TW202102256A - Hepatitis b immunisation regimen and compositions - Google Patents

Abstract

There is provided a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in a human, comprising the steps of: a) administering to the human a composition comprising an antisense oligonucleotide (ASO) 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO); b) administering to the human a composition comprising a replication-defective chimpanzee adenoviral (ChAd) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc); c) administering to the human a composition comprising a Modified Vaccinia Virus Ankara (MVA) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc); and d) administering to the human a composition comprising a recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and an adjuvant.

Description

Hepatitis B immune method and composition

The present invention relates to an immune method that is particularly suitable for the treatment of chronic hepatitis B, a method for the treatment of chronic hepatitis B, and a composition suitable for such schemes and methods. These schemes and methods involve the administration of a composition comprising antisense oligonucleotides, a composition comprising a carrier for delivering hepatitis B antigen, and a composition comprising recombinant hepatitis B antigen protein.

Hepatitis B virus is a DNA virus with a partial double-stranded circular DNA genome, the full-length chain is 3020-3320 nucleotides long and the shorter chain is 1700-2800 nucleotides long. Viral DNA is found in the nucleus shortly after infecting the cell. After infection, cellular DNA polymerase makes the viral genome fully double-stranded and ends connected. The viral core (C), surface (S) and X genes overlap with the viral polymerase (P) gene in the genome. Hepatitis B core antigen (HBcAg), pre-core and HBeAg are produced by different processes from a gene with two independent start codons. Similarly, surface genes have three start codons and produce three proteins of different lengths: large (pre-S1+pre-S2+S), medium (pre-S2+S), and small (S) surface antigens. Hepatitis B virus (HBV) infection is a major public health problem. Globally, about 257 million people are infected with HBV [WHO, 2017]. The clinical course and outcome of HBV infection are mainly driven by the age of infection and the complex interaction between the virus and the host immune response [Ott, 2012; Maini, 2016]. Therefore, exposure to HBV can cause acute hepatitis, which resolves spontaneously or can develop into various forms of chronic infection, including indolent hepatitis B surface antigen (HBsAg) carrier status, chronic hepatitis, cirrhosis, and hepatocellular carcinoma (HCC) [ Liaw, 2009]. The prevalence rate of HBsAg in the adult population is> 2%, the prevalence rate in Southeast Asia and China is 5-8%, and the prevalence rate in the African region is> 8%. 15%-40% of people with chronic hepatitis B infection (defined as the detection of serum HBsAg for more than 6 months) will have liver sequelae, of which liver cirrhosis (LC), liver decompensation and HCC are the main complications disease.

Although the implementation of universal preventive hepatitis B immunization in infants has been highly effective in reducing the incidence and prevalence of hepatitis B in many endemic countries, it has not yet caused chronic hepatitis B infection (CHB) in adolescents and adults. The prevalence rate of) is greatly reduced, and until decades after its introduction, it is not expected to affect HBV-related deaths. In 2015, hepatitis B caused 887,000 deaths, mainly from cirrhosis and HCC [WHO, 2017].

The clinical management of chronic hepatitis B aims to improve survival and quality of life by preventing disease progression, and thus prevent the development of HCC [Liaw, 2013]. Current treatment strategies are mainly based on the long-term inhibition of HBV DNA replication in order to stabilize HBV-induced liver disease and prevent progression. Serum HBV DNA content is a key indicator of all current treatment models. Achieving (detectable) loss of hepatitis B antigen (HBeAg) is another valuable biomarker. However, with or without anti-HBs seroconversion, HBsAg loss is generally regarded as representing "functional cure" "The best indicator because it shows significant inhibition of HBV replication and viral protein expression [Block, 2017; Cornberg, 2017]. Currently, there are two main treatment options for CHB patients: by pegylated interferon alpha (PegIFNα) or nucleating (s/t) agent analogs (NA) [EASL, 2017]. PegIFNα, which aims at the induction of long-term immune control with limited duration of treatment, can achieve long-lasting non-therapeutic control, but the long-lasting viral response and the loss of hepatitis B surface antigen (HBsAg) are limited to a small proportion of patients. In addition, due to its poor tolerability and long-term safety issues, a large number of patients are not suitable for this type of treatment.

NAs work by inhibiting DNA replication by inhibiting HBV polymerase reverse transcriptase activity. NAs approved for HBV treatment in Europe include entecavir (entecavir, ETV) and tenofovir disoproxil fumarate (TDF), which are associated with high barriers to HBV resistance. And tenofovir alafenamide (TAF) and lamivudine (LAM), adefovir dipivoxil (ADV) and dipivoxil (ADV) associated with the low barrier to HBV resistance Fuding (telbivudine, TBV). The main advantage of antagonistic effective NA therapy with a high barrier is its predictable and high long-term antiviral efficacy, resulting in HBV DNA suppression in most compliant patients and its favorable safety profile. The disadvantage of NA treatment is its long-term treatment plan, because NA usually does not achieve HBV eradication and NA interruption can make HBV relapse [Kranidioti, 2015]. The loss of HBsAg, which represents functional cure, is now the highest standard treatment index in CHB [Block, 2017; Cornberg, 2017], however, it is rarely achieved by NA treatment [Zoutendijk, 2011].

Because of the low serum clearance rate of HBsAg [Zoutendijk, 2011] and the high risk of non-NA virus recurrence [Kranidioti, 2015], most patients remain under long-term or even uncertain NA therapy, which can reduce the patient's compliance with the therapy , Increased financial costs and increased risk of drug toxicity and drug resistance mutations during long-term exposure [Terrault, 2015]. Therefore, new strategies are needed to complement NA therapy to achieve "functional cure" with limited options.

Antisense therapy is different from nucleoside therapy because it can directly target the RNA transcript of the antigen and thereby reduce serum HBeAg and HBsAg levels. In addition to antisense therapies and novel antiviral drugs, novel treatment strategies currently under study include immunotherapy strategies that enhance HBV-specific adaptive immune responses or activate innate intrahepatic immunity [Durantel, 2016]. So far, none of these experimental treatments have been shown to be effective. None of the evaluated vaccination strategies can induce a stable multifunctional CD8 ⁺ T cell response to the HBV core antigen (HBcAg), which is essential to restore immune control to the virus [Lau, 2002; Li, 2011; Liang, 2011; Bertoletti, 2012; Boni, 2012]. The early results of recombinant vaccines based on HBV surface and/or PreS antigens initially induced an antibody response but no HBV-specific CD8+ T cell response, and no clinical or virological benefits [Jung, 2002; Vandepapelière, 2007]. The DNA vaccine showing the HBV envelope failed to restore the specific T cell response to HBsAg and HBcAg, and therefore did not reduce the risk of recurrence in patients after NA interruption [Fontaine, 2015]. Under the new delivery system, DNA vaccine encoding S (primary vaccine) and MVA virus vector vaccine (additional vaccine), preS1/S2 showed no T cell induction or reduced viremia, indicating that HBV PreS and surface antigen alone are not enough to cure Patients [Cavenaugh, 2011]. In recent years, vaccine strategies targeting multiple HBV antigens and novel delivery systems have been studied. The recombinant HBsAg/HBcAg vaccine reduces the viral load to a very low level (ie about 50 IU/ml) in only half of the patients [Al-Mahtab, 2013]. DNA vaccines encoding S, preS1/S2, core, polymerase, and X proteins with genetically adjuvanted IL-12, and Lamefolin elicited a multispecific T cell response and reduced viral load> 2 log10 in half of the patients. However, no changes in quantitative detection of HBsAg, loss of HBsAg or HBsAg seroconversion were observed in any patient [Yang, 2012]. In virus-suppressed CHB patients, the GS-4774 vaccine, a yeast-based T cell vaccine that expresses large S, core, and HBV X proteins, does not provide a significant reduction in HBsAg [Lok, 2016].

The need for the treatment of chronic hepatitis B that can clear HBsAg has not been met, in order to allow patients to safely discontinue NA treatment without virological or clinical recurrence.

Hepatitis D virus (HDV) (also known as hepatitis delta) is a virus that requires hepatitis B virus for its replication. HDV infection occurs at the same time or as a super infection with HBV. HDV is transmitted through contact with the blood or other body fluids of an infected individual. Vertical transmission from mother to child is rare. At least 5% of people with chronic HBV are co-infected with HDV. However, this may be an underestimate because the prevalence of HDV is not reported in many countries. Hepatitis D infection can be prevented by hepatitis B vaccination, and since successful national HBV preventive vaccination campaigns were introduced in the 1980s, the number of HDV infections has also decreased. Due to the faster progression towards liver-related death and hepatocellular carcinoma, HBV-HDV co-infection is regarded as the most serious form of chronic viral hepatitis. The treatment is through the administration of pegylated interferon, but the rate of sustained viral response is low [WHO 2018]. Currently, the treatment rate is also low. The need for treatment that can stop the development or reversal of chronic hepatitis caused by HDV and/or eliminate chronic HDV infection (chronic hepatitis D-CHD) or HBV/HDV co-infection (CHB/CHD) has not yet been met.

In one aspect, a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans is provided, which includes the following steps: a) administering to the human a composition comprising antisense oligonucleotides (ASO) (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administer a composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector to the human, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen (HBc)的 Nucleic Acid; c) administering to the human a composition comprising a modified Vaccinia Virus Ankara (Modified Vaccinia Virus Ankara, MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and hepatitis B virus encoding Nucleic acid of core antigen (HBc); and d) Administer a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant to the human.

In one embodiment, the steps of the method are performed sequentially, wherein step b) precedes step c) and step c) precedes step d). If necessary, repeat step a). If necessary, repeat step d). In another embodiment, step d) is performed simultaneously with step b) and/or with step c).

In a specific embodiment, step a) is repeated and then stopped, and then step b), step c), and step d) are performed in sequence. If necessary, repeat step d). In another embodiment, step a) is repeated and then stopped before any subsequent steps, and step d) is performed simultaneously with step b) and/or with step c). In these embodiments, the ASO of step a) is administered before the other compositions.

Therefore, in another aspect, a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans is provided, which includes the following steps: a) administering to the human a composition comprising antisense oligonucleotides (ASO) (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administration to the human i) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid; and simultaneous administration ii) a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant; and c) administering to the human i) a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid; and simultaneously administer a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant.

In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step b) and step b) precedes step c). If necessary, repeat step a). If necessary, repeat step c).

In a specific embodiment, step a) is repeated and then stopped, and then step b) and step c) are performed in sequence. If necessary, repeat step c). In these embodiments, the ASO of step a) is administered before the other compositions.

In another aspect, there is provided an immunogenic combination in a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic combination comprising: a) A composition containing 10 to 30 nucleoside antisense oligonucleotides (ASO) (HBV ASO) targeting HBV nucleic acid; b) A composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); c) A composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and d) A composition containing recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvants, Wherein the method comprises sequentially or simultaneously administering the compositions to the human.

In another aspect, there is provided an immunogenic composition for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic composition comprising : A composition comprising an antisense oligonucleotide (ASO) (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; and a replication-deficient chimpanzee adenovirus (ChAd) vector, which contains the coding type B Hepatitis surface antigen (HBs) polynucleotide, hepatitis B virus core antigen (HBc) encoding nucleic acid and human invariant chain (hIi) fused to HBc nucleic acid, wherein the method comprises administration The composition and at least one other immunogenic composition in the prime-additional regimen. In certain embodiments, the immunogenic composition used in the method of treating chronic CHB and/or CHD further comprises one or more recombinant HBV protein antigens.

In another aspect, there is provided an immunogenic composition for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic composition comprising : A composition comprising an antisense oligonucleotide (ASO) (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid (HBV ASO); and a modified pox virus Ankara (MVA) vector, which The vector comprises a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); wherein the method comprises administering the composition in the prime-additional regimen and at least one other Immunogenic composition. In certain embodiments, the immunogenic composition used in the method of treating chronic CHB and/or CHD further comprises one or more recombinant HBV protein antigens.

In another aspect, there is provided an immunogenic composition for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic composition comprising ：Composition containing 10 to 30 nucleoside antisense oligonucleotides (HBV ASO) targeting HBV nucleic acid; recombinant hepatitis B surface antigen (HBs), C-terminal truncated recombinant hepatitis B virus core antigen (the HBc) and contain MPL (3-D acyl monophosphoryl lipid A) and QS-21 (purified from Quillaja saponaria (Quillaja saponaria) bark of triterpene glycosides) of the adjuvant, wherein the method comprises administering the The composition and at least one other immunogenic composition in the priming-additional regimen. In certain embodiments, the immunogenic composition used in the method of treating chronic CHB and/or CHD further comprises one or more vectors encoding one or more HBV antigens.

In another aspect, there is provided an immunogenic combination comprising: a) A composition containing 10 to 30 nucleoside antisense oligonucleotides (ASO) (HBV ASO) targeting HBV nucleic acid; b) A composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); c) A composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and d) A composition containing recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvants.

The immunogenic combination can be used in a method of treating chronic hepatitis B (CBH) by administering the composition in a prime-up regimen.

The immunogenic combination can be used in a method of treating CHB and/or CHD in humans by sequentially or simultaneously administering the composition.

In another aspect, a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans is provided, which comprises the following steps: a) administering to the human a composition comprising antisense oligonucleotides (ASO) (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administer a composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector to the human, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen (HBc) The nucleic acid; and c) administer a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant to the human.

In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step b) and step b) precedes step c). If necessary, repeat step a). If necessary, repeat step c). In another embodiment, step c) and step b) are performed simultaneously.

In a specific embodiment, step a) is repeated and then stopped, and then step b) and step c) are performed in sequence. If necessary, repeat step c). In another embodiment, step c) and step b) are performed simultaneously. In these embodiments, the ASO of step a) is administered before the other compositions.

Therefore, in another aspect, a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans is provided, which includes the following steps: a) administering to the human a composition comprising antisense oligonucleotides (ASO) (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; and b) Administration to the human i) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid; and simultaneously administered ii) a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant.

In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step b). If necessary, repeat step a). If necessary, repeat step b).

In another aspect, there is provided an immunogenic combination in a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic combination comprising: a) A composition containing 10 to 30 nucleoside antisense oligonucleotides (ASO) (HBV ASO) targeting HBV nucleic acid; b) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and c) A composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvants, Wherein the method comprises sequentially or simultaneously administering the compositions to the human.

In another aspect, there is provided an immunogenic combination comprising: a) A composition containing 10 to 30 nucleoside antisense oligonucleotides (ASO) (HBV ASO) targeting HBV nucleic acid; b) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and c) A composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant.

The immunogenic combination can be used in a method of treating chronic hepatitis B (CBH) and/or CHD by administering the composition in a prime-additional regimen.

The immunogenic combination can be used in a method of treating CHB and/or CHD in humans by sequentially or simultaneously administering the composition.

In one embodiment, the antisense oligonucleotide targeting the HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC. In one such embodiment, the antisense oligonucleotide targeted to the HBV nucleic acid is a modified oligonucleotide "gapmer" composed of 20 linked nucleosides, where each nucleoside is linked Is phosphorothioate linkage and each cytosine is 5-methylcytosine, the antisense oligonucleotide has the sequence GCAGAGGTGAAGCGAAGTGC, and consists of five linked nucleosides each containing 2'-O-methoxyethyl sugar GCAGA consists of a 5'wing segment, followed by ten linked deoxynucleosides GTGAAGCGA and a 3'wing segment consisting of five linked nucleosides ATGGC each containing 2'-O-methoxyethyl sugar.

Sequence Listing SEQ ID NO:1: Amino acid sequence of HBs SEQ ID NO: 2: Amino acid sequence of HBc truncation SEQ ID NO: 3: The amino acid sequence of the spacer incorporating the 2A cleavage region of foot-and-mouth disease virus SEQ ID NO:4: Nucleotide sequence encoding the spacer incorporated into the 2A cleavage region of foot-and-mouth disease virus SEQ ID NO: 5: Amino acid sequence of HBc-2A-HBs SEQ ID NO: 6: Nucleotide sequence encoding HBc-2A-HBs SEQ ID NO: 7: amino acid sequence of hIi SEQ ID NO: 8: Nucleotide sequence encoding hIi SEQ ID NO: 9: amino acid sequence of hIi-HBc-2A-HBs SEQ ID NO: 10: Nucleotide sequence encoding hIi-HBc-2A-HBs SEQ ID NO:11: Amino acid sequence of HBc SEQ ID NO: 12: Amino acid sequence of hIi substitution variant SEQ ID NO: 13: Nucleotide sequence encoding a substitution variant of hI SEQ ID NO: 14: Alternative nucleic acid sequence of hIi-HBc-2A-HBs SEQ ID NO: 15: Alternative amino acid sequence of hIi-HBc-2A-HBs SEQ ID NO:16: Nucleotide sequence of hepatitis B virus genome (GENBANK accession number U95551.1)

definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. For example, the specific terms used in this article are "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)" (Leuenberger, HGW, Nagel, B. and Klbl, H. Eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).

Throughout this specification and subsequent patent applications, unless the context requires otherwise, the word "comprise" and variations such as "comprises/comprising" should be understood to imply including the described whole or step or whole Or groups of steps but does not exclude any other wholes or steps or steps or wholes or groups of steps.

Several documents are cited throughout the text of this manual. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether above or below, is incorporated herein by reference in its entirety. Nothing in this document should be construed as an admission that the present invention has no right to precede such disclosures by virtue of previous inventions. In the case of one aspect of the present invention, all the definitions provided herein also apply to other aspects of the present invention.

"2'-O-Methoxyethyl" (also 2'-MOE and 2'-O(CH ₂ ) ₂ -OCH ₃ ) refers to the O-methoxyethyl group at the 2'position of the furanose ring Retouch. Sugars modified with 2'-O-methoxyethyl are modified sugars.

"2'-MOE nucleoside" (also 2'-O-methoxyethyl nucleoside) means a nucleoside containing a 2'-MOE modified sugar moiety.

"2' substituted nucleoside" means a nucleoside containing a substituent at the 2'-position of the furanosyl ring other than H or OH. In certain embodiments, 2'substituted nucleosides include nucleosides with bicyclic sugar modifications.

"5-Methylcytosine" refers to a methyl-modified cytosine attached to the 5 position, and 5-methylcytosine is a modified nucleobase.

"About" means within ±7% of the value. For example, if the statement "Infects about 70% of HBV-inhibiting compounds", it implies that the HBV content is inhibited in the range of 63% and 77%.

"Active pharmaceutical agent" means one or more substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments, antisense oligonucleotides targeting HBV are active pharmaceutical agents.

When individuals exposed to hepatitis B virus begin to develop signs and symptoms of viral hepatitis, "acute hepatitis B infection" develops. The period of time between exposure and the appearance of signs and symptoms of infection (called the incubation period) is an average of 90 days, but it can be as short as 45 days or as long as 6 months. For most humans, this infection will cause mild to moderate discomfort, but will disappear on its own, because the body's immune response successfully fights the virus. However, some people, especially those with impaired immune systems, such as those with AIDS, undergoing chemotherapy, taking immunosuppressive drugs, or taking steroids, have very serious problems due to acute HBV infection, and it rises to More serious conditions, such as fulminant liver failure.

When an individual initially suffers from an acute infection but is unable to fight the infection later, "chronic hepatitis B infection" occurs. About 90% of babies infected at birth will develop chronic diseases. However, as people age, the risk of chronic infection decreases, so that 20%-50% of children infected and less than 10% of older children or adults infected will progress from acute infection to chronic infection. Chronic HBV infection is the main treatment target of the embodiments of the present invention, although the composition of the present invention can also treat HBV-related conditions, such as inflammation, fibrosis, liver cirrhosis, liver cancer, serum hepatitis, and the like.

"Peptide" means a molecule formed by linking at least two amino acids with an amide bond (also called a peptide bond). The terms "protein", "polypeptide" and "peptide" are used interchangeably herein and refer to any peptide linking chain of amino acids, regardless of length, co-translation, or post-translational modification. "Fusion protein" (or "chimeric protein") is a recombinant protein comprising two or more peptide-linked proteins. Fusion proteins are produced by joining two or more genes that originally coded for individual proteins. The translation of this fusion gene produces a single fusion protein. With regard to proteins or polypeptides, recombination means expressing proteins from recombinant polynucleotides.

The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to polymeric macromolecules made from nucleotide monomers. Suitably, the polynucleotides of the invention are recombinant. Recombination means that a polynucleotide is the product of at least one of the selection, restriction, or conjugation steps or other procedures that produce polynucleotides other than those found in nature.

A heterologous nucleic acid sequence refers to any nucleic acid sequence that is not isolated from, derived from, or based on: a naturally occurring nucleic acid sequence found in a host organism. "Naturally occurring" means a sequence that is found in nature and has not been prepared or modified synthetically. When a sequence is isolated from a source but has been modified (for example, by deletion, substitution (mutation), insertion or other modification), the sequence is "derived" from the source, suitably so as not to disrupt the normal function of the source gene.

Suitably, the polynucleotide used in the present invention is isolated. An "isolated" polynucleotide is one that has been removed from its original environment. For example, if the naturally occurring polynucleotide is separated from some or all of the coexisting substances in the natural system, then the naturally occurring polynucleotide is separated. If, for example, the polynucleotide is cloned into a vector that is not part of its natural environment or if the polynucleotide is contained in a cDNA, then the polynucleotide is considered to be isolated.

"Treatment" refers to the administration of a composition to affect the change or amelioration of a disease or condition. As used herein with regard to chronic hepatitis B infection, the term "treatment" refers to the administration of a suitable composition with the intention of reducing CHB symptoms, preventing CHB progression, or reducing the content of one or more detectable markers of CHB. For example, preventing the progression of CHB may include preventing the onset of liver disease or stabilizing pre-existing liver disease, as indicated by ALT (alanine transaminase) content, liver fibrosis, or other suitable detectable markers. Other markers of CHB include serum HBV DNA content, which is an indicator of viral replication; and serum HBs antigen content, which is an indicator of viral load. Therefore, treatment of CHB may include serum HBsAg (for example, as determined by quantitative immunoassay). Determination) or the level of HBV DNA is reduced (for example, as determined by Cobas ^® HBV analysis (Roche) or equivalent) to an undetectable level ("clearing" HBsAg or HBV DNA). The term "treatment" for chronic hepatitis D infection (CHD) as used herein is explained accordingly.

"Administration" means the provision of medical agents to an individual, and includes, but is not limited to, administration by medical professionals and self-administration.

"Simultaneous administration" refers to the co-administration of two drugs in any way that pharmacological effects appear in the patient at the same time. Simultaneous administration does not require the two agents to be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. As used herein, "simultaneous" administration in relation to components of a vaccine regimen refers to administration during the same ongoing immune response, and "simultaneous" is interpreted accordingly. Preferably, the two components are administered at the same time (such as simultaneous administration of a carrier-containing composition and a protein-containing composition), however, one component can be administered within minutes (for example, during the same medical appointment or doctor visit). ) Or other components are administered within a few hours. This type of investment is also called co-investment. Simultaneous administration of the individual components can be carried out via the same route of administration, such as intramuscular injection. Alternatively, the simultaneous administration of the separate components can be carried out via different administration routes, such as intramuscular injection and intradermal injection, intramuscular and intranasal administration, inhalation and subcutaneous administration, and the like. In some embodiments, simultaneous administration may refer to administration of adenovirus vector and protein component. In other embodiments, co-administration refers to the administration of an adenoviral vector and another viral vector, such as a poxvirus, such as MVA. In other embodiments, co-administration refers to the administration of adenovirus vectors and protein components, wherein the protein components are adjuvants.

"Sequential" administration refers to the administration of the first composition followed by the second composition after a longer period of time. The time period between two sequential administrations is between 1 week and 12 months, such as between 2 weeks and 12 weeks, such as 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, or 12 weeks , 6 months or 12 months. More specifically, it is between 4 weeks and 8 weeks, for example, the time period between sequential administration may be 4 weeks. Therefore, sequential administration encompasses the first and subsequent administrations in the primary immunization-additional environment, that is, when the administration of the second composition does not occur during the ongoing immune response generated by the first administration.

"Immunogenic combination" as used herein refers to a plurality of separately formulated immunogenic compositions administered sequentially and/or simultaneously in a single immunization method, such as a prime-additional regimen, each of which is separately formulated The original composition is a component of the immunogenic combination.

"Antisense compound" means an oligomeric compound capable of hybridizing to a target nucleic acid via hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotides, siRNA, shRNA, snoRNA, miRNA, and satellite repeats.

"Antisense inhibition" means a target nucleic acid content that is reduced in the presence of an antisense compound complementary to the target nucleic acid compared to the target nucleic acid content in the absence of the antisense compound.

"Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that allows hybridization with a corresponding region or fragment of a target nucleic acid.

"Complementarity" means the ability to pair between the nucleobases of the first nucleic acid base and the second nucleic acid.

"Base complementation" refers to the ability of the nucleobase of an antisense oligonucleotide to accurately base pair (ie, hybridize) with the corresponding nucleobase in the target nucleic acid, and is determined by the difference between the corresponding nucleobases. It is mediated by Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonding.

"Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense oligonucleotides and nucleic acid targets.

"Fully complementary" or "100% complementary" means that each nucleobase of the first nucleic acid has the complementary nucleobase of the second nucleic acid. In certain embodiments, the first nucleic acid is an antisense compound and the target nucleic acid is a second nucleic acid.

"Contiguous nucleobases" means nucleobases that are next to each other.

"Deoxyribonucleotide" means a nucleotide with hydrogen at the 2'position of the sugar portion of the nucleotide. Deoxyribonucleotides can be modified with any of a variety of substituents.

"Diluent" means an ingredient in a composition that does not have pharmacological activity, but is medically necessary or required. For example, in injected drugs, the diluent may be a liquid, such as a saline solution.

"Dosage unit" means a form in which a pharmaceutical agent is provided, such as a pill, lozenge, or other dosage unit known in the art.

"Dose" means a specified amount of pharmaceutical agent provided in a single administration or within a specified period of time. In certain embodiments, the dosage may be administered in the form of two or more boluses, lozenges, or injections. For example, in certain embodiments, where subcutaneous administration is required, the required dose requires a volume that cannot be easily adjusted by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, the dose may be administered in two or more injections to minimize injection site reactions in the individual. In other embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Dosage can be stated as the amount of pharmaceutical agent per hour, day, week, or month.

A "dosing regimen" is a combination of dosages designed to achieve one or more desired effects.

"HBV" means mammalian hepatitis B virus, including human hepatitis B virus. The term covers the geographical genotype of hepatitis B virus, especially human hepatitis B virus, and the variant strains of the geographical genotype of hepatitis B virus.

"HBV antigen" means any hepatitis B virus antigen or protein, including core proteins such as "hepatitis B core antigen" or "HBcAg" and "hepatitis B E antigen" or "HBeAG" and envelope proteins such as " HBV surface antigen" or "HBsAg".

"Hepatitis B E antigen" or "HBeAg" is a secreted, non-granular form of HBV core protein. The HBV antigens HBeAg and HBcAg share the primary amino acid sequence, so they exhibit cross-reactivity in T cell content. HBeAg is not required for virus assembly or replication, but studies have shown that it may be required to establish chronic infection.

"HBV surface antigen" or "HBsAg" or "HBsAG" is the envelope protein of infectious HBV virus particles, but it is also secreted in the form of non-infectious particles (Dane particles), and the serum content is 1000 times higher than that of HBV virus particles. The serum level of HBsAg in infected individuals or animals can be as high as 1000 μg/mL (Kann and Gehrlich (1998) Topley &Wilson's Microbiology and Microbial Infections, 9th edition 745).

"Hepatitis B-related conditions" or "HBV-related conditions" means any disease, biological condition, medical condition or event that is caused by, related to, or traceable to the following: hepatitis B infection, Exposure or disease. The term hepatitis B-related conditions includes chronic HBV infection, inflammation, fibrosis, liver cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, hepatitis, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocyte inflammatory disease, phagocytosis Symptoms, serum hepatitis, HBV viremia, transplant-related liver disease, and symptoms that may include any or all of the following: when accompanied by the presence of hepatitis B virus and hepatitis B virus antigens When the test is positive or the presence of antibodies specific to hepatitis B virus antigen is tested positive, influenza-like illness, weakness, pain, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain in the liver area of the body, colon Or multi-colored stools, itchy whole body, and dark urine.

"Inhibition of performance or activity" refers to the reduction or blocking of performance or activity and does not necessarily indicate the complete elimination of performance or activity.

"Internucleoside linkage" refers to the chemical bond between nucleosides.

"Co-tuberculoside" means adjacent nucleosides that are linked together by internucleoside linkages.

"Modified internucleoside linkage" refers to any change substituted or changed from naturally occurring internucleoside linkage (ie, phosphodiester internucleoside linkage).

"Phosphorothioate linkage" means a linkage between nucleosides in which the phosphodiester linkage is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. Phosphorothioate linkages are modified internucleoside linkages.

"Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine or uracil. "Unmodified nucleobases" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

"Modified nucleoside" means a nucleoside independently having a modified sugar moiety and/or a modified nucleobase.

"Modified nucleotides" means nucleotides that independently have modified sugar moieties, modified internucleoside linkages, or modified nucleobases.

"Modified oligonucleotide" means an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, and/or modified nucleobase.

"Modified sugar" means any substitutions and/or changes from natural sugar moieties.

"Chemically different region" refers to a region of an antisense compound, which is chemically different from another region of the same antisense compound in some respects. For example, a region with 2'-O-methoxyethyl nucleotides is chemically different from a region with nucleotides without 2'-O-methoxyethyl modification.

"Motif" means the pattern of unmodified and modified nucleosides in antisense compounds.

"Spacer" means a chimeric antisense compound in which the inner region with a plurality of nucleosides supporting RNase H cleavage is positioned between the outer region with one or more nucleosides, wherein the nucleoside containing the inner region is located in It is chemically different from containing one or more nucleosides of the outer region. The inner area can be called "space", and the outer area can be called "wing".

"Wing segment" means a plurality of nucleosides modified to impart characteristics to oligonucleotides, such as enhanced inhibitory activity, enhanced binding affinity for target nucleic acids, or resistance to degradation by nucleases in vivo .

"Natural sugar moiety" means the sugar moiety found in DNA (2'-H) or RNA (2'-OH).

"Unmodified" nucleobases mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

"Unmodified nucleotides" means nucleotides composed of naturally occurring nucleobases, sugar moieties and internucleoside linkages. In certain embodiments, the unmodified nucleotides are RNA nucleotides (ie β-D-nucleosides) or DNA nucleotides (ie β-D-deoxynucleosides).

