TW201902912A - Synergistic combination of nucleic acid oligonucleotides and anthracycline chemotherapeutic agents - Google Patents

Abstract

The invention provides compositions and methods for treating cancers comprising administering a combination of antineoplastic agents, wherein the combination comprises anthracycline chemotherapeutics and one or more nucleic acid molecules capable of down-regulating expression of at least one splice variant of the IG20 gene, and wherein not all splice variants of the IG20 gene are down-regulated. In an embodiment, the splice variant of the IG20 gene is a MADD splice variant and the nucleic acid molecules are siRNA, shRNA and antisense oligonucleotides which comprise a nucleic acid sequence complementary to a nucleic acid sequence of exon 13L of the MADD splice variant or to an mRNA transcript of exon 13L of the MADD splice variant. The invention encompasses methods of treating cancers which include combination therapy with nucleic acid molecules capable of down-regulating the expression of the at least one splice variant of the IG20 gene, and anthracycline chemotherapeutics.

Description

Synergistic combination of nucleic acid oligonucleotide and anthracycline chemotherapeutic agent

The present invention relates to a pharmaceutical composition and method for treating cancer, which includes a combination of administration of an anti-tumor agent, wherein the combination includes an anthracycline chemotherapeutic agent and one or more types of insulinoma-glucagonoma (Insulinoma-Glucagonoma) ( IG20) A nucleic acid molecule that expresses at least one splice variant of a gene, and not all splice variants of the IG20 gene are down-regulated. In one embodiment aspect, splice variants of the gene for the MADD IG20 splice variants (MADD splice variant), can be cut at least one splice IG20 gene expression of a nucleic acid molecule variants selected from siRNA, shRNA and antisense oligonucleotides Nucleotides (antisense oligonucleotide), wherein siRNA, shRNA and antisense oligonucleotides contain the nucleic acid sequence of exon 13L of the MADD splice variant and / or the exon 13L of the MADD splice variant mRNA transcripts (complementary) nucleic acid sequences. The present invention includes a method of treating cancer, which includes a combination therapy of a nucleic acid molecule capable of down- regulating the expression of at least one splice variant of the IG20 gene and an anthracycline chemotherapeutic.

IG20 gene plays an important role in cancer cell proliferation, apoptosis and survival (Chow VT, Lee SS. (1996). DNA Seq 6: 263-273, Chow VT, Lim KM, Lim D. (1998). Genome 41 : 543-552; Schievella AR, Chen JH, Graham JR, Lin LL. (1997). J Biol Chem 272: 12069-12075; Brinkman BM, Telliez JB, Schievella AR, Lin LL, Goldfeld AE. (1999). J Biol Chem 274: 30882-30886; Murakami-Mori K, Mori S, Bonavida B, Nakamura S. (1999). J Immunol 162: 3672-3679; Telliez JB, Bean KM, Lin LL. (2000). Biochem Biophys Acta 1478: 280-288; Al-Zoubi AM, Efimova EV, Kaithamana S, Martinez O, El-Idrissi ME, Dogan RE et al. (2001). J Biol Chem 276: 47202-47211; Lim KM, Chow VT. 2002). Mol Carcinog 35: 110-126; Efimova EV, Al-Zoubi AM, Martinez O, Kaithamana S, Lu SF, Arima T et al. (2004). Oncogene 23: 1076-1087; Efimova EV, Martinez O, Lokshin A, Arima T, Prabhakar BS. (2003). Cancer Res 63: 8768-8776; Lim KM, Yeo WS, Chow VT. (2004). Int J Cancer 109: 24-37; Ramaswamy M, Efimova EV, Martinez O, Mulherkar NU, Singh SP, Prabhakar BS. (2004). Oncogene 23: 6083-6094). In addition, its neurotransmission (Zhang Y, Zhou L, Miller CA. (1998). Proc Natl Acad Sci USA 95: 2586-2591; Tanaka M, Miyoshi J, Ishizaki H, Togawa A, Ohnishi K, Endo K et al . (2001). Mol Biol Cell 12: 1421-1430; Yamaguchi K, Tanaka M, Mizoguchi A, Hirata Y, Ishizaki H, Kaneko K et al. (2002). Proc Natl Acad Sci USA 99: 14536-14541), Neurodegeneration (Del Villar K, Miller CA. (2004). Proc Natl Acad Sci USA 101: 4210-4215) and guanine nucleotide exchange (Wada M, Nakanishi H, Satoh A, Hirano H, Obaishi H, Matsuura Y et al. (1997). J Biol Chem 272: 3875-3878; Brown TL, Howe PH. (1998). Curr Biol 8: R191; Iwasaki K, Toyonaga R. (2000). EMBO J 19 : 4806-4816; Levivier E, Goud B, Souchet M, Calmels TP, Mornon JP, Callebaut I. (2001). Biochem Biophys Res Commun 287: 688-695) plays an important role. These divergent functions are most likely to be mediated by alternative splicing of the IG20 gene to provide splice variants and protein diversity (Chow VT, Lim KM, Lim D. (1998). Genome 41: 543- 552; Al-Zoubi AM, Efimova EV, Kaithamana S, Martinez O, El-Idrissi ME, Dogan RE et al. (2001). J Biol Chem 276: 47202-47211; Efimova EV, Al-Zoubi AM, Martinez O, Kaithamana S, Lu, SF, Arima T et al. (2004). Oncogene 23: 1076-1087). Using antisense oligonucleotides, all endogenous IG20 splice variants are down-regulated, showing spontaneous apoptosis of cancer cells in vitro and in vivo , but normal This is not the case in cells (Lim KM, Chow VT. (2002). Mol Carcinog 35: 110-126; Lim KM, Yeo WS, Chow VT. (2004). Int J Cancer 109: 24-37).

US Patent No. 8,722,637 states that "IG20 and IG20- [SV2] and the previously reported KIAA0358, MADD, and DENN-SV are splice variants of the IG20 gene (located on chromosome 11p11 and composed of 36 exons). The above variants The difference is due to the alternative splicing of exons 13L, 16, 21, 26 and 34. " Consider the IG20, MADD, SV2 and DENN-SV isomers described in the following articles: Contrasting Effects of IG20 and Its Splice Isoforms, MADD and DENN-SV, on Tumor Necrosis Factor α-induced Apoptosis and Activation of Caspase- 8 and -3, Adeeb M. Al-Zoubi, Elena V. Efimova, Shashi Kaithamana, Osvaldo Martinez, Mohammed El-Azami El-Idrissi, Rukiye E. Dogan, and Bellur S. Prabhakar, THE JOURNAL OF BIOLOGICAL CHEMISTRY, Vol. 276, No. 50, Issue of December 14, pp. 47202-47211, 2001.

Following the disclosure by Al-Zoubi et al., Longer isoforms were identified, including KIAA0358. Therefore, the IG20 splice variant identified as IG20 by Al-Zoubi et al. Is called IG20pa, because according to the '637 patent interpretation, IG20 behaves as a pro-apoptotic signaling molecule, which is different from IG20- FL or full-length variants. (Column 5, lines 43-45).

Efimova stated that "all seven variants of IG20 identified so far are derived from the alternative splicing of exons 13L, 16, 21, 26, and 34. The full-length cDNA of IG20 (IG20-FL) (accession number) AF440100) is 5,995 base pairs (bp) in length, composed of all 36 exons and represents the longest variant. Elena V. Efimova, et al ., IG20, in contrast to DENN-SV, (MADD splice variants) suppresses tumor cell survival, and enhances their susceptibility to apoptosis and cancer drugs, Oncogene (2004) 23, 1076-1087. These splicing variants can be represented graphically as shown in Figure 1. Only splicing exon 34 is generated by KIAA0358 (access number AB002356) composed of 5942 bp. The splicing of exons 21 and 26 and the splicing of exons 16, 21 and 26 respectively produced 5878 bp length of IG20 (access number AF440101) and 6002 bp length of MADD (access number U77352). MADD is also known as DENN (access number U44953), which is 5844 bp length. Exons 13L, 21 and 26, and 13L, 16, 21 and 26 are generated by splicing 5749 bp length IG20-SV2 (access number AF440102) and 5689 bp length IG20-SV3 (storage Number AF440103) (earlier called DENN-SV). Finally, splicing of all five exons (13L, 16, 21, 26, and 34) produced IG20-SV4 (access number AF440434), which is the shortest variation It consists of 5619 bps.

FIG. 1 is a diagram showing human IG20 splicing variants generated by alternative mRNA splicing. CDNA sequence homology among seven IG20 splice variants is shown. The solid bars represent regions of complete homology among all variants. The empty regions represent exons 13L, 16, 21, 26, and 34, which, when spliced in different combinations, resulted in seven splice variants as shown on the left. In KIAA0358 and IG20-SV4, splicing of exon 34 leads to an early stop codon at exon 35. It also shows the different 5 'untranslated regions (UTR) of different splice variants.

At the time of the invention described in the '637 patent, it was determined that the IG20pa, MADD, IG20-SV2 and DENN-SV lines were expressed in human tissues and to a greater extent in tumors. ’637, column 5, lines 1 to 2. The overexpression of DENN-SV is associated with increased cell replication and apoptosis resistance caused by chemotherapy. ’637, column 5, lines 4 to 6. Overexpression of IG20pa has been shown to suppress endogenous DENN-SV function, leading to apoptosis. ’637, column 5, lines 16 to 17.

Through experiments conducted in the '637 patent, it was determined that "because DENN-SV lacks both exons 13L and 16, MADD lacks exon 16, and IG20-SV2 lacks exon 13L, these results confirm the exon The performance of both exons 13L and 16 (as seen in IG20 [pa]) is required for anti-proliferative and pro-apoptotic properties, while the absence of two exons (such as DENN-SV Seen in) is required for proliferative and anti-apoptotic properties. " ’637, column 17, lines 38 to 44. Finally, the '637 patent concluded that "there is clear evidence that IG20 [pa] and DENN-SV have different effects on apoptosis and cell proliferation." ’637, column 18, lines 37 to 39. Its further conclusion "IG20 [pa] is a pro-apoptotic protein, which can interact with DR4 and DR5 and promote the formation of DISC (increasing FADD and caspase-8) Recruit) and significantly increase TRAIL-induced apoptosis. " ’637, column 23, lines 1 to 4. Finally, the conclusion is that "IG20 [pa] can make cells more prone to apoptosis and inhibit cell growth. This increases the possibility of using IG20 [pa] to make resistant cells more susceptible to various forms of cancer therapy. ’637, column 27, lines 20-24.

Through the understanding of the over-expression of IG20 splice variants, the conclusion is that "cells transfected with IG20 [pa] and DENN-SV are the most susceptible to and resistant to TNFα-induced apoptosis, respectively; and Cells transfected with MADD or IG20-SV2 showed no significant difference compared to cells transfected with control plastids. Because DENN-SV lacked two exons 13L and 16, MADD lacked exon 16, IG20-SV2 lacks exon 13L. These results confirm that the performance of both exons 13L and 16 (as seen in IG20 [pa]) is required for anti-proliferative and pro-apoptotic properties, while the absence of both exons (As seen in DENN-SV) required for proliferative and anti-apoptotic properties. "'637, column 17, lines 34 to 44.

Therefore, before the '637 patent, we did not understand the complete complexity of the IG20 splice variant performance, the selective performance of different isoforms in different tissues, and the unique functional properties of each splice variant. Based on the over-expression experiments on the IG20 splice variant disclosed in the '637 patent, the effect of arbitrary indiscriminant knock-down of the splice variant (not considering intron 16 (MADD), 13L and 16 (DENN-SV), 21 and 26 (MADD, DENN-SV, IG20pa) and 34 (KIAA0358, IG20-SV4) different splicing) can prove the normal neuronal function and survival of animals (ie KIAA0358), cancer Cell survival (ie MADD) and hyperplasia (ie DENN-SV) are extremely important. Therefore, the patent provides the qualitative and functional interpretation of IG20 isoforms and the complexity of design strategies that can selectively adjust the performance of various isoforms while avoiding undesirable fatal outcomes.

IG20pa splice variants are pro-apoptotic, anti-proliferative, and make cells more prone to cell death (ie, tumor suppressors). IG20pa or its fragments can be over-expressed to control cell proliferation and cell cycle, and make the cells more susceptible to chemotherapy, radiation therapy or death receptor mediated cell death death).

The performance of DENN-SV can be adjusted to reduce cell proliferation, affect the cell cycle, and increase susceptibility to chemotherapy, radiation therapy, and death receptor-mediated cell death treatment.

Differential expressions of IG20pa and DENN-SV splice variants make cells more susceptible to or resistant to induced cell death, respectively, and the pro-apoptotic properties of IG20pa variants can be used to make chemotherapeutic agents available The resistant tumor cells become easily killed by TRAIL and / or chemotherapeutic agents.

When IG20pa is over-expressed in cells, the cells show significantly reduced proliferation and are also more prone to spontaneous, TNFα, TRAIL-induced apoptosis. Therefore, the pro-apoptotic properties of the IG20pa splice variant can be used to make resistant tumor cells vulnerable to TRAIL and / or chemotherapeutic agents.

The use of siRNA to reduce the expression of IG20 splice variants uses siRNA targeting the middle region (especially exon 15) of IG20 mRNA with the sequence (5'-GTACCAGCTTCAGTCTTTC-3 ') and targeting IG20 mRNA SiRNA in the Death Domain (DD) region was evaluated. Both the middle region and the DD region are present in all IG20 splice variants.

Treatment of cells with siRNA to the middle region of IG20 mRNA but not to the death domain (DD) of IG20 mRNA suppressed the amount of DENN-SV (completely abrogate). Cells treated with siRNA to the middle region of IG20 mRNA (ie, exon 15) experienced spontaneous apoptosis. Moreover, cells that did not undergo spontaneous apoptosis after treatment with siRNA to the middle region of IG20 mRNA (ie, exon 15) were more susceptible to TNF-α-induced apoptosis.

It can be concluded that in order to reduce cell replication, it is desirable to select siRNA to reduce the performance of DENN-SV, especially not to affect the performance of IG20 splice variants, which are required for normal cell function, especially neuronal function and survival (KIAA0358 and IG20 -SV4 splice variant).

Moreover, comparing the prior art oligodeoxynucleotide sequences that proved fatal in many examples, the oligodeoxynucleotides considered in the study of the '637 patent can be optimized to incorporate differences in different isoforms Special exons. Use of these engineered oligodeoxynucleotides (knockdown) can only weaken those isoforms that exhibit special targeting exons, allowing selective reduction of the desired isoform And reduce the undesirable negative effects associated with the weakening of key isoforms.

Map kinase-activated death domain (MADD) protein ( product of the MADD splice variant of the IG20 gene) is essential for cancer cell survival. MADD is expressed at higher levels in cancer cells and tissues (relative to their normal counterparts). MADD has been shown to bind to death receptor-4 (DR4) and death receptor-5 (DR5) and confer resistance to TRAIL-induced apoptosis in thyroid cancer, ovarian cancer and cervical cancer cell lines (Mulherkar N, Prasad KV, Prabhakar BS, MADD / DENN splice variant of the IG20 gene is a negative regulator of caspase-8 activation. Knockdown enhances TRAIL-induced apoptosis of cancer cells, J Biol Chem 282: 11715-11721 (2007); Subramanian M, Pilli T, Bhattacharya P, Pacini F, Nikiforov YE, et al., Knockdown of IG20 gene expression renders thyroid cancer cells susceptible to apoptosis, J Clin Endocrinol Metab 94: 1467-1471 (2009); Prabhakar BS, Mulherkar N, Prasad KV, Role of IG20 splice variants in TRAIL resistance ,. Clin Cancer Res 14: 347-351 (2008); Li LC, Jayaram S, Ganesh L, Qian L, Rotmensch J, et al., Knockdown of MADD and c-FLIP overcomes resistance to TRAIL-induced apoptosis in ovarian cancer cells, Am J Obstet Gynecol 205: 362 e312-325 (2011)).

The abrogation of MADD (non-other IG20 splice variants) can make cancer cells more susceptible to spontaneous and TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) induction Apoptosis. Spontaneous and TRAIL-induced apoptosis in cells without MADD can be inhibited by the expression of CrmA or dominant-negative FADD (dominant-negative FADD), thereby demonstrating that endogenous MADD can interfere with the caspase Asparaginase-8 is activated. Furthermore, it has been found that MADD can directly interact with death receptors, but not with caspase-8 or FADD, but still inhibits caspase-8 activation. It has been shown that MADD interferes with the cytoplasmic domain of FADD recruitment to death receptors (Mulherkar N, Prasad K and Prabhakar B, MADD / DENN Splice Variant of the IG20 Gene is a Negative Regulator of Caspase-8 Activation, Journal of Biological Chemistry, Vol. 282, no. 16, 11715-11721 (2007). This confirms the importance of MADD in controlling cancer cell survival / death and conferring resistance to TRAIL-induced apoptosis.

The ERK (extracellular signal-related kinase) pathway is a drug target for cancer chemotherapy because about one third of all human cancers have dysregulated mitogen-activated protein kinase protein kinase) (MAPK) pathway, causing ERK activation. MAPK is a serine / threonine-specific protein kinase that responds to extracellular stimuli (mitogens) and regulates many important and critical cellular functions required for cell stability, such as metabolism, cell cycle progression , The performance, motility and adhesion of cytokines. Therefore, MAPK affects cell survival, proliferation, differentiation, development and apoptosis. Extracellular stimuli (such as cytokines, growth factors and environmental stresses) cause the successive activation of the signaling cascade composed of MAPK.

During activation, ERK1 / 2 phosphorylates many nuclear and cytoplasmic matrices involved in various cellular processes, including transcription factors, signaling proteins, kinases and phosphatases, cytoskeletal proteins, apoptotic proteins, and proteases. Although the ERK pathway can be activated by many extracellular signals, the pathway that signals cytokines and growth factors to activate ERK is particularly relevant to cancer. For example, the TNF-α (cytokine enriched in tumor stroma) system binds to TNF receptor 1 (TNFR1) present on cancer cells and effectively activates ERK MAPK. In the absence of MADD, this pro-survival signaling pathway may be converted into an apoptosis signaling pathway, causing cancer cell death (Kurada BRVVSN, Li LC, Mulherkar N, Subramanian M, Prasad KV, Prabhakar BS, MADD , a Splice Variant of IG20 , is Indispensable for MAPK Activation and Protection against Apoptosis upon Tumor Necrosis Factor-α Treatment, (2009), Journal of Biological Chemistry 284: 13533-13541).

The extrinsic cell death inducing signaling pathway can be triggered when a death ligand (such as TRAIL) binds to its cognate death receptor. The death receptor undergoes a trimerization reaction and recruits FADD, resulting in subsequent activation of caspase-8, followed by activation of caspase-3 by the executioner, leading to apoptosis. TRAIL generally binds to death receptor-4 (DR4) and death receptor-5 (DR5) of cancer cells, leading to oligomerization of death receptor (DR) and subsequent FADD and pro-caspase-8 (procaspase- 8) Recruited to DR (Bodmer JL, Holler N, Reynard S, Vinciguerra P, Schneider P, et al., TRAIL receptor-2 signals apoptosis through FADD and caspase-8, Nat Cell Biol 2: 241-243 (2000); Sprick MR, Weigand MA, Rieser E, Rauch CT, Juo P, et al., FADD / MORT1 and caspase-8 are recruited to TRAIL receptors 1 and 2 and are essential for apoptosis mediated by TRAIL receptor 2, Immunity 12: 599- 609 (2000); Kischkel FC, Lawrence DA, Chuntharapai A, Schow P, Kim KJ, et al., Apo2L / TRAIL-dependent recruitment of endogenous FADD and caspase-8 to death receptors 4 and 5, Immunity 12: 611-620 (2000)). Procaspase-8 then undergoes proximity induced cleavage and activation to form caspase-8, which in turn activates executor caspase-3, which causes apoptosis Sex cell death. However, in cancer cells where MADD is over-expressed, MADD binds to DR4 and DR5 and prevents FADD recruitment to DR. When MADD is reduced, FADD is more likely to be recruited to DR, leading to increased apoptosis (Mulherkar N, Prasad KV, Prabhakar BS, MADD / DENN splice variant of the IG20 gene is a negative regulator of caspase-8 activation. Knockdown enhances TRAIL- induced apoptosis of cancer cells, J Biol Chem 282: 11715-11721 (2007); Mulherkar N, Ramaswamy M, Mordi DC, Prabhakar BS, MADD / DENN splice variant of the IG20 gene is necessary and sufficient for cancer cell survival, Oncogene 25 : 6252-6261 (2006)).

The uniqueness of TRAIL is that it usually has no adverse effects on normal cells or tissues (Keane MM, Ettenberg SA, Nau MM, Russell EK, Lipkowitz S, Chemotherapy augments TRAIL-induced apoptosis in breast cell lines, Cancer Res 59: 734- 741 (1999)). However, due to the interference of different anti-apoptotic proteins, the development of chemotherapy and TRAIL resistance still pose significant challenges. MADD is one such anti-apoptotic protein, confirming that MADD downregulation can be used to make cancer cells prone to cell death (Mulherkar N, Ramaswamy M, Mordi DC, Prabhakar BS, MADD / DENN splice variant of the IG20 gene is necessary and sufficient for cancer cell survival, Oncogene 25: 6252-6261 (2006)).

Depending on phosphorylation with Akt, MADD may have a dual function in regulating apoptosis. The tumor suppressor PTEN (phosphatase and tensin homolog deleted on chromosome 10) is a lipid that negatively regulates the phospholipid inositol 3-kinase (PI3K) -Akt signaling pathway Phosphatase (lipid phosphatase). When phosphorylation of MADD is attenuated by PTEM, MADD can act as a pro-apoptotic factor to induce apoptosis (Jayarama S, Li L, Ganesh L, Mardi D, Kanteti P, Hay N, Li P, and Prabhakar BS, J Cell Biochem. 2014, 115 (2): 261-270). TRAIL induces upregulation of PTEN with reduced MADD phosphorylation. The decrease in PTEN interferes with the TRAIL-induced decrease in pMADD content. Unphosphorylated MADD is translocated from the plasma membrane to the cytoplasm, where it binds to 14-3-3 protein and replaces 14-3-3 associated Bax (14-3-3 associated Bax), which Bax translocates to the mitochondria, resulting in the release of cytochrome-c. In conclusion, it can be concluded that PTEN can convey a death signal by preventing Akt from phosphorylating MADD.

The extrinsic apoptotic pathway can be abolished by phosphorylated MADD. Endogenous MADD (Endogenous MADD) is phosphorylated by Akt at three highly conserved sites, and only phosphorylated MADD can directly interact with the TRAIL receptor DR4, thereby preventing FADD recruitment (recruitment) . However, in cells that are susceptible to TRAIL, TRAIL triggers a decrease in MADD phosphorylation levels, resulting in the dissociation of MADD and DR4 and the association of FADD and DR4, which makes the death-inducing signaling complex (death) -inducing signaling complex) (DISC), leading to apoptosis (Li P, Jayarama S, Ganesh L, Mordi D, Carr R, Kanteti P, Hay N, and Prabhakar BS, J Biol Chem. 2010 July 16; 285 (29 ): 22713-22722). Therefore, the pro-survival function of MADD depends on its phosphorylation by Akt. Because Akt is active in most cancer cells and phosphorylated MADD confers resistance to TRAIL-induced apoptosis, co-targeting the Akt-MADD axis may increase therapeutic agents involving DR4 / 5 binding The efficacy, including TRAIL-based therapy.

When death signals trigger mitochondrial pro-apoptotic proteins (such as cytochrome c) (Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X. Cell, 1997; 91 (4): 479-489), mitochondrial apoptosis-inducing factor (Susin SA, Lorenzo HK, Zamzami N, Marzo I, Snow BE, Brothers GM, Mangion J, Jacotot E, Costantini P, Loeffler M, Larochette N, Goodlett DR, Aebersold R, Siderovski DP, Penninger JM, Kroemer G. Nature. 1999; 397 (6718): 441-446) and Smac / Diablo (Du C, Fang M, Li Y, Li L, Wang X. Cell. 2000; 102 (1): 33-42; Verhagen AM, Ekert PG, Pakusch M, Silke J, Connolly LM, Reid GE, Moritz RL, Simpson RJ, Vaux DL. Cell. 2000; 102 (1): 43-53) When released, it triggers an intrinsic apoptotic pathway. Cytochrome-c forms a complex with Apaf-1 and procaspase-9, resulting in the activation of caspase-9. Smac / Diablo can associate with Inhibitor of Apoptosis Protein (IAP) and counteract its inhibitory effect on caspase. The intrinsic pathway is regulated by members of the Bcl-2 family. For example, in response to pro-apoptotic stimuli, cytosolic Bax and Bad translocate to the mitochondria to penetrate the outer membrane of the mitochondria, resulting in the release of cytochrome c into the cytosol. In contrast, Bcl-2 and Bcl-xL can associate with Bax and Bad, thereby preventing their induced death (Antignani A, Youle RJ. Curr Opin Cell Biol. 2006; 18 (6): 685-689). Interestingly, unphosphorylated MADD translocates from the cell membrane to the cytoplasm, where it binds to 14-3-3 and replaces the 14-3-3 associated Bax, which translocates to the mitochondria, resulting in cytochrome- c release (Jayarama S, Li L, Ganesh L, Mardi D, Kanteti P, Hay N, Li P, and Prabhakar BS, J Cell Biochem. 2014, 115 (2): 261-270).

The MADD cDNA sequence can be obtained from the GenBank database under the access code: NM_130470, and is represented by the nucleotide sequence of SEQ ID NO: 11 and the polypeptide sequence of SEQ ID NO: 12 herein. Designed to downgrade the interfering RNA of MADD (including siRNA, shRNA and antisense oligonucleotides) to target the nucleic acid sequence of exon 13L of the splice variant of the IG20 gene, and include any dual gene variant of MADD (allelic variant ) And naturally occurring mutants, and polymorphisms that occur in MADD splice variants that can be found in specific population parts. In other words, sequences with high similarity (eg, about 95% at the amino acid level and about 75% at the nucleic acid level) and representing naturally occurring variations in MADD splice variants are disclosed in this disclosure Within the scope, the siRNA, shRNA and antisense oligonucleotides disclosed herein can down-regulate the performance of these sequences. The exon 13L of the MADD splice variant may comprise the nucleotide sequence represented by nucleotides 2699 to 2827 of SEQ ID NO: 11. Nucleic acid sequences that are approximately 80%, 90%, or 95% similar to the MADD sequence disclosed herein at the nucleic acid level can also be downregulated. Generate nucleic acid sequences that are complementary to the nucleic acid sequence of exon 13L of the MADD splice variant of the IG20 gene and / or the mRNA transcript of exon 13L of the MADD splice variant, and can appear in the target region of exon 13L The nucleic acid sequences of siRNA and shRNA of nucleic acid variations are within the scope of the present disclosure. Furthermore, a nucleic acid sequence comprising a nucleic acid sequence complementary to the exon 13L of the MADD splice variant of the IG20 gene and / or an mRNA transcript of the exon 13L of the MADD splice variant, and may appear in the exon 13L target Antisense oligonucleotides with nucleic acid variations within are within the scope of this disclosure.

Methods that have been shown to specifically reduce the expression of splice variants of the IG20 gene include: (a) obtaining a nucleic acid molecule capable of reducing the expression of MADD, wherein the nucleic acid molecule or its transcription product can selectively bind to an mRNA molecule, and the mRNA molecule includes The nucleic acid sequence of the MADD splice variant of the IG20 gene; and (b) contacting a cell expressing the MADD splice variant of the IG20 gene with a nucleic acid molecule, wherein the nucleic acid molecule reduces the performance of the MADD splice variant. In the cytoplasm, nucleic acids selected from siRNA, expressed shRNA, and antisense oligonucleotides bind to target exon 13L mRNA, resulting in target 13L mRNA degradation, which downgrades the performance of MADD splice variants .

In other words, it has been shown that down-regulation of MADD is a substantial down-regulation, for example, over 90% or 95% of endogenous MADD performance is reduced. In fact, it is desirable to reduce, for example, at least 40%, at least 50%, at least 60%, at least 70%, and at least 80% of endogenous MADD expression.

Isolated siRNA, shRNA and antisense oligonucleotides that selectively downregulate the splice variant of the IG20 gene (where the splice variant is MADD) are disclosed in US Patent No. 7,910,723. The patent describes the development of "splice variant specific" nucleic acid molecules that selectively down- regulate one or more splice variants of the IG20 gene and their relative importance in cancer cell survival. Not all cancer cells show all IG20 splice variants and some only show MADD and DENN splice variants. Use cells expressing four known splicing variants or only MADD and DENN splicing variants and specifically selected exon 13L (downregulated IG20pa and MADD), exon 16 (modulated ShRNA, siRNA, and antisense oligonucleosides of IG20pa and IG20-SV2) and exon 15 (exon 15 is expressed in all splice variants of the IG20 gene, so it can reduce the performance of all splice variants) The different nucleic acid molecules of glucuronides have confirmed the critical requirement of MADD for cancer cell survival. Although siRNA, shRNA and antisense oligonucleotides targeting exon 16 can attenuate IG20pa, only siRNA, shRNA and antisense oligonucleotides targeting exon 13L can cause cancer cell death. This first suggests that MADD may be particularly critical for cancer cell survival. Additional evidence showing that MADD is essential for the survival of cancer cells was confirmed in cells transfected with Mid-shRNA resistant IG20 splice variants, in which the triple code in the Mid-shRNA target region of the cDNA construct The third base of the triple codon is replaced. This DNA substitution does not change the amino acid sequence, but makes them resistant to Mid-shRNA. When the performance of all endogenous IG20 splice variants is down-regulated using Mid-shRNA, only cells expressing MADD splice variants can avoid cell death, while other splice variants cannot avoid cell death. The use of cancer cells expressing only MADD and DENN-SV splice variants shows that siRNA, shRNA or antisense oligonucleotides targeting exon 13L can be used to selectively reduce MADD, and that only MADD is sufficient for cancer cells Survival is essential (Mulherkar, N., et al ., Oncogene 2006; 25: 6252-61).

Earlier studies did not reveal the complete complexity of IG20 gene expression, the differential performance of splice variants in different tissues, and the unique functional properties of each splice variant (that is, cancer cell survival (MADD) and hyperplasia (DENN)) . Therefore, the discovery of various splice variants, their functional characteristics, and the ability to identify specific nucleic acid molecules that can selectively reduce the expression of splice variants can enable the inventors to develop cancer therapies without undesirable potential negative consequences.

