JP2019508379A - Therapeutic method and therapeutic composition for malignant tumor - Google Patents

Abstract

The present invention provides methods and compositions for preventing, treating or ameliorating one or more symptoms of malignancy associated with KRAS mutations. Identifying a mammalian tumor cell, wherein the tumor cell has at least one of (i) mutation of KRAS gene and (ii) abnormal expression level of KRAS protein; expression of GST-π in mammal One or more RNs active to reduce
Administering a therapeutically effective amount of the composition comprising the Ai molecule.
[Selected figure] Figure 1

Description

The present invention relates to the field of biopharmaceuticals and therapeutics consisting of nucleic acid based molecules. More particularly, the present invention relates to KR wherein the cancer cells contain KRAS mutations or exhibit abnormal KRAS expression levels
The present invention relates to a tumor therapy for preventing, treating or ameliorating AS-related cancer. The invention further relates to pharmaceutical compositions containing one or more RNAi molecules that inhibit the expression of GST-π.

  This application contains a sequence listing submitted electronically as an ASCII file named ND7023946WO_SL.txt, which is incorporated herein by reference in its entirety.

Glutathione S-transferase (IUBMB EC 2.5. 1. 18) is a family of enzymes that play an important role in detoxification by catalyzing the binding of many hydrophobic compounds to electrophilic compounds with reduced glutathione. Based on their biochemical, immunological and structural properties, soluble GSTs are classified into four major classes: alpha, mu, pi and theta.
Some of these types prevent carcinogenesis by detoxifying adjacent or final carcinogens, particularly electrophiles including Michael Reactive Acceptors, Diphenols, Quinones, Isothiocyanates, Peroxides, vicinal Dimercaptans, etc. It is suggested to act as However, in neoplastic cells, specific forms are known to be expressed, and are known to be involved in resistance to anticancer agents.

The GST-π gene (GSTP1) is a polymorphic gene encoding a functionally distinct GSTP1 mutein that is thought to function in xenobiotic metabolism, and may play a role in cancer susceptibility. The GST-π gene is abundantly expressed in tumor cells. For example,
Aliya S. et al. MoI Cell Biochem., November 2003; 253 (1-2): 319-327. Glutathione
S-transferase-π is an enzyme encoded by the GSTP1 gene in humans. For example, Bora PS, et al. (Oct. 1991) J. Biol. Chem., 266 (25): 16774-16777. GS
T-π isozymes have been shown to catalyze the conjugation of GSH to several alkylated anticancer agents, suggesting that overexpression of GST-π results in tumor cell resistance.

Elevated serum GST-π levels were observed in patients with various gastrointestinal malignancies including gastric cancer, esophageal cancer, colon cancer, pancreatic cancer, hepatocellular carcinoma and biliary cancer. Patients with benign gastrointestinal disease had normal GST-π, but some patients with chronic hepatitis and cirrhosis were slightly elevated. More than 80% of stage III or IV gastric cancer patients and approximately 50% of stage I and II patients showed elevated serum GST-π. For example, Niitsu Y, et al. Cancer, January 15, 1989;
(2): 317-23. Elevated levels of GST-π in plasma were noted in patients with oral cancer, while those with benign oral disease had normal levels of GST-π. GST-π evaluates response to chemotherapy,
It has been found to be a useful marker for monitoring postoperative tumor resectability or tumor burden, and for predicting tumor recurrence in oral cancer patients. For example, Hirata S. et al. Cancer, 199.
2 Nov 15: 70 (10): 2381-7.

Many cancers that are classified histologically into adenocarcinoma or squamous cell carcinoma by immunohistochemical study are GS
It has been clarified that T-π is expressed. Plasma or serum GST-π levels are increased in 30-50% of gastrointestinal cancer patients. This type is also suggested to be involved in resistance to anticancer agents such as cisplatin and daunorubicin, whose expression in cancerous tissue can be a prognostic value in cancer patients.

The protein product of the normal human KRAS gene (V-Ki-ras2 Kirsten rat sarcoma virus oncogene homolog) plays a signaling function in normal tissues, and mutations in the KRAS gene
It is a presumed step in the occurrence of many cancers. For example, Kranenburg O, November 2005, Biochim.
Biophys. Acta, 1756 (2): 81-82. KRAS proteins are GTPases and are involved in several signal transduction pathways. KRAS is a protein and c- that are necessary for growth factor growth.
It acts as a molecular on / off switch that activates the signals of Raf as well as other receptors such as PI 3-kinase.

Mutations in KRAS may be associated with malignancies such as lung adenocarcinoma, mucinous adenoma, pancreatic ductal adenocarcinoma and colon cancer. In human colon cancer, KRAS mutations cause GST-mediated activation of AP-1.
It is thought to induce overexpression of π. For example, Miyanishi et al., Gastroenterology, 2001;
121 (4): 865-74.

The mutant KRAS is a colon cancer (Burmer GC, Loeb LA, 1989, Proc. Natl. Acad. Sci. USA,
86 (7): 2403-2407), pancreatic cancer (Almoguera C et al., 1988, Cell, 53 (4): 549-554) and lung cancer (Tam IY et al., 2006, Clin. Cancer Res., 12 (5): 1647-1653). KRAS accounts for 90% of RAS mutations in lung adenocarcinoma (Forbes S et al., Cosmic 2005. Br J Can
cer, 2006; 94: 318-322).

The KRAS gene may also be amplified in colon cancer. KRAS amplification is mutually exclusive with KRAS mutations. For example, Valtorta E et al., 2013, Int. J. Cancer, 133 (5): 1259-65.
reference. Amplification of wild type KRAS has also been observed in ovarian cancer, gastric cancer, uterine cancer and lung cancer. See, for example, Chen Y et al., 2014, PLoS ONE, 9 (5): e98293.

The expression of GST-π is increased in various cancer cells which may be associated with resistance to some anticancer agents. For example, Ban et al., Cancer Res., 1996, 56 (15): 3577-82; Nakajima et al., J Pharmac.
ol Exp Ther., 2003, 306 (3): 861-9.

Agents that inhibit GST-π are disclosed as those that induce apoptosis in cells. However, such compositions and techniques also cause autophagy, requiring a combination of actions by various agents. See, for example, US2014 / 0315975A1. Furthermore, GST-π suppression has not been found to reduce or suppress tumors. For example, GST-π
In cancers that overexpress, the weight of the tumor was not affected by the suppression of GST-π, but other effects were observed. For example, Hokaiwado et al., Carcinogenesis, 2008, 29 (6): 1134-1138.
Please refer to.

There is an urgent need for methods and compositions for developing treatments for patients with malignancies associated with KRAS.

There is a need for methods and compositions for preventing or treating malignancies. There is a continuing need for RNAi molecules, and other structures and compositions to prevent, treat, reduce or reduce malignancies.

The present invention relates to the surprising discovery that the size of malignant tumors can be reduced in vivo by treatment with GST-π siRNA inhibitors.

In some embodiments, malignancies containing KRAS mutations or exhibiting abnormal KRAS expression levels can be reduced by treatment with siRNA agents that modulate expression of GST-π.

The present invention relates to methods and compositions for nucleic acid based therapeutic compounds against malignant tumors. In some embodiments, the present invention provides RNAi molecules, structures and compositions that can silence expression of GST-π. The structures and compositions of the present disclosure can be used to prevent, treat or reduce the size of malignant tumors.

The present invention provides compositions and methods that can be used to treat neoplasia in a subject. In particular, the present invention is for treating KRAS related neoplasms without unwanted autophagy
Therapeutic compositions capable of reducing the expression of GST-π nucleic acid molecules or polypeptides are provided.

In some embodiments, the invention includes inhibitory nucleic acid molecules that correspond to or are complementary to at least a fragment of a GST-π nucleic acid molecule and reduce GST-π expression in a cell.

In a further aspect, the invention features a double stranded inhibitory nucleic acid molecule that corresponds to or is complementary to at least a fragment of a GST-π nucleic acid molecule and reduces GST-π expression in a cell. In certain embodiments, the double stranded nucleic acid molecule is a siRNA or a shRNA.

In some embodiments, the invention includes a vector encoding the inhibitory nucleic acid molecule described above. The vector can be a retroviral vector, an adenoviral vector, an adeno-associated viral vector or a lentiviral vector. In further embodiments,
The vector can include a promoter suitable for expression in mammalian cells. A further embodiment is a cancer cell containing a KRAS mutation or exhibiting abnormal KRAS expression levels, which can include a vector or an inhibitory nucleic acid molecule of any one of the above aspects. . In further embodiments, the cells may be neoplastic cells in vivo.

In some embodiments, the invention includes methods of reducing GST-π expression in a malignant tumor cell comprising a KRAS mutation or exhibiting aberrant KRAS expression. The method comprises the step of contacting the cell with an effective amount of an inhibitory nucleic acid molecule corresponding to or complementary to at least a portion of a GST-π nucleic acid molecule, said inhibitory nucleic acid molecule expressing GST-π polypeptide Can inhibit
This reduces GST-π expression in cells.

In certain embodiments, the inhibitory nucleic acid molecule can be an antisense nucleic acid molecule that is active to inhibit gene expression, a small interfering RNA (siRNA) or a double stranded RNA (dsRNA).

In a further embodiment, the methods of the invention can reduce GST-π transcription or translation in malignancy.

In a specific embodiment, the invention is a method of reducing GST-π expression in a malignant tumor cell, which can be human cells, tumor cells, in vivo cells or in vitro cells.

Embodiments of the present invention can also provide methods for treating a subject having a neoplasm that contains a KRAS mutation or that exhibits abnormal KRAS expression levels. The method comprises the step of administering to the subject an effective amount of an inhibitory nucleic acid molecule corresponding to or complementary to the GST-π nucleic acid molecule, said inhibitory nucleic acid molecule inhibiting expression of the GST-π polypeptide This will treat neoplasms. In some embodiments, the methods of the invention can reduce the size of neoplasms as compared to the size before or without treatment.

In various embodiments, inhibitory nucleic acid molecules can be delivered into liposomes, polymers, microspheres, nanoparticles, gene therapy vectors, or naked DNA vectors.

In a further aspect, the invention features a method of treating a subject, such as, for example, a human patient with a neoplasia cancer cell containing a KRAS mutation or having a neoplasia that exhibits abnormal KRAS expression levels. In certain embodiments, the method comprises administering an effective amount of an inhibitory nucleic acid molecule to a subject, wherein the inhibitory nucleic acid molecule inhibits expression of a GST-π polypeptide, It is siRNA or dsRNA.

  In certain embodiments, the neoplastic cells overexpress GST-π.

In certain embodiments, the neoplasm can be a malignant tumor, or lung cancer, or pancreatic cancer.

Embodiments of the invention include the following:
A pharmaceutical composition for treatment or treatment of a tumor associated with mutation of KRAS gene or overexpression of wild type KRAS gene, the composition comprising RNAi molecule and a pharmaceutically acceptable excipient, The RNAi molecule contains a nucleotide sequence corresponding to the target sequence in GST-π.

In some embodiments, the pharmaceutical composition comprises an RNAi molecule having a duplex region comprising a nucleotide sequence corresponding to a target sequence of GST-π mRNA.

In certain embodiments, the RNAi molecule is an siRNA or s that is active to suppress gene expression
hRNA.

Pharmaceutical compositions can include one or more pharmaceutically acceptable excipients, such as lipid compounds. The lipid compound can comprise lipid nanoparticles. In certain embodiments, lipid nanoparticles can encapsulate RNAi molecules.

The invention further provides a method for preventing, treating or ameliorating one or more symptoms of malignancy associated with a KRAS mutation in a mammal in need thereof,
Identifying a mammalian tumor cell comprising (i) at least one of mutation of KRAS gene and (ii) abnormal expression level of KRAS protein; and reducing expression of GST-π in said mammal Administering a therapeutically effective amount of a composition comprising one or more active RNAi molecules.

In such a method, a mammal can be human and GST-π can be human GST-π. The RNAi molecule can be siRNA, shRNA or microRNA.

