate (500 mL). The mixture was extracted three times with dichloromethane (300 mL). The combined organic layers were washed with brine (300 mL), and concentrated to give crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=4:1) to obtain the desired compound (18.7 g, 90% purity according to ¹ HNMR, 99% yield) as a white solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.78 - 7.76 (m, 2H), 7.64 - 7.61 (m, 2H), 7.44 - 7.40 (m, 2H), 7.35 - 7.31 (m, 2H), 4.87 - 4.59 ( m, 3H), 4.57 - 4.47 (m, 1H), 4.34 - 4.23 (m, 2H), 3.96 - 3.82 (m, 2H), 3.60 - 3.53 (m, 1H) 1.52 - 1.49 (m, 9H). Intermediate T1-11 : 6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 1,4(5H) -dicarboxylic acid 1-((9H- oxa -9- yl ) methyl ) 4- tertiary butyl ester

At 0°C, to 6-oxotetrahydro-1H-pyrrolo[3,2-c]isoxazol-1,4(5H)-dicarboxylic acid 1-((9H-fen-9-yl )methyl)4-tertiary butyl ester Intermediate T1-10 (6.50 g, 90% purity, 14.4 mmol) in dichloromethane (100 mL) was added diethylaminosulfur trifluoride (23.1 g, 144 mmol). The mixture was stirred at 40°C for 16 hours. The mixture was poured into 2 M aqueous sodium bicarbonate (500 mL) and extracted three times with dichloromethane (100 mL). The combined organic layers were washed with brine (100 mL), and concentrated to give crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=8:1) to obtain the desired compound (5.1 g, 88% purity according to LCMS, 66% yield) as a yellow oil. LC-MS (ESI): calculated mass for C ₂₅ H ₂₆ F ₂ N ₂ O ₅ is 472.2, found m/z is 473.4 [M+H] ⁺ .

Chiral separation of intermediate T1-11 : chiral Prep.SFC (column: Chiralpak IG 5 µm 20 * 250 mm; mobile phase: CO ₂ : MeOH = 60 : 40 at 45 g/min; column temperature: 40° C; wavelength: 214 nm, back pressure: 100 bar), both as yellow oils.

Intermediate T1-11A : chiral analysis (column: Chiralpak IG 5 µm 4.6 * 250 mm; mobile phase: CO ₂ : MeOH = 60 : 40, at 3 g/min; column temperature: 40°C; wavelength: 214 nm , back pressure: 100 bar, R _T = 2.29 min). ¹ HNMR (300 MHz, CDCl ₃ ) δ 7.82 (d, J = 7.2 Hz, 2H), 7.67 (t, J = 6.6 Hz, 2H), 7.49 - 7.44 (m, 2H), 7.40 - 7.37 (m, 2H ), 4.88 - 4.79 (m, 1H), 4.73 - 4.53 (m, 3H), 4.35 - 4.28 (m, 1H), 4.21 - 4.12 (m, 1H), 4.06 - 3.93 (m, 1H), 3.67 - 3.50 (m, 2H), 1.54 - 1.53 (m, 9H).

Intermediate T1-11B : chiral analysis (column: Chiralpak IG 5 µm 4.6 * 250 mm; mobile phase: CO ₂ : MeOH = 60 : 40, at 3 g/min; column temperature: 40°C; wavelength: 214 nm , back pressure: 100 bar, R _T = 3.60 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.77 (d, J = 7.6 Hz, 2H), 7.62 (t, J = 7.6 Hz, 2H), 7.43 - 7.40 (m, 2H), 7.35 - 7.30 (m, 2H ), 4.83 - 4.74 (m, 1H), 4.65 - 4.49 (m, 3H), 4.29 - 4.23 (m, 1H), 4.15 - 4.09 (m, 1H), 4.06 - 3.87 (m, 1H), 3.60 - 3.46 (m, 2H), 1.49 - 1.48 (m, 9H). Intermediate T1 : (3a S *,6a S *)-6,6 -difluorotetrahydro- 1 H - pyrrolo [3,2-c] isoxazole- 4(5 H ) -carboxylic acid tertiary butyl ester

中間體 T2-1 ： (3aS*,6aS*)-1-(4-( 苄基氧基 )-2- 氟 -3,3- 二甲基 -4- 側氧基丁基 )-6,6- 二氟四氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -4(5H)- 甲酸三級丁酯 To (3a S *,6a S *)-6,6-difluorotetrahydro-1 H -pyrrolo[3,2-c]isoxazole-1,4(5 H )-dicarboxylic acid 1-(( 9H- Trex -9-yl)methyl)4-tert-butyl ester Intermediate T1-11B (3.50 g, 90% purity, 6.67 mmol) in N,N -dimethylformamide (35 mL) To the solution was added piperidine (2.80 g, 32.9 mmol). After stirring at room temperature for 4 hours, the mixture was poured into water (100 mL) and extracted three times with dichloromethane (50 mL). The combined organic layers were washed with brine (100 mL), and concentrated to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 4: 1) to obtain the desired product as a yellow oil (1.70 g, 90% purity by ¹ HNMR, 91% yield). ¹ HNMR (300 MHz, CDCl ₃ ) δ 5.60 - 5.56 (m, 1H), 4.99 - 4.86 (m, 1H), 4.38 - 4.24 (m, 1H), 4.08 - 3.91 (m, 1H), 3.64 - 3.49 ( m, 2H), 1.52 - 1.51 (m, 9H). Preparation of intermediate T2 :

Intermediate T2-1 : (3aS*,6aS*)-1-(4-( benzyloxy )-2- fluoro -3,3 -dimethyl- 4 -oxobutyl )-6,6 -Difluorotetrahydro - 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -tertiary butyl carboxylate

To (3aS*,6aS*)-1-(4-(benzyloxy)-2-hydroxy-3,3-dimethyl-4-oxobutyl) at -78°C under nitrogen atmosphere -6,6-Difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazole-4(5H)-carboxylic acid tertiary butyl ester Intermediate M1-1 (200 mg, 90% purity, 0.383 mmol ) in dichloromethane (4 mL) was added diethylaminosulfur trifluoride (185 mg, 1.15 mmol). After stirring at room temperature under a nitrogen atmosphere for 2 hours, the mixture was poured into saturated sodium bicarbonate (5 mL), and extracted twice with dichloromethane (5 mL). The organic layer was washed with brine (5 mL), dried over anhydrous sodium sulfate, and concentrated to give crude product, which was purified by C18 column (acetonitrile: water = 60% to 70%) to give the title product as yellow oil (40 mg, 85% purity, 19% yield). LC-MS (ESI): Calculated mass for C ₂₃ H ₃₁ F ₂ N ₂ O ₅ is 472.2, found m/z is 473.6 [M+H] ⁺ . Intermediate T2-2 : 4-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 - fluoro- Benzyl 2,2 -dimethylbutyrate

To (3aS*,6aS*)-1-(4-(benzyloxy)-2-fluoro-3,3-dimethyl-4-oxobutyl)-6,6-difluorotetrahydro -1H-Pyrrolo[3,2-c]isoxazole-4(5H)-carboxylic acid tertiary butyl ester Intermediate T2-1 (140 mg, 59% purity, 0.175 mmol) in dichloromethane (1 mL) To the mixture was added trifluoroacetic acid (0.5 mL). The mixture was stirred at room temperature for 2 hours. It is then concentrated. The residue was purified by C18 column (acetonitrile: water = 60% to 70%) to obtain the desired compound (160 mg, 39% purity, 96% yield) as a red oil. LC-MS (ESI): calculated mass for C ₁₈ H ₂₃ F ₃ N ₂ O ₃ is 372.2, found m/z is 373.5 [M+H] ⁺ . Intermediate T2-3 : (4S)-6-(((3aS*,6aS*)-1-(4-( benzyloxy )-2- fluoro -3,3 -dimethyl- 4 -oxo butylbutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2- methyl phenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

To 4-((3aS*,6aS*)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isozazol-1-yl)-3-fluoro-2,2-di Benzyl methylbutyrate Intermediate T2-2 (120 mg, 80% purity, 0.258 mmol) in N,N-Dimethylformamide (1.5 mL) was added with 2,2',2"- Nitrilotriethanol (130 mg, 0.871 mmol) and (S)-6-(bromomethyl)-4-(3-fluoro-2-methylphenyl)-2-(thiazol-2-yl)- Ethyl 1,4-dihydropyrimidine-5-carboxylate Intermediate H1A (170 mg, 95% purity, 0.368 mmol). The resulting mixture was stirred at 40°C under nitrogen for 5 hours. It was then distilled with ethyl acetate ( 5 mL) and washed twice with water (2 mL) and brine (3 mL). The organic phase was dried over anhydrous sodium sulfate(s), filtered and concentrated. The residue was passed through a C18 column (acetonitrile: water = 70 % to 80%) to give the desired product (135 mg, 89% purity, 64% yield) as a yellow oil. LC-MS (ESI): mass calculated for C ₃₆ H ₃₉ F4N ₅ O ₅ S System 729.3, m/z found value system 730.3 [M+H] ⁺ . Intermediates T2-3A and T2 : (S)-6-(((3aS*,6aS*)-1-((R*)-4 -( Benzyloxy )-2- fluoro -3,3 -dimethyl- 4 -oxobutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] iso ( Zazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine -5- carboxylic acid Ethyl ester and (S)-6-(((3aS*,6aS*)-1-((S*)-4-( benzyloxy )-2- fluoro -3,3 -dimethyl- 4- Oxybutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -Methylphenyl )-2-( thiazol- 2 - yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

(4S)-6-(((3aS*,6aS*)-1-(4-(benzyloxy)-2-fluoro-3,3-dimethyl-4-oxobutyl)- 6,6-Difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazol-4(5H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)- 2-(Thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl ester The racemic mixture of intermediate T2-3 (190 mg, 99% purity, 0.286 mmol) was prepared by chiral Prep. Purification by HPLC (column: Chiralpak OD-H 10 μm 30*250 mm; mobile phase: Hex:EtOH = 80:20 at 25 mL/min; temperature: 30°C; wavelength: 214 nm) gave a yellow oil The desired products of intermediate T2-3A (20 mg, 90% pure according to ¹ HNMR, 11% yield, 99.7% stereopure) and Intermediate T2 (100 mg, 90% pure according to ¹ HNMR, 57% Yield, 100% stereopure).

Intermediate T2-3A : chiral analysis (column: Chiralpak OD-H 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 80 : 20, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm , R _T = 7.400 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.18 (s, 1H), 7.82 (d, J = 2.8 Hz, 1H), 7.41 (d, J = 2.0 Hz, 1H), 7.36 - 7.27 (m, 5H), 7.10 - 7.04 (m, 1H), 6.99 - 6.89 (m, 2H), 6.00 (s, 1H), 5.18 - 5.05 (m, 2H), 4.68 - 4.54 (m, 1H), 4.49 - 4.33 (m, 1H ), 4.25 - 4.09 (m, 3H), 4.05 - 3.98 (m, 3H), 3.72 - 3.70 (m, 1H), 3.63 - 3.54 (m, 2H), 3.35 - 3.24 (m, 1H), 3.07 - 3.01 (m, 1H), 2.54 (s, 3H), 1.32 (s, 3H), 1.26 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H).

Intermediate T2 : chiral analysis (column: Chiralpak OD-H 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 80 : 20, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 9.676 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.19 (s, 1H), 7.82 (d, J = 2.8 Hz, 1H), 7.41 (d, J = 2.0 Hz, 1H), 7.36 - 7.29 (m, 5H), 7.10 - 7.05 (m, 1H), 6.98 - 6.89 (m, 2H), 6.01 (s, 1H), 5.19 - 5.11 (m, 2H), 5.04 - 4.90 (m, 1H), 4.32 - 4.11 (m, 3H ), 4.05 - 3.98 (m, 3H), 3.89 - 3.85 (m, 1H), 3.66 - 3.61 (m, 1H), 3.51 - 3.40 (m, 1H), 3.11 - 2.90 (m, 3H), 2.54 (s , 3H), 1.29 - 1.26 (m, 6H), 1.12 (t, J = 7.2 Hz, 3H). Compound 18 : (S)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 - Fluoro -2,2 -dimethylbutanoic acid (single diastereomer)

中間體 T3-1 ：異丁酸苄酯 To (S)-6-(((3aS*,6aS*)-1-((S*)-4-(benzyloxy)-2-fluoro-3,3-dimethyl-4-oxo butylbutyl)-6,6-difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazol-4(5H)-yl)methyl)-4-(3-fluoro-2-methyl Ethylphenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate Intermediate T2 (100 mg, 90% purity, 0.123 mmol) in dichloromethane (1 mL) To the solution in was added trifluoromethanesulfonic acid (125 mg, 0.833 mmol). After stirring at room temperature under nitrogen atmosphere for 0.5 h, the mixture was neutralized with 2 M saturated sodium bicarbonate solution (3 mL), and extracted three times with dichloromethane (3 mL). The organic layer was dried over anhydrous sodium sulfate and concentrated to give crude product which was purified by C18 column (acetonitrile: water = 60% to 70%) to give the title product as yellow solid (51 mg, 99% pure by LCMS , 64% yield). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₅ S is 639.2, found m/z is 640.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.19 (s, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.40 (d, J = 2.8 Hz, 1H), 7.10 - 7.04 (m, 1H), 6.98 - 6.88 (m, 2H), 6.00 (s, 1H), 5.03 - 4.89 (m, 1H), 4.26 - 4.22 (m, 3H), 4.09 - 3.98 (m, 4H), 3.78 - 3.73 (m, 1H ), 3.50 - 3.39 (m, 1H), 3.13 - 3.05 (m, 3H), 2.53 - 2.50 (m, 3H), 1.29 (s, 3H), 1.23 (s, 3H), 1.11 (t, J = 6.8 Hz, 3H). Preparation of intermediate T4 :

Intermediate T3-1 : benzyl isobutyrate

To a solution of benzyl alcohol (50.0 g, 462 mmol) and isobutyryl chloride (56.7 g, 532 mmol) in dichloromethane (500 mL) was added DIPEA (120 g, 928 mmol) at 0°C. After stirring at room temperature for 12 hours, the reaction mixture was poured into water (400 mL) and extracted three times with dichloromethane (300 mL). The combined organic layers were washed with water (500 mL), brine (500 mL), dried over anhydrous magnesium sulfate, filtered and concentrated. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=40:1) to obtain the title compound (82.3 g, 95% purity according to ¹ HNMR, 94% yield) as a red liquid. ¹ HNMR (300 MHz, CDCl ₃ ) δ 7.38 - 7.29 (m, 5H), 5.12 (s, 2H), 2.65 - 2.56 (m, 1H), 1.19 (d, J = 7.2 Hz, 6H). Intermediate T3-2 : Benzyl 2,2 -dimethylpent- 4 - enoate

To a solution of benzyl isobutyrate intermediate T3-1 (82.3 g, 439 mmol, 95% purity) in THF (800 mL) was added 1 M diisopropylamino group at -78 °C under nitrogen atmosphere Lithium in tetrahydrofuran (600 mL, 600 mol). Then, the mixture was stirred at -78°C under nitrogen atmosphere for 2 hours. Allyl bromide (112 g, 926 mmol) was added dropwise at -78 °C under nitrogen atmosphere. After the addition, the resulting solution was stirred overnight at room temperature under nitrogen atmosphere. The reaction mixture was quenched with saturated ammonium chloride solution (100 mL), diluted with water (800 mL), and extracted three times with ethyl acetate (550 mL). The combined organic phases were washed with brine (800 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=100:1) to obtain the title compound (67.0 g, 90% purity according to ¹ HNMR, 62% yield) as a yellow oil .

¹ HNMR (300 MHz, CDCl ₃ ) δ 7.39 - 7.29 (m, 5H), 5.79 - 5.65 (m, 1H), 5.11 (s, 2H), 5.05 (s, 1H), 5.00 (d, J = 5.7 Hz , 1H), 2.30 (d, J = 7.5 Hz, 2H), 1.21 (s, 6H). Intermediate T3-3 : Benzyl 2,2 -dimethyl- 4 - oxobutanoate

To a solution of benzyl 2,2-dimethylpent-4-enoate intermediate T3-2 (67.0 g, 90% purity, 276 mmol) in dichloromethane (700 mL) at -78°C Ozone gas was bubbled in until the reaction mixture turned dark blue. After stirring at -78°C for 1 hour and purging with nitrogen, dimethyl sulfide (147 g, 2.37 mol) was added to the reaction mixture and allowed to warm to room temperature. After stirring overnight at 35°C, the solution was concentrated to give a residue, which was purified by silica gel column chromatography (ethyl acetate: ethyl acetate = 1:50 to 1:4) to give a colorless oil (47.0 g, 95% pure by ¹ HNMR, 73% yield). ¹ HNMR (300 MHz, CDCl ₃ ) δ 9.72 (s, 1H), 7.45-7.29 (m, 5H), 5.13 (s, 2H), 2.67 (brs, 2H), 1.31 (s, 6H). Intermediate T3-4 : Benzyl 3- fluoro -2,2 -dimethyl- 4 -oxobutanoate

To a solution of benzyl 2,2-dimethyl-4-oxobutanoate intermediate T3-3 (5.00 g, 20.4 mmol, 95% purity) in tertiary butyl methyl ether (50 mL) was added (S )-2-(bis(3,5-bis(trifluoromethyl)phenyl)((trimethylsilyl)oxy)methyl)pyrrolidine (305 mg, 0.511 mmol) and N-fluoro-N - (Phenylsulfonyl)benzenesulfonamide (7.09 g, 22.5 mmol). The mixture was stirred overnight at room temperature. The mixture was filtered. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=50:1) to obtain the desired compound (4.8 g, 90% purity according to ¹ HNMR, 88% yield) as a colorless oil ).

¹ HNMR(300 MHz, CDCl3) δ 9.82 (d, J = 6.0 Hz, 1H), 7.45 - 7.39 (m, 5H), 5.22 (s, 2H), 4.73 (d, J = 47.7 Hz, 1H), 1.41 (s, 3H), 1.39 (s, 3H). Intermediate T3-5 : (3aS*,6aS*)-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylic acid tertiary butyl ester

3-Fluoro-2,2-dimethyl-4-oxobutanoic acid benzyl ester Intermediate T3-4 (2.50 g, 9.44 mmol, 90% purity) in dichloromethane (20 mL ) to the solution in (3aS*,6aS*)-6,6-difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazole-4(5H)-carboxylic acid tertiary butyl ester intermediate T1 (1.50 g, 5.40 mmol, 90% purity), acetic acid (1.5 mL), and 1 M triisopropoxytitanium(IV) chloride in dichloromethane (6 mL, 6 mmol). The mixture was stirred at 0°C for 5 minutes. Sodium cyanoborohydride (678 mg, 10.8 mmol) was added to the mixture at 0 °C. The mixture was stirred at 0°C for 20 minutes. The mixture was diluted with dichloromethane (50 mL). The mixture was poured into saturated aqueous sodium bicarbonate (30 mL). The mixture was extracted twice with dichloromethane (20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue. The residue was purified by C18 column (acetonitrile:water=30% to 80% in 30 minutes, water: addition of 0.1% ammonium bicarbonate) to give the title compound as colorless oil (1.8 g, 64% yield, 90% pure according to HNMR). The 900 mg product was further separated by chiral prep-HPLC (separation conditions: column: Chiralpak IE 5 μm 30 * 250 mm; mobile phase: Hex:EtOH=70:30, at 25 mL/min, temperature: 30 ° C, wavelength: 214 nm) to afford the compound (820 mg, 90% pure by ¹ H NMR, 99.9% stereopure, 86% yield) as a colorless oil.

Chiral analysis (column: Chiralpak IE 5 μm 4.6 * 250 mm; mobile phase: Hex : EtOH = 70 : 30, at 1.0 mL/min; temperature: 30°C; wavelength: 214 nm, RT = _9.270 min).

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.38 - 7.30 (m, 5H), 5.19 - 5.11 (m, 2H), 5.01 - 4.87 (m, 1H), 4.85 - 4.71 (m, 1H), 4.06 - 3.65 ( m, 4H), 3.45 - 3.40 (m, 1H), 3.13 - 2.87 (m, 2H), 1.46 (s, 9H), 1.28 (s, 3H), 1.23 (s, 3H). Intermediate T3 : (S*)-4-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isozazol- 1 -yl )-3 -Benzyl fluoro - 2,2 -dimethylbutyrate

To (3aS*,6aS*)-1-((S*)-4-(benzyloxy)-2-fluoro-3,3-dimethyl-4-oxobutyl at 0°C )-6,6-difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazole-4(5H)-tertiary butyl carboxylate Intermediate T3-5 (290 mg, 80% purity, 0.491 mmol) in dichloromethane (3 mL) was added dropwise trifluoroacetic acid (1.5 mL). After stirring at room temperature for 1 hour, the reaction was quenched with saturated sodium bicarbonate (10 mL) and extracted three times with dichloromethane (10 mL). The organic phase was washed with brine (30 mL), dried over anhydrous sodium sulfate(s), filtered and concentrated to afford the title compound (200 mg, 75% yield, 69% pure by LCMS) as a pale yellow oil.

LC-MS (ESI): calculated mass for C ₁₈ H ₂₃ F ₃ N ₂ O ₃ is 372.2, found m/z is 373.1 [M+H] ⁺ . Intermediate T4 : (S*)-6-(((3aS*,6aS*)-1-((S*)-4-( benzyloxy )-2- fluoro -3,3 - dimethyl- 4 -oxobutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -Methylphenyl )-2-(4 -methylthiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

To (S*)-4-((3aS*,6aS*)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isozazol-1-yl)- To a solution of benzyl 3-fluoro-2,2-dimethylbutyrate intermediate T3 (60 mg, 80% purity, 0.13 mmol) in N,N-dimethylformamide (0.6 mL) was added 2 ,2',2"-Nitrotriethanol (58 mg, 0.39 mmol) and (S*)-6-(bromomethyl)-4-(3-fluoro-2-methylphenyl)-2- Ethyl (4-methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate Intermediate H7B (130 mg, 90% purity, 0.259 mmol).Stir overnight at 40°C under nitrogen atmosphere After that, the reaction mixture was slowly quenched with water (20 mL) and extracted three times with ethyl acetate (20 mL).The combined organic layers were washed with brine (20 mL), dried over anhydrous Na ₂ SO ₄ (s) and filtered. The filtrate was concentrated under reduced pressure, and the residue was purified by C18 column (acetonitrile: water = 5% to 95%) to obtain the title compound (83 mg, 90% purity according to ¹ HNMR, 77.9% yield) as a yellow solid ) ^.1 HNMR (400 MHz, CDCl ₃ ) δ 9.19 (br s, 1H), 7.35 - 7.29 (m, 5H), 7.09 - 7.04 (m, 1H), 6.99 - 6.96 (m, 2H), 6.92 - 6.88 (m, 1H), 5.99 (s, 1H), 5.19 - 5.11 (m, 2H), 5.04 - 5.01 (m, 0.5H), 4.92 - 4.90 (m, 0.5H), 4.25 - 4.24 (m, 2H) , 4.22 - 4.20 (m, 1H), 4.07 - 3.96 (m, 3H), 3.88 - 3.84 (m, 1H), 3.66 - 3.60 (m, 1H), 3.50 - 3.40 (m, 1H), 3.14 - 3.08 ( m, 1H), 3.03 - 2.90 (m, 2H), 2.52 (s, 3H), 2.43 (s, 3H), 1.29 (s, 3H), 1.24 (s, 3H), 1.11 (t, J = 7.2 Hz , 3H) .Compound 19 : (S)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl ) -2-(4 -methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H -pyrrolo [3,2 - c] isozazol- 1 -yl )-3 - fluoro -2,2 -dimethylbutanoic acid (single diastereomer)

(S*)-6-(((3aS*,6aS*)-1-((S*)-4-(benzyloxy)-2-fluoro-3,3-dimethyl Base-4-oxobutyl)-6,6-difluorotetrahydro-1H-pyrrolo[3,2-c]isozazol-4(5H)-yl)methyl)-4-(3 -Fluoro-2-methylphenyl)-2-(4-methylthiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl ester Intermediate T4 (83 mg, 90% purity, 0.100 mmol) in dichloromethane (2 mL) was added dropwise trifluoromethanesulfonic acid (1 mL). After stirring at room temperature for 1 hour, the reaction mixture was quenched with saturated aqueous sodium bicarbonate (10 mL) and extracted three times with ethyl acetate (30 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ (s) and filtered. The filtrate was concentrated under reduced pressure, and the residue was purified by C18 column (acetonitrile: water = 5% to 95%) to give the title compound (40 mg, 98.3% purity by LCMS, 60.6% yield) as a yellow solid .

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.19 (s,1H), 7.06 - 7.03 (m, 1H), 6.97 - 6.95 (m, 2H), 6.91 - 6.87 (m, 1H), 5.98 (s, 1H) , 5.03 - 4.89 (m, 1H), 4.32 - 4.26 (m, 3H), 4.08 - 3.98 (m, 4H), 3.75 - 3.70 (m, 1H), 3.50 - 3.40 (m, 1H), 3.13 - 3.05 ( m, 3H), 2.52 (s, 3H), 2.43 (s, 3H), 1.30 (s, 3H), 1.24 (s, 3H), 1.11 (t, J = 6.8 Hz, 3H). LC-MS (ESI): Calculated mass for C ₃₀ H ₃₅ F ₄ N ₅ O ₅ S is 653.2, found m/z is 654.2 [M+H] ⁺ . Compound 20 : (S)-4-(( cis )-4-(((R)-6-(2- chloro -3,4 -difluorophenyl )-5-( ethoxycarbonyl )-2 -( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1 -yl )-3 - fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H4A for Intermediate H7B . Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 30% to 50%) afforded the title compound (17 mg, 33.3% yield, 98.6% purity by LCMS) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.28 (s, 1H), 7.85 (d, J = 2.8 Hz, 1H), 7.44 (d, J = 3.2 Hz, 1H), 7.05 - 7.02 (m, 2H), 6.19 (s, 1H), 5.04 - 4.89 (m, 1H), 4.30 - 4.24 (m, 3H), 4.06 - 3.99 (m, 4H), 3.77 - 3.72 (m, 1H), 3.49 - 3.39 (m, 1H ), 3.13 - 3.06 (m, 3H), 1.29 (s, 3H), 1.24 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). LC-MS (ESI): calculated mass for C ₂₈ H ₂₉ ClF ₅ N ₅ O ₅ S 677.1, found m/z 678.2 [M+H] ⁺ . Compound 21 : (S)-4-(( cis )-4-(((R)-6-(2- chloro- 3 - fluorophenyl )-5-( ethoxycarbonyl )-2-( thiazole -2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl ) -3 - Fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H17A for Intermediate H7B . By prep.HPLC (preparation method: SunFire®Prep C18 OBD TM (5 μm 19 * 150 mm), mobile phase A: water (0.01% trifluoroacetic acid), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min, gradient: 40% - 70% (%B)) to afford the title compound (28 mg, 97.8% purity by LCMS, 37% yield) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.90 (d, J = 2.8 Hz, 1H), 7.55 (s, 1H), 7.22 - 7.06 (m, 3H), 6.28 (s, 1H), 5.03 - 4.88 (m , 1H), 4.35 - 4.03 (m, 7H), 3.75 - 3.70 (m, 1H), 3.61 - 3.50 (m, 1H), 3.19 - 3.07 (m, 3H), 1.31 (s, 3H), 1.26 (s , 3H), 1.12 (t, J = 7.2 Hz, 3H). LC-MS (ESI): calculated mass for C ₂₈ H ₃₀ ClF ₄ N ₅ O ₅ S 659.2, found m/z 660.2 [M+H] ⁺ . Compound 22 : (S)-4-(( cis )-4-(((S)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )- 2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c ] isoxazole- 1- yl )-3 - fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H3B for Intermediate H7B . Purification by C18 column (acetonitrile: water = 5% to 95%) afforded the title compound (38 mg, 98.9% purity by LCMS, 59.5% yield) as a yellow solid.

¹ HNMR (400 MHz, CD ₃ OD) δ 7.93 (d, J = 3.2 Hz, 1H), 7.73 (d, J = 2.8 Hz, 1H), 7.06 - 7.02 (m, 2H), 5.92 (s, 1H) , 5.02 - 5.00 (m, 0.5H), 4.90 - 4.88 (m, 0.5H), 4.41 - 4.28 (m, 3H), 4.07 - 3.99 (m, 2H), 3.95 - 3.89 (m, 1H), 3.62 ( s, 3H), 3.38 - 3.36 (m, 1H), 3.21 - 3.08 (m, 2H), 3.02 - 2.93 (m, 1H), 2.57 (s, 3H), 1.26 (s, 3H), 1.19 (s, 3H). LC-MS (ESI): The calculated mass for C2 ₈ H ₃₀ F ₅ N ₅ O ₅ S is 643.2, and the found m/z is 644.2 [M+H] ⁺ . Compound 23 : (S)-4-(( cis )-4-(((R)-6-(2- chloro -3,4 -difluorophenyl )-5-( methoxycarbonyl )-2 -( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1 -yl )-3 - fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H2A for Intermediate H7B . Purification by C18 chromatography (acetonitrile: water = 30% to 80%) afforded the title compound (27.9 mg, 46% yield, 99.9% pure by LCMS) as a yellow solid.

LC-MS (ESI): calculated mass for C ₂₇ H ₂₇ ClF ₅ N ₅ O ₅ S 663.1, found m/z 664.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.92 - 7.88 (m, 1H), 7.58 - 7.49 (m, 1H), 7.13 - 7.04 (m, 2H), 6.30 - 6.21 (m, 1H), 5.02 - 4.88 ( m, 1H), 4.35 - 4.30 (m, 3H), 4.21 - 4.02 (m, 2H), 3.76 - 3.71 (m, 1H), 3.66 - 3.52 (m, 4H), 3.20 - 3.07 (m, 3H), 1.30 (s, 3H), 1.26 (s, 3H). Compound 24 : (S)-4-(( cis )-4-(((R)-6-(3,4 -difluoro -2 -methylphenyl )-5-( ethoxycarbonyl )- 2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c ] isoxazole- 1- yl )-3 - fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H5A for Intermediate H7B . Purification by C18 column (acetonitrile: water = 40% to 80%) gave the desired compound (12 mg, 27% yield, 99.8% purity by LCMS) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.86 (s, 1H), 7.52 - 7.45 (m, 1H), 6.95 - 6.89 (m, 2H), 5.97 (s, 1H), 5.04 - 4.89 (m, 1H) , 4.28 (s, 3H), 4.10 - 4.00 (m, 4H), 3.75 - 3.70 (m, 1H), 3.54 - 3.43 (m, 1H), 3.17 - 3.03 (m, 3H), 2.58 (s, 3H) , 1.31 (s, 3H), 1.26 (s, 3H), 1.13 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₂ F ₅ N ₅ O ₅ S is 657.2, found m/z is 658.3 [M+H] ⁺ . Compound 25 : (S)-4-(( cis )-6,6 -difluoro -4-(((S)-6-(3- fluoro -2 -methylphenyl )-5-( methoxy Cylcarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl ) hexahydro -1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 - Fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H20B for Intermediate H7B . Purification by C18 column (acetonitrile: water = 30% to 80%) afforded the title compound (22.4 mg, 37% yield, 99.1% purity by LCMS) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.90 - 7.85 (m, 1H), 7.56 - 7.46 (m, 1H), 7.12 - 7.03 (m, 1H), 6.98 - 6.92 (m, 2H), 6.11 - 6.07 ( m, 1H), 5.03 - 4.89 (m, 1H), 4.34 - 4.30 (m, 3H), 4.09 - 4.00 (m, 2H), 3.76 - 3.71 (m, 1H), 3.62 (s, 3H), 3.55 - 3.45 (m, 1H), 3.14 - 3.06 (m, 3H), 2.57 - 2.55 (m, 3H), 1.30 (s, 3H), 1.26 (s, 3H). LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₅ S is 625.2, found m/z is 626.2 [M+H] ⁺ . Compound 26 : (S)-4-(( cis )-4-(((R)-6-(2- chloro- 4 - fluorophenyl )-5-( ethoxycarbonyl )-2-( thiazole -2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl ) -3 - Fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H19A for Intermediate H7B . Purification by C18 column (acetonitrile: water = 30% to 80%) afforded the title compound (23.4 mg, 99.2% purity by LCMS, 24% yield) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.85 (d, J = 2.8 Hz, 1H), 7.46 (d, J = 2.8 Hz, 1H), 7.31 - 7.28 (m, 1H), 7.14 - 7.12 (m, 1H ), 6.95 -6.90 (m, 1H), 6.19 (s, 1H), 5.04 - 5.01 (m, 0.5H), 4.92 -4.89 (m, 0.5H), 4.29 - 4.24 (m, 3H), 4.09 - 3.99 (m, 4H), 3.74 - 3.69 (m, 1H), 3.52 - 3.43 (m, 1H), 3.20 - 3.03 (m, 3H), 1.31 (s, 3H), 1.26 (s, 3H), 1.14 - 1.10 (m, 3H). LC-MS (ESI): calculated mass for C ₂₈ H ₃₀ ClF ₄ N ₅ O ₅ S 659.2, found m/z 660.2 [M+H] ⁺ . Compound 27 : (S)-4-(( cis )-4-(((R)-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-6-(2,3,4 -Trifluorophenyl )-3,6 - dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 - Fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H15A for Intermediate H7B . Purification by C18 column (acetonitrile: water = 30% to 80%) afforded the title compound (46 mg, 99% purity by LCMS, 48% yield) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.89 - 7.88 (m, 1H), 7.52 - 7.50 (m, 1H), 7.09 - 7.03 (m, 1H), 6.94 -6.87 (m, 1H), 6.01 - 6.00 ( m, 1H), 5.04 - 5.01 (m, 0.5H), 4.92 -4.89 (m, 0.5H), 4.29 - 4.01 (m, 7H), 3.72 - 3.67 (m, 1H), 3.55 - 3.44 (m, 1H ), 3.13 - 3.02 (m, 3H), 1.31 (s, 3H), 1.26 (s, 3H), 1.18 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₈ H ₂₉ F ₆ N ₅ O ₅ S is 661.2, found m/z is 662.2 [M+H] ⁺ . Compound 28 : (S)-4-(( cis )-4-(((R)-6-(2- chloro- 4 - fluorophenyl )-5-( methoxycarbonyl )-2-( thiazole -2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl ) -3 - Fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H18A for Intermediate H7B . Purification by C18 column (acetonitrile: water = 30% to 80%) afforded the title compound (59 mg, 98.3% purity by LCMS, 51% yield) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.37 - 9.16 (m, 1H), 7.85 (d, J = 3.2 Hz, 1H), 7.45 (d, J = 3.2 Hz, 1H), 7.29 - 7.27 (m, 1H ), 7.15 - 7.12 (m, 1H), 6.95 - 6.90 (m, 1H), 6.17 (s, 1H), 5.04 - 4.89 (m, 1H), 4.29 - 4.24 (m, 3H), 4.08 - 3.99 (m , 2H), 3.74 - 3.69 (m, 1H), 3.60 (s, 3H), 3.53 - 3.43 (m, 1H), 3.16 - 3.03 (m, 3H), 1.31 (s, 3H), 1.26 (s, 3H ). LC-MS (ESI): calculated mass for C ₂₇ H ₂₈ ClF ₄ N ₅ O ₅ S 645.1, found m/z 646.1 [M+H] ⁺ . Compound 29 : (S)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl- 6-d) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-3 - fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared using a procedure similar to Compound 19 by substituting Intermediate H22B for Intermediate H7B . Purification by C18 column (acetonitrile: water = 20% to 90%) afforded the desired compound (34 mg, 99% purity by LCMS, 48% yield) as a yellow solid.

中間體 T5-1 ： (3a R*,6a R*)-6,6- 二氟六氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -1- 甲酸 (9H- 茀 -9- 基 ) 甲酯 LC-MS (ESI): Calculated mass for C ₂₉ H ₃₂ DF ₄ N ₅ O ₅ S is 640.2, found m/z is 641.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ): δ 9.24 (br s, 1H), 7.87 - 7.81 (m, 1H), 7.44 (s, 1H), 7.11 - 7.05 (m, 1H), 6.99 - 6.89 (m, 2H), 5.04 - 4.90 (m, 1H), 4.35 - 4.23 (m, 3H), 4.11 - 3.97 (m, 4H), 3.77 - 3.70 (m, 1H), 3.53 - 3.42 (m, 1H), 3.14 - 3.02 (m, 3H), 2.54 (s, 3H), 1.31 (s, 3H), 1.26 (s, 3H), 1.22 (t, J = 7.2 Hz, 3H). Preparation of Intermediate T5 :

Intermediate T5-1 : (3a R *,6a R *)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1 - carboxylic acid (9H- oxahydro - 9- base ) methyl ester

(3aR*,6aR*)-6,6-difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazole-1,4(5H)-dicarboxylic acid 1-( (9H-Fil-9-yl)methyl)4-tert-butyl ester To a mixture of Intermediate T1-11A (3.00 g, 90% purity, 5.72 mmol) in dichloromethane (4 mL) was added trifluoroacetic acid (1 mL). After stirring at room temperature for 3 hours, the mixture was quenched by saturated aqueous sodium bicarbonate (5 mL) and extracted twice with dichloromethane (5 mL). The combined organic layers were washed with brine (10 mL), and concentrated to give crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=2:1) to obtain the title compound (2.14 g, 95% purity according to ¹ HNMR, 95.4% yield) as a yellow oil.

¹ HNMR (300 MHz, CDCl ₃ ): δ 7.82 (d, J = 7.8 Hz, 2H), 7.68 (t, J = 6.6 Hz, 2H), 7.46 (t, J = 7.5 Hz, 2H), 7.41 - 7.34 (m, 2H), 4.64 - 4.50 (m, 3H), 4.38 - 4.31 (m, 2H), 4.11 - 4.08 (m, 1H), 3.69 - 3.64 (m, 1H), 3.28 - 3.09 (m, 2H) . Intermediate T5-2 : ((3a R *,6a R *)-4-((( S )-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2 -( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1 - (9H- Flange -9- yl ) methyl formate

To (S)-6-(bromomethyl)-4-(3-fluoro-2-methylphenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl Ester A solution of intermediate H1A (2.00 g, 90% purity, 4.11 mmol) in N , N -dimethylformamide (10 mL) was added in N , N -dimethylformamide (10 mL) and (3a R *,6a R *)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isoxazole-1-carboxylic acid in triethanolamine (1.04 g, 6.98 mmol) ( 9H-Trem-9-yl)methyl ester Intermediate T5-1 (1.60 g, 95% purity, 4.11 mmol). After stirring overnight at 25°C under nitrogen atmosphere, the reaction mixture was diluted with water (60 mL) and extracted twice with ethyl acetate (60 mL). The combined organic layers were washed with brine (40 mL), dried over anhydrous sodium sulfate, filtered and concentrated to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 4: 1 to 2: 1 ) to afford the title compound (2.67 g, 90% purity by ¹ H NMR, 80.1% yield) as a yellow solid.

¹ HNMR (300 MHz, CDCl ₃ ): δ 7.91 - 7.90 (m, 1H), 7.82 - 7.80 (m, 2H), 7.69 - 7.66 (m, 2H), 7.50 - 7.35 (m, 4H), 7.28 - 7.25 (m, 1H), 7.17 - 7.10 (m, 1H), 6.97 - 6.96 (m, 1H), 6.89 - 6.86 (m, 1H), 6.09 (s, 1H), 4.80 - 4.73 (m, 1H), 4.69 - 4.63 (m, 1H), 4.58 - 4.47 (m, 2H), 4.38 - 4.30 (m, 2H), 4.21 - 4.13 (m, 4H), 3.54 - 3.41 (m, 2H), 3.23 - 3.15 (m, 1H), 2.59 (s, 3H), 1.19 (t, J = 6.9 Hz, 3H). Intermediate T5-3 : ( S )-6-(((3a R *,6a R *)-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4( 5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

To ((3aR*,6aR*)-4-(((S)-5-(ethoxycarbonyl)-6-(3-fluoro-2-methylphenyl)-2-(thiazol-2-yl )-3,6-dihydropyrimidin-4-yl)methyl)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isoxazole-1-carboxylic acid (9H-oxahydro- 9-yl)methyl ester To a solution of intermediate T5-2 (2.67 g, 90% purity, 3.29 mmol) in N , N -dimethylformamide (10 mL) was added piperidine (841 mg, 9.88 mmol ). After stirring at room temperature for 2 hours, the mixture was concentrated to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 2: 1 to 1: 1) to obtain a yellow oil The title compound was obtained (1.541 g, 80% pure by ¹ HNMR, 73.8% yield).

¹ HNMR (300 MHz, CDCl ₃ ): δ 7.87 - 7.86 (m, 1H), 7.47 (s, 1H), 7.14 - 7.07 (m, 1H), 7.03 - 6.97 (m, 1H), 6.95 - 6.92 (m , 1H), 6.05 (s, 1H), 4.51 - 4.42 (m, 2H), 4.22 - 4.12 (m, 5H), 3.53 - 3.48 (m, 1H), 3.44 -3.30 (m, 1H), 3.20 - 3.11 (m, 1H), 2.57 (s, 3H), 1.16 (t, J = 7.2 Hz, 3H). Intermediate T5 : (S)-6-(((3aR*,6aR*)-1-((S*)-4-( benzyloxy )-2- fluoro -3,3 -dimethyl- 4 -Oxybutyl )-6,6 - difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3 - fluoro- 2 -Methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

To (S)-6-(((3aR*,6aR*)-6,6-difluorotetrahydro-1H-pyrrolo[3,2-c]isozol-4(5H)-yl)methyl )-4-(3-fluoro-2-methylphenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl ester Intermediate T5-3 (150 mg, 80 % purity, 0.236 mmol) and (S*)-3-fluoro-2,2-dimethyl-4-oxobutanoic acid benzyl ester intermediate T3-4 (95 mg, 90% purity, 0.36 mmol) in To a solution in dichloromethane (3 mL) was added a 1 M solution of triisopropoxytitanium(IV) chloride in dichloromethane (0.3 mL, 0.3 mmol) and acetic acid (0.15 mL). After stirring at 0°C for 5 minutes, sodium cyanoborohydride (30 mg, 0.477 mmol) was added. After stirring at 0 °C for 0.5 h, the mixture was poured into saturated aqueous sodium bicarbonate (10 mL) and extracted three times with dichloromethane (10 mL). The combined organic layers were dried over anhydrous sodium sulfate, and concentrated to obtain a crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5: 1) to obtain (126 mg, 80% purity by HNMR, 58.4% yield).

Intermediate T5 : chiral analysis ( _RT = 9.04 min, area%: 99.8, method: column: Chiralpak IE 5 μm 4.6 * 250 mm; mobile phase: Hex : EtOH : DEA = 65 : 35 : 0.2, in 1 mL /min; temperature: 30°C; wavelength: 254 nm). ¹ HNMR (300 MHz, CDCl ₃ ): δ 7.84 (s, 1H), 7.50 (s, 1H), 7.41 (s, 5H), 7.16 - 7.09 (m, 1H), 7.04 - 6.94 (m, 2H), 6.08 (s, 1H), 5.21 - 5.20 (m, 2H), 5.11 - 4.90 (m, 1H), 4.57 - 4.51 (m, 1H), 4.16 - 4.08 (m, 4H), 4.03 - 4.02 (m, 2H ), 3.60 - 3.47 (m, 2H), 3.23 - 3.01 (m, 3H), 2.60 (s, 3H), 1.30 (s, 6H), 1.18 (t, J = 6.9 Hz, 3H). Compound 30 : (S)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 - Fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

To (S)-6-(((3aR*,6aR*)-1-((S*)-4-(benzyloxy)-2-fluoro-3,3-dimethyl-4-oxo butylbutyl)-6,6-difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazol-4(5H)-yl)methyl)-4-(3-fluoro-2-methyl Ethylphenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylate Intermediate T5 (180 mg, 80% purity, 0.197 mmol) in dichloromethane (4 mL) To the solution in was added trifluoromethanesulfonic acid (0.8 mL). The mixture was stirred at room temperature under nitrogen atmosphere for 0.5 hours. The mixture was neutralized with saturated aqueous sodium bicarbonate (5 mL), and extracted three times with dichloromethane (5 mL). The combined organic layers were dried over anhydrous sodium sulfate, and concentrated to give crude product. The crude product was subjected to prep-HPLC (column: Waters Xbrige C18 (5 μm 19 * 150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL /min, gradient: 20% - 70% (%B)) to afford the title compound (65.8 mg, 97.8% pure by LCMS, 51% yield) as a yellow solid.

