TW201707711A - Oligonucleotide compositions and methods thereof - Google Patents

Abstract

Among other things, the present disclosure relates to chirally controlled oligonucleotides of select designs, chirally controlled oligonucleotide compositions, and methods of making and using the same. In some embodiments, a provided chirally controlled oligonucleotide composition provides different cleavage patterns of a nucleic acid polymer than a reference oligonucleotide composition. In some embodiments, a provided chirally controlled oligonucleotide composition provides single site cleavage within a complementary sequence of a nucleic acid polymer. In some embodiments, a chirally controlled oligonucleotide composition has any sequence of bases, and/or pattern or base modifications, sugar modifications, backbone modifications and/or stereochemistry, or combination of these elements, described herein.

Description

Oligonucleotide composition and method therefor Cross-reference to related applications

This application claims US Provisional Application No. 62/195,779, filed on July 22, 2015, US Provisional Application No. 62/236,847, filed on October 2, 2015, and US Provisional Application, filed on May 4, 2016 Priority to Application No. 62/331,960, the entire contents of each of which are incorporated herein by reference.

Oligonucleotides are useful in therapeutic, diagnostic, research, and nanomaterial applications. The use of naturally occurring nucleic acids (eg, unmodified DNA or RNA) for therapy may be limited, for example, due to their instability to extracellular and intracellular nucleases and/or their poor cell permeability and distributed. There is a need for novel and improved oligonucleotide and oligonucleotide compositions, such as novel antisense and siRNA oligonucleotides and oligonucleotide compositions.

In particular, the present invention recognizes structural elements of oligonucleotides (such as base sequences), chemical modifications (eg, modification of sugars, bases and/or internucleotide linkages, and modes thereof) and/or stereochemistry. (For example, the stereochemistry of the backbone to the palmar center (for palm-to-nucleotide linkages) and/or its mode) can have a large impact on the properties (eg, activity) of the oligonucleotide. In some embodiments, the present invention demonstrates that oligonucleotide compositions comprising oligonucleotides having controlled structural elements (eg, controlled chemical modifications and/or controlled backbone stereochemistry patterns) provide unexpected characteristics, This includes, but is not limited to, the features described herein. In some embodiments, the present invention demonstrates that the combination of chemical modification and stereochemistry can provide unexpected, greatly improved properties (e.g., biological activity, selectivity, etc.). In some embodiments, the present invention provides an oligonucleotide composition having a specific base sequence and/or a sugar modification pattern (eg, 2'-OMe, 2'-F, 2'-MOE, etc.) and a mode of stereochemistry of a mode or base modification (eg, 5-methylcytosine) and/or a backbone modification mode (phosphate or phosphorothioate) and/or backbone modification (eg, each thio The phosphate ester is S p or R p).

In some embodiments, the modification of the internucleotide linkage converts the phosphorus atom in the modified linkage into a palm center. For example, in a phosphorothioate (PS) modification, a non-bridged oxygen (O) atom bonded to a phosphorus (P) atom is replaced with a sulfur (S) atom. The result of using the PS modification in oligonucleotide synthesis is the formation of a palm center at the phosphorus, which may have a "Sp" or "Rp" configuration. For example, with 19 PS linkages [e.g. having a length of 20 nucleotides, modified PS 19, each having two possible stereochemically (S p or R p) in each of the modified PS] of conventional The stereoregular PS modified oligonucleotide composition is a random mixture of more than 500,000 (2 ¹⁹ ) stereoisomers each having the same nucleotide sequence (eg, base sequence), However, the stereochemistry along its backbone is different; such compositions are "stereo-random" oligonucleotide compositions. In some embodiments, in contrast to a stereospecific composition, the palm-controlled oligonucleotide composition is a substantially pure single oligonucleotide preparation because of a predetermined amount of oligonucleotide in the composition. It has a common base sequence and length, a common backbone linkage mode, and a common backbone-to-palm center mode. In some embodiments, some of the oligonucleotide compositions is a perspective pure (i.e., chiral oligonucleotide compositions controlled), wherein the stereochemistry of each PS has been defined (S p or R p) . In some embodiments, in a stereoregular composition of oligonucleotides, the various oligonucleotides can have the same base sequence, the same sugar modification pattern (eg, 2'-OMe, 2'-F, 2' -OME, etc.), the same base modification mode (for example, 5-methylcytosine) and the same main chain modification mode (phosphate or PS), but with different main chain-to-palm central modes, and due to non-stereoscopic control Synthetic, so its content is random (not pre-determined via stereospecific synthesis as in some of the methods described herein for the palmitic adjuvant). The palm-controlled oligonucleotide composition can be selected such that the desired biological activity becomes greater compared to a stereoregular preparation of oligonucleotides of the same base sequence (eg, in RNA interference or ribonuclease H) The activity in the mediated pathway is increased, the efficiency is increased, etc., and the inappropriate activity (eg, inappropriate immunogenicity, toxicity, etc.) is reduced. In some embodiments, the palm-controlled oligonucleotide composition is capable of better distinguishing between a mutant (mu) and a wild-type (wt) HTT sequence (having a single nt difference).

In particular, the present invention recognizes that stereoregular oligonucleotide preparations contain a plurality of distinct chemical entities that differ from one another, such as the individual chemical chains within the oligonucleotide chain differing in the stereochemical structure of the palm center. Stereotactic oligonucleotide preparations provide an uncontrolled composition comprising an indeterminate amount of oligonucleotide stereoisomers without controlling the stereochemistry of the backbone to the palm center. Even though such stereoisomers may have the same base sequence, at least due to their different backbone stereochemistry, they are still different chemical entities and, as presented herein, may have different properties, such as active. In particular, the invention provides novel compositions which are or contain specific stereoisomers of the oligonucleotide of interest. In some embodiments, a particular stereoisomer can be defined, for example, by its base sequence, its length, its backbone linkage mode, and its backbone-to-palm central mode. As is understood in the art, in some embodiments, a base sequence can refer to a nucleoside residue in an oligonucleotide (eg, a sugar and/or base component relative to a standard naturally occurring nucleotide. The identity and/or modification status of, for example, adenine, cytosine, guanosine, thymine, and uracil, and/or the hybridization characteristics of the residues (ie, the ability to hybridize to a particular complementary residue) ).

In particular, the invention demonstrates that individual stereoisomers of a particular oligonucleotide may exhibit different stability and/or activity (e.g., functional and/or toxic properties) from one another. Furthermore, the present invention demonstrates that stability and/or activity improvement achieved by positioning within a oligonucleotide comprising a particular pair of palmar structures and/or specific pairs of palmar structures may be similar, or even superior to, achieved via These improvements: the use of specific backbone linkages, residue modifications, etc. (eg, via the use of certain types of modified phosphates [eg, phosphorothioates, substituted thiophosphates) Ester, etc.], sugar modification [eg 2' modification, etc.] and/or base modification [eg methylation, etc.).

In particular, the present invention recognizes that in some embodiments, the characteristics (eg, stability and/or activity) of an oligonucleotide can be adjusted by optimizing its backbone-to-palm central mode, as appropriate, with oligonucleotides. An adjusted/optimized combination of one or more other features of the glycoside (eg, linkage mode, nucleoside modification mode, etc.).

In some embodiments, the invention provides compositions of oligonucleotides, wherein the oligonucleotides have a common backbone-to-palm center mode that unexpectedly greatly enhances the stability of the oligonucleotide and/or Or biological activity. In some embodiments, the backbone provides increased stability to the palm center mode. In some embodiments, the backbone provides an unexpectedly increased activity to the palm center pattern. In some embodiments, the backbone provides increased stability and activity to the palm center mode. In some embodiments, when the oligonucleotide is used to cleave the nucleic acid polymer, the backbone-to-palm center mode itself unexpectedly alters the cleavage mode of the target nucleic acid polymer. In some embodiments, the backbone-to-palm central mode is effective to prevent cleavage at the secondary site. In some embodiments, the backbone forms a new cleavage site for the palm center pattern. In some embodiments, the backbone-to-palm central mode minimizes the number of cleavage sites. In some embodiments, the backbone-to-palm central mode minimizes the number of cleavage sites such that the target nucleic acid polymer cleaves only at one site within the target nucleic acid polymer sequence complementary to the oligonucleotide. In some embodiments, the backbone-to-palm center mode can enhance the efficiency of cleavage at the cleavage site. In some embodiments, the backbone-to-palm center mode of the oligonucleotide can improve cleavage of the target nucleic acid polymer. In some embodiments, the backbone adds selectivity to the palm center mode. In some embodiments, the main chain versus palm center mode minimizes off-target effects. In some embodiments, the backbone increases selectivity for the palm center pattern, such as cleavage selectivity between two target sequences that differ only by single nucleotide polymorphism (SNP). In some embodiments, the backbone-to-palm center mode comprises the following, one or more of the following repetitions or is: ( S p) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m . In some embodiments described herein, m is from 1 to 50; and n is from 1 to 10; and t is from 1 to 50. In some embodiments, the main chain versus palm center mode comprises or is ( S p)m( R p)n, ( R p)n( S p)m, ( N p)t( R p)n( S p)m or ( S p)t( R p)n( S p)m. In some embodiments, the main chain-to-palm center mode comprises or is ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , where m>2. In some embodiments, the backbone-to-palm center mode is a sequence comprising at least 5, 6, 7, 8, 9, or 10 or more consecutive ( Sp ) positions. In some embodiments, the backbone-to-palm center mode is a sequence comprising at least 5 consecutive ( Sp ) positions. In some embodiments, the backbone-to-palm center mode is a sequence comprising at least 8 consecutive ( Sp ) positions. In some embodiments, the backbone-to-palm center mode is a sequence comprising at least 10 consecutive ( Sp ) positions. In some embodiments, the backbone sequence chiral centers in addition to a single mode (R p) than a full (S p) thereof. In some embodiments, other than a single (R p) backbone chiral centers mode except at the position adjacent to the SNP at that position or the full sequence of (S p) thereof. In some embodiments, backbone chiral centers in addition to a single sequence mode (R p) than a full (S p) thereof, wherein the molecule has wings - Core - wing form. In some embodiments, backbone chiral centers other than a single sequence mode (R p) of the full (S p) thereof, wherein the molecule has wings - Core - wing form, wherein the 5 'end of the wing It is 1-9 nt long, the core is 1-15 nt long, and the wing at the 3' end is 1-9 nt long. In some embodiments, backbone chiral centers other than a single sequence mode (R p) of the full (S p) thereof, wherein the molecule has wings - Core - wing form, wherein the 5 'end of the wing It is 5 nt long, the core is 1-15 nt long, and the wing at the 3' end is 5 nt long. In some embodiments, backbone chiral centers other than a single sequence mode (R p) of the full (S p) thereof, wherein the molecule has wings - Core - wing form, wherein the 5 'end of the wing It is 1-9 nt long, the core is 10 nt long, and the wing at the 3' end is 1-9 nt long. In some embodiments, backbone chiral centers other than a single sequence mode (R p) of the full (S p) thereof, wherein the molecule has wings - Core - wing form, wherein the 5 'end of the wing It is 5 nt long, the core is 10 nt long, and the wing at the 3' end is 5 nt long. In some embodiments, backbone chiral centers other than a single sequence mode (R p) of the full (S p) thereof, wherein the molecule has wings - Core - wing form, wherein the 5 'end of the wing It is 5 nt long, the core is 10 nt long, and the wing at the 3' end is 5 nt long, and at least one wing contains a nucleotide with a 2'-OMe modification. In some embodiments, backbone chiral centers other than a single sequence mode (R p) of the full (S p) thereof, wherein the molecule has wings - Core - wing form, wherein each wing comprises at least one having 2'-OMe modified nucleotide. In some embodiments, backbone chiral centers other than a single sequence mode (R p) of the full (S p) thereof, wherein the molecule has wings - Core - wing form, wherein each nucleoside of the wings The acids all have a 2'-OMe modification. In some embodiments, backbone chiral centers other than a single sequence mode (R p) of the full (S p) thereof, wherein the molecule has wings - Core - wing form, wherein the 5 'end of the wing It is 5 nt long, the core is 10 nt long, and the wing at the 3' end is 5 nt long, and each nucleotide in each wing has a 2'-OMe modification. In some embodiments, the oligonucleotide is single-stranded and has a wing-core-wing form, wherein the wing at the 5' end of the molecule comprises 4 to 8 nt, each of which has a 2'-OMe modification and wherein the molecule The 5' nt has a phosphorothioate in the Sp configuration; the core comprises 8 to 12 nt, each of which is DNA (2'-H), wherein one nt has a phosphorothioate at the Rp position. In addition, each has a phosphorothioate at the Sp position; and wherein the wing at the 3' end of the molecule comprises 4 to 8 nt, each of which has a 2'-OMe modification, and wherein the nt at the 3' end of the molecule comprises Phosphorothioate of the Sp configuration. In some embodiments, the oligonucleotide is single-stranded and has a wing-core-wing form, wherein the wing at the 5' end of the molecule comprises 6 nt, each of which has a 2'-OMe modification and wherein the molecule is 5' The nt has a phosphorothioate in the form of a Sp; the core comprises 10 nt, each of which is DNA (2'-H), wherein each of the nt has a phosphorothioate at the Rp position, each having Phosphorothioate at the Sp position; and wherein the wing at the 3' end of the molecule comprises 6 nt, each of which has a 2'-OMe modification, and wherein the nt at the 3' end of the molecule comprises a thio group in the Sp configuration Phosphate ester.

In some embodiments, the present invention recognizes that chemical modifications such as modifications of nucleosides and internucleotide linkages can provide enhanced properties. In some embodiments, the present invention demonstrates that the combination of chemical modification and stereochemistry can provide unexpected, greatly improved properties (e.g., biological activity, selectivity, etc.). In some embodiments, chemical combinations (such as modifications of sugars, bases, and/or internucleotide linkages) and stereochemical modes (eg, ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m ) combinations, resulting in oligonucleotides having surprisingly enhanced properties and compositions thereof. In some embodiments, the provided oligonucleotide composition is palm-controlled and comprises one or more sugar moieties, one or more natural phosphate linkages, one or more phosphorothioates The 2' modification of the bond and the stereochemical mode ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p ) the combination of _m, where m> 2.

In some embodiments, the invention provides a palm-controlled oligonucleotide composition comprising an oligonucleotide having the following definitions: 1) a common base sequence and length; 2) a common backbone linkage Mode; and 3) a common backbone-to-palm central mode, the composition being a substantially pure single oligonucleotide preparation, as the predetermined amount of oligonucleotides in the composition have a common base sequence and length, common Main chain bonding mode and common main chain versus palm center mode.

In some embodiments, the invention provides a palm-controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type, characterized by: 1) a common base sequence and length; a common backbone linkage mode; and 3) a common backbone-to-palm central mode; the composition is palm-controlled because it is substantially external to an oligonucleotide having the same base sequence and length For racemic formulations, the oligonucleotide of the particular oligonucleotide type is enriched in the composition.

In some embodiments, the invention provides a palm-controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type, characterized by: 1) a common base sequence and length; a common backbone linkage mode; and 3) a common backbone versus palm center mode, the composition being a substantially pure single nucleus The glycoside preparation is such that at least about 10% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone pair palm center pattern.

In particular, the present invention recognizes that combinations of oligonucleotide structural elements (e.g., chemical modifications, backbone linkages, backbone-to-palm centers, and/or modes of backbone phosphorus modification) can provide unexpectedly improved properties, such as Biological activity. In some embodiments, the invention provides an oligonucleotide composition comprising a predetermined amount of oligonucleotides comprising one or more wing regions and a common core region, wherein: each wing The regions independently have the length of two or more bases, and independently and optionally one or more pairs of palmar internucleotide linkages; the core regions independently have two or more bases Length, and independently comprising one or more pairs of palmitic internucleotide linkages, and the common core region has: 1) a common base sequence and length; 2) a common backbone linkage pattern; and 3) a common backbone For the palm center mode.

In some embodiments, in an oligonucleotide comprising a wing-core-wing form, the "wing" is the portion of the oligonucleotide at the 5' or 3' end of the core, wherein "core" (or named "Gap" is between the two wings. In some embodiments, an oligonucleotide can have a single wing and a single core; in such cases, the wing is on the 5' or 3' end of the oligonucleotide. The wing and core may be defined by any of a number of structural elements (eg, modified or modified modes of sugar, base, backbone, or backbone stereochemistry). In some embodiments, the wing and core are defined by nucleoside modifications, wherein the wing comprises a nucleoside modification that is not present in the core region. In some embodiments, the oligonucleotides in the provided compositions have a nucleoside modified wing-core structure. In some embodiments, the oligonucleotides in the provided compositions have a nucleoside modified core-wing structure. In some embodiments, the oligonucleotides in the provided compositions have a nucleoside modified wing-core-wing structure. In some embodiments, the wings and core are defined by modifications of the sugar moiety. In some embodiments, the wing and core are defined by modifications of the base moiety. In some embodiments, in the wing region Each sugar moiety has the same 2' modification that is not present in the core region. In some embodiments, each sugar moiety in the wing region has the same 2' modification that is different from any sugar modification in the core region. In some embodiments, each sugar moiety in the wing region has the same 2' modification and the core region has no 2' modification. In some embodiments, when two or more wings are present, each sugar portion in the wing region has the same 2' modification, but the common 2' modification in the first wing region can be common to the second wing region 2' modifications are the same or different.

In some embodiments, each wing comprises at least one pair of palmitic internucleotide linkages and at least one native phosphate linkage. In some embodiments, each wing comprises at least one modified sugar moiety. In some embodiments, the individual glycan moieties are modified. In some embodiments, the glycan moiety is modified by a modification that is not present in the core region. In some embodiments, the wing region has only internucleotide linkages modified at one or both of its ends. In some embodiments, the wing region has only internucleotide linkages modified at its 5' end. In some embodiments, the wing region has only internucleotide linkages modified at its 3' end. In some embodiments, the wing regions have only internucleotide linkages modified at their 5' and 3' ends. In some embodiments, the wing is at the 5' end of the core and the wing only has a modified internucleotide linkage at its 5' end. In some embodiments, the wing is at the 5' end of the core and the wing only has a modified internucleotide linkage at its 3' end. In some embodiments, the wing is at the 5' end of the core and the wing has only modified internucleotide linkages at its 5' and 3' ends. In some embodiments, the wing is at the 3' end of the core and the wing only has a modified internucleotide linkage at its 5' end. In some embodiments, the wing is at the 3' end of the core and the wing only has a modified internucleotide linkage at its 3' end. In some embodiments, the wing is at the 3' end of the core and the wing has only modified internucleotide linkages at its 5' and 3' ends. In some embodiments, modifications or other modifications in one wing to a sugar moiety or an internucleotide linkage may differ from those in the other wing.

In some embodiments, the internucleotide linkages within the core region are modified. In some embodiments, the internucleotide linkages within the core region are palmarous. In some embodiments, the core-to-palm center mode of the core region is ( S p ) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m . In some embodiments, the core-to-palm center mode of the core region is ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , where m>2. In particular, the present invention demonstrates that, in some embodiments, the modes can provide or enhance controlled cleavage of a target sequence (e.g., an RNA sequence).

In some embodiments, the oligonucleotides in the provided compositions have a common backbone phosphorus modification pattern. In some embodiments, the provided composition is a palm-controlled oligonucleotide composition, as the composition contains a predetermined amount of an oligonucleotide of an individual oligonucleotide type, wherein the oligonucleotide type is The following definitions: 1) base sequence; 2) main chain linkage mode; 3) main chain versus palm center mode; and 4) main chain phosphorus modification mode.

As indicated above and as understood in such techniques, in some embodiments, the base sequence of an oligonucleotide can refer to a nucleoside residue in an oligonucleotide (eg, a sugar and/or base component, Consistency and/or modification status of, for example, adenine, cytosine, guanosine, thymine, and uracil relative to standard naturally occurring nucleotides and/or may refer to hybridization characteristics of such residues (also That is, the ability to hybridize to a particular complementary residue).

In some embodiments, a particular oligonucleotide type can be defined as follows: 1A) base identity; 1B) base modification pattern; 1C) sugar modification pattern; 2) backbone linkage mode; 3) backbone pair Sex center mode; and 4) main chain phosphorus modification mode.

Thus, in some embodiments, a particular type of oligonucleotide may share the same base, but the mode of base modification and/or sugar modification is different. In some embodiments, specific Types of oligonucleotides may share the same base and base modification patterns (including, for example, lack of base modifications), but differ in sugar modification patterns.

In some embodiments, a particular type of oligonucleotide is chemically identical in that it has the same base sequence (including length), the same chemical modification pattern for sugar and base moieties, and the same backbone linkage mode. (eg, native phosphate linkage mode, phosphorothioate linkage mode, phosphorothioate triester linkage mode, and combinations thereof), same backbone-to-palm center mode (eg, for palmitic internucleotide linkages) The mode of stereochemistry ( R p / S p) and the same main chain phosphorus modification mode (for example, a modification mode for a phosphorus atom between nucleotides, such as -S- and -LR ^{1 of} formula I).

In some embodiments, the sequence of the oligonucleotide comprises or consists of the sequence of any of the oligonucleotides disclosed herein. In some embodiments, the sequence of the oligonucleotide comprises or consists of a sequence selected from any of the oligonucleotides of Table N1, Table N2, Table N3, Table N4, and Table 8. In some embodiments, the sequence of the oligonucleotide comprises or consists of a sequence selected from any of the oligonucleotides of Table N1A, Table N2A, Table N3A, Table N4A, and Table 8. In some embodiments, the sequence of the oligonucleotide in the stereo-pure (controlled palm control) oligonucleotide composition comprises or consists of: WV-1092, WVE120101, WV-2603, or WV-2595 sequence. In some embodiments, the sequence of the oligonucleotide includes any one or more of the following: base sequence (including length); chemical modification pattern of sugar and base moiety; backbone linkage mode; natural phosphate linkage Link mode, phosphorothioate linkage mode, phosphorothioate triester linkage mode and combinations thereof; main chain-to-palm central mode; stereochemistry of inter-nucleotide linkages ( R p/ S p) Mode; main chain phosphorus modification mode; modification mode for phosphorus atoms between nucleotides, such as -S ^- and -LR ^{1 of} formula I.

In particular, the present invention recognizes the challenges of stereoselective (rather than stereotactic or racemic) preparation of oligonucleotides. In particular, the invention provides for the stereoselective preparation of oligonucleotides comprising a plurality (eg, more than 5, 6, 7, 8, 9 or 10) of internucleotide linkages, and in particular comprising a plurality (eg, More than 5, 6, 7, 8, 9, or 10) of the internucleotide linkages Nucleotide methods and reagents. In some embodiments, the diastereoselective formation of the oligonucleotide is less than 90:10, 95:5, 96:4, 97:3, or 98:2 when stereospecifically or racemicly prepared. At least one pair of palmitic internucleotide linkages. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, diastereoselective selection of greater than 90:10, 95:5, 96:4, 97:3, or 98:2 Sexual formation of each pair of palmitic internucleotide linkages. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with diastereoselectivity greater than 95:5. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with a diastereoselectiveness greater than 96:4. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with a diastereoselectiveness greater than 97:3. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with diastereoselectivity greater than 98:2. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with a diastereoselectiveness greater than 99:1. In some embodiments, the diastereoselective selectivity of the palmitic internucleotide linkages in the oligonucleotide can be measured via model reaction, eg, under substantially identical or similar conditions, Wherein the dimer has the same internucleotide linkage as the palmitic internucleotide linkage, and the dimer 5'-nucleoside is the same as the nucleoside at the 5' end of the palmitic internucleotide linkage And the dimer of the 3'-nucleoside is the same as the nucleoside linked to the 3' end of the palmitic internucleotide.

It has been found, inter alia, that certain of the provided oligonucleotide compositions achieve unprecedented control of cleavage of the target sequence, for example by ribonuclease H cleavage of the target RNA. In some embodiments, the present invention demonstrates that precise control of the chemical and stereochemical properties of an oligonucleotide can result in improved oligonucleotide preparations compared to formulations that do not control stereochemical properties but are otherwise similar. active. In particular, the invention specifically demonstrates that the rate, extent and/or specificity of cleavage of a nucleic acid target to which the provided oligonucleotide hybridizes is improved.

In some embodiments, the invention provides various uses of oligonucleotide compositions. In particular, the present invention demonstrates that the properties of oligonucleotides can be greatly improved by controlling structural elements of the oligonucleotide, such as base sequences, chemical modifications, stereochemistry, and the like. For example, in some embodiments, the invention provides methods for highly selectively inhibiting transcripts of a target nucleic acid sequence. In some embodiments, the invention provides methods of treating an individual by inhibiting a transcript from a pathogenic replica (eg, a disease-causing dual gene). In some embodiments, the invention provides methods for designing and preparing oligonucleotide compositions wherein the activity and/or selectivity is unexpectedly enhanced when the transcript of the target sequence is inhibited. In some embodiments, the invention provides methods for designing and/or preparing oligonucleotide compositions that provide dual gene-specific inhibition of a transcript from a target nucleic acid sequence.

In some embodiments, the present invention provides a method for controlling a cleavage of a nucleic acid polymer, the method comprising the steps of: ???a nucleic acid polymer comprising a nucleotide sequence of a nucleotide sequence and an oligonucleoside comprising a specific oligonucleotide type The acid is contacted with a palm-controlled oligonucleotide composition characterized by: 1) a common base sequence and a length, wherein the common base sequence is or comprises a nucleic acid a sequence complementary to the target sequence present in the polymer; 2) a common backbone linkage mode; and 3) a common backbone-to-palm center mode; the composition is controlled by palmarity because of the specific base For substantially racemic preparations of oligonucleotides of base sequence and length, oligonucleotides of a particular oligonucleotide type are enriched in the composition.

In some embodiments, the invention provides a method for altering a cleavage mode, wherein the nucleotide sequence comprises a nucleic acid polymer of a target sequence and a reference comprising an oligonucleotide having a particular base sequence and length a cleavage pattern observed when the oligonucleotide composition is contacted, the specific base sequence being or comprising a sequence complementary to the target sequence, the party The method comprises: contacting a nucleic acid polymer with a palm-controlled oligonucleotide composition having an oligonucleotide of a specific base sequence and length, the composition being controlled by palmarity because In the case of a substantially racemic preparation of base sequence and length oligonucleotides, a single oligonucleotide type of oligonucleotide is enriched in the composition, which is characterized by: 1) Specific base sequence and length; 2) specific backbone linkage mode; and 3) specific backbone pair palm center mode.

In some embodiments, the invention provides a method for inhibiting a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences are present in a population, the target sequence and the like sequence each containing a specificity A nucleotide signature sequence element that defines a target sequence relative to a similar sequence, the method comprising the steps of: contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide composition comprising an oligonucleotide having: : 1) a common base sequence and length; and 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a target nucleic acid sequence, the composition being characterized by Upon contact with a system comprising a target nucleic acid sequence and a transcript of a similar nucleic acid sequence, the transcript of the target nucleic acid sequence is inhibited to a greater extent than that observed with similar nucleic acid sequences.

In some embodiments, the invention provides a method for inhibiting a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences are present in a population, the target sequence and the like sequence each containing a specificity A nucleotide signature sequence element that defines a target sequence relative to a similar sequence, the method comprising the steps of: contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide composition comprising an oligonucleotide having: : 1) a common base sequence and length; and 2) a common backbone linkage pattern; 3) a common backbone pair palmar central pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining the target nucleic acid sequence The composition is characterized in that when it is contacted with a system comprising a target nucleic acid sequence and a transcript of a similar nucleic acid sequence, the transcript of the target nucleic acid sequence is inhibited to a greater extent than that observed with a similar nucleic acid sequence.

In some embodiments, the transcript of the target nucleic acid sequence is inhibited to a greater extent than is observed by any of the similar nucleic acid sequences.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide A characteristic sequence element that defines a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising an oligonucleotide having the following Composition contact: 1) a common base sequence and length; and 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by When it is in contact with a system comprising a target dual gene and a transcript of another pair of genes of the same nucleic acid sequence, the transcript of the specific dual gene is inhibited to a greater extent than is observed by another pair of genes of the same nucleic acid sequence. degree.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide Characteristic sequence element Defining a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: bringing a sample comprising a transcript of the target nucleic acid sequence to a palm-controlled oligo of an oligonucleotide comprising a particular oligonucleotide type The nucleotide composition is contacted, and the oligonucleotide of the specific oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone pair palm center Mode; the composition is palm-controlled because of the specific oligonucleotide type in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length Nucleotide enrichment; wherein the common base sequence of an oligonucleotide of a particular oligonucleotide type is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by When the target dual gene and the transcript of another pair of genes of the same nucleic acid sequence are contacted, the transcript of the specific dual gene is inhibited to a greater extent than that observed by another pair of genes of the same nucleic acid sequence. Degree system.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: contacting a sample comprising a transcript of the gene of interest with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and length; 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by Target dual gene and phase When a systemic transcript of another pair of genes is contacted, the transcript of a particular dual gene is inhibited to a degree that is at least 2-fold greater than that observed by another pair of genes of the same gene.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: reacting a sample comprising a transcript of the target gene with an oligonucleotide comprising a particular oligonucleotide type The oligonucleotides of the particular oligonucleotide type are characterized by: 1) a common base sequence and length; 2) a common backbone linkage pattern; 3) a common backbone pair Sex central mode; the composition is palm-controlled because of the specific oligonucleotide type in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length Oligonucleotide enrichment; wherein the common base sequence of an oligonucleotide of a particular oligonucleotide type is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition Characterized by the fact that when it is contacted with a system comprising a target dual gene and a transcript of another pair of genes of the same gene, the transcript of the specific dual gene is inhibited to a greater extent than that observed by another pair of genes of the same gene. The degree is at least 2 times larger.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: constituting a sample comprising a transcript of the gene of interest and an oligonucleotide comprising a particular oligonucleotide type Nucleotide is contacted with a palm-controlled oligonucleotide composition of the particular oligonucleotide type characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode 3) a common backbone-to-palm central mode; the composition is palm-controlled because of the combination with respect to a substantially racemic formulation of oligonucleotides having the same base sequence and length Enrichment of oligonucleotides of a particular oligonucleotide type; wherein the common base sequence of the oligonucleotide of a particular oligonucleotide type is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, The composition is characterized in that when it is in contact with a system that expresses a target dual gene and a transcript of another pair of genes of the same gene, the transcript of the specific dual gene is inhibited to a greater extent than the other pair of genes of the same gene. The degree of inhibition is at least 2 times greater.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide A characteristic sequence element that defines a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising an oligonucleotide having the following Composition contact: 1) a common base sequence and length; 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by When it is contacted with a system comprising a transcript of the same target nucleic acid sequence, it shows that the transcript of a particular dual gene is inhibited to the extent that: a) greater than when the composition is absent; b) greater than the degree of inhibition observed by another pair of genes of the same nucleic acid sequence; or c) greater than when the composition is absent, and greater than the same nucleic acid sequence To the extent of suppression.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide A characteristic sequence element that defines a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising a particular oligonucleotide type Contacting the palm-controlled oligonucleotide composition, the oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common Main chain-to-palm central mode; the composition is palm-controlled because of the specific oligo in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length Nucleotide type oligonucleotide enrichment; wherein the common base sequence of an oligonucleotide of a particular oligonucleotide type is or comprises a complementary to a characteristic sequence element defining a particular dual gene Sequence, the composition characterized in that when it is contacted with a system comprising a transcript of the same target nucleic acid sequence, it exhibits inhibition of the transcript of the particular dual gene to the extent that: a) greater than when the composition is absent; b) The degree of inhibition observed by another pair of genes greater than the same nucleic acid sequence; or c) greater than the degree of inhibition observed by the other pair of genes of the same nucleic acid sequence when the composition is absent.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: contacting a sample comprising a transcript of the gene of interest with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and length; and 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by Upon systemic exposure of a transcript of a gene of interest, it is shown to inhibit the expression of a transcript of a particular dual gene to the extent that: a) the amount of transcript from a particular dual gene detected is at least 2-fold different, the presence of the composition Reduced by a factor of 2 relative to the absence of the composition; b) at least greater than that observed for the other pair of genes of the same gene 2 times; or c) the amount of transcripts detected from a particular dual gene is at least 2-fold different, the composition is reduced by a factor of 2 compared to the absence of the composition, and is more than another pair of genes of the same gene. The degree of inhibition observed was at least 2 times greater.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: reacting a sample comprising a transcript of the target gene with an oligonucleotide comprising a particular oligonucleotide type The oligonucleotide of the particular oligonucleotide type is characterized by the control oligonucleotide composition being: 1) common base sequence and length; 2) common backbone linkage mode; 3) common backbone versus palm center mode; the composition is palm-controlled because of the same base sequence and length For a substantially racemic preparation of an oligonucleotide, the oligonucleotide of a particular oligonucleotide type is enriched in the composition; wherein the common base sequence of the oligonucleotide of a particular oligonucleotide type Or comprising a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized in that, when it is contacted with a system that exhibits a transcript of the gene of interest, it exhibits inhibition of the transcript of the particular dual gene to the extent that Performance: a) the amount of transcripts from a particular dual gene detected is at least 2-fold different, the composition is reduced by a factor of 2 compared to the absence of the composition; b) is observed over another pair of genes of the same gene The degree of inhibition is at least 2 times greater; or c) the amount of transcripts detected from a particular dual gene is at least 2-fold different, and the composition is reduced by a factor of 2 compared to the absence of the composition, and is greater than the same gene Another pair Because of the degree of inhibition observed at least 2 times.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: ligating a sample comprising a transcript of the target gene with an oligonucleotide comprising an oligonucleotide of a particular oligonucleotide type The oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; Wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized in that when it is contacted with a system expressing a transcript of the gene of interest, it exhibits inhibition of the specific duality to the extent that The expression of the transcript of the gene: a) the amount of transcript from the specific dual gene detected is at least 2-fold different, the composition is reduced by a factor of 2 compared to the absence of the composition; b) the other than the same gene The degree of inhibition observed by a pair of even genes is at least 2-fold greater; or c) the amount of transcripts detected from a particular dual gene is at least 2-fold different, and the composition is reduced by a factor of 2 relative to the absence of the composition. And at least 2-fold greater inhibition than observed by another pair of genes of the same gene.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: reacting a sample comprising a transcript of the target gene with an oligonucleotide comprising a particular oligonucleotide type The oligonucleotides of the particular oligonucleotide type are characterized by: 1) a common base sequence and length; 2) a common backbone linkage pattern; 3) a common backbone pair Sex central mode; the composition is palm-controlled because of the specific oligonucleotide type in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length Oligonucleotide enrichment; wherein the common base sequence of an oligonucleotide of a particular oligonucleotide type is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition Features When it is contacted with a system that expresses a transcript of a gene of interest, it exhibits inhibition of the expression of a transcript of a particular dual gene to the extent that: a) the amount of transcript from the specific dual gene detected is at least 2 Times, the composition is reduced by a factor of 2 relative to the absence of the composition; b) is at least 2-fold greater than that observed for the other pair of genes of the same gene; or c) the specific dual gene is detected The amount of transcript differs by at least 2 fold, is reduced by a factor of 2 relative to the absence of the composition in the presence of the composition, and is at least 2-fold greater than that observed for the other pair of genes of the same gene.

In some embodiments, the nucleotide signature sequence comprises a mutation that defines a target sequence relative to other similar sequences. In some embodiments, a nucleotide signature sequence comprises a point mutation that defines a target sequence relative to other similar sequences. In some embodiments, the nucleotide signature sequence comprises a SNP that defines a target sequence relative to other similar sequences.

In some embodiments, the invention provides a method for preparing an oligonucleotide composition comprising a specific sequence of oligonucleotides, the composition providing selective inhibition of a transcript of a target sequence, comprising providing a specific oligo A palm-controlled oligonucleotide composition of a nucleotide type oligonucleotide characterized by: 1) a common base sequence identical to a particular sequence; 2) a common backbone linkage mode; and 3) a common main chain versus palm center mode, which includes ( S p) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , wherein: m is 1-50; n is 1-10; t is 1-50; and each N p is independently R p or Sp .

In general, the activity of the oligonucleotide composition as described herein can be used in any suitable manner. When assessed by evaluation. The relative activities of different compositions (eg, stereo control versus non-stereo control, and/or different stereo control compositions) are generally determined in the same assay; in some embodiments, substantially simultaneously; and in some embodiments , with reference to historical results.

Those skilled in the art will be aware of and/or will be able to readily develop suitable assays for a particular oligonucleotide composition. The invention provides instructions for certain specific assays, such as analysis of one or more of the characteristics of an oligonucleotide composition, as applicable to ribonuclease H cleavage of a target sequence.

For example, some assays that may be suitable for assessing one or more characteristics of ribonuclease H cleavage (eg, rate, extent, and/or selectivity of cleavage) may be included as herein (eg, in Examples 4, 9-10) The analysis described in any of the analyses described and/or illustrated in one or more of 12, 14, 17-20, and the like.

In some embodiments, the invention recognizes that base sequences can affect the identity of an oligonucleotide. The present invention demonstrates that chemical and stereochemical modifications in combination with a designed base sequence can provide oligonucleotide compositions having unexpectedly improved properties (e.g., unexpectedly higher activity and/or selectivity, etc.). In some embodiments, an oligonucleotide having a common base sequence that is complementary to a characteristic sequence element of a target nucleic acid sequence is superior to another common base sequence that is complementary to a characteristic sequence element of the target nucleic acid sequence. In some embodiments, an oligonucleotide having a common base sequence that is complementary to a characteristic sequence element of a target nucleic acid sequence has a selectivity that is superior to another common base sequence that is complementary to a characteristic sequence element of the target nucleic acid sequence.

In some embodiments, a composition of an oligonucleotide having a common base sequence complementary to a signature sequence element of a target nucleic acid sequence is compared to another common base sequence having a sequence element complementary to the target nucleic acid sequence Another composition of the oligonucleotide, the cleavage rate of the transcript from the target nucleic acid sequence is higher, and/or provides a cleavage pattern with only one major cleavage site, and the primary cleavage site is in the nucleus The nucleotide sequence is within or close to the nucleotide signature sequence. In some embodiments, having a complementary common base sequence The composition of the listed oligonucleotides has a higher cleavage rate of the transcript from the target nucleic acid sequence when compared to another composition of the oligonucleotide having another complementary common base sequence, and provides the following cleavage A pattern that has only one major cleavage site and that is within or near the nucleotide signature sequence. In some embodiments, for example, when measured by a suitable method (eg, ribonuclease H assay), more than 50%, 60%, 70%, 80%, or 90% of the cleavage occurs at this primary cleavage site. In some embodiments, a composition having an oligonucleotide that complements a common base sequence is transcribed from a target nucleic acid sequence when compared to another composition of an oligonucleotide having another complementary common base sequence The rate of cleavage of the substance is higher and provides a cleavage mode with only one major cleavage site, and the major cleavage site is within or near the mutation or SNP, the mutation or SNP defines the target relative to other similar sequences sequence. In some embodiments, the mutation is a point mutation. In some embodiments, the primary cleavage site defines a mutation or SNP of the target sequence relative to other similar sequences. In some embodiments, each common base sequence is 100% complementary to a signature element of the target nucleic acid sequence. In some embodiments, the primary cleavage site is within a linkage of less than 5, 4, 3 or 1 nucleotides from a mutation or SNP of a target sequence relative to other similar sequences. In some embodiments, when a stereospecific composition of oligonucleotides having the same common sequence and/or a composition of DNA oligonucleotides having the same common sequence are used, the primary cleavage site is at a distance relative to the other A similar sequence defines a mutation or SNP of a target sequence that is less than 5, 4, 3 or 1 internucleotide linkages and is less than 5, 4, 3 or 1 nucleotide linkages from the cleavage site. . In some embodiments, the primary cleavage site is a cleavage site when a stereospecific composition of oligonucleotides having the same common sequence is used. In some embodiments, the primary cleavage site is the primary cleavage site when a stereospecific composition of oligonucleotides having the same common sequence is used. In some embodiments, the primary cleavage site is a cleavage site when a composition of DNA oligonucleotides having the same common sequence is used. In some embodiments, the primary cleavage site is the primary cleavage site when a composition of DNA oligonucleotides having the same common sequence is used.

In some embodiments, when comparing the effects of the first and second common base sequences, the stereoregular composition having the first common base sequence and the second common base sequence can be compared A stereoregular composition of oligonucleotides. In some embodiments, the stereoregular composition is a composition of oligonucleotides having a common base sequence, a common nucleoside modification pattern, and a common backbone linkage mode. In some embodiments, the stereoregular composition is a composition of oligonucleotides having a common base sequence, a common nucleoside modification pattern, wherein each internucleotide linkage is a phosphorothioate. In some embodiments, when comparing the effects of the first and second common base sequences, the palm-controlled oligonucleotide composition having the first common base sequence can be compared with the first A palmar controlled oligonucleotide composition of an oligonucleotide of two common base sequences. In some embodiments, the oligonucleotides in the palm-controlled oligonucleotide composition have a common base sequence, a common nucleoside modification pattern, a common backbone linkage pattern, a common backbone pair palm center pattern And a common backbone phosphorus modification mode. In some embodiments, each internucleotide linkage is a phosphorothioate.

In some embodiments, the oligonucleotide compositions and techniques described herein are particularly useful for treating Huntington's disease. For example, in some embodiments, the invention defines a stereochemically controlled oligonucleotide composition that directs cleavage of a nucleic acid associated with Huntington's disease (eg, ribonuclease H-mediated cleavage). In some embodiments, the compositions direct Huntington's disease-associated dual genes of a particular target sequence preferentially cleavage relative to one or more (eg, all non-Huntington's disease-related) other dual genes of the sequence.

Huntington's disease is a hereditary disease that can cause progressive degeneration of brain nerve cells and affect the individual's motor and cognitive ability. In some embodiments, Huntington's disease is an autosomal dominant disorder. In some embodiments, it is caused by a Huntington's gene mutation. The normal HTT gene contains 10 to 35 CAG trinucleotide repeats. People with 40 or more repeats often develop this condition. In some embodiments, the expanded CAG segment on the first exon of the HTT gene results in the production of an unusually long Huntington protein form (expanded polybrene) Polyglutamine tract, which is cut into smaller toxic fragments that bind together and accumulate in neurons, disrupting the normal function of these cells. Warby et al. (Am J Hum Genet. 2009, 84(3), 351-366) report a variety of SNPs that are associated with disease chromosomes and have a stronger association with CAG extension than their previously reported SNPs. A variety of SNPs that are highly correlated with CAG expansion are not independently separated and are linked to each other (Linkage Disequilibrium). In particular, the present invention recognizes that a strong correlation between specific SNPs and CAG-extended chromosomes provides an attractive therapeutic opportunity for treating Huntington's disease (eg, via reverse therapy). In addition, the association of specific SNPs with high ratio heterozygous binding in HD patients provides a suitable target for gene expression of dual gene-specific blocking mutant gene products. See, for example, Liu et al. Journal of Huntington's Disease 2, 2013, 491-500; Aronin, Neil and Pfister, Edith WO 2010/118263 A1; Pfister et al. Current Biology 2009, 19, 774-778.

In some embodiments, the subject SNPs of the invention have high frequency heterozygousity in HD and have specific variants associated with mutant HTT dual genes. In some embodiments, the SNP is rs362307. In some embodiments, the SNP is rs7685686. In some embodiments, the SNPs may not be linked, but may have a high profile junction frequency. In some embodiments, the SNP is rs362268 (3'-UTR region). In some embodiments, the SNP is rs362306 (3'-UTR region). In some embodiments, the SNP is rs2530595. In some embodiments, the SNP is rs362331.

In some embodiments, a method for treating or preventing Huntington's disease in an individual comprising administering to the individual the provided oligonucleotide composition. In some embodiments, a method of treating or preventing Huntington's disease in an individual comprising administering to the individual a palm-controlled oligonucleotide composition comprising an oligonucleotide of a particular oligonucleotide type, The oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone-to-palm central mode; the composition is palm-controlled because of the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length The oligonucleotide of a particular oligonucleotide type is enriched.

In some embodiments, the methods provided improve the symptoms of Huntington's disease. In some embodiments, the methods provided slow the onset of Huntington's disease. In some embodiments, the methods provided slow the progression of Huntington's disease.

In some embodiments, the invention provides methods of identifying a patient for a given oligonucleotide composition. In some embodiments, the invention provides methods for stratifying a patient. In some embodiments, the methods provided comprise identifying mutations and/or SNPs associated with a disease-causing dual gene. For example, in some embodiments, a method is provided comprising identifying SNPs in an individual associated with an expanded CAG repeat sequence associated with Huntington's disease or causing Huntington's disease.

In some embodiments, the individual has a SNP in the Huntington's gene. In some embodiments, the individual has a SNP, wherein one of the dual genes is a mutant huntingtin protein associated with an expanded CAG repeat. In some embodiments, the individual has a SNP selected from the group consisting of rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In some embodiments, the oligonucleotide of the provided composition has a sequence that is complementary to a sequence comprising a SNP from a disease-causing dual gene (mutant), and the composition selectively inhibits the pathogenic dual gene expression.

In some embodiments, the sequences of the oligonucleotides in the provided techniques (compounds, compositions, methods, etc.) comprise, consist of, or are: the sequence of any of the oligonucleotides described herein. In some embodiments, the sequence is selected from Tables N1A, N2A, N3A, N4A, or 8; or WV-1092, WVE120101, WV-2603, or WV-2595. In some embodiments, the sequence is selected from the group consisting of WV-1092, WVE120101, WV-2603, or WV-2595. In some embodiments, the oligonucleotide provided is by WV-1092, The type defined by WVE120101, WV-2603 or WV-2595. In some embodiments, the oligonucleotides provided are of the type defined by WV-1092. In some embodiments, the provided oligonucleotide is of the type defined by WVE120101. In some embodiments, the provided oligonucleotide is of the type defined by WV-2603. In some embodiments, the oligonucleotides provided are of the type defined by WV-2595.

In some embodiments, provided oligonucleotide compositions comprise lipids and oligonucleotides. In some embodiments, the lipid binds to the oligonucleotide.

In some embodiments, the composition comprises an oligonucleotide and a lipid selected from the list consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid , γ-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, arachidonic acid and dilinoleyl. In some embodiments, the composition comprises an oligonucleotide and a lipid selected from the list consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid , γ-linolenic acid, docosahexaenoic acid (cis-DHA), trumpetic acid and dilinoleic acid.

In some embodiments, the composition comprises an oligonucleotide and a lipid selected from the group consisting of:

In some embodiments, the composition comprising a lipid and an oligonucleotide, wherein the lipid comprises a C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more C _1-4 aliphatic group.

In some embodiments, an oligonucleotide composition comprises a plurality of oligonucleotides that share: 1) a common base sequence; 2) a common backbone linkage pattern; and 3) a common backbone phosphorus modification pattern; One or more of the plurality of oligonucleotides are individually bound to the lipid.

In some embodiments, the palm-controlled oligonucleotide composition comprises a plurality of oligonucleotides that share: 1) a common base sequence; 2) a common backbone linkage pattern; and 3) a common backbone Phosphorus modification mode; wherein: the composition is controlled by palmarity because a plurality of oligonucleotides share the same stereochemistry at one or more inter-nucleotide linkages; one of the plurality Or a plurality of oligonucleotides are individually bound to the lipid; and one or more of the plurality of oligonucleotides are optionally joined to the target compound or moiety, as appropriate.

In some embodiments, a cell or group that delivers an oligonucleotide to a human subject A method of weaving, comprising: (a) providing a composition of any of the embodiments described herein; and (b) administering to the human subject a composition such that the oligonucleotide is delivered to the individual's cells or tissues in.

In some embodiments, a method for delivering an oligonucleotide to a cell or tissue comprises preparing a composition according to any of the embodiments described herein and contacting the cell or tissue with the composition.

In some embodiments, a method of modulating the amount of a transcript or gene product of a gene in a cell, the method comprising the step of contacting a cell with a composition according to any of the embodiments described herein, wherein the oligo Glycosylates are capable of modulating the amount of a transcript or gene product.

In some embodiments, a method for inhibiting the expression of a gene in a cell or tissue comprises preparing a composition according to any of the embodiments described herein and treating the cell or tissue with the composition.

In some embodiments, a method for inhibiting the expression of a gene in a cell or tissue in a mammal comprises preparing a composition according to any of the embodiments described herein and administering the composition to a mammal.

In some embodiments, a method of treating a disease caused by an overexpression of one or several proteins in a cell or tissue, the method comprising administering to the individual a method according to any of the embodiments described herein combination.

In some embodiments, a method of treating a disease caused by a decrease, inhibition, or deletion in expression of one or several proteins, the method comprising administering to the individual a method according to any of the embodiments described herein combination.

In some embodiments, a method for producing an immune response in an individual, the method comprising administering to the individual a composition according to any one of the embodiments described herein, wherein the biologically active compound is immunized Regulate nucleic acids.

In some embodiments, a method for treating signs and/or symptoms of Huntington's disease by administering a composition of any of the embodiments described herein and administering the composition to an individual.

In some embodiments, a method of modulating the amount of ribonuclease H-mediated cleavage in a cell, the method comprising the step of contacting a cell with a composition according to any of the embodiments described herein, wherein Oligonucleotides are capable of modulating the amount of ribonuclease H mediated cleavage.

In some embodiments, a method of administering an oligonucleotide to an individual in need thereof, comprising the steps of: providing a composition comprising a pharmaceutical lipid and administering to the individual a composition, wherein the pharmaceutical agent is as disclosed herein Any agent, and wherein the lipid is any of the lipids disclosed herein.

In some embodiments, a method of treating a disease in a subject, the method comprising the steps of: providing a composition comprising a pharmaceutical lipid and administering to the individual a therapeutically effective amount of a composition, wherein the agent is any of the agents disclosed herein, And wherein the lipid is any of the lipids disclosed herein, and wherein the disease is any of the diseases disclosed herein.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprises a C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more C _1-4 aliphatic group.

In some embodiments, the lipid comprises an unsubstituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, lipid comprises no more than one of the optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprises two or more of the optionally substituted C ₁₀ - C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid does not contain a tricyclic or polycyclic moiety.

In some embodiments, the lipid has the structure of R ¹ -COOH, wherein R ¹ is an optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic chain.

The composition or method of any one of claims 16 wherein the lipid is bound via its carboxyl group.

A composition or method according to any of the embodiments described herein, wherein the lipid system is selected from the group consisting of:

In some embodiments, the lipid binds to the oligonucleotide.

In some embodiments, the lipid binds directly to the oligonucleotide.

In some embodiments, the lipid is bound to the oligonucleotide via a linking group.

In some embodiments, the linking group is selected from the group consisting of: an uncharged linking group; a charged linking group; a linking group comprising an alkyl group; a linking group comprising a phosphate; a branched linking group; an unbranched linking group a linking group comprising at least one cleavage group; a linking group comprising at least one redox cleavage group; a linking group comprising at least one phosphate-based cleavage group; a linkage comprising at least one acid cleavage group a group; a linking group comprising at least one ester-based cleavage group; and a linking group comprising at least one peptide-based cleavage group.

In some embodiments, each of the plurality of oligonucleotides individually binds to the same lipid at the same position.

In some embodiments, the lipid is bound to the oligonucleotide via a linking group.

In some embodiments, one or more of the plurality of oligonucleotides bind independently to the target compound or moiety.

In some embodiments, one or more of the plurality of oligonucleotides bind independently to the lipid and the target compound or moiety.

In some embodiments, one or more of the plurality of oligonucleotides independently bind to the lipid at one end and to the target compound or moiety at the other end.

In some embodiments, the plurality of oligonucleotides share the same chemical modification pattern.

In some embodiments, a plurality of oligonucleotides share the same chemical modification pattern comprising one or more base modifications.

In some embodiments, the plurality of oligonucleotides share the same chemical modification pattern comprising one or more sugar modifications.

In some embodiments, the common base sequence is capable of hybridizing to a transcript in a cell containing a mutation associated with Huntington's disease, or a content, activity and/or distribution thereof associated with Huntington's disease.

In some embodiments, the oligonucleotide is a nucleic acid.

In some embodiments, the oligonucleotide is an oligonucleotide.

In some embodiments, the oligonucleotide is an oligonucleotide involved in ribonuclease H-mediated cleavage of the mutant Huntington gene mRNA.

In some embodiments, the disease or condition is Huntington's disease.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units are independently and optionally substituted optionally substituted by the group The group is selected from the group consisting of C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡c-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -,- Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O) N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-,- OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently as defined and described herein.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₈₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units are independently and optionally substituted optionally substituted by the group The group is selected from the group consisting of C ₁ -C ₆ alkylene, C ₁ -C ₆ alkylene, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -,- Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O) N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-,- OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently as defined and described herein.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units are independently and optionally substituted optionally substituted by the group The group is selected from the group consisting of C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -,- Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O) N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-,- OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently as defined and described herein.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic chain.

In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the composition further comprises one or more additional components selected from the group consisting of: polynucleotides, carbonic anhydrase inhibitors, dyes, intercalators, acridine, crosslinkers, psoralen, silk Myostatin C, porphyrin, TPPC4, texaphyrin, sapphyrin, polycyclic aromatic hydrocarbon phenazine, dihydrophenazine, artificial endonuclease, chelating agent, EDTA, alkyl Agent, phosphate, amine, sulfhydryl, PEG, PEG-40K, MPEG, [MPEG] ₂ , polyamine, alkyl, substituted alkyl, radiolabeled, enzyme, hapten biotin, delivery / absorption enhancers, aspirin, vitamin E, folic acid, synthetic ribonuclease, proteins, glycoproteins, peptides, molecules with specific affinity for synergistic ligands, antibodies, hormones, hormone receptors, Non-peptide substances, lipids, lectins, carbohydrates, vitamins, cofactors, selective agents or drugs. In some embodiments, the composition further comprises one or more additional components selected from the group consisting of: polynucleotides, carbonic anhydrase inhibitors, dyes, intercalators, acridine, crosslinkers, psoralen, silk Myostatin C, porphyrin, TPPC4, deporphyrin, sialoline, polycyclic aromatic hydrocarbon phenazine, dihydrophenazine, artificial endonuclease, chelating agent, EDTA, alkylating agent, phosphate, Amino, mercapto, PEG, PEG-40K, MPEG, [MPEG] ₂ , polyamino, alkyl, substituted alkyl, radiolabeled, enzyme, hapten biotin, transport/absorption enhancer, Spirulin, vitamin E, folic acid, synthetic ribonuclease, protein, glycoprotein, peptide, molecules with specific affinity for synergistic ligands, antibodies, hormones, hormone receptors, non-peptide substances, lipids, lectins, Carbohydrates, vitamins, cofactors or drugs.

In some embodiments, the invention provides an oligonucleotide that binds to a selective agent. In some embodiments, the invention provides a composition comprising an oligonucleotide or a class of oligonucleotides comprising a selective agent. In some embodiments, the selective agent specifically binds to one or more neurotransmitter transporters selected from the group consisting of a dopamine transporter (DAT), a serotonin transporter (SERT), and a norepinephrine transporter (NET) Group. In some embodiments, the selective agent is selected from the group consisting of a dopamine reuptake inhibitor (DRI), a selective serotonin reuptake inhibitor (SSRI), a norepinephrine reuptake inhibitor (NRI), A norepinephrine-dopamine reuptake inhibitor (NDRI) and a serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI). In some embodiments The selective agent is selected from the group consisting of a triple reuptake inhibitor, a norepinephrine dopamine dual reuptake inhibitor, a serotonin single reuptake inhibitor, a norepinephrine single reuptake inhibitor, and a dopamine single re Absorption inhibitor. In some embodiments, the selective agent is selected from the group consisting of dopamine reuptake inhibitor (DRI), norepinephrine-dopamine reuptake inhibitor (NDRI), and serotonin-norepinephrine-dopamine reabsorption Inhibitor (SNDRI). In some embodiments, the selective agent is selected from the group consisting of the selective agents described in U.S. Patent Nos. 9,084,825 and 9,193,969, and WO2011131693, WO2014064258.

In some embodiments, the lipid comprises a C ₁₀ -C ₈₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, the composition further comprises a linking group linking the oligonucleotide to the lipid, wherein the linking group is selected from the group consisting of: an uncharged linking group; a charged linking group; a linking group comprising an alkyl group; a linking group comprising a phosphate; a branched chain linking group; an unbranched linking group; a linking group comprising at least one cleavage group; a linking group comprising at least one redox cleavage group; comprising at least one phosphate-based ester a linking group for the cleavage group; a linking group comprising at least one acid cleavage group; a linking group comprising at least one ester-based cleavage group; and a linking group comprising at least one peptide-based cleavage group.

In some embodiments, the oligonucleotide comprises or consists of or is: an oligonucleotide or oligonucleotide composition or a palm-controlled oligonucleotide composition.

In some embodiments, the oligonucleotide comprises or consists of or is: an oligonucleotide composition or a palm-controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises The sequence of any oligonucleotide consists of or consists of this sequence.

In some embodiments, the oligonucleotide comprises or consists of or is: an oligonucleotide composition or a palm-controlled oligonucleotide composition, wherein the sequence of the oligonucleotides is contained in Table 4. The sequence of any of the listed oligonucleotides consists of or consists of the sequence.

In some embodiments, the oligonucleotide comprises or consists of or is: an oligonucleotide composition or a palm-controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises a splice-switch The sequence of the oligonucleotide consists of or consists of the sequence.

A composition or method of any of the embodiments described herein, wherein the oligonucleotide is a palm-controlled oligonucleotide composition.

A composition or method of any of the embodiments described herein, wherein the disease or condition is Huntington's disease.

A composition or method of any of the embodiments described herein, wherein the oligonucleotide is capable of participating in ribonuclease H-mediated cleavage of the mutant Huntington gene mRNA.

A composition or method according to any of the embodiments described herein, wherein the oligonucleotide comprises, consists of, or is: a sequence of any of the oligonucleotides disclosed herein.

A composition or method as in any one of the embodiments described herein, wherein the oligonucleotide is capable of distinguishing between a wild-type and a mutant Huntington's dual gene.

A composition or method of any of the embodiments described herein, wherein the oligonucleotide is capable of participating in ribonuclease H-mediated cleavage of the mutant Huntington gene mRNA.

A composition or method according to any of the embodiments described herein, wherein the oligonucleotide comprises the sequence consisting of, consisting of, or following: the sequence of any of the oligonucleotides disclosed in Table 4.

In some embodiments, the oligonucleotide comprises or consists of or is: an oligonucleotide or oligonucleotide composition or a palm-controlled oligonucleotide composition, wherein the oligonucleotide The sequence comprises or consists of a sequence of any of the following: WV-1092, WV-2595 or WV-2603.

In some embodiments, the sequence of the oligonucleotide includes any one or more of the following: base sequence (including length); chemical modification pattern of sugar and base moiety; backbone linkage mode; natural phosphate linkage Link mode, phosphorothioate linkage mode, phosphorothioate triester linkage mode and combinations thereof; main chain-to-palm central mode; stereochemistry (Rp/Sp) mode of inter-nucleotide linkage ; main chain phosphorus modification mode; modification mode for phosphorus atoms between nucleotides, such as -S ^- and -LR ^{1 of} formula I.

In some embodiments, the invention provides a palm-controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type, characterized by: 1) a common base sequence and length; a common backbone linkage mode; and 3) a common backbone-to-palm central mode; the composition is palm-controlled because it is substantially external to an oligonucleotide having the same base sequence and length In the case of a racemic formulation, an oligonucleotide of a particular oligonucleotide type is enriched in the composition, wherein the oligonucleotide targets a mutant Huntington gene and is from about 10 to about 50 nucleotides in length, wherein backbone linking comprises at least one phosphorothioate, and wherein the backbone chiral centers comprise at least one mode shape R p configuration of a chiral center and at least one chiral center as a configuration of the S p.

In some embodiments, the present invention provides a method for cleavage of a nucleic acid having a base sequence comprising a target sequence, the method comprising the steps of: (a) Having a nucleic acid having a base sequence comprising a target sequence and comprising a specific oligo The oligonucleotide of the nucleotide type is contacted with a palm-controlled oligonucleotide composition of the particular oligonucleotide type characterized by: 1) a common base sequence and a length, wherein The common base sequence is or comprises a sequence complementary to the target sequence in the nucleic acid; 2) a common backbone linkage mode; and 3) a common backbone-to-palm center mode; the composition is controlled by palmarity because An oligonucleotide of a particular oligonucleotide type is enriched in the composition relative to a substantially racemic formulation of an oligonucleotide having a particular base sequence and length, wherein the oligonucleotide is targeted Mutant Huntington gene, and length Is about 10 to about 50 nucleotides, wherein the backbone linkage comprises at least one phosphorothioate, and wherein the backbone-to-palm center mode comprises at least one pair of palmar centers in the Rp configuration and at least one in the form of Sp The shape of the palm of the hand.

In some embodiments, the present invention provides a method for cleavage of a nucleic acid having a base sequence comprising a target sequence, the method comprising the steps of: (a) Having a nucleic acid having a base sequence comprising a target sequence and comprising a specific oligo The oligonucleotide of the nucleotide type is contacted with a palm-controlled oligonucleotide composition of the particular oligonucleotide type characterized by: 1) a common base sequence and a length, wherein The common base sequence is or comprises a sequence complementary to the target sequence in the nucleic acid; 2) a common backbone linkage mode; and 3) a common backbone-to-palm center mode; the composition is controlled by palmarity because An oligonucleotide of the particular oligonucleotide type is enriched in the composition relative to a substantially racemic formulation of the oligonucleotide having the particular base sequence and length, wherein the oligonucleotide Targeting a mutant Huntington gene, and the length is from about 10 to about 50 nucleotides, wherein the backbone linkage comprises at least one phosphorothioate, and wherein the backbone-to-palm center mode comprises at least one Rp configuration The palm center and at least one S The palmar center of the p-configuration; and (b) cleavage of the nucleic acid by ribonuclease H or RNA interference mechanisms.

In some embodiments, the provided compositions further comprise a selective agent selected from the group consisting of: specifically binding to one or more selected from the group consisting of a dopamine transporter (DAT), a serotonin transporter (SERT), and a nail a group of compounds of the neurotransmitter transporter consisting of a group of adrenergic transporters (NET); by dopamine reuptake inhibitor (DRI), selective serotonin reuptake inhibitor (SSRI), norepinephrine reuptake inhibition Group of agents (NRI), norepinephrine-dopamine reuptake inhibitor (NDRI) and serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI); inhibition by triple reuptake Agent, norepinephrine dopamine dual reuptake inhibitor, serotonin single reuptake inhibitor, norepinephrine single reuptake inhibitor and dopamine single reuptake inhibitor; and dopamine reuptake inhibitor (DRI) a group consisting of norepinephrine-dopamine reuptake inhibitor (NDRI) and serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI).

definition

Aliphatic : As used herein, the term "aliphatic" or "aliphatic" means a straight-chain (ie unbranched) or branched chain, substituted or unsubstituted, which is fully saturated or contains one or more units of unsaturation. a hydrocarbon chain, or a monocyclic hydrocarbon or a bicyclic or polycyclic hydrocarbon that is completely saturated or contains one or more unsaturated units but is not an aromatic group (also referred to herein as "carbon ring", "cycloaliphatic") Or "cycloalkyl", which has a single point of attachment to the rest of the molecule. In some embodiments, the aliphatic group contains from 1 to 50 aliphatic carbon atoms. Unless otherwise specified, the aliphatic group contains 1-10 aliphatic carbon atoms. In some embodiments, the aliphatic group contains 1-6 aliphatic carbon atoms. In some embodiments, the aliphatic group contains 1-5 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1-4 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1-3 aliphatic carbon atoms, and in other embodiments, the aliphatic group contains 1-2 aliphatic carbon atoms. In some embodiments, "cycloaliphatic" (or "carbocyclic" or "cycloalkyl") refers to a monocyclic or bicyclic C that is fully saturated or contains one or more units of unsaturation, but is not an aromatic group. ₃ -C ₁₀ hydrocarbon, which has a single point of attachment to the rest of the molecule. In some embodiments, "cycloaliphatic" (or "carbocyclic" or "cycloalkyl") refers to a monocyclic C ₃ - which is fully saturated or contains one or more units of unsaturation, but is not aromatic. C ₆ hydrocarbons, which has a single point of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, straight or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl and mixtures thereof, such as (cycloalkyl)alkyl, (cycloalkenyl) Alkyl or (cycloalkyl)alkenyl.

Alkyl group : The term "alkylene" refers to a divalent alkyl group. The "alkyl chain" is a polymethylene group, that is, -(CH ₂ ) _n -, wherein n is a positive integer, preferably 1 to 6, 1 to 4, 1 to 3, 1 to 2 or 2 to 3 . The substituted alkyl chain is a polymethylene group in which one or more methylene hydrogen atoms are replaced with a substituent. Suitable substituents include the substituents described below for the substituted aliphatic group.

Alkenyl grouping : The term "alkenyl group" refers to a divalent alkenyl group. The substituted extended alkenyl chain is a polymethylene group containing at least one double bond and one or more hydrogen atoms substituted with a substituent. Suitable substituents include the substituents described below for the substituted aliphatic group.

Animal : The term "animal" as used herein refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (eg, a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and/or pig). In some embodiments, the animal includes, but is not limited to, a mammal, a bird, a reptile, an amphibian, a fish, and/or a helminth. In some embodiments, the animal can be a transgenic animal, a genetically engineered animal, and/or a pure line.

Approx . The term "about" or "about" as used herein with respect to a number is generally used to include 5%, 10 of the number in either direction (greater than or less than), unless otherwise stated or distinct from the context. A number in the range of %, 15% or 20% (except where the number will be less than 0% of the possible value or more than 100% of the possible value). In some embodiments, the term "about" with respect to dosage use means ± 5 mg/kg/day.

Aryl : the term "aryl" as used alone or as part of a larger part of "aralkyl", "aralkyloxy" or "aryloxyalkyl" means having a total of five to fourteen Single-ring and bicyclic systems of ring members in which at least one ring in the system is aromatic and wherein each ring in the system contains three to seven ring members. The term "aryl" is used interchangeably with the term "aryl ring". In certain embodiments of the invention, "aryl" refers to an aromatic ring system including, but not limited to, phenyl, biphenyl, naphthyl, anthryl and the like, which may contain one or more Substituents. Also included within the scope of the term "aryl" as used herein is a group in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimido, naphthyl. Amino, phenanthryl or tetrahydronaphthyl and the like.

Characteristic portion : A "characteristic portion" of a phrase protein or polypeptide as used herein is a portion containing a continuous extension of an amino acid or a continuous extension of an amino acid that is a feature of a protein or polypeptide. Such continuous extensions will generally each contain at least two amino acids. Additionally, one of ordinary skill will appreciate that at least 5, 10, 15, 20 or more amino acids are typically required to be characteristic of the protein. In general, the feature portion is a portion that shares at least one functional feature with the associated intact protein in addition to the sequence identity indicated above.

Characteristic sequence : A "characteristic sequence" is a sequence that is present in all members of a polypeptide or nucleic acid family and thus can be used by a general practitioner to define family members.

Characteristic structural element: The term "characteristic structural element" refers to a unique structural element (eg, core structure, side-by-side portion) that is present in all members of a polypeptide, small molecule, or nucleic acid family, and thus can be used by a general practitioner to define family members. Collections, sequence components, etc.).

Comparable : The term "comparable" is used herein to describe two or more sets of conditions or conditions that are sufficiently similar to each other to allow comparison of the results obtained or observed phenomena. In some embodiments, an array-like condition or condition is characterized by a plurality of substantially identical features and one or a few different features. It will be appreciated by those of ordinary skill that when the condition of the array is characterized by the number and type of substantially identical features sufficient to warrant the following reasonable conclusions, the conditions are similar to each other, and the reasonable conclusion is that the result or observation obtained in the different conditions or circumstances of the array Differences in phenomena are caused by or indicative of changes in different features of their features.

Dosing regimen : As used herein, "dosing regimen" or "treatment regimen" refers to a single unit dose (usually more than one) that is administered to an individual individually, usually over a period of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen that can involve one or more doses. In some embodiments, the dosing regimen comprises a plurality of doses each separated by a period of the same length; in some embodiments, the dosing regimen comprises a plurality of doses and at least two different times for separating the individual doses segment. In some embodiments, all doses within the dosing regimen have the same unit dose amount. In some embodiments, different doses within a dosing regimen have different amounts. In some embodiments, the dosing regimen comprises administering a first dose in a first dose, followed by one or more doses in a second dose different than the first dose. In some embodiments, the dosing regimen comprises administering a first dose in a first dose, followed by one or more doses in a second dose equal to the first dose.

Equivalent Agents : It should be understood by those of ordinary skill in the art that the scope of the application of the invention is not limited to those specifically mentioned or exemplified herein. In particular, those skilled in the art will recognize that the active agent typically has a structure consisting of the core and the attached side portions, and it should be understood that such simple changes in core and/or side portions are not significant. Change the activity of the agent. For example, in some embodiments, replacing one or more flanking portions with an array-like three-dimensional structure and/or chemically reactive features can result in a substituted compound or moiety equivalent to the parent reference compound or moiety. In some embodiments, the addition or removal of one or more of the pendant moieties can result in a substituted compound equivalent to the parent reference compound. In some embodiments, changes to the core structure (eg, by adding or removing a small number of bonds (typically no more than 5, 4, 3, 2, or 1 bond, and often only a single bond) can yield equivalent to the parent reference A substituted compound of a compound. In various embodiments, equivalent compounds can be readily prepared using starting materials, reagents, and conventional or conventional means by methods such as those shown in the general reaction schemes described below, or by modified versions thereof. A synthetic program is provided to prepare. In such reactions, it is also possible to utilize variants known per se but not mentioned here.

Equivalent Dose : The term "equivalent dose" is used herein to compare the dosage of different pharmaceutically active agents that produce the same biological result. According to the present invention, if two different agents achieve a similar or similar biological result, the doses are considered to be "equivalent" to each other. In some embodiments, equivalent doses of different pharmaceutical formulations for use in accordance with the present invention are determined using in vitro and/or in vivo assays as described herein. In some embodiments, one or more lysosomal activating agents for use in accordance with the present invention are used at a dose equivalent to the dose of the reference lysosomal activating agent; in some such embodiments, a reference for this purpose The lysosomal activating agent is selected from the group consisting of a small molecule ectopic activator (such as pyrazolyl), an imidoose (such as isofagomine), and an antioxidant (such as N-ethyl fluorenyl). -cysteine) and a cell trafficking regulator (eg, Rab1a polypeptide).

Heteroaliphatic : The term "heteroaliphatic" refers to an aliphatic group in which one or more units selected from C, CH, CH ₂ or CH ₃ are independently replaced by a hetero atom. In some embodiments, the heteroaliphatic group is a heteroalkyl group. In some embodiments, the aliphatic group is a heteroalkenyl group.

Heteroaryl : the terms "heteroaryl" and "heteroaryl" used alone or as part of a larger part of, for example, "heteroaralkyl" or "heteroaralkyloxy" means having 5 to 10 A ring atom, preferably 5, 6 or 9 ring atoms; having 6, 10 or 14 π electrons shared in a ring array; and a group having 1 to 5 hetero atoms in addition to carbon atoms. The term "heteroatom" refers to nitrogen, oxygen or sulfur and includes any oxidized form of nitrogen or sulfur; and any quaternized form of basic nitrogen. Heteroaryl groups include, but are not limited to, thienyl, furyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, Isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyridazinyl, fluorenyl, Pyridyl and acridinyl. The terms "heteroaryl" and "heteroaryl" as used herein also includes a group in which a heteroaryl ring is fused to one or more aryl, cycloaliphatic or heterocyclyl rings, wherein a linking group or point of attachment Attached to the heteroaryl ring. Non-limiting examples include mercapto, isodecyl, benzothienyl, benzofuranyl, dibenzofuranyl, oxazolyl, benzimidazolyl, benzothiazolyl, quinolinyl, isoquine Olinyl group, Lolinyl, pyridazinyl, quinazolinyl, quinoxalinyl, 4 H -quinazinyl, oxazolyl, acridinyl, cyanozinyl, phenothiazine, phenoxazinyl, tetrahydroquinoline Base, tetrahydroisoquinolyl and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. The heteroaryl group can be monocyclic or bicyclic. The term "heteroaryl" is used interchangeably with the terms "heteroaryl ring", "heteroaryl group" or "heteroaromatic", in which terms Either include a ring that is replaced as appropriate. The term "heteroaralkyl" refers to an alkyl group substituted with a heteroaryl group wherein the alkyl and heteroaryl moieties are independently substituted as appropriate.

Heteroatoms : The term "heteroatom" means one or more of the following: oxygen, sulfur, nitrogen, phosphorus, boron, selenium or tellurium (including any oxidized form of nitrogen, boron, selenium, sulfur, phosphorus or antimony; any a quaternized form of a basic nitrogen; or a nitrogen-substituted nitrogen, such as N (as in 3,4-dihydro- 2H -pyrrolyl), NH (as in pyrrolidinyl) or NR ⁺ (such as in the substituted pyrrolidinyl group on N)).

Heterocycle : As used herein, the terms "heterocycle", "heterocyclyl", "heterocyclic radical" and "heterocyclic ring" are used interchangeably and mean stable. 3 to 7 membered monocyclic or 7 to 10 membered bicyclic heterocyclic moiety which is saturated or partially unsaturated and has one or more, in addition to carbon atoms, preferably one to four, as defined above atom. When used with respect to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. For example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen may be N (as in 3,4-dihydro- 2H -pyrrolyl) NH (as in pyrrolidinyl) or ⁺ NR (as in pyrrolidinyl substituted on N ).

The heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom to give a stable structure, and any ring atom may be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic groups include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolyl, tetrahydroisoquinolinyl. , decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazenium, oxazinyl, thiazolidine, morpholine Base and Pyridyl. The terms "heterocycle", "heterocyclyl", "heterocyclyl ring", "heterocyclic group", "heterocyclic moiety" and ""Heterocyclicradicals" are used interchangeably herein and include a group of a heterocyclyl ring fused to one or more aryl, heteroaryl or cycloaliphatic rings, such as porphyrinyl, 3 H - thiol, An alkyl, phenanthryl or tetrahydroquinolyl group wherein the linking group or point of attachment is attached to a heterocyclyl ring. The heterocyclic group may be monocyclic or bicyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted with a heterocyclic group wherein the alkyl and heterocyclyl moieties are independently substituted as appropriate.

Intraperitoneal : As used herein, the terms "intraperitoneal administration" and "intraperitoneal administration" have their meaning as understood in the art and refer to the administration of a compound or composition into the peritoneum of an individual.

In vitro : As used herein, the term "in vitro" refers to the occurrence in an artificial environment, such as a test tube or reaction vessel, a cell culture fluid, and not within an organism (eg, an animal, plant, and/or microorganism). event.

In vivo : As used herein, the term "in vivo" refers to an event occurring within an organism (eg, an animal, a plant, and/or a microorganism).

Lower alkyl : The term "lower alkyl" means a _C1-4 straight or branched alkyl group. Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl and tert-butyl.

Lower Haloalkyl : The term "lower haloalkyl" means a _C1-4 straight or branched alkyl group substituted by one or more halogen atoms.

Substituted as appropriate : As described herein, the compounds of the invention may contain "as appropriate". Generally, the term "substituted" whether or not the term "optionally" precedes means that one or more of the specified moieties are replaced by a suitable substituent. Unless otherwise indicated, a "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and more than one position in any given structure may pass through more than one substituent selected from the specified group. Substituents at each position may be the same or different when substituted. Combinations of substituents contemplated by the present invention are preferably those which will form stable or chemically feasible compounds. The term "stable" as used herein refers to a compound that is substantially subjected to conditions that permit its production, detection, and (in certain embodiments) its recovery, purification, and use for one or more of the purposes disclosed herein. No change.

A suitable monovalent substituent on a carbon atom which may be substituted by a "optionally substituted" group is independently a halogen; -(CH ₂ ) _0-4 R ^o ; -(CH ₂ ) _0-4 OR ^o ; -O ( CH ₂ ) _0-4 R ^o ; -O-(CH ₂ ) _0-4 C(O)OR ^o ;-(CH ₂ ) _0-4 CH(OR ^o ) ₂ ;-(CH ₂ ) _0-4 SR ^O; may be substituted with R ^o of - (CH _{2) 0-4} Ph; it may be substituted by ^{_{R o - (CH 2) 0-4}} O (CH 2) 0-1 Ph; it may be substituted by R ^o -CH =CHPh; -(CH ₂ ) _0-4 O(CH ₂ ) _0-1 -pyridyl group which may be substituted by R ^o ; -NO ₂ ; -CN; -N ₃ ; -(CH ₂ ) _0-4 N( R ^o ) ₂ ; -(CH ₂ ) _0-4 N(R ^o )C(O)R ^o ; -N(R ^o )C(S)R ^o ;-(CH ₂ ) _0-4 N(R ^o C(O)NR ^o ₂ ;-N(R ^o )C(S)NR ^o ₂ ;-(CH ₂ ) _0-4 N(R ^o )C(O)OR ^o ;-N(R ^o )N (R ^o )C(O)R ^o ;-N(R ^o )N(R ^o )C(O)NR ^o ₂ ;-N(R ^o )N(R ^o )C(O)OR ^o ;-( CH ₂ ) _0-4 C(O)R ^o ;-C(S)R ^o ;-(CH ₂ ) _0-4 C(O)OR ^o ;-(CH ₂ ) _0-4 C(O)SR ^o ;-(CH ₂ ) _0-4 C(O)OSiR ^o ₃ ;-(CH ₂ ) _0-4 OC(O)R ^o ;-OC(O)(CH ₂ ) _0-4 SR;-SC(S ) SR ^o ; -(CH ₂ ) _0-4 SC(O)R ^o ; -(CH ₂ ) _0-4 C(O)NR ^o ₂ ; -C(S)NR ^o ₂ ;-C(S)SR ^o ;-SC(S)SR ^o ;-(CH ₂ ) _0-4 OC(O)NR ^o ₂ ;-C(O)N(OR ^o )R ^o ;- C(O)C(O)R ^o ;-C(O)CH ₂ C(O)R ^o ;-C(NOR ^o )R ^o ;-(CH ₂ ) _0-4 SSR ^o ;-(CH ₂ ) _0-4 S(O) ₂ R ^o ;-(CH ₂ ) _0-4 S(O) ₂ OR ^o ;-(CH ₂ ) _0-4 OS(O) ₂ R ^o ;-S(O) ₂ NR ^o ₂ ; -(CH ₂ ) _0-4 S(O)R ^o ; -N(R ^o )S(O) ₂ NR ^o ₂ ; -N(R ^o )S(O) ₂ R ^o ;-N( OR ^o )R ^o ;-C(NH)NR ^o ₂ ;-P(O) ₂ R ^o ;-P(O)R ^o ₂ ;-OP(O)R ^o ₂ ;-OP(O)(OR ^o ₂ ;-SiR ^o ₃ ;-(C _1-4 straight or branched alkyl)ON(R ^o ) ₂ ; or -(C _1-4 straight or branched alkyl)C(O) ON(R ^o ) ₂ , wherein each R ^o may be substituted as defined below and independently hydrogen, C _1-6 aliphatic, -CH ₂ Ph, -O(CH ₂ ) _0-1 Ph, -CH _2- (5-6 membered heteroaryl ring) or a 5-6 membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur, or whatever It is defined that two independently occurring R ^o together with the intervening atoms form a 3-12 membered saturated, partially unsaturated or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur, It can be substituted as defined below.

Suitable monovalent substituents on R ^o (or a ring formed by two independently occurring R ^o and its intervening atoms) are independently halogen, -(CH ₂ ) _0-2 R ^● , -(halo R ^● ), - (CH ₂ ) _0-2 OH, -(CH ₂ ) _0-2 OR ^● , -(CH ₂ ) _0-2 CH(OR ^● ) ₂ , -O(halo R ^● ), -CN, -N ₃ , -(CH ₂ ) _0-2 C(O)R ^● , - (CH ₂ ) _0-2 C(O)OH, -(CH ₂ ) _0-2 C(O)OR ^● , -(CH ₂ ) _0-2 SR ^● , -(CH ₂ ) _0-2 SH, -(CH ₂ ) _0-2 NH ₂ , -(CH ₂ ) _0-2 NHR ^● , -(CH ₂ ) _0-2 NR ^● ₂ , -NO ₂ , -SiR ^● ₃ , -OSiR ^● ₃ , -C(O)SR ^● , -(C _1-4 linear or branched alkyl) C(O)OR ^● or -SSR ^● , each of which R ^● unsubstituted or substituted with only one or more halogens in the presence of a "halo" group, and independently selected from a C _1-4 aliphatic group, -CH ₂ Ph, -O(CH ₂ ) _{0 -1} Ph or a 5-6 membered saturated, partially unsaturated or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen or sulfur. Suitable divalent substituents for saturated carbon atoms of R ^o include =0 and =S.

Suitable divalent substituents on saturated carbon atoms of the "optionally substituted" group include the following: =O, =S, =NNR ^* ₂ , =NNHC(O)R ^* , =NNHC(O)OR ^* , =NNHS(O) ₂ R ^* , =NR ^* , =NOR ^* , -O(C(R ^* ₂ )) _2-3 O- or -S(C(R ^* ₂ )) _2-3 S-, where R ^*, at each occurrence, is independently selected from the group consisting of hydrogen, a substituted _C1-6 aliphatic group as defined below, or a heteroatom having 0-4 independently selected from nitrogen, oxygen or sulfur. Substituting a 5-6 member of a saturated, partially unsaturated or aryl ring. Suitable divalent substituents which may be substituted for carbon adjacent to the "optionally substituted" group include: -O(CR ^* ₂ ) _2-3 O-, wherein each occurrence of R ^* is independently selected from each Hydrogen, a substituted C _1-6 aliphatic group as defined below or an unsubstituted 5-6 member saturated, partially unsaturated or aromatic having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur Base ring.

R ^* fit on the aliphatic group substituents include halogen, -R ^●, - (halo ^{R ●), - OH, -OR} ●, -O ( halo ^{R ●), - CN, -C} (O) ^{OH, -C (O) oR ●} , -NH 2, -NHR ●, -NR ● 2 or -NO _2, wherein each R ^● unsubstituted or front case where "halo" only through one or more of Halogen substituted, and independently C _1-4 aliphatic, -CH ₂ Ph, -O(CH ₂ ) _0-1 Ph or having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur 5-6 member saturated, partially unsaturated or aryl ring.

Suitable substituents on the nitrogen which may be substituted by the "optionally substituted" group include -R ^† , -NR ^† ₂ , -C(O)R ^† , -C(O)OR ^† , -C(O)C (O)R ^† , -C(O)CH ₂ C(O)R ^† , -S(O) ₂ R ^† , -S(O) ₂ NR ^† ₂ , -C(S)NR ^† ₂ , -C (NH)NR ^† ₂ or -N(R ^† )S(O) ₂ R ^† ; wherein each R ^{† is} independently hydrogen, a substituted C _1-6 aliphatic group as defined below, unsubstituted -OPh or an unsubstituted 5-6 membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur, or two independent occurrences, no matter how defined above R ^† together with its intercalating atoms form an unsubstituted 3-12 membered saturated, partially unsaturated or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur.

The aliphatic group for R ^† on the substituents are independently halogen, -R ^●, - (halo ^{R ●), - OH, -OR} ●, -O ( halo ^{R ●), - CN, -C} ( O) OH, -C (O) oR ●, -NH 2, -NHR ●, -NR ● 2 or -NO _2, wherein each R ^● unsubstituted or front case where "halo" only with one of the Or substituted by a plurality of halogens, and independently of a C _1-4 aliphatic group, -CH ₂ Ph, -O(CH ₂ ) _0-1 Ph or having 0-4 independently selected from nitrogen, oxygen or sulfur A 5-6 member of the atom is saturated, partially unsaturated, or an aryl ring.

Oral : As used herein, the terms "oral administration" and "oral administration" have their meaning as understood in the art and refer to a compound or composition administered orally.

Parenteral : as used herein, the terms "parenteral administration" and "parenteral administration" have their meanings as understood in the art, and refer to modes of administration other than enteral and topical administration, usually By injection, and including (but not limited to) intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, intra-articular, sac Intra, subarachnoid, intraspinal and intrasternal injections and infusions.

Partially unsaturated : The term "partially unsaturated" as used herein means that the ring portion includes at least one double bond or a bond. The term "partially unsaturated" is intended to encompass a ring having multiple sites of unsaturation, but is not intended to include an aryl or heteroaryl moiety as defined herein.

Pharmaceutical Composition : The term "pharmaceutical composition" as used herein refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in the treatment regimen in an amount suitable for the unit dose administered, which, when administered to the relevant population, exhibits a statistically significant probability of achieving a predetermined therapeutic effect. In some embodiments, the pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including for pharmaceutical compositions for oral administration, for example, for application to the tongue ( Aqueous or non-aqueous solutions or suspensions, lozenges (for example, lozenges targeted for buccal, sublingual, and systemic absorption), boluses, powders, granules, pastes; parenteral administration, for example Administration by, for example, sterile solution or suspension or sustained release formulation by subcutaneous, intramuscular, intravenous or epidural injection; topical application, for example, application to the skin, lung or oral cream, ointment or controlled release patch Or spray; intravaginal or rectal administration, for example in the form of a pessary, cream or foam; sublingual; transocular; percutaneous; or nasal, transpulmonary and other mucosal surfaces.

Pharmaceutically acceptable : As used herein, the phrase "pharmaceutically acceptable" means that their compounds, substances, compositions and/or dosage forms are suitable for use in connection with human and animal tissues within the scope of sound medical judgment. Without excessive toxicity, irritation, allergic reactions or other problems or complications, match the reasonable benefit/risk ratio.

Pharmaceutically acceptable carrier : As used herein, the term "pharmaceutically acceptable carrier" means when an organ or part of a compound of the invention is carried or delivered to another organ or part of the body. A pharmaceutically acceptable substance, composition or vehicle, such as a liquid or solid filler, diluent, excipient or solvent encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient. Some examples of materials that can serve as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, Ethyl cellulose and cellulose acetate; powdered scutellaria; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil And soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as hydroxide Magnesium and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; pH buffer solution; polyester, polycarbonate and/or polyanhydride; Other non-toxic compatible substances used in the formulation.

Pharmaceutically acceptable salts : As used herein, the term "pharmaceutically acceptable salts" means salts of such compounds suitable for use in the context of medicine, that is, within the scope of sound medical judgment, Salts that come into contact with humans and tissues of lower animals without abnormal toxicity, irritation, allergic reactions and the like, and which match the reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, SM Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts which are salts of amine groups with inorganic acids or with organic acids or by using other techniques used in the art. Salts formed by methods such as ion exchange, inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid . In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, besylate, benzoate, hydrogen sulfate , borate, butyrate, camphorate, camphor sulfonate, citrate, cyclopentane propionate, digluconate, lauryl sulfate, ethanesulfonate, formate, Fumarate, glucoheptonate, glycerol phosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate , lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinic acid, nitrate, oil Acid salt, oxalate, palmitate, pamoate, pectate, peroxosulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate , stearates, succinates, sulfates, tartrates, thiocyanates, p-toluenesulfonates, undecanoates, valerates and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium and the like. In some embodiments, where appropriate, pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, Phosphate, nitrate, alkyl having 1 to 6 carbon atoms, sulfonate and arylsulfonate.

Prodrug : In general, the term "prodrug" as used herein and as understood in such art, is administered in vivo to the body to deliver an activity of interest (eg, therapeutic or diagnostic) when administered to an organism. The entity of the agent. Typically, such metabolism involves the removal of at least one "prodrug moiety" to form an active agent. Various forms of "prodrugs" are known in the art. For examples of such prodrug moieties, see: a) Design of Prodrugs , edited by H. Bundgaard, (Elsevier, 1985) and Methods in Enzymology , 42: 309-396, edited by K. Widder et al. (Academic Press, 1985); b) Prodrugs and Targeted Delivery , edited by J. Rautio (Wiley, 2011); c) Prodrugs and Targeted Delivery , edited by J. Rautio (Wiley, 2011); d) A Textbook of Drug Design and Development, Krogsgaard-Larsen; e) Bundgaard, Chapter 5, "Design and Application of Prodrugs", H. Bundgaard, pp. 113-191 (1991); f) Bundgaard, Advanced Drug Delivery Reviews , 8: 1-38 (1992) ;g) Bundgaard et al, Journal of Pharmaceutical Sciences , 77: 285 (1988); and h) Kakeya et al, Chem. Pharm. Bull. , 32: 692 (1984).

Like other compounds described herein, prodrugs can be provided in any of a variety of forms, such as crystalline forms, salt forms, and the like. In some embodiments, the prodrug is provided in the form of a pharmaceutically acceptable salt thereof.

Protecting group : The term "protecting group" as used herein is well known in the art and includes the protecting groups described in detail in Protecting Groups in Organic Synthesis , TW Greene and PGM Wuts, 3rd edition, John Wiley & Sons, 1999. The entire contents of this reference are hereby incorporated by reference. Also included in Current Protocols in Nucleic Acid Chemistry , which are specifically used for nucleoside and nucleotide chemistry as described in Serge L. Beaucage et al., 06/2012, the entire contents of which are incorporated by reference. The manner is incorporated herein. Suitable amine protecting groups include methyl amino formate, ethyl urethane, 9-fluorenylmethyl formate (Fmoc), 9-(2-sulfonate) carbazate, amine 9-(2,7-dibromo)indolyl carbamate, 2,7-di-t-butyl-carbamic acid [9-(10,10-di-oxy--10,10,10,10 - tetrahydrothioxyl)]methyl ester (DBD-Tmoc), 4-methoxybenzyl hydrazide methyl ester (Phenoc), 2,2,2-trichloroethyl urethane (Troc), 2-Trimethyldecyl carbamic acid ethyl ester (Teoc), 2-phenylethyl carbazate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc) 1,1-dimethyl-2-haloethyl carbamic acid, 1,1-dimethyl-2,2-dibromoethylamine (DB- t- BOC), uric acid 1 , 1-dimethyl-2,2,2-trichloroethyl ester (TCBOC), 1-methyl-1-(4-biphenyl)ethyl carbamate (Bpoc), urethane 1-( 3,5-di- t -butylphenyl)-1-methylethyl ester ( t- Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), urethane 2-( N,N -dicyclohexylcarbamimidyl)ethyl ester, tert-butyl carbamic acid (BOC), 1-adamantyl carbazate (Adoc), vinyl urethane (Voc), Amino group Allocyl ester (Alloc), 1-isopropylallyl propyl carbamate (Ipaoc), cinnamate citrate (Coc), 4-nitrocinnamate (Noc) carbazate, 8-quinucin carbamic acid Porphyrin ester, N -hydroxypiperidinyl carbazate, alkyl dithiocarbamate, benzyl carbazate (Cbz), p-methoxybenzyl carbazate (Moz), carbamic acid Nitrobenzyl ester, p-bromobenzyl carbazate, p-chlorobenzyl carbazate, 2,4-dichlorobenzyl carbazate, 4-methylsulfinyl benzoate Ester (Msz), 9-fluorenylmethyl carbamate, diphenylmethyl carbazate, 2-methylthioethyl carbamate, 2-methylsulfonyl urethane, uric acid 2-(p-toluenesulfonyl)ethyl ester, [2-(1,3-dithiaalkyl)]methylcarbamate (Dmoc), 4-methylphenylthiocarbamate (Mtpc), amine 2,4-dimethylphenylthiocarbamate (Bmpc), 2-phosphonylcarbamate (Peoc), 2-triphenylphosphonium isopropyl carbamate (Ppoc), amine group 1,1-dimethyl-2-cyanoethyl formate, m-chloro-p-methoxybenzyl carbazate, (dihydroxyboroboryl) benzyl carbamate, urethane 5- benzene And isoxazolylmethyl ester, 2-(trifluoromethyl)-6-chromonylmethylcarbamate (Tcroc), m-nitrophenyl carbazate, 3,5-dimethoxycarbamate Methyl phenyl methyl ester, o-nitrophenyl methyl carbazate, 3,4-dimethoxy-6-nitrophenyl methyl carbazate, phenyl (o-nitrophenyl) methyl carbamate, Phenylthiazinyl-(10)-carbonyl derivative, N' -p-toluenesulfonylaminocarbonyl derivative, N' -phenylaminothiocarbonyl derivative, third amyl carbamate, thiamine group S -Benzyl formate, p-cyanobenzyl carbazate, cyclobutyl carbazate, cyclohexyl carbazate, cyclopentyl carbazate, cyclopropyl methyl carbazate, urethane p- N -methoxybenzyl ester, 2,2-dimethoxycarbonyl vinyl carbamate, o-( N,N -dimethylformamido)benzyl amide, amide 1,1 - dimethyl-3-( N,N -dimethylformamido)propyl ester, 1,1-dimethylpropynyl carbamic acid ester, di(2-pyridyl)methylcarbamate, 2-furyl methyl carbazide, 2-iodoethyl carbamic acid, isobornyl carbazate, isobutyl carbazate, isonicotinic acid carbazate , carbamic acid p-(p-'-methoxyphenylazo) benzyl ester, 1-methylcyclobutyl carbazate, 1-methylcyclohexyl carbazate, 1-methyl carbamic acid 1--1-cyclopropylmethyl ester, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbazate, 1-methyl-1-amino-1-carboxylate Nitrophenyl)ethyl ester, 1-methyl-1-phenylethyl carbazate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamic acid, amide P-(phenylazo)benzyl ester, 2,4,6-tri-t-butylphenyl carbamic acid, 4-(trimethylammonium) benzyl carbamate, 2,4,6-carbamic acid Trimethyl benzyl ester, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropionamide, pyridinamine, 3-pyridylformamide, N -benzylidenephenylpropylamine decyl derivative, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxy Acetamide, acetamidine, ( N' -dithiobenzyloxycarbonylamino) acetamide, 3-(p-hydroxyphenyl) propylamine, 3-(o-nitrophenyl)propanoid Amine, 2-methyl-2-(o-nitrophenoxy)propanamide 2-Methyl-2- (phenylazo o-phenoxy) propan-acyl amines, acyl amine 4-chlorobutyryl, 3-methyl-butyl Amides nitro, o-nitrocinnamic acyl amine, N - Ethyl methionine derivative, o-nitrobenzamide, o-(benzyloxymethyl)benzamide, 4,5-diphenyl-3-oxazoline-2- Ketone, N -phthalimide, N -dithiabutadienimide (Dts), N -2,3-diphenylbutyleneimine, N -2,5-di Methylpyrrole, N- 1,1,4,4-tetramethyldidecylazetane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5 - triazacyclohexan-2-one, 5-substituted 1,3-diphenylmethyl-1,3,5-triazacyclo-2-one, 1-substituted 3,5- Dinitro-4-pyridone, N -methylamine, N -allylamine, N- [2-(trimethyldecyl)ethoxy]methylamine (SEM), N- 3-ethoxypropoxypropylamine , N- (1-isopropyl-4-nitro-2-oxo-3-pyrrolidin-3-yl)amine, quaternary ammonium salt, N -benzylamine, N -di(4-A Oxyphenyl)methylamine, N -5-dibenzocycloheptylamine, N -triphenylmethylamine (Tr), N -[(4-methoxyphenyl)benzhydryl]amine (MMTr ), N -9- phenyl fluorene amine group (PhF), N -2,7- two -9- methylene fluorene amine, N - methylamino ferrocenyl (Fcm), N -2- methylamino pyridine N '- oxide, N -1,1- dimethyl sulfoxide sulfur Methylamine, N -benzylideneamine, N -p-methoxybenzylideneamine, N -diphenylmethyleneamine, N -[(2-pyridyl) Methyleneamine, N- ( N',N' -dimethylaminomethylene)amine, N,N' -isopropylidenediamine, N -p-nitrobenzylideneamine, N - sulphonylamine, N -5-chlorolinamide, N- (5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N -cyclohexyleneamine, N- (5,5- Dimethyl-3-oxo-1-cyclohexenyl)amine, N -borane derivative, N -diphenylboronic acid derivative, N- [phenyl(pentacarbonyl chromium- or tungsten)carbonyl] Amine, N -copper chelate, N -zinc chelate, N -nitroamine, N -nitrosamine, amine N -oxide, diphenylphosphoniumamine (Dpp), dimethylthio Phosphonium amide (Mpt), diphenyl thiophosphonium decylamine (Ppt), dialkyl amino phosphate, diphenyl methyl amide, diphenyl phosphinate, sulfinamide, ozon Benzosulfinamide (Nps), 2,4-dinitrobenzenesulfinamide, pentachlorobenzenesulfinamide, 2-nitro-4-methoxybenzamide, triphenyl Methylsulfinamide, 3-nitropyridinesulfinamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzene Sulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxy Sulfaguanamine (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6 -trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethyl Alkan-6-sulfonamide (Pmc), mesylate (Ms), β-trimethyldecyl sulfonamide (SES), 9-nonylsulfonamide, 4-(4',8'- Dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and benzamidine methylsulfonamide.

Well-protected carboxylic acids further include, but are not limited to, carboxylic acids protected by decyl, alkyl, alkenyl, aryl and aralkyl groups. Examples of suitable decyl groups include trimethyldecyl, triethyl decyl, tert-butyldimethyl decyl, tert-butyldiphenyl decyl, triisopropyldecyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, tert-butyl, tetrahydropyran-2- base. Examples of suitable alkenyl groups include allyl groups. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl groups (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, o-nitrobenzyl, p- Nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl) and 2- and 4-pyridylmethyl.

Suitable hydroxy protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), tert-butylthiomethyl, (phenyl dimethyl decyl) methoxymethyl ( SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl ( p- AOM), guaiacol A Guaiacolmethyl (GUM), tert-butoxymethyl, 4-pentenyloxymethyl (POM), nonyloxymethyl, 2-methoxyethoxymethyl (MEM), 2, 2 , 2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethyldecyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP) , 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl -4,7-methanol benzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1- methyl 1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethyldecylethyl, 2 -(phenylhydroseleno)ethyl, tert-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxy Benzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyano Benzyl, p-phenylbenzyl, 2-pyridylmethyl, 4-pyridylmethyl, 3-methyl-2-pyridylmethyl N -oxyl, diphenylmethyl, p-, p-- Nitrodiphenylmethyl, 5-dibenzocycloheptyl, trityl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, bis(p-methoxyphenyl) Benzyl, tris(p-methoxyphenyl)methyl, 4-(4'-bromobenzylidenemethyloxyphenyl)diphenylmethyl, 4,4',4"-para (4, 5-Dichlorophthalimidoiminophenyl)methyl, 4,4',4"-parade(ethindolyloxyphenyl)methyl, 4,4',4"-para ( Benzyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4"-dimethoxyphenyl)methyl, 1,1-bis(4-methoxybenzene Base)-1'-mercaptomethyl , 9-fluorenyl, 9-(9-phenyl) , 9-(9-phenyl-10-oxooxy)indolyl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxyionyl, three Methyl decyl (TMS), triethyl decyl (TES), triisopropyl decyl (TIPS), dimethyl isopropyl decyl (IPDMS), diethyl isopropyl decyl (DEIPS) , dimethyl hexyl decyl decyl, tert-butyl dimethyl decyl (TBDMS), tert-butyl diphenyl decyl (TBDPS), trityl decyl, tri-p-dimethylphenyl decyl , triphenyldecylalkyl, diphenylmethyldecanealkyl (DPMS), tert-butylmethoxyphenyl decyl (TBMPS), formate, benzalkonate, acetate, chloroacetate , dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetic acid Ester, 3-phenylpropionate, 4-oxovalerate (acetamyl propionate), 4,4-(ethylidene disulfide) valerate Aldehyde), pivalate, adamantate, crotonate, 4-methoxy crotonate, benzoate, p-phenyl benzoate, 2,4,6-trimethyl Benzoate (mesitoate), alkyl alkyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl carbonate, alkyl carbonate 2, 2, 2- Trichloroethyl ester (Troc), 2-(trimethyldecyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonium) carbonate Ethyl ester (Peoc), alkyl isobutyl carbonate, vinyl carbonate alkyl ester, alkyl carbonate allyl ester, alkyl carbonate p-nitrophenyl ester, alkyl carbonate benzyl ester, alkyl carbonate P-methoxybenzyl ester, alkyl carbonate 3,4-dimethoxybenzyl ester, alkyl carbonate o-nitrobenzyl ester, alkyl carbonate p-nitrophenyl methyl ester, thio Alkyl carbonate S -benzyl ester, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitrate 4-methylvalerate, o-(dibromomethyl)benzoate, 2-methylmercaptobenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methyl Thiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro -4-(1,1,3,3-tetramethylbutyl)benzene Acetate, 2,4-bis (1,1-dimethylpropyl) phenoxyacetate, chloro diphenyl acetate, isobutyrate, monosuccinate, (E) -2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, N , N, N', N' -tetramethyldiamine Alkyl phosphate, alkyl N -phenylcarbamate, borate, dimethylphosphinothio, alkyl 2,4-dinitrophenylsulfinate, sulfate, methanesulfonic acid Ester (mesylate), benzylsulfonate and tosylate (Ts). To protect the 1,2- or 1,3-diol, the protecting group includes a methylene acetal, an ethylene acetal, a 1-tert-butylethylene ketal, and a 1-phenylethyl ketal. , (4-methoxyphenyl) ethylene acetal, 2,2,2-trichloroethylene acetal, acetonide, cyclopentylene ketal, cyclohexylene ketal, cyclohexylene Ketal ketone, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene Aldehyde, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylidene Orthoester, 1-ethoxyethylidene orthoester, 1,2-dimethoxyethyl orthoester, α-methoxybenzylidene orthoester, 1-( N,N -dimethylamino)ethylene derivative, α-( N,N' -dimethylamino)benzylidene derivative, 2-oxacyclopentylene orthoester, di-t-butylene Decylalkyl (DTBS), 1,3-(1,1,3,3-tetraisopropyldipyridiniumoxy) derivatives (TIPDS), tetra-tert-butoxydioxane-1,3 -di-subunit derivatives (TBDS), cyclic carbonates, rings Acid ester, Ethyl acetate Benzate.

In some embodiments, the hydroxy protecting group is ethyl hydrazino, tert-butyl, tert-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-( 2-chloroethoxy)ethyl, 2-trimethyldecylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzhydryl, p-phenylbenzhydrazide Base, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl/trityl, 4,4'-dimethoxytrityl, trimethyl Base alkyl, triethyl decyl, tert-butyl dimethyl decyl, tert-butyl diphenyl decyl, triphenyl decyl, triisopropyl decyl, benzyl carbazate , chloroethyl fluorenyl, trichloroethenyl, trifluoroethane, pentylene, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, triphenyl Methyl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl (DMTr) and 4,4',4"-trimethoxytrityl (TMTr) , 2-cyanoethyl (CE or Cne), 2-(trimethyldecyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl) Ethyl, 2-(4-nitrobenzene) Ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4 -nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4"-paraben (benzonitrile) Triphenylmethyl, diphenylamine methyl hydrazino, acetamyl propyl, 2-(dibromomethyl)benzylidene (Dbmb), 2-(isopropylthiomethoxymethyl) Benzomidine (Ptmt), 9-phenyldibenzopyran-9-yl (pixyl) or 9-(p-methoxyphenyl)xanthene-9-yl (MOX). In some embodiments, the hydroxy protecting groups are each independently selected from the group consisting of ethenyl, benzyl, tert-butyldimethyldecyl, tert-butyldiphenyldecyl, and 4,4'-dimethoxy Trityl group. In some embodiments, the hydroxy protecting group is selected from the group consisting of trityl, monomethoxytrityl, and 4,4'-dimethoxytrityl.

In some embodiments, a phosphorus protecting group is a group attached to an internucleotide phosphorus linkage throughout the synthesis of the oligonucleotide. In some embodiments, the phosphorus protecting group is attached to an internucleotide phosphorothioate-linked sulfur atom. In some embodiments, the phosphorus protecting group is attached to an internucleotide phosphorothioate-linked oxygen atom. In some embodiments, the phosphorus protecting group is attached to an internucleotide phosphate linked oxygen atom. In some embodiments, the phosphorus protecting group is 2-cyanoethyl (CE or Cne), 2-trimethyldecylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, Benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-( N -tert-butylformamido)-1-propene , 4-sided oxypentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4- N -methylaminobutyl, 3-(2 -pyridyl)-1-propyl, 2-[ N -methyl- N- (2-pyridyl)]aminoethyl, 2-( N -methylindolyl, N -methyl)amineethyl, 4 -[ N -Methyl- N- (2,2,2-trifluoroethyl)amino]butyl.

Protein : The term "protein" as used herein refers to a polypeptide (i.e., a string of at least two amino acids joined to each other by peptide bonds). In some embodiments, the protein includes only naturally occurring amino acids. In some embodiments, the protein comprises one or more non-naturally occurring amino acids (eg, a moiety that forms one or more peptide bonds with an adjacent amino acid). In some embodiments, one or more residues in the protein chain contain a non-amino acid moiety (eg, a glycan, etc.). In some embodiments, the protein comprises more than one polypeptide chain, for example linked by one or more disulfide bonds or by other means. In some embodiments, the protein contains L-amino acid, D-amino acid, or both; in some embodiments, the protein contains one or more amino acid modifications or analogs known in the art. Suitable modifications include, for example, terminal acetylation, guanidine, methylation, and the like. The term "peptide" is generally used to refer to polypeptides having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, the protein is an antibody, an antibody fragment, a biologically active portion thereof, and/or a characteristic portion thereof.

Sample : A "sample" as used herein is a specific organism or a substance obtained therefrom. In some embodiments, the sample is a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, the source of interest comprises an organism, such as an animal or a human. In some embodiments, the biological sample comprises biological tissue or body fluids. In some embodiments, the biological sample is or comprises any one or more of the following: bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free-floating nucleic acids; sputum; saliva; Fluid; cerebrospinal fluid; peritoneal fluid; pleural fluid; feces; lymph; gynecological fluid; skin swab; vaginal swab; buccal swab; nasal swab; washing or lavage, such as catheter lavage Fluid or bronchoalveolar lavage fluid; extract; scraping; bone marrow sample; tissue biopsy sample; surgical sample; stool, other body fluids, secretions and/or excretion; and/or cells from it. In some embodiments, the biological sample is or comprises cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from a source of interest by any suitable means. For example, in some embodiments, the primary biological sample is obtained by a method selected from the group consisting of: a biopsy (eg, fine needle aspiration or tissue biopsy), surgery, collection of body fluids (eg, blood, Lymph, feces, etc.). In some embodiments, as the term "sample" is taken from the context, it is meant by processing (eg, by removing one or more components therefrom and/or by adding one or more reagents thereto) A preparation obtained from a primary sample. For example, semi-permeable membrane filtration is used. Such "treated samples" may comprise, for example, nucleic acids or proteins obtained from sample extraction or by applying techniques such as mRNA amplification or reverse transcription, isolation and/or purification of certain components to the primary sample. In some embodiments, the sample is an organism. In some embodiments, the sample is a plant. In some embodiments, the sample is an animal. In some embodiments, the sample is a human. In some embodiments, the sample is an organism other than a human.

Stereochemically isomeric forms : As used herein, the phrase "stereochemically isomeric forms" refers to different compounds consisting of the same atoms bonded by the same bond sequence, but having different three-dimensional structures that are not interchangeable. In some embodiments of the invention, the chemical composition provided may be or comprise a pure preparation of individual stereochemically isomeric forms of the compound; in some embodiments, the chemical composition provided may be or include the compound A mixture of two or more stereochemically isomeric forms. In certain embodiments, the mixtures contain equal amounts of different stereochemically isomeric forms; in certain embodiments, the mixtures contain different amounts of at least two different stereochemically isomeric forms. In some embodiments, the chemical composition can contain all diastereomers and/or enantiomers of the compound. In some embodiments, the chemical composition does not contain all of the diastereomers and/or enantiomers of the compound. In some embodiments, if a particular enantiomer of a compound of the invention is desired, it can be prepared, for example, by asymmetric synthesis or by derivatization with a palmitic adjuvant, wherein the resulting diastereomeric mixture is isolated. And the auxiliary group is cleaved to give the pure desired enantiomer. Alternatively, where the molecule contains a basic functional group such as an amine group, the diastereomeric salt is formed with an acid having an appropriate optical activity and resolved, for example, by fractional crystallization.

Individual : As used herein, the term "individual" or "testing individual" refers to any organism to which a provided compound or composition is administered in accordance with the present invention, for example, for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical individuals include animals (eg, mammals such as mice, rats, rabbits, non-human primates, and humans; insects; helminths, etc.) and plants. In some embodiments, an individual may have and/or be susceptible to a disease, disorder, and/or condition.

Basically : As used herein, the term "substantially" refers to a qualitative condition that exhibits a total or near total extent or level of a feature or property of interest. It is understood by one of ordinary skill in the art of biology that biological and chemical phenomena are rarely, if ever, performed completely and/or continuously with complete or seldom achieved or avoided absolute results. Thus the term "substantially" is used herein to address the potential lack of integrity inherent in many biological and/or chemical phenomena.

Suffering from : An individual "having" a disease, disorder, and/or condition has been diagnosed with the disease, disorder, and/or condition and/or presents one or more symptoms thereof.

Susceptibility : Individuals who are "susceptible" to a disease, condition and/or condition are at higher risk of developing the disease, condition and/or condition than individuals of the public. In some embodiments, an individual susceptible to a disease, disorder, and/or condition may not have been diagnosed with the disease, disorder, and/or condition. In some embodiments, an individual susceptible to a disease, disorder, and/or condition can present symptoms of the disease, disorder, and/or condition. In some embodiments, an individual susceptible to a disease, disorder, and/or condition may not exhibit symptoms of the disease, disorder, and/or condition. In some embodiments, an individual susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.

Systemic : As used herein, the phrase "systemic administration", "systemic administration", "peripheral administration" and "peripheral administration" have their meaning as understood in the art, and refers to the administration of a compound or The composition is brought into the recipient's system.

Tautomeric form : As used herein, the phrase "tautomeric form" is used to describe different isomeric forms of organic compounds that are readily convertible. Tautomers are characterized by the migration of hydrogen atoms or protons, with the switching of single bonds and adjacent double bonds. In some embodiments, tautomers can be produced by proton transfer tautomerization (ie, proton relocation). In some embodiments, tautomers can be produced by valence tautomerization (ie, rapid recombination of bonding electrons). All such tautomeric forms are intended to be included within the scope of the invention. In some embodiments, the tautomeric forms of the compounds exist in equilibrium with one another such that an attempt is made to prepare a separate material, resulting in a mixture. In some embodiments, the tautomeric form of the compound is a detachable and separable compound. In some embodiments of the invention, a chemical composition can be provided that is or includes a pure formulation of a single tautomeric form of the compound. In some embodiments of the invention, the chemical composition can be provided as a mixture of two or more tautomeric forms of the compound. In certain embodiments, the mixtures contain equal amounts of different tautomeric forms; in certain embodiments, the mixtures contain different amounts of at least two different tautomeric forms of the compound. In some embodiments of the invention, the chemical composition may contain all tautomeric forms of the compound. In some embodiments of the invention, the chemical composition does not contain all tautomeric forms of the compound. In some embodiments of the invention, the chemical composition may contain one or more tautomeric forms of the compound, the amount of which varies over time due to interconversion. In some embodiments of the invention, tautomerization is keto-enol tautomerization. Those of ordinary skill in the art will recognize that keto-enol tautomers can be "captured" using any suitable reagent known in the art (i.e., chemically modified such that they remain in the form of "enol" Thereby, an enol derivative which can subsequently be separated using one or more suitable techniques known in the art is obtained. Unless otherwise indicated, the invention encompasses all tautomeric forms of the relevant compounds, whether in pure form or mixed with each other.

Therapeutic Agent : As used herein, the phrase "therapeutic agent" refers to any agent that, when administered to an individual, has a therapeutic effect and/or produces a desired biological and/or pharmacological effect. In some embodiments, the therapeutic agent is any agent that can be used to alleviate, ameliorate, alleviate, inhibit, prevent, delay, reduce, and/or reduce one or more symptoms or characteristics of the disease, disorder, and/or condition. The substance of the incidence.

Therapeutically effective amount : As used herein, the term "therapeutically effective amount" means an amount of a substance (eg, a therapeutic agent, composition, and/or formulation) that, when administered as part of a therapeutic regimen, elicits a desired biological response. In some embodiments, a therapeutically effective amount of a substance is sufficient to treat, diagnose, or prevent the disease, condition, and/or condition when administered to an individual having or susceptible to a disease, disorder, and/or condition. / or delay the amount of its onset. As will be appreciated by those of ordinary skill in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance to be delivered, the target cell or tissue. For example, in a formulation for treating a disease, disorder, and/or condition, an effective amount of the compound is to alleviate, ameliorate, alleviate, inhibit, prevent, delay, or reduce the onset, disease, and/or condition of the compound. The amount of severity and/or reduction in the incidence of one or more symptoms or characteristics. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

Treatment : As used herein, the term "treat/treatment/treating" refers to the use of partial or complete relief, amelioration, alleviation, inhibition, prevention of a disease, condition and/or condition, delaying its onset, reducing its severity. And/or any method that reduces the incidence of one or more symptoms or characteristics. Treatment can be administered to an individual who does not present a condition for the disease, condition, and/or condition. In some embodiments, for example, for the purpose of reducing the risk of developing a disease associated with a disease, disorder, and/or condition, it may be administered to an individual who presents only an early symptom of the disease, disorder, and/or condition. treatment.

Unsaturated : As used herein, the term "unsaturated" means that the moiety has one or more units of unsaturation.

Unit Dosage : As used herein, the expression "unit dose" refers to an amount administered in a single dose and/or in a physically discrete unit of a pharmaceutical composition. In various embodiments, the unit dose contains a predetermined amount of active agent. In some embodiments, the unit dose contains the entire single dose of the agent. In some embodiments, more than one unit dose is administered to achieve a total single dose. In some embodiments, it may be desirable or desirable to administer multiple unit doses in order to achieve a defined effect. The unit dose can be, for example, a volume of a liquid containing a predetermined amount of one or more therapeutic agents (eg, an acceptable carrier), a predetermined amount of one or more therapeutic agents in solid form, containing one or more of a predetermined amount of treatment Sustained release of the formulation or drug delivery device, and the like. It will be appreciated that a unit dose may be in the form of a formulation in addition to the therapeutic agent, including any of the various components. For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, and the like can be included, as described below. It will be appreciated by those skilled in the art that, in various embodiments, a total appropriate daily dose of a particular therapeutic agent can comprise a portion or a plurality of unit doses of a unit dose, and can be determined, for example, by the attending physician in accordance with sound medical judgment. In some embodiments, the particular effective amount of any particular individual or organism may depend on a number of factors, including the condition being treated and the severity of the condition; the activity of the particular active compound employed; Composition; age, weight, overall health, sex and diet of the individual; time of administration and excretion rate of the particular active compound employed; duration of treatment; combination with or concurrent use of the particular compound employed and/or other Therapy; and similar factors well known in medical technology.

Wild type : As used herein, the term "wild type" has its meaning as understood in the art and refers to a state or condition such as "normal" (relative to mutation, disease, alteration, etc.) in nature. The structure and/or active entity present underneath. One of ordinary skill will appreciate that wild-type genes and polypeptides often exist in a variety of different forms (e.g., dual genes).

Nucleic acid : The term "nucleic acid" includes any nucleotide, modified variants thereof, analogs thereof, and polymers thereof. The term "polynucleotide" as used herein refers to a polymeric form of nucleotides of any length (ribonucleotides (RNA) or deoxyribonucleotides (DNA)) or modified variants thereof or analog. These terms refer to a hierarchical structure of molecules and thus include double-stranded and single-stranded DNA as well as double-stranded and single-stranded RNA. These terms include RNA or DNA analogs made from nucleotide analogs and modified polynucleotides, such as, but not limited to, methylated, protected, and/or blocked. Nucleotide or polynucleotide. These terms encompass poly or oligoribonucleotides (RNA) and poly or oligodeoxyribonucleotides (DNA); N-glycosides or C derived from nucleobases and/or modified nucleobases - RNA or DNA of glycosides; nucleic acids derived from sugars and/or modified sugars; and bridges derived from phosphate bridges and/or modified phosphorus atoms (also referred to herein as "internucleotide linkages") ) nucleic acid. The term encompasses nucleic acids comprising nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or any combination of modified phosphorus atom bridges. Examples include, but are not limited to, nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing a ribose moiety and a deoxyribose moiety, nucleic acids containing a ribose moiety, and a modified ribose moiety. The prefix poly-system refers to a nucleic acid containing from 2 to about 10,000 nucleotide unit units and wherein the prefix oligo-referring nucleic acid contains from 2 to about 200 nucleotide unit units.

Nucleotide : As used herein, the term "nucleotide" refers to a polynucleotide monomer unit consisting of a heterocyclic base, a sugar, and one or more phosphate groups or phosphorus-containing internucleotide linkages. Naturally occurring bases (guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)) are derivatives of purines or pyrimidines, but it should be understood that Natural and non-naturally occurring base analogs. Naturally occurring sugars are pentose (pentaose) deoxyribose (which forms DNA) or ribose (which forms RNA), but it is understood that natural and non-naturally occurring sugar analogs are also included. Nucleotides are linked via internucleotide linkages to form nucleic acids or polynucleotides. A variety of internucleotide linkages are known in the art (such as, but not limited to, phosphates, phosphorothioates, borane phosphates, and the like). Artificial nucleic acids include PNA (peptide nucleic acids), phosphotriester, phosphorothioate, H - phosphonate, amine phosphates, boranophosphate, methylphosphonate, acyl phosphonate acetate, ethyl thiophosphonic XI Other variants of the acid ester backbone of the acid ester and natural nucleic acid, such as those described herein. Other analogs (eg, artificial nucleic acids or components that can be incorporated into nucleic acids or artificial nucleic acids) include: borane phosphate RNA, FANA, locked nucleic acid (LNA), morpholinol (Morpholinos), peptide nucleic acid (PNA), Threose (TNA) and diol nucleic acid (GNA). In various embodiments, the modified nucleotide or nucleotide analog is any of the modified nucleotides or nucleotide analogs described in any one of the following: Gryaznov, S; Chen, J .-KJAm.Chem.Soc. 1994, 116, 3143; Hendrix et al. 1997 Chem. Eur. J. 3: 110; Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Jepsen et al. 2004 Oligo. 130-146; Jones et al. J. Org. Chem. 1993, 58, 2983; Koizumi et al. 2003 Nuc. Acids Res. 12: 3267-3273; Koshkin et al. 1998 Tetrahedron 54: 3607-3630; Kumar et al. 1998 Bioo .Med. Chem. Let. 8: 2219-2222; Lauritsen et al. 2002 Chem. Comm. 5: 530-531; Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; Mesmaeker et al. Angew. Chem., Int. Ed. Engl. 1994, 33, 226; Morita et al. 2001 Nucl. Acids Res. Suppl 1:241-242; Morita et al. 2002 Bioo. Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem. Lett. 2211-2226; Nielsen et al. 1997 Chem. Soc. Rev. 73; Nielsen et al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Obika et al. 1997 Tetrahedron Lett .38(50): 8735-8; Obika et al. 1998 Tetrahedron Lett. 39: 5401-5404 Pallan et al. 2012 Chem. Comm. 48: 8195-8197, Petersen et al. 2003 TRENDS Biotech. 21: 74-81; Rajwanshi et al. 1999 Chem. Commun. 1395-1396; Schultz et al. 1996 Nucleic Acids Res. 24: 2966 Seth et al. 2009 J. Med. Chem. 52: 10-13; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al. 2010 J. Org. Chem. 75: 1569-1581; Seth Et al 2012 Bioo. Med. Chem. Lett. 22: 296-299; Seth et al. 2012 Mol. Ther-Nuc. Acids. 1, e47; Seth, Punit P; Siwkowski, Andrew; Allerson, Charles R; Vasquez, Guillermo ; Lee, Sam; Prakash, Thazha P; Kinberger, Garth; Migawa, Michael T; Gaus, Hans; Bhat, Balkrishen et al. Nucleic Acids Symposium Series (2008), 52(1), 553-554; Singh et al 1998 Chem .Comm. 1247-1248; Singh et al. 1998 J. Org. Chem. 63: 10035-39; Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Sorensen 2003 Chem. Comm. 2130-2131; Ts 'o et al. Ann. NY Acad. Sci. 1988, 507, 220; Van Aerschot et al. 1995 Angew. Chem Int. Ed. Engl. 34: 1338; Vasseur et al. J. Am. Chem. Soc. 1992, 114, 4006; 20070900071; WO 20070900071 or WO 2016/079181.

Nucleoside : The term "nucleoside" refers to a portion of a nucleobase or modified nucleobase that is covalently bonded to a sugar or modified sugar.

Sugar : The term "sugar" means a monosaccharide in a closed and/or open form. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentamigosaccharide, and heptafurose moieties. The term as used herein also encompasses structural analogs, such as diols, which are used in place of conventional sugar molecules, the polymers of which form the backbone of nucleic acid analogs, diol nucleic acids ("GNA").

Modified Sugar : The term "modified sugar" refers to a portion of a replaceable sugar. The modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical properties of the sugar.

Nucleobase : The term "nucleobase" refers to the portion of a nucleic acid that participates in a hydrogen bond. Hydrogen bonding binds one strand of nucleic acid to another complementary strand in a sequence-specific manner. The most common naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally occurring nucleobase is a modified adenine, guanine, uracil, cytosine or thymine. In some embodiments, the naturally occurring nucleobase is methylated adenine, guanine, uracil, cytosine or thymine. In some embodiments, the nucleobase is a "modified nucleobase", such as adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). Nucleotides other than nucleobases. In some embodiments, the modified nucleobase is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical properties of the nucleobase, and retains hydrogen bonding that binds one nucleic acid to another nucleic acid in a sequence-specific manner. characteristic. In some embodiments, the modified nucleobase can be paired with all five naturally occurring bases (uracil, thymine, adenine, cytosine or guanine) and does not substantially affect the melting properties, by the cell Internal enzyme recognition or activity of oligonucleotide duplexes.

For palm ligands : The term "palphatic ligand" or "palphatic aid" refers to a moiety that has a palmarity and can be incorporated into a reaction such that the reaction can proceed in a stereoselective manner.

Condensation reagent : In the condensation reaction, the term "condensation reagent" refers to an agent that activates a less reactive site and makes it more susceptible to attack by another reagent. In some embodiments, the additional agent is a nucleophile.

Resistor : The term "barrier" refers to a group that masks the reactivity of a functional group. The functional group can then be unmasked by removing the barrier group. In some embodiments, the barrier group is a protecting group.

Part : The term "portion" refers to a specific segment or functional group of a molecule. The chemical moiety is a generally recognized chemical entity that is embedded in or attached to the molecule.

Solid carrier : The term "solid carrier" refers to any carrier that enables the synthesis of a nucleic acid. In some embodiments, the term refers to a glass or polymer that is insoluble in the medium employed in the reaction step performed to synthesize the nucleic acid and is derivatized to include a reactive group. In some embodiments, the solid support is highly crosslinked polystyrene (HCP) or controlled microporous glass (CPG). In some embodiments, the solid support is a controlled microporous glass (CPG). In some embodiments, the solid support is a mixed carrier of controlled microporous glass (CPG) and highly crosslinked polystyrene (HCP).

Linked moiety : The term "linkage moiety" refers to any moiety that is optionally located between a terminal nucleoside and a solid support or between a terminal nucleoside and another nucleoside, nucleotide or nucleic acid.

DNA molecule : "DNA molecule" refers to a polymer form of a deoxyribonucleotide (adenine, guanine, thymine or cytosine) in a single-stranded form or in a double-stranded helix. This term refers only to the primary and secondary structure of the molecule and does not limit it to any particular tertiary form. Thus, the term includes double-stranded DNA that is particularly found in linear DNA molecules (eg, restriction fragments), viruses, plastids, and chromosomes. In discussing the structure of a particular double-stranded DNA molecule, the general convention for providing sequences only in the 5' to 3' direction can be based on non-transcribed strands along the DNA (i.e., strands having sequences homologous to the mRNA). To describe the sequence.

Coding sequence : A DNA "coding sequence" or "coding region" is a double-stranded DNA sequence that is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate expression control sequences. The boundaries of the coding sequence ("Open Reading Framework" or "ORF") are determined by the start codon at the 5' (amino) terminus and the translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, a prokaryotic sequence, a cDNA from eukaryotic mRNA, a genomic DNA sequence from eukaryotic (eg, mammalian) DNA, and a synthetic DNA sequence. The polyadenylation signal and transcription termination sequence are usually located 3' to the coding sequence. The term "non-coding sequence" or "non-coding region" refers to a region of a polynucleotide sequence that is not translated into an amino acid (eg, a 5' and 3' non-translated region).

Reading Framework : The term "reading frame" refers to one of the six possible reading frames (three in each direction) of a double-stranded DNA molecule. The reading frame is used to determine which codons are used to encode the amino acid within the coding sequence of the DNA molecule.

Antisense : An "antisense" nucleic acid molecule as used herein encompasses a nucleoside that is complementary to a "sense" nucleic acid encoding a protein, such as a complementary strand of a double-stranded cDNA molecule, complementary to an mRNA sequence, or complementary to a coding strand of a gene. Acid sequence. Thus, an antisense nucleic acid molecule can be bonded to a sense nucleic acid molecule via hydrogen bonding. In some embodiments, the antisense oligonucleotide is an oligonucleotide involved in ribonuclease H-mediated cleavage; for example, the antisense oligonucleotide hybridizes to a portion of the target mRNA in a sequence-specific manner, Thereby the mRNA is targeted for cleavage by ribonuclease H. In some embodiments, an antisense oligonucleotide is capable of distinguishing between a wild type and a mutant dual gene of interest. In some embodiments, the antisense oligonucleotide is involved in a large amount of ribonuclease H-mediated cleavage of the mutant dual gene, but is involved in much less ribonuclease H-mediated cleavage of the wild-type dual gene (eg, There is no ribonuclease H-mediated cleavage of the wild-type dual gene involved in the target.

Wobble position : As used herein, "rocking position" refers to the third position of a codon. In some embodiments, a mutation within the rocking position of the codon in the DNA molecule results in a resting or conservative mutation in the amino acid level. For example, there are four codons encoding glycine, namely GGU, GGC, GGA and GGG, thus any nucleotide at the rocking position relative to any other nucleotide selected from A, U, C and G None of the mutations caused a change in the amino acid content of the encoded protein and was therefore a silent substitution.

The quiescent substitution : "stationary substitution" or "silent mutation" is a modification of a nucleotide in a codon, but does not cause a change in the amino acid residue encoded by the codon. Examples include codon third position mutations, including first position mutations of certain codons, such as the codon "CGG", which, when mutated to AGG, still encode Arg.

Gene : As used herein, the terms "gene", "recombinant gene" and "gene construct" refer to a portion of a DNA molecule or DNA molecule encoding a protein or a portion thereof. The DNA molecule may contain an open reading frame (eg, an exon sequence) encoding the protein and may further include an intron sequence. The term "intron" as used herein refers to a DNA sequence that is present in a given gene, is not translated into a protein, and, in some but not all cases, between exons. It is contemplated that the gene is operably linked (or may comprise) one or more promoters, enhancers, repressors and/or other regulatory sequences to modulate the activity or expression of the gene, as is well known in the art.

Complementary DNA : As used herein, "complementary DNA" or "cDNA" includes recombinant polynucleotides that are synthesized by reverse transcription of mRNA and in which the insertion sequence (intron) has been removed.

Homology : "homology" or "consistency" or "similarity" refers to sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing the positions in each sequence, and the sequences can be aligned for comparison purposes. When the equivalent positions in the compared sequences are occupied by the same base, then the molecules are identical at the same position; when the equivalent sites are identical or similar nucleic acid residues (eg, stereo and/or electronic properties are similar) When occupied, then the molecules may be referred to as homologous (similar) at that position. A representation such as the percentage of homology/similarity or identity refers to a function of the number of identical or similar nucleic acids at positions shared by the sequences being compared. An "unrelated" or "non-homologous" sequence shares less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with the sequences described herein. In the comparison of two sequences, the lack of residues (amino acids or nucleic acids) or the presence of other residues also reduces homology and homology/similarity.

In some embodiments, the term "homology" describes a mathematically based sequence similarity comparison result for identifying genes having similar functions or motifs. The nucleic acid sequences described herein can be used as a "query sequence" to search a public repository, for example to identify other family members, related sequences or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10. In some embodiments, the BLAST nucleotide search can be performed using the NBLAST program, score = 100, wordlength = 12 to obtain a nucleotide sequence homologous to the nucleic acid molecule of the invention. In some embodiments, for comparison purposes, to obtain gap alignment, gap BLAST can be employed as described in Altschul et al, (1997) Nucleic Acids Res. 25(17): 3389-3402. Preset parameters for individual programs (eg, XBLAST and BLAST) can be used when using BLAST and Gapped BLAST programs (see Www.ncbi.nlm.nih.gov).

Consistency : As used herein, "consistency" means the same nucleotide residue at the corresponding position in the sequence when two or more sequences are aligned to achieve maximum sequence matching, ie, gaps and insertions are considered. Percentage. Consistency is readily calculated by known methods including, but not limited to, the methods described in: Computational Molecular Biology, Lesk, AM, Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, ed., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., M. Stockton Press, New York, 1991; and Carillo, H. and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). A method for determining consistency is designed to achieve the largest match between the sequences tested. In addition, the method for determining consistency is coded using a publicly available computer program. Computer program methods for determining consistency between two sequences include, but are not limited to, GCG packages (Devereux, J. et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, SF et al, J. Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids Res. 25: 3389-3402 (1997)). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al., J. Mol. Biol. 215: 403-410 ( 1990)). The well-known Smith Waterman algorithm can also be used to determine consistency.

Heterologous : The "heterologous" region of a DNA sequence is an identifiable DNA segment within a larger DNA sequence that is not found in nature to be associated with that larger sequence. Thus, when a heterologous region encodes a mammalian gene, the gene can typically be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a sequence in which the coding sequence itself is not found in nature (e.g., cDNA, wherein the genomic coding sequence contains an intron or a synthetic sequence having a codon or motif different from the unmodified gene). A dual gene variant or naturally occurring mutation event does not result in a heterologous region of DNA as defined herein.

Translocation mutation (Transition mutation): The term "translocation mutations" means changes in the nucleotide sequence of DNA, wherein the pyrimidine (cytidine (C) or thymidine (T)) via another substituted pyrimidine, or purine (adenosine (A) or guanosine (G) is replaced by another hydrazine.

Transversion mutation : The term "transversion mutation" refers to a base change in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T)) is passed through adenine (A) or guanosine. (G)) replacement, or pyrimidine replacement.

Oligonucleotide : The term "oligonucleotide" refers to a polymer or oligomer of a nucleomonomer that contains a nucleobase, a modified nucleobase, a sugar, a modified sugar, a phosphate bridge. Or any combination of modified phosphorus atom bridges (also referred to herein as "internucleotide linkages", otherwise defined herein).

Oligonucleotides can be single or double stranded. The term "oligonucleotide strand" as used herein encompasses a single strand of oligonucleotide. A single-stranded oligonucleotide can have a double-stranded region and a double-stranded oligonucleotide can have a single-stranded region. Exemplary oligonucleotides include, but are not limited to, structural genes, genes including control and termination regions, self-replicating systems (such as viral or plastid DNA), single-stranded and double-stranded siRNA, and other RNA interference agents (RNAi agents or iRNA agent), shRNA, antisense oligonucleotide, ribozyme, microRNA, microRNA mimic, super miR (supermir), aptamer, anti-miR (antimir), antagonistic miR (antagomir), Ul-attached protein, A triplicate-forming oligonucleotide, a G-quadruplex, an RNA activator, an immunostimulatory oligonucleotide, and a decoy oligonucleotide are formed.

Double-stranded and single-stranded oligonucleotides that are effective in inducing RNA interference are also referred to herein as siRNA, RNAi agents or iRNA agents. In some embodiments, such RNA interference inducible Oligonucleotides bind to a cytoplasmic multiprotein complex called the RNAi-induced silencing complex (RISC). In various embodiments, the single and double stranded RNAi agents are sufficiently long that they can be cleaved by an endogenous molecule, such as by Dicer cleavage, to produce smaller oligonucleotides that can enter RISC The system is involved in RISC-mediated cleavage of a target sequence, such as a target mRNA.

Oligonucleotides of the invention can be of various lengths. In particular embodiments, the length of the oligonucleotide can range from about 2 to about 200 nucleotides. In various related embodiments, the length of the single, double and triple oligonucleotides can be in the range of from about 4 to about 10 nucleotides, from about 10 to about 50 nucleotides, from about 20 to about 50 nucleotides, from about 15 to about 30 nucleotides, from about 20 to about 30 nucleotides. In some embodiments, the oligonucleotide is from about 9 to about 39 nucleotides in length. In some embodiments, the oligonucleotide is at least 4 nucleotides in length. In some embodiments, the oligonucleotide is at least 5 nucleotides in length. In some embodiments, the oligonucleotide is at least 6 nucleotides in length. In some embodiments, the oligonucleotide is at least 7 nucleotides in length. In some embodiments, the oligonucleotide is at least 8 nucleotides in length. In some embodiments, the oligonucleotide is at least 9 nucleotides in length. In some embodiments, the oligonucleotide is at least 10 nucleotides in length. In some embodiments, the oligonucleotide is at least 11 nucleotides in length. In some embodiments, the oligonucleotide is at least 12 nucleotides in length. In some embodiments, the oligonucleotide is at least 15 nucleotides in length. In some embodiments, the oligonucleotide is at least 20 nucleotides in length. In some embodiments, the oligonucleotide is at least 25 nucleotides in length. In some embodiments, the oligonucleotide is at least 30 nucleotides in length. In some embodiments, the oligonucleotide is a double helix of complementary strands of at least 18 nucleotides in length. In some embodiments, the oligonucleotide is a double helix of complementary strands of at least 21 nucleotides in length.

Internucleotide linkage : As used herein, the phrase "internucleotide linkage" generally refers to a phosphorus-containing linkage between nucleotide units of an oligonucleotide, and can be used as described above and herein. "Inter-sugar linkage" and "phosphorus bridge" are interchangeable. In some embodiments, the internucleotide linkages are phosphodiester linkages, such as are present in naturally occurring DNA and RNA molecules. In some embodiments, the internucleotide linkage is a "modified internucleotide linkage" in which each oxygen atom to which the phosphodiester linkage is attached is optionally replaced by an organic or inorganic moiety. In some embodiments, such organic or inorganic moieties are selected from, but are not limited to, =S, =Se, =NR', -SR', -SeR', -N(R') ₂ , B(R' ₃ , -S-, -Se-, and -N(R')-, wherein each R' is independently defined and described below. In some embodiments, the internucleotide linkage is a phosphotriester linkage, a phosphorothioate diester linkage ( Or modified phosphorothioate linkages. One of ordinary skill will appreciate that because of the presence of an acid or base moiety in the internucleotide linkage, the linkage can exist in an anionic or cationic form at a given pH.

Unless otherwise specified, when used with an oligonucleotide sequence, s, s1, s2, s3, s4, s5, s6, and s7 each independently represent the following modified internucleotide linkages, as shown in Table 1 below. Shown in .

For example, ( R p, S p)-ATsCs1GA has 1) a phosphorothioate internucleotide linkage between T and C ( ); and 2) between C and G The structure of the phosphorothioate triester is internucleotide linked. Unless otherwise specified, the foregoing oligonucleotide sequence R p / S p from the name of the oligonucleotide sequence 5 'to 3' nucleotide linkage between the sequence described in the configuration of the chiral phosphorus atoms linking. For example, in the (R p, S p) -ATsCs1GA in between "s" linkage between T and C in the R p configuration and having a phosphorus between "s1" bond between C and G Phosphorus in Lianzhong has a S p configuration. In some embodiments, "Full (R p)" or "full (S p)" are used to represent the oligonucleotide are all having the same configuration R p or S p chiral phosphorus atom linking. For example, all ( R p)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC indicates that all pairs of palm-bonded phosphorus atoms in the oligonucleotide have an R p configuration; all ( S p)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC represent all pairs of oligonucleotides The sexually bonded phosphorus atoms all have a Sp configuration.

Oligonucleotide type : As used herein, the phrase "oligonucleotide type" is used to define a pattern having a specific base sequence and a backbone linkage mode (i.e., a mode of internucleotide linkage type, such as a phosphate ester). , phosphorothioate, etc.), main chain-to-palm central mode (ie, linked phosphorus stereochemical mode ( R p/ S p)) and backbone phosphorus modification mode (eg, "-XLR ^{1 in} formula I " Oligonucleotides of the pattern of the group. Oligonucleotides having a commonly named "type" are structurally identical to each other.

Those skilled in the art will appreciate that the synthetic methods of the present invention provide some degree of control during the synthesis of oligonucleotide strands such that each nucleotide unit of the oligonucleotide strand can be designed and/or selected in advance to The phosphorous has specific stereochemistry and/or specific modifications at the linked phosphorus and/or specific bases and/or specific sugars. In some embodiments, advance design and / Alternatively, the oligonucleotide strands are selected to have a specific stereocenter combination at the linked phosphorus. In some embodiments, the oligonucleotide strands are designed and/or determined to have a particular combination of modifications at the linkage phosphorus. In some embodiments, the oligonucleotide strands are designed and/or selected to have a particular base combination. In some embodiments, the oligonucleotide strands are designed and/or selected to have a particular combination of one or more of the above structural features. The invention provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., a palm-controlled oligonucleotide composition). In some embodiments, all of the molecules are of the same type (ie, are structurally identical to each other). However, in various embodiments, the provided compositions comprise a plurality of different types of oligonucleotides, typically differing in a predetermined relative amount.

Palm Control : As used herein, "control of palmity" refers to the ability to control the stereochemical name of each of the oligonucleotide strands in the palm of the hand. The phrase "pivoted controlled oligonucleotide" refers to an oligonucleotide that exists in a single diastereoisomeric form for a palm-bonded phosphorus. The palm-controlled oligonucleotides were prepared by synthesis of a palm-controlled oligonucleotide.

Palm-controlled oligonucleotide composition : As used herein, the phrase "pivoted controlled oligonucleotide composition" refers to an oligonucleotide composition containing a predetermined amount of individual oligonucleotide types. . For example, in some embodiments, the palm-controlled oligonucleotide composition comprises an oligonucleotide type. In some embodiments, the palm-controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, the palm-controlled oligonucleotide composition comprises a mixture of a plurality of oligonucleotide types. Exemplary palmate controlled oligonucleotide compositions are additionally described in the text.

For palm pure : as used herein, the phrase "pure pure" is used to describe a palm-controlled oligonucleotide that is present in a single diastereomeric form for all linked oligonucleotides. combination.

Uniformity to palm : The phrase "uniformity of palmity" as used herein is used to describe an oligonucleotide molecule or type in which all nucleotide units have the same stereochemistry at the linked phosphorus. For example, an oligonucleotide having the nucleotide units are p R stereochemistry at phosphorus in linkage to a chiral homogeneous. Similarly, oligonucleotides in which the nucleotide unit has a s stereochemistry at the linked phosphorus are homogenous to the palm.

Schedule : A reservation means a cautious choice, such as contrary to random occurrence or achievement. Upon reading this specification, one of ordinary skill in the art will appreciate that the present invention provides novel and unexpected techniques that allow for the selection of a particular oligonucleotide type to prepare and/or include the provided compositions, and further The compositions provided are allowed to be prepared by controlling the preparation of a particular type that is accurately selected, optionally prepared in a particular relative amount selected. The compositions provided are "scheduled" as described herein. Because of the inability to control the process of deliberately producing a particular oligonucleotide type resulting in the accidental production of certain individual oligonucleotide types, compositions that may contain such oligonucleotide types are not "predetermined" compositions. In some embodiments, the predetermined composition is a composition that can be intentionally remanufactured (eg, via a repetitive control process).

Bonded Phosphorus : The phrase "bonded phosphorus" as defined herein is used to indicate that the particular phosphorus atom referred to is a phosphorus atom present in an internucleotide linkage that corresponds to an internucleotide The phosphorus atom of the linked phosphodiester, such as occurs in naturally occurring DNA and RNA. In some embodiments, the bonded phosphorus atom is in a modified internucleotide linkage, wherein each oxygen atom to which the phosphodiester is linked is optionally replaced by an organic or inorganic moiety. In some embodiments, the bonded phosphorus atom is P* of Formula I. In some embodiments, the bonded phosphorus atom has a palmarity. In some embodiments, the palm-bonded phosphorus atom is P* of Formula I.

P Modification : The term "P modification" as used herein refers to any modification other than a stereochemical modification at a linked phosphorus. In some embodiments, the P modification comprises the addition, substitution or removal of a pendant moiety covalently attached to the linked phosphorus. In some embodiments, the "P modification" is -XLR ¹ , wherein X, L, and R ¹ are each independently as defined and described herein and below.

Blockmer : As used herein, the term "block" refers to an oligonucleotide strand that characterizes the structural pattern of individual nucleotide units characterized by the presence of at least two nucleosides. The inter-acid phosphorus linkages share contiguous nucleotide units of common structural features. The common structural feature means a common stereochemistry at the bond phosphorus or a co-modification at the bond phosphorus. In some embodiments, at least two contiguous nucleotide units that share a common structural feature at the internucleotide phosphorus linkage are referred to as "blocks."

In some embodiments, the block is a "stereoblockmer", such as at least two contiguous nucleotide units having the same stereochemistry at the bonded phosphorus. The at least two consecutive nucleotide units form a "stereoblock". For example, ( S p, S p)-ATsCs1GA is a stereoblock because at least two consecutive nucleotide units Ts and Cs1 have the same stereochemistry at the bonded phosphorus (both Sp ). In the same oligonucleotide ( S p, S p)-ATsCs1GA, TsCs1 forms a block and it is a stereoblock.

In some embodiments, the block is a "P-modified block", such as at least two contiguous nucleotide units having the same modification at the bonded phosphorus. The at least two consecutive nucleotide units form a "P-modified block". For example, ( R p, S p)-ATsCsGA is a P-modified block because at least two consecutive nucleotide units Ts and Cs have the same P modification (ie, both are phosphorothioate diesters). In the same oligonucleotide ( R p, S p)-ATsCsGA, TsCs form a block and it is a P-modified block.

In some embodiments, the block is a "bonded block", such as at least two contiguous nucleotide units having the same stereochemistry and the same modification at the bonded phosphorus. At least two consecutive nucleotide units form a "linkage block". For example, ( R p, R p)-ATsCsGA is a bonded block because at least two consecutive nucleotide units Ts and Cs have the same stereochemistry (both R p) and P modification (both thio Phosphate). In the same oligonucleotide ( R p, R p)-ATsCsGA, TsCs form a block and it is a bonded block.

In some embodiments, the block comprises one or more blocks independently selected from the group consisting of a stereoblock, a P-modified block, and a bonded block. In some embodiments, the block is a steric block for one block, and/or a P-modified block for the other block, and/or a bond for yet another block. Joint block. For example, ( R p, R p, R p, R p, R p, S p, S p, S p)-AAsTsCsGsAs1Ts1Cs1Gs1ATCG is the stereoblock AsTsCsGsAs1 ( R p at the bond phosphorus) or Ts1Cs1Gs1 ( In the case of the bonded phosphorus, it is a steric block for S p), and a P-modified block for the P-modified block AsTsCsGs (both s-bonded) or As1Ts1Cs1Gs1 (both s1-bonded), or linkage to block AsTsCsGs (in the linkage are both phosphorus and R p are both bonded s) or Ts1Cs1Gs1 (in the phosphorus linkages are both s1 and s p are both bonded) For linkage to a block body.

Alter : The term "alternate" as used herein refers to an oligonucleotide strand that characterizes the structural pattern of individual nucleotide units in that it is not present in the oligonucleotide strand. Two contiguous nucleotide units share specific structural features at the internucleotide phosphorus linkage. In some embodiments, the alternations are designed such that they contain a repeating pattern. In some embodiments, the alternations are designed such that they do not contain a repeating pattern.

In some embodiments, the alternating body is a "stereoaltmer", for example, no two consecutive nucleotide units have the same stereochemistry at the bonded phosphorus. For example ( R p, S p, R p, S p, R p, S p, R p, S p, R p, S p R p, S p, R p, S p, R p, S p, R p, S p, R p)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC.

In some embodiments, the alternating bodies are "P-modified alternations", for example, no two consecutive nucleotide units have the same modification at the bonded phosphorus. For example, all ( S p )-CAs1GsT in which the P modifications of the respective linked phosphorus are different from each other.

In some embodiments, the alternating bodies are "bonding alternations", for example, no two consecutive nucleotide units have the same stereochemistry or the same modification at the bonded phosphorus. For example ( R p, S p, R p, S p, R p, S p, R p, S p, R p, S p R p, S p, R p, S p, R p, S p, R p, S p, R p)-GsCs1CsTs1CsAs1GsTs1CsTs1GsCs1TsTs2CsGs3CsAs4CsC.

Unimer : As used herein, the term "monomer" refers to an oligonucleotide strand that characterizes the structural characteristics of individual nucleotide units such that all nucleotide units within the strand At least one common structural feature is shared at the internucleotide phosphorus linkage. The common structural feature means a common stereochemistry at the bond phosphorus or a co-modification at the bond phosphorus.

In some embodiments, the monomer is a "stereounimer," for example, all nucleotide units have the same stereochemistry at the bonded phosphorus. For example, all ( S p)-CsAs1GsT, in which all linkages have S p phosphorous.

In some embodiments, the monomer is a "P-modified monomer", for example, all nucleotide units have the same modification at the linkage phosphorus. For example ( R p, S p, R p, S p, R p, S p, R p, S p, R p, S p R p, S p, R p, S p, R p, S p, R p, S p, R p)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC, wherein all internucleotide linkages are phosphorothioate diesters.

In some embodiments, the monomer is a "bonded monomer", for example, all nucleotide units have the same stereochemistry and the same modification at the bonded phosphorus. For example, all ( S p)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC, in which all internucleotide linkages are phosphorothioate diesters with S p-linked phosphorus.

Gapmer : The term "spacer" as used herein refers to an oligonucleotide strand characterized by a phosphoric acid linkage between at least one nucleotide of the oligonucleotide strand. Such as phosphodiester linkages present in naturally occurring DNA or RNA. In some embodiments, more than one internucleotide phosphorus linkage in an oligonucleotide strand is a phosphodiester linkage, such as a phosphodiester linkage present in naturally occurring DNA or RNA. For example, all ( S p)-CAs1GsT, wherein the internucleotide linkage between C and A is a phosphodiester linkage.

Skipmer : The term "skip" as used herein refers to a type of spacer in which every other nucleotide in the oligonucleotide strand is phosphorylated to a phosphodiester linkage, such as The phosphodiesters present in the naturally occurring DNA or RNA are linked, and every other nucleotide in the oligonucleotide strand is phosphorylated to a modified internucleotide linkage. Such as full (S p) -AsTCs1GAs2TCs3G.

For the purposes of the present invention, chemical elements are identified on the inside cover according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics , 67th edition, 1986-87.

The methods and structures described herein with respect to the compounds and compositions of the present invention are also applicable to medical treatment Pharmaceutically acceptable acid or base addition salts and all stereoisomeric forms of such compounds and compositions.

Figure 1. Reverse phase HPLC after incubation with rat liver tissue homogenate. The total amount of oligonucleotide remaining on different days when incubated with rat whole liver tissue homogenate at 37 ° C was measured. It was found that the in vitro metabolic stability of ONT-154 is similar to that of ONT-87, which has a 2'-MOE wing, while the stability of ONT-154 and ONT-87 is more stable than the stereoregular 2'-MOE spacer (ONT- 41, Mipomersen) is much better. The amount of remaining full length oligomer was measured by reverse phase HPLC, wherein the peak area of the peak of interest was normalized with an internal standard.

Figure 2. Degradation of various palmitic pure analogs of imipenem (ONT-41) in rat whole liver homogenate. The total amount of oligonucleotide remaining on different days when incubated with rat whole liver tissue homogenate at 37 ° C was measured. Found that human ApoB sequence ONT-41 (US Health poise m) of non-pure chiral vitro metabolic stability of the enantiomers with increasing S p linkage between nucleotides increases. The amount of remaining full length oligomer was measured by reverse phase HPLC, wherein the peak area of the peak of interest was normalized with an internal standard. The compositions used included: ONT-41, ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, and ONT-89.

Figure 3. Degradation of various palm pure analogs of mouse ApoB sequence (ISIS 147764, ONT-83) in rat whole liver homogenate. The total amount of oligonucleotide remaining on different days when incubated with rat whole liver tissue homogenate at 37 ° C was measured. The in vitro metabolic stability of the murine pure diastereomers of the murine ApoB sequence (ONT-83, 2'-MOE spacer, stereotactic phosphorothioate) was found along with the S p nucleotide The bond is increased and increased. The amount of remaining full length oligomer was measured by reverse phase HPLC, wherein the peak area of the peak of interest was normalized with an internal standard. Compositions used include: ONT-82 to ONT-86.

Figure 4. Degradation of the ferrocene analog ONT-75 in rat whole liver tissue homogenate over a 24 hour period. This figure shows the stability of ONT-75 in rat whole liver homogenate.

Figure 5 Degradation of the imipenem analog ONT-81 in rat whole liver tissue homogenate over a 24 hour period. This figure shows the stability of ONT-81 in rat whole liver homogenate.

Figure 6. Duration of blocking gene expression in ONT-87, ONT-88, and ONT-89. Stereoisomers can exhibit a substantially different duration of blocking gene expression. The inhibition caused by ONT-87 is substantially longer than other stereoisomers. An increase in the duration of the effect of ONT-87 was observed in multiple in vivo studies. In some in vivo studies, ONT-88 showed similar efficacy and recovery profiles as ONT-41 (Mipomeisheng). Hu ApoB transgenic mice (n=4) were given a 10 mpk IP bolus, 2 x/week for three weeks. Mice were randomized into study groups and based on individual mouse body weights measured prior to dosing on each dosing day, on Day 1, Day 4, Day 8, Day 11, Day 15, 18 On day 22 and day 22, 10 mg/kg was administered intraperitoneally (IP). On day 0, day 17, day 24, day 31, day 38, day 45, and day 52, blood was collected by submandibular (cheek) bleeding and sacrificed by cardiac puncture on day 52, And then processed into serum. ApoB was measured by ELISA. Emphasis was placed on maintaining 72% versus 35% blocking gene performance 3 weeks after dosing.

FIG 7 show measured in human serum having a plurality of R p, HPLC curve difference metabolic stability of duplexes siRNA S p or a random perspective view of a phosphorothioate linkage. Compositions used include: ONT-114, ONT-116, ONT-109, ONT-107, ONT-108, and ONT-106.

Figure 8. Effect of stereochemistry on ribonuclease H activity. The oligonucleotide was hybridized to RNA and subsequently incubated with ribonuclease H at 37 ° C in the presence of 1 x RNase H buffer. From top to bottom, at 120 minutes: ONT-89, ONT-77, ONT-81, ONT-80, ONT-75, ONT-41, ONT-88, ONT-154, ONT-87, among which ONT-77/ 154 are very close to each other.

Figure 9. Analysis of human ribonuclease Hl cleavage of 20-mer RNA when hybridized to different formulations of stereoisomers of phosphorothioate oligonucleotides that target the same region of human ApoB mRNA. Specific cleavage sites are strongly influenced by different stereochemistry. The arrow indicates the location of the cleavage (cleavage site). The product was analyzed by UPLC/MS. The length of the arrow indicates the amount of product present in the reaction mixture as determined by the ratio of the UV peak area of the fragment to the theoretical extinction coefficient (the larger the arrow, the more cleavage products are detected). (A): Legend of the cleavage map. (B) and (C): A cleavage map of the oligonucleotide. In the figures: (┬) indicates the identification of two ribonuclease H1 cleavage fragments (5'-phosphate material and 5'-OH 3'-OH species) in the reaction mixture. (┌) indicates that only the 5'-phosphate material was detected and (┐) indicates that the 5'-OH 3'-OH component was detected in mass spectrometry. The compositions used included: ONT-41, ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, ONT-88, and ONT-154.

Figure 10. Cleavage map of different oligonucleotide compositions ((A)-(C)). These three sequences target different regions of the FOXO1 mRNA. Each sequence was studied in five different chemical methods. The cleavage profile was derived from the reaction mixture obtained after incubation of each individual duplex with RNase H1C in the presence of 1 x PBS buffer for 30 minutes at 37 °C. Arrows indicate cleavage sites. The length of the arrow indicates the amount of product present in the reaction mixture as determined by the ratio of the UV peak area of the fragment to the theoretical extinction coefficient (the larger the arrow, the more cleavage products are detectable). The 5'-OH 3 '-OH was used to quantify only the 5'-OH 3 '-OH in the reaction mixture. The rate of cleavage is determined by measuring the amount of full length RNA remaining in the reaction mixture by reverse phase HPLC. The reaction was quenched by 30 mM Na ₂ EDTA at a fixed time point. Compositions used include: ONT-316, ONT-355, ONT-361, ONT-367, ONT-373, ONT-302, ONT-352, ONT-358, ONT-364, ONT-370, ONT-315, ONT -354, ONT-360, ONT-366 and ONT-372.

Figure 11. Cleavage map of oligonucleotide compositions having different common base sequences and lengths ((A)-(B)). These maps show a comparison of stereotactic random DNA compositions (top panel) with three different stereochemically pure oligonucleotide compositions. Comparison of data from a palm-controlled oligonucleotide composition to two stereospecific random phosphorothioate oligonucleotide compositions (ONT-366 and ONT-367) that target different regions of FOXO1 mRNA. Each figure shows a comparison of stereoregular DNA (top panel) with three different stereochemically pure oligonucleotide preparations. The cleavage profile was derived from the reaction mixture obtained after incubation of each individual duplex with RNase H1C in the presence of 1 x PBS buffer for 30 minutes at 37 °C. Arrows indicate cleavage sites. The length of the arrow indicates the amount of metabolite present in the reaction mixture as determined by the ratio of the UV peak area of the fragment to the theoretical extinction coefficient (the larger the arrow, the more cleavage products are detectable). The 5'-OH 3 '-OH was used to quantify only the 5'-OH 3 '-OH in the reaction mixture. The compositions used included: ONT-366, ONT-389, ONT-390, ONT-391, ONT-367, ONT-392, ONT-393, and ONT-394.

Figure 12. Effect of stereochemistry on ribonuclease H activity. In two independent experiments, antisense oligonucleotides targeting the same region of FOXO1 mRNA were hybridized to RNA and subsequently incubated with ribonuclease H at 37 ° C in the presence of 1 x RNase H buffer. . The disappearance of the peak area of the full-length RNA was measured using RP-HPLC at 254 nm. (A): From top to bottom, at 60 min: ONT-355, ONT-316, ONT-367, ONT-392, ONT-393 and ONT-394 (ONT-393 and ONT-394 are approximately the same at 60 min; At 5 min, the remaining RNA of ONT-393 was higher in mass. (B): From top to bottom, at 60 min: ONT-315, ONT-354, ONT-366, ONT-391, ONT-389, and ONT-390. The rate of cleavage is determined by measuring the amount of full length RNA remaining in the reaction mixture by reverse phase HPLC. The reaction was quenched by 30 mM Na ₂ EDTA at a fixed time point.

Figure 13. Conversion of antisense oligonucleotides. A double helix was produced in which each DNA strand concentration was equal to 6 μM and RNA was 100 μM. These double helices were incubated with 0.02 μM ribonuclease H enzyme and their disappearance was measured according to the peak area of the full-length RNA at 254 nm using RP-HPLC. The rate of cleavage is determined by measuring the amount of full length RNA remaining in the reaction mixture by reverse phase HPLC. The reaction was quenched by 30 mM Na ₂ EDTA at a fixed time point. Top down, at 40 min: ONT-316, ONT-367 and ONT-392.

Figure 14 compares the cleavage map of stereotactic random phosphorothioate oligonucleotides with six different stereochemically pure oligonucleotide preparations that target the same FOXO1 mRNA region. The compositions used included: ONT-367, ONT-392, ONT-393, ONT-394, ONT-400, ONT-401, and ONT-406.

Figure 15. Effect of stereochemistry on ribonuclease H activity. The antisense oligonucleotide was hybridized to RNA and subsequently incubated with ribonuclease H at 37 ° C in the presence of 1 x RNase H buffer. The dependence of stereochemistry on ribonuclease H activity was observed. It is also apparent that the chemical chemistry of the composition is strongly dependent on the activity of ribonuclease H when comparing ONT-367 (stereospecific DNA) with ONT-316 (5-10-5 2'-MOE spacer). Top down, at 40 min: ONT-316, ONT-421, ONT-367, ONT-392, ONT-394, ONT-415 and ONT-422 (ONT-394/415/422 has similar content at 40 min At 5 min, in terms of the % RNA remaining in the DNA/RNA duplex, ONT-422>ONT-394>ONT-415).

Figure 16. Effect of stereochemistry on ribonuclease H activity. Antisense oligonucleotides targeting the same region of FOXO1 mRNA were hybridized to RNA and subsequently incubated with ribonuclease H at 37 ° C in the presence of 1 x RNase H buffer. The dependence of stereochemistry on ribonuclease H activity was observed. From top to bottom, at 40 min: ONT-396, ONT-409, ONT-414, ONT-408 (ONT-396/409/414/408 has similar content at 40 min), ONT-404, ONT-410, ONT-402 (ONT-404/410/408 has similar content at 40min), ONT-403, ONT-407, ONT-405, ONT-401, ONT-406 and ONT-400 (ONT-401/405/406 /400 has a similar content at 40 min).

Figure 17. Effect of stereochemistry on ribonuclease H activity. Antisense oligonucleotides targeting the same region of FOXO1 mRNA were hybridized to RNA and subsequently incubated with ribonuclease H at 37 ° C in the presence of 1 x RNase H buffer. The dependence of stereochemistry on ribonuclease H activity was observed. It was observed that ONT-406 caused a double-helical RNA cleavage rate slightly higher than the phosphodiester oligonucleotide ONT-415. From top to bottom, at 40 min: ONT-396, ONT-421, ONT-392, ONT-394, ONT-415, ONT-406 and ONT-422 (ONT-394/415/406 have similar contents at 40 min) At 5 min, in terms of the % RNA remaining in the DNA/RNA duplex, ONT-394>ONT-415>ONT-406).

Figure 18. When RNA (ONT-388) and stereotactic random DNA (ONT-367) double helix (top panel) and when stereoscopic pure DNA and repeating triplet motif-3'-SSR-5' (ONT- 394) An exemplary UV chromatogram of the RNA cleavage product obtained in the double helix (bottom panel). 2.35min: 7mer; 3.16min: 8mer and p-6mer; 4.48min: P-7mer; 5.83min: P-8mer; 6.88min: 12mer; 9.32min: 13mer; 10.13min: P-11mer; 11.0min: P- 12mer and 14mer; 11.93min: P-13mer; 13.13min: P-14mer. ONT-394 (bottom panel) peak distribution: 4.55 min: p-7mer; 4.97 min: 10 mer; 9.53 min: 13 mer.

Figure 19. Electrospray ionization spectra of RNA cleavage products. When the double helix is ONT-387(RNA)/ONT-354(7-6-7,DNA-2'-OMe-DNA) (top) and ONT-387(RNA)/ONT-315(5-10-5 , 2'-MOE spacer) (bottom panel) RNA fragment obtained from these double helices when incubated with ribonuclease H in the presence of 1 x RNse H buffer for 30 minutes.

Figure 20. UV chromatogram and TIC of ONT-406 and ONT-388 duplexes incubated with ribonuclease H for 30 minutes.

Figure 21. Exemplary proposed lysis. The provided palm-controlled oligonucleotide composition is capable of cleavage of the target as described.

Figure 22. Exemplary dual gene-specific cleavage of targeted mutant Huntington mRNA. (A) and (B): Exemplary oligonucleotides. (C)-(E): Cleavage map. (F)-(H): RNA cleavage. Stereotactic random and palm-controlled oligonucleotide compositions were prepared to target single nucleotide polymorphism for dual gene selective inhibition of mutant Huntington. ONT-450 (stereoregular) targets ONT-453 (muHTT) and ONT-454 (wtHTT), showing minimal differences in RNA cleavage and its cleavage profile. The 3'-SSR-5' motif is selectively placed in the ribonuclease H recognition site for the palm-controlled ONT-451 targeting ONT-453 (muHTT) and ONT-454 (wtHTT) at the RNA cleavage rate Aspects show a big difference. Based on the cleavage map, it is worth noting that the 3'-SSR-5' motif is placed to direct cleavage between positions 8 and 9, which is followed by a mismatch if read from the 5' end of the RNA. The 3'-SSR-5' motif is selectively placed in the ribonuclease H recognition site. ONT-452 targets ONT-453 (muHTT) and ONT-454 (wtHTT), showing a moderate difference in RNA cleavage rate. . The 3'-SSR-5' motif was placed to direct cleavage at positions 7 and 8, and if read from the 5' end of the RNA, it was before the mismatch. Exemplary data demonstrate the importance of the placement of the 3'-SSR-5' motif for enhanced differentiation of dual gene-specific cleavage. All cleavage profiles were derived from reaction mixtures obtained after incubation of each individual duplex with RNase H1C in the presence of 1 x PBS buffer for 5 minutes at 37 °C. Arrows indicate cleavage sites. The length of the arrow indicates the amount of metabolite present in the reaction mixture as determined by the ratio of the UV peak area of the fragment to the theoretical extinction coefficient. The 5'-OH 3 '-OH was used to quantify only the 5'-OH 3 '-OH in the reaction mixture. Compositions used include: ONT-450 to ONT-454.

Figure 23. (A)-(C): Exemplary dual gene-specific cleavage targeting FOXO1 mRNA.

Figure 24. ApoB mRNA was silenced in vitro after treatment with ApoB oligonucleotide. The stereochemically pure diastereomers with and without the 2'-MOE wing showed similar efficacy to ONT-41 (Mipomeisheng). Compositions used include: ONT-87, ONT-41, and ONT-154.

25. FIG dimensional random composition (ONT-367) with a chiral controlled oligonucleotide compositions (ONT-421, S p and the whole ONT-455, whole R p) and DNA (ONT-415) of Comparison of ribonuclease H cleavage map (A) and RNA cleavage rate (B). These sequences target the same region in FOXO1 mRNA. The cleavage profile was derived from the reaction mixture obtained after incubation of each individual duplex with RNase H1C in the presence of 1 x PBS buffer for 5 minutes at 37 °C. Arrows indicate cleavage sites. The length of the arrow indicates the amount of metabolite present in the reaction mixture as determined by the ratio of the UV peak area of the fragment to the theoretical extinction coefficient. The 5'-OH 3 '-OH was used to quantify only the 5'-OH 3 '-OH in the reaction mixture. The rate of cleavage is determined by measuring the amount of full length RNA remaining in the reaction mixture by reverse phase HPLC. The reaction was quenched by 30 mM Na ₂ EDTA at a fixed time point.

Figure 26. Comparison comprising a self-position and R p 3 'end of the DNA cleavage pattern of change of the sequence. Compositions used include: ONT-396 to ONT-414. These sequences target the same region in FOXO1 mRNA. The cleavage profile was derived from a reaction mixture obtained after incubation of each individual duplex with RNase H1C in the presence of 1 x RNase H buffer for 5 minutes at 37 °C. Arrows indicate cleavage sites. The length of the arrow indicates the amount of metabolite present in the reaction mixture as determined by the ratio of the UV peak area of the fragment to the theoretical extinction coefficient. The 5'-OH 3 '-OH was used to quantify only the 5'-OH 3 '-OH in the reaction mixture.

Figure 27. Comparison of ribonuclease H cleavage rates of (A) stereoscopic pure oligonucleotides (ONT-406), (ONT-401), (ONT-404) and (ONT-408). All four sequences are stereoscopic pure phosphorothioates containing one R p linkage. These sequences target the same region in FOXO1 mRNA. All B. diploids were incubated with ribonuclease H1C in the presence of 1 x RNase H buffer at 37 °C. The reaction was quenched by 30 mM Na ₂ EDTA at a fixed time point. The rate of cleavage is determined by measuring the amount of full length RNA remaining in the reaction mixture by reverse phase HPLC. ONT-406 and ONT-401 were found to have a higher rate of cleavage. (B) Correlation between % cleavage of RNA in ribonuclease H assay (10 μM oligonucleotide) and % inhibition of gene expression in in vitro assays (20 nM oligonucleotide). All sequences are targeted to the same region of the mRNA in the FOXO1 target. When normalizing to DNA in the same reaction mixture, the amount of remaining RNA is determined by the UV peak area of the RNA. The above spectra were derived from the reaction mixture obtained after incubation of each individual double helix with ribonuclease H1C in the presence of 1 x PBS buffer for 5 minutes at 37 °C. All sequences from ONT-396 to ONT-414 have one R p phosphorothioate and their R p positions are different. The ONT-421 (full Sp ) phosphorothioate was inactivated in an in vitro assay. It is associated with poor cleavage rate of RNA when ONT-421 and complementary RNA duplexes are in the ribonuclease H assay.

Figure 28. Single R p walking PS DNA (ONT-396-ONT-414), stereotactic random PS DNA (ONT-367), full Sp DNA (ONT-421), and total R p PS DNA (ONT- 455) Serum stability analysis in rat serum for 2 days. It should be noted that ONT-396 and ONT-455 are decomposed at the time points tested. Compositions used include: ONT-396 to ONT-414, ONT-367, ONT-421, and ONT-455.

Figure 29. Exemplary oligonucleotides include hemimers. (A): Cleavage map. (B): RNA cleavage analysis. (C): FOXO1 mRNA blocks gene expression. Use ONT-440, ONT-441 and ONT-367. In some embodiments, introducing a 2' modification at the 5' end of the sequence increases the stability of binding to the target RNA while maintaining ribonuclease H activity. ONT-367 (stereotactic phosphorothioate DNA) and ONT-440 (5-15, 2'-F-DNA) have similar cleavage profiles and similar RNA in ribonuclease H assay (10 μM oligonucleotide) Rate of lysis. In some embodiments, the ONT-440 (5-11, 2'-F-DNA) sequence has better cell permeability. In some embodiments, the asymmetric 2' modification provides a Tm advantage while maintaining ribonuclease H activity. The introduction of the RSS motif further enhances the efficiency of ribonuclease H in the semi-mer. The cleavage profile was derived from a reaction mixture obtained after incubation of each individual duplex with RNase H1C in the presence of 1 x RNase H buffer for 5 minutes at 37 °C. Arrows indicate cleavage sites. (┬) indicates that two fragments were identified in the reaction mixture: 5'-phosphate material and 5'-OH 3'-OH material. (┌) indicates that only the 5'-phosphate material was detected and (┐) indicates that the 5'-OH 3'-OH component was detected in mass spectrometry. The length of the arrow indicates the amount of metabolite present in the reaction mixture as determined by the ratio of the UV peak area of the fragment to the theoretical extinction coefficient. The 5'-OH 3 '-OH was used to quantify only the 5'-OH 3 '-OH in the reaction mixture.

Figure 30 Exemplary mass spectrometric data for lysis analysis. Above: Information on ONT-367: 2.35min: 7 mer; 3.16min: 8 mer and P-6 mer; 4.58min: P-7 mer; 5.91min: P-8 mer; 7.19min: 12 mer; 9.55min :13 mer; 10.13 min: P-11 mer; 11.14 min: P-12 mer and 14 mer; 12.11 min: P-13 mer; 13.29 min: P-14 mer; 14.80 min: full length RNA (ONT-388); And 18.33 min: Stereotactic random DNA (ONT-367). Below: Information on ONT-406: 4.72 min: p-rArUrGrGrCrUrA, 5'-phosphorylated 7 mer RNA; 9.46 min: 5'-rGrUrGrArGrCrArGrCrUrGrCrA, 5'-OH 3'-OH 13 mer RNA; 16.45 min: full length RNA (ONT-388); 19.48 and 19.49 min: Stereo pure DNA (ONT-406).

Figure 31. Exemplary RNA cleavage rate. The double helix was incubated with ribonuclease H1C in the presence of 1 x RNase H buffer at 37 °C. The reaction was quenched by the addition of 30 mM Na ₂ EDTA at a fixed time point. The rate of lysis is determined by measuring the amount of full length RNA remaining in the reaction mixture. The compositions used include: WV-944, WV-945, WV-936, WV-904, WV-937, WV-905, WV-938, WV-906, WV-939, WV-907, WV-940, WV -908, WV-941 and WV-909.

Figure 32. AN: RNA cleavage rate of certain compositions targeting rs362307 in ribonuclease H assays. Some of these compositions are stereoregular and some are controlled by palmarity. The compositions used include: WV-1085, WV-1086, WV-1087, WV-1088, WV-1089, WV-1090, WV-1091, WV-1092, WV-905, WV-944, WV-945, WV -911, WV-917, WV-931, WV-937 and WV-1497.

Figure 33. A: Exemplary cleavage map. The cleavage profile was derived from a reaction mixture obtained after incubation of each individual duplex with RNase H1C in the presence of 1 x RNase H buffer for 5 minutes at 37 °C. B: Legend. Arrows indicate cleavage sites. (┬) indicates that two fragments were identified: 5'-phosphate material and 3'-OH substance. (┌) indicates that only the 5'-OH 3'-OH species was detected and (┐) indicates that the 5'-phosphate component was detected. The length of the arrow indicates the amount of fragment present in the reaction mixture as determined by the ratio of the UV peak area of the fragment to the theoretical extinction coefficient. The 5'-OH 3 '-OH fragment was used to quantify only the 5'-OH 3 '-OH fragment in the reaction mixture. Compositions used include: WV-944, WV-945, WV-904, WV-905, WV-906, WV-907, WV-908, and WV-909.

Figure 34. Exemplary cleavage map. An exemplary cleavage map. The cleavage profile was derived from a reaction mixture obtained after incubation of each individual duplex with RNase H1C in the presence of 1 x RNase H buffer for 30 minutes at 37 °C. See Figure 33 for a legend. The compositions used include: WV-944, WV-945, WV-936, WV-937, WV-938, WV-939, WV-940, WV-941, WV-1085, WV-1086, WV-1087, WV -1088, WV-1089, WV-1090, WV-1091 and WV-1092.

Figure 35. Exemplary cleavage map. See Figure 33 for a legend. Compositions used include: WV-944, WV-945, WV-905, WV-911, WV-917, WV-931, and WV-937.

Figure 36. Total ion chromatogram of the ribonuclease H cleavage reaction of WV-937 when double helixed with WT HTT RNA (WV-944, top panel) or mu HTT RNA (WV-945, lower panel). After the enzymatic reaction was quenched with disodium EDTA for 30 minutes, the ribonuclease H cleavage product was subjected to chromatographic analysis and analysis using an Agilent 1290 UPLC and an Agilent 6230 MS-TOF mass spectrometer. High-accuracy, high-resolution MS spectra of the identified peaks were extracted and de-spinned. The location of the cleavage is determined by comparing the meta-average mass to the predicted mass of the RNA metabolite to identify metabolites.

Figure 37. Schematic representation of screening based on luciferase reporter genes.

Figure 38. Figure 38 and Figure 39 show the activity of various HTT oligonucleotides. Dose response curve of HTT silenced in COS7 cells in a reporter-based assay following transfection of ASO targeting rs362331_T or rs2530595_T SNP. By adding a stereoscopically pure design (designated IC50), the ASO specificity is increased with no significant loss in potency. The data represents 2 independent experiments. Lines represent the fitted curve and error bars represent the standard deviation. In these figures, the position of the SNP is indicated in light green or light blue. The compositions tested in Figure 38 include: WV-2067, WV-2416, WV-2069, WV-2417, WV-2072, WV-2418, WV-2076, WV-2419, WV-2605, WV-2589, WV-2606, WV-2590, WV-2607, WV-2591, WV-2608, WV-2592, WV-2609, WV-2593, WV-2610, WV-2594, WV-2611, WV-2595, WV- 2612, WV-2596, WV-2611, WV-2595, WV-2671, WV-2672, WV-2673, WV-2675, WV-2674, WV-2613, WV-2597, WV-2614, WV-2598, WV-2615, WV-2599, WV-2616, WV-2600, WV-2617, WV-2601, WV-2618, WV-2602, WV-2619, WV-2603, WV-2620 and WV-2604.

Figure 39. Dose response curves of HTT silenced in COS7 cells in a reporter gene based assay following transfection of ASO. The compositions tested included: WVE120101, WV-1092, WV-1497, WV-2619, WV-2603, WV-2611, and WV-2595. IC ₅₀ information is also displayed.

Figure 40. Figure 40 shows liquid chromatography and mass spectrometry data for the following oligonucleotides: WV1092.22 (WV-1092), WV2595.01 (WV-2595), and WV2603.01 (WV-2603). The suffixes (01), (02), .01, .02, .22, etc., as used herein, denote batch numbers.

Figure 41. Figure 41 shows liquid chromatography and mass spectrometry data for the following oligonucleotides: WV-1510, WV-2378 and WV-2380.

Synthetic oligonucleotides provide molecular tools for a variety of applications. For example, oligonucleotides are useful in therapeutic, diagnostic, research, and novel nanomaterial applications. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited, for example, due to their susceptibility to endonucleases and exonucleases. Therefore, various synthetic counterparts have been developed to avoid these disadvantages. Such synthetic counterparts include synthetic oligonucleotides containing backbone modifications that render such molecules less susceptible to degradation. From a structural point of view, such modifications to internucleotide phosphate linkages introduce palmarity. It is now clear that certain characteristics of oligonucleotides It is affected by the configuration of the phosphorus atoms that form the backbone of the oligonucleotide. For example, in vitro studies have shown that antisense nucleotides such as binding affinity, sequence-specific binding to complementary RNA, stability to nucleases, and the like are particularly subject to host-to-palm (eg, phosphorus atoms) The impact of configuration).

In particular, the present invention recognizes structural elements of oligonucleotides (such as base sequences), chemical modifications (eg, modification of sugars, bases and/or internucleotide linkages, and modes thereof) and/or stereochemistry. (For example, the stereochemistry of the backbone to the palmar center (for palm-to-nucleotide linkages) and/or its mode) can have a large impact on the properties (eg, activity) of the oligonucleotide. In some embodiments, the present invention demonstrates that oligonucleotide compositions comprising oligonucleotides having controlled structural elements (eg, controlled chemical modifications and/or controlled backbone stereochemistry patterns) provide unexpected characteristics, This includes, but is not limited to, the features described herein. In some embodiments, the invention provides an oligonucleotide composition comprising a predetermined amount of an oligonucleotide of an individual oligonucleotide type, the oligonucleotides being chemically identical, eg, having the same base The base sequence, the same nucleoside modification pattern (if present, modifications to the sugar and base moieties), the same backbone pair palm center pattern, and the same backbone phosphorus modification pattern.

In particular, the present invention recognizes that stereoregular oligonucleotide preparations contain a plurality of distinct chemical entities that differ from one another, such as the individual chemical chains within the oligonucleotide chain differing in the stereochemical structure of the palm center. Stereotactic oligonucleotide preparations provide an uncontrolled composition comprising an indeterminate amount of oligonucleotide stereoisomers without controlling the stereochemistry of the backbone to the palm center. Even though such stereoisomers may have the same base sequence, at least due to their different backbone stereochemistry, they are still different chemical entities and, as presented herein, may have different properties, such as active. Stereoscopically pure (or "controlled palm") oligonucleotide compositions or formulations are otherwise identical (eg, both stereogenic and stereoregular versions have the same base sequence, base, and sugar modification pattern) Or a stereospecific random oligonucleotide preparation, which may have improved biological activity. For example, the stereoregular oligonucleotide WV-1497 composition and the stereoscopic pure oligonucleotide WV-1092 composition have The same base sequence and the same sugar modification mode and the main chain linkage mode are different only in stereochemistry. However, at higher concentrations, the stereo-pure WV-1092 composition differs significantly from the stereotactic WV-1497 composition in the ability to distinguish between wt HTT and mutant HTT (both differing by only one nt). At high concentrations, both of them largely blocked the gene expression of mutant HTT, which is desirable; however, stereo-pure WV-1092 showed only a small amount of gene expression blocking wild-type HTT, while WV-1497 showed Gene expression of wt HTT is more significantly blocked, which is less suitable in some cases.

Both palm-controlled oligonucleotide compositions WVE120101 and WV-1092 were able to distinguish between the wt version and the mutant version of SNP rs362307, which differed by one nt; WVE120101 and WV-1092 significantly blocked the mutant dual gene. The gene exhibited, but did not block, the gene expression of wt, whereas the stereoregular version WV-1497 was unable to significantly distinguish between the wt-pair gene and the mutant-type dual gene (see Figure 39D). The modified sequences of WVE120101 and WV-1092 are identical.

The palm-controlled oligonucleotide composition WV-2595 was able to distinguish between the C-pair gene and the T-pair gene in SNP rs2530595, which differed by only one nt. Stereo-pure WV-2595 significantly blocks the gene expression of the T-pair gene, but does not block the gene expression of the C-pair gene, unlike the stereoregular oligonucleotide composition WV-2611, which does not significantly distinguish the dual gene (see figure). 39F). The sequence of WV-2595 is 5'-mG _* mGmGmUmC _* C _* T _* C _* C _* C _* C _* A _* C _* A _* G _* mAmGmGmG _* mA-3' or 5'-mG*SmGmGmUmC*SC*ST *SC*SC*SC*SC*SA*SC*RA*SG*SmAmGmGmG*SmA-3', which contains some stereochemical information.

The stereoscopic pure oligonucleotide composition WV-2603 is capable of distinguishing the C-pair gene and the T-pair gene of SNP rs362331, and the difference between them is only one nt. Stereo-pure WV-2603 significantly blocks the gene expression of the T-pair gene, but does not block the gene expression of the C-pair gene, unlike the stereoregular oligonucleotide composition WV-2619, which does not significantly distinguish the dual gene (see figure). 39A, FIG. 39B, FIG. 39C, and FIG. 39E). The sequence of WV-2603 is 5'- mG _* mUmGmCmA _* C _* A _* C _* A _* G _* T _* A _* G _* A _* T _* mGmAmGmG _* mG-3' or 5'-mG*SmUmGmCmA*SC*SA *SC*SA*SG*ST*SA*SG*RA*ST*SmGmAmGmG*SmG-3', which contains some stereochemical information.

In some embodiments, the sequence of the oligonucleotide in the stereo-pure (controlled palm control) oligonucleotide composition comprises or consists of the sequence of any of the oligonucleotides disclosed herein. In some embodiments, the sequence of the oligonucleotide in the stereo-pure (controlled palm control) oligonucleotide composition comprises or consists of: selected from Table N1, Table N2, Table N3, Table N4, and The sequence of any of the oligonucleotides of Table 8. In some embodiments, the sequence of the oligonucleotide in the stereo-pure (controlled palm control) oligonucleotide composition comprises or consists of: selected from Table N1A, Table N2A, Table N3A, Table N4A, and The sequence of any of the oligonucleotides of Table 8. In some embodiments, the sequence of the oligonucleotide in the stereo-pure (controlled palm control) oligonucleotide composition comprises or consists of: WV-1092, WVE120101, WV-2603, or WV-2595 sequence.

Each oligonucleotide described herein comprising an HTT sequence represents an HTT oligonucleotide that has been designed, constructed, and tested in various assays, in some embodiments, in one or more in vitro assays. Each HTT oligonucleotide listed in any of Table N1A, Table N2A, Table N3A, Table N4A, and Table 8 or elsewhere herein is designed, constructed, and in various analyses, in some embodiments , tested in one or more in vitro assays. For example, the HTT oligonucleotides described herein are tested in a dual luciferase reporter gene assay. In some embodiments, the HTT oligonucleotide is tested according to the invention in one or more of the other assays described in the invention and/or described in the art. In some embodiments, HTT oligonucleotides found to be particularly effective in dual luciferase assays are further tested in vitro and in vivo assays in accordance with the present invention.

In some embodiments, the sequence of the oligonucleotide in the stereo-pure (controlled palm control) oligonucleotide composition comprises any one or more of the following: base sequence (including length); Chemical modification mode of base moiety; main chain linkage mode; natural phosphate linkage mode, phosphorothioate linkage mode, phosphorothioate triester linkage mode and combinations thereof; main chain versus palm center mode; Stereochemistry ( R p / S p) mode of inter-nucleotide linkage; main chain phosphorus modification mode; modification mode of phosphorus atom between nucleotides, such as -S ^- and -LR ^{1 of} formula I.

In particular, the invention provides novel compositions which are or contain specific stereoisomers of the oligonucleotide of interest. In some embodiments, a particular stereoisomer can be defined, for example, by its base sequence, its length, its backbone linkage mode, and its backbone-to-palm central mode. As is understood in the art, in some embodiments, a base sequence can refer to a nucleoside residue in an oligonucleotide (eg, a sugar and/or base component relative to, for example, adenine, cytosine, bird) The identity and/or modification status of the standard naturally occurring nucleotides of the glycoside, thymine, and uracil and/or may refer to the hybridization characteristics of the residues (ie, the ability to hybridize to a particular complementary residue) ). In some embodiments, the oligonucleotides in the provided compositions comprise, for example, a sugar modification of a wing region, such as a 2' modification. In some embodiments, the oligonucleotides in the provided compositions comprise a sugar-free modified intermediate region, such as a core region.

In particular, the invention demonstrates that individual stereoisomers of a particular oligonucleotide may exhibit different stability and/or activity (e.g., functional and/or toxic properties) from one another. Furthermore, the present invention demonstrates that the stability and/or activity improvement achieved by including a particular pair of palmar structures and/or localization within the oligonucleotides can be similar or even superior to the use of specific backbone linkages, residues Base modifications, etc. (eg, via the use of certain types of modified phosphates [eg, phosphorothioates, substituted phosphorothioates, etc.], sugar modifications [eg, 2' modifications, etc.] and/or base modifications [ For example, methylation, etc.]) achieved improvements.

In particular, the present invention recognizes that in some embodiments, the characteristics (eg, stability and/or activity) of an oligonucleotide can be adjusted by optimizing its backbone-to-palm central mode, as appropriate, with oligonucleotides. An adjusted/optimized combination of one or more other features of the glycoside (eg, linkage mode, nucleoside modification mode, etc.). In some embodiments, the invention provides oligonucleotide compositions wherein the oligonucleotide comprises a nucleoside modification, a palmitic internucleotide linkage, and a native phosphate linkage. For example, WV-1092 contains 2'-OMe modifications, phosphorus in its 5' and 3' wing regions. The acid ester linkage and the phosphorothioate linkage in its core region.

In some embodiments, the present invention demonstrates that stability improvements achieved by including a particular pair of palmar structures and/or localizing them within an oligonucleotide can be similar or even better than using a modified backbone linkage , bases and/or sugars (eg, via the use of certain types of modified phosphates, 2' modifications, base modifications, etc.). In some embodiments, the invention also demonstrates that activity improvement via the inclusion of a particular pair of palmar structures and/or localization within the oligonucleotides can be similar or even superior to the use of modified backbone linkages. , bases and/or sugars (eg, via the use of certain types of modified phosphates, 2' modifications, base modifications, etc.).

In some embodiments, including a particular pair of palmar linkages and/or localization within the oligonucleotides can unexpectedly alter the cleavage pattern of the nucleic acid polymer when such oligonucleotides are used to cleave the nucleic acid polymer. For example, in some embodiments, the backbone-to-palm central mode provides an unexpectedly high cleavage efficiency of the target nucleic acid polymer. In some embodiments, the backbone provides a new cleavage site for the palm center mode. In some embodiments, for example, the backbone-to-palm central mode provides fewer cleavage sites by blocking certain existing cleavage sites. Even more unexpectedly, in some embodiments, the backbone-to-palm central mode provides for cleavage only at one site of the target nucleic acid polymer within the sequence complementary to the oligonucleotide used for cleavage. In some embodiments, higher lysis efficiency is achieved by selecting a backbone-to-palm center mode that minimizes the number of cleavage sites.

In some embodiments, the invention provides compositions of oligonucleotides, wherein the oligonucleotides have a common backbone-to-palm center mode that unexpectedly greatly enhances the stability of the oligonucleotide and/or Or biological activity. In some embodiments, the backbone provides increased stability to the palm center mode. In some embodiments, the backbone provides an unexpectedly increased activity to the palm center pattern. In some embodiments, the backbone provides increased stability and activity to the palm center mode. In some embodiments, when the oligonucleotide is used to cleave the nucleic acid polymer, the backbone-to-palm center mode itself unexpectedly alters the cleavage mode of the target nucleic acid polymer. In some embodiments, the backbone-to-palm central mode is effective to prevent cleavage at the secondary site. In some embodiments, the backbone forms a new cleavage site for the palm center pattern. In some embodiments, the backbone-to-palm central mode minimizes the number of cleavage sites. In some embodiments, the backbone-to-palm central mode minimizes the number of cleavage sites such that the target nucleic acid polymer cleaves only at one site within the sequence of the target nucleic acid polymer complementary to the oligonucleotide. (For example, cleavage at other sites cannot be readily detected by some means; in some embodiments, greater than 85%, 90%, 91%, 92%, 93%, 94 occurs at such sites. %, 95%, 96%, 97%, 98% or 99% cleavage). In some embodiments, the backbone-to-palm central mode enhances cleavage efficiency at the cleavage site. In some embodiments, the backbone of the oligonucleotide cleaves the target nucleic acid polymer against the palm center mode. In some embodiments, the backbone adds selectivity to the palm center mode. In some embodiments, the main chain versus palm center mode minimizes off-target effects. In some embodiments, the backbone increases selectivity for the palm center pattern, such as only the cleavage selectivity between the two target sequences of the single nucleotide polymorphism (SNP). In some embodiments, the backbone-to-palm central mode increases cleavage at the cleavage site of the stereoregular or DNA oligonucleotide composition. In some embodiments, the backbone-to-palm central mode increases cleavage at a major cleavage site of a stereoregular or DNA oligonucleotide composition. In some embodiments, such a site is the primary cleavage site of the oligonucleotide having the backbone-to-palm central mode. In some embodiments, if the site is the site with the most, or the second, third, fourth or fifth multiple cleavage, or occurs greater than 5%, 10%, 15%, 20%, 25%, 30% , 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99 The % cleavage site is considered to be the primary site. In some embodiments, the main chain versus palm center mode comprises or is ( S p) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m . In some embodiments, the main chain-to-palm center mode comprises or is ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , where m>2. In some embodiments, the main chain versus palm center mode comprises or is ( R p ) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , where n is 1, t>1, and m>2. In some embodiments, m > 3. In some embodiments, m > 4.

In some embodiments, the present invention recognizes that chemical modifications such as modifications of nucleosides and internucleotide linkages can provide enhanced properties. In some embodiments, the present invention demonstrates that the combination of chemical modification and stereochemistry can provide unexpected, greatly improved properties (e.g., biological activity, selectivity, etc.). In some embodiments, chemical combinations (such as modifications of sugars, bases, and/or internucleotide linkages) and stereochemical modes (eg, ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m ) combinations, resulting in oligonucleotides having surprisingly enhanced properties and compositions thereof. In some embodiments, the provided oligonucleotide composition is palm-controlled and comprises one or more sugar moieties, one or more natural phosphate linkages, one or more phosphorothioates The 2' modification of the bond and the stereochemical mode ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p ) the combination of _m, where m> 2. In some embodiments, n is 1, t > 1, and m > 2. In some embodiments, m > 3. In some embodiments, m > 4.

In some embodiments, the invention provides a palm-controlled oligonucleotide composition comprising an oligonucleotide having the following definitions: 1) a common base sequence and length; 2) a common backbone linkage Mode; and 3) a common backbone-to-palm central mode, the composition being a substantially pure single oligonucleotide preparation, as the predetermined amount of oligonucleotides in the composition have a common base sequence and length, common Main chain bonding mode and common main chain versus palm center mode.

In some embodiments, the common base sequence and length can be referred to as a common base sequence. In some embodiments, oligonucleotides having a common base sequence can have the same nucleoside modification pattern, such as sugar modifications, base modifications, and the like. In some embodiments, the nucleoside modification pattern can be represented by a combination of position and modification. For example, with respect to WV-1092, the nucleoside modification pattern from the 5' end to the 3' end is 5 x 2'-OMe (2'-OMe modification on the sugar moiety)-DNA (no 2' on the sugar moiety) Modified) - 5 x 2'-OMe. In some embodiments, the backbone linkage mode comprises the location and type of linkage between the various nucleotides (eg, phosphates, phosphorothioates, substituted phosphorothioates, etc.). In some embodiments, an oligonucleotide can have a designated backbone linkage mode. In some embodiments, the backbone linkage mode of the oligonucleotide is _n PS- _n PO- _n PS- _n PO- _n PS, wherein PO is a phosphate (phosphodiester) and PS is a phosphorothioate, And n is 1-15, and n may be the same or different at each occurrence. In some embodiments, at least one n is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, at least one n of the PS is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, the n of the PS between the two POs is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. In some embodiments, n is greater than 5. In some embodiments, n is greater than 6. In some embodiments, n is greater than 7. In some embodiments, n is greater than 8. In some embodiments, n is greater than 9. In some embodiments, n is greater than 10. In some embodiments, n is greater than 11. In some embodiments, n is greater than 12. In some embodiments, n is greater than 13. In some embodiments, n is greater than 14. In some embodiments, n is greater than 15. In some embodiments, the backbone linkage mode of the oligonucleotide is 1-5PS - 1-7PO - 5-15PS - 1-7PO - 1-5PS (meaning 1 to 5 phosphorothioates, 1 to 7 phosphates, 5 to 15 phosphorothioates, 1 to 7 phosphates and 1 to 5 phosphorothioates). In some embodiments, the backbone linkage mode of the oligonucleotide is from 1' to 3' to 1PS-3PO-11PS-3PO-1PS (meaning 1 phosphorothioate, 3 phosphates, 11 sulfur) phosphorothioate, phosphate and a 3 phosphorothioate, and it can be expressed as or _{PS 1 PO 3 PS 11 PO 3} PS 1). For example, regarding WV-1092, the main chain bonding mode is 1PS-3PO-11PS-3PO-1PS from the 5' end to the 3' end. In some embodiments, the backbone linkage mode of the oligonucleotide is 1-5PS - 1-7PO - 5-15PS - 1-7PO - 1-5PS, wherein each PS is S except for one of R p p. In some embodiments, the backbone linkage mode of the oligonucleotide is 1-5PS - 1-7PO - 5-15PS - 1-7PO - 1-5PS, with the exception of the 5th through the 15th PS Each PS at a position is R p , and each PS is S p . In some embodiments, the backbone linkage mode of the oligonucleotide is 1-5PS - 1-7PO - 5-15PS - 1-7PO - 1-5PS, wherein the 10th PS is counted starting from the 5' end In addition to R p , each PS is S p . In some embodiments, the backbone linkage mode of the oligonucleotide is 1-5PS - 1-7PO - 5-15PS - 1-7PO - 1-5PS, with the ninth PS counting from the 5' end In addition to R p , each PS is S p . In some embodiments, the backbone linkage mode of the oligonucleotide is 1-5PS - 1-7PO - 5-15PS - 1-7PO - 1-5PS, with the eleventh PS counting from the 5' end In addition to R p , each PS is S p . The oligonucleotide backbone chiral centers mode from the composition by 5 'to 3' linkage of the phosphate stereochemistry (R p / S p) of the named. For example, the mode of WV-1092 is 1S-3PO (phosphate)-8S-1R-2S-3PO-1S, and the mode of WV-937 is 12S-1R-6S. In some embodiments, all of the non-paired keys (eg, PO) may be omitted when describing the main chain versus palm center mode. As exemplified above, the position of the non-paired bond can be obtained, for example, in an autonomous chain bonding mode. Any of the sequences disclosed herein can be combined with any of the backbone linkage modes disclosed herein and/or any backbone to palm center mode. Unless otherwise indicated, nucleotide sequence, backbone linkages mode stereochemistry (e.g., R p or S p) mode, mode base modifications, backbone chiral centers presentation mode in the 5 'to 3' direction.

In some embodiments, the invention provides a palm-controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type, characterized by: 1) a common base sequence and length; a common backbone linkage mode; and 3) a common backbone-to-palm central mode; the composition is palm-controlled because it is substantially external to an oligonucleotide having the same base sequence and length For racemic formulations, oligonucleotides of a particular oligonucleotide type are enriched in the composition.

An exemplary substantially racemic formulation of an oligonucleotide is synthesized by a well-known process in the art, according to conventional amino phosphate oligosynthesis, using tetraethyl bis-thiocarbosulfide disulfide Phosphorothioate oligonucleotides are prepared by decylamine or (TETD) or 3H-1,2-benzodithiol-3-one 1,1-dioxide (BDTD) sulfurized phosphite triester. In some embodiments, the substantially racemic formulation of the oligonucleotide provides a substantially racemic oligonucleotide composition (or an oligonucleotide assembly that does not control the palmity).

As is generally understood by those skilled in the art, stereospecific random or racemic formulations of oligonucleotides are non-stereoselective and/or low stereoselectively coupled to a nucleomonomer, usually without the use of any pair of palms. It is prepared by a auxiliaries, a palmitic modification reagent and/or a palmitic catalyst. In some embodiments, all or most of the coupling steps do not control the palmity when the oligonucleotide is prepared substantially (or does not control palmarity) because the coupling step is not specifically performed to Provides enhanced stereo selectivity. An exemplary substantially racemic formulation of an oligonucleotide is synthesized by a well-known process in the art, according to conventional amino phosphate oligosynthesis, using tetraethyl bis thiocarbamidine disulfide or (TETD) Or a 3H-1,2-benzodithiol-3-one 1,1-dioxide (BDTD) sulfurized phosphite triester to prepare a phosphorothioate oligonucleotide. In some embodiments, the substantially racemic formulation of the oligonucleotide provides a substantially racemic oligonucleotide composition (or an oligonucleotide assembly that does not control the palmity). In some embodiments, at least one coupling of the nucleotide monomers has less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, Diastereoselectivity of 98:2 or 99:1. In some embodiments, at least two couplings of nucleotide monomers have less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3 , 98:2 or 99:1 diastereoselective. In some embodiments, at least three couplings of nucleotide monomers have less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3 , 98:2 or 99:1 diastereoselective. In some embodiments, at least four couplings of nucleotide monomers have less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3 , 98:2 or 99:1 diastereoselective. In some embodiments, at least five couplings of nucleotide monomers have less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3 , 98:2 or 99:1 diastereoselective. In some embodiments In the stereoregular or racemic formulation, the at least one internucleotide linkage has less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92: 8, 97:3, 98:2 or 99:1 diastereoselective. In some embodiments, the at least two internucleotide linkages have less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, Diastereoselectivity of 98:2 or 99:1. In some embodiments, the at least three internucleotide linkages have less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, Diastereoselectivity of 98:2 or 99:1. In some embodiments, the at least four internucleotide linkages have less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, Diastereoselectivity of 98:2 or 99:1. In some embodiments, the at least five internucleotide linkages have less than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, Diastereoselectivity of 98:2 or 99:1. In some embodiments, the diastereoselectivity is less than about 60:40. In some embodiments, the diastereoselectivity is less than about 70:30. In some embodiments, the diastereoselectivity is less than about 80:20. In some embodiments, the diastereoselectivity is less than about 90:10. In some embodiments, the diastereoselectivity is less than about 91:9. In some embodiments, the diastereoselectivity is less than about 92:8. In some embodiments, the diastereoselectivity is less than about 93:7. In some embodiments, the diastereoselectivity is less than about 94:6. In some embodiments, the diastereoselectivity is less than about 95:5. In some embodiments, the diastereoselectivity is less than about 96:4. In some embodiments, the diastereoselectivity is less than about 97:3. In some embodiments, the diastereoselectivity is less than about 98:2. In some embodiments, the diastereoselectivity is less than about 99:1. In some embodiments, at least one coupling has a diastereoselectivity of less than about 90:10. In some embodiments, at least two couplings have a diastereoselectivity of less than about 90:10. In some embodiments, at least three couplings have a diastereoselectivity of less than about 90:10. In some embodiments, at least four couplings have a diastereoselectivity of less than about 90:10. In some embodiments, at least five couplings have a diastereomeric ratio of less than about 90:10 Stereoselective. In some embodiments, the at least one internucleotide linkage has a diastereoselectivity of less than about 90:10. In some embodiments, at least two internucleotide linkages have a diastereoselectivity of less than about 90:10. In some embodiments, at least three internucleotide linkages have a diastereoselectivity of less than about 90:10. In some embodiments, at least four internucleotide linkages have a diastereoselectivity of less than about 90:10. In some embodiments, at least five internucleotide linkages have a diastereoselectivity of less than about 90:10.

As will be appreciated by those of ordinary skill in the art, in some embodiments, the diastereoselectivity of the coupling or linkage can be assessed via diastereoselectivity of the dimer formed under the same or similar conditions, Wherein the dimer has the same 5' and 3' nucleosides and internucleotide linkages. For example, WV-1092 mG*SmGmCmAmC*SA*SA*S G*SG *SG*SC*SA*SC*RA*SG*SmAmCmUmU*SmC with a bottom line coupling or linkage of diastereoselective The two G moieties can be assessed by coupling the same under similar or similar conditions, such as monomers, palmitic aids, solvents, activators, temperatures, and the like.

In some embodiments, the invention provides a palm-controlled (and/or stereochemically pure) oligonucleotide composition comprising an oligonucleotide having the following definitions: 1) a common base sequence and length; 2) a common backbone linkage mode; and 3) a common backbone versus palm center mode, the composition being a substantially pure single oligonucleotide preparation because at least about 10% of the oligonucleotides in the composition It has a common base sequence and length, a common backbone linkage mode, and a common backbone-to-palm center mode.

In some embodiments, the invention provides a palm-controlled oligonucleotide composition of oligonucleotides, wherein a single oligo in the composition relative to a substantially racemic formulation of the same oligonucleotide Nucleotide type oligonucleotides are enriched. In some embodiments, the invention provides a palm-controlled oligonucleotide composition of oligonucleotides, wherein a single oligo in the composition relative to a substantially racemic formulation of the same oligonucleotide Nucleotide type oligonucleotide Concentration, the oligonucleotides of the single oligonucleotide type are shared: 1) a common base sequence and length; 2) a common backbone linkage pattern; and 3) a common backbone pair palm center pattern.

In some embodiments, the invention provides a palm-controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type, characterized by: 1) a common base sequence and length; a common backbone linkage mode; and 3) a common backbone-to-palm central mode; the composition is palm-controlled because it is substantially external to an oligonucleotide having the same base sequence and length For racemic formulations, oligonucleotides of a particular oligonucleotide type are enriched in the composition.

In some embodiments, oligonucleotides having a common base sequence and length, a common backbone linkage pattern, and a common backbone versus palm center pattern have a common backbone phosphorus modification pattern and a common base modification pattern. In some embodiments, oligonucleotides having a common base sequence and length, a common backbone linkage pattern, and a common backbone versus palm center pattern have a common backbone phosphorus modification pattern and a common nucleoside modification pattern. In some embodiments, oligonucleotides having a common base sequence and length, a common backbone linkage pattern, and a common backbone versus palm center pattern have the same structure.

In some embodiments, an oligonucleotide of a certain oligonucleotide type has a common backbone phosphorus modification pattern and a common sugar modification pattern. In some embodiments, an oligonucleotide of a certain oligonucleotide type has a common backbone phosphorus modification pattern and a common base modification pattern. In some embodiments, an oligonucleotide of a certain oligonucleotide type has a common backbone phosphorus modification pattern and a common nucleoside modification pattern. In some embodiments, an oligonucleotide of the oligonucleotide type is the same.

In some embodiments, the palm-controlled oligonucleotide composition is an oligonucleotide a substantially pure preparation of the type, since the oligonucleotide of the oligonucleotide type in the composition is a preparation process from the oligonucleotide type, and in some cases, impurities after some purification procedures .

In some embodiments, at least about 20% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 25% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 30% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 35% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 40% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least 45% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 50% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 55% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 60% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 65% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 70% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 75% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone-to-palm center pattern. In some embodiments, at least about 80% of the oligonucleotides in the composition have a total Same base sequence and length, common backbone linkage mode, and common main chain versus palm center mode. In some embodiments, at least about 85% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 90% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 92% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 94% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 95% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the oligonucleotides in the composition have a common base sequence and length, Common main chain bonding mode and common main chain versus palm center mode. In some embodiments, greater than about 99% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern. In some embodiments, the purity of the oligonucleotide-controlled oligonucleotide composition of the oligonucleotide can have a common base sequence and length, a common backbone linkage pattern, and a common backbone-to-palm center in the composition. The percentage representation of the pattern of oligonucleotides.

In some embodiments, oligonucleotides having a common base sequence and length, a common backbone linkage pattern, and a common backbone versus palm center pattern have a common backbone phosphorus modification pattern. In some embodiments, oligonucleotides having a common base sequence and length, a common backbone linkage pattern, and a common backbone versus palm center pattern have a common backbone phosphorus modification pattern and a common nucleoside modification pattern. In some embodiments, oligonucleotides having a common base sequence and length, a common backbone linkage pattern, and a common backbone versus palm center pattern have a common backbone phosphorus modification pattern and a common sugar modification pattern. In some embodiments, oligonucleotides having a common base sequence and length, a common backbone linkage pattern, and a common backbone to palm center pattern have a total The same main chain phosphorus modification mode and common base modification mode. In some embodiments, oligonucleotides having a common base sequence and length, a common backbone linkage pattern, and a common backbone versus palm center pattern have a common backbone phosphorus modification pattern and a common nucleoside modification pattern. In some embodiments, oligonucleotides having a common base sequence and length, a common backbone linkage pattern, and a common backbone versus palm center pattern are identical.

In some embodiments, the oligonucleotides in the provided compositions have a common backbone phosphorus modification pattern. In some embodiments, the common base sequence is a base sequence of a certain oligonucleotide type. In some embodiments, the provided composition is a palm-controlled oligonucleotide composition, as the composition contains a predetermined amount of an oligonucleotide of an individual oligonucleotide type, wherein the oligonucleotide type It is defined as follows: 1) base sequence; 2) backbone linkage mode; 3) backbone-to-palm central mode; and 4) backbone phosphorus modification mode.

As noted above and as understood in the art, in some embodiments, the base sequence of an oligonucleotide can refer to a nucleoside residue in an oligonucleotide (eg, a sugar and/or base component, Consistency and/or modification status relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil and/or may refer to hybridization characteristics of such residues (also That is, the ability to hybridize to a particular complementary residue).

In some embodiments, a particular oligonucleotide type can be defined as follows: 1A) base identity; 1B) base modification pattern; 1C) sugar modification pattern; 2) backbone linkage mode; 3) backbone pair Sex center mode; and 4) main chain phosphorus modification mode.

Thus, in some embodiments, a particular type of oligonucleotide may share the same base, but the mode of base modification and/or sugar modification is different. In some embodiments, certain types of oligonucleotides may share the same base and base modification patterns (including, for example, lack of base modifications), but the sugar modification patterns are different.

In some embodiments, a particular type of oligonucleotide is identical in that it has the same base sequence (including length), the same chemical modification pattern for sugar and base moieties, and the same backbone linkage mode ( For example, natural phosphate linkage mode, phosphorothioate linkage mode, phosphorothioate triester linkage mode, and combinations thereof, the same main chain versus palm center mode (eg, for palm-to-nucleotide linkages) The stereochemistry ( R p / S p mode) and the same main chain phosphorus modification mode (for example, a modification mode for a phosphorus atom between nucleotides, such as -S ^- and -LR ^{1 of} formula I).

In some embodiments, the purity of a palm-controlled oligonucleotide composition of a certain oligonucleotide type is expressed as a percentage of the oligonucleotide of the oligonucleotide type in the composition. In some embodiments, at least about 10% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 20% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 30% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 40% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 50% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 60% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 70% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 80% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 90% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, in a palm-controlled oligonucleotide composition At least about 92% of the oligonucleotides are of the same oligonucleotide type. In some embodiments, at least about 94% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 95% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 96% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 97% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 98% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 99% of the oligonucleotides in the palm-controlled oligonucleotide composition are of the same oligonucleotide type.

In some embodiments, the purity of the palm-controlled oligonucleotide composition can be controlled by the stereoselectivity of each coupling step in its preparation process. In some embodiments, the coupling step has a stereoselectivity (eg, diastereoselectivity) of 60% (60% of the new internucleotide linkages formed by the coupling step have a given stereochemistry). After such a coupling step, the new internucleotide linkage formed can be said to have a purity of 60%. In some embodiments, each coupling step has a stereoselectivity of at least 60%. In some embodiments, each coupling step has a stereoselectivity of at least 70%. In some embodiments, each coupling step has a stereoselectivity of at least 80%. In some embodiments, each coupling step has a stereoselectivity of at least 85%. In some embodiments, each coupling step has a stereoselectivity of at least 90%. In some embodiments, each coupling step has a stereoselectivity of at least 91%. In some embodiments, each coupling step has a stereoselectivity of at least 92%. In some embodiments, each coupling step has a stereoselectivity of at least 93%. In some embodiments, each coupling step has a stereoselectivity of at least 94%. In some embodiments, each coupling step has a stereoselectivity of at least 95%. In some embodiments, each coupling step has a stereoselectivity of at least 96%. In some embodiments, each coupling step has a stereoselectivity of at least 97%. In some embodiments, each coupling step has a stereoselectivity of at least 98%. In some embodiments, each coupling step has at least 99% stereo selection Sex. In some embodiments, each coupling step has a stereoselectivity of at least 99.5%. In some embodiments, each coupling step has a stereoselectivity of almost 100%. In some embodiments, the coupling step has almost 100% stereoselectivity because all detectable products of the coupling step have a given stereoselectivity according to analytical methods (eg, NMR, HPLC, etc.).

In particular, the present invention recognizes that combinations of oligonucleotide structural elements (e.g., chemical modifications, backbone linkages, backbone-to-palm centers, and/or modes of backbone phosphorus modification) can provide unexpectedly improved properties, such as Biological activity.

In some embodiments, the invention provides an oligonucleotide composition comprising a predetermined amount of oligonucleotides comprising one or more wing regions and a common core region, wherein: each wing The regions independently have the length of two or more bases, and independently and optionally one or more pairs of palmar internucleotide linkages; the core regions independently have two or more bases Length, and independently comprising one or more pairs of palmitic internucleotide linkages, and the common core region has: 1) a common base sequence and length; 2) a common backbone linkage pattern; and 3) a common backbone For the palm center mode.

In some embodiments, the wing region includes structural features that are not present in the core region. In some embodiments, the wing and core can be defined by any structural element, such as base modifications (eg, methylation/unmethylation, methylation at position 1 / methylation at position 2, etc.) , sugar modification (eg, modified/non-modified, 2' modified/another type of modification, one type of 2' modification / another type of 2' modification, etc.), backbone linkage type (eg, phosphate ester / Phosphorothioate, phosphorothioate/substituted phosphorothioate, etc.), stereochemistry of the main chain to the palm center (eg, full Sp / full R p, ( S p R p) repeat / full R p Etc.), the main chain phosphorus modification type (for example, s1/s2, s1/s3, etc.).

In some embodiments, the wing and core are defined by nucleoside modifications, wherein the wing comprises a nucleoside modification that is not present in the core region. In some embodiments, the wing and core are defined by a sugar modification, wherein the wing comprises a sugar modification that is not present in the core region. In some embodiments, the sugar modification is a 2' modification. In some embodiments, the sugar modification is 2'-OR ¹ . In some embodiments, the sugar is modified to 2'-MOE. In some embodiments, the sugar is modified to 2'-OMe. Other exemplary sugar modifications are described herein.

In some embodiments, the oligonucleotides in the provided compositions have a wing-core structure (hemimer). In some embodiments, the oligonucleotides in the provided compositions have a nucleoside modified wing-core structure. In some embodiments, the oligonucleotides in the provided compositions have a core-wing structure (another type of semi-polymer). In some embodiments, the oligonucleotides in the provided compositions have a nucleoside modified core-wing structure. In some embodiments, the oligonucleotides in the provided compositions have a wing-core-wing structure (spacer). In some embodiments, the oligonucleotides in the provided compositions have a nucleoside modified wing-core-wing structure. In some embodiments, the wings and core are defined by modifications of the sugar moiety. In some embodiments, the wing and core are defined by modifications of the base moiety. In some embodiments, each sugar moiety in the wing region has the same 2' modification that is not present in the core region. In some embodiments, each sugar moiety in the wing region has the same 2' modification that is different from any sugar modification in the core region. In some embodiments, the core region is free of sugar modifications. In some embodiments, each sugar moiety in the wing region has the same 2' modification and the core region has no 2' modification. In some embodiments, when two or more wings are present, each wing is defined by its own modification. In some embodiments, each wing has its own characteristic sugar modification. In some embodiments, each wing has the same characteristic sugar modification that distinguishes it from the core. In some embodiments, each of the glycan moieties have the same modification. In some embodiments, each of the oligosaccharide moieties have the same 2' modification. In some embodiments, each sugar moiety in the wing region has the same 2' modification, however the common 2' modification in the first wing region may be the same or different than the common 2' modification in the second wing region. In some embodiments, each sugar moiety in the wing region has the same 2' modification and the first wing The common 2' modification in the region is identical to the common 2' modification in the second wing region. In some embodiments, each sugar moiety in the wing region has the same 2' modification, and the common 2' modification in the first wing region is different from the common 2' modification in the second wing region.

In some embodiments, the palm-controlled (and/or stereochemically pure) formulation provided is an antisense oligonucleotide (eg, chiromersen). In some embodiments, the palm-controlled (and/or stereochemically pure) preparation provided is a siRNA oligonucleotide. In some embodiments, the oligonucleotides provided in the palm-controlled oligonucleotide composition can be antisense oligonucleotides, antagonistic miRs, microRNAs, microRNA precursors (pre-microRNs) , anti-miR, super miR, ribonuclease, Ul-attached protein, RNA activator, RNAi agent, decoy oligonucleotide, triploid-forming oligonucleotide, aptamer or adjuvant. In some embodiments, the palm-controlled oligonucleotide composition has an antisense oligonucleotide. In some embodiments, the palm controlled oligonucleotide composition has an antagonistic miR oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has a microRNA oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has a microRNA precursor oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has an anti-miR oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has a super-miR oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has a ribonuclease oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has an Ul-attached protein oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has an RNA activator oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has an RNAi agent oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has a decoy oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has an oligonucleotide that forms a triple helix. In some embodiments, the palm-controlled oligonucleotide composition has an aptamer oligonucleotide. In some embodiments, the palm-controlled oligonucleotide composition has an adjuvant oligonucleotide.

In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation is provided The oligonucleotides contained include one or more modified backbone linkages, bases and/or sugars.

In some embodiments, the provided oligonucleotides comprise one or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide comprises two or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide comprises three or more modified pairs of palm phosphate linkages. In some embodiments, the provided oligonucleotide comprises four or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide comprises five or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotides comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 modified palmitic phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 5 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 6 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 7 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 8 or more modified pairs of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 9 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 10 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 11 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 12 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 13 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 14 or more modified pairs of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 15 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 16 or more modified pair of palm phosphate linkages. In some embodiments, the type of oligonucleotide provided Contains 17 or more modified pairs of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 18 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 19 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 20 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 21 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 22 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 23 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 24 or more modified pair of palm phosphate linkages. In some embodiments, the provided oligonucleotide type comprises 25 or more modified pair of palm phosphate linkages.

In some embodiments, the provided oligonucleotide comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% , 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% modified palmitic phosphate linkage. Examples of such modified palmitic phosphate linkages are described above and herein. In some embodiments, the provided oligonucleotide comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% , 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the modified p-phosphate linkages in the Sp configuration.

In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 80%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 85%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 90%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 91%. In some embodiments, the provided palmity is subject to The controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 92%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 93%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 94%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 95%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 96%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 97%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 98%. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation has a stereochemical purity greater than about 99%.

In some embodiments, the modified palmitic phosphate linkage is a palmitic phosphorothioate linkage, ie, a phosphorothioate internucleotide linkage. In some embodiments, the provided oligonucleotide comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% , 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the palmitic phosphorothioate internucleotide linkage. In some embodiments, all of the modified pair of palm phosphate linkages are internucleotide linkages to the palmitic phosphorothioate. In some embodiments, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the provided oligonucleotides are palmitic phosphorothioate cores. The interglycosidic linkage has a Sp configuration. In some embodiments, at least about 10% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 20% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 30% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 40% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 50% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 60% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 70% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 80% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 90% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 95% of the provided oligonucleotides have a Sp configuration for the palmitic phosphorothioate internucleotide linkage. In some embodiments, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the provided oligonucleotides are palmitic phosphorothioate cores. inter nucleotide linkage having R p configuration. In some embodiments, oligonucleotides are provided having at least about 10% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, oligonucleotides are provided having at least about 20% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, oligonucleotides are provided having at least about 30% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, oligonucleotides are provided having at least about 40% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, oligonucleotides are provided having at least about 50% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, oligonucleotides are provided having at least about 60% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, oligonucleotides are provided having at least about 70% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, oligonucleotides are provided having at least about 80% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotides are provided with about 90% of the R p configuration at least a chiral phosphorothioate linkages between nucleotides. In some embodiments, oligonucleotides are provided having at least about 95% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, less than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the provided oligonucleotides are palmitic phosphorothioate cores inter nucleotide linkage having R p configuration. In some embodiments, the oligonucleotides are provided having less than about 10% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotides are provided having less than about 20% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotides are provided having less than about 30% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotides are provided having less than about 40% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, oligonucleotides are provided having less than about 50% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotides are provided having less than about 60% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotides are provided having less than about 70% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotides are provided having less than about 80% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotides are provided having less than about 90% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotides are provided having less than about 95% of the R p configuration chiral phosphorothioate linkages between nucleotides. In some embodiments, the oligonucleotide has only provided a R p chiral phosphorothioate internucleotide linkage. In some embodiments, the provided oligonucleotide has only one R p to palmitic phosphorothioate internucleotide linkage, wherein all internucleotide linkages are for the palmitic phosphorothioate nucleus Glycosylation linkages. In some embodiments, the palmitic phosphorothioate internucleotide linkage is a pair of palmitic phosphorothioate linkages. In some embodiments, each pair of palmothiophosphate internucleotide linkages are independently a pair of palmitic phosphorothioate linkages. In some embodiments, each internucleotide linkage is independently a pair of palmitic phosphorothioate linkages. In some embodiments, the linkage between each nucleotide is independently chiral phosphorothioate diester linkage, and only one of R p.

In some embodiments, a palm-controlled (and/or stereochemically pure) formulation provided is provided with an oligonucleotide comprising one or more modified bases. In some embodiments, a palm-controlled (and/or stereochemically pure) formulation provided is provided with an oligonucleotide that does not contain a modified base. Examples of such modified bases are described above and herein.

In some embodiments, the oligonucleotides of the provided compositions comprise at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least one native phosphate linkage. In some embodiments, the oligonucleotide of the provided composition comprises at least two natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least three natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least four natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least five natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least six natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least seven natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least eight natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least nine natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least ten natural phosphate linkages.

In some embodiments, the oligonucleotides of the provided compositions comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises a native phosphate linkage. In some embodiments, the oligonucleotide of the provided composition comprises two natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises three natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises four natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises five natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises six natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises seven natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises eight natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises nine natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises ten natural phosphate linkages.

In some embodiments, the oligonucleotide of the provided composition comprises at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 consecutive natural phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least two consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least three consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least four consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least five consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least six consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least seven consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least eight consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least nine consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises at least ten consecutive native phosphate linkages.

In some embodiments, the oligonucleotides of the provided compositions comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises two consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises three consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises four consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises five consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises six consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises seven consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises eight consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises nine consecutive native phosphate linkages. In some embodiments, the oligonucleotide of the provided composition comprises ten consecutive native phosphate linkages.

In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 8 bases. In some embodiments The palm-controlled (and/or stereochemically pure) preparations provided herein contain oligonucleotides having a common base sequence of at least 9 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 10 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 11 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 12 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 13 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 14 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 15 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 16 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 17 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 18 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 19 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 20 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 21 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 22 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 23 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation contains at least 24 bases Oligonucleotides based on a common base sequence. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations comprise oligonucleotides having a common base sequence of at least 25 bases. In some embodiments, the provided palm-controlled (and/or stereochemically pure) preparations have a commonality of at least 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75 bases. An oligonucleotide of a base sequence.

In some embodiments, a palm-controlled (and/or stereochemically pure) formulation provided comprises an oligonucleotide comprising one or more residues modified in a sugar moiety. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation comprises one or more modifications at the 2' position of the sugar moiety (referred to herein as "2' modification"). Residue oligonucleotide. Examples of such modifications are described above and herein and include, but are not limited to, 2'-OMe, 2'-MOE, 2'-LNA, 2'-F, FRNA, FANA, S-cEt, and the like. In some embodiments, a palm-controlled (and/or stereochemically pure) formulation provided comprises an oligonucleotide comprising one or more 2' modified residues. For example, in some embodiments, the provided oligonucleotide contains one or more residues, which are 2'-O-methoxyethyl (2'-MOE) Modified residue. In some embodiments, the provided palm-controlled (and/or stereochemically pure) formulation comprises an oligonucleotide that does not contain any 2' modifications. In some embodiments, the palm-controlled (and/or stereochemically pure) formulation provided is an oligonucleotide that does not contain any 2'-MOE residues. That is, in some embodiments, the provided oligonucleotides are not modified by MOE. Other exemplary sugar modifications are described herein.

In some embodiments, the provided oligonucleotides have the general motif of a wing-core or core-wing (hemimer, also typically referred to herein as XY or YX, respectively). In some embodiments, the provided oligonucleotides have the general motif of a wing-core-wing (spacer, also commonly referred to herein as XYX). In some embodiments, each wing independently contains one or more residues with a particular modification that is not present in the core "Y" portion. In some embodiments, each wing independently contains one or more residues having a particular nucleoside modification that is not present in the core "Y" moiety. In some embodiments, each wing independently contains one or more residues having a particular base modification that is not present in the core "Y" moiety. In some embodiments, each wing independently contains one or more residues having a particular sugar modification that is not present in the core "Y" moiety. Exemplary sugar modifications are widely known in the art. In some embodiments, the sugar modifications are modifications selected from those modified as described in US9006198, which are incorporated herein by reference. Other exemplary sugar modifications are described herein. In some embodiments, each wing contains one or more residues having a 2' modification that is not present in the core portion. In some embodiments, the 2' modification is 2'-OR ¹ , wherein R ^{1 is} as defined and described in the present invention.

In some embodiments, the provided oligonucleotide has a wing-core motif represented as XY or a core-wing motif represented as YX, wherein the residue at the "X" moiety is a particular type of sugar The residue of the modification and the residue in the core "Y" moiety are the same specific type of unsugar-modified residue. In some embodiments, the provided oligonucleotide has a wing-core-wing motif expressed as XYX, wherein the residue at each "X" moiety is a particular type of sugar modified residue and is at the core The residues in the "Y" portion are the same specific type of unsugar-modified residues. In some embodiments, the provided oligonucleotide has a wing-core motif represented as XY or a core-wing motif represented as YX, wherein the residue at the "X" moiety is a particular type of 2 'Modified residues and residues in the core "Y" moiety are residues of the same specific type that are not 2' modified. In some embodiments, the provided oligonucleotide has a wing-core motif represented as XY, wherein the residue at the "X" moiety is a particular type of 2' modified residue and is at the core "Y" The residues in the section are the same specific types of residues that have not been 2' modified. In some embodiments, the provided oligonucleotide has a core-wing motif represented as YX, wherein the residue at the "X" moiety is a particular type of 2' modified residue and is at the core "Y" The residues in the section are the same specific types of residues that have not been 2' modified. In some embodiments, the provided oligonucleotide has a wing-core-wing motif expressed as XYX, wherein the residue at each "X" moiety is a particular type of 2' modified residue and The residues in the core "Y" part are the same specific type without 2' modification The residue. In some embodiments, the provided oligonucleotide has a wing-core motif represented as XY, wherein the residue at the "X" moiety is a particular type of 2' modified residue and is at the core "Y" The residue in the section is 2'-deoxynucleoside. In some embodiments, the provided oligonucleotide has a core-wing motif represented as YX, wherein the residue at the "X" moiety is a particular type of 2' modified residue and is at the core "Y" The residue in the section is 2'-deoxynucleoside. In some embodiments, the provided oligonucleotide has a wing-core-wing motif expressed as XYX, wherein the residue at each "X" moiety is a particular type of 2' modified residue and The residue in the core "Y" portion is a 2'-deoxynucleoside. In some embodiments, the provided oligonucleotide has a wing-core-wing motif expressed as XYX, wherein the residue at each "X" moiety is a particular type of 2' modified residue and The residue in the core "Y" portion is a 2'-deoxynucleoside. For example, in some embodiments, the provided oligonucleotide has a wing-core-wing motif expressed as XYX, wherein the residue at each "X" moiety is a particular type of 2'-MOE The residue of the modification and the residue in the "Y" portion of the core are residues that have not been modified by 2'-MOE. In some embodiments, the provided oligonucleotide has a wing-core-wing motif expressed as XYX, wherein the residue at each "X" moiety is a 2'-MOE modified residue and is at the core The residue in the "Y" portion is a 2'-deoxynucleoside. Those skilled in the relevant art will recognize that in the context of such X-Y, Y-X and/or X-Y-X motifs, all such 2' modifications described above and herein are contemplated.

In some embodiments, the wings have a length of one or more bases. In some embodiments, the wings have a length of two or more bases. In some embodiments, the wings have a length of three or more bases. In some embodiments, the wings have a length of four or more bases. In some embodiments, the wings have a length of five or more bases. In some embodiments, the wings have a length of six or more bases. In some embodiments, the wings have a length of seven or more bases. In some embodiments, the wings have a length of eight or more bases. In some embodiments, the wings have a length of nine or more bases. In some embodiments, the wings have a length of ten or more bases. In some embodiments, the wings It has a length of 11 or more bases. In some embodiments, the wings have a length of 12 or more bases. In some embodiments, the wings have a length of 13 or more bases. In some embodiments, the wings have a length of 14 or more bases. In some embodiments, the wings have a length of 15 or more bases. In some embodiments, the wings have a length of 16 or more bases. In some embodiments, the wings have a length of 17 or more bases. In some embodiments, the wings have a length of 18 or more bases. In some embodiments, the wings have a length of 19 or more bases. In some embodiments, the wings have a length of ten or more bases.

In some embodiments, the wings have a length of one base. In some embodiments, the wings have a length of two bases. In some embodiments, the wings have a length of three bases. In some embodiments, the wings have a length of four bases. In some embodiments, the wings have a length of five bases. In some embodiments, the wings have a length of six bases. In some embodiments, the wings have a length of seven bases. In some embodiments, the wings have a length of eight bases. In some embodiments, the wings have a length of nine bases. In some embodiments, the wings have a length of ten bases. In some embodiments, the wings have a length of 11 bases. In some embodiments, the wings have a length of 12 bases. In some embodiments, the wings have a length of 13 bases. In some embodiments, the wings have a length of 14 bases. In some embodiments, the wings have a length of 15 bases. In some embodiments, the wings have a length of 16 bases. In some embodiments, the wings have a length of 17 bases. In some embodiments, the wings have a length of 18 bases. In some embodiments, the wings have a length of 19 bases. In some embodiments, the wings have a length of ten bases.

In some embodiments, the wing comprises one or more pairs of palmitic internucleotide linkages. In some embodiments, the wing comprises one or more native phosphate linkages. In some embodiments, the wing comprises one or more pairs of palmitic internucleotide linkages and one or more native phosphate linkages. In some embodiments, the wing comprises one or more pairs of palmitic internucleotide linkages and two or more native phosphate linkages. In some embodiments, the wing comprises one or more pairs of palmitic internucleotide bonds Two or more natural phosphate linkages are combined, wherein two or more natural phosphate linkages are continuous. In some embodiments, the wings are free of inter-nucleotide linkages. In some embodiments, each wing linkage is a native phosphate linkage. In some embodiments, the wings are free of phosphate linkages. In some embodiments, each wing is independently a pair of palmitic internucleotide linkages.

In some embodiments, each wing independently comprises one or more pairs of palmitic internucleotide linkages. In some embodiments, each wing independently comprises one or more native phosphate linkages. In some embodiments, each wing independently comprises one or more pairs of palmitic internucleotide linkages and one or more native phosphate linkages. In some embodiments, each wing independently comprises one or more pairs of palmar internucleotide linkages and two or more native phosphate linkages. In some embodiments, each wing independently comprises one or more pairs of palmitic internucleotide linkages and two or more native phosphate linkages, wherein two or more native phosphate linkages are continuously.

In some embodiments, each wing independently comprises at least one pair of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least two pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least three pairs of palmitic internucleotide linkages. In some embodiments, each wing independently comprises at least four pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least five pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least six pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least seven pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least eight pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least nine pairs of palmitic internucleotide linkages. In some embodiments, each wing independently comprises at least ten pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 11 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 12 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 13 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 14 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 15 pairs of palmar internucleotide linkages Union. In some embodiments, each wing independently comprises at least 16 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 17 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 18 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 19 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 20 pairs of palmar internucleotide linkages.

In some embodiments, each wing independently comprises a pair of palmar internucleotide linkages. In some embodiments, each wing independently comprises two pairs of palmitic internucleotide linkages. In some embodiments, each wing independently comprises three pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises four pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises five pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises six pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises seven pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises eight pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises nine pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises ten pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 11 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 12 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 13 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 14 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 15 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 16 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 17 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 18 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 19 pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 20 pairs of palmar internucleotide linkages.

In some embodiments, each wing independently comprises at least one continuous native phosphate linkage Union. In some embodiments, each wing independently comprises at least two consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least three consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least four consecutive pairs of palmitic internucleotide linkages. In some embodiments, each wing independently comprises at least five consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least six consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least seven consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least eight consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least nine consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least ten consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 11 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 12 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 13 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 14 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 15 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 16 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 17 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 18 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 19 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises at least 20 consecutive pairs of palmar internucleotide linkages.

In some embodiments, each wing independently comprises a continuous native phosphate linkage. In some embodiments, each wing independently comprises two consecutive pairs of palmitic internucleotide linkages. In some embodiments, each wing independently comprises three consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises four consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises five consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises six consecutive pairs of palmar internucleotide linkages. In some implementations In one example, each wing independently comprises seven consecutive pairs of palmitic internucleotide linkages. In some embodiments, each wing independently comprises eight consecutive pairs of palmitic internucleotide linkages. In some embodiments, each wing independently comprises nine consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises ten consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 11 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 12 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 13 consecutive pairs of palmitic internucleotide linkages. In some embodiments, each wing independently comprises 14 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 15 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 16 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 17 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 18 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 19 consecutive pairs of palmar internucleotide linkages. In some embodiments, each wing independently comprises 20 consecutive pairs of palmar internucleotide linkages.

In some embodiments, each wing independently comprises at least one native phosphate linkage. In some embodiments, each wing independently comprises at least two native phosphate linkages. In some embodiments, each wing independently comprises at least three native phosphate linkages. In some embodiments, each wing independently comprises at least four natural phosphate linkages. In some embodiments, each wing independently comprises at least five natural phosphate linkages. In some embodiments, each wing independently comprises at least six natural phosphate linkages. In some embodiments, each wing independently comprises at least seven natural phosphate linkages. In some embodiments, each wing independently comprises at least eight native phosphate linkages. In some embodiments, each wing independently comprises at least nine natural phosphate linkages. In some embodiments, each wing independently comprises at least ten natural phosphate linkages. In some embodiments, each wing independently comprises at least 11 natural phosphate linkages. In some embodiments, each wing independently comprises at least 12 natural phosphate linkages. In some embodiments, each wing independently comprises at least 13 natural phosphate linkages. In some embodiments Wherein each wing independently comprises at least 14 natural phosphate linkages. In some embodiments, each wing independently comprises at least 15 natural phosphate linkages. In some embodiments, each wing independently comprises at least 16 natural phosphate linkages. In some embodiments, each wing independently comprises at least 17 native phosphate linkages. In some embodiments, each wing independently comprises at least 18 natural phosphate linkages. In some embodiments, each wing independently comprises at least 19 natural phosphate linkages. In some embodiments, each wing independently comprises at least 20 natural phosphate linkages.

In some embodiments, each wing independently comprises a native phosphate linkage. In some embodiments, each wing independently comprises two native phosphate linkages. In some embodiments, each wing independently comprises three natural phosphate linkages. In some embodiments, each wing independently comprises four natural phosphate linkages. In some embodiments, each wing independently comprises five natural phosphate linkages. In some embodiments, each wing independently comprises six natural phosphate linkages. In some embodiments, each wing independently comprises seven natural phosphate linkages. In some embodiments, each wing independently comprises eight natural phosphate linkages. In some embodiments, each wing independently comprises nine natural phosphate linkages. In some embodiments, each wing independently comprises ten natural phosphate linkages. In some embodiments, each wing independently comprises 11 natural phosphate linkages. In some embodiments, each wing independently comprises 12 natural phosphate linkages. In some embodiments, each wing independently comprises 13 natural phosphate linkages. In some embodiments, each wing independently comprises 14 natural phosphate linkages. In some embodiments, each wing independently comprises 15 natural phosphate linkages. In some embodiments, each wing independently comprises 16 natural phosphate linkages. In some embodiments, each wing independently comprises 17 natural phosphate linkages. In some embodiments, each wing independently comprises 18 natural phosphate linkages. In some embodiments, each wing independently comprises 19 natural phosphate linkages. In some embodiments, each wing independently comprises 20 natural phosphate linkages.

In some embodiments, each wing independently comprises at least one continuous native phosphate linkage. In some embodiments, each wing independently comprises at least two consecutive native phosphate linkages Union. In some embodiments, each wing independently comprises at least three consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least four consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least five consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least six consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least seven consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least eight consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least nine consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least ten consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 11 consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 12 consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 13 consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 14 consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 15 consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 16 consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 17 consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 18 consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 19 consecutive native phosphate linkages. In some embodiments, each wing independently comprises at least 20 consecutive native phosphate linkages.

In some embodiments, each wing independently comprises a continuous native phosphate linkage. In some embodiments, each wing independently comprises two consecutive native phosphate linkages. In some embodiments, each wing independently comprises three consecutive native phosphate linkages. In some embodiments, each wing independently comprises four consecutive native phosphate linkages. In some embodiments, each wing independently comprises five consecutive native phosphate linkages. In some embodiments, each wing independently comprises six consecutive native phosphate linkages. In some embodiments, each wing independently comprises seven consecutive native phosphate linkages. In some embodiments, each wing independently contains eight links Continued natural phosphate linkage. In some embodiments, each wing independently comprises nine consecutive native phosphate linkages. In some embodiments, each wing independently comprises ten consecutive native phosphate linkages. In some embodiments, each wing independently comprises 11 consecutive native phosphate linkages. In some embodiments, each wing independently comprises 12 consecutive native phosphate linkages. In some embodiments, each wing independently comprises 13 consecutive native phosphate linkages. In some embodiments, each wing independently comprises 14 consecutive native phosphate linkages. In some embodiments, each wing independently comprises 15 consecutive native phosphate linkages. In some embodiments, each wing independently comprises 16 consecutive native phosphate linkages. In some embodiments, each wing independently comprises 17 consecutive native phosphate linkages. In some embodiments, each wing independently comprises 18 consecutive native phosphate linkages. In some embodiments, each wing independently comprises 19 consecutive native phosphate linkages. In some embodiments, each wing independently comprises 20 consecutive native phosphate linkages.

In some embodiments, the wing comprises only one pair of palmar internucleotide linkages. In some embodiments, the 5' end wing comprises only one pair of palmar internucleotide linkages. In some embodiments, the 5' end wing comprises only one pair of palmar internucleotide linkages at the 5' end of the wing. In some embodiments, the 5 'end of a wing flap contains only the 5' end of the inter-nucleotide linkages palm, palm and the inter-nucleotide linkage is R p. In some embodiments, the 5' end wing comprises only one pair of palmitic internucleotide linkages at the 5' end of the wing and the inter-nucleotide linkage to Sp . In some embodiments, the 3' end wing comprises only one pair of palmitic internucleotide linkages at the 3' end of the wing. In some embodiments, the 3 'end of a wing flap contains only the 3' end of the inter-nucleotide linkages palm, palm and the inter-nucleotide linkage is R p. In some embodiments, the 3' end wing comprises only one pair of palmitic internucleotide linkages at the 3' end of the wing and the inter-nucleotide linkage to Sp .

In some embodiments, the wing comprises two or more native phosphate linkages. In some embodiments, all phosphate linkages within the wing are continuous and there is no non-phosphate linkage between any two phosphate linkages within the wing.

In some embodiments, when a bond is described (eg, bond chemistry, bonded stereochemistry, etc.), the bond between the link and the core is considered to be part of the core. For example, in WV-1092 (mG*SmGmCmAmC *S A*SA*SG*SG*SG*SC*SA*SC*RA*SG *S mAmCmUmU*SmC), the underline keying can be regarded as the core (thick One part of the body, its 5' wing (having 2'-OMe on the sugar moiety) has a single Sp phosphorothioate linkage at its 5' end, its 3' wing (having 2' on the sugar moiety) -OMe) has a S phosphorothioate linkage at its 3' end and no 2' modification on the sugar in its core.

In some embodiments, the 5'-nucleotide linkage to the sugar moiety without the 2' modification is a modified linkage. In some embodiments, the 5'-nucleotide linkage to the sugar moiety without the 2' modification is a linkage having the structure of Formula I. In some embodiments, the 5'-nucleotide linkage to the sugar moiety without the 2' modification is a phosphorothioate linkage. In some embodiments, the 5'-nucleotide linkage to the sugar moiety without the 2' modification is a substituted phosphorothioate linkage. In some embodiments, the 5'-nucleotide linkage to the sugar moiety without the 2' modification is a phosphorothioate triester linkage. In some embodiments, each 5'-nucleotide linkage to a sugar moiety without a 2' modification is a modified linkage. In some embodiments, each 5'-nucleotide linkage to a sugar moiety without a 2' modification is a linkage having the structure of Formula I. In some embodiments, each 5'-nucleotide linkage linked to a 2'-modified sugar moiety is a phosphorothioate linkage. In some embodiments, each 5'-nucleotide linkage to a sugar moiety without a 2' modification is a substituted phosphorothioate linkage. In some embodiments, each 5'-nucleotide linkage to a sugar moiety without a 2' modification is a phosphorothioate triester linkage.

In some embodiments, the 3'-nucleotide linkage to the sugar moiety without the 2' modification is a modified linkage. In some embodiments, the 3'-nucleotide linkage to the sugar moiety without the 2' modification is a linkage having the structure of Formula I. In some embodiments, the 3'-nucleotide linkage to the sugar moiety without the 2' modification is a phosphorothioate linkage. In some embodiments, the 3'-nucleotide linkage to the sugar moiety without the 2' modification is a substituted phosphorothioate linkage. In some embodiments, the 3'-nucleotide linkage to the sugar moiety without the 2' modification is a phosphorothioate triester linkage. In some embodiments, each 3'-nucleotide linkage linked to a 2'-modified sugar moiety is a modified linkage. In some embodiments, each 3'-nucleotide linkage to a sugar moiety without a 2' modification is a linkage having the structure of Formula I. In some embodiments, each 3'-nucleotide linkage to a sugar moiety without a 2' modification is a phosphorothioate linkage. In some embodiments, each 3'-nucleotide linkage to a sugar moiety without a 2' modification is a substituted phosphorothioate linkage. In some embodiments, each 3'-nucleotide linkage linked to a 2'-modified sugar moiety is a phosphorothioate triester linkage.

In some embodiments, the two internucleotide linkages linked to the 2' modified sugar moiety are modified linkages. In some embodiments, the two internucleotide linkages attached to the sugar moiety without the 2' modification are all linkages having the structure of Formula I. In some embodiments, the two internucleotide linkages linked to the 2' modified sugar moiety are phosphorothioate linkages. In some embodiments, the two internucleotide linkages attached to the 2' modified sugar moiety are substituted phosphorothioate linkages. In some embodiments, the two internucleotide linkages linked to the 2' modified sugar moiety are phosphorothioate triester linkages. In some embodiments, the inter-nucleotide linkages linked to the 2'-modified sugar moiety are modified linkages. In some embodiments, the internucleotide linkages linked to the 2' modified sugar moiety are linkages having the structure of Formula I. In some embodiments, the internucleotide linkages linked to the 2' modified sugar moiety are phosphorothioate linkages. In some embodiments, each internucleotide linkage linked to a 2' modified sugar moiety is a substituted phosphorothioate linkage. In some embodiments, the internucleotide linkages linked to the 2' modified sugar moiety are phosphorothioate triester linkages.

In some embodiments, the 2'-modified sugar moiety is a sugar moiety present in the native DNA nucleoside.

In some embodiments, with respect to the wing-core-wing structure, the 5' end wing comprises only one pair of palmar internucleotide linkages. In some embodiments, with respect to the wing-core-wing structure, the 5' end wing comprises only one pair of palmar internucleotide linkages at the 5' end of the wing. In some embodiments, with respect to the wing-core-wing structure, the 3' end wing comprises only one pair of palmar internucleotide linkages. In some embodiments, with respect to the wing-core-wing structure, the 3' end wing comprises only one pair of palmar internucleotide linkages at the 3' end of the wing. In some embodiments, with respect to the wing-core-wing structure, each wing comprises only one pair of palmar internucleotide linkages. In some embodiments, with respect to the wing-core-wing structure, each wing comprises only one pair of palmar internucleotide linkages, wherein the 5' end wing comprises only one pair of palmitic nucleotides at its 5' end The linkage; and the 3' end wing comprises only one pair of palmitic internucleotide linkages at its 3' end. In some embodiments, the 5 'wing to the sole linkage between nucleotides palm of R p. In some embodiments, the only pair of palmitic internucleotide linkages in the 5' wing is Sp . In some embodiments, the 3 'wing of the sole linkage between nucleotides palm of R p. In some embodiments, the only pair of palmitic internucleotide linkages in the 3' wing is Sp . In some embodiments, the only pair of palmitic internucleotide linkages in the 5' wing and the 3' wing are Sp . In some embodiments, the 5 'wing and the 3' wing of the sole between the p chiral nucleotide linkages are R. In some embodiments, the 5 'wing to the sole linkage between nucleotides of palm S p, and the 3' wing of the sole linkage between nucleotides palm of R p. In some embodiments, the 5 'wing to the sole linkage between nucleotides palm is R p, and the 3' wing of the sole linkage between nucleotides of palm S p.

In some embodiments, the wing comprises two pairs of palmitic internucleotide linkages. In some embodiments, the wing comprises only two pairs of palmitic internucleotide linkages and one or more native phosphate linkages. In some embodiments, the wing comprises only two pairs of palmitic internucleotide linkages and two or more native phosphate linkages. In some embodiments, the wing comprises only two pairs of palmitic internucleotide linkages and two or more consecutive native phosphate linkages. In some embodiments, the wing comprises only two pairs of palmitic internucleotide linkages and two consecutive native phosphate linkages. In some embodiments, the wing comprises only two pairs of palmitic internucleotide linkages and three consecutive native phosphate linkages. In some embodiments, the 5' wing (to the core) comprises only two pairs of palmitic internucleotide linkages, one at its 5' end and the other at its 3' end, with one or more A natural phosphate linkage. In some embodiments, the 5' wing (to the core) comprises only two pairs of palmitic internucleotide linkages, one at its 5' end and the other at its 3' end, with two or More natural phosphate linkages. In some embodiments, the 3' wing (to the core) comprises only two pairs of palmitic internucleotide linkages, one at its 3' end and the other at its 3' end, with one or more One Natural phosphate linkages. In some embodiments, the 3' wing (to the core) comprises only two pairs of palmitic internucleotide linkages, one at its 3' end and the other at its 3' end, with two or More natural phosphate linkages.

In some embodiments, the 5' wing comprises only two pairs of palmitic internucleotide linkages, one at its 5' end and the other at its 3' end, with one or more natural phosphates in between The linkage; and the 3' wing contains only one internucleotide linkage at its 3' end. In some embodiments, the 5' wing (to the core) comprises only two pairs of palmitic internucleotide linkages, one at its 5' end and the other at its 3' end, with two or More natural phosphate linkages; and the 3' wing contains only one internucleotide linkage at its 3' end. In some embodiments, each pair of palmitic internucleotide linkages independently has its own stereochemistry. In some embodiments, two of the 5' wings have the same stereochemistry for palmar internucleotide linkages. In some embodiments, two of the 5' wings have different stereochemistry for palmar internucleotide linkages. In some embodiments, the two wings 5 'p inter-nucleotide linkages are chiral R. In some embodiments, the two pairs of palmar internucleotide linkages in the 5' wing are both Sp . In some embodiments, the palmar internucleotide linkages in the 5' wing and the 3' wing have the same stereochemistry. In some embodiments, the 5 'wing and the 3' wing of the inter-nucleotide linkage is chiral R p. In some embodiments, the inter-nucleotide linkages in the 5'-wing and the 3'-wing are Sp . In some embodiments, the palmar internucleotide linkages in the 5' wing and the 3' wing have different stereochemistry.

In some embodiments, the core region has a length of one or more bases. In some embodiments, the core region has a length of two or more bases. In some embodiments, the core region has a length of three or more bases. In some embodiments, the core region has a length of four or more bases. In some embodiments, the core region has a length of five or more bases. In some embodiments, the core region has a length of six or more bases. In some embodiments, the core region has a length of seven or more bases. In some embodiments, the core region has a length of eight or more bases. In some embodiments, the core region has a length of nine or more bases. In some embodiments, the core region has The length of ten or more bases. In some embodiments, the core region has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or more bases. In certain embodiments, the core region has a length of 11 or more bases. In certain embodiments, the core region has a length of 12 or more bases. In certain embodiments, the core region has a length of 13 or more bases. In certain embodiments, the core region has a length of 14 or more bases. In certain embodiments, the core region has a length of 15 or more bases. In certain embodiments, the core region has a length of 16 or more bases. In certain embodiments, the core region has a length of 17 or more bases. In certain embodiments, the core region has a length of 18 or more bases. In certain embodiments, the core region has a length of 19 or more bases. In certain embodiments, the core region has a length of 20 or more bases. In certain embodiments, the core region has a length of more than 20 bases. In certain embodiments, the core region has a length of 2 bases. In certain embodiments, the core region has a length of 3 bases. In certain embodiments, the core region has a length of 4 bases. In certain embodiments, the core region has a length of 5 bases. In certain embodiments, the core region has a length of 6 bases. In certain embodiments, the core region has a length of 7 bases. In certain embodiments, the core region has a length of 8 bases. In certain embodiments, the core region has a length of 9 bases. In certain embodiments, the core region has a length of 10 bases. In certain embodiments, the core region has a length of 11 bases. In certain embodiments, the core region has a length of 12 bases. In certain embodiments, the core region has a length of 13 bases. In certain embodiments, the core region has a length of 14 bases. In certain embodiments, the core region has a length of 15 bases. In certain embodiments, the core region has a length of 16 bases. In certain embodiments, the core region has a length of 17 bases. In certain embodiments, the core region has a length of 18 bases. In certain embodiments, the core region has a length of 19 bases. In certain embodiments, the core region has a length of 20 bases.

In some embodiments, the core comprises one or more pairs of palmitic internucleotide linkages. in In some embodiments, the core comprises one or more natural phosphate linkages. In some embodiments, the core independently comprises one or more pairs of palmitic internucleotide linkages and one or more native phosphate linkages. In some embodiments, the core is free of phosphate linkages. In some embodiments, each core linkage is a pair of palmitic internucleotide linkages.

In some embodiments, the core comprises at least one natural phosphate linkage. In some embodiments, the core comprises at least two pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least three pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least four pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least five pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least six pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least seven pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least eight pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least nine pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least ten pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 11 pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 12 pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 13 pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 14 pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 15 pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 16 pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 17 pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 18 pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 19 pairs of palmar internucleotide linkages. In some embodiments, the core comprises at least 20 pairs of palmar internucleotide linkages.

In some embodiments, the core comprises a native phosphate linkage. In some embodiments, the core comprises two pairs of palmitic internucleotide linkages. In some embodiments, the core comprises three pairs of palmar internucleotide linkages. In some embodiments, the core comprises four pairs of palmitic internucleotide linkages. In some embodiments, the core comprises five pairs of internucleotide internucleotide bonds Union. In some embodiments, the core comprises six pairs of palmitic internucleotide linkages. In some embodiments, the core comprises seven pairs of palmar internucleotide linkages. In some embodiments, the core comprises eight pairs of palmitic internucleotide linkages. In some embodiments, the core comprises nine pairs of palmar internucleotide linkages. In some embodiments, the core comprises ten pairs of palmar internucleotide linkages. In some embodiments, the core comprises 11 pairs of palmitic internucleotide linkages. In some embodiments, the core comprises 12 pairs of palmar internucleotide linkages. In some embodiments, the core comprises 13 pairs of palmar internucleotide linkages. In some embodiments, the core comprises 14 pairs of palmar internucleotide linkages. In some embodiments, the core comprises 15 pairs of palmitic internucleotide linkages. In some embodiments, the core comprises 16 pairs of palmar internucleotide linkages. In some embodiments, the core comprises 17 pairs of palmar internucleotide linkages. In some embodiments, the core comprises 18 pairs of palmar internucleotide linkages. In some embodiments, the core comprises 19 pairs of palmar internucleotide linkages. In some embodiments, the core comprises 20 pairs of palmitic internucleotide linkages.

In some embodiments, the core-to-palm center mode of the core region comprises ( S p ) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , wherein m, n, t and N p are each independently defined and described in the present invention. In some embodiments, the core-to-palm center mode of the core region comprises ( S p ) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m . In some embodiments, the core-to-palm center mode of the core region comprises ( S p ) _m ( R p) _n . In some embodiments, the backbone of the core region comprises a chiral center mode _{(S p) m (R p} ) n, where m> 2 and n is 1. In some embodiments, the backbone of the core region comprising a pattern chiral center _{(R p) n (S p} ) m. In some embodiments, the backbone of the core region comprising a pattern chiral center _{(R p) n (S p} ) m, where m> 2 and n is 1. In some embodiments, the core-to-palm center mode of the core region comprises ( N p) _t ( R p) _n ( S p) _m . In some embodiments, the core-to-palm center mode of the core region comprises ( N p) _t ( R p) _n ( S p) _m , where m>2 and n is 1. In some embodiments, the core-to-palm center mode of the core region comprises ( N p) _t ( R p) _n ( S p) _m , where t>2, m>2, and n is 1. In some embodiments, the core-to-palm center mode of the core region comprises ( S p ) _t ( R p) _n ( S p) _m . In some embodiments, the core-to-palm center mode of the core region comprises ( S p ) _t ( R p) _n ( S p) _m , where m>2 and n is 1. In some embodiments, the core-to-palm center mode of the core region comprises ( S p ) _t ( R p) _n ( S p) _m , where t>2, m>2, and n is 1. In particular, the present invention demonstrates that, in some embodiments, such modes can provide and/or enhance controlled cleavage of a target sequence (e.g., an RNA sequence), improved cleavage rate, selectivity, and the like. An exemplary backbone-to-palm center mode is described in the present invention.

In some embodiments, at least 60% of the palmar internucleotide linkages in the core region are Sp . In some embodiments, at least 65% of the palmar internucleotide linkages in the core region are Sp . In some embodiments, at least 66% of the palmar internucleotide linkages in the core region are Sp . In some embodiments, at least 67% of the palmar internucleotide linkages in the core region are Sp . In some embodiments, at least 70% of the palmar internucleotide linkages in the core region are Sp . In some embodiments, at least 75% of the palmar internucleotide linkages in the core region are Sp . In some embodiments, at least 80% of the palmar internucleotide linkages in the core region are Sp . In some embodiments, at least 85% of the palmar internucleotide linkages in the core region are Sp . In some embodiments, at least 90% of the palmar internucleotide linkages in the core region are Sp . In some embodiments, at least 95% of the palmar internucleotide linkages in the core region are Sp .

In some embodiments, the wing-core-wing (ie, XYX) motif is represented numerically by, for example, 5-10-4, meaning that the length of the wing attached to the 5' end of the core is 5 bases, the core region The length is 10 bases, and the wing region attached to the 3' end of the core is 4 bases in length. In some embodiments, the wing-core-wing primitive is any of the following: for example 2-16-2, 3-14-3, 4-12-4, 5-10-5, 2-9- 6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-3, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 8-7-5, 7-7-6, 5-9-3, 5-9-5, 5- 10-4, 5-10-5, 6-7-6, 6-8-5 and 6-9-2, etc. In certain embodiments, the wing-core-wing primitive is 5-10-5. In certain embodiments, the wing-core-wing primitive is 7-7-6. In certain embodiments, the wing-core-wing primitive is 8-7-5.

In some embodiments, the wing-core elements are 5-15, 6-14, 7-13, 8-12, 9-12, and the like. In some embodiments, the core-wing elements are 5-15, 6-14, 7-13, 8-12, 9-12, and the like.

In some embodiments, the internucleoside linkages of the oligonucleotides provided by the istel-core-wing (ie, XYX) motif are modified palmitic phosphate linkages. In some embodiments, the internucleoside linkages of the oligonucleotides provided by the istel-core-wing (ie, XYX) motif are internucleotide linkages to the palmitic phosphorothioate. In some embodiments, the equi-nucleotide linkage of the oligonucleotide provided by the isol-core-wing motif is at least about 10%, 20%, 30%, 40%, 50%, 50%, 70%, 80% or 90% modified palmitic phosphate internucleotide linkage. In some embodiments, the equi-nucleotide linkage of the oligonucleotide provided by the isol-core-wing motif is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the palmitic phosphorothioate internucleotide linkages. In some embodiments, the equi-nucleotide linkage of the oligonucleotide provided by the isol-core-wing motif is at least about 10%, 20%, 30%, 40%, 50%, 50%, 70%, 80% or 90% were S p configuration of a chiral phosphorothioate internucleotide linkage.

In some embodiments, the wing regions of the wing-core-wing motif optionally contain modified palmitic phosphate internucleotide linkages. In some embodiments, the wing regions of the wing-core-wing motif optionally contain internucleotide linkages to the palmitic phosphorothioate. In some embodiments, each wing region of a wing-core-wing motif contains an internucleotide linkage to a palmitic phosphorothioate. In some embodiments, the two wing regions of the wing-core-wing motif have the same internucleotide linkage stereochemistry. In some embodiments, the two wing regions have different internucleotide linkage stereochemistry. In some embodiments, the internucleotide linkages in the wings are independently a pair of palmitic internucleotide linkages.

In some embodiments, the core region of the wing-core-wing motif optionally contains a modified pair of palmitic phosphate internucleotide linkages. In some embodiments, the core region of the wing-core-wing motif optionally contains an internucleotide linkage to the palmitic phosphorothioate. In some embodiments, the core region of the wing-core-wing motif comprises a repeating pattern of internucleotide linkage stereochemistry. In some embodiments, the core region of the wing-core-wing motif has a repeating pattern of internucleotide linkage stereochemistry. In some embodiments, the core region of the wing-core-wing motif comprises a repeating pattern of internucleotide linkage stereochemistry, wherein the repeating pattern is ( Sp ) _m R p or R p( S p) _m , Where m is 1-50. In some embodiments, the core region of the wing-core-wing motif comprises a repeating pattern of internucleotide linkage stereochemistry, wherein the repeating pattern is ( Sp ) _m R p or R p( S p) _m , Where m is 1-50. In some embodiments, the wing - Core - wing motif of the core region comprising a repeating pattern of inter-nucleotide linkages of stereochemistry, wherein the repeating pattern is (S p) _m R p, wherein m is 1-50. In some embodiments, the wing - Core - wing motif of the core region comprising a repeating pattern of inter-nucleotide linkages of stereochemistry, wherein the repeating pattern of R p (S p) _m, wherein m is 1-50. In some embodiments, the core region of the wing-core-wing motif has a repeating pattern of internucleotide linkage stereochemistry, wherein the repeating pattern is ( Sp ) _m R p or R p( S p) _m , Where m is 1-50. In some embodiments, the wing - Core - wing motif of the core region having a repeating pattern of inter-nucleotide linkages of stereochemistry, wherein the repeating pattern is (S p) _m R p, wherein m is 1-50. In some embodiments, the wing - Core - The core motif wing region having a repeating pattern of inter-nucleotide linkages of stereochemistry, wherein the repeating pattern of R p (S p) _m, wherein m is 1-50. In some embodiments, the core region of the wing-core-wing motif has a repeating pattern of internucleotide linkage stereochemistry, wherein the repeat pattern is an internucleotide linkage comprising at least 33% S conformation Primitive. In some embodiments, the core region of the wing-core-wing motif has a repeating pattern of internucleotide linkage stereochemistry, wherein the repeat pattern is an internucleotide linkage comprising at least 50% S conformation Primitive. In some embodiments, the core region of the wing-core-wing motif has a repeating pattern of internucleotide linkage stereochemistry, wherein the repeat pattern is an internucleotide linkage comprising at least 66% S conformation Primitive. In some embodiments, the core region of the wing-core-wing motif has a repeating pattern of internucleotide linkage stereochemistry, wherein the repeat pattern is selected from the group consisting of R p R p S p and S p S p R p Repeat the triplet primitive. In some embodiments, the core region of the wing-core-wing motif has a repeating pattern of internucleotide linkage stereochemistry, wherein the repeat pattern is a repeating R p R p S p . In some embodiments, the core region of the wing-core-wing motif has a repeating pattern of internucleotide linkage stereochemistry, wherein the repeat pattern is a repeating S p S p R p .

In some embodiments, the present invention provides an oligonucleotide chiral oligonucleotide type of controlled composition, the main chain of the core region comprises a chiral center mode (S p) _m R p or R p( S p) _m . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition having a backbone-to-palm center pattern in the core region comprising R p( S p) _m . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a backbone-to-palm center pattern in the core region comprising ( Sp ) _m R p . In some embodiments, m is 2. In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition having a backbone-to-palm center pattern in the core region comprising R p( S p) ₂ . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition having a backbone-to-palm center pattern in the core region comprising ( S p) ₂ R p( S p) ₂ . In some embodiments, the present invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition having a backbone-to-palm center pattern in the core region comprising ( R p) ₂ R p( S p) ₂ . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition, wherein the backbone-to-palm center pattern in the core region comprises R p S p R p( S p ) ₂ . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition, wherein the backbone-to-palm center pattern in the core region comprises S p R p R p( S p ) ₂ . In some embodiments, the present invention provides an oligonucleotide chiral nucleotide oligonucleotide type of controlled composition, the main chain of the core region comprises a chiral center mode (S p) ₂ R p.

In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a backbone-to-palm center pattern comprising ( S p) _m R p or R p( S p ) _m . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a main chain-to-palm central mode comprising R p( S p) _m . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising ( S p) _m R p in a backbone-to-palm center mode. In some embodiments, m is 2. In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a main chain-to-palm central mode comprising R p( S p) ₂ . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising ( S p) ₂ R p( S p) _{2 in a} backbone-to-palm central mode. In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising ( R p) ₂ R p( S p) _{2 in a} backbone-to-palm central mode. In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a main chain-to-palm central mode comprising R p S p R p( S p) ₂ . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a backbone-to-palm center pattern comprising S p R p R p( S p) ₂ . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising ( S p) ₂ R p in a backbone-to-palm center mode.

m is 1-50 as defined herein. In some embodiments, m is one. In some embodiments, m is 2-50. In some embodiments, m is 2, 3, 4, 5, 6, 7, or 8. In some embodiments, m is 3, 4, 5, 6, 7, or 8. In some embodiments, m is 4, 5, 6, 7, or 8. In some embodiments, m is 5, 6, 7, or 8. In some embodiments, m is 6, 7, or 8. In some embodiments, m is 7 or 8. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5. In some embodiments, m is 6. In some embodiments, m is 7. In some embodiments, m is 8. In some embodiments, m is 9. In some embodiments, m is 10. In some embodiments, m is 11. In some embodiments, m is 12. In some embodiments, m is 13. In some embodiments, m is 14. In some embodiments, m is 15. In some embodiments, m is 16. In some embodiments, m is 17. In some embodiments, m is 18. In some embodiments, m is 19. In some embodiments, m is 20. In some embodiments, m is 21. In some embodiments, m is 22. In some real In the example, m is 23. In some embodiments, m is 24. In some embodiments, m is 25. In some embodiments, m is greater than 25.

In some embodiments, the repeating pattern is _{(S p) m (R p} ) n, where n is 1-10, and m is independently as defined above and described herein. In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising ( S p) _m ( R p) _{n in a} backbone-to-palm center mode. In some embodiments, the present invention provides an oligonucleotide chiral oligonucleotide type of controlled composition, the main chain of the core region comprises a chiral center mode _{(S p) m (R p} ) _n . In some embodiments, the repeating pattern is _{(R p) n (S p} ) m, wherein n is 1-10, and m is independently as defined above and described herein. In some embodiments, the present invention provides an oligonucleotide chiral nucleotide oligonucleotide type of controlled composition, its backbone chiral centers modes include _{(R p) n (S p} ) m. In some embodiments, the present invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a backbone-to-palm center pattern in the core region comprising ( R p) _n ( S p) _m . In some embodiments, ( R p) _n ( S p) _m is ( R p)( S p) ₂ . In some embodiments, ( S p) _n ( R p) _m is ( S p) ₂ ( R p).

In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a backbone-to-palm center pattern comprising ( S p) _m ( R p) _n ( S p ) _t . In some embodiments, the repeating pattern is _{(S p) m (R p} ) n (S p) t, wherein n is 1-10, t is 1-50, and m are as defined above and described herein. In some embodiments, the present invention provides an oligonucleotide chiral oligonucleotide type of controlled composition, the main chain of the core region comprises a chiral center mode _{(S p) m (R p} ) _n ( S p) _t . In some embodiments, the repeating pattern is _{(S p) t (R p} ) n (S p) m, wherein n is 1-10, t is 1-50, and m are as defined above and described herein. In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a backbone-to-palm center pattern comprising ( S p) _t ( R p) _n ( S p ) _m . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a backbone-to-palm center pattern in the core region comprising ( S p) _t ( R p) _n ( S p) _m .

In some embodiments, the repeating pattern is ( N p) _t ( R p) _n ( S p) _m , where n is 1-10, t is 1-50, and N p is independently R p or Sp , and m is as defined above and as described herein. In some embodiments, the present invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a main chain-to-palm central mode comprising ( N p) _t ( R p) _n ( S p ) _m . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a backbone-to-palm center pattern in the core region comprising ( N p) _t ( R p) _n ( S p) _m . In some embodiments, the repeating pattern is ( N p) _m ( R p) _n ( S p) _t , where n is 1-10, t is 1-50, and N p is independently R p or Sp , and m is as defined above and as described herein. In some embodiments, the present invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a main chain-to-palm center pattern comprising ( N p) _m ( R p) _n ( S p ) _t . In some embodiments, the invention provides an oligonucleotide-type, palm-controlled oligonucleotide composition comprising a backbone-to-palm center pattern in the core region comprising ( N p) _m ( R p) _n ( S p) _t . In some embodiments, N p is R p . In some embodiments, N p is Sp . In some embodiments, all N p are the same. In some embodiments, all N p are S p . In some embodiments, the at least one N p N p different from the other. In some embodiments, t is 2.

As defined herein, n is 1-10. In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, or 8. In some embodiments, n is one. In some embodiments, n is 2, 3, 4, 5, 6, 7, or 8. In some embodiments, n is 3, 4, 5, 6, 7, or 8. In some embodiments, n is 4, 5, 6, 7, or 8. In some embodiments, n is 5, 6, 7, or 8. In some embodiments, n is 6, 7, or 8. In some embodiments, n is 7 or 8. In some embodiments, n is one. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6. In some embodiments, n is 7. In some embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10.

As defined herein, t is 1-50. In some embodiments, t is one. In some embodiments, t is 2-50. In some embodiments, t is 2, 3, 4, 5, 6, 7, or 8. In some embodiments, t is 3, 4, 5, 6, 7, or 8. In some embodiments, t is 4, 5, 6, 7 or 8. In some embodiments, t is 5, 6, 7, or 8. In some embodiments, t is 6, 7, or 8. In some embodiments, t is 7 or 8. In some embodiments, t is 2. In some embodiments, t is 3. In some embodiments, t is 4. In some embodiments, t is 5. In some embodiments, t is 6. In some embodiments, t is 7. In some embodiments, t is 8. In some embodiments, t is 9. In some embodiments, t is 10. In some embodiments, t is 11. In some embodiments, t is 12. In some embodiments, t is 13. In some embodiments, t is 14. In some embodiments, t is 15. In some embodiments, t is 16. In some embodiments, t is 17. In some embodiments, t is 18. In some embodiments, t is 19. In some embodiments, t is 20. In some embodiments, t is 21. In some embodiments, t is 22. In some embodiments, t is 23. In some embodiments, t is 24. In some embodiments, t is 25. In some embodiments, t is greater than 25.

In some embodiments, at least one of m and t is greater than two. In some embodiments, at least one of m and t is greater than three. In some embodiments, at least one of m and t is greater than four. In some embodiments, at least one of m and t is greater than 5. In some embodiments, at least one of m and t is greater than 6. In some embodiments, at least one of m and t is greater than seven. In some embodiments, at least one of m and t is greater than 8. In some embodiments, at least one of m and t is greater than 9. In some embodiments, at least one of m and t is greater than 10. In some embodiments, at least one of m and t is greater than 11. In some embodiments, at least one of m and t is greater than 12. In some embodiments, at least one of m and t is greater than 13. In some embodiments, at least one of m and t is greater than 14. In some embodiments, at least one of m and t is greater than 15. In some embodiments, at least one of m and t is greater than 16. In some embodiments, at least one of m and t is greater than 17. In some embodiments, at least one of m and t is greater than 18. In some embodiments, at least one of m and t is greater than 19. In some embodiments, at least one of m and t is greater than 20. In some embodiments, at least one of m and t is greater than 21. In some embodiments, at least one of m and t is greater than 22. In some embodiments, at least one of m and t is greater than 23. In some embodiments, At least one of m and t is greater than 24. In some embodiments, at least one of m and t is greater than 25.

In some embodiments, each of m and t is greater than two. In some embodiments, each of m and t is greater than three. In some embodiments, each of m and t is greater than four. In some embodiments, each of m and t is greater than five. In some embodiments, each of m and t is greater than 6. In some embodiments, each of m and t is greater than seven. In some embodiments, each of m and t is greater than eight. In some embodiments, each of m and t is greater than 9. In some embodiments, each of m and t is greater than 10. In some embodiments, each of m and t is greater than 11. In some embodiments, each of m and t is greater than 12. In some embodiments, each of m and t is greater than 13. In some embodiments, each of m and t is greater than 14. In some embodiments, each of m and t is greater than 15. In some embodiments, each of m and t is greater than 16. In some embodiments, each of m and t is greater than 17. In some embodiments, each of m and t is greater than 18. In some embodiments, each of m and t is greater than 19. In some embodiments, each of m and t is greater than 20.

In some embodiments, the sum of m and t is greater than three. In some embodiments, the sum of m and t is greater than four. In some embodiments, the sum of m and t is greater than five. In some embodiments, the sum of m and t is greater than 6. In some embodiments, the sum of m and t is greater than seven. In some embodiments, the sum of m and t is greater than eight. In some embodiments, the sum of m and t is greater than 9. In some embodiments, the sum of m and t is greater than 10. In some embodiments, the sum of m and t is greater than 11. In some embodiments, the sum of m and t is greater than 12. In some embodiments, the sum of m and t is greater than 13. In some embodiments, the sum of m and t is greater than 14. In some embodiments, the sum of m and t is greater than 15. In some embodiments, the sum of m and t is greater than 16. In some embodiments, the sum of m and t is greater than 17. In some embodiments, the sum of m and t is greater than 18. In some embodiments, the sum of m and t is greater than 19. In some embodiments, the sum of m and t is greater than 20. In some embodiments, the sum of m and t is greater than 21. In some embodiments In the middle, the sum of m and t is greater than 22. In some embodiments, the sum of m and t is greater than 23. In some embodiments, the sum of m and t is greater than 24. In some embodiments, the sum of m and t is greater than 25.

In some embodiments, n is 1, and at least one of m and t is greater than one. In some embodiments, n is 1 and m and t are each independently greater than one. In some embodiments, m>n and t>n. In some embodiments, ( S p) _m ( R p) _n ( S p) _t is ( S p) ₂ R p( S p) ₂ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is ( S p) ₂ R p( S p) ₂ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is S p R p( S p) ₂ . In some embodiments, ( N p) _t ( R p) _n ( S p) _m is ( N p) _t R p( S p) _m . In some embodiments, ( N p) _t ( R p) _n ( S p) _m is ( N p) ₂ R p( S p) _m . In some embodiments, ( N p) _t ( R p) _n ( S p) _m is ( R p) ₂ R p( S p) _m . In some embodiments, ( N p) _t ( R p) _n ( S p) _m is ( S p) ₂ R p( S p) _m . In some embodiments, ( N p) _t ( R p) _n ( S p) _m is R p S p R p( S p) _m . In some embodiments, ( N p) _t ( R p) _n ( S p) _m is S p R p R p( S p) _m .

In some embodiments, ( S p) _t ( R p) _n ( S p) _m is S p R p S p S p. In some embodiments, ( S p) _t ( R p) _n ( S p) _m is ( S p) ₂ R p( S p) ₂ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is ( S p) ₃ R p( S p) ₃ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is ( S p) ₄ R p( S p) ₄ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is ( S p) _t R p( S p) ₅ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is S p R p( S p) ₅ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is ( S p) ₂ R p( S p) ₅ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is ( S p) ₃ R p( S p) ₅ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is ( S p) ₄ R p( S p) ₅ . In some embodiments, ( S p) _t ( R p) _n ( S p) _m is ( S p) ₅ R p( S p) ₅ .

In some embodiments, ( S p) _m ( R p) _n ( S p) _t is ( S p) ₂ R p( S p) ₂ . In some embodiments, ( S p) _m ( R p) _n ( S p) _t is ( S p) ₃ R p( S p) ₃ . In some embodiments, ( S p) _m ( R p) _n ( S p) _t is ( S p) ₄ R p( S p) ₄ . In some embodiments, ( S p) _m ( R p) _n ( S p) _t is ( S p) _m R p( S p) ₅ . In some embodiments, ( S p) _m ( R p) _n ( S p) _t is ( S p) ₂ R p( S p) ₅ . In some embodiments, ( S p) _m ( R p) _n ( S p) _t is ( S p) ₃ R p( S p) ₅ . In some embodiments, ( S p) _m ( R p) _n ( S p) _t is ( S p) ₄ R p( S p) ₅ . In some embodiments, ( S p) _m ( R p) _n ( S p) _t is ( S p) ₅ R p( S p) ₅ .

In some embodiments, the core region comprises at least one of R p internucleotide linkage. In some embodiments, the wing - Core - wing motif of the core region comprises at least one R p internucleotide linkage. In some embodiments, the core region comprises at least one Rp phosphorothioate internucleotide linkage. In some embodiments, the core region of the wing-core-wing motif comprises at least one Rp phosphorothioate internucleotide linkage. In some embodiments, the core region of the wing-core-wing motif comprises only one Rp phosphorothioate internucleotide linkage. In some embodiments, the core region comprises between at least two primitives R p nucleotide linkages. In certain embodiments, the wing - Core - wing motif of the core region comprising at least two R p between nucleotide linkages. In some embodiments, the core region of the wing-core-wing motif comprises at least two Rp phosphorothioate internucleotide linkages. In some embodiments, the core region comprising at least three inter-nucleotide linkages R p. In some embodiments, the wing - Core - wing motif of the core region comprising at least three inter-nucleotide linkages R p. In some embodiments, the core region comprises at least three Rp phosphorothioate internucleotide linkages. In some embodiments, the core region of the wing-core-wing motif comprises at least three Rp phosphorothioate internucleotide linkages. In some embodiments, the core region comprising at least nine, or ten R p internucleotide linkage. In some embodiments, the wing - Core - wing motif of the core region comprising at least nine, or ten R p internucleotide linkage. In some embodiments, the core region comprising at least nine, or ten R p phosphorothioate internucleotide linkage. In some embodiments, the wing - Core - wing motif of the core region comprising at least nine, or ten R p phosphorothioate internucleotide linkage.

In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein the residues of each wing region are 2' modified residues. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein the residue of each wing region is a 2'-OR ¹ modified residue. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein the residues of each wing region are 2'-MOE modified residues. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein the residues of each wing region are 2'-OMe modified residues. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein the residue in the core region is a 2'-deoxynucleoside residue. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein all internucleotide linkages are phosphorothioate linkages. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein all internucleotide linkages are for a palmitic phosphorothioate linkage. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein the residues in each wing region are 2' modified residues and the residues in the core region are 2'- An nucleoside residue, and all internucleotide linkages in the core region are linked to a palmitic phosphorothioate. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein the residues in each wing region are 2'-OR ¹ modified residues, and the residues in the core region are 2 '-Deoxynucleoside residues, and all internucleotide linkages in the core region are linked to palmitic phosphorothioate. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein the residues in each wing region are 2'-MOE modified residues and the residues in the core region are 2' - a deoxynucleotide residue, and all internucleotide linkages in the core region are linked to a palmitic phosphorothioate. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein the residues in each wing region are 2'-OMe modified residues and the residues in the core region are 2' - a deoxynucleotide residue, and all internucleotide linkages in the core region are linked to a palmitic phosphorothioate.

In some embodiments, the residue at the "X" wing region is not a 2'-MOE modified residue. In certain embodiments, the wing-core motif is a motif in which the residue in the "X" wing region is not a 2'-MOE modified residue. In certain embodiments, the core-wing motif is a motif in which the residue in the "X" wing region is not a 2'-MOE modified residue. In certain embodiments, the wing-core-wing motif is a motif in which residues at each "X" wing region are not 2'-MOE modified residues. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein residues in each "X" wing region are not 2'-MOE modified residues. In certain embodiments, the wing-core-wing motif is 5-10-5 motif, wherein the residue in the core "Y" region is a 2'-deoxynucleoside residue. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein all internucleotide linkages are phosphorothioate internucleotide linkages. In certain embodiments, the wing-core-wing motif is a 5-10-5 motif, wherein all internucleotide linkages are internucleotide linkages to the palmitic phosphorothioate. In some embodiments, the wing-core-wing primitive is 5-10-5 primitives, wherein The residues in each "X" wing region are not 2'-MOE-modified residues, and the residues in the core "Y" region are 2'-deoxynucleosides, and all internucleotide linkages are Palmitic phosphorothioate internucleotide linkages.

The oligonucleotides and compositions provided are particularly useful for targeting a large number of nucleic acid polymers, as understood by those of ordinary skill in the art. For example, in some embodiments, the provided oligonucleotides and compositions can target transcripts of nucleic acid sequences, wherein the oligonucleotides have a common base sequence (eg, a certain oligonucleotide type) The base sequence) comprises or is a sequence that is complementary to the sequence of the transcript. In some embodiments, the common base sequence comprises a sequence that is complementary to the target sequence. In some embodiments, the common base sequence is a sequence that is complementary to the target sequence. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to the target sequence. In some embodiments, the common base sequence comprises a sequence that is 100% complementary to the target sequence. In some embodiments, the common base sequence is a sequence that is 100% complementary to the target sequence. In some embodiments, the common base sequence in the core comprises or is a sequence that is complementary to the sequence of interest. In some embodiments, the common base sequence in the core comprises a sequence that is complementary to the target sequence. In some embodiments, the common base sequence in the core is a sequence that is % complementary to the target sequence. In some embodiments, the common base sequence in the core comprises or is a sequence that is 100% complementary to the target sequence. In some embodiments, the common base sequence in the core comprises a sequence that is 100% complementary to the target sequence. In some embodiments, the common base sequence in the core is a sequence that is 100% complementary to the target sequence.

In some embodiments, as provided in the present invention, the provided oligonucleotides and compositions can provide a new cleavage mode, a higher cleavage rate, a higher degree of cleavage, a higher cleavage selectivity, and the like. In some embodiments, a provided composition can selectively inhibit (eg, cleave) a transcript from a target nucleic acid sequence for which one or more similar sequences, target sequences, and The similar sequences each contain a specific nucleotide signature sequence element that defines the target sequence relative to a similar sequence. In some embodiments, for example, the target sequence is a copy of a wild-type dual gene or gene, and is similar A sequence is a sequence having a very similar base sequence, such as a sequence having a SNP, a mutation, etc.; in some embodiments, a characteristic sequence element defines a target sequence relative to a similar sequence: for example, when the target sequence is Huntington's disease related When rs362307 contains a dual gene of T (U in the corresponding RNA; non-disease-associated dual gene is C), the characteristic sequence contains this SNP.

In some embodiments, the similar sequence and the target sequence have greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98% or 99% sequence homology. In some embodiments, the target sequence is a pathogenic replica of a nucleic acid sequence comprising one or more mutations and/or SNPs, and the analogous sequence is a non-pathogenic replica (wild type). In some embodiments, the sequence of interest comprises a mutation, wherein the similar sequence is the corresponding wild-type sequence. In some embodiments, the target sequence is a mutant dual gene and the analogous sequence is a wild-type dual gene. In some embodiments, the target sequence comprises a SNP associated with a disease-causing dual gene, and the similar sequence comprises the same SNP that is not associated with a disease-causing dual gene. In some embodiments, the region of the target sequence that is complementary to the common base sequence of the provided oligonucleotide composition and the corresponding region of the similar sequence have greater than 60%, 65%, 70%, 75%, 80%, Sequence homology of 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In some embodiments, the region of the target sequence that is complementary to the common base sequence of the provided oligonucleotide composition differs from the corresponding region of the similar sequence by less than 5, less than 4, less than 3, less than 2, or Only 1 base pair. In some embodiments, the region of the target sequence that is complementary to the common base sequence of the provided oligonucleotide composition differs from the corresponding region of the similar sequence only by the mutation site or the SNP site. In some embodiments, the region of the target sequence that is complementary to the common base sequence of the provided oligonucleotide composition differs from the corresponding region of the similar sequence only by the mutation site. In some embodiments, the region of the target sequence that is complementary to the common base sequence of the provided oligonucleotide composition differs from the corresponding region of the similar sequence only by the SNP site.

In some embodiments, the common base sequence comprises or is complementary to a characteristic sequence element The sequence. In some embodiments, the common base sequence comprises a sequence that is complementary to a characteristic sequence element. In some embodiments, the common base sequence is a sequence that is complementary to a characteristic sequence element. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to a characteristic sequence element. In some embodiments, the common base sequence comprises a sequence that is 100% complementary to a characteristic sequence element. In some embodiments, the common base sequence is a sequence that is 100% complementary to a characteristic sequence element. In some embodiments, the common base sequence in the core comprises or is a sequence that is complementary to a characteristic sequence element. In some embodiments, the common base sequence in the core comprises a sequence that is complementary to a characteristic sequence element. In some embodiments, the common base sequence in the core comprises a sequence that is complementary to a characteristic sequence element. In some embodiments, the common base sequence in the core comprises or is a sequence that is 100% complementary to a characteristic sequence element. In some embodiments, the common base sequence in the core comprises a sequence that is 100% complementary to the signature sequence element. In some embodiments, the common base sequence in the core is a sequence that is 100% complementary to a characteristic sequence element.

In some embodiments, the characteristic sequence element comprises or is a mutation. In some embodiments, the characteristic sequence element comprises a mutation. In some embodiments, the characteristic sequence element is a mutation. In some embodiments, the characteristic sequence element comprises or is a point mutation. In some embodiments, the characteristic sequence element comprises a point mutation. In some embodiments, the characteristic sequence element is a point mutation. In some embodiments, the characteristic sequence element comprises or is a SNP. In some embodiments, the feature sequence element comprises a SNP. In some embodiments, the characteristic sequence element is a SNP.

In some embodiments, the common base sequence is 100% matched to the target sequence, but it does not 100% match a similar sequence of the target sequence. For example, in some embodiments, the common base sequence matches a pathogenic copy of a target nucleic acid sequence or a mutation in a dual gene, but does not match a non-pathogenic copy or a dual gene of the mutation site; in some other embodiments The common base sequence matches the SNP in the pathogenic dual gene of the target nucleic acid sequence, but does not match the non-pathogenic dual gene of the corresponding site. In some embodiments, the common base sequence in the core 100% matches the target sequence, but it does not 100% match a similar sequence of the target sequence. For example, in WV-1092, the common base sequence (and the common base sequence in its core) matches the disease-associated U of rs362307, but does not match the non-disease-associated (wild-type) C.

In particular, the present invention recognizes that base sequences can have an impact on oligonucleotide characteristics. In some embodiments, when an oligonucleotide is used to inhibit a target with a base sequence, such as via a pathway involving ribonuclease H, the base sequence can affect the cleavage mode of the target: for example, Figure 33 demonstrates that oligonucleotides that are structurally similar (total phosphorothioate linkage, fully stereoregular) have different sequences and can have different cleavage modes. In some embodiments, the common base sequence of a non-stereorandomized oligonucleotide composition (eg, certain oligonucleotide compositions provided in the invention) is the following base sequence, when applied to DNA DNA cleavage mode (DNA cleavage mode) and/or stereo in the case of an oligonucleotide composition (eg, ONT-415) or a stereoregular perthiophosphate oligonucleotide composition (eg, WV-905) The cleavage mode (stereorandom cleavage mode) of the random perthiophosphate composition has a cleavage site within or adjacent to the characteristic sequence element. In some embodiments, the cleavage site, either internal or nearby, is within a sequence complementary to the core region of the common sequence. In some embodiments, the cleavage site, either internal or nearby, is within a sequence that is 100% complementary to the core region of the common sequence.

In some embodiments, the common base sequence is a base sequence having a cleavage site within or adjacent to the characteristic sequence element in its DNA cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site within a characteristic sequence element in its DNA cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of the signature sequence element in its DNA cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of a mutation or a SNP of a characteristic sequence element in its DNA cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of the mutation in its DNA cleavage mode. In some embodiments, the common base sequence is cleaved near the SNP in its DNA cleavage mode The base sequence of the site of resolution.

In some embodiments, the common base sequence is a base sequence having a cleavage site within or adjacent to the characteristic sequence element in its stereoregular cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site within the characteristic sequence element in its stereoregular cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of the characteristic sequence element in its stereoregular cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of a mutation or a SNP of a characteristic sequence element in its stereoregular cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of the mutation in its stereoregular cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of the SNP in its stereoregular lysis mode.

In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of a mutation in a characteristic sequence element in its DNA and/or stereoregular cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of the mutation in its DNA and/or stereoregular lysis mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of the mutation in its DNA cleavage mode. In some embodiments, the cleavage site in the vicinity of the mutation is at the mutation, ie, the cleavage site is at the internucleotide linkage of the mutated nucleotide (eg, if the mutation is in the target sequence GGG A CGTCTT) In the case of A, the cleavage is between A and C). In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the mutation by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides, wherein Means cleavage at the mutation site (for example, if the mutation is at A of the target sequence GGG A CGTCTT, the cleavage line that is distant from the 0-nucleotide linkage is between A and C; away from the mutation 1 nucleoside The cleavage site of the acid linkage is mutated towards 5' away from between G and A or towards 3' away from between C and G. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the 0, 1, 2, 3, 4 or 5 nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the mutation by 0, 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the nearby cleavage site is a cleavage site that is linked 3' away from the mutation by 0, 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the 0, 1, 2, 3, 4 or 5 nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the mutation by 0, 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the nearby cleavage site is a cleavage site that is linked 3' away from the mutation by 0, 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the 0, 1, 2, 3 or 4 nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the mutation by 0, 1, 2, 3 or 4 nucleotides. In some embodiments, the nearby cleavage site is a cleavage site that is linked 3' away from the mutation by 0, 1, 2, 3, or 4 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the 0, 1, 2, or 3 nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the mutation by 0, 1, 2, or 3 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 3' away from the mutation by 0, 1, 2, or 3 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the 0, 1 or 2 nucleotide linkages of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the mutation by 0, 1 or 2 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 3' away from the mutation by 0, 1 or 2 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the 0 or 1 nucleotide linkage of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 5' away from the mutation 0 or 1 nucleotide linkage. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 3' away from the mutated 0 or 1 nucleotide linkage. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the 0-nucleotide linkage of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the mutated one nucleotide. In some embodiments, the nearby cleavage site is a cleavage site that is 5' away from the mutated internucleotide linkage. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 3' away from the mutated one nucleotide. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the two nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the two nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 3' away from the two nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the three nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the mutated three nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 3' away from the three nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the four nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the mutated four nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 3' away from the four nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the five nucleotides of the mutation. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the mutation by five nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 3' away from the mutation by five nucleotides.

In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of the SNP of the characteristic sequence element in its DNA and/or stereoregular cleavage mode. In some embodiments, the common base sequence is a base sequence having a cleavage site in the vicinity of the SNP in its DNA and/or stereoregular lysis mode. In some embodiments, the common base sequence is a base sequence having a cleavage site near the SNP in its DNA cleavage mode. In some embodiments, the cleavage site near the SNP is at the SNP, ie, the cleavage site is at the internucleotide linkage of the nucleotide at the SNP (eg, with respect to the target of WV-905, G * G * C * A * C * A * A * G * G * G * C * A * C * A * G * A * C * T * T * C, comprising rUrUrUrGrGrArArGrUrCrUrG rU rG rCrCrCrUrUrGrUrGrCrCrC (rs362307 bold ), the cleavage is between the thick rU and the bottom line rG immediately followed). In some embodiments, the cleavage site in the vicinity is a cleavage site that is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the SNP, wherein Means cleavage at the SNP (for example, regarding the target of WV-905, G*G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C* T * T * C, comprising rUrUrUrGrGrArArGrUrCrUrG rU rG rCrCrCrUrUrGrUrGrCrCrC (rs362307 bold), remote from about 0 intemucleotide linkage, cleavage between the bold line and immediately thereafter there rU underlined of rG; away from the SNP ( underline: rUrUrUrGrGrArArGrUrCrU rG rU rGrCrCrCrUrUrGrUrGrCrCrC) between a nucleotide cleavage site towards the line linking the 5 'and away from between rG rU SNP; or toward the SNP (underlined: rUrUrUrGrGrArArGrUrCrUrG rU rGrC rCrCrUrUrGrUrGrCrCrC), the 3 'Between the end of rG and rC). In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the 0, 1, 2, 3, 4, or 5 nucleotides of the SNP. In some embodiments, the nearby cleavage site is a cleavage site that is 5', 5, 1, 2, 3, 4, or 5 nucleotides away from the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 3' away from the SNP by 0, 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the 0, 1, 2, 3, 4, or 5 nucleotides of the SNP. In some embodiments, the nearby cleavage site is a cleavage site that is 5', 5, 1, 2, 3, 4, or 5 nucleotides away from the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 3' away from the SNP by 0, 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 0, 1, 2, 3 or 4 nucleotides away from the SNP. In some embodiments, the nearby cleavage site is a cleavage site that is 5', 0, 1, 2, 3, or 4 nucleotides away from the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 3' away from the SNP by 0, 1, 2, 3, or 4 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 0, 1, 2, or 3 nucleotides away from the SNP. In some embodiments, the nearby cleavage site is a cleavage site that is 5', 0, 1, 2, or 3 nucleotides away from the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 3' away from the SNP by 0, 1, 2, or 3 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 0, 1 or 2 nucleotides away from the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 5' away from the SNP by 0, 1 or 2 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 3' away from the SNP by 0, 1 or 2 nucleotides. In some embodiments, the cleavage site in the vicinity is a cleavage site that is distant from the SNP 0 or 1 nucleotide linkage. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 5' away from the SNP 0 or 1 nucleotide linkage. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 3' away from the SNP 0 or 1 nucleotide linkage. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 0 linkages away from the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked to the SNP by an internucleotide linkage. In some embodiments, the nearby cleavage site is a cleavage site that is 5' away from the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 3' away from the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the two nucleotides of the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the two nucleotides of the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 3' away from the two nucleotides of the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the three nucleotides of the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the three nucleotides of the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 3' away from the three nucleotides of the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the four nucleotides of the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked 5' away from the SNP by four nucleotides. In some embodiments, the nearby cleavage site is a cleavage site that is 3' away from the SNP of the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is linked away from the five nucleotides of the SNP. In some embodiments, the cleavage site in the vicinity is a cleavage site that is 5' away from the SNP away from the SNP. In some embodiments, the nearby cleavage site is a cleavage site that is linked 3' apart from the SNP by five nucleotides. For example, Figure 33 demonstrates that the stereoregular cleavage pattern of the WV-905 sequence is at the SNP (between CUGU and GCCC), away from the internucleotide linkage (between GUCU and GUGC and at GUGC) (between CCUU), away from the linkage between three nucleotides (between UGCC and CUUG), away from the four-nucleotide linkage (between GCCC and UUGU and between AAGU and CUGU) And there is a cleavage site away from the linkage between five nucleotides (between CCCU and UGUG).

In some embodiments, the cleavage site within the signature sequence element or near the signature sequence element (eg, near a mutation, SNP, etc.) is the primary cleavage site for the DNA and/or stereoregular lysis mode. In some embodiments, the cleavage site within or adjacent to the characteristic sequence element is the primary cleavage site of the DNA cleavage mode. In some embodiments, the cleavage site within or adjacent to the characteristic sequence element is the primary cleavage site of the stereoregular lysis mode. In some embodiments, the cleavage site near the mutation is the primary cleavage site of the DNA cleavage mode. In some embodiments, the cleavage site adjacent to the mutation is the primary cleavage site of the stereoregular lysis mode. In some embodiments, the cleavage site near the SNP is the primary cleavage site of the DNA cleavage mode. In some embodiments, the cleavage site near the SNP is the primary cleavage site of the stereoregular lysis mode. In some embodiments, the primary cleavage site is within a sequence complementary to the core region of the common sequence. In some embodiments, the primary cleavage site is within a sequence that is 100% complementary to the core region of the common sequence.

In some embodiments, the primary cleavage site is a site having a maximum or a second, a third, a fourth, or a fifth multiple cleavage. In some embodiments, the primary cleavage site is the site with the most or the second, third, or fourth multiple cleavage. In some embodiments, the primary cleavage site is the site with the most or the second most or third multiple cleavage. In some implementations In the example, the primary cleavage site is the site with the most or second multiple cleavage. In some embodiments, the primary cleavage site is the site with the most cleavage. In some embodiments, the primary cleavage site is the site with a second multiple cleavage. In some embodiments, the primary cleavage site is the site with a third multiple cleavage. In some embodiments, the primary cleavage site is the site with a fourth multiple cleavage. In some embodiments, the primary cleavage site is the site with a fifth multiple cleavage.

In some embodiments, the primary cleavage site is greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65 Sites of %, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% cleavage. In some embodiments, the primary cleavage site is a site where greater than 5% cleavage occurs. In some embodiments, the primary cleavage site is the site at which greater than 10% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 15% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 20% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 25% cleavage occurs. In some embodiments, the primary cleavage site is the site at which greater than 30% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 35% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 40% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 45% cleavage occurs. In some embodiments, the primary cleavage site is the site at which greater than 50% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 55% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 60% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 65% cleavage occurs. In some embodiments, the primary cleavage site is the site at which greater than 70% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 75% cleavage occurs. In some embodiments, the primary cleavage site is the site where greater than 80% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 85% cleavage occurs. In some embodiments, the primary cleavage site is the site at which greater than 90% cleavage occurs. In some embodiments, the primary cleavage site is greater than 91% The site of lysis. In some embodiments, the primary cleavage site is a site where greater than 92% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 93% cleavage occurs. In some embodiments, the primary cleavage site is the site where greater than 94% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 95% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 96% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 97% cleavage occurs. In some embodiments, the primary cleavage site is a site where greater than 98% cleavage occurs. In some embodiments, the primary cleavage site is the site at which greater than 99% cleavage occurs. In some embodiments, the primary cleavage site is the site where 100% cleavage occurs.

In some embodiments, the primary cleavage site is greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the target cleavage sites. In some embodiments, the primary cleavage site is a site of greater than 5% target cleavage. In some embodiments, the primary cleavage site is greater than 10% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 15% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 20% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 25% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 30% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 35% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 40% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 45% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 50% of the site of target cleavage. In some embodiments, the primary cleavage site is greater than 55% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 60% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 65% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 70% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 75% of the target cleavage The solution point. In some embodiments, the primary cleavage site is greater than 80% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 85% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 90% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 91% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 92% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 93% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 94% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 95% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 96% of the site of target cleavage. In some embodiments, the primary cleavage site is greater than 97% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 98% of the site of the target cleavage. In some embodiments, the primary cleavage site is greater than 99% of the site of the target cleavage. In some embodiments, the primary cleavage site is 100% of the site of the target cleavage. In some embodiments, the lysis mode may not have a primary cleavage site because no site reaches the absolute cleavage threshold level.

As will be appreciated by those of ordinary skill in the art, a variety of methods are available for generating a lysis mode and/or identifying cleavage sites, including major cleavage sites. In some embodiments, an example of such an assay is an RNase cleavage assay as described herein; for example, the results are shown in Figures 33, 34, and the like.

In some embodiments, the invention identifies the positional effects of sequence motifs that are complementary to a characteristic sequence element. In some embodiments, the invention recognizes the positional effects of sequence motifs that are complementary to a mutation. In some embodiments, the invention recognizes the positional effects of sequence motifs that are complementary to a SNP.

In some embodiments, the sequence 11, 12 or 13 in the sequence as counted from its 5' end is aligned with the feature sequence elements. In some embodiments, the position 11 in the sequence as counted from its 5' end is aligned with the feature sequence element. In some embodiments, the position 12 in the sequence as counted from its 5' end is aligned with the feature sequence element. In some embodiments, the sequence is counted from its 5' end Position 13 is aligned with the feature sequence element. In some embodiments, the sequence 8, 8, or 10, as counted from its 3' end, is aligned with the feature sequence elements. In some embodiments, the sequence 8 is aligned with the feature sequence element as it is counted from its 3' end. In some embodiments, the sequence 9 is aligned with the feature sequence element as it is counted from its 3' end. In some embodiments, the sequence 10, as counted from its 3' end, is aligned with the feature sequence elements. In some embodiments, the position 6, 7, or 8 in the core region, as counted from the 5' end of the core region, is aligned with the feature sequence elements. In some embodiments, the position 6 in the core region as counted from the 5' end of the core region is aligned with the feature sequence element. In some embodiments, the position 7 in the core region, as counted from the 5' end of the core region, is aligned with the feature sequence elements. In some embodiments, the position 8 in the core region as counted from the 5' end of the core region is aligned with the feature sequence elements. In some embodiments, the position 3, 4, or 5 in the core region as counted from the 3' end of the core region is aligned with the feature sequence elements. In some embodiments, the position 3 in the core region as counted from the 3' end of the core region is aligned with the feature sequence element. In some embodiments, the position 4 in the core region as counted from the 3' end of the core region is aligned with the feature sequence element. In some embodiments, the position 5 in the core region, as counted from the 3' end of the core region, is aligned with the feature sequence elements.

In some embodiments, the position 11, 12 or 13 in the sequence as counted from its 5' end is aligned with the mutation. In some embodiments, the position 11 in the sequence as counted from its 5' end is aligned with the mutation. In some embodiments, the position 12, as counted from its 5' end, is aligned with the mutation. In some embodiments, the position 13 in the sequence, as counted from its 5' end, is aligned with the mutation. In some embodiments, the sequence is aligned with the mutation as position 8, 9 or 10 from its 3' end count. In some embodiments, the sequence is aligned with the mutation as position 8 counted from its 3' end. In some embodiments, the sequence is aligned with the mutation as position 9 counted from its 3' end. In some embodiments, the sequence 10 is aligned with the mutation as it is counted from its 3' end. In some embodiments, the position 6, 7, or 8 in the core region, as counted from the 5' end of the core region, is aligned with the mutation. In some embodiments, the position 6 in the core region, as counted from the 5' end of the core region, is aligned with the mutation. In some embodiments, the core region is as predicted from the 5' end of the core region. Change alignment. In some embodiments, the position 8 in the core region, as counted from the 5' end of the core region, is aligned with the mutation. In some embodiments, the position 3, 4 or 5 in the core region as counted from the 3' end of the core region is aligned with the mutation. In some embodiments, position 3 in the core region, as counted from the 3' end of the core region, is aligned with the mutation. In some embodiments, position 4 in the core region as counted from the 3' end of the core region is aligned with the mutation. In some embodiments, the position 5 in the core region, as counted from the 3' end of the core region, is aligned with the mutation.

In some embodiments, the position 11, 12 or 13 in the sequence as counted from its 5' end is aligned with the SNP. In some embodiments, the position 11 in the sequence, as counted from its 5' end, is aligned with the SNP. In some embodiments, the position 12 in the sequence as counted from its 5' end is aligned with the SNP. In some embodiments, the position 13 in the sequence, as counted from its 5' end, is aligned with the SNP. In some embodiments, the sequence is aligned with the SNP at positions 8, 9 or 10 as counted from its 3' end. In some embodiments, the sequence 8 is aligned with the SNP as it is counted from its 3' end. In some embodiments, the sequence 9 is aligned with the SNP as it is counted from its 3' end. In some embodiments, the sequence 10 is aligned with the SNP as it is counted from its 3' end. In some embodiments, the position 6, 7, or 8 in the core region, as counted from the 5' end of the core region, is aligned with the SNP. In some embodiments, the position 6 in the core region, as counted from the 5' end of the core region, is aligned with the SNP. In some embodiments, the position 7 in the core region, as counted from the 5' end of the core region, is aligned with the SNP. In some embodiments, the position 8 in the core region as counted from the 5' end of the core region is aligned with the SNP. In some embodiments, the position 3, 4 or 5 in the core region as counted from the 3' end of the core region is aligned with the SNP. In some embodiments, position 3 in the core region as counted from the 3' end of the core region is aligned with the SNP. In some embodiments, the position 4 in the core region, as counted from the 3' end of the core region, is aligned with the SNP. In some embodiments, the position 5 in the core region, as counted from the 3' end of the core region, is aligned with the SNP.

In some embodiments, the common base sequence comprises or is a sequence that is complementary to a nucleic acid sequence. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to the nucleic acid sequence. In some embodiments, the common base sequence comprises or is in interaction with a causative nucleic acid sequence Complement the sequence. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to the pathogenic nucleic acid sequence. In some embodiments, the common base sequence comprises or is a sequence that is complementary to a characteristic sequence element of a causative nucleic acid sequence that distinguishes between a pathogenic nucleic acid sequence and a non-pathogenic nucleic acid sequence. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to a signature sequence element of a causative nucleic acid sequence that distinguishes between a causative nucleic acid sequence and a non-pathogenic nucleic acid sequence. In some embodiments, the common base sequence comprises or is a sequence that is complementary to a nucleic acid sequence associated with the disease. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to a nucleic acid sequence associated with the disease. In some embodiments, the common base sequence comprises or is a sequence that is complementary to a signature sequence element of a nucleic acid sequence associated with a disease, the sequence of which distinguishes between a nucleic acid sequence associated with the disease and a nucleic acid sequence associated with the disease. In some embodiments, the common base sequence comprises or is 100% complementary to a signature sequence element of a nucleic acid sequence associated with a disease, the signature sequences distinguishing between a nucleic acid sequence associated with a disease and a nucleic acid sequence associated with a non-disease.

In some embodiments, the common base sequence comprises or is a sequence that is complementary to the gene. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to the gene. In some embodiments, the common base sequence comprises or is a sequence that is complementary to a characteristic sequence element of the gene that distinguishes a gene from a similar sequence that shares homology to the gene. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to a characteristic sequence element of the gene, the signature sequences distinguishing genes from similar sequences that share homology to the gene. In some embodiments, the common base sequence comprises or is a sequence that is complementary to a characteristic sequence element of the target gene, the signature sequence comprising a mutation that is not found in other copies of the gene, such as a wild-type copy of the gene, a gene Another mutant copy, etc. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to a signature sequence element of the target gene, the signature sequence comprising a mutation that is not found in other copies of the gene, eg, a wild-type copy of the gene, a gene Another mutant copy, etc.

In some embodiments, the common base sequence comprises or is complementary to a sequence comprising a SNP the sequence of. In some embodiments, the common base sequence comprises or is a sequence that is complementary to a sequence comprising a SNP, and the common base sequence is 100% complementary to a disease-associated SNP. For example, in some embodiments, the common base sequence is 100% complementary to a SNP associated with a dual gene associated with (or causing the disease) Huntington's disease. In some embodiments, the common base sequence is a common base sequence of WV-1092 that is 100% complementary to the disease-associated dual gene in multiple Huntington's disease patients at rs362307. In some embodiments, the SNP is rs362307. In some embodiments, the SNP is rs7685686. In some embodiments, the SNP is rs362268. In some embodiments, the SNP is rs362306. In some embodiments, the SNP is rs362331. In some embodiments, the SNP is rs2530595. In some embodiments, other exemplary SNP sites can be any of the Huntington's sites disclosed in the present invention.

In some embodiments, the common base sequence comprises the sequence present in GCCTCAGTCTGCTTCGCACC. In some embodiments, the common base sequence comprises a sequence present in GCCTCAGTCTGCTTCGCACC, wherein the sequence present in GCCTCAGTCTGCTTCGCACC comprises at least 15 nucleotides. In some embodiments, the common base sequence is GCCTCAGTCTGCTTCGCACC.

In some embodiments, the common base sequence comprises the sequence present in GAGCAGCTGCAACCTGGCAA. In some embodiments, the common base sequence comprises a sequence present in GAGCAGCTGCAACCTGGCAA, wherein the sequence present in GAGCAGCTGCAACCTGGCAA comprises at least 15 nucleotides. In some embodiments, the common base sequence is GAGCAGCTGCAACCTGGCAA. In some embodiments, the common base sequence is GGGCACAAGGGCACAGACTT. In some embodiments, the common base sequence is GAGCAGCTGCAACCTGGCAA. In some embodiments, the common base sequence is GCACAAGGGCACAGACTTCC. In some embodiments, the common base sequence is CACAAGGGCACAGACTTCCA. In some embodiments, the common base sequence is ACAAGGGCACAGACTTCCAA. In some embodiments, the common base sequence is CAAGGGCACAGACTTCCAAA. In some embodiments, the common base sequence comprises the sequence present in GAGCAGCTGCAACCTGGCAA. In some embodiments, the common base sequence comprises a sequence present in GAGCAGCTGCAACCTGGCAA, wherein the sequence present in GAGCAGCTGCAACCTGGCAA comprises at least 15 nucleotides. In some embodiments, the common base sequence is GAGCAGCTGCAACCTGGCAA. In some embodiments, the common base sequence is GAGCAGCTGCAACCTGGCAA. In some embodiments, the common base sequence is AGCAGCTGCAACCTGGCAAC. In some embodiments, the common base sequence is GCAGCTGCAACCTGGCAACA. In some embodiments, the common base sequence is CAGCTGCAACCTGGCAACAA. In some embodiments, the common base sequence is AGCTGCAACCTGGCAACAAC. In some embodiments, the common base sequence is GCTGCAACCTGGCAACAACC. In some embodiments, the common base sequence comprises the sequence present in GGGCCAACAGCCAGCCTGCA. In some embodiments, the common base sequence comprises a sequence present in GGGCCAACAGCCAGCCTGCA, wherein the sequence present in GGGCCAACAGCCAGCCTGCA comprises at least 15 nucleotides. In some embodiments, the common base sequence is GGGCCAACAGCCAGCCTGCA. In some embodiments, the common base sequence is GGGCCAACAGCCAGCCTGCA. In some embodiments, the common base sequence is GGCCAACAGCCAGCCTGCAG. In some embodiments, the common base sequence is GCCAACAGCCAGCCTGCAGG. In some embodiments, the common base sequence is CCAACAGCCAGCCTGCAGGA. In some embodiments, the common base sequence is CAACAGCCAGCCTGCAGGAG. In some embodiments, the common base sequence is AACACGCAGCCCTAGAGAGGG. In some embodiments, the common base sequence comprises the sequence present in ATTAATAAATTGTCATCACC. In some embodiments, the common base sequence comprises a sequence present in ATTAATAAATTGTCATCACC, The sequence present in the ATTAATAAATTGTCATCACC contains at least 15 nucleotides. In some embodiments, the common base sequence is ATTAATAAATTGTCATCACC. In some embodiments, the common base sequence is ATTAATAAATTGTCATCACC.

In some embodiments, the invention provides stereochemical design parameters for oligonucleotides. That is, the present invention particularly demonstrates the effect of stereochemical structures along different positions along the oligonucleotide strand, such as on the stability and/or activity of the oligonucleotide, including oligonucleotides and cognate ligands. And/or the effect of interaction with the processing enzyme. The invention particularly provides oligonucleotides in the structure incorporating such design parameters or structures reflecting such design parameters. Such oligonucleotides are novel chemical entities relative to stereoregular formulations having the same base sequence and length.

In some embodiments, the invention provides stereochemical design parameters for antisense oligonucleotides. In some embodiments, the invention specifically provides for design parameters for oligonucleotides that can be bound and/or cleaved by ribonuclease H. In some embodiments, the invention provides stereochemical design parameters for siRNA oligonucleotides. In some embodiments, the invention specifically provides for design parameters for oligonucleotides that can be combined and/or cleaved by, for example, DICER, Argonaute proteins (eg, Algu-1 and Argu-2), and the like.

In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, wherein the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and At least one of the twentieth internucleotide linkages is palmarous. In some embodiments, at least two of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages For the palm of the hand. In some embodiments, at least three of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages For the palm of the hand. In some embodiments, at least four of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages For the palm of the hand. In some embodiments Wherein at least five of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotide linkages are palmar of. In some embodiments, at least six of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages For the palm of the hand. In some embodiments, at least seven of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages For the palm of the hand. In some embodiments, at least eight of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages For the palm of the hand. In some embodiments, at least nine of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages For the palm of the hand. In some embodiments, one of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages is For the palm of the hand. In some embodiments, the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages are For the palm of the hand. In some embodiments, three of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages are For the palm of the hand. In some embodiments, four of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages are For the palm of the hand. In some embodiments, five of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages are For the palm of the hand. In some embodiments, six of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages are For the palm of the hand. In some embodiments, seven of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages are For the palm of the hand. In some embodiments, eight of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages are For the palm of the hand. In some embodiments, first, second, third, fifth, seventh, eighth, ninth, Eighteen of the nineteenth and twentieth internucleotide linkages are palmar. In some embodiments, ten of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth, and twentieth internucleotide linkages are For the palm of the hand.

In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, wherein the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth nucleosides At least one of the inter-acid linkages is palm-to-hand. In some embodiments, at least two of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, at least three of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, at least four of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, at least five of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, at least six of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, at least seven of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, one of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages is palmarous. In some embodiments, two of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, three of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, four of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, five of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth cores Six of the linkages between the glycosides are palmar. In some embodiments, seven of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous. In some embodiments, eight of the first, second, third, fifth, seventh, eighteenth, nineteenth, and twentieth internucleotide linkages are palmarous.

In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, wherein the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and At least one of the twentieth internucleotide linkages is palmarous and at least one internucleotide linkage is non-palphatic. In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, wherein the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth nucleosides At least one of the inter-acid linkages is palm-like and at least one internucleotide linkage is non-pivoling. In some embodiments, at least two internucleotide linkages are non-paired. In some embodiments, at least three internucleotide linkages are non-paired. In some embodiments, at least four internucleotide linkages are non-paired. In some embodiments, at least five internucleotide linkages are non-paired. In some embodiments, at least six internucleotide linkages are non-paired. In some embodiments, at least seven internucleotide linkages are non-paired. In some embodiments, at least eight internucleotide linkages are non-paired. In some embodiments, at least nine nucleotide linkages are non-paired. In some embodiments, at least 10 internucleotide linkages are non-pivoling. In some embodiments, at least 11 internucleotide linkages are non-pivoling. In some embodiments, at least 12 internucleotide linkages are non-paired. In some embodiments, at least 13 internucleotide linkages are non-paired. In some embodiments, at least 14 internucleotide linkages are non-pivoling. In some embodiments, at least 15 internucleotide linkages are non-paired. In some embodiments, at least 16 internucleotide linkages are non-paired. In some embodiments, at least 17 nucleotide linkages are non-pivoling. In some embodiments, at least 18 internucleotide linkages are non-paired. In some embodiments, at least 19 internucleotide linkages are non-pivoling. In some embodiments, at least 20 cores The linkage between the glycosides is non-paired. In some embodiments, an internucleotide linkage is non-palphatic. In some embodiments, the two internucleotide linkages are non-paired. In some embodiments, the three internucleotide linkages are non-paired. In some embodiments, the four internucleotide linkages are non-paired. In some embodiments, the five internucleotide linkages are non-paired. In some embodiments, the internucleotide linkages are non-pivoling. In some embodiments, seven internucleotide linkages are non-paired. In some embodiments, the eight internucleotide linkages are non-paired. In some embodiments, the nine internucleotide linkages are non-paired. In some embodiments, the 10 nucleotide linkages are non-paired. In some embodiments, the 11 nucleotide linkages are non-paired. In some embodiments, the 12 nucleotide linkages are non-paired. In some embodiments, the 13 nucleotide linkages are non-paired. In some embodiments, the 14 nucleotide linkages are non-palphatic. In some embodiments, the 15 nucleotide linkages are non-palphatic. In some embodiments, the 16 nucleotide linkages are non-paired. In some embodiments, the 17 nucleotide linkages are non-paired. In some embodiments, the 18 nucleotide linkages are non-paired. In some embodiments, the 19 nucleotide linkages are non-palphatic. In some embodiments, the 20 nucleotide linkages are non-paired. In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, except for the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth And at least one of the twentieth internucleotide linkages is in addition to palmarity, and all other internucleotide linkages are non-paired.

In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, wherein the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and At least one of the twentieth internucleotide linkages is palmitic and at least one internucleotide linkage is a phosphate. In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, wherein the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth nucleosides At least one of the inter-acid linkages is palm-shaped and at least one The internucleotide linkage is a phosphate. In some embodiments, at least two of the nucleotides are linked to a phosphate. In some embodiments, at least three of the nucleotides are linked to a phosphate. In some embodiments, at least four of the nucleotides are linked to a phosphate. In some embodiments, at least five nucleotides are linked to a phosphate. In some embodiments, at least six nucleotides are linked to a phosphate. In some embodiments, at least seven nucleotides are linked to a phosphate. In some embodiments, at least eight nucleotides are linked to a phosphate. In some embodiments, at least nine nucleotides are linked to a phosphate. In some embodiments, at least 10 nucleotides are linked to a phosphate. In some embodiments, at least 11 nucleotides are linked to a phosphate. In some embodiments, at least 12 nucleotides are linked to a phosphate. In some embodiments, at least 13 nucleotides are linked to a phosphate. In some embodiments, at least 14 nucleotides are linked to a phosphate. In some embodiments, at least 15 nucleotides are linked to a phosphate. In some embodiments, at least 16 nucleotides are linked to a phosphate. In some embodiments, at least 17 nucleotides are linked to a phosphate. In some embodiments, at least 18 nucleotides are linked to a phosphate. In some embodiments, at least 19 nucleotides are linked to a phosphate. In some embodiments, at least 20 nucleotides are linked to a phosphate. In some embodiments, an internucleotide linkage is a phosphate. In some embodiments, the two nucleotides are linked to a phosphate. In some embodiments, the three nucleotides are linked to a phosphate. In some embodiments, the four nucleotides are linked to a phosphate. In some embodiments, five nucleotides are linked to a phosphate. In some embodiments, the six nucleotides are linked to a phosphate. In some embodiments, seven nucleotides are linked to a phosphate. In some embodiments, the eight nucleotides are linked to a phosphate. In some embodiments, the nine nucleotide linkages are phosphates. In some embodiments, 10 nucleotides are linked to a phosphate. In some embodiments, 11 nucleotides are linked to a phosphate. In some embodiments, 12 nucleotides are linked to a phosphate. In some embodiments, 13 nucleotides are linked to a phosphate. In some embodiments, 14 nucleotides are linked to a phosphate. In some embodiments, 15 nucleotides are linked to a phosphate. In some embodiments, 16 internucleotide linkages Linked to phosphate. In some embodiments, 17 nucleotides are linked to a phosphate. In some embodiments, 18 nucleotides are linked to a phosphate. In some embodiments, the 19 nucleotides are linked to a phosphate. In some embodiments, the 20 nucleotides are linked to a phosphate. In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, except for the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth And at least one of the twentieth internucleotide linkages is in addition to palmarity, and all other internucleotide linkages are phosphate esters.

In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, wherein the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and At least one of the twentieth internucleotide linkages is palmarous, and at least 10% of all internucleotide linkages in the region are non-palphatic. In some embodiments, a single oligonucleotide of the provided composition comprises the following regions, wherein the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth nucleosides At least one of the inter-acid linkages is palm-like, and at least 10% of all internucleotide linkages in the region are non-palphatic. In some embodiments, at least 20% of all internucleotide linkages in the region are non-palphatic. In some embodiments, at least 30% of all internucleotide linkages in the region are non-palphatic. In some embodiments, at least 40% of all internucleotide linkages in the region are non-palphatic. In some embodiments, at least 50% of all internucleotide linkages in the region are non-palphatic. In some embodiments, at least 60% of all internucleotide linkages in the region are non-palphatic. In some embodiments, at least 70% of all internucleotide linkages in the region are non-palphatic. In some embodiments, at least 80% of all internucleotide linkages in the region are non-palphatic. In some embodiments, at least 90% of all internucleotide linkages in the region are non-palphatic. In some embodiments, at least 50% of all internucleotide linkages in the region are non-palphatic. In some embodiments, the non-preferential internucleotide linkage is a phosphate linkage. In some embodiments, each non-preferential internucleotide linkage is a phosphate linkage.

In some embodiments, the first internucleotide linkage of the region is a Sp modified internucleotide linkage. In some embodiments, the first internucleotide linkage of the region is an internucleotide linkage modified by Rp . In some embodiments, the second internucleotide linkage of the region is a Sp modified internucleotide linkage. In some embodiments, the second internucleotide linkage of the region is an internucleotide linkage modified by Rp . In some embodiments, the third internucleotide linkage of the region is a Sp- modified internucleotide linkage. In some embodiments, the third internucleotide linkage of the region is an internucleotide linkage modified by Rp . In some embodiments, the fifth internucleotide linkage of the region is a Sp modified internucleotide linkage. In some embodiments, the fifth internucleotide linkage of the region is an internucleotide linkage modified by Rp . In some embodiments, the seventh internucleotide linkage of the region is a Sp modified internucleotide linkage. In some embodiments, the seventh internucleotide linkage of the region is an internucleotide linkage modified by Rp . In some embodiments, the eighth internucleotide linkage of the region is a Sp modified internucleotide linkage. In some embodiments, the eighth internucleotide linkage of the region is an internucleotide linkage modified by Rp . In some embodiments, the ninth internucleotide linkage of the region is a Sp- modified internucleotide linkage. In some embodiments, the ninth internucleotide linkage of the region is an internucleotide linkage modified by Rp . In some embodiments, the eighteenth internucleotide linkage of the region is a Sp modified internucleotide linkage. In some embodiments, the eighteenth internucleotide linkage of the region is an internucleotide linkage modified by Rp . In some embodiments, the nineteenth internucleotide linkage of the region is a Sp- modified internucleotide linkage. In some embodiments, the nineteenth internucleotide linkage of the region is an internucleotide linkage modified by Rp . In some embodiments, the second decimal internucleotide linkage of the region is a Sp modified internucleotide linkage. In some embodiments, the second decanucleotide linkage of the region is an internucleotide linkage modified by Rp .

In some embodiments, the region has a length of at least 21 bases. In some embodiments, the region has a length of 21 bases. In some embodiments, a single oligonucleotide in a provided composition has a length of at least 21 bases. In some embodiments, A single oligonucleotide in the composition is provided having a length of 21 bases.

In some embodiments, the palmitic internucleotide linkage has the structure of Formula I. In some embodiments, the palmitic internucleotide linkage is a phosphorothioate. In some embodiments, each pair of palmitic internucleotide linkages in a single oligonucleotide of the provided composition independently has the structure of Formula I. In some embodiments, each pair of palmitic internucleotide linkages in a single oligonucleotide of the provided composition is a phosphorothioate.

In some embodiments, an oligonucleotide of the invention comprises one or more modified sugar moieties. In some embodiments, an oligonucleotide of the invention comprises one or more modified base moieties. Various modifications may be introduced into the sugar and/or portion as known to those of ordinary skill in the art and as described in the present invention. For example, in some embodiments, modifications are described in US9006198 and WO2014/012081, each of which is incorporated herein by reference.

In some embodiments, the sugar modification is a 2' modification. Common 2' modifications include, but are not limited to, 2'-OR ¹ , where R ^{1 is} not hydrogen. In some embodiments, the modification is 2'-OR, wherein R is an optionally substituted aliphatic group. In some embodiments, the modification is 2'-OMe. In some embodiments, the modification is 2'-MOE. In some embodiments, the invention demonstrates that the inclusion and/or localization of a particular pair of palm pure internucleotide linkages can provide similar or superior to the use of modified backbone linkages, bases, and/or sugars. Improved stability achieved by improved stability. In some embodiments, the single oligonucleotide provided by the provided composition is unmodified on the sugar. In some embodiments, the provided single oligonucleotide of the provided composition is unmodified at the 2' position of the sugar (ie, the two groups at the 2' position are -H/-H or -H /-OH). In some embodiments, the provided single oligonucleotide provided by the provided composition does not have any 2'-MOE modification.

In some embodiments, the 2' modification is -OL- or -L-, which links the 2'-carbon of the sugar moiety to another carbon of the sugar moiety. In some embodiments, the 2' modification is -OL- or -L-, which links the 2'-carbon of the sugar moiety to the 4'-carbon of the sugar moiety. In some embodiments, the 2' modification is S -cEt. In some embodiments, the modified sugar moiety is an LNA moiety.

In some embodiments, the 2' modification is -F. In some embodiments, the 2' modification is FANA. In some embodiments, the 2' modification is an FRNA.

In some embodiments, the sugar modification is a 5' modification, such as R -5'-Me, S -5'-Me, and the like.

In some embodiments, the sugar modification changes the size of the sugar ring. In some embodiments, the sugar is modified to a sugar moiety in the FHNA.

In some embodiments, the single oligonucleotide in the provided composition is a preferred acceptor of alpha protein (eg, hAgo-1 and hAgo-2) compared to a stereoregular oligonucleotide composition. . The selection and/or location of the palm pure bond as described in the present invention is a useful design parameter for oligonucleotides (such as siRNA) that interact with such proteins.

In some embodiments, a single oligonucleotide in a provided composition has at least about 25% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 30% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 35% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 40% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 45% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 50% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 55% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 60% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 65% internucleotide linkage in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 70% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 75% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 80% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 85% internucleotide linkages in a Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 90% internucleotide linkages in a Sp configuration.

In some embodiments, the oligonucleotide in the provided composition is not an oligonucleotide selected from the group consisting of T _k T _k ^m C _k AGT ^m CATGA ^m CT _k T ^m C _k ^m C _k Each nucleoside of the subscript "k" indicates (S)-cEt modification, R is a R p phosphorothioate linkage, S is a S phosphorothioate linkage, and each ^m C is a 5-methylcytosine. Modified nucleosides, and all internucleoside linkages are phosphorothioate (PS), and its stereochemical mode is selected from RSSSRSRRRS, RSSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSSSSSS, RRRRSSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.

In some embodiments, the single oligonucleotide in the provided composition is not an oligonucleotide selected from the group consisting of T _k T _k ^m C _k AGT ^m CATGA ^m CTT _k ^m C _k ^m C _k Each nucleoside of the subscript "k" indicates (S)-cEt modification, R is a R p phosphorothioate linkage, S is a S phosphorothioate linkage, and each ^m C is a 5-methylcytosine. Modified nucleosides, and all core internucleoside linkages are phosphorothioate (PS), and its stereochemical mode is selected from: RSSSRSRRRS, RSSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSRSSSS, RRRRSSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRRSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.

Palm-controlled oligonucleotide and palm-controlled oligonucleotide composition

The present invention provides a palm-controlled oligonucleotide, and a palm-controlled oligonucleotide composition having high crude product purity and high diastereomeric purity. In some embodiments, the invention provides a palm-controlled oligonucleotide, and a palm-controlled oligonucleotide composition having a high crude product purity. In some embodiments, the invention provides a palm-controlled oligonucleotide, and a palm-controlled oligonucleotide composition having high diastereomeric purity.

In some embodiments, the palm-controlled oligonucleotide composition is a substantially pure preparation of a certain oligonucleotide type, as the oligonucleotide that is not of the oligonucleotide type in the composition is Preparation processes from this type of oligonucleotide, in some cases, impurities after certain purification procedures.

In some embodiments, the invention provides oligonucleotides comprising one or more diastereomeric pure internucleotide linkages for palm-bonded phosphorus. In some embodiments, the invention provides oligonucleotides comprising one or more diastereomeric pure internucleotide linkages having the structure of Formula I. In some embodiments, the invention provides oligonucleotides comprising one or more diastereomeric pure internucleotide linkages and one or more phosphates for palm-bonded phosphorus Ester linkage. In some embodiments, the invention provides oligonucleotides comprising one or more diastereomeric pure internucleotide linkages having the structure of Formula I and one or more phosphodiester linkages. In some embodiments, the invention provides oligonucleotides comprising one or more diastereomeric pure internucleotide linkages having the structure of Formula Ic and one or more phosphodiester linkages. In some embodiments, the oligonucleotides are prepared by using stereoselective oligonucleotide synthesis as described in the application, which is used to form a pre-form for the palm-bonded phosphorus Designed for diastereomeric pure internucleotide linkages. For example, in ( R p / S p, R p / S p, R p / S p, R p, R p, S p, S p, S p, S p, S p S p, S p, In an exemplary oligonucleotide of S p, S p, R p, R p, R p, R p, R p)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGs1Cs1As1CsC], the first three internucleotide linkages use traditional oligonucleotides The glycosidic acid synthesis method is constructed, and the diastereomeric pure internucleotide linkages are constructed under stereochemical control as described in the present application. Exemplary internucleotide linkages include internucleotide linkages having the structure of Formula I , as further described below.

In some embodiments, the invention provides a palm-controlled oligonucleotide, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different stereochemistry relative to each other and / or a different P modification. In certain embodiments, the invention provides a palm-controlled oligonucleotide wherein at least two individual internucleotide linkages within the oligonucleotide have different P modifications relative to each other. In certain embodiments, the invention provides a palm-controlled oligonucleotide, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P modifications relative to each other, and Wherein the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage. In certain embodiments, the invention provides a palm-controlled oligonucleotide, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P modifications relative to each other, and Wherein the palm controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least one phosphorothioate diester internucleotide linkage. In certain embodiments, the invention provides a palm-controlled oligonucleotide, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P modifications relative to each other, and Wherein the palm controlled oligonucleotide comprises at least one phosphorothioate triester internucleotide linkage. In certain embodiments, the invention provides a palm-controlled oligonucleotide, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P modifications relative to each other, and Wherein the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least one phosphorothioate triester internucleotide linkage.

In certain embodiments, the modified internucleotide linkage has the structure of Formula I :

The variables are as defined and described below. In some embodiments, the linkage of Formula I is palmar. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising one or more modified internucleotide linkages of Formula I. In some embodiments, the present invention provides a chiral controlled oligonucleotide which comprises one or more rooms by Formula I of the modified nucleotide linkages, and wherein the individual oligonucleotides of the formula I The internucleotide linkages have different P modifications relative to each other. In some embodiments, the present invention provides a chiral controlled oligonucleotide which comprises one or more rooms by Formula I of the modified nucleotide linkages, and wherein the individual oligonucleotides of the formula I The internucleotide linkages have -XLR ¹ that are different relative to each other. In some embodiments, the present invention provides a chiral controlled oligonucleotide which comprises one or more rooms by Formula I of the modified nucleotide linkages, and wherein the individual oligonucleotides of the formula I The internucleotide linkages have different Xs relative to each other. In some embodiments, the present invention provides a chiral controlled oligonucleotide which comprises one or more rooms by Formula I of the modified nucleotide linkages, and wherein the individual oligonucleotides of the formula I The internucleotide linkages have -LR ¹ that are different relative to each other. In some embodiments, the palm-controlled oligonucleotide is an oligonucleotide of a particular oligonucleotide type in the provided composition. In some embodiments, the palm-controlled oligonucleotide is an oligonucleotide having a common base sequence and length, a common backbone linkage pattern, and a common backbone-to-palm center pattern in the provided composition.

In some embodiments, the invention provides a palm-controlled oligonucleotide, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different stereochemistry relative to each other and / or a different P modification. In some embodiments, the invention provides a palm-controlled oligonucleotide, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different stereochemistry relative to each other, and wherein At least a portion of the structure of the palm controlled oligonucleotide is characterized by a repeating pattern of alternating stereochemistry.

In some embodiments, the invention provides a palm-controlled oligonucleotide, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P modifications relative to each other, except that in its partially -XLR ¹ having different X atoms, and / or portions thereof having different -XLR ¹ in which L group, and / or portions thereof having different -XLR ¹ in which R ¹ atom.

In some embodiments, the invention provides a palm-controlled oligonucleotide, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different stereochemistry relative to each other and/or Different P modifications and oligonucleotides have a structure represented by the following formula: [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny]

Wherein: each R ^B independently represents a nucleotide unit having a configuration of a block R in the phosphorus linkages; each independently represent S ^B block having a nucleotide unit in the S configuration at phosphorus linkage; N1 to Each of ny is zero or an integer requiring at least one odd number n and at least one even number n must not be zero such that the oligonucleotide comprises at least two individual nucleotides having different stereochemistry relative to each other Bonding; and wherein the sum of n1 to ny is between 2 and 200, and in some embodiments, is selected from the group consisting of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 The lower limit of the group consisting of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or greater than 25 is selected from 5, 10, 15, 20, 25, 30, 35 Groups of 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 and 200 Between the upper limits, and the upper limit is greater than the lower limit.

In some such embodiments, each n has the same value; in some embodiments, each even number n has the same value as each other even number n; in some embodiments, each odd number n has the same as each other odd number n Value; in some embodiments, at least two even numbers n have different values from each other; in some embodiments, at least two odd numbers n have different values from each other.

In some embodiments, at least two adjacent n are equal to each other such that the provided oligo Glycosylates include adjacent blocks of equal length S stereo chemical linkages and R stereochemical linkages. In some embodiments, the provided oligonucleotides comprise repeating blocks of equal length S and R stereochemical linkages. In some embodiments, the provided oligonucleotides comprise repeating blocks of S and R stereochemical linkages, wherein at least two such blocks have different lengths from each other; in some such embodiments, each S stereo The chemical blocks have the same length and have different lengths from the respective R stereochemical lengths, and each of the R stereochemical lengths may be the same length as each other.

In some embodiments, at least two skip-adjacent n are equal to one another such that the provided oligonucleotide comprises at least two lengths that are equal to each other and separated by another stereochemically bonded block. A first stereochemically bonded block, the spacer block can have the same length or a different length than the first stereochemical block.

In some embodiments, the n associated with the linkage block of the provided oligonucleotide ends has the same length. In some embodiments, the provided oligonucleotides have an end block of the same linked stereochemistry. In some such embodiments, the end blocks are separated from each other by a mid-block of another linked stereochemistry.

In some embodiments, the oligonucleotides of the formula [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny] are provided as stereoblocks. In some embodiments, the oligonucleotide of the formula [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny] is provided as a stereoscopic skip. In some embodiments, the oligonucleotides of the formula [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny] are provided as stereo-alternates. In some embodiments, the oligonucleotides of the formula [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny] are provided as spacers.

In some embodiments, the oligonucleotide of the formula [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny] is provided with any of the above described modes and further comprises a P modification mode . For example, in some embodiments, the oligonucleotides of the formula [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny] are provided as stereo skips and P modifier skips. In some embodiments, the oligonucleotides of the formula [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny ] are provided as stereoblocks and P-modified alternations. In some embodiments, the oligonucleotides of the formula [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny] are provided as stereo-alternates and P-modified blocks.

In some embodiments, the oligonucleotide of the formula [S ^B n1R ^B n2S ^B n3R ^B n4...S ^B nxR ^B ny] is provided as a palm-controlled oligonucleotide comprising one or more Modified internucleotide linkages independently of the structure of Formula I:

Wherein: P* is an asymmetric phosphorus atom and is R p or S p; W is O, S or Se; and X, Y and Z are each independently -O-, -S-, -N(-LR ¹ )- Or L; L is a covalent bond or a optionally substituted straight or branched chain C ₁ -C ₁₀ alkylene group, wherein one or more methylene units of L are optionally and optionally selected from the group consisting of Substituted group substitution: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ - , -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C( O) N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O- , -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-; R ¹ is halogen, R or optionally substituted C ₁ -C _{a 50} aliphatic group wherein one or more methylene units are optionally and independently substituted with a group selected from the group consisting of C ₁ -C ₆ alkyl, C ₁ -C ₆ alkylene , -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')- , -N(R') C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O -; each R' is independently -R, -C(O)R, -CO ₂ R or -SO ₂ R, or: two R's together with the intervening atoms form an optionally substituted aryl, carbocyclic, a heterocyclic or heteroaryl ring; -Cy- is a divalent ring selected from the group consisting of a phenylene group, a carbocyclic group, an aryl group, a heteroaryl group, and a heterocyclic group; each R independently a hydrogen or a group optionally substituted with a C ₁ -C ₆ aliphatic group, a carbocyclic group, an aryl group, a heteroaryl group, and a heterocyclic group; Independently indicates the linkage to the nucleoside.

In some embodiments, L is a covalent bond or an optionally substituted straight or branched C ₁ -C ₁₀ alkylene group, wherein one or more methylene units of L are optionally replaced by the following : C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S- , -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N( R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')- , -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, - C(O)S-, -OC(O)- or -C(O)O-; R ¹ is halogen, R or optionally substituted C ₁ -C ₅₀ aliphatic, wherein one or more The base unit is optionally substituted with the following: optionally substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkylene, -C≡C-, -C(R') ₂ -, Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O) N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-,- OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-; each R' is independently -R, -C(O)R, -CO or -SO ₂ R ₂ R Or: two R's on the same nitrogen together with the intervening atom form an optionally substituted heterocyclic or heteroaryl ring, or two R's on the same carbon together with the intervening atom form an optionally substituted aryl group, a carbocyclic, heterocyclic or heteroaryl ring; -Cy- is a divalent ring selected from the group consisting of a phenylene group, a carbocyclic group, an extended aryl group, a heteroaryl group or a heterocyclic group; R is independently hydrogen or an optionally substituted group selected from a C ₁ -C ₆ aliphatic group, a phenyl group, a carbocyclic group, an aryl group, a heteroaryl group or a heterocyclic group; Independently indicates the linkage to the nucleoside.

In some embodiments, the palm-controlled oligonucleotide comprises one or more modified internucleotide phosphorus linkages. In some embodiments, the palm-controlled oligonucleotide comprises, for example, a phosphorothioate or a phosphorothioate linkage. In some embodiments, the palm-controlled oligonucleotide comprises a phosphorothioate triester linkage. In some embodiments, the palm-controlled oligonucleotide comprises at least two phosphorothioate linkages. In some embodiments, the palm-controlled oligonucