TW201823268A - Recombinant polypeptides and nucleic acid molecules, compositions, and methods of making and uses thereof - Google Patents

Abstract

The present disclosure provides recombinant polypeptides, homodimeric and heterodimeric proteins comprising the recombinant polypeptides, nucleic acid molecules encoding the recombinant polypeptides, and vectors and host cells comprising the nucleic acid molecules. The present disclosure also provides compositions comprising the recombinant polypeptides and methods of making the recombinant polypeptides.

Description

   Recombinant polypeptide, nucleic acid molecule and composition thereof, and method for making and using same   

The present invention relates to a recombinant polypeptide, a nucleic acid molecule and a composition thereof, and a method for manufacturing and using the same, and particularly to a recombinant polypeptide, a nucleic acid molecule and a composition thereof having an ability to induce alkaline phosphatase activity, and a method for manufacturing and using the same.

Bone is a highly rigid tissue with unique mechanical properties that form part of the spine bones, which is derived from its extensive matrix structure. During the life of an animal, bone tissue is constantly renewed.

The process of osteogenesis and regeneration is performed by individually specialized cells. Osteogenesis (osteogenesis or bone growth) is performed by osteoblasts (osteoblasts). Bone remodeling is accomplished by the interaction between bone-resorbing cells called osteoclasts and bone-forming osteoblasts. Because these processes are performed by specific living cells, chemical (eg, drugs and / or hormones), physical and physicochemical changes can affect the quality, quantity, and shape of bone tissue.

Various growth factors (eg, PDGF) and cellular mediators are involved in the process of osteogenesis. Therefore, it is valuable to identify physiologically acceptable chemical mediators (such as hormones, drugs, growth factors, and cellular mediators) that can induce osteogenesis at predetermined sites. However, to successfully use chemical media as a therapeutic tool, several obstacles need to be overcome. One of the obstacles includes the development of recombinant polypeptides with osteoinductive activity. For example, osteogenic activity in recombinant human platelet-derived growth factor-BB has not been demonstrated. Another obstacle is bone-induced variability in chemical media. For example: demineralized bone matrix (DBM) is a chemical medium, a bone-induced allograft derived from processed bone. There are more and more DBM-based products on the market, but bone-induced variability has been found between different products and different batches of the same product. Therefore, there is a need for a chemical medium that exhibits consistent osteogenic activity, such as recombinant polypeptides and related compositions.

The present invention discloses a recombinant polypeptide comprising: a first domain selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 39; a second domain selected from the group consisting of SEQ ID A group consisting of NO: 47 and SEQ ID NO: 49; and a third domain selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 61; wherein the second domain comprises a molecule Internal disulfide bond.

The invention also discloses a recombinant polypeptide comprising: a first domain selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 39; a second domain selected from the group consisting of SEQ ID NO: A group consisting of 47 and SEQ ID NO: 49; and a third domain selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 61; wherein the second domain is included in the first One intramolecular disulfide bond between the 23 amino acids and the 27th amino acid of the second domain.

In one embodiment, the recombinant polypeptide is capable of inducing alkaline phosphatase activity.

In an embodiment, the third domain of the recombinant polypeptide includes: a first amino acid sequence PKACCVPTE (SEQ ID NO: 356) and a second amino acid sequence GCGCR (SEQ ID NO: 357), and The third domain contains two intramolecular disulfide bonds between the first and second amino acid sequences.

In one embodiment, the recombinant polypeptide comprises: a first between the fourth amino acid of the first amino acid sequence and the second amino acid of the second amino acid sequence. Intramolecular disulfide bond, and a second intramolecular disulfide bond between the fifth amino acid of the first amino acid sequence and the fourth amino acid of the second amino acid sequence .

In one embodiment, the recombinant polypeptide comprises: a first between the fifth amino acid of the first amino acid sequence and the second amino acid of the second amino acid sequence. Intramolecular disulfide bond, and a second intramolecular disulfide bond between the fourth amino acid of the first amino acid sequence and the fourth amino acid of the second amino acid sequence .

The present invention also discloses a homodimer protein comprising two identical recombinant polypeptides of any one of the recombinant polypeptides as described above, wherein the homodimer protein is contained in the first domains of the two recombinant polypeptides. An intermolecular disulfide bond.

In one embodiment, the second domain of a single or all two of the two identical recombinant polypeptides of the homodimer protein comprises an intramolecular disulfide bond.

In an embodiment, the third domain of each of the recombinant polypeptides of the homodimer protein comprises: a first amino acid sequence PKACCVPTE (SEQ ID NO: 356) and a second amino acid sequence GCGCR (SEQ ID NO: 357), and wherein the homodimer protein comprises: the first amino acid sequence in the third domain of the two one of the recombinant polypeptides and the first amino acid sequence of the other recombinant polypeptide Two intermolecular disulfide bonds between the second amino acid sequence in the three domains. In one embodiment, the homodimer protein comprises: the fourth amino acid in the first amino acid sequence of the two recombinant polypeptides and the second amino acid in the other recombinant polypeptide. One of the first intermolecular disulfide bond between the second amino acid sequence of the amino acid sequence, and the fifth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides And a second intermolecular disulfide bond between the fourth amino acid of the second amino acid sequence of the other recombinant polypeptide. In one embodiment, the homodimer protein comprises: the fifth amino acid of the first amino acid sequence of the two recombinant polypeptides and the second amino acid of the other recombinant polypeptide. One of the first intermolecular disulfide bonds between the second amino acid sequence of the second amino acid sequence, and the fourth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides And a second intermolecular disulfide bond between the fourth amino acid of the second amino acid sequence of the other recombinant polypeptide.

In an embodiment, the third domain of each of the recombinant polypeptides of the homodimer protein comprises: a first amino acid sequence PKACCVPTE (SEQ ID NO: 356) and a second amino acid sequence GCGCR (SEQ ID NO: 357), and wherein the homodimer protein comprises: the first amino acid sequence in the third domain of the two one of the recombinant polypeptides and the first amino acid sequence of the one of the recombinant polypeptides Two intramolecular disulfide bonds between the second amino acid sequence in the three domains. In one embodiment, the homodimer protein comprises: the fourth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides and the second amino acid of the one of the recombinant polypeptides. One of the first intramolecular disulfide bond between the second amino acid of the amino acid sequence, and the fifth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides And a second intramolecular disulfide bond between the fourth amino acid of the second amino acid sequence of the recombinant polypeptide. In one embodiment, the homodimeric protein comprises: a fifth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides and the second amine of the one recombinant polypeptide. One of the first intramolecular disulfide bonds between the second amino acid sequence of the amino acid sequence, and the fourth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides and A second intramolecular disulfide bond between the fourth amino acid of the second amino acid sequence of the one recombinant polypeptide.

The present invention also discloses a heterodimer protein comprising two distinct recombinant polypeptides of any one of the recombinant polypeptides as described above, wherein the heterodimer protein comprises: An intermolecular disulfide bond between the first domains.

In one embodiment, the second domain of the single or all two of the one or two different heterogeneous recombinant polypeptides of the heterodimer protein comprises an intramolecular disulfide bond.

The invention also discloses a recombinant polypeptide, which comprises a first domain selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 39; a second domain selected from the group consisting of SEQ ID A group consisting of NO: 47 and SEQ ID NO: 49; and a third domain selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 61; wherein the recombinant polypeptide comprises an amino group Acid sequence, the amino acid sequence is selected from the group consisting of SEQ ID NO: 260, SEQ ID NO: 268, SEQ ID NO: 276, SEQ ID NO: 284, SEQ ID NO: 292, SEQ ID NO: 300, SEQ ID NO : 308, a group consisting of SEQ ID NO: 316, SEQ ID NO: 324, SEQ ID NO: 332, SEQ ID NO: 340, and SEQ ID NO: 348.

The present invention also discloses a recombinant polypeptide comprising a monoamino acid sequence, the amino acid sequence is selected from the group consisting of SEQ ID NO: 260, SEQ ID NO: 268, SEQ ID NO: 276, SEQ ID NO: 284, SEQ ID NO: 292, SEQ ID NO: 300, SEQ ID NO: 308, SEQ ID NO: 316, SEQ ID NO: 324, SEQ ID NO: 332, SEQ ID NO: 340 and SEQ ID NO: 348 Wherein the recombinant polypeptide comprises an intramolecular disulfide bond between cysteine 44 and cysteine 48.

In one embodiment, the recombinant polypeptide comprises: an intramolecular disulfide bond between cysteine 79 and cysteine 112, and between cysteine 80 and cysteine 114 An intramolecular disulfide bond.

In one embodiment, the recombinant polypeptide comprises: an intramolecular disulfide bond between cysteine 80 and cysteine 112, and between cysteine 79 and cysteine 114 An intramolecular disulfide bond.

The present invention also discloses a homodimer protein comprising two identical recombinant polypeptides of any one of the recombinant polypeptides described above.

In one embodiment, the homodimer protein comprises an intermolecular disulfide bond between cysteine 15 of one of the two recombinant polypeptides and cysteine 15 of the other recombinant polypeptide. . In one embodiment, the homodimer protein comprises: (a) a molecule between the two recombinant polypeptides of cysteine 79 and the other recombinant polypeptide of cysteine 112 An intermolecular disulfide bond, and an intermolecular disulfide bond between cysteine 80 of one of the two recombinant polypeptides and cysteine 114 of the other recombinant polypeptide; or (b) between the two One intermolecular disulfide bond between cysteine 80 of one of the recombinant polypeptides and cysteine 112 of the other recombinant polypeptide, and cysteine 79 of the two recombinant polypeptides An intermolecular disulfide bond with cysteine 114 of the other recombinant polypeptide.

The invention also discloses an isolated nucleic acid molecule comprising a polynucleotide sequence encoding any one of the recombinant polypeptides as described above.

The present invention also discloses a recombinant nucleic acid molecule comprising an expression control region operably linked to the isolated nucleic acid molecule as described above.

The invention also discloses an isolated host cell comprising an isolated nucleic acid molecule as described above or a recombinant nucleic acid molecule as described above.

The present invention also discloses a method for preparing a recombinant vector, which comprises inserting the isolated nucleic acid molecule as described above into a vector.

The present invention also discloses a method for preparing a recombinant host cell, which comprises introducing an isolated nucleic acid molecule as described above or a recombinant nucleic acid molecule as described above into a host cell.

The present invention also provides a method for manufacturing a recombinant polypeptide, comprising: culturing the isolated host cell as described above, and isolating the recombinant polypeptide.

The invention also provides a composition comprising any of the recombinant polypeptides as described above, any of the homodimer proteins as described above, or any of the heterodimer proteins as described above.

Figures 1A and 1B show representative X-ray images of the ulna of female rabbits (NZW strain) of experimental groups A-G. The ulna in each experimental group contained a 20 mm large circumferential defect (ie, the defect site) created by surgery. For group A-F, a graft was placed in the defect site. In the AE group, each ulna received a 200 mg β-TCP implant. The β-TCP lines in A, B, C, and D were used as 2, 6, 20, and 60 μg of the recombinant polypeptide (ie, SEQ ID NO: 260). Carrier. The β-TCP in group E does not carry any recombinant polypeptide. Group F received a sacrum autograft. Group G did not receive any graft at the defect site. For each group of AG at 0 weeks (that is, immediately after surgery, indicated by "0W"), and at 2, 4, 6, and 8 weeks after surgery (that is, "2W", "4W", "6W", and "8W" indicates) to take X-ray images. The implant site (group A-F) or defect site (group G) on the ulna is located directly above the white asterisk in each image.

Figures 2A and 2B show representative computer tomography (CT) images of experimental groups A-G. The change in the cross-sectional image of the center of the implantation site (AF group) or the defect site (Group G) with time is displayed as 0 weeks (that is, immediately after surgery, indicated by "0W"), and 4 weeks after surgery and 8 weeks (represented by "4W" and "8W" respectively). The A-G group is as described in Fig. 1 above.

Figure 3 shows the torsional strength test results of the ulna and the experimental A-G groups (ie, indicated by "A" to "G", respectively) without surgical modification without defects. Maximum torque is Newton-meters (N-m). Groups A-G are as described above in Figure 1.

The invention provides a recombinant polypeptide, a homodimer and a heterodimer protein comprising the recombinant polypeptide, a nucleic acid molecule and a vector encoding the recombinant polypeptide, and a host cell expressing the recombinant polypeptide. The invention also provides a composition of the recombinant polypeptide and a method for manufacturing the recombinant polypeptide.

The entire contents of all publications cited herein are incorporated herein by reference, including but not limited to all journal articles, books, manuals, patent applications and patents cited herein, to the same extent and scope as if they were individually and individually published Things are incorporated by reference.

[Specific term]

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used in this application, the following terms have the following meanings.

Unless specified otherwise in context, the singular forms "a", "an", "an" and "the" include plural referents in the singular forms described herein and in the scope of the patent application. Therefore, for example, "a domain" includes one domain or a plurality of domains, "the recombinant polypeptide" includes one or more recombinant polypeptides, and the like. Terms such as: "a", "the", "one or more", "plurality" and "at least one" are interchangeable.

Unless otherwise stated, "or" as used herein means "and / or". Similarly, the terms "including", "including", "containing", "including", and "having" described herein may be substituted without restriction.

In addition, the terms "and / or" and "and / or" are used herein to specifically express one or both of two particular features or compositions. Therefore, the term "and / or" is used to express a sentence such as "A and / or B" including "A and B", "A or B", "(separate) A", "(separate) B". Similarly, the term "and / or" is used to express a sentence such as "A, B, and / or C" which includes the meanings described below: A, B and C; A, B or C; A or C; A Or B; B or C; A and C; A and B; B and C; (alone) A; (alone) B; (alone) C.

It should be understood that the term "comprising" in this document, when describing any aspect, also provides similar meanings as described in the terms "consisting of" and / or "consisting essentially of".

An `` amino acid '' is a type having a central carbon atom (α-carbon atom) connected to a hydrogen atom, a carboxylic acid group (the carbon atom is referred to herein as a "carboxylic acid carbon atom"), a amine group (the A nitrogen atom is referred to herein as an "amino nitrogen atom") and a molecule of the structure of a side chain R group. When incorporated into a peptide, polypeptide, or protein, an amino acid loses one or more atoms on its amino acid carboxylic acid group in a dehydration reaction, linking one amino acid to another amino acid. Therefore, when incorporated into proteins, amino acids are referred to as "amino acid residues".

"Protein" or "polypeptide" means any polymer (whether naturally occurring or not) that links two or more individual amino acids by peptide bonds and occurs when combined with a monoamino acid (or amino acid residue) The carboxylic acid carbon atom on the α-carbon atom bonded carboxylic acid group becomes a covalent bond to the amine nitrogen atom of the amine group bonded to a non-α-carbon atom on an adjacent amino acid. The "protein" includes the meanings of "polypeptide" and "peptide" (the terminology will be used interchangeably). In addition, proteins that contain multiple polypeptide subunits (eg, DNA polymerase III, RNA polymerase II) or other components (eg, RNA molecules, which also occur in telomerase) are also understood herein. It means "protein". Similarly, fragments of proteins and polypeptides are also involved in the category of "proteins" disclosed herein. In one aspect, the polypeptides disclosed herein comprise a chimera of two or more parental peptides. The term "polypeptide" also refers to and includes products of peptide post-translation modification (PTM), including but not limited to disulfide bond generation, saccharification, carbamylation, lipidation, acetylation, phosphorylation, hydrazone Amination, derivation of known protecting / blocking groups, cleavage of proteins, modification with non-natural amino acids, or any other regulation or modification, such as conjugation with a labeling composition. Polypeptides can be derived from natural biological sources or produced by genetic recombination technology. It does not need to be translated from a specific nucleic acid sequence, and can be generated by any method, including chemical synthesis. An "isolated" polypeptide or fragment, variant or derivative refers to a polypeptide that is not in its natural environment. No specific degree of purification is required. For example, an isolated polypeptide can be simply removed from its natural or natural environment. For the purposes of this disclosure, recombinantly produced polypeptides and proteins expressed in host cells are considered to be isolated as if the natural or recombinant polypeptides had been isolated, fractionated, partially or substantially purified by any suitable technique.