中間體 T6 ： 3,3- 二氟 -2,2- 二甲基 -4- 側氧基丁酸苄酯 LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₅ S is 639.2, found m/z is 640.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD): δ 7.81 (d, J = 2.8 Hz, 1H), 7.61 (d, J = 3.6 Hz, 1H), 7.07 - 6.98 (m, 2H), 6.85 - 6.81 (m , 1H), 5.86 (s, 1H), 4.82 - 4.79 (m, 0.5H), 4.70 - 4.67 (m, 0.5H), 4.35 - 4.31 (m, 1H), 4.23 - 4.20 (m, 1H), 4.05 - 4.01 (m, 1H), 3.98 - 3.87 (m, 4H), 3.83 - 3.77 (m, 1H), 3.38 - 3.25 (m, 1H), 3.12 - 2.95 (m, 3H), 2.40 (d, J = 2.0 Hz, 3H), 1.15 (s, 3H), 1.09 (s, 3H), 1.03 (t, J = 7.2 Hz, 3H). Preparation of Intermediate T6 :

Intermediate T6 : benzyl 3,3 -difluoro -2,2 -dimethyl- 4 -oxobutanoate

To a solution of benzyl 2,2-dimethyl-4-oxobutyrate intermediate T3-3 (1.50 g, 6.47 mmol, 95% purity) in tertiary butyl methyl ether (40 mL) was added (S )-2-(bis(3,5-bis(trifluoromethyl)phenyl)((trimethylsilyl)oxy)methyl)pyrrolidine (97 mg, 0.16 mmol), (R)-2 -(bis(3,5-bis(trifluoromethyl)phenyl)((trimethylsilyl)oxy)methyl)pyrrolidine (97 mg, 0.16 mmol) and N-fluoro-N-(benzene sulfonyl)benzenesulfonamide (6.12 g, 19.4 mmol). After stirring overnight at room temperature, the mixture was filtered. The filtrate was concentrated. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=10:1) to obtain the desired compound (1.2 g, 80% purity according to ¹ HNMR, 58% yield) as a colorless oil ). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.61 (t, J = 2.8 Hz, 1H), 7.38 - 7.31 (m, 5H), 5.17 (s, 2H), 1.41 (s, 6H). Compound 31 : 4-(( cis )-4-(((S)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazole -2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl ) -3,3 -Difluoro -2,2 -dimethylbutanoic acid (single diastereomer)

Using a procedure similar to Compound 19 , this compound was prepared by substituting Intermediate T6 for Intermediate T3-3 and Intermediate H3B for Intermediate H7B . Purification by C18 column (acetonitrile:water = 30% to 80% in 30 minutes) afforded the title compound (34.4 mg, 99.4% purity by LCMS, 56% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₂₉ F ₆ N ₅ O ₅ S is 661.2, found m/z is 662.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.92 (d, J = 3.2 Hz, 1H), 7.72 (d, J = 3.2 Hz, 1H), 7.09 - 7.00 (m, 2H), 5.92 (s, 1H) , 4.40 - 4.23 (m, 3H), 4.08 - 4.05 (m, 1H), 4.00 - 3.92 (m, 2H), 3.62 - 3.53 (m, 5H), 3.38 - 3.29 (m, 1H), 3.17 - 3.10 ( m, 1H), 2.56 (d, J = 2.0 Hz, 3H), 1.38 (s, 3H), 1.37 (s, 3H). Compound 32 : 4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazole- 2- Base )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3, 3 -Difluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

中間體 T7-1 ： (S)-2-( 甲氧基甲氧基 ) 丙酸乙酯 This compound was prepared using a procedure similar to compound 31 by substituting Intermediate H1A for Intermediate H3B . Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 5% to 95%) afforded the title compound (8.5 mg, 97.4% purity by LCMS, 59% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₂ F ₅ N ₅ O ₅ S is 657.2, found m/z is 658.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.10 (s, 1H), 7.82 - 7.80 (m, 1H), 7.43 - 7.41 (m, 1H), 7.10 - 7.05 (m, 1H), 6.96 - 6.89 (m, 2H), 6.00 (s, 1H), 4.32 - 4.21 (m, 3H), 4.08 - 4.00 (m, 4H), 3.67 - 3.57 (m, 2H), 3.51 - 3.44 (m, 2H), 3.10 - 3.03 ( m, 1H), 2.53 (s, 3H), 1.45 (s, 3H), 1.40 (s, 3H), 1.10 (t, J = 7.2 Hz, 3H). Preparation of Intermediate T7 :

Intermediate T7-1 : ethyl (S)-2-( methoxymethoxy ) propionate

To a solution of 60% sodium hydride (6.70 g, 168 mmol) in tetrahydrofuran (150 mL) in mineral oil was added ethyl (S)-2-hydroxypropionate (10.0 g , 84.7 mmol). After stirring at 0°C for 1 hour, bromo(methoxy)methane (12.7 g, 102 mmol) was added dropwise at 0°C. The resulting solution was stirred overnight at room temperature under nitrogen atmosphere. It was then quenched with water (30 mL) and extracted with ethyl acetate (200 mL). The organic layer was washed with brine (100 mL), dried over anhydrous Na ₂ SO _4(s) , filtered and concentrated under reduced pressure to afford the title compound as a pale yellow oil (10.5 g, 90% pure by ¹ HNMR, 69% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.69 - 4.65 (m, 2H), 4.21 - 4.15 (m, 3H), 3.37 (s, 3H), 1.41 (d, J = 6.8 Hz, 3H), 1.26 (t , J = 7.2 Hz, 3H). Intermediate T7-2 : ethyl 2-( methoxymethoxy )-2 -methylpent- 4 - enoate

(S)-2-(Methoxymethoxy)propionate ethyl ester Intermediate T7-1 (10.5 g, 90% purity, 58.3 mmol) in THF (210 mL) at -78 °C under nitrogen atmosphere A 2 M solution of lithium diisopropylamide in tetrahydrofuran (47 mL, 94.0 mmol) was added dropwise to the solution. After stirring at -78°C for 1 h, allyl bromide (11 mL, 127 mmol) was added dropwise at -78°C under nitrogen atmosphere. The resulting solution was stirred overnight at room temperature. It was then quenched with water (100 mL) and extracted with ethyl acetate (300 mL). The organic layer was washed with brine (150 mL), dried over anhydrous Na ₂ SO _4(s) , filtered and concentrated. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=1:0 to 20:1) to obtain the title compound (5.26 g, 90% purity according to ¹ HNMR, 40 %Yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.85 - 5.71 (m, 1H), 5.11 (s, 1H), 5.07 (s, 1H), 4.75 (s, 2H), 4.20 - 4.11 (m, 2H), 3.37 (s, 3H), 2.51 (d, J = 9.2 Hz, 2H), 1.43 (s, 3H), 1.27 (t, J = 8.4 Hz, 3H). Intermediate T7-3 : ethyl 2-( methoxymethoxy )-2- methyl- 4 -oxobutanoate

2-(Methoxymethoxy)-2-methylpent-4-enoic acid ethyl ester Intermediate T7-2 (5.26 g, 90% purity, 23.4 mmol) in dichloromethane at -78°C (100 mL) was bubbled with ozone until blue. The reaction solution was quenched with dimethylsulfane (4.2 mL, 57.2 mmol) at -78 °C. After stirring overnight at room temperature under a nitrogen atmosphere, the mixture was concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10:1 to 2:1) to obtain a yellow oil The title compound was obtained as a solid (2.0 g, 90% pure by ¹ HNMR, 30% yield). ¹ HNMR (300 MHz, CDCl ₃ ) δ 9.77 (s, 1H), 4.80 (s, 2H), 4.24 - 4.16 (m, 2H), 3.36 (s, 3H), 2.83 (d, J = 2.1 Hz, 2H ), 1.55 (s, 3H), 1.30 - 1.28 (m, 3H). Intermediate T7-4 : (3aS*,6aS*)-1-(4- ethoxy - 3-( methoxymethoxy )-3 -methyl- 4 -oxobutyl )-6, 6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylic acid tertiary butyl ester

2-(Methoxymethoxy)-2-methyl-4-oxobutanoic acid ethyl ester intermediate T7-3 (300 mg, 90% purity, 1.08 mmol) and anhydrous sulfuric acid at 0°C To a solution of magnesium (390 mg, 3.24 mmol) in dichloromethane (15 mL) was added (3aS*,6aS*)-6,6-difluorotetrahydro-1H-pyrrolo[3,2-c]iso Oxazole-4(5H)-tertiary butyl carboxylate Intermediate T1 (600 mg, 90% purity, 2.64 mmol). After stirring overnight at 20°C under a nitrogen atmosphere, acetic acid (0.3 mL) and sodium triacetyloxyborohydride (1.1 g, 5.19 mmol) were added at 0°C. After stirring at room temperature for 1 hour, 20 mL of water was added. The mixture was extracted with dichloromethane (100 mL). The organic layer was washed with brine (100 mL), dried over anhydrous Na ₂ SO _4(s) , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=20:1 to 10:1) to obtain the desired compound (380 mg, 86% purity, 69% yield) as a colorless oil ). LC-MS (ESI): calculated mass for C ₁₉ H ₃₂ F ₂ N ₂ O ₇ is 438.2, found m/z is 439.4 [M+H] ⁺ . Intermediate T7-5 : 4-((3aS*,6aS*)-4-( tertiary butoxycarbonyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso㗁Azol- 1 -yl )-2-( methoxymethoxy )-2 -methylbutanoic acid

To (3aS*,6aS*)-1-(4-ethoxy-3-(methoxymethoxy)-3-methyl-4-oxobutyl) at 0°C under nitrogen atmosphere -6,6-Difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazole-4(5H)-carboxylic acid tertiary butyl ester Intermediate T7-4 (380 mg, 86% purity, 0.745 mmol ) in methanol (6 mL) and water (6 mL) was added sodium hydroxide (120 mg, 3.00 mmol). After stirring at 30 °C for 2 hours, the mixture was concentrated under reduced pressure to afford the title compound (600 mg, 45% purity, 84% yield) as a colorless oil. LC-MS (ESI): calculated mass for C ₁₇ H ₂₈ F ₂ N ₂ O ₇ is 410.2, found m/z is 411.4 [M+H] ⁺ . Intermediate T7-6 : (3aS*,6aS*)-1-(4-( allyloxy )-3-( methoxymethoxy )-3 -methyl- 4 -oxobutyl ) -6,6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylic acid tertiary butyl ester

4-((3aS*,6aS*)-4-(tertiary butoxycarbonyl)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c ]isozol-1-yl)-2-(methoxymethoxy)-2-methylbutanoic acid Intermediate T7-5 (600 mg, 45% purity, 0.623 mmol) and potassium carbonate (520 mg, 3.76 mmol) in N,N -dimethylformamide (10 mL) was added allyl bromide (450 mg, 3.72 mmol). After stirring overnight at 30°C, the mixture was diluted with water (50 mL) and extracted with ethyl acetate (100 mL). The organic layer was washed with brine (50 mL), dried over anhydrous Na ₂ SO _4(s) , filtered and concentrated under reduced pressure to obtain the crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10 : 1 ) to afford the title compound (350 mg, 63% purity, 79% yield) as a brown oil. LC-MS (ESI): Calculated mass for C ₂₀ H ₃₂ F ₂ N ₂ O ₇ is 450.2, found m/z is 451.3 [M+H] ⁺ . Intermediate T7-7 : 4-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-2 - hydroxyl- Allyl 2 -methylbutyrate

To (3aS*,6aS*)-1-(4-(allyloxy)-3-(methoxymethoxy)-3-methyl-4-oxobutyl)-6,6- Difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazole-4(5H)-carboxylic acid tertiary butyl ester Intermediate T7-6 (350 mg, 63% purity, 0.489 mmol) in dichloromethane (5 mL) was added trifluoroacetic acid (1 mL). After stirring at room temperature for 3 h, the mixture was quenched with saturated aqueous sodium carbonate (10 mL). The mixture was extracted twice with ethyl acetate (50 mL). The combined organic phases were dried over Na ₂ SO _4(s) , filtered and concentrated to give the title compound (400 mg, 26% purity, 69% yield) as a colorless oil. LC-MS (ESI): calculated mass for C ₁₃ H ₂₀ F ₂ N ₂ O ₄ is 306.1, found m/z is 307.1 [M+H] ⁺ . Intermediate T7-8 : (3aS*,6aS*)-1-(4-( allyloxy )-3 -hydroxy- 3 -methyl- 4 -oxobutyl )-6,6 -difluoro Tertiary butyl tetrahydro -1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylate

4-((3aS*,6aS*)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isozazol-1-yl)-2-hydroxy-2 -Allyl methylbutyrate Intermediate T7-7 (400 mg, 26% purity, 0.340 mmol) in dichloromethane (5 mL) was added triethylamine (135 mg, 1.33 mmol) and dicarbonic acid Ditertiary butyl ester (95 mg, 0.435 mmol). After stirring overnight at 25 °C, the reaction mixture was diluted with water (10 mL) and extracted three times with dichloromethane (10 mL). The combined organic phases were washed with brine (10 mL), dried over Na ₂ SO _4(s) and filtered. The filtrate was concentrated to give a residue, which was purified by C18 column (acetonitrile: water = 5% to 100%) to give the title compound (120 mg, 90% purity, 78% yield) as a pale yellow oil . LC-MS (ESI): calculated mass for C ₁₈ H ₂₈ F ₂ N ₂ O ₆ is 406.2, found m/z is 407.2 [M+H] ⁺ . Intermediate T7-9 : (3aS*,6aS*)-1-(4-( allyloxy )-3 - fluoro - 3 -methyl- 4 -oxobutyl )-6,6 -difluoro Tertiary butyl tetrahydro -1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylate

(3aS*,6aS*)-1-(4-(allyloxy)-3-hydroxy-3-methyl-4-oxobutyl)-6,6-di Fluorotetrahydro-1H-pyrrolo[3,2-c]isoxazole-4(5H)-carboxylic acid tertiary butyl ester Intermediate T7-8 (90 mg, 90% purity, 0.199 mmol) in dichloromethane ( 6 mL) was added diethylaminosulfur trifluoride (1.5 mL). The reaction mixture was warmed to room temperature and stirred overnight. It was then poured into saturated aqueous sodium bicarbonate (10 mL) and extracted twice with dichloromethane (15 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO _4(s) , filtered and concentrated. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=10:1) to obtain the desired product (73 mg, 22% purity, 20% yield) as a colorless oil. LC-MS (ESI): calculated mass for C ₁₈ H ₂₇ F ₃ N ₂ O ₅ is 408.2, found m/z is 409.2 [M+H] ⁺ . Intermediate T7-10 : 4-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isozazol- 1 -yl )-2 - fluoro- Allyl 2 -methylbutyrate

To (3aS*,6aS*)-1-(4-(allyloxy)-3-fluoro-3-methyl-4-oxobutyl)-6,6-difluorotetrahydro-1H- Pyrrolo[3,2-c]isoxazole-4(5H)-carboxylic acid tert-butyl ester Intermediate T7-9 (73 mg, 22% purity, 0.039 mmol) in dichloromethane (5 mL) Trifluoroacetic acid (1 mL) was added. After stirring at room temperature for 3 hours, the mixture was quenched with saturated aqueous sodium carbonate (10 mL), and extracted twice with ethyl acetate (50 mL). The combined organic phases were dried over Na ₂ SO _4(s) , filtered and concentrated to give the title compound (32 mg, 20% purity, 53% yield) as a colorless oil. LC-MS (ESI): calculated mass for C ₁₃ H ₁₉ F ₃ N ₂ O ₃ is 308.1, found m/z is 309.3 [M+H] ⁺ . Intermediate T7 : (4S)-6-(((3aS*,6aS*)-1-(4-( allyloxy )-3 - fluoro - 3 -methyl- 4 -oxobutyl )- 6,6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )- 2-( Thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

4-((3aS*,6aS*)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isozazol-1-yl)-2-fluoro-2 -Allyl methylbutyrate Intermediate T7-10 (32 mg, 20% purity, 0.021 mmol) in N,N -Dimethylformamide (1 mL) was added with (S)-6- (Bromomethyl)-4-(3-fluoro-2-methylphenyl)-2-(thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl ester Intermediate H1A (20 mg , 90% purity, 0.041 mmol) and 2,2',2"-nitrilotriethanol (20 mg, 0.134 mmol). After stirring overnight at 40°C, the mixture was directly passed through a C18 column (acetonitrile:water (+0.1% ammonium bicarbonate) = 5% to 95%) to give the title compound (14 mg, 90% purity, 91% yield) as a yellow solid. LC-MS (ESI): C ₃₁ H ₃₅ F The calculated mass of ₄ N ₅ O ₅ S is 665.2, and the measured value of m/z is 666.8 [M+H] ⁺ . Compound 33 : 4-(( cis )-4-(((S)-5-( ethoxy ylcarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -di Fluorohexahydro - 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-2- fluoro -2 -methylbutanoic acid

中間體 T8-1 ：異丁酸三級丁酯 To (S)-6-(((3aS*,6aS*)-1-(4-(allyloxy)-3-fluoro-3-methyl-4-oxobutyl)-6,6 -Difluorotetrahydro-1H-pyrrolo[3,2-c]isoxazol-4(5H)-yl)methyl)-4-(3-fluoro-2-methylphenyl)-2-( Thiazol-2-yl)-1,4-dihydropyrimidine-5-carboxylic acid ethyl ester Intermediate T7 (14 mg, 90% purity, 0.019 mmol) and pyrrolidine (30 mg, 0.422 mmol) in dichloromethane (2 mL) was added tetrakis(triphenylphosphine)palladium (10 mg, 0.009 mmol). After stirring at room temperature for 2 hours, the mixture was concentrated. The residue was purified by C18 column (acetonitrile: water = 5% to 80%) to give the title compound (3.2 mg, 99.3% purity by LCMS, 27% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₅ S is 625.2, found m/z is 626.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.80 (d, J = 3.2 Hz, 1H), 7.61 (d, J = 3.2 Hz, 1H), 7.07 - 6.99 (m, 2H), 6.85 - 6.81 (m, 1H ), 5.86 (s, 1H), 4.29 - 4.26 (m, 1H), 4.22 - 4.11 (m, 2H), 3.98 - 3.89 (m, 4H), 3.77 - 3.68 (m, 1H), 3.06 - 2.93 (m , 2H), 2.83 - 2.79 (m, 1.5H), 2.73 - 2.67 (m, 0.5H), 2.40 (d, J = 2.0 Hz, 3H), 2.27 - 2.13 (m, 1H), 2.05 - 1.94 (m , 1H), 1.49 - 1.43 (m, 3H), 1.02 (t, J = 7.2 Hz, 3H). Preparation of Intermediate T8 :

Intermediate T8-1 : tertiary butyl isobutyrate

To a solution of isobutyryl chloride (70.0 g, 657 mmol) in tetrahydrofuran (100 mL) was added potassium tert-butoxide (150 g, 1.34 mol) at 0°C. After stirring overnight at room temperature, the mixture was quenched with saturated aqueous ammonium chloride (120 mL) at 0 °C under nitrogen atmosphere, and extracted twice with ethyl acetate (80 mL). The combined organic layers were concentrated and distilled under reduced pressure to afford the title compound (77.0 g, 90% purity by ¹ H NMR, 73% yield) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 2.44 - 2.37 (m, 1H), 1.42 (s, 9H), 1.10 - 1.08 (m, 6H). Intermediate T8-2 : Tertiary butyl 6-( benzyloxy )-2,2 -dimethylhexanoate

To a solution of tertiary-butyl isobutyrate intermediate T8-1 (3.0 g, 19.76 mmol) in anhydrous THF (30 mL) was added dropwise lithium diisopropylamide under argon at -78°C (12 mL, 2 M, 24 mmol). After stirring at -78 °C under argon for 30 min, benzyl 4-bromobutyl ether (4 mL, 21.058 mmol) was added. The resulting solution was slowly warmed to room temperature and stirred overnight. The reaction mixture was neutralized to pH 6-7 with 1 M aqueous hydrochloride solution (about 4 mL), and extracted twice with ethyl acetate (100 mL). The combined organic phases were washed with brine (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated to obtain the crude product, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 80: 1 to 40: 1) Purification afforded the product as a yellow oil (5.2 g, 90% purity by ¹ H NMR, 77.3% yield). ¹ HNMR (300 MHz, CDCl ₃ ) δ 7.36 - 7.28 (m, 5H), 4.50 (s, 2H), 3.46 (t, J = 6.9 Hz, 2H), 1.65 - 1.60 (m, 1.5H), 1.51 - 1.46 (m, 2H), 1.42 (s, 9H), 1.36 - 1.26 (s, 2.5H), 1.11 (s, 6H). Intermediate T8-3 : Tertiary butyl 6- hydroxy- 2,2 -dimethylhexanoate

6-(Benzyloxy)-2,2-dimethylhexanoic acid tertiary butyl ester intermediate T8-2 (4.2 g, 12.3 mmol, 90% purity) and 10% by weight of palladium carbon (2.0 g, 01.88 mmol) in ethanol (40 mL) was stirred at 40°C under hydrogen (50 psi) for 16 hours. The mixture was filtered, and the filtrate was concentrated under reduced pressure to afford the title compound (2.8 g, 90% purity by ¹ H NMR, 94.4% yield) as a colorless oil.

¹ HNMR (300 MHz, CDCl ₃ ) δ 3.65 (t, J = 6.3 Hz, 2H), 1.60 - 1.50 (m, 3H), 1.43 (s, 9H), 1.36 - 1.26(m, 3H), 1.12 (s , 6H). Intermediate T8 : tertiary butyl 2,2 -dimethyl -6- oxohexanoate

To a mixture of 6-hydroxy-2,2-dimethylhexanoic acid tertiary butyl ester intermediate T8-3 (2.6 g, 10.8 mmol, 90% purity) in dichloromethane (30 mL) at 0 °C Dess-Martin periodinane (6.8 g, 16.0 mmol) was added. The reaction mixture was warmed to room temperature and stirred at room temperature for 1 hour. Saturated aqueous sodium thiosulfate (100 mL) and saturated aqueous sodium bicarbonate (100 mL) were added to the reaction mixture. The mixture was extracted with dichloromethane (100 mL). The organic phase was washed with brine (100 mL) and concentrated under reduced pressure to afford the title compound (2.6 g, 80% purity by ¹ H NMR, 89.7% yield) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.75 - 9.74 (m, 1H), 2.42 - 2.38 (m, 2H), 1.59 - 1.54 (m, 2H), 1.50 - 1.47 (m, 2H), 1.43 (s, 9H), 1.12 (s, 6H). Compound 34 : (R)-6-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-5- fluoro -2,2 -dimethylhexanoic acid (single diastereomer)

This compound was prepared using a procedure similar to compound 19 by substituting Intermediate T8 for Intermediate T3-3 , fluorinating using the R-isomer of the catalyst, substituting Intermediate H1A for Intermediate H7B , and substituting TFA The DCM solution hydrolyzes the tertiary butyl ester. Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 5% to 95%) afforded the title compound (63.2 mg, 99.4% purity by LCMS, 75.7% yield) as a yellow solid.

LC-MS (ESI): Calculated mass for C ₃₁ H ₃₇ F ₄ N ₅ O ₅ S is 667.2, found m/z is 668.2 [M +H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.17 (s, 1H),7.83 (d, J = 2.8 Hz, 1H), 7.41 (d, J = 3.2 Hz, 1H), 7.10 - 7.05 (m, 1H), 6.97 - 6.89 (m, 2H), 6.00 (s, 1H), 4.80 - 4.66 (m, 1H), 4.33 - 4.21 (m, 3H), 4.09 - 3.99 (m, 4H), 3.70 - 3.65 (m, 1H ), 3.52 - 3.42 (m, 1H), 3.22 - 2.95 (m, 3H), 2.56 (d, J = 1.6 Hz, 3H), 1.83 - 1.67 (m, 4H), 1.24 (s, 6H), 1.11 ( t, J = 7.2 Hz, 3H). Compound 35 : (S)-6-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-5- fluoro -2,2 -dimethylhexanoic acid (single diastereomer)

This compound was prepared using a procedure similar to compound 19 by substituting Intermediate T8 for Intermediate T3-3 , Intermediate H1A for Intermediate H7B , and hydrolysis of the tertiary butyl ester with TFA in DCM. By Prep.HPLC (column: Sunfire waters C18 (5 μm 19 *150 mm), mobile phase A: water (0.1% trifluoroacetic acid), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min , gradient: 35% - 85% (%B)) purified, concentrated under reduced pressure to obtain a residue, which was purified by a C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 5% to 95%) to obtain The title compound as a yellow solid (20.3 mg, 99.2% pure by LCMS, 44.9% yield). LC-MS (ESI): Calculated mass for C ₃₁ H ₃₇ F ₄ N ₅ O ₅ S is 667.2, found m/z is 668.3 [M +H] ⁺ .

¹ HNMR (400 MHz, CDCl3) δ 9.19 (s, 1H),7.83 (d, J = 3.2 Hz, 1H), 7.41 (d, J = 3.2 Hz, 1H), 7.10 - 7.04 (m, 1H), 6.98 - 6.89 (m, 2H), 6.00 (s, 1H), 4.84 - 4.68 (m, 1H), 4.34 - 4.22 (m, 3H), 4.08 - 3.99 (m, 4H), 3.71 - 3.66 (m, 1H) , 3.55 - 3.45 (m, 1H), 3.12 - 2.96 (m, 3H), 2.53 (d, J = 1.6 Hz, 3H), 1.77 - 1.64 (m, 4H), 1.23 (s, 6H), 1.12 (t , J = 6.8 Hz, 3H). Compound 36 : (R)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 - Fluoro -2,2 -dimethylbutanoic acid (single diastereomer)

中間體 M1 的製備

中間體 M1-1 ： (3aS*,6aS*)-1-(4-( 苄基氧基 )-2- 羥基 -3,3- 二甲基 -4- 側氧基丁基 )-6,6- 二氟四氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -4(5H)- 甲酸三級丁酯 This compound was prepared using a procedure similar to Compound 18 by substituting Intermediate T2-3A for Intermediate T2 . Purification by C18 column (acetonitrile: water = 40% to 70%) afforded the title compound (6.4 mg, 97.4% purity by LCMS, 23.0% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₅ S is 639.2, found m/z is 640.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.83 (d, J = 3.2 Hz, 1H), 7.63 (d, J = 3.2 Hz, 1H), 7.10 - 7.01 (m, 2H), 6.88 - 6.83 (m, 1H), 5.88 (s, 1H), 4.93 (d, J = 8.0 Hz, 0.5H), 4.80 (d, J = 8.8 Hz, 0.5H), 4.34 - 4.30 (m, 1H), 4.25 - 4.13 (m , 2H), 4.00 - 3.90 (m, 4H), 3.87 - 3.80 (m, 1H), 3.32 - 3.27 (m, 1H), 3.11 - 2.99 (m, 2H), 2.94 - 2.83 (m, 1H), 2.43 (s, 3H), 1.16 (s, 3H), 1.08 (s, 3H), 1.05 (t, J = 7.2 Hz, 3H). Compound 37 :

Preparation of intermediate M1

Intermediate M1-1 : (3aS*,6aS*)-1-(4-( benzyloxy )-2- hydroxy -3,3 -dimethyl- 4 -oxobutyl )-6,6 -Difluorotetrahydro - 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -tertiary butyl carboxylate

A solution of Intermediate T1 (1.00 g, 90% purity, 3.60 mmol) and Intermediate S1-3 (1.15 g, 90% purity, 4.70 mmol) in butan-1-ol (4.0 mL) was heated at 120°C Stir overnight. After cooling to room temperature, the mixture was concentrated to give a residue, which was purified by C18 column (acetonitrile: water = 20% to 95%) to give the title compound as a yellow oil (500 mg, according to ¹ HNMR purity: 90%, 27% yield). LC-MS (ESI): Calculated mass for C ₂₃ H ₃₂ F ₂ N ₂ O ₆ is 470.5, found m/z is 471.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.40 - 7.33 (m, 5H), 5.22 - 5.10 (m, 2H), 4.85 - 4.69 (m, 1H), 4.06 - 3.38 (m, 6H), 3.04 - 2.76 ( m, 2H), 1.48 - 1.42 (m, 9H), 1.25 - 1.20 (m, 6H). Intermediates M1-1a and M1-1b (3aS*,6aS*)-1-((R*)-4-( benzyloxy )-2- hydroxy -3,3 -dimethyl- 4 -oxo butyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -tertiary butyl carboxylate and (3aS*,6aS*)-1- ((S*)-4-( benzyloxy )-2- hydroxy -3,3 -dimethyl- 4 -oxobutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [ 3,2-c] isoxazole- 4(5H) -tertiary butyl carboxylate

The racemic mixture of intermediate M1-1 (1.00 g, 95% purity, 2.02 mmol) was filtered by chiral Prep.HPLC (column: Chiralpak ID 10 μm 30*250 mm; mobile phase: CO ₂ :IPA=70 : 30, with 60 g/min; temperature: 40 ° C; wavelength: 214 nm, back pressure: 100 bar) to obtain Intermediate M1-1a (600 mg, purity 90 according to ¹ HNMR) as a yellow oil %, 57% yield, 100% stereopure) and intermediate M1-1b (400 mg, 90% purity according to ¹ HNMR, 38% yield, 99.5% stereopure).

Intermediate M1-1a : chiral analysis (column: Chiralpak ID 10 μm 4.6 * 250 mm; mobile phase: CO ₂ : IPA = 70 : 30, at 3 g/min; temperature: 40°C; wavelength: 214 nm, Back pressure: 99 bar, R _T = 2.08 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.36 - 7.30 (m, 5H), 5.20 - 5.17 (m, 1H), 5.11 - 5.08 (m, 1H), 4.79 - 4.67 (m, 1H), 4.06 - 3.80 ( m, 4H), 3.69 - 3.57 (m, 1H), 3.41 - 3.36 (m, 1H), 2.97 - 2.85 (m, 2H), 1.46 (s, 9H), 1.27 (s, 3H), 1.21 (s, 3H).

Intermediate M1-1b : chiral analysis (column: Chiralpak ID 10 μm 4.6 * 250 mm; mobile phase: CO ₂ : IPA = 70 : 30, at 3 g/min; temperature: 40°C; wavelength: 214 nm, Back pressure: 99 bar, R _T = 3.20 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.36 - 7.30 (m, 5H), 5.13 (q, J = 12.0 Hz, 2H), 4.84 - 4.71 (m, 1H), 4.03 - 3.74 (m, 4H), 3.70 - 3.58 (m, 1H), 3.52 - 3.46 (m, 1H), 2.97 - 2.90 (m, 1H), 2.80 - 2.69 (m, 1H), 1.46 (s, 9H), 1.25 (s, 3H), 1.22 (s, 3H). Intermediate M1 : (R*)-4-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isozazol- 1 -yl )-3 -Hydroxy - 2,2 -dimethylbutyrate benzyl trifluoroacetate

典型偶合方法 1 ： To a mixture of Intermediate M1-1a (300 mg, 90% purity, 0.574 mmol) in dichloromethane (2 mL) was added trifluoroacetic acid (1 mL). The mixture was stirred at room temperature for 4 hours. It was then concentrated to give the desired compound (350 mg, 73% purity, 91% yield) as a brown oil. LC-MS (ESI): Calculated mass for C ₁₈ H ₂₄ F ₂ N ₂ O ₄ .C ₂ HF ₃ O ₂ is 484.2, found m/z is 371.6 [M-TFA+H] ⁺ . Compound 37-1 : (R*)-6-((( cis )-1-((R*)-4-( benzyloxy )-2- hydroxyl -3,3 -dimethyl- 4- Oxybutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(4- chloro- 3 -Ethyl -fluorophenyl )-2-( thiazol- 2 - yl )-1,4- dihydropyrimidine- 5 -carboxylate (single diastereomer)

Typical coupling method 1 :

典型方法 2 ：苄基酯的去保護： To a mixture of intermediate M1 (118 mg, 73% purity, 0.178 mmol) in N,N-dimethylformamide (1 mL) was added 2,2',2"-nitrilotriethanol (104 mg, 0.697 mmol) and intermediate H21A (110 mg, 97% purity, 0.233 mmol). The resulting mixture was stirred overnight at 40°C under nitrogen. It was then diluted with ethyl acetate (5 mL) and washed with water ( 2 mL) and brine (3 mL) twice. The organic layer was separated and dried over sodium sulfate(s), filtered and concentrated. The residue was purified by C18 column (acetonitrile:water=70% to 80%), The desired product was obtained as a yellow oil (90 mg, 91% purity, 47% yield). LC-MS (ESI): Mass calculated for C ₃₅ H ₃₇ ClF ₃ N ₅ O ₆ S 747.2, m/ The measured value of z is 748.7 [M+H] ⁺ . Compound 37 : (R*)-4-(( cis )-4-(((R*)-6-(4- chloro- 3 - fluorophenyl ) -5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [ 3,2-c] isozazol- 1 -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Typical Method 2 : Deprotection of Benzyl Ester:

中間體 M2 的製備

中間體 M2-1 ： 4-((3aS*,6aS*)-4-( 三級丁氧基羰基 )-6,6- 二氟六氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -1- 基 )-3- 羥基 -2,2- 二甲基丁酸 To a solution of compound 37-1 (95 mg, 91% purity, 0.116 mmol) in dichloromethane (0.5 mL) was added trifluoromethanesulfonic acid (117 mg, 0.780 mmol). The mixture was stirred at room temperature under nitrogen atmosphere for 0.5 hours. It was then basified with saturated sodium bicarbonate solution (3 mL) and extracted three times with dichloromethane (3 mL). The organic layer was dried over sodium sulfate and filtered. The filtrate was concentrated to give a residue, which was purified by C18 column (acetonitrile:water = 60% to 70%) to give the title product (18 mg, 96% purity, 23% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ ClF ₃ N ₅ O ₆ S is 657.2, found m/z is 658.2 [M+H] ⁺ . ¹ HNMR (400 MHZ, CDCl ₃ ) δ 9.31 (s, 1H), 7.88 (d, J = 3.2 Hz, 1H), 7.49 (d, J = 3.2 Hz, 1H), 7.34 - 7.30 (m, 1H), 7.15 - 7.09 (m, 2H), 5.80 (s, 1H), 4.27 - 4.11 (m, 5H), 4.04 - 3.98 (m, 3H), 3.68 - 3.63 (m, 1H), 3.47 - 3.36 (m, 1H ), 3.08 - 3.03 (m, 2H), 2.94 - 2.89 (m, 1H), 1.30 (s, 3H), 1.25 - 1.21 (m, 6H). Compounds 38A and 38B

Preparation of Intermediate M2

Intermediate M2-1 : 4-((3aS*,6aS*)-4-( tertiary butoxycarbonyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso㗁Azol- 1 -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid

A mixture of Intermediate M1-1 (980 mg, 75% purity, 1.56 mmol) and 10 wt% palladium on carbon (100 mg) in ethanol (10 mL) was stirred under a hydrogen balloon at 0°C for 3 hours. The mixture was filtered. The filtrate was concentrated to obtain a residue, which was purified by silica gel chromatography (petroleum ether: ethyl acetate = 5: 1 to 0: 1) to obtain Intermediate M2-1 (700 mg, 90.7 % yield, 77% pure by LCMS).

LC-MS (ESI): Calculated mass for C ₁₆ H ₂₆ F ₂ N ₂ O ₆ is 380.2, found m/z is 381.4 [M+H] ⁺ . Intermediate M2-2 : (3aS*,6aS*)-1-(4-( allyloxy )-2- hydroxy -3,3 -dimethyl- 4 -oxobutyl )-6,6 -Difluorotetrahydro - 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -tertiary butyl carboxylate

To a mixture of intermediate M2-1 (700 mg, 77% purity, 1.42 mmol) and potassium carbonate (570 mg, 4.12 mmol) in N,N-dimethylformamide (7 mL) was added 3-bromo Prop-1-ene (520 mg, 4.30 mmol). The mixture was stirred at room temperature for 12 hours. The mixture was poured into water (30 mL) and extracted three times with dichloromethane (10 mL). The combined organic layers were washed with brine (10 mL), dried over Na ₂ SO ₄ and filtered. The filtrate was concentrated to obtain a residue, which was purified by silica gel chromatography (petroleum ether: ethyl acetate=5: 1) to obtain intermediate M2-2 (550 mg, 92.3% yield, 100% pure by LCMS).

LC-MS (ESI): calculated mass for C ₁₉ H ₃₀ F ₂ N ₂ O ₆ is 420.2, found m/z is 421.4 [M+H] ⁺ . Intermediate M2 : 4-((3aS*,6aS*-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isozazol- 1 -yl )-3 -hydroxy- 2,2 -Allyl dimethylbutyrate 2,2,2- trifluoroacetic acid

To a solution of Intermediate M2-2 (600 mg, 85% purity, 1.21 mmol) in dichloromethane (2 mL) was added 2,2,2-trifluoroacetic acid (1 mL). After stirring at room temperature for 1.5 hours, the mixture was concentrated to afford Intermediate M2 (1.0 g, 96.8% yield, 51% purity by LCMS) as a yellow oil.

LC-MS (ESI): Calculated mass for C ₁₄ H ₂₂ F ₂ N ₂ O ₄ is 320.1, found m/z is 321.4 [M+H] ⁺ . Compound 38-1 : (4S)-6-(((3aS*,6aS*)-1-(4-( allyloxy )-2- hydroxyl -3,3 -dimethyl- 4 -oxo Butyl )-6,6 -difluorohexahydro- 4H- pyrrolo [3,2-c] isoxazol- 4 -yl ) methyl )-4-(3- fluoro -2 -methylphenyl ) -2-( Thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

This compound was prepared according to typical coupling method 1 from Intermediate H1A and Intermediate M2 .

Purification by C18 column (acetonitrile: water = 20% to 80%) afforded the desired compound 38-1 (500 mg, 95.6% yield, 100% purity by LCMS) as a yellow solid.

LC-MS (ESI): The calculated mass for C ₃₂ H ₃₈ F ₃ N ₅ O ₆ S is 677.3, and the found m/z is 676.9 [MH] ^- . Compounds 38A-1 and 38B-1 : (S)-6-((( cis )-1-((R*)-4-( allyloxy )-2- hydroxyl -3,3 -dimethyl -4 -oxobutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- Fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer ) and (S)-6-(( ( cis )-1-((S*)-4-( allyloxy )-2- hydroxy -3,3 -dimethyl- 4 -oxobutyl )-6,6 -difluorotetra Hydrogen -1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazole- 2- base )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer )

The racemic mixture of compound 38-1 (550 mg, 100% purity, 0.812 mmol) was filtered by chiral Prep.SFC (column: ChiralPak ID 5 μm 250*30 mm; mobile phase: CO2 : MeOH = 65 : 35 , at 30 g/min; temperature: 30 °C; wavelength: 254 nm, back pressure: 100 bar) to give compound 38A-1 (230 mg, 37.6% yield, 90% pure by NMR) as a yellow solid ) and compound 38B-1 (220 mg, 36.0% yield, 90% pure by NMR) as a yellow solid.

Compound 38A-1 : chiral HPLC (column: ChiralPak ID 10 μm 250*30 mm; mobile phase: CO2 : IPA = 65 : 35, at 1.95 mL/min; temperature: 40 ° C; wavelength: 254 nm, R _T = 2.79 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.17 (br s, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.42 (d, J = 3.2 Hz, 1H), 7.11- 7.05 (m, 1H) , 6.98 - 6.89 (m, 2H), 6.00 (s, 1H), 5.97 - 5.84 (m, 1H), 5.36 - 5.31 (m, 1H), 5.25 - 5.22 (m, 1H), 4.67 - 4.57 (m, 2H), 4.33 - 4.22 (m, 3H), 4.11 - 4.00 (m, 5H), 3.71 - 3.64 (m, 1H), 3.50 - 3.40 (m, 1H), 3.22 - 3.20 (m, 1H), 3.13 - 3.10 (m, 1H), 2.99 - 2.90 (m, 2H), 2.54 - 2.53 (m, 3H), 1.27 (s, 3H), 1.23 (s, 3H), 1.13 - 1.10 (m, 3H).

典型方法 3 ：烯丙基酯的去保護 Compound 38B-1 : chiral HPLC (column: ChiralPak ID 10 μm 250*30 mm; mobile phase: CO2 : IPA = 65 : 35, at 1.95 mL/min; temperature: 40 ° C; wavelength: 254 nm, R _T = 4.02 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.21 (br s, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.41 (d, J = 3.2 Hz, 1H), 7.11 - 7.05 (m, 1H) , 6.98 - 6.89 (m, 2H), 6.00 (s, 1H), 5.97 - 5.87 (m, 1H), 5.36 - 5.31 (m, 1H), 5.24 - 5.22 (m, 1H), 4.67 - 4.57 (m, 2H), 4.32 - 4.22 (m, 3H), 4.11 - 3.98 (m, 5H), 3.74 - 3.68 (m, 1H), 3.50 - 3.40 (m, 1H), 3.17 - 3.08 (m, 2H), 3.03 - 2.99 (m, 1H), 2.79 - 2.73 (m, 1H), 2.54 - 2.53 (m, 3H), 1.26 (s, 3H), 1.22 (s, 3H), 1.12 (d, J = 6.8 Hz, 3H) . Compound 38A : (R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -Hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Typical Method 3 : Deprotection of Allyl Ester

To a mixture of compound 38A-1 (210 mg, 90% purity, 0.279 mmol) in dichloromethane (2 mL) were added pyrrolidine (70 mg, 0.984 mmol) and tetrakis(triphenylphosphine)palladium (34 mg , 0.029 mmol). The reaction mixture was stirred at room temperature under nitrogen atmosphere for 3 hours. The reaction mixture was concentrated, and the residue was purified by C18 column (acetonitrile: water = 5% to 60%) to give Compound 38A (130 mg, 73.1% yield, 99.97% pure by LCMS) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ): δ 9.13 (br s, 1H), 7.82 (d, J = 2.8 Hz, 1H), 7.41 (d, J = 3.2 Hz, 1H), 7.11 - 7.05 (m, 1H ), 6.97 - 6.89 (m, 2H), 6.00 (s, 1H), 4.34 - 4.22 (m, 3H), 4.11 - 3.97 (m, 5H), 3.68 - 3.63 (m, 1H), 3.52 - 3.40 (m , 1H), 3.16 - 3.05 (m, 2H), 2.98 - 2.83 (m, 2H), 2.53 (s, 3H), 1.32 (s, 3H), 1.23 (s, 3H), 1.11 (t, J = 6.8 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₆ S is 637.2, found m/z is 638.2 [M+H] ⁺ . Compound 38B : (S*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -Hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared from compound 38B-1 using typical method 3 to remove allyl ester protection, and purified by C18 column (acetonitrile: water = 5% to 60%) to give compound 38B (95 mg according to LCMS) as a yellow solid 99.9% purity, 53% yield). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₆ S is 637.2, found m/z is 638.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.17 (br s, 1H), 7.83 - 7.82 (m, 1H), 7.42 - 7.41 (m, 1H), 7.12 - 7.02 (m, 1H), 6.97 - 6.88 (m , 2H), 6.00 (s, 1H), 4.33 - 4.27 (m, 3H), 4.08 - 3.99 (m, 4H), 3.94 - 3.92 (m, 1H), 3.77 - 3.68 (m, 1H), 3.54 - 3.39 (m, 1H), 3.17 - 3.09 (m, 2H), 2.78 - 2.70 (m, 2H), 2.54 - 2.53 (m, 3H), 1.32 (s, 3H), 1.20 (s, 3H), 1.11 (t , J = 7.2 Hz, 3H). Compound 39 : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro- 3 - fluorophenyl )-5-( methoxycarbonyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -Hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 39 was prepared from Intermediate H6A and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially .

Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 20% to 95%) afforded the title compound (43.8 mg, 98.8% purity, 73% yield) as a yellow solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.22 (br s, 1H), 7.85 (d, J = 3.2 Hz, 1H), 7.45 (d, J = 2.8 Hz, 1H), 7.20 - 7.15 (m, 1H) , 7.10 - 7.03 (m, 2H), 6.24 (s, 1H), 4.30 - 4.25 (m, 3H), 4.07 (d, J = 4.4 Hz, 2H), 4.00 (d, J = 8.4 Hz, 1H), 3.69 - 3.64 (m, 1.5H), 3.59 (s, 3H), 3.50 - 3.39 (m, 1.5H), 3.13 - 3.02 (m, 2H), 2.95 - 2.90 (m, 1H), 1.31 (s, 3H ), 1.22 (s, 3H). LC-MS (ESI): Calculated mass for C ₂₇ H ₂₉ ClF ₃ N ₅ O ₆ S is 643.1, found m/z is 644.2 [M+H] ⁺ . Compound 40A : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro- 3 - fluorophenyl )-5-( ethoxycarbonyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -Hydroxy- 2,2 -dimethylbutanoic acid (single diastereomer)

Compound 40A was prepared from Intermediate H17A and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially .

Purification by C18 column (acetonitrile: water (+ 0.1% ammonium bicarbonate) = 05% to 95%) afforded the title compound. The compound was dissolved with a solution of sodium bicarbonate (1.33 g, 15.8 mmol) in water (200 mL) to pH = 8-9, 2 M aqueous hydrogen chloride was added dropwise to the solution to pH = 4-5 and filtered. The filter cake was washed twice with water (30 mL) and concentrated under reduced pressure to give the title compound (7.30 g, 99.8% purity by LCMS, 88% yield) as a yellow solid.

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.22 (br s, 1H), 7.84 (d, J = 3.2 Hz, 1H), 7.48 - 7.39 (m, 1H), 7.20 - 7.10 (m, 2H), 7.04 ( t, J = 8.0 Hz, 1H), 6.25 (s, 1H), 4.41 - 4.20 (m, 3H), 4.06 - 3.96 (m, 5H), 3.70 - 3.65 (m, 1H), 3.47 - 3.39 (m, 1H), 3.13 - 2.91 (m, 3H), 1.26 (s, 3H), 1.22 (s, 3H), 1.10 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ ClF ₃ N ₅ O ₆ S is 657.2, found m/z is 658.2 [M+H] ⁺ . Compound 40B : (S*)-4-(( cis )-4-(((R*)-6-(2- chloro- 3 - fluorophenyl )-5-( ethoxycarbonyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -Hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 40B was prepared analogously to Compound 40A .

LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ ClF ₃ N ₅ O ₆ S is 657.2, found m/z is 658.1 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.84 (d, J = 3.2 Hz, 1H), 7.55 (d, J = 2.8 Hz, 1H), 7.25 - 7.16 (m, 2H), 7.09 - 7.05 (m, 1H), 6.14 (s, 1H), 4.32 - 4.14 (m, 3H), 3.98 - 3.91 (m, 6H), 3.30 - 3.27 (m, 1H), 3.10 - 3.02 (m, 1H), 2.97 - 2.93 ( m, 1H), 2.63 - 2.57 (m, 1H), 1.10 - 1.02 (m, 9H). Compound 41 : (R*)-4-(( cis )-4-(((S*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 41 was prepared from Intermediate H3B and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially .

Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 5% to 95%) afforded the title compound (30 mg, 98.2% purity, 62% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₆ S is 641.2, found m/z is 642.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.19 (brs, 1H), 7.83 (d, J = 3.6 Hz, 1H), 7.43 (d, J = 3.2 Hz, 1H), 6.91 - 6.83 (m, 2H), 5.93 (s, 1H), 4.32 - 4.23 (m, 3H), 4.10 - 4.07 (m, 2H), 4.02 - 4.00 (m, 1H), 3.68 - 3.63 (m, 1H), 3.60 (s, 3H), 3.50 - 3.40 (m, 1H), 3.13 - 3.05 (m, 2H), 2.95 - 2.89 (m, 1H), 2.56 (s, 3H), 1.33 (s, 3H), 1.23 (s, 3H). Compound 42 : (R*)-4-(( cis )-4-(((R*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid (single diastereomer)

Compound 42 was prepared from Intermediate H5A and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially .

Purification by C18 column (acetonitrile: water (+ 0.02% ammonium bicarbonate) = 15% to 60%) afforded the title compound (38 mg, 98.3% purity, 53% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₆ S is 655.2, found m/z is 656.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.16 (br s, 1H), 7.83 (d, J = 3.2 Hz, 1H), 7.43 (d, J = 3.2 Hz, 1H), 6.94 - 6.88 (m, 2H) , 5.94 (s, 1H), 4.30 - 4.23 (m, 3H), 4.08 - 4.00 (m, 5H), 3.69 - 3.64 (m, 1H), 3.50 - 3.40 (m, 1H), 3.13 - 2.90 (m, 3H), 2.56 (d, J = 2.0 Hz, 3H), 1.31 (s, 3H), 1.23 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compound 43 : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( ethoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid (single diastereomer)

Compound 43 was prepared from Intermediate H4A and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially.

Purification by C18 column (acetonitrile:water (+0.02% ammonium bicarbonate) = 15% to 50%) afforded the title compound (23 mg, 97.1% purity, 59% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₀ ClF ₄ N ₅ O ₆ S is 675.2, found m/z is 676.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.22 (s, 1H), 7.85 (d, J = 3.2 Hz, 1H), 7.46 (d, J = 3.2 Hz, 1H), 7.06 - 7.02 (m, 2H), 6.19 (s, 1H), 4.28 - 4.25 (m, 3H), 4.08 - 4.00 (m, 5H), 3.68 - 3.63 (m, 1H), 3.51 - 3.40 (m, 1H), 3.13 - 3.05 (m, 2H ), 2.95 - 2.89 (m, 1H), 1.33 (s, 3H), 1.23 (s, 3H), 1.13 (t, J = 7.2 Hz, 3H). Compound 44 : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( methoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid (single diastereomer)

Compound 44 was prepared from Intermediate H2A and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially.

Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 20% to 95%) afforded the title compound (29.3 mg, 98.8% purity, 73% yield) as a yellow solid. LC-MS (ESI): calculated mass for C ₂₇ H ₂₈ ClF ₄ N ₅ O ₆ S 661.1, found m/z 662.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.25 (br s, 1H), 7.85 (d, J = 3.2 Hz, 1H), 7.46 (d, J = 3.2 Hz, 1H), 7.04 - 7.02 (m, 2H) , 6.17 (s, 1H), 4.29 - 4.25 (m, 3H), 4.08 (d, J = 4.8 Hz, 2H), 4.03 - 3.99 (m, 1H), 3.68 - 3.61 (m, 1.5 H), 3.59 ( s, 3H), 3.51 - 3.40 (m, 1.5H), 3.13 - 3.05 (m, 2H), 2.95 - 2.90 (m, 1H), 1.33 (s, 3H), 1.23 (s, 3H). Compound 45 : (R*)-4-(( cis )-4-(((R*)-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-6-(2,3 ,4- trifluorophenyl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1 -yl )-3 - Hydroxy- 2,2 -dimethylbutanoic acid (single diastereomer)

Compound 45 was prepared from Intermediate H15A and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially.

Purification by C18 column (acetonitrile: water = 40% to 70%) afforded the title compound (46.3 mg, 98% purity, 73% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₀ F ₅ N ₅ O ₆ S is 659.2, found m/z is 660.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.29 (brs, 1H), 7.87 (d, J = 3.2 Hz, 1H), 7.47 (d, J = 3.6 Hz, 1H), 7.06 - 7.01 (m, 1H), 6.93 - 6.87 (m, 1H), 5.99 (s, 1H), 4.28 - 3.99 (m, 9H), 3.67 - 3.62 (m, 1H), 3.49 - 3.39 (m, 1H), 3.12 - 3.04 (m, 2H ), 2.95 - 2.89 (m, 1H), 1.31 (s, 3H), 1.22 (s, 3H), 1.19 (t, J = 7.2 Hz, 3H). Compound 46 : (R*)-4-(( cis )-4-(((S*)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2 -(4 -Methylthiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso (azol- 1 -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 46 was prepared from Intermediate H7B and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially .

Purification by C18 column (acetonitrile: water = 50% to 60%) afforded the desired compound (39 mg, 38% yield, 99.8% purity) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₀ H ₃₆ F ₃ N ₅ O ₆ S is 651.2, found m/z is 652.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.13 (brs, 1H), 7.09 - 7.03 (m, 1H), 6.96 - 6.88 (m, 3H), 5.99 (s, 1H), 4.32 - 4.27 (m, 3H) , 4.07 - 3.97 (m, 5H), 3.68 - 3.63 (m, 1H), 3.49 - 3.39 (m, 1H), 3.15 - 3.04 (m, 2H), 2.95 - 2.89 (m, 1H), 2.52 (s, 3H), 2.44 (s, 3H), 1.31 (s, 3H), 1.22 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compound 47 : (R*)-4-(( cis )-4-(((R*)-6-(2,3 -difluorophenyl )-5-( ethoxycarbonyl )-2-( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 -Hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 47 was prepared from Intermediate H9A and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially .

By prep-HPLC (column: Waters Xbrige C18 (5 µm 19 * 150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min , gradient: 20% - 70% (%B)) purification afforded the desired product (26.4 mg, 33% yield, 99.6% purity) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₆ S is 641.2, found m/z is 642.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.25 (br s, 1H), 7.87 (d, J = 3.2 Hz, 1H), 7.46 (d, J = 3.2 Hz, 1H), 7.10 - 6.98 (m, 3H) , 6.05 (s, 1H), 4.29 (m, 1H), 4.25 - 4.22 (m, 1H), 4.13 - 4.00 (m, 6H), 3.63 (dd, J = 14.0 Hz, 7.2 Hz, 1H), 3.52 - 3.41 (m, 1H), 3.14 - 3.05 (m, 2H), 2.94 - 2.88 (m, 1H), 1.32 (s, 3H), 1.23 (s, 3H), 1.17 (t, J = 7.2 Hz, 3H) . Compound 48 : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro- 4 - fluorophenyl )-5-( methoxycarbonyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -Hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 48 was prepared from Intermediate H18A and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially .

Purification by C18 column (acetonitrile: water = 40% to 70%) afforded the title compound (27.3 mg, 97.9% purity, 32% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₇ H ₂₉ ClF ₃ N ₅ O ₆ S is 643.2, found m/z is 644.1 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.92 (s, 1H), 7.73 (s, 1H), 7.28 - 7.14 (m, 3H), 6.20 (s, 1H), 4.36 - 4.28 (m, 3H), 4.03 - 3.97 (m, 3H), 3.89 - 3.84 (m, 1H), 3.59 (s, 3H), 3.41 - 3.36 (m, 1H), 3.18 - 3.10 (m, 1H), 2.99 - 2.89 (m, 2H) , 1.21 (s, 3H), 1.16 (s, 3H). Compound 49 : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro- 4 - fluorophenyl )-5-( ethoxycarbonyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -Hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 49 was prepared from Intermediate H19A and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially.

By prep-HPLC (column: Waters Xbrige C18 (5 µm 19 * 150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min , gradient: 20% - 70% (%B)) to give the desired product (37.4 mg, 36% yield, 99.5% purity) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ ClF ₃ N ₅ O ₆ S is 657.2, found m/z is 658.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.81 (d, J = 2.4 Hz, 1H), 7.63 - 7.62 (m, 1H), 7.35 - 7.31 (m, 1H), 7.13 - 7.11 (m, 1H), 6.98 - 6.93 (m, 1H), 6.05 (s, 1H), 4.27 - 4.17 (m, 3H), 3.96 - 3.91 (m, 4H), 3.85 - 3.77 (m, 2H), 3.30 - 3.24 (m, 1H) , 3.03 (s, 1H), 2.91 - 2.77 (m, 2H), 1.10 (s, 3H), 1.05 - 1.01 (m, 6H). Compound 50 :

(R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 - methylphenyl )-2-( thiazole- 2- yl )-3,6 -dihydropyrimidin- 4 -yl- 6-d) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1 -yl )-3 - Hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 50 was prepared from Intermediate H22B and Intermediate M1 according to Typical Method 1 and Typical Method 2 sequentially .

中間體 M3 的製備

中間體 M3-1 ： 2,2,3- 三甲基丁 -3- 烯酸苄酯 Purification by C18 column (acetonitrile: water = 5% to 60%) gave the desired compound 50 (23.1 mg, 72.9% yield, 98.9% purity by LCMS) as a yellow solid. LC-MS (ESI): The calculated mass for C ₂₉ H ₃₃ DF ₃ N ₅ O ₆ S is 638.677, and the found m/z is 639.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.14 (br s, 1H), 7.83 (d, J = 3.2 Hz, 1H), 7.44 (s, 1H), 7.11 - 7.05 (m, 1H), 7.00 - 6.90 ( m, 2H), 4.33 - 4.24 (m, 3H), 4.08 - 3.98 (m, 5H), 3.68 - 3.63 (m, 1H), 3.52 - 3.42 (m, 1H), 3.15 - 3.05 (m, 2H), 2.95 - 2.87 (m, 1H), 2.53 (s, 3H), 1.32 (s, 3H), 1.23 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compounds 51A and 51B

Preparation of Intermediate M3

Intermediate M3-1 : Benzyl 2,2,3 -trimethylbut- 3 -enoate

To a solution of methyltriphenylphosphonium bromide (4.98 g, 13.9 mmol) in THF (50 mL) was added a 1.0 M solution of potassium 2-methylpropan-2-oxide in THF (13.9 mL, 13.9 mmol). After stirring at room temperature for 30 minutes, a solution of Intermediate S3-2 (3.10 g, 90% purity, 12.7 mmol) in tetrahydrofuran (30 mL) was added dropwise to the mixture and stirred at room temperature for 2 hours. The reaction mixture was then poured slowly into ice water (100 mL) and extracted three times with ethyl acetate (100 mL). The separated organic layer was washed with brine (100 mL), dried over Na ₂ SO ₄ (s), filtered and concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 150:1 to 100:1) to afford the title compound (2.40 g, 90% purity by ¹ H NMR, 78% yield) as a colorless oil. LC-MS (ESI): calculated mass for C ₁₄ H ₁₈ O ₂ is 218.1, found m/z is 219.2 [M+H] ⁺ . ¹ HNMR (300 MHz, CDCl ₃ ) δ 7.39 - 7.29 (m, 5H), 5.12 (s, 2H), 4.91 - 4.87 (m, 2H), 1.71 (s, 3H), 1.35 (s, 6H). Intermediate M3-2 : Benzyl 2- methyl -2-(2 -methyloxiran - 2- yl ) propionate

To a solution of intermediate M3-1 (3.30 g, 90% purity, 13.6 mmol) in dichloromethane (50 mL) was added 3-chloroperoxybenzoic acid (4.14 g, 85 % purity, 20.4 mmol). After stirring overnight at room temperature, the mixture was quenched with saturated aqueous sodium sulfite (100 mL) and extracted three times with dichloromethane (100 mL). The combined organic layers were washed with brine (100 mL), dried over anhydrous Na ₂ SO ₄ (s), filtered and concentrated. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=50:1 to 20:1) to obtain the title compound (3.10 g, 90% purity according to ¹ HNMR, 88 %Yield). LC-MS (ESI): calculated mass for C ₁₄ H ₁₈ O ₃ is 234.1, found m/z is 235.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.39 - 7.29 (m, 5H), 5.16 (s, 2H), 2.89 (d, J = 4.4 Hz, 1H), 2.51 (d, J = 4.4 Hz, 1H), 1.26 (s, 3H), 1.24 (s, 3H), 1.15 (s, 3H). Intermediate M3 : (3a S *, 6a S *)-4-(6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 - hydroxyl- Benzyl 2,2,3 -trimethylbutyrate

To a solution of Intermediate T1 (530 mg, 90% purity, 1.91 mmol) in dichloromethane (10 mL) was added Intermediate M3-2 (1.50 g, 90% purity, 5.76 mmol) and Tris Scandium fluoromethanesulfonate (938 mg, 1.91 mmol). After stirring overnight at 25°C under a nitrogen atmosphere, the mixture was quenched with saturated aqueous sodium bicarbonate (50 mL) at 0°C and extracted twice with ethyl acetate (50 mL). The separated organic layer was washed with brine (50 mL), dried over Na ₂ SO ₄ (s), filtered and concentrated under reduced pressure to give a residue, which was purified by C18 column (acetonitrile:water=10% to 95%) , the title compound was obtained as a yellow oil (500 mg, 90% purity by ¹ H NMR, 61% yield). LC-MS (ESI): calculated mass for C ₁₉ H ₂₆ F ₂ N ₂ O ₄ is 384.2, found m/z is 385.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.40 - 7.29 (m, 5H), 5.17 - 5.09 (m, 2H), 4.35 - 4.28 (m, 1H), 4.09 - 3.98 (m, 1.6H), 3.65 - 3.57 (m, 1.4H), 3.34 - 3.03 (m, 4H), 2.96 - 2.90 (m, 1H), 1.29 - 1.22 (m, 9H). Compound 51-1 : (4 S )-6-(((3a S *, 6a S *)-1-(4-( benzyloxy )-2- hydroxyl- 2,3,3 - trimethyl- 4 -oxobutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -Methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

This compound was prepared according to Typical Coupling Method 1 from Intermediate H1A and Intermediate M3 .

Purification by C18 column (acetonitrile: water (+ 0.1% ammonium bicarbonate) = 30% to 95%) afforded the title compound (700 mg, 90% purity by ¹ H NMR, 73% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₇ H ₄₂ F ₃ N ₅ O ₆ S is 741.3, found m/z is 742.4 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.19 - 9.18 (br s, 1H), 7.80 (d, J = 3.2 Hz, 0.5H), 7.76 (d, J = 2.8 Hz, 0.5H), 7.41 - 7.30 ( m, 6H), 7.10 - 7.05 (m, 1H), 6.97 - 6.89 (m, 2H), 6.00 (s, 1H), 5.21 - 5.13 (m, 2H), 4.32 - 4.14 (m, 3H), 4.09 - 3.94 (m, 4.6H), 3.79 (s, 0.4H), 3.71 - 3.58 (m, 1H), 3.48 - 3.31 (m, 1H), 3.10 - 2.86 (m, 3H), 2.54 (d, J = 1.6 Hz, 3H), 1.31 - 1.25 (m, 9H), 1.12 (t, J = 7.2 Hz, 3H). Compounds 51A-1 and 51B-1 : ( S )-6-((( cis )-1-(( R *)-4-( benzyloxy )-2- hydroxy- 2,3,3 -tri Methyl- 4 -oxobutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl )-4-( 3- Fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer ) and ( S )-6- ((( cis )-1-(( S *)-4-( benzyloxy )-2- hydroxy- 2,3,3 -trimethyl- 4 -oxobutyl )-6,6 -Difluorotetrahydro - 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( Thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer )

The racemic mixture of compound 51-1 (700 mg, 90% purity, 0.849 mmol) was analyzed by chiral Prep-HPLC (column: Chiralpak IG 5 µm 30 mm * 250 mm; mobile phase: Hex: EtOH = 70: 30, at 30 mL/min; temperature: 30 °C; wavelength: 254 nm) to obtain compound 51A-1 (380 mg, 90% purity according to ¹ HNMR, 54% yield, 100% stereo pure) and compound 51B-1 (300 mg, 90% pure by ¹ HNMR, 43% yield, 99.9% stereopure).

Compound 51A-1 : LC-MS (ESI): The calculated mass for C ₃₇ H ₄₂ F ₃ N ₅ O ₆ S is 741.3, and the found m/z is 742.3 [M+H] ⁺ . Chiral analysis (column: Chiralpak IG 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 70 : 30, at 1 mL/min; temperature: 30°C; wavelength: 254 nm, RT = _10.633 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.19 (br s, 1H), 7.76 (d, J = 3.2 Hz, 1H), 7.39 - 7.30 (m, 6H), 7.10 - 7.05 (m, 1H), 7.00 - 6.94 (m, 1H), 6.91 (t, J = 8.8 Hz, 1H), 6.00 (s, 1H), 5.20 (dd, J = 12.4 Hz, J = 12.4 Hz, 2H), 4.29 (m, 2H), 4.17 - 4.13 (m, 1H), 4.09 - 4.00 (m, 3H), 3.97 - 3.91 (m, 2H), 3.71 - 3.66 (m, 1H), 3.42 - 3.31 (m, 1H), 3.03 (t, J = 12.4 Hz, 1H), 2.96 (s, 2H), 2.54 (d, J = 1.6 Hz, 3H), 1.31 (s, 3H), 1.26 (s, 3H), 1.25 (s, 3H), 1.12 (t , J = 7.2 Hz, 3H).

Compound 51B-1 : LC-MS (ESI): The calculated mass for C ₃₇ H ₄₂ F ₃ N ₅ O ₆ S is 741.3, and the found m/z is 742.3 [M+H] ⁺ . Chiral analysis (column: Chiralpak IG 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 70 : 30, at 1 mL/min; temperature: 30°C; wavelength: 254 nm, RT = _13.211 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.18 (br s, 1H), 7.80 (d, J = 3.2 Hz, 1H), 7.41 - 7.30 (m, 6H), 7.10 - 7.05 (m, 1H), 7.00 - 6.94 (m, 1H), 6.91 (t, J = 8.8 Hz, 1H), 6.00 (s, 1H), 5.18 - 5.12 (m, 2H), 4.30 (m, 1H), 4.24 - 4.17 (m, 2H) , 4.11 - 4.00 (m, 2H), 3.99 - 3.93 (m, 2H), 3.80 (m, 1H), 3.63 - 3.58 (m, 1H), 3.48 - 3.37 (m, 1H), 3.14 - 3.05 (m, 2H), 2.88 (d, J = 14.0 Hz, 1H), 2.54 (s, 3H), 1.32 - 1.26 (m, 9H), 1.12 (t, J = 7.2 Hz, 3H). Compound 51A : ( R *)-4-(( cis )-4-((( S )-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1- base )-3 -Hydroxy- 2,2,3 -trimethylbutanoic acid ( single diastereomer )

This compound was prepared from compound 51A-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water (+ 0.1% ammonium bicarbonate) = 05% to 95%) to afford the title compound as a yellow solid Compound (90 mg, 99.5% purity, 76% yield). LC-MS (ESI): Calculated mass for C ₃₀ H ₃₆ F ₃ N ₅ O ₆ S is 651.2, found m/z is 652.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.14 (br s, 1H), 7.83 (d, J = 2.8 Hz, 1H), 7.43 (d, J = 3.2 Hz, 1H), 7.10 - 7.05 (m, 1H) , 6.96 - 6.89 (m, 2H), 6.00 (s, 1H), 4.33 - 4.22 (m, 3H), 4.08 - 4.00 (m, 4H), 3.64 - 3.50 (m, 2H), 3.15 - 3.04 (m, 2H), 2.96 (m, 1H), 2.53 (s, 3H), 1.33 (s, 6H), 1.25 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compound 51B : ( S *)-4-(( cis )-4-((( S )-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -Hydroxy- 2,2,3 -trimethylbutanoic acid ( single diastereomer )

This compound was prepared from compound 51B-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water (+ 0.1% ammonium bicarbonate) = 05% to 95%) to afford the title compound as a yellow solid Compound (100 mg, 99.6% purity, 84% yield). LC-MS (ESI): Calculated mass for C ₃₀ H ₃₆ F ₃ N ₅ O ₆ S is 651.2, found m/z is 652.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.12 (br s, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.54 - 7.52 (m, 0.1H), 7.42 (d, J = 3.2 Hz, 0.9 H), 7.19 - 7.16 (m, 0.1H), 7.10 - 7.05 (m, 0.9H), 7.96 (d, J = 7.6 Hz, 1H), 6.91 (t, J = 9.2 Hz, 1H), 6.00 (s , 0.9H), 5.95 (s, 0.1H), 4.35 - 4.23 (m, 3H), 4.13 - 4.00 (m, 4H), 3.64 - 3.46 (m, 2H), 3.13 (t, J = 12.8 Hz, 1H ), 3.04 (d, J = 13.6 Hz, 1H), 2.95 (d, J = 13.6 Hz, 1H), 2.54 (d, J = 1.6 Hz, 3H), 1.43 (s, 3H), 1.32 (s, 3H ), 1.22 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compound 52A : (R*)-4-(( cis )-4-(((S*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -hydroxy- 2,2,3 -trimethylbutanoic acid (single diastereomer)

This compound was prepared sequentially according to Typical Coupling Method 1 from Intermediate H3B and Intermediate M3 , Chiral Separation, Typical Method 2.

Chiral Prep-HPLC (column: Chiralpak IG 5 µm 30 mm * 250 mm; mobile phase: Hex : EtOH = 70 : 30, at 30 mL/min; temperature: 30°C; wavelength: 254 nm)

By Prep.HPLC (column: Xbridge C18 (5 µm 19 *150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min, Gradient: 20% - 75% (%B)) Purification afforded the title compound (94.1 mg, 99.1% purity, 81% yield) as a yellow solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.85 (d, J = 2.8 Hz, 1H), 7.48 (s, 1H), 6.94 - 6.84 (m, 2H), 5.94 (s, 1H), 4.53 (s, 1H ), 4.36 - 4.22 (m, 3H), 4.06 (s, 2H), 3.65 - 3.57 (m, 5H), 3.17 - 3.10 (m, 1H), 3.08 - 2.95 (m, 2H), 2.57 (d, J = 2.0 Hz, 3H), 1.32 (s, 6H), 1.25 (s, 3H). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₆ S is 655.2, found m/z is 656.3 [M+H] ⁺ . Compound 52B : (S*)-4-(( cis )-4-(((S*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -hydroxy- 2,2,3 -trimethylbutanoic acid (single diastereomer)

Compound 52B was prepared analogously to Compound 52A .

中間體 M4 的製備

中間體 M4-1 ： 2,2- 二乙基 -3- 側氧基丁酸苄酯 By Prep.HPLC (column: Xbridge C8 (5 µm 19 *150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min, Gradient: 20% - 75% (%B)) Purification afforded the title compound (43.4 mg, 99.2% purity, 44% yield) as a yellow solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.89 (d, J = 2.8 Hz, 1H), 7.56 (s, 1H), 6.95 - 6.86 (m, 2H), 5.99 (s, 1H), 4.55 (s, 1H ), 4.36 - 4.25 (m, 3H), 4.15 - 4.05 (m, 2H), 3.66 - 3.61 (m, 4H), 3.58 - 3.47 (m, 1H), 3.17 - 3.11 (m, 1H), 3.07 - 2.93 (m, 2H), 2.57 (d, J = 2.0 Hz, 3H), 1.44 (s, 3H), 1.33 (s, 3H), 1.22 (s, 3H). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₆ S is 655.2, found m/z is 656.3 [M+H] ⁺ . Compounds 53A and 53B

Preparation of Intermediate M4

Intermediate M4-1 : Benzyl 2,2 -diethyl- 3 - oxobutanoate

To a mixture of benzyl acetoacetate (8.00 g, 10.4 mmol) in N,N-dimethylformamide (80 mL) was added cesium carbonate (40.7 g, 125 mmol) and ethyl iodide (21.4 g, 137 mmol). The mixture was stirred at room temperature for 12 hours. The reaction mixture was poured into ice water (100 mL) and extracted three times with ethyl acetate (100 mL). The organic phase was washed three times with brine (100 mL) and concentrated in vacuo to afford Intermediate M4-1 (9.8 g, 80.6% yield, 85% purity by ¹ HNMR) as a yellow oil.

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.37 - 7.30 (m, 5H), 5.16 (s, 2H), 2.04 (s, 3H), 1.99 - 1.81 (m, 4H), 0.74 (t, J = 7.6 Hz , 6H). Intermediate M4-2 : Benzyl 2,2 -diethyl- 3 -hydroxybutyrate

To a mixture of Intermediate M4-1 (11.0 g, 85% purity, 37.7 mmol) in tetrahydrofuran (100 mL) was added sodium borohydride (3.00 g, 79.3 mmol) and methanol (10 mL). The mixture was stirred at room temperature for 12 hours. Ice water (200 mL) was then added, and the mixture was stirred for 10 minutes. The mixture was extracted with ethyl acetate (400 mL), and the organic phase was washed with brine (200 mL) and concentrated in vacuo. The residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate=7: 1) to obtain intermediate M4-2 (5.5 g, 52.5% yield, according to ¹ HNMR purity of yellow oil) 90%).

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.39 - 7.31 (m, 5H), 5.17 - 5.16 (m, 2H), 3.98 - 3.91 (m, 1H), 2.91 (d, J = 7.2 Hz, 1H), 1.88 - 1.70 (m, 3H), 1.60 - 1.50 (m, 1H), 1.13 (d, J = 6.4 Hz, 3H), 0.87 (t, J = 7.6 Hz, 3H), 0.81 (t, J = 7.6 Hz, 3H). Intermediate M4-3 : Benzyl 2,2 -diethyl- 3-( tosyloxy ) butanoate

To a solution of intermediate M4-2 (5.50 g, 90% purity, 19.8 mmol) in pyridine (60 mL) was added toluenesulfonyl chloride (5.70 g, 29.9 mmol). The mixture was stirred at 30°C for 12 hours. The mixture was then poured into water (100 mL) and extracted three times with ethyl acetate (100 mL). The combined organic layers were washed with brine (100 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and the residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate=20: 1) to obtain Intermediate M4-3 (5.5 g, 61.9% yield, according to ¹ H NMR purity 90%)).

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.75 (d, J = 8.4 Hz, 2H), 7.36 - 7.28 (m, 7H), 5.08 - 5.05 (m, 2H), 5.02 - 4.97 (m, 1H), 2.43 (s, 3H), 1.81 - 1.59 (m, 4H), 1.28 (d, J = 6.4 Hz, 3H), 0.79 (t, J = 7.6 Hz, 6H). Intermediate M4-4 : Benzyl 2,2 -diethylbut- 3 -enoate

A solution of intermediate M4-3 (5.50 g, 90% purity, 12.2 mmol) in 1,8-diazabicyclo[5.4.0]undec-7-ene (50 mL) was stirred at 130°C 12 hours. The mixture was cooled to room temperature and quenched with 1.0 M hydrochloric acid solution (100 mL). The mixture was extracted three times with ethyl acetate (100 mL). The combined organic layers were washed with sodium bicarbonate solution (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give Intermediate M4-4 (2.9 g, 86.7% yield, 85% purity by ¹ H NMR) as a yellow oil.

¹ HNMR (300 MHz, CDCl ₃ ) δ 7.38 - 7.30 (m, 5H), 6.03 - 5.93 (m, 1H), 5.22 - 5.18 (m, 1H), 5.14 (s, 2H), 5.12 - 5.06 (m, 1H), 1.79 - 1.74 (m, 4H), 0.79 (t, J = 7.2 Hz, 6H). Intermediate M4-5 : Benzyl 2- ethyl -2-( oxiran -2- yl ) butanoate

To a mixture of Intermediate M4-4 (2.90 g, 85% purity, 10.6 mmol) in dichloromethane (30 mL) was added 3-chloroperoxybenzoic acid (3.0 g, 85% purity, 14.8 mol), and The mixture was stirred at room temperature for 12 hours. The reaction mixture was filtered, and the filtrate was quenched with saturated aqueous sodium thiosulfate (100 mL) and saturated aqueous sodium bicarbonate (100 mL). After stirring for 10 min, the mixture was extracted with dichloromethane (200 mL). The organic phase was washed with brine (100 mL), dried over Na ₂ SO ₄ , filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10: 1) to obtain intermediate M4-5 (1.4 g, 47.8% yield, according to ¹ HNMR purity of yellow oil) 90%).

¹ HNMR (300 MHz, CDCl ₃ ) δ 7.39 - 7.30 (m, 5H), 5.16 (s, 2H), 3.18 - 3.16 (m, 1H), 2.76 - 2.70 (m, 2H), 1.72 - 1.58 (m, 4H), 0.91 - 0.84 (m, 6H). Intermediate M4-6 : (3aS*,6aS*)-1-(3-(( benzyloxy ) carbonyl )-3 -ethyl -2- hydroxypentyl )-6,6 - difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -tertiary butyl carboxylate

To a solution of Intermediate T1 (400 mg, 95% purity, 1.52 mmol) in Intermediate M4-5 (2.30 g, 90% purity, 8.34 mmol) was added vanadium(III) chloride (40 mg, 0.25 mmol) . The mixture was stirred at 60°C for 12 hours. The reaction mixture was purified by silica gel column chromatography (petroleum ether: ethyl acetate=8: 1) to obtain intermediate M4-6 (450 mg, 55% yield according to LCMS purity of 93 %).

LC-MS (ESI): Calculated mass for C ₂₅ H ₃₆ F ₂ N ₂ O ₆ is 498.3, found m/z is 499.0 [M+H] ⁺ . Intermediate M4 : 4-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-2,2- diethyl benzyl- 3 -hydroxybutyrate

To a mixture of Intermediate M4-6 (450 mg, 90% purity, 0.812 mmol) in dichloromethane (4 mL) was added trifluoroacetic acid (2 mL) at room temperature. After stirring at room temperature for 2 hours, the mixture was basified with saturated aqueous sodium bicarbonate (100 mL) and extracted three times with dichloromethane (100 mL). The combined organic phases were washed with brine (100 mL) and concentrated in vacuo to afford Intermediate M4 (400 mg, 92.7% yield, 75% purity by ¹ HNMR) as a yellow oil.

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.37 - 7.33 (m, 5H), 5.20 - 5.10 (m, 2H), 4.36 - 4.27 (m, 1H), 4.11 - 3.70 (m, 2H), 3.69 - 3.48 ( m, 1H), 3.33 - 2.76 (m, 5H), 1.84 - 1.57 (m, 4H), 0.90 - 0.83 (m, 6H). Compound 53-1 : (4S)-6-(((3aS*,6aS*)-1-(3-(( benzyloxy ) carbonyl )-3 -ethyl -2- hydroxypentyl )-6, 6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

This compound was prepared from Intermediate H1A and Intermediate M4 according to Typical Coupling Procedure 1 .

Purification by silica gel column chromatography (petroleum ether: ethyl acetate = 6: 1) gave Compound 53-1 (400 mg, 62% yield, 88% purity by LCMS) as a yellow oil.

LC-MS (ESI): Calculated mass for C ₃₈ H ₄₄ F ₃ N ₅ O ₆ S is 755.3, found m/z is 755.8 [M+H] ⁺ . Compounds 53A-1 and 53B-1 : (S)-6-((( cis )-1-((R*)-3-(( benzyloxy ) carbonyl )-3 -ethyl -2- hydroxy Pentyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2- methyl Phenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer ) and (S)-6-((( cis )-1 -((S*)-3-(( Benzyloxy ) carbonyl )-3 -ethyl -2- hydroxypentyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c ] isozol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 - ethyl formate ( single diastereomer )

Racemic compound 53-1 (400 mg, 88% purity, 0.466 mmol) was subjected to chiral prep.HPLC (column: ChiralPak IC 10 μm 250*30 mm; mobile phase: CO2: EtOH = 70: 30, to 3 mL/min; temperature: 40 °C; wavelength: 230 nm) to give Compound 53A-1 (140 mg, 35.8% yield, 90% purity according to ¹ HNMR) as a yellow solid and Compound 53A-1 as a yellow solid 53B-1 (160 mg, 40.9% yield, 90% pure by ¹ H NMR).

Compound 53A-1 : chiral HPLC (column: ChiralPak IC 10 μm 250*30 mm; mobile phase: CO2 : EtOH = 70 : 30, at 3 mL/min; temperature: 40 ° C; wavelength: 230 nm, R _T = 3.12 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.21 (br s, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.41 - 7.30 (m, 6H), 7.10 - 7.05 (m, 1H), 6.99 - 6.89 (m, 2H), 6.00 (s, 1H), 5.21 - 5.11 (m, 2H), 4.31 - 4.18 (m, 3H), 4.09 - 3.90 (m, 5H), 3.67 - 3.61 (m, 1H), 3.48 - 3.36 (m, 1H), 3.14 - 3.04 (m, 3H), 2.77 - 2.71 (m, 1H), 2.52 (s, 3H), 1.87 - 1.73 (m, 3H), 1.59 -1.55 (m, 1H ), 1.12 (t, J = 7.2 Hz, 3H), 0.86 (q, J = 7.6 Hz, 6H).

Compound 53B-1 : chiral HPLC (column: ChiralPak IC 10 μm 250*30 mm; mobile phase: CO2 : EtOH = 70 : 30, at 3 mL/min; temperature: 40 ° C; wavelength: 230 nm, R _T = 3.89 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.17 (br s, 1H), 7.82 (d, J = 4.0 Hz, 1H), 7.42 - 7.29 (m, 6H), 7.11 - 7.04 (m, 1H), 6.98 - 6.88 (m, 2H), 6.01 (s, 1H), 5.23 - 5.08 (m, 2H), 4.33 - 4.24 (m, 2H), 4.19 - 3.92 (m, 6H), 3.62 - 3.55 (m, 1H), 3.47 - 3.33 (m, 1H), 3.26 - 3.24 (m, 1H), 3.12 - 2.90 (m, 3H), 2.51 (s, 3H), 1.85 -1.62 (m, 4H), 1.12 (t, J = 7.2 Hz, 3H), 0.88 (q, J = 7.6 Hz, 6H). Compound 53A : (R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-2,2 -diethyl- 3 -hydroxybutanoic acid ( single diastereomer )

This compound was prepared from compound 53A-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water = 50% to 60%) to give compound 53A (53 mg, 47% yield) as a yellow solid. Yield, 98.5% purity according to LCMS).

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.17 (br s, 1H), 7.83 (d, J = 3.2 Hz, 1H), 7.42 (d, J = 3.2 Hz, 1H), 7.10 - 7.04 (m, 1H) , 6.97 - 6.89 (m, 2H), 6.01 (s, 1H), 4.32 - 4.23 (m, 3H), 4.11 - 3.99 (m, 5H), 3.70 - 3.65 (m, 1H), 3.52 - 3.42 (m, 1H), 3.17 - 3.10 (m, 2H), 2.74 - 2.68 (m, 1H), 2.54 (d, J = 2.0 Hz, 3H), 1.95 - 1.80 (m, 3H), 1.47 -1.38 (m, 1H) , 1.11 (t, J = 7.2 Hz, 3H), 0.92 - 0.85 (m, 6H). LC-MS (ESI): Calculated mass for C ₃₁ H ₃₈ F ₃ N ₅ O ₆ S is 665.3, found m/z is 666.2 [M+H] ⁺ . Compound 53B : (S*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-2,2 -diethyl- 3 -hydroxybutanoic acid ( single diastereomer )

This compound was prepared from compound 53B-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water = 50% to 60%) to give compound 53B (37 mg, 28% yield) as a yellow solid. Yield, 96.5% purity according to LCMS).

中間體 M5 的製備

中間體 M5-1 ： 2- 溴丁酸苄酯 ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.12 (brs, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.42 (d, J = 3.2 Hz, 1H), 7.10 - 7.05 (m, 1H), 6.97 - 6.89 (m, 2H), 6.00 (s, 1H), 4.34 - 4.23 (m, 3H), 4.16 - 4.00 (m, 5H), 3.66 - 3.61 (m, 1H), 3.53 - 3.42 (m, 1H ), 3.15 - 3.09 (m, 2H), 2.96 - 2.90 (m, 1H), 2.54 (d, J = 2.0 Hz, 3H), 1.95 - 1.80 (m, 3H), 1.48 -1.40 (m, 1H), 1.11 (t, J = 7.2 Hz, 3H), 0.93 - 0.87 (m, 6H). LC-MS (ESI): Calculated mass for C ₃₁ H ₃₈ F ₃ N ₅ O ₆ S is 665.3, found m/z is 666.2 [M+H] ⁺ . Compound 54A/54B/54C/54D

Preparation of intermediate M5

Intermediate M5-1 : Benzyl 2- bromobutyrate

Add 2-bromobutyric acid (10.0 g, 60.0 mmol), benzyl alcohol (12.0 g, 111 mmol) and 4-dimethylaminopyridine (1.5 g, 12.3 mmol) in tetrahydrofuran (100 mL) at room temperature Dicyclohexylcarbodiimide (20.0 g, 97.0 mmol) was added to the solution. After stirring at room temperature for 16 hours, the mixture was filtered and the filtrate was poured into water (120 mL) and extracted three times with ethyl acetate (80 mL). The combined organic layers were washed with brine (100 mL), dried over Na ₂ SO _4(s) and filtered. The filtrate was concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 100: 1 to 20: 1) to obtain the title compound (10 g, according to ¹ HNMR purity 90%, 59% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.38 - 7.33 (m, 5H), 5.21 (s, 2H), 4.21 (t, J = 7.2 Hz, 1H), 2.16 - 1.97 (m, 2H), 1.01 (t , J = 7.2 Hz, 3H). Intermediate M5-2 : Benzyl 2- ethylbut - 3 - enoate

Intermediate M5-1 (3.0 g, 90% purity, 10.5 mmol), 4,5-bis(diphenylphosphine)-9,9-dimethyl phosphine (600 mg, 1.04 mmol), cobalt chloride (200 mg, 1.54 mmol) in tetrahydrofuran (25 mL) was added to a solution of 1 M vinylmagnesium bromide in tetrahydrofuran (31 mL, 31 mmol). After stirring at room temperature for 16 h, the mixture was quenched with ice-saturated ammonium chloride solution (30 mL), and extracted three times with ethyl acetate (20 mL). The combined organic layers were washed with brine (30 mL), dried over Na ₂ SO _4(s) and filtered. The filtrate was concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 100: 1 to 20: 1) to obtain the title compound (750 mg, with a purity of 80% according to ¹ HNMR , 28% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.36 - 7.31 (m, 5H), 5.88 - 5.79 (m, 1H), 5.16 - 5.12 (m, 4H), 3.01 - 2.95 (m, 1H), 1.85 - 1.78 ( m, 1H), 1.64 - 1.60 (m, 1H), 0.90 (t, J = 7.6 Hz, 3H). Intermediate M5-3 : Benzyl 2-( oxiran -2- yl ) butanoate

To a mixture of intermediate M5-2 (1.06 g, 80% purity, 4.15 mmol) in acetonitrile (15 mL) and water (7 mL) was added edetate disodium dihydrate (400 mg , 1.08 mmol) and 1,1,1-trifluoropropan-2-one (6 mL, 66.9 mol), and the mixture was stirred for 10 minutes. Potassium monopersulfate (oxone) (7.5 g, 12.2 mmol) was then added in portions followed by sodium bicarbonate (2.5 g, 29.8 mmol). After stirring at room temperature for 16 hours, the mixture was diluted with water (10 mL) and extracted three times with ethyl acetate (10 mL). The combined organic layers were washed with brine (15 mL), dried over Na ₂ SO _4(s) and filtered. The filtrate was concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 100: 1 to 10: 1) to obtain the title compound (500 mg, with a purity of 85% according to ¹ HNMR , 47% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.37 - 7.33 (m, 5H), 5.19 - 5.15 (m, 2H), 3.20 - 3.07 (m, 1H), 2.84 - 2.77 (m, 1H), 2.63 - 2.55 ( m, 1H), 2.18 - 2.12 (m, 1H), 1.86 - 1.68 (m, 2H), 0.96 (t, J = 7.6 Hz, 3H). Intermediate M5-4 : (3aS*, 6aS*)-1-(3-(( benzyloxy ) carbonyl )-2- hydroxypentyl )-6,6 -difluorohexahydro- 4H- pyrrolo [ 3,2-c] isoxazole- 4 - carboxylic acid tertiary butyl ester

To a mixture of Intermediate T1 (350 mg, 90% purity, 1.26 mmol) and Intermediate M5-3 (500 mg, 85% purity, 1.93 mmol) in dichloromethane (4 mL) was added Tris Scandium fluoromethanesulfonate (100 mg, 0.20 mmol). After stirring at room temperature for 16 hours, the mixture was purified by C18 column (acetonitrile: water (0.02% ammonium bicarbonate) = 30% to 80%) to give the title compound (420 mg according to ¹ HNMR purity 90%, 64% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.37 - 7.34 (m, 5H), 5.17 - 5.14 (m, 2H), 4.82 - 4.72 (m, 1H), 4.11 - 3.39 (m, 6H), 3.05 - 2.60 ( m, 3H), 1.76 - 1.69 (m, 2H), 1.46 (s, 9H), 0.96 - 0.89 (m, 3H). Intermediate M5 : (3aS*,6aS*)-1-(3-(( benzyloxy ) carbonyl )-2- hydroxypentyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3, 2-c] Isoxazole- 4(5H) -tertiary butyl carboxylate trifluoroacetate

A mixture of intermediate M5-4 (420 mg, 90% purity, 0.80 mmol) and trifluoroacetic acid (2 mL, 26.9 mmol) in dichloromethane (4 mL) was stirred at room temperature for 1 hour. It was then concentrated under reduced pressure to afford the title compound (450 mg, 80% purity by ¹ H NMR, 93% yield) as a brown oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.36 - 7.33 (m, 5H), 5.17 - 5.16 (m, 2H), 4.28 - 4.03 (m, 3H), 3.80 - 3.56 (m, 4H), 3.07 - 2.54 ( m, 3H), 1.76 - 1.59 (m, 2H), 0.94 - 0.90 (m, 3H). Compound 54-1 : (4S)-6-(((3aS*,6aS*)-1-(3-(( benzyloxy ) carbonyl )-2- hydroxypentyl )-6,6 -difluorohexa Hydrogen -4H- pyrrolo [3,2-c] isozazol- 4 -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )- Ethyl 1,4 -dihydropyrimidine- 5 -carboxylate

This compound was prepared from Intermediate H1A and Intermediate M5 according to Typical Coupling Procedure 1 .