US Patent No. 7,910,723 describes the use of nucleic acid molecules targeting the exon 13L of the IG20 gene and encoded siRNA, shRNA, and antisense oligonucleotides to down-regulate the performance of MADD protein. The patent describes how to optimize nucleic acid selection to achieve effective MADD performance reduction, including the selection of a nucleic acid molecule consisting essentially of the nucleotide sequence CGGCGAATCTATGACAATC (SEQ ID NO: 1) and its transcription product, encoding essentially by A nucleic acid molecule composed of the nucleotide sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2). The types of nucleic acid molecules in this strategy include siRNA, shRNA and antisense oligonucleotides, which contain less than 50% GC nucleotide content, high AU nucleotide content toward the 3 'end, and no inversion in the siRNA region Inverted repeat, this oligonucleotide constitutes an array of nucleic acid molecules that can span the 13L nucleotide sequence of exon. These encoded nucleic acid molecules and encoded siRNA, shRNA, and antisense oligonucleotides have been shown to be sufficient to down-regulate the performance of MADD splice variants. Natural variations of MADD (including specific SNPs, dual gene variants or mutations) that may occur in one or more subgroups of cancer types can be targeted by these nucleic acid molecules.

A method for reducing the performance of MADD is described, which includes: (a) obtaining a nucleic acid molecule that selectively reduces the performance of MADD, wherein the nucleic acid molecule can selectively bind to the mRNA molecule of the MADD splice variant of the IG20 gene; and (b ) Contacting a cancer cell expressing the MADD splice variant of the IG20 gene with a nucleic acid molecule, wherein the nucleic acid molecule downregulates the performance of the MADD splice variant in cancer cells.

Furthermore, representative nucleic acid molecules showing MADD splicing variants that downregulate IG20 , their dual gene variants, their polymorphisms, and their gene mutations include siRNA, shRNA, and antisense nucleic acid molecules, which may include the nucleotide sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2). The siRNA can be in the form of a duplex with homologous antisense nucleic acid. The homologous antisense nucleic acid (cognate antisense nucleic acid) is exon 13L nucleotide sequence and / or MADD exon of the target MADD The 13L mRNA transcript is complementary.

The down-regulation of specific splice variants of the IG20 gene is difficult because of the very short target sequence (which differs differentially among different splice variants). US Patent No. 7,910,723 explained in the implementation of the invention that downregulation can be achieved by using specially designed short hairpin RNA molecules (shRNA). Short hairpin RNA (shRNA) contains complementary sense and antisense sequences of target genes linked by a loop structure. dsDNA can be cloned into the expression vector for transfection, and then can be transcribed to form shRNA, which is cleaved into siRNA, which can inhibit gene expression through RNA interference (RNAi). In one embodiment, the nucleic acid encoding the shRNA includes the following structure: X _sense -hairpin loop-X _antisense , wherein X (encoding siRNA) includes or consists essentially of the sequence CGGCGAATCTATGACAATC (SEQ ID NO: 1) Composed of nucleic acids. The nucleic acid is transcribed to form shRNA and can be cleaved to form siRNA, which can ultimately inhibit MADD performance. Therefore, RNA molecules that are transcribed in a test tube ( in vitro ) or in vivo (for example, in a cancer cell or tumor) to form shRNA and siRNA are also included.

Encoding shRNA MADD inhibiting expression of dsDNA Exemplary nucleic acid sequences may be CGGCGAATCTATGACAATCTTCAA GAGAGATTGTCATAGATTCGCCG (SEQ ID NO: 3 ), wherein, in the hairpin loop region between X and _sense lines from the X position of _{the antisense} sequence 20-28. The hairpin loop zone can contain any suitable sequence. For constructing shRNA vectors, see McIntyre and Fanning, Design and cloning strategies for constructing shRNA expression vectors, BMC Biotechnol. 2006; 6: 1 (2006), the entirety of which is incorporated herein by reference.

In one embodiment, the double-stranded RNA or dsRNA refers to a double-stranded RNA that matches a predetermined gene sequence, which can activate and degrade the cell enzyme of the corresponding gene messenger RNA transcript. The dsRNA includes nucleic acid molecules that can be short interfering RNA (siRNA) and can be used to suppress gene expression. The term "double stranded RNA" or "dsRNA" as used herein refers to a double-stranded RNA molecule capable of RNA interference ("RNAi"), including short interfering RNA ("siRNA" ").

SiRNA, shRNA, and antisense oligonucleotide molecules as described herein can also include nucleic acid modifications known in the art to increase the stability of target mRNA and increase cleavage disruption. Regarding a specific nucleic acid molecule, a representative example may include a 19-base core including 2 or 3 nucleotide overhanging 3 'ends, such as 3' terminal thymine (TT). The overhang can play a structural role that makes RISC appear symmetrical double-stranded. DTdT is often selected because it can impart nuclease resistance to nucleic acid molecules. Nevertheless, some researchers still prefer UU overhangs or overhangs that are complementary to authentic mRNA targets. The most important thing is that the 19-base core essence of the nucleic acid molecule is toward a unique mRNA target.

siRNA, shRNA and antisense oligonucleotide molecules can also be chemically synthesized de novo . The synthesized nucleic acid molecule may be in the form of a single-stranded nucleic acid molecule or may be in a double-stranded form with a homologous antisense nucleic acid molecule. siRNA, shRNA, and antisense oligonucleotides include nucleic acid sequences that are complementary to the target MADD exon 13L nucleotide sequence and / or MADD exon 13L mRNA transcript.

RNA interference is a conservative pathway found in most eukaryotes, where double-stranded RNA (dsRNA) down-regulates the performance of genes with complementary sequences. The long dsRNA is degraded by endoribonuclease (Dicer) into a small effector molecule (effector molecule), called siRNA (small interfering RNA). siRNA is usually about 21 base pairs (bp) long, with a center 19 bp double strand and 2 base 3'-overhangs (this can be TT) (Elbashir, SM, Lendeckel W and Tuschl T, RNA interference is mediated by 21- and 23-nucleotide RNAs, Genes & Development, 2001, 15: 188-200). In mammals, Dicer processing occurs in a multiprotein complex with RNA-binding protein TRBP. Nascent siRNA is associated with Dicer, TRBP and Argonaute 2 (Ago2) to form RNA-Induced Silencing Complex (RISC). Once in the RISC, one strand of siRNA (passenger strand / strand having the same sequence as the target mRNA) is degraded or discarded, while the other strand (guide strand (guide strand) / complementary to the targeted mRNA) Shares) to continue to guide the sequence specificity of the silent complex. The Ago2 component of RISC is ribonuclease, which cleaves the target RNA under the guidance of the guide strand. Once the RISC complex is activated, it can continue to target other mRNA targets. This effect expands gene silencing and enables therapeutic effects to persist in rapidly dividing cells for 3 to 7 days. Many researchers currently use synthetic RNA double-strands as their RNAi reagents, which mimic natural siRNA processed by the dicase of long substrate RNA. These synthetic siRNA double-stranded lines are transfected into cell lines, where they mimic the Dicer product in vivo.

The use of siRNA, shRNA, or antisense oligonucleotides to modulate MADD performance and / or reduce MADD performance can enhance traditional cancer therapy.

From the point of view of chemotherapeutics, cancer chemotherapy has progressed significantly in recent years. Many cancer chemotherapeutic substances that have been effective in treating cancer have been identified. Nonetheless, many cancer chemotherapies are characterized by the toxic side effects often encountered when administering specific chemotherapeutic agents.

For example, it is well known that the administration of many established chemotherapeutic agents causes undesirable side effects, including nausea and vomiting, loss of appetite, changes in taste, sparse or brittle hair, joint pain, nail deformity, and tingling of hands or toes. More serious side effects may also occur, such as difficulty in bowel movements, difficulty swallowing, dizziness, shortness of breath, severe fatigue, and chest pain. Therefore, there is still a need to provide caregivers that have the advantages of the chemotherapeutic potential of various known chemotherapeutic agents, but without undesirable side effects that limit compliance and efficacy.

Chemotherapeutic agents such as anthracycline are used to treat various solid tumors and hematological malignancies. The role of anthracene is by intercalating between the base pairs of DNA / RNA strands to inhibit DNA and RNA synthesis, thereby preventing the replication of rapidly dividing cancer cells. The role of anthracycline is also by inhibiting topoisomerase II enzyme (topoisomerase II enzyme), thereby preventing the relaxation of supercoiled DNA (supercoiled DNA), thus blocking DNA transcription and replication. Anthracycline is the most commonly used chemotherapeutic agent.

The effect of anthracycline in the treatment of cancer can be attributed to their cytostatic and cytotoxic effects, such as free radical formation, lipid peroxidation and direct membrane effect. The best characterization mechanism is the interaction and base modification with DNA topoisomerase II or DNA itself by intercalation or covalent bonding. They are responsible for disrupting DNA replication and transcription, which ultimately leads to apoptosis. .

Anthracycline is used to treat cancer, including leukemia, lymphoma, breast cancer, gastric cancer, uterine cancer, ovarian cancer, bladder cancer, and lung cancer.

Representative anthracyclines include daunorubicin, doxorubicin, epirubicin, idarubicin, and valrubicin. Daunomycin (daunorubicin) is the first anthracycline compound characterized structurally and stereochemically. Daunomycin is used to treat acute lymphoblastic and myeloblastic leukemia. Adriamycin (common name doxorubicin) is a hydroxyl derivative of daunorubicin. Doxorubicin is one of the most widely used chemotherapeutic agents and is usually prescribed in combination with other drugs. Doxorubicin has a wide range of activities. It is one of the most effective drugs for the treatment of solid tumors, such as breast cancer, small cell lung cancer and ovarian cancer. It has significant activity against bladder, stomach, liver, and thyroid tumors, Ewing's and osteogenic bone tumors, soft tissue sarcoma, neuroblastoma, and Wilms tumor. It also has resistance The activity of multiple myeloma, many types of leukemia and cutaneous T-cell lymphoma. It also plays an important role in the treatment of Hodgkin's disease and non-Hodgkin's lymphoma The role of panamycin is the epimer of doxorubicin (epimer), the difference is only in the orientation of the C-4 hydroxyl group on the sugar. Because of this slight change in structure, the panamycin has more than The cardiotoxicity of rubicin is low. Panthencin is used to treat gastric and breast cancer and is also used to treat carcinoid, endometrial cancer, lung cancer, ovarian cancer, esophageal cancer and prostate cancer, and soft tissue sarcoma. Damycin is an analogue of daunorubicin. It lacks C-4 methoxy, which increases its lipophilicity. Idamycin has improved activity as an induction therapy for acute myeloid leukemia. E Doxorubicin N-trifluoroacetyl 1-4-valerate derivative (N-trifluoroacetyl, 1-4-valerate derivative). Pentarubicin enters cells more quickly than doxorubicin. It is especially used for early treatment Bladder Cancer.

One of the main side effects of anthracycline is cardiotoxicity, which is often manifested by ECG changes and arrhythmia, or by myocardial lesions, leading to heart failure. It is related to the patient's cumulative lifetime dose, so treatment is often stopped when the maximum cumulative dose of that particular anthracycline is reached. Cardiotoxicity is further overcome by using Dexrazoxane (cardioprotectant) or by using liposomal formulations of daunorubicin and doxorubicin or by using a longer perfusion rate.

Furthermore, although anthracycline therapy prolongs the average life expectancy, it is not without undesirable side effects of drugs. Therefore, there is still a need to provide treatments that include the administration of new classes of drugs with different mechanisms of action that can achieve a more complete remission profile without undesirable side effects.

The inventors have now confirmed a novel method of administering anthracycline, which, when combined with the down-regulation of MADD splice variants, results in significant synergistic effects, including increased efficacy and reduced Side effects.

The inventors first thought and confirmed that one or more nucleic acid molecules capable of down-regulating the performance of at least one splice variant of the IG20 gene (where not all splice variants of the IG20 gene are down-regulated) and conventional chemotherapeutic agents (such as anthracene The clinical combination of "Huan" is an unexpectedly high-value drug treatment method for treating various forms of cancer. When administered in combination to individuals with cancer (such as those with ovarian cancer, breast cancer, lung cancer, pancreatic cancer, bladder cancer, cervical cancer, prostate cancer, melanoma, esophageal cancer, and other solid solid tumors (including Kappa Kaposi's sarcoma)), the inventors confirmed that siRNA, shRNA and antisense oligonucleotides (wherein, siRNA, shRNA and antisense oligonucleotides contain exon 13L with MADD splice variant Nucleic acid sequence or a nucleic acid sequence complementary to the mRNA transcript (mRNA transcript) of exon 13L of the MADD splice variant) and the effect of chemotherapeutic agents (such as anthracyclines) have unexpected benefits, and at least over a period of time Unexpected reductions in superadditive symptoms are obtained, with significantly reduced or no symptoms, tumor growth and tumor survival are proven, and in this way are particularly beneficial for the treatment of multiple cancers. Furthermore, siRNA, shRNA and antisense oligonucleotides are combined for the first time (wherein the siRNA, shRNA and antisense oligonucleotides comprise the nucleic acid sequence of exon 13L of the MADD splice variant or the exon of the MADD splice variant At least one of the nucleic acid sequences complementary to the mRNA transcript of exon 13L and a chemotherapeutic agent (such as anthracycline) has been shown to provide the possibility of complete remission of various cancers and increased safety and tolerance limits. Object of the invention

The object of the present invention is to provide a novel combination of anti-tumor therapy, which comprises the administration of a representative chemotherapeutic agent in combination with a nucleic acid molecule capable of down-regulating the performance of MADD splice variants, the combined anti-tumor therapy can effectively treat various cancers; And to provide pharmaceutical compositions containing antitumor agents of these combinations. Another object of the present invention is to provide a novel method for treating various cancers, which includes administration of an anti-tumor therapy comprising a nucleic acid molecule capable of down-regulating the performance of MADD splice variants and a chemotherapeutic agent such as anthracycline.

A further object of the present invention is to provide a method of producing targeted formulations and therapeutic agent delivery procedures for combined anti-tumor therapy. Other objectives will become clear below, and those skilled in the art will understand the other objectives. Contents of the invention

We believe that our inventions can be specifically summarized below:

There is a combination of anti-tumor agents for the treatment of cancer, which contains an effective amount of one or more nucleic acid molecules capable of down- regulating the performance of at least one splice variant of the IG20 gene, wherein not all splice variants of the IG20 gene are down-regulated ; And one or more anthracycline chemotherapeutics (anthracycline chemotherapeutic).

In this combination, at least one splice variant system of the IG20 gene is selected from MADD splice variants, SNPs, its dual variation, its polymorphism, and its genetic mutation.

In this combination, at least one splice variant of the IG20 gene is a MADD splice variant displaying exon 13L.

In this combination, one or more nucleic acid molecules capable of down- regulating the performance of at least one splice variant of the IG20 gene are selected from siRNA, shRNA, and antisense oligonucleotides.

In this combination, the siRNA, shRNA and antisense oligonucleotides comprise the nucleic acid sequence of exon 13L with MADD splice variant, SNP, its dual gene variant, its polymorphism and its gene mutation and / or mRNA transcript (mRNA transcript) complementary nucleic acid.

In this combination, a nucleic acid molecule capable of down- regulating the expression of at least one splice variant of the IG20 gene is included in siRNA or shRNA.

In this combination, siRNA and shRNA are encoded by a nucleic acid molecule that includes the following structure: X _sense -hairpin loop-X _antisense , where X includes or consists essentially of the following nucleic acid sequence: CGGCGAATCTATGACAATC (SEQ ID NO: 1).

In this combination, the siRNA or shRNA comprises a nucleic acid having the sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2).

In this combination, the siRNA or shRNA contains a nucleic acid having the sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2), and is in a duplex with the cognate nucleic acid having the sequence GAUUGUCAUAGAUUCGCCG (SEQ ID NO: 10) form.

In this combination, the shRNA and siRNA are encoded by a nucleic acid having the sequence CGAATCTATGACAATCTTCAAGAGAGATTGTCATAGA TTCGCCG (SEQ ID NO: 3), wherein the hairpin loop region is from positions 20 to 28 of the sequence.