The "domain" described herein can be replaced by the term "peptide", which refers to a protein or a larger polypeptide or a fragment of a protein. The domain need not have its own functional activity, in some examples the domain may have its own biological activity.

The specific amino acid sequence of a given protein (i.e. the "main structure" of the polypeptide when written from the amine end to the carboxylic acid end) is determined by the nucleotide sequence of the coding portion of the mRNA, which is in turn determined by Genetic information to indicate, usually genetic DNA (including organelle DNA such as mitochondrial or chloroplast DNA). Therefore, determining the sequence of a gene is helpful in predicting the main sequence of the corresponding polypeptide, and more particularly in predicting the action or activity of the polypeptide or protein via the encoding of the gene or polynucleotide sequence.

As used herein, "N-terminus" refers to the orientation or position of an amino acid, domain, or peptide in a polypeptide relative to the amino terminus on the polypeptide. For example: "The A domain is located at the N-terminus of the B and C domains" means that the A domain is located closer to the amine end than the B and C domains. Thus, when the positions of the B and C domains are not specifically specified, The sequence of peptides from the amino-terminal domain can be understood as ABC or ACB. In addition, any number of amino acids containing zero may be present between the N-terminal domain and another domain. Similarly, any number of amino acids containing zero may be present between the N-terminus of a polypeptide and the N-terminus of a domain that is the N-terminus of other domains in the polypeptide.

As used herein, the "C-terminus" refers to the orientation or position of an amino acid, domain, or peptide in a polypeptide relative to the carboxylic acid terminus on the polypeptide. For example: "A domain is located at the C-terminus of B and C domains" means that A domain is located at a position closer to the end of the carboxylic acid group than B and C domains, so when the positions of B and C domains are not specified The sequence of the polypeptide from the amine terminal domain can be understood as BCA or CBA. In addition, any number of amino acids containing zero may be present between the C-terminal domain and another domain. Similarly, any number of amino acids containing zero may be present between the C-terminus of a polypeptide and a domain that is the C-terminus of other domains in the polypeptide.

When referring to two or more domains broadly referring to the formation of a recombinant polypeptide by any chemical or physical method of coupling the two or more domains, the terms "fusion", "operably linked" and "operably linked" are used in This article can be replaced by each other. In one embodiment, the recombinant polypeptide disclosed herein is a chimeric polypeptide comprising a plurality of domains from two or more disparate polypeptides.

A recombinant polypeptide comprising two or more domains disclosed herein may be encoded by a single coding sequence comprising a polynucleotide sequence encoding each domain. Unless otherwise stated, the polynucleotide sequence encoding each domain is "in frame", so translation of a single mRNA containing the polynucleotide sequence would result in a single polypeptide containing each domain. In general, the domains in the recombinant polypeptides described herein will be fused directly to each other or linked by a peptide linker. Various polynucleotide sequences encoding peptide linkers are known in the art.

As used herein, "polynucleotide" or "nucleic acid" refers to a nucleotide in a polymerized form. In some cases, a polynucleotide comprises a sequence that is either either directly next to the coding sequence or directly next to it (at the 5 'terminal or the 3' terminal), which is a coding sequence derived from a organism's naturally occurring organism sequence. Thus, the term includes, for example, recombinant DNA incorporated into a vector, recombinant DNA incorporated into an autonomously replicating plastid or virus, or recombinant DNA incorporated into a prokaryotic or eukaryotic genome, or is independent of Other sequences are recombinant DNA that exist as isolated molecules (such as cDNA). The nucleotides described herein can be ribonucleotides, deoxyribonucleotides, or modified versions of one of the nucleotides. Polynucleotide as described herein refers in particular to single- and double-stranded DNA, single- and double-stranded mixed DNA, single- and double-stranded RNA, single- and double-stranded mixed RNA, or hybrids comprising DNA and RNA The DNA and RNA contained in the molecule or hybrid molecule can be single-stranded, more typically double-stranded or a mixture of single-stranded and double-stranded regions. Polynucleotides include genomic DNA or RNA (depending on the organism, ie, the RNA genomics of the virus) and mRNA encoded by the genomic DNA, and cDNA. In some embodiments, the polynucleotide comprises a traditional phosphodiester bond or a non-traditional bond (eg, an amidine bond, found in peptide nucleic acids (PNA)). "Isolated" nucleic acid or polynucleotide refers to a nucleic acid molecule such as DNA or RNA removed from its natural environment. For the purposes of this disclosure, for example, a nucleic acid molecule comprising a recombinant polypeptide contained in a polynucleotide encoding vector is considered "isolated." Other examples of isolated polynucleotides include recombinant polynucleotides maintained in a heterologous host cell or recombinant polynucleotides purified (in part or mostly) from other polynucleotides in solution. The isolated RNA molecule comprises an in vivo or in vitro RNA transcript of a polynucleotide disclosed in the present invention. The isolated polynucleotides or nucleic acids disclosed in accordance with the present invention further include synthetically produced polynucleotides and nucleic acids (eg, nucleic acid molecules).

The "coding region" or "coding sequence" described herein is part of a polynucleotide, which consists of codons that can be translated into amino acids. Although the "stop codon" (TAG, TGA, or TAA) is generally not translated into amino acids, it can be considered as part of the coding region, but any adjacent sequences such as: promoter, ribosome binding site, transcription termination Introns, introns, etc. are not part of the coding region. The boundaries of the coding region are generally determined by the start codon at the amine end of the resulting polypeptide, that is, at the 5 'end, and the translation stop codon at the carboxyl end of the polypeptide, which is at the 3' end, but the invention is not limited thereto.

"Expression control region" as used herein refers to a transcription control unit that is operatively combined with a coding region to guide or control the expression of a product encoded by the coding region, including, for example, promoters, enhancers, operons, and repressors , Ribosome binding site, translation leader sequence, intron, polyadenylation recognition sequence, RNA processing site, effector binding site, stem-loop structure and transcription termination signal. For example: if the induction of promoter function results in the transcription of an mRNA containing a coding region of a coding product, the coding region and the promoter are "operably combined", and if the linking nature of the promoter and coding region does not interfere with the promoter's guidance by the coding The ability of a region-encoded product to express or interfere with the transcription of a DNA template. The expression control region comprises a nucleotide sequence located either upstream (5 'non-coding sequence) or downstream (3' non-coding sequence) of the coding region, which affects the transcription, RNA processing, stability, or translation of the associated coding region. If the coding region is used for expression in a eukaryotic cell, the polyadenylation signal and transcription termination sequence are usually located at the 3 'end of the coding sequence.

"Nucleotide fragment", "oligonucleotide fragment" or "polynucleotide fragment" refers to a portion of a larger polynucleotide molecule. A polynucleotide fragment need not correspond to an encoded functional domain of a protein, however, in some cases, the fragment will encode a functional domain of a protein. Polynucleotide fragments can be about 6 or more nucleotides in length (e.g., 6-20, 20-50, 50-100, 100-200, 200-300, 300-400 or more nucleosides Acid length).

As used herein, a "vector" refers to any vehicle that transfects and / or transfers a nucleotide molecule into a host cell. The term "vector" includes viral and non-viral vectors for introducing nucleic acids into cells in vitro, ex vivo, or in vivo (eg, plastids, phages, adherents, viruses).

The terms "host cell" and "cell" described herein are interchangeable, and refer to any type of cell or cell population that carries or is capable of carrying nucleic acid molecules (such as recombinant nucleic acid molecules), such as: primary cells, culture systems Cell or cell line. The host cell may be a prokaryotic cell or a eukaryotic cell, for example, a fungal cell such as a yeast cell, various animal cells such as an insect cell, or a mammalian cell.

"Culture, to culture, cultivation" as described herein refers to incubating cells under in vitro conditions that allow the cells to grow, divide, or maintain the cells in a viable state. "Cultured cell" means a cell that has propagated in vitro.

As used herein, "osteoinductive" refers to the induction or formation of bone and / or cartilage, including, for example, the induction of markers related to bone and / or cartilage formation or growth (such as the induction of alkaline phosphatase active).

The terms "yeast two-hybrid test" or "yeast two-hybrid system" described herein can be used interchangeably, and refer to tests or systems used to detect interactions between protein pairs. In a typical two-hybrid screening test / system, the transcription factor splits into two separate fragments, namely the binding domain (BD) and the activation domain (AD). These fragments are each provided in an independent plasmid. In vivo and each of these fragments is fused to a protein of interest. The yeast two-hybrid test system includes (1) a "bait" vector, which includes a bait protein and a binding domain of the transcription factor used in the system; (2) a "prey" vector, which includes a prey protein (or a split Protein database is screened to interact with the bait protein) and the activation domain of the transcription factor; and (3) a suitable reporter yeast strain that contains binding sequences for use of the transcription factor in the system. Combine domain. When a bait-prey interaction occurs, the activation domain of the transcription factor drives expression of one or more reporter proteins. The bait and the prey vector are introduced into the reporter yeast strain, where the expressed bait and prey proteins may interact. Alternatively, independent haploid yeast strains each containing a bait vector or a prey vector may be paired, and the resulting diploid yeast strains express two proteins. The interacting bait and prey protein pairs will cause the recombination and activation of the transcription factor, and then combine with the activation domain provided in the reporter yeast strain that is compatible with it, trigger the expression of the reporter gene in turn, and then be detected.

[Recombinant polypeptide and composition]

The disclosure herein relates to a recombinant polypeptide comprising any two or more selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, The domains of the group consisting of 61, 63, 65, 67, 69, 71, 73, 75, 77, and 355 include, but are not limited to, any combination of the two domains shown in Table 3. In one embodiment, the recombinant polypeptide comprises any three domains, including but not limited to any combination of the three domains as shown in Table 3.

Any of the domains of the recombinant polypeptides described herein can be located at any position relative to the amine or carboxylic acid terminus of the recombinant polypeptide. For example, any domain of a recombinant polypeptide described herein may be located at the N-terminus of any one or more other domains in the recombinant polypeptide. Similarly, any domain of a recombinant polypeptide described herein can be located at the C-terminus of any one or more other domains in the recombinant polypeptide.

Disclosed herein is a recombinant polypeptide comprising any two or more selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, Domains of the group consisting of 65, 67, 69, 71, 73, 75, 77, and 355, which have higher activin receptor IIB protein (i.e., ActRIIBecd) cells than any individual domain in the recombinant polypeptide Affinity in Outland. The nucleic acid and polypeptide sequences of ActRIIBecd are known, as are naturally occurring variations. For example, ActRIIBecd may be SEQ ID NO: 9 described herein, which corresponds to residues 27-117 of SEQ ID NO: 8 described herein. Affinity can be measured by, for example, radioimmunoassay (RIA), surface plasmon resonance (e.g., BIAcore ^™ ), or any other binding assay known in the art. In some embodiments, the recombinant polypeptide comprises a combination of two domains, and the combination of the domains is selected from the group consisting of SEQ ID NO: 39 and SEQ ID NO: 49, SEQ ID NO: 49 and SEQ ID NO: 61, SEQ ID NO: 61 and SEQ ID NO: 39, SEQ ID NO: 35 and SEQ ID NO: 47, SEQ ID NO: 57 and SEQ ID NO: 35, SEQ ID NO: 57 and SEQ ID NO: 47, where Either of the two domains is located at the N- or C-terminus of the other domain. In some embodiments, the combination of these two domains results in a recombinant polypeptide selected from the group consisting of a sequence as described below: SEQ ID NO: 188, 194, 200, 206, 212, 218, 224 , 230, 236, 242, 248 and 254. In some embodiments, the recombinant polypeptide comprises a combination of three domains, and the combination of domains is selected from the following: SEQ ID NOs: 39, 49, and 61; SEQ ID NOs: 35, 47, and 57; SEQ ID NO: 39, 47, and 61; SEQ ID NOs: 35, 49, and 57; SEQ ID NOs: 39, 57, and 47; SEQ ID NOs: 35, 61, and 49, in which any domain is located in the other or two domains N- or C-terminus. In some embodiments, the combination of these three domains produces a recombinant polypeptide comprising a group selected from the group consisting of sequences as described below: SEQ ID NO: 260, 268, 276, 284, 292, 300, 308, 316, 324, 332, 340 and 348.

Disclosed herein is a recombinant polypeptide comprising a first domain of SEQ ID NO: 39, a second domain of SEQ ID NO: 49, and a third domain of SEQ ID NO: 61, wherein the first domain is located in the second domain C-terminal, the third domain is located at the N-terminal of the second domain, or a combination thereof. In some embodiments, the recombinant polypeptide comprises a first domain selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 39, and a second domain selected from the group consisting of SEQ ID NO: 47 and SEQ ID NO : The group consisting of: 49 and the third domain are selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 61, wherein the first domain is located at the C-terminus of the second domain and the third domain It is located at the N-terminus of the second domain, or a combination of the first, second, and third domains when they are SEQ ID NOs: 39, 49, and 61, respectively.

In certain embodiments, the recombinant polypeptide described herein comprises a post-translational modification (PTM), including but not limited to disulfide bond formation, glycosylation, amidation, lipidation, acetylation, phosphorylation,醯 Amination, derivation of known protecting / blocking groups, cleavage of proteins, modification with non-naturally occurring amino acids, or any other manipulation or modification, such as conjugation with a labeled component.

In certain embodiments, the recombinant polypeptide may include one or more cysteine acids, which can participate in the generation of one or more disulfide bonds under physiological conditions or any other standard conditions (purification conditions or storage conditions). . In some embodiments, the disulfide bond is an intramolecular disulfide bond formed between two semi-photogenic amino acid residues in a recombinant polypeptide. In some embodiments, the disulfide bond is an intermolecular disulfide bond formed between two recombinant polypeptides in a dimer. In certain embodiments, an intermolecular disulfide bond is formed between two identical recombinant polypeptides as described herein, wherein the two identical recombinant polypeptides form a homodimer. In certain embodiments, the homodimer includes at least one or more than three intermolecular disulfide bonds. In certain embodiments, an intermolecular disulfide bond is formed between two disparate recombinant polypeptides as described herein, wherein the two disparate recombinant polypeptides form a heterodimer. In certain embodiments, the heterodimer includes at least one or more than three intermolecular disulfide bonds.

Disclosed herein is a recombinant polypeptide comprising a first domain selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 39; a second domain selected from the group consisting of SEQ ID NO: 47 and SEQ ID NO : A group consisting of: 49; and a third domain selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 61; wherein the recombinant polypeptide includes an intramolecular disulfide bond.

In some embodiments, the first domain, the second domain, the third domain, or a combination thereof comprises an intramolecular disulfide bond. In certain embodiments, one or more intramolecular disulfide bonds are located within a single domain, between one domain and another domain, one domain with more than two cysteine and one or more other Between domains or a combination of them. In some embodiments, the first domain includes a disulfide bond. In some embodiments, the second domain includes a disulfide bond. In some embodiments, the third domain includes a disulfide bond. In some embodiments, each domain contains a disulfide bond. The "domain contains a disulfide bond" as referred to herein. When referring to an intramolecular disulfide bond, if more than one cysteine is present in a domain, it refers to the A sulfur bond, or between a cysteine in one domain and a cysteine in the other domain.