Purification by C18 column (acetonitrile: water = 30% to 90%) afforded the title compound (330 mg, 90% purity by ¹ H NMR, 55% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 8.03 - 7.36 (m, 8H), 7.13 - 6.99 (m, 3H), 6.20 - 6.14 (m, 1H), 5.18 - 5.13 (m, 2H), 4.32 - 3.99 ( m, 7H), 3.60 - 2.83 (m, 7H), 2.66 - 2.58 (m, 3H), 1.79 - 1.68 (m, 2H), 1.18 - 1.14 (m, 3H), 0.95 - 0.93 (m, 3H). Compound 54A-1/54B-1/54C-1/54D-1 : (S)-6-((( cis )-1-((2R*,3R*)-3-(( benzyloxy ) Carbonyl )-2- hydroxypentyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl )-4-(3- Fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester (single diastereomer) (S)-6-((( cis )-1-((2S*,3S*)-3-(( benzyloxy ) carbonyl )-2- hydroxypentyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3, 2-c] isozazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydro Ethyl pyrimidine -5 -carboxylate (single diastereomer) (S)-6-((( cis )-1-((2S*,3R*)-3-(( benzyloxy ) carbonyl ) -2- Hydroxypentyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3 - fluoro- 2 -Methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester (single diastereomer) (S)-6-((( cis )-1-((2R*,3S*)-3-(( Benzyloxy ) carbonyl )-2- hydroxypentyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2- c] Isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4 - dihydropyrimidine- Ethyl 5 -carboxylate (single diastereomer)

The racemic mixture of compound 54-1 (450 mg, 90% purity, 0.56 mmol) was separated by chiral Prep-HPLC (first separation: column: Chiralpak IE 5 μm 30 * 250 mm; mobile phase: Hex: EtOH = 80 : 20 at 30 mL/min; temperature: 30°C; wavelength: 214 nm; second separation: column: Chiralpak IG 5 µm 30 * 250 mm; mobile phase: Hex : EtOH = 70 : 30, The title compound 54A-1 (113 mg, 90% pure by ¹ HNMR, 25% yield, 100% stereo pure), compound 54B-1 (104 mg, 90% pure according to ¹ HNMR, 23% yield, 99.9% stereopure), compound 54C-1 (37 mg, 90% pure according to ¹ HNMR, 39% yield , 100% stereopure), compound 54D-1 (39 mg, 90% pure according to ¹ HNMR, 41% yield, 99.9% stereopure).

Compound 54A-1 : chiral analysis (column: Chiralpak IE 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 80 : 20, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, _RT = 17.590 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.84 (d, J = 2.0 Hz, 1H), 7.46 (s, 1H), 7.37 - 7.31 (m, 5H), 7.07 - 6.92 (m, 3H), 6.02 (s , 1H), 5.18 (s, 2H), 4.28 - 4.21 (m, 3H), 4.07 - 4.00 (m, 5H), 3.60 - 3.30 (m, 3H), 3.10 - 3.00 (m, 2H), 2.89 - 2.85 (m, 1H), 2.76 - 2.71 (m, 1H), 2.55 (s, 3H), 1.78 - 1.72 (m, 2H), 1.12 (t, J = 7.2 Hz, 3H), 0.94 (t, J = 7.6 Hz, 3H).

Compound 54B-1 : chiral analysis (column: Chiralpak IE 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 80 : 20, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, _RT = 22.001 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.84 (d, J = 2.8 Hz, 1H), 7.44 (s, 1H), 7.37 - 7.31 (m, 5H), 7.09 - 6.89 (m, 3H), 6.02 (s , 1H), 5.19 (s, 2H), 4.26 - 4.22 (m, 3H), 4.07 - 3.97 (m, 5H), 3.64 - 3.40 (m, 2H), 3.13 - 3.04 (m, 2H), 2.84 - 2.79 (m, 1H), 2.65 - 2.61 (m, 1H), 2.54 (s, 3H), 1.75 - 1.67 (m, 2H), 1.12 (t, J = 7.2 Hz, 3H), 0.92 (t, J = 7.6 Hz, 3H).

Compound 54C-1 : chiral analysis (column: Chiralpak IG 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 70 : 30, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, _RT = 12.720 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.85 (d, J = 1.6 Hz, 1H), 7.46 (s, 1H), 7.37 - 7.33 (m, 5H), 7.09 - 6.90 (m, 3H), 6.03 (s , 1H), 5.17 (d, J = 12.0 Hz, 1H), 5.12 (d, J = 12.4 Hz, 1H), 4.25 - 4.19 (m, 3H), 4.07 - 3.96 (m, 4H), 3.89 - 3.85 ( m, 1H), 3.60 - 3.36 (m, 2H), 3.12 - 3.05 (m, 1H), 2.94 - 2.90 (m, 1H), 2.76 - 2.71 (m, 1H), 2.61 - 2.55 (m, 4H), 1.84 - 1.73 (m, 2H), 1.12 (t, J = 7.2 Hz, 3H), 0.92 (t, J = 7.6 Hz, 3H).

Compound 54D-1 : chiral analysis (column: Chiralpak IG 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 70 : 30, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 15.858 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.84 (d, J = 2.4 Hz, 1H), 7.45 (s, 1H), 7.37 - 7.31 (m, 5H), 7.09 - 6.92 (m, 3H), 6.02 (s , 1H), 5.18 (d, J = 12.0 Hz, 1H), 5.13 (d, J = 12.4 Hz, 1H), 4.26 - 4.18 (m, 3H), 4.07 - 3.98 (m, 4H), 3.92 - 3.88 ( m, 1H), 3.57 - 3.24 (m, 3H), 3.11 - 3.05 (m, 1H), 2.97 - 2.92 (m, 1H), 2.81 - 2.77 (m, 1H), 2.64 - 2.59 (m, 1H), 2.55 (s, 3H), 1.83 - 1.73 (m, 2H), 1.12 (t, J = 7.2 Hz, 3H), 0.92 (t, J = 7.6 Hz, 3H). Compound 54A : (2R*,3R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- ethyl- 3 -hydroxybutanoic acid ( single diastereomer )

This compound was prepared from compound 54A-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water (0.02% ammonium bicarbonate) = 15% to 60%) to give the title compound as a yellow solid (70 mg, 98.9% purity, 78% yield). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₆ S is 637.2, found m/z is 638.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.15 (s, 1H), 7.83 (d, J = 3.2 Hz, 1H), 7.42 (d, J = 2.4 Hz, 1H), 7.08 - 6.89 (m, 3H), 6.00 (s, 1H), 4.28 - 4.26 (m, 3H), 4.11 - 4.00 (m, 5H), 3.68 - 3.63 (m, 1H), 3.50 - 3.40 (m, 1H), 3.16 - 2.99 (m, 3H ), 2.62 - 2.58 (m, 1H), 2.53 (s, 3H), 1.83 - 1.69 (m, 2H), 1.11 (t, J = 7.2 Hz, 3H), 1.02 (t, J = 7.6 Hz, 3H) . Compound 54B : (2S*,3S*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- ethyl- 3 -hydroxybutanoic acid ( single diastereomer )

This compound was prepared from compound 54B-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water (0.02% ammonium bicarbonate) = 15% to 60%) to give the title compound as a yellow solid (56 mg, 99.1% purity, 68% yield). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₆ S is 637.2, found m/z is 638.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.16 (br s, 1H), 7.83 (d, J = 3.2 Hz, 1H), 7.43 (d, J = 2.8 Hz, 1H), 7.10 - 6.91 (m, 3H) , 6.00 (s, 1H), 4.27 (s, 3H), 4.06 - 4.00 (m, 5H), 3.67 - 3.48 (m, 2H), 3.14 - 3.10 (m, 2H), 2.91 - 2.86 (m, 1H) , 2.53 - 2.49 (m, 4H), 1.82 - 1.73 (m, 2H), 1.11 (t, J = 7.2 Hz, 3H), 1.02 (t, J = 7.6 Hz, 3H). Compound 54C : (2S*,3R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- ethyl- 3 -hydroxybutanoic acid ( single diastereomer )

This compound was prepared from compound 54C-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water (0.02% ammonium bicarbonate) = 15% to 60%) to give the title compound as a yellow solid (20 mg, 98.9% purity, 68% yield). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₆ S is 637.2, found m/z is 638.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.18 (br s, 1H), 7.84 (d, J = 2.8 Hz, 1H), 7.43 (s, 1H), 7.08 - 6.91 (m, 3H), 6.01 (s, 1H), 4.27 (s, 3H), 4.09 - 4.00 (m, 5H), 3.68 - 3.62 (m, 1H), 3.52 - 3.44 (m, 1H), 3.14 - 3.06 (m, 2H), 2.88 - 2.82 ( m, 1H), 2.65 - 2.60 (m, 1H), 2.54 (s, 3H), 1.80 - 1.74 (m, 2H), 1.11 (t, J = 7.2 Hz, 3H), 1.01 (t, J = 7.6 Hz , 3H). Compound 54D : (2R*,3S*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- ethyl- 3 -hydroxybutanoic acid ( single diastereomer )

中間體 M6 的製備

中間體 M6-1 ： (3aS*,6aS*)-1-(3-( 三級丁氧基 )-2- 羥基 -2- 甲基 -3- 側氧基丙基 )-6,6- 二氟四氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -4(5H)- 甲酸三級丁酯 This compound was prepared from compound 54D-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water (0.02% ammonium bicarbonate) = 15% to 60%) to give the title compound as a yellow solid (20 mg, 98.3% purity, 64% yield). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₆ S is 637.2, found m/z is 638.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.14 (br s, 1H), 7.83 (d, J = 3.2 Hz, 1H), 7.42 (d, J = 2.8 Hz, 1H), 7.08 - 6.91 (m, 3H) , 6.00 (s, 1H), 4.27 - 4.17 (m, 4H), 4.06 - 3.99 (m, 4H), 3.66 - 3.61 (m, 1H), 3.51 - 3.44 (m, 1H), 3.13 - 2.97 (m, 3H), 2.66 - 2.62 (m, 1H), 2.53 (s, 3H), 1.81 - 1.75 (m, 2H), 1.11 (t, J = 7.2 Hz, 3H), 1.02 (t, J = 7.6 Hz, 3H ). Compound 55

Preparation of Intermediate M6

Intermediate M6-1 : (3aS*,6aS*)-1-(3-( tertiary butoxy )-2- hydroxy -2- methyl- 3 -oxopropyl )-6,6 -di Fluorotetrahydro - 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylic acid tertiary butyl ester

A mixture of Intermediate T1 (1.00 g, 90% purity, 3.60 mmol) and Intermediate S5-2 (1.00 g, 90% purity, 22.8 mmol) was heated to 120 °C and stirred overnight under nitrogen. The mixture was poured into water (20 mL) and extracted three times with ethyl acetate (20 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=1:0 to 5:1) to obtain Intermediate M6-1 (500 mg, 26% yield, according to LCMS purity 76.7%). LC-MS (ESI): calculated mass for C ₁₈ H ₃₀ F ₂ N ₂ O ₆ is 408.2, found m/z is 409.2 [M+H] ⁺ . Intermediate M6-2 : 3-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-2 - hydroxyl- 2 -Methylpropionic acid

To a solution of Intermediate M6-1 (500 mg, 76.7% purity, 0.939 mmol) in dichloromethane (5 mL) was added trifluoroacetic acid (5 mL). The mixture was stirred at room temperature for 2 hours. The mixture was concentrated to afford Intermediate M6-2 (450 mg, 92% yield, 70% purity by LCMS) as a red solid, which was used directly in the next step. LC-MS (ESI): Calculated mass for C ₉ H ₁₄ F ₂ N ₂ O ₄ is 252.1, found m/z is 253.1 [M+H] ⁺ . Intermediate M6-3 : (3aS*,6aS*)-1-((R*)-3-( allyloxy )-2- hydroxyl -2- methyl- 3 -oxopropyl )-6 ,6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -tertiary butyl carboxylate

To a solution of Intermediate M6-2 (450 mg, 0.860 mmol, 70% purity) in dichloromethane (5 mL) was added ditertiary-butyl dicarbonate (210 mg, 0.962 mmol) and triethylamine (250 mg, 2.47 mmol). The mixture was stirred at room temperature for 1 hour. The mixture was concentrated to give a residue. The residue was diluted with N,N-dimethylformamide (5 mL). Then 3-bromoprop-1-ene (120 mg, 0.992 mmol) and potassium carbonate (370 mg, 2.68 mmol) were added to the mixture. The mixture was stirred at room temperature for another 2 hours. The mixture was poured into water (20 mL) and extracted three times with ethyl acetate (20 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=1:0 to 3:1) to give single diastereomer intermediate M6-3 (120 mg, 20% yield, 57% purity by LCMS). LC-MS (ESI): calculated mass for C ₁₇ H ₂₆ F ₂ N ₂ O ₆ is 392.2, found m/z is 393.2 [M+H] ⁺ . Intermediate M6 : (R*)-3-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isozazol- 1 -yl )-2 -Allyl hydroxy -2- methylpropionate

To a solution of Intermediate M6-3 (120 mg, 0.174 mmol, 57% purity) in dichloromethane (2 mL) was added trifluoroacetic acid (1 mL). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water (10 mL) and basified to pH 8-9 with saturated aqueous sodium bicarbonate. The mixture was then extracted three times with ethyl acetate (10 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to afford Intermediate M6 (55 mg, 82% yield, 85% purity by LCMS) as a brown oil, which was used directly in the next step. LC-MS (ESI): calculated mass for C ₁₂ H ₁₈ F ₂ N ₂ O ₄ is 292.1, found m/z is 293.1 [M+H] ⁺ . Compound 55-1 : (S)-6-((( cis )-1-((R*)-3-( allyloxy )-2- hydroxyl -2- methyl- 3 -oxopropyl Base )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2- methylbenzene base )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer )

This compound was prepared from Intermediate H1A and Intermediate M6 according to Typical Coupling Procedure 1 .

Purification by C18 column (acetonitrile: water = 40% to 85%) afforded Compound 55-1 (50 mg, 46% yield, 96% purity by LCMS) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₀ H ₃₄ F ₃ N ₅ O ₆ S is 649.2, found m/z is 650.4 [M+H] ⁺ . Compound 55 : (R*)-3-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1- base )-2- hydroxy -2- methylpropanoic acid ( single diastereomer )

This compound was prepared from compound 55-1 using typical method 3 to remove the allyl ester protection, and purified by C18 column (acetonitrile: water (+ 0.1% ammonium bicarbonate) = 30% to 50%) to give the compound as a yellow solid. Compound 55 (26.3 mg, 54% yield, 92.3% pure by LCMS).

中間體 M7 的製備

中間體 M7-1 ： 2- 亞甲基丁酸甲酯 ¹ HNMR (400 MHz, CDCl ₃ ): δ 9.12 (br s, 1H), 7.84 (d, J = 3.2 Hz, 1H), 7.40 (d, J = 2.4 Hz, 1H), 7.10 - 7.05 (m, 1H ), 6.97 - 6.88 (m, 2H), 5.99 (s, 1H), 4.29 - 4.20 (m, 3H), 4.09 - 3.97 (m, 4H), 3.82 - 3.75 (m, 1H), 3.42 - 3.27 (m , 2H), 3.11 - 3.00 (m, 2H), 2.53 (s, 3H), 1.43 (s, 3H), 1.10 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₇ H ₃₀ F ₃ N ₅ O ₆ S is 609.2, found m/z is 610.2 [M+H] ⁺ . Compound 56

Preparation of Intermediate M7

Intermediate M7-1 : Methyl 2 -methylene butyrate

To a suspension of copper cyanide (20.0 g, 223 mmol) in THF (800 mL) was added dropwise a 1 M solution of methylmagnesium bromide in THF (200 mL, 200 mmol ). After stirring at this temperature for 1 hour, methyl 2-(bromomethyl)acrylate (20.0 g, 112 mmol) was added to the mixture. The mixture was then stirred at room temperature for 2 hours. The mixture was quenched with saturated NH ₄ Cl solution (80 mL), diluted with water (200 mL), and extracted three times with dichloromethane (100 mL). The combined organic layers were washed with brine (300 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give Intermediate M7-1 (10.0 g, 63% yield, 80% purity by HNMR) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ): δ 6.13 (s, 1H), 5.53 (d, J = 1.2 Hz, 1H), 3.76 (s, 3H), 2.36 - 2.30 (m, 2H), 1.08 (t, J = 7.6 Hz, 3H). Intermediate M7-2 : Methyl 2 - ethyloxirane- 2- carboxylate

To a solution of Intermediate M7-1 (10.0 g, 80% purity, 70.1 mmol) in dichloromethane (150 mL) was added 3-chloroperoxybenzoic acid (24.1 g, 85% purity, 120 mmol). The mixture was stirred overnight at room temperature. The mixture was quenched with saturated aqueous sodium thiosulfate (200 mL), and extracted three times with petroleum ether (100 mL). The combined organic layers were washed with brine (150 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=1:0 to 5:1) to obtain Intermediate M7-2 (2.50 g, 19% yield, according to HNMR purity 70%). HNMR (400 MHz, CDCl ₃ ): δ 3.76 (s, 3H), 3.04 (d, J = 6.0 Hz, 1H), 2.80 (d, J = 6.0 Hz, 1H), 2.14 - 2.05 (m, 1H), 1.81 - 1.72 (m, 1H), 1.01 (t, J = 6.8 Hz, 3H). Intermediate M7-3 : (3aS*,6aS*)-6,6 -difluoro- 1-(2- hydroxyl -2-( methoxycarbonyl ) butyl ) tetrahydro -1H- pyrrolo [3,2 -c] Isoxazole- 4(5H) -tertiary butyl carboxylate

A mixture of Intermediate T1 (500 mg, 90% purity, 1.80 mmol) and Intermediate M7-2 (2.50 g, 70% purity, 13.4 mmol) was heated to 120 °C and stirred overnight under nitrogen. After cooling to room temperature, the mixture was poured into water (20 mL) and extracted three times with ethyl acetate (20 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=1:0 to 3:1) to obtain Intermediate M7-3 (320 mg, 43% yield, according to LCMS purity 92%). LC-MS (ESI): Calculated mass for C ₁₆ H ₂₆ F ₂ N ₂ O ₆ is 380.2, found m/z is 381.2 [M+H] ⁺ . Intermediate M7-4 : (3aS*, 6aS*)-1-(2-(( allyloxy ) carbonyl )-2 -hydroxybutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [ 3,2-c] isoxazole- 4(5H) -tertiary butyl carboxylate

To a solution of Intermediate M7-3 (320 mg, 92% purity, 0.774 mmol) in tetrahydrofuran (3 mL) was added sodium hydroxide (150 mg, 3.75 mmol) and water (3 mL). The mixture was stirred overnight at room temperature. The reaction mixture was acidified to pH 3-4 with 1 M aqueous hydrochloride solution (about 5 mL), and extracted three times with ethyl acetate (10 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give crude product. The crude product was dissolved in N,N-dimethylformamide (3 mL). To the mixture was added 3-bromoprop-1-ene (100 mg, 0.827 mmol) and potassium carbonate (320 mg, 2.32 mmol). The mixture was stirred at room temperature for 1 hour. The mixture was poured into water (10 mL) and extracted three times with ethyl acetate (10 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give a residue. The residue was purified by C18 column (acetonitrile: water = 60% to 85%) to give intermediate M7-4 (120 mg, 38% yield, 99% pure by LCMS) as yellow oil. LC-MS (ESI): calculated mass for C ₁₈ H ₂₈ F ₂ N ₂ O ₆ is 406.2, found m/z is 351.2 [M-56+H] ⁺ . Intermediate M7 : 2-(((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl ) methyl )-2- Allyl hydroxybutyrate

To a solution of Intermediate M7-4 (120 mg, 99% purity, 0.292 mmol) in dichloromethane (2 mL) was added trifluoroacetic acid (1 mL). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water (10 mL) and basified to pH 8-9 with saturated aqueous sodium bicarbonate. The mixture was then extracted three times with ethyl acetate (10 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to afford Intermediate M 7 (50 mg, 35% yield, 63% purity by LCMS) as a brown oil, which was used directly in the next step.

LC-MS (ESI): calculated mass for C ₁₃ H ₂₀ F ₂ N ₂ O ₄ is 306.1, found m/z is 307.3 [M+H] ⁺ . Compound 56-1 : (4S)-6-(((3aS*,6aS*)-1-(2-(( allyloxy ) carbonyl )-2 -hydroxybutyl )-6,6 -difluorotetra Hydrogen -1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazole- 2- base )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

This compound was prepared from Intermediate H1A and Intermediate M7 according to Typical Coupling Procedure 1 .

Purification by Prep-TLC (petroleum ether:ethyl acetate=3:1) afforded Compound 56-1 (40 mg, 39% yield, 67% purity by LCMS) as a yellow solid.

LC-MS (ESI): Calculated mass for C ₃₁ H ₃₆ F ₃ N ₅ O ₆ S is 663.2, found m/z is 664.3 [M+H] ⁺ . Compound 56 : 2-(((3aS*,6aS*)-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl ) methyl )-2 -hydroxybutyric acid

化合物 57-1 ： (4S)-6-(((3aS*,6aS*)-1-(4-( 烯丙氧基 )-3- 羥基 -3- 甲基 -4- 側氧基丁基 )-6,6- 二氟四氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -4(5H)- 基 ) 甲基 )-4-(3- 氟 -2- 甲基苯基 )-2-( 噻唑 -2- 基 )-1,4- 二氫嘧啶 -5- 甲酸乙酯

This compound was prepared from compound 56-1 using typical method 3 to remove the allyl ester protection, and purified by C18 column (acetonitrile: water (+ 0.1% ammonium bicarbonate) = 30% to 50%) to give the compound as a yellow solid. Compound 56 (3.5 mg, 14% yield, 98.1% pure by LCMS). ¹ HNMR (400 MHz, CDCl ₃ ): δ 9.11 (br s, 1H), 7.87 - 7.80 (m, 1H), 7.43 - 7.37 (m, 1H), 7.09 - 7.04 (m, 1H), 6.96 - 6.88 ( m, 2H), 5.99 (s, 1H), 4.31 - 4.21 (m, 3H), 4.10 - 3.98 (m, 4H), 3.78 - 3.67 (m, 1H), 3.44 - 3.31 (m, 2H), 3.14 - 3.02 (m, 2H), 2.53 (s, 3H), 1.86 - 1.69 (m, 2H), 1.10 (t, J = 7.2 Hz, 3H), 0.96 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₈ H ₃₂ F ₃ N ₅ O ₆ S is 623.2, found m/z is 624.2 [M+H] ⁺ . Compounds 57A and 57B

Compound 57-1 : (4S)-6-(((3aS*,6aS*)-1-(4-( allyloxy )-3 -hydroxyl- 3 -methyl- 4 -oxobutyl ) -6,6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl ) -2-( Thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

This compound was prepared from Intermediate H1A and Intermediate T7-7 according to Typical Coupling Procedure 1 .

Purified by silica gel column chromatography (petroleum ether: ethyl acetate = 9: 1 to 3: 1) and further purified by C18 (acetonitrile: water (+ 0.1% ammonium bicarbonate) = 50% to 60%), Compound 57-1 (85 mg, 96% purity by LCMS, 55% yield) was obtained as a yellow solid.

LC-MS (ESI): Calculated mass for C ₃₁ H ₃₆ F ₃ N ₅ O ₆ S is 663.2, found m/z is 664.4 [M+H] ⁺ . Compound 57A-1 , 57B-1 : (S)-6-((( cis )-1-((R*)-4-( allyloxy )-3 -hydroxyl- 3 -methyl- 4- Oxybutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -Methylphenyl )-2-( thiazol- 2 - yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer ) (S)-6-((( cis ) -1-((S*)-4-( allyloxy )-3 -hydroxyl- 3 -methyl- 4 -oxobutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [ 3,2-c] isozazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- Ethyl dihydropyrimidine- 5 -carboxylate ( single diastereomer )

The racemic mixture of compound 57-1 (85 mg, 96% purity, 0.123 mmol) was subjected to chiral prep HPLC (conditions: column IB 5 um 30 * 250 mm, mobile phase: Hex: EtOH = 90: 10, Separation at 25 mL/min; column temperature: 30°C; wavelength 254 nm) to obtain compound 57A-1 (38 mg, 90% purity according to ¹ HNMR, 100% stereopure, 42% yield) as a yellow solid and Compound 57B-1 (41 mg, 90% pure by HNMR, 100% stereopure, 45% yield) as a yellow solid.

Compound 57A-1 : chiral analysis (column: Chiralpak IB 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 90 : 10, at 1 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 9.723 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.19 (br s, 1H), 7.79 (d, J = 3.2 Hz, 1H), 7.40 (d, J = 3.2 Hz, 1H), 7.09 - 7.01 (m, 1H) , 6.96 - 6.88 (m, 2H), 5.99 - 5.91 (m, 2H), 5.37 (d, J = 15.6 Hz, 1H), 5.28 (d, J = 11.2 Hz, 1H), 4.58 - 4.62 (m, 2H ), 4.32 - 4.19 (m, 3H), 4.06 - 4.01 (m, 3H), 3.96 - 3.90 (m, 1H), 3.64 (s, 1H), 3.55 - 3.50 (m, 1H), 3.46 - 3.32 (m , 2H), 3.07 (t, J = 12.4 Hz, 1H), 2.96 - 2.91 (m, 1H), 2.53 (d, J = 2.0 Hz, 3H), 2.32 - 2.25 (m, 2H), 1.45 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H).

Compound 57B-1 : chiral HPLC (column: Chiralpak IB 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 90 : 10, at 1 mL/min; temperature: 30°C; wavelength: 254 nm, R _T = 11.773 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.12 (br s, 1H), 7.76 (d, J = 2.8 Hz, 1H), 7.34 (d, J = 3.2 Hz, 1H), 7.02 - 6.97 (m, 1H) , 6.90 - 6.81 (m, 2H), 5.93 - 5.82 (m, 2H), 5.28 (d, J = 17.2 Hz, 1H), 5.20 (d, J = 10.8 Hz, 1H), 4.60 (d, J = 6.0 Hz, 2H), 4.25 - 4.14 (m, 3H), 4.05 (s, 1H), 3.99 - 3.93 (m, 4H), 3.52 - 3.46 (m, 1H), 3.41 - 3.31 (m, 1H), 3.03 ( t, J = 12.4 Hz, 1H), 2.89 - 2.83 (m, 2H), 2.47 (s, 3H), 2.06 - 2.02 (m, 2H), 1.40 (s, 3H), 1.05 (t, J = 7.2 Hz , 3H). Compound 57A : (R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

This compound was prepared from compound 57A-1 using typical method 3 to remove the allyl ester protection and purified by C18 column (acetonitrile: water (5% ammonium bicarbonate) = 5% - 100%) to give the compound as a yellow solid 57A (13.8 mg, 96.1% purity, 45% yield).

¹ HNMR (400 MHz, CD ₃ OD) δ 7.80 (d, J = 3.2 Hz, 1H), 7.61 (d, J = 2.8 Hz, 1H), 7.07 - 6.99 (m, 2H), 6.86 - 6.81 (m, 1H), 5.86 (s, 1H), 4.29 - 4.26 (m, 1H), 4.23 - 4.11 (m, 2H), 3.98 - 3.91 (m, 4H), 3.77 - 3.71 (m, 1H), 3.21 - 3.20 ( m, 1H), 3.07 - 3.01 (m, 1H), 2.99 - 2.92 (m, 1H), 2.70 - 2.63 (m, 1H), 2.40 (s, 3H), 1.99 - 1.91 (m, 1H), 1.89 - 1.81 (m, 1H), 1.30 (s, 3H), 1.02 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₂₈ H ₃₂ F ₃ N ₅ O ₂ S is 623.2, found m/z is 624.3 [M+H] ⁺ . Compound 57B : (S*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

中間體 T7-7a 和 T7-7b 的製備

中間體 T7-6a 和 T7-6b ： (3aS*, 6aS*)-1-((R*)-4-( 烯丙氧基 )-3-( 甲氧基甲氧基 )-3- 甲基 -4- 側氧基丁基 )-6,6- 二氟四氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -4(5H)- 甲酸三級丁酯和 (3aS*, 6aS*)-1-((S*)-4-( 烯丙氧基 )-3-( 甲氧基甲氧基 )-3- 甲基 -4- 側氧基丁基 )-6,6- 二氟四氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -4(5H)- 甲酸三級丁酯 This compound was prepared from compound 57B-1 using typical method 3 to remove the allyl ester protection, and purified by C18 column (acetonitrile: water (5% ammonium bicarbonate) = 5% - 100%) to give the compound as an orange solid 57B (11.6 mg, 95.4% purity, 34% yield). ¹ HNMR (400 MHz, CD ₃ OD) δ 7.81 (d, J = 2.4 Hz, 1H), 7.62 (d, J = 2.4 Hz, 1H), 7.06 - 6.99 (m, 2H), 6.86 - 6.81 (m, 1H), 5.86 (s, 1H), 4.28 - 4.12 (m, 3H), 3.97 - 3.91 (m, 4H), 3.79 - 3.73 (m, 1H), 3.21 - 3.20 (m, 1H), 3.02 (m, 1H), 2.78 - 2.76 (m, 2H), 2.40 (s, 3H), 2.09 - 2.00 (m, 1H), 1.79 - 1.69 (m, 1H), 1.29 (s, 3H), 1.05 - 1.01 (m, 3H). LC-MS (ESI): Calculated mass for C ₂₈ H ₃₂ F ₃ N ₅ O ₂ S is 623.2, found m/z is 624.3 [M+H] ⁺ . Compounds 58A and 58B

Preparation of intermediates T7-7a and T7-7b

Intermediates T7-6a and T7-6b : (3aS*, 6aS*)-1-((R*)-4-( allyloxy )-3-( methoxymethoxy )-3 -methyl -4 -oxobutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylic acid tertiary butyl ester and (3aS*, 6aS *)-1-((S*)-4-( allyloxy )-3-( methoxymethoxy )-3 -methyl- 4 -oxobutyl )-6,6 -di Fluorotetrahydro - 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylic acid tertiary butyl ester

The racemic mixture of intermediate T7-6 (900 mg, 90% purity, 1.80 mmol) was passed through chiral Prep.HPLC (column: Chiralpak IG 5 µm 20 * 250 mm, mobile phase: Hex: IPA = 95: 5, separated at 15 mL/min, temperature: 30 °C, wavelength: 214 nm) to obtain Intermediate T7-6a (380 mg, 90% purity according to ¹ HNMR, 44% yield, as a colorless oil, 99.4% stereopure) and intermediate T7-6b (370 mg, 90% pure by ¹ H NMR, 41% yield, 96.0% stereopure).

Intermediate T7-6a : LC-MS (ESI): Calculated mass for C ₂₀ H ₃₂ F ₂ N ₂ O ₇ is 450.2, found m/z is 451.3 [M+H] ⁺ . Chiral analysis (column: Chiralpak AD-H 5 µm 4.6 * 250 mm; mobile phase: Hex : IPA = 95 : 5, at 1.0 mL/min; temperature: 30°C; wavelength: 214 nm, RT = _8.606 min ). ¹ HNMR (300 MHz, CDCl ₃ ) δ 5.99 - 5.86 (m, 1H), 5.37 - 5.31 (m, 1H), 5.27 - 5.23 (m, 1H), 4.81 - 4.74 (m, 2H), 4.61 (d, J = 5.7 Hz, 2H), 4.16 - 4.11 (m, 1H), 4.02 - 3.83 (m, 2H), 3.77 - 3.59 (m, 2H), 3.45 - 3.35 (m, 4H), 3.00 - 2.93 (m, 2H), 2.18 - 2.09 (m, 2H), 1.51(s, 3H), 1.46 (s, 9H).

Intermediate T7-6b : LC-MS (ESI): calculated mass for C ₂₀ H ₃₂ F ₂ N ₂ O ₇ is 450.2, found m/z is 451.3 [M+H] ⁺ . Chiral analysis (column: Chiralpak AD-H 5 µm 4.6 * 250 mm; mobile phase: Hex : IPA = 95 : 5, at 1.0 mL/min; temperature: 30°C; wavelength: 214 nm, RT = _10.147 min ). ¹ HNMR (300 MHz, CDCl ₃ ) δ 5.99 - 5.87 (m, 1H), 5.37 - 5.31 (m, 1H), 5.27 - 5.24 (m, 1H), 4.79 - 4.76 (m, 2H), 4.62 (d, J = 5.7 Hz, 2H), 4.12 - 4.08 (m, 1H), 4.03 - 3.86 (m, 2H), 3.78 - 3.60 (m, 2H), 3.47 - 3.38 (m, 4H), 3.09 - 2.84 (m, 2H), 2.23 - 2.10 (m, 2H), 1.52(s, 3H), 1.46 (s, 9H). Intermediate T7-7a : (R*)-4-((3aS*, 6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isozazol- 1 -yl ) -Allyl 2- hydroxy -2 -methylbutyrate trifluoroacetate

To a solution of Intermediate T7-6a (380 mg, 90% purity, 0.759 mmol) in dichloromethane (4 mL) was added trifluoroacetic acid (4 mL). After stirring at room temperature under nitrogen atmosphere for 0.5 h, the reaction mixture was concentrated under reduced pressure to afford Intermediate T7-7a (580 mg, 50% purity by ¹ HNMR, 91% yield) as a red oil. ¹ HNMR (300 MHz, CDCl ₃ ) δ 5.97 - 5.86 (m, 1H), 5.34 (d, J = 1.5 Hz, 0.5H), 5.29 (d, J = 1.2 Hz, 0.5H), 5.25 - 5.19 (m , 1H), 4.85 - 4.71 (m, 1H), 4.58 (d, J = 5.1 Hz, 2H), 4.09 - 4.04 (m, 1H), 3.82 - 3.71 (m, 3H), 3.03 - 2.93 (m, 1H ), 2.87 - 2.80 (m, 1H), 2.76 - 2.67 (m, 1H), 2.03 - 1.94 (m, 2H), 1.23 (s, 3H). Intermediate T7-7b : (S*)-4-((3aS*, 6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl ) -Allyl 2- hydroxy -2 -methylbutyrate trifluoroacetate

To a solution of Intermediate T7-6b (370 mg, 90% purity, 0.739 mmol) in dichloromethane (4 mL) was added trifluoroacetic acid (4 mL). After the mixture was stirred at room temperature under nitrogen atmosphere for 0.5 hours, it was then concentrated under reduced pressure to afford Intermediate T7-7b (480 mg, 60% purity by ¹ HNMR, 93% yield) as a red oil. ¹ HNMR (300 MHz, CDCl ₃ ) δ 5.99 - 5.86 (m, 1H), 5.32 (d, J = 17.4 Hz, 1H), 5.23 (d, J = 10.5 Hz, 1H), 4.84 - 4.71 (m, 1H ), 4.59 - 4.57 (m, 2H), 4.07 - 4.00 (m, 2H), 3.81 - 3.71 (m, 3H), 2.86 - 2.78 (m, 1H), 2.70 - 2.65 (m, 1H), 2.00 - 1.90 (m, 2H), 1.23 (s, 3H). Compound 58A-1 : (S*)-6-((( cis )-1-((R*)-4-( allyloxy )-3 -hydroxyl- 3 -methyl- 4 -side oxy Butyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3,4 -difluoro -2 -Methylphenyl )-2-( thiazol- 2 - yl )-1,4- dihydropyrimidine- 5- carboxylate ( single diastereomer )

This compound was prepared from Intermediate H3B and Intermediate T7-7a according to Typical Coupling Procedure 1 .

Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 10% to 95%) afforded the title compound (60 mg, 85% purity by ¹ H NMR, 45% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₀ H ₃₃ F ₄ N ₅ O ₆ S is 667.2, found m/z is 668.1 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.95 (d, J = 2.4 Hz, 1H), 7.59 (d, J = 3.6 Hz, 1H), 6.93 - 6.88 (m, 2H), 6.02 (s, 1H), 5.96 - 5.90 (m, 1H), 5.35 (d, J = 17.2 Hz, 1H), 5.27 (d, J = 10.0 Hz, 1H), 4.67 (d, J = 6.0 Hz, 2H), 4.03 - 4.00 (m , 2H), 3.63 (s, 3H), 3.59 - 3.56 (m, 1H), 3.49 - 3.41 (m, 1H), 3.12 - 3.06 (m, 1H), 2.97 - 2.93 (m, 2H), 2.63 - 2.61 (m, 3H), 2.13 - 2.09 (m, 2H), 1.47 (s, 3H). Compound 58B-1 : (S*)-6-((( cis )-1-((S*)-4-( allyloxy )-3 -hydroxyl- 3 -methyl- 4 -side oxy Butyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3,4 -difluoro -2 -Methylphenyl )-2-( thiazol- 2 - yl )-1,4- dihydropyrimidine- 5- carboxylate ( single diastereomer )

This compound was prepared from Intermediate H3B and Intermediate T7-7b according to Typical Coupling Procedure 1 .

Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 10% to 95%) afforded the title compound (65 mg, 85% purity by ¹ H NMR, 48% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₀ H ₃₃ F ₄ N ₅ O ₆ S is 667.2, found m/z is 668.0 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.95 (d, J = 2.4 Hz, 1H), 7.59 (d, J = 3.6 Hz, 1H), 6.93 - 6.88 (m, 2H), 6.02 (s, 1H), 5.96 - 5.90 (m, 1H), 5.35 (d, J = 17.2 Hz, 1H), 5.27 (d, J = 10.0 Hz, 1H), 4.67 (d, J = 6.0 Hz, 2H), 4.03 - 4.00 (m , 2H), 3.63 (s, 3H), 3.59 - 3.56 (m, 1H), 3.49 - 3.41 (m, 1H), 3.12 - 3.06 (m, 1H), 2.97 - 2.93 (m, 2H), 2.63 - 2.61 (m, 3H), 2.13 - 2.09 (m, 2H), 1.47 (s, 3H). Compound 58A : (R*)-4-(( cis )-4-(((S*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

This compound was prepared from compound 58A-1 using typical method 3 to remove the allyl ester protection and purified by Prep.HPLC (column: Sunfire Waters C18 (5 µm 19 * 150 mm), mobile phase A: water (0.1% carbonic acid ammonium hydrogen), mobile phase B: acetonitrile, UV: 254 nm, flow rate: 15 mL/min, gradient: 35% - 95% (%B)) to obtain the title compound (12.7 mg, 97.6% purity , 29% yield). LC-MS (ESI): Calculated mass for C ₂₇ H ₂₉ F ₄ N ₅ O ₆ S is 627.2, found m/z is 628.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.83 (d, J = 3.2 Hz, 1H), 7.44 (d, J = 2.8 Hz, 1H), 6.91 - 6.85 (m, 2H), 5.93 (s, 1H), 4.34 - 4.23 (m, 3H), 4.05 - 4.00 (m, 2H), 3.61 - 3.56 (m, 4H), 3.53 - 3.44 (m, 1H), 3.19 - 3.14 (m, 1H), 3.11 - 3.02 (m , 2H), 2.57 (s, 3H), 2.38 - 2.34 (m, 1H), 1.88 - 1.86 (m, 1H), 1.51 (s, 3H). Compound 58B : (S*)-4-(( cis )-4-(((S*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

This compound was prepared from compound 58B-1 using typical method 3 to remove allyl ester protection, and purified by Prep.HPLC (column: Sunfire Waters C18 (5 µm 19 * 150 mm), mobile phase A: water (0.1% carbonic acid ammonium hydrogen), mobile phase B: acetonitrile, UV: 254 nm, flow rate: 15 mL/min, gradient: 35% - 95% (%B)) to obtain the title compound (29.5 mg, 99.0% purity , 56% yield). LC-MS (ESI): Calculated mass for C ₂₇ H ₂₉ F ₄ N ₅ O ₆ S is 627.2, found m/z is 628.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.85 (d, J = 3.2 Hz, 1H), 7.45 (d, J = 2.8 Hz, 1H), 6.93 - 6.87 (m, 2H), 5.93 (s, 1H), 4.33 - 4.19 (m, 3H), 4.05 (d, J = 4.4 Hz, 2H), 3.64 - 3.59 (m, 4H), 3.46 - 3.36 (m, 1H), 3.19 - 3.11 (m, 2H), 2.95 - 2.89 (m, 1H), 2.57 (s, 3H), 2.20 - 2.17 (m, 2H), 1.49 (s, 3H). Compound 59A : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( ethoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compound 59A was prepared from Intermediate H4A and Intermediate T7-7a according to Typical Method 1 and Typical Method 3 sequentially.

By Prep.HPLC (column: Sunfire Waters C18 (5 µm 19 *150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min , gradient: 35% - 85% (%B)) to afford the title compound (15.2 mg, 98.7% purity, 35% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₇ H ₂₈ ClF ₄ N ₅ O ₆ S is 661.1, found m/z is 662.1 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.18 (br s, 1H), 7.85 (d, J = 2.8 Hz, 1H), 7.46 (d, J = 2.8 Hz, 1H), 7.05 - 7.00 (m, 2H) , 6.19 (s, 1H), 5.24 (br s, 1H), 4.31 - 4.16 (m, 3H), 4.07 - 3.99 (m, 4H), 3.61 - 3.56 (m, 1H), 3.54 - 3.43 (m, 1H ), 3.21 - 3.14 (m, 1H), 3.11 - 3.02 (m, 2H), 2.40 - 2.33 (m, 1H), 1.88 - 1.85 (m, 1H), 1.51 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compound 59B : (S*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( ethoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- hydroxy -2 -methylbutanoic acid (single diastereomer)

Compound 59B was prepared from Intermediate H4A and Intermediate T7-7b according to Typical Method 1 and Typical Method 3 sequentially.

By Prep.HPLC (column: Sunfire Waters C18 (5 µm 19 *150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min , gradient: 35% - 85% (%B)) to afford the title compound (36.0 mg, 98.1% purity, 52% yield) as a yellow solid. LC-MS (ESI): calculated mass for C ₂₇ H ₂₈ ClF ₄ N ₅ O ₆ S 661.1, found m/z 662.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.22 (br s, 1H), 7.87 (d, J = 2.8 Hz, 1H), 7.45 (d, J = 2.8 Hz, 1H), 7.05 - 7.00 (m, 2H) , 6.35 (br s, 1H), 6.19 (s, 1H), 4.29 - 4.16 (m, 3H), 4.06 - 4.01 (m, 4H), 3.64 - 3.58 (m, 1H), 3.46 - 3.35 (m, 1H ), 3.19 - 3.09 (m, 2H), 2.96 - 2.89 (m, 1H), 2.23 - 2.17 (m, 2H), 1.49 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compound 60A : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( methoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compound 60A was prepared from Intermediate H2A and Intermediate T7-7a according to Typical Method 1 and Typical Method 3 sequentially.