In certain embodiments, the RNAi molecule can have a duplex region, wherein the duplex region is GST-π
A nucleotide sequence corresponding to a target sequence of mRNA can be included. RNAi molecules can reduce the expression of GST-π in mammals.

In some embodiments, the administration can reduce expression of GST-π in the mammal by at least 5% for at least 5 days. In certain embodiments, the administration is to reduce the volume of malignancy in a mammal by at least 5%, or at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%. it can. In further embodiments, the method can reduce one or more symptoms of the malignancy, or can delay or terminate the progression of the malignancy.

In certain embodiments, the administration can reduce the growth of malignant cells in a subject. The administration can reduce proliferation of at least 2%, or at least 5%, or at least 10%, or at least 15%, or at least 20% of the malignant tumor cells of the subject.

In general, tumor cells can increase the level of expression of wild-type KRAS protein as compared to levels in normal cells. In some embodiments, the tumor cells overexpress wild type GST-π RNA or protein.

In particular, the tumor cells can have a mutation in the KRAS protein at one or more of residues 12, 13 and 61.

The present invention contemplates that the tumor cells can have a mutation in the KRAS protein, making the tumor a cancer selected from lung cancer, colon cancer and pancreatic cancer.

In some embodiments, the tumor cell can have a mutation in the KRAS protein, and the tumor can be a sarcoma selected from the group consisting of lung adenocarcinoma, mucinous adenoma, pancreatic ductal adenocarcinoma and colon cancer. In certain embodiments, the malignancy may be a sarcoma selected from the group of lung adenocarcinoma, mucinous adenoma, pancreatic ductal adenocarcinoma, colon cancer, breast cancer and fibrosarcoma. In addition, malignancy is lung, colon,
It can be located in an anatomical region selected from the group of pancreas, gallbladder, liver, breast, and any combination thereof.

Aspects of the invention can provide a method of administering once to twelve times a day. Administration is
It can take place over a period of 1, 2, 3, 4, 5, 6 or 7 days. In certain embodiments,
Administration can be over a period of 1, 2, 3, 4, 5, 6, 8, 10 or 12 weeks.

The dose for administration is at least once a day 0. 1 ng of the RNAi molecule for a period of up to 12 weeks.
It can be made into 01-2 mg / kg. In some embodiments, administration can provide an average AUC (0-final) of 1-1000 μg / min / mL and an average C _max of 0.1-50 μg / mL for GST-π RNAi molecules.

Administration can be intravenous injection, intradermal injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, oral, topical, infusion or inhalation.

These and other aspects will be apparent from the following description of the embodiments in conjunction with the following drawings, but variations and modifications thereto will deviate from the spirit and scope of the novel concept of the present disclosure. Can be affected without.

FIG. 1 shows that siRNAs of the invention targeting GST-π significantly reduced orthotopic lung cancer tumors in vivo. GST-π siRNA was administered as a liposome formulation at a dose of 2 mg / kg to athymic nude mice presenting A549 orthotopic lung cancer tumors. Final primary tumor weights were measured at necropsy of treatment and vehicle control groups. GST-π siRNA showed significant efficacy for the inhibition of lung cancer tumors in this 6 week study. As shown in FIG. 1, after 43 days, GST-π siRNA showed significant advantageous tumor inhibition, and the final primary tumor mean weight was significantly reduced 2.8 fold compared to the control. FIG. 2 shows in vivo tumor inhibition potency for GST-π siRNA. A cancer xenograft model using A549 cells was used at a relatively low dose of siRNA at 0.75 mg / kg. GST-π siRNA showed favorable tumor inhibition within a few days. After 36 days, GST-πsiRNA showed significant advantageous tumor inhibition, and the final tumor mean volume was significantly reduced by about 2 times compared to the control. FIG. 3 shows the in vivo tumor inhibitory potency of GST-π siRNA at the endpoint of FIG. GST-π siRNA showed advantageous tumor inhibition, such as a two-fold or more reduction in average tumor weight. FIG. 4 shows that the GST-π siRNA of the invention significantly increased cancer cell death by apoptosis in vitro. GST-π siRNA triggered upregulation of PUMA, a biomarker of apoptosis associated with decreased cell viability. As shown in FIG. 4, PUMA expression was greatly increased 2 to 6 days after GST-π siRNA transfection. FIG. 5 shows that the GST-π siRNAs of the invention exhibit in vivo knockdown effects on A549 xenograft tumors. Dose dependent knockdown of GST-π mRNA was observed in athymic nude (nu / nu) female mice (Charles River) using siRNA targeting GST-π. As shown in FIG. 5, at a dose of 4 mg / kg, a significant decrease of approximately 40% in GST-π mRNA was detected at 24 hours after injection. FIG. 6 shows that the GST-π siRNAs of the invention inhibited pancreatic cancer xenograft tumors in vivo. GST-π siRNA resulted in gene silencing efficacy in vivo when administered as a liposomal formulation to pancreatic cancer xenograft tumors of 6-8 week old athymic nude female mice. As shown in FIG. 6, dose responses were obtained at doses ranging from 0.375 mg / kg to 3 mg / kg of siRNA targeting GST-π. GST-π siRNA showed favorable tumor inhibition within a few days after administration, and tumor volume was reduced approximately 2 fold at the endpoint. FIG. 7 shows that serum stability was increased in the GST-π siRNA of the present invention. As shown in FIG. 7, the half-life (t _1/2 ) in serum of the sense strand (FIG. 7, upper part) and the antisense strand (FIG. 7, lower) of GST-π siRNA was about 100 minutes. FIG. 8 shows that the stability of the GST-π siRNA of the present invention as a preparation has been improved in plasma. FIG. 8 shows the incubation of liposome formulations of GST-π siRNA in 50% human serum in PBS and detection of residual siRNA at various time points. As shown in FIG. 8, the plasma half-life (t _1/2 ) of the formulation of GST-π siRNA was significantly longer than 100 hours. FIG. 9 shows in vitro knock down of GST-π siRNA guide strand. As shown in FIG. 9, guide strand knockdown of GST-π siRNA was nearly exponential as compared to controls with scrambled sequences showing no effect. FIG. 10 shows in vitro knock down for passenger strand in GST-π siRNA in FIG. As shown in FIG. 10, off-target knockdown of the passenger strand is slowly reduced for GST-π siRNA, indicating essentially no effect. FIG. 11 shows in vitro knockdown for several high activity GST-π siRNA guide strands. As shown in FIG. 11, the guide strand knockdown activity of GST-π siRNA was nearly exponential. FIG. 12 shows in vitro knock down for the passenger strand of GST-π siRNA in FIG. As shown in FIG. 12, the off-target knockdown activity of the passenger strand of GST-π siRNA was significantly reduced to less than about 500 pM. FIG. 13 shows in vitro knock down for the guide strand of highly active GST-π siRNA. As shown in FIG. 13, the guide strand knockdown activity of GST-π siRNA was approximately exponential. FIG. 14 shows the in vitro knock down for the passenger strand of GST-π siRNA in FIG. As shown in FIG. 14, the off-target knockdown activity of the passenger strand of GST-π siRNA was significantly reduced.

The present invention provides methods of utilizing a therapeutic composition for reducing the expression of GST-π nucleic acid molecules or polypeptides for the treatment of neoplasia in a subject. Here, the neoplasm is associated with a cell that contains a KRAS mutation or exhibits abnormal KRAS expression levels.

Therapeutic compositions of the invention may comprise inhibitory nucleic acid molecules such as siRNA, shRNA and antisense RNA.
Can be included.

GST-π is encoded by the GSTP1 gene and represents an enzyme that catalyzes glutathione conjugation. GST-π is present in various animals including human, and its sequence information is NCBI database accession number (eg, human: NP_000843 (NM_000852), rat: NP_036709 (NM_012577)
, Mouse: NP — 038569 (NM — 013541), etc.).

By “GST-π polypeptide” is meant a protein or protein variant or fragment thereof that is substantially identical to at least a portion of the protein encoded by the GST-π coding sequence. By "GST-π nucleic acid molecule" is meant a polynucleotide encoding a GST-π polypeptide or variant or fragment thereof.

The occurrence of mutations in gene sequences or amino acid sequences between living individuals may not impair the physiological function of the protein. GST-π and GSTP1 genes in the present invention are not limited to proteins or nucleic acids having the same sequence as the GST-π sequence described herein, and sequences different from the above sequence by one or more amino acids, for example , 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 different amino acids or bases may be included, which have the same function as known GST-π.

The sequences of human glutathione S-transferase gene (GST-π), complete CDS, GenBank accession number: U12472 are shown in Table 1.

As used herein, a KRAS-related malignancy or KRAS-related cancer is (a) a cancer cell or tumor cell that contains a somatic KRAS mutation, or (b) a cancer cell or tumor cell that has an aberrant expression level of KRAS. Defined as a cancer cell or tumor cell comprising amplification of DNA encoding KRAS, overexpression of KRAS gene or underexpression of KRAS gene as compared to levels found in, but not limited to, normal non-cancer cells Be done.

Table 2 shows the amino acid sequence of the KRAS protein and identifies mutations associated with cancer.

QIAGEN THERASCREEN KRAS TEST is a genetic test designed to detect the presence of seven mutations of the KRAS gene in colon cancer cells.

Therapeutic Compositions After a subject has been diagnosed with a KRAS mutation or neoplasm associated with KRAS amplification, eg, lung cancer or pancreatic cancer, a therapeutic regimen involving GST-π suppression is selected.

In one embodiment, the inhibitory nucleic acid molecule of the invention is about 1 to 100 mg / kg, for example 1, 5, 10, 20.
, 25, 50, 75 or 100 mg / kg administered systemically.

In a further embodiment, the dosage can be in the range of about 25-500 mg / m < ² > / day.

Here, examples of the drug that suppresses GST-π include a drug that suppresses the production and / or activity of GST-π, a drug that promotes the decomposition and / or inactivation of GST-π, and the like. As agents that inhibit GST-π production, RNAi molecules, ribozymes, antisense nucleic acids, DNA encoding GST-π
DNA / RNA chimeric polynucleotides or vectors expressing them.

One skilled in the art of GST-π and RNAi molecules will understand that the reported sequence may change over time and, accordingly, the necessary changes may be incorporated into the nucleic acid molecules herein.

Embodiments of the present invention can provide compositions and methods for gene silencing of GST-π expression using small nucleic acid molecules. Nucleic acid molecules include RNA interference (RNAi molecules), short interfering RNA (siRNA), double stranded RNA (dsRNA), microRNA (miRNA) and short hairpin RNA
Included are molecules that are active in (shRNA) molecules. Such molecules can mediate RNA interference on GST-π gene expression.

The compositions and methods disclosed herein can also be used in the treatment of various types of malignancies in a subject.

The nucleic acid molecules and methods of the invention are used to downregulate the expression of a gene encoding GST-π.

The compositions and methods of the invention may comprise one or more nucleic acid molecules, alone or in combination, a gene encoding a GST-π protein and / or a GST-π protein, eg a disease such as a malignant tumor, And regulation or control of expression of a protein involved in maintenance and / or onset of a condition or disease associated with GST-π and / or a gene encoding GST-π.

The compositions and methods of the invention are described with reference to the exemplary sequence of GST-π. Those skilled in the art will
Various aspects and embodiments of the present invention include polymorphisms involving related GST-.pi. Genes, sequences, or homolog genes and transcript variants, and polymorphisms comprising single nucleotide polymorphisms (SNPs) associated with GST-.pi. Genes. You will understand that it is targeted.

In some embodiments, the compositions and methods of the invention comprise a GST-pi gene, such as human GST-
A double stranded short interfering nucleic acid (siRNA) molecule can be provided that downregulates pi expression.

The RNAi molecules of the invention can target GST-π and, for example, using complementary sequences, or additional target sequences by incorporating non-standard base pairs, such as mismatches and / or wobble base pairs. Can be targeted to any homologous sequence that can provide

If a mismatch is identified, non-standard base pairs, eg, mismatches and / or wobble bases, can be used to generate nucleic acid molecules targeted to more than one gene sequence.

For example, different GSs with sequence homology using non-standard base pairs such as UU and CC base pairs
Nucleic acid molecules can be generated that can target sequences for T-π targets. Thus, the RNAi molecule is
Nucleotide sequences that are conserved among homologous genes can be targeted, and a single RNAi molecule can be used to inhibit the expression of more than one gene.

In some embodiments, the compositions and methods of the present invention comprise RNAi active against GST-π mRNA
Containing molecules, RNAi molecules include sequences complementary to any mRNA encoding GST-π sequence.

In some embodiments, an RNAi molecule of the present disclosure can have activity against GST-π RNA, the RNAi molecule being RNA having a sequence encoding a mutant GST-π, eg, associated with a malignant tumor Contains a sequence that is complementary to the RNA of the mutated GST-pi gene as known in the art.

In a further embodiment, the RNAi molecule of the invention can comprise a nucleotide sequence capable of mediating silencing of GST-π gene expression.

  Examples of RNAi molecules of the invention that target GST-π mRNA are shown in Table 3.

Key points of Table 3: Uppercase letters A, G, C and U indicate ribo A, ribo G, ribo C and ribo U, respectively.
The lower case letters a, u, g, c, t mean 2′-deoxy-A, 2′-deoxy-U, 2′-deoxy-G, 2′-deoxy-C and deoxythymidine, respectively.

  Examples of RNAi molecules of the invention that target GST-π mRNA are shown in Table 4.

Key points of Table 4: Uppercase letters A, G, C and U mean ribo A, ribo G, ribo C and ribo U, respectively. Lowercase letters a, u, g, c, t are 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2 'respectively
-Deoxy-C and deoxythymidine (dT = T = t). Underline means a 2'-OMe substitution, eg U. Lowercase f means 2′-deoxy-2′-fluoro substitution, eg fU is 2′-deoxy-2′-fluoro-U. N is A, C, G, U, U , a, c, g, u, t or modified nucleotides, inverted nucleotides or chemically modified nucleotides.

  Examples of RNAi molecules of the invention that target GST-π mRNA are shown in Table 5.

Key points in Table 5: Uppercase letters A, G, C and U mean ribo A, ribo G, ribo C and ribo U respectively. Lowercase letters a, u, g, c, t are 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2 'respectively
-Deoxy-C and deoxythymidine (dT = T = t). Underline means a 2'-OMe substitution, eg U. Lowercase f means 2′-deoxy-2′-fluoro substitution, eg fU is 2′-deoxy-2′-fluoro-U. N is A, C, G, U, U , a, c, g, u, t or modified nucleotides, inverted nucleotides or chemically modified nucleotides.

  Examples of RNAi molecules of the invention that target GST-π mRNA are shown in Table 6.

Key points of Table 6: Uppercase letters A, G, C and U mean ribo A, ribo G, ribo C and ribo U respectively. Lowercase letters a, u, g, c, t are 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2 'respectively
-Deoxy-C and deoxythymidine (dT = T = t). Underline means a 2'-OMe substitution, eg U. Lowercase f means 2′-deoxy-2′-fluoro substitution, eg fU is 2′-deoxy-2′-fluoro-U. N is A, C, G, U, U , a, c, g, u, t or modified nucleotides, inverted nucleotides or chemically modified nucleotides.

  Examples of RNAi molecules of the invention that target GST-π mRNA are shown in Table 7.

Points of Table 7: Uppercase letters A, G, C and U mean ribo A, ribo G, ribo C and ribo U respectively. Lowercase letters a, u, g, c, t are 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2 'respectively
-Deoxy-C and deoxythymidine (dT = T = t). Underline means a 2'-OMe substitution, eg U. Lowercase f means 2′-deoxy-2′-fluoro substitution, eg fU is 2′-deoxy-2′-fluoro-U. N is A, C, G, U, U , a, c, g, u, t or modified nucleotides, inverted nucleotides or chemically modified nucleotides.

  Examples of RNAi molecules of the invention that target GST-π mRNA are shown in Table 8.

The key points of Table 8: capital letters A, G, C and U mean ribo A, ribo G, ribo C and ribo U respectively. Lowercase letters a, u, g, c, t are 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2 'respectively
-Deoxy-C and deoxythymidine (dT = T = t). Underline means a 2'-OMe substitution, eg U. Lowercase f means 2′-deoxy-2′-fluoro substitution, eg fU is 2′-deoxy-2′-fluoro-U. N is A, C, G, U, U , a, c, g, u, t or modified nucleotides, inverted nucleotides or chemically modified nucleotides.

As used herein, RNAi molecules can be siRNA (small interfering RNA), miRNA (microRNA), shRNA (short hairpin RNA), ddRNA (DNA targeting RNA), piRNA (Piwi interacting RNA) Or including but not limited to double RNA such as rasiRNA (repeat related siRNA) and its modified forms. These RNAi molecules are commercially available or can be designed and prepared based on known sequence information and the like. Antisense nucleic acids include RNA, DNA, PNA, or complexes thereof. As used herein, a DNA / RNA chimeric polynucleotide is
It includes, but is not limited to, double-stranded polynucleotides consisting of DNA and RNA that inhibit the expression of target genes.

In embodiments, the agents of the invention comprise siRNA as a therapeutic agent. The siRNA molecules can have a length of about 10 to 50 or more nucleotides. The siRNA molecules can have a length of about 15-45 nucleotides. The siRNA molecules can have a length of about 19-40 nucleotides. The siRNA molecules can have a length of 19-23 nucleotides. The siRNA molecules of the invention can mediate RNAi to a target mRNA. Ambion, Inc. (Austin
, TX) and commercially available design tools and kits such as the Whitehead Institute of Biomedical Research at MIT (Cambridge, Mass.) Allow the design and production of siRNAs.

Methods for Modulating GST-π and Treating Malignant Tumors Embodiments of the invention are RNAi molecules that can be used to downregulate or inhibit expression of GST-π and / or GST-π proteins Can be provided.

In some embodiments, the RNAi molecules of the invention downregulate or inhibit expression of GST-π and / or GST-π proteins resulting from GST-π haplotype polymorphisms that may be associated with a disease or condition, such as malignancy Can be used to

Monitoring of GST-π protein or mRNA levels can be used to characterize gene silencing and to determine the efficacy of the compounds and compositions of the invention.

The RNAi molecules of the present disclosure may be used alone or in combination with other siRNAs to modulate the expression of one or more genes.
Can be used in combination with

The RNAi molecules of the present disclosure can be used alone or in combination, or in combination with other known drugs, for the prevention or treatment of diseases (including malignant tumors) associated with GST-π, or amelioration of symptoms or symptoms. It can be used.

The RNAi molecules of the invention can be used to modulate or inhibit expression of GST-π in a sequence specific manner.

The RNAi molecules of the present disclosure can comprise a guide strand in which the series of contiguous nucleotides is at least partially complementary to GST-π mRNA.

In certain embodiments, malignancies can be treated by RNA interference with the RNAi molecules of the invention.

Treatment of malignancies can be characterized in appropriate cell-based models, as well as ex vivo or in vivo animal models.

Treatment of malignancy is characterized by determining the level of GST-π mRNA or the level of GST-π protein in cells of the affected tissue.

Treatment of malignancies is characterized by non-invasive medical scanning of the affected organ or tissue.

Embodiments of the invention can include methods for preventing, treating, or ameliorating the symptoms of a GST-π related disease or condition in a subject in need thereof.

In some embodiments, a method for preventing, treating or ameliorating a symptom of malignancy in a subject comprises administering to the subject an RNAi molecule of the invention to express GST-π gene expression in the subject or Including modulating in an organism.

In some embodiments, the present invention contemplates a method of downregulating the expression of GST-π gene in a cell or organism by contacting the cell or organism with an RNAi molecule of the invention.

The GST-π inhibitory nucleic acid molecules may be nucleotide oligomers employed as single or double stranded nucleic acid molecules to reduce GST-π expression. In one approach, the GST
-π inhibitory nucleic acid molecules are double stranded RNAs used for RNA interference (RNAi) mediated GST-π gene expression knockdown. In one embodiment, double stranded RNA (dsRNA) molecules are produced which are 8 to 25 (e.g. 8, 10, 12, 15, 16, 17, 18, 19, 19) in the nucleotide oligomers of the invention.
20, 21, 22, 23, 24, 25) consecutive nucleotides can be included. The dsRNA may be a single RNA strand (a small hairpin (sh
) RNA).

In some embodiments, the dsRNA is about 21 or 22 base pairs, but may be shorter or longer, up to about 29 nucleotides. Double stranded RNA can be made using standard techniques, such as chemical synthesis or in vitro transcription. The kit is, for example, Ambion
Available from (Austin, Tex.) And Epicentre (Madison, Wis.).

Methods for expressing dsRNA in mammalian cells are described in Brummelkamp et al. Science
296: 550-553, 2002; Paddison et al. Genes & Devel. 16: 948-958, 2002; Paul et al. Natu
Re Biotechnol. 20: 505-508, 2002; Sui et al., Proc. Natl. Acad. Sci. USA 99: 5515-552.
0, 2002; Yu et al. Proc. Natl. Acad. Sci. USA 99: 6047-6052, 2002; Miyagishi et al., Natur.
e Biotechnol. 20: 497-500, 2002; and Lee et al., Nature Biotechnol. 20: 500-505 2002. Each of these is incorporated herein by reference.

Inhibitory nucleic acid molecules “corresponds to” the GST-π gene comprise fragments of at least double stranded genes, and each strand of the double stranded inhibitory nucleic acid molecule can bind to the complementary strand of the target GST-π gene. The inhibitory nucleic acid molecule does not have to correspond completely to the reference GST-π sequence.

In one embodiment, the siRNA comprises at least about 85%, 90%, 95%, 96%, 97% of the target nucleic acid.
%, 98% or even 99% sequence identity. For example, a 19 base pair duplex with a 1 to 2 base pair mismatch is considered useful in the methods of the invention. In other embodiments, the nucleotide sequence of the inhibitory nucleic acid molecule exhibits one, two, three, four, five or more mismatches.

Inhibitory nucleic acid molecules provided by the present invention are not limited to siRNA, and include any nucleic acid molecule sufficient to reduce the expression of GST-π nucleic acid molecules or polypeptides. Each of the DNA sequences provided herein can be used, for example, in the discovery and development of therapeutic antisense nucleic acid molecules for reducing the expression of GST-π. The invention further provides a catalytic RNA
Providing a molecule or a ribozyme. Such catalytic RNA molecules can be used to inhibit expression of GST-π nucleic acid molecules in vivo. By including the ribozyme sequence in the antisense RNA, RNA cleaving activity is conferred on the molecule, thereby enhancing the activity of the construct. The design and use of target RNA specific ribozymes is described by Haseloff et al., Nature 334: 585-591.
1988 and U.S. Patent Application Publication No. 2003/0003469 A1. Each of these is incorporated herein by reference.

In various embodiments of the invention, the catalytic nucleic acid molecule is formed into a hammerhead or hairpin motif. Examples of such hammerhead motifs can be found in Rossi et al., Aids Research
and Human Retroviruses, 8: 183, 1992. An example of a hairpin motif is H
ampel et al., Biochemistry, 28: 4929, 1989 and Hampel et al. Nucleic Acids Research, 18
299, 1990. Those skilled in the art will require that the enzymatic nucleic acid molecule
Recognize that it is a specific substrate binding site complementary to one or more of the target gene RNA region, and
It is recognized that it has a nucleotide sequence within or around its substrate binding site that confers RNA cleaving activity.

  Table 9 shows the mRNA coding sequence of GST-π.

Drugs that inhibit GST-π production or activity have high specificity and low possibility of side effects, such as RNAi molecules, ribozymes, antisense nucleic acids, DNA / RNA chimeric polynucleotides of GST-π-encoding DNA Alternatively, it may be a vector that expresses it.