In certain embodiments, the second domain of a recombinant polypeptide as described herein comprises a molecule between the 23rd amino acid of the second domain and the 27th amino acid of the second domain Internal disulfide bond. In some embodiments, the recombinant polypeptide is between the first domain and the third domain, within the third domain, or both, and further comprises one or more additional intramolecular disulfide bonds. In some embodiments, the recombinant polypeptide is between the 9th amino acid of the third domain and the 43th amino acid of the third domain, the 8th amino acid of the third domain and the Between the 41st amino acid of the third domain, between the 8th amino acid of the third domain and the 43th amino acid of the third domain or between the 9th amino acid of the third domain and the The 41st amino acid in the third domain further contains an intramolecular disulfide bond. In some embodiments, the recombinant polypeptide further comprises a disulfide bond between the 9th amino acid of the third domain and the 43th amino acid of the third domain, and the A disulfide bond is included between the 8th amino acid and the 41st amino acid of the third domain. In some embodiments, the recombinant polypeptide further comprises a disulfide bond between the 8th amino acid of the third domain and the 43th amino acid of the third domain, and the A disulfide bond is included between the 9th amino acid and the 41st amino acid of the third domain.

In certain embodiments, the third domain of a recombinant polypeptide as described herein comprises a first amino acid sequence PKACCVPTE (SEQ ID NO: 356) and a second amino acid sequence GCGCR (SEQ ID NO: 357), and wherein the third domain comprises two intramolecular disulfide bonds or two intermolecular disulfide bonds between the first and second amino acid sequences. In some embodiments, the recombinant polypeptide comprises a first intramolecular molecule between a fourth amino acid of the first amino acid sequence and a second amino acid of the second amino acid sequence. An intermolecular disulfide bond and a second intramolecular or intermolecular disulfide between the fifth amino acid of the first amino acid sequence and the fourth amino acid of the second amino acid sequence key. In some embodiments, the recombinant polypeptide comprises a first intramolecular molecule between the fifth amino acid of the first amino acid sequence and the second amino acid of the second amino acid sequence. An intermolecular disulfide bond and a second intramolecular or intermolecular disulfide between the fourth amino acid of the first amino acid sequence and the fourth amino acid of the second amino acid sequence key. In some embodiments, the recombinant polypeptide further comprises an intramolecular disulfide bond between the 23rd amino acid in the second domain and the 27th amino acid in the second domain.

Disclosed herein is a recombinant polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 260, SEQ ID NO: 268, SEQ ID NO: 276, SEQ ID NO: 284, SEQ ID NO: 292, SEQ ID NO: 300, SEQ ID NO: 308, SEQ ID NO: 316, SEQ ID NO: 324, SEQ ID NO: 332, SEQ ID NO: 340 and SEQ ID NO: 348 Wherein the recombinant polypeptide comprises an intramolecular disulfide bond. In certain embodiments, the intra-molecular disulfide bond comprises cysteine 15, cysteine 44, cysteine 48, cysteine 79, cysteine numbered from the amino terminal end of the recombinant polypeptide. One or more disulfide bonds of cystine 80, cysteine 112, cysteine 114, and combinations thereof. In certain embodiments, the intra-molecular disulfide bond comprises cysteine 44, cysteine 48, or both.

In certain embodiments, a recombinant polypeptide as described herein comprises an intramolecular disulfide bond between cysteine 44 and cysteine 48 numbered from the amine end of the recombinant polypeptide. In certain embodiments, the recombinant polypeptide is between cysteine 79 and cysteine 112, between cysteine 80 and cysteine 114, and cysteine 80 and cysteine Between 112 or between cysteine 79 and cysteine 114 further comprises an intra- or intermolecular disulfide bond. In some embodiments, the recombinant polypeptide further comprises an intra- or inter-molecular disulfide bond between cysteine 79 and cysteine 112, and between cysteine 80 and cysteine 114 further includes an intra- or intermolecular disulfide bond. In certain embodiments, the recombinant polypeptide further comprises an intra- or inter-molecular disulfide bond between cysteine 80 and cysteine 112, and between cysteine 79 and cysteine 114 further includes an intra- or intermolecular disulfide bond.

The disclosure herein relates to a homodimer protein comprising two identical recombinant polypeptides as described herein.

The disclosure herein relates to a heterodimer protein comprising two distinct recombinant polypeptides as described herein.

In certain embodiments, a homodimer protein or a heterodimer protein as described herein is between the first domains of the two recombinant polypeptides, the first polypeptides of the two recombinant polypeptides, Between two domains, between the third domains of the two recombinant polypeptides, between the first domain and the second domain of the two recombinant polypeptides, the first domain and the first domain of the two recombinant polypeptides Between three domains, between the second domain and the third domain of the two recombinant polypeptides, or a combination thereof comprises one or more intermolecular disulfide bonds.

In certain embodiments, a homodimer or heterodimer protein as described herein, which is between the 15th amino acid of the first domain of the two one of the recombinant polypeptides and the other The 15th amino acid of the first domain of the recombinant polypeptide includes an intermolecular disulfide bond. In some embodiments, the homodimer or heterodimer protein is the ninth amino acid in the third domain of the two recombinant polypeptides and the third amino acid of the other recombinant polypeptide. Between the 43th amino acid of the third domain, between the 8th amino acid of the third domain of the two one of the recombinant polypeptides and the 41st amino acid of the third domain of the other recombinant polypeptide Between, between the eighth amino acid of the third domain of one of the two recombinant polypeptides and the 43th amino acid of the third domain of the other recombinant polypeptide, or between the two A ninth amino acid in the third domain of one of the recombinant polypeptides and a 41th amino acid in the third domain of the other recombinant polypeptide further includes an intermolecular disulfide bond. In some embodiments, the homodimer or heterodimer protein is further between the ninth amino acid in the third domain of the two one of the recombinant polypeptides and the ninth amino acid of the other recombinant polypeptide. The 43th amino acid of the three domains includes a disulfide bond, and the 8th amino acid of the third domain of the two recombinant polypeptides and the third domain of the other recombinant polypeptide The 41st amino acid contains a disulfide bond. In certain embodiments, the homodimer or heterodimer protein is further between the eighth amino acid in the third domain of the two one of the recombinant polypeptides and the eighth amino acid of the other recombinant polypeptide. The 43th amino acid of the three domains includes a disulfide bond, and the 9th amino acid of the third domain of the two one of the recombinant polypeptides and the third domain of the other recombinant polypeptide The 41st amino acid contains a disulfide bond.

In certain embodiments, the homodimer or heterodimer protein is cysteine 15 of the one of the two recombinant polypeptides and the other recombinant polypeptide numbered from the amine end of the recombinant polypeptide. The cysteine 15 contains an intermolecular disulfide bond. In certain embodiments, the homodimer or heterodimer protein is further between cysteine 79 of one of the two recombinant polypeptides and cysteine 112 of the other recombinant polypeptide, Between cysteine 80 of one of the two recombinant polypeptides and cysteine 114 of the other recombinant polypeptide, between cysteine 80 of the two recombinant polypeptides and the other recombinant An intermolecular disulfide bond is included between cysteine 112 of the polypeptide or between cysteine 79 of one of the two recombinant polypeptides and cysteine 114 of the other recombinant polypeptide. In certain embodiments, the homodimer or heterodimer protein further comprises between cysteine 79 of one of the two recombinant polypeptides and cysteine 112 of the other recombinant polypeptide. An intermolecular disulfide bond and an intermolecular disulfide bond between cysteine 80 of one of the two recombinant polypeptides and cysteine 114 of the other recombinant polypeptide. In some embodiments, the homodimer or heterodimer protein further comprises between cysteine 80 of one of the two recombinant polypeptides and cysteine 112 of the other recombinant polypeptide. An intermolecular disulfide bond and an intermolecular disulfide bond between cysteine 79 of one of the two recombinant polypeptides and cysteine 114 of the other recombinant polypeptide.

In some embodiments, the homodimer or heterodimer protein is the ninth amino acid in the third domain of the two recombinant polypeptides and the third amino acid of the other recombinant polypeptide. Between the 43th amino acid of the third domain, between the 8th amino acid of the third domain of the two one of the recombinant polypeptides and the 41st amino acid of the third domain of the other recombinant polypeptide Between, between the eighth amino acid of the third domain of one of the two recombinant polypeptides and the 43th amino acid of the third domain of the other recombinant polypeptide, or between the two The ninth amino acid in the third domain of one of the recombinant polypeptides and the 41th amino acid in the third domain of the other recombinant polypeptide include an intermolecular disulfide bond. In some embodiments, the homodimer or heterodimer protein is the ninth amino acid in the third domain of the two recombinant polypeptides and the third amino acid of the other recombinant polypeptide. Between the 43th amino acid of the domain and a disulfide bond between the 8th amino acid of the third domain of the two one of the recombinant polypeptides and the third domain of the other recombinant polypeptide The 41st amino acid contains a disulfide bond. In certain embodiments, the homodimer or heterodimer protein is the eighth amino acid in the third domain of the two recombinant polypeptides and the third amino acid of the other recombinant polypeptide. The 43th amino acid of the two domains includes a disulfide bond, and the 9th amino acid of the third domain of the two recombinant polypeptides and the third domain of the other recombinant polypeptide The 41st amino acid contains a disulfide bond.

In certain embodiments, the homodimer or heterodimer protein is cysteine 79 and the other recombinant polypeptide numbered from one of the two recombinant polypeptides numbered from the amine end of the recombinant polypeptide. Between cysteine 112, cysteine 80 of one of the two recombinant polypeptides, and cysteine 114 of the other recombinant polypeptide, cysteamine of the one of the two recombinant polypeptides Between the acid 80 and the cysteine 112 of the other recombinant polypeptide, between the cysteine 79 of one of the two recombinant polypeptides and the cysteine 114 of the other recombinant polypeptide Sulfur bond. In some embodiments, the homodimer or heterodimer protein comprises a molecule between cysteine 79 of one of the two recombinant polypeptides and cysteine 112 of the other recombinant polypeptide. An intermolecular disulfide bond, and an intermolecular disulfide bond between cysteine 80 of one of the two recombinant polypeptides and cysteine 114 of the other recombinant polypeptide. In certain embodiments, the homodimer or heterodimer protein comprises a cysteine 80 of one of the two recombinant polypeptides and a cysteine 112 of the other recombinant polypeptide. An intermolecular disulfide bond and an intermolecular disulfide bond between cysteine 79 of one of the two recombinant polypeptides and cysteine 114 of the other recombinant polypeptide.

In certain embodiments, the third domain of each of the recombinant polypeptides of the homodimer or heterodimer protein described herein comprises a first amino acid sequence PKACCVPTE (SEQ ID NO: 356) And a second amino acid sequence GCGCR (SEQ ID NO: 357), wherein the homodimer or heterodimer protein is the first amino acid in the third domain of one of the two recombinant polypeptides The sequence and the second amino acid sequence in the third domain of the another recombinant polypeptide include two intermolecular disulfide bonds. In some embodiments, the homodimer or heterodimer protein is between the fourth amino acid of the first amino acid sequence of the two recombinant polypeptides and the other recombinant polypeptide. The second amino acid sequence of the second amino acid sequence includes a first intermolecular disulfide bond, and a fifth amino group of the first amino acid sequence of the two one of the recombinant polypeptides. A second intermolecular disulfide bond is included between the acid and the fourth amino acid of the second amino acid sequence of the another recombinant polypeptide. In certain embodiments, the homodimer or heterodimer protein is between the fifth amino acid of the first amino acid sequence of the two recombinant polypeptides and the other recombinant polypeptide. The second amino acid sequence of the second amino acid sequence includes a first intermolecular disulfide bond, and a fourth amino group of the first amino acid sequence of the two one of the recombinant polypeptides. A second intermolecular disulfide bond is included between the acid and the fourth amino acid of the second amino acid sequence of the another recombinant polypeptide.

In certain embodiments, the single or all two recombinant polypeptides of a homodimer or heterodimer protein as described herein comprise any one or more of the intramolecular disulfide bonds as described herein.

In certain embodiments, the second domain of the single or all two recombinant polypeptides of a homodimer or heterodimer protein as described herein comprises an intramolecular disulfide bond. In certain embodiments, the single or all two recombinant polypeptides of the homodimer or heterodimer protein as described herein are in the 23rd amino acid of the second domain and the The 27th amino acid contains an intramolecular disulfide bond.

In certain embodiments, the single or all two recombinant polypeptides of a homodimer or heterodimer protein as described herein are numbered at the cysteine 44 and hemase number from the amine end of the recombinant polypeptide. Cysteine 48 contains an intramolecular disulfide bond.

In certain embodiments, a homodimer protein as described herein comprises two recombinant polypeptides, each of which comprises the same sequence, wherein the sequence is selected from the group consisting of SEQ ID NO: 260, SEQ ID NO: 268, SEQ ID NO: 276, SEQ ID NO: 284, SEQ ID NO: 292, SEQ ID NO: 300, SEQ ID NO: 308, SEQ ID NO: 316, SEQ ID NO: 324, SEQ ID NO: 332, SEQ ID The group consisting of NO: 340 and SEQ ID NO: 348. In some embodiments, the recombinant polypeptide comprises the same intramolecular disulfide bond as described herein. In some embodiments, the recombinant polypeptide comprises a dissimilar intramolecular disulfide bond as described herein.

In certain embodiments, a heterodimer protein as described herein comprises two distinct recombinant polypeptides, wherein each polypeptide comprises a distinct sequence selected from the group consisting of: SEQ ID NO: 260, SEQ ID NO: 268, SEQ ID NO: 276, SEQ ID NO: 284, SEQ ID NO: 292, SEQ ID NO: 300, SEQ ID NO: 308, SEQ ID NO: 316, SEQ ID NO: 324, SEQ ID NO: 332, SEQ ID NO: 340 and SEQ ID NO: 348. In certain embodiments, one of the two recombinant polypeptides of the heterodimer protein comprises a sequence of SEQ ID NO: 260, and the other recombinant polypeptide comprises a sequence selected from the group consisting of Group: SEQ ID NO: 268, SEQ ID NO: 276, SEQ ID NO: 284, SEQ ID NO: 292, SEQ ID NO: 300, SEQ ID NO: 308, SEQ ID NO: 316, SEQ ID NO : 324, SEQ ID NO: 332, SEQ ID NO: 340 and SEQ ID NO: 348. In some embodiments, the recombinant polypeptide comprises the same intramolecular disulfide bond as described herein. In some embodiments, the recombinant polypeptide comprises a dissimilar intramolecular disulfide bond as described herein.

In certain embodiments, the recombinant polypeptide, homodimer protein or heterodimer protein as described herein comprises the one or more between the cysteine pairs as listed in Table 4 or 5 Disulfide bond.

In certain embodiments, a recombinant polypeptide, homodimer protein, or heterodimer protein as described herein comprises osteoinducing activity. Osteoinduction activity can be measured under any conditions routinely used to measure such activity (ie, "osteoinduction conditions").

For example: C2C12 cells are a murine myofibroblast cell line derived from the muscles of malnourished mice. Exposing C2C12 cells to polypeptides with osteoinductive activity can transfer C2C12 cells from muscle to bone differentiation, for example, by forming osteoblasts characterized by inducing expression of bone-related proteins such as alkaline phosphatase. Alkaline phosphatase is a widely accepted bone marker, and an assay to detect alkaline phosphatase activity is believed to be useful for showing osteoinductive activity. See, for example, Peel et al. ( Published in J. Craniofacial Surg. 14 : 284-291 in 2003), Hu et al. (Published in Growth Factors 22 : 29033 in 2004), and Kim et al. (Published in J. Biol. In 2004) . Chem. 279 : 50773-50780).

In certain embodiments, a recombinant polypeptide, homodimer, or heterodimer protein line as described herein has the ability to induce alkaline phosphatase activity.

In some embodiments, osteogenic activity can be detected using medical imaging techniques or histological examination of bone samples, or any other conventional test method for detecting osteogenesis or growth. In some embodiments, the detection includes a radiographic image, such as an X-ray image. In some embodiments, the detection includes a computer tomography (CT) scan. In some embodiments, the detection includes molecular or nuclear imaging (ie, positron emission tomography (PET)). In some embodiments, the testing includes a histological test. In some embodiments, the detection includes hematoxylin-eosin (HE) staining.