By Prep.HPLC (column: Xbridge C8 (5 μm 19 * 150 mm), mobile phase A: water (0.1% trifluoroacetic acid), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min, Gradient: 20% - 75% (%B)) and purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 05% to 95%) afforded the title compound (47.3 mg, 99.1% purity, 69% yield). LC-MS (ESI): calculated mass for C ₂₆ H ₂₆ ClF ₄ N ₅ O ₆ S 647.1, found m/z 648.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.21 (br s, 1H), 7.88 - 7.85 (m, 1H), 7.52 - 7.45 (m, 1H), 7.07 - 7.00 (m, 2H), 6.17 (s, 1H) ), 5.28 (br s, 1H), 4.33 - 4.17 (m, 3H), 4.14 - 3.99 (m, 2H), 3.63 - 3.45 (m, 5H), 3.24 - 2.99 (m, 3H), 2.41 - 2.32 ( m, 1H), 1.90 - 1.80 (m, 1H), 1.51 (s, 3H). Compound 60B : (S*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( methoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compound 60B was prepared from Intermediate H2A and Intermediate T7-7b according to Typical Method 1 and Typical Method 3 sequentially.

By Prep.HPLC (column: Xbridge C8 (5 μm 19 * 150 mm), mobile phase A: water (0.1% trifluoroacetic acid), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min, Gradient: 20% - 75% (%B)) and purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 05% to 95%) afforded the title compound (47.3 mg, 99.1% purity, 69% yield). LC-MS (ESI): calculated mass for C ₂₆ H ₂₆ ClF ₄ N ₅ O ₆ S 647.1, found m/z 648.1 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.25 (br s, 1H), 7.87 (d, J = 3.2 Hz, 1H), 7.54 - 7.45 (m, 1H), 7.10 - 7.02 (m, 2H), 6.17 ( s, 1H), 4.29 - 4.16 (m, 3H), 4.10 - 4.05 (m, 2H), 3.65 - 3.59 (m, 4H), 3.45 - 3.34 (m, 1H), 3.18 - 3.10 (m, 2H), 3.00 - 2.90 (m, 1H), 2.21 - 2.12 (m, 2H), 1.48 (s, 3H). Compound 61A : (R*)-4-(( cis )-4-(((R*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compound 61a was prepared from Intermediate H5A and Intermediate T7-7a according to Typical Method 1 and Typical Method 3 sequentially.

By prep.HPLC (column: Waters X-bridge C18 (5 μm 19 * 150 mm), mobile phase A: water (0.02% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL /min, gradient: 20% - 60% (%B)) to afford the title compound (15 mg, 98.9% purity, 42% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₆ S is 641.2, found m/z is 642.1 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.12 (br s, 1H), 7.83 (d, J = 3.2 Hz, 1H), 7.46 (s, 1H), 6.94 - 6.88 (m, 2H), 5.94 (s, 1H), 5.23 (br s, 1H), 4.35 - 4.26 (m, 3H), 4.06 - 4.01 (m, 4H), 3.61 - 3.56 (m, 2H), 3.21 - 3.02 (m, 3H), 2.56 (s , 3H), 2.40 - 2.35 (m, 1H), 1.87 - 1.83 (m, 1H), 1.51 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compound 61B : (S*)-4-(( cis )-4-(((R*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-2- hydroxy -2 -methylbutanoic acid ( single diastereomer )

Compound 61B was prepared from Intermediate H5A and Intermediate T7-7b according to Typical Method 1 and Typical Method 3 sequentially.

中間體 M8 的製備

中間體 M8-1 ： 3- 羥基 -5-((4- 甲氧基苄基 ) 氧基 )-2,2- 二甲基戊酸三級丁酯 By prep.HPLC (column: Waters X-bridge C18 (5 μm 19 * 150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL /min, gradient: 20% - 60% (%B)) to afford the title compound (32 mg, 97.9% purity, 67% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₆ S is 641.2, found m/z is 642.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.15 (br s, 1H), 7.85 (d, J = 3.2 Hz, 1H), 7.43 (d, J = 2.8 Hz, 1H), 6.91 - 6.87 (m, 2H) , 5.93 (s, 1H), 4.32 - 4.19 (m, 3H), 4.06 - 4.00 (m, 4H), 3.64 - 3.59 (m, 1H), 3.44 - 3.35 (m, 1H), 3.18 - 3.12 (m, 2H), 2.96 - 2.91 (m, 1H), 2.56 (s, 3H), 2.18 - 2.16 (m, 2H), 1.49 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compound 62

Preparation of intermediate M8

Intermediate M8-1 : tertiary butyl 3- hydroxy- 5-((4 -methoxybenzyl ) oxy )-2,2 -dimethylpentanoate

((1-(tertiary butoxy)-2-methylprop-1-en-1-yl)oxy)trimethylsilane (3.7 g, 17.1 mmol) in dichloro To a solution in methane (50 mL) was added 3-((4-methoxybenzyl)oxy)propanal (3.4 g, 20.5 mmol) and BF ₃ .OEt ₂ (8.6 mL, 68.4 mmol). After stirring at this temperature for 1 hour, the mixture was poured into saturated sodium bicarbonate solution (50 mL) and extracted twice with dichloromethane (30 mL), the organic layer was dried over Na ₂ SO ₄ (s) and filtered. The filtrate was concentrated to obtain a crude compound, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 1: 0 to 50: 1) to obtain Intermediate M8-1 (1.6 mg, Yield 25%).

¹ HNMR (400 MHz, CDCl ₃ ) δ = 7.28 - 7.23 (m, 2H), 6.95 - 6.76 (m, 2H), 4.46 (s, 2H), 3.80 - 3.77 (m, 4H), 3.69 - 3.65 (m , 2H), 1.88 - 1.59 (m,2H), 1.48 - 1.40 (m, 9H), 1.17 - 1.10 (m, 6H).

Intermediate M8-2 : Prepare a solution of Intermediate M8-1 (200 mg, 0.591 mmol) and 2,6-lutidine (0.21 mL, 1.8 mmol) in DCM (30 mL) at -78°C Add tertiary butyldimethylsilyl triflate (0.27 mL, 1.15 g/mL, 1.182 mmol). The mixture was stirred at this temperature for 2.5 hours. The mixture was then quenched with saturated aqueous NaHCO ₃ (20 mL), and extracted with DCM (3×20 mL). The combined organic layers were washed with H ₂ O (10 mL), brine (10 mL), dried over Na ₂ SO ₄ and filtered. The filtrate was concentrated in vacuo to give a residue, which was purified by flash chromatography (hexane:EtOAc, 3:1) to afford intermediate M8-2 (100 mg, 37% yield).

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.24 - 7.17 (d, J = 12.0 Hz, 2H), 6.87 - 6.85 (d, J = 12.0 Hz, 2H), 3.94 (dd, J = 3.0, 7.7 Hz, 1H ), 3.81 (s, 3H), 3.62 - 3.42 (m, 2H), 1.80 - 1.57 (m, 2H), 1.44 - 1.38 (s, 9H), 1.12 (s, 3H), 1.03 (s, 3H), 0.93 - 0.81 (m, 9H), 0.04 (m, 6H).

Intermediate M8-3 : To a solution of Intermediate M8-2 (100 mg, 0.2 mmol) in DCM (9 mL) and water (0.5 mL) was added portionwise DDQ (75.216 mg , 0.3 mmol). The mixture was stirred at this temperature for 1.5 hours. The mixture was then quenched with saturated aqueous NaHCO ₃ (25 mL), and extracted with DCM (3×20 mL). The combined organic layers were washed with H ₂ O (10 mL), brine (10 mL), dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated in vacuo to give a residue, which was purified by flash chromatography (PE:EtOAc = 2:1) to give intermediate M8-3 (45 mg, 61% yield).

Intermediate M8-4 : To a solution of Intermediate M8-3 (180 mg, 0.54 mmol) in DCM (15 mL) was added Dess-Martin periodinane (459 mg, 1.08 mmol). The mixture was stirred at room temperature for 3 hours. The mixture was poured into aqueous NaHCO3 (15 mL) and extracted with DCM (25 mL x 3). The combined organic phases _were dried over _Na2SO4 and filtered. The filtrate was concentrated in vacuo to give crude intermediate M8-4 (180 mg, yield 111.8%), which was directly used in the next step without purification. ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.71 (t, J = 2.0 Hz, 1H), 4.34 (t, J = 5.2 Hz, 1H), 2.46 (m, 2H), 1.33 (s, 9H), 1.05 ( s, 3H), 1.01 (s, 3H), 0.77 (s, 9H), 0.08-0.00 (m, 6H).

intermediate M8-5 : Typical reductive amination method 4

To a solution of Intermediate M8-4 (130 mg, 0.47 mmol) and Intermediate T1 (185.4 mg, 0.56 mmol) in DCM (2 mL) was added magnesium sulfate (169.0 mg, 1.40 mmol). After stirring at room temperature for 1 hour, acetic acid (168.4 mg, 2.8 mmol) and sodium triacetyloxyborohydride (295.6 mg, 1.4 mmol) were added. The resulting mixture was stirred at room temperature for 16 hours. It was then diluted with water (20 mL) and extracted twice with dichloromethane (20 mL). The organic layer was washed with water (30 mL), dried over Na ₂ SO _4(s) and filtered. The filtrate was concentrated to give crude compound, which was purified by flash column (PE:EA = 5% to 40%) to give Intermediate M8-5 (130 mg, 49% yield) as pale yellow oil.

Intermediate M8 : To a solution of Intermediate M8-5 (120 mg, 0.212 mmol) in DCM (5 mL) was added zinc(II) bromide (239.1 mg, 1.1 mmol). After stirring at room temperature for 3 h, the mixture was quenched with saturated aqueous NaHCO3 (10 mL). The mixture was extracted with DCM (15 mL x 3). The combined organic phases _were dried over _Na2SO4 and filtered. The filtrate was concentrated in vacuo to afford crude intermediate M8 (70 mg, 71% yield), which was used directly in the next step.

LC-MS (ESI): Calculated mass for C ₂₂ H ₄₂ F ₂ N ₂ O ₄ Si is 464.2, found m/z is 465.2 [M+H] ⁺ . Compound 62-1 : (4S)-6-(((3aS*,6aS*)-1-(5-( tertiary butoxy )-3 -hydroxyl- 4,4 -dimethyl -5 -oxo Amylpentyl )-6,6 -difluorohexahydro- 4H- pyrrolo [3,2-c] isoxazol- 4 -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

Compound 62-1 was prepared from Intermediate H1A and Intermediate M8 according to Typical Coupling Method 1 .

Purification by reverse phase C18 column (water containing 0.5% FA: MeCN = 10% to 50%) gave Compound 62-1 (15 mg, yield 31%).

LC-MS (ESI): The calculated mass of C ₃₄ H ₄₄ F ₃ N ₅ O ₆ S is 707.3, and the measured m/z value is 708.1 [M+H] ⁺ Compound 62 : 5-(( cis )-4- (((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidine- 4- Base ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 -hydroxy- 2,2 -dimethylpentanoic acid

To a solution of compound 62-1 (15 mg, 0.028 mmol) in DCM (3 mL) was added TFA (1 mL). The mixture was stirred at room temperature for 1 hour. The mixture was concentrated in vacuo to give a residue, which was purified by reverse phase C18 column (water with 0.5% FA: MeCN = 10% to 50%) to give compound 62 (2.5 mg, 13.5% yield) as a yellow solid .

LC-MS (ESI): The calculated mass of C ₃₀ H ₃₆ F ₃ N ₅ O ₆ S is 651.2, and the measured value of m/z is 652.3 [M+H] ⁺

中間體 M9 的製備

中間體 M9-1 ： 3- 羥基 -2,2- 二甲基丙酸苄酯 ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.16 - 9.11 (br s, 1H), 7.85 - 7.82 (d, J = 3.2 Hz, 1H), 7.42 (d, J = 3.2 Hz, 1H), 7.10 - 7.04 ( m, 1H), 7.00 - 6.89 (m, 2H), 6.00 (s, 1H), 4.33 - 4.24 (m, 3H), 4.13 - 3.97 (m, 5H), 3.88-3.86 (m, 1H), 3.71 - 3.63 (m, 1H), 3.49 - 3.39 (m, 1H), 3.30 - 3.28 (m, 1H), 3.19 - 2.95 (m, 1H), 2.55 (s, 3H), 2.02-1.86 (m, 2H), 1.31 (m, 3H), 1.18 (m, 3H) 1.12 (t, J = 8.0 Hz, 3H). Compounds 63A and 63B

Preparation of intermediate M9

Intermediate M9-1 : Benzyl 3- hydroxy- 2,2 -dimethylpropionate

To a solution of 3-hydroxy-2,2-dimethylpropionic acid (15.0 g, 127 mmol) and potassium carbonate (35.1 g, 254 mmol) in N,N -dimethylformamide (150 mL) Add benzyl bromide (21.7 g, 127 mmol). The mixture was stirred overnight at room temperature. The mixture was then poured into water (600 mL) and extracted with ethyl acetate (300 mL). The organic layer was washed with water (300 mL) and brine (300 mL), dried over anhydrous magnesium sulfate and filtered. The filtrate was concentrated in vacuo to afford Intermediate M9-1 (26.1 g, 90% purity by ¹ H NMR, 88.8% yield) as a yellow oil.

¹ HNMR (400 MHz, CDCl ₃ ) δ 7.36 - 7.31 (m, 5H), 5.14 (s, 2H), 3.57 (d, J = 6.4 Hz, 2H), 1.22 (s, 6H). Intermediate M9-2 : Benzyl 2,2 -dimethyl- 3 -oxopropionate

To a solution of dimethylsulfene (18.9 g, 242 mmol) in dichloromethane (400 mL) was added dropwise oxalyl chloride (15.4 g, 121 mmol) at -78°C. The reaction mixture was stirred at -78°C for 10 minutes. A solution of Intermediate M9-1 (21.0 g, 90% purity, 91.0 mmol) in dichloromethane (80 mL) was then added to the mixture and stirred at -78°C for 1 hour. Triethylamine (40.8 g, 403 mmol) was added to the mixture and the mixture was warmed to room temperature. The mixture was poured into water (100 mL) and extracted 3 times with dichloromethane (100 mL). The combined organic phases were washed with brine (100 mL), dried over sodium sulfate and filtered. The filtrate was concentrated to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 15: 1) to obtain Intermediate M9-2 (18.5 g, according to ¹ HNMR purity) as a yellow oil 95%, 94% yield).

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.66 (s, 1H), 7.35 - 7.32 (m, 5H), 5.17 (s, 2H), 1.36 (s, 6H). Intermediate M9-3 : Benzyl (E)-2,2 -dimethylpent- 3 - enoate

To a mixture of ethyltriphenylphosphonium bromide (27.0 g, 72.7 mmol) in tetrahydrofuran (200 mL) was added potassium tert-butoxide (10.8 g, 96.2 mmol) at 0°C. After stirring for 30 min under nitrogen atmosphere, Intermediate M9-2 (10.0 g, 90% purity, 46.1 mmol) was added to the mixture at 0 °C. The mixture was stirred at room temperature for 3 hours. The mixture was then poured into water (100 mL) and extracted twice with ethyl acetate (100 mL). The combined organic layers were washed with brine (100 mL), dried over sodium sulfate and filtered. The filtrate was concentrated to give a residue, which was purified by silica gel chromatography (petroleum ether: ethyl acetate = 100: ¹ ) to give intermediate M9-3 (6.40 g, according to HNMR purity of 90%, 63% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.35 - 7.32 (m, 5H), 5.43 - 5.41 (m, 2H), 5.13 (s, 2H), 1.49 (d, J = 5.2 Hz, 3H), 1.35 (s , 6H). Intermediate M9-4 : Benzyl ( trans )-2- methyl -2-(3 -methyloxiran - 2- yl ) propionate

To a solution of Intermediate M9-3 (6.40 g, 90% purity, 26.4 mmol) in dichloromethane (200 mL) was added 3-chloroperoxybenzoic acid (10.7 g, 85% purity, 52.7 mmol). The mixture was stirred overnight at room temperature. The mixture was then quenched with saturated aqueous sodium sulfite (100 mL) and extracted three times with dichloromethane (200 mL). The combined organic layers were washed with brine (100 mL), dried over sodium sulfate and filtered. The filtrate was concentrated under reduced pressure to afford Intermediate M9-4 (5 g, 90% purity by HNMR, 73% yield) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.36 - 7.31 (m, 5H), 5.15 (s, 2H), 3.03 - 2.99 (m, 2H), 1.38 (s, 3H), 1.26 - 1.25 (m, 3H) , 1.23 (s, 3H). Intermediate M9-5 : (3aS*,6aS*)-1-(5-( benzyloxy )-3 -hydroxy- 4,4 -dimethyl -5 -oxopentan -2- yl )- 6,6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylic acid tertiary butyl ester

A solution of Intermediate T1 (500 mg, 90% purity, 1.80 mmol) in Intermediate M9-4 (3.00 g, 90% purity, 11.5 mmol) was heated to 125°C and stirred for 4 days. The mixture was cooled to room temperature and purified by silica gel chromatography (petroleum ether: ethyl acetate = 100: 1) to obtain a crude product, which was passed through a C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 05% to 95%) to give Intermediate M9-5 (200 mg, 87% purity by LCMS, 20% yield) as a yellow oil. LC-MS (ESI): calculated mass for C ₂₄ H ₃₄ F ₂ N ₂ O ₆ is 484.5, found m/z is 485.3 [M+H] ⁺ . Intermediate M9 : 4-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 -hydroxyl- 2, Benzyl 2 -Dimethylpentanoate

To a solution of intermediate M9-5 (200 mg, 90% purity, 0.371 mmol) in dichloromethane (6 mL) was added trifluoroacetic acid (2 mL) at room temperature. After stirring at room temperature for 1 hour, the reaction mixture was concentrated under reduced pressure to give a residue, which was diluted with dichloromethane (15 mL). The mixture was washed with saturated aqueous sodium bicarbonate (10 mL), brine (100 mL), dried over sodium sulfate and filtered. The filtrate was concentrated to afford Intermediate M9 (170 mg, 60% purity by LCMS, 72% yield) as a colorless oil. LC-MS (ESI): Mass calculated for C ₁₉ H ₂₆ F ₂ N ₂ O ₄ is 384.4, found m/z is 385.4 [M+H] ⁺ . Compound 63-1 : (S)-6-(((3aS*6aS*)-1-(5-( benzyloxy )-3 -hydroxyl- 4,4 -dimethyl -5 -oxopentyl -2- yl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2- Methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

Compound 63-1 was prepared from Intermediate H1A and Intermediate M9 according to Typical Coupling Method 1 .

Purification by C18 column (acetonitrile:water = 05% to 95%) afforded Compound 63-1 (200 mg, 90% purity by ¹ H NMR, 91% yield) as a yellow solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.21-9.18 (m, 1H), 7.79-7.75 (m, 1H), 7.40-7.30 (m, 6H), 7.09-7.04 (m, 1H), 6.96-6.88 ( m, 2H), 6.00 (s, 1H), 5.18 - 5.10 (m, 2H), 4.32 - 4.28 (m, 1H), 4.24 - 4.23 (m, 2H), 4.20 - 4.16 (m, 1H), 4.14 - 4.10 (m, 2H), 4.01 - 3.86 (m, 2H), 3.83 - 3.79 (m, 1H), 3.72 - 3.69 (m, 1H), 3.57 - 3.55 (m, 1H), 3.26 - 3.23 (m, 1H ), 3.14 - 3.06 (m, 1H), 2.53 (s, 3H), 1.31 -1.28 (m, 6H), 1.13 - 1.07 (m, 4.5H), 1.01 - 1.00 (m, 1.5H). Compound 63A-1 and 63B-1 : (S)-6-((( cis )-1-((2R*,3R*)-5-( benzyloxy )-3 -hydroxyl- 4,4- Dimethyl- 5 - oxopent- 2- yl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl ) -Ethyl 4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylate ( single diastereomer ) (S) -6-((( cis )-1-((2S*,3S*)-5-( benzyloxy )-3 -hydroxy- 4,4 -dimethyl -5 -oxopentyl- 2 -yl )-6,6 - difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2- methyl Phenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer )

The racemic mixture of compound 63-1 (350 mg, 90% purity, 0.425 mmol) was passed through chiral Prep-HPLC (column: Chiralpak IG 7 um 30 mm * 250 mm; mobile phase: Hex: IPA = 70: 30, at 30 mL/min; temperature: 30°C; wavelength: 214 nm) to obtain compound 63A-1 (120 mg, 90% purity according to HNMR, 34% yield, 100% stereopure ) and compound 63B-1 (130 mg, 90% pure by HNMR, 37% yield, 98.7% stereopure) as yellow solids.

Compound 63A-1 : chiral analysis (RT = _10.856 min, area %: 100, method: column: Chiralpak IG 5 um 4.6 * 250 mm; mobile phase: hexane: ethanol = 70 : 30, at 1 mL/min ; temperature: 30°C; wavelength: 254 nm). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.21 (br s, 1H), 7.76 (d, J = 3.2 Hz, 1H), 7.38 - 7.30 (m, 6H), 7.09 - 7.04 (m, 1H), 6.96 - 6.88 (m, 2H), 5.99 (s, 1H), 5.16 (s, 2H), 4.32 - 4.24 (m, 2H), 4.20 - 4.14 (m, 1H), 4.06 - 3.99 (m, 3H), 3.83 - 3.79 (m, 1H), 3.74 - 3.69 (m, 2H), 3.67 - 3.64 (m, 1H), 3.61 - 3.49 (m, 1H), 3.14 - 3.03 (m, 2H), 2.53 (s, 3H), 1.30 (s, 3H), 1.28 (s, 3H), 1.11 (t, J = 7.6 Hz, 3H), 1.08 (d, J = 6.4 Hz, 3H).

Compound 63B-1 : chiral analysis (RT = _13.492 min, area %: 99.3, method: column: Chiralpak IG 5 um 4.6 * 250 mm; mobile phase: hexane: ethanol = 70 : 30, at 1 mL/min ; temperature: 30°C; wavelength: 254 nm). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.17 (s, 1H), 7.78 (d, J = 3.2 Hz, 1H), 7.40 (d, J = 3.2 Hz, 1H), 7.36 - 7.29 (m, 5H), 7.09 - 7.04 (m, 1H), 6.96 - 6.88 (m, 2H), 6.00 (s, 1H), 5.18 - 5.16 (m, 2H), 4.23 - 4.21 (m, 2H), 4.20 - 4.17 (m, 1H ), 4.09 - 4.01 (m, 2H), 3.99 - 3.92 (m, 2H), 3.89 - 3.85 (m, 1H), 3.82 - 3.81 (m, 1H), 3.57 - 3.55 (m, 1H), 3.34 - 3.23 (m, 2H), 3.14 - 3.07 (m, 1H), 2.53 (s, 3H), 1.31 (s, 3H), 1.27 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H), 1.08 ( d, J = 7.6 Hz, 3H). Compound 63A : ((3R*,4R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -hydroxy- 2,2 -dimethylpentanoic acid ( single diastereomer )

This compound was prepared from compound 63A-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water = 05% to 95%) to give compound 63A as a yellow solid (50 mg, according to LCMS purity was 99.8%, 79% yield). LC-MS (ESI): Calculated mass for C ₃₀ H ₃₆ F ₃ N ₅ O ₆ S is 651.2, found m/z is 652.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.87 - 7.86 (m, 1H), 7.54 (m, 1H), 7.13 - 7.08 (m, 1H), 6.99 - 6.91 (m, 2H), 6.01 (s, 1H) , 4.42 - 4.34 (m, 2H), 4.28 - 4.11 (m, 3H), 4.08 - 4.00 (m, 3H), 3.84 - 3.82 (m, 1H), 3.71 - 3.66 (m, 1H), 3.41 - 3.35 ( m, 2H), 3.19 - 3.08 (m, 1H), 2.52 (s, 3H), 1.42 (s, 3H), 1.24 (d, J = 4.4 Hz, 3H), 1.20 (s, 3H), 1.10 (t , J = 7.2 Hz, 3H). Compound 63B : ((3S*,4S*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -hydroxy- 2,2 -dimethylpentanoic acid ( single diastereomer )

This compound was prepared from compound 63B-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water = 05% to 95%) to give compound 63B (51 mg according to LCMS purity) as a yellow solid 99.5%, 80% yield). LC-MS (ESI): The calculated mass for C ₃₀ H ₃₆ F ₃ N ₅ O ₆ S is 651.2, and the found m/z is 652.2 [M+H]+. ¹ HNMR (400 MHz, CDCl3) δ 7.86 (m, 1H), 7.48 (m, 1H), 7.09 - 7.05 (m, 1H), 6.98 - 6.90 (m, 2H), 6.03 (s, 1H), 4.25 - 4.24 (m, 3H), 4.09 - 3.99 (m, 5H), 3.97 - 3.91 (m, 1H), 3.48 - 3.47 (m, 1H), 3.39 - 3.30 (m, 2H), 3.15 - 3.12 (m, 1H ), 2.54 (s, 3H), 1.33 (s, 3H), 1.29 (s, 3H), 1.19 (d, J = 6.8 Hz, 3H), 1.11 ( t , J = 6.8 Hz, 3H). Preparation of compound 64B : ( S )-4-(( cis )-4-((( S *)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )- 2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2 H ) -yl )-3 - fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 64B was prepared starting from S1 and intermediate H1 using the same procedure as described for compound 2B .

LC-MS (ESI): Calculated mass for C ₃₀ H ₃₅ F ₄ N ₅ O ₄ S is 637.2, found m/z is 634.3 [M+H] ⁺ .

中間體 M10 的製備

中間體 M10-1 ： 2-( 甲氧基甲氧基 )-2- 甲基己 -5- 烯酸乙酯 ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.28 (br s, 1H), 7.84 (d, J = 3.2 Hz, 1H), 7.43 (s, 1H), 7.10 - 7.05 (m, 1H), 7.00 - 6.98 ( m, 1H), 6.93 - 6.89 (m, 1H), 6.01 (s, 1H), 4.86 - 4.72 (m, 1H), 4.30 - 4.26 (m, 1H), 4.14 - 3.98 (m, 3H), 3.89 - 3.80 (m, 1H), 3.56 - 3.50 (m, 1H), 3.43 - 3.38 (m, 2H), 3.25 - 3.15 (m, 1H), 3.07 - 2.97 (m, 2H), 2.76 - 2.68 (m, 1H ), 2.53 (s, 3H), 2.02 - 1.94 (m, 2H), 1.33 (s, 3H), 1.29 (s, 3H), 1.11 (t, J = 6.8 Hz, 3H). Compound 65

Preparation of intermediate M10

Intermediate M10-1 : ethyl 2-( methoxymethoxy )-2 -methylhex -5- enoate

To a solution of Intermediate T7-1 (5.00 g, 27.7 mmol) in THF (50 mL) was added dropwise a 2.0 M solution of lithium diisopropylamide in THF (21 mL, 44 mmol). After the mixture was stirred at -70°C for 0.5 hours, hexamethylphosphoramide (7.00 g, 36.1 mmol) and 4-bromobut-1-ene (4.50 g, 33.3 mmol) were added dropwise. After stirring at -70°C for 4 hours, the mixture was poured into water (100 mL) and extracted three times with ethyl acetate (50 mL). The combined organic layers were washed with brine (50 mL) and concentrated to give a crude product, which was purified by silica gel chromatography (petroleum ether: ethyl acetate = 40: 1) to give the desired compound as a yellow oil (1.8 g, 90% purity by HNMR, 27% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.92 - 5.77 (m, 1H), 5.09 - 4.97 (m, 2H), 4.80 (s, 2H), 4.26 - 4.19 (m, 2H), 3.45 (s, 3H) , 2.27 - 2.03 (m, 2H), 1.97 - 1.81 (m, 2H), 1.51 (s, 3H), 1.32 (t, J = 7.2 Hz, 3H). Intermediate M10-2 : ethyl 2-( methoxymethoxy )-2- methyl -5- oxovalerate

A solution of Intermediate M10-1 (900 mg, 90% purity, 3.75 mmol) in dichloromethane (30 mL) was cooled to -75 °C and ozone was bubbled through the reaction mixture until a blue solution was obtained. Oxygen was then bubbled through to remove excess ozone until a colorless solution was obtained. Dimethyl sulfide (3 mL) was added to the mixture, and the mixture was stirred at room temperature for 12 hr. The mixture was poured into water (30 mL) and extracted three times with dichloromethane (15 mL). The combined organic layers were washed with brine (30 mL) and concentrated to give the crude product, which was purified by silica gel chromatography (petroleum ether:ethyl acetate=20:1) to give intermediate M10 as a yellow oil -2 (350 mg, 90% purity by HNMR, 39% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.78 - 9.77 (m, 1H), 4.78 - 4.72 (m, 2H), 4.22 - 4.16 (m, 2H), 3.38 (s, 3H), 2.64 - 2.46 (m, 2H), 2.22 - 2.05 (m, 2H), 1.48 (s, 3H), 1.29 (t, J = 7.2 Hz, 3H). Intermediate M10-3 : (3aS*,6aS*)-1-(5- ethoxy - 4-( methoxymethoxy )-4 -methyl -5- pentoxypentyl )-6, 6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylic acid tertiary butyl ester

This compound was prepared from Intermediate M10-2 and Intermediate T1 according to typical reductive amination method 4.

Purification by silica gel chromatography (petroleum ether:ethyl acetate=8:1) afforded intermediate M10-3 (440 mg, 90% purity by NMR, 74% yield) as a yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.79 - 4.62 (m, 3H), 4.18 - 4.07 (m, 2H), 4.03 - 3.98 (m, 1H), 3.98 - 3.54 (m, 3H), 3.54 - 3.27 ( m, 4H), 2.85 - 2.69 (m, 2H), 1.96 - 1.58 (m, 4H), 1.40 (s, 9H), 1.23 - 1.21 (m, 6H). Intermediate M10-4 : 5-((3aS*,6aS*)-4-( tertiary butoxycarbonyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso㗁Azol- 1 -yl )-2-( methoxymethoxy )-2- methylpentanoic acid carbonyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2-( methoxymethoxy )-2- methylpentanoic acid

To a solution of intermediate M10-3 (50 mg, 90% purity, 0.099 mmol) in tetrahydrofuran (0.5 mL) and water (0.2 mL) was added lithium hydroxide hydrate (21 mg, 0.50 mmol). The mixture was stirred at 50°C for 6 hours. The mixture was acidified with 1 M hydrochloride to pH = 5, and extracted three times with ethyl acetate (15 mL). The combined organic layers were washed with brine (15 mL) and concentrated to give Intermediate M10-4 (30 mg, 100% purity by LCMS, 71% yield) as a yellow oil. LC-MS (ESI): The calculated mass for C ₁₈ H ₃₀ F ₂ N ₂ O ₇ is 424.20, and the found m/z is 423.0 [M - H] ^- . Intermediate M10-5 : (3aS*,6aS*)-1-(5-( allyloxy )-4-( methoxymethoxy )-4 -methyl -5- pentoxypentyl ) -6,6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazole- 4(5H) -carboxylic acid tertiary butyl ester

To a mixture of intermediate M10-4 (250 mg, 100% purity, 0.590 mmol) and potassium carbonate (300 mg, 2.48 mmol) in N,N-dimethylformamide (4 mL) was added 3-bromo Prop-1-ene (300 mg, 2.17 mmol). After stirring at room temperature for 5 hours, the mixture was poured into water (30 mL) and extracted three times with dichloromethane (10 mL). The combined organic layers were washed with brine (10 mL) and concentrated to give the crude product, which was purified by silica gel chromatography (petroleum ether:ethyl acetate=5:1) to give intermediate M10 as a yellow oil -5 (140 mg, 90% purity by HNMR, 46% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 6.04 - 5.93 (m, 1H), 5.41 - 5.31 (m, 2H), 4.93 - 4.77 (m, 3H), 4.68 - 4.66 (m, 2H), 4.21 - 3.67 ( m, 4H), 3.48 - 3.38 (m, 4H), 2.97 - 2.82 (m, 2H), 2.09 - 1.66 (m, 4H), 1.54 (s, 3H), 1.51 (s, 9H). Intermediate M10 : 5-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-2- hydroxyl -2- Allyl Methylvalerate

A solution of intermediate M10-5 (460 mg, 90% purity, 0.891 mmol) in 4 M hydrogen chloride in ethyl acetate (3 mL) was stirred at 0 °C for 1 h. The mixture was basified with 2 M aqueous sodium bicarbonate to pH = 8, and extracted three times with ethyl acetate (10 mL). The combined organic layers were washed with brine (30 mL) and concentrated to give Intermediate M10 (300 mg, 90% purity by LCMS, 95% yield) as a yellow oil. LC-MS (ESI): Calculated mass for C ₁₄ H ₂₂ F ₂ N ₂ O ₄ is 320.15, found m/z is 321.1 [M+H] ⁺ . Compound 65-1 : (4S)-6-(((3aS*,6aS*)-1-(5-( allyloxy )-4 -hydroxyl- 4 -methyl -5 -pentoxypentyl ) -6,6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl ) -2-( Thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

Compound 65-1 was prepared from Intermediate H1A and Intermediate M10 according to Typical Coupling Method 1 .

Purification by C18 column (acetonitrile: water = 20% to 80%) afforded Compound 65-1 as a yellow solid

(220 mg, 87% pure by LCMS, 56% yield). LC-MS (ESI): Calculated mass for C ₃₂ H ₃₈ F ₃ N ₅ O ₆ S is 677.2, found m/z is 677.9 [M+H] ⁺ . Compounds 65A-1 and 65B-1 : (4S)-6-((( cis )-1-(5-( allyloxy )-4-(R*)- hydroxyl- 4 -methyl -5- Pendant oxypentyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -Methylphenyl )-2-( thiazol- 2 - yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer ) (4S)-6-((( cis ) -1-(5-( allyloxy )-4-(S*)- hydroxy- 4 -methyl -5 -oxopentyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [ 3,2-c] isozazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- Ethyl dihydropyrimidine- 5 -carboxylate ( single diastereomer )

Compound 65-1 (220 mg, 87% purity, 0.263 mmol) was separated by chiral Prep-HPLC (separation conditions: column IF 10 um, 30 * 250 mm, mobile phase: Hex : EtOH = 80 : 20, with 60 mL/min; column temperature: 38°C; wavelength 214 nm) to obtain Compound 65A-1 (127 mg, 70% purity according to HNMR, 50% yield) as a yellow oil and Compound 65B-1 (95 mg, 70% purity by HNMR, 37% yield).

Compound 65A-1 chiral analysis ( _RT = 9.65 min, area%: 99.2, method: column: Chiralpak IF 5 um 4.6 * 250 mm; mobile phase: Hex : EtOH = 85 : 15, at 1 mL/min; temperature : 35°C; wavelength: 254 nm). ¹ HNMR (300 MHz, CDCl ₃ ) δ 7.95 (s, 1H), 7.59 (s, 1H), 7.15 - 7.12 (m, 2H), 7.01 - 6.96 (m, 1H), 6.12 (s, 1H), 6.05 - 5.94 (m, 1H), 5.37 - 5.31 (m, 2H), 4.73 - 4.72 (m, 2H), 4.35 - 4.32 (m, 3H), 4.13 - 4.08 (m, 4H), 3.66 - 3.61 (m, 1H), 3.55 - 3.52 (m, 1H), 3.19 - 3.11 (m, 1H), 2.90 - 2.81 (m, 2H), 2.63 (s, 3H), 1.97 - 1.93 (m, 3H), 1.87 - 1.83 ( m, 1H), 1.38 (s, 3H), 1.18 (t, J = 6.9 Hz, 3H).

Compound 65B-1 chiral analysis ( _RT = 10.99 min, area%: 100, method: column: Chiralpak IF 5 um 4.6 * 250 mm; mobile phase: Hex: EtOH = 85: 15, at 1 mL/min; temperature : 35°C; wavelength: 254 nm). ¹ HNMR (300 MHz, CDCl ₃ ) δ 7.92 - 7.91 (m, 1H), 7.60 - 7.57 (m, 1H), 7.15 - 7.12 (m, 2H), 7.01 - 6.95 (m, 1H), 6.09 (s, 1H), 6.03 - 5.92 (m, 1H), 5.40 - 5.31 (m, 2H), 4.74 - 4.72 (m, 2H), 4.35 - 4.31 (m, 3H), 4.13 - 4.06 (m, 4H), 3.67 - 3.60 (m, 1H), 3.48 - 3.39 (m, 1H), 3.19 - 3.11 (m, 1H), 2.98 - 2.89 (m, 1H), 2.84 - 2.77 (m, 1H), 2.61 (s, 3H), 2.10 - 1.99 (m, 3H), 1.60 - 1.55 (m, 1H), 1.38 (s, 3H), 1.18 (t, J = 6.9 Hz, 3H). Compound 65B : 5-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazole- 2- Base )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-2- (S*)- Hydroxy -2- methylpentanoic acid ( single diastereomer )

This compound was prepared from compound 65B-1 using typical method 3 to remove allyl ester protection, and was analyzed by prep-HPLC (column: Waters Xbrige C18 (5 um 19 * 150 mm), mobile phase A: water (0.1% bicarbonate ammonium), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min, gradient: 20% - 70% (%B)) to obtain compound 65B as a yellow solid (10.6 mg, according to LCMS purity of 97.7%, 17% yield).

中間體 R1 的製備

中間體 T1-12B ： (3a S*,6a S*)-6,6- 二氟六氫 -1 H- 吡咯并 [3,2-c] 異㗁唑 -1- 甲酸 (9 H- 茀 -9- 基 ) 甲酯 LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₆ S is 637.2, found m/z is 638.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.80 (d, J = 2.8 Hz, 1H), 7.61 (d, J = 3.2 Hz, 1H), 7.07 - 6.99 (m, 2H), 6.85 - 6.81 (m, 1H), 5.86 (s, 1H), 4.26 - 4.11 (m, 3H), 3.98 - 3.90 (m, 4H), 3.73 - 3.67 (m, 1H), 3.28 - 3.25 (m, 1H), 3.07 - 3.01 ( m, 1H), 2.83 - 2.76 (m, 1H), 2.66 - 2.58 (m, 1H), 2.40 (d, J = 1.2 Hz, 3H), 1.79 - 1.65 (m, 2H), 1.58 - 1.45 (m, 2H), 1.28 (s, 3H), 1.03 (t, J = 7.2 Hz, 3H). Compounds 66A and 66B

Preparation of intermediate R1

Intermediate T1-12B : (3a S *,6a S *)-6,6 -difluorohexahydro- 1 H - pyrrolo [3,2-c] isoxazole- 1 - carboxylic acid (9 H - oxahydro- 9- yl ) methyl ester

To a solution of intermediate T1-11B (1.90 g, 90% purity, 3.62 mmol) in dichloromethane (8 mL) was added trifluoroacetic acid (4 mL). The reaction mixture was stirred at room temperature for 2 hours. It was then concentrated and diluted with ethyl acetate (30 mL). The organic solution was washed with sodium bicarbonate solution (10 mL) and brine (10 mL), dried over _{Na2SO4 (s)} , filtered and concentrated to give Intermediate T1-12B as a brown solid (1.30 g according to ¹ HNMR 95% purity, 92% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.77 (d, J = 7.6 Hz, 2H), 7.63 (t, J = 7.2 Hz, 2H), 7.43 - 7.40 (m, 2H), 7.35 - 7.30 (m, 2H ), 4.58 - 4.46 (m, 3H), 4.32 - 4.26 (m, 2H), 4.05 - 4.03 (m, 1H), 3.63 - 3.60 (m, 1H), 3.18 - 3.05 (m, 2H). Intermediate R1 : (S)-6-((( cis )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer )

This compound was prepared according to Typical Coupling Procedure 1 from Intermediate H1A and Intermediate T1-12B .

中間體 N1-1 ： 4-( 苄基氧基 )-3- 羥基 -2,2- 二甲基丁酸三級丁酯 Purification by C18 column (acetonitrile: water = 70% to 80%) afforded the desired product (1.8 mg, 90% purity by ¹ H NMR, 85% yield) as a yellow solid. ¹ HNMR (300 MHz, CDCl ₃ ) δ 9.26 (br s, 1H), 7.87 (d, J = 3.3 Hz, 1H), 7.46 (d, J = 3.0 Hz, 1H), 7.15 - 7.08 (m, 1H) , 7.00 - 6.92 (m, 2H), 6.05 (s, 1H), 5.59 - 5.58 (m, 1H), 4.44 - 4.41 (m, 1H), 4.33 - 4.21 (m, 4H), 4.14 - 4.04 (m, 2H), 3.58 - 3.53 (m, 1H), 3.41 - 3.28 (m, 1H), 3.20 - 3.10 (m, 1H), 2.58 (s, 3H), 1.17 (t, J = 7.2 Hz, 3H). Preparation of Intermediate N1

Intermediate N1-1 : tertiary butyl 4-( benzyloxy )-3 -hydroxy- 2,2 -dimethylbutyrate

To a solution of 2-(benzyloxy)acetaldehyde (10.0 g, 66.6 mmol) in dichloromethane (150 mL) was added ((1-(tertiary-butoxy)-2 -methylprop-1-en-1-yl)oxy)trimethylsilane (22.0 g, 90% purity, 91.5 mmol) and boron trifluoride diethyl ether (25 mL). After stirring for 1 hour, the mixture was poured into saturated sodium bicarbonate solution (250 mL) and extracted twice with dichloromethane (300 mL). The organic layer was dried over _{Na2SO4 (s)} and filtered. The filtrate was concentrated to give the crude compound, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 1:0 to 50:1) to give the title compound as a colorless oil (14.0 g, according to ¹ HNMR 90% purity, 64% yield). ¹ HNMR (400 MHz, CD ₃ OD) δ 7.37 - 7.28 (m, 5H), 4.55 (s, 2H), 3.89 - 3.86 (m, 1H), 3.57 - 3.42 (m, 2H), 1.41 (s, 9H) ), 1.15 (s, 6H). Intermediate N1-2 : tertiary butyl 4-( benzyloxy )-3 -methoxy- 2,2 -dimethylbutyrate

To a solution of intermediate N1-1 (10 g, 90% purity, 30.6 mmol) in N,N-dimethylformamide (150 mL) at 0°C was added 60% of Sodium hydride (3.6 g, 90.0 mmol). After stirring at 0°C for 0.5 hours, iodomethane (6.5 g, 45.8 mmol) was added to the mixture and stirred at 30°C for another 2 hours. It was then quenched with water (100 mL) and extracted twice with ethyl acetate (100 mL). The organic layer was washed twice with water (100 mL), twice with brine (100 mL), dried over Na ₂ SO _4(s) and filtered. The filtrate was concentrated and purified by silica gel column chromatography (petroleum ether:ethyl acetate=1:0 to 50:1) to obtain the title compound (7.0 g, 95% purity according to ¹ HNMR, as a colorless oil, 71% yield). ¹ HNMR (400 MHz, CD ₃ OD) δ 7.35 - 7.26 (m, 5H), 4.58 - 4.48 (m, 2H), 3.65 - 3.59 (m, 1H), 3.56 - 3.49 (m, 5H), 1.42 (s , 9H), 1.13 (s, 3H), 1.08 (s, 3H). Intermediate N1-3 : tertiary butyl 4- hydroxy- 3 -methoxy- 2,2 -dimethylbutyrate

To a solution of intermediate N1-2 (1.5 g, 95% purity, 4.62 mmol) in methanol (30 mL) was added 10 wt% palladium on carbon (200 mg, 0.188 mmol). After heating to 50 °C overnight under a hydrogen atmosphere (balloon), the mixture was cooled to room temperature and filtered. The filtrate was concentrated to give the title compound (1.0 g, 95% purity by ¹ H NMR, 94% yield) as a colorless oil. ¹ HNMR (400 MHz, CD ₃ OD) δ 3.75 - 3.70 (m, 1H), 3.65 - 3.59(m, 1H), 3.51 - 3.47 (m, 4H), 1.45 (s, 9H), 1.17 (s, 3H ), 1.09 (s, 3H). Intermediate N1 : tertiary butyl 3 -methoxy- 2,2 -dimethyl- 4 -oxobutyrate

To a solution of acetyldichloride (1 mL, 11.8 mmol) in dichloromethane (5 mL) was added dropwise (methylsulfinyl)methane (1.5 mL, 21.1 mmol) at -70°C Solution in dichloromethane (5 mL). After stirring the reaction mixture at -70°C for 1 hour, intermediate N1-3 (1.0 g, 95% purity, 4.35 mmol) in dichloromethane (20 mL) was added dropwise at -70°C solution. The mixture was stirred at -70°C for 2 hours, then triethylamine (2.0 g, 19.8 mmol) was added dropwise. The mixture was warmed to room temperature and stirred for an additional 30 minutes, then quenched with water (40 mL). The phases were separated and the organic phase was dried over _{Na2SO4 (s)} , filtered and concentrated to give crude intermediate N1 (1.0 g, 80% purity by ¹ HNMR, 85% yield) as a colorless oil , which is used directly in the next step. ¹ HNMR (400 MHz, CD ₃ OD) δ 9.73 (d, J = 2.4 Hz, 1H), 3.49 (d, J = 2.4 Hz, 1H), 3.44 (s, 3H), 1.44 (s, 9H), 1.20 (s, 3H), 1.18 (s, 3H). Compound 66-1 : (4S)-6-(((3aS*,6aS*)-1-(4-( tertiary butoxy )-2- methoxy- 3,3 -dimethyl- 4- Oxybutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -Methylphenyl )-2-( thiazol- 2 - yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

This compound was prepared from intermediate R1 and intermediate N1 according to typical reductive amination method 4.