Suppression of GST-π may be determined by suppression of GST-π expression or activity in cells as compared to when GST-π suppression is not utilized. The expression of GST-π can be assessed by any known technique. As an example of these, a method using an anti-GST-π antibody,
EIA, ELISA, IRA, IRMA, Western blotting, immunohistochemistry, immunocytochemistry, flow cytometry, nucleic acid or transcript (mRNA (mRNA) encoding GST-π or a unique fragment thereof
Or a hybridization method using a nucleic acid that specifically hybridizes with the splicing product of the nucleic acid, Northern blotting, Southern blotting, and various PCR methods.

The activity of GST-π is assessed by analyzing the known activity of proteins including binding to GST-π, such as, for example, Raf-1 (especially phosphorylated Raf-1) or EGFR (especially phosphorylated EGFR) be able to. These include, for example, immunoprecipitation, Western blotting, mass spectrometry, pull-down, surface plasmon resonance (SPR) and the like.

Whether GST-π is expressed in a particular cell can be determined by detecting the expression of GST-π in the cell. Expression of GST-π can be detected by any technique known in the art.

Examples of mutated KRAS include, but are not limited to, mutations that cause continued activation of KRAS and that inhibit endogenous GTPases or mutations that increase the rate of guanine nucleotide exchange. Specific examples of such mutations include, for example, mutations of amino acids 12, 13 and / or 61 in human KRAS (which inhibit endogenous GTPases), and mutations of amino acids 116 and / or 119 in human KRAS. (Increasing guanine nucleotide exchange rate) (Bos, Canc
er Res. 1989; 49 (17): 4682-9, Levi et al., Cancer Res. 1991; 51 (13): 3497-502).

In some embodiments of the invention, the mutant KRAS is amino acids 12, 13, 61, of human KRAS.
KRAS having a mutation at least one of 116 and 119 can be used. In one embodiment of the invention, the mutant KRAS has a mutation at amino acid 12 of human KRAS. In some embodiments, the mutant KRAS may induce overexpression of GST-π. Cells with mutant KRAS may exhibit overexpression of GST-π.

The detection of the mutant KRAS can be carried out by any known technique, for example, selective hybridization, enzymatic mismatch cleavage method, sequencing method (Bos, Cancer Res. 1989; 49 (17 (17) ): 4682-9) and PCR-RFLP (Miyanishi et al., Gastroenterology. 2001; 121 (4): 865-74).

The detection of GST-π expression can be performed using any known technique. For example, comparing the degree of expression of GST-π in cells with KRAS mutations with the degree of expression of GST-π in cells of the same type with normal KRAS as to whether GST-π is overexpressed or not Can be assessed by In this situation, if the degree of expression of GST-π in cells with mutant KRAS exceeds the degree of expression of GST-π in homotypic cells with normal KRAS,
Is overexpressed.

In one aspect, the invention features a vector encoding the inhibitory nucleic acid molecule of any of the above aspects. In a specific embodiment, the vector is a retroviral vector, an adenoviral vector, an adeno-associated viral vector or a lentiviral vector. In another embodiment, the vector comprises a promoter suitable for expression in mammalian cells.

The amount of active RNA interference inducing component formulated in the composition of the invention can be an amount that does not cause side effects beyond the benefits of administration. Such amount can be measured by in vitro tests using cultured cells, tests with model animals such as mice, rats, dogs and pigs, and these test methods will be apparent to those skilled in the art.

The amount of active ingredient formulated may vary depending on the manner in which the drug or composition is administered. For example, if multiple units of the composition are used for a single dose, the amount of active ingredient formulated in one unit of composition will be the amount of active ingredient required for a single dose. It can be determined by dividing by.

The present invention also relates to methods of making agents or compositions that inhibit GST-π, as well as the use of agents that inhibit GST-π in making agents or compositions for reducing or shrinking drug malignancy.

RNA interference
RNA interference (RNAi) refers to sequence specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs). For example, Zamore et al., Cell, 2000, Vol. 101,
25-33; Fire et al., Nature, 1998, Vol. 391, 806 811; Sharp, Genes & Development, 1
999, Vol. 13, pp. 139-141.

Intracellular RNAi responses can be elicited by double stranded RNA (dsRNA), but the mechanism is not yet fully understood. Specific dsRNAs in cells can be subjected to the action of Dicer enzyme, ribonuclease III enzyme. For example, Zamore et al., Cell, 2000, Vol.
Hammond et al., Nature, 2000, Vol. 404, pp. 293-296. Dicer dsRN
A can be processed into shorter fragments of dsRNA that are siRNA.

In general, the siRNA can be about 21 to about 23 nucleotides in length and can include a base pair duplex region of about 19 nucleotides in length.

RNAi involves an endonuclease complex known as RNA-induced silencing complex (RISC). The siRNA is an antisense or guide strand that enters the RISC complex, and
It has an antisense or guide strand that mediates cleavage of a single stranded RNA target having a sequence that is complementary to the antisense strand of the iRNA duplex. The other strand of the siRNA is the passenger strand. Target RNA
Cleavage occurs in the middle of the region complementary to the antisense strand of the siRNA duplex (eg, Elbas
See hir et al., Genes & Development, 2001, Vol. 15, pp. 188-200).

The term "sense strand" as used herein refers to the nucleotide sequence of a siRNA molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand of the siRNA molecule. siR
The sense strand of the NA molecule can comprise a nucleic acid sequence having homology to the target nucleic acid sequence.

The term "antisense strand" as used herein refers to the nucleotide sequence of a siRNA molecule that is partially or completely complementary to at least a portion of a target nucleic acid sequence. The antisense strand of the siRNA molecule can comprise a nucleic acid sequence that is complementary to at least a portion of the corresponding sense strand of the siRNA molecule.

RNAi molecules can downregulate or knock down gene expression by mediating RNA interference in a sequence specific manner. For example, Zamore et al., Cell, 2000, Vol.
01, 25-33; Elbashir et al., Nature, 2001, Vol. 411, pages 494-498; Kreutzer et al., WO 2000.
Zernicka-Goetz et al, WO 2001/36646; Fire et al, WO 1999/032619; Plaetinck et al, WO 2
000/01846; Mello et al., WO 2001/029058.

As used herein, the terms "inhibit,""downregulate," or "reduce" with respect to gene expression refers to expression of the gene or levels of mRNA molecules encoding one or more proteins, Alternatively, it is meant that the activity of one or more encoded proteins is lower than the activity observed in the absence of the RNAi molecule or siRNA of the invention. For example, the level of expression, the level of mRNA or the level of encoded protein activity
At least 1%, or at least 10%, or at least 20%, or at least 50%, or at least 90%, or more than the activity observed in the absence of the RNAi molecule or siRNA of the invention good.

RNAi molecules can also be used to knock down viral gene expression,
Thus, it affects virus replication.

RNAi molecules can be made from separate polynucleotide strands: sense or passenger strands and antisense or guide strands. The guide strand and the passenger strand are at least partially complementary. The guide and passenger strands can form a duplex region having about 15 to about 49 base pairs.

In some embodiments, the duplex region of the siRNA is 17, 18, 19, 20, 21, 22, 23, 24, 2
5, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 4
It can contain 5, 46, 47, 48, or 49 base pairs.

In certain embodiments, the RNAi molecule is active in the RISC complex and can have a duplex region length active against RISC.

In a further embodiment, the RNAi molecule can be active as a Dicer substrate that is converted to an RNAi molecule that is active in the RISC complex.

In some embodiments, the RNAi molecule can have a guide and a passenger sequence portion complementary to opposite ends of the long molecule, such that the molecule forms a duplex region in the complementary sequence portion Each strand is attached at one end of the duplex region by either a nucleotide or non-nucleotide linker. For example, hairpin sequence stem and loop sequences. Linker interactions with each chain can be covalent or non-covalent interactions.

The RNAi molecules of the present disclosure may comprise nucleotides, non-nucleotides or mixed nucleotide / non-nucleotide linkers that bind the sense region of the nucleic acid to the antisense region of the nucleic acid. Nucleotide linkers are two or more nucleotides in length, for example about 3, 4, 5, 6, 7, 8, 9
Alternatively, it can be a 10 nucleotide linker. The nucleotide linker may be a nucleic acid aptamer. As used herein, "aptamer" or "nucleic acid aptamer" refers to a nucleic acid molecule that specifically binds to a target molecule, wherein the nucleic acid molecule is a sequence comprising a sequence recognized by the target molecule in its native context Have. Alternatively, the aptamer may be a nucleic acid molecule that binds to a target molecule, where the target molecule may not naturally bind to the nucleic acid. For example, aptamers can be used to bind to the ligand binding domain of a protein, thereby preventing interaction of the naturally occurring ligand with the protein.
See, for example, Gold et al., Annu Rev Biochem, 1995, Vol. 64, 763-797; Brody et al., J. Biotechno.
l., 2000, Vol. 74, pages 5 to 13; see Hermann et al., Science, 2000, Vol. 287, pp. 820-825.

Examples of non-nucleotide linkers are abasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, lipids, polyhydrocarbons or other macromolecular compounds, such as 2-1.
Mention may be made of macromolecular compounds such as polyethylene glycol having 00 ethylene glycol units. Some examples are described by Seela et al., Nucleic Acids Research, 1987, Vol.
Cload et al., J. Am. Chem. Soc., 1991, Vol. 113, 6324-6326; Jaeschk.
e et al., Tetrahedron Lett., 1993, Vol. 34, page 301; Arnold et al., WO 1989/002439; Usman et al., W.
O1995 / 006731; Dudycz et al., WO 1995/011910; and Ferentz et al., J. Am. Chem. Soc., 1991, V.
ol. 113, pp. 4000-4002.

The RNAi molecule can have one or more overhangs from the duplex region. The overhang is a single stranded region that is not base paired and may be 1 to 8 nucleotides or more in length. The overhang may be a 3 'end overhang having a single-stranded region of 1 to 8 nucleotides at the 3' end of the strand. The overhang may be a 5 'end overhang having a single-stranded region of 1 to 8 nucleotides at the 5' end of the strand.

The overhangs of the RNAi molecules may have the same length or may be of different lengths.

The RNAi molecule can have one or more blunt ends, wherein the duplex region ends without overhangs and the strand is base paired to the end of the duplex region.

The RNAi molecules of the present disclosure can have one or more blunt ends, or can have one or more overhangs, or can have a combination of blunt ends and overhangs.

The 5 'end of the strand of the RNAi molecule may be blunt ended or overhanging. The 3 'end of the strand of the RNAi molecule may be blunt ended or overhanging.

The 5 'end of the strand of the RNAi molecule may be blunt ended and the 3' end may be overhanging. RN
The 3 'end of the Ai molecule chain may be blunt end and the 5' end may be overhanging.

  In some embodiments, both ends of the RNAi molecule are blunt ends.

  In a further embodiment, both ends of the RNAi molecule have overhangs.

  The overhangs at the 5'- and 3'-ends may be of different lengths.

In certain embodiments, the RNAi molecule may be one wherein the 5 'end of the antisense strand and the 3' end of the sense strand have blunt ends without overhanging nucleotides.

In a further embodiment, the RNAi molecule may be one wherein the 3 'end of the antisense strand and the 5' end of the sense strand have blunt ends without overhanging nucleotides.

  The RNAi molecule may have a mismatch in base pairing in the duplex region.

Any nucleotide in the overhang of the RNAi molecule can be deoxyribonucleotide or ribonucleotide.

One or more deoxyribonucleotides may be present at the 5 'end, where the 3' end of the other strand of the RNAi molecule may have no overhangs, even without deoxyribonucleotide overhangs Good.

One or more deoxyribonucleotides may be present at the 3 'end, where the 5' end of the other strand of the RNAi molecule may have no overhangs, even if it has no deoxyribonucleotide overhangs Good.

In some embodiments, one or more or all of the overhanging nucleotides of the RNAi molecule may be 2'-deoxyribonucleotides.

Dicer Substrate RNAi Molecules In some embodiments, the RNAi molecule can be of a length suitable as a Dicer substrate that is processed to produce a RISC active RNAi molecule. For example, Rossi et al., US 2005 /
See 0244858.