In certain embodiments, a recombinant polypeptide, homodimer protein, or heterodimer protein as described herein may include, but is not limited to, fragments, variants, or derivative molecules thereof. When referring to polypeptides, the terms "fragment", "variant", "derivative" and "analog" encompass any polypeptide that retains at least some of the properties or biological activity of a reference polypeptide. Polypeptide fragments can include degraded protein fragments, deleted fragments, and fragments that more easily reach the site of action when implanted in an animal. Polypeptide fragments can include variant regions, including fragments as described above, and polypeptides having altered amino acid sequences due to amino acid substitutions, deletions, or insertions. Non-naturally occurring variants can be generated using mutagenesis techniques known in the art. The polypeptide fragments disclosed herein may include conservative or non-conservative amino acid substitutions, deletions, or additions. A variant polypeptide may also be referred to herein as a "polypeptide analog." The polypeptide fragments disclosed herein may also include derivative molecules. As used herein, a "derivative" of a polypeptide or polypeptide fragment refers to a host polypeptide that has one or more residues that are chemically derived from the reaction of functional side groups. "Derivatives" also include those polypeptides which contain one or more of the 20 standard amino acids naturally occurring amino acid derivatives. For example: 4-hydroxyproline can be substituted as proline; 5-hydroxylysine can be substituted as lysine; 3-methylhistamine can be substituted as histamine; homoseramine Acids can be substituted as serine; and ornithine can be substituted as lysine.

In certain embodiments, a recombinant polypeptide, homodimer protein, or heterodimer protein as described herein comprises a label. In some embodiments, the label is a catalyzed chemical change of a matrix compound or composition. An enzyme label, a radioactive label, a fluorophore, a chromophore, an imaging agent, or a metal includes a metal ion.

In certain embodiments, the recombinant polypeptides described herein include one or more conservative amino acid substitutions. A "conservative amino acid substitution" is an amino acid substitution with different amino acid residues of similar side chains. The art has defined a family of amino acid residues with similar amino acid side chains, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (aspartic acid, Glutamic acid), without electrode side chains (glycine, asparagine, glutamic acid, serine, threonine, tyrosine, cysteine), non-polar side chains (alanine , Valine, Leucine, Isoleucine, Proline, Phenylalanine, Methionine, Tryptophan), β -Branched Side Chains (Threonine, Valine, Isoleucine ) And aromatic side chains (tyrosine, phenylalanine, tryptophan, histidine). Therefore, if an amino acid in a polypeptide is replaced by another amino acid from the same side chain family, the substitution is considered conservative. In another embodiment, the amino acid chain may be conservatively replaced with a structurally similar amino acid chain that differs in order and / or composition of side chain family members.

In certain embodiments, the recombinant polypeptides disclosed herein are encoded by a nucleic acid molecule or vector as described herein, or expressed by a host cell as described herein.

[Nucleic acid molecules, vectors and host cells]

The disclosure herein is directed to an isolated nucleic acid molecule comprising a polynucleotide sequence encoding any of the recombinant polypeptides described herein.

In certain embodiments, the isolated nucleic acid molecule comprises any two or more polynucleotide sequences encoding a domain as described herein. In certain embodiments, the isolated nucleic acid molecule comprises any two or more polynucleotide sequences selected from the group consisting of SEQ ID NOs: 32, 34, 36, 38, 40, 42, Groups of 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78, whose encodings are as described in this article, respectively. Corresponding to SEQ ID NO: 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77 And 355. In certain embodiments, the isolated nucleic acid molecule comprises any combination of two or three polynucleotide sequences that encode corresponding combinations of the two or three domains shown in Table 3 herein. .

In certain embodiments, the isolated nucleotide molecule comprises a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 115, 157, 187, 193, 199, 205, 211, 217, 223, 229, 235, A group consisting of 241, 247, 253, 259, 267, 275, 283, 291, 299, 307, 315, 323, 331, 339, and 347, which encode the recombinant polypeptides described herein corresponding to SEQ ID NO: 116, 158, 188, 194, 200, 206, 212, 218, 224, 230, 236, 242, 248, 254, 260, 268, 276, 284, 292, 300, 308, 316, 324, 332, 340 and 348.

In certain embodiments, the polynucleotide sequence is codon-optimized.

The disclosure herein is directed to a recombinant nucleic acid molecule comprising an expression control region operably linked to an isolated nucleic acid molecule as described herein. In some embodiments, the expression control region is a promoter, enhancer, operon, repressor, ribosome binding site, translation leader sequence, intron, polyadenylation recognition sequence, RNA processing site, effect Daughter binding sites, stem-loop structures, transcription termination signals, or combinations thereof. In some embodiments, the expression control region is a promoter. The expression control region may be a transcription control region and / or a translation control region.

Various transcription control regions are known in the art to which the present invention pertains. These transcriptional control regions include, but are not limited to, transcriptional control regions that function in vertebrate cells, such as, but not limited to, promoters and enhancer fragments from cytomegalovirus (fast promoters, linked to intron-A) ), Simian virus 40 (early promoter), retrovirus (such as Rolls sarcoma virus). Other transcriptional control regions include those derived from vertebrate genes such as actin, heat shock protein, bovine growth hormone, and rabbit beta-globulin, as well as other sequences that control gene expression in eukaryotic cells. In addition, suitable transcriptional control regions include tissue-specific promoters and enhancers, as well as lymphocyte-inducible promoters (eg, interferon or interleukin-inducible promoters).

Similarly, various translation control control units are known in the technical field to which the present invention pertains. The translation control units include, but are not limited to, ribosome binding sites, translation initiation and stop codons, and units derived from picornaviruses (especially internal ribosome entry site (IRES), (Also known as CITE sequence).

In some embodiments, the recombinant nucleic acid molecule is a recombinant vector.

A vector can be any medium that transfects and / or transfers a nucleic acid into a host cell. A large number of vectors are known and used in the art, including, for example: plastids, phages, adhesive plastids, chromosomes, viruses, modified eukaryotic viruses, modified bacterial viruses. Insertion of a polynucleotide into a suitable vector can be accomplished by ligating appropriate polynucleotide fragments into a selected vector with complementary cohesive ends.

The vector can be designed to encode a selectable marker or reporter that provides a means for selecting or identifying cells that have been incorporated into the vector. The expression of the selectable marker or reporter allows the host cell to recognize and / or select, the host cell being incorporated and expressing other coding regions contained on the vector. Selectable marker genes known and used in the art include, for example, for ampicillin, streptomycin, kinastamycin, concomycin, hygromycin, neomycin, puromycin, diampaliphos herbicides (bialaphos herbicide), genes that provide resistance to sulfonamide and their analogs, and genes that serve as phenotypic markers, namely, anthocyanin-regulated genes, isopentenyl transferase genes and their analogs. Reporters known and used in the art include, for example, luciferase (Luc), green fluorescein (GFP), chloramphenicol acetyltransferase (CAT), β-galactosidase (LacZ ), Β-glucuronidase (Gus) and their analogs. Selective markers can also be used as reporters.

The term "plasmid" refers to an extrachromosomal unit that normally carries a gene that is not part of the cell's central metabolism and is usually in the form of a circular double-stranded DNA molecule. Such units can be single- or double-stranded DNA or RNA derived from an autonomously replicating sequence (ARS), a genomic integration sequence, a phage or nucleotide sequence, linear, circular, or supertwisted, derived from any source. Nucleotide sequences are ligated or reconstituted into unique constructs that can introduce promoter fragments and DNA sequences into the cell for the selected gene product, along with appropriate 3 'untranslated sequences.

Eukaryotic viral vectors that can be used include, but are not limited to, adenovirus vectors, retrovirus vectors, adeno-associated virus vectors, and poxviruses, such as vaccinia virus vectors, baculovirus vectors, or herpes virus vectors. Non-viral vectors include plastids, liposomes, charged lipids (cytokines), DNA-protein complexes, and biopolymers. Mammalian expression vectors may include non-transcribed units such as: origin of replication, suitable promoters and enhancers linked to the gene to be expressed, and other non-transcribed sequences adjacent to the 5 'or 3' end and non-translated 5 'or 3' ends Sequences, such as essential ribosome binding sites, polyadenylation sites, splice donor and recipient sites, and transcription termination sequences.

The recombinant vector may be a "recombinant expression vector", which refers to any nucleic acid structure containing the necessary units for transcription and translation of the inserted coding sequence, or in the case of an RNA virus vector, when introduced into Necessary unit for replication and translation when appropriate host cells.

Disclosed herein is a method for preparing a recombinant vector comprising inserting an isolated nucleic acid molecule as described herein into a vector.

Disclosed herein is directed to an isolated host cell comprising an isolated nucleic acid molecule or a recombinant nucleic acid molecule as described herein. In certain embodiments, the isolated host cell comprises a recombinant vector as described herein.

Nucleic acid molecules can be introduced into host cells by methods known in the art, such as: transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosomes Fusion), the use of gene guns or DNA vector transporters.

Disclosed herein is a method directed to the preparation of a recombinant host cell comprising introducing an isolated nucleic acid molecule or recombinant nucleic acid molecule into a host cell as described herein. In certain embodiments, the method comprises introducing a recombinant vector as described herein into a host cell.

A host cell as described herein can express any isolated nucleic acid molecule or recombinant nucleic acid molecule as described herein. The term "expression / expression" used in the expression of a nucleic acid molecule in a host cell refers to a biochemical process caused by a gene, such as RNA or a polypeptide. This process includes any specific appearance of the function of the gene in the cell, including but not limited to: transient or stable expression. This includes, but is not limited to, transcription of the gene into messenger RNA (mRNA) and translation of the mRNA into a polypeptide.

Host cells include, but are not limited to, prokaryotes or eukaryotes. Representative examples of suitable host cells include: bacterial cells, fungal cells such as yeast, insect cells, and isolated animal cells. Bacterial cells may include, but are not limited to, Gram-negative or Gram-positive bacteria, such as Escherichia coli . Alternatively, lactobacilli can also be used (Lactobacillus) species or genus Bacillus (Bacillus) species as host cells. Eukaryotic cells can include, but are not limited to, established mammalian-derived cell lines. Suitable mammalian cell lines include, for example: COS-7, L, C127, 3T3, Chinese Hamster Ovary (CHO), HeLa and BHK cell lines.

The host cell can be cultured in a suitably modified conventional nutrient medium suitable for activating promoters, selecting transformants, or amplifying nucleic acid molecules as described herein. The culture conditions such as temperature, pH, etc. may be any conditions known to be used or conventionally modified when using a host cell selected for expression, and it is obvious to those having ordinary knowledge in the technical field to which the present invention belongs.

Disclosed herein is a method of making a recombinant polypeptide, comprising: culturing an isolated host cell as described herein, and isolating the recombinant polypeptide from the host cell. As a technique for isolating a polypeptide from a cultured host cell, any technique known to be used or conventionally modified when isolating a polypeptide from a host cell for expression can be selected, and it will be apparent to those having ordinary knowledge in the technical field to which the present invention belongs.

[combination]

Disclosed herein is a composition comprising a recombinant polypeptide, a homodimer protein, or a heterodimer protein as described herein.

In certain embodiments, the composition further comprises a physiologically acceptable carrier, excipient, or stabilizer. See, for example, Remington's Pharmaceutical Sciences, published by Mack Publishing Co., Easton, PA, 1990, USA. An acceptable carrier, excipient, or stabilizer may contain a substance that is not toxic to the subject. In certain embodiments, the composition or one or more ingredients in the composition are sterile. Sterile ingredients can be prepared using, for example, filtration (such as through a sterile filter membrane) or radiation irradiation (such as through gamma-ray irradiation).

In certain embodiments, a composition as described herein further comprises an allograft or autograft of bone or bone fragments.

In certain embodiments, a composition as described herein further comprises a bone graft substitute.

In some embodiments, the bone graft substitute is a bioceramic material. The terms "bioceramic material" and "bioceramic" are used interchangeably in this article. In certain embodiments, the bioceramic is biocompatible and resorbable in vivo. In some embodiments, the bioceramic is any bioceramic based on calcium phosphate salts. In some embodiments, the bioceramic is selected from the group consisting of tricalcium phosphate (TCP), α-tricalcium phosphate (α-TCP), β-tricalcium phosphate (β-TCP), and biphasic calcium phosphate (BCT). , Hydroxide apatite, calcium sulfate and calcium carbonate. In some embodiments, the bioceramic is β-tricalcium phosphate (β-TCP).

In some embodiments, the bone graft substitute is a bioactive glass. In some embodiments, the bioactive glass comprises silicon dioxide (SiO ₂ ), sodium oxide (Na ₂ O), calcium oxide (CaO), or platinum oxide (Pt ₂ O ₅ ).

The following examples are intended to illustrate but not limit the invention.

[Example]

[Example 1]-Construction of plastids

In order to construct the plastid pQE-80L-Kana, Bsp HI (BioLab) was used to cut the concomycin resistance gene from pET-24a (+) (Novagen) to generate a 875-bp concomycin resistance gene (+3886 To +4760) fragment (SEQ ID NO: 1). The pQE-80L (Kaijie) vector was cut with Bsp HI to remove the ampicillin resistance gene (+3587 to +4699) fragment (SEQ ID NO: 2), and then the concomycin resistance gene fragment was ligated to the pQE-80L vector to generate 4513-bp plastids (pQE-80L-Kana). (SEQ ID NO: 3).

[Example 2]-Yeast two-hybrid screening

A. Decoy plastid construction

A commercially available system (Medium Double Hybrid System 2; CLONTECH, Palo Alto, California, USA) was used for yeast double hybrid screening. To construct bait plastids, a polymerase chain reaction (PCR) with pCRII / ActRIIB (a study by Hilden et al., Published in Blood 83 (8): 2163-70, 1994) was used to produce type IIB activin receptors The coding region of the extracellular domain (+103 to +375 bp) (SEQ ID NO: 4) of the (ActRIIB) protein was used as a template. Primers ( Xma I: 5'-CCCGGGACGGGAGTGCATCTACAACG-3 '(SEQ ID NO: 5); Sal I: 5'-GTCGACTTATGGCAAATGAGTGAAGCGTTC-3' (SEQ ID NO: 6) designed to amplify ActRIIB's extracellular domain (ActRIIBecd) ) So that it contains an Xma I and Sal I restriction site at the 5 'end, respectively. Use 10 ng of template DNA, 0.2 μM per primer, 0.2 mM per dNTP, 1X PCR buffer (10 mM Tris-HCl), pH 8.3, 50 mM potassium chloride (KCl), and 1.5 mM magnesium chloride ( MgCl ₂ )) and pfu DNA polymerase (Jin Yin Technology Co., Ltd.) 1.25 U, PCR was performed in a total volume of 50 μl. The PCR was performed 30 cycles: denatured at 95 ° C for 30 seconds, followed by adhesion at 45 ° C for 1 minute, and extension at 68 ° C for 5 minutes. The PCR product was cut with Xma I- Sal I, and then subcloned into the frame to the same restriction site in the DNA-binding domain of GAL4 in the pAS2-1 vector (CLONTECH Corporation GenBank Accession Number: U30497). Production of plastid pAS-ActRIIBecd.

The nucleic acid and polypeptide sequences of ActRIIB and naturally occurring variants are known. For example, the wild-type ActRIIB nucleic acid sequence is SEQ ID NO: 7. The corresponding polypeptide sequence is SEQ ID NO: 8. The extracellular domain (ActRIIBecd) of ActRIIB is SEQ ID NO: 9, which corresponds to residues 21-117 of SEQ ID NO: 8, and is encoded by the nucleic acid sequence SEQ ID NO: 4.

B. Construction of pACT2 / MC3T3 cDNA Database

To construct a pACT2 / MC3T3 cDNA database, approximately 7 × 10 ⁶ transgenic mouse MC3T3-E1 cells were disclosed by Tu Q. et al . (Published in 2003 by J Bone Miner Res. 18 (10): 1825-33). Osteoblast cDNA database, and some modifications were made to allow the cDNA database to be inserted less than 1.5 kb. The database was constructed into the pACT2 vector (CLONTECH's GenBank accession number: U29899). cDNA synthesis system (CAT. No. 18267-013), the double-stranded cDNA was transfected in the pACT2 vector, which was cut by Sma I to express a fusion protein with a GAL4 activation domain. The pACT2 / MC3T3 cDNA library was then screened using the "HIS3 Jump-Start" program according to the manufacturer's protocol (CLONTECH, Palo Alto, California, USA). In another embodiment, the pACT2 cDNA library is obtained from a commercially available product.

C. Yeast strain selection

First, bait plastids were used to transform Saccharomyces cerevisiae Y190 cells (CLONTECH, Palo Alto, California, USA, MATa, ura3-52, his3-D200, lys2-801, ade2-101, trp1-901, leu2-3 , 112, gal4D, gal80D, URA3 :: GAL1 _UAS -GAL1 _TATA -lacZ, cyh ^r 2, LYS2 :: GAL _UAS -HIS3 _TATA -HIS3), and in a tryptophan-free synthetic glucose medium (SD-Trp) Filter on. Transformants grown on this SD-Trp medium were subsequently transformed with the pACT2 / MC3T3 cDNA library and screened on tryptophan and leucine-free media (SD-Trp-Leu). In the absence of tryptophan, leucine and histidine (SD-Trp-Leu-His) and 30mM 3-amino-1,2,4-triazole (3-amino-1,2,4 -triazole) medium (St. Louis, Missouri, Sigma-Aldrich) to collect and re-cultivate the bait and database co-transformed transformants to inhibit the leaky growth of Y190 cells. The β -galactosidase activity of the transplants selected in this step was further determined. After 3 days of incubation at 30 ° C, the petri dishes were photographed and photographed. At least three independent experiments were performed with similar results. This pACT2 library plastid was purified from individual positive transgenics and amplified in E. coli. The cDNA inserted into the positive transfectants was sequenced using a PerkinElmer ABI automatic DNA sequencer, as shown in Table 1 (primer 5'-AATACCACTACAATGGAT-3 '(SEQ ID NO: 10)).

[Example 3]-Error-prone random mutagenesis PCR

A. Mutagenesis of Primer Design

The DNA sequence from the positive transgenic body of Example 2 was induced to be mutated.

In one embodiment, the sequenced positive transfectants are subtransplanted into pQE-80L-Kana, followed by random mutagenesis PCR. The primers used to amplify the positive transgenic DNA sequence are shown in Table 1. It is designed to contain an Mse I or Bam HI restriction site at its 5 'end. The PCR conditions were as described in Example 2. The PCR product was cut with Mse I- Bam HI and then subtransplanted in the frame to the same restriction site in the pQE-80L-Kana vector. In Leung et al (1989 disclosed in Technique, 1,11-15) error prone PCR disclosed the base, slightly modified by the random mutagenesis was introduced into the secondary transfer colonization of pQE-80L-Kana plastid. Linearized pQE-80L-Kana (cut by Xho I) was used as template DNA. For mutagenic PCR amplification primers (Mse I: 5'- GAATTCATTAAAGAGGAGAAA TTAA ( SEQ ID NO: 29); Bam HI: 5'-CCGGGGTACCGAGCTCGCATGC GGATCC TTA (SEQ ID NO: 30)), designed at its 5 The 'terminus contains a Mse I or Bam HI restriction site, respectively. 10 ng of template DNA, 40 pM per primer, 0.2 mM per dNTP, 1X PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl and 1.5 mM MgCl ₂ ), manganese chloride (MnCl ₂ ) 0.2-0.3 mM, Mutagenesis PCR was performed with 1% dimethylarsine and Taq DNA polymerase 1.25U (Invitrogen, Carlsbad, California, USA) in a total volume of 50 μl. The mutagenesis PCR was performed for 30 cycles: denatured at 94 ° C for 30 seconds, followed by sticking at 55 ° C for 2 minutes and extension at 72 ° C for 3 minutes. This PCR product was cut with Mse I and Bam HI. This fragment was ligated to a 4.5-kb fragment of pQE-80L-Kana cleaved by Mse I and Bam HI. The obtained pQE-80L-Kana derivative was used to transform E. coli BL 21 (Novagen). The colonies were on LTB-agar medium (LB supplemented with 1% v / v glycerol tributyrate, 0.1% v / v earth temperature emulsifier-80, 100 mg / L of concomycin, and 0.01 μM isopropyl β-D -Galactopyranoside and 1.5% agar) in a petri dish at 37 ° C.

B. Table 1 Mutagenesis

In another embodiment, based on the error-prone PCR previously disclosed by Lenug and with some modifications, random mutagenesis is introduced into the pACT2 database plastid from the positive transgene. This linearized pACT2 (cut by Xba I) was used as template DNA. Synthetic oligonucleotides with Mse I and Bam HI restriction sites as shown in Table 1 were used as primers for the mutagenesis PCR amplification reaction. 10 ng of template DNA, 40 pM per primer, 0.2 mM per dNTP, 1X PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl and 1.5 mM MgCl ₂ ), MnCl ₂ 0.2-0.3 mM, dimethylarsine 1 % And Taq DNA polymerase 1.25U (Invitrogen, Carlsbad, California, USA). Mutagenesis PCR was performed in a total volume of 50 μl. The mutagenesis PCR was performed for 30 cycles: denatured at 94 ° C for 30 seconds, followed by sticking at 55 ° C for 1.5 minutes and extension at 72 ° C for 4 minutes. This PCR product was cut with Mse I and Bam HI. This fragment was ligated to a 4.5-kb fragment of pQE-80L-Kana cleaved by Mse I and Bam HI. The obtained pQE-80L-Kana derivative was used to transform E. coli BL 21 (Novagen). The colonies were on LTB-agar medium (LB supplemented with 1% v / v glycerol tributyrate, 0.1% v / v earth temperature emulsifier-80, 100 mg / L of concomycin, and 0.01 μM isopropyl β-D -Galactopyranoside and 1.5% agar) in a petri dish at 37 ° C.

[Example 4]-Expression of ActRIIBecd related polypeptide

E. coli cells stably transformed as described in Example 3 were used to express the polypeptide (ie, "domain") that interacts with ActRIIBecd from the mutagenic DNA of Example 2.

A. Transformant fermentation

In one embodiment, an E. coli BL21 transformant having a pQE-80L-Kana derivative is put in a 65 mL culture medium (10 g / L BBL plant peptone, 5 g / L Bacto yeast extract) containing 25-32 μg / mL of Conomycin. (10 g / L NaCl) in a 500 mL Erlenmeyer flask, and stirred at 180 ± 20 rpm at 30 ° C to 37 ° C for overnight culture (about 10 hours). 37-420 mL of the aforementioned overnight culture was added to 3.7-42 L of TB medium (18 g of BBL plant peptone, 36 g of Bacto yeast extract, 18.81 g of potassium dihydrogen phosphate (KH ₂ PO ₄ ), 6 mL of glycerol in 1 L of water), The culture medium contains 23.8-38.5 μg / mL of concomycin and 1-3 mmol / L of isopropyl β-D-thiogalactopyranoside (IPTG) in a 5-50L fermentation tank, and the temperature is controlled at In the range of 37 ° C to 42 ° C, the medium is stirred at 260-450 rpm for 10-24 hours. The cells were collected in an ice water bath after centrifugation at 8,000 rpm for 10 minutes in a GSA rotator (Sophie Corporation).

In another embodiment, 1 L of LB liquid medium (with 100 mg / L of conmycin) and freshly grown colonies (E. coli BL21 transformants with pQE-80L-Kana derivatives) or 10 mL of fresh The grown culture is inoculated and incubated at 37 ° C until the OD ₆₀₀ reaches 0.4-0.8. The expression of the polypeptide was induced by adding 40 or 400 μM IPTG at 37 ° C. for 3 to 5 hours. After centrifugation (about 8,000 rpm), cells were collected at 4 ° C.

B. Recovery and purification of peptides from E. coli

E. coli BL21 / pQE-80L-Kana derivative cells were fermented as described in previous Example 4A. In one embodiment, the peptides from those derivatives are disrupted and recovered at 4 ° C. About 18 g of wet cells were suspended in 60 mL of 0.1 M TRIS / HCl, 10 mM EDTA (ethylene diamine tetraacetic acid), 1 mM PMSF (phenylmethanesulfonyl fluoride), and pH 8.3 (crushing buffer). According to the manufacturer's instructions, the cells were passed through a French cell disruptor (Frenchpress, SLM Instruments) twice, and the volume was adjusted to 200 mL with a disruption buffer. The suspension was centrifuged at 15,000 g for 20 minutes. The obtained precipitate was suspended in 100 mL of a crushing buffer containing 1M sodium chloride (NaCl), and centrifuged for 10 minutes as described above. The precipitate was suspended in 100 mL of a crushing buffer containing 1% Triton X-100 (Pierce), and centrifuged again as described above for 10 minutes. The washed precipitate was then suspended in 50 mL of Tris / HCl, 1 mM EDTA, 1 mM PMSF, 1% DTT (dithiothreitol), and homogenized in a Teflon tissue mill. The obtained suspension contains crude polypeptide in an insoluble form.

10 mL of the polypeptide suspension obtained according to the foregoing embodiment was acidified to pH 2.5 with 10% acetic acid, and centrifuged at room temperature for 10 minutes using an Eppendorf centrifuge. The supernatant was chromatographed at a flow rate of 10% acetic acid at 1.4 mL / min using a Sephacryl S-100 column (Famacia, 2.6 x 78 cm). Combine the extracted chromatographic fractions containing peptides at appropriate time intervals. Use this material for refolding to obtain biologically active polypeptides or for further purification.

5 mg of the polypeptide from the foregoing embodiment was dissolved in 140 mL of 50 mM Tris / HCl, pH 8.0, 1M NaCl, 5 mM EDTA, 2 mM reduced glutathione, 1 mM oxidized glutathione, and 33 mM Chaps biochemical reagent (Calbiochem). After 72 hours at 4 ° C, the pH value of the above solution was adjusted to pH 2.5 with hydrochloric acid (HCl), and the foregoing mixture was subjected to a YM 10 film in a Amred ultrafiltration cell (Danfos, Massachusetts, USA, Amicon Corporation) was subjected to ultrafiltration 10-fold concentration. The aforementioned concentrated solution was diluted to the original volume with 10 mM HCl, and then concentrated in the same way to a final volume of 10 mL. The formed precipitate was removed by centrifugation at 5000 g for 30 minutes. In a non-reduced state, the aforementioned supernatant containing the disulfide-linked polypeptide was judged by sodium lauryl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The surface plasmon resonance biomolecule sensor (BIAcore ^™ ) was used to measure the biological activity of the aforementioned formulation (Example 5).

The concentrated solution from the foregoing embodiment was applied to a Mono S HR 5/5 column (Famacia) at a flow rate of 1 mL / min, and the column was subjected to 85% buffer A (20 mM sodium acetate, 30% A mixture of isopropanol, pH 4.0) and 15% buffer B (buffer A containing 1M sodium chloride) was equilibrated. Then rinse the column at the same flow rate, keeping the composition of the buffer mixture constant until the absorbance reading at 280nm reaches the baseline level, then start the linear gradient injection for more than 20 minutes under equilibrium, and finally buffer with 50% buffer A / 50% The mixture of liquid B ends. The biologically active polypeptide is eluted approximately 9 minutes after the start of the gradient and collected. Bioassay and SDS-PAGE determination under non-reducing conditions.

In another embodiment, the polypeptide is prepared via the inclusion bodies of the cells collected in Example 4. After overnight extraction at room temperature (50 mM sodium acetate, pH 5, 8 M urea, 14 mM 2-mercaptoethanol), and thoroughly dialyzed against water, the peptide was refolded, concentrated, and passed through a Sephacryl S-100 HR tube The column (Famasia) was concentrated with 1% acetic acid or 5mM HCL at a flow rate of 1.8 mL / min. Protein chromatograph Finally ^- purified (FPLC, Fractogel EMD SO ₃ 650,50mM of sodium acetate, pH 5,30% of 2-propanol,), and in the gradient of NaCl 0 to 1.5M was eluted. Combine the peptide-containing fractions that have been drawn at appropriate time intervals. After thorough dialysis against water, the polypeptide was frozen / dried and stored at -20 ° C. The purity of the polypeptide was analyzed by SDS-PAGE, followed by Coomassie Brilliant Blue R staining.

In another embodiment, each 1 gram of cell particles derived from, for example, Example 4A described above is resuspended in 10-20 mL of 10 mM TRIS / HCl, 150 mM NaCl, 1 mM EDTA, 5 mM DTT, pH 8.0 (Breaking buffer), and the cells were blasted by sonication using a Misonix S4000 instrument with a No. 1 booster (Enhance Booster # 1) probe for 5 minutes at 30A (instrument scale). Optionally, the aforementioned cell lysis mixture was clarified by centrifugation (18,000 × g for 20 minutes or 15,000 × g for 30 minutes), and the pellet was washed with 10-20 mL of disruption buffer containing 1v / v% Triton X-100 Several times and centrifuged for 10 minutes as described above. The cell lysate was dissolved in 100-200 mL of disruption buffer containing 6 M urea, and centrifuged for 10 minutes as described above, and the supernatant containing the polypeptide was retained for further purification.

The aforementioned supernatant was dissolved in refolding buffer (100 mL of Tris / HCl pH 8.0, 500 mM Arginine-HCl, 5 mM EDTA, 25 mM Chaps, 2 mM oxidized glutathione, and 1 mM reduced gluten Glutathione). After 4-7 days, the polypeptide to FPLC at room temperature ^- and is purified from the 3M NaCl 0 to gradient (Fractogel EMD SO ₃ 650,20mM sodium acetate, pH 4-5,30% 2- propanol and 25mM Chaps) Rush. Combine the peptide-containing fractions that have been drawn at appropriate time intervals. The purity of the polypeptide was analyzed by SDS-PAGE, followed by Coomassie Brilliant Blue R staining.

In certain embodiments, the heterodimers disclosed herein can be prepared by co-expression in a transient expression system as previously described in Example 3, and the heterotype can be isolated from the medium Dimers were screened using the assay of Example 5.

[Example 5]-BIAcore in vitro ^TM Determination

Biosensor experiments. In one embodiment, experiments are performed in a multi-channel mode (the flow path involves a cell flow chamber 1 + 2 + 3 + 4) of a BIAcore ^™ T100 / T200 instrument (Pharmacia Biosensor AB). The flow rate was 10 μl / min, the temperature was 25 ° C., and data was recorded at 2.5 points / second. All four fragments of the sensor wafer CM5 were coated with streptavidin (streptavidin, Sigma) to a density of 2000 pg / mm ² (2000 resonance units) using an amine coupling method. ActRIIBecd (10 mg) and amine-PEG3-biotin (amine-PEG3-Biotin, 10 mg, Rockford, Illinois, Pierce) were dissolved in 200 μl of water, and 10 mg of sodium cyanoborohydride (NaCNBH ₃ ) was added. To prepare biotinylated ActRIIBecd. The reaction mixture was heated at 70 ° C for 24 hours, and then 10 mg of NaCNBH ₃ was further added, and the reaction was further heated at 70 ° C for 24 hours. After cooling to room temperature, the mixture was desalted with a spin column (3,000 cut-off molecular weight (MWCO)). Biotinylated ActRIIBecd was collected and freeze-dried for streptavidin (SA) wafer preparation. Then the amine biotinylated ActRIIBecd was independently fixed on the cell flow chamber for 2-4 at a flow rate of 5 μL / min, and the concentration was 20 μM in 10 mM sodium acetate, pH 4.0, and the density was 50-250 resonance units. (RU). The stored polypeptide was dissolved in a glycine buffer solution (2.5 g of glycine, 0.5 g of sucrose, 370 mg of L-glutamate, 10 mg of sodium chloride, and 10 mg of earth temperature emulsifier-80. 100 mL of water, pH 4.5) to prepare a 10 mg / mL solution, and then diluted with the previous glycine buffer to prepare analytes of various concentrations. Sensing patterns were recorded during the flow of analytes (ActRIIBecd-related polypeptides (ie, domains) as previously described), first through cell flow chamber 1 (control) and then through cell flow chamber 2 (biotinylated ActRIIBecd). The induction pattern obtained from the cell flow chamber 2 is subtracted from the induction pattern obtained from the cell flow chamber 2. Using the program provided by the instrument (Pharmacia Biosensor AB, 1995 Software Manual, BIA Evaluation 2.1), the equilibrium binding, binding rate, and dissociation of the sensing patterns obtained on 1, 11, 3.33, 10, 30, and 90 nM analytes were evaluated. rate. Analytes and bovine serum albumin (BSA, negative control) are listed in Table 2. Sequencing of the pQE-80L-Kana derivative in the analyte-associated transfectants (primer 5'-CTCGAGAAAT CATAAAAAAT TTATTTG-3 '(SEQ ID NO: 31)), the pQE-80L-Kana derivative has a higher affinity constant than albumin.

[Example 6]-Production of recombinant polypeptide

In order to determine whether the affinity constant can be enhanced, the PCR-Fusion method disclosed by Atanassov et al. (Published in Plant Methods 5:14 in 2009) with some modifications was used to fuse the respective domains in Table 2 to each other to make Recombinant polypeptide. PCR fusion was performed using Phusion DNA polymerase (Finnzymes, Finland) and a standard thermal cycler. Gateway recombination reactions were performed with BP Clonase II and LR Clonase II enzyme mixtures (Invitrogen). Competent E. coli DH5α cells were prepared according to the disclosure of Nojima et al. (Published in Gene 96 (1): 23-28 in 1990). Spin Miniprep kits from QIAprep ^® and colloid extraction and PCR purification kits from QIAquick ^® (Kager, Germany) were used to purify plastid DNA and PCR fragments.

The DNA template, PCR primers and DNA / polypeptide sequences of the obtained recombinant polypeptides are shown in Table 3. PCR fusion involves two or three parallel PCR amplifications from plastid templates. On the colloidal purified PCR fragments from these parallel reactions, PCR fusions were performed by amplifying the fragments by a single overlapping extension. According to Phusion DNA Polymerase Guidelines (NewEnglandBiolabs: Phusion ^TM High Fidelity (HF) DNA Polymerase Handbook), the cycle parameters for reaction mixing and conditions are the same for all PCR amplifications in this draft. The bonding temperature of the plastid template was 55 ° C.

For fusing two PCR fragments, use 30 μl overlap extension reaction, which contains: 16 μl of the two PCR fragment mixture (usually 8 μl each, about 200-800 ng, DNA), 6 μl of 5 × Phusion HF buffer, 3 μl of 2 mM dNTP mixture, 0.3 μl of Phusion ™ DNA polymerase (2U / μl). No primers were added to the overlapping extension mixture. When three DNA fragments are fused, 18 μl of this PCR mixture is used (typically 6 μl each). In general, the use of an equal volume of purified PCR fragments will not check the exact DNA concentration. If the molar ratio of the amplified PCR fragment appears to be significantly different (eg, the estimated DNA band strength is more than 5-7 times after agarose electrophoresis), the volume of the purified PCR fragment should be adjusted accordingly. The reaction mixture was incubated at 98 ° C for 30 seconds, 60 ° C for 1 minute, and 72 ° C for 7 minutes. The DNA obtained after the overlap extension reaction was purified using a PCR purification kit. As mentioned previously, the PCR product was cleaved and incorporated into the pQE-80L-Kana vector for protein / polypeptide expression. The previously discussed BIAcore ^™ T100 / T200 (GE Healthcare) was used to monitor the affinity of the purified protein / peptide for ActRIIBecd, and the data analysis was performed using the BIA evaluation software version 4.1 (GE Healthcare) in Example 5.

The data show that compared to the individual polypeptides from each individual transgenic body, the recombinant polypeptide formed from the combination of two transgenic bodies as described below has a lower affinity constant (KD): transgenic body number 10 is operational Connected to transgenic number 15 (SEQ ID NO: 188), transgenic number 15 operably linked to transgenic number 10 (SEQ ID NO: 194), transgenic number 15 operably linked to transgenic number 21 (SEQ ID NO: 200), transgenic number 21 is operably linked to transgenic number 15 (SEQ ID NO: 206), transgenic number 21 is operably linked to transgenic number 10 (SEQ ID NO: 212) ), Transgenic number 10 is operably connected to transgenic number 21 (SEQ ID NO: 218), transgenic number 8 is operatively linked to transgenic number 14 (SEQ ID NO: 224), transgenic number 14 operably linked to transgenic number 8 (SEQ ID NO: 230), transgenic number 19 operably linked to transgenic number 8 (SEQ ID NO: 236), transgenic number 8 operatively linked Transgenic number 19 (SEQ ID NO: 242), transgenic number 19 is operatively linked to transgenic number 14 (SEQ ID NO: 248), and transgenic number 14 is operatively linked Transfer explants number 19 (SEQ ID NO: 254). In other words, the recombinant polypeptide formed from the combination is relative to that derived from transgenic body number 8 (SEQ ID NO: 35), transgenic body number 10 (SEQ ID NO: 39), and transgenic body number 14 (SEQ ID NO : 47), transgenic number 15 (SEQ ID NO: 49), transgenic number 19 (SEQ ID NO: 57), and transgenic number 21 (SEQ ID NO: 61) Other peptides have a higher affinity for ActRIIBecd.

In addition, a combination of three transgenics was used to make a recombinant polypeptide, which was used: transgenic number 8 (SEQ ID NO: 35), transgenic number 10 (SEQ ID NO: 39) ), Transgenic number 14 (SEQ ID NO: 47), transgenic number 15 (SEQ ID NO: 49), transgenic number 19 (SEQ ID NO: 57), and transgenic number 21 (SEQ ID NO : 61). Surprisingly, the KD of a recombinant polypeptide formed from a combination of three transgenes as described below is lower than that of a polypeptide from individual transgenics or from a combination of two transgenics. The body is: transgenic number 10 is operably connected to transgenic number 15 and 21 (SEQ ID NO: 260), transgenic number 15 is operatively linked to transgenic number 10 and 21 (SEQ ID NO: 268) Transgenic number 21 is operatively linked to transgenic numbers 15 and 10 (SEQ ID NO: 276), Transgenic number 21 is operatively linked to transgenic numbers 10 and 15 (SEQ ID NO: 284), transgenic Colony number 8 is operatively linked to transgenic number 14 and 19 (SEQ ID NO: 292), transgenic number 14 is operatively linked to transgenic number 8 and 19 (SEQ ID NO: 300), transgenic Number 19 is operably linked to transgenic numbers 8 and 14 (SEQ ID NO: 308), transgenic number 19 is operably linked to transgenic numbers 14 and 8 (SEQ ID NO: 316), and transgenic number 10 Operatively connects transgenic number 14 and 21 (SEQ ID NO: 324), transgenic number 8 Operatively connects transgenic number 15 and 19 (SEQ ID NO: 332), transgenic number 10 is operable Ground connection transplantation Body numbers 19 and 14 (SEQ ID NO: 340) and transgenic number 8 are operably linked to transgenic numbers 21 and 15 (SEQ ID NO: 348).

[Example 7]-Post-translational modification

The effect of post-translational modification (PTM) on the KD value of the recombinant polypeptide was studied. One example of a PTM is a disulfide bond. Table 4 shows data on the relationship between the position of the disulfide bond and the binding affinity. The results show that PTM affects the binding affinity of the recombinant polypeptide to ActRIIBecd. This PTM measurement was performed based on the following experiments.

A. Enzyme cleavage and dimethyl labeling

Polypeptides were prepared as in Examples 4 and 6. Standard proteins were purchased from Sigma (St. Louis, Missouri, USA). Alternatively, 100 mM sodium acetate (NTB, Sigma, Inc.) containing 5 mM N-ethyl cis-butene diimide (NEM, Sigma) at pH 6 (JTBaker, Philipsburg, NJ, USA) can be used at room temperature. Disconnect free cysteine for 30 minutes. Enzyme cleavage was performed directly in sodium acetate at 37 ° C with 1:50 trypsin (Madison, Wisconsin, USA). Prior to dimethyl labeling, protein cleavages were three-fold diluted with 100 mM sodium acetate (pH 5).

In certain embodiments, the recombinant polypeptides prepared as in Examples 4 and 6 are diluted with 50 mM Triethylammonium bicarbonate (TEABC, T7408, Sigma-Aldrich) buffer (pH 7) and separated Place in two test tubes for cutting with different enzymes. First, NEM (N-ethylcis-butenediamidine, E3876, Sigma-Aldrich) was added to a final concentration of 5 mM to block free cysteine. The alkylation reaction was performed at room temperature for 30 minutes. After NEM alkylation, one of the two test tubes was added with trypsin (V5111, Jin Yin) (1:65) at 37 ° C for 18 hours, and then Glu-C (P8100S, New England) was added at 37 ° C. BioLabs) (1:50) for overnight cutting. Another tube was added with Glu-C (1:50) at 37 ° C for 18 hours, followed by overnight cleavage with chymotrypsin (1:50) at 37 ° C.

To perform dimethyl labeling, 2.5 μL of 4% (w / v) formaldehyde-H ₂ (JTBaker) or 2.5 μL of 4% (w / v) formaldehyde-D ₂ (Ao Ricky Co., Ltd.), then 2.5 μL of 600 mM sodium cyanoborohydride (Sigma) was added, and the above reaction was performed at pH 5-6 for 30 minutes.

B. Mass spectrometry

Using a sprinkler quadrupole-time-of-flight (ESI Q-TOF) equipped with a CapLC system (Milford, Mass., U.S.A.) using a capillary column (Toshin Industrial Co., Taiwan, inner diameter 75 μm, Measurement length (MS, m / z 400-1600; MS / MS, m / z 50-2000). The alkylated and dimethylated labeled protein cleavage was analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS) in a 5% to 50% linear gradient of acetonitrile containing 0.1% formic acid.45 minute.

In some embodiments, the cleavage and labeled protein cleavages are analyzed by high-resolution mass spectrometry (Q-Exactive Plus MS) connected to a rapid liquid chromatography (Ultimate 3000 RSLC) system. A C18 column (Acclaim PepMap RSLC, 75μm x 150mm, 2μm, 100Å) was used for liquid chromatography (LC) separation. The gradient used was as follows:

A full MS scan was performed in the m / z 300-2000 range, and the 10 strongest ions in the MS scan were used for tandem mass spectrometry (MS / MS) spectral fragmentation analysis.

C. Data analysis

MassLynx 4.0 was used to generate a list of peaks from the raw data (minus 30%, 3/2 Savitzky Golay smoothing, 80% centroid of the three central channels). Relatively high subtraction can be used to eliminate background noise. True a1 ions are usually shown as the main peak so that they remain in the peak list.

D. Reverse phase chromatography

The Agilent 1100 HPLC system with a binary pump (Agilent 1100 HPLC) was equipped with a UV detector and an autosampler. The protein was injected into a Zorbax 300SB C8 column (150 ± 2.1 mm, 5 μm, 300Å) at 75 ° C. The flow rate was 0.5 ml / min. Mobile phase A was water containing 0.1% trifluoroacetic acid. Mobile phase B was 70% isopropanol, 20% acetonitrile, and 0.1% trifluoroacetic acid in water. The sample was injected under a load of 10% B and increased to 19% B in 2 minutes. A linear stripping gradient of 1.1% B / min started at two minutes and ended at 24 minutes. The column was then rinsed with 95% B for 5 minutes. The column was rebalanced under load for 5 minutes. This method can partially separate and distinguish the disulfide isomers.

As shown in Table 4, the disulfide bonds between different cysteine positions affect the value of the affinity constant (K _D ). In addition, the data also show that the disulfide bond between two recombinant polypeptides in the dimer will significantly reduce the K _D value. In other words, dimerization may contribute to in vitro molecular interactions between the dimer of the recombinant polypeptide and the ActRIIBecd.

It was observed that some recombinant polypeptides spontaneously formed dimer proteins as shown in Table 4. All of the dimeric proteins can be isolated and purified from the recombinant polypeptide via gel filtration as described in Example 4B. In this embodiment, the dimer protein is a homodimer protein because the monomers are the same. In other embodiments, if the stably transformed E. coli cells as described in Example 4 are selected from the group consisting of SEQ ID No: 260, 268, 276, 284, 292, 300, 308, 316, 324, 332, If two distinct recombinant polypeptides of the group consisting of 340 and 348 are co-expressed, the dimer protein can be a heterodimer protein.

[Example 8]-Determination of the biological activity of alkaline phosphatase

Using the published alkaline phosphatase induction assay in C2C12 cells, the ability of the recombinant polypeptide to bind to cellular receptors and induce signal transduction pathways was investigated. See, for example, Peel et al. ( Published in J Craniofacial Surg. 14: 284-291 in 2003) and Hu et al. (Published in Growth Factors 22: 29033 in 2004).

Prior to confluence, C2C12 cells (Manassas, Virginia, ATCC accession number CRL-1772) were subcultured and resuspended in DMEM supplemented with 10% heat-inactivated fetal bovine serum 1 × 10 ⁵ cells / mL. 100 μL of cell suspension was implanted into each well of a 96-well tissue culture plate (Corning, Cat # 3595). Aliquots of serially diluted standards and test samples were added and the cultures were maintained at 37 ° C and 5% CO ₂ environment. Test samples include restricted media, purified recombinant polypeptides, and commercially available purified recombinant human BMP-2 "rhBMP-2" (R & D Systems, Minneapolis, USA) as a positive control. rhBMP-2 has been shown to play an important role in the development of bone and cartilage, for example: the research of Mundy GR et al. (published in Growth Factors. 22 (4): 233-41 in 2004). Negative control cultures (without sample or rhBMP-2) were cultured for 2 to 7 days. The medium was changed every two days.

When the culture was harvested, it was rinsed with physiological saline (0.90% NaCl, pH 7.4), and the rinsed saline was discarded. 50 μL of an extraction solution (Takara Bio, catalogue # MK301) was added to these cultures, and then subjected to ultrasonic treatment at room temperature for 10 minutes. The lysate was tested for alkaline phosphatase (ALP) by monitoring alkaline buffers as disclosed by Peel et al. ( Published in 2003 by J Craniofacial Surg. 14: 284-291) (St. Louis, Missouri, Sigma, USA) Orich, catalog P5899) for hydrolysis of nitrophenol phosphates, or use the TRACP & ALP detection kit (Takara Bio, catalogue # MK301) according to the manufacturer's instructions. ALP activity was measured by recording the absorbance at 405 nm. The activity score was calculated from the average ALP activity of duplicate samples. Using a 4-parameter curve fitting (4-parameter curve fit) of serially diluted sample rates and relative activity plotted to calculate an EC concentration of ₅₀ individual recombinant polypeptide. The data are shown in Table 5. In some implementations, Coomassie Brilliant Blue (Bradford) protein assay ( oomasie (Bradford) Protein Assay, Pierce Biotechnology Co., Ltd., catalogue # 23200) normalized this ALP activity to the cellular protein content in each well. The normalized ALP activity of each sample was calculated by dividing the ALP activity of each well by the protein content of each well.