"Nucleic acid" refers to a molecule composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), and microRNA (miRNA).

"Nucleobase" means a heterocyclic moiety capable of pairing with the base of another nucleic acid.

"Nucleobase complementation" refers to a nucleobase capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, the complementary nucleobase refers to the nucleobase of an antisense compound capable of base pairing with the nucleobase of the target nucleic acid. For example, if the nucleobase at a certain position of the antisense compound can hydrogen bond with the nucleobase at a certain position of the target nucleic acid, then hydrogen bonding between the oligonucleotide and the target nucleic acid is considered The position is considered to be complementary at that nucleobase pair.

"Nucleobase sequence" means the sequence of consecutive nucleobases unrelated to any sugar, linkage and/or nucleobase modification.

"Nucleoside" means a nucleobase linked to a sugar.

"Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar moiety of the nucleoside.

"Oligonucleotide" means a polymer of linked tuberculin, each of which can be modified or unmodified independently of the other.

"Parenteral administration" means administration via injection (such as bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal or intracerebroventricular administration.

"Pharmaceutical composition" means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition suitable for administration by injection may include antisense oligonucleotides and/or vaccine components and a sterile aqueous solution.

"Individual" means a human or non-human animal selected for treatment or therapy.

Regarding the percentage of homology, by observing the alignment of the two sequences, the aligned residues ("identity") between the two sequences can be observed. The percentage of identity (or homology) can be calculated by multiplying the quotient between the number of identity and the full length of the reference sequence by 100 (a) (ie, the percentage of identity = (number of identity × 100) / reference Sequence length).

Program The present disclosure covers the following program, which provides antisense oligonucleotide (ASO) therapy followed by a time course of allogeneic primary immunization-boost vaccine time course, which involves coding hepatitis B core (HBc) and B At least one viral vector of hepatitis B surface antigen (HBs) to induce strong CD8⁺ T cell response, simultaneous or simultaneous administration of adjuvanted recombinant HBc and HBs proteins to induce strong antigen-specific CD4⁺ T cell and antibody response. The disclosed ASO treatment successfully inhibits the target HBV DNA and RNA in liver cells in vivo and in vitro. In a mouse model that reproduces the viral and immune characteristics of chronic HBV infection in humans, the disclosed vaccine program successfully restored HBs-specific and HBc-specific antibodies and CD8⁺ T cell response and HBs-specific CD4⁺ T cell response without the related symptoms of liver changes side effects. In conclusion, the combined ASO and vaccine regimen will provide viral and clinical responses, including loss of HBsAg and/or HBsAg seroconversion, accompanied by a robust and versatile CD8 against HBV core antigen (HBcAg)⁺ Induction of T cell response.

More specifically, a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans is provided, which includes the following steps: a) administering to the human a composition comprising an antisense oligonucleotide (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administer a composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector to the human, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen (HBc)的 Nucleic Acid; c) administering to the human a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and encoding hepatitis B virus core antigen (HBc) The nucleic acid; and d) Administer a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant to the human.

In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step b), step b) precedes step c), and step c) precedes step d). If necessary, repeat step a). If necessary, repeat step c). In some embodiments, the time period between the steps of the method is 2 to 12 weeks, such as 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks or 12 weeks. In one embodiment, the time period between steps of the method is 4 to 8 weeks. In one embodiment, the time period between sequential administration of the composition according to this method is 4 weeks. In one embodiment, step a) is performed 2 to 12 times at weekly intervals or every two weeks intervals or every 3 weeks or every 4 weeks, such as 2 to 10 times, 2 to 8 times, 2 to 7 times, 2 to 6 times, 2 to 5 times, for example 4 times, 3 times, or twice. In a particular embodiment, step a) is performed at weekly intervals of 2 to 10 times, at weekly intervals of 2 to 8 times, at weekly intervals of 2 to 7 times, at weekly intervals of 2 to 6 times, and at weekly intervals. 2 to 5 times, for example, 4 times at weekly intervals, 3 times at weekly intervals, or twice a week at intervals. In another embodiment, step a) is repeated every day and then once a week. For example, step a) can be performed 2 to 4 times a day, followed by 2 to 8 times at weekly intervals. In another embodiment, step a) is repeated three times on the first day, the third day, and the fifth day of the protocol, followed by 2 to 8 times, 2 to 6 times per week starting on the 12th day of the protocol, 2 to 4 times, for example 4 times, 3 times, or twice. In another embodiment, step a) is within a period of 20-36 days, for example, on day 1, day 4, day 8, day 11, day 15, day 22, day 26 of the protocol Day and 30th day, or on the 1st, 4th, 8th, 11th, 15th and 22nd day of the plan, or on the 1st, 6th, and 11th day of the plan 4 to 8 times on the 16th day, the 16th day, the 21st day, the 26th day, the 31st day, and the 36th day. In one embodiment, step a) is performed every day, every other day, and/or at weekly intervals before step b), step b) is performed before step c), and step c is performed before step d). In another embodiment, step a) is performed every day, every other day, and/or at weekly intervals before step b), and is performed at weekly intervals during the period of performing step b), step c), and/or step d) repeat. In another embodiment, step d) is performed simultaneously with step a) and/or with step b) and/or with step c). In some embodiments, steps b) and c) can be repeated at the same time. In some embodiments, steps c) and d) can be repeated simultaneously. In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step c) as appropriate, step c) precedes step b), and step d) repeats after step b), or with step b) And/or simultaneously with step c). In one embodiment, the steps of the method are performed sequentially, wherein step a) optionally precedes step d), step d) precedes step b), and step b) is repeated before step c). In another embodiment, the steps of the method are performed sequentially, wherein step a) optionally precedes step d), step d) precedes step c), and step c) is repeated before step b). In another embodiment, step d is repeated and the steps of the method are performed in the following order: step a) (repeated as appropriate), step b), step c), step d), step d). In some embodiments, the time period between steps b), c), and d) of the method is 2 to 12 weeks, for example, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 Weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks. In one embodiment, the time period between steps b), c) and d) of the method is 4 to 8 weeks. In one embodiment, the time period between the sequential administration of the composition according to steps b), c) and d) of the method is 4 weeks. In some embodiments, the method is performed over a period of one year. In some embodiments, the method is performed in a period of 8 to 50 weeks, for example, 8 to 40 weeks, 8 to 30 weeks, 8 to 20 weeks, 8 to 16 weeks, for example, the method can be performed in 8 weeks, 9 weeks , 10 weeks, 12 weeks, 14 weeks, 16 weeks, over a period of 10 to 16 weeks, 12 to 16 weeks, 16 to 20 weeks, 20 to 40 weeks, or 30 to 50 weeks.

In another aspect, a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans is provided, which comprises the following steps: a) administering to the human a composition comprising antisense oligonucleotides (ASO) (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administer a composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector to the human, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen (HBc) The nucleic acid; and c) administer a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant to the human.

In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step b) and step b) precedes step c). If necessary, repeat step a). If necessary, repeat step c). In another embodiment, step c) and step b) are performed simultaneously. In some embodiments, the time period between steps b) and c) of the method is 2 to 12 weeks, for example, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 Weeks, 10 weeks, 11 weeks, or 12 weeks. In one embodiment, the time period between steps b) and c) of the method is 4 to 8 weeks. In one embodiment, step a) is performed 2 to 12 times at weekly intervals or every two weeks intervals or every 3 weeks or every 4 weeks, such as 2 to 10 times, 2 to 8 times, 2 to 7 times, 2 to 6 times, 2 to 5 times, for example 4 times, 3 times, or twice. In a particular embodiment, step a) is performed at weekly intervals of 2 to 10 times, at weekly intervals of 2 to 8 times, at weekly intervals of 2 to 7 times, at weekly intervals of 2 to 6 times, and at weekly intervals. 2 to 5 times, for example, 4 times at weekly intervals, 3 times at weekly intervals, or twice a week at intervals. In another embodiment, step a) is repeated every day and then once a week. For example, step a) can be performed 2 to 4 times a day, followed by 2 to 8 times at weekly intervals. In another embodiment, step a) is repeated three times on the first day, the third day, and the fifth day of the protocol, followed by 2 to 8 times, 2 to 6 times per week starting on the 12th day of the protocol, 2 to 4 times, for example 4 times, 3 times, or twice. In another embodiment, step a) is within a period of 20-36 days, for example, on day 1, day 4, day 8, day 11, day 15, day 22, day 26 of the protocol Day and 30th day, or on the 1st, 4th, 8th, 11th, 15th and 22nd day of the plan, or on the 1st, 6th, and 11th day of the plan 4 to 8 times on the 16th day, the 16th day, the 21st day, the 26th day, the 31st day, and the 36th day. In one embodiment, step a) is performed every day, every other day, and/or at weekly intervals before step b) and step b) is performed before step c). In another embodiment, step a) is performed every day, every other day, and/or at weekly intervals before step b), and is repeated at weekly intervals during the period during which step b) and step c) are performed. In another embodiment, step c) is performed simultaneously with step a) and/or with step b). In some embodiments, steps b) and c) can be repeated at the same time. In one embodiment, the steps of the method are performed sequentially, wherein step a) optionally precedes step c), and step c) repeats before step b). In some embodiments, the method is performed over a period of one year. In some embodiments, the method is performed in a period of 8 to 50 weeks, for example, 8 to 40 weeks, 8 to 30 weeks, 8 to 20 weeks, 8 to 16 weeks, for example, the method can be performed in 8 weeks, 9 weeks , 10 weeks, 12 weeks, 14 weeks, 16 weeks, over a period of 10 to 16 weeks, 12 to 16 weeks, 16 to 20 weeks, 20 to 40 weeks, or 30 to 50 weeks.

In certain embodiments, the composition administered in step a) of the method comprises an oligonucleotide (HBV ASO) with a length of 10 to 30 linked nucleosides targeting HBV nucleic acid. The HBV target has a sequence included in the sequence of SEQ ID NO:16. Therefore, in certain embodiments, HBV ASO targets a region of HBV nucleic acid. In certain embodiments, the composition administered in step a) comprises HBV ASO having a continuous nucleobase portion complementary to the same length nucleobase portion of the target region of the HBV nucleic acid of SEQ ID NO:16. For example, the continuous nucleobase portion of HBV ASO may be at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, which are complementary to the same length portion of SEQ ID NO: 16 in the region. 19 or 20 consecutive nucleobases. In certain embodiments, the composition administered in step a) comprises an antisense oligonucleotide targeting HBV nucleic acid, which is complementary in one of the following nucleotide regions of SEQ ID NO: 16: 58 -73, 58-74, 58-77, 59-74, 59-75, 60-75, 60-76, 61-76, 61-77, 62-77, 253-272, 253-269, 254-270 , 255-271, 256-272, 411-437, 411-426, 411-427, 411-430, 412-427, 412-428, 412-431, 413-428, 413-429, 413-432, 414 -429, 414-430, 414-433, 415-430, 415-431, 415-434, 416-431, 416-432, 416-435, 417-432, 417-433, 417-436, 418-433 , 418-434, 418-437, 457-472, 457-473, 458-473, 670-706, 670-685, 670-686, 671-686, 671-687, 672-687, 672-688, 673 -688, 687-702, 687-703, 687-706, 688-703, 688-704, 689-704, 689-705, 690-705, 690-706, 691-706, 1261-1285, 1261-1276 , 1261-1277, 1261-1280, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1265-1280, 1265 -1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1269-1284, 1269-1285, 1270-1285, 1577-1606 , 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1581 -1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1583-1598, 1583-1 599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779- 1794, 1779-1795, 1779-1798, 1780-1795, 1780-1796, 1780-1799, 1781-1796, 1781-1797, 1781-1800, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1799 and 1784-1800.

In certain embodiments, the composition administered in step a) comprises HBV ASO, wherein the continuous nucleobase portion is 16, 17, 18 that are complementary to the same length portion of the HBV nucleic acid region of SEQ ID NO: 16. , 19 or 20 consecutive nucleobases. In a specific embodiment, the antisense oligonucleotide targeting HBV nucleic acid has 16-20 complementary contiguous nucleobases that are complementary to one of the following nucleotide regions of SEQ ID NO: 16: 58-77 , 253-272, 411-430, 412-431, 413-432, 414-433, 415-434, 416-435, 417-436, 418-437, 687-706, 1261-1280, 1262-1281, 1263 -1282, 1264-1283, 1265-1284, 1266-1285, 1577-1596, 1578-1597, 1579-1598, 1580-1599, 1581-1600, 1582-1601, 1583-1602, 1584-1603, 1585-1604 , 1586-1605, 1587-1606, 1778-1797, 1779-1798, 1780-1799, and 1781-1800 or parts thereof. In a specific embodiment, the antisense oligonucleotide targeting HBV nucleic acid has 20 complementary contiguous nucleobases that are complementary to one of the following nucleotide regions of SEQ ID NO: 16: 58-77, 253 -272, 411-430, 412-431, 413-432, 414-433, 415-434, 416-435, 417-436, 418-437, 687-706, 1261-1280, 1262-1281, 1263-1282 , 1264-1283, 1265-1284, 1266-1285, 1577-1596, 1578-1597, 1579-1598, 1580-1599, 1581-1600, 1582-1601, 1583-1602, 1584-1603, 1585-1604, 1586 -1605, 1587-1606, 1778-1797, 1779-1798, 1780-1799 and 1781-1800.

In certain embodiments, the composition administered in step a) comprises an antisense oligonucleotide targeting HBV nucleic acid, which is complementary in the following nucleotide region of SEQ ID NO: 16: 1583-1602. In a specific embodiment, the antisense oligonucleotide targeting HBV nucleic acid has 16-20 complementary contiguous nucleobases that are complementary to the following nucleotide region of SEQ ID NO: 16: 1583-1602. In a specific embodiment, the antisense oligonucleotide targeting HBV nucleic acid has 20 complementary contiguous nucleobases that are complementary to the following nucleotide regions of SEQ ID NO: 16: 1583-1602.

In certain embodiments, the composition administered in step a) comprises an antisense oligonucleotide having a nucleotide sequence selected from SEQ ID NO: 83-310 of WO2012/145697 (PCT/US2012/034550 , Applied on April 20, 2012). In a specific embodiment, the antisense oligonucleotide (HBV ASO) targeting HBV nucleic acid has a nucleotide sequence selected from SEQ ID NO: 224-227 of WO2012/145697, or a nucleotide sequence selected from SEQ ID NO: 224-227 of WO2012/145697 The sequence of ID NO: 224-227 has a sequence of 85-95% identity. In a specific embodiment, the HBV ASO administered in step a) of the method has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is consistent with the nucleobase 1583 The HBV genome sequence SEQ ID NO: 16 at 1602 is complementary. In a specific embodiment, the HBV ASO administered in step a) of the method has the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is the same as the HBV genome sequence at nucleobases 1583-1602 SEQ ID NO: 16 is complementary.

In certain embodiments, the composition administered in step b) of the method comprises a ChAd vector, which is selected from the group consisting of ChAd3, ChAd63, ChAd83, ChAd155, ChAd157, Pan 5, Pan 6, Pan 7 (Also known as C7) and Pan 9, especially ChAd63 or ChAd155. In certain embodiments, the ChAd vector includes vector inserts encoding HBc and HBs, which are separated by sequences encoding the 2A cleavage region of foot-and-mouth disease virus. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In certain embodiments, HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) is fused to hIi (e.g., SEQ ID NO: 7 or an amino acid sequence that is at least 98% homologous to it) Or SEQ ID NO: 12 or an amino acid sequence that is at least 98% homologous to it). For example, HBc (e.g., SEQ ID NO: 11) is fused to hIi (e.g., SEQ ID NO: 7), or HBc (e.g., SEQ ID NO: 11) is fused to hIi (e.g., SEQ ID NO: 12). In a specific embodiment, the composition administered in step b) of the method includes a ChAd155 vector, which includes a polynucleotide vector insert encoding hIi, HBc, 2A, and HBs, for example, the encoding has as shown in FIG. 13 The insert of the structure of the structure shown. In one embodiment, the composition administered in step b) of the method comprises a ChAd vector, which comprises a polynucleus encoding the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence of SEQ ID NO: 15 Nucleotide carrier insert. In certain embodiments, the composition administered in step b) of the method comprises a ChAd vector comprising a nucleotide sequence given in SEQ ID NO: 10 or a nucleotide sequence given in SEQ ID NO: 14 The polynucleotide vector insert of the nucleotide sequence. In a specific embodiment, the vector is a ChAd155 vector. Therefore, in certain embodiments, the composition administered in step b) of the method comprises a ChAd155 vector, which comprises a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:9. In other embodiments, the composition administered in step b) of the method comprises a ChAd155 vector, which comprises a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:15. In one embodiment, the composition administered in step b) of the method comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:10. In other embodiments, the composition administered in step b) of the method comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:14.

In one embodiment, the composition administered in step c) of the method comprises an MVA vector, which includes a vector insert encoding HBc and HBs, the vector insert being separated by a sequence encoding the 2A cleavage region of the foot-and-mouth disease virus . In certain embodiments, the vector insert encodes HBc and HBs, which are separated by a sequence that encodes a spacer that incorporates the 2A cleavage region of foot-and-mouth disease virus. In a specific embodiment, the composition administered in step c) of the method includes an MVA vector, which includes a polynucleotide vector insert encoding HBc, 2A, and HBs, for example, the encoding has a vector as shown in FIG. 12 The insert of the structure of the structure. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In one embodiment, the composition administered in step c) of the method comprises an MVA vector, which comprises a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:5. In one embodiment, the composition administered in step c) of the method comprises an MVA vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:6.

In one embodiment, the composition administered in step d) of the method comprises recombinant HBc and recombinant HBs in a ratio of 1:1. In another embodiment, the ratio of HBc to HBs in the composition is greater than 1, for example, the ratio of HBc to HBs can be 1.5:1, 2:1, 2.5:1, 3:1, 3.5:1, 4:1 , 4.5:1, 5:1, 5.5:1, 6:1 or greater, especially 3:1 to 5:1, such as 3:1, 4:1 or 5:1, especially 4:1 ratio. In a specific embodiment, the composition administered in step d) of the method comprises recombinant HBc and recombinant HBs in a ratio of 4:1 or greater. In certain embodiments, the composition administered in step d) of the method comprises a full-length recombinant hepatitis B surface antigen (HBs) (e.g., SEQ ID NO: 1 or an amino acid sequence that is at least 98% homologous to it ), Recombinant hepatitis B virus core antigen (HBc) truncated at the C-terminus and adjuvant. In certain embodiments, the truncated recombinant HBc includes the assembly domain of HBc, such as the amino acid 1-149 of HBc (eg SEQ ID NO: 2 or an amino acid sequence that is at least 98% homologous to it). In one embodiment, the composition administered in step d) of the method includes full-length recombinant HBs, amino acids 1-149 of HBc, and adjuvants including MPL and QS-21. For example, the composition administered in step d) of the method includes full-length recombinant HBs (SEQ ID NO: 1), the amino acid 1-149 of HBc (SEQ ID NO: 2), and includes MPL and QS- 21 adjuvant. In some embodiments, the recombinant protein HBs and HBc antigens are in the form of virus-like particles.

In another embodiment, a method for treating CHB and/or chronic hepatitis D (CHD) in humans is provided, which comprises the following steps: a) administering to the human a composition comprising an antisense oligonucleotide (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administer a composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector to the human, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen (HBc)的 Nucleic Acid; c) administering to the human a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and encoding hepatitis B virus core antigen (HBc) The nucleic acid; and d) Administer a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant to the human.

In a specific embodiment, the HBV ASO administered in step a) of the method has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is consistent with the nucleobase 1583 The HBV genome sequence SEQ ID NO: 16 at 1602 is complementary. In a specific embodiment, the HBV ASO administered in step a) of the method has the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is the same as the HBV genome sequence at nucleobases 1583-1602 SEQ ID NO: 16 is complementary.

In another aspect of the present invention, a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans is provided, which comprises the following steps: a) administering to the human a composition comprising an antisense oligonucleotide (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administration to the human i) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid; and simultaneous administration ii) a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant; and c) administering to the human i) a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid, and simultaneous administration of a composition containing recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant.

In a specific embodiment, the HBV ASO administered in step a) of the method has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is consistent with the nucleobase 1583 The HBV genome sequence SEQ ID NO: 16 at 1602 is complementary. In a specific embodiment, the HBV ASO administered in step a) of the method has the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is the same as the HBV genome sequence at nucleobases 1583-1602 SEQ ID NO: 16 is complementary.

In an embodiment of this aspect of the present invention, the steps of the method are performed sequentially, wherein step a) precedes step b) and step b) precedes step c). If necessary, repeat step a). If necessary, repeat step b). If necessary, repeat step c). In one embodiment, the method steps are performed in the following order: step a) followed by step a) followed by step b) followed by step c). In an alternative embodiment, the method steps are performed in the following order: step a) followed by step b) followed by step c) followed by step c). In one embodiment, the method steps are performed in the following order: step a) followed by step b) followed by step b) followed by step c). Optionally, step a) can be repeated more than once. As appropriate, both steps a) and c) can be repeated. In one embodiment of this aspect of the invention, the method steps are performed in the following order: step a) followed by step a) followed by step b) followed by step c) followed by step c). In an alternative embodiment, the method steps are performed in the following order: step b) followed by step a) followed by step b) followed by step b). In another embodiment, the method steps are performed in the following order: step a) is repeated 2 to 8 times, followed by step b) followed by step c), followed by step c), and optionally followed by step c ). In some embodiments, the time period between the steps of the method is 2 to 12 weeks, such as 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks or 12 weeks. In one embodiment, the time period between steps of the method is 4 to 8 weeks. In one embodiment, the time period between sequential administration of the composition according to this method is 4 weeks.

Therefore, in another embodiment of this aspect of the present invention, a method for treating CHB and/or CHD in humans is provided, which includes the following steps: a) administering to the human a composition comprising an antisense oligonucleotide (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administration to the human i) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid; and simultaneously administered ii) a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant; c) administering to the human the following i) a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding HBs antigen and a nucleic acid encoding HBc antigen; and simultaneous administration ii) comprising Composition of recombinant HBs protein antigen, recombinant HBc protein antigen and adjuvant; d) administering to the human i) a composition containing an MVA vector, the MVA vector containing a polynucleotide encoding HBs antigen and a nucleic acid encoding HBc antigen; and simultaneously administering ii) containing recombinant HBs protein antigen and recombinant HBc protein Composition of antigen and adjuvant; and e) administering to the human i) a composition comprising an MVA vector, the MVA vector comprising a polynucleotide encoding an HBs antigen and a nucleic acid encoding an HBc antigen; and simultaneously administering ii) a recombinant HBs protein antigen and a recombinant HBc protein Combination of antigen and adjuvant.

In a specific embodiment, the HBV ASO administered in step a) of the method has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is consistent with the nucleobase 1583 The HBV genome sequence SEQ ID NO: 16 at 1602 is complementary. In a specific embodiment, the HBV ASO administered in step a) of the method has the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is the same as the HBV genome sequence at nucleobases 1583-1602 SEQ ID NO: 16 is complementary.

In some embodiments, step a) can be repeated. In a specific embodiment, step a) is repeated 2 to 12 times at daily or weekly intervals. In some embodiments, the time period between steps b), c), d) and e) of the method is 2 to 12 weeks, for example, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks. Weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks. In one embodiment, the time period between steps b), c), d) and e) of the method is 4 to 8 weeks. In one embodiment, the time period between sequential administration of the composition according to this method is 4 weeks. In one embodiment, the composition is administered in step b) of the method i) comprises a ChAd vector, which is selected from the group consisting of ChAd3, ChAd63, ChAd83, ChAd155, ChAd157, Pan 5, Pan 6, Pan 7 (also known as C7) and Pan 9, especially ChAd63 or ChAd155. In certain embodiments, the ChAd vector includes vector inserts encoding HBc and HBs, which are separated by sequences encoding the 2A cleavage region of foot-and-mouth disease virus. In certain embodiments, the vector insert encodes HBc and HBs, which are separated by a sequence encoding a spacer that incorporates the 2A cleavage region of foot-and-mouth disease virus. In certain embodiments, HBc is fused to hIi. In a specific embodiment, the composition is administered in step b) of the method i) includes a ChAd155 vector, which includes a polynucleotide vector insert encoding hIi, HBc, 2A, and HBs, for example, the encoding has a Figure 13 The insert of the structure of the structure shown in. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In certain embodiments, HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) is fused to hIi (e.g., SEQ ID NO: 7 or an amino acid sequence that is at least 98% homologous to it) Or SEQ ID NO: 12 or an amino acid sequence that is at least 98% homologous to it). For example, HBc (e.g., SEQ ID NO: 11) is fused to hIi (e.g., SEQ ID NO: 7), or HBc (e.g., SEQ ID NO: 11) is fused to hIi (e.g., SEQ ID NO: 12). In certain embodiments, the composition is administered in step b) of the method i) comprises a ChAd155 vector, which comprises a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:9. In another embodiment, the composition i) is administered in step b) of the method comprising a ChAd155 vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:15. In one embodiment, the composition i) is administered in step b) of the method and comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:10. In another embodiment, the composition is administered in step b) of the method i) comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO: 14 . In certain embodiments, the composition is administered in step b) of the method ii) comprises a full-length recombinant hepatitis B surface antigen (HBs), a recombinant hepatitis B virus core antigen (HBc) truncated at the C-terminus And adjuvants. In certain embodiments, the truncated recombinant HBc comprises the assembly domain of HBc, such as the amino acid 1-149 of HBc. In one embodiment, the composition is administered in step b) of the method ii) comprises full-length recombinant HBs (e.g. SEQ ID NO: 1), amino acids 1-149 of HBc (e.g. SEQ ID NO: 2) And an adjuvant containing MPL and QS-21. In some embodiments, the recombinant protein HBs and HBc antigens are in the form of virus-like particles.

In one embodiment, the composition i) is administered in step c) of the method. It comprises an MVA vector, which includes a vector insert encoding HBc and HBs, and the vector insert consists of a vector encoding the 2A cleavage region of the foot-and-mouth disease virus. Sequence separation. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In a specific embodiment, the composition is administered in step c) of the method i) comprises an MVA vector, which comprises a polynucleotide vector insert encoding HBc, 2A, and HBs, for example, the encoding has the one shown in FIG. 12 The insert of the structure of the structure shown. In one embodiment, the composition i) administered in step c) of the method comprises an MVA vector, which comprises a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:5. In one embodiment, the composition i) administered in step c) of the method comprises an MVA vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:6. In certain embodiments, the composition is administered in step c) of the method ii) comprises a full-length recombinant hepatitis B surface antigen (HBs), a recombinant hepatitis B virus core antigen (HBc) truncated at the C-terminus And adjuvants. In certain embodiments, the truncated recombinant HBc comprises the assembly domain of HBc, such as the amino acid 1-149 of HBc. In one embodiment, the composition administered in step c) of the method ii) comprises full-length recombinant HBs (e.g. SEQ ID NO: 1), amino acids 1-149 of HBc (e.g. SEQ ID NO: 2) And an adjuvant containing MPL and QS-21. In some embodiments, the recombinant protein HBs and HBc antigens are in the form of virus-like particles.

In one embodiment, the composition i) is administered in step d) of the method. It comprises an MVA vector, which includes a vector insert encoding HBc and HBs, and the vector insert consists of a vector insert encoding the 2A cleavage region of the foot-and-mouth disease virus. Sequence separation. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In a specific embodiment, the composition is administered in step d) of the method i) comprises an MVA vector, which comprises a polynucleotide vector insert encoding HBc, 2A and HBs, for example, the encoding has the one shown in FIG. 12 The insert of the structure of the structure shown. In one embodiment, the composition i) administered in step d) of the method comprises an MVA vector, which comprises a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:5. In one embodiment, the composition i) administered in step d) of the method comprises an MVA vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:6. In certain embodiments, the composition is administered in step d) of the method ii) comprises a full-length recombinant hepatitis B surface antigen (HBs), a recombinant hepatitis B virus core antigen (HBc) truncated at the C-terminus And adjuvants. In certain embodiments, the truncated recombinant HBc comprises the assembly domain of HBc, such as the amino acid 1-149 of HBc. In some embodiments, the recombinant protein HBs and HBc antigens are in the form of virus-like particles. In one embodiment, the composition is administered in step d) of the method ii) comprising full-length recombinant HBs (e.g. SEQ ID NO: 1), amino acids 1- to 149 of HBc (e.g., SEQ ID NO: 2 ) And adjuvants containing MPL and QS-21.

In one embodiment, the composition i) is administered in step e) of the method. It comprises an MVA vector, which includes a vector insert encoding HBc and HBs, and the vector insert consists of a vector encoding the 2A cleavage region of the foot-and-mouth disease virus. Sequence separation. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In a specific embodiment, the composition i) is administered in step e) of the method. It comprises an MVA vector, which comprises a polynucleotide vector insert encoding HBc, 2A and HBs, for example, the encoding has the one shown in FIG. 12 The insert of the structure of the structure shown. In one embodiment, the composition i) administered in step e) of the method comprises an MVA vector, which comprises a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:5. In one embodiment, the composition i) administered in step e) of the method comprises an MVA vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:6. In certain embodiments, the composition is administered in step e) of the method ii) comprises a full-length recombinant hepatitis B surface antigen (HBs), a recombinant hepatitis B virus core antigen (HBc) truncated at the C-terminus And adjuvants. In certain embodiments, the truncated recombinant HBc comprises the assembly domain of HBc, such as the amino acid 1-149 of HBc. In one embodiment, the composition administered in step e) of the method ii) comprises full-length recombinant HBs (e.g. SEQ ID NO: 1), amino acids 1-149 of HBc (e.g. SEQ ID NO: 2) And an adjuvant containing MPL and QS-21. In some embodiments, the recombinant protein HBs and HBc antigens are in the form of virus-like particles.

The present invention also provides a method for inducing cellular immune response and humoral immune response in humans suffering from CHB and/or CHD, in particular, CD4+ response, CD8+ response and antibody response. The method includes the following steps: a) administering to the human a composition comprising an antisense oligonucleotide (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administer a composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector to the human, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen (HBc)的 Nucleic Acid; c) administering to the human a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and encoding hepatitis B virus core antigen (HBc) The nucleic acid; and d) Administer a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant to the human.

In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step b), step b) precedes step c), and step c) precedes step d). If necessary, repeat step a). If necessary, repeat step d). In another embodiment, step d) is performed simultaneously with step b) and/or with step c). In another embodiment, the method of inducing cellular immune response and humoral immune response in humans suffering from CHB and/or CHD. Specifically, the method of CD4+ response, CD8+ response and antibody response includes the following steps: a) administering to the human a composition comprising an antisense oligonucleotide (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administration to the human i) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid; and simultaneous administration ii) a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant; and c) administering to the human i) a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid, and simultaneous administration of a composition containing recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant.

In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step b) and step b) precedes step c). If necessary, repeat step c).

The present invention also provides a method for reducing the serum HBsAg content and/or serum HBV DNA content of humans suffering from CHB and/or CHD, the method comprising the following steps: a) administering to the human a composition comprising an antisense oligonucleotide (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administer a composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector to the human, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen (HBc)的 Nucleic Acid; c) administering to the human a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and encoding hepatitis B virus core antigen (HBc) The nucleic acid; and d) Administer a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant to the human.

In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step b), step b) precedes step c), and step c) precedes step d). If necessary, repeat step a). If necessary, repeat step d). In another embodiment, step d) is performed simultaneously with step b) and/or with step c).

In another embodiment, the method for reducing the content of serum HBsAg and/or the content of serum HBV DNA in humans suffering from CHB and/or CHD includes the following steps: a) administering to the human a composition comprising an antisense oligonucleotide (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) Administration to the human i) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid; and simultaneous administration ii) a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant; and c) administering to the human i) a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid and simultaneous administration ii) a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant.

In one embodiment, the steps of the method are performed sequentially, wherein step a) precedes step b) and step b) precedes step c). If necessary, repeat step a). If necessary, repeat step c). In another embodiment, the serum HBsAg level is reduced to an undetectable level as determined by quantitative immunoassay. In another embodiment, the serum HBV DNA content is reduced to an undetectable level as determined ^{by the Cobas ® HBV analysis method or equivalent.} In another embodiment, the level of serum HBsAg and/or the level of serum HBV DNA is reduced to an undetectable level and maintained for at least 6 months. In another embodiment, the level of serum HBsAg and/or the level of serum HBV DNA is reduced to an undetectable level and the ALT level is maintained within the normal range for at least 6 months.

antigen At least nine genotypes (A to I) of HBV have been identified, and their genomes differ by more than 8%. Within a given HBV genotype, multiple genotypes with a difference of 4-8% have been identified. The antigens used in the disclosed methods are suitably selected to provide immune coverage across multiple and preferably all HBV genotypes. Hepatitis B core protein antigen (HBc) is highly conserved between genotypes and genotypes, and the hepatitis B surface protein antigen (HBs) sequence is appropriately selected to include the key exchange-genotype- that allows the induction of a broad neutralization response The reserved B cell epitope. Suitably, the sequences of HBc and HBs used in the disclosed methods and compositions are based on sequences from genotype/subtype A2.

Suitably, the HBs antigens used in the disclosed methods and compositions are derived from small, medium or large surface antigen proteins. Specifically, suitable HBs antigens include HBV adw2 strain, small (S) protein of genotype A. For example, a suitable HBs antigen has the 226 amino acids of the amino acid sequence SEQ ID NO:1. When used as a recombinant protein, the HBs antigen is preferably assembled into virus-like particles. This antigen is included in well-researched commercially available hepatitis B vaccines ( Engerix B , Fendrix , Twinrix, and others), and has been proven to protect against hepatitis B in different genotypes. Preferably, the recombinant HBs protein antigen is expressed from yeast and purified for use in the vaccine composition and method of the present invention. Suitable methods for expression and purification are, for example, known from EP1307473B1.

The hepatitis B core protein (HBc) is the main component of the nucleoprotein shell capsid that encapsulates the viral genome. This protein (183-185 aa long) is expressed in the cytoplasm of infected cells and remains unglycosylated. HBc contains 149 residue assembly domain and 34-36 residue RNA binding domain at the C-terminus. The HBc antigen used in the disclosed methods and compositions may be full-length or may include a C-terminal truncated protein (lack of RNA binding C-terminal), for example, including the 145-149 amino acids of the assembly domain of the wild-type core antigen protein, For example, the amino acid 1-145, 1-146, 1-147, 1-148 or the amino acid 1-149 of the wild-type hepatitis B core antigen protein. Truncated proteins retain the ability to assemble into nucleoprotein shell particles. The HBc antigen suitable for use in the disclosed method and composition has the amino acid sequence of HBV adw2 strain genotype A. When used as a recombinant protein, the HBc antigen is appropriately truncated from the wild type at the C-terminus. In particular, the antigen may have the amino acid sequence of SEQ ID NO: 2. Preferably, the recombinant HBc protein antigen is expressed from E. coli and purified for use in the vaccine composition and method of the present invention. The method for recombinant expression of viral proteins in E. coli is well known in the art.

When used as a recombinant protein, the HBc antigen is preferably assembled into virus-like particles. When expressed from a viral vector, the HBc antigen may be full-length or truncated, for example, a full-length HBc antigen (for example, SEQ ID NO: 11) is appropriate. The suitable dose of recombinant HBs antigen used in the method disclosed herein is 10 μg per dose to 100 μg per dose, such as 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg per dose. μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, or 100 μg. The suitable dose of recombinant HBc antigen used in the method disclosed herein is 10 μg per dose to 100 μg per dose, such as 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg per dose. μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, or 100 μg.

Antigens are substances that induce immune responses in the body, especially antibodies. Antigens can be foreign (that is, pathogenic) sources or from the backbone of the organism itself, the latter being called self-antigens or self-antigens. Antigens can be presented on the surface of antigen-presenting cells by MHC molecules. There are two types of MHC molecules: MHC class I (MHC-I) and MHC class II (MHC-II). MHC-II molecules are membrane-bound receptors, which are synthesized in the endoplasmic reticulum and leave the endoplasmic reticulum in the MHC class II compartment. In order to prevent endogenous peptides (that is, from antigens) from binding to MHC-II molecules and presenting to produce an immune response, the new MHC-II molecules and another protein (not the cleft) blocking the peptide binding gap (cleft) of the MHC-II molecules Variable chain) combination. The human invariant chain (hIi, also known as CD74 when expressed on the plasma membrane) is an evolutionarily conserved type II membrane protein that has several roles in the cell and in the entire immune system [Borghese, 2011]. When the MHC class II compartment is fused to late endosomes containing phagocytosed and degraded foreign proteins, the invariant strand is cleaved to leave only the CLIP region bound to the MHC-II molecule. In the second step, CLIP is removed by HLA-DM molecules, freeing MHC-II molecules to bind foreign protein fragments. Once the MHC class II compartment is fused with the plasma membrane, these fragments are presented on the surface of antigen presenting cells, thus presenting foreign antigens to other cells, mainly T helper cells.

It is known that when the adenovirus expression system encoding the invariant chain fusion and the antigen are used for vaccination, the immune response to the antigen is increased (see WO2007/062656, which is also disclosed as US2011/0293704 and for revealing the invariant chain sequence The purpose is incorporated by reference), that is, the invariant chain enhances the immunogenicity of the antigen and the invariant chain (such as hIi) is sometimes referred to as the "gene adjuvant" in the recognition of this effect. In addition, the adenovirus construct has proven to be suitable for initiating an immune response in the case of a primary immunization booster vaccination regimen (see WO2014/141176, which is also disclosed as US2016/0000904; and WO2010/057501, which is also disclosed as US2010/0278904 And for the purpose of revealing the invariant chain sequence and the adenoviral vector encoding the invariant chain sequence, it is incorporated by reference). In particular, hIi sequence and hIi have ^{the potential to increase CD8 +} T cell response [Spencer, 2014; Capone, 2014]. In certain embodiments, the nucleotide sequence included in the vector used in the methods, uses, and compositions disclosed herein may include a nucleotide sequence encoding hIi. The amino acid sequence of hIi as included in the disclosed adenovirus vector ChAd155-hIi-HBV is set forth in SEQ ID NO: 7, and the alternative sequence is set forth in SEQ ID NO: 12. The nucleotide sequences encoding these amino acid sequences are set forth in SEQ ID NO: 8 and SEQ ID NO: 13. Suitably, the nucleotide sequence encoding the hIi is fused to the nucleotide sequence encoding the HBc antigen to produce a fusion protein in which the hIi polypeptide is fused to the HBc antigen at the N-terminus.

Carrier In addition to polynucleotides encoding antigenic proteins (also referred to herein as "inserts"), the vectors used in the methods and compositions disclosed herein may also include conventional control elements that allow them to be used in The mode of transcription, translation and/or expression in the vector-transfected cell is operably linked to the encoding polynucleotide. Therefore, a vector insert polynucleotide encoding a protein antigen is incorporated into a performance cassette with suitable control elements.

Performance control elements include appropriate transcription initiation, termination, promoter and enhancer sequences; effective RNA processing signals, such as splicing and polyadenylation (poly A) signals, including rabbit β-hemoglobin polyA; stable cytoplasmic mRNA Sequence; sequence that enhances translation efficiency (such as Kozak common sequence); sequence that enhances protein stability; and, if necessary, sequence that enhances secretion of encoded product.

A promoter is a nucleotide sequence that allows RNA polymerase to bind and direct the transcription of a gene. Generally, the promoter is located in the 5'non-coding region of the gene, adjacent to the transcription start site of the gene. The sequence elements within the promoter used to initiate transcription are often characterized by a common nucleotide sequence. Examples of promoters include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and mammals (including humans). A large number of performance control sequences, including internal, natural, constitutive, inducible, and/or tissue-specific promoters, are known and available in the art.

Examples of constitutive promoters include, but are not limited to, the retrovirus Rous sarcoma virus (Rous sarcoma virus, RSV) LTR promoter (optionally with RSV enhancer), cytomegalovirus (CMV) promoter (optionally with CMV enhancer) See, for example, Boshart et al., Cell, 41:521-530 (1985)), CASI promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, phosphoglycerol kinase (PGK) Promoter and EF1a promoter (Invitrogen). The promoter is suitably a CMV promoter or a variant thereof, more suitably a human CMV (HCMV) promoter or a variant thereof.

Adenovirus vector Adenovirus has been widely used in gene transfer applications because of its ability to achieve high-efficiency gene transfer and its large gene transfer ability in a variety of target tissues. Conventionally, the E1 gene of adenovirus is deleted and replaced with a transgenic cassette consisting of the selected promoter, the cDNA sequence of the related gene, and the poly A signal to produce a replication-deficient recombinant virus. In animal models and in humans, human adenovirus vectors have been shown to induce CD8 targeting transgenic genes⁺ Effective carrier for T cell response. Adenovirus has a broad tropism and has the ability to infect replicating and non-replicating cells. The main limitation of the clinical application of vectors based on human adenovirus is the high prevalence of neutralizing antibodies in the general population. Adenovirus isolated from alternative species has been regarded as a potential vaccine vector that circumvents the pre-existing problem of anti-adenovirus immunity in humans. Among them, monkey adenoviruses derived from chimpanzees, gorillas or bonobos can be suitable for delivering antigens and eliciting targeted T cell and/or humoral responses against those antigens in humans. Monkey adenoviruses including adenovirus derived from chimpanzees have been tested in clinical studies. It is known that the chimpanzee adenovirus vector has a low serum/serum-free incidence in the human population and does not cause human pathological diseases. )) to grow to a higher titer.

Replication-deficient or replication-deficient adenovirus is an adenovirus that cannot replicate because it is engineered to contain at least one loss of function (or "loss of function" mutation), that is, one that impairs the function of a gene without completely removing the gene Deletions or mutations, such as the introduction of artificial stop codons, deletions or mutations of active sites or interaction domains, mutations or deletions of gene regulatory sequences, etc., or complete removal of genes encoding gene products mainly used for viral replication, such as One or more of the following adenovirus genes: E1A, E1B, E2A, E2B, E3, and E4 (such as E3 ORF1, E3 ORF2, E3 ORF3, E3 ORF4, E3 ORF5, E3 ORF6, E3 ORF7, E3 ORF8 , E3 ORF9, E4 ORF7, E4 ORF6, E4 ORF5, E4 ORF4, E4 ORF3, E4 ORF2 and/or E4 ORF1). Suitably, the E1 and E3 genes are deleted. More suitably, the E1, E3 and E4 genes are deleted.

Vectors suitable for use in the methods and compositions disclosed herein are replication-deficient chimpanzee adenovirus vectors, such as ChAd3, ChAd63, ChAd83, ChAd155, ChAd157, Pan 5, Pan 6, Pan 7 (also known as C7) or Pan 9. Examples of such strains are described in WO03/000283, WO2005/071093, WO2010/086189 and WO2016/198621. The ChAd155 vector (see WO2016/198621 incorporated by reference for the purpose of revealing the ChAd155 vector sequence and method) belongs to the same lineage adenovirus group (group C) as the ChAd3 vector. In one embodiment, the vector used in the methods and compositions disclosed herein is a ChAd vector of pedigree group C, such as ChAd3 or ChAd155. In a specific embodiment, the method for treating chronic hepatitis B disclosed herein comprises the step of administering to humans a composition comprising a ChAd155 vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and encoding Hepatitis B virus core antigen (HBc) nucleic acid. The suitable dose of ChAd vector suitable for the method disclosed herein is 1×10 ⁸ -1×10 ¹¹ virus particles (vp) per dose, for example, about 1×10 ⁸ , 5×10 ⁸ , 1×10 ^{9 per dose} , 5×10 ⁹ , 1×10 ¹⁰ , 5×10 ¹⁰ or 1×10 ¹¹ virus particles (vp).

More specifically, in one embodiment, the vector used in the methods and compositions disclosed herein is the replication-deficient chimpanzee adenovirus vector ChAd155, which encodes from two HBV proteins: HBc (core, nucleocapsid protein) And HBs (small surface antigen) sequence fusion. In some specific embodiments, the vector is ChAd155, which encodes HBc and HBs isolated from SEQ ID NO: 3, and the spacer also has a sequence encoding the 2A cleavage region of foot-and-mouth disease virus (FMDV) [Donnelly et al. 2001] (generated The 23 amino acid tails at the C-terminus of the upstream protein and the monoproline at the N-terminus of the downstream protein are used to process HBc and HBs into separate proteins. The cleavage of the core from the surface antigen allows for proper folding of HBs, allowing the generation of antibody responses against the surface antigen. Alternatively, the adenovirus vector may be a dual promoter (bicistronic) vector that allows independent expression of HBs and HBc antigens.

In certain embodiments, the N-terminal part of the gene encoding the HBc protein can be fused to the human major histocompatibility complex (MHC) class II related invariant chain, p35 isoform (ie hIi or CD74) The gene. Therefore, the specific ChAd155 vector used in the methods and compositions disclosed herein includes a polynucleotide vector insert encoding a construct having the structure shown in Figure 13, which includes hIi, HBc, 2A, and HBs. The amino acid sequence of such a construct is given in SEQ ID NO: 9 and the nucleotide sequence encoding the amino acid sequence of the construct is given in SEQ ID NO: 10. The amino acid sequence that replaces such a construct is given in SEQ ID NO: 15 and the nucleotide sequence encoding the amino acid sequence of the construct is given in SEQ ID NO: 14.

Modified Pox Virus Ankara ( MVA ) Carrier The modified pox virus Ankara (MVA), which is replication-deficient in humans and other mammals, is derived from pox virus. It belongs to the poxvirus family and was originally developed to improve the safety of smallpox vaccination. This vaccination causes multiple deletions by passing pox virus in chicken embryo fibroblast (CEF) cells more than 570 times, and then the virus is highly Attenuated and replication defective in humans and other mammals. Replication defects occur in the late stage of viral particle assembly, so that the expression of viruses and recombinant genes is not impaired, making MVA an effective single circular expression vector that cannot cause mammalian infection. MVA has subsequently been widely used as a viral vector to induce antigen-specific immunity against transgenic genes in animal models and in humans. A description of MVA can be found in Mayr A et al. (1978) and Mayr, A. et al. (1975).

In one example, the MVA is derived from virus seed batch 460 MG obtained from the 571th generation of pox virus on CEF cells. In another embodiment, the MVA is derived from the viral seed batch MVA 476 MG/14/78. In another embodiment, MVA was derived or produced before December 31, 1978 and is free of prion contamination. A suitable dose of MVA vector used in the method disclosed herein is 1×10 ⁶ -1×10 ⁹ plaque forming units (pfu) per dose, for example, about 1×10 ⁶ , 2×10 ⁶ , 5 per dose. ×10 ⁶ , 1×10 ⁷ , 2×10 ⁷ , 5×10 ⁷ , 1×10 ⁸ , 2×10 ⁸ , 5×10 ⁸ or 1×10 ⁹ pfu.

In a specific embodiment, the method for treating chronic hepatitis B disclosed herein comprises the step of administering to humans a composition comprising an MVA vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and encoding Hepatitis B virus core antigen (HBc) nucleic acid.

More specifically, in one embodiment, the carrier used in the methods and compositions disclosed herein is MVA, which encodes the one derived from two HBV proteins: HBc (core nucleocapsid protein) and HBs (small surface antigen) Sequence fusion. In certain embodiments, the vector used in the methods and compositions disclosed herein is MVA, which encodes HBc and HBs isolated from SEQ ID NO: 3, and the spacer has 2A cleavage region encoding foot-and-mouth disease virus (FMDV) The sequence (generating the 23 amino acid tail at the C-terminus of the upstream protein and the monoproline at the N-terminus of the downstream protein) is used to process HBc and HBs into separate proteins. Therefore, the specific MVA vector used in the methods and compositions disclosed herein includes a polynucleotide vector insert encoding a construct having the structure shown in FIG. 12, which includes HBc, 2A, and HBs. The amino acid sequence of such constructs is given in SEQ ID NO: 5 and the nucleotide sequence encoding the amino acid insert construct is given in SEQ ID NO: 6.

Antisense oligonucleotide ( ASO ) For cells expressing proteins encoded by DNA, one strand of DNA serves as a template for the synthesis of complementary strands of RNA. The template DNA strand is said to have been transcribed, and its sequence is antisense or complementary to an mRNA transcript that has the same sequence as the sense sequence of the original double-stranded DNA. Because DNA is double-stranded, the strand complementary to the antisense sequence is called the non-transcribed strand or sense strand, and has the same sequence as the mRNA transcript (the T nucleobase in the DNA sequence is passed through the U nucleobase in the RNA sequence Except for group substitution).

Nucleic acids that are complementary to RNA transcribed from DNA are called "antisense" oligonucleotides (ASO) because their base sequence is complementary to the gene's messenger RNA (mRNA)-"sense" sequence. Therefore, the coding DNA region with the sense sequence of 5'-AAGGTC-3' will be transcribed to produce mRNA with the sense sequence of 5'-AAGGUC-3', and therefore, if the antisense oligomer contains RNA core Base, the antisense oligomer of the sense sequence will have a sequence of 3'-UUCCAG-5'; or if the antisense oligomer contains RNA nucleobases, it will have 3'-TTCCAG-5' The sequence.

Currently, the main focus of antisense therapy involves the use of oligomers or oligonucleotides (approximately 20 nucleotides/nucleoside in length), which are synthesized to be responsible for the performance or performance of the target protein. The translated specific "sense"(5' to 3'orientation) DNA or mRNA sequence is complementary.

After being introduced into the cell, the antisense oligonucleotide hybridizes to its corresponding mRNA sequence via Watson-Crick combination to form a heteroduplex. Once the double helix is formed, it inhibits the translation of the protein encoded by the mRNA-binding sequence. Therefore, antisense therapy can directly target the RNA transcript of the antigen and thereby reduce serum HBeAg and HBsAg levels. Due to the multiple overlapping transcripts produced after HBV infection, a single antisense oligomer also has the opportunity to reduce HBV DNA more than one HBV antigen.

There are several proposed mechanisms through which oligonucleotide/mRNA duplexes can hinder subsequent translation. The most widely accepted explanation involves the degradation of mRNA in the heteroduplex by the ubiquitous enzyme RNase H. RNase H is attracted to the heteroduplex and the bound mRNA is cleaved while leaving the antisense oligonucleotide (ASO) sequence intact, allowing the ASO to continue to seek and bind to the corresponding mRNA sequence. Some other accepted explanations for the inhibition of translation via antisense therapy that can occur alone or in combination with RNase H activity include, but are not limited to, blocking appropriate ribosome assembly that prevents the ribosome complex from being translated and blocks RNA splicing And/or hinder the proper export of mRNA.

In the field of antisense therapy, the introduction of chemically modified nucleosides into nucleic acid molecules, especially RNA, provides a powerful tool to overcome the inherent in vivo stability and biological availability of exogenous RNA. For example, the use of chemically modified nucleic acid molecules can achieve lower doses of specific nucleic acid molecules for a given therapeutic effect, because chemically modified nucleic acid molecules tend to have a longer half-life in serum. In addition, certain chemical modifications can improve the bioavailability of nucleic acid molecules by targeting specific cells or tissues and/or improving cellular uptake of nucleic acid molecules. Therefore, even if compared with natural nucleic acid molecules, the activity of chemically modified nucleic acid molecules is reduced. For example, when compared to all RNA nucleic acid molecules, the overall activity of modified nucleic acid molecules can be greater than that of natural molecules because of the stability and /Or delivery improvement.

A suitable chemical modification, referred to as a locked nucleic acid (the LNA), the introduction of 2'O-4'C- alkylene bridge, wherein the alkylene bridge is a C _{1 - 6} alkylene bridge, more specific words, in a Or 2'O-4'C-methylene bridges at multiple nucleoside portions of RNA or DNA. When LNA is incorporated into antisense RNA or DNA oligomers, it has been shown to greatly increase the stability of antisense RNA or DNA molecules, and therefore, after the antisense RNA or DNA is taken up by the host cell, it greatly increases its Bioavailability. Other applicable chemical modifications that can be introduced into antisense RNA or DNA oligomers to improve the stability and bioavailability of antisense oligomers include phosphorothioate linkages or phosphotriester linkages, where these bonds are substituted instead of individual The naturally occurring phosphodiester linkage between RNA or DNA nucleotides.

In certain embodiments, the composition comprising antisense oligonucleotides (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid used in the methods, protocols and immune combinations of the present invention comprises: HBV ASO of modified antisense oligonucleotides. In a specific embodiment, the HBV ASO at nucleobases 1583-1602 has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO:226 of WO2012/145697) complementary to the HBV genome sequence SEQ ID NO:16. In a specific embodiment, the HBV ASO has the complementary sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697) to the HBV genome sequence SEQ ID NO: 16 at nucleobases 1583-1602.

In certain embodiments, at least one internucleoside linkage of the modified antisense oligonucleotide is a modified internucleoside linkage. In certain embodiments, the at least one modified internucleoside linkage is selected from the group consisting of phosphotriester internucleoside linkages and phosphorothioate internucleoside linkages. In certain embodiments, each internucleoside linkage is selected from phosphotriester internucleoside linkages and phosphorothioate internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, at least one nucleoside of the modified antisense oligonucleotide comprises a modified sugar. In certain embodiments, at least one modified sugar comprises 2'-O-methoxyethyl (2'-O(CH ₂ ) ₂ -OCH ₃ ). In certain embodiments, the modified sugar comprises a 2'-O-CH ₃ group.

In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar, a bicyclic sugar, comprises a 4'-(CH ₂ ) _n -O-2' bridge, where n is 1 or 2. In certain embodiments, the bicyclic sugar comprises a 4'-CH ₂ -O-2' bridge. In certain embodiments, the bicyclic sugar comprises a 4'-CH(CH ₃ )-O-2' bridge.

In certain embodiments, at least one nucleoside of the modified antisense oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of a single-stranded modified oligonucleotide.

In certain embodiments, the modified antisense oligonucleotides comprise: a) a spacer consisting of linked deoxynucleosides; b) a 5'-wing segment consisting of nucleosides; and c) consisting of linked nucleosides Composition of the 3'wing segment. The spacer segment is placed between the 5'wing segment and the 3'wing segment and each nucleoside of each wing segment contains a modified sugar.

In certain embodiments, the modified antisense oligonucleotide consists of 15-30, such as 15, 16, 17, 20, 25 or 30 linked nucleosides; the spacer consists of 7-15, such as 7 , 8, 9, 10, 12 or 15 linked deoxynucleosides; 5'wing segment consists of 3-8, for example, 3, 5, 7 or 8 linked nucleosides; 3'wing segment consists of 3-8 One, such as 3, 5, 7 or 8 linked nucleosides, wherein each nucleoside of each wing segment contains 2'-O-methoxyethyl sugar, and at least one internucleoside linkage is a phosphorothioate bond At least one cytosine is 5-methylcytosine.

In certain embodiments, the modified antisense oligonucleotide consists of 15-30, such as 15, 16, 17, 20, 25 or 30 linked nucleosides; the spacer consists of 7-15, such as 7 , 8, 9, 10, 12 or 15 linked deoxynucleosides; 5'wing segment consists of 3-8, for example, 3, 5, 7 or 8 linked nucleosides; 3'wing segment consists of 3-8 One, for example, 3, 5, 7 or 8 linked nucleosides, wherein at least one nucleoside of each wing segment contains 2'-O-methoxyethyl sugar, and at least one internucleoside linkage is phosphorothioate Linked, and each cytosine is 5-methylcytosine.

In certain embodiments, the modified antisense oligonucleotide consists of 15-30, such as 15, 16, 17, 20, 25 or 30 linked nucleosides; the spacer consists of 7-15, such as 7 , 8, 9, 10, 12 or 15 linked deoxynucleosides; 5'wing segment consists of 3-8, for example, 3, 5, 7 or 8 linked nucleosides; 3'wing segment consists of 3-8 Consisting of 3, 5, 7 or 8 linked nucleosides, wherein at least one nucleoside of each wing segment contains 2'-O-methoxyethyl sugar, and the linkage between each nucleoside is a phosphorothioate bond At least one cytosine is 5-methylcytosine.

In certain embodiments, the modified antisense oligonucleotide consists of 15-30, such as 15, 16, 17, 20, 25 or 30 linked nucleosides; the spacer consists of 7-15, such as 7 , 8, 9, 10, 12 or 15 linked deoxynucleosides; 5'wing segment consists of 3-8, for example, 3, 5, 7 or 8 linked nucleosides; 3'wing segment consists of 3-8 One, such as 3, 5, 7 or 8 linked nucleosides, where each nucleoside of each wing segment contains 2'-O-methoxyethyl sugar, and the linkage between each nucleoside is a phosphorothioate linkage And each cytosine is 5-methylcytosine.

In certain embodiments, the modified antisense oligonucleotide consists of 20 linked nucleosides, the spacer segment consists of ten linked deoxynucleosides, and the 5'wing segment consists of five linked nucleosides, 3' The wing segment is composed of five linked nucleosides, each nucleoside of each wing segment contains 2'-O-methoxyethyl sugar, the linkage between each nucleoside is a phosphorothioate linkage, and each cytosine is 5- Methylcytosine.

In a specific embodiment, the antisense oligonucleotide targeting HBV nucleic acid is a modified oligonucleotide "spacer" composed of 20 linked nucleosides, where the internucleoside linkage is phosphorothioate Linked and each cytosine is 5-methylcytosine, the antisense oligonucleotide has the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), and each contains 2'-O-methoxyethyl sugar A 5'wing segment consisting of five connected nucleosides GCAGA, followed by a 3'wing segment consisting of ten connected deoxynucleosides GGTGAAAGCGA and five connected nucleosides AGTGC each containing 2'-O-methoxyethyl sugar composition.

。In certain embodiments, the antisense compound may be covalently linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the resulting antisense oligonucleotide. Typical conjugate groups include cholesterol moieties, lipid moieties and carbohydrates. In certain embodiments, the conjugate group is a carbohydrate. In a specific embodiment, the conjugate group is a sugar. In a specific embodiment, the conjugate group is a carbohydrate comprising an asialoglycoprotein receptor (ASGPR) binding moiety, such as an N-acetylgalactosamine (GalNAc) sugar. In certain embodiments, the conjugate group carbohydrate is a GalNAc sugar, which comprises:

.

， 或其醫藥學上可接受之鹽(其中鹽為H₂ SO₄ 鹽或HCl鹽)。In certain embodiments, the antisense oligonucleotide comprises a modified oligonucleotide that binds to a carbohydrate group having the following structure, such as SEQ ID NO: 226 of WO2012/0145697 described above (GCAGAGGTGAAGCGAAGTGC )'S spacer:

, Or a pharmaceutically acceptable salt thereof (wherein the salt is H ₂ SO ₄ salt or HCl salt).

In certain embodiments, the antisense oligonucleotide is a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence consisting of SEQ ID NO: 226 of WO2012/0145697, and wherein The modified oligonucleotide contains: A spacer consisting of ten linked deoxynucleosides; A 5'wing segment composed of five linked nucleosides; 3'wing segment consisting of five linked nucleosides; Wherein the spacer is arranged between the 5'wing segment and the 3'wing segment, wherein each nucleoside of each wing segment contains 2'-O-methoxyethyl sugar, and each cytosine residue is 5-methyl Cytosine, and the linkage between each nucleoside of the modified oligonucleotide is a phosphorothioate linkage.

或其醫藥學上可接受之鹽(其中鹽為H₂ SO₄ 鹽或HCl鹽)。In a certain embodiment, the antisense oligonucleotide has the following structure:

Or a pharmaceutically acceptable salt thereof (wherein the salt is H ₂ SO ₄ salt or HCl salt).

。In certain embodiments, the antisense oligonucleotides comprise modified antisense oligonucleotides and conjugate groups, wherein the modified antisense oligonucleotides consist of 12 to 30 linked nucleosides and include A nucleobase sequence comprising a part of at least 8 consecutive nucleobases complementary to the same length part of SEQ ID NO: 16 (GENBANK accession number U95551.1), wherein the modified oligonucleotide The nucleobase sequence is at least 80% complementary to the 12 to 30 nucleotide fragment of SEQ ID NO: 16; and wherein the conjugate group comprises:

.

In certain embodiments, the modified antisense oligonucleotides comprise at least one modified sugar, wherein the modified sugar is selected from 2'-O-methoxyethyl, 2'-O-methyl Oxyethyl, restricted ethyl, 3'-fluoro-HNA and bicyclic sugars.

In certain embodiments, the at least one modified sugar is 2'-O-methoxyethyl, and the modified antisense oligonucleotide further comprises a bicyclic sugar comprising 4'-(CH ₂ ) _n -O-2' bridge, where n is 1 or 2.