The dicer substrate dsRNA can be of sufficient length to be processed by Dicer to generate active RNAi molecules, and may further include one or more of the following properties: (i)
The dicer substrate dsRNA can be asymmetric, eg, having a 3 'overhang on the antisense strand, and (ii) the dicer substrate dsRNA directs the orientation of the dicer binding, dsR
It may have a modified 3 'end on the sense strand to process NA to make it an active RNAi molecule.

Methods of Using RNAi Molecules The nucleic acid molecules and RNAi molecules of the invention can be delivered to cells or tissues by direct application of the molecules or using molecules in combination with a carrier or diluent.

The nucleic acid molecules and RNAi molecules of the invention may be used as carriers or diluents or other delivery vehicles that function to assist or promote entry into cells such as viral sequences, viral agents or lipid or liposome formulations. It can be delivered or administered to cells, tissues, organs or subjects by direct application.

The nucleic acid molecules and RNAi molecules of the invention can be complexed with cationic lipids, packaged in liposomes, or delivered to target cells or tissues. The nucleic acids or nucleic acid complexes can be locally administered to relevant tissues in vitro or in vivo by direct dermal application, transdermal application or injection.

Delivery systems may include, for example, aqueous and non-aqueous gels, creams, emulsions, microemulsions, liposomes, ointments, aqueous and non-aqueous solutions, lotions, aerosols, hydrocarbon bases and powders, and solubilizers and An additive such as a penetration enhancer may be included.

The GST-π inhibitory nucleic acid molecules of the invention can be administered in unit dosage forms of a pharmaceutically acceptable diluent, carrier or excipient. Conventional pharmaceutical practice can be used to provide a suitable formulation or composition for administering a compound to a patient suffering from a disease caused by excessive cell proliferation. Patients can begin dosing before symptoms appear. For example, parenteral, intravenous, intraarterial, subcutaneous, intratumoral, intracranial, intraorbital, ophthalmology, intracerebroventricular, intrahepatic, intracapsular, intrathecal, intravesical, intraperitoneal, intranasal, aerosol, Suppository or oral administration is included. For example, the therapeutic preparation may be in the form of a liquid solution or a suspension. In the case of oral administration,
The formulations can be in the form of tablets or capsules. Intranasal formulations may be in the form of powders, nasal drops or aerosols.

The compositions and methods of the present disclosure can include an expression vector comprising a nucleic acid sequence encoding at least one RNAi molecule of the present invention to allow expression of the nucleic acid molecule.

The nucleic acid molecules and RNAi molecules of the invention can be expressed from transcription units inserted into DNA or RNA vectors. The recombinant vector can be a DNA plasmid or a viral vector. Viral vectors that provide for transient expression of nucleic acid molecules can be used.

For example, the vector may comprise sequences encoding both strands of a double stranded RNAi molecule, or a single nucleic acid molecule that is self-complementary and forms an RNAi molecule. The expression vector may comprise nucleic acid sequences encoding more than one nucleic acid molecule.

The nucleic acid molecules can be expressed in cells from eukaryotic promoters. Those skilled in the art will
It is understood that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA / RNA vector.

In some embodiments, viral constructs can be used to introduce expression constructs into cells, which is for transcription of the dsRNA construct encoded by the expression construct.

The lipid formulation can be administered to the animal by intravenous, intramuscular or intraperitoneal injection, or orally or by inhalation, or by other methods known in the art.

Pharmaceutically acceptable formulations for administering oligonucleotides are known and can be used.

In one embodiment of the above method, the inhibitory nucleic acid molecule is about 5-500 mg / m ² / day, eg 5, 25, 5
It is 0, 100, 125, 150, 175, 200, 225, 250, 275 or 300 mg / m < ² > / day.

Methods known in the art for producing formulations are described, for example, in "Remington: The Science an
d Practice of Pharmacy "Ed. AR Gennaro, Lippincourt Williams & Wilkins, Phil
adelphia, Pa., 2000.

Formulations for parenteral administration may, for example, comprise excipients, sterile water or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin or hydrogenated naphthalenes. Biocompatible, biodegradable lactide polymer, lactide / glycolide copolymers or polyoxyethylene-polyoxypropylene copolymers can be used to control the release of the compound. Other potentially useful parenteral delivery systems for GST-π inhibitory nucleic acid molecules include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems and liposomes. Formulations for inhalation may include excipients such as lactose, or may be an aqueous solution containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or It may be an oily solution administered in the form of a nasal spray.

The formulation is a therapeutically effective amount (eg, to provide treatment of a neoplastic disease or condition).
Can be administered to human patients in an amount to prevent, eliminate or reduce a pathological condition. The preferred dosage of the nucleotide oligomers of the invention can depend on variables such as the type and extent of the disorder, the general health of the particular patient, the formulation of the compound vehicle and its route of administration.

All of the above methods for reducing malignancy may be either in vitro or in vivo methods. Dosages can be determined by in vitro tests, using cultured cells and the like, as known in the art. An effective amount is at least 10%, at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or the tumor size in the KRAS-related tumor. The amount may be reduced by at least 90% and up to 100%.

The pharmaceutical composition of the present invention is effective for the treatment of KRAS related diseases. The diseases include diseases caused by abnormal cell proliferation, diseases caused by KRAS mutation, diseases caused by overexpression of GST-π, and the like.

Diseases caused by abnormal cell proliferation include malignant tumor, hyperplasia, keloid, Cushing's syndrome,
Primary aldosteronism, erythrocytosis, erythrocytosis, leukocytosis, hyperplastic scars, lichen planus and leukoplakia are included.

Examples of diseases due to KRAS mutations include malignant tumors (also called cancer or malignant neoplasms).

  Examples of diseases caused by GST-π overexpression include malignant tumors.

Examples of cancer include fibrosarcoma, malignant fibrohistocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, angiosarcoma, Kaposi's sarcoma, lymphangiosarcoma, synovial sarcoma, chondrosarcoma and osteosarcoma , Brain cancer, head and neck cancer, breast cancer, lung cancer, esophageal cancer, gastric cancer, duodenal cancer, colon cancer, colon cancer, liver cancer, liver cancer, pancreas cancer, gallbladder cancer, cholangiocarcinoma, kidney cancer, ureteral cancer, bladder cancer, prostate cancer, Mention may be made of carcinomas such as testicular cancer, uterine cancer, ovarian cancer, skin cancer, leukemia and malignant lymphoma.

Cancers include epithelial malignancies and non-epithelial malignancies. Cancer is any part of the body, for example
Brain, head and neck, chest, limbs, lung, heart, thymus, esophagus, stomach, small intestine (duodenum, jejunum, ileum),
Large intestine (colon, cecum, appendix, rectum), liver, pancreas, gallbladder, kidney, ureter, bladder, prostate, testis, uterus, ovary, skin, striated muscle, smooth muscle, synovium, cartilage, bone, thyroid, Adrenal gland, peritoneum, mesentery,
It can be present in bone marrow, blood, blood vessels, lymph systems such as lymph nodes, lymph fluid and the like.

In one embodiment of the invention, the cancer comprises cancer cells having a mutant KRAS as defined above. In another embodiment, the cancer comprises cancer cells that exhibit hormone dependent growth factor or growth factor independent growth. In a further embodiment, the cancer comprises cancer cells that exhibit GST-π overexpression.

Example 1 The siRNA of the invention targeting GST-π was found to be active for gene silencing in vitro. The dose dependent activity of GST-π siRNA for gene knockdown was found to exhibit an IC50 of less than about 250 picomoles (pM) and an IC50 as low as 1 pM.

In vitro transfection was performed on the A549 cell line to determine siRNA knockdown efficiency. As shown in Table 10, dose-dependent knockdown of GST-π mRNA was observed with siRNA in Table 3.

As shown in Table 10, the activity of GST-π siRNA in Table 3 is in the range of 17-235 pM and is suitable for many uses, including drug agents used in vivo.

Example 2 The structure of GST-π siRNA of the present invention having deoxynucleotides located in the seed region of the antisense strand of the siRNA was shown to unexpectedly and advantageously increase the gene knockdown activity in vitro.

In vitro transfection is performed on the A549 cell line and structures BU2 '(SEQ ID NO: 133 and 15)
The knockdown efficiency of GST-π siRNA based on 9) was determined. As shown in Table 11, structure BU2 '
Dose-dependent knockdown of GST-π mRNA was observed using GST-π siRNA based on

As shown in Table 11, the activity of GST-.pi. SiRNA based on the structure BU2 'having 3 deoxynucleotides in the seed region of the antisense strand, as compared to GST-.pi. SiRNA without deoxynucleotide in double-stranded region, Surprisingly, it has unexpectedly increased to six times.

These data show that positions 3, 5 and 7 or positions 4, 6 and 8 of the seed region of the antisense strand
It has been shown that GST-πsiRNA having a structure having three deoxynucleotides has surprisingly high gene knockdown activity as compared to GST-πsiRNA without deoxynucleotides in the double stranded region.

The activities shown in Table 11 for GST-.pi. SiRNAs with three deoxynucleotides in the seed region of the antisense strand are in the range of 5-8 pM and are very suitable for many uses including drug agents used in vivo The

Example 3: The structure of GST-π siRNA of the present invention having deoxynucleotides located in the seed region of the antisense strand of the siRNA was shown to unexpectedly and advantageously increase gene knockdown activity in vitro.

In vitro transfection was performed on the A549 cell line and structures A9 '(SEQ ID NO: 185 and 197)
The knockdown efficiency of GST-πsiRNA based on) was determined. As shown in Table 12, GST-π mRNA
Dose dependent knockdown was observed with GST-πsiRNA based on structure A9 ′.

As shown in Table 12, the activity of GST-.pi. SiRNA based on structure A9 'having 3 to 6 deoxynucleotides in the seed region of the antisense strand surprisingly does not have deoxynucleotides in the duplex region It increased to 24-fold compared to GST-π siRNA.

These data show that positions 4, 6 and 8 or position 1, in the seed region of the antisense strand
GST-.pi.siRNAs having a structure with three, four and five deoxynucleotides at positions 3, 5 and 7, or positions 3-8, or positions 5-8, or positions 3, 5 and 7 are deoxydeoxynucleotides in the duplex region It is shown to have unexpectedly high gene knockdown activity as compared to GST-πsiRNA having no nucleotide.

The activities shown in Table 12 for GST-.pi. SiRNAs with 3 to 6 deoxynucleotides in the seed region of the antisense strand are in the range of 1-15 pM, which has many uses including drug agents used in vivo Very suitable for.

Example 4: The structure of GST-πsiRNA having deoxynucleotides located in the seed region of the antisense strand of the siRNA was shown to unexpectedly and advantageously increase the gene knockdown activity in vitro.

In vitro transfection was performed on the A549 cell line and structures B13 '(SEQ ID NO: 209 and 22)
The knockdown efficiency of GST-πsiRNA based on 4) was determined. As shown in Table 13, GST-π mRNA
Dose-dependent knockdown was observed with GST-πsiRNA based on structure B13 ′.

As shown in Table 13, the activity of GST-.pi. SiRNA based on structure B13 'with 3 deoxynucleotides in the seed region of the antisense strand is expected as compared to GST-.pi. SiRNA without deoxynucleotide in double-stranded region Increased outside.

These data show that GST-.pi.siRNAs having a structure with three deoxynucleotides at positions 4, 6 and 8 of the seed region of the antisense strand are compared to GST-.pi.siRNAs that do not contain deoxynucleotides in the duplex region It has been shown to have unexpectedly high gene knockdown activity.

The activity shown in Table 13 for GST-.pi. SiRNAs with three deoxynucleotides in the seed region of the antisense strand was in the picomolar range of 11 pM and was well suited for many uses, including drug agents used in vivo .

Example 5: The structure of GST-πsiRNA having deoxynucleotides located in the seed region of the antisense strand of the siRNA unexpectedly and advantageously increased the gene knockdown activity in vitro.