Purification by C18 column (acetonitrile: water (5% ammonium bicarbonate) = 5% - 100%) afforded the desired product (110 mg, 95% purity by ¹ H NMR, 50% yield) as a yellow solid. ¹ HNMR (400 MHz, CD ₃ OD) δ 9.25 (br s, 1H), 7.86 (d, J = 4.4 Hz, 1H), 7.45 (d, J = 4.4 Hz, 1H), 7.15 - 7.08 (m, 1H ), 7.02 - 6.92 (m, 2H), 6.00 (s, 1H), 4.35 - 4.20 (m, 3H), 4.07 - 3.97 (m, 3H), 3.78 - 3.56 (m, 3H), 3.54 - 3.36 (m , 4H), 3.13 - 3.04 (m, 1H), 2.95 - 2.79 (m, 2H), 2.58 (d, J = 2.0 Hz, 3H), 1.50 (s, 9H), 1.22 - 1.16 (m, 9H). Compound 66A-1 and 66B-1 : (S)-6-((( cis )-1-((R*)-4-( tertiary butoxy )-2- methoxy- 3,3- Dimethyl- 4 -oxobutyl )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl )-4- (3- Fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer ) and (S)-6 -((( cis )-1-((S*)-4-( tertiary butoxy )-2- methoxy- 3,3 -dimethyl- 4 -oxobutyl )-6 ,6 -Difluorotetrahydro- 1H- pyrrolo [3,2-c] isoxazol- 4(5H) -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2 -( Thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer )

The racemic mixture of compound 66-1 (140 mg, 95% purity, 0.188 mmol) was subjected to chiral Prep.HPLC (column: column Chiralpak OD 5 μm 30 * 250 mm; mobile phase: Hex: EtOH = 95: 5, separated at 25 mL/min; temperature 30°C; wavelength: 254 nm) to obtain compound 66A-1 (30 mg, 100% purity, 100% stereopure, 23% yield) and Compound 66B-1 (90 mg, 100% purity, 99.9% stereopure, 68% yield) as a yellow oil.

Compound 66A-1 : LC-MS (ESI): The calculated mass for C ₃₄ H ₄₄ F ₃ N ₅ O ₆ S is 707.3, and the found m/z is 708.3 [M+H] ⁺ . Chiral analysis (column: Chiralpak OD-H 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 95 : 5, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, RT = _9.087 min ).

典型方法 5 ：三級丁酯的去保護 Compound 66B-1 : LC-MS (ESI): The calculated mass for C ₃₄ H ₄₄ F ₃ N ₅ O ₆ S is 707.3, and the found m/z is 708.4 [M+H] ⁺ . Chiral analysis (column: Chiralpak OD-H 5 µm 4.6 * 250 mm; mobile phase: Hex : EtOH = 95 : 5, at 1.0 mL/min; temperature: 30°C; wavelength: 254 nm, RT = _10.828 min ). Compound 66A : (R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Typical Method 5 : Deprotection of Tertiary Butyl Ester

To a solution of compound 66A-1 (30 mg, 100% purity, 0.042 mmol) in dichloromethane (1 mL) was added trifluoroacetic acid (0.5 mL). The mixture was stirred at room temperature for 2 hours. It was then concentrated to dryness and purified with a C18 column (acetonitrile:water (5% ammonium bicarbonate) = 5% to 100%) to afford Compound 66A (11.2 mg, 99.2% purity, 40% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₀ H ₃₆ F ₃ N ₅ O ₆ S is 651.2, found m/z is 652.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl3) δ 7.82 (d, J = 3.2 Hz, 1H), 7.42 (d, J = 3.2 Hz, 1H), 7.10 - 7.05 (m, 1H), 6.98 - 6.89 (m, 2H) , 6.00 (s, 1H), 4.34 - 4.19 (m, 3H), 4.06 - 3.99 (m, 4H), 3.68 - 3.61 (m, 5H), 4.50 - 3.89 (m, 1H), 3.15 - 3.07 (m, 2H), 2.89 - 2.84 (m, 1H), 2.52 (d, J = 1.6 Hz, 3H), 1.62 (s, 3H), 1.20 (s, 3H), 1.11 (t, J = 6.8 Hz, 3H). Compound 66B : (S*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -methoxy- 2,2 -dimethylbutanoic acid (single diastereomer)

Compound 66B was prepared analogously to Compound 66A .

中間體 R2 的製備

中間體 R2-1 ( 順式 )-4-(((S*)-6-(3,4- 二氟 -2- 甲基苯基 )-5-( 甲氧基羰基 )-2-( 噻唑 -2- 基 )-3,6- 二氫嘧啶 -4- 基 ) 甲基 )-6,6- 二氟六氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -1- 甲酸 (9H- 茀 -9- 基 ) 甲酯（單一非鏡像異構物） Purification with C18 column (acetonitrile: water (5% ammonium bicarbonate) = 5% to 100%) afforded Compound 66B (56.1 mg, 99.7% purity, 68% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₀ H ₃₆ F ₃ N ₅ O ₆ S is 651.2, found m/z is 652.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.15 (br s, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.42 (d, J = 3.2 Hz, 1H), 7.10 - 7.05 (m, 1H) , 7.00 - 6.89 (m, 2H), 6.00 (s, 1H), 4.32 - 4.22 (m, 3H), 4.10 - 3.95 (m, 4H), 3.64 - 3.61 (m, 1H), 3.57 - 3.46 (m, 5H), 3.10 - 2.99 (m, 3H), 2.53 (d, J = 1.6 Hz, 3H), 1.28 (s, 3H), 1.24 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compounds 67A and 67B

Preparation of intermediate R2

Intermediate R2-1 ( cis )-4-(((S*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazole -2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1 - carboxylic acid ( 9H- Oxen -9- yl ) methyl ester (single diastereomer)

This compound was prepared according to Typical Coupling Procedure 1 from Intermediate H3B and Intermediate T1-12B .

Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 50% to 95%) afforded the title compound (680 mg, 77% purity by LCMS, 53.1% yield) as a yellow solid. LC-MS (ESI): calculated mass for C ₃₇ H ₃₁ F ₄ N ₅ O ₅ S 733.7, found m/z 733.8 [M+H] ⁺ . Typical deprotection Fmoc group method 6 intermediate R2 : (S*)-4-(3,4 -difluoro -2 -methylphenyl )-6-((( cis )-6,6 -difluoro Tetrahydro -1H- pyrrolo [3,2-c] isozazol- 4(5H) -yl ) methyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine -5- carboxylic acid Methyl ester (single diastereomer)

To a solution of intermediate R2-1 (680 mg, 77% purity, 0.714 mmol) in N,N-dimethylformamide (5 mL) was added piperidine (211 mg, 2.48 mmol). The mixture was stirred at room temperature for 4 hours. Then the reaction mixture was washed with water (10 mL), 0.1 M hydrochloric acid (10 mL). The mixture was then extracted three times with dichloromethane (10 mL). The combined organic layers were washed with brine (100 mL), dried over anhydrous sodium sulfate, and the filtrate was concentrated under reduced pressure to obtain a residue, which was passed through a C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 50% to 95%) Purification afforded intermediate R2 (312 mg, 80% purity by HNMR, 68.4% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₂ H ₂₁ F ₄ N ₅ O ₃ S is 511.5, found m/z is 511.9 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.83 (d, J = 3.2 Hz, 1H), 7.43 (d, J = 3.2 Hz, 1H), 6.93 - 6.87 (m, 2H), 5.93 (s, 1H), 4.38 - 4.16 (m, 4H), 3.61 (s, 3H), 3.52 - 3.49 (m, 1H), 3.38 - 3.25 (m, 1H), 3.13 - 3.07 (m, 1H), 2.57 (s, 3H). Compound 67A : (R*)-4-(( cis )-4-(((S*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was sequentially prepared according to typical reductive amination method 4 from intermediate R2 and intermediate N1 , chiral separation, typical deprotected tertiary butyl ester method 5.

By chiral Prep.HPLC (separation conditions: column: column Chiralpak OD 5 um * 30 * 250 mm; mobile phase: Hex: IPA: DEA = 80: 20: 0.2, at 15 mL/min; temperature 30°C; Wavelength: 254 nm, back pressure 100 bar) separation.

Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 50% to 95%) afforded Compound 67A (28 mg, 99% purity by LCMS, 74% yield) as a pale yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₆ S is 655.7, found m/z is 656.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.84 (d, J = 3.2 Hz, 1H), 7.46 (d, J = 3.2 Hz, 1H), 6.94 - 6.85 (m, 2H), 5.94 (s, 1H), 4.32 - 4.22 (m, 3H), 4.00 - 3.99 (m, 2H), 3.68 - 3.61 (m, 8.5H), 3.49 - 3.39 (m, 1.5H), 3.14 - 3.07 (m, 2.5H), 2.89 - 2.85 (m, 1.5H), 2.56 (s, 3H), 1.26 (s, 3H), 1.20 (s, 3H). Compound 67B : (S*)-4-(( cis )-4-(((S*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -methoxy- 2,2 -dimethylbutanoic acid (single diastereomer)

Compound 67B was prepared analogously to Compound 67A .

中間體 R3 的製備

(R*)-4-(3,4- 二氟 -2- 甲基苯基 )-6-((( 順式 )-6,6- 二氟六氫 -4H- 吡咯并 [3,2-c] 異㗁唑 -4- 基 ) 甲基 )-2-( 噻唑 -2- 基 )-1,4- 二氫嘧啶 -5- 甲酸乙酯 （單一非鏡像異構物） Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 50% to 95%) afforded Compound 67B (51 mg, 99% purity by LCMS, 53% yield) as a pale yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ F ₄ N ₅ O ₆ S is 655.7, found m/z is 656.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.21 (br s, 1H), 7.83 (d, J = 3.2 Hz, 1H), 7.43 (d, J = 3.2 Hz, 1H), 6.93 - 6.83 (m, 2H) , 5.92 (s, 1H), 4.27 - 4.23 (m, 3H), 4.09 - 4.05 (m, 1H), 3.97 - 3.94 (m, 1H), 3.63 - 3.47 (m, 9H), 3.09 - 3.02 (m, 3H), 2.56 (s, 3H), 1.28 (s, 3H), 1.24 (s, 3H). Compounds 68A and 68B :

Preparation of intermediate R3

(R*)-4-(3,4 -difluoro -2 -methylphenyl )-6-((( cis )-6,6 -difluorohexahydro- 4H- pyrrolo [3,2- c] Ethyl isoxazol- 4 -yl ) methyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylate (single diastereomer)

Intermediate R3 was prepared sequentially from intermediate H5A and intermediate T1-12B according to typical coupling method 1 and typical de-Fmoc protection method 6 .

Purification by silica gel column chromatography (petroleum ether:ethyl acetate=10:1 to 2:1) afforded Intermediate R3 (370 mg, 90% purity according to ¹ HNMR, 82% yield) as a yellow solid . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.85 (d, J = 3.2 Hz, 1H), 7.45 (m. 1H), 6.93 - 6.88 (m, 2H), 5.94 (s, 1H), 4.37 (d, J = 9.6 Hz, 1H), 4.25 - 4.22 (m, 2H), 4.18 - 4.13 - 3.97 (m, 4H), 3.52 - 3.49 (m, 1H), 3.39 - 3.25 (m, 1H), 3.16 - 3.09 (m , 1H), 1.12 (t, J = 6.8 Hz, 3H). Compound 68A : (S*)-4-(( cis )-4-(((R*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared sequentially according to typical reductive amination method 4 from intermediate R3 and intermediate N1 , chiral separation, typical tertiary butyl ester deprotection method 5.

By chiral Prep. HPLC (separation conditions: column: Chiralpak OD-H 5 µm 30 * 250 mm; mobile phase: Hex : EtOH = 95 : 5, at 25 mL/min; temperature: 30 ° C; wavelength: 254 nm) separation.

Purification by C18 column (acetonitrile: water = 0.5% to 95%) afforded Compound 68A (23 mg, 98.2% purity, 68% yield) as a yellow solid. LC-MS (ESI): The calculated mass for C ₃₀ H ₃₅ F ₄ N ₅ O ₆ S is 669.2, and the found m/z is 670.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.21 (br s, 1H), 7.83 (d, J = 2.8 Hz, 1H), 7.43 (d, J = 2.8 Hz, 1H), 6.92 - 6.88 (m, 2H) , 5.94 (s, 1H), 4.32 - 4.21 (m, 3H), 4.10 - 3.93 (m, 4H), 3.67 - 3.61 (m, 5H), 3.49 - 3.38 (m, 1H), 3.13 - 3.06 (m, 2H), 2.90 - 2.84 (m, 1H), 2.57 - 2.56 (m, 3H), 1.26 (s, 3H), 1.20 (s, 3H), 1.13 (t, J = 7.2 Hz, 3H). Compound 68B : (R*)-4-(( cis )-4-(((R*)-6-(3,4 -difluoro -2 -methylphenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso Azol- 1 -yl )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 68B was prepared analogously to Compound 68A .

中間體 R4 的製備

中間體 R4 ： (R*)-4-(2- 氯 -3- 氟苯基 )-6-((( 順式 )-6,6- 二氟四氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -4(5H)- 基 ) 甲基 )-2-( 噻唑 -2- 基 )-1,4- 二氫嘧啶 -5- 甲酸乙酯（單一非鏡像異構物） Purification by C18 column (acetonitrile: water = 0.5% to 95%) afforded Compound 68B (84.2 mg, 99.4% purity, 67% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₀ H ₃₅ F ₄ N ₅ O ₆ S is 669.2, found m/z is 670.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.84 (d, J = 3.2 Hz, 1H), 7.45 (s, 1H), 6.93 - 6.87 (m, 2H), 5.94 (s, 1H), 4.27 - 4.20 (m , 3H), 4.10 - 3.99 (m, 4H), 3.64 - 3.61 (m, 1H), 3.57 - 3.51 (m, 5H), 3.11 - 3.02 (m, 3H), 2.56 (s, 3H), 1.28 (s , 3H), 1.24 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compounds 69A and 69B

Preparation of intermediate R4

Intermediate R4 : (R*)-4-(2- chloro- 3 - fluorophenyl )-6-((( cis )-6,6 -difluorotetrahydro- 1H- pyrrolo [3,2- c] Ethyl isoxazol- 4(5H) -yl ) methyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylate (single diastereomer)

Intermediate R4 was prepared sequentially from Intermediate H17A and Intermediate T1-12B according to typical coupling method 1 and typical de-Fmoc protection method 6 .

Purification by silica gel column chromatography (petroleum ether:ethyl acetate=2:1 to 1:1) afforded intermediate R4 (380 mg, 90% purity according to ¹ HNMR, 81% yield) as a yellow solid . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.85 (d, J = 3.2 Hz, 1H), 7.45 (m, 1H), 7.20 - 7.11 (m, 2H), 7.07 - 7.03 (m, 1H), 6.26 (s , 1H), 4.37 (d, J = 9.6 Hz, 1H), 4.25 (m, 2.5H), 4.18 - 4.13 (m, 1.5H), 4.08 - 3.97 (m, 2H), 3.52 - 3.49 (m, 1H ), 3.39 - 3.25 (m, 1H), 3.16 - 3.09 (m, 1H), 1.12 (t, J = 6.8 Hz, 3H). Compound 69A : (S*)-4-(( cis )-4-(((R*)-6-(2- chloro- 3 - fluorophenyl )-5-( ethoxycarbonyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared sequentially according to typical reductive amination method 4 from intermediate R4 and intermediate N1 , chiral separation, typical tertiary butyl ester deprotection method 5.

By chiral Prep. HPLC (separation conditions: column: Chiralpak OD-H 5 µm 30 * 250 mm; mobile phase: Hex : IPA : DEA = 80 : 20 : 0.2, at 25 mL/min; temperature: 30°C ; wavelength: 254 nm) separation.

Purification by C18 column (acetonitrile: water = 0.5% to 95%) afforded Compound 69A as a yellow solid

(31.4 mg, 99.0% purity, 66.7% yield). LC-MS (ESI): The calculated mass for C ₂₉ H ₃₃ ClF ₃ N ₅ O ₆ S is 671.2, and the found m/z is 672.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ7.84 (d, J = 3.2 Hz, 1H), 7.45 (d, J = 3.2 Hz, 1H), 7.21 - 7.11 (m, 2H), 7.08 - 7.03 (m, 1H), 6.25 (s, 1H), 4.31 - 4.18 (m, 3H), 4.09 - 3.91 (m, 4H), 3.68 - 3.61 (m, 5H), 3.50 - 3.39 (m, 1H), 3.16 - 3.06 ( m, 2H), 2.89 - 2.84 (m, 1H), 1.26 (s, 3H), 1.20 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compound 69B : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro- 3 - fluorophenyl )-5-( ethoxycarbonyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 69B was prepared analogously to Compound 69A .

中間體 R5 的製備

中間體 R5 ： (R*)-4-(2- 氯 -3,4- 二氟苯基 )-6-((( 順式 )-6,6- 二氟四氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -4(5H)- 基 ) 甲基 )-2-( 噻唑 -2- 基 )-1,4- 二氫嘧啶 -5- 甲酸乙酯（單一非鏡像異構物） Purification by C18 column (acetonitrile: water = 0.5% to 95%) afforded Compound 69 B (167.2 mg, 99.3% purity, 76.9% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ ClF ₃ N ₅ O ₆ S is 671.2, found m/z is 672.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.22 (br s, 1H), 7.85 (d, J = 3.2 Hz, 1H), 7.45 (d, J = 3.2 Hz, 1H), 7.20 - 7.15 (m, 1H) , 7.12 - 7.10 (m, 1H), 7.07 - 7.03 (m, 1H), 6.26 (s, 1H), 4.29 - 4.23 (m, 3H), 4.19 - 3.91 (m, 4H), 3.64 - 3.61 (m, 1H), 3.57 - 3.45 (m, 5H), 3.10 - 2.97 (m, 3H), 1.28 (s, 3H), 1.24 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compounds 70A and 70B

Preparation of intermediate R5

Intermediate R5 : (R*)-4-(2- chloro -3,4 -difluorophenyl )-6-((( cis )-6,6 -difluorotetrahydro- 1H- pyrrolo [3 ,2-c] isozazol- 4(5H) -yl ) methyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester (single diastereomer )

Intermediate R5 was prepared sequentially from Intermediate H4A and Intermediate T1-12B according to typical coupling method 1 and typical de-Fmoc protection method 6 .

Purification by silica gel column chromatography (petroleum ether:ethyl acetate=10:1 to 2:1) afforded intermediate R5 (301 mg, 98% purity by LCMS, 96% yield) as a yellow solid. LC-MS (ESI): The calculated mass of the chemical formula C ₂₂ H ₂₀ ClF ₄ N ₅ O ₃ S is 545.1, and the measured value of m/z is 546.2 [M+H] ⁺ . Compound 70A : (S*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( ethoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared sequentially according to typical reductive amination method 4 from intermediate R5 and intermediate N1 , chiral separation, typical tertiary butyl ester deprotection method 5.

By chiral Prep. HPLC (separation conditions: column: Chiralpak OD-H 5 μm 20 * 250 mm; mobile phase: Hex: EtOH: DEA = 95: 05: 0.2, with 18 mL min; temperature: 30 ° C; wavelength: 254 nm) separation.

Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 5% to 95%) afforded Compound 70A (15.3 mg, 98.7% purity by LCMS, 76% yield) as a pale yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₂ ClF ₄ N ₅ O ₆ S is 689.2, found m/z is 690.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.27 (br s, 1H), 7.85 (d, J = 3.2 Hz, 1H), 7.44 (d, J = 2.8 Hz, 1H), 7.08 - 7.00 (m, 2H) , 6.19 (s, 1H), 4.30 - 4.18 (m, 3H), 4.08 - 3.96 (m, 4H), 3.70 - 3.61 (m, 5H), 3.48 - 3.37 (m, 1H), 3.13 - 3.07 (m, 2H), 2.90 - 2.85 (m, 1H), 1.27 (s, 3H), 1.20 - 1.18 (m, 3H), 1.13 (t, J = 7.2 Hz, 3H). Compound 70B : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( ethoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 70B was prepared analogously to Compound 70A .

中間體 R6 的製備：

中間體 R6 ： (R*)-4-(2- 氯 -3,4- 二氟苯基 )-6-((( 順式 )-6,6- 二氟六氫 -4H- 吡咯并 [3,2-c] 異㗁唑 -4- 基 ) 甲基 )-2-( 噻唑 -2- 基 )-1,4- 二氫嘧啶 -5- 甲酸甲酯（單一非鏡像異構物） Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 5% to 95%) afforded Compound 70B (39.3 mg, 99.1% purity by LCMS, 49% yield) as a pale yellow solid. LC-MS (ESI): calculated mass for C ₂₉ H ₃₂ ClF ₄ N ₅ O ₆ S 689.1, found m/z 690.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.24 (br s, 1H), 7.85 (d, J = 2.8 Hz, 1H), 7.45 (d, J = 3.2 Hz, 1H), 7.05 - 7.02 (m, 2H) , 6.19 (s, 1H), 4.24 - 4.20 (m, 3H), 4.10 - 3.94 (m, 4H), 3.64 - 3.61 (m, 1H), 3.57 - 3.45 (m, 5H), 3.09 - 2.99 (m, 3H), 1.27 (s, 3H), 1.24 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compounds 71A and 71B

Preparation of intermediate R6 :

Intermediate R6 : (R*)-4-(2- chloro -3,4 -difluorophenyl )-6-((( cis )-6,6 -difluorohexahydro- 4H- pyrrolo [3 ,2-c] isozazol- 4 -yl ) methyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5- carboxylic acid methyl ester (single diastereomer)

Intermediate R6 was prepared sequentially from Intermediate H2A and Intermediate T1-12B according to typical coupling method 1 and typical de-Fmoc protection method 6 .

Purification by silica gel column chromatography (petroleum ether:ethyl acetate=10:1 to 2:1) afforded intermediate R6 (321 mg, 98% purity by LCMS, 90% yield) as a yellow solid. LC-MS (ESI): The calculated mass of the chemical formula C ₂₁ H ₁₈ ClF ₄ N ₅ O ₃ S is 531.1, and the measured value of m/z is 532.1 [M+H] ⁺ . Compound 71A : (S*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( methoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared sequentially according to typical reductive amination method 4 from intermediate R6 and intermediate N1 , chiral separation, typical tertiary butyl ester deprotection method 5.

By chiral Prep.HPLC (separation conditions: column: Chiralpak OD-H 5 μm 20 * 250 mm; mobile phase: Hex: IPA: DEA = 85: 15: 0.2, at 18 mL/min; temperature: 30°C ; wavelength: 254 nm).

Purification with C18 column (acetonitrile: water (5% ammonium bicarbonate) = 5% - 100%) afforded Compound 71A (30.2 mg, 98.7% purity by LCMS, 67% yield) as a yellow solid. LC-MS (ESI): calculated mass for C ₂₈ H ₃₀ ClF ₄ N ₅ O ₆ S 676.1, found m/z 676.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.30 (br s, 1H), 7.83 (d, J = 2.4 Hz, 1H), 7.43 (d, J = 2.0 Hz, 1H), 7.03 - 7.02 (m, 2H) , 6.17 (s, 1H), 4.29 - 4.14 (m, 3H), 4.06 - 3.94 (m, 2H), 3.72 - 3.67 (m, 4H), 3.59 - 3.51 (m, 4H), 3.45 - 3.34 (m, 1H), 3.11 - 3.01 (m, 2H), 2.94 - 2.80 (m, 1H), 1.23 (s, 3H), 1.19 (s, 3H) Compound 71B : (R*)-4-(( cis )- 4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( methoxycarbonyl )-2-( thiazol- 2- yl )-3,6- di Hydropyrimidin - 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-3 -methoxy- 2,2- Dimethylbutyric acid (single diastereomer)

Compound 71B was prepared analogously to Compound 71A .

中間體 N2 的製備：

中間體 N2-1 ： 4-( 苄基氧基 )-3- 乙氧基 -2,2- 二甲基丁酸三級丁酯 Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 50% to 95%) afforded Compound 71B (42.4 mg, 99.2% purity by LCMS, 49% yield) as a pale yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₀ ClF ₄ N ₅ O ₆ S is 675.15, found m/z is 676.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.27 (br s, 1H), 7.85 (d, J = 3.2 Hz, 1H), 7.46 (d, J = 2.4 Hz, 1H), 7.05 - 7.02 (m, 2H) , 6.17 (s, 1H), 4.28 - 4.23 (m, 3H), 4.10 - 4.06 (m, 1H), 3.98 - 3.95 (m, 1H), 3.63 - 3.60 (m, 1H), 3.59 (s, 3H) , 3.57 - 3.54 (m, 1H), 3.52 (s, 3H), 3.49 - 3.46 (m, 1H), 3.09 - 2.99 (m, 3H), 1.28 (s, 3H), 1.24 (s, 3H). Compounds 72A and 72B

Preparation of intermediate N2 :

Intermediate N2-1 : Tertiary butyl 4-( benzyloxy )-3 - ethoxy -2,2 -dimethylbutyrate

To a solution of intermediate N1-1 (2 g, 90% purity, 6.11 mmol) in N,N-dimethylformamide (16 mL) was added sodium hydride (1 g, 25.0 mmol) at 0°C ). After stirring at 0°C for 0.5 h, iodomethane (2 g, 12.8 mmol) was added to the mixture. The mixture was stirred for a further 2 hours at 30°C. The mixture was quenched with water (50 mL) and extracted twice with ethyl acetate (50 mL). The organic layer was washed twice with brine (50 mL), dried over Na ₂ SO ₄ (s), filtered. The filtrate was concentrated and purified by silica gel column chromatography (petroleum ether: ethyl acetate = 1:0 to 50: ¹ ) to obtain Intermediate N2-1 (1.6 g, according to HNMR purity of 90%, 73.0% yield).

¹ HNMR (300 MHz, CDCl ₃ ) δ 7.39 - 7.32 (m, 5H), 4.61 - 4.52 (m, 2H), 3.95 - 3.85 (m, 1H), 3.79 - 3.76 (m, 1H), 3.65 - 3.56 ( m, 3H), 1.46 (s, 9H), 1.23 (t, J = 6.9 Hz, 3H), 1.19 (s, 3H), 1.12 (s, 3H). Intermediate N2-2 : tertiary butyl 3- ethoxy - 4 -hydroxy- 2,2 -dimethylbutyrate

To a solution of intermediate N2-1 (1.6 g, 90% purity, 4.47 mmol) in ethanol (20 mL) was added 10% palladium on carbon 10 wt% (180 mg, 0.169 mmol). After stirring at room temperature under a hydrogen (balloon) atmosphere, the mixture was filtered and the filtrate was concentrated to afford Intermediate N2-2 (1 g, 90% purity by ¹ H NMR, 86.7% yield) as a colorless oil.

¹ HNMR (300 MHz, CDCl ₃ ) δ 9.10 (s, 1H), 3.74 - 3.56 (m, 5H), 1.44 (s, 9H), 1.18 (t, J = 7.2 Hz, 3H), 1.17 (s, 3H ), 1.09 (s, 3H). Intermediate N2 : tertiary butyl 3- ethoxy -2,2 -dimethyl- 4 -oxobutyrate

To a solution of intermediate N2-2 (500 mg, 90% purity, 1.94 mmol) in dichloromethane (10 mL) was added Dess-Martin periodinane (1.25 g, 2.95 mmol). After stirring at room temperature for 3 hours, saturated aqueous sodium bicarbonate (50 mL) was added to the reaction mixture and extracted three times with dichloromethane (50 mL). The combined organic layers were washed with brine (50 mL), dried over Na ₂ SO ₄ (s) and filtered to afford Intermediate N2 (405 mg, 80% purity by ¹ HNMR, 72.6% yield) as a yellow oil. rate), which is used directly in the next step.

¹ HNMR (300 MHz, CDCl ₃ ) δ 9.71 (d, J = 2.4 Hz, 1H), 3.70 - 3.62 (m, 1H), 3.58 (d, J = 2.1 Hz, 1H), 3.51 - 3.41 (m, 1H ), 1.43 (s, 9H), 1.22 - 1.17 (m, 9H). Compound 72A : ( R *)-3- ethoxy -4-(( cis )-4-((( S )-5-( ethoxycarbonyl )-6-(3- fluoro - 2methylbenzene Base )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso (azol- 1 -yl )-2,2 -dimethylbutanoic acid (single diastereomer)

This compound was prepared sequentially according to typical reductive amination method 4 from intermediate R1 and intermediate N2 , chiral separation, typical tertiary butyl ester deprotection method 5.

By chiral Prep. HPLC (separation conditions: column: column Chiralpak IG 5 um, 30*250 mm; mobile phase: Hex : EtOH = 95 : 5, at 25 mL/min; temperature 30 ° C; wavelength: 254 nm , back pressure: 100 bar) separation. Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 5% to 95%) afforded Compound 72A (41 mg, 99.6% purity by LCMS, 50.2% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₁ H ₃₈ F ₃ N ₅ O ₆ S is 665.7, found m/z is 666.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.83 (d, J = 2.8 Hz, 1H), 7.45 (s, 1H), 7.11 - 7.05 (m, 1H), 6.97 - 6.89 (m, 2H), 6.01 (s , 1H), 4.32 - 4.24 (m, 3H), 4.09 - 3.98 (m, 4H), 3.88 - 3.80 (m, 1H), 3.71 - 3.68 (m, 1H), 3.62 - 3.49 (m, 3H), 3.12 - 2.97 (m, 3H), 2.53 (s, 3H), 1.28 (s, 3H), 1.25 (s, 3H), 1.21 (t, J = 7.2 Hz, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compound 72B : ( S *)-3- ethoxy -4-(( cis )-4-((( S )-5-( ethoxycarbonyl )-6-(3- fluoro -2- methyl Phenyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] Isoxazol- 1 -yl )-2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 72B was prepared analogously to Compound 72A .

Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 5% to 95%) afforded Compound 72 B (6.5 mg, 99.3% purity by LCMS, 19.8% yield) as a yellow solid.

中間體 M11 的製備

中間體 M11-1 (3aS*,6aS*)-1-((R*)-4-( 苄基氧基 )-2-( 二氟甲氧基 )-3,3- 二甲基 -4- 側氧基丁基 )-6,6- 二氟六氫 -4H- 吡咯并 [3,2-c] 異㗁唑 -4- 甲酸三級丁酯 LC-MS (ESI): Calculated mass for C ₃₁ H ₃₈ F ₃ N ₅ O ₆ S is 665.7, found m/z is 666.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.17 (s, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.41 (d, J = 3.2 Hz, 1H), 7.10 - 7.05 (m, 1H), 6.97 - 6.87 (m, 2H), 6.00 (s, 1H), 4.34 (d, J = 17.2 Hz, 1H), 4.29 - 4.18 (m, 2H), 4.12 - 3.98 (m, 5H), 3.77 - 3.59 ( m, 3H), 3.48 - 3.37 (m, 1H), 3.14 - 3.07 (m, 2H), 2.87 - 2.82 (m, 1H), 2.54 (d, J = 1.6 Hz, 1H), 1.30 (s, 3H) , 1.27 (t, J = 7.2 Hz, 3H), 1.20 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compound 73A

Preparation of Intermediate M11

Intermediate M11-1 (3aS*,6aS*)-1-((R*)-4-( benzyloxy )-2-( difluoromethoxy )-3,3 -dimethyl- 4- tertiary butyl ) -6,6 -difluorohexahydro- 4H- pyrrolo [3,2-c] isoxazole- 4 -carboxylate

Copper(I) iodide (44.52 mg, 0.23 mmol) and TEA (0.15 mL, 0.73 g/mL, 1.05 mmol) were added to Intermediate M1-1a (550 mg, 1.17 mmol) in MeCN ( 15 mL, 0.79 g/mL, 288.65 mmol) in a stirred solution. Then 2,2-difluoro-2-(fluorosulfonyl)acetic acid (0.6 mL, 1.72 g/mL, 5.84 mmol) was added dropwise at 50°C, and the mixture was stirred at 50°C for 1 hour. The mixture was concentrated under reduced pressure. Water (50 mL) was added to the residue, and the mixture was extracted with EtOAc (25 mL×3). The combined organic layers were washed with brine, dried _over anhydrous _Na2SO4 , filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography (column: C18, 20 ~ 35 µm. 100Å. 40 g) eluting with 5% ~ 75% acetonitrile in water (with 0.05% FA added) to obtain a colorless Intermediate M11-1 as an oil (137 mg, 23% yield).

LC-MS (ESI): The calculated mass of C ₂₄ H ₃₂ F ₄ N ₂ O ₆ is 520.2, the measured value of m/z is 521.2 [M+H] ⁺ intermediate M11-2 : (R*)-4-( (3aS*,6aS*)-4-( tertiary butoxycarbonyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isozazol- 1 -yl )-3- ( Difluoromethoxy )-2,2 -dimethylbutanoic acid

To a solution of Intermediate M11-1 (100 mg, 0.19 mmol) in EtOH (6 mL) was added Pd/C (5%) (20.44 mg, 0.0096 mmol). The mixture was then stirred at 20°C for 8 hours under a hydrogen atmosphere using a balloon. The mixture was filtered. The filtrate was concentrated under reduced pressure to afford crude intermediate M11-2 (90 mg, 50% purity, 54% yield) as an oil, which was directly used in the next step without purification.

LC-MS (ESI): The calculated mass of C ₁₇ H ₂₆ F ₄ N ₂ O ₆ is 430.1, the measured value of m/z is 431.1 [M+H] ⁺ intermediate M11-3 : (3aS*,6aS*)- 1-((R*)-4-( allyloxy )-2-( difluoromethoxy )-3,3 -dimethyl- 4 -oxobutyl )-6,6 -difluoro Hexahydro -4H- pyrrolo [3,2-c] isoxazole- 4 - carboxylic acid tertiary butyl ester

To a solution of intermediate M11-2 (90 mg, 0.1 mmol, 50% purity) and 3-bromoprop-1-ene (37.95 mg, 0.31 mmol) in DMF (2 mL, 0.94 g/mL, 25.72 mmol) K ₂ CO ₃ (57.8 mg, 0.42 mmol) was added. The mixture was then stirred at 20°C for 16 hours. The reaction mixture was poured into water (5 mL) and extracted twice with ethyl acetate (10 mL). The combined organic phases were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ (s) and filtered. The filtrate was concentrated under reduced pressure to give a residue, which was purified by flash silica gel column chromatography (eluting with 0-25% EtOAc in hexanes) to afford Intermediate M11-3 (75 mg , 65% purity, 99% yield). LC-MS (ESI): The calculated mass of C20H30F4N2O6 is 470.2, the measured value of m/z is 471.2 [M+H] ⁺ intermediate M11 : (R*)-4-((3aS*,6aS*)-6,6 -Allyl difluorohexahydro- 1H - pyrrolo [3,2-c] isoxazol- 1 -yl )-3-( difluoromethoxy )-2,2 -dimethylbutyrate

To a solution of Intermediate M11-3 (75 mg, 0.16 mmol) in DCM (1.5 mL) was added TFA (1.5 mL). The mixture was then stirred at 20 °C for 0.5 h. The mixture was diluted with DCE (2 mL). The mixture was then concentrated under reduced pressure to afford crude intermediate M11 (59 mg), which was used directly in the next step without further purification.

LC-MS (ESI): The calculated mass of C15H22F4N2O4 is 370.2, and the measured value of m/z is 371.1 [M+H] ⁺ Compound 73A-1 : (S)-6-((( cis )-1-((R *)-4-( allyloxy )-2-( difluoromethoxy )-3,3 -dimethyl- 4 -oxobutyl )-6,6 -difluorohexahydro- 4H- Pyrrolo [3,2-c] isozazol- 4 -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- Ethyl dihydropyrimidine- 5 -carboxylate (single diastereomer)

Compound 73A-1 was prepared from Intermediate H1A and Intermediate M11 according to Typical Coupling Method 1 .

Purified by flash column chromatography (column: C18, 20 to 35 µm, 100 Å, 40 g) eluting with 5% to 85% acetonitrile in water (addition of 0.05% FA) to give a yellow oil Compound 73-1

(120 mg, 43% purity, 45% yield).

LC-MS (ESI): The calculated mass of C ₃₃ H ₃₈ F ₅ N ₅ O ₆ S is 727.2 m/z, and the measured value is 728.2 [M+H] ⁺ compound 73A : (R*)-3-( difluoro Methoxy )-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 - methylphenyl )-2-( thiazole- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )- 2,2 -Dimethylbutanoic acid (single diastereomer)

This compound was prepared from compound 73A-1 by removal of allyl ester protection using typical method 3, and by flash column chromatography (column: C18, 20 ~ 35 µm, 100 Å, 40 g) with 20% ~ 65% of Purification by eluting acetonitrile in water (with 0.05% FA addition) afforded compound 73 (11 mg, yield: 54%) as a yellow solid.

LC-MS (ESI): The calculated mass of C ₃₀ H ₃₄ F ₅ N ₅ O ₆ S is 687.2 m/z, and the measured value is 688.2 [M+H] ⁺

中間體 M12 的製備

中間體 M12-1 ： ( S)-2- 羥基丙酸苄酯 ¹ HNMR (400 MHz, CDCl ₃ ) δ ppm 8.93 - 9.20 (m, 1 H), 7.74 - 7.91 (m, 1 H), 7.40 - 7.49 (m, 1 H), 7.03 - 7.13 (m, 1 H) , 6.81 - 7.01 (m, 2H), 6.12 - 6.64 (m, 1H), 5.88 - 6.07 (m, 1H), 4.52 - 4.64 (m, 1H), 4.17 - 4.36 (m, 3H) , 3.99 - 4.12 (m, 3 H), 3.95 (br d, J=8.8 Hz, 1 H), 3.48 - 3.66 (m, 2 H), 3.00 - 3.17 (m, 3 H), 2.53 (br s, 3 H), 1.34 (br s, 3 H), 1.24 (br s, 3 H), 1.10 (br t, J=7.0 Hz, 3 H). Compounds 74A and 74B

Preparation of intermediate M12

Intermediate M12-1 : ( S )-Benzyl 2- hydroxypropionate

To a solution of ( S )-2-hydroxypropionic acid (15.0 g, 167 mmol) in toluene (700 mL) was added (bromomethyl)benzene (34.2 g, 200 mmol) and 2,3,4,6, 7,8,9,10-Octahydropyrimido[1,2-a]nitrogen (25.4 g, 167 mmol). After stirring overnight at 100 °C, the mixture was poured into water (200 mL) and extracted twice with ethyl acetate (200 mL). The combined organic layers were concentrated to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10: 1 to 6: 1) to obtain the title compound (18.3 g, 90% purity by ¹ HNMR, 55% yield). LC-MS (ESI): The calculated mass for C ₁₀ H ₁₂ O ₃ is 180.1, and the found m/z is 203.1 [M+Na] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.40 - 7.29 (m, 5H), 5.21 (s, 2H), 4.35 - 4.29 (m, 1H), 2.87 - 2.80 (m, 1H), 1.43 (d, J = 6.8 Hz, 3H). Intermediate M12-2 : ( S )-Benzyl 2- methoxypropionate

To a suspension of 60 wt% sodium hydride in mineral oil (6.4 g, 160 mmol) in tetrahydrofuran (250 mL) at 0°C was added Intermediate M12-1 (24.1 g, 90% purity, 120 mmol). After stirring at 0°C for 1 hour, to the mixture was added a solution of iodomethane (35.0 g, 247 mmol) in tetrahydrofuran (50 mL). The mixture was stirred at 0°C for 2 hours. The mixture was then quenched with saturated aqueous NH ₄ Cl (200 mL) and extracted twice with ethyl acetate (200 mL). The combined organic phases _were dried over _Na2SO4 and filtered. The filtrate was concentrated to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 100: 1 to 20: 1) to obtain Intermediate M12-2 (16.6 g, 90% by ¹ HNMR, 64% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.37 - 7.33 (m, 5H), 5.22 (d, J = 12.4 Hz, 1H), 5.18 (d, J = 12.4 Hz, 1H), 3.92 (q, J = 7.2 Hz, 1H), 3.39 (s, 3H), 1.41 (d, J = 6.8 Hz, 3H). Intermediate M12-3 : Benzyl 2 -methoxy- 2 -methylpent- 4 - enoate

To a solution of intermediate M12-2 (8.0 g, 90% purity, 37.1 mmol) and 3-bromoprop-1-ene (14.0 g, 116 mmol) in tetrahydrofuran (60 mL) was added at -78°C 1.0 M solution of lithium bis(trimethylsilyl)amide in tetrahydrofuran (50 mL, 50 mmol). After stirring at -78°C for 1.5 hours, the mixture was warmed to -40°C and stirred at -40°C for a further 2 hours. The mixture was then slowly warmed to room temperature and quenched at -10 °C with saturated aqueous ammonium chloride (100 mL), extracted twice with ethyl acetate (100 mL). The combined organic layers were concentrated to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate: dichloromethane = 100: 1: 1 to 40: 1: 1) to obtain a yellow oil Intermediate M12-3 (5.6 g, 90% pure by ¹ H NMR, 58% yield). LC-MS (ESI): calculated mass for C ₁₄ H ₁₈ O ₃ is 234.1, found m/z is 235.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.38 - 7.31 (m, 5H), 5.80 - 5.69 (m, 1H), 5.18 (s, 2H), 5.09 - 5.03 (m, 2H), 3.28 (s, 3H) , 2.57 - 2.45 (m, 2H), 1.40 (s, 3H). Intermediate M12-4 : Benzyl 2 -methoxy- 2- methyl- 4 -oxobutanoate

To a solution of Intermediate M12-3 ( 2.0 g, 90% purity, 7.68 mmol) in dichloromethane (60 mL) was bubbled ozone at -78°C until the reaction mixture turned dark blue. The reaction mixture was quenched with dimethyl sulfide (10 mL) and stirred at room temperature overnight. Dimethyl sulfide (10 mL) was added to the mixture, and the mixture was stirred at 30°C for 3 hours, concentrated to obtain a residue, which was subjected to silica gel column chromatography (petroleum ether: ethyl acetate = 100: 1 to 8:1) purification afforded intermediate M12-4 (1.3 g, 90% purity by ¹ H NMR, 64% yield) as a yellow oil. LC-MS (ESI): calculated mass for C ₁₃ H ₁₆ O ₄ is 236.1, found m/z is 237.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.75 (t, J = 2.4 Hz, 1H), 7.38 - 7.33 (m, 5H), 5.21 (s, 2H), 3.30 (s, 3H), 2.78 (d, J = 2.4 Hz, 2H), 1.53 (s, 3H). Intermediate M12-5 : (3aS*,6aS*)-1-(4-( benzyloxy )-3 -methoxy- 3 -methyl- 4 -oxobutyl )-6,6- Tertiary butyl difluorohexahydro- 4H- pyrrolo [3,2-c] isoxazole- 4 -carboxylate

Intermediate M12-5 was prepared from Intermediate T1 and Intermediate M12-4 according to typical reductive amination method 4 .

Purified by silica gel column chromatography (petroleum ether: tetrahydrofuran = 10: 1 to 6: 1) to obtain intermediate M12-5 (490 mg, 90% purity according to ¹ HNMR, 52% yield) as a yellow oil Rate). LC-MS (ESI): Calculated mass for C ₂₃ H ₃₂ F ₂ N ₂ O ₆ is 470.2, found m/z is 471.4 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.37 - 7.30 (m, 5H), 5.13 - 5.14 (m, 2H), 4.79 - 4.64 (m, 1H), 4.06 - 3.93 (m, 1H), 3.89 - 3.82 ( m, 1H), 3.75 - 3.56 (m, 1H), 3.37 - 3.27 (m, 4H), 2.96 - 2.87 (m, 1H), 2.79 - 2.69 (m, 1H), 2.20 - 2.03 (m, 3H), 1.45 - 1.44 (m, 12H). Intermediate M12-6 : 4-((3aS*,6aS*)-4-( tertiary butoxycarbonyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] iso㗁Azol- 1 -yl )-2- methoxy- 2 -methylbutanoic acid

To a solution of intermediate M12-5 (490 mg, 90% purity, 0.937 mmol) in ethanol (10 mL) was added 10 wt% palladium on carbon (110 mg, 0.103 mmol) at 0°C. After the mixture was stirred at 0°C under an atmosphere of hydrogen (balloon) for 1 hour, the mixture was filtered and concentrated to afford Intermediate M12-6 (390 mg, 90% pure by ¹ HNMR, 98% yield), which was used in the next step without further purification. ¹ HNMR (400 MHz, CDCl ₃ ) δ 4.87 - 4.73 (m, 1H), 4.17 - 4.09 (m, 1H), 4.02 - 3.85 (m, 1.5 H), 3.78 - 3.60 (m, 3H), 3.42 - 3.33 (m, 3H), 3.00 - 2.81 (m, 1.5H), 227 - 2.00 (m, 2H), 1.50 - 1.43 (m, 9H), 1.24 (t, J = 7.2H, 2H). Intermediate M12-7 : (3aS*,6aS*)-1-(4-( allyloxy )-3 -methoxy- 3 -methyl- 4 -oxobutyl )-6,6- Tertiary butyl difluorohexahydro- 4H- pyrrolo [3,2-c] isoxazole- 4 -carboxylate

To a solution of intermediate M12-6 (390 mg, 90% purity, 0.923 mmol) in N , N -dimethylformamide (3 mL) was added 3-bromoprop-1-ene (700 mg, 5.79 mmol) and potassium carbonate (400 mg, 2.89 mmol). After stirring overnight at room temperature, the mixture was poured into water (20 mL) and extracted twice with ethyl acetate (20 mL). The combined organic layers were concentrated to give a residue, which was purified by silica gel column chromatography (petroleum ether:ethyl acetate=10:1 to 6:1) to give Intermediate M12-7 as a yellow oil ( 355 mg, 90% pure by ¹ HNMR, 80% yield). LC-MS (ESI): calculated mass for C ₁₉ H ₃₀ F ₂ N ₂ O ₆ is 420.2, found m/z is 421.4 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 5.98 - 5.88 (m, 1H), 5.35 (d, J = 17.2 Hz, 1H), 5.26 (d, J = 10.4 Hz, 1H), 4.85 - 4.72 (m, 1H ), 4.64 (d, J = 5.6 Hz, 1H), 4.15 - 4.08 (m, 1H), 4.02 - 3.75 (m, 2H), 3.72 - 3.60 (m, 1H), 3.45 - 3.35 (m, 1H), 3.29 (m, 3H), 3.04 - 2.77 (m, 2H), 2.23 - 2.03 (m, 2H), 1.476 - 1.44 (m, 12H). Intermediate M12 : 4-((3aS*,6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-2 - methoxy- Allyl 2 -methylbutyrate

To a solution of Intermediate M12-7 (350 mg, 90% purity, 0.749 mmol) in dichloromethane (4 mL) was added trifluoroacetic acid (1 mL) at room temperature. After stirring at room temperature for 2 hours, the mixture was concentrated to dryness to give a residue, which was diluted with dichloromethane (20 mL) and adjusted with saturated aqueous sodium bicarbonate (30 mL). The aqueous phase was extracted twice with dichloromethane (20 mL), the combined organic layers were dried over _{Na2SO4 (s)} , filtered and concentrated to give crude intermediate M12 which was used directly in the next step. Compound 74-1 : (4S)-6-(((3aS*, 6aS*)-1-(4-( allyloxy )-3 -methoxy- 3 -methyl- 4 -oxobutane Base )-6,6 -difluorohexahydro- 4H- pyrrolo [3,2-c] isoxazol- 4 -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )- 2-( Thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

Compound 74-1 was prepared from Intermediate H1A and Intermediate M12 according to Typical Coupling Method 1 .

Purification by silica gel column chromatography (petroleum ether: tetrahydrofuran = 10:1 to 4:1) and C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 50% to 95%) gave the title as a yellow solid Compound (336 mg, 90% pure by ¹ HNMR, 60% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.20 (br s, 1H), 7.81 (d, J = 3.6 Hz, 1H), 7.41 (d, J = 2.8 Hz, 1H), 7.10 - 7.05 (m, 1H) , 6.96 (d, J = 7.6 Hz, 1H), 6.91 (t, J = 8.8 Hz, 1H), 6.00 (s, 1H), 5.97- 5.89 (m, 1H), 5.35 (m, 1H), 5.26 ( m, 1.2 Hz, 1H), 4.65 (t, J = 4.8 Hz, 2H), 4.32 - 4.20 (m, 3H), 4.11 - 3.98 (m, 4H), 3.63 - 3.56 (m, 1H), 3.45 - 3.35 (m, 1H), 3.30 (s, 3H), 3.08 (t, J = 12.0 Hz, 1H), 3.00 - 2.89 (m, 1H), 2.86 - 2.76 (m, 1H), 2.54 (s, 3H), 2.21 - 2.00 (m, 2H), 1.46 (s, 1.5H), 1.45 (s, 1.5H), 1.12 (t, J = 7.2 Hz, 3H). Compounds 74A-1 and 74B-1 : (S)-6-((( cis )-1-((R*)-4-( allyloxy )-3 -methoxy- 3 - methyl- 4 -oxobutyl )-6,6 -difluorohexahydro- 4H- pyrrolo [3,2-c] isoxazol- 4 -yl ) methyl )-4-(3- fluoro -2- Methylphenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylic acid ethyl ester ( single diastereomer ) and (S)-6-((( cis ) -1-((S*)-4-( allyloxy )-3 -methoxy- 3 -methyl- 4 -oxobutyl )-6,6 -difluorohexahydro- 4H- pyrrole And [3,2-c] isozazol- 4 -yl ) methyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-1,4- di Ethyl hydropyrimidine -5 -carboxylate ( single diastereomer )

The racemic mixture of compound 74-1 (280 mg, 90% purity, 0.372 mmol) was analyzed by chiral prep.HPLC (column: Chiralpak ID 5 µm 20 * 250 mm; mobile phase: Hex: EtOH = 95: 5 , at 30 mL/min; temperature: 30°C; wavelength: 254 nm) to obtain compound 74A-1 (138 mg, 90% purity according to ¹ HNMR, 49% yield, 100% stereopure) as a yellow solid ) and compound 74B-1 (118 mg, 90% pure by ¹ HNMR, 42% yield, 99.9% stereopure).

Compound 74A-1 : LC-MS (ESI): The calculated mass for C ₃₂ H ₃₈ F ₃ N ₅ O ₆ S is 677.3, and the found m/z is 678.6 [M+H] ⁺ . Chiral analysis (column: Chiralpak IB 5 μm 4.6 * 250 mm; mobile phase: Hex : EtOH = 95 : 5, at 1 mL/min; temperature: 30°C, wavelength: 254 nm, RT = _11.790 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.87 (d, J = 3.2 Hz, 1H), 7.51 (d, J = 3.2 Hz, 1H), 7.12 - 7.07 (m, 1H), 6.99 (d, J = 7.6 Hz, 1H), 6.93 (t, J = 9.2 Hz, 1H), 6.06 (s, 1H), 5.99 - 5.89 (m, 1H), 5.35 (dd, J = 17.2, 1.2 Hz, 1H), 5.26 (dd , J = 10.8, 1.2 Hz, 1H), 4.66 (d, J = 5.6 Hz, 2H), 4.33 - 4.22 (m, 3H), 4.10 - 3.98 (m, 4H), 3.61 (dd, J = 14.4, 7.2 Hz, 1H), 3.47 - 3.37 (m, 1H), 3.30 (s, 3H), 3.10 (t, J = 11.6 Hz, 1H), 3.00 - 2.94 (m, 1H), 2.82 - 2.75 (m, 1H) , 2.52 (s, 3H), 2.16 - 2.12 (m, 2H), 1.45 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H).

Compound 74B-1 : The calculated mass for C ₃₂ H ₃₈ F ₃ N ₅ O ₆ S is 677.3, and the found m/z is 678.6 [M+H] ⁺ . Chiral analysis (column: Chiralpak IB 5 μm 4.6 * 250 mm; mobile phase: Hex : EtOH = 95 : 5, at 1 mL/min; temperature: 30°C, wavelength: 254 nm, RT = _13.617 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.87 (d, J = 3.2 Hz, 1H), 7.51 (d, J = 3.2 Hz, 1H), 7.12 - 7.06 (m, 1H), 6.98 (d, J = 7.6 Hz, 1H), 6.93 (t, J = 9.2 Hz, 1H), 6.06 (s, 1H), 5.98 - 5.88 (m, 1H), 5.35 (dd, J = 17.2, 1.6 Hz, 1H), 5.26 (dd , J = 10.4, 1.2 Hz, 1H), 4.65 (d, J = 5.6 Hz, 2H), 4.33 - 4.22 (m, 3H), 4.10 - 3.99 (m, 4H), 3.62 (dd, J = 14.8, 7.2 Hz, 1H), 3.48 - 3.37 (m, 1H), 3.30 (s, 3H), 3.10 (t, J = 12.0 Hz, 1H), 2.95 - 2.89 (m, 1H), 2.86 - 2.81 (m, 1H) , 2.52 (s, 3H), 2.24 - 2.18 (m, 1H), 2.12 - 2.06 (m, 1H), 1.46 (s, 3H), 1.12 (t, J = 7.6 Hz, 3H). Compound 74A : (R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-2- methoxy- 2 -methylbutanoic acid ( single diastereomer )

This compound was prepared from compound 74A-1 using typical method 3 to remove allyl ester protection, and was analyzed by Prep.HPLC (column: Xbrige C18 (5 µm 19 * 150 mm), mobile phase A: water (0.1% ammonium bicarbonate ), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min, gradient: 20% - 60% (%B)) to obtain the title compound (50.3 mg, 99.7% purity, 46 %Yield). LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₆ S is 637.2, found m/z is 638.3 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.18 (br s, 1H), 7.83 (d, J = 3.2 Hz, 1H), 7.41 (d, J = 2.8 Hz, 1H), 7.10 - 7.04 (m, 1H) , 6.96 (d, J = 7.6 Hz, 1H), 6.90 (t, J = 9.2 Hz, 1H), 6.00 (s, 1H), 4.33 - 4.18 (m, 3H), 4.09 - 3.96 (m, 4H), 3.59 - 3.41 (m, 2H), 3.35 (s, 3H), 3.09 (t, J = 12.0 Hz, 1H), 2.99 - 2.86 (m, 2H), 2.54 (s, 3H), 2.29 - 2.22 (m, 1H), 2.04 - 1.98 (m, 1H), 1.47 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compound 74B : (S*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-2- methoxy- 2 -methylbutanoic acid ( single diastereomer )

Compound 74B was prepared analogously to Compound 74A .

中間體 M13 的製備

4-((3aS*, 6aS*)-6,6- 二氟六氫 -1H- 吡咯并 [3,2-c] 異㗁唑 -1- 基 )-2- 甲氧基 -2- 甲基丁酸苄酯 By Prep.HPLC (column: Xbrige C18 (5 µm 19 * 150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min, Gradient: 15% - 55% (%B)) Purification afforded the title compound (32.5 mg, 99.3% purity, 76% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₄ F ₃ N ₅ O ₆ S is 637.2, found m/z is 638.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.17 (br s, 1H), 7.81 (d, J = 2.8 Hz, 1H), 7.41 (d, J = 3.2 Hz, 1H), 7.10 - 7.05 (m, 1H) , 6.96 (d, J = 7.2 Hz, 1H), 6.91 (t, J = 8.8 Hz, 1H), 6.00 (s, 1H), 4.31 - 4.21 (m, 3H), 4.11 - 3.99 (m, 4H), 3.59 (dd, J = 14.8, 7.2 Hz, 1H), 3.46 - 3.36 (m, 4H), 3.09 (t, J = 12.4 Hz, 1H), 2.87 - 2.76 (m, 2H), 2.54 (s, 3H) , 2.27 - 2.12 (m, 2H), 1.48 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compounds 75A and 75B

Preparation of Intermediate M13

4-((3aS*, 6aS*)-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isozazol- 1 -yl )-2- methoxy- 2- methyl Benzyl butyrate

To a solution of Intermediate M12-5 (127 mg, 90% purity, 0.243 mmol) in dichloromethane (2 mL) was added trifluoroacetic acid (1 mL) at room temperature. After stirring at room temperature for 1 h, the reaction mixture was diluted with dichloromethane (30 mL) and poured into saturated aqueous sodium bicarbonate (30 mL). The organic phase was separated, and the aqueous phase was extracted twice with dichloromethane (30 mL). The combined organic extracts were dried over _{Na2SO4 (s)} , filtered and concentrated to afford Intermediate M13 (100 mg, 57% purity, 63% yield) as a colorless oil. LC-MS (ESI): RT = 1.50 min, calculated mass for C _{18 H 24} F ₂ N ₂ O ₄ is 370.2, found m/z is 371.2 [M+H] ⁺ . Compound 75-1 : (4R*)-6-(((3aS*, 6aS*)-1-(4-( benzyloxy )-3 -methoxy- 3 -methyl- 4 -oxo Butyl )-6,6 -difluorohexahydro- 4H- pyrrolo [3,2-c] isoxazol- 4 -yl ) methyl )-4-(2- chloro -3,4 -difluorobenzene Base )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine -5 -carboxylic acid ethyl ester

This compound was prepared according to Typical Coupling Method 1 from Intermediate H4A and Intermediate M13 .

Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 30% to 95%) afforded the title compound (100 mg, 90% purity by ¹ H NMR, 76% yield) as a yellow solid. ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.28 (br s, 1H), 7.83 (t, J = 3.6 Hz, 1H), 7.45 - 7.43 (m, 1H), 7.38 - 7.31 (m, 5H), 7.05 - 7.00 (m, 2H), 6.19 (s, 1H), 5.21 - 5.15 (m, 2H), 4.21 (s, 2H), 4.04 (m, 2H), 3.98 - 3.90 (m, 2H), 3.79 - 3.76 ( m, 1H), 3.57 - 3.46 (m, 1H), 3.40 - 3.31 (m, 1H), 3.28 (s, 3H), 3.04 (t, J = 10 Hz, 1H), 2.91 - 2.80 (m, 1H) , 2.73 - 2.57 (m, 1H), 2.22 - 2.09 (m, 2H), 1.45 (s, 1H), 1.45 (s, 2H), 1.13 (t, J = 7.2 Hz, 3H). Compound 75A-1 and 75B-1 : (R*)-6-((( cis )-1-((R*)-4-( benzyloxy )-3 -methoxy- 3 -methyl -4 -oxobutyl )-6,6 -difluorohexahydro- 4H- pyrrolo [3,2-c] isoxazol- 4 -yl ) methyl )-4-(2- chloro- 3 , ethyl 4 -difluorophenyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylate ( single diastereomer ) and (R*)-6-(( ( cis )-1-((S*)-4-( benzyloxy )-3 -methoxy- 3 -methyl- 4 -oxobutyl )-6,6 -difluorohexahydro -4H- pyrrolo [3,2-c] isoxazol- 4 -yl ) methyl )-4-(2- chloro -3,4 -difluorophenyl )-2-( thiazol- 2- yl ) -Ethyl 1,4- dihydropyrimidine- 5 -carboxylate ( single diastereomer )

The racemic mixture of compound 75-1 (100 mg, 90% purity, 0.117 mmol) was analyzed by chiral Prep.HPLC (column: Chiralpak IG 5 µm 20 * 250 mm, mobile phase: Hex: EtOH = 30: 70 , at 15 mL/min, temperature: 25°C, wavelength: 214 nm) to obtain Compound 75A-1 (33 mg, 90% purity according to ¹ HNMR, 33% yield, 100% stereopure ) and compound 75B-1 (48 mg, 90% pure by ¹ HNMR, 48% yield, 100% stereopure).

Compound 75A-1 : LC-MS (ESI): The calculated mass for C ₃₅ H ₃₆ ClF ₄ N ₅ O ₆ S is 765.2, and the found m/z is 766.1 [M+H] ⁺ . Chiral analysis (column: Chiralpak IG 5 μm 4.6 * 250 mm; mobile phase: Hex : EtOH = 30 : 70, at 1 mL/min; temperature: 30°C, wavelength: 214 nm, _RT = 7.482 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.28 (br s, 1H), 7.83 (d, J = 2.8 Hz, 1H), 7.44 (d, J = 3.2 Hz, 1H), 7.38 - 7.33 (m, 5H) , 7.05 - 7.00 (m, 2H), 6.19 (s, 1H), 5.22 (m, 2H), 4.21 (s, 2H), 4.16 - 4.08 (m, 2H), 3.97 - 3.90 (m, 2H), 3.75 - 3.59 (m, 1H), 3.51 - 3.45 (m, 1H), 3.40 - 3.31 (m, 1H), 3.28 (s, 3H), 3.07 - 3.00 (m, 1H), 3.94 - 2,87 (m, 1H), 3.64 - 2.57 (m, 1H), 2.11 (t, J = 8 Hz, 2H), 1.45 (s, 3H), 1.13 (t, J = 7.2 Hz, 3H).

Compound 75B-1 : LC-MS (ESI): The calculated mass for C ₃₅ H ₃₆ ClF ₄ N ₅ O ₆ S is 765.2, and the found m/z is 766.1 [M+H] ⁺ . Chiral analysis (column: Chiralpak IG 5 μm 4.6 * 250 mm; mobile phase: Hex : EtOH = 30 : 70, at 1 mL/min; temperature: 30°C, wavelength: 214 nm, RT = _12.151 min). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.28 (br s, 1H), 7.84 (d, J = 3.2 Hz, 1H), 7.44 (d, J = 3.2 Hz, 1H), 7.37 - 7.32 (m, 5H) , 7.05 - 7.02 (m, 2H), 6.19 (s, 1H), 5.21 (m, 2H), 4.21 (s, 2H), 4.08 - 3.98 (m, 3H), 3.92 - 3.89 (m, 1H), 3.79 - 3.76 (m, 1H), 3.57 - 3.51 (m, 1H), 3.39 - 3.31 (m, 1H), 3.28 (s, 3H), 3.07 - 3.01 (m, 1H), 3.87 - 2,80 (m, 1H), 3.74 - 2.68 (m, 1H), 2.22 - 2.15 (m, 1H), 2.11 - 2.07 (m, 1H), 1.45 (s, 3H), 1.13 (t, J = 7.2 Hz, 3H). Compound 75A : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( ethoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- methoxy- 2 -methylbutanoic acid ( single diastereomer )

This compound was prepared from compound 75A-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 5% to 95%) to give compound 75A as a yellow solid (9.5 mg, 99% purity, 36% yield). LC-MS (ESI): Calculated mass for C ₂₈ H ₃₀ ClF ₄ N ₅ O ₆ S is 675.2, found m/z is 676.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.26 (br s, 1H), 7.86 (d, J = 3.2 Hz, 1H), 7.44 (d, J = 2.8 Hz, 1H), 7.05 - 7.00 (m, 2H) , 6.18 (s, 1H), 4.24 - 4.17 (m, 3H), 4.05 - 3.99 (m, 4H), 3.57 - 3.49 (m, 2H), 3.35 (s, 3H), 3.07 (m, 1H), 2.96 - 2.87 (m, 2H), 2.31 - 2.24 (m, 1H), 2.03 - 2.00 (m, 1H), 1.47 (s, 3H), 1.13 (t, J = 7.2 Hz, 3H). Compound 75B : (S*)-4-(( cis )-4-(((R*)-6-(2- chloro -3,4 -difluorophenyl )-5-( ethoxycarbonyl ) -2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole -1 -yl )-2- methoxy- 2 -methylbutanoic acid ( single diastereomer )

This compound was prepared from compound 75B-1 using typical method 2 to remove the benzyl ester protection and purified by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 5% to 95%) to give (16.8 mg, 99% purity, 44% yield). LC-MS (ESI): Calculated mass for C ₂₈ H ₃₀ ClF ₄ N ₅ O ₆ S is 675.2, found m/z is 676.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.26 (br s, 1H), 7.84 (d, J = 2.4 Hz, 1H), 7.44 (d, J = 2,8 Hz, 1H), 7.06 - 7.01 (m, 2H), 6.19 (s, 1H), 4.23 (m, 3H), 4.05 - 3.99 (m, 4H), 3.62 - 3.57 (m, 1H), 3.45 - 3.38 (m, 4H), 3.10 - 3.03 (m, 1H), 2.82 - 2.75 (m, 2H), 2.24 - 2.17 (m, 2H), 1.49 (m, 3H), 1.12 (t, J = 6.8 Hz, 3H). Preparation of Compounds 76A and 76B : (S*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-4-(3- fluoro -2 -methylphenyl ) )-2-(4 -methylthiazol- 2- yl )-4H-1l2- pyrimidin -6- yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1 (2H) -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer ) and (R*)-4-(( cis )-4-(((S*) -5-( ethoxycarbonyl )-4-(3- fluoro -2 -methylphenyl )-2-(4 -methylthiazol- 2- yl )-4H-1l2- pyrimidin -6- yl ) methyl base )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compounds 76A and 76B were prepared starting from S8-6 and intermediate H7A using the same procedure as described for compounds 10A and 10B .

Compound 76A : LC-MS (ESI): mass calculated for C ₃₁ H ₃₇ F ₃ N ₅ O ₅ S 648.2, found m/z 649.4 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.30 (s, 1H), 7.01 - 7.09 (m, 1H), 6.94 - 7.01 (m, 2H), 6.87 - 6.94 (m, 1H), 6.00 (s, 1H) , 4.27 (d, J = 17.36 Hz, 1H), 3.97 - 4.11 (m, 3H), 3.80 - 3.89 (m, 1H), 3.73 (dd, J = 4.03, 9.90 Hz, 1H), 3.29 - 3.48 (m , 3H), 2.99 (q, J = 11.09 Hz, 1H), 2.72 - 2.85 (m, 2H), 2.49 - 2.55(m, 4H), 2.44 (s, 3H), 1.94 - 2.10 (m, 2H), 1.35 (s, 3H), 1.19 (s, 3H), 1.11 (t, J = 7.15 Hz, 3H).

Compound 76B : LC-MS (ESI): The calculated mass for C ₃₁ H ₃₇ F ₃ N ₅ O ₅ S is 648.2, and the found m/z is 649.4 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.31 (s, 1H), 7.09 - 7.01 (m, 1H), 7.01 - 6.93 (m, 2H), 6.90 (t, J = 8.56 Hz, 1H), 6.00 (s , 1H), 4.32 (d, J = 17.3 Hz, 1H), 4.15 - 3.91 (m, 3H), 3.91 - 3.75 (m, 1H), 3.67 (br dd, J = 2.45,10.51 Hz, 1H), 3.50 (dt, J = 7.47,14.5 Hz, 1H), 3.37 - 3.12 (m, 2H), 3.07 - 2.79 (m, 3H), 2.74 - 2.65 (m, 1H), 2.53 (d, J = 1.83 Hz, 4H ), 2.43 (s, 3H), 1.97 - 1.94 (m, 2H), 1.38 - 1.30 (m, 3H), 1.22 - 1.15 (m, 3H), 1.11 (t, J = 7.09 Hz, 3H) of compound 77B Preparation : (R*)-4-(( cis )-4-(((S*)-5-( ethoxycarbonyl )-4-(3- fluoro -2 -methylphenyl )-2- (4 -methylthiazol- 2- yl )-4H-1l2- pyrimidin -6- yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H)- base )-3 - fluoro -2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 77B was prepared starting from S8-7A and intermediate H7B using the same procedure as described for compounds 10A and 10B .

LC-MS (ESI): Calculated mass for C ₃₁ H ₃₆ F ₄ N ₅ O ₄ S is 650.2, found m/z is 651.4 [M+H] ⁺ .

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.72 - 9.44 (m, 1H), 7.09 - 6.87 (m, 4H), 5.99 (s, 1H), 4.39 - 4.15 (m, 1H), 4.14 - 3.94 (m, 3H), 3.90 - 3.73 (m, 1H), 3.61 - 3.43 (m, 1H), 3.28 (m, 1H), 3.10 - 2.90 (m, 2H), 2.80 - 2.62 (m, 1H), 2.52 (d, J = 1.83 Hz, 3H), 2.46 - 2.38 (m, 3H), 2.13 - 1.86 (m, 2H), 1.32 (s, 3H), 1.20 - 1.30 (m,6H), 1.11 (t, J = 7.09 Hz , 3H) Preparation of compound 78A : (S*)-4-(( cis )-4-(((S*)-4-(2- cyano - 3 -fluorophenyl )-5-( ethoxy ylcarbonyl )-2-( thiazol- 2- yl )-4H-1l2- pyrimidin -6- yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1(2H ) -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid (single diastereomer)

Compound 78A was prepared starting from S3-6 and intermediate H23A using the same procedure as described for compounds 10A and 10B .

LCMS (ESI): mass calculated for C ₃₀ H ₃₂ F ₃ N ₆ O ₅ S 645.2, found m/z 646.4 [M+H] ⁺ .

¹ HNMR (400 MHz, DMSO-d ₆ ) δ 12.03 (br s, 1H), 9.59 (s, 1H), 8.02 (d, J = 3.18 Hz, 1H), 7.97 (d, J = 3.18 Hz, 1H) , 7.77 (dt, J = 5.99, 8.13 Hz, 1H), 7.40 - 7.48 (m, 2H), 5.93 (s, 1H), 4.45 (br s, 1H), 4.03 - 4.18 (m, 2H), 4.02 - 3.91 (m, 2H), 3.90 - 3.75 (m, 2H), 3.46 - 3.38 (m, 1H), 3.31 - 3.18 (m, 1H), 3.16 - 2.94 (m, 2H), 2.77 - 2.65 (m, 1H ), 2.64 - 2.55 (m, 1H), 1.91 - 1.71 (m, 2H), 1.12 - 0.96 (m, 9H) Preparation of compound 79A : (S*)-4-(( cis )-4-(( (S)-5-( ethoxycarbonyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-4H-1l2- pyrimidin -6- yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 79A was prepared starting from S8-8 and intermediate H1A using the same procedure as described for compounds 8A and 8B .

LCMS (ESI): mass calculated for C ₃₀ H ₃₅ F ₃ N ₅ O ₅ S 635.2, found m/z 636.3 [M+H] ⁺ .

¹ HNMR (400 MHz, methanol-d ₄ ) δ 7.91 (d, J = 3.18 Hz, 1H), 7.71 (d, J = 3.18 Hz, 1H), 7.06 - 7.18 (m, 2H), 6.93 (t, J = 8.77 Hz,1H), 5.95 (s, 1H), 4.63 (br s, 2H), 4.20 - 4.29 (m, 1H), 3.95 - 4.14 (m, 4H), 3.83 - 3.90 (m, 1H), 3.48 - 3.56 (m, 1H), 3.01 (br d, J = 11.25 Hz, 1H), 2.88 (dd, J = 12.72, 9.54 Hz, 1H), 2.75 (dd, J = 12.65, 3.36 Hz, 1H), 2.58 - 2.67 (m,1H), 2.50 (d, J = 1.96 Hz, 3H), 1.90 - 2.05 (m, 2H), 1.21 (s, 3H), 1.09 - 1.16 (m, 6H). Preparation of Compounds 80A and 80B : (S*)-4-(( cis )-4-(((S)-4-(2,3 -difluorophenyl )-5-( ethoxycarbonyl )- 2-( thiazol- 2- yl )-4H-1l2- pyrimidin -6- yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl ) -3 -Hydroxy- 2,2 -dimethylbutanoic acid (single diastereomer) and (R*)-4-(( cis )-4-(((S)-4-(2,3 -Difluorophenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-4H-1l2- pyrimidin -6- yl ) methyl ) -6,6 - difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-3 -hydroxy- 2,2 -dimethylbutanoic acid (single diastereomer)

Compounds 80A and 80B were prepared starting from S8-6 and intermediate H9 using the same procedure as described for compounds 10A and 10B .

Compound 80A : LCMS (ESI): mass calculated for C ₂₉ H ₃₃ F ₄ N ₅ O ₅ S 639.67, found m/z 640.3 [M+H] ⁺ . ¹ HNMR (400 MHz, methanol-d ₄ ) δ: 7.99 - 7.91 (m, 1H), 7.79 - 7.70 (m, 1H), 7.22 - 7.06 (m, 3H), 6.07 - 5.98 (m, 1H), 4.70 - 4.57 (m, 2H), 4.26 - 4.15 (m, 1H), 4.13 - 4.01 (m, 3H), 4.00 - 3.92 (m, 1H), 3.88 - 3.79 (m, 1H), 3.52 - 3.41 (m, 1H), 3.39 - 3.32 (m, 2H), 3.07 - 2.94 (m, 1H), 2.92 - 2.82 (m, 1H), 2.77 - 2.67 (m, 1H), 2.64 - 2.53 (m, 1H), 2.00 - 1.84 (m, 2H), 1.26 - 1.18 (m, 3H), 1.18 - 1.07 (m, 6H)

Compound 80B : LCMS (ESI): mass calculated for C ₂₇ H ₂₇ ClF ₃ N ₅ O ₅ S 626.05, found m/z 640.3 [M+H] ⁺ . ¹ HNMR (400 MHz, methanol-d ₄ ) δ: 7.97 - 7.90 (m, 1H), 7.80 - 7.71 (m, 1H), 7.25 - 7.06 (m, 3H), 6.07 - 5.98 (m, 1H), 4.71 - 4.57 (m, 2H), 4.25 - 4.15 (m, 1H), 4.13 - 3.99 (m, 3H), 4.00 - 3.91 (m, 1H), 3.90 - 3.78 (m, 1H), 3.50 - 3.39 (m, 1H), 3.29 - 3.21 (m, 2H), 3.05 - 2.89 (m, 2H), 2.74 - 2.58 (m, 2H), 2.00 - 1.85 (m, 2H), 1.24 - 1.07 (m, 9H) of compound 81 Preparation : 4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-4-(3- fluoro -2 -methylphenyl )-2-( thiazol- 2- yl )-4H-1l2- pyrimidin -6- yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-3,3 - difluoro- 2,2 -Dimethylbutanoic acid ( single diastereomer )

Compound 81 was prepared starting from S9 and intermediate H1A using the same procedure as described for compounds 8A and 8B .

LCMS (ESI): mass calculated for C ₃₀ H ₃₂ F ₅ N ₅ O ₄ S 653.2, found m/z 654.4 [M+H] ⁺ .

¹ HNMR (400 MHz, methanol-d ₄ ) δ 8.03 (d, J = 3.06 Hz, 1H), 7.92 - 7.96 (m, 1H), 7.17 - 7.30 (m, 2H), 7.01 (ddd, J = 9.60, 7.83, 1.53 Hz, 1H), 6.02 (s, 1H), 4.42 - 4.56 (m, 2H), 4.18 - 4.32 (m, 1H), 4.02 - 4.14 (m, 2H), 3.71 - 3.90 (m, 2H) , 3.47 - 3.64 (m, 2H), 3.33 - 3.46 (m, 2H), 2.79 - 2.86 (m, 1H), 2.47 (d, J = 1.96 Hz, 3H), 2.12 - 2.31 (m, 2H), 1.30 - 1.37 (m, 6H), 1.08 - 1.15 (m, 3H). Preparation of Compounds 82A , 82C and 82D : (R*)-3-(( cis )-4-(((S*)-6-(2,3 -difluorophenyl )-5-( ethoxy Carbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrole- 1( 2H) -yl )-2- hydroxy -2- methylpropanoic acid (single diastereomer) and ( R *)-3-(( cis )-4-((( R *)-6-( 2,3 -Difluorophenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -di Fluorohexahydropyrrolo [3,2-b] pyrrol- 1( 2H ) -yl )-2- hydroxy -2- methylpropanoic acid (single diastereomer) and ( S *)-3-( ( cis )-4-((( R *)-6-(2,3- Difluorophenyl )-5-( ethoxycarbonyl )-2-( thiazol- 2- yl )-3,6- Dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2 H ) -yl )-2- hydroxy -2- methylpropionic acid (single diastereomer)

Compounds 82C and 82D were prepared starting from S6 and intermediate H9B using the same procedures as described for compounds 8A and 8B , respectively.

Compound 82C : LC-MS (ESI): The calculated mass for C ₂₇ H ₂₉ F ₄ N ₅ O ₅ S is 611.6, and the found m/z is 612.2 [M+H] ⁺ .

¹ HNMR (400 MHz, CD ₃ OD) δ 7.97 (d, J = 3.2 Hz, 1H), 7.76 (d, J = 2.8 Hz, 1H), 7.19 - 7.11 (m, 3H), 6.06 (s, 1H) , 4.24 (d, J = 17.2 Hz, 1H), 4.11 - 4.03 (m, 3H), 3.77 - 3.72 (m, 2H), 3.38 - 3.35 (m, 0.7H), 3.30 - 3.22 (m, 2.3H) , 2.98 - 2.85 (m, 3H), 1.91 - 1.87 (m, 2H), 1.37 (s, 3H), 1.17 (t, J = 7.2 Hz, 3H).

Compound 82D : LC-MS (ESI): The calculated mass for C ₂₇ H ₂₉ F ₄ N ₅ O ₅ S is 611.6, and the found m/z is 612.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CD ₃ OD) δ 7.98 (d, J = 3.2 Hz, 1H), 7.76 (d, J = 3.2 Hz, 1H), 7.18 - 7.12 (m, 3H), 6.06 (s, 1H) , 4.23 (d, J = 17.2 Hz, 1H), 4.11 - 4.05 (m, 3H), 3.81 - 3.77 (m, 1H), 3.61 - 3.55 (m, 1H), 3.38 - 3.36 (m, 1H), 3.30 - 3.27 (m, 1H), 3.14 (d, J = 13.2 Hz, 1H), 3.02 - 2.93 (m, 2H), 2.83 - 2.77 (m, 1H), 1.95 - 1.89 (m, 2H), 1.38 (s , 3H), 1.18 (t, J = 7.2 Hz, 3H). Preparation of Compound 83A : (S*)-4-(( cis )-4-(((R*)-6-(2,3 -difluorophenyl )-5-( methoxycarbonyl )-2 -( thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydropyrrolo [3,2-b] pyrrol- 1(2H) -yl )-3 -Hydroxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 83A was prepared starting from S1-4 and intermediate H8A using the same procedure as described for compounds 8A and 8B .

LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ F ₄ N ₅ O ₅ S is 625.2, found m/z is 626.2 [M+H] ⁺ .

¹ HNMR (400 MHz, CD ₃ OD) δ 7.98 (d, J = 3.6 Hz, 1H), 7.77 (d, J = 3.2 Hz, 1H), 7.19 - 7.14 (m, 3H), 6.06 (s, 1H) , 4.24 (d, J = 16.4 Hz, 1H), 4.10 (d, J = 17.2 Hz, 1H), 3.98 - 3.95 (m, 1H), 3.90 - 3.84 (m, 1H), 3.65 (s, 3H), 3.52 - 3.46 (m, 1H), 3.41 - 3.37 (m, 2H), 3.06 - 2.99 (m, 1H), 2.91 - 2.86 (m, 1H), 2.79 - 2.75 (m, 1H), 2.65 - 2.59 (m , 1H), 2.04 - 1.91 (m, 2H), 1.23 (s, 3H), 1.16 (s, 3H). Compound 84B : (R*)-4-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -methoxy- 2,2 -dimethylbutanoic acid- D ( single diastereomer )

Using a procedure similar to compound 66A , compound 84B was prepared by substituting intermediate H1A for intermediate H22B .

By prep-HPLC (column: Waters Xbrige C18 (5 um 19 * 150 mm), mobile phase A: water (0.1% ammonium bicarbonate), mobile phase B: acetonitrile, UV: 214 nm, flow rate: 15 mL/min , gradient: 20% - 70% (%B)) to give Compound 84B (66.8 mg, 72.7% yield, 99.2% pure by LCMS) as a yellow solid.

中間體 R7 的製備

中間體 R7 ： (R*)-4-(2- 氯 -4- 氟苯基 )-6-((( 順式 )-6,6- 二氟六氫 -4H- 吡咯并 [3,2-c] 異㗁唑 -4- 基 ) 甲基 )-2-( 噻唑 -2- 基 )-1,4- 二氫嘧啶 -5- 甲酸乙酯 （單一非鏡像異構物） ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.16 (brs, 1H), 7.82 (d, J = 3.2 Hz, 1H), 7.42 (d, J = 2.8 Hz, 1H), 7.10 - 7.05 (m, 1H), 6.97 - 6.89 (m, 2H), 4.32 - 4.22 (m, 3H), 4.10 - 3.96 (m, 4H), 3.64 - 3.61 (m, 1H), 3.56 - 3.53 (m, 1H), 3.51 (s, 3H ), 3.50 - 3.47 (m, 1H), 3.10 - 3.01 (m, 3H), 2.53 (s, 3H), 1.28 (s, 3H), 1.24 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). LC-MS (ESI): Calculated mass for C ₃₀ H ₃₅ DF ₃ N ₅ O ₆ S is 652.2, found m/z is 653.3 [M+H] ⁺ . Compounds 85A and 85B :

Preparation of intermediate R7

Intermediate R7 : (R*)-4-(2- chloro- 4 - fluorophenyl )-6-((( cis )-6,6 -difluorohexahydro- 4H- pyrrolo [3,2- c] Ethyl isoxazol- 4 -yl ) methyl )-2-( thiazol- 2- yl )-1,4- dihydropyrimidine- 5 -carboxylate (single diastereomer)

Intermediate R7 was prepared sequentially from Intermediate H19A and Intermediate T1-12B according to typical coupling method 1 and typical de-Fmoc protection method 6 .

Purification by silica gel chromatography (petroleum ether:ethyl acetate=5:1 to 2:1) afforded intermediate R7 (493 mg, 93% purity by LCMS, 87% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₂ H ₂₁ ClF ₃ N ₅ O ₃ S is 527.9, found m/z is 527.9 [M+H] ⁺ . Compound 85A : (S*)-4-(( cis )-4-(((R*)-6-(2- chloro- 4 - fluorophenyl )-5-( ethoxycarbonyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazole- 1- base )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

This compound was prepared sequentially according to typical reductive amination method 4 from intermediate R7 and intermediate N1 , chiral separation, typical tertiary butyl ester deprotection method 5.

By chiral Prep.HPLC (separation conditions: column: column Chiralpak OD 5 um * 30 * 250 mm; mobile phase: Hex: IPA: DEA = 90: 10: 0.2, at 15 mL/min; temperature 30 ° C; Wavelength: 254 nm, back pressure 100 bar) separation.

Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 50% to 95%) afforded Compound 85A (55 mg, 98.6% purity by LCMS, 50% yield) as a pale yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ ClF ₃ N ₅ O ₆ S is 671.1, found m/z is 672.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.23 (brs, 1H), 7.84 (d, J = 3.2 Hz, 1H), 7.43 (d, J = 3.2 Hz, 1H), 7.14 - 7.11 (m, 1H), 6.94 - 6.89 (m, 1H), 6.19 (s, 1H), 4.29 - 4.21 (m, 3H), 4.05 - 4.00 (m, 4H), 3.70 - 3.65 (m, 5H), 3.48 - 3.37 (m, 1.5 H), 3.13 - 3.06 (m, 2.5H), 2.89 - 2.84 (m, 1H), 1.26 (s, 3H), 1.20 (s, 3H), 1.13 (t, J = 7.2 Hz, 3H). Compound 85B : (R*)-4-(( cis )-4-(((R*)-6-(2- chloro- 4 - fluorophenyl )-5-( ethoxycarbonyl )-2- ( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1- base )-3 -methoxy- 2,2 -dimethylbutanoic acid ( single diastereomer )

Compound 85B was prepared analogously to Compound 85A .