In certain embodiments, at least one nucleoside of the modified antisense oligonucleotide comprises a modified nucleobase, wherein the at least one nucleoside comprises a modified nucleobase, and wherein the modified nucleobase The group is 5-methylcytosine.

In certain embodiments, the conjugate group is connected to the modified antisense oligonucleotide at the 5'end of the modified antisense oligonucleotide, or the conjugate group is connected to the modified antisense oligonucleotide The 3'end of the nucleotide.

In certain embodiments, each internucleoside linkage of the modified antisense oligonucleotide is selected from the group consisting of phosphodiester internucleoside linkages, phosphotriester internucleoside linkages and phosphorothioate internucleoside linkages United.

In certain embodiments, the internucleoside linkages of the modified antisense oligonucleotide are selected from phosphodiester internucleoside linkages and phosphorothioate internucleoside linkages.

In certain embodiments, the modified oligonucleotide is single-stranded.

Pharmaceutical composition In certain embodiments, the composition comprising a replication-deficient chimpanzee adenovirus vector used in the method for treating CHB and/or CHD comprises a ChAd vector selected from the group consisting of ChAd3, ChAd63, ChAd83, ChAd155, ChAd157, Pan 5, Pan 6, Pan 7 (also known as C7) and Pan 9, specifically ChAd63 or ChAd155. In certain embodiments, the ChAd vector includes vector inserts encoding HBc and HBs, which are separated by sequences encoding the 2A cleavage region of foot-and-mouth disease virus. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In certain embodiments, HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) is fused to hIi (e.g., SEQ ID NO: 7 or an amino acid sequence that is at least 98% homologous to it) Or SEQ ID NO: 12 or an amino acid sequence that is at least 98% homologous to it). For example, HBc (e.g., SEQ ID NO: 11) is fused to hIi (e.g., SEQ ID NO: 7), or HBc (e.g., SEQ ID NO: 11) is fused to hIi (e.g., SEQ ID NO: 12). In a specific embodiment, the composition comprising a replication-deficient chimpanzee adenovirus vector used in the method for treating CHB and/or CHD comprises a ChAd155 vector, which comprises a polynucleotide vector encoding hIi, HBc, 2A and HBs An insert, for example, an insert encoding a construct having the structure shown in FIG. 13. In one embodiment, the composition comprising a replication-deficient chimpanzee adenovirus vector used in the method for treating CHB and/or CHD comprises a ChAd vector, which comprises the amino acid sequence encoding SEQ ID NO: 9 or SEQ ID NO : The polynucleotide vector insert of the amino acid sequence of 15%. In certain embodiments, the composition comprising a replication-deficient chimpanzee adenovirus vector used in the method for treating CHB and/or CHD comprises a ChAd vector, which comprises the nucleotide sequence given in SEQ ID NO: 10 Or a polynucleotide vector insert of the nucleotide sequence given in SEQ ID NO: 14. In a specific embodiment, the vector is a ChAd155 vector. Therefore, in certain embodiments, the composition comprising the replication-deficient chimpanzee adenovirus vector used in the method for treating CHB and/or CHD comprises the ChAd155 vector, which comprises the amino acid sequence encoding the amino acid sequence of SEQ ID NO: 9 Polynucleotide vector insert. In other embodiments, the composition comprising a replication-deficient chimpanzee adenovirus vector used in the method for treating CHB and/or CHD comprises a ChAd155 vector, which comprises a polynucleoside encoding the amino acid sequence of SEQ ID NO: 15 Acid carrier insert. In one embodiment, the composition comprising the replication-deficient chimpanzee adenovirus vector used in the method for treating CHB and/or CHD comprises the ChAd155 vector, which comprises the nucleotide sequence given in SEQ ID NO: 10 The polynucleotide vector insert. In other embodiments, the composition comprising the replication-deficient chimpanzee adenovirus vector used in the method for treating CHB and/or CHD comprises the ChAd155 vector, which comprises the nucleotide sequence given in SEQ ID NO: 14 Polynucleotide vector insert.

In one embodiment, the MVA vector-containing composition used in the method for treating CHB and/or CHD includes an MVA vector, which includes a vector insert encoding HBc and HBs, which is cleaved by 2A encoding foot-and-mouth disease virus Sequence separation of regions. In certain embodiments, the vector insert encodes HBc and HBs, which are separated by a sequence that encodes a spacer that incorporates the 2A cleavage region of foot-and-mouth disease virus. In a specific embodiment, the composition comprising an MVA vector used in the method for treating CHB and/or CHD comprises an MVA vector, which comprises a polynucleotide vector insert encoding HBc, 2A and HBs, for example, the encoding has a map The insert of the structure of the structure shown in 12. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In one embodiment, the MVA vector-containing composition used in the method for treating CHB and/or CHD includes the MVA vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:5. In one embodiment, the composition comprising an MVA vector used in the method for treating CHB and/or CHD comprises an MVA vector, which comprises a polynucleotide vector having the nucleotide sequence given in SEQ ID NO: 6 Insert.

In one embodiment, the composition comprising recombinant HBs antigen, recombinant HBc antigen and adjuvant in the method for treating CHB and/or CHD comprises recombinant HBc and recombinant HBs in a ratio of 1:1. In another embodiment, the ratio of HBc to HBs in the composition is greater than 1, for example, the ratio of HBc to HBs can be 1.5:1, 2:1, 2.5:1, 3:1, 3.5:1, 4:1 , 4.5:1, 5:1, 5.5:1, 6:1 or greater, especially 3:1 to 5:1, such as 3:1, 4:1 or 5:1, especially 4:1 ratio. In a specific embodiment, the composition comprising recombinant HBs antigen, recombinant HBc antigen and adjuvant in the method for treating CHB and/or CHD comprises recombinant HBc and recombinant HBs in a ratio of 4:1 or greater. In certain embodiments, the composition comprising recombinant HBs antigen, recombinant HBc antigen and adjuvant in the method for treating CHB and/or CHD comprises full-length recombinant hepatitis B surface antigen (HBs) (e.g., SEQ ID NO: 1) Recombinant hepatitis B virus core antigen (HBc) truncated at the C-terminal and adjuvant. In certain embodiments, the truncated recombinant HBc comprises the assembly domain of HBc, such as the amino acid 1-149 of HBc (eg SEQ ID NO: 2). In one embodiment, the composition comprising recombinant HBs antigen, recombinant HBc antigen and adjuvant in the method for treating CHB and/or CHD comprises full-length recombinant HBs, HBc amino acid 1-149 and comprises MPL and QS -21 adjuvant. For example, the composition comprising recombinant HBs antigen, recombinant HBc antigen and adjuvant in the method for treating CHB and/or CHD comprises full-length recombinant HBs (SEQ ID NO:1), amino acids 1-149 of HBc (SEQ ID NO: 2) and adjuvants containing MPL and QS-21. In some embodiments, the recombinant protein HBs and HBc antigens are in the form of virus-like particles.

The compositions disclosed herein that can be used in the disclosed methods are suitable pharmaceutically acceptable compositions. Suitably, the pharmaceutical composition will include a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a salt of a modified oligonucleotide.

Antisense oligonucleotides can be blended with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. The composition and method for formulating the pharmaceutical composition depend on multiple indicators, including but not limited to the route of administration, the degree of disease, or the dose to be administered.

Antisense oligonucleotides targeting HBV nucleic acids can be used in pharmaceutical compositions by combining ASO with suitable pharmaceutically acceptable diluents or carriers. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS). PBS is a suitable diluent for compositions to be delivered parenterally. Therefore, in one embodiment, the method used in the method described herein is a pharmaceutical composition comprising HBV ASO and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. A composition containing HBV ASO can be prepared for use by suspending ASO or its pharmaceutically acceptable salt in PBS or any pharmaceutically or physiologically acceptable carrier (such as isotonic saline, injection Use water or other suitable diluents) for administration.

Compositions containing ChAd or MVA carriers can be prepared for administration by suspending viral vector particles in a pharmaceutically or physiologically acceptable carrier (such as isotonic saline or other isotonic saline solutions). versus. Appropriate carriers will be obvious to those skilled in the art, and will largely depend on the route of administration.

Compositions containing recombinant protein antigens can be separated and purified from the cell culture in which the proteins are expressed, suspended in a formulation buffer including one or more salts, surfactants and/or cryoprotectants, and lyophilized To prepare. For example, a suitable formulation buffer may include sugar or a mixture of sugars, such as sucrose, trehalose or sucralose as cryoprotective agents and non-ionic copolymers, such as poloxamer as a surfactant. For administration, the lyophilized recombinant protein formulation is reconstituted in a pharmaceutically or physiologically acceptable carrier (such as isotonic saline or other isotonic saline solution for injection or inhalation). Appropriate carriers will be obvious to those skilled in the art, and will largely depend on the route of administration. The reconstituted composition may also include an adjuvant or a mixture of adjuvants. In one embodiment, the lyophilized recombinant protein is reconstituted in a liquid adjuvant system formulation.

As used herein, the term "carrier" refers to a pharmacologically inactive substance, such as, but not limited to, a diluent, excipient, or vehicle with therapeutically active ingredients to be administered. Liquid carriers include, but are not limited to, sterile liquids such as physiological saline solutions in water and oils, including oils of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Physiological saline solution, dextrose aqueous solution and glycerol solution can also be used as liquid carriers, especially for injectable solutions. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin.

In addition to the ASO, carrier, or recombinant protein of the composition, the composition used in the methods disclosed herein may include an adjuvant system. The term "adjuvant" refers to an agent that enhances, stimulates, activates, enhances or modulates the immune response of the antigen of the composition with the content of cells or body fluids. For example, an immune adjuvant stimulates the response of the immune system to the antigen, but does not have an immune effect. The compositions disclosed herein may include adjuvants as individual ingredients in the formulation, regardless of whether the vector included in the composition also encodes a "gene adjuvant", such as hIi.

Suitable adjuvants are those adjuvants that can enhance the immune response in individuals suffering from chronic conditions and destroying immunity. CHB patients are characterized by their inability to establish a highly effective innate and adaptive immune response to the virus, which makes the development of highly effective vaccines challenging. In these patients, a key function of adjuvanted vaccine formulations should be to direct cell-mediated immune responses to the T-helper 1 (Th1) profile, which is recognized to be critical for the removal of intracellular pathogens.

Examples of suitable adjuvants include, but are not limited to, inorganic adjuvants (e.g., inorganic metal salts, such as aluminum phosphate or aluminum hydroxide), organic non-peptide adjuvants (e.g., saponin, such as QS21 or squalene), oil-based adjuvants (E.g. Freund's complete adjuvant (Freund's complete adjuvant) and Freund's incomplete adjuvant (Freund's incomplete adjuvant)), cytokines (e.g. IL-1β, IL-2, IL-7, IL-12, IL- 18.GM-CFS and INF-γ), particle adjuvants (such as immunostimulatory complex (ISCOMS), liposomes or biodegradable particles), viral particles, bacterial adjuvants (such as monophosphoryl lipid A (MPL) , Such as 3-deacylated monophosphoryl lipid A (3D-MPL) or cell mural peptide), synthetic adjuvants (such as non-ionic block copolymers, cell mural peptide analogs or synthetic lipid A ), synthetic polynucleotide adjuvants (such as polyarginine or polylysine) and immunostimulatory oligonucleotides containing unmethylated CpG dinucleotides ("CpG"). In detail, the adjuvant may be an organic non-peptide adjuvant (e.g., saponin, such as QS21 or squalene) and/or a bacterial adjuvant (e.g., monophosphoryl lipid A (MPL), such as 3-deglycyl phosphate Monophosphoryl lipid A (3D-MPL).

A suitable adjuvant is monophosphoryl lipid A (MPL), especially 3-deacylated monophosphoryl lipid A (3D-MPL). Chemical methods, which are usually supplied as a mixture of 3-deacylated monophosphoryl lipid A and 4, 5 or 6 acylated chains. It can be purified and prepared by the method taught in GB 2122204B. The reference also discloses the preparation of diphosphatidyl lipid A and its 3-O-deacylated variants. Other purified and synthesized lipopolysaccharides have been described [US Patent No. 6,005,099 and EP0729473B1; Hilgers, 1986; Hilgers, 1987; and EP0549074B1].

Saponin is also a suitable adjuvant [[Lacaille-Dubois, 1996]. For example, QuilA saponin (derived from the South American tree Quillaja saponaria (Quillaja saponaria) Molina the bark) and parts thereof are described in U.S. Patent No. 5,057,540 and Kensil, 1996; and in EP 0 362 279 B1. The purified part of Quil A is also called immunostimulant, such as QS21 and QS17; its production method is disclosed in US Patent No. 5,057,540 and EP 0 362 279 B1. The use of QS21 is further described in Kensil, 1991. The combination of QS21 and polysorbate or cyclodextrin is also known (WO 99/10008). Particulate adjuvant systems containing parts of QuilA (such as QS21 and QS7) are described in WO 96/33739 and WO 96/11711.

Adjuvants such as those described above can be formulated with carriers such as liposomes, oil-in-water emulsions, and/or metal salts (including aluminum salts such as aluminum hydroxide). For example, 3D-MPL can be formulated with aluminum hydroxide (EP 0 689 454) or oil-in-water (WO 95/17210); QS21 can be formulated with liposome-containing cholesterol (WO 96/33739), oil-in-water emulsion (WO 95 /17210) or alum (WO 98/15287).

Combinations of adjuvants can be used in the disclosed compositions, specifically the combination of monophosphoryl lipid A and saponin derivatives (see, for example, WO 94/00153, WO 95/17210, WO 96/33739, WO 98/ 56414, WO 99/12565, WO 99/11241), more specifically the combination of QS21 and 3D-MPL as disclosed in WO 94/00153, or wherein QS21 is quenched in containing as disclosed in WO 96/33739 Composition in cholesterol liposomes (DQ). An effective adjuvant formulation involving QS21, 3D-MPL and tocopherol in an oil-in-water emulsion is described in WO 95/17210 and is another formulation that can be used in the disclosed composition. Therefore, suitable adjuvant systems include, for example, a combination of monophosphoryl lipid A, preferably 3D-MPL, and aluminum salt (e.g. as described in WO00/23105). Another exemplary adjuvant includes QS21 and/or MPL and/or CpG. QS21 can be quenched in cholesterol-containing liposomes as disclosed in WO 96/33739.

Therefore, an adjuvant suitable for use in the disclosed composition is AS01, which is a liposome-based adjuvant containing MPL and QS-21. Liposomes, which are vehicles for MPL and QS-21 immune enhancers, are composed of dioleyl phospholipid choline (DOPC) and cholesterol in a phosphate buffered saline solution. AS01 _{B - 4} is a particularly preferred variant of AS01 adjuvant, which is composed of DOPC/cholesterol liposome-containing immune enhancer QS-21 (triterpene glycosides purified from the bark of Quillaja saponaria) and MPL (3-D single Phospholipid A) is used as a vehicle for these immune enhancers and sorbitol in a PBS solution. Specifically, a single human dose of AS01 _{B - 4} (0.5 mL) contains 50 µg QS-21 and 50 µg MPL. AS01 _{E - 4} corresponds to _{the two-fold dilution of AS01 B - 4} , that is, it contains 25 µg QS-21 and 25 µg MPL/human dose.

In one embodiment, there is provided an immunogenic combination in a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic combination comprising a composition, The composition includes recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and an adjuvant. In one embodiment, the immunogenic combination comprises a composition comprising recombinant hepatitis B surface antigen (HBs), truncated recombinant hepatitis B virus core antigen (HBc) and an adjuvant. In one embodiment, the immunogenic combination comprises a composition comprising recombinant HBs, truncated recombinant HBc and AS01 adjuvant. In a specific embodiment, the immunogenic combination comprises a composition comprising truncated recombinant HBc and recombinant HBs in a ratio of 4:1 or greater, and an AS01 adjuvant, such as AS01 _{B - 4} or AS01 _{E - 4} .

In one embodiment, there is provided an immunogenic combination in a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic combination comprising: a) A composition containing 10 to 30 nucleoside antisense oligonucleotides (HBV ASO) targeting HBV nucleic acid; b) A composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); c) A composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and d) A composition containing recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvants, Wherein the method comprises sequentially or simultaneously administering the compositions to the human.

In a specific embodiment, the HBV ASO administered in step a) of the method has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is consistent with the nucleobase 1583 The HBV genome sequence SEQ ID NO: 16 at 1602 is complementary. In a specific embodiment, the HBV ASO administered in step a) of the method has the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), which is the same as the HBV genome sequence at nucleobases 1583-1602 SEQ ID NO: 16 is complementary.

In another aspect, there is provided an immunogenic composition for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic composition comprising : Replication-deficient chimpanzee adenovirus (ChAd) vector, which contains polynucleotides encoding hepatitis B surface antigen (HBs), nucleic acid encoding hepatitis B virus core antigen (HBc), and human invariant encoding fusion to HBc A nucleic acid of strand (hIi), wherein the method comprises administering the composition in the prime-additional regimen and at least one other immunogenic composition as provided herein. In one embodiment, the composition comprises a ChAd vector selected from the group consisting of ChAd3, ChAd63, ChAd83, ChAd155, ChAd157, Pan 5, Pan 6, Pan 7 (also known as C7) and Pan 9, especially ChAd63 Or ChAd155. In certain embodiments, the ChAd vector includes vector inserts encoding HBc and HBs separated by spacers incorporating sequences encoding the 2A cleavage region of foot-and-mouth disease virus. In a specific embodiment, the composition includes a ChAd155 vector, which includes a polynucleotide vector insert encoding hIi, HBc, 2A, and HBs, such as an insert encoding a construct having the structure shown in FIG. 12. In one embodiment, the composition includes a ChAd155 vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:9. In another embodiment, the composition includes a ChAd155 vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:15. In one embodiment, the composition comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:10. In another embodiment, the composition comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:14.

In another aspect, there is provided an immunogenic composition for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic composition comprising : A modified pox virus Ankara (MVA) vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); wherein the method comprises administration in The composition in the prime-additional regimen and at least one other immunogenic composition as provided herein. In one embodiment, the composition includes an MVA vector, which includes vector inserts encoding HBc and HBs separated by a spacer incorporating a sequence encoding the 2A cleavage region of foot-and-mouth disease virus. In a specific embodiment, the composition includes an MVA vector, which includes a polynucleotide vector insert encoding HBc, 2A, and HBs, such as an insert encoding a construct having the structure shown in FIG. 12. In one embodiment, the composition includes an MVA vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:5. In one embodiment, the composition comprises an MVA vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:6.

In another aspect, there is provided an immunogenic composition for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic composition comprising : Recombinant hepatitis B surface antigen (HBs), C-terminal truncated recombinant hepatitis B virus core antigen (HBc), and adjuvants containing MPL and QS-21, wherein the method includes administration in the primary immunization-additional program The composition and at least one other immunogenic composition as provided herein. In one embodiment, the composition comprises truncated recombinant HBc, which comprises the assembly domain of HBc, such as the amino acid 1-149 of HBc. In one embodiment, the composition includes full-length recombinant HBs, amino acids 1-149 of HBc, and an adjuvant including MPL and QS-21. More specifically, the composition for the method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans comprises full-length recombinant HBs (for example, SEQ ID NO: 1), an amine of HBc Base acid 1-149 (such as SEQ ID NO: 2) and adjuvants containing MPL and QS-21 and liposomes containing dioleyl phosphatidylcholine (DOPC) and cholesterol. In some embodiments, the recombinant protein HBs and HBc antigens are in the form of virus-like particles. In a specific embodiment, the composition includes truncated recombinant HBc and full-length recombinant HBs in a ratio of 4:1 or greater, and AS01 adjuvant. In certain embodiments, the composition comprises a truncation consisting of amino acids 1-149 of HBc in a ratio of 4:1 (e.g., SEQ ID NO: 2) and full-length recombinant HBs (e.g., SEQ ID NO: 1) Core antigen and AS01 _B-4 .

In another aspect, there is provided a composition for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the composition comprising: a nucleic acid targeting HBV An antisense oligonucleotide (HBV ASO) of 10 to 30 nucleosides in length, wherein the method comprises administering a composition in a treatment regimen and at least one immunogenic composition as provided herein. In one embodiment, the composition comprises an antisense oligonucleotide having a nucleotide sequence selected from SEQ ID NO: 83-310 of WO2012/145697. In a specific embodiment, the antisense oligonucleotide targeting HBV nucleic acid (HBV ASO) has a nucleotide sequence selected from SEQ ID NO: 224-227 of WO2012/145697. In a specific embodiment, the HBV ASO has the complementary sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697) to the HBV genome sequence SEQ ID NO: 16 at nucleobases 1583-1602. In a specific embodiment, HBV ASO is a modified oligonucleotide "spacer" composed of 20 linked nucleosides, wherein the linkage between each nucleoside is a phosphorothioate linkage and each cytosine is 5- Methyl cytosine, the HBV ASO has the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), and a 5'wing segment consisting of five linked nucleosides GCAGA each containing 2'-O-methoxyethyl sugar , Then ten linked deoxynucleosides GGTGAAGGCGA and 5 linked nucleosides ATGGC each containing 2'-O-methoxyethyl sugar consist of 3'wing segments.

In another aspect, there is provided an immunogenic combination comprising: a) A composition containing 10 to 30 nucleoside antisense oligonucleotides (ASO) (HBV ASO) targeting HBV nucleic acid; b) A composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); c) A composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and d) A composition containing recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvants.

In a specific embodiment, the HBV ASO at nucleobases 1583-1602 has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO:226 of WO2012/145697) complementary to the HBV genome sequence SEQ ID NO:16. In a specific embodiment, the HBV ASO has the complementary sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697) to the HBV genome sequence SEQ ID NO: 16 at nucleobases 1583-1602.

The immunogenic combination can be used in a method of treating CHB and/or CHD in humans by sequentially or simultaneously administering the composition.

In one embodiment, part a) of the combination comprises a composition having an antisense oligonucleotide selected from the nucleotide sequence of SEQ ID NO: 83-310 of WO2012/145697. In a specific embodiment, the antisense oligonucleotide targeting HBV nucleic acid (HBV ASO) has a nucleotide sequence selected from SEQ ID NO: 224-227 of WO2012/145697. In a specific embodiment, the HBV ASO has the complementary sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697) to the HBV genome sequence SEQ ID NO: 16 at nucleobases 1583-1602. In a specific embodiment, HBV ASO is a modified oligonucleotide "spacer" composed of 20 linked nucleosides, wherein the linkage between each nucleoside is a phosphorothioate linkage and each cytosine is 5- Methyl cytosine, the HBV ASO has the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), and a 5'wing segment consisting of five linked nucleosides GCAGA each containing 2'-O-methoxyethyl sugar , Then ten linked deoxynucleosides GGTGAAGGCGA and 5 linked nucleosides ATGGC each containing 2'-O-methoxyethyl sugar consist of 3'wing segments.

In one embodiment, part b) of the combination comprises a composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs), encoding The nucleic acid of hepatitis B virus core antigen (HBc) and the nucleic acid of human invariant chain (hIi) fused to HBc. In one embodiment, the composition comprises a ChAd vector selected from the group consisting of ChAd3, ChAd63, ChAd83, ChAd155, ChAd157, Pan 5, Pan 6, Pan 7 (also known as C7) and Pan 9, especially ChAd63 Or ChAd155. In certain embodiments, the ChAd vector includes vector inserts encoding HBc and HBs separated by spacers incorporating sequences encoding the 2A cleavage region of foot-and-mouth disease virus. In a specific embodiment, the composition includes a ChAd155 vector, which includes a polynucleotide vector insert encoding hIi, HBc, 2A, and HBs, such as an insert encoding a construct having the structure shown in FIG. 12. In one embodiment, the composition includes a ChAd155 vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:9. In another embodiment, the composition includes a ChAd155 vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:15. In one embodiment, the composition comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:10. In another embodiment, the composition comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:14.

In one embodiment, part c) of the combination comprises a composition comprising an MVA vector, the MVA vector comprising a vector insert encoding HBc and HBs separated by a sequence encoding the 2A cleavage region of foot-and-mouth disease virus子detached. In a specific embodiment, the composition includes an MVA vector, which includes a polynucleotide vector insert encoding HBc, 2A, and HBs, such as an insert encoding a construct having the structure shown in FIG. 12. In one embodiment, the composition includes an MVA vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:5. In one embodiment, the composition comprises an MVA vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:6.

In one embodiment, part d) of the combination comprises a composition comprising recombinant hepatitis B surface antigen (HBs), C-terminally truncated recombinant hepatitis B virus core antigen (HBc) and containing MPL and QS-21 The adjuvant. In one embodiment, the composition comprises truncated recombinant HBc, which comprises the assembly domain of HBc, such as the amino acid 1-149 of HBc. In one embodiment, the composition includes full-length recombinant HBs, amino acids 1-149 of HBc, and an adjuvant including MPL and QS-21. More specifically, the composition for the method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans comprises full-length recombinant HBs (for example, SEQ ID NO: 1), an amine of HBc Base acid 1-149 (such as SEQ ID NO: 2) and adjuvants containing MPL and QS-21 and liposomes containing dioleyl phosphatidylcholine (DOPC) and cholesterol. In some embodiments, the recombinant protein HBs and HBc antigens are in the form of virus-like particles. In a specific embodiment, the composition includes truncated recombinant HBc and full-length recombinant HBs in a ratio of 4:1 or greater, and AS01 adjuvant. In certain embodiments, the composition comprises a truncation consisting of amino acids 1-149 of HBc in a ratio of 4:1 (e.g., SEQ ID NO: 2) and full-length recombinant HBs (e.g., SEQ ID NO: 1) Core antigen and AS01 _{B - 4} .

In another aspect, there is provided the use of an immunogenic composition in the manufacture of a medicament for the treatment of chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans. The immunogenicity The composition comprises: a replication-deficient chimpanzee adenovirus (ChAd) vector, which comprises a polynucleotide encoding hepatitis B surface antigen (HBs), a nucleic acid encoding hepatitis B virus core antigen (HBc), and a nucleic acid encoding hepatitis B virus core antigen (HBc) fused to HBc Human invariant chain (hIi) nucleic acid, wherein the method of treating chronic hepatitis B infection comprises administering the composition in the prime-additional regimen and at least one other immunogenic composition as provided herein. In one embodiment, the composition comprises a ChAd vector selected from the group consisting of ChAd3, ChAd63, ChAd83, ChAd155, ChAd157, Pan 5, Pan 6, Pan 7 (also known as C7) and Pan 9, especially ChAd63 Or ChAd155. In certain embodiments, the ChAd vector includes vector inserts encoding HBc and HBs separated by spacers incorporating sequences encoding the 2A cleavage region of foot-and-mouth disease virus. In a specific embodiment, the composition includes a ChAd155 vector, which includes a polynucleotide vector insert encoding hIi, HBc, 2A, and HBs, such as an insert encoding a construct having the structure shown in FIG. 13. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In certain embodiments, HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) is fused to hIi (e.g., SEQ ID NO: 7 or an amino acid sequence that is at least 98% homologous to it) Or SEQ ID NO: 12 or an amino acid sequence that is at least 98% homologous to it). For example, HBc (e.g., SEQ ID NO: 11) is fused to hIi (e.g., SEQ ID NO: 7), or HBc (e.g., SEQ ID NO: 11) is fused to hIi (e.g., SEQ ID NO: 12). In one embodiment, the composition includes a ChAd155 vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:9. In an alternative embodiment, the composition comprises a ChAd155 vector, which comprises a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:15. In one embodiment, the composition comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:10. In an alternative embodiment, the composition comprises a ChAd155 vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:14.

In another aspect, there is provided the use of an immunogenic composition in the manufacture of a medicament for the treatment of chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans. The immunogenicity The composition comprises: a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc), wherein the treatment of chronic B The method of hepatitis B infection comprises administering the composition in the prime-additional regimen and at least one other immunogenic composition as provided herein. In one embodiment, the composition includes an MVA vector that includes a vector insert encoding HBc and HBs separated by a spacer incorporating a sequence encoding the 2A cleavage region of foot-and-mouth disease virus. In a specific embodiment, the composition includes an MVA vector, which includes a polynucleotide vector insert encoding HBc, 2A, and HBs, such as an insert encoding a construct having the structure shown in FIG. 12. In certain embodiments, the vector insert encodes HBc (e.g., SEQ ID NO: 11 or an amino acid sequence that is at least 98% homologous to it) and HBs (e.g., SEQ ID NO: 1) separated by a sequence encoding a spacer. Or an amino acid sequence that is at least 98% homologous to it), the spacer incorporates the 2A cleavage region of the foot-and-mouth disease virus (for example, SEQ ID NO: 3 or an amino acid sequence that is at least 98% homologous to it). In one embodiment, the composition includes an MVA vector, which includes a polynucleotide vector insert encoding the amino acid sequence of SEQ ID NO:5. In one embodiment, the composition comprises an MVA vector, which comprises a polynucleotide vector insert having the nucleotide sequence given in SEQ ID NO:6.

In another aspect, there is provided the use of an immunogenic composition in the manufacture of a medicament for the treatment of chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans. The immunogenicity The composition includes: recombinant hepatitis B surface antigen (HBs), C-terminal truncated recombinant hepatitis B virus core antigen (HBc), and an adjuvant containing MPL and QS-21, wherein the method of treating chronic hepatitis B infection includes administration With the composition in the prime-additional regimen and at least one other immunogenic composition as provided herein. In one embodiment, the composition comprises truncated recombinant HBc, which comprises the assembly domain of HBc, such as the amino acid 1-149 of HBc. In one embodiment, the composition comprises full-length recombinant HBs (e.g. SEQ ID NO: 1), the amino acid 1-149 of HBc (e.g. SEQ ID NO: 2) and an adjuvant comprising MPL and QS-21 (e.g. AS01 adjuvant, such as AS01 _{B - 4} or AS01 _{E - 4} ). In some embodiments, the recombinant protein HBs and HBc antigens are in the form of virus-like particles.

In another aspect, there is provided the use of a composition in the manufacture of a medicament for the treatment of chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the composition comprising targeting HBV The length of the nucleic acid is 10 to 30 nucleoside antisense oligonucleotides (HBV ASO). In one embodiment, the composition comprises an antisense oligonucleotide having a nucleotide sequence selected from SEQ ID NO: 83-310 of WO2012/145697. In a specific embodiment, the antisense oligonucleotide targeting HBV nucleic acid (HBV ASO) has a nucleotide sequence selected from SEQ ID NO: 224-227 of WO2012/145697. In a specific embodiment, the HBV ASO has the complementary sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697) to the HBV genome sequence SEQ ID NO: 16 at nucleobases 1583-1602. In a specific embodiment, HBV ASO is a modified oligonucleotide "spacer" composed of 20 linked nucleosides, wherein the linkage between each nucleoside is a phosphorothioate linkage and each cytosine is 5- Methyl cytosine, the HBV ASO has the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697), and a 5'wing segment consisting of five linked nucleosides GCAGA each containing 2'-O-methoxyethyl sugar , Then ten linked deoxynucleosides GGTGAAGGCGA and 5 linked nucleosides ATGGC each containing 2'-O-methoxyethyl sugar consist of 3'wing segments.

In one embodiment, there is provided a use of an immunogenic combination in the manufacture of a medicament for the treatment of chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in humans, the immunogenic combination comprising : i. A composition containing 10 to 30 nucleoside antisense oligonucleotides (HBV ASO) targeting HBV nucleic acid; ii. A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); iii. A composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and iv. A composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvants, Wherein the method of treating chronic hepatitis B infection comprises administering the compositions to the human sequentially or simultaneously.

In a specific embodiment, the HBV ASO at nucleobases 1583-1602 has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO:226 of WO2012/145697) complementary to the HBV genome sequence SEQ ID NO:16. In a specific embodiment, the HBV ASO has the complementary sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697) to the HBV genome sequence SEQ ID NO: 16 at nucleobases 1583-1602.

In a specific embodiment, the use of an immunogenic combination in the manufacture of a medicament for the treatment of CHB and/or CHD includes: i. A composition containing 10 to 30 nucleoside antisense oligonucleotides (HBV ASO) targeting HBV nucleic acid; ii. A composition comprising a replication-deficient ChAd vector, the ChAd vector comprising a polynucleotide encoding HBs, a nucleic acid encoding HBc, and a polynucleotide encoding hIi; iii. A composition comprising an MVA vector, the MVA vector comprising a polynucleotide encoding HBs and a nucleic acid encoding HBc; and iv. Compositions containing recombinant HBs, truncated HBc and adjuvants containing MPL and QS-21, The method for treating CHB and/or CHD includes the following steps: a) administer the composition to the human i.; b) administer the composition to the human being ii.; c) administer the composition iii. to the human; and d) administer the composition to the human being iv., The steps of the method are carried out sequentially, wherein step a) precedes step b), step b) precedes step c), and step c) precedes step d). In another embodiment, step a) is repeated. In another embodiment, step d) is repeated and the steps of the method are performed in sequence a), b), c), c), c), and d). In another embodiment, step d) is performed simultaneously with step b) and/or with step b).

In a specific embodiment, the HBV ASO at nucleobases 1583-1602 has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO:226 of WO2012/145697) complementary to the HBV genome sequence SEQ ID NO:16. In a specific embodiment, the HBV ASO has the complementary sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697) to the HBV genome sequence SEQ ID NO: 16 at nucleobases 1583-1602.

In another aspect, the present invention provides a kit including: a) A composition containing 10 to 30 nucleoside antisense oligonucleotides (HBV ASO) targeting HBV nucleic acid; b) A composition containing a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector containing a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); c) A composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and d) A composition containing recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvants, The instructions are for sequential or simultaneous administration of the components used to treat CHB and/or CHD.

In a specific embodiment, the HBV ASO at nucleobases 1583-1602 has 85-95% identity with the sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO:226 of WO2012/145697) complementary to the HBV genome sequence SEQ ID NO:16. In a specific embodiment, the HBV ASO has the complementary sequence GCAGAGGTGAAGCGAAGTGC (SEQ ID NO: 226 of WO2012/145697) to the HBV genome sequence SEQ ID NO: 16 at nucleobases 1583-1602.

Invest In one embodiment of the disclosed method, the disclosed composition is administered via intranasal, intramuscular, subcutaneous, intradermal, or topical routes. Preferably, the administration is via intramuscular route.

Intranasal administration is the administration of the composition to the mucosa of the intact respiratory tract including the lungs. More specifically, the composition is administered to the mucosa of the nose. In one embodiment, intranasal administration is achieved by means of sprays or aerosols. Intramuscular administration refers to the injection of the composition into any muscle of an individual. An exemplary intramuscular injection is administered to the deltoid muscle, lateral femoral muscle, or abdominal buttocks and buttocks area. Preferably, the administration is to the deltoid muscle. Subcutaneous administration refers to the injection of the composition into the subcutaneous tissue. Intradermal administration refers to the injection of the composition into the dermis between the skin layers. Topical administration is to administer the composition to any part of the skin or mucosa without penetrating the skin with a needle or similar device. The composition can be topically administered to the mucosa of the oral cavity, nose, genital area and/or rectum. Local administration includes methods of administration, such as sublingual and/or intrabuccal administration. Sublingual administration is the administration of the composition under the tongue (for example, using an oral film (OTF)). Intrabuccal administration is to administer the carrier through the buccal mucosa of the cheek.

The method disclosed herein can be in the form of primary immunization-additional immunization. Therefore, this article discloses a composition suitable for a method of treating CHB and/or CHD, which is a primary immunization-boost immunization method. In many cases, a single administration of an immunogenic composition is insufficient to produce the number of durable immune cells required for effective protection or treatment of disease. Therefore, it may be necessary to repeatedly challenge a biological agent specific to a particular pathogen or disease in order to generate sustained and protective immunity against the pathogen or disease or to treat or functionally cure a given disease. The administration plan that includes repeated administration of immunogenic compositions or vaccines against the same pathogen or disease is called "primary immunization-additional plan". In one embodiment, the prime-boost regimen involves at least two administrations of immunogenic compositions against hepatitis B. The first administration of an immunogenic composition is called "primary immunization" and any subsequent administration of the same immunogenic composition or immunogenic composition against the same pathogen is called "additional". It should be understood that 2, 3, 4 or even 5 administrations for the booster immune response are also encompassed. The time period between the initial exemption and the supplementation is 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, or 12 weeks depending on the situation. More specifically, it is 4 weeks or 8 weeks. If more than one supplement is performed, the subsequent supplement will be administered 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, 6 months, or 12 months after the previous boost. For example, the interval between any two additions can be 4 weeks or 8 weeks.

The compositions used in the disclosed methods are administered in a therapeutic regimen that involves the administration of another immunogenic component each formulated in a different composition. The composition is advantageously administered at or near the same site. For example, the components can be administered intramuscularly to the same side or end ("same side" administration) or to the opposite side or end ("anti-side" administration). For example, in reverse administration, the first composition can be administered to the left deltoid muscle, and the second composition can be administered to the right deltoid muscle sequentially or simultaneously. Alternatively, in the same side administration, the first composition can be administered to the left deltoid muscle, and the second composition can also be administered to the left deltoid muscle sequentially or simultaneously.

General manufacturing method ChAd155-hIi-HBV: As a transgenic gene, insert the recombinant replication-deficient monkey (chimpanzee-derived) adenovirus group C vector ChAd155. The DNA fragment is derived from two HBV protein antigens, core nucleocapsid protein antigen HBc and The small surface antigen HBs was isolated by the self-cleavage 2A region of foot-and-mouth disease virus (FMDV) [Donnelly et al. 2001]. The 2A region of FMDV allows the processing of HBc-HBs fusion to a single protein antigen. In addition, the N-terminal part of the gene encoding the HBc protein has been fused to the gene encoding the human major histocompatibility complex (MHC) class II related invariant chain p35 isoform (hIi). A schematic representation of the hIi-HBV transgenic gene sequence is provided in (Figure 13).

The 2A region (18 amino acids) has been supplemented with 6 amino acid spacers at its N-terminus; spacers of this nature have been reported to increase the efficacy of 2A-mediated cleavage. Region 2A-mediated protease cleavage occurs at the C-terminus of 2A, just before the last proline in the 2A amino acid sequence. Proline remains at the N-terminus of the HBs protein, and the 23 amino acids located before the proline cleavage site remain together with the hIi-HBc-2A polypeptide.

The expression of the transgenic gene thus produces two independent polypeptides after protease treatment: hIi-HBc-spacer-2A and HBs. For brevity, the hIi-HBc-spacer-2A polypeptide is referred to as hIi-HBc protein. When expressed in cell culture, the hIi-HBc antigen was detected in the cell culture supernatant and the HBs protein was detected in the intracellular fraction.

The expression cassette encoding the antigen protein operably linked to the regulatory component in a manner that permits expression in the host cell is assembled into the ChAd155 vector plastid construct as described previously (see WO2016/198621, for revealing the ChAd155 vector For the purpose of the sequence and method, it is incorporated by reference) to obtain ChAd155-hIi-HBV. The hIi-HBV transgene is under the transcriptional control of the human cytomegalovirus (hCMV) promoter and the bovine growth hormone polyadenylation signal (BGH pA). The expression cassette encodes the amino acid sequences of HBs, HBc and hIi. The hIi sequence is fused to the HBc N-terminus of HBc. And HBs are processed into separated protein.

In order to produce a replication-deficient recombinant ChAd155 adenovirus, a helper virus or cell line, that is, a supplement or packaging cell line, must be used to supply the recombinant virus with the functions of the deleted gene region required for the replication and infectivity of the adenovirus. A particularly suitable supplemental cell line is the Procell92 cell line. The Procell92 cell line is based on HEK 293 cells transfected with Tet suppressor under the control of the human phosphoglycerate kinase-1 (PGK) promoter and G418 resistance gene expressing the adenovirus E1 gene (Vitelli et al. PLOS One (2013) ) 8(e55435):1-9). Procell92.S is suitable for growth in suspension conditions and for the production of adenovirus vectors that exhibit toxic proteins.

Production of ChAd155 - hIi - HBV API : The manufacture of ChAd155-hIi-HBV virus particles (API) involves culturing Procell-92.S cells at a cell density of 5e 5 cells/ml under infection. Subsequently, the cells were infected with ChAd155-hIi-HBV original seed virus (MVS) at an infection rate of 200 vp/cell. After cell lysis, clarification and concentration of the lysate (filtration step), the ChAd155-hIi-HBV virus collection is purified by a multi-step process including anion exchange chromatography.

Vaccine formulation and filling The purified ChAd155-hI-HBV bulk drug substance is then processed as follows: − Dilute the purified ChAd155-hIi-HBV bulk drug in the formulation buffer. − Sterile filtration. − Fill the final container.

ChAd155-hIi-HBV vaccine is a liquid formulation contained in a vial. The preparation buffer includes Tris (10 mM), L-histidine (10 mM), NaCl (75 mM), MgCl (1 mM), EDTA (0.1 mM) and sucrose (5% w/v), polysorbate -80 (0.02% w/v) and ethanol (0.5% w/v), adjust the pH to 7.4 with HCl (to the final volume of water for injection).

• MVA-HBV: MVA-HBV is a recombinant modified pox virus Ankara (MVA) carrying two different HBV proteins: core and S protein, which are separated by 2A peptide. The MVA-HBV construct is produced by the MVA-Red vector system [Di Lullo et al. 2010], which is derived from the MVA virus seed batch of the attenuation channel 571 described by Professor Anton Mayr (called MVA-571) [Mayr, A. et al. 1978].

The MVA-HBV transgenic gene encodes the core nucleocapsid protein HBc of HBV and the small surface antigen HBs. The HBc-HBs sequence is separated from the self-cleaving 2A region of the foot-and-mouth disease virus, which allows the fusion protein to be processed into separate HBc and HBs antigens as described above for the adenovirus vector. A schematic representation of the transgenic gene is provided in Figure 12.

After protease treatment, the expression of the transgene resulted in the production of two separate polypeptides: HBc-spacer-2A and HBs. For brevity, the HBc-spacer-2A polypeptide is referred to as HBc protein.

The expression cassettes were cloned into the MVA shuttle vector p94-elisaRen to produce the transfer vector p94-HBV. p94-HBV contains an antigen expression cassette flanked by the FlankIII-2 and FlankIII-1 regions under the control of the acne P7.5 early/late promoter to allow the insertion of del III of MVA by homologous recombination.

The production of recombinant virus is based on two events of in vivo recombination in CEF cells.

Briefly, primary chicken embryonic fibroblasts (CEF) were infected with MVA-Red and then transfected with p94-HBV carrying an antigen transgenic gene (and the EGFP marker gene under the control of the synthetic promoter sP). The first recombination event occurred between the MVA-Red genome and the homologous sequences (FlankIII-1 and FlankIII-2 regions) present in the transfer vector p94-HBV, and allowed the replacement of the Hcred protein gene with the transgenic gene/eGFP cassette . Infected cells containing MVA-Green intermediate were separated by FACS sorting and used to infect fresh CEF. The intermediate recombinant MVA produced by the first recombination carries the transgenic gene and the eGFP cassette and is unstable due to the existence of the repeated Z region.

Therefore, a spontaneous second recombination event involving the Z region occurs and the eGFP cassette is removed. The resulting recombinant MVA is colorless and carries a transgenic cassette.

Finally, the marker-free recombinant virus (MVA-HBV) infected cells were sorted by FACS, MVA-HBV was cloned by terminal dilution, and amplified in CEF by conventional methods.

MVA - Production of HBV API MVA-HBV virus particles (API) are produced in the primary cell culture of chicken embryonic fibroblast (CEF) cells to a cell density between 1E6 and 2E6 cells/ml, and then used MVA-HBV original seed virus (MVS) infection at an infection rate between 0.01 and 0.05 PFU/cell. The MVA-HBV virus harvest is purified by a multi-step method based on centrifugal granulation, resuspension, and step gradient centrifugation steps.

Vaccine formulation and filling The purified MVA-HBV main bulk drug is then processed as follows: − The purified MVA-HBV DS is diluted in the formulation buffer. − Fill the final container.

The MVA-HBV vaccine is a liquid formulation contained in a vial. The formulation buffer includes ginseng (hydroxymethyl) aminomethane pH 7.7 (10 mM), NaCl (140 mM) and the final volume of water for injection.

• HBs-HBc recombinant protein mixture: HBc produce recombinant protein HBc of drug (drug substance) manufacturing method consists of: using a recombinant Escherichia coli culture flasks pre-inoculated seed operation, followed by fermentation method and comprises collecting Po, extraction, clarification and Multi-step purification method with multiple chromatography and filtration steps.

The method for producing the drug to produce HBs recombinant HBs protein (drug) consists of: using a recombinant Saccharomyces cerevisiae culture flasks pre-inoculated with working seed followed by a fermentation method and comprises a Po collection, extraction, clarification and filtration steps and multiple chromatographic much Step purification method.

Vaccine formulations and filled in a formulation buffer containing sucrose as a cryoprotectant and poloxamer as a surfactant to dilute the purified HBs and HBc APIs, fill and lyophilize in 4 mL clear glass vials .

Although certain compounds, compositions, schemes and methods described herein have been specifically described according to certain embodiments, the following examples are only used to illustrate the compounds, compositions, schemes and methods described herein and are not intended to limit these Compounds, compositions, schemes and methods. Each reference mentioned in this application is incorporated herein by reference in its entirety.

Instance The goal of non-clinical trials : Strong and functional CD8⁺ Prepare CD4⁺ T cell response, specifically the response to HBcAg, has been associated with HBV clearance and identification of infections [Boni, 2012; Li, 2011; Liang, 2011; Lau, 2002; Bertoletti, 2012]. In addition, anti-S antibodies prevent the spread of HBV to uninfected hepatocytes and can be the key to the rebound after treatment to control HBV replication [Rehermann 2005; Neumann 2010]. The proposed vaccination protocol includes a heterologous primary immunization with two viral vector vaccines (ChAd155-hIi-HBV and MVA-HBV) encoding hepatitis B core (HBc) and hepatitis B surface antigen (HBs)-when supplemented Process in order to induce strong CD8⁺ T cell response and sequential or simultaneous administration of AS01_{B - 4} Adjuvant HBc-HBs protein in order to induce the stronger antigen-specific CD4 in CHB patients⁺ T cell antibody and antibody response. The immune response induced by this vaccine should ultimately be translated into a significant reduction in HBsAg concentration or HBsAg loss (that is, HBsAg concentration below the detectable level), which is regarded as a marker of complete and permanent control of HBV infection. Antisense therapy can directly target the mRNA transcript of HBV antigen, regulate the expression of HBV mRNA and protein, and thereby reduce the serum HBeAg and HBsAg content. One of the goals of non-clinical trials is to evaluate the combination of HBV ASO and vaccine regimens in overcoming tolerance to HBs (anti-HBs Ab titer), inducing T cell responses and reducing circulating HBs antigen and HBV DNA content.

Materials and methods involving examples of antisense oligonucleotides RNA Separate

RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. RNA isolation methods are well known in the art. RNA is prepared using methods well known in the art, such as using TRIZOL reagent (Invitrogen, Carlsbad, CA) according to the protocol recommended by the manufacturer.

Analysis of inhibition of target content or manifestation The content or manifestation of inhibition of HBV nucleic acid can be analyzed in a variety of ways known in the art. For example, the target nucleic acid content can be quantified by, for example, Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. RNA isolation methods are well known in the art. Northern ink spot analysis is also conventional in this technique. Quantitative real-time PCR can be conveniently implemented using commercially available ABI PRISM 7600, 7700 or 7900 sequence detection systems. These sequence detection systems can be purchased from PE-Applied Biosystems, Foster City, CA and used according to the manufacturer's instructions .

Quantitative analysis of RNA content of a target RNA in quantitative real time PCR of targets may be by quantitative real time PCR using the ABI PRISM 7600,7700, or 7900 Sequence Detection System according to manufacturer & instructions (PE-Applied Biosystems, Foster City, CA) to achieve. Quantitative real-time PCR methods are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is subsequently used as a substrate for real-time PCR amplification. Perform RT and real-time PCR reactions sequentially in the same sample tank. RT and real-time PCR reagents can be obtained from Invitrogen (Carlsbad, CA). The RT real-time PCR reaction is performed by a method familiar to those skilled in the art.

The target amount of gene (or RNA) obtained by real-time PCR is normalized using the expression amount of a gene with constant expression (such as cyclophilin A), or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A is expressed by real-time PCR, by running simultaneously with the target, multi-channel modulation, or quantification by running separately. RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR) was used to quantify total RNA. The method of RNA quantification by RIBOGREEN is taught in Jones, L.J. et al. (Analytical Biochemistry, 1998, 265, 368-374). The CYTOFLUOR 4000 instrument (PE Applied biological system) was used to measure RIBOGREEN fluorescence.

The probes and primers are designed to hybridize to HBV nucleic acid. Methods of designing real-time PCR probes and primers are well known in the art, and may include the use of software, such as PRIMER EXPRESS software (Applied Biosystems, Foster City, CA).

Quantification of target DNA content DNA content quantitative real time PCR analysis of a target can be achieved by quantitative real time PCR using the ABI PRISM 7600,7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer & instructions. Quantitative real-time PCR methods are well known in the art.

The target amount of gene (or DNA) obtained by real-time PCR is normalized by using the expression amount of a gene with constant expression (such as cyclophilin A), or by quantifying total DNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A is expressed by real-time PCR, by running simultaneously with the target, multi-channel modulation, or quantification by running separately. RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR) was used to quantify total DNA. The method of DNA quantification by RIBOGREEN is taught in Jones, L.J. et al. (Analytical Biochemistry, 1998, 265, 368-374). The CYTOFLUOR 4000 instrument (PE Applied biological system) was used to measure RIBOGREEN fluorescence.

The probes and primers are designed to hybridize to HBV nucleic acid. Methods of designing real-time PCR probes and primers are well known in the art, and may include the use of software, such as PRIMER EXPRESS software (Applied Biosystems, Foster City, CA).

Example 1: Cell widely used model for in vitro study of hepatitis B virus by spacer MOE antisense viral mRNA in cells of the HepG2 .2 15 inhibition of HBV HepG2.2.15 cells. In these cells, the HBV genome is integrated into several sites in the cell's DNA. The cells were originally derived from the human hepatoblastoma cell line HepG2 and are characterized by stable HBV expression and replication in the culture system.

Antisense oligonucleotides are designed to target HBV viral nucleic acid and tested in vitro for its effect on HBV mRNA. The cultured HepG2.2.15 cells with a density of 25,000 cells per well were transfected with 15,000 nM antisense oligonucleotides using electroporation. After a treatment period of about 24 hours, RNA was isolated from the cells and the HBV mRNA content was measured by quantitative real-time PCR. Use viral primer probe set RTS3370 (forward sequence CTTGGTCATGGGCCATCAG, designated as SEQ ID NO: 17 herein; reverse sequence CGGCTAGGAGTTCCGCAGTA, designated herein as SEQ ID NO: 18; probe sequence TGCGTGGAACCTTTTCGGC TCC, designated herein as SEQ ID NO:19) Measure mRNA content. RTS3370 detects full-length mRNA and the second part of pre-S1, pre-S2 and pre-C mRNA transcripts. The spacer is also probed with another primer probe set. Use viral primer probe set RTS3371 (forward sequence CCAAACCTTCGGACGGAAA, designated herein as SEQ ID NO: 20; reverse sequence TGAGGCCCACTCCCATAGG, designated herein as SEQ ID NO: 21; probe sequence CCCATCATCCTGGGCTTTCGGAAAAT, designated herein as SEQ ID NO :22) Measure the mRNA content. RTS3371 detects full-length mRNA and the second part of pre-S1, pre-S2 and pre-C mRNA transcripts, similar to RTS3370, but in a different region. Use viral primer probe set RTS3372 (forward sequence ATCCTATCAACACTTCCGGAAACT, designated herein as SEQ ID NO: 23; reverse sequence CGACGCGGCGATTGAG, designated herein as SEQ ID NO: 24; probe sequence AAGAACTCCCTCGCCTCGCAGACG, designated herein as SEQ ID NO :25) Measure the mRNA content. RTS3372 detects the full-length genome sequence. Use the viral primer probe set RTS3373MGB (forward sequence CCGACCTTGAG GCATACTTCA, designated herein as SEQ ID NO: 26; reverse sequence AATTTAT GCCTACAGCCTCCTAGTACA, designated herein as SEQ ID NO: 27; probe sequence TTAAAGACTGGGAGGAGTTG, designated herein as SEQ ID NO: 28) Measure the mRNA content. RTS3373MGB detects the second part of full-length mRNA and pre-S1, pre-S2 and pre-C and pre-X mRNA transcripts.

Adjust the HBV mRNA content according to the total RNA content, as measured by RIBOGREEN®. The results are presented as the percentage of HBV inhibition relative to untreated control cells.

The chimeric antisense oligonucleotides in Table 1 are designed as 5-10-5 MOE spacer, 3-10-3 MOE spacer or 2-10-2 MOE spacer. The length of the 5-10-5 MOE spacer is 20 nucleosides, in which the central spacer segment contains ten 2'-deoxynucleosides and each flanked by five nuclei on both sides (in the 5'and 3'directions) Wings of glycosides. The length of the 3-10-3 MOE spacer is 16 nucleosides, the central spacer segment contains ten 2'-deoxynucleosides and each side (in the 5'and 3'directions) flanking each contains three nucleosides s wing. The length of the 2-10-2 MOE spacer is 14 nucleosides, in which the central spacer segment contains ten 2'-deoxynucleosides and two nuclei are flanked on both sides (in the 5'and 3'directions) Wings of glycosides. Each nucleoside in the 5'wing segment and each nucleoside in the 3'wing segment have MOE sugar modifications. Each nucleoside in the central spacer has a deoxy sugar modification. The linkage between nucleosides in each spacer is a phosphorothioate (P=S) linkage. All cytosine residues in each spacer are 5'-methylcytosine.

The "start site" indicates that the spacer targets the 5'-most nucleotides in the viral gene sequence. The "stop site" indicates that the spacer targets the 3'-most nucleotide of the viral gene sequence. Each spacer listed in Table 1 targets the viral genome sequence and is referred to herein as SEQ ID NO: 16 (GENBANK accession number U95551.1). Table 1 Inhibition of viral HBV mRNA content targeting the MOE spacer of SEQ ID NO: 16 (detected by RTS3370, RTS3371, RTS3372 and RTS3373MGB) corresponds to the SQ under SEQ ID NO: 83-310 of WO2012/145697 ID NO:83-310 Start site Stop site sequence RTS3370% inhibition RTS3371% inhibition RTS3372% inhibition RTS3373MGB% inhibition Primitive SEQ ID NO 58 77 GAACTGGAGCCACCAGCAGG 76 80 82 81 5-10-5 83 58 71 GAGCCACCAGCAGG 38 32 45 31 2-10-2 84 61 80 CCTGAACTGGAGCCACCAGC 68 71 67 66 5-10-5 85 62 77 GAACTGGAGCCACCAG 36 32 71 53 3-10-3 86 196 215 AAAAACCCCGCCTGTAACAC 69 74 80 88 5-10-5 87 199 218 AAGAAAAACCCCGCCTGTAA 60 60 64 64 5-10-5 88 205 224 GTCAACAAGAAAAACCCCGC 85 83 79 85 5-10-5 89 228 241 GTATTGTGAGGATT 28 18 0 16 2-10-2 90 229 242 GGTATTGTGAGGAT 40 37 19 34 2-10-2 91 244 263 CACCACGAGTCTAGACTCTG 74 73 62 75 5-10-5 92 245 260 CACGAGTCTAGACTCT 18 15 45 46 3-10-3 93 245 258 CGAGTCTAGACTCT 32 26 twenty three 19 2-10-2 94 246 261 CCACGAGTCTAGACTC 34 35 63 60 3-10-3 95 247 266 GTCCACCACGAGTCTAGACT 75 77 64 75 5-10-5 96 250 269 GAAGTCCACCACGAGTCTAG 46 46 39 40 5-10-5 97 250 265 TCCACCACGAGTCTAG 38 39 65 59 3-10-3 98 251 270 AGAAGTCCACCACGAGTCTA 55 56 17 38 5-10-5 99 251 266 GTCCACCACGAGTCTA 34 35 64 51 3-10-3 100 252 271 GAGAAGTCCACCACGAGTCT 39 38 39 33 5-10-5 101 252 267 AGTCCACCACGAGTCT 47 51 50 45 3-10-3 102 253 272 AGAGAAGTCCACCACGAGTC 88 83 80 78 5-10-5 103 253 268 AAGTCCACCACGAGTC 46 50 56 46 3-10-3 104 254 273 GAGAGAAGTCCACCACGAGT 43 40 49 44 5-10-5 105 254 269 GAAGTCCACCACGAGT 41 46 51 44 3-10-3 106 254 267 AGTCCACCACGAGT 41 32 47 48 2-10-2 107 255 274 TGAGAGAAGTCCACCACGAG 50 57 55 55 5-10-5 108 255 270 AGAAGTCCACCACGAG 40 41 52 34 3-10-3 109 255 268 AAGTCCACCACGAG 26 29 19 twenty three 2-10-2 110 256 275 TTGAGAGAAGTCCACCACGA 51 57 55 66 5-10-5 111 256 271 GAGAAGTCCACCACGA 30 31 43 33 3-10-3 112 256 269 GAAGTCCACCACGA 44 38 53 54 2-10-2 113 257 270 AGAAGTCCACCACG 39 42 32 25 2-10-2 114 258 273 GAGAGAAGTCCACCAC 54 52 60 48 3-10-3 115 258 271 GAGAAGTCCACCAC 29 30 25 19 2-10-2 116 259 274 TGAGAGAAGTCCACCA 39 44 47 38 3-10-3 117 259 272 AGAGAAGTCCACCA 31 29 3 15 2-10-2 118 260 273 GAGAGAAGTCCACC twenty one 19 twenty three 18 2-10-2 119 261 274 TGAGAGAAGTCCAC 16 twenty two twenty one 20 2-10-2 120 262 281 AGAAAATTGAGAGAAGTCCA 53 58 52 56 5-10-5 121 265 284 CCTAGAAAATTGAGAGAAGT 62 65 69 67 5-10-5 122 293 312 ATTTTGGCCAAGACACACGG 86 84 81 85 5-10-5 123 296 315 CGAATTTTGGCCAAGACACA 67 67 69 64 5-10-5 124 302 321 GGACTGCGAATTTTGGCCAA 77 75 73 76 5-10-5 125 360 379 TCCAGCGATAACCAGGACAA 89 90 77 91 5-10-5 126 366 385 GACACATCCAGCGATAACCA 83 85 75 86 5-10-5 127 369 388 GCAGACACATCCAGCGATAA 65 68 49 57 5-10-5 128 384 399 GATAAAACGCCGCAGA 37 46 53 35 3-10-3 129 384 397 TAAAACGCCGCAGA 36 36 33 33 2-10-2 130 385 398 ATAAAACGCCGCAG 12 7 19 15 2-10-2 131 386 401 ATGATAAAACGCCGCA 49 55 57 53 3-10-3 132 386 399 GATAAAACGCCGCA 39 39 45 37 2-10-2 133 387 400 TGATAAAACGCCGC 40 37 29 39 2-10-2 134 388 401 ATGATAAAACGCCG twenty two twenty four 9 twenty two 2-10-2 135 411 430 TGAGGCATAGCAGCAGGATG 60 64 47 55 5-10-5 136 411 426 GCATAGCAGCAGGATG 62 64 71 60 3-10-3 137 411 424 ATAGCAGCAGGATG 44 34 30 48 2-10-2 138 412 431 ATGAGGCATAGCAGCAGGAT 45 54 71 62 5-10-5 139 412 427 GGCATAGCAGCAGGAT 72 75 80 71 3-10-3 140 412 425 CATAGCAGCAGGAT 29 twenty four twenty four 20 2-10-2 141 413 432 GATGAGGCATAGCAGCAGGA 54 58 54 49 5-10-5 142 413 428 AGGCATAGCAGCAGGA 63 66 68 64 3-10-3 143 413 426 GCATAGCAGCAGGA 55 54 37 46 2-10-2 144 414 433 AGATGAGGCATAGCAGCAGG 85 87 74 82 5-10-5 20 414 429 GAGGCATAGCAGCAGG 64 64 80 68 3-10-3 145 414 427 GGCATAGCAGCAGG 58 54 41 45 2-10-2 146 415 430 TGAGGCATAGCAGCAG 59 59 66 64 3-10-3 147 415 428 AGGCATAGCAGCAG 58 55 38 41 2-10-2 148 416 431 ATGAGGCATAGCAGCA 56 54 65 56 3-10-3 149 416 429 GAGGCATAGCAGCA 64 62 64 57 2-10-2 150 417 432 GATGAGGCATAGCAGC 57 52 58 49 3-10-3 151 417 430 TGAGGCATAGCAGC 48 50 55 48 2-10-2 152 418 433 AGATGAGGCATAGCAG 50 52 64 51 3-10-3 153 418 431 ATGAGGCATAGCAG 36 31 36 26 2-10-2 154 419 434 AAGATGAGGCATAGCA 48 47 72 65 3-10-3 155 419 432 GATGAGGCATAGCA 44 28 0 14 2-10-2 156 420 435 GAAGATGAGGCATAGC 45 41 65 62 3-10-3 157 420 433 AGATGAGGCATAGC 41 43 37 29 2-10-2 158 421 436 AGAAGATGAGGCATAG 32 29 64 51 3-10-3 159 421 434 AAGATGAGGCATAG twenty one 18 26 27 2-10-2 160 422 437 AAGAAGATGAGGCATA twenty one 17 55 46 3-10-3 161 422 435 GAAGATGAGGCATA 25 twenty four twenty three 25 2-10-2 162 423 436 AGAAGATGAGGCAT twenty one 17 25 19 2-10-2 163 424 437 AAGAAGATGAGGCA 17 11 38 27 2-10-2 164 454 473 ACGGGCAACATACCTTGATA 55 57 65 60 5-10-5 165 457 476 CAAACGGGCAACATACCTTG 73 77 77 74 5-10-5 166 457 472 CGGGCAACATACCTTG 60 61 73 70 3-10-3 167 458 473 ACGGGCAACATACCTT 58 63 64 58 3-10-3 168 458 471 GGGCAACATACCTT 58 56 57 46 2-10-2 169 459 472 CGGGCAACATACCT 49 43 47 37 2-10-2 170 460 473 ACGGGCAACATACC 50 50 54 51 2-10-2 171 463 482 AGAGGACAAACGGGCAACAT 64 68 64 71 5-10-5 172 466 485 ATTAGAGGACAAACGGGCAA 59 62 42 69 5-10-5 173 472 491 CCTGGAATTAGAGGACAAAC 78 81 73 86 5-10-5 174 475 494 GATCCTGGAATTAGAGGACA 56 65 61 72 5-10-5 175 639 654 GGCCCACTCCCATAGG 38 55 74 48 3-10-3 176 641 656 GAGGCCCACTCCCATA 30 46 77 54 3-10-3 177 642 657 TGAGGCCCACTCCCAT 58 57 84 66 3-10-3 178 643 658 CTGAGGCCCACTCCCA 38 53 70 66 3-10-3 179 670 689 GGCACTAGTAAACTGAGCCA 61 64 63 63 5-10-5 180 670 685 CTAGTAAACTGAGCCA 71 71 78 80 3-10-3 181 670 683 AGTAAACTGAGCCA 49 48 52 53 2-10-2 182 671 684 TAGTAAACTGAGCC 41 38 19 30 2-10-2 183 672 685 CTAGTAAACTGAGC 25 27 42 47 2-10-2 184 673 692 AATGGCACTAGTAAACTGAG 34 46 49 52 5-10-5 185 679 698 TGAACAAATGGCACTAGTAA 74 77 71 80 5-10-5 186 682 701 CACTGAACAAATGGCACTAG 82 83 71 82 5-10-5 187 687 702 CCACTGAACAAATGGC 72 73 76 80 3-10-3 188 688 707 ACGAACCACTGAACAAATGG 69 69 78 76 5-10-5 189 688 703 ACCACTGAACAAATGG 47 48 67 65 3-10-3 190 689 704 AACCACTGAACAAATG 33 33 39 41 3-10-3 191 690 705 GAACCACTGAACAAAT 50 49 63 48 3-10-3 192 691 710 CCTACGAACCACTGAACAAA 64 70 70 72 5-10-5 193 691 706 CGAACCACTGAACAAA 67 66 78 77 3-10-3 194 691 704 AACCACTGAACAAA 36 36 twenty three 32 2-10-2 195 692 705 GAACCACTGAACAA 45 44 51 43 2-10-2 196 693 706 CGAACCACTGAACA 59 52 48 49 2-10-2 197 697 716 GAAAGCCCTACGAACCACTG 76 80 73 83 5-10-5 198 738 753 CCACATCATCCATATA 40 33 62 54 3-10-3 199 738 751 ACATCATCCATATA 19 9 30 27 2-10-2 200 739 754 ACCACATCATCCATAT 76 78 93 85 3-10-3 201 739 752 CACATCATCCATAT 45 35 twenty four 17 2-10-2 202 740 753 CCACATCATCCATA 52 49 43 40 2-10-2 203 741 754 ACCACATCATCCAT 44 45 48 47 2-10-2 204 756 775 TGTACAGACTTGGCCCCCAA 47 56 55 68 5-10-5 205 823 842 AGGGTTTAAATGTATACCCA 66 71 64 72 5-10-5 206 1170 1189 GCAAACACTTGGCACAGACC 76 80 35 70 5-10-5 207 1176 1191 CAGCAAACACTTGGCA 42 44 56 54 3-10-3 208 1177 1192 TCAGCAAACACTTGGC 60 54 74 70 3-10-3 209 1259 1278 CCGCAGTATGGATCGGCAGA 88 82 57 80 5-10-5 210 1261 1276 GCAGTATGGATCGGCA 61 58 65 72 3-10-3 211 1262 1281 GTTCCGCAGTATGGATCGGC 84 81 71 83 5-10-5 212 1268 1287 CTAGGAGTTCCGCAGTATGG 78 68 70 79 5-10-5 213 1271 1290 CGGCTAGGAGTTCCGCAGTA 47 54 59 61 5-10-5 214 1277 1296 AACAAGCGGCTAGGAGTTCC 55 62 69 69 5-10-5 215 1280 1299 CAAAACAAGCGGCTAGGAGT 20 49 49 54 5-10-5 216 1283 1302 GAGCAAAACAAGCGGCTAGG 53 83 73 87 5-10-5 217 1286 1305 TGCGAGCAAAACAAGCGGCT 64 73 68 78 5-10-5 218 1413 1426 ACAAAGGACGTCCC 14 8 0 0 2-10-2 219 1515 1534 GAGGTGCGCCCCGTGGTCGG 68 81 61 80 5-10-5 220 1518 1537 AGAGAGGTGCGCCCCGTGGT 59 75 75 84 5-10-5 221 1521 1540 TAAAGAGAGGTGCGCCCCGT 63 76 83 78 5-10-5 222 1550 1563 AAGGCACAGACGGG 35 38 25 32 2-10-2 223 1577 1596 GTGAAGCGAAGTGCACACGG 88 91 84 93 5-10-5 224 1580 1599 GAGGTGAAGCGAAGTGCACA 70 75 71 82 5-10-5 225 1583 1602 GCAGAGGTGAAGCGAAGTGC 77 82 72 84 5-10-5 226 1586 1605 CGTGCAGAGGTGAAGCGAAG 72 73 67 80 5-10-5 227 1655 1674 AGTCCAAGAGTCCTCTTATG 66 68 54 68 5-10-5 228 1706 1719 CAGTCTTTGAAGTA 19 19 26 17 2-10-2 229 1778 1793 TATGCCTACAGCCTCC 64 60 64 63 3-10-3 230 1779 1794 TTATGCCTACAGCCTC 66 66 77 73 3-10-3 231 1780 1795 TTTATGCCTACAGCCT 56 55 68 67 3-10-3 232 1781 1796 ATTTATGCCTACAGCC 52 52 68 63 3-10-3 233 1782 1797 AATTTATGCCTACAGC 48 44 70 59 3-10-3 234 1783 1798 CAATTTATGCCTACAG twenty four 18 39 40 3-10-3 235 1784 1799 CCAATTTATGCCTACA 37 37 55 55 3-10-3 236 1785 1800 ACCAATTTATGCCTAC 35 36 60 55 3-10-3 237 1806 1825 AAAGTTGCATGGTGCTGGTG 42 55 75 61 5-10-5 238 1809 1828 GAAAAAGTTGCATGGTGCTG 45 56 64 53 5-10-5 239 1812 1831 GGTGAAAAAGTTGCATGGTG 71 70 80 72 5-10-5 240 1815 1834 AGAGGTGAAAAAGTTGCATG 51 57 77 82 5-10-5 241 1818 1837 GGCAGAGGTGAAAAAGTTGC 54 63 76 78 5-10-5 242 1821 1840 TTAGGCAGAGGTGAAAAAGT 61 65 80 66 5-10-5 243 1822 1837 GGCAGAGGTGAAAAAG 47 51 74 54 3-10-3 244 1823 1838 AGGCAGAGGTGAAAAA 47 40 76 54 3-10-3 245 1824 1843 TGATTAGGCAGAGGTGAAAA 41 39 62 29 5-10-5 246 1824 1839 TAGGCAGAGGTGAAAA 46 42 79 59 3-10-3 247 1826 1839 TAGGCAGAGGTGAA 40 33 44 31 2-10-2 248 1827 1846 AGATGATTAGGCAGAGGTGA 27 46 62 51 5-10-5 249 1861 1880 AGCTTGGAGGCTTGAACAGT 59 61 65 72 5-10-5 250 1864 1883 CACAGCTTGGAGGCTTGAAC 11 twenty one 48 31 5-10-5 251 1865 1880 AGCTTGGAGGCTTGAA 13 1 45 40 3-10-3 252 1865 1878 CTTGGAGGCTTGAA twenty two 17 20 14 2-10-2 253 1866 1881 CAGCTTGGAGGCTTGA 29 19 51 45 3-10-3 254 1866 1879 GCTTGGAGGCTTGA twenty four 25 37 32 2-10-2 255 1867 1886 AGGCACAGCTTGGAGGCTTG 32 36 58 33 5-10-5 63 1867 1882 ACAGCTTGGAGGCTTG 1 4 twenty three 12 3-10-3 256 1867 1880 AGCTTGGAGGCTTG twenty three twenty four 17 twenty three 2-10-2 257 1868 1883 CACAGCTTGGAGGCTT 5 1 48 41 3-10-3 258 1868 1881 CAGCTTGGAGGCTT twenty one 20 0 18 2-10-2 259 1869 1884 GCACAGCTTGGAGGCT 14 10 50 37 3-10-3 260 1869 1882 ACAGCTTGGAGGCT 19 twenty two twenty four 27 2-10-2 261 1870 1889 CCAAGGCACAGCTTGGAGGC 27 40 68 38 5-10-5 69 1870 1885 GGCACAGCTTGGAGGC 10 12 43 16 3-10-3 262 1870 1883 CACAGCTTGGAGGC 28 31 33 30 2-10-2 263 1871 1886 AGGCACAGCTTGGAGG twenty four 20 46 25 3-10-3 264 1871 1884 GCACAGCTTGGAGG 20 18 twenty two 15 2-10-2 265 1872 1887 AAGGCACAGCTTGGAG 6 0 45 twenty four 3-10-3 266 1872 1885 GGCACAGCTTGGAG 18 18 32 twenty three 2-10-2 267 1873 1892 CACCCAAGGCACAGCTTGGA 18 8 55 16 5-10-5 268 1873 1888 CAAGGCACAGCTTGGA 9 0 31 15 3-10-3 269 1873 1886 AGGCACAGCTTGGA twenty three 9 27 10 2-10-2 270 1874 1889 CCAAGGCACAGCTTGG 0 0 39 25 3-10-3 271 1876 1895 AGCCACCCAAGGCACAGCTT 47 50 69 56 5-10-5 272 1879 1898 CAAAGCCACCCAAGGCACAG 27 27 55 30 5-10-5 273 1882 1901 CCCCAAAGCCACCCAAGGCA 34 40 54 39 5-10-5 274 1885 1904 ATGCCCCAAAGCCACCCAAG 41 43 54 52 5-10-5 275 1888 1907 TCCATGCCCCAAAGCCACCC 40 42 72 40 5-10-5 276 1891 1910 ATGTCCATGCCCCAAAGCCA 35 33 70 40 5-10-5 277 1918 1933 CTCCAAATTCTTTATA 9 2 53 41 3-10-3 278 1918 1931 CCAAATTCTTTATA 28 twenty two 7 twenty two 2-10-2 279 1919 1934 GCTCCAAATTCTTTAT 43 39 72 57 3-10-3 280 1919 1932 TCCAAATTCTTTAT 19 11 0 2 2-10-2 281 1920 1933 CTCCAAATTCTTTA 19 11 0 0 2-10-2 282 1921 1934 GCTCCAAATTCTTT 50 48 61 55 2-10-2 283 1957 1976 GGAAAGAAGTCAGAAGGCAA 17 14 81 39 5-10-5 284 2270 2285 GTGCGAATCCACACTC twenty one 4 36 11 3-10-3 285 2270 2283 GCGAATCCACACTC 32 29 41 33 2-10-2 286 2271 2284 TGCGAATCCACACT 28 20 25 11 2-10-2 287 2272 2285 GTGCGAATCCACAC 28 20 32 twenty two 2-10-2 288 2368 2387 GAGGGAGTTCTTCTTCTAGG twenty four twenty two 90 48 5-10-5 289 2378 2393 CGAGGCGAGGGAGTTC 12 1 65 10 3-10-3 290 2378 2391 AGGCGAGGGAGTTC 17 18 29 25 2-10-2 291 2379 2394 GCGAGGCGAGGGAGTT 18 13 82 37 3-10-3 292 2379 2392 GAGGCGAGGGAGTT 29 twenty two 54 30 2-10-2 293 2380 2395 TGCGAGGCGAGGGAGT 13 11 69 44 3-10-3 294 2380 2393 CGAGGCGAGGGAGT 25 20 53 42 2-10-2 295 2381 2396 CTGCGAGGCGAGGGAG 17 14 79 53 3-10-3 296 2381 2394 GCGAGGCGAGGGAG 33 29 66 48 2-10-2 297 2382 2397 TCTGCGAGGCGAGGGA 18 4 77 47 3-10-3 298 2420 2439 CCGAGATTGAGATCTTCTGC 12 18 83 28 5-10-5 299 2459 2478 CCCACCTTATGAGTCCAAGG 14 19 80 36 5-10-5 300 2819 2838 TGTTCCCAAGAATATGGTGA 29 32 78 44 5-10-5 301 2820 2835 TCCCAAGAATATGGTG 10 10 68 40 3-10-3 302 2821 2836 TTCCCAAGAATATGGT 5 0 62 twenty four 3-10-3 303 2822 2837 GTTCCCAAGAATATGG 6 2 42 16 3-10-3 304 2823 2838 TGTTCCCAAGAATATG 18 18 47 18 3-10-3 305 2824 2839 TTGTTCCCAAGAATAT 7 5 57 19 3-10-3 306 2825 2838 TGTTCCCAAGAATA 25 20 44 25 2-10-2 307 2873 2892 GAAAGAATCCCAGAGGATTG 8 4 61 twenty two 5-10-5 308 3161 3180 ACTGCATGGCCTGAGGATGA 47 46 82 54 5-10-5 309 3163 3182 CCACTGCATGGCCTGAGGAT 25 34 69 19 5-10-5 310

Example 2: tolerant BALB MOE gapmer targeting BALB / c mice of the HBV / c mice (Charles River, MA) is a frequently used model mice purpose of the safety and efficacy testing. The mice were treated with antisense oligonucleotides selected from Example 1 above and the changes in the content of various metabolic markers were evaluated.

Four BALB/c mice in each group were subcutaneously injected with all the sequence numbers of WO2012/145697 with 50 mg/Kg SEQ ID NO: 83, SEQ ID NO: 224, SEQ ID NO: 88, SEQ ID NO: 103, SEQ ID NO: 20, SEQ ID NO: 116, SEQ ID NO: 187, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 226, SEQ ID NO: 24, SEQ ID NO: 39, SEQ ID NO: 46. SEQ ID NO: 50, SEQ ID NO: 140, SEQ ID NO: 17, SEQ ID NO: 27, SEQ ID NO: 40, and SEQ ID NO: 74 twice a week for 3 weeks. A group of four BALB/c mice were injected subcutaneously with 50 mg/Kg antisense oligonucleotide twice a week for 3 weeks, wherein the antisense oligonucleotide has the sequence CCTTCCCTGAAGGTTCCTCC (SEQ ID NO: 320 of WO2012/145697) , 5-10-5 MOE spacer, which has no known homology with any human or mouse gene sequence. Another group of 4 BALB/c mice were injected subcutaneously with PBS twice a week for 3 weeks. This group of mice served as a control group. Three days after the last dose at each time point, body weight was obtained, the mice were euthanized, and organs and plasma were collected for further analysis.

Body weight and organ weight The body weight of the mice was measured before the administration and at the end of each treatment period. The body weight is presented in Table 2 and is expressed as the% change in weight obtained before the start of the treatment. The liver, spleen, and kidney weights were measured at the end of the study, and they are presented in Table 3 as the percentage difference of the corresponding organ weights with the PBS control. The results showed that most of the ISIS oligonucleotides did not have any adverse effects on body weight or organ weight. Table 2 Body weight change (%) of BALB/c mice after antisense oligonucleotide treatment (all sequence numbers of WO2012/145697) deal with body weight PBS 9 SEQ ID NO: 320 9 SEQ ID NO: 83 11 SEQ ID NO: 224 9 SEQ ID NO: 88 10 SEQ ID NO: 103 14 SEQ ID NO: 20 11 SEQ ID NO: 116 10 SEQ ID NO: 187 14 SEQ ID NO: 210 12 SEQ ID NO: 212 16 SEQ ID NO: 226 12 SEQ ID NO: 24 8 SEQ ID NO: 39 9 SEQ ID NO: 46 twenty one SEQ ID NO: 50 14 SEQ ID NO: 140 10 SEQ ID NO: 17 10 SEQ ID NO: 27 15 SEQ ID NO: 40 16 SEQ ID NO: 74 19 Table 3 Changes in organ weight (%) of BALB/c mice after antisense oligonucleotide treatment (all sequence numbers of WO2012/145697) deal with liver kidney spleen PBS - - - SEQ ID NO: 320 3 -3 -9 SEQ ID NO: 83 10 1 13 SEQ ID NO: 224 19 -3 4 SEQ ID NO: 88 -4 -7 9 SEQ ID NO: 103 1 -16 twenty three SEQ ID NO: 20 12 -4 9 SEQ ID NO: 116 7 -2 14 SEQ ID NO: 187 5 -6 7 SEQ ID NO: 210 7 -6 0 SEQ ID NO: 212 12 -7 5 SEQ ID NO: 226 8 0 3 SEQ ID NO: 24 17 14 200 SEQ ID NO: 39 -4 -9 3 SEQ ID NO: 46 18 -9 79 SEQ ID NO: 50 6 -6 2 SEQ ID NO: 140 0 -2 15 SEQ ID NO: 17 2 1 8 SEQ ID NO: 27 5 -2 58 SEQ ID NO: 40 12 -8 7 SEQ ID NO: 74 20 -8 49

Liver function To assess the effect of ISIS oligonucleotides on liver function, the plasma concentration of transaminase was measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 4 expressed in IU/L. The same clinical chemistry analyzer was also used to measure the plasma levels of cholesterol and triglycerides, and the results are also shown in Table 4. Table 4 The effect of antisense oligonucleotide treatment on metabolic markers in the liver of BALB/c mice (all sequence numbers of WO2012/145697) deal with ALT (IU/L) AST (IU/L) Cholesterol (mg /dL ) Triglycerides (mg /dL ) PBS 37 58 114 238 SEQ ID NO: 320 36 57 114 234 SEQ ID NO: 83 43 56 121 221 SEQ ID NO: 224 53 76 118 327 SEQ ID NO: 88 68 103 117 206 SEQ ID NO: 103 136 152 144 168 SEQ ID NO: 20 281 194 119 188 SEQ ID NO: 116 67 70 123 226 SEQ ID NO: 187 113 111 135 249 SEQ ID NO: 210 56 63 128 234 SEQ ID NO: 212 79 83 122 347 SEQ ID NO: 226 78 175 112 214 SEQ ID NO: 24 111 166 61 175 SEQ ID NO: 39 635 508 110 179 SEQ ID NO: 46 92 113 118 131 SEQ ID NO: 50 38 89 97 176 SEQ ID NO: 140 159 229 85 173 SEQ ID NO: 17 90 87 86 222 SEQ ID NO: 27 61 88 79 239 SEQ ID NO: 40 70 95 124 214 SEQ ID NO: 74 1247 996 161 167

Renal function To assess the effect of ISIS oligonucleotides on renal function, an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) was used to measure the plasma concentration of blood urea nitrogen (BUN). The results are presented in Table 5, expressed in mg/dL. Table 5 The effect of antisense oligonucleotide treatment on the kidney markers of BALB/c mice (all sequence numbers of WO2012/145697) deal with BUN (mg/dL) PBS 29 SEQ ID NO: 320 29 SEQ ID NO: 83 28 SEQ ID NO: 224 30 SEQ ID NO: 88 30 SEQ ID NO: 103 30 SEQ ID NO: 20 29 SEQ ID NO: 116 28 SEQ ID NO: 187 29 SEQ ID NO: 210 27 SEQ ID NO: 212 26 SEQ ID NO: 226 26 SEQ ID NO: 24 25 SEQ ID NO: 39 twenty three SEQ ID NO: 46 28 SEQ ID NO: 50 25 SEQ ID NO: 140 twenty four SEQ ID NO: 17 27 SEQ ID NO: 27 27 SEQ ID NO: 40 25 SEQ ID NO: 74 twenty two

Example 3: Targeting turn colonization efficacy MOE gapmer HBV transgenic mice in the use of mice carrying the gene fragment HBV (Guidotti, LG et al., J Virol 1995, 69, 6158-6169 ..). Mice were treated with antisense oligonucleotides selected from the research choices described above and their efficacy was evaluated in this model.

6 mice in each group were injected subcutaneously with 50 mg/kg of SEQ ID NO: 83, SEQ ID NO: 226, SEQ ID NO: 224, SEQ ID NO: 181, SEQ ID NO: 143 or SEQ ID NO: 145 (WO2012 /145697 (all serial numbers) twice a week for 4 weeks. A control group of 10 mice was injected subcutaneously with PBS twice a week for 4 weeks. The mice were euthanized 48 hours after the last dose, and the liver was collected for further analysis.

DNA and RNA analysis Use primer probe set RTS3370 to extract RNA from liver tissue for real-time PCR analysis of HBV DNA. The DNA content is normalized to picogreen. After RT-PCR analysis, the primer probe set RTS3370 was also used to analyze HBV RNA samples. The mRNA content is standardized to RIBOGREEN®. The data is presented in Table 6, expressed as a percentage of inhibition compared to the control group. As shown in Table 6, most of the antisense oligonucleotides achieved the reduction of HBV DNA and RNA relative to the PBS control. The results are presented as the percentage inhibition of HBV mRNA or DNA relative to the control. Table 6 The percentage of inhibition of HBV RNA and DNA in the liver of transgenic mice (all sequence numbers in WO2012/145697) deal with DNA inhibition % RNA inhibition % SEQ ID NO: 83 39 5 SEQ ID NO: 226 84 77 SEQ ID NO: 224 83 73 SEQ ID NO: 181 56 28 SEQ ID NO: 143 82 29 SEQ ID NO: 145 54 30

The rationale for selecting an animal model that includes examples of vaccine treatment: Use HLA.A2/DR1 mice (transgenic genes of human HLA-A2 and HLA-DR1 molecules) to evaluate candidate vaccines to induce HBc-specific CD8⁺ The ability of T cells to respond. Evaluation of HBV-specific CD4 in the same HLA.A2/DR1 mice⁺ T cells and antibodies.

Animal models that can be used to evaluate the efficacy of therapeutic vaccines are limited because HBV naturally only infects chimpanzees and humans. A mouse model has been developed in which the entire HBV genome is expressed through the integration of the viral genome in the host genome (HBV transgenic mice) or through infection with replicating HBV DNA or a vector expressing the HBV genome. Although these do not reproduce the pathogenesis of chronic HBV, viral replication intermediates and proteins can be detected in the liver, and immune tolerance is observed.

AAV2/8-HBV transduced HLA.A2/DR1 murine model reproduces the virological and immune characteristics of chronic HBV infection and is selected [Dion, 2013; Martin, 2015]

Materials and methods involving examples of vaccine handling Used in non-clinical immunogenicity research AS01 Dosage of adjuvant system AS01_{B - 4} The adjuvant system consists of the following: immune-enhancer QS-21 (triterpene glycoside purified from the bark of Quillaja saponaria) and MPL (3-D monophosphoryl lipid A), as well as these immune enhancers and sorbus Liposomes as a vehicle for sugar alcohols. Specifically, a single human dose of AS01_{B - 4} (0.5 mL) contains 50 µg QS-21 and 50 µg MPL. 1/10 of the human dose^th , That is, 50 µl is the volume injected into mice (corresponding to 5 µg QS-21 and MPL).

Cellular immune response - Intracellular cytokine staining ( ICS ) Fresh aggregates of splenocytes or liver infiltrating lymphocytes collected at different time points were stimulated in vitro with 15-mer, overlapping 11aa, aggregates covering HBc or HBs sequence for 6 hours. CD4 that expresses IFN-γ and/or IL-2 and/or tumor necrosis factor (TNF)-α by measurement⁺ Or CD8⁺ The ICS of the amount of T cells evaluates HBc and HBs-specific cell responses. The technical accreditation criteria for considering the results of ICS include the minimum number of CD8 obtained for> 3000 events⁺ T or CD4⁺ T cells.

Humoral immune response - Enzyme-linked immunosorbent assay ( ELISA ) The HBc and HBs specific antibody response was measured by ELISA at different time points in the serum from the immunized mice. In short, 96-well plates are coated with HBc or HBs antigen. Individual serum samples were then added to the serial dilutions and incubated for 2 hours. Subsequently, the biotin-labeled anti-mouse F(ab)'2 fragment was added and combined with streptavidin horseradish peroxidase complex and peroxidase substrate o-phenylenediamine dihydrochloride/H₂ O₂ Cultivate together to expose antigen-antibody complexes. For each time point and each antigen (HBc, HBs), the analysis of variance (ANOVA) model conforms to the log10 titer including group, study and interaction as a fixed effect and using a heterogeneous variance model (the same variance is not assumed between groups) . This model is used to estimate the geometric mean (and its 95% CI) and the geometric mean ratio and its 95% CI. Because no predefined criteria were set, the analysis was descriptive, and the 95% CI ratio between the groups was calculated without adjusting for multiplicity.

ALT / AST Measure The following commercial kits were used to quantify the levels of ALT and AST in mouse serum: • Alanine transaminase activity analysis kit Sigma Aldrich catalog number MAK052 • Aspartate transaminase activity analysis kit Sigma Aldrich catalog number MAK055

Serum HBs antigen quantification Monolisa anti-HBs PLUS (catalog number 72566) from BIO-RAD and international standards (Abbott Diagnostics) were used to quantify circulating HBs antigen in mouse serum.

Histopathological analysis Collect liver (one bulge per liver) and keep it in 10% formaldehyde fixative. All samples for microscopy were trimmed based on RITA guidelines [Ruehl-Fehlert, 2003; Kittel 2004; Morawietz 2004], embedded in paraffin, sliced with a thickness of approximately 4 microns and stained with H&E. According to the METAVIR scoring system [Bedossa, 1996; Mohamadnejad, 2010; Rammeh, 2014], histological activity (necrotizing inflammatory lesions) and fibrosis were graded. The grading of inflammatory cell lesions is based on the Desmet score, as described by Buchmann et al. [Buchmann, 2013].

The statistical analysis performed in each study is detailed in the section on each study.

Example 4 - ChAd155 - hIi - HBV / MVA - HBV / HBs - HBc / AS01 _{B - 4} in HLA . A2 / DR1 transgenic mice. Immunogenicity evaluation objective of the vaccine program. -hIi-HBV / MVA-HBV viral vector prime / protein added subsequently or with two doses of recombinant hepatitis B core antigen (HBcAg 4 μg) and the hepatitis B surface antigen (HBsAg 1 μg) and the adjuvant AS01 _{B - 4} (written as: HBc-HBs 4-1/AS01 _{B - 4} ) The immunogenicity of co-administering different vaccine programs.

Study design The first group of mice (N=16) were immunized with ChAd155-hIi-HBV on day 0, and subsequently with MVA-HBV after day 28. After this initial immunization/additional viral vector program, two doses of HBc-HBs 4-1 µg/AS01 _{B - 4 were} injected 14 days apart (Table 4). The second group of mice (N=16) were immunized with ChAd155-hIi-HBV and HBc-HBs 4-1/AS01 _{B - 4} on day 0, followed by co-administration of HBc-HBs with MVA-HBV after day 28 4-1/AS01 _B is added to get immunity. Two consecutive co-immunizations of MVA-HBV and HBc-HBs 4-1/AS01 _B were performed 14 days apart (Table 4). The third group of mice (N=8) was injected with NaCl as a negative control. Mice were sacrificed 7 days after the second immunization (7dpII) and the fourth immunization (7dpIV) to determine HBc and HBs-specific humoral (serum) and cellular immune responses (spleen cells and liver infiltrating lymphocytes).

This study is descriptive and no statistical sample size adjustment and analysis were performed. Table 7: Treatment group group Day 0 Day 28 Day 42 Day 56 Put to death 1 10 ⁸ vp ChAd155-hIi-HBV 10 ⁷ pfu MVA-HBV HBc-HBs 4-1/AS01 _B-4 HBc-HBs 4-1/AS01 _B-4 7dpII and 7dpIV 2 10 ⁸ vp ChAd155-hIi-HBV + HBc-HBs 4-1/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B-4 7dpII and 7dpIV 3 NaCl NaCl NaCl NaCl 7dpII and 7dpIV

Results HBc and HBs specific CD8 ⁺ T cell response ( spleen cells ) when compared with ChAd155-hli-HBV/MVA-HBV injection (group 1) at 7dpII, HBc-HBs 4-1/ Co-administration of AS01 _{B - 4} with ChAd155-hIi-HBV vector as a primary immunization and MVA-HBV vector as an additional (group 2) induced a ^{4-fold increase in HBc-specific CD8 +} T cell response (Figure 1 ). ^{A similar CD8 +} T cell response to HBs was induced in both groups (Figure 1).

At 7dpIV, after continuous administration of HBc-HBs/AS01 _{B - 4} , HBc but not HBs-specific CD8 ⁺ T cell response significantly increased (compared to 7dpII, 5 times increase) (group 1). When two additional doses of MVA-HBV/HBc-HBs 4-1/AS01 _{B - 4} were co-administered, no further increase in HBc or HBs-specific CD8 ⁺ T cells was observed (group 2).

HBc and HBs- specific CD4 ⁺ T cell responses ( spleen cells ) detected lower levels of HBc after priming-additional ChAd155-hIi-HBV/MVA-HBV vaccination (median 0.17% and 0.11%, respectively) And HBs-specific CD4 ⁺ T cells (group 1), and when HBc-HBs 4-1/AS01 _{B - 4 is} co-administered with ChAd155-hI-HBV at 7 dpII (group 2) An effective response to both antigens was observed (Figure 2).

After ChAd155-hIi-HBV/MVA-HBV initial immunization-addition (group 1), _{continuous administration of HBc-HBs 4-1/AS01 B - 4} substantially enhanced HBcx and HBs-specific CD4 ^{+ at 7dpIV} T cell response (median values were 1.64% and 2.32%, respectively). Finally, when two additional doses of MVA-HBV and HBc-HBs/AS01 _{B - 4 are} co-administered to the pre-exempt HBc-HBs/AS01 _{B - 4} co-administration at the same time point, ChAd155-hIi-HBV is added In mice immunized with /MVA-HBV (group 2), a ^{steady increase in HBs-specific CD4 +} T cells was observed. In the same group, HBc-specific CD4 ⁺ T cells remained at the same level as in 7dpost II.

HBc and HBs- specific T cell responses measured in infiltrating lymphocytes of the liver 7 days after the last immunization, the presence of vaccination-induced T cell responses in the liver was studied by ICS. In order to have a sufficient number of liver infiltrating lymphocytes for in vitro restimulation and ICS, each data point constitutes a cell aggregate recovered after 3 or 4 livers are perfused. Due to the low number of data points, no statistical analysis was performed, and the results were descriptive.

Both vaccine regimens resulted in HBc and HBs-specific CD4 ⁺ T cells detectable in the liver of vaccinated mice (Figure 3). ^{The stronger HBc-specific CD8 +} T cell responses were measured in the livers of animals vaccinated with the two vaccine regimens, while the much lower frequency of HBs-specific CD8 ⁺ T cells were measured.

HBc and HBs specific antibody response ChAd155-hIi-HBV/MVA-HBV (group 2) was co-administered with HBc-HBs 4-1/AS01 _{B - 4 at 7dpII to induce the highest amount of anti-HBc antibody (Figure 4)} . Continuous injection of MVA-HBV+HBc-HBs/AS01 _{B - 4} did not further increase the content of anti-HBc antibody response (7dpIV). _{After injection of HBc-HBs/AS01 B - 4} into mice initially immunized with ChAd155-hIi-HBV and MVA-HBV, a significant increase in the anti-HBc specific antibody response was observed at 7dpIV (group 1). The presence of the HBc-HBs/AS01 _{B - 4} component seems to be important in the time course of inducing effective anti-HBs antibodies, because after immunization with ChAd155-hIi-HBV/MVA-HBV, no antibodies were detected in the animals. HBs antibody response (Figure 4). The highest response value was observed in the co-administration group (group 2) after the last immunization.

Conclusion In HLA.A2/DR1 transgenic mice, ChAd155-hIi-HBV/MVA-HBV caused a lower but detectable HBc-specific CD4 ⁺ T cell response, which was achieved by HBc-HBs 4-1/ AS01 _{B - 4 is} significantly enhanced. Initial immunization with ChAd155-hIi-HBV/MVA-HBV-supplemental immunization induces effective HBc and HBs-specific CD8 ⁺ T cell responses. After HBc-HBs/AS01 _{B - 4} supplements are given sequentially, HBc is specific The sexual response is further improved.

Interestingly, when ChAd155-hIi-HBV/MVA-HBV was _{co-administered with HBc-HBs 4-1/AS01 B - 4} , it induced a higher content of HBc and HBs-specific CD4 ⁺ and CD8 ⁺ T cells and only Antibodies after two immunizations. Further immunization with MVA-HBV+HBc-HBs/AS01 _{B - 4} does not increase the content of these reactions.

In addition, HBc and HBs-specific CD4 ⁺ and CD8 ⁺ T cells induced by vaccination were also detected in the livers of animals vaccinated with the two vaccination regimens.

Example 5 - Evaluation of the immunogenicity and safety of ChAd155 - hIi - HBV / MVA - HBV / HBc - HBs / AS01 _{B - 4} vaccine regimen in AAV2 / 8 - HBV transduced HLA . A2 / DR1 mice The target HLA.A2/DR1 murine model transduced by AAV2/8-HBV reproduces the virological and immune characteristics of chronic HBV infection. In this model, the liver of mice is transduced with an adeno-associated virus serotype 2/8 (AAV2/8) vector carrying the replication-competent HBV DNA genome.

A single tail vein injection of 5x10 ¹⁰ vg (viral genome) AAV2/8-HBV vector produced HBV replication and gene expression in the liver of AAV2/8-AAV transduced mice [Dion; 2013]. Up to 1 year after injection of unrelated significant hepatitis, HBV DNA replication intermediates, HBV RNA transcripts, and HBc antigen were detected in the liver. HBs and HBe antigens and HBV DNA can be detected in the serum for up to 1 year. In addition, the establishment of immune tolerance to HBV antigens was observed in this alternative model of chronic HBV infection.

The goal of this study in AAV2/8-HBV-transduced HLA.A2/DR1 mice is to prove that the vaccine regimen can overcome the tolerance to HBs and HBc antigens to evaluate liver infiltration HBc-specific CD8 ⁺ T The effect of cells (potentially targeting hepatocytes expressing HBcAg) on liver histology (H&E staining) and AST and ALT content is used as a substitute parameter for liver function.

Study design The test is based on sequential immunization with ChAd155-hIi-HBV and MVA-HBV (both encoding HBV core [HBc] and surface [HBs] antigens), either alone or in combination with HBc-HBs 4-1/AS01 _{B - 4} , Followed by two different vaccine regimens with two additional doses of HBc-HBs 4-1/AS01 _{B - 4} (alone or in combination with MVA-HBV) (Table 6).

The HLA.A2/DR1 mice of group 1, group 2 and group 3 were transduced with 5x10 ¹⁰ vg AAV2/8-HBV vector (intravenous administration) on day 0, and group 4 served as the immunogen Positive control for sex (tolerance is not established before vaccination).

Animals in group 1 (N=21) were immunized with ChAd155-hIi-HBV on day 31, followed by MVA-HBV on day 58. _{Two doses of HBc-HBs 4-1 µg/AS01 B - 4 were} injected on the 72nd and 86th day after the initial immunization/additional viral vector regimen (Table 6).

Animals in group 2 (N=21) were immunized with ChAd155-hIi-HBV on day 31 and co-administered with HBc-HBs 4-1/AS01 _{B - 4} , and then supplemented with MVA-HBV on day 58. Co-invested with HBc-HBs 4-1/AS01 _B. Two consecutive co-immunizations of MVA-HBV and HBc-HBs 4-1/AS01 _B were performed on the 72nd and 86th days (Table 6).

Animals in group 3 (N=21) were injected with NaCl on days 31, 58, 72 and 86 as a negative control.

Animals in group 4 (N=8) received the same vaccine protocol as group 2 (except that they were not transduced with AAV2/8-HBV).

All vaccines are administered intramuscularly.

Measure the levels of circulating HBs antigen in the serum on the 23rd, 65th and 93rd days (group 1, group 2 and group 3).

On day 23 (after transduction of AAV2/8-HBV), day 65 (7 days after the second immunization), and day 93 (7 days after the fourth immunization), ELISA was used in all animals. Measure HBc and HBc specific antibody response in serum. ^{After in vitro restimulation and ICS, HBs and HBc specific CD4 +} and CD8 were evaluated in spleen cells and liver infiltrating lymphocytes on day 65 (9 animals/group) and day 93 (12 animals/group) ⁺ T cell response (group 1, group 2 and group 3). For animals from group 4 (8 animals), these immunogenicity readings were only taken on day 93.

Regarding liver-related safety parameters, the levels of AST and ALT in serum were measured on the 38th, 65th, and 93rd days, and the liver sections stained with H&E were examined under a microscope on the 65th and 93rd days. Detect potential vaccine-related histopathological changes or inflammation (group 1, group 2, and group 3). Table 8 : Treatment Group group N* Day 0 Day 31 Day 58 Day 72 Day 86 1 twenty one AAV2/8-HBV 10 ⁸ vp ChAd155-hIi-HBV 10 ⁷ pfu MVA-HBV HBc-HBs 4-1/AS01 _B-4 HBc-HBs 4-1/AS01 _B-4 2 twenty one AAV2/8-HBV 10 ⁸ vp ChAd155-hIi-HBV + HBc-HBs 4-1/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B-4 3 twenty one AAV2/8-HBV NaCl NaCl NaCl NaCl 4 8 No carrier 10 ⁸ vp ChAd155-hIi-HBV + HBc-HBs 4-1/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B-4 *1 mouse was found dead in group 3 before day 65 and in group 2 before day 93.

Statistical analysis of AST and ALT content The unstructured covariate structure was used to fit the ANOVA model of repeated measurements (including gender, number of days, group and pairwise interaction) to the log10-transformation enzyme activity value. Verify model assumptions. Interactions that are not significant at 5% content are removed from the model. For both enzymes, the final model includes gender, number of days, group, and the interaction between group and day. The geometric mean of the enzyme activity of each group at each time point is derived from this model. The group comparison of interest is reported via the geometric mean ratio (GMR) also derived from this model. All these statistics are presented in a two-sided 95% confidence interval. When calculating these GMRs, multiplicity is not considered.

Use SAS 9.2 for all analyses.

Body fluid response Perform descriptive statistics to calculate the number of responders. The truncation of the reactivity of the anti-HBc or anti-HBs antibody response was defined based on the geometric mean titer calculated in Group 3 (AAV2/8-HBV transduction, but no vaccination).

Cell response A descriptive analysis was performed to limit the number of responders ^{for HBc, HBs-specific CD4 +} or CD8 ^{+ T cells.} The truncation is defined as reactive for the measurement of the Group 3 95 ^th percentile (AAV2 / 8-HBV transduction, but no vaccination).

Results HBc- specific CD8 ⁺ and CD4 ⁺ T cells In AAV2/8-HBV-transduced HLA-A2/DR1 mice, HBc-specific CD8 ⁺ or CD4 ⁺ T cells without immunization at all test time points The background content of the cells is extremely low to undetectable (group 3).

Immunization with ChAd155-hIi-HBV and MVA-HBV vectors alone (group 1) or in combination with HBc-HBs 4-1/AS01 _{B - 4} (group 2) induces HBc-specific CD8 ⁺ T cells (respectively in II The 6/7 and 9/9 responders in the last 7 days), indicating the bypass of tolerance to the HBc antigen (Figure 5A). The two additional doses of HBc-HBs 4-1/AS01 _{B - 4} alone or in combination with MVA-HBV, as measured 7 days after the fourth dose, only moderately increased these HBc-specific CD8 ⁺ T cell responses, The median frequency reached 1% in the first group and 1.45% in the second group. ^{The frequency of HBc-specific CD8 +} T cells induced by the same vaccine regimen in group 2 was higher in untransduced HLA.A2/DR1 mice from group 4 (8/8 responders, after IV The 7-day frequency is about 4 times higher), as expected for immune tolerance against HBc antigen. ^{HBc-specific CD8 +} T cells with the same profile as in the spleen were also detected in the liver of the vaccinated mice (Figure 5B).

In AAV2/8-HBV transduced HLA-A2/DR1 mice (groups 1 and 2), both vaccine regimens elicited extremely low to undetectable HBc-specific CD4 ⁺ T cells, and The stable response was measured in untransduced mice (group 4), indicating that under these experimental conditions, the vaccine protocol did not overcome ^{the tolerance of CD4 +} T cells to HBc antigen (Figure 6A, B).

HBs- specific CD8 ⁺ and CD4 ⁺ T cells In AAV2/8-HBV transduced mice, ChAd155-hIi-HBV and MVA-HBV vectors alone (group 1) or with HBc-HBs 4-1/AS01 _{The immunization of the B - 4} combination (group 2) caused HBs-specific CD8 ⁺ T cells without a further increase in intensity, followed by two additional doses of HBc-HBs 4-1/AS01 _{B - 4} alone or with MVA- HBV combination (Figure 7A). Measured in the spleens of animals from group 1 (4/10 responders) and group 2 (8/11 responders) at the end of the vaccination schedule (7 days after the fourth dose) The frequency of HBs-specific CD8 ⁺ T cells and the frequency detected in group 4 (untransduced HLA.A2/DR1 mice, median value = 0.62% at 7 days after IV, 5/8 responders) The similarity indicates that the tolerance of T cells to HBs antigen is overcome. ^{HBs-specific CD8 +} T cells were detected in the livers of animals from groups 1, 2 and 4 in most of the vaccinated animals (Figure 7B).

After administering HBc-HBs 4-1/AS01 _{B - 4} alone or in combination with a carrier, 7 days after the second vaccination in group 2 (9/9 responders) and the fourth time in group 1 Seven days after vaccination (11/12 responders), HBs-specific CD4 ⁺ T cells were induced (Figure 8A). Compared with the vaccine schedule used in animals from group 1 (median value at 7 days after IV = 1.34%, 11/12 responders), the vaccine schedule used in animals from group 2 is triggered About 3 times higher frequency of HBs-specific CD4 ⁺ T cells (median 7 days after IV = 3.7%, 11/11 responders), reaching levels similar to those in group 4 (untransduced HLA. A2/DR1 mice, 7 days after IV, median = 3%, 8/8 responders), indicating that T cell tolerance to antigen is almost completely overcome. Similar to the systemic CD4 ^{+ T cell response, in all vaccinated animals, HBs-specific CD4 +} T cells were detected in the livers of animals from groups 1, 2 and 4 (Figure 8B ).

HBs and HBc specific antibody response 23 days after AAV2/8-HBV vector injection, no anti-HBs antibody response was detected in HLA.A2/DR1 mice, indicating strong humoral tolerance against HBs antigen. Immunization with ChAd155-hIi-HBV and MVA-HBV vector alone (group 1) does not disrupt this tolerance, while immunization with a combination of _{vector and HBc-HBs 4-1/AS01 B - 4 caused induction on day 65} Anti-HBs antibody response in 15 out of 21 animals (group 2) (Figure 9A). In the first group, two additional doses of HBc-HBs 4-1/AS01 _{B - 4} caused detectable anti-HBs antibodies (on day 93, the geometric mean titer (GMT) was 116.8 and 8/12 Responder) and administered 2 additional doses of MVA-HBV and HBc-HBs 4-1/AS01 _{B - 4} combination in the second group to further increase the intensity of the anti-HBs antibody response, reaching GMT of 775 and 11/11 Responders, while remaining approximately 5 times lower than animals that were not transduced with AAV2/8-HBV from group 4 (GMT=3933; 8/8 responders) on day 93.

Similarly, the anti-HBc antibody response was induced only in the presence of the HBc-HBs 4-1/AS01 _{B - 4} component in the vaccine regimen, which was compared to group 1 (GMT=442.8; 12/12 responders) Figure 9B) , In the animals of the second group (GMT=1335,5; 11/11 responders), the content was measured 3 times higher on the 93rd day. The anti-HBc antibody titers induced in untransduced mice with the same vaccine regimen as in group 2 (group 4) were higher (approximately 27 times, GMT=35782; 8/8 responders).

These results show that the presence of the adjuvanted protein component in the vaccine regimen is critical to the destruction of humoral tolerance to both HBc and HBs antigens. In addition, the vaccine regimen used in group 2 containing 4 doses of HBc-HBs 4-1/AS01 _{B - 4} elicited the highest anti-HBc and anti-HBs antibody response while remaining smaller than non-AAV2/8-HBV transduction Rat low (group 4).

AST / ALT content is used as a liver-related inflammation parameter, on day 38 (7 days after the first vaccination), day 65 (7 days after the second vaccination) and/or day 93 (the fourth vaccination) After 7 days) (all groups), the serum activities of AST and ALT were measured. In general, the contents of AST and ALT were stable in HLA.A2/DR1 mice transduced by AAV2/8-HBV during the course of the vaccine protocol (groups 1 and 2) and were comparable to those in the non-vaccinated HLA.A2/DR1 mice. The levels measured in rats (group 3) were similar (Figure 10). On day 65, compared to control group 3, the AST content was found to be statistically significantly higher in the animals from the vaccine group (group 1 and group 2). However, compared with the rest of the kinetics, the AST content of animals in group 3 was unexpectedly lower on day 65, indicating that these differences were actually due to the particularly unexpected results obtained in control group 3 at this point in time Low value, but increased AST content in the non-vaccine group (group 1 and group 2) (Figure 10A).

Compared to control animals from group 3, a slightly lower ALT content was measured in animals in group 1 on day 38, but this difference is not considered clinically relevant (Figure 10B).

Liver microscopy Microscopy of liver sections stained with H&E was performed on 65 and 93 days to detect potential vaccine-related histopathological changes or inflammation (groups 1, 2, and 3) (Table 7).

In AAV2/8-HBV-transduced HLA-A2/DR mice, on the 65th day (7 days after the injection of the second viral vector vaccine, with or without HBc-HBs 4-1/AS01 _{B - 4} MVA-HBV) or on the 93rd day (7 days after the last injection) there is no microscopic result related to the test item, that is, there is no vaccine component ChAd155-hIi-HBV, MVA-HBV and HBc-HBs 4-1 /AS01 _{B - 4} related histopathological changes.

In addition, except for the control animal 3.13 (which showed focal grade 1 partial necrosis), none of these animals showed morphological signs of chronic hepatitis.

Other microscopic results indicated in the treated animals are considered incidental changes because they also occur in the control group, have low incidence/quantity and/or are common background findings in mice of similar age [McInnes, 2012] . TABLE 9: Day 65 and second 93 days from Group 1, Group 3 animals the liver of Group 2 and microscopic examination 45028_EPS ( original data ) liver Group 1 ( "low dose"), the following processing :ChAd155-HBV (day 30) + MVA-FIBV (at day 58) + HBc - HBs / AS01B - 4 ( day 72 and second 86 days ) 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Execution day 93 93 93 93 65 93 65 93 93 65 93 65 65 65 93 93 65 93 65 65 93 Partial necrosis 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Focal lobular necrosis 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 METAVIR A (active) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 METAVIR B (fibrosis) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Inflammatory cell lesions 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Single cell necrosis 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Holographic hematogenesis 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Pigment (consistent with hemosiderin); Kupffer cell 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 liver Group 2 ( "high dose"), the following processing :ChAd155-HBV (day 30) + MVA-FIBV (at day 58) + HBc - HBs / AS01B - 4 ( at 30, 58, and 72 86 days ) 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 Execution day 93 65 93 93 65 93 65 65 NA 93 93 93 65 65 93 93 65 93 65 65 93 Partial necrosis 0 0 0 0 0 0 0 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 Focal lobular necrosis 0 0 0 0 0 0 0 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 METAVIR A (active) 0 0 0 0 0 0 0 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 METAVIR B (fibrosis) 0 0 0 0 0 0 0 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 Inflammatory cell lesions 0 0 0 0 0 0 0 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 Single cell necrosis 0 0 0 0 0 0 0 0 NA 1 0 0 0 0 0 0 0 0 0 0 0 Holographic hematopoiesis 0 0 0 0 0 0 0 0 NA 0 0 0 0 0 1 1 0 0 0 0 0 Pigment (consistent with hemosiderin); Kuffer cell 0 0 0 0 0 0 0 0 NA 0 0 0 0 0 0 0 0 0 1 0 0 NA: Not applicable (death rate 2.9) liver Group 3 (control), with the following process: NaCl 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 3.20 3.21 Execution day 65 NA 65 93 93 65 93 65 65 65 93 93 93 93 93 93 65 93 65 65 93 Partial necrosis 0 NA 0 0 0 0 0 0 0 0 0 0 1* 0 0 0 0 0 0 0 0 Focal lobular necrosis 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 METAVIR A (active) 0 NA 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 METAVIR B (fibrosis) 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Inflammatory cell lesions 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Single cell necrosis 0 NA 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 Holographic hematopoiesis 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Pigment (consistent with hemosiderin); Kuffer cell 0 NA 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 *Focal/minor partial necrosis in a single portal space. NA: Not applicable (mortality rate 3.2)

From AAV2 / 8 - HBs antigen in serum of mice injected HBV, such as the Dion et al [Dion,, 2013] have been reported, at 23 days post-injection with AAV2 / 8-HBV carriers, compared to females, males. The content of HBs antigen is higher. These levels remained stable in all groups without the detectable effect of the vaccination regimen (Figure 11). However, mice injected with AAV2/8-HBV are not animal models for studying the efficacy of vaccines against HBsAg.

Conclusion In an alternative model of chronic HBV infection that establishes immune tolerance against HBc and HBs antigens, that is, AAV2/8-HBV-transduced HLAA2/DR1 mice, two tested vaccine regimens induce HBc And HBs-specific IgG and CD8 ⁺ T cell response and HBs-specific CD4 ⁺ T cell response to bypass tolerance, but its content is lower than that of non-transduced mice, such as due to stronger immune tolerance As expected. When ChAd155-hIi-HBV/MVA-HBV vector is _{co-administered with HBc-HBs 4-1/AS01 B - 4} , the intensity of the antibody and T cell response induced by the vaccine is higher than that of the vaccine regimen, where the vector and HBc-HBs are administered sequentially. Adjuvanted protein. In addition, although serum activity of AST and ALT was measured and liver histopathological assessment was performed to assess vaccination-related hepatitis, no increase in liver enzymes was detected in the vaccine group compared with non-vaccinated subjects. And no microscopic results can be related to vaccine treatment. All in all, these results show that under these experimental conditions, the tested vaccine candidates successfully restored HBs and HBc specific antibodies and CD8 ⁺ T cell responses and HBs specific CD4 ⁺ T cell responses without detecting liver changes. Related symptoms.

Example 6 - in AAV2 / 8 - HBV turn guided by HLA A2 / DR1 mice HBV ASO / ChAd155 -. HIi - HBV / MVA - HBV / HBc - efficacy HBs / AS01 _B embodiment, the safety and immunogenicity of Evaluation Objectives This study utilized a murine model of HLA.A2/DR1 chronic HBV infection transduced with AAV2/8-HBV as described in Example 5.

The goals of this study are: • To prove that the combination of HBV ASO and vaccine regimen can further overcome the tolerance to HBs (anti-HBs Ab titer) compared with the single vaccine regimen. • To demonstrate that the combination of HBV ASO and the vaccine regimen can reduce circulating HBs antigen content compared to the single vaccine regimen • To evaluate the HBc-specific CD8 ⁺ T cell response against the combination of HBV ASO and these vaccine regimens • To evaluate HBV ASO The effect of combination with vaccine regimen on the viral load of serum HBV DNA • Evaluate AST and ALT levels as alternative parameters for liver function.

The study design tested two different vaccine regimens with or without HBV ASO treatment, based on the use of ChAd155-hIi-HBV and MVA-HBV (both of which encode HBV core [HBc] and surface [HBs] antigens) Sequential immunization alone or in combination with HBc-HBs 4-1/AS01 _B , followed by two additional doses of HBc-HBs 4-1/AS01 _B (alone or in combination with MVA-HBV) (Table 10).

HLA.A2/DR1 mice in groups 1 to 6 were transduced with 5x10 ¹⁰ vg AAV2/8-HBV vector (intravenous administration, tail vein) on day 0, and the safety of group 7 as a vaccine regimen And positive control of immunogenicity (no HBV ASO treatment and no tolerance established before treatment).

Animals in groups 1 to 6 were pretreated with HBV ASO (SEQ ID NO: 226 of WO2012/145697) or NaCl on the 30th, 33rd, and 37th days, and then this treatment was continued every week and was administered at the same time Specify the vaccine schedule (or NaCl) to day 100.

Animals from group 1 and group 2 treated with HBV ASO or NaCl, respectively, were immunized with ChAd155-hIi-HBV on day 44, followed by MVA-HBV on day 72. _{Two doses of HBc-HBs 4-1 µg/AS01 B were} administered on the 86th and 100th days after the initial immunization/additional viral vector regimen (Table 10).

Animals from groups 3 and 4 treated with HBV ASO or NaCl, respectively, were immunized with ChAd155-hIi-HBV and HBc-HBs 4-1/AS01 _B co-administration on day 44, and then on day 72 Add MVA-HBV and HBc-HBs 4-1/AS01 _B co-administration. Two consecutive co-immunizations of MVA-HBV and HBc-HBs 4-1/AS01 _B were performed on the 86th and 100th days (Table 10).

Animals from groups 5 and 6 treated with NaCl or HBV ASO, respectively, were injected with NaCl on day 44, day 72, day 86, and day 100 as the negative control of the vaccine regimen.

All components of the protocol are administered intramuscularly.

Serum HBsAg and serum HBsAg were measured on day 0 (before induction of CHB model), day 21 (to confirm the induction of CHB model), day 44, 58, 72, 79, 86, 100, 107, 114, 128, and 142 The content of serum HBV DNA.

The HBs and HBc specific antibody responses were measured on days 0, 21, 44, 58, 72, 79, 86, 100, 107, 114, 128 and 142 by ELISA in the serum from all animals.

^{Separate the mouse group for sacrifice and evaluation of HBs and HBc specific CD4 +} and CD8 ⁺ T cell responses on day 79 (groups 1 to 4 and 7), day 107 and day 142 (all groups) (ICS-spleen and liver perfusion).

Regarding liver-related safety parameters, the levels of AST and ALT enzymes in serum were measured on days 0, 44, 58, 86, 100, 114, 128 and 142. Table 10 : Treatment Group group Day 0 Day 30, day 33, and day 37 to day 100 weekly Day 44 Day 72 Day 86 The first 100 days Put to death 1 AAV2/8-HBV HBV ASO 10 ⁸ vp ChAd155-hIi-HBV 10 ⁷ pfu MVA-HBV HBc-HBs 4-1/AS01 _B HBc-HBs 4-1/AS01 _B Day 79, Day 107, Day 142 2 AAV2/8-HBV NaCl 10 ⁸ vp ChAd155-hIi-HBV 10 ⁷ pfu MVA-HBV HBc-HBs 4-1/AS01 _B HBc-HBs 4-1/AS01 _B Day 79, Day 107, Day 142 3 AAV2/8-HBV HBV ASO 10 ⁸ vp ChAd155-hIi-HBV + HBc-HBs 4-1/AS01 _B 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B Day 79, Day 107, Day 142 4 AAV2/8-HBV NaCl 10 ⁸ vp ChAd155-hIi-HBV + HBc-HBs 4-1/AS01 _B 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B Day 79, Day 107, Day 142 5 AAV2/8-HBV NaCl NaCl NaCl NaCl NaCl Day 107, Day 142 6 AAV2/8-HBV HBV ASO NaCl NaCl NaCl NaCl Day 107, Day 142 7 No carrier --- 10 ⁸ vp ChAd155-hIi-HBV + HBc-HBs 4-1/AS01 _B 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1/AS01 _B Day 79, Day 107, Day 142

Instance 7 - in AAV2 / 8 - HBV Transduction of HLA . A2 / DR1 In mice HBV - ASO / ChAd155 - hIi - HBV / MVA - HBV / HBc - HBs / AS01 _B Evaluation of the efficacy, immunogenicity and safety of the program aims This study utilized a murine model of HLA.A2/DR1 chronic HBV infection transduced with AAV2/8-HBV as described in Example 5.

The objectives of this research are the same as those of Example 6: • To prove that the combination of HBV ASO and the vaccine regimen can further overcome the tolerance to HBs (anti-HBs Ab titer) compared with the single vaccine regimen. • To prove that the combination of HBV ASO and the vaccine regimen can reduce the circulating HBs antigen content compared to the single vaccine regimen • To evaluate HBc-specific CD8 against the combination of HBV ASO and these vaccine regimens⁺ T cell response • To evaluate the effect of the combination of HBV ASO and vaccine regimen on the viral load of serum HBV DNA • To evaluate the content of AST and ALT as substitute parameters for liver function and also to perform histopathological examination of major organs (liver, lung, heart, brain, kidney, thymus) to evaluate potential systemic toxicity.

The study design tested two different vaccine regimens with or without HBV ASO treatment, based on ChAd155-hIi-HBV and MVA-HBV (both of which encode HBV core [HBc] and surface [HBs] antigens) Sequential immunization alone or in combination with HBc-HBs 4-1/AS01 _B , followed by two additional doses of HBc-HBs 4-1/AS01 _B (alone or in combination with MVA-HBV) (Table 11). In addition, treatment with HBV ASO was stopped on day 44 before the first vaccine was administered, or continued until day 100.

HLA.A2/DR1 mice in groups 1 to 6 and groups 8 to 10 were transduced with 10 ¹⁰ vg AAV2/8-HBV vector (intravenous administration, tail vein) on day 0, and The 7 groups served as positive controls for the safety and immunogenicity of the vaccine regimen (no HBV ASO treatment and no tolerance established before treatment).

Animals of group 1, group 6 and group 8 were pretreated with HBV ASO (SEQ ID NO: 226 of WO2012/145697) on day 31, day 35, and day 38. This treatment was then continued once a week, while the designated vaccine regimen (or NaCl) was administered to the 100th day.

Animals in groups 3, 4 and 10 were also pretreated with HBV ASO (SEQ ID NO: 226 of WO2012/145697) on day 31, day 35, and day 38. However, additional HBV ASO administration was performed on day 42, and treatment with HBV ASO was subsequently discontinued.

Animals in groups 2, 5, and 9 were pretreated with HBV ASO or NaCl on the 31st, 35th, and 38th days, and then this treatment continued once a week, and the designated vaccine regimen (or NaCl) was administered at the same time. ) To the 100th day.

Animals from groups 1, 2, and 3 treated with HBV ASO or NaCl were immunized with ChAd155-hIi-HBV on day 44 and subsequently immunized with MVA-HBV on day 72. _{Two doses of HBc-HBs 4-1 µg/AS01 B were} administered on the 86th and 100th days after the initial immunization/additional viral vector regimen (Table 11).