In vitro transfection was performed on the A549 cell line, structures B4 '(SEQ ID NO: 263 and 275)
The knockdown efficiency of GST-πsiRNA based on) was determined. As shown in Table 14, GST-π mRNA
Dose dependent knockdown was observed with GST-πsiRNA based on structure B4 '.

As shown in Table 14, the activity of GST-.pi. SiRNA based on structure B4 'with 6 deoxynucleotides in the seed region of the antisense strand is compared to GST-.pi. SiRNA without deoxynucleotide in the duplex region Unexpectedly more than doubled.

These data show that GST-.pi.siRNAs having a structure with 6 deoxynucleotides located at positions 3-8 in the seed region of the antisense strand are compared to GST-.pi.siRNAs not having deoxynucleotides in the duplex region It shows that it has surprisingly high gene knockdown activity.

Table 14: GST-π siRNAs with 6 deoxynucleotides in the seed region of the antisense strand
The activity shown in is in the picomolar range of 113 pM and was very suitable for many uses, including drug agents used in vivo.

Example 6: The structure of GST-πsiRNA having deoxynucleotides located in the seed region of the antisense strand of the siRNA unexpectedly and advantageously increased the gene knockdown activity in vitro.

In vitro transfection was performed on the A549 cell line and structures B2 '(SEQ ID NO: 239 and 251)
The knockdown efficiency of GST-πsiRNA based on) was determined. As shown in Table 15, dose-dependent knockdown of GST-π mRNA was observed using GST-π siRNA based on structure B2 ′.

As shown in Table 15, the activity of GST-.pi. SiRNA based on structure B2 'with 3 to 4 deoxynucleotides in the seed region of the antisense strand is with GST-.pi. SiRNA without deoxynucleotide in the duplex region Astonishingly, it increased to 4 times in comparison.

These data indicate that positions 5-8, or positions 1, 3, 5 and 7 of the seed region of the antisense strand,
Or a GST- having a structure having 3 to 4 deoxynucleotides located at positions 3, 5 and 7
It has been shown that π siRNA has unexpectedly high gene knockdown activity as compared to GST-π siRNA which does not contain deoxynucleotides in the duplex region.

The activity shown in Table 15 for GST-.pi. SiRNAs with 3-4 deoxynucleotides in the seed region of the antisense strand is in the range of 30-100 pM, which has many uses including drug agents used in vivo Very suitable for

Example 7: The structure of GST-π siRNA containing one or more 2'-deoxy-2'-fluoro substituted nucleotides showed unexpectedly increased gene knockdown activity in vitro.

In vitro transfection is performed on the A549 cell line and structures BU2 '(SEQ ID NO: 133 and 15)
The knockdown efficiency of GST-π siRNA based on 9) was determined. As shown in Table 16, structure BU2 '
Dose-dependent knockdown of GST-π mRNA was observed using GST-π siRNA based on

As shown in Table 16, GS based on the structure BU2 'having one or more 2'-F deoxynucleotides
The activity of T-π siRNA was surprisingly increased by up to 10-fold compared to GST-π siRNA without 2'-F deoxynucleotides.

These data show that GST-.pi.s has a structure having one or more 2'-F deoxynucleotides
It has been shown that iRNA has unexpectedly high gene knockdown activity as compared to GST-π siRNA without 2'-F deoxynucleotides.

The activities shown in Table 16 for GST-.pi. SiRNAs with one or more 2'-F deoxynucleotides are 3
It was in the range of ̃13 pM and was very suitable for many uses, including drug agents used in vivo.

Example 8: The structure of GST-π siRNA containing one or more 2'-deoxy-2'-fluoro substituted nucleotides showed unexpectedly increased gene knockdown activity in vitro.

In vitro transfection was performed on the A549 cell line and structures B13 '(SEQ ID NO: 209 and 22)
The knockdown efficiency of GST-πsiRNA based on 4) was determined. As shown in Table 17, GST-π mRNA
Dose-dependent knockdown was observed with GST-πsiRNA based on structure B13 ′.

As shown in Table 17, the activity of GST-.pi. SiRNA based on structure B13 'having three 2'-F deoxynucleotides at non-overhanging positions was surprisingly found to be that GST-.pi. It increased about 3-fold compared to πsiRNA.

These data show that GST-.pi.s has a structure having one or more 2'-F deoxynucleotides
It has been shown that iRNA has unexpectedly high gene knockdown activity as compared to GST-π siRNA without 2'-F deoxynucleotides.

The activity shown in Table 17 for GST-.pi. SiRNAs with one or more 2'-F deoxynucleotides is in the picomolar range of 6 pM and was very suitable for many uses, including drug agents used in vivo .

Example 9: Orthotopic A549 Lung Cancer Mouse Model. The GST-π siRNAs of the invention can show a marked reduction of orthotopic lung cancer tumors in vivo. In this example, GST-π siRNA resulted in gene knockdown efficacy in vivo when administered as a liposomal formulation to orthotopic lung cancer tumors in athymic nude mice.

In general, orthotopic tumor models can show direct clinical relevance for efficacy and efficacy, as well as improved predictive ability. In orthotopic tumor models, tumor cells are directly transplanted into the homogeneous organ from which the cells are derived.

The anti-tumor efficacy of the siRNA formulation against human lung cancer A549 was evaluated by comparing the final primary tumor weights measured at necropsy of the treatment group and the vehicle control group.

FIG. 1 shows in vivo orthotopic lung cancer tumor inhibition of GST-π siRNAs based on structure BU2 (SEQ ID NO: 63 and 128). Orthotopic A549 Lung Cancer Mouse Model with 2 mg of siRNA Targeting GST-π
Used at relatively low doses at / kg.

GST-π siRNA showed significant and unexpected advantageous lung tumor inhibitory efficacy in this 6 week study. As shown in FIG. 1, after 43 days, GST-πsiRNA showed a significant advantageous tumor inhibition potency, and the final tumor mean weight was significantly reduced 2.8 fold compared to the control.

For this study, 5-6 week old male NCr nu / nu mice were used. The experimental animals were maintained in HEPA filtered environment for the duration of the experiment. The siRNA formulation was stored at 4 ° C. prior to use and allowed to warm to room temperature 10 minutes prior to injection into mice.

On the day of surgical orthotopic implantation (SOI), for this A549 human lung cancer orthotopic model, stock tumors were harvested from the subcutaneous site of animals bearing A549 tumor xenografts and placed in RPMI-1640 medium. The necrotic tissue was removed and cut living tissue to 1.5 to 2 mm ^3. The animals were anesthetized by isoflurane inhalation and the surgical area was sterilized with iodine and alcohol. A transverse incision of approximately 1.5 cm was made on the left chest wall of the mouse using a pair of surgical scissors. An intercostal incision was made between the third and fourth intercostals to expose the left lung. One A549 tumor fragment was implanted on the surface of the lung with 8-0 surgical suture (nylon). The chest wall was closed with 6-0 surgical suture (silk). The lungs were reinflated by intrathoracic puncture using a 25 G × 1/2 needle 3 cc syringe to draw out the remaining air in the thoracic cavity. The chest wall was closed with a 6-0 surgical silk suture. All procedures of the above operation were performed using a 7x magnification microscope under a HEPA filtered laminar flow hood.

Three days after tumor implantation, model bearing mice were randomly divided into groups of 10 mice per group. For the group of interest, treatment of 10 mice was initiated 3 days after tumor implantation.

For the group of interest, the formulation is (ionizable lipid: cholesterol: DOPE: DOPC:
It was a liposome composition of DPPE-PEG-2K: DSPE-PEG-2K). Liposomes encapsulated GST-π siRNA.

For study endpoints, experimental mice were sacrificed 42 days after treatment initiation. Primary tumors were excised and weighed on an electronic balance for subsequent analysis.

For assessment of compound toxicity, the average body weight of mice in the treatment and control groups was maintained within the normal range throughout the experimental period. No other symptoms of toxicity were observed in mice.

Example 10: The GST-π siRNAs of the invention showed a marked reduction of cancer xenograft tumors in vivo. GST-π siRNA resulted in gene knockdown efficacy in vivo when administered to cancer xenograft tumors in liposomal formulations.

FIG. 2 shows the tumor inhibitory potency of GST-π siRNA (SEQ ID NO: 158 and 184). A cancer xenograft model was used at a relatively low dose of 0.75 mg / kg of siRNA targeting GST-π.

GST-π siRNA showed significant and unexpected advantageous tumor inhibitory potency within several days after administration. After 36 days, GST-πsiRNA showed a significant advantageous tumor inhibition potency and tumor volume was reduced 2-fold compared to control.

As shown in FIG. 3, GST-π siRNA showed significant and unexpected advantageous tumor inhibition potency on the last day. In particular, the tumor weight was reduced by more than twofold.

Composition (ionizable lipid: cholesterol: DOPE: DOPC: DPPE-PEG-2K) (25:30)
GST-πsiRNA was administered by two injections (Day 1 and Day 15) as a liposomal formulation with 20: 20: 5).

For the cancer xenograft model, the A549 cell line was obtained from ATCC. 10% fetal bovine serum and 100 U / ml
Cells were maintained in culture medium supplemented with penicillin and 100 μg / ml streptomycin.
Cells were split 48 hours prior to inoculation to allow log phase growth at harvest. Cells were lightly trypsinized with trypsin-EDTA and harvested from tissue culture. The number of viable cells was counted and measured in a hemocytometer in the presence of trypan blue (count only viable cells). The cells were resuspended to a concentration of 5 × 10 ⁷ / ml in serum free medium. The cell suspension was then ice thawed B
It was mixed well with D Matrigel in a ratio of 1: 1 and used for injection.

The mice were Charles River Laboratory thymic nude mice (nu / nu) female mice, immunodeficient, 6-8 weeks old, 7-8 mice per group.

For tumor model preparation, using an inoculum volume of 25 G needle and syringe per mouse, 2.5
A 0.1 ml inoculum of 10 ⁶ A549 cells was inoculated subcutaneously in the right flank. The mice were not anesthetized for inoculation.

Tumor size was measured to the nearest 0.1 mm for tumor volume measurement and randomization. Tumor volume, formula was calculated using the tumor volume = length × width ^2/2. The established tumor is about 120 to 175 mm
^{When 3} was reached, mice were assigned to various vehicle controls and treatment groups such that the average tumor volume was about 150 mm ³ and the average tumor volume of the treatment group was within 10% of the average tumor volume of the vehicle control group . Ideally, the CV% of the tumor volume was less than 25%. On the same day, test article and control vehicle were administered according to the dosing regimen. Tumor volumes were monitored three times in the first week and twice in the remaining week including the day of study termination.

For dosing, on the day of dosing, the test article was removed from the -80 ° C freezer and thawed on ice. The bottle containing the formulation was manually returned several times before being applied to the syringe. All test articles were dosed at 0.75 mg / kg IV, q2wX2, 10 ml / kg.

For body weight, mice were weighed to the nearest 0.1 g. Monitor your weight and receive your first dose
Recorded daily within 7 days. Body weight was monitored for several weeks and recorded twice a week for the remaining weeks including the end of the study.

Tumor volumes were measured to collect tumors 28 days after the first dose, and tumors were dissected for weight measurement and saved for PD biomarker studies. Tumor weights were recorded.

Example 11: GST-π siRNA of the present invention showed an increase in cancer cell death by apoptosis of cancer cells in vitro. GST-π siRNA resulted in GST-π knockdown, resulting in upregulation of PUMA, a biomarker of apoptosis, accompanied by decreased cell viability.

Deoxynucleotides, 2'-F substituted deoxynucleotides and 2'-OMe in the seed region
GST-π siRNAs SEQ ID NO: 158 and 184 containing combinations of substituted ribonucleotides unexpectedly increased the apoptosis of cancer cells.

The expression levels of PUMA for GST-π siRNAs SEQ ID NO: 158 and 184 are shown in FIG. As shown in FIG. 4, PUMA expression was greatly increased 2 to 4 days after transfection of GST-π siRNA.

These data indicate that the structure of GST-.pi. SiRNA, including a combination of deoxynucleotides, 2'-F substituted deoxynucleotides and 2'-OMe substituted ribonucleotides in the seed region, unexpectedly increases the apoptosis of cancer cells ing.