In this combination, the siRNA, shRNA and antisense oligonucleotides comprising nucleic acid sequences complementary to the nucleic acid sequence of exon 13L of the MADD splice variant of the IG20 gene and / or their mRNA transcripts are selected from GAUUGUCAUAGAUUCGCCGTT ( SEQ ID NO: 4) and nucleic acids of the sequence of GAUUGUCAUAGAUUCGCCG (SEQ ID NO: 10).

In this combination, one or more nucleic acid molecules capable of down- regulating the performance of at least one splice variant of the IG20 gene are included in a drug delivery system.

In this combination, the drug delivery system is a targeted liposome formulation or a lentivirus vector.

In this combination, one or more anthracycline chemotherapeutic agents are selected from daunorubicin, doxorubicin, epirubicin, idarubicin, and valerox Valrubicin.

In this combination, one or more anthracycline chemotherapeutic agents are in the form of pharmaceutically acceptable salts.

In this combination, the cancer is selected from leukemia, lymphoma, breast cancer, gastric cancer, uterine cancer, ovarian cancer, bladder cancer and lung cancer and other types of solid solid tumor cancer, and Kaposi's sarcoma.

Furthermore, a method for treating cancer selected from the following individuals in need: leukemia, lymphoma, breast cancer, gastric cancer, pancreatic cancer, uterine cancer, ovarian cancer, cervical cancer, prostate cancer, melanoma, esophageal cancer, bladder Cancer, liver cancer, thyroid tumor, lung cancer and other types of solid solid tumor cancer, and Kaposi's sarcoma, the method includes administering an effective amount of an antitumor agent combination, which includes: an effective amount of one or more can reduce IG20 A nucleic acid molecule that exhibits at least one splice variant of a gene (where not all splice variants of the IG20 gene are down-regulated), and one or more anthracycline chemotherapeutic agents.

In this method, the cancer line exhibits the performance of at least one splice variant of the IG20 gene.

In this method, the cancer line exhibits the MADD splice variant of the IG20 gene, SNP, its dual gene variant, its polymorphism, and its genetic mutation.

In this method, the MADD splice variant exhibits exon 13L of the IG20 gene.

In this method, one or more nucleic acid molecules capable of down- regulating the performance of at least one splice variant of the IG20 gene are selected from siRNA, shRNA, and antisense oligonucleotides.

In this method, the siRNA, shRNA, and antisense oligonucleotide comprise the nucleic acid sequence of exon 13L of the MADD splice variant of the IG20 gene, SNP, its dual gene variant, its polymorphism, and its gene mutation, and / or Or a nucleic acid complementary to its mRNA transcript.

In this method, a nucleic acid molecule capable of reducing the expression of at least one splice variant of the IG20 gene is contained in siRNA or shRNA.

In this method, siRNA and shRNA are encoded by a nucleic acid molecule that includes the following structure: X- _sense -hairpin loop-X _antisense , where X includes or consists essentially of the following nucleic acid sequence: CGGCGAATCTATGACAATC (SEQ ID NO: 1).

In this method, the siRNA and shRNA comprise a nucleic acid having the sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2).

In this method, the siRNA and shRNA comprise a nucleic acid having the sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2), and are in a double-stranded form with a homologous nucleic acid having the sequence GAUUGUCAUAGAUUCGCCG (SEQ ID NO: 10).

In this method, the shRNA is encoded by a nucleic acid having the sequence CGAATCTATGACAATCTTCAAGAGAGATTGTCATAGATTCGCCG (SEQ ID NO: 3), wherein the hairpin loop region is from positions 20 to 28 of the sequence.

This method, wherein the siRNA, shRNA and antisense oligonucleotides comprising nucleic acid sequences complementary to the nucleic acid sequence of exon 13L of the MADD splice variant of the IG20 gene and / or their mRNA transcripts comprise an antisense oligonucleotide selected from GAUUGUCAUAGAUUCGCCGTT ID NO: 4) and nucleic acids of the sequence of GAUUGUCAUAGAUUCGCCG (SEQ ID NO: 10).

In this method, one or more siRNAs, shRNAs and antisense oligonucleotides are administered in the form of liposomal formulations or by lentivirus transfection.

In this method, one or more siRNA, shRNA and antisense oligonucleotides are administered as an adjuvant.

In this method, one or more of the anthracycline chemotherapeutic agents are selected from the group consisting of daunorubicin, doxorubicin, panamectin, idamycin and pentorubicin.

In this method, one or more anthracycline chemotherapeutic agents are administered in the form of a pharmaceutical composition further comprising one or more pharmaceutically acceptable diluents, excipients or carriers.

In this method, one or more siRNAs, shRNAs, and antisense oligonucleotides are administered before one or more anthracycline chemotherapeutics, or are administered simultaneously with one or more anthracycline chemotherapeutics.

In this method, one or more siRNAs, shRNAs and antisense oligonucleotides are administered in the form of a pharmaceutical composition further comprising one or more pharmaceutically acceptable diluents, excipients or carriers.

This method, wherein one or more siRNA, shRNA and antisense oligonucleotides and one or more anthracycline chemotherapeutic agents are formulated in a dose pack and administered according to the selected treatment regime .

Combination of inventions

As clearly stated above, in one aspect, the present invention provides for the treatment, prevention, suppression, delay of the onset of at least one symptom of a cancer selected from the following cancers in mammals and / or reducing the risk of the development of the symptom or reversing the Symptoms of novel drug combinations: ovarian cancer, breast cancer, lung cancer, pancreatic cancer, bladder cancer, cervical cancer, prostate cancer, melanoma, esophageal cancer and other solid solid tumors (including Kaposi's sarcoma), including: The mammal administered the amount of siRNA, shRNA, and / or antisense oligonucleotides that can reduce the performance of the MADD splice variant of the IG20 gene (where the splice variants are MADD, SNP, its dual gene variant, and many others Genotype and its genetic mutations, and not all splicing variants of the IG20 gene are down-regulated), and a therapeutically effective dose of anthracycline that provides beneficial effects when administered in combination. definition

The term "combination" applied to the active ingredient is used herein to define siRNA, shRNA, and antisense oligonucleotides that include the two drugs of the invention (i.e., one or more MADD splice variants that can downregulate the IG20 gene) Not all splicing variants of IG20 are down-regulated), and one or more anthracycline) single pharmaceutical composition (formulation) or conjointly or two separate administered in the pre-treatment / treatment regimen The pharmaceutical composition (formulation) each contains a single drug of the present invention (that is, one or more siRNA, shRNA, and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene (not all of which are IG20 Of splice variants are down-regulated), and one or more anthracene rings).

Within the meaning of the present invention, the term "conjoint administration" is used to mean simultaneous administration of one composition, or simultaneous administration of different compositions, or sequential administration of different compositions : One or more siRNA, shRNA, and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene (not all splicing variants of the IG20 gene are downregulated ), and one or more anthracene rings. However, with regard to the sequential administration of what is considered to be "conjoint", one or more siRNAs, shRNAs and antisense oligonucleotides (which are not all of the IG20 gene) can downregulate the performance of the MADD splice variant of the IG20 gene Splice variants are down-regulated) and one or more anthracyclines must be administered separately at time intervals, which can still be used to treat, prevent, suppress, delay the onset of cancer in mammals and / or reduce cancer development The beneficial effects of combination therapy of risk. For example, one or more siRNA, shRNA, and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene (where not all splice variants of the IG20 gene are downregulated ) and one or more anthracene ring systems Can be voted in succession. For example, siRNA can be administered 8 to 72 hours (hr) before anthracycline administration to have a reduced MADD performance before treatment with a chemotherapeutic agent.

According to yet another embodiment of the present invention, one or more siRNAs, shRNAs and antisense oligonucleotides capable of down- regulating the performance of the MADD splice variant of the IG20 gene are used as adjuvants. In the context of this description, "adjuvant" refers to an enhancer of a specific anthracycline reaction. "Can be cut using one or more siRNA expression of splice variants MADD IG20 gene, shRNA and antisense oligonucleotide" means one or more splice variants can be lowered MADD IG20 gene expression of siRNA, The shRNA and antisense oligonucleotides are included in pre-treatment before chemotherapeutic agents or combined with chemotherapeutic agents for simultaneous delivery. Adjuvants (such as siRNA, shRNA, and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene) in combination with chemotherapeutic agents can provide synergistic cell death.

Therefore, in another embodiment of the present invention, one or more of siRNA, shRNA and antisense oligonucleotides capable of down- regulating the performance of the MADD splice variant of the IG20 gene are administered to mammals exhibiting cancer (including Human), initiate the death of cancer cells. In the case of increased susceptibility to tumor development (such as in patients in remission), one or more siRNA, shRNA, and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene and one or more Chemotherapeutics can also be used to support the apoptosis pathway.

The term "treat" is used herein to mean reducing or alleviating at least one symptom of an individual's disease. For example, the term "treatment" related to cancer may mean reducing or alleviating tumor growth or symptoms associated with cancer and / or causing tumor regression. Within the meaning of the present invention, the term "treatment" can also mean to suppress, delay the onset (ie, a period before the clinical manifestation of the disease) and / or reduce the risk of the disease developing or worsening. The term "protect" is used herein to mean preventing, delaying or treating (or, where appropriate, all of the above) the development or persistence or aggravation of an individual's disease. Within the meaning of the present invention, cancer is associated with clinical manifestations, including (but not limited to) drug-induced undesirable side effects. For example, as disclosed herein, the prophylactic administration of one or more siRNA, shRNA and antisense oligonucleotides and anthracycline that can downregulate the performance of the MADD splice variant of the IG20 gene can protect against individual development Risk of cancer (eg, individuals with elevated CA125 levels, individuals exhibiting histopathological cancer markers; also refer to the genetic screening and clinical analysis described in the oncology literature for standard screening of various cancers). Similarly, according to the present invention, the therapeutic administration of one or more siRNA, shRNA and antisense oligonucleotides and anthracycline that can downregulate the performance of the MADD splice variant of the IG20 gene can delay clinical symptoms Development or even the symptoms subside.

The term short interfering RNA (siRNA) refers to RNA molecules that are capable of interfering with the transcription of specific genes, thereby silencing the gene expression of the target protein. Representative mechanisms for this process may include administration of siRNA, dsRNA, hairpin RNA (shRNA) and / or antisense oligos that are complementary to the nucleic acid sequence of exon 13L of the MADD splice variant mRNA transcript Nucleic acid molecule of nucleotide. The dsRNA and short hairpin RNA are cleaved by endo-ribonuclease Dicer, which cuts dsRNA or shRNA into siRNA components. The role of siRNA is through the formation of RNA-induced Silencing Complex or RISC. The RISC complex unwinds the siRNA to form a single strand siRNA. RISC containing a single strand of siRNA binds target mRNA, cleaves the mRNA, making it unrecognizable and thereby silencing the production of the desired protein.

Within the meaning of the present invention, the term "siRNA, shRNA, and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene" is used to mean drugs that target messenger RNA. Embodiments of the siRNA, shRNA and antisense oligonucleotides of the present invention that can downregulate the performance of the MADD splice variant of the IG20 gene can be siRNA derivatives, such as modified siRNA, shRNA and / or antisense oligonucleotides Glycosides include nucleic acids that are complementary to the nucleic acid sequence of exon 13L of the MADD splice variant mRNA transcript. Specific embodiments include those described in US Patent No. 7,910,723.

The design of siRNA, shRNA and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene can be accomplished through established technologies. SiRNA, shRNA and antisense oligonucleotides used to target MADD mRNA transcripts were obtained from Dharmacon (Lafayette, Colo.). The most suitable sequence is based on less than 50% GC nucleotide content, high AU nucleotide content towards the 3 'end, and sorted out (Inverted repeat) without reversal in the siRNA region (Reynolds et al. (2004), Nat Biotechnol, 22 (3), 326-30).

Antisense oligonucleotide refers to a nucleic acid that binds to and changes the activity of target mRNA by means of RNA-RNA or RNA-DNA or RNA-PNA (peptide nucleic acid) interaction. molecule. Antisense molecules are usually complementary to the target sequence (single contiguous sequence along the antisense molecule).

In another embodiment, antisense DNA can be used to target RNA by means of DNA-RNA interaction, thereby activating RNase H, which breaks down the target RNA in the double strand. The antisense oligonucleotide may include one or more RNAse H activation regions, which can activate RNAse H cleavage of the target RNA. Antisense DNA can be chemically synthesized or expressed by using a single-stranded DNA expression vector or its equivalent.

In another aspect, a nucleic acid molecule or antisense molecule that interacts with a target RNA molecule and reduces MADD activity is expressed from a transcription unit inserted into a DNA or RNA vector. The recombinant vector may be a DNA plastid or a viral vector. Enzymatic nucleic acid molecules or antisense expression virus vectors can be constructed based on adeno-associated virus, retrovirus, adenovirus, or alpha virus. In one embodiment, the recombinant vector capable of expressing the nucleic acid molecule is delivered as described herein and persists in the target cell. Alternatively, viral vectors can be used to provide transient expression of shRNA / siRNA / antisense nucleic acid molecules. These carriers can be administered repeatedly if necessary. After performance, the interfering nucleic acid molecule binds to the target RNA and down-regulates its function or performance. Delivery of nucleic acid molecules or antisense expression vectors can be systemic, such as by intravenous or intramuscular administration, by administering to target cells transplanted by a patient or individual before introducing into the patient or individual, or by It can be introduced into the desired target cell by any other means. Antisense DNA can also be expressed by using single stranded DNA intracellular expression vectors.

siRNA and shRNA nucleic acid molecules and antisense oligonucleotides are designed based on the nucleotide sequence of exon 13L of the MADD splice variant. The nucleotide sequence exhibited by exon 13L of the MADD splice variant is such as defined as nucleotides 2699 to 2827 of SEQ ID NO: 11. siRNA, shRNA, and antisense oligonucleotides include oligonucleotides with a 19-base core nucleotide sequence that specifically targets exon 13L of the MADD splice variant. Those skilled in the art can construct siRNA, shRNA, and antisense oligonucleotides, which contain less than 50% of GC nucleotide content, high AU nucleotide content toward the 3 'end, and no inverted repeats (inverted repeat), this oligonucleotide constitutes an oligonucleotide array that can span the 13L nucleotide sequence of exon. siRNA, shRNA, and antisense oligonucleotides may further include 2 or 3 nucleotide overhanging 3 'ends (such as terminal TT) to improve cleavage of target mRNA. DTdT is often selected because it can impart nuclease resistance to oligonucleotides. Furthermore, UU overhangs or overhangs complementary to authentic mRNA targets can be added to the 19-base core of the oligonucleotide.

In one embodiment, the siRNA, shRNA and antisense oligonucleotides comprise nucleic acids having the sequence GAUUGUCAUAGAUUCGCCGTT (SEQ ID NO: 4). siRNA and shRNA can be in double-stranded form.

In one embodiment, siRNA, shRNA, and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene (where not all splice variants of the IG20 gene are downregulated) include the sequence GAUUGUCAUAGAUUCGCCG (SEQ ID NO: 10) nucleic acid. The siRNA or shRNA can be in double-stranded form.

In one embodiment, siRNA, shRNA, and antisense oligonucleotides that can down- regulate the performance of the MADD splice variant of the IG20 gene (where not all splice variants of the IG20 gene are down-regulated) basically consist of The sequence GAUUGUCAUAGAUUCGCCG (SEQ ID NO: 10) consists of nucleic acids. The siRNA or shRNA can be in double-stranded form.