Animals from groups 8, 9 and 10 treated with HBV ASO or NaCl were immunized with ChAd155-hIi-HBV and HBc-HBs 4-1/AS01 _B co-administration on day 44, and then On the 72nd day, MVA-HBV and HBc-HBs 4-1/AS01 _B were co-administered for supplementation. Two consecutive co-immunizations of MVA-HBV and HBc-HBs 4-1/AS01 _B were performed on the 86th day and the 100th day (Table 11).

Animals from groups 4, 5, and 6 treated with NaCl or HBV ASO were injected with NaCl on day 44, day 72, day 86, and day 100 as a negative control for the vaccine regimen.

All components of the protocol are administered intramuscularly.

On day 0 (before the induction of the CHB model), day 21 (to confirm the induction of the CHB model), day 42, day 56, day 70, day 80, day 84, day 98, day The levels of serum HBsAg and serum HBV DNA were measured on day 107, day 113, day 127 and day 141.

By ELISA in serum from all animals on day 0, day 21, day 42, day 56, day 70, day 80, day 84, day 98, day 107, day 113 , Measure HBs and HBc specific antibody response on day 127 and day 141.

^{Separate the mouse group for sacrifice and evaluation of HBs and HBc specific CD4+} on day 80 (group 1, group 2, group 3, and group 7), day 107, and day 141 (all groups) And CD8 ⁺ T cell response (ICS-spleen and liver perfusion).

Regarding liver-related safety parameters, measure the levels of AST and ALT enzymes in serum at least on days 0, 42, 80, 107, and 141. Table 11 : Treatment Group group Day 0 ** On day 31, day 35 and day 38 to day 100 weekly Day 44 Day 72 Day 86 The first 100 days Put to death 1 AAV2/8-HBV HBV ASO** 10 ⁸ vp ChAd155-hIi-HBV 10 ⁷ pfu MVA-HBV HBc-HBs 4-µg/AS01 _B-4 HBc-HBs 4-µg/AS01 _B-4 7dPII (day 80) 7dPIV (day 107) 41PIV (day 141) 2 AAV2/8-HBV NaCl** 10 ⁸ vp ChAd155-hIi-HBV 10 ⁷ pfu MVA-HBV HBc-HBs 4-µg/AS01 _B-4 HBc-HBs 4-µg/AS01 _B-4 7dPII (day 80) 7dPIV (day 107) 41PIV (day 141) 3 AAV2/8-HBV HBV ASO is only on day 31, day 35, day 38, and day 42 10 ⁸ vp ChAd155-hIi-HBV 10 ⁷ pfu MVA-HBV HBc-HBs 4-µg/AS01 _B-4 HBc-HBs 4-µg/AS01 _B-4 7dPII (day 80) 7dPIV (day 107) 41PIV (day 141) 4 AAV2/8-HBV HBV ASO is only on day 31, day 35, day 38, and day 42 NaCl NaCl NaCl NaCl 41PIV (day 141) 5 AAV2/8-HBV NaCl** NaCl NaCl NaCl NaCl 41PIV (day 141) 6 AAV2/8-HBV HBV ASO** NaCl NaCl NaCl NaCl 41PIV (day 141) 7 No carrier - 10 ⁸ vp ChAd155-hIi-HBV 10 ⁷ pfu MVA-HBV HBc-HBs 4-µg/AS01 _B-4 HBc-HBs 4-µg/AS01 _B-4 7dPII (day 80) 7dPIV (day 107) 41PIV (day 141) 8 AAV2/8-HBV HBV ASO** 10 ⁸ vp ChAd155-hIi-HBV + HBc-HBs 4-1µg/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1µg/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1µg/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1µg/AS01 _B-4 41PIV (day 141) 9 AAV2/8-HBV NaCl** 10 ⁸ vp ChAd155-hIi-HBV + HBc-HBs 4-1µg/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1µg/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1µg/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1µg/AS01 _B-4 41PIV (day 141) 10 AAV2/8-HBV HBV ASO is only on day 31, day 35, day 38, and day 42 10 ⁸ vp ChAd155-hIi-HBV + HBc-HBs 4-1µg/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1µg/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1µg/AS01 _B-4 10 ⁷ pfu MVA-HBV + HBc-HBs 4-1µg/AS01 _B-4 42PIV (day 142)

SEQ ID NO:2：HBc截短物之胺基酸序列

SEQ ID NO:3：併入口蹄疫病毒之2A裂解區域之間隔子之胺基酸序列

SEQ ID NO:4：編碼併入有口蹄疫病毒之2A裂解區域之間隔子的核苷酸序列

SEQ ID NO:5：HBc-2A-HBs之胺基酸序列

SEQ ID NO:6：編碼HBc-2A-HBs之核苷酸序列

SEQ ID NO:7：hIi之胺基酸序列

SEQ ID NO:8：編碼hIi之核苷酸序列

SEQ ID NO:9：hIi-HBc-2A-HBs之胺基酸序列

SEQ ID NO:10：編碼hIi-HBc-2A-HBs之核苷酸序列

SEQ ID NO:11：HBc之胺基酸序列

SEQ ID NO:12：hIi替代變異體之胺基酸序列

SEQ ID NO:13：編碼hI替代變異體之核苷酸序列

SEQ ID NO:14：hIi-HBc-2A-HBs之替代核酸序列

SEQ ID NO:15：hIi-HBc-2A-HBs之替代胺基酸序列

SEQ ID NO:16：B型肝炎病毒基因組之核苷酸序列(GENBANK寄存編號U95551.1)

Sequence Listing SEQ ID NO:1: Amino acid sequence of HBs

SEQ ID NO: 2: Amino acid sequence of HBc truncation

SEQ ID NO: 3: The amino acid sequence of the spacer in the 2A cleavage region of the imported foot disease virus

SEQ ID NO:4: Nucleotide sequence encoding the spacer incorporated into the 2A cleavage region of foot-and-mouth disease virus

SEQ ID NO: 5: Amino acid sequence of HBc-2A-HBs

SEQ ID NO: 6: Nucleotide sequence encoding HBc-2A-HBs

SEQ ID NO: 7: amino acid sequence of hIi

SEQ ID NO: 8: Nucleotide sequence encoding hIi

SEQ ID NO: 9: amino acid sequence of hIi-HBc-2A-HBs

SEQ ID NO: 10: Nucleotide sequence encoding hIi-HBc-2A-HBs

SEQ ID NO:11: Amino acid sequence of HBc

SEQ ID NO: 12: Amino acid sequence of hIi substitution variant

SEQ ID NO: 13: Nucleotide sequence encoding a substitution variant of hI

SEQ ID NO: 14: Alternative nucleic acid sequence of hIi-HBc-2A-HBs

SEQ ID NO: 15: Alternative amino acid sequence of hIi-HBc-2A-HBs

SEQ ID NO:16: Nucleotide sequence of hepatitis B virus genome (GENBANK accession number U95551.1)

references : Al-Mahtab M, Akbar SM, Aguilar JC, Uddin MH, Khan MS, Rahman S. Therapeutic potential of a combined hepatitis B virus surface and core antigen vaccine in patients with chronic hepatitis B.Hepatol Int . 2013;7(4):981-9. Bedossa P, Poynard T. An algorithm for the grading of activity in chronic hepatitis C. The METAVIR Cooperative Study Group.Hepatology . 1996;24(2):289-93. Bertoletti A, Ferrari C. Innate and adaptive immune responses in chronic hepatitis B virus infections: towards restoration of immune control of viral infection.Gut . 2012;61(12):1754-64. Block TM, Locarnini S, McMahon BJ, Rehermann B, Peters MG. Use of Current and New Endpoints in the Evaluation of Experimental Hepatitis B Therapeutics.Clin Infect Dis . 2017;64(9):1283-1288. Boni C, Laccabue D, Lampertico P,et al . Restored function of HBV-specific T cells after long-term effective therapy with nucleos(t)ide analogues.Gastroenterology . 2012;143(4):963-73.e9. Borghese F, Clanchy FI. CD74: an emerging opportunity as a therapeutic target in cancer and autoimmune disease.Expert Opin Ther Targets . 2011;15(3):237-51. Buchmann P, Dembek C, Kuklick L,et al Novel therapeutic hepatitis B vaccine induces cellular and humoral immune responses and breaks tolerance in hepatitis B virus (HBV) transgenic mice.Vaccine . 2013;31(8):1197-203. Cavenaugh JS, Awi D, Mendy M,et al . Partially Randomized, Non-Blinded Trial of DNA and MVA Therapeutic Vaccines Based on Hepatitis B Virus Surface Protein for Chronic HBV Infection.PLoS ONE . 2011;6:1-14. Capone S, Naddeo M, D'Alise AM,et al . Fusion of HCV nonstructural antigen to MHC class II-associated invariant chain enhances T-cell responses induced by vectored vaccines in nonhuman primates.Mol Ther . 2014;22(5):1039-47. Cornberg M, Wong VW, Locarnini S, Brunetto M, Janssen HL, Chan HL. The role of quantitative hepatitis B surface antigen revisited.J Hepatol . 2017;66(2):398-411. Di Lullo, G., E. Soprana, M. Panigada, A. Palini, A. Agresti, C. Comunian, A. Milani, I. Capua, V. Erfle and AG Siccardi (2010). The combination of marker gene swapping and fluorescence-activated cell sorting improves the efficiency of recombinant modified vaccinia virus Ankara vaccine production for human use. Journal of Virological Methods 163(2): 195-204 Dion S, Bourgine M, Godon O, Levillayer F, Michel ML. Adeno-associated virus-mediated gene transfer leads to persistent hepatitis B virus replication in mice expressing HLA-A2 and HLA-DR1 molecules.J Virol . 2013;87(10):5554-63. Donnelly ML, Luke G, Mehrotra A, Li X, Hughes LE, Gani D, Ryan MD. Analysis of the aphthovirus 2A/2B polyprotein'cleavage' mechanism indicates not a proteolytic reaction, but a novel translational effect: a putative ribosomal'skip '.J Gen Virol . 2001 May;82 (Pt 5):1013-25 Durantel D, Zoulim F. New antiviral targets for innovative treatment concepts for hepatitis B virus and hepatitis delta virus.J Hepatol 2016;64;S117-S131. EASL 2017. Clinical Practice Guidelines on the management of hepatitis B virus infection.J Hepatol 2017;67(2),370-398. Fontaine H, Kahi S, Chazallon C,et al . Anti-HBV DNA vaccination does not prevent relapse after discontinuation of analogues in the treatment of chronic hepatitis B: a randomised trial—ANRS HB02 VAC-ADN.Gut . 2015;64:139-147. Hilgers et al., Synergistic Effects of Synthetic Adjuvants on the Humoral Immune Response. Int.Arch.Allergy.Immunol. 1986, 79(4):392-6; Hilgers et al., Novel adjuvants for humoral immune responses. Immunology, 1987, 60(1):141-6 Jung MC, Grüner N, Zachoval R,et al. Immunological monitoring during therapeutic vaccination as a prerequisite for the design of new effective therapies: induction of a vaccine-specific CD4+ T-cell proliferative response in chronic hepatitis B carriers.Vaccine . 2002;20(29-30):3598-612. Kensil C R et al. Separation and characterization of saponins with adjuvant activity from Quillaja saponaria Molina cortex.J. Immunology (1991) 146: 431-437. Kensil C R, Saponins as Vaccine Adjuvants.Crit. Rev. Ther. Drug Carrier Syst. , 1996, 13:1-55; Kittel B, Ruehl-Fehlert C, Morawietz G,et al . Revised guides for organ sampling and trimming in rats and mice--Part 2. A joint publication of the RITA and NACAD groups.Exp Toxicol Pathol . 2004;55(6):413-31. Kranidioti H, Manolakopoulos S, Khakoo SI. Outcome after discontinuation of nucleot(s)ide analogues in chronic hepatitis B: relapse rate and associated factors.Ann Gastroenterol . 2015;28(2):173-181. Lau GK, Suri D, Liang R,et al . Resolution of Chronic Hepatitis B and Anti-HBs Seroconversion in Humans by Adoptive Transfer of Immunity to Hepatitis B Core Antigen.Gastroenterology 2002;122:614-24. Lacaille-Dubois, M and Wagner H, A review of the biological and pharmacological activities of saponins. Phytomedicine vol 2 pp 363-386 (1996). Li J, Han Y, Jin K,et al. Dynamic changes of cytotoxic T lymphocytes (CTLs), natural killer (NK) cells, and natural killer T (NKT) cells in patients with acute hepatitis B infection.Virol J . 2011;8:199. Liang M, Ma S, Hu X,et al . Cellular immune responses in patients with hepatitis B surface antigen seroclearance induced by antiviral therapy.Virol J . 2011;8:69. Liaw YF. Impact of therapy on the long-term outcome of chronic hepatitis B.Clin Liver Dis . 2013;17:413-423. Liaw YF, Chu CM. Hepatitis B virus infection.Lancet 2009; 373, 582-592. Lok AS, Pan CQ, Han SH,et al . Randomized phase II study of GS-4774 as a therapeutic vaccine in virally suppressed patients with chronic hepatitis B.J Hepatol . 2016;65(3):509-16. Lorin C, Vanloubbeeck Y, Baudart S,et al. Heterologous prime-boost regimens with a recombinant chimpanzee adenoviral vector and adjuvanted F4 protein elicit polyfunctional HIV-1-specific T-Cell responses in macaques.PLoS One . 2015;10(4):e0122835. Maini M, Gehring A, The role of innate immunity in the immunopathology and treatment of HBV infection.J Hepatol 2016;64;S60-S70. Martin P, Furman RR, Rutherford S,et al . Phase I study of the anti-CD74 monoclonal antibody milatuzumab (hLL1) in patients with previously treated B-cell lymphomas.Leuk Lymphoma . 2015;12:1-6. Mayr A, Stickl H, Muller HK, Danner K, Singer, H. The smallpox vaccination strain MVA: marker, genetic structure, experience gained with the parenteral vaccination and behavior in organisms with a debilitated defense mechanism. Zentralblatt fur Bakteriologie, Parasitenkunde, Infektionskrankheiten und Hygiene Erste Abteilung Originale Reihe B: Hygiene, Betriebshygiene, praventive Medizin. 1978;167:375-90. Mayr, A., Hochstein-Mintzel, V. & Stickl, H. (1975).Infection 3, 6-14. McInnes KJ, Smith LB, Hunger NI, Saunders PT, Andrew R, Walker BR. Deletion of the androgen receptor in adipose tissue in male mice elevates retinol binding protein 4 and reveals independent effects on visceral fat mass and on glucose homeostasis.Diabetes . 2012;61(5):1072-81. Mohamadnejad M, Tavangar SM, Sotoudeh M,et al . Histopathological Study of Chronic Hepatitis B: A Comparative Study of Ishak and METAVIR Scoring Systems.Int J Organ Transplant Med . 2010;1(4):171-6. Morawietz G, Ruehl-Fehlert C, Kittel B,et al . Revised guides for organ sampling and trimming in rats and mice--Part 3. A joint publication of the RITA and NACAD groups.Exp Toxicol Pathol . 2004;55(6):433-49. Neumann AU, Phillips S, Levine I,et al. Novel mechanism of antibodies to hepatitis B virus in blocking viral particle release from cells.Hepatology . 2010;52(3):875-85. Ott JJ, Stevens GA, Groeger J, Wiersma ST. Global epidemiology of hepatitis B virus infection: new estimates of age-specific HBsAg seroprevalence and endemicity.Vaccine 2012;30:2212-19. Rammeh S, Khadra HB, Znaidi NS,et al . Inter-observes agreement of Ishak and Metavir scores in histological evaluation of chronic viral hepatitis B and C.Ann Biol Clin (Paris). 2014;72(1):57-60. Rehermann B, Nascimbeni M. Immunology of hepatitis B virus and hepatitis C virus infection.Nat Rev Immunol . 2005;5(3):215-29. Riedl P, Reiser M, Stifter K, Krieger J, Schirmbeck R. Differential presentation of endogenous and exogenous hepatitis B surface antigens influences priming of CD8(+) T cells in an epitope-specific manner.Eur J Immunol . 2014;44(7):1981-91. Ruehl-Fehlert C, Kittel B, Morawietz G,et al . Revised guides for organ sampling and trimming in rats and mice--part 1.Exp Toxicol Pathol . 2003;55(2-3):91-106. Spencer AJ, Cottingham MG, Jenks JA,et al . Enhanced vaccine-induced CD8+ T cell responses to malaria antigen ME-TRAP by fusion to MHC class ii invariant chain.PLoS One . 2014;9(6):e100538. Terrault NA, Bzowej NH, Chang K-M,et al . AASLD Guidelines for Treatment of Chronic Hepatitis B.Hepatology .2015;DOI:10.1002/hep.28156. WHO Hepatitis D Fact Sheet, 23 July 2018,https://www.who.int/news-room/fact-sheets/detail/hepatitis-d Accessed February 2019. World Health Organization (WHO). Global Hepatitis report, 2017.http://apps.who.int/iris/bitstream/10665/255016/1/9789241565455-eng.pdf?ua=1 . Accessed November 2017. Yang FQ, Yu YY, Wang GQ,et al . A pilot randomized controlled trial of dual-plasmid HBV DNA vaccine mediated by in vivo electroporation in chronic hepatitis B patients under lamivudine chemotherapy.J Viral Hepat . 2012;19:581-593. Zoutendijk R, Hansen BE, van Vuuren AJ, Boucher CA, Janssen HL. Serum HBsAg decline during long-term potent nucleos(t)ide analogue therapy for chronic hepatitis B and prediction of HBsAg loss.J Infect Dis . 2011;204(3):415-8.

Figure 1 -HBc-(A) and HBs-(B) specific CD8 ⁺ T cell response at 7 days after the second and fourth doses of NaCl, and subsequent recombination protein priming-additional heterologous vector or concomitant Recombinant protein priming-additional heterologous vector (individual animals with median value)

Figure 2 -HBc-(A) or HBs-(B) specific CD4 ⁺ T cell response at 7 days after the second and fourth doses of NaCl, and subsequent recombination protein priming-additional heterologous vector or concomitant Recombinant protein priming-additional heterologous vector (individual animals with median value)

Figure 3 ^{-HBc- and HBs-specific CD4 +} (A) and CD8 ⁺ (B) T cells in liver infiltrating lymphocytes 7 days after the fourth dose of NaCl, and subsequent recombinant protein priming-additional heterologous vector Or with concomitant recombinant protein prime-additional heterologous vector (a collection of 3 or 4 animals with a median value)

Figure 4 -HBc-specific (A) and HBs-specific (B) antibody responses after the primary vaccine supplement regimen (presenting individual animals with a geometric mean)

Figure 5 -HBc-specific spleen (A) or liver (B) CD8+ T cells 7 days after the second dose of NaCl and 7 days after the fourth dose of NaCl, and subsequent recombinant protein priming-additional heterologous vector Or with concomitant recombinant protein prime-additional heterologous vector (individual animal with median value)

Figure 6 -HBc specific spleen (A) or liver (B) CD4+ T cells 7 days after the second dose of NaCl and 7 days after the fourth dose of NaCl, and subsequent recombinant protein priming-additional heterologous vector Or with concomitant recombinant protein prime-additional heterologous vector (individual animal with median value)

Figure 7 -HBs-specific spleen (A) or liver (B) CD8+ T cells 7 days after the second dose of NaCl and 7 days after the fourth dose of NaCl, and subsequent recombinant protein priming-additional heterologous vector Or with concomitant recombinant protein prime-additional heterologous vector (individual animal with median value)

Figure 8 -HBs-specific spleen (A) or liver (B) CD4+ T cells 7 days after the second dose of NaCl and 7 days after the fourth dose of NaCl, and subsequent recombinant protein priming-additional heterologous vector Or with concomitant recombinant protein prime-additional heterologous vector (individual animal with median value)

Figure 9 -Anti-HBs(A) and anti-HBc(B) binding antibody responses on days 23, 65 and 93 (before administration, 7 days after the second dose of NaCl, and 7 days after the fourth dose of NaCl, and subsequent reconstitution Protein priming-additional heterologous vector or concomitant recombinant protein priming-additional heterologous vector)

Figure 10 -On the 38th, 65th, and 93rd days (7 days after the first dose of NaCl, the second dose of NaCl, and the fourth dose of NaCl, and subsequent recombination protein priming-additional heterologous vector or concomitant recombination Protein immunization-additional heterologous carrier, groups 1, 2, 3) or AST measured in serum from mice (groups 1, 2, 3 and 4) on day 93 (group 4) (A) and ALT(B) content

Figure 11 -HBs antigen content in serum from mice injected with AAV2/8-HBV before administration, 7 days after the second dose of NaCl, and 7 days after the fourth dose of NaCl, and subsequent recombinant protein immunization-additional heterologous Vector or with concomitant recombinant protein prime-additional heterologous vector

Figure 12 -Structure of HBc-2A-HBs structure

Figure 13- Structure of hIi-HBc-2A-HBs construct

Claims (33)

A method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, which comprises the following steps: a) administering to the human a composition comprising antisense oligonucleotides (ASO) (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) administering to the human a composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and encoding hepatitis B virus core antigen (HBc)的 Nucleic Acid; c) administering to the human a composition comprising a modified Vaccinia Virus Ankara (Modified Vaccinia Virus Ankara, MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and encoding hepatitis B virus Nucleic acid of core antigen (HBc); and d) administering a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant to the human. Such as the method of claim 1, wherein steps b), c) and d) of the method are performed in sequence, step b) is before step c) and step c) is before step d). Such as the method of claim 2, wherein step d) of the method is repeated. Such as the method of claim 1, wherein step a) is repeated. Such as the method of claim 2, wherein step a) is repeated before step b). The method according to any one of the preceding claims, wherein the time period between each step is 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, 6 months or 12 months, such as 4 weeks or 8 weeks. Such as the method of claim 1, wherein step d) and step b) and/or step c) are performed simultaneously. Such as the method of claim 7, wherein step a) is repeated. A method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in humans, which comprises the following steps: a) administering to the human a composition comprising antisense oligonucleotides (ASO) (HBV ASO) with a length of 10 to 30 nucleosides targeting HBV nucleic acid; b) administering to the human i) a composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid; and simultaneous administration ii) a composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant; and c) administering to the human i) a composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a hepatitis B virus core antigen ( HBc) nucleic acid, and simultaneous administration of a composition containing recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and adjuvant. Such as the method of claim 10, wherein step a) is repeated and step a) is before step b), and step b) is before step c). The method according to any one of the preceding claims, wherein the antisense oligonucleotide targeting HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC. The method according to any one of the preceding claims, wherein the antisense oligonucleotide targeting HBV nucleic acid is a modified oligonucleotide "gapmer" composed of 20 linked nucleosides, wherein each core The inter-glycosidic linkages are phosphorothioate linkages and each cytosine is 5-methylcytosine. The antisense oligonucleotide has the sequence GCAGAGGTGAAGCGAAGTGC, which is composed of five groups each containing 2'-O-methoxyethyl sugar. A 5'wing segment consisting of two linked nucleosides GCAGA, followed by ten linked deoxynucleosides GGTGAAGCGA and a 3'wing segment consisting of five linked nucleosides ATGGC each containing 2'-O-methoxyethyl sugar . An immunogenic combination in a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic combination comprising: a) A composition comprising 10 to 30 nucleoside antisense oligonucleotides (ASO) (HBV ASO) targeting HBV nucleic acid; b) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); c) A composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and d) A composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and an adjuvant, Wherein the method comprises sequentially or simultaneously administering the compositions to the human. The immunogenic combination of claim 13, wherein the antisense oligonucleotide targeting HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC. The immunogenic combination of claim 13 or 14, wherein the antisense oligonucleotide targeting HBV nucleic acid is a modified oligonucleotide "spacer" composed of 20 linked nucleosides, wherein each nucleoside The linkage is a phosphorothioate linkage and each cytosine is 5-methylcytosine. The antisense oligonucleotide has the sequence GCAGAGGTGAAGCGAAGTGC, which is connected by five each containing 2'-O-methoxyethyl sugar The 5'wing segment consisting of the nucleoside GCAGA, followed by ten linked deoxynucleosides GGTGAAGCGA and the 3'wing segment consisting of five linked nucleosides ATGGC each containing 2'-O-methoxyethyl sugar. An immunogenic composition used in a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in humans, the immunogenic composition comprising a nucleic acid targeting HBV with a length of 10 to A 30-nucleoside antisense oligonucleotide (HBV ASO) and replication-deficient chimpanzee adenovirus (ChAd) vector, which contains a polynucleotide encoding hepatitis B surface antigen (HBs) and encoding hepatitis B virus The nucleic acid of core antigen (HBc) and the nucleic acid of human invariant chain (hIi) fused to HBc, wherein the method comprises administering the composition in the prime-boost scheme and at least An other immunogenic composition. The immunogenic composition used in claim 16, further comprising one or more recombinant HBV protein antigens. An immunogenic composition used in a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in humans, the immunogenic composition comprising a nucleic acid targeting HBV with a length of 10 to 30 nucleoside antisense oligonucleotides (HBV ASO); and modified pox virus Ankara (MVA) vector, which contains polynucleotides encoding hepatitis B surface antigen (HBs) and hepatitis B Viral core antigen (HBc) nucleic acid, wherein the method comprises administering the composition in the prime-additional regimen and at least one other immunogenic composition. The immunogenic composition used in claim 18 further comprises one or more recombinant HBV protein antigens. An immunogenic composition used in a method for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in humans, the immunogenic composition comprising a nucleic acid targeting HBV with a length of 10 to 30 nucleoside antisense oligonucleotides (HBV ASO); and recombinant hepatitis B surface antigen (HBs), C-terminal truncated recombinant hepatitis B virus core antigen (HBc), and an adjuvant containing MPL and QS-21 Wherein the method comprises administering the composition in the prime-additional regimen and at least one other immunogenic composition. The immunogenic composition used in claim 20, wherein the ratio of HBc to HBs in the composition is greater than 1. The immunogenic composition used in claim 21, wherein the ratio of HBc to HBs in the composition is 4:1. The immunogenic composition used in any one of claims 20 to 22, which further comprises one or more vectors encoding one or more HBV antigens. The immunogenic composition used in any one of claims 16 to 23, wherein the antisense oligonucleotide targeting HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC. The immunogenic composition used in any one of claims 16 to 24, wherein the antisense oligonucleotide targeting HBV nucleic acid is a modified oligonucleotide "spacer" composed of 20 linked nucleosides , Wherein the linkage between each nucleoside is a phosphorothioate linkage and each cytosine is 5-methylcytosine, the antisense oligonucleotide has the sequence GCAGAGGTGAAGCGAAGTGC, and each contains 2'-O-methoxyethyl The 5'wing segment consisting of five linked nucleosides GCAGA of the base sugar, followed by ten linked deoxynucleosides GGTGAAGGCGA and five linked nucleosides ATGGC each containing 2'-O-methoxyethyl sugar 3 'Wing segment composition. Use of an immunogenic composition in the manufacture of a medicament for the treatment of chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in humans, the immunogenic composition comprising a length of nucleic acid targeting HBV 10 to 30 nucleoside antisense oligonucleotides (HBV ASO); and replication-deficient chimpanzee adenovirus (ChAd) vector, which contains a polynucleotide encoding hepatitis B surface antigen (HBs), encoding B The nucleic acid of the hepatitis B virus core antigen (HBc) and the nucleic acid encoding the human invariant strand (hIi) fused to the nucleic acid encoding the HBc, wherein the method of treating chronic hepatitis B infection and/or CHD infection includes administration in the primary immunization- The composition in the supplementary scheme and at least one other immunogenic composition. Use of an immunogenic composition in the manufacture of a medicament for the treatment of chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in humans, the immunogenic composition comprising a length of nucleic acid targeting HBV 10 to 30 nucleoside antisense oligonucleotides (HBV ASO) and modified pox virus Ankara (MVA) vector, which contains polynucleotides encoding hepatitis B surface antigen (HBs) and encoding type B The nucleic acid of hepatitis virus core antigen (HBc), wherein the method for treating chronic hepatitis B infection and/or CHD infection comprises administering the composition in the prime-additional regimen and at least one other immunogenic composition. The use of an immunogenic combination in the manufacture of a medicament for the treatment of chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in humans, the immunogenic combination comprising: a) 10-30 nucleoside antisense oligonucleotides (HBV ASO) targeting HBV nucleic acid; b) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); c) A composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and d) A composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and an adjuvant, Wherein, the method for treating chronic hepatitis B infection and/or CHD infection comprises administering the compositions to the human sequentially or simultaneously. The use of the immunogenic composition of any one of claims 26 to 28 in the manufacture of a medicament, wherein the antisense oligonucleotide targeting HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC. The use of the immunogenic composition of any one of claims 26 to 29 in the manufacture of a medicament, wherein the antisense oligonucleotide targeting HBV nucleic acid is a modified oligonucleotide composed of 20 linked nucleosides "Spacer", in which the linkage between the nucleosides is a phosphorothioate linkage and each cytosine is 5-methylcytosine, the antisense oligonucleotide has the sequence GCAGAGGTGAAGCGAAGTGC, and each contains 2'-O- A 5'wing segment consisting of five linked nucleosides GCAGA of methoxyethyl sugar, followed by ten linked deoxynucleosides GGTGAAGCGA and five linked nucleosides each containing 2'-O-methoxyethyl sugar AGTGC is composed of 3'wings. An immunogenic combination comprising: a) A composition comprising 10 to 30 nucleoside antisense oligonucleotides (ASO) (HBV ASO) targeting HBV nucleic acid; b) A composition comprising a replication-deficient chimpanzee adenovirus (ChAd) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); c) A composition comprising a modified pox virus Ankara (MVA) vector, the vector comprising a polynucleotide encoding hepatitis B surface antigen (HBs) and a nucleic acid encoding hepatitis B virus core antigen (HBc); and d) A composition comprising recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and an adjuvant. The immunogenic combination of claim 31, wherein the antisense oligonucleotide targeting HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC. The immunogenic combination of claim 31 or 32, wherein the antisense oligonucleotide targeting HBV nucleic acid is a modified oligonucleotide "spacer" composed of 20 linked nucleosides, wherein each nucleoside The linkage is a phosphorothioate linkage and each cytosine is 5-methylcytosine. The antisense oligonucleotide has the sequence GCAGAGGTGAAGCGAAGTGC, which is connected by five each containing 2'-O-methoxyethyl sugar The 5'wing segment consisting of the nucleoside GCAGA, followed by the 3'wing segment consisting of ten connected deoxynucleosides GGTGAAGCGA and five connected nucleosides ATGGC each containing 2'-O-methoxyethyl sugar.

Images