中間體 N3的製備：

中間體 N3-1 ： 1-( 苄基氧基 ) 己 -5- 烯 -2- 醇 Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 50% to 95%) gave Compound 85B (150 mg, 99.5% purity by LCMS, 65% yield) as a pale yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ ClF ₃ N ₅ O ₆ S is 671.1, found m/z is 672.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.20 (brs, 1H), 7.84 (d, J = 3.2 Hz, 1H), 7.44 (d, J = 3.2 Hz, 1H), 7.14 - 7.11 (m, 1H), 6.94 - 6.89 (m, 1H), 6.19 (s, 1H), 4.23 (s, 3H), 4.09 - 3.95 (m, 4.5H), 3.63 - 3.44 (m, 7.5H), 3.09 - 3.00 (m, 3H ), 1.27 (s, 3H), 1.23 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H). Compound 86 : 5-((3aS*,6aS*)-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazole -2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl ) -4 -methoxy- 2,2 -dimethylpentanoic acid

Preparation of intermediate N3 :

Intermediate N3-1 : 1-( Benzyloxy ) hex -5- en -2- ol

To a suspension of copper(I) iodide (1.20 g, 6.30 mmol) in THF (50 mL) at -40°C was added 1.7 M solution of allylmagnesium chloride in THF (78.0 mL, 132.6 mmol) , and the resulting mixture was stirred at -40 °C for 30 min. 2-((Benzyloxy)methyl)oxirane (11.0 g, 67.01 mmol) was then added to the resulting mixture. The mixture was stirred at -40°C for 15 min and at -25°C for a further 1.75 hours. The reaction mixture was quenched with saturated ammonium chloride (40 mL) and extracted with ethyl acetate (100 mL). The combined organic layers were washed with brine (50 mL), dried over Na ₂ SO _4(s) , filtered and concentrated to give a residue, which was purified by silica gel column chromatography (petroleum ether:ethyl acetate=20: 1 to 10:1) purification afforded Intermediate N3-1 (15 g, 90% purity by ¹ H NMR, 98% yield) as a pale yellow oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.38 - 7.29 (m, 5H), 5.88 - 5.78 (m, 1H), 5.06 - 5.02 (m, 1H), 4.99 - 4.96 (m, 1H), 4.56 (s, 2H), 3.87 - 3.81 (m, 1H), 3.53 - 3.50 (m, 1H), 3.37 - 3.33 (m, 1H), 2.27 - 2.09 (m, 3H), 1.63 - 1.47 (m, 2H). Intermediate N3-2 : (((2 -methoxyhex- 5- en- 1 -yl ) oxy ) methyl ) benzene

To a solution of Intermediate N3-1 (15.0 g, 90% purity, 65.4 mmol) in N,N-dimethylformamide (70 mL) was added 60% by weight sodium hydride in mineral oil (8.00 g, 200 mmol). After stirring at 0°C for 0.5 hours, iodomethane (29.0 g, 204 mmol) was added to the mixture and stirred for 2 hours. The mixture was quenched with water (100 mL) and extracted twice with ethyl acetate (100 mL). The combined organic layers were washed with brine (50 mL), dried over Na ₂ SO _4(s) and filtered. The filtrate was concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10: 1) to obtain Intermediate N3-2 (13 g, according to ¹ HNMR purity 90%, 81% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.36 - 7.29 (m, 5H), 5.87 - 5.77 (m, 1H), 5.05 - 5.00 (m, 1H), 4.98 - 4.95 (m, 1H), 4.56 (s, 2H), 3.50 - 3.49 (m, 2H), 3.42 (s, 3H), 3.40 - 3.32 (m, 1H), 2.15 - 2.07 (m, 2H), 1.63 - 1.60 (m, 2H). Intermediate N3-3 : 5-( Benzyloxy )-4 -methoxypentanoic acid

To a solution of Intermediate N3-2 (10.0 g, 90% purity, 40.9 mmol) in dichloromethane (20 mL) and acetonitrile (20 mL) was added in water (30 mL) at 0 °C Sodium iodate (35.00 g, 163.6 mmol), and ruthenium(III) chloride (850 mg, 4.10 mmol). After stirring at 0 °C for 3 h, the reaction mixture was diluted with water (100 mL) and extracted twice with dichloromethane (80 mL). The combined organic layers were washed with brine (30 mL), dried over Na ₂ SO _4(s) , filtered and concentrated to give a residue, which was purified by C18 column (acetonitrile:water = 50% to 80%) to give Intermediate N3-3 (6 g, 81% purity by LCMS, 50% yield) as pale yellow oil. LC-MS (ESI): calculated mass for C ₁₃ H ₁₈ O ₄ is 238.1, found m/z is 239.0 [M+H] ⁺ . Intermediate N3-4 : tertiary butyl 5-( benzyloxy )-4 -methoxyvalerate

To a solution of intermediate N3-3 (6.00 g, 81% purity, 20.4 mmol) in dichloromethane (30 mL) was added tertiary butyl N,N'-diisopropylisourea at 0°C (15.0 g, 80% purity, 59.9 mmol). After stirring at room temperature under nitrogen atmosphere overnight, the reaction mixture was diluted with water (20 mL) and extracted twice with ethyl acetate (20 mL). The combined extracts were washed with brine (10 mL), dried over Na ₂ SO _4(s) , filtered and concentrated. The residue was purified by C18 column (acetonitrile: water = 60% to 80%) to give Intermediate N3-4 ( 4.5 g, 90% purity by ¹ HNMR, 67% yield) as light yellow oil . ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.34 - 7.29 (m, 5H), 4.55 (s, 2H), 3.49 - 3.47 (m, 2H), 3.41 - 3.36 (m, 4H), 2.32 - 2.28 (m, 2H), 1.90 - 1.75 (m, 2H), 1.44 (s, 9H). Intermediate N3-5 : tertiary butyl 5-( benzyloxy )-4 -methoxy- 2- methylpentanoate

To a solution of intermediate N3-4 (2.80 g, 90% purity, 8.56 mmol) in THF (20 mL) was added 2 M lithium diisopropylamide in THF at -70 °C under nitrogen atmosphere (12 mL, 24 mmol). After stirring at -70°C for 1 hour, iodomethane (2.50 g, 17.6 mmol) was added to the mixture at -70°C and stirred at this temperature for 5 hours. The reaction mixture was then quenched with saturated ammonium chloride (10 mL) and extracted with ethyl acetate (10 mL). The combined organic layers were washed with brine (10 mL), dried over Na ₂ SO _4(s) , filtered and concentrated to give a residue, which was purified by C18 column (acetonitrile:water = 50% to 80%) to give Intermediate N3-5 (2.1 g, 90% purity by ¹ H NMR, 72% yield) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.34 - 7.29 (m, 5H), 4.55 (s, 2H), 3.50 - 3.46 (m, 2H), 3.41 - 3.36 (m, 4H), 2.61 - 2.53 (m, 0.5H), 2.48 - 2.40 (m, 0.5H), 1.96 - 1.88 (m, 0.5H), 1.84 - 1.78 (m, 0.5H), 1.57 - 1.48 (m, 1H), 1.44 - 1.43 (m, 9H ), 1.14 - 1.12 (m, 3H). Intermediate N3-6 : Tertiary butyl 5-( benzyloxy )-4 -methoxy- 2,2 -dimethylpentanoate

To a solution of intermediate N3-5 (2.10 g, 90% purity, 6.13 mmol) in THF (20 mL) was added a 2 M solution of lithium diisopropylamide in THF ( 6.0 mL, 12 mmol). After stirring at -70°C for 1 hour, iodomethane (2.60 g, 18.3 mmol) was added to the mixture at -70°C and stirred at this temperature for 5 hours. The reaction mixture was quenched with saturated ammonium chloride (10 mL) and extracted with ethyl acetate (10 mL). The combined organic layers were washed with brine (10 mL), dried over Na ₂ SO ₄ (s), filtered and concentrated to give a residue, which was purified by silica gel column chromatography (petroleum ether:ethyl acetate=10: 1) Purification gave a colorless oil. To a solution of the above colorless oil in THF (20 mL) was added a 2 M solution of lithium diisopropylamide in tetrahydrofuran (4 mL, 8 mmol) at -70 °C under nitrogen atmosphere. After stirring at -70°C for 1 hour, iodomethane (2.2 g, 15.500 mmol) was added to the mixture at -70°C and stirred for another 5 hours. The reaction mixture was then quenched with saturated ammonium chloride (10 mL) and extracted with ethyl acetate (10 mL). The combined organic layers were washed with brine (10 mL), dried over Na ₂ SO ₄ (s), filtered and concentrated to give a residue, which was purified by silica gel column chromatography (petroleum ether:ethyl acetate=10: 1) Purification afforded intermediate N3-6 (1.8 g, 90% purity according to ¹ H NMR, 98% yield) as a colorless oil. ¹ HNMR (400 MHz, CDCl ₃ ) δ 7.34 - 7.29 (m, 5H), 4.54 (s, 2H), 3.50 - 3.39 (m, 3H), 3.35 (s, 3H), 1.88 - 1.82 (m, 1H) , 1.60 - 1.57 (m, 1H), 1.42 (s, 9H), 1.16 (s, 3H), 1.13 (s, 3H). Intermediate N3-7 : Tertiary butyl 5- hydroxy- 4 -methoxy- 2,2 -dimethylpentanoate

To a solution of intermediate N3-6 (1.80 g, 90% purity, 5.02 mmol) in ethyl acetate (5 ml) was added 10% palladium on activated carbon (1.10 g, 1.03 mmol) at room temperature. After stirring under a hydrogen atmosphere (balloon) at room temperature for 6 hours, the reaction mixture was filtered and the filtrate was concentrated to afford Intermediate N3-7 (1.2 g, 90% purity by ¹ HNMR, 93% yield) as a colorless oil. Rate). ¹ HNMR (400 MHz, CDCl ₃ ) δ 3.72 (dd, J = 11.6, 3.2 Hz, 1H), 3.42 (dd, J = 11.6, 4.8 Hz, 1H), 3.33 (s, 3H), 3.30 - 3.26 (m , 1H), 2.04 - 1.98 (m, 1H), 1.90 (dd, J = 14.4, 8.0 Hz, 1H), 1.56 (dd, J = 14.4, 4.4 Hz, 1H), 1.43 (s, 9H), 1.16 ( s, 3H), 1.15 (s, 3H). Intermediate N3 : tertiary butyl 4 -methoxy- 2,2 -dimethyl -5 -pentoxypentanoate

To a solution of intermediate N3-7 (1.20 g, 90% purity, 4.65 mmol) in dichloromethane (20 mL) was added Dess-Martin periodinane (2.20 g, 5.19 mmol) under nitrogen atmosphere. After stirring overnight at room temperature under a nitrogen atmosphere, the mixture was filtered and the filtrate was concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 10: 1 to 5: 1), Intermediate N3 was obtained as a yellow oil (1.1 g, 90% purity by ¹ H NMR, 92% yield).

¹ HNMR (400 MHz, CDCl ₃ ) δ 9.63 (s, 1H), 3.62 - 3.58 (m, 1H), 3.37 (s, 3H), 1.90 - 1.83 (m, 1H), 1.78 - 1.73 (m, 1H) , 1.43 (s, 9H), 1.19 (s, 3H), 1.16 (s, 3H). Compound 86 : 5-((3aS*,6aS*)-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( thiazole -2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl ) -4 -methoxy- 2,2 -dimethylpentanoic acid

This compound was prepared sequentially according to typical reductive amination method 4 from intermediate R1 and intermediate N3 , typical tertiary butyl ester deprotection method 5.

中間體 T9-1 ： 2,2- 二甲基己 -5- 烯酸三級丁酯 Purification by C18 column (acetonitrile: water = 5% to 95%) afforded Compound 86 (27.6 mg, 98.6% purity, 65% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₁ H ₃₈ F ₃ N ₅ O ₆ S is 665.2, found m/z is 666.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.22 (br s, 1H), 7.84 - 7.82 (m, 1H), 7.43 (s, 1H), 7.10 - 7.05 (m, 1H), 6.98 - 6.89 (m, 2H ), 6.01 (s, 1H), 4.35 - 4.20 (m, 3H), 4.09 - 3.91 (m, 4H), 3.66 - 3.50 (m, 2.5H), 3.48 (s, 1.5H), 3.44 - 3.38 (m , 0.5H), 3.33 (s, 1.5H), 3.13 - 3.06 (m, 1.5H), 2.93 - 2.83 (m, 1H), 2.71 - 2.66 (m, 0.5H), 2.54 (s, 3H), 2.00 - 1.92 (m, 1.5H), 1.63 - 1.59 (m, 0.5H), 1.28 - 1.24 (m, 6H), 1.12 (t, J = 7.2 Hz, 3H). Preparation of intermediate T9 :

Intermediate T9-1 : Tertiary butyl 2,2 -dimethylhex- 5- enoate

To a stirred solution of 2.0 M lithium diisopropylamide (48 mL, 96 mmol) in tetrahydrofuran (100 mL) in n-heptane/THF/ethylbenzene was added dropwise at -65°C Tertiary butyl isobutyrate intermediate T8-1 (6.00 g, 90% purity, 37.4 mmol) was added. After 1 hour, hexamethylphosphoramide (9.64 g, 48.9 mmol) was added at -65°C and stirred for 10 minutes. Then 4-bromobut-1-ene (7.98 g, 59.1 mmol) was added, warmed to room temperature and stirred for 16 hours. The reaction was poured into saturated aqueous ammonium chloride (200 mL) and separated. The aqueous layer was extracted twice with ethyl acetate (200 mL). The combined organic layers were washed with brine (300 mL), and dried over anhydrous sodium sulfate. The mixture was filtered, and the filtrate was concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (eluted with petroleum ether: ethyl acetate = 100: 1) to obtain the desired product as a colorless oil (5.60 g, 85% pure by ¹ HNMR, 64% yield).

¹ HNMR (300 MHz, CDCl ₃ ) δ 5.92 - 5.76 (m, 1H), 5.05 (d, J = 16.8 Hz, 1H), 4.99 (d, J = 6.9 Hz, 1H), 2.09 - 2.02 (m, 2H ), 1.65 - 1.59 (m, 2H), 1.49 (s, 9H), 1.19 (s, 6H). Intermediate T9 : tertiary butyl 2,2 -dimethyl -5 -pentoxypentanoate

Bubble ozone through tert-butyl 2,2-dimethylhex-5-enoate Intermediate T9-1 (5.60 g, 85% purity, 24.0 mmol) in dichloromethane (120 mL) at -65 °C ) in the solution. After 15 minutes, the color of the solution turned blue. Stirring was then continued for an additional 30 minutes and ozone was bubbled through the solution until the blue color turned colorless. Dimethyl sulfide (50 mL) was added, and the mixture was warmed to 25° C. and stirred for 16 hours. The mixture was filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluted with petroleum ether: ethyl acetate = 50:1 to 20:1) to obtain the desired compound as a colorless oil (2.1 g, according to ¹ HNMR purity of 95%, 41% yield). ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.77 (t, J = 1.6 Hz, 1H), 2.45 - 2.41 (m, 2H), 1.84 - 1.80 (m, 2H), 1.44 (s, 9H), 1.15 (s , 6H). Compound 87B : (S)-5-(( cis )-4-(((S)-5-( ethoxycarbonyl )-6-(3- fluoro -2 -methylphenyl )-2-( Thiazol- 2- yl )-3,6 -dihydropyrimidin- 4 -yl ) methyl )-6,6 -difluorohexahydro- 1H- pyrrolo [3,2-c] isoxazol- 1 -yl )-4 - fluoro -2,2 -dimethylpentanoic acid (single diastereomer)

This compound was prepared using a procedure similar to compound 19 by substituting Intermediate T9 for Intermediate T3-3 , Intermediate H1A for Intermediate H7B , and hydrolysis of the tertiary butyl ester with TFA in DCM. The desired product was obtained as a yellow solid (35 mg, 98% purity by LCMS, 87% yield).

LC-MS (ESI): RT = _3.417 min, calculated mass for C ₃₀ H ₃₅ F ₄ N ₅ O ₅ S is 653.2, found m/z is 654.2 [M+H] ⁺ . ¹ HNMR (400 MHz, CDCl ₃ ) δ 9.19 (br s, 1H), 7.81 (d, J = 3.2 Hz, 1H), 7.40 (d, J = 3.2 Hz, 1H), 7.07 (q, J = 7.6 Hz , 1H), 6.96 (d, J = 7.6 Hz, 1H), 6.90 (t, J = 8.8 Hz, 1H), 6.00 (s, 1H), 5.05 - 4.87 (m, 1H), 4.33 - 4.21 (m, 3H), 4.11 - 3.97 (m, 4H), 3.72 - 3.67 (m, 1H), 3.52 - 3.40 (m, 1H), 3.14 - 2.93 (m, 3H), 2.53 (d, J = 1.2 Hz, 3H) , 2.12 - 2.02 (m, 1H), 1.88 - 1.74 (m, 1H), 1.31 (s, 3H), 1.30 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compounds 88A and 88B :

(S*)-4-((cis)-4-(((R*)-5-(ethoxycarbonyl)-2-(thiazol-2-yl)-6-(2,3,4- Trifluorophenyl)-3,6-dihydropyrimidin-4-yl)methyl)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isozazol-1-yl) -3-methoxy-2,2-dimethylbutanoic acid and (R*)-4-((cis)-4-(((R*)-5-(ethoxycarbonyl)-2- (Thiazol-2-yl)-6-(2,3,4-trifluorophenyl)-3,6-dihydropyrimidin-4-yl)methyl)-6,6-difluorohexahydro-1H- Pyrrolo[3,2-c]isoxazol-1-yl)-3-methoxy-2,2-dimethylbutanoic acid

These two compounds were prepared analogously to 66A/B.

Compound 88A: Purification by C18 column (acetonitrile: water = 40% to 75%) afforded the title compound (50 mg, 96% purity by LCMS, 54% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₂ F ₅ N ₅ O ₆ S is 673.2, found m/z is 674.2 [M+H] ⁺ . ¹ H NMR (400 MHz, CD ₃ OD) δ 7.95 (d, J = 2.8 Hz, 1H), 7.77 (d, J = 2.8 Hz, 1H), 7.23 - 7.17 (m, 1H), 7.13 - 7.07 (m , 1H), 6.01 (s, 1H), 4.37 - 4.36 (m, 1H), 4.27 (s, 2H), 4.12 - 4.07 (m, 2H), 4.01 - 4.00 (m, 2H), 3.87 - 3.82 (m , 2H), 3.64 (s, 3H), 3.38 - 3.35 (m, 0.5H), 3.29 - 3.28 (m, 0.5H), 3.17 - 3.11 (m, 1H), 3.08 - 3.04 (m, 1H), 2.75 - 2.70 (m, 1H), 1.21 - 1.17 (m, 6H), 1.09 (s, 3H).

Compound 88B: Purification by C18 column (acetonitrile: water = 40% to 60%) afforded the title compound (50 mg, 98.3% purity by LCMS, 70% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₂ F ₅ N ₅ O ₆ S is 673.2, found m/z is 674.1 [M+H] ⁺ .

¹ H NMR (400 MHz, CD ₃ OD) δ 7.95 (d, J = 3.2 Hz, 1H), 7.76 (d, J = 3.2 Hz, 1H), 7.23 - 7.17 (m, 1H), 7.14 - 7.07 (m , 1H), 6.01 (s, 1H), 4.38 - 4.36 (m, 1H), 4.31 - 4.24 (m, 3H), 4.12 - 4.05 (m, 3H), 4.00 - 3.96 (m, 1H), 3.60 (s , 3H), 3.55 - 3.53 (m, 1H), 3.33 - 3.23 (m, 1H), 3.18 - 3.09 (m, 1H), 3.02 - 2.99 (m, 1H), 2.86 - 2.81 (m, 1H), 1.21 - 1.17 (m, 6H), 1.01 (s, 3H). Compounds 89A and 89B :

(S*)-4-((cis)-6,6-difluoro-4-(((R*)-5-(methoxycarbonyl)-2-(thiazol-2-yl)-6- (2,3,4-trifluorophenyl)-3,6-dihydropyrimidin-4-yl)methyl)hexahydro-1H-pyrrolo[3,2-c]isozazol-1-yl) -3-methoxy-2,2-dimethylbutanoic acid and (R*)-4-((cis)-6,6-difluoro-4-(((R*)-5-(methano Oxycarbonyl)-2-(thiazol-2-yl)-6-(2,3,4-trifluorophenyl)-3,6-dihydropyrimidin-4-yl)methyl)hexahydro-1H- Pyrrolo[3,2-c]isoxazol-1-yl)-3-methoxy-2,2-dimethylbutanoic acid

These two compounds were prepared analogously to 66A/B.

Compound 89A : Purification by C18 column (acetonitrile: water = 40% to 75%) afforded the title compound (54.2 mg, 55% yield, 98% purity by LCMS) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₀ F ₅ N ₅ O ₆ S is 659.2, found m/z is 660.2 [M+H] ⁺ . ¹ H NMR (400 MHz, CD ₃ OD) δ 7.95 (d, J = 3.2 Hz, 1H), 7.76 (d, J = 3.2 Hz, 1H), 7.20 - 7.15 (m, 1H), 7.12 - 7.00 (m , 1H), 6.01 (s, 1H), 4.38 - 4.36 (m, 1H), 4.27 (s, 2H), 4.04 - 4.00 (m, 2H), 3.87 - 3.81 (m, 2H), 3.65 - 3.64 (m , 6H), 3.39 - 3.36 (m, 0.5H), 3.29 - 3.26 (m, 0.5H), 3.18 - 3.05 (m, 2H), 2.77 - 2.71 (m, 1H), 1.18 (s, 3H), 1.11 (s, 3H).

Compound 89B : Purification by C18 column (acetonitrile: water = 40% to 60%) afforded the title compound (55 mg, 98.5% purity by LCMS, 56% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₀ F ₅ N ₅ O ₆ S is 659.2, found m/z is 660.2 [M+H] ⁺ . ¹ H NMR (400 MHz, CD ₃ OD) δ 7.84 (d, J = 3.2 Hz, 1H), 7.65 (d, J = 2.8 Hz, 1H), 7.10 - 7.04 (m, 1H), 7.01 - 6.94 (m , 1H), 5.89 (s, 1H), 4.26 - 4.23 (m, 1H), 4.18 - 4.10 (m, 2H), 3.96 - 3.90 (m, 2H), 3.84 - 3.78 (m, 1H), 3.53 (s , 3H), 3.52 - 3.49 (m, 1H), 3.41 (s, 3H), 3.28 - 3.25 (m, 0.5H), 3.19 - 3.16 (m, 0.5H), 3.08 - 2.98 (m, 1H), 2.92 - 2.82 (m, 2H), 1.10 (s, 3H), 1.04 (s, 3H). Compounds 90A and 90B : (S*)-4-((cis)-4-(((S*)-5-(ethoxycarbonyl)-6-(3-fluoro-2-methylphenyl) -2-(4-methylthiazol-2-yl)-3,6-dihydropyrimidin-4-yl)methyl)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c ]isozazol-1-yl)-3-methoxy-2,2-dimethylbutanoic acid and (R*)-4-((cis)-4-(((S*)-5- (Ethoxycarbonyl)-6-(3-fluoro-2-methylphenyl)-2-(4-methylthiazol-2-yl)-3,6-dihydropyrimidin-4-yl)methyl )-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isoxazol-1-yl)-3-methoxy-2,2-dimethylbutanoic acid

These two compounds were prepared analogously to 66A/B.

Compound 90A : Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 5% to 95%) afforded the title compound (21.0 mg, 99.0% purity by LCMS, 79.9% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₁ H ₃₈ F ₃ N ₅ O ₆ S is 665.3, found m/z is 666.4 [M+H] ⁺ . ¹ H NMR (400 MHz, CDCl ₃ ) δ 9.19 (s, 1H), 7.09 - 7.03 (m, 1H), 6.97 - 6.96 (m, 2H), 6.92 - 6.88 (m, 1H), 5.99 (s, 1H) ), 4.31 - 4.21 (m, 3H), 4.07 - 3.98 (m, 4H), 3.69 (s, 3H), 3.66 - 3.59 (m, 2H), 3.49 - 3.38 (m, 1H), 3.15 - 3.07 (m , 2H), 2.89 - 2.83 (m, 1H), 2.53 (d, J = 1.6 Hz, 3H), 2.44 (s, 3H), 1.28 (s, 3H), 1.20 (s, 3H), 1.12 (t, J = 7.2 Hz, 3H).

Compound 90B : Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 5% to 95%) afforded the title compound (71.0 mg, 99.9% purity by LCMS, 78.4% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₃₁ H ₃₈ F ₃ N ₅ O ₆ S is 665.3, found m/z is 666.4 [M+H] ⁺ . ¹ H NMR (400 MHz, CDCl ₃ ) δ 9.13 (s, 1H), 7.09 - 7.03 (m, 1H), 6.96 - 6.85 (m, 3H), 5.99 (s, 1H), 4.29 - 4.23 (m, 3H ), 4.09 - 3.96 (m, 4H), 3.60 - 3.44 (m, 6H), 3.13 - 3.07 (m, 1H), 3.04 - 2.98 (m, 2H), 2.53 (d, J = 1.6 Hz, 3H), 2.44 (s, 3H), 1.27 (s, 3H), 1.26 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H). Compounds 91A and 91B: (S*)-4-((cis)-4-(((R*)-6-(2-chloro-4-fluorophenyl)-5-(methoxycarbonyl)- 2-(5-Methyloxazol-4-yl)-3,6-dihydropyrimidin-4-yl)methyl)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c ]isozazol-1-yl)-3-methoxy-2,2-dimethylbutanoic acid and (R*)-4-((cis)-4-(((R*)-6- (2-Chloro-4-fluorophenyl)-5-(methoxycarbonyl)-2-(5-methyloxazol-4-yl)-3,6-dihydropyrimidin-4-yl)methyl )-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isoxazol-1-yl)-3-methoxy-2,2-dimethylbutanoic acid

This compound was prepared analogously to 66A/B.

Compound 91A : Purification by C18 column (acetonitrile:water (0.1% ammonium bicarbonate) = 05% to 95%) afforded the title compound (42 mg, 97.8% purity, 71% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ ClF ₃ N ₅ O ₇ is 655.2, found m/z is 656.1 [M+H] ⁺ . ¹ H NMR (400 MHz, CDCl ₃ ) δ 9.03 (br s, 1H), 7.68 (s, 1H), 7.17 - 7.13 (m, 2H), 6.95 - 6.88 (m, 1H), 6.14 - 6.01 (m, 1H), 4.31 - 4.21 (m, 3H), 4.01 - 3.94 (m, 2H), 3.71 - 3.64 (m, 5H), 3.59 (s, 3H), 3.48 - 3.32 (m, 2H), 3.12 - 3.06 ( m, 1H), 2.89 - 2.84 (m, 1H), 2.56 (s, 3H), 1.27 (s, 3H), 1.20 (s, 3H).

Compound 91B : Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 5% to 95%) afforded the title compound (170 mg, 99.6% purity, 79% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₉ H ₃₃ ClF ₃ N ₅ O ₇ is 655.2, found m/z is 656.1 [M+H] ⁺ . ¹ H NMR (400 MHz, CDCl ₃ ) δ 8.99 (br s, 1H), 7.72 (s, 1H), 7.17 - 7.12 (m, 2H), 6.94 - 6.88 (m, 1H), 6.14 - 6.02 (m, 1H), 4.33 - 4.17 (m, 3H), 4.08 - 4.04 (m, 1H), 3.96 - 3.93 (m, 1H), 3.63 - 3.55 (m, 5H), 3.54 - 3.47 (m, 4H), 3.06 - 3.00 (m, 3H), 2.56 (s, 3H), 1.27 (s, 3H), 1.24 (s, 3H). Compound 92C: (R*)-4-((cis)-4-(((S*)-6-(3,4-difluoro-2-methylphenyl)-5-(methoxycarbonyl )-2-(4-methylthiazol-2-yl)-3,6-dihydropyrimidin-4-yl)methyl)-6,6-difluorohexahydro-1H-pyrrolo[3,2- c] Isoxazol-1-yl)-3-methoxy-2,2-dimethylbutanoic acid

This compound was prepared analogously to compound 66A/B.

Compound 92C : Purification by C18 column (acetonitrile: 0.02% aqueous ammonium bicarbonate = 40% to 70%) afforded the title compound (35 mg, 33.3% yield, 96.9% purity by LCMS) as a yellow solid. LC-MS (ESI): The calculated mass for C ₃₀ H ₃₅ F ₄ N ₅ O ₆ S is 669.2, and the found m/z is 670.4 [M+H] ⁺ . ¹ H NMR (400 MHz, CD ₃ OD) δ 7.27 (s, 1H), 7.09 - 6.97 (m, 2H), 5.88 (s, 1H), 4.40 - 4.24 (m, 3H), 4.09 - 3.99 (m, 2H), 3.92 - 3.84 (m, 1H), 3.65 - 3.57 (m, 4H), 3.49 (s, 3H), 3.41 - 3.34 (m, 1H), 3.19 - 3.08 (m, 1H), 3.02 - 2.93 ( m, 2H), 2.58 (s, 3H), 2.45 (s, 3H), 1.19 (s, 3H), 1.16 (s, 3H). Compound 93B : (R*)-4-((cis)-4-(((R*)-6-(2-chloro-3-fluorophenyl)-5-(methoxycarbonyl)-2- (Thiazol-2-yl)-3,6-dihydropyrimidin-4-yl)methyl)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isoxazole-1- base)-3-methoxy-2,2-dimethylbutanoic acid

This compound was prepared analogously to compound 66A/B.

Compound 93B : Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 20% - 70%) afforded (55.1 mg, 99.6% purity, 69% yield) as a yellow solid. LC-MS (ESI): Calculated mass for C ₂₈ H ₃₁ ClF ₃ N ₅ O ₆ S is 657.2, found m/z is 658.2 [M+H]+. ¹ H NMR (400 MHz, CDCl ₃ ) δ 9.24 (s, 1H), 7.85 (d, J = 2.8 Hz, 1H), 7.45 (d, J = 3.2 Hz, 1H), 7.20 - 7.14 (m, 1H) , 7.09 - 7.02 (m, 2H), 6.24 (s, 1H), 4.24 - 4.21 (m, 3H), 4.10 - 4.06 (m, 1H), 3.96 (dd, J = 9.2, 3.2 Hz, 1H), 3.63 - 3.60 (m, 1H), 3.58 (s, 3H), 3.56 - 3.47 (m, 5H), 3.11 - 3.07 (m, 1H), 3.04 - 3.01 (m, 2H), 1.28 (s, 3H), 1.25 (s, 3H). Compound 94B :

(R*)-4-((cis)-4-(((R*)-6-(2-chloro-4-fluorophenyl)-5-(methoxycarbonyl)-2-(thiazole- 2-yl)-3,6-dihydropyrimidin-4-yl)methyl)-6,6-difluorohexahydro-1H-pyrrolo[3,2-c]isoxazol-1-yl)- 3-methoxy-2,2-dimethylbutanoic acid

This compound was prepared analogously to compound 66A/B.

Compound 94B : Purification by C18 column (acetonitrile: water (0.1% ammonium bicarbonate) = 20% to 95%) afforded the title compound as a yellow solid (75 mg, 99.6% pure by LCMS, 67.4% yield) . LC-MS (ESI): RT = 4.169 min, calculated mass for C _{28 H 31} ClF ₃ N ₅ O ₆ S is 657.2, found m/z is 658.1 [M+H] ⁺ . ¹ H NMR (400 MHz, CDCl ₃ ) δ 9.23 (br s, 1H), 7.85 (d, J = 3.2 Hz, 1H), 7.53 - 7.52 (m, 0.1H), 7.44 (d, J = 2.8 Hz, 0.9H), 7.25 - 7.23 (m, 1H), 7.15 - 7.12 (m, 1H), 6.94 - 6.89 (m, 1H), 6.17 (s, 0.9H), 6.08 (s, 0.1H), 4.28 - 4.18 (m, 3H), 4.10 - 4.06 (m, 1H), 3.98 - 3.94 (m, 1H), 3.63 - 3.60 (m, 1H), 3.59 (s, 3H), 3.57 - 3.46 (m, 5.6H), 3.09 - 2.98 (m, 3.4H), 1.28 (s, 3H), 1.25 (s, 3H).

The following compounds were prepared according to the synthetic procedures described above, or analogous synthetic procedures:

1A

1B

2B

3B

4B

5A

6A

7A

7B

8A

8B

9A

9B

10A

10B

11A

11B

12A

12B

13A

13B

14A

14B

15A

16A

16B

17A

17B

18

19

20

21

22

23

24

25

26

27

28

29

30

31

32

33

34

35

36

37

38A

38B

39

40A

40B

41

42

43

44

45

46

47

48

49

50

51A

51B

52A

52B

53A

53B

54A

54B

54C

54D

55

56

57A

57B

58A

58B

59A

59B

60A

60B

61A

61B

62

63A

63B

64B

65

66A

66B

67A

67B

68A

68B

69A

69B

70A

70B

71A

71B

72A

72B

73A

74A

74B

75A

75B

76A

76B

77B

78A

79A

80A

80B

81

82C

82D

83A

84B

85A

85B

86

87B

88A

88B

89A

89B

90A

90B

91A

91B

92C

93B

94B     實例 2 ： HepG2.2.15 細胞中的抗病毒測定 材料和設備1) 細胞系 [ Table 1 ]

1A

1B

2B

3B

4B

5A

6A

7A

7B

8A

8B

9A

9B

10A

10B

11A

11B

12A

12B

13A

13B

14A

14B

15A

16A

16B

17A

17B

18

19

20

twenty one

twenty two

twenty three

twenty four

25

26

27

28

29

30

31

32

33

34

35

36

37

38A

38B

39

40A

40B

41

42

43

44

45

46

47

48

49

50

51A

51B

52A

52B

53A

53B

54A

54B

54C

54D

55

56

57A

57B

58A

58B

59A

59B

60A

60B

61A

61B

62

63A

63B

64B

65

66A

66B

67A

67B

68A

68B

69A

69B

70A

70B

71A

71B

72A

72B

73A

74A

74B

75A

75B

76A

76B

77B

78A

79A

80A

80B

81

82C

82D

83A

84B

85A

85B

86

87B

88A

88B

89A

89B

90A

90B

91A

91B

92C

93B

94B Example 2 : Antiviral Assay Materials and Equipment 1) Cell Lines in HepG2.2.15 Cells

HepG2.2.15 (this HepG2.2.15 cell line can be produced by transfecting the HepG2 cell line, as in Sells, Chen and Acs 1987 (Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States] 84: 1005-1009) described, and the HepG2 cell line is available from the ATCC® under number HB-8065™). 2) Reagents

DMEM/F12 (INVITROGEN-11330032)

FBS (GIBCO-10099-141)

Dimethyl Oxon (DMSO) (SIGMA-D2650)

Penicillin-streptomycin solution (HYCLONE-SV30010)

NEAA (Invitrogen-1114050)

L-glutamine (Invitrogen-25030081)

Geneticin selective antibiotic (G418, 500 mg/ml) (Invitrogen-10131027)

Trypsin digestion solution (Invitrogen-25300062)

CCK8 (BIOLOTE-35004)

QIAamp 96 DNA Blood Kit (Kit) (12) (QIAGEN-51162)

FastStart Universal Probe Master Mix (ROCHE-04914058001) 3) Consumables

96-well cell culture plate (COSTAR-3599)

Micro Amp Optical 96-well reaction plate (Applied Biosystems (APPLIED BIOSYSTEMS)-4306737)

Micro Amp Optical 384-well reaction plate (Applied Biosystems) 4) Equipment

Plate reader (MOLECULAR DEVICES, SPECTRAMAX M2e)

Centrifuge (BECKMAN, ALLEGRA-X15R)

Real-time PCR system (Applied Biosystems, QUANTSTUDIO 6)

Real-time PCR system (Applied Biosystems, 7900HT) Method 1) Anti- HBV activity and cytotoxicity assay

HepG2.2.15 cells were plated in 2% FBS medium in 96-well plates at a density of 40,000 cells/well and 5,000 cells/well for HBV inhibitor activity and cytotoxicity assays, respectively. After overnight incubation at 37°C, 5% CO, cells were treated with compound-containing medium for 6 days (renew medium and compound after 3 days of treatment). Each compound was tested in triplicate at 1:3 serial dilutions at 8 different concentrations. For the anti-HBV activity assay, the highest concentration of the compound was 10 uM or 1 uM, and for the cytotoxicity assay, the highest concentration was 100 uM.

Cell viability was determined by CCK-8 assay. Six days after compound treatment, 20 μl of CCK-8 reagent was added to each well in the cytotoxicity assay plate. Incubate the cell culture plate at 37°C, 5% CO2 for 2.5 h. Measure the absorbance at a wavelength of 450 nm and the absorbance at a wavelength of 630 nm (the latter being the reference absorbance).

Compound-induced changes in HBV DNA levels were assessed by quantitative real-time polymerase chain reaction (qPCR). Briefly, HBV DNA in culture medium was extracted using the QIAamp 96 DNA blood kit according to the manual, and then quantified by real-time PCR assay using the primers and probes in Table 2 below.

[ Table 2 ] Primer or Probe sequence SEQ ID NO: HBV-Fw GTGTCTGCGGCGTTTTATCA 1 HBV-Rev GACAAACGGGCAACATACCTT 2 HBV-probe with FAM reporter and TAMRA quencher CCTCTKCATCCTGCTGCTATGCCTCATC 3 2) Data Analysis

EC ₅₀ and CC ₅₀ values were calculated by GRAPHPAD PRISM software. Data from this batch of experiments were considered acceptable if the CV% of the DMSO control was less than 15% and the reference compound showed the expected activity or cytotoxicity.

Results: See Table 3 below.

[ Table 3 ] Compound number EC50 (μM) CC50 (μM) Compound number EC50 (μM) CC50 (μM) 01A 0.014 22.8 53B 0.013 15.8 01B 0.002 21.4 54A 0.051 > 100 02B 0.005 33 54B 0.086 100 03B 0.001 20.8 54C 0.057 > 100 04B 0.001 29.8 54D 0.068 > 100 05A 0.001 30 55 0.282 > 50 06A 0.003 19.7 56 0.773 > 100 07A 0.0035 14.7 57A 0.3005 > 100 07B 0.0395 23.5 57B > 0.625 > 100 08A 0.009 25 58A 0.319 > 100 08B 0.004 > 50 58B 0.15 > 100 09A 0.0495 49.4 59A 0.049 > 100 09B 0.0065 25.3 59B 0.073 > 100 10A 0.046 > 50 60A 0.178 > 100 10B 0.034 > 25 60B 0.138 > 100 11A 0.011 67.9 61A 0.054 > 100 11B 0.007 90.6 61B 0.039 > 100 12A 0.056 > 50 62 0.024 18.3 12B 0.0405 > 100 63A 0.036 > 6.25 13A 0.038 > 50 63B 0.011 8.1 13B 0.028 > 50 64B 0.001 3 14A 0.014 81.8 65 0.29 100 14B 0.007 50 66A 0.002 > 50 15A 0.034 > 100 66B 0.0095 > 50 16A 0.068 39.7 67A 0.003 > 50 16B 0.043 100 67B 0.016 50 17A 0.189 > 100 68A 0.001 30.6 17B 0.085 > 100 68B 0.001 65.3 18 0.011 50 69A 0.001 > 50 19 0.008 32.4 69B 0.005 100 20 0.002 29.7 70A 0.001 32.4 twenty one 0.003 76.7 70B 0.0035 74.7 twenty two 0.01 45.7 71A 0.004 100 twenty three 0.005 50 71B 0.01 25 twenty four 0.003 23.8 72B 0.002 48 25 0.024 > 50 72A 0.012 50 26 0.0095 > 25 73 0.023 11.9 27 0.012 > 25 74A 0.099 > 100 28 0.019 50 74B 0.1 > 100 29 0.0095 25 75A 0.026 > 50 30 0.07 25 75B 0.0345 > 100 31 0.014 > 12.5 76A 0.003 31.5 32 0.01 > 50 76B 0.0125 21.7 33 0.26 > 100 77B 0.0045 34.4 34 0.008 36.8 78A 0.0133 19.1 35 0.008 44 79A 0.001 6.5 36 0.0225 > 50 80A 0.011 > 25 37 0.039 > 50 80B 0.035 > 25 38A 0.064 100 81 0.0085 13.2 38B 0.034 88.7 82C 0.098 > 50 39 0.1295 > 100 82D 0.021 > 50 40A 0.0285 > 100 83A 0.035 > 100 40B 0.024 > 100 84B 0.012 52 41 0.045 100 85A 0.025 72.8 42 0.0115 > 50 85B 0.016 100 43 0.013 100 86 0.009 50 44 0.042 > 100 87B 0.015 6.3 45 0.0455 > 100 88A 0.004 41.7 46 0.0425 80.3 88B 0.058 > 100 47 0.179 > 100 89A 0.011 88.95 48 0.167 > 100 89B 0.051 > 100 49 0.036 100 90B 0.012 > 50 50 0.055 100 90A 0.001 54 51A 0.029 > 100 91B 0.062 > 100 51B 0.005 31.4 91A 0.013 > 100 52A 0.044 > 6.25 92C 0.025 > 50 52B 0.011 > 3.13 93B 0.033 > 100 53A 0.0195 > 25 94B 0.031 > 100

none

none

none

Claims (20)

A compound of formula (I),

(I) includes deuterated, stereoisomeric or tautomeric forms thereof, wherein: R ¹ , R ² and R ³ are each independently selected from the group consisting of H, halogen, CN and C _1-3 alkane base ^; R is selected from the group consisting of thiazolyl, imidazolyl, oxazolyl and pyridyl, each of which can be optionally substituted by one or more substituents independently selected from CH or halogen; _R ⁵ is C _1-4 alkyl, X is selected from CH ₂ and O, R ⁶ and R ⁷ are independently selected from H and C _1-3 alkyl, R ⁸ is selected from H and C _1-6 alkyl, L is C _1-6 alkylene substituted by a) a substituent selected from OH and C _1-3 alkyloxy, or b) one or two halogens, the above C _1-3 alkyl, C _1- Each of ₃ alkoxy, C _1-4 alkyl and C _1-6 alkyl can be optionally substituted by one, two or three halogens, or a pharmaceutically acceptable salt or solvate thereof. The compound as claimed in item 1, wherein L is a group with formula (a)

(a) wherein R ^a1 is selected from OH and C _1-3 alkyloxy, and R ^a2 is selected from C _1-3 alkyl, or R ^a1 is selected from halogen, and R ^a2 is selected from C _1-3 alkyl. The compound as claimed in item 1, wherein L is a group with formula (b)

(b) wherein R ^b1 is selected from halogen, OH and C _1-3 alkyloxy, R ^{b2 is} selected from C _1-3 alkyl, R ^b3 and R ^b4 are H, or R ^b1 and R ^b2 are independently selected from H and C _1-3 alkyl, R ^b3 is selected from halogen, OH and C _1-3 alkyloxy, R ^b4 is H, or R ^b1 and R ^b2 are independently selected from H and C _1-3 alkyl, R ^b3 is selected from halogen, R ^b4 is selected from halogen and C _1-3 alkyl, or R ^b1 and R ^b2 are independently selected from H and C _1-3 alkyl, R ^b3 is selected from OH and C _1-3 alkyl Oxygen, R ^b4 is C _1-3 alkyl. The compound as claimed in item 1, wherein L is a group with formula (c)

(c) wherein R ^c1 is selected from halogen, OH and C _1-3 alkyloxy, R ^c2 is selected from C _1-3 alkyl, R ^c3 , R ^c4 , R ^c5 and R ^c6 are H, or R ^c1 and R ^c2 is independently selected from H and C _1-3 alkyl, R ^c3 is selected from halogen, OH and C _1-3 alkyloxy, R ^c4 , R ^c5 and R ^c6 are H, or R ^c1 and R ^c2 are independently is selected from H and C _1-3 alkyl, R ^C3 and R ^C4 are H, R ^C5 is selected from halogen, OH and C _1-3 alkyloxy, R ^C6 is selected from H and C _1-3 alkyl, Or ^Rc1 and ^Rc2 are independently selected from H and _C1-3 alkyl, ^Rc3 and ^Rc4 are H, ^Rc5 and ^Rc6 are halogen. The compound as claimed in item 1, wherein L is a group with formula (d)

( ^d ) wherein Rd1 and ^Rd2 are independently selected from C _1-3 alkyl, ^Rd3 , ^Rd4 , ^Rd5 and ^Rd6 are H, and ^Rd8 is selected from halogen, OH and C _1-3 alkyloxy , R ^d9 is selected from H and C _1-3 alkyl, or R ^d1 and R ^d2 are independently selected from H and C _1-3 alkyl, R ^d3 , R ^d4 , R ^d5 and R ^d6 are H, R ^d8 and R ^d9 is a halogen. The compound as described in any one of the preceding claims, wherein R ⁸ is H. The compound as described in any one of the preceding claims, wherein L-COOR ⁸ is selected from the group consisting of:

. The compound as described in any one of the preceding claims, wherein X is O. The compound according to any one of the preceding claims, wherein R ¹ , R ² and R ³ are each independently selected from the group consisting of H, F, Cl, CN and CH ₃ . The compound as described in any one of the preceding claims, wherein R ⁴ is selected from the group consisting of thiazolyl, imidazolyl and oxazolyl, each of which can be optionally substituted by one CH ₃ . The compound according to any one of the preceding claims, wherein R ⁵ is CH ₃ or C ₂ H ₅ . The compound as claimed in any one of the preceding claims, wherein R ⁶ and R ⁷ are independently selected from H and CH ₃ . The compound as described in any one of the preceding claims, which is selected from the group consisting of the following compounds:

. A pharmaceutical composition comprising the compound as described in any one of the preceding claims and further comprising at least one pharmaceutically acceptable carrier. The compound as described in any one of Claims 1 to 13 or the pharmaceutical composition as described in Claim 14 for use as a medicine. The compound as described in any one of claims 1 to 13 or the pharmaceutical composition as described in claim 14 is used for preventing or treating HBV infection or HBV-induced diseases in mammals in need. A product comprising a first compound and a second compound as a combined preparation for simultaneous, separate or sequential use in the prophylaxis or treatment of HBV infection or HBV-induced disease in a mammal in need thereof , wherein the first compound is different from the second compound, wherein the first compound is the compound as described in any one of claims 1 to 13 or the pharmaceutical composition as described in claim 14. A method for preparing a compound as described in any one of claims 1 to 13, the method comprising: making a compound of formula (I-2)

(I-2) wherein R ¹ -R ⁵ are as defined in any one of claims 1 to 13, and LG represents a suitable leaving group; and a compound of formula (V)

(V) wherein R ⁶ -R ⁸ , X and L are as defined in any one of claims 1 to 13; react under suitable nucleophilic substitution conditions. A use of the compound as described in any one of Claims 1 to 13 or the pharmaceutical composition as described in Claim 14 for preparing a medicament for treating HBV infection in an individual in need. A method for preparing the pharmaceutical composition as described in Claim 14, the method comprising: mixing at least one pharmaceutically acceptable carrier with a therapeutically effective amount of the compound as described in any one of Claims 1 to 13 .