Antisense oligonucleotides capable of down- regulating the performance of at least one splice variant of the IG20 gene (where not all splice variants are down-regulated) can be single-stranded nucleic acid molecules that exhibit an appearance that is different from MADD splice variants The nucleic acid sequence of the sub 13L nucleic acid sequence or a part thereof and / or its mRNA transcript (mRNA transcript) is complementary. The single-stranded nucleic acid molecule may be in the form of RNA or DNA. In one embodiment, the antisense oligonucleotide comprises the sequence GAUUGUCAUAGAUUCGCCG (SEQ ID NO: 10).

The term anthracycline as used herein refers to a drug used to treat various solid solid tumors and hematological malignancies and exhibit anti-cancer chemotherapeutic effects. The role of anthracycline is to inhibit DNA and RNA synthesis by intercalating between base pairs of DNA / RNA strands, thereby preventing the replication of rapidly dividing cancer cells. The role of anthracycline is also by inhibiting topoisomerase II enzyme (topoisomerase II enzyme), thereby preventing the relaxation of supertwisted DNA (relaxing), thus blocking DNA transcription and replication. Anthracycline is the most commonly used chemotherapeutic agent. The effectiveness of anthracycline in treating cancer can be attributed to their cytostatic and cytotoxic effects, such as free radical formation, lipid peroxidation, and direct membrane effects. The best characterization mechanism is the interaction and base modification with DNA topoisomerase II or DNA itself by intercalation or covalent bonding. They are responsible for disrupting DNA replication and transcription, which ultimately leads to apoptosis. (apoptotic cell death). The term encompasses daunorubicin, doxorubicin, pangamycin, idamycin and pentorubicin, as well as other modifications and related derivatives known in the art.

The term "analog" or "derivative" used in the conventional medical sense herein refers to a molecule that is structurally similar to a reference molecule (such as an anthracycline), but has been modified in a targeted and controlled manner to use an alternative The substituents replace one or more specific substituents of the reference molecule, thereby producing molecules similar in structure to the reference molecule. Known for identifying potentially improved or biased properties (such as higher potency and / or selectivity for specific target receptor types, greater ability to penetrate mammalian blood-brain barriers, fewer side effects, etc.) The synthesis and screening of lightly modified versions of analogs of compounds (eg, using structural and / or biochemical analysis) are well-known methods of drug design in medicinal chemistry.

Various salts and isomers (including stereoisomers and mirror isomers) of the drugs listed herein can be used. The term "salts" may include pharmaceutically acceptable addition salts of free acids or free bases. Examples of acids that can be used to form pharmaceutically acceptable acid addition salts include inorganic acids such as hydrochloric acid, sulfuric acid, or phosphoric acid, and organic acids such as acetic acid, maleic acid, succinic acid, or citric acid, and the like. All such salts (or other similar salts) can be prepared in a conventional manner. The nature of the salt or isomer is not important, its prerequisite is that it is non-toxic and does not significantly interfere with the desired pharmacological activity.

The term "therapeutically effective" as applied to a dose or amount refers to an amount sufficient to obtain the desired active compound or pharmaceutical composition when administered to a mammal in need. As used herein for the pharmaceutical composition containing siRNA, shRNA, antisense oligonucleotides and anthracycline that can reduce the performance of the MADD splice variant of the IG20 gene, the term "therapeutically effective amount / dose" is used in conjunction "Chemotherapy effective amount / dose" is used interchangeably and refers to an amount / dose of a compound or pharmaceutical composition sufficient to produce an effective chemotherapeutic response when administered to a mammal. It should be noted that when a combination of active ingredients is administered, then the effective amount of the combination may or may not include the amount of each therapeutically effective ingredient.

The term "subthreshold" referring to the amount of active ingredient means an amount that is insufficient to produce a reaction, that is, an amount that is below the minimum effective amount. In the same article, the term "suboptimal" means that the resulting reaction is not yet at its maximum level of active ingredient (this maximum level is to be achieved in higher amounts). This method is of particular interest in the context of the present invention in which the combination therapy described therein provides a "sub-threshold" amount for administration of, for example, anthracycline, where in other cases it is administered at a "sub-threshold", but it can be reduced by The combination of siRNA, shRNA, and antisense oligonucleotides that exhibit the MADD splice variant of the IG20 gene can provide a completely effective treatment and reduce the undesirable side effects associated with anthracycline.

When used with the combination therapy of the present invention, the words "synergistic effect", "synergistic", "synergy", and "synergism" refer to two or more The cooperative behavior of the stimuli when they are combined produces a greater effect than the sum of the effects contributed by the individual stimuli, that is, exceeds the additive effect. The stimulant may be, for example, an agent that reduces the performance of MADD and at least one therapeutic agent.

When used with the composition of the present invention, the term "pharmaceutically acceptable" refers to molecular entities and such compositions that can be tolerated by the body and generally do not produce adverse reactions when administered to a mammal (such as a human) Other ingredients. In one embodiment, the term "pharmaceutically acceptable" as used herein means approved by the Federal or State Government Administration or listed in the United States Pharmacopeia or other recognized pharmacopoeia for mammals and more particularly for Human use.

The term "carrier" applied to the pharmaceutical composition of the present invention refers to administration with an active compound (for example, siRNA, shRNA, antisense oligonucleotide, and anthracycline that can downregulate the performance of the MADD splice variant of the IG20 gene) Diluent, excipient or vehicle. Such pharmaceutical carriers may be sterile liquids such as water, saline solution, dextrose solution, aqueous glycerin solution, and oils including those of petroleum, animal, plant, or synthetic origin such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. In addition, suitable carriers can include liposome formulations. Suitable pharmaceutical carriers also in "Remington's Pharmaceutical Sciences" by EW Martin, 18 th Edition described.

The term "individual" as used herein refers to mammals (eg, rodents, such as mice or rats). The term specifically refers to humans.

The term "about" or "approximately" generally means within 20%, within 10%, and optionally within 5% of a given value or range. Or, especially in biological systems, the term "about" means within about a log (ie, an order of magnitude), optionally within twice the given value.

The term "consisting of" excludes any elements, steps or ingredients that are not explicitly stated in the scope of the patent application. Related Gray, 53 F.2d 520, 11 USPQ 255 (CCPA 1931). The term "consisting essentially of" limits the scope of the patent application to clearly stated materials or steps and these do not materially affect the basic and novel features of the claimed invention. Related Herz, 537 F. 2d 549, 551-52, 190 USPQ 461, 463 (CCPA 1976)) (emphasized in the original work). Pharmaceutical composition

Along with the method of the present invention, there is also provided a pharmaceutical composition comprising a therapeutically effective amount of siRNA, shRNA and antisense oligonucleotides capable of reducing the performance of the MADD splice variant of the IG20 gene and / or a therapeutically effective amount of anthracene Rings and optionally additional carriers or excipients (all pharmaceutically acceptable). The siRNA, shRNA, antisense oligonucleotides and anthracene ring system that can downregulate the performance of the MADD splice variant of the IG20 gene can be formulated into a single composition or into two separate compositions that can be co-administered. In one embodiment, they are formulated into a single composition or two separate compositions administered randomly or sequentially or simultaneously. The composition can be formulated for administration once a day or twice a day, as well as typical dosage regimens in individual therapies.

In a further embodiment, the formulation of this combination may allow them to be administered in a titration regimen so that the patient can adapt to the effect of anthracycline and / or the clinician can titrate up to reduce IG20 The siRNA, shRNA and antisense oligonucleotides of the MADD splice variant of the gene allow the anthracycline to be down-regulated to a significantly lower dose to minimize the toxicity and / or harmonization of the anthracycline Difficulty of drug delivery.

In the disclosed composition, siRNA, shRNA, antisense oligonucleotides, and anthracycline capable of down- regulating the performance of the MADD splice variant of the IG20 gene are optionally present in therapeutically effective amounts. The optimal therapeutically effective amount should consider the actual mode of administration, the form of medication administered, the indications targeted for administration, the individual involved (e.g. body weight, health, age, gender, etc.) and the responsible physician or veterinarian. Preferences and experience are determined by experiment. As disclosed herein, for human administration, both siRNA, shRNA, antisense oligonucleotides, and anthracycline that can reduce the performance of the MADD splice variant of the IG20 gene are understood in the art in a suitable form Those dose ranges are administered. In one embodiment, siRNA, shRNA, and antisense oligonucleotides that can reduce the performance of the MADD splice variant of the IG20 gene are administered at a therapeutic dose; the anthracycline system is suboptimal or reduced Dosing. In some examples, it may also be desirable to administer one or the other of the active ingredients in suboptimal or subthreshold amounts, and such administration also falls within the scope of the invention.

The present invention also provides a method of preparing a pharmaceutical composition, which comprises blending a therapeutically effective amount of siRNA, shRNA, antisense oligonucleotides, and anthracycline capable of down- regulating the performance of the MADD splice variant of the IG20 gene, and optionally ( Optionally) one or more physiologically acceptable carriers and / or excipients and / or auxiliary substances. Give

The active agent of the present invention may contain a conventional unit dose formulation of a non-toxic pharmaceutically acceptable carrier (with or without a targeting molecule that can selectively deliver the active agent to a specific cell type or tissue) unit formulation) administered intradermally, parenterally, intranasally, or intratumorally. Intradermal administration may include the use of transdermal patches, microabrasion, or nanoemulsion. Parenterally administered drugs can be administered in the form of injections, time-controlled release vehicles (including diffusion control systems), osmotic devices, dissolution control matrices, and erodible / degradable matrices To.

For oral administration in the form of tablets or capsules, the active pharmaceutical ingredient may be combined with non-toxic pharmaceutically acceptable excipients, such as a binding agent (eg, pregelatinized maize starch, polyvinylpyrrole Pyridone or hydroxypropyl methylcellulose); fillers (such as lactose, sucrose, glucose, mannitol, sorbitol and other reduced and non-reduced sugars, microcrystalline cellulose, calcium sulfate or calcium hydrogen phosphate) ); Lubricants (eg magnesium stearate, talc or silica, stearic acid, sodium stearyl fumarate), glyceryl behenate, calcium stearate And the like); disintegrant (such as potato starch or sodium starch glycolate); or wetting agent (such as sodium lauryl sulphate), coloring and flavoring agents, gelatin , Sweeteners, natural and synthetic gums (such as acacia, tragacanth or alginate), buffer salts, carboxymethylcellulose, polyethylene glycol, wax And the like. For oral administration in liquid form, the pharmaceutical ingredients can be combined with non-toxic pharmaceutically acceptable inert carriers (eg ethanol, glycerol, water), suspending agents (eg sorbitol syrup, cellulose derivatives or hydrogenated edible fats) (hydrogenated edible fat)), emulsifier (e.g. lecithin or gum arabic), non-aqueous vehicle (e.g. almond oil, oily ester, ethanol or fractionated vegetable oil), preservative (e.g. p-hydroxybenzoic acid Ester or propyl ester or sorbic acid) and the like. Stabilizers can also be added to stabilize the dosage form, such as antioxidants (BHA, BHT, propyl gallate, sodium ascorbate, citric acid).

The lozenges can be coated by methods known in the art. The composition of the present invention can also be incorporated into, for example, microspheres or microcapsules made of polyglycolic acid / lactic acid (PGLA) (see, for example, U.S. Patent Nos. 5,814,344, 5,100,669) And 4,849,222; PCT Publications WO95 / 11010 and WO93 / 07861). Liquid preparations for oral administration may be in the form of, for example, solutions, syrups, emulsions or suspensions, or they may be presented as dry products (for reconstitution with water or other suitable vehicles before use). Formulations for oral administration can be suitably formulated to give controlled or delayed release of the active compound.

Drug delivery systems known in the art are specific technologies for targeted delivery and / or controlled release of therapeutic agents.

The drug delivery system allows the drug to be deployed to a specific target body part by controlling the medium administered by the treatment. Such drug delivery systems may include microtechnology and nanotechnology.

Nucleic acid molecules selected from siRNA, shRNA and antisense oligonucleotides complementary to the nucleotide sequence of the MADD splice variant of the IG20 gene mRNA transcript can down- regulate the performance of at least one splice variant of the IG20 gene Drug delivery systems that are known in the art and can include polymer microspheres, polymer microcells, and hydrogel-type materials. It is understood in the art that the drug delivery system effectively improves drug targeting specificity and reduces drug targeting specificity. Systemic toxicity, improved therapeutic absorption rate, and protection against biochemical degradation of drugs. In addition, many other drug delivery systems are envisioned, including biodegradable polymers, dendrimers (also known as star polymers), electroactive polymers, and modified C-60 fullerenes (also known as It is "buckyball".

Furthermore, the drug delivery system may include a lentivirus-mediated transduction of a nucleic acid encoding a nucleic acid molecule capable of down- regulating the expression of at least one splice variant of the IG20 gene, the nucleic acid molecule selected from the group consisting of IG20 SiRNA, shRNA and antisense oligonucleotides complementary to the nucleotide sequence of MADD splice variants of gene mRNA transcripts.

Active drugs can also be administered in the form of liposome delivery systems, such as single-layer small liposomes, single-layer large liposomes, and multi-layer liposomes. Liposomes can be formed from various well-known phospholipids, such as cholesterol, stearylamine, or phospholipid choline.

SiRNA, shRNA and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene can be combined in the form of targeted liposome formulations. Representative assembly may include encapsulation within self-assembled engineered proteins, which provides efficient packaging, binding, assembly, and delivery of these oligonucleotides. The components of these engineered proteins can be selected from peptides that actively target tumor cells by attaching to selected cell surface receptors, peptides that promote receptor-mediated endocytosis, and active release of oligonucleotides that provide delivery Peptide. These self-assembled protein transport molecules (including the oligonucleotide of the present invention) can be assembled in the form of nanoparticles (<50 nanometers) containing the following two components: engineered polypeptides (targeting peptides, membrane penetrating peptides) , Oligonucleotide capturing peptide (oligonucleotide capturing peptide) and oligonucleotide therapeutic payload (oligonucleotide therapeutic payload).

The drugs of the present invention can also be delivered by using monoclonal antibodies (as individual carriers coupled to compound molecules). Active drugs can also be coupled with soluble polymers as targetable drug carriers. Such polymers may include polyvinylpyrrolidone, pyran copolymer, polyhydroxy-propyl methacrylamide-phenol, polyhydroxy-ethyl aspartame-phenol (polyhydroxy-ethyl-aspartamide-phenol) or polyethylene oxide-polylysine substituted with palmitic acid residues. In addition, active drugs can be coupled with biodegradable polymers that are used to achieve controlled drug release, such as polylactic acid, polyglycolic acid, copolymers of polylactic acid and polyglycolic acid, polyepsilon caprolactone, Cross-linked or amphiphilic block copolymer of polyhydroxybutyric acid, polyorthoester, polyacetal, polyhydropyran, polycyanoacrylate and hydrogel.

For administration by inhalation, the therapeutic agent according to the present invention may come from the pressurized packaging using a suitable propellant (such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas) Or the aerosol spray of the nebulizer is conveniently delivered. In the case of pressurized aerosols, the unit dose can be determined by providing a valve that delivers a metered amount. Capsules and cartridges such as gelatin used in inhalers or insufflators can be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch.

The formulation of the present invention can be delivered parenterally, that is, intravenously (iv), intracerebroventricular (icv), subcutaneous (sc), intraperitoneal (ip), intramuscular (im), Subdermal (sd), intratumoral (it), or intradermal (id) administration for direct injection via, for example, bolus injection or continuous infusion. Formulations for injection can be presented in unit dosage form with added preservatives, for example in ampoules or multi-dose containers. The composition may take such forms as excipients, suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulating agents such as suspending agents, stabilizers and / or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle (eg, sterile pyrogen-free water) before use.

The composition of the present invention can also be formulated for rectal administration, for example as suppositories or retention enemas (for example containing conventional suppository bases such as cocoa butter or other glycerides).

As disclosed herein, siRNA, shRNA and antisense oligonucleotides and anthracyclines that can downregulate the performance of the MADD splice variant of the IG20 gene can be blended with excipients that are pharmaceutically acceptable and compatible with the active ingredient . In addition, if necessary, the preparation may also include a small amount of auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, and / or agents that increase the effectiveness of the pharmaceutical composition. These accessory molecules can be delivered systemically or locally as proteins or expressed by vectors expressing the encoded molecules. The above techniques for delivering siRNA, shRNA, antisense oligonucleotides, and anthracyclines that can down- regulate the performance of the MADD splice variant of the IG20 gene can also be used for delivery of auxiliary molecules.

Although the active agent of the present invention can be administered in divided doses, for example, siRNA, shRNA, antisense oligonucleotides, and anthracycline, which can downregulate the performance of the MADD splice variant of the IG20 gene, are single The daily dose is divided into two or three times a day, but a single daily dose in which two doses are administered in one composition or two separate compositions simultaneously is one embodiment.

The present invention also includes a method of preparing a pharmaceutical composition, which includes siRNA, shRNA and antisense oligonucleotides capable of down- regulating the performance of the MADD splice variant of the IG20 gene, anthracycline and a pharmaceutically acceptable carrier and / or Or a combination of excipients.

The specific amount of siRNA, shRNA and antisense oligonucleotides that can be used to reduce the performance of the MADD splice variant of the IG20 gene in the amount of the unit dose of the present invention can be easily determined by those skilled in the art. Specific amounts of anthracycline that can be used in the reduced unit dose amount of the present invention include, for example, 3/4, 1/2, 1/3, 1/4, 1/5, 1/10, 1 / 20 used anthracene ring.

The present invention also provides a pharmaceutical package or kit comprising one or more containers containing one or more ingredients of the formulation of the present invention. In a related embodiment, the present invention provides a kit for preparing the pharmaceutical composition of the present invention, the kit comprising one or more MADD splices capable of down- regulating the IG20 gene in a first container or multiple containers The formulation of the siRNA, shRNA and antisense oligonucleotides of the variants and one or more anthracene rings in the second container or containers, and optionally used for blending two drugs and / or for Instructions for administering the drug in a therapeutically meaningful protocol. Each container of the kit may optionally include one or more body-acceptable carriers and / or excipients and / or auxiliary substances. Related to these containers is an announcement that may be in the form prescribed by a government agency that regulates the manufacture, use, or sale of pharmaceuticals or biological products. The announcement reflects the agency's approval for the manufacture, use, or sale of medicines for human administration.

If desired, the composition can be presented in a package or dispenser device that can contain one or more unit dosage forms containing the active ingredient. The packaging may contain, for example, metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The composition of the present invention formulated in a compatible pharmaceutical carrier can also be prepared, placed in a suitable container, and labeled with a label for indication treatment. Effective dose and safety assessment

According to the method of the present invention, the pharmaceutical composition described herein is administered to a patient in a therapeutically effective dose, and in one embodiment, has the lowest toxic dose other than that required for the combined therapeutic purpose. The section titled "Definitions" provides definitions for the terms "chemotherapy effective dose" and "therapeutically effective dose". In one embodiment, the siRNA, shRNA, antisense oligonucleotides, and anthracycline that can downregulate the performance of the MADD splice variant of the IG20 gene each provide an improved effect when combined (eg, administered separately in each agent) The effect was not observed at the time). One embodiment of the present invention is that siRNA, shRNA, antisense oligonucleotides and anthracycline that can downregulate the performance of the MADD splice variant of the IG20 gene are administered at a "suboptimal" or "subthreshold" dose In addition, these doses, when combined, provide a superior additive effect that unexpectedly reduces unwanted side effects.

The efficacy of siRNA, shRNA, and antisense oligonucleotides that can reduce the performance of the MADD splice variant of the IG20 gene of the present invention can be measured using in vitro pharmacological tests, such as the use of quantitative reverse transcriptase-polymerase chain reaction (quantitative Reverse Transcriptase-Polymerase Chain Reaction) (Q-RT-PCR) or RT-PCR to measure mRNA levels. The efficacy of the anthracycline of the present invention can be measured using in vitro methods known to those skilled in the art, such as cell cytotoxicity assay, MTT assay, and apoptosis assay Method, cell migration assay, etc.

In accordance with well-established methods in the field, effective doses and toxicity of the compounds and compositions of the present invention that are well-executed in in vitro tests can then be used in preclinical studies using small animal models (eg, mice or rats) In the assay, it was found that siRNA, shRNA, antisense oligonucleotides and anthracycline that can downregulate the performance of the MADD splice variant of the IG20 gene are therapeutically effective.

Any of the therapeutic composition in a pharmaceutically effective dosage of the method of the present invention may be used to estimate the first by an animal model of a circulating plasma concentration range that includes the IC ₅₀ (i.e., to reach half of the maximum concentration of test compound). The dose response curve derived from the animal system can then be used to determine the test dose for initial clinical studies in humans. In the safety determination of each composition, the dosage and frequency of administration should meet or exceed those expected by users in clinical trials.

As disclosed herein, the dosage of the components in the composition of the present invention is determined to ensure that the dose administered continuously or intermittently does not exceed the amount determined after considering the results in the test animal and the individual condition of the patient. The specific dosage varies depending on the dosage procedure, the condition of the patient or individual animal, such as age, weight, sex, sensitivity, feeding, dosage cycle, combined drugs, and the severity of the disease. Under certain conditions, the appropriate dose and the number of doses can be determined by the test based on the above index, but can be pondered according to standard clinical techniques according to the judgment of the physician and the conditions of each patient (age, general condition, severity of symptoms, gender, etc.) And final decision. As disclosed herein, the appropriate doses of siRNA, shRNA and antisense oligonucleotides that can downregulate the performance of the MADD splice variant of the IG20 gene are generally those that can be determined by those skilled in the art. The dose can be determined by those skilled in the art. In one embodiment, the dose of siRNA to be administered may be in the range of 1 to 10 mg / kg body weight. The dosage can vary within this range depending on the dosage form used and the route of administration utilized. In one embodiment, a single dose of each drug can be administered daily.

Toxicity and therapeutic efficacy of the composition of the present invention may be measured in a standard pharmaceutical procedures in experimental animals, e.g. measured by LD ₅₀ (lethal to 50% of the dose groups) and the ED ₅₀ (50% of the population so that therapeutically effective dose). Between the toxic dose and the therapeutic effect is the therapeutic index and it can ED ₅₀ / LD ₅₀ ratio of FIG. Formulations / combinations that exhibit a large therapeutic index are preferred.

The data obtained from the Animal Institute can be used to formulate a range of dosage for use in humans. The therapeutically effective doses of siRNA, shRNA and antisense oligonucleotides and anthracyclines that can downregulate the performance of the MADD splice variant of the IG20 gene are within the range of circulating concentrations, including those with little or no addition to treatment ED ₅₀ other than toxicity. For example, these therapeutically effective circulating concentrations of siRNA, shRNA, and antisense oligonucleotides that can reduce the performance of the MADD splice variant of the IG20 gene are often determinable by those skilled in the art concentration. The dosage of siRNA, shRNA and antisense oligonucleotides that can reduce the performance of the MADD splice variant of the IG20 gene can be in the range of 1 to 10 mg / kg body weight. The dosage can vary within this range depending on the dosage form used and the route of administration utilized. It is best to use a single dose of each drug every day.

The pharmaceutical combination of the present invention is not only very effective at relatively low doses, but also has low toxicity and produces fewer side effects than necessary for treatment. In fact, the only common side effects of the anthracycline of the present invention are those that are alleviated by the designed combination therapy of the present invention, and are derived from the use of the siRNA, shRNA and anti-reactions of the present invention that can downregulate the performance of the MADD splice variant of the IG20 gene The most common side effects of sense oligonucleotides are associated with RNA injections, such as temporarily exacerbated inflammatory reactions, including increased interferon production. Pharmacology - summary

The active principal drug of the present invention, its pharmaceutical composition, and the method of treatment thereof are characterized by unique advantageous and unpredictable properties, making the "subject whole" as claimed herein unobvious. The combination and its pharmaceutical composition exhibit the following valuable properties and characteristics in standard acceptable and reliable test procedures.

The results confirmed that the combination of MADD siRNA reduction and doxorubicin treatment has a synergistic effect on cell death of pancreatic cancer cells, in which the combination of MADD siRNA reduction and doxorubicin treatment combined cell death exceeded the MADD siRNA reduction The additive effect of monotherapy or doxorubicin monotherapy.

The results confirmed that the combination of MADD siRNA reduction and doxorubicin treatment has a synergistic effect on the cell death of lung cancer cells, wherein the combination of MADD siRNA reduction and doxorubicin treatment combined cell death exceeded the single MADD siRNA reduction The additive effect of therapy or doxorubicin monotherapy.

The results confirmed that the combination of MADD siRNA reduction and doxorubicin treatment has a synergistic effect on the cell death of breast cancer cells, wherein the number of cell deaths due to the combination of MADD siRNA reduction and doxorubicin treatment exceeds that of MADD siRNA reduction The additive effect of therapy or doxorubicin monotherapy.

The results confirmed that the combination of MADD siRNA reduction and doxorubicin treatment has a synergistic effect on cell death of gastric cancer cells, in which the combination of MADD siRNA reduction and doxorubicin treatment combined cell death exceeded the single MADD siRNA reduction The additive effect of therapy or doxorubicin monotherapy.

The results confirmed that the combination of MADD siRNA reduction and doxorubicin treatment has a synergistic effect on the cell death of chronic myeloid leukemia cells, wherein the combination of MADD siRNA reduction and doxorubicin treatment combined cell death exceeds the MADD siRNA Reduced additive effect of monotherapy or doxorubicin monotherapy. Example 1 : Determination of the cytotoxic dose curve of anthracycline chemotherapeutics

The representative cancer cell lines of various cancers susceptible to anthracycline treatment include 8505C (thyroid carcinoma), HTH7 (thyroid carcinoma), C643 (human thyroid carcinoma), AsPC-1 (Pancreatic cancer), SU.86.86 (pancreatic cancer), CFPAC-1 (pancreatic cancer), MCF7 (adenocarcinoma breast cancer), SK-BR -3 (breast cancer), OVCAR3 (ovarian cancer), SKOV3 (ovarian cancer), NCI-H522 (non-small cell lung cancer), NCI- H2122 (non-small cell lung cancer), NCI-H2227 (small cell lung cancer), HepG2 (liver hepatocellular carcinoma), PLC / PRF / 5 (liver cancer (liver hepatoma)), JIMT1 (breast cancer), N87 (gastric carcinoma) and K562 (chronic myelogenous leukemia). Cell lines can be obtained from the National Cancer Institute (Bethesda, MD) or the American Type Culture Collection or similar organizations in other countries in Bethesda, Maryland. These cell lines can be selected because they all exhibit higher levels of MADD splice variants, are derived from different types of cancer, all require new treatment modalities, exhibit unique growth properties and are due to radically different mutations. Different treatments with chemotherapeutic agents have different susceptibility. Despite the heterogeneity of these cell lines, they can make them susceptible to therapeutic treatment when MADD weakens, thus showing the potential beneficial effects of MADD weakening in different cancer ranges. Because of the unique growth properties of these cell lines, they are cultivated in a medium that is formulated to support their optimal growth during cultivation.

The 8505C cell line was cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin.

The HTH7 cell line was cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin.

C643 cell line was cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin.

AsPC-1 cell line was modified in an incubator for air using 5% CO ₂ to contain 2 mM L-glutamine, 10 mM HEPES, 1 mM sodium pyruvate (sodium pyruvate), 4500 mg / L glucose and 1500 mg / L sodium bicarbonate in RPMI-1640 medium. Additional sodium bicarbonate may be required for incubators containing higher percentages of CO ₂ . Base medium is supplemented with 10% fetal calf serum and antibiotics and anti-fungal agents.

SU.86.86 cell line was modified in an incubator for air with 5% CO ₂ to contain 2 mM L-glutamic acid, 10 mM HEPES, 1 mM sodium pyruvate, 4500 mg / L glucose And 1500 mg / L sodium bicarbonate in RPMI-1640 medium. Additional sodium bicarbonate may be required for incubators containing higher percentages of CO ₂ . The basic culture medium is supplemented with 10% fetal calf serum, antibiotics and antifungal agents.

The CFPAC-1 cell line is in Iscove's Modified Dulbecco's Medium (Iscove's Modified Dulbecco's Medium) containing 4 mM L-glutamic acid, 4500 mg / L glucose and 1500 mg / L sodium bicarbonate. IMDM). This basic medium is supplemented with 10% fetal calf serum and antibiotics and antifungal agents.

MCF7 cell line was modified to contain Earle's Balanced Salt Solution, non-essential amino acids, 2 mM L-glutamic acid, 1 mM sodium pyruvate, and 1500 mg / L bicarbonate Sodium is cultured in Eagle's minimum essential mediu. This basic medium is supplemented with 0.01 mg / ml human recombinant insulin and fetal bovine serum to a final concentration of 10%.

The SK-BR-3 cell line was cultured in McCoy's 5A Medium modified to contain 1.5 mM L-glutamic acid and 2200 mg / L sodium bicarbonate. This basic medium is supplemented with 10% fetal calf serum and antibiotics and antifungal agents.

The OVCAR3 cell line was modified in an incubator for air using 5% CO ₂ to contain 2 mM L-glutamic acid, 10 mM HEPES, 1 mM sodium pyruvate, 4500 mg / L glucose and 1500 Milligram / liter sodium bicarbonate in RPMI-1640 medium. This basic medium is supplemented with 0.01 milligrams per milliliter (mg / ml) of bovine insulin, antibiotics and antimycotics and fetal bovine serum to a final concentration of 20%.

The SKOV3 cell line was cultured in McCoy's 5A Medium modified to contain 1.5 mM L-glutamic acid and 2200 mg / L sodium bicarbonate. This basic medium is supplemented with 10% fetal calf serum and antibiotics and antifungal agents.

NCI-H522 cell line was modified in an incubator for air using 5% CO ₂ to contain 2 mM L-glutamic acid, 10 mM HEPES, 1 mM sodium pyruvate, 4500 mg / L glucose And 1500 mg / L sodium bicarbonate in RPMI-1640 medium. This basic medium is supplemented with 10% fetal calf serum and antibiotics and antifungal agents.

The NCI-H2122 cell line was modified in an incubator for air using 5% CO ₂ to contain 2 mM L-glutamic acid, 10 mM HEPES, 1 mM sodium pyruvate, 4500 mg / L glucose And 1500 mg / L sodium bicarbonate in RPMI-1640 medium. This basic medium is supplemented with 10% fetal calf serum and antibiotics and antifungal agents.

The NCI-H2227 cell line contains 0.005 mg / ml insulin, 0.01 mg / ml transferrin, 30 nM sodium selenite, 10 nM Hydrocortisone, 10 nM β-estrogen Glycol (beta-estradiol), additional 2 mM L-glutamic acid (4.5 mM final concentration), 5% fetal bovine serum in DMEM: F12 medium.

The HepG2 cell line was cultured in Eagle ’s Minimum Essential Medium (EMEM) supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin.

The PLC / PRF / 5 cell line was cultured in the minimal essential medium (EMEM) supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin.

The K562 cell line was cultured in Iscove ’s Modified Dulbecco ’s Medium (IMDM) supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin.

The HCT116 cell line was cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin.

The AGS cell line was cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin.

The JIMT1 cell line was cultured in complete RPMI medium (GIBCO) with 10% fetal bovine serum and 1X antibiotic-antimycotic solution (Gibco). The antibiotic-antimycotic solution contains 10,000 units / ml penicillin, 10,000 μg / ml streptomycin and 25 μg / ml Gibco amphotericin B (Amphotericin B).

The N87 cell line was cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin.

All cell lines were maintained in a humidified atmosphere with 5% CO ₂ at 37 ° C.

Anthracycline chemotherapeutic agents are available on the market in the form of physician-prescribed pharmacies and approved by the FDA.

All cell lines are cultured in their respective media with appropriate supplements as described above. Table 1. Summary of Process - adhesion type cell line (Adherent cell line) Process Summary - type cell line suspension (Suspension cell line)

On day 0, adherent cells were seeded in 96-well plates (Corning; catalog number: 353072) and incubated overnight.

On day 0, suspension cells were seeded in 96-well plates (Corning; catalog number: 353072) and anthracycline chemotherapeutic agents were added.

After overnight incubation (day 1), 6 different concentrations of each chemotherapeutic drug were added in triplicate.

The cytotoxicity of each cell line model can be evaluated based on the comparative cytotoxicity measured by the MTT assay.

MTT staining for metabolic activity : MTT (3- [4,5-dimethylthiazol-2-yl] -2,5-diphenyltetrazolium bromide ((3- [4,5-Dimethylthiazol-2 -yl] -2,5-diphenyltetrazolium bromide); Thiazolyl blue) can be purchased from Sigma Aldrich (catalog number: M5655) and dissolved in sterile DPBS at a concentration of 5 mg / ml.

In adherent cells, after 24 and 48 hours of drug exposure (on days 2 and 3, respectively), 10 microliters (µl) of the prepared MTT solution was added to each well of a 96-well plate. The dish was incubated at 37 ° C in a humidified CO ₂ incubator for 2 hours. After 2 hours, aspirate the culture medium using a vacuum inside the biosafety hood. Purple formazan crystals formed in living cells were dissolved by adding 100 microliters of dimethyl sulfoxide (Thermo Fisher Scientific; catalog number: D128-500). The disk was kept on the shaker for 10 minutes to completely dissolve the crystals and the absorbance at 595 nanometers (nm) was recorded using a Bio-Rad iMark microplate reader.

In suspension cells, after 24 and 48 hours of drug exposure (on Day 1 and Day 2, respectively), 10 μl of the prepared MTT solution was added to each well of a 96-well plate. The dish was incubated at 37 ° C in a humidified CO ₂ incubator for 2 hours. After 2 hours of incubation, an equal volume of dissolving agent (20% SDS in 50% Dimethylformamide) was added and the dish was incubated overnight at 37 ° C in a humidified CO ₂ incubator . After overnight incubation, the disk was kept on a shaker for 10 minutes to completely dissolve the crystals and the absorbance at 595 nm was recorded using a Bio-Rad iMark microplate reader.

The cell survival percentage was calculated using MS excel. EC ₅₀ is calculated using GraphPad Prism software. The MTT assay indicates that the whole cell is dead.

Studies have confirmed that treatment of cancer cells with anthracycline chemotherapeutic agents exhibits a measurable dose response profile based on cancer cell death. Example 2 : Transfection of siRNA containing Map kinase activated death domain protein (MADD)

SiRNA, shRNA and / or antisense oligonucleotides containing nucleic acid molecules that target the exon 13L of the MADD splice variant can be designed. An siRNA containing a 19-bp double strand in the center and a 2 base 3'-overhang ((2-base 3'-overhang)) was synthesized. Furthermore, a non-specific Scramble siRNA having 19 bp double strands and 2 base 3'-overhangs was synthesized to provide a negative control siRNA. The sequence of the siRNA (double-stranded double-stranded) used is: MADD siRNA : 5 '-GAUUGUCAUAGAUUCGCCGTT-3' (SEQ ID NO: 4) scrambled siRNA : 5 '-UUGCUAAGCGUCGGUCAAUTT-3' (SEQ ID NO: 5 )

Lipofectamine RNAimax (transfection mediating reagent) is a cationic unilamellar liposomal structure with positive surface charge in water. The lipid cationic charge interacts with the negative phosphate group of the nucleic acid in the siRNA and forms a liposome / siRNA transfection complex with the cell membrane. This complex can easily fuse with the cell membrane and deliver siRNA inside the cell via endocytosis. Dosing of siRNA and transfection reagents should be determined for each cell line. The volume of transfection reagent per cubic millimeter of tissue culture disc area recommended by the manufacturer is usually used and the siRNA concentration can be changed. For most cells, 10 nM siRNA is sufficient to cause knock-down of MADD within 48 hours of transfection. Transfection (Transfection):

The cell line is in a 5% CO ₂ incubator at 37 ° C in a humidified atmosphere containing 5% CO ₂ with 10% fetal bovine serum (Gibco; catalog number: 26140-079) recommended by the ATCC. And 1x antibiotic / antimycotic agent (Gibco; catalog number: 15240096) culture and maintenance. Cells used for transfection were seeded in 96-well plates (24 hours before transfection to achieve 60 to 80% confluence).

The details of the transfection response of each cell line tested are presented below.

The transfection reaction mixture was prepared in triplicate as recommended by the manufacturer's instructions. Briefly, in test tube A, an aliquot of 100 µM siRNA stock solution (aliquot) was diluted in 5 µl (5 µl) OPTI-MEM to give a final 10 nM siRNA per well concentration. In Test Tube B, 0.3 microliter RNAiMax (Thermo Fisher Scientific) reagent was mixed in 4.7 microliter OPTI-MEM. The contents from test tubes A and B were mixed and incubated at room temperature for 15 minutes. The reaction mixture was added to the dish and incubated at 37 ° C for 24 hours, 48 hours and 72 hours. The medium was changed after 48 hours. RNA isolation :

Total RNA was extracted using Trizol reagent (Ambion; catalog number: 15596018). To each well of a 96-well plate, 150 microliters of Trizol was added to suspend and homogenize the cell suspension. Triplicate samples were collected together for further processing. The cells were incubated at room temperature for 10 minutes. 250 microliters of chloroform (Fisher; catalog number: C606-1) was added to the cell suspension. The samples were incubated at room temperature for 3 minutes. The test tube was centrifuged at 10,000 rpm for 15 minutes at 4 ° C. The top layer was moved to a fresh tube and 600 microliters of isopropanol (Fisher; catalog number: A451-1) was added. Incubate the test tube at room temperature for 10 minutes. Next, the test tube was centrifuged at 10,000 rpm for 10 minutes at 4 ° C. The supernatant was discarded and the precipitate was washed with 1 ml of 75% ethanol (Decon; catalog number: DSP-AZ-1). The test tube was centrifuged at 7500 rpm for 5 minutes at 4 ° C. The precipitate was air dried and dissolved in 20 microliters of DEPC water (Fisher; catalog number: BP561-1). The RNA line was quantified using Thermo Fisher Scientific NanoDrop One. Use A260 / 280 and A260 / 230 to verify the purity of the sample. Reverse transcriptase PCR :

For RT-PCR, MADD and β-actin (internal loading control) primers were used. The sequence of the primers used is: MADD 13L forward : 5'- AGC CCC AAT ATG GCT TTC CC-3 '(SEQ ID NO: 6) MADD 13L reverse : 5'-CTG ATC CAC TAA CGC CCT CC-3 '(SEQ ID NO: 7) β- actin forward : 5'-ATCTGGCACCACACCTTCTAC AATGAGCTGCG-3' (SEQ ID NO: 8) β- actin reverse : 5'-CGTCATACTCCTGCTTGCTG ATCCACATCTGC-3 '(SEQ ID NO: 9)

For amplification, Qiagen One step RT_PCR kit (catalog number: 210212) and BioRaD T100 thermal cycler (thermocycler) were used. A description of RT-PCR is presented below. Table 2. The RT-PCR amplification process is: 1. 50 ° C for 30 minutes 2. 95 ° C for 15 minutes 3. 94 ° C for 50 seconds 4. 55 ° C for 50 seconds 5. 72 ° C for 60 seconds 6. Repeat steps 3 to 5. 39 times 7. 72 ° C for 7 minutes 8. Keep at 4 ° C 5% polypropylene amide gel electrophoresis :

Polyacrylamide gel (polyacrylamidegel) was manually poured and the following formulation was used to prepare the gel. Add all the components in order. table 3.

Before loading in the gel, the entire sample volume (25 µl) was mixed with 5 µl of 6x nucleic acid buffer (Thermo Fisher Scientific; catalog number: RO611). Gel electrophoresis was performed using BioRad Protean II Xi Cell at 200 volts for 2 hours. The gel was stained with 100 ml of working staining solution (1 μg / ml of Ethidium Bromide in 0.5x TBE) for 30 minutes. Ethidium bromide was purchased from BioRad (catalog number: 161-0433). Use BioRad ChemiDoc MP Imaging System (BioRad ChemiDoc MP Imaging System) to capture images.

These studies confirmed the effective transfection of nucleic acids in this experiment, as well as the effect of distinguishing transfection reagents on MADD performance (MADD reduction) and cell survival. Example 3: Effect of cancer death anthracycline chemotherapeutic agent and there is no weakening MADD (knockdown of MADD) of cells

The cytotoxic effect of anthracycline chemotherapeutic agents on cancer cells with or without MADD modulation can be determined.

The SU.86.86, H2227, C643, PLC / PRF / 5, JIMT1, N87, K562, and H522 cell lines were cultured in their respective mediums with appropriate supplements as described above. Table 4. Process overview

The cell line was cultured and maintained at 37 ° C in a humidified atmosphere containing 5% CO ₂ as described above. On day 0, the cells were seeded in 100 mm ³ tissue culture dishes (Corning; catalog number: 353003) to achieve 60 to 70% confluence. At the same time, cells were also seeded in a 96-well plate (Corning; catalog number: 353072) for survival analysis before reseeding.

After 12 to 18 hours (Day 1), cells were transfected with scrambled or MADD siRNA at a concentration of 10 nM. The sequence of the siRNA (double-stranded) used is: MADD siRNA : 5 '-GAUUGUCAUAGAUUCGCCGTT-3' (SEQ ID NO: 4) scrambled siRNA : 5 '-UUGCUAAGCGUCGGUCAAUTT-3' (SEQ ID NO: 5)

The stock siRNA was reconstituted to a concentration of 100 µM in 1x siRNA lysis buffer (GE Healthcare; catalog number: B-002000-UB-700) and stored at -20 ° C. For transfection, prepare the reaction mixture for each plate: add 30 µl of lipofectamine RNAimax (Invitrogen; catalog number: 13778-150), 1 ml of Opti-MEM (Gibco; catalog number: 31985062) and aliquots of stock siRNA to Obtain a final concentration of 10 nM siRNA for each plate or well plate containing 70% confluent cells. The reaction mixture was incubated at room temperature for 10 minutes. The transfection mixture was added dropwise to a dish containing 70% confluent cells in RPMI medium with 10% FBS but no antibiotics. The transfection mixture was also added to the cells plated in 96-well plates.

The cell lines were incubated in a humidified CO ₂ incubator at 37 ° C for 24 hours, and on the next day (day 2), the medium was replaced with complete RPMI (10% FBS and 1x antibiotic / antimycotic agent). Change the medium of all cells.

48 hours after transfection (day 3), the cells were harvested by treatment with 0.05% trypsin (Gibco; catalog number: 25-300-054). Briefly, cells were washed with DPBS (Gibco; catalog number: 14190250) and treated with trypsin for 5 minutes. The cells were then detached and collected in 10 ml of complete media. The cell suspension was centrifuged at 1500 rpm for 10 minutes. The supernatant was discarded and the cell pellet was suspended in 5 ml of complete RPMI. All cells [control group (untreated), transfected Scramble and MADD siRNA] were counted using a hemocytometer before re-inoculation. For cell counting, the cell suspension was mixed with 0.4% trypan blue (Lonza; catalog number: 17-942E) in equal volumes. Place 10 microliters of cell suspension (with trypan Blue) on the hemocytometer and count the cells. Perform two counts and use the average to determine the number of cells.

Equal numbers of cells [control group (untreated), transfected disordered type and MADD siRNA] were seeded in 96-well plates. The MTT assay was performed on the same day (48 hours after transfection) to determine the relative cell survival rate before re-inoculation.

On Day 4, when the cells were properly attached to the 96-well plate and maintained their shapes, the drug was added.

table 5.

All drug lines were diluted in complete medium on the same day before addition to the cells. For untreated cells, the medium is replaced with complete medium. A volume of 200 microliters of culture medium (with or without drugs) was used for the drug therapy assay. The plates were incubated at 37 ° C in a humidified CO ₂ incubator for 24 hours, 48 hours, and 72 hours.

The MTT assay was performed to determine the relative survival rate after drug treatment as described above.

MTT staining for metabolic activity : MTT (3- [4,5-dimethylthiazol-2-yl] -2,5-diphenyltetrazolium bromide (3- [4,5-Dimethylthiazol-2- yl] -2,5-diphenyltetrazolium bromide); Thiazolyl blue (Thiazolyl blue) was purchased from Sigma Aldrich (catalog number: M5655). MTT was dissolved in sterile DPBS at a concentration of 5 mg / ml and filtered through a 0.45 µM syringe filter (Corning; catalog number: 431220). Add 10 microliters of MTT solution to each well of the 96-well plate. The dish was incubated at 37 ° C for 2 hours in a humidified CO ₂ incubator. After 2 hours, aspirate the culture medium inside the biosafety hood. The purple crystal system formed in living cells was dissolved by adding 100 microliters of dimethylsulfoxide (Thermo Fisher Scientific; catalog number: D128-500). The disk was kept on the shaker for 10 minutes to complete crystal dissolution and the absorbance at 595 nanometers (nm) was recorded using a Bio-Rad iMark microplate reader.

The data is analyzed with MS excel software. The relative survival is calculated relative to the absorbance of the control group (untreated cells) to determine the effect of transfection and combination therapy.

Transfection with disordered siRNA resulted in little or no spontaneous cell death. Spontaneous cell death can be attributed to the sensitivity of individual cell lines to transfection reagents. Disordered siRNA transfection needs to be included in each experiment as a transfection control group and establish a baseline that reflects the number of cell deaths that can occur due to the transfection reaction.

Each data set takes into account any spontaneous cell death observed when transfected with scrambled siRNA; the number of cell deaths observed in each siRNA transfection reaction minus spontaneous transfection from scrambled siRNA The number of sex cell deaths (baseline) is the net cell death percentage (net%) after considering the cell death induced by the disordered siRNA.

In one embodiment, 5 nM doxorubicin is added to SU.86.86 pancreatic cancer cells as a monotherapy. Furthermore, the cells were transfected with MADD siRNA as a monotherapy. In combination, 5 nM doxorubicin was added to cells transfected with MADD siRNA. Untreated control cells, control cells transfected with scrambled siRNA, cells transfected with MADD siRNA, cells treated with 5 nM doxorubicin, and more than 5 nM transfected with MADD siRNA The amount of cell death in the cell culture of the treatment paradigm represented by the cells treated with doxorubicin was evaluated 24 hours after doxorubicin treatment. Table 6.

The results described in Table 6 confirmed that the weakening of siRNA of MADD resulted in 0% cell death. Monotherapy with 5 nM doxorubicin monotherapy resulted in 36% cell death. Add 5 nM doxorubicin to MADD siRNA transfected cells resulted in 52% cell death. All results take into account the effect of transfection using scrambled siRNA cell death data. In conclusion, the results confirmed that the synergy of the combination of siRNA reduction of MADD and doxorubicin treatment resulted in 52% cell death, which far exceeded the combination of MADD siRNA-reduced monotherapy or doxorubicin monotherapy Additive effect, the additive effect of each monotherapy will be 36% cell death.

In another embodiment, 9.375 nM doxorubicin is added to H2227 lung cancer cells as a monotherapy. Furthermore, cells were transfected with MADD siRNA as monotherapy. In combination, 9.375 nM doxorubicin was added to cells transfected with MADD siRNA. Untreated control cells, scrambled siRNA transfected control cells, MADD siRNA transfected cells, 9.375 nM doxorubicin treated cells, and MADD siRNA transfected and more than 9.375 nM The amount of cell death in the cell culture of the treatment paradigm represented by the cells treated with doxorubicin was evaluated 48 hours after doxorubicin treatment. Table 7.

The results described in Table 7 confirmed that MADD siRNA attenuation resulted in 7% cell death. Doxorubicin monotherapy at a concentration of 9.375 nM resulted in 3% cell death. Addition of 9.375 nM doxorubicin to MADD siRNA Transfected cells resulted in 38% cell death. All results take into account the effect of transfection using scrambled siRNA cell death data. In conclusion, the results confirm the synergy of the combination of MADD siRNA reduction and doxorubicin treatment, resulting in 38% cell death, which far exceeds the additive effect of MADD siRNA-reduced monotherapy or doxorubicin monotherapy, each The additive effect of monotherapy will be 10% cell death.

In one embodiment, 0.075 µM doxorubicin is added to JIMT1 breast cancer cells as a monotherapy. Furthermore, cells were transfected with MADD siRNA as monotherapy. In combination, 0.075 µM doxorubicin was added to cells transfected with MADD siRNA. Untreated control cells, scrambled siRNA control cells, MADD siRNA transfected cells, 0.075 µM doxorubicin-treated cells, and MADD siRNA transfected and more than 0.075 µM The amount of cell death in the cell culture of the treatment paradigm represented by the cells treated with doxorubicin was evaluated 24 hours after doxorubicin treatment. Table 8.

The results described in Table 8 confirmed that the weakening of siRNA of MADD caused 26% of cell death. Monotherapy with a concentration of 0.075 µM of doxorubicin resulted in 17% of cell death. Addition of 0.075 µM of doxorubicin to MADD siRNA transfected cells resulted in 59% cell death. All results take into account the effect of transfection using scrambled siRNA cell death data. In conclusion, the results confirm the synergy of the combination of MADD siRNA reduction and doxorubicin treatment, resulting in 59% of cell death, which far exceeds the additive effect of MADD siRNA-reduced monotherapy or doxorubicin monotherapy, each The additive effect of monotherapy will be 43% cell death.

In one embodiment, 0.8 µM doxorubicin is added to N87 gastric cancer cells as a monotherapy. Furthermore, cells were transfected with MADD siRNA as monotherapy. When combining, add 0.8 µM doxorubicin to cells transfected with MADD siRNA. Untreated control cells, control cells transfected with scrambled siRNA, cells transfected with MADD siRNA, cells treated with 0.8 µM doxorubicin, and transfected with MADD siRNA and more than 0.8 µM The amount of cell death in the cell culture of the treatment paradigm represented by the cells treated with doxorubicin was evaluated 72 hours after doxorubicin treatment. Table 9.

The results described in Table 9 confirmed that the weakening of siRNA of MADD resulted in 7% cell death. Monotherapy at a concentration of 0.8 µM doxorubicin resulted in 38% cell death. Addition of 0.8 µM doxorubicin to MADD siRNA transfected cells resulted in 56% cell death. All results take into account the effect of transfection using scrambled siRNA cell death data. In conclusion, the results confirm the synergy of the combination of MADD siRNA reduction and doxorubicin treatment, resulting in 56% cell death, which far exceeds the additive effect of MADD siRNA-reduced monotherapy or doxorubicin monotherapy, each The additive effect of monotherapy will be 45% cell death.

In one embodiment, 0.25 µM doxorubicin is added to K562 chronic myelogenous leukemia cells as a monotherapy. Furthermore, cells were transfected with MADD siRNA as monotherapy. When combining, add 0.25 µM doxorubicin to cells transfected with MADD siRNA. Untreated control cells, control cells transfected with scrambled siRNA, cells transfected with MADD siRNA, cells treated with 0.25 µM doxorubicin, and more than 0.25 µM transfected with MADD siRNA The amount of cell death in the cell culture of the treatment paradigm represented by the cells treated with doxorubicin was evaluated 72 hours after doxorubicin treatment. Table 10.

The results described in Table 10 confirmed that the weakening of siRNA of MADD caused 47% of the cell death. Monotherapy at a concentration of 0.25 µM doxorubicin resulted in 11% of the cell death. The addition of 0.25 µM doxorubicin to MADD siRNA transfected cells resulted in 76% cell death. All results take into account the effect of transfection using scrambled siRNA cell death data. In conclusion, the results confirmed the synergy of the combination of MADD siRNA reduction and doxorubicin treatment, resulting in 76% cell death, which far exceeds the additive effect of MADD siRNA-reduced monotherapy or doxorubicin monotherapy, each The additive effect of monotherapy will be 58% cell death.

In one embodiment, 0.5 µM doxorubicin is added to K562 chronic myeloid leukemia cells as a monotherapy. Furthermore, cells were transfected with MADD siRNA as monotherapy. When combining, add 0.5 µM doxorubicin to cells transfected with MADD siRNA. Untreated control cells, control cells transfected with scrambled siRNA, cells transfected with MADD siRNA, cells treated with 0.5 µM doxorubicin, and transfected with MADD siRNA and more than 0.5 µM The amount of cell death in the cell culture of the treatment paradigm represented by the cells treated with doxorubicin was evaluated 48 hours after doxorubicin treatment. Table 11.

The results described in Table 11 confirmed that the weakening of siRNA of MADD caused 4% of cell death. Doxorubicin monotherapy at a concentration of 0.5 µM resulted in 0% of cell death. Addition of 0.5 µM doxorubicin to MADD siRNA transfected cells resulted in 23% cell death. All results take into account the effect of transfection using scrambled siRNA cell death data. In conclusion, the results confirm the synergy of the combination of MADD siRNA reduction and doxorubicin treatment, resulting in 23% cell death, which far exceeds the additive effect of MADD siRNA attenuated monotherapy or doxorubicin monotherapy, each The additive effect of monotherapy will be 4% cell death.

Considering the aforementioned experimental results, this assay confirms that the combination of anthracycline chemotherapeutic agent treatment and MADD reduction has an unexpected synergistic effect on cancer cell death. The results confirmed that the combination of anthracycline chemotherapy and attenuated MADD resulted in more than additive effects on cell death. As a result, the dose of anthracycline chemotherapeutic agents can be reduced to levels previously thought to be non-therapeutic, thereby providing cancer therapies that exhibit unexpected safety limits and reduced undesirable side effects.

The invention is not limited to the scope of the specific embodiments described herein. In fact, in addition to those described herein, those skilled in the art can clearly understand the various modifications of the present invention from the foregoing description. Such modifications are intended to fall within the scope of the attached patent application.

All patents, applications, publications, test methods, literature and other materials cited herein are incorporated by reference.

Figure 1. Splice variants of human IG20 produced by alternative mRNA splicing. CDNA sequence homology among seven IG20 splice variants is shown. The solid bars represent areas of complete homology among all variants. The empty regions represent exons 13L, 16, 21, 26, and 34, which, when spliced in different combinations, resulted in seven splice variants as shown on the left. In KIAA0358 and IG20-SV4, the splicing of exon 34 leads to an early stop codon in exon 35. It also shows the different 5 'untranslated regions (UTR) of different splice variants.

Claims (35)

A combination of antitumor agents useful for the treatment of cancer, comprising an effective amount of one or more nucleic acid molecules capable of down- regulating the performance of at least one splice variant of the IG20 gene, not all of which are splicing variants of the IG20 gene The body is down regulated; and one or more anthracycline chemotherapeutics. According to the combination of item 1 of the patent application scope, wherein at least one splice variant system of the IG20 gene is selected from MADD splice variants, SNPs, allelic variations, polymorphisms, and gene mutations thereof. According to the combination of item 2 of the patent application scope, wherein at least one splice variant of the IG20 gene is a MADD splice variant exhibiting exon 13L. According to the combination of claim 2 of the patent application scope, wherein one or more nucleic acid molecules capable of down- regulating the performance of at least one splice variant of the IG20 gene are selected from siRNA, shRNA and antisense oligonucleotide. According to the combination of item 4 of the patent application scope, siRNA, shRNA and antisense oligonucleotides include exon 13L with MADD splice variant, SNP, its dual gene variant, its polymorphism and its gene mutation Nucleic acid sequence complementary to the nucleic acid sequence and / or its mRNA transcript. The combination according to item 4 of the patent application scope, wherein the nucleic acid molecule capable of down- regulating the expression of at least one splice variant of the IG20 gene is contained in siRNA or shRNA. According to the combination of item 6 of the patent application scope, wherein siRNA and shRNA are encoded by a nucleic acid molecule including the following structure: X _sense -hairpin loop-X _antisense , wherein X includes or consists essentially of the nucleic acid sequence CGCGCAGATATCTATG SEQ ID NO: 1). The combination according to item 6 of the patent application scope, wherein the siRNA or shRNA comprises a nucleic acid having the sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2). According to the combination of claim 6, the siRNA or shRNA contains a nucleic acid having the sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2), and is a homologous nucleic acid (cognate nucleic acid) having the sequence GAUUGUCAUAGAUUCGC CG (SEQ ID NO: 10) acid) is in the form of duplex. According to the combination of item 7 of the patent application scope, the shRNA and siRNA are encoded by a nucleic acid having the sequence CGAATCTATGACAATCTTCAAGAGA GATTGTCATAGATTCGCCG (SEQ ID NO: 3), wherein the hairpin loop region is from positions 20 to 28 of the sequence. The combination according to item 4 of the patent application scope, which includes siRNA, shRNA and antisense oligonucleosides of nucleic acids complementary to the nucleic acid sequence of exon 13L of the MADD splice variant of the IG20 gene and / or its mRNA transcript The acid system comprises a nucleic acid having a sequence selected from GAUUGUCAUAGAUUCGCCGTT (SEQ ID NO: 4) and GAUUGUCAUAGAUUCGCCG (SEQ ID NO: 10). The combination according to item 4 of the patent application scope, wherein the one or more nucleic acid molecules capable of down- regulating the performance of at least one splice variant of the IG20 gene are included in the drug delivery system. The combination according to item 12 of the patent application scope, wherein the drug delivery system is a targeted liposome formulation or a lentivirus vector. The combination according to item 1 of the patent application scope, wherein the one or more anthracycline chemotherapeutics are selected from daunorubicin, doxorubicin, epirubicin, and ada Idarubicin and valrubicin. The combination according to item 1 of the patent application scope, wherein the one or more anthracycline chemotherapeutic agents are in the form of pharmaceutically acceptable salts. The combination according to item 1 of the patent application scope, wherein the cancer is selected from leukemia, lymphoma, breast cancer, gastric cancer, uterine cancer, ovarian cancer, bladder cancer, lung cancer and other types of solid tumor cancer, And Kaposi's sarcoma. Use of a combination of an anti-tumor agent and one or more anthracycline chemotherapeutic agents for the preparation of a medicament for the treatment of an individual in need of cancer selected from the group consisting of leukemia, lymphoma, breast cancer, gastric cancer, uterine cancer, and pancreas Dental cancer, ovarian cancer, cervical cancer, prostate cancer, melanoma, esophageal cancer, bladder cancer, liver cancer, thyroid and lung cancer and other types of solid solid tumor cancer, and Kaposi's sarcoma, in which the anti-tumor agent It includes one or more nucleic acid molecules capable of down- regulating the performance of at least one splice variant of the IG20 gene, and not all splice variants of the IG20 gene are down-regulated. According to the use of claim 17 in the patent application scope, wherein the cancer exhibits the performance of at least one splice variant of the IG20 gene. According to the use of item 17 of the patent application scope, the cancer line exhibits the MADD splice variant of the IG20 gene, SNP, its dual gene variant, its polymorphism, and its gene mutation. According to the use of item 19 in the patent application range, the MADD splice variant exhibits exon 13L of the IG20 gene. The use according to item 17 of the patent application scope, wherein the one or more nucleic acid molecules capable of down- regulating the performance of at least one splice variant of the IG20 gene are selected from siRNA, shRNA, and antisense oligonucleotides. According to the use of item 21 of the patent application scope, siRNA, shRNA and antisense oligonucleotides include MADD splice variants with the IG20 gene, SNPs, their dual gene variants, their polymorphisms and their gene mutations. The nucleic acid sequence of the exon 13L and / or its mRNA transcript is complementary. The use according to item 22 of the patent application scope, wherein the nucleic acid molecule capable of down- regulating the expression of at least one splice variant of the IG20 gene is contained in siRNA or shRNA. According to the use of item 23 of the patent application scope, siRNA and shRNA are encoded by a nucleic acid molecule including the following structure: X _sense -hairpin loop-X _antisense , wherein X includes or consists essentially of the nucleic acid sequence CGGCGAATCTATG ACAATC ( SEQ ID NO: 1). According to the use in item 23 of the patent application range, the siRNA and shRNA include a nucleic acid having the sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2). The use according to item 25 of the patent application scope, wherein the siRNA and shRNA comprise a nucleic acid having the sequence CGGCGAAUCUAUGACAAUC (SEQ ID NO: 2) and are double-stranded with a homologous nucleic acid having the sequence GAUUGUCAUAGAUUCGC CG (SEQ ID NO: 10) form. According to the use of item 22 of the patent application scope, wherein the shRNA is encoded by a nucleic acid having the sequence CGAATCTATGACAATCTTCAAGAGAGATTGTCA TAGATTCGCCG (SEQ ID NO: 3), wherein the hairpin loop region is from positions 20 to 28 of the sequence. Use according to item 22 of the patent application scope, which includes siRNA, shRNA and antisense oligonucleosides of nucleic acids complementary to the nucleic acid sequence of exon 13L of the MADD splice variant of the IG20 gene and / or its mRNA transcript The acid system comprises a nucleic acid having a sequence selected from GAUUGUCAUAGAUUCGCCGTT (SEQ ID NO: 4) and GAUUGUCAUAGAUUCGCCG (SEQ ID NO: 10). The use according to item 22 of the patent application scope, wherein one or more siRNAs, shRNAs and antisense oligonucleotides are administered in the form of liposome formulations or by lentivirus transfection. According to the use of item 22 in the patent application scope, one or more of siRNA, shRNA and antisense oligonucleotides are administered as an adjuvant. The use according to item 17 of the patent application scope, wherein the one or more anthracycline chemotherapeutic agents are selected from the group consisting of daunorubicin, doxorubicin, pangamycin, idamycin and pentorubicin. The use according to item 17 of the patent application scope, wherein the one or more anthracycline chemotherapeutic agents are administered in the form of a pharmaceutical composition further comprising one or more pharmaceutically acceptable diluents, excipients or carriers . The use according to item 22 of the patent application scope, in which one or more siRNAs, shRNAs and antisense oligonucleotides are administered before one or more anthracycline chemotherapeutics or in combination with one or more anthracycline chemotherapeutics Give at the same time. The use according to item 22 of the patent application scope, wherein one or more siRNAs, shRNAs and antisense oligonucleotides are pharmaceutical compositions further comprising one or more pharmaceutically acceptable diluents, excipients or carriers In the form of giving. Use according to item 22 of the patent application scope, in which one or more siRNA, shRNA and antisense oligonucleotides and one or more anthracycline chemotherapeutic agents are formulated in a dosage pack and according to the selected treatment Projects are given.