The protocol for PUMA biomarkers was as follows. For transfection
One day before, 100 μl of DMEM (HyClone catalog number SH3024.01) containing 10% FBS is seeded at 2 × 10 ³ cells / well in a 96-well plate, 37 ° C. with a humidified atmosphere in air of 5% CO ₂ It was cultured in an incubator. The following day, before transfection, 90 μl of medium containing 2% FBS
And Opti-MEM I reduced serum medium (Life Technologies Catalog No. 31985-070). Then, 0.2 μl Lipofectamine RNAiMAX (Life Technologies Catalog No. 13778-100)
Mixed with 8 μl Opti-MEM I for 5 minutes at room temperature. 1 μl of siRNA (stock concentration 1 μM) in 4 μl of O
Mixed with pti-MEM I, mixed with RNAiMAX solution, then mixed gently. Mixture 10 at room temperature
Incubate for a minute to form the RNA-RNAiMAX complex. 10 μl of RNA-RNAiMAX complex was added per well to give a final concentration of 10 nM siRNA. Incubate the cells for 2 hours
The medium was replaced with fresh Opti-MEM I reduced serum medium containing 2% FBS. For transfection
After 1, 2, 3, 4 and 6 days, wash the cells once with ice cold PBS, then use 50 μl of Cell-to-Ct lysis buffer (Life Technologies Catalog No. 4391851 C) for about 5-30 minutes at room temperature It dissolved. 5 μl of stop solution was added and incubated for 2 minutes at room temperature. PUMA (BBC3, Cat # Hs00248075, Li
mRNA levels of fe Technologies) were measured by qPCR using TAQMAN.

Example 12: GST-π siRNAs of the invention were able to show a marked reduction of cancer xenograft tumors in vivo. GST-π siRNA is administered to cancer xenograft tumors in a liposomal formulation,
Gene knockdown efficacy can be provided in vivo.

FIG. 5 shows the tumor inhibitory potency of GST-π siRNA (SEQ ID NO: 63 and 128). GST-π mRNA
Dose dependent knockdown was observed in vivo with siRNA targeting GST-π. The cancer xenograft model was used with a relatively low dose of 0.75 mg / kg of siRNA targeting GST-π.

GST-π siRNA showed significant and unexpected advantageous tumor inhibitory potency within several days after administration. As shown in FIG. 5, treatment with GST-π siRNA significantly reduced GST-π mRNA expression four days after injection into the lipid formulation. At the high dose of 4 mg / kg, a significant decrease of about 40% was detected at 24 hours post injection.

GST-πsiRNA, composition (ionizable lipid: cholesterol: DOPE: DOPC: DPPE-PE
G-2K) (25: 30: 20: 20: 5) was administered in a single injection as a 10 mL / kg liposome formulation.

For the cancer xenograft model, the A549 cell line was obtained from ATCC. Cells were maintained in RPMI-1640 supplemented with 10% fetal bovine serum and 100 U / ml penicillin and 100 μg / ml streptomycin. Cells were split 48 hours prior to inoculation to allow log phase growth at harvest. Cells were lightly trypsinized with trypsin-EDTA and harvested from tissue culture. The number of viable cells was counted and measured in a hemocytometer in the presence of trypan blue (count only viable cells). The cells were resuspended in serum free RPMI medium to a concentration of 4 × 10 ⁷ / ml. The cell suspension was then intimately mixed with ice-thawed BD Matrigel in a ratio of 1: 1 and used for injection.

The mice were Charles River laboratory thymus nude (nu / nu) female mice, immunodeficient, 6-8 weeks old, 3 mice per group.

For tumor model preparation, use 2 doses of 25G needle and syringe per mouse, 2 x 10
^A 0.1 ml inoculum of ⁶ A549 cells was inoculated subcutaneously in the right flank. The mice were not anesthetized for inoculation.

Tumor size was measured to the nearest 0.1 mm for tumor volume measurement and randomization. Tumor volume, formula was calculated using the tumor volume = length × width ^2/2. Tumor volume was monitored twice weekly. Mice were assigned to groups at various time points when the established tumors reached approximately 350-600 mm ³ .
On the same day, the test article was administered according to the dosing regimen.

The test article was removed from the 4 ° C. refrigerator on the day when the established tumors reached about 350-600 mm ³ for dose administration. Before applying to the syringe, the bottle containing the formulation was handed back several times to make a homogeneous solution.

For body weight, mice were weighed to the nearest 0.1 g. Body weight was monitored for several weeks and recorded twice weekly for the remaining weeks including the end of the study.

Animals were sacrificed with excess CO ₂ for tumor collection and tumors were dissected at 0, 24, 48, 72 and 96 (optional) and 168 hours post dose. Tumors were initially wetted and divided into three parts for KD, distribution and biomarker analysis. The samples were flash frozen in liquid nitrogen and stored at -80 0 C until ready to be processed.

Example 13: GST-π siRNAs of the Invention Inhibited Pancreatic Cancer Xenograft Tumors In Vivo. G
ST-π siRNA resulted in gene knockdown efficacy in vivo when administered to pancreatic cancer xenograft tumors in a liposomal formulation.

In this xenograft model, each mouse was inoculated subcutaneously in the right flank with 0.1 ml of a 2.5 × 10 ⁶ PANC-1 cell inoculum. Athymic nude female mice (6-8 weeks old, Charles River) were used. Tumor size was measured to the nearest 0.1 mm. When the established tumors reach about 150-250 mm ³ (mean tumor volume about 200 mm ³ ), mice are varied such that the mean tumor volume of the treatment group is within 10% of the mean tumor volume in the vehicle control group. Assigned to vehicle control and treatment groups. On the same day, test article and control vehicle were administered according to the dosing regimen. Tumor volumes three times a week,
The remaining weeks were monitored twice, including the study end date.

FIG. 6 shows the tumor inhibitory potency of GST-π siRNA (SEQ ID NO: 63 and 128). As shown in FIG. 6, dose responses were obtained at doses ranging from 0.375 mg / kg to 3 mg / kg of siRNA targeting GST-π. GST-π siRNA showed significant and unexpectedly advantageous tumor inhibitory potency within several days after administration. Thus, GST-π siRNA showed significant and unexpectedly advantageous tumor inhibition efficacy at the endpoint.

GST-πsiRNA, composition (ionizable lipid: cholesterol: DOPE: DOPC: DPPE-PE
G-2K) (25: 30: 20: 20: 5) was administered in a liposome formulation.

Example 14: GST-π siRNA of the invention showed increased serum stability.
Figure 7 shows the incubation in human serum and the remaining at various time points by HPLS / LCMS.
The detection of siRNA is shown. As shown in Figure 7, the half-lives (t1 _{/ 2} ) in the serum of both the sense strand (Figure 7, top row) and the antisense strand (Figure 7, bottom row) of GST-pi siRNA (SEQ ID NO: 63 and 128) Was about 100 minutes.

Example 15: GST-π siRNAs of the Invention Showed Improved Stability in Formulation in Plasma
Figure 8 shows incubation of the formulation in plasma and detection of the remaining siRNA at various time points. As shown in FIG. 8, the plasma half-life (t _1/2 ) of the GST-π siRNA formulations (SEQ ID NO: 63 and 128) was significantly longer than 100 hours.

GST-πsiRNA, composition (ionized lipid: cholesterol: DOPE: DOPC: DPPE-PEG-2K)
It was prepared with a liposome formulation having (25: 30: 20: 20: 5). The z-average size of the liposomal nanoparticles was 40.0 nm and the siRNA was 91% encapsulated.

The formulations were incubated in 50% human serum in PBS for 40 minutes, 1.5 hours, 3 hours, 24 hours and 96 hours. The amount of GST-π siRNA was determined by ELISA based assay.

Example 16: GST-π siRNA of the present invention showed a reduction in off-target effect by passenger strand.

For GST-.pi. SiRNA (SEQ ID NO: 158 and 184), FIG. 9 shows that the in vitro knockdown for the guide strand was approximately exponential compared to the control with the scrambled sequence that showed no effect. There is. The IC50 of this siRNA was measured at 5 pM. Figure 10 shows the same GST-
In vitro knock down of passenger strand of π siRNA is shown. As shown in FIG. 10, off-target knockdown of passenger strand was reduced by more than 100-fold for GST-π siRNA.

GST-π siRNA (SEQ ID NO: 189 and 201), (SEQ ID NO: 191 and 203) and (SEQ ID NO: 192 and
With regard to 204), FIG. 11 shows that in vitro knockdown of the guide strand was approximately exponential. The IC50s of these siRNAs were measured at 6, 7 and 5 pM, respectively. As shown in FIG. 12, the in vitro knockdown of the passenger strand of these GST-π siRNAs was significantly reduced by at least 10-fold. All these GST-π siRNAs had deoxynucleotides in the seed region of the duplex region and no other modifications in the duplex region.

For GST-π siRNA (SEQ ID NOs: 219 and 234), FIG. 13 shows that the in vitro knockdown for this highly active GST-π siRNA guide strand was approximately exponential.
The IC50 of this siRNA was measured at 11 pM. As shown in FIG. 14, the in vitro knockdown of the passenger strand of this GST-π siRNA was significantly reduced by more than 100-fold. This GST-πsiR
The NA had deoxynucleotides in the seed region of the duplex region and no other modifications in the duplex region.

Off-target effects were determined using the expression reporter plasmid psiCHECK-2 encoding the Renilla luciferase gene (Dual luciferase reporter assay system, Promega, Cat. No .: E1960). The siRNA concentration was typically 50 pM. Protocol: Day 1, were seeded HeLa cells in 5~7.5 × 10 ³ / 100μl / well. Day 2, co-transfection at approximately 80% cell confluence. On the third day, cells were harvested and luciferase activity was measured. Luciferase activity was measured using Promega's luciferase assay system (E4550) according to the manufacturer's protocol.

The psiCHECK-2 vector can monitor changes in expression of target genes fused to the reporter gene of Renilla luciferase. The siRNA construct was cloned into the multiple cloning region and the vector was cotransfected into HeLa cells with the siRNA. When a particular siRNA binds to the target mRNA and initiates the RNAi process, the fusion Renilla luciferase: construction mRNA is cleaved and subsequently degraded, reducing the Renilla luciferase signal.

For example, a plasmid insert for siRNA having the BU2 ′ structure was as follows:
PsiCHECK-2 (F) plasmid insert:
SEQ ID NO: 288
ctcgag gggcaacTGAAGCCTTTTGAGACCCTG cTgTcccag gcggccgc
PsiCHECK-2 (R) plasmid insert:
SEQ ID NO: 289
ctcgag cTgggcagCAGGGTCTCAAAAGGCTTCagTT gccc gcggccgc

Example 17: The GST-π siRNA of the present invention showed that the miRNA-like off-target effect was advantageously reduced, which is seed-independent unintended off-target gene silencing.

GST-π siRNA (SEQ ID NOS: 158 and 184), (SEQ ID NOS: 189 and 201), (SEQ ID NOS: 191 and 20)
3), (SEQ ID NOS: 192 and 204) and (SEQ ID NOS: 219 and 234), the off-target activities that mimic miRNAs proved to be essentially negligible. The seed-dependent unintended off-target gene silencing of these GST-π siRNAs was at least 10-fold to 100-fold less than the targeting activity of the guide strand.

In order to test miRNA-related off-target effects, the remaining non-seed region (positions 9 to 21) complementary to the entire seed-containing region, which is the position 1 to 8 of the 5 'end of the antisense strand
A non-complementary, 1-4 repeat seed-matched target sequence was introduced into the region corresponding to the 3'UTR of luciferase mRNA to determine the efficiency of the seed-independent unintended off-target effect. The plasmid insert was used to mimic miRNA with a perfect match in the seed region and a mismatch (bulge) in the non-seed region.