In another embodiment. The alkaline phosphatase assay disclosed by Katagiri, T. et al. ( Published in 1990 in Biochem. Biophys. Res. Cornrnun . 172,295-299) was performed. From mouse fibroblasts C3H10T1 / 2 plus strains were cultured in 10% fetal calf serum viviparous BME-Earle medium, 1mL of 1 x 10 ⁵ cells / mL aliquots placed in 24-well culture plate, Maintain at 37 ° C and 10% CO ₂ for 24 hours. After the supernatant was removed, 1 mL of fresh medium with various concentrations of samples was added. After further culture for 4 days, the cells were lysed in 0.2 mL of buffer (0.1 M glycerol, pH 9.6, 1% NP-40, 1 mM MgCl ₂ , 1 mM ZnCl ₂ ), and alkaline phosphatase activity was 50 μL. An aliquot of the lysate was measured, and the lysate was treated with 150 μL of 0.3 mM p-nitrophenol phosphate using a pH 9.6 buffer as a substrate. After incubation at 37 ° C for 20 minutes, the absorbance at 405 nm was recorded. The activity is related to the protein content (BCA protein assay, Pierce Chemical Co.) in each sample.

As shown in Table 5, some of the most recombinant polypeptide having disulfide links which EC ₅₀ values of more rhBMP-2 EC ₅₀ value is low. In other words, most recombinant polypeptides with certain disulfide linkages are able to induce signaling pathways related to bone or cartilage formation or osteogenesis.

[Example 9]-Osteogenic activity in vivo

In rabbit ulnar axis defect, bone-inducing activity against the homodimer protein of two recombinant polypeptides according to Example 6 (ie, SEQ ID NO: 260, including intramolecular disulfide bonds C44-C48) and porous β- Tricalcium phosphate (β-TCP) was evaluated as a carrier material.

In 40 female rabbits (NZW strain, Japan SLC Co., Ltd.), a left and right ulna axis was surgically exposed to make a 20-mm-wide defect. In brief, ketamine hydrochloride (Ketalar, Daiichi Sankyo Co., Ltd.) and xylazine (Selactar 2% injection, Bayer Pharmaceutical Co., Ltd.) were used for compounding in a 3: 1 combination. anesthesia. Use the same solution as additional anesthesia during prolonged surgery. Before surgery, flumilin (Flumarin scientific name flomoxef sodium, Susono Pharmaceutical Co., Ltd.) was administered subcutaneously as an antibiotic. The hair in the general area of the forearm was shaved with an electric razor, and disinfected with Hibitane (chlorhexidine gluconate-ethanol solution, Dainippon Sumitomo Pharmaceutical Co., Ltd.). A longitudinal incision is made in the posteromedial part of each limb of the ulna. Lift the muscle tissue to expose the ulna. A scalpel was used to make a mark from 25 mm of the hand joint exposing the ulna. A 15mm diameter drill was used to drill holes longitudinally and vertically at this mark, paying close attention not to cause the bone to break. Use bone scissors to divide the bone. A mark was also made at a distance of 20 mm from the proximal end, and divided in a similar manner. When segmented, the ulna covered the periosteum, then the periosteum was removed and the bone fragments were thoroughly cleaned with saline.

As shown in Table 6 below, according to one of the A-G groups, an implant is implanted or not implanted in each ulna. In group A-D, ulna was implanted with a single implant of β-TCP carrying a specific dose of homodimer protein. In group E, the ulna was implanted with a single implant of β-TCP without any homodimer protein. Group F ulna was implanted as a single implant for autograft. The ulna of group G had no implants. After that, quickly sew the muscles and dermis.

The β-TCP used in the AE group is a 1-3mm granular type with a porosity of 75% and a pore size of 50-350 μm (Japan, Superpore ^TM Corporation, pentax ceramic artificial bone series, "HOYA" artificial bone substitute) .

In some embodiments, the β-TCP used in the AE group is a particle type of 1-3 mm, with a porosity of 70% or more, and a pore size of 300-600 μm (Taiwan Micro-invasive Medical Equipment Company, "Kangguyi Artificial Bone Replacement".

The homodimeric protein containing the recombinant polypeptide (i.e., SEQ ID NO: 260) in the AD group was frozen from the frozen batch immediately with 0.5 mM hydrochloric acid (diluted with an injection (Otsuka Pharmaceutical Co., Ltd.) as standard solution) immediately before implantation in each animal ready. For unilateral implantation, the fluid volume was set to 180 μl, and 200 mg of β-TCP particles in a sterilized petri dish were uniformly added dropwise. When the fluid was completely dripped, the β-TCP particles were gently stirred with a spatula, allowed to stand at room temperature for more than 15 minutes, and then implanted.

For group F, autograft bone was obtained from the left or right sacrum using bone scissors. The bone was processed into fragments and the implanted bone amount was the same as that of the A-E group.

X-ray evaluation

X-ray images (ie, radiographs) of the side and front were taken immediately after implantation and once every two weeks until 8 weeks after implantation. The radiograph was used to evaluate the condition of the implant site and the degree of osteogenesis. The X-ray images of each group of representative examples are shown in FIG. 1A (Group A-D) and FIG. 1B (Group E-G).

At 2 weeks, the contrast of the particles and boundaries of the graft material in the implant bed can be clearly seen in all groups. At 4 weeks, the TCP particles in the homodimer protein group (namely, A-D group) became inconspicuous, showing the absorption of the particles and the progress of bone formation. In some samples of groups C and D with high-dose homodimer proteins, the boundary between the implantation site and the implant bed became less obvious. At 6 weeks, the boundary between the implantation site and the implant bed in group B became inconspicuous. Improvements in the continuity of the implant bed and the formation of cortical bone were observed in some samples from groups C and D. At 8 weeks, the boundaries of the implant bed in groups A and B became less visible. In group C, the continuity of the implant bed and the formation of cortical bone were improved. Reconstruction of this ulnar defect was observed in group D, as shown in the 6-week image.

In group E using TCP alone, osteogenesis of the implant bed was observed over time. However, the remaining TCP particles were clearly visible even at 8 weeks, indicating insufficient bone formation at the implantation site and poor continuity in the implant bed. Therefore, repair of the defect in group E was still incomplete at 8 weeks.

In group F with autograft, the progress of osteogenesis can be observed over time, and fusion with the implant bed has been achieved at 8 weeks. However, the generation is not uniform.

In group G, which had only a defect and no graft, some micro-osteogenesis was observed on the radius at 8 weeks without any other repair of the defect.

Computerized tomography (CT) scan

Axial orientation was performed at 1 mm intervals using CT scans immediately after transplantation, 4 weeks and 8 weeks after transplantation (GE Yokogawa Medical Systems Co., Ltd.). The image of the implantation site is mainly scanned. Representative examples in Figures 2A (Group A-D) and Figure 2B (Group E-G) show changes in the cross-sectional image of the center of the implantation site over time.

In groups A to D with homodimer proteins, the particles observed immediately after transplantation were partially degraded in a cross-sectional image at 4 weeks, showing that osteogenesis occurred. In group D at a dose of 60 μg, the progress of osteogenesis was further observed, and bone marrow cavity formation was observed in some samples. At 8 weeks, the progress of bone marrow cavity and cortical bone formation was observed in the images of the dose group above 6 μg. In the TCP-only group E, there were still particle agglomerates even at 8 weeks. In group F with autograft, bone marrow cavity formation was observed at 8 weeks, as during reshaping. In the defect-only group G, only slight osteogenesis was observed.

Torsional strength test

The graft material was removed from rabbits euthanized 8 weeks after implantation, and the torsional strength test was performed on the radial bones isolated from ulnar samples from each group. Tests were performed using the 858 Mini Bionix II tool (MTS Systems). The test was performed in a 50 mm long area, that is, a 20 mm long reconstruction area in the center of the ulnar axis and a 15 mm long area proximal and distal to the reconstruction area. The edges on each side are fixed with dental resin. Clamp the resin part in the measuring device. Rotate the left ulna in a counterclockwise direction and the right ulna in a clockwise direction at a rotation speed of 30 ° / min to determine the maximum torque in the event of failure. The ulnar bones of healthy rabbits were examined and compared. These healthy rabbit ulna were obtained from Japanese white rabbits and were different from the types used in groups A to E. However, these Japanese white rabbits were euthanized at the same age and gender as those in groups A to E, ie, 26-week-old female rabbits.

Figure 3 shows the maximum torque obtained by each group under this torsional strength test. In groups A to D with homodimer proteins, the maximum torque and dose dependence was high.

Compared to group E using TCP alone, significantly higher values were observed in groups A to D with homodimer protein doses of 2 μg and above.

Significantly higher values were observed in Groups B to D with a homodimer protein dose of 6 μg and over 6 μg compared to the G-only group.

No significant differences were observed between groups of intact ulna, autograft, or homodimer protein.

Due to insufficient osteogenesis in groups E and G, it was difficult to ensure support in some samples when the radius was isolated. Therefore, only 2 samples of group E and 4 samples of group G were used in the test, and 6 samples of groups A to D and F were used.

Table 7 below shows a comparison of test conditions and results between CHO-derived BMP-2 evaluation studies of the invention using the same animal model and Kokubo et al. (Published in 2003 in Biomaterials 24: 1643-1651, 2003). Compared to the report by Kokubo et al., The present invention is performed under more difficult conditions, such as larger bone defects, smaller doses of active agent, and shorter implantation periods before torsional strength testing. However, the present invention shows successful repair of the ulna, and the maximum torque in the present invention is very similar.

Histological assessment

Specimens were prepared for all animals in groups of 8 and 4 weeks. The tissue obtained during necropsy was stored in a 4% paraformaldehyde solution and decalcified with 10% EDTA. The tissue is then embedded in paraffin. Lamellar samples were made on a plane parallel to the long axis of the radius, stained with hematoxylin and eosin (HE), and histologically evaluated. To determine osteogenesis and fusion conditions for the implant bed.

In groups A to D with homodimer proteins, osteogenesis progressed to a striated pattern at 4 weeks. Active osteogenesis was observed in samples of high-dose homodimer proteins. A significant amount of new bone and angiogenesis was observed in group D at 60 μg. Residual material was observed in some samples at low doses of groups A and B, while almost no residual material was observed in groups C and D. In groups A and B, cartilage formation was observed near the border of the implant bed in some samples. In all samples, the implant bed was directly connected to the striated neonatal bone. At 8 weeks, stripes and residual material were still observed in group A at a dose of 2 μg. Cartilage was also observed near the border of the implant bed. Even with insufficient reshaping, progress in osteogenesis can be observed. The generation of cortical bone in the radius was observed in some samples. Groups B to D in doses exceeding 6 μg were reshaped to form bone cortex and bone marrow. The improvement was more pronounced in the higher dose groups. Continuity also increases at the implantation site.

In group E using TCP alone, osteogenesis was observed on the graft material in the radius, but the residual material was clearly visible even at 8 weeks, indicating insufficient bone formation and poor continuity on the axis.

In group F with autograft, good bone formation on the graft bone fragments was seen at 4 weeks, and new bone was in contact with the implant bed. Chondrogenesis was observed near the border of the implant bed. At 8 weeks, the progress of new bone remodeling and cortical formation can be observed, but residual graft bone fragments can still be observed.

In group G with only defects, osteogenesis was observed only in the radius, and the defect has not yet been repaired.

The invention is not limited to the scope of the specific embodiments described herein. In fact, in addition to what has been described, various modifications will be apparent to those skilled in the art to which the present invention pertains from the foregoing description and the accompanying drawings. Such modifications are intended to fall within the scope of the appended patent applications.

Other implementations are within the scope of the attached patent application.

<110> Osteopharma Inc.

<120> Recombinant polypeptide, nucleic acid molecule and composition thereof, and method for producing and using same

<130> 3902.0010000

<160> 357

<170> PatentIn version 3.5

<210> 1

<211> 875

<212> DNA

<213> Artificial sequence

<220>

<223> Fragment of Conomycin resistance gene (+3886 to +4760)

<400> 1

<210> 2

<211> 1113

<212> DNA

<213> Artificial sequence

<220>

<223> Ampicillin resistance gene (+3587 to +4699) fragment

<400> 2

<210> 3

<211> 4513

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana

<400> 3

<210> 4

<211> 273

<212> DNA

<213> Homo sapiens

<400> 4

<210> 5

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 5

<210> 6

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 6

<210> 7

<211> 1539

<212> DNA

<213> Homo sapiens

<400> 7

<210> 8

<211> 512

<212> PRT

<213> Homo sapiens

<400> 8

<210> 9

<211> 91

<212> PRT

<213> Homo sapiens

<400> 9

<210> 10

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 10

<210> 11

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> pACT2 database plastid insertion

<400> 11

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 12

<210> 13

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 13

<210> 14

<211> 150

<212> DNA

<213> Artificial sequence

<220>

<223> pACT2 database plastid insertion

<400> 14

<210> 15

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 15

<210> 16

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 16

<210> 17

<211> 132

<212> DNA

<213> Artificial sequence

<220>

<223> pACT2 database plastid insertion

<400> 17

<210> 18

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 18

<210> 19

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 19

<210> 20

<211> 90

<212> DNA

<213> Artificial sequence

<220>

<223> pACT2 database plastid insertion

<400> 20

<210> 21

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 21

<210> 22

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 22

<210> 23

<211> 120

<212> DNA

<213> Artificial sequence

<220>

<223> pACT2 database plastid insertion

<400> 23

<210> 24

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 24

<210> 25

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 25

<210> 26

<211> 174

<212> DNA

<213> Artificial sequence

<220>

<223> pACT2 database plastid insertion

<400> 26

<210> 27

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 27

<210> 28

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 28

<210> 29

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 29

<210> 30

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 30

<210> 31

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 31

<210> 32

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 32

<210> 33

<211> 21

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 33

<210> 34

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 34

<210> 35

<211> 21

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 35

<210> 36

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 36

<210> 37

<211> 21

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 37

<210> 38

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 38

<210> 39

<211> 21

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 39

<210> 40

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 40

<210> 41

<211> 21

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 41

<210> 42

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 42

<210> 43

<211> 21

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 43

<210> 44

<211> 150

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 44

<210> 45

<211> 50

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 45

<210> 46

<211> 150

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 46

<210> 47

<211> 50

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 47

<210> 48

<211> 150

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 48

<210> 49

<211> 50

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 49

<210> 50

<211> 150

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 50

<210> 51

<211> 50

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 51

<210> 52

<211> 150

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 52

<210> 53

<211> 50

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 53

<210> 54

<211> 150

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 54

<210> 55

<211> 50

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 55

<210> 56

<211> 132

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 56

<210> 57

<211> 44

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 57

<210> 58

<211> 132

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 58

<210> 59

<211> 44

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 59

<210> 60

<211> 132

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 60

<210> 61

<211> 44

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 61

<210> 62

<211> 132

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 62

<210> 63

<211> 44

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 63

<210> 64

<211> 132

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 64

<210> 65

<211> 44

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 65

<210> 66

<211> 132

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 66

<210> 67

<211> 44

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 67

<210> 68

<211> 90

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 68

<210> 69

<211> 30

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 69

<210> 70

<211> 90

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 70

<210> 71

<211> 30

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 71

<210> 72

<211> 90

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 72

<210> 73

<211> 30

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 73

<210> 74

<211> 120

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 74

<210> 75

<211> 40

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 75

<210> 76

<211> 120

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 76

<210> 77

<211> 40

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 77

<210> 78

<211> 174

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 78

<210> 79

<211> 126

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 79

<210> 80

<211> 42

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 80

<210> 81

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 81

<210> 82

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 82

<210> 83

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 83

<210> 84

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 84

<210> 85

<211> 126

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 85

<210> 86

<211> 42

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 86

<210> 87

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 87

<210> 88

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 88

<210> 89

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 89

<210> 90

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 90

<210> 91

<211> 300

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 91

<210> 92

<211> 100

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 92

<210> 93

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 93

<210> 94

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 94

<210> 95

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 95

<210> 96

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 96

<210> 97

<211> 300

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 97

<210> 98

<211> 100

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 98

<210> 99

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 99

<210> 100

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 100

<210> 101

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 101

<210> 102

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 102

<210> 103

<211> 264

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 103

<210> 104

<211> 88

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 104

<210> 105

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 105

<210> 106

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 106

<210> 107

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 107

<210> 108

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 108

<210> 109

<211> 264

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 109

<210> 110

<211> 88

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 110

<210> 111

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 111

<210> 112

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 112

<210> 113

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 113

<210> 114

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 114

<210> 115

<211> 153

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 115

<210> 116

<211> 51

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 116

<210> 117

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 117

<210> 118

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 118

<210> 119

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 119

<210> 120

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 120

<210> 121

<211> 153

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 121

<210> 122

<211> 51

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 122

<210> 123

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 123

<210> 124

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 124

<210> 125

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 125

<210> 126

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 126

<210> 127

<211> 240

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 127

<210> 128

<211> 80

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 128

<210> 129

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 129

<210> 130

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 130

<210> 131

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 131

<210> 132

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 132

<210> 133

<211> 240

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 133

<210> 134

<211> 80

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 134

<210> 135

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 135

<210> 136

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 136

<210> 137

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 137

<210> 138

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 138

<210> 139

<211> 183

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 139

<210> 140

<211> 61

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 140

<210> 141

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 141

<210> 142

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 142

<210> 143

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 143

<210> 144

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 144

<210> 145

<211> 183

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 145

<210> 146

<211> 61

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 146

<210> 147

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 147

<210> 148

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 148

<210> 149

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 149

<210> 150

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 150

<210> 151

<211> 270

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 151

<210> 152

<211> 90

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 152

<210> 153

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 153

<210> 154

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 154

<210> 155

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 155

<210> 156

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 156

<210> 157

<211> 270

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 157

<210> 158

<211> 90

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 158

<210> 159

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 159

<210> 160

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 160

<210> 161

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 161

<210> 162

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 162

<210> 163

<211> 237

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 163

<210> 164

<211> 79

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 164

<210> 165

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 165

<210> 166

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 166

<210> 167

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 167

<210> 168

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 168

<210> 169

<211> 237

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 169

<210> 170

<211> 79

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 170

<210> 171

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 171

<210> 172

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 172

<210> 173

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 173

<210> 174

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 174

<210> 175

<211> 324

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 175

<210> 176

<211> 108

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 176

<210> 177

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 177

<210> 178

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 178

<210> 179

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 179

<210> 180

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 180

<210> 181

<211> 213

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 181

<210> 182

<211> 71

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 182

<210> 183

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 183

<210> 184

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 184

<210> 185

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 185

<210> 186

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 186

<210> 187

<211> 213

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 187

<210> 188

<211> 71

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 188

<210> 189

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 189

<210> 190

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 190

<210> 191

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 191

<210> 192

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 192

<210> 193

<211> 213

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 193

<210> 194

<211> 71

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 194

<210> 195

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 195

<210> 196

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 196

<210> 197

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 197

<210> 198

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 198

<210> 199

<211> 282

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 199

<210> 200

<211> 94

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 200

<210> 201

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 201

<210> 202

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 202

<210> 203

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 203

<210> 204

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 204

<210> 205

<211> 282

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 205

<210> 206

<211> 94

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 206

<210> 207

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 207

<210> 208

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 208

<210> 209

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 209

<210> 210

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 210

<210> 211

<211> 195

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 211

<210> 212

<211> 65

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 212

<210> 213

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 213

<210> 214

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 214

<210> 215

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 215

<210> 216

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 216

<210> 217

<211> 195

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 217

<210> 218

<211> 65

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 218

<210> 219

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 219

<210> 220

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 220

<210> 221

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 221

<210> 222

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 222

<210> 223

<211> 213

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 223

<210> 224

<211> 71

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 224

<210> 225

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 225

<210> 226

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 226

<210> 227

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 227

<210> 228

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 228

<210> 229

<211> 213

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 229

<210> 230

<211> 71

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 230

<210> 231

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 231

<210> 232

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 232

<210> 233

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 233

<210> 234

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 234

<210> 235

<211> 195

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 235

<210> 236

<211> 65

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 236

<210> 237

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 237

<210> 238

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 238

<210> 239

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 239

<210> 240

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 240

<210> 241

<211> 195

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 241

<210> 242

<211> 65

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 242

<210> 243

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 243

<210> 244

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 244

<210> 245

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 245

<210> 246

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 246

<210> 247

<211> 282

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 247

<210> 248

<211> 94

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 248

<210> 249

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 249

<210> 250

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 250

<210> 251

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 251

<210> 252

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 252

<210> 253

<211> 282

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 253

<210> 254

<211> 94

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 254

<210> 255

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 255

<210> 256

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 256

<210> 257

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 257

<210> 258

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 258

<210> 259

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 259

<210> 260

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 260

<210> 261

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 261

<210> 262

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 262

<210> 263

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 263

<210> 264

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 264

<210> 265

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 265

<210> 266

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 266

<210> 267

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 267

<210> 268

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 268

<210> 269

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 269

<210> 270

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 270

<210> 271

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 271

<210> 272

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 272

<210> 273

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 273

<210> 274

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 274

<210> 275

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 275

<210> 276

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 276

<210> 277

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 277

<210> 278

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 278

<210> 279

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 279

<210> 280

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 280

<210> 281

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 281

<210> 282

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 282

<210> 283

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 283

<210> 284

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 284

<210> 285

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 285

<210> 286

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 286

<210> 287

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 287

<210> 288

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 288

<210> 289

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 289

<210> 290

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 290

<210> 291

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 291

<210> 292

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 292

<210> 293

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 293

<210> 294

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 294

<210> 295

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 295

<210> 296

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 296

<210> 297

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 297

<210> 298

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 298

<210> 299

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 299

<210> 300

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 300

<210> 301

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 301

<210> 302

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 302

<210> 303

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 303

<210> 304

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 304

<210> 305

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 305

<210> 306

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 306

<210> 307

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 307

<210> 308

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 308

<210> 309

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 309

<210> 310

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 310

<210> 311

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 311

<210> 312

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 312

<210> 313

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 313

<210> 314

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 314

<210> 315

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 315

<210> 316

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 316

<210> 317

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 317

<210> 318

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 318

<210> 319

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 319

<210> 320

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 320

<210> 321

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 321

<210> 322

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 322

<210> 323

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 323

<210> 324

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 324

<210> 325

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 325

<210> 326

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 326

<210> 327

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 327

<210> 328

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 328

<210> 329

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 329

<210> 330

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 330

<210> 331

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 331

<210> 332

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 332

<210> 333

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 333

<210> 334

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 334

<210> 335

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 335

<210> 336

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 336

<210> 337

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 337

<210> 338

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 338

<210> 339

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 339

<210> 340

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 340

<210> 341

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 341

<210> 342

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 342

<210> 343

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 343

<210> 344

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 344

<210> 345

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 345

<210> 346

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 346

<210> 347

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 347

<210> 348

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative PCR fusion product

<400> 348

<210> 349

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 349

<210> 350

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 350

<210> 351

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 351

<210> 352

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 352

<210> 353

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 353

<210> 354

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 354

<210> 355

<211> 58

<212> PRT

<213> Artificial sequence

<220>

<223> pQE-80L-Kana derivative

<400> 355

<210> 356

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Third domain fragment of recombinant polypeptide

<400> 356

<210> 357

<211> 5

<212> PRT

<213> Artificial sequence

<220>

<223> Third domain fragment of recombinant polypeptide

<400> 357

Claims (30)

    A recombinant polypeptide comprising: a first domain selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 39; a second domain selected from the group consisting of SEQ ID NO: 47 And a group consisting of SEQ ID NO: 49; and a third domain selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 61; wherein the second domain contains an intramolecular disulfide Bond (intramolecular disulfide bond).         A recombinant polypeptide comprising: a first domain selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 39; a second domain selected from the group consisting of SEQ ID NO: 47 and SEQ ID A group consisting of NO: 49; and a third domain selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 61; wherein the second domain comprises the 23rd amine group in the second domain An intramolecular disulfide bond between the acid and the 27th amino acid of the second domain.         The recombinant polypeptide according to claim 1 or 2, wherein the recombinant polypeptide is capable of inducing alkaline phosphatase activity.         The recombinant polypeptide of claim 1 or 2, wherein the third domain comprises: a first amino acid sequence PKACCVPTE (SEQ ID NO: 356) and a second amino acid sequence GCGCR (SEQ ID NO: 357), and The third domain contains two intramolecular disulfide bonds between the first and second amino acid sequences.         The recombinant polypeptide according to claim 4, wherein the recombinant polypeptide comprises: a first between a fourth amino acid of the first amino acid sequence and a second amino acid of the second amino acid sequence An intramolecular disulfide bond, and a second intramolecular disulfide bond between one of the fifth amino acid of the first amino acid sequence and the fourth amino acid of the second amino acid sequence.         The recombinant polypeptide of claim 4, wherein the recombinant polypeptide comprises: a first between a fifth amino acid of the first amino acid sequence and a second amino acid of the second amino acid sequence An intramolecular disulfide bond, and a second intramolecular disulfide bond between one of the fourth amino acid of the first amino acid sequence and the fourth amino acid of the second amino acid sequence.         A homodimer protein comprising two identical recombinant polypeptides according to any one of claims 1 to 6, wherein the homodimer protein comprises one between the first domains of the two recombinant polypeptides Intermolecular disulfide bond.         The homodimer protein of claim 7, wherein the second domain of the single or all two of the two identical recombinant polypeptides comprises an intramolecular disulfide bond.         For example, the homodimeric protein of claim 7 or claim 8, wherein the third domain of each of the recombinant polypeptides includes: a first amino acid sequence PKACCVPTE (SEQ ID NO: 356) and a second amino acid Sequence GCGCR (SEQ ID NO: 357), and wherein the homodimer protein comprises: the first amino acid sequence and the other recombinant polypeptide in the third domain of the two one of the recombinant polypeptides Two intermolecular disulfide bonds between the second amino acid sequence in the third domain.         The homodimer protein of claim 9, wherein the homodimer protein comprises: a fourth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides and the other recombinant polypeptide One of the first intermolecular disulfide bonds between the second amino acid sequence of the second amino acid sequence, and the fifth amine of the first amino acid sequence of the two one of the recombinant polypeptides A second intermolecular disulfide bond between one of the amino acid and the fourth amino acid of the second amino acid sequence of the another recombinant polypeptide.         The homodimer protein of claim 9, wherein the homodimer protein comprises: the fifth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides and the other recombinant polypeptide One of the first intermolecular disulfide bond between the second amino acid sequence of the second amino acid sequence, and the fourth amine of the first amino acid sequence of the two one of the recombinant polypeptides A second intermolecular disulfide bond between one of the amino acid and the fourth amino acid of the second amino acid sequence of the another recombinant polypeptide.         The homodimer protein of claim 7, wherein the third domain of each of the recombinant polypeptides comprises: a first amino acid sequence PKACCVPTE (SEQ ID NO: 356) and a second amino acid sequence GCGCR (SEQ ID NO: 357), and wherein the homodimer protein comprises: the first amino acid sequence in the third domain of one of the two recombinant polypeptides and the third domain of the one recombinant polypeptide Among the two intra-molecular disulfide bonds between the second amino acid sequence.         The homodimer protein of claim 12, wherein the homodimer protein comprises: the fourth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides and the one of the recombinant polypeptides One of the first intramolecular disulfide bonds between the second amino acid of the second amino acid sequence, and the fifth amine of the first amino acid sequence of the two one of the recombinant polypeptides A second intramolecular disulfide bond between the amino acid and the fourth amino acid of the second amino acid sequence of the one recombinant polypeptide.         The homodimer protein of claim 12, wherein the homodimer protein comprises: the fifth amino acid of the first amino acid sequence of the two one of the recombinant polypeptides and the one of the recombinant polypeptides One of the first intramolecular disulfide bonds between the second amino acid of the second amino acid sequence, and the fourth amine of the first amino acid sequence of the two one of the recombinant polypeptides A second intramolecular disulfide bond between the amino acid and the fourth amino acid of the second amino acid sequence of the one recombinant polypeptide.         A heterodimer protein comprising two different recombinant polypeptides as in any one of claims 1 to 6, wherein the heterodimer protein comprises: the first domains of the two different recombinant polypeptides An intermolecular disulfide bond.         The heterodimer protein of claim 15, wherein the second domain of one or both of the one or two different two different recombinant polypeptides comprises an intramolecular disulfide bond.         A recombinant polypeptide comprising: a first domain selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 39; a second domain selected from the group consisting of SEQ ID NO: 47 And a group consisting of SEQ ID NO: 49; and a third domain selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 61; wherein the recombinant polypeptide comprises an amino acid sequence, The amino acid sequence is selected from the group consisting of SEQ ID NO: 260, SEQ ID NO: 268, SEQ ID NO: 276, SEQ ID NO: 284, SEQ ID NO: 292, SEQ ID NO: 300, SEQ ID NO: 308, The group consisting of SEQ ID NO: 316, SEQ ID NO: 324, SEQ ID NO: 332, SEQ ID NO: 340 and SEQ ID NO: 348.         A recombinant polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 260, SEQ ID NO: 268, SEQ ID NO: 276, SEQ ID NO: 284, SEQ ID NO: 292, A group consisting of SEQ ID NO: 300, SEQ ID NO: 308, SEQ ID NO: 316, SEQ ID NO: 324, SEQ ID NO: 332, SEQ ID NO: 340 and SEQ ID NO: 348, wherein the recombination The polypeptide contains an intramolecular disulfide bond between cysteine 44 and cysteine 48.         The recombinant polypeptide of claim 17 or 18, wherein the recombinant polypeptide comprises: an intramolecular disulfide bond between cysteine 79 and cysteine 112, and cysteine 80 and cysteine An intramolecular disulfide bond between 114.         The recombinant polypeptide of claim 17 or 18, wherein the recombinant polypeptide comprises: an intramolecular disulfide bond between cysteine 80 and cysteine 112, and cysteine 79 and cysteine An intramolecular disulfide bond between 114.         A homodimeric protein comprising two identical recombinant polypeptides as claimed in claims 1 to 6 or 17 to 20.         The homodimer protein of claim 21, comprising an intermolecular disulfide bond between the two cysteine 15 of one of the recombinant polypeptides and the cysteine 15 of the other recombinant polypeptide.         The homodimer protein of claim 22, comprising: (a) an intermolecular molecule between cysteine 79 of one of the two recombinant polypeptides and cysteine 112 of the other recombinant polypeptide A disulfide bond, and an intermolecular disulfide bond between cysteine 80 of one of the two recombinant polypeptides and cysteine 114 of the other recombinant polypeptide; or (b) between the two An intermolecular disulfide bond between cysteine 80 of one of the recombinant polypeptides and cysteine 112 of the other recombinant polypeptide, and cysteine 79 and An intermolecular disulfide bond between cysteine 114 of the other recombinant polypeptide.         An isolated nucleic acid molecule comprising a polynucleotide sequence encoding a recombinant polypeptide according to any one of claims 1 to 6 or 17 to 20.         A recombinant nucleic acid molecule comprising an expression control region operably linked to an isolated nucleic acid molecule as claimed in claim 24.         An isolated host cell comprising an isolated nucleic acid molecule as claimed in claim 24 or a recombinant nucleic acid molecule as claimed in claim 25.         A method of making a recombinant vector comprising inserting an isolated nucleic acid molecule as claimed in claim 24 into a vector.         A method for preparing a recombinant host cell, comprising introducing an isolated nucleic acid molecule as claimed in claim 24 or a recombinant nucleic acid molecule as claimed in claim 25 into a host cell.         A method of manufacturing a recombinant polypeptide, comprising: culturing an isolated host cell as in claim 26, and isolating the recombinant polypeptide.         A composition comprising a recombinant polypeptide according to any of claims 1 to 6 or 17 to 20, a homodimeric protein according to any of claims 7 to 14 or 21 to 23, or a polypeptide according to claims 15 or 16 Heterodimeric protein.