For example, the plasmid insert for siRNA having the BU2 ′ structure was as follows:
PsiCHECK-2 (Fmi1) plasmid insert:
SEQ ID NO: 290
ctcgag gggcaacTCTACGCAAAACAGACCCTG cTgTcccag gcggccgc
PsiCHECK-2 (Fmi2) plasmid insert:
SEQ ID NO: 291
ctcgag gggcaacTCTACGCAAAACAGACCCTG cT CTACGCAAAAACAGACCCTG cT gTcccag gcggccgc
PsiCHECK-2 (Fmi3) plasmid insert:
SEQ ID NO: 292
ctcgag gggcaacTCTACGCAAAACAGACCCTGcT CTACGCAAAAACAGACCCTGcT CTACGCAAAAACAGACCCTGcT
gTcccag gcggccgc
PsiCHECK-2 (Fmi4) plasmid insert:
SEQ ID NO: 293
ctcgag gggcaacTCTACGCAAAACAGACCCTGcT CTACGCAAAAACAGACCCTGcT CTACGCAAAAACAGACCCTG
cT CTACGCAAACAGACCCTG cT gTcccag gcggccgc

Additional Definitions The terms used herein generally have their ordinary meaning in the art, within the context of the present invention, and in the specific context in which each term is used. It is not particularly important whether the terms have been described in detail or are discussed herein. The description of the embodiments in the present disclosure is merely illustrative and does not in any way limit the scope and meaning of the present invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The following references can provide a general definition of specific terms used in the present invention: Sing
Leton et al., Dictionary of Microbiology and Molecular Biology (2nd edition, 1994); Cambridge Technical Dictionary (Walker ed., 1988); R. Rieger et al., The Genetics, 5th Ed.
(Ed.), Springer Verlag (1991); Hale & Marham, The Harper Collins Dictionary of
Biology (1991)

"Neoplasia" can mean any disease caused or resulting from inappropriate high levels of cell division, inadequate low levels of apoptosis, or both. For example, cancer is an example of a neoplasm. The cancer may be, for example, acute leukemia, acute lymphocytic leukemia, acute myelogenous leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia,
Acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, erythrocytosis, lymphoma (Hodgkin's disease, non-Hodgkin's disease)
, Leukemia such as Waldenstrom macroglobulinemia, heavy chain disease, and non-epithelial malignancy (sarcoma) and epithelial malignancy (fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma,
Chordoma, hemangiosarcoma, endothelial sarcoma, lymphangiosarcoma, lymphatic ductal sarcoma, synovial tumor, mesothelioma, Ewing tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, Prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat adenocarcinoma, sebaceous adenocarcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, cystic adenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, liver cancer, cholangiocarcinoma, villous Cancer, seminoma, embryonal carcinoma, Wilms tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharynx, Solid tumors such as ependymoma, pineal tumor, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, meningioma, melanoma, neuroblastoma and retinoblastoma) are included. Lymphoproliferative disorders are also considered to be proliferative diseases.

"Nucleic acid" means an oligomer or polymer of ribonucleic acid or deoxyribonucleic acid or an analogue thereof. The term includes oligomers consisting of naturally occurring bases, sugars and intersugar (backbone) linkages as well as oligomers having non-naturally occurring moieties that function in a similar manner. Such modified or substituted oligonucleotides are often preferred over the native form due to properties such as, for example, improved stability in the presence of nucleases.

By "substantially identical" is meant that the protein or nucleic acid molecule is a reference amino acid sequence (e.g., any one of the amino acid sequences described herein) or a nucleic acid sequence (e.g., a nucleic acid described herein) It is meant to show at least 50% identity with the sequence). Preferably, such a sequence is at least 60 at the amino acid level or nucleic acid to the sequence used for comparison.
%, More preferably 80% or 85%, even more preferably 90%, 95% or even 99% identical.

Sequence identity is typically sequence analysis software (eg Genetics Computer Grou
p Sequence Analysis software package, University of Wisconsin Biotechnolog
y Centre, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or
Measured using the PILEUP / PRETTYBOX program). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; It is. An exemplary approach for determining the degree of identity is e- ³ and e- ¹
BLAST programs can be used in which probability scores between ⁰⁰ and ⁰⁰ indicate sequences that are closely related.

"Inhibitory nucleic acid" means single- or double-stranded RNA, siRNA (short interfering RNA), shRNA (short hairpin RNA) or antisense RNA or a portion thereof or a mimic thereof, administered to mammalian cells Results in decreased expression of the target gene (eg, 10%, 25%,
50%, 75% or even 90-100%). Typically, the nucleic acid inhibitor comprises or corresponds to at least a portion of the target nucleic acid molecule or its ortholog, or comprises at least a portion of the complementary strand of the target nucleic acid molecule.

An "antisense nucleic acid" binds to target RNA through RNA-RNA or RNA-DNA interactions,
By non-enzymatic nucleic acid molecule that alters the activity of target RNA (for review see Stein et al. 1993; W
oolf et al., U.S. Patent No. 5,849,902). Typically, the antisense molecule is complementary to the target sequence and is along a single contiguous sequence of the antisense molecule. However, in certain embodiments, the antisense molecule can be attached to the substrate such that the substrate molecule forms a loop and / or the antisense molecule binds and the antisense molecule forms a loop. Thus, the antisense molecule may be complementary to two (or more) non-contiguous substrate sequences, or two (or more) non-contiguous sequence portions of the antisense molecule may be target sequences or Both may be complementary. Schmajuk N for a review of current antisense strategies
A et al., 1999; Delihas N et al., 1997; Aboul-Fadl T, 2005.

The term "siRNA" refers to small interfering RNA. An siRNA is a double stranded RNA that "corresponds" or corresponds to a reference or target gene sequence. This matching need not be as complete as each strand of the siRNA can bind to at least a portion of the target sequence. siRNA can be used to inhibit gene expression (eg, Bass, 2001, Nature, 411, 428, 429; Elbashi
r et al., 2001, Nature, 411, 494, 498; and Zamore et al., Cell 101: 25-33 (2000)).

The embodiments described herein are not limiting, and one of ordinary skill in the art would not have undue experimentation to identify specific combinations of the modifications described herein with nucleic acid molecules having improved RNAi activity. It can be easily understood that it can be tested.

All publications, patents and publications specifically mentioned herein are incorporated by reference in their entirety for all purposes.

It is understood that the present invention is not limited to the particular methodology, protocols, materials, and reagents described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention. Various substitutions and modifications may be made to the description disclosed herein without departing from the scope and spirit of the description, and these embodiments are within the scope of this description and the appended claims. It is very clear to the person skilled in the art.

It should be noted that the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise. Similarly, the terms "a" (or "an"), "one or more" and "
At least one "can be used interchangeably herein. The term "include (com
"prises", "comprising", "containing", "including"
g) and "having" can be used interchangeably and should be read broadly and without limitation.

The recitation of ranges of values herein is intended to serve as a shorthand method of referring individually to each separate value within the range, unless the context indicates otherwise. Values are incorporated as if individually listed. Here, for a Markush group, one skilled in the art will recognize that this description includes individual members as well as subgroups of Markush group members.

Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. Accordingly, the following specific embodiments are to be construed as illustrative only and in no way limit the remainder of the present disclosure.

All of the features disclosed herein can be combined in any combination.
Each feature disclosed herein can be replaced with an alternative feature serving the same, equivalent, or similar purpose.

Claims (31)

For the treatment or treatment of a tumor associated with a mutation of the KRAS gene or overexpression of the wild-type KRAS gene, comprising an RNAi molecule comprising a nucleotide sequence corresponding to a GST-π target sequence and a pharmaceutically acceptable excipient Pharmaceutical composition for. 2. The pharmaceutical composition of claim 1, wherein the RNAi molecule has a duplex region comprising a nucleotide sequence corresponding to the target sequence of SEQ ID NO: 287. An antisense strand, wherein said RNAi molecule comprises a nucleotide sequence corresponding to SEQ ID NO: 184;
The pharmaceutical composition according to claim 1, having a sense strand comprising a nucleotide sequence corresponding to SEQ ID NO: 158.   The pharmaceutical composition according to claim 1, wherein the RNAi molecule is a siRNA or a shRNA. The pharmaceutical composition of claim 1, wherein the pharmaceutically acceptable excipient comprises one or more lipid compounds.   The pharmaceutical composition according to claim 1, wherein the pharmaceutically acceptable excipient comprises lipid nanoparticles. The pharmaceutical composition according to claim 1, wherein the pharmaceutically acceptable excipient comprises lipid nanoparticles encapsulating an RNAi molecule. A method of preventing, treating or ameliorating one or more symptoms of malignancy associated with a KRAS mutation in a mammal in need thereof,
Identifying a mammalian tumor cell comprising (i) at least one of mutation of KRAS gene and (ii) abnormal expression level of KRAS protein; and reducing expression of GST-π in said mammal Administering a therapeutically effective amount of a composition comprising one or more active RNAi molecules.   9. The method of claim 8, wherein said mammal is a human and said GST-.pi. Is human GST-.pi.   9. The method of claim 8, wherein the RNAi molecule is a siRNA or a shRNA. 9. The method of claim 8, wherein the RNAi molecule has a duplex region comprising a nucleotide sequence corresponding to the target sequence of SEQ ID NO: 287. An antisense strand, wherein said RNAi molecule comprises a nucleotide sequence corresponding to SEQ ID NO: 184;
9. The method of claim 8, having a sense strand comprising a nucleotide sequence corresponding to SEQ ID NO: 158. 9. The method of claim 8, wherein the RNAi molecule reduces expression of GST-π in the mammal. 9. The method of claim 8, wherein said administration reduces expression of GST-pi in the mammal by at least 5 days for at least 5 days. Said administration is at least 5%, or at least 10%, of the malignancy of said mammal
Or at least 20%, or at least 30%, or at least 40%, or at least 50%
9. The method of claim 8, wherein said reducing. 9. The method of claim 8, wherein the method reduces one or more symptoms of the malignancy, or delays or terminates the progression of the malignancy. 9. The method of claim 8, wherein said administration reduces the growth of malignant tumor cells in said subject. Said administration is at least 2%, or at least 5% of the malignant tumor cells in said subject,
9. The method of claim 8, wherein the growth is reduced by at least 10%, or at least 15%, or at least 20%. 9. The method according to claim 8, wherein the tumor cells have an increased expression level of wild type KRAS protein as compared to normal cells. 9. The method of claim 8, wherein the tumor cells overexpress wild type GST-π RNA or protein. 9. The method of claim 8, wherein the tumor cell has a mutation in the KRAS protein at one or more of residues 12, 13 and 61. The method according to claim 8, wherein the tumor cell comprises a mutation in KRAS protein, and the tumor is a cancer selected from lung cancer, colon cancer and pancreatic cancer. The method according to claim 8, wherein the tumor cell is a sarcoma containing a mutation in the KRAS protein, and the tumor is selected from the group consisting of lung adenocarcinoma, mucinous adenoma, pancreatic ductal adenocarcinoma and colorectal cancer. The method according to claim 8, wherein the malignant tumor is a sarcoma selected from the group of lung adenocarcinoma, mucinous adenoma, pancreatic ductal adenocarcinoma, colon cancer, breast cancer and fibrosarcoma. 9. The method of claim 8, wherein the malignancy is located in an anatomical region selected from the group of lung, colon, pancreas, gallbladder, liver, breast and any combination thereof.   9. The method of claim 8, wherein the administration is performed 1 to 12 times a day.   9. The method of claim 8, wherein said administration is for a period of 1, 2, 3, 4, 5, 6 or 7 days. 9. The method of claim 8, wherein said administration is for a period of 1, 2, 3, 4, 5, 6, 8, 10 or 12 weeks. 9. The method of claim 8, wherein the administration is a dose of 0.01-2 mg / kg of the RNAi molecule at least once daily for a period of up to 12 weeks. 9. The method of claim 8, wherein said administration is for the GST-pi RNAi molecule an average AUC (0-final) of 1 to 1000 μg * min / mL and an average C _max of 0.1 to 50 μg / mL. The method according to claim 8, wherein the administration is intravenous injection, intradermal injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, oral, topical, infusion or inhalation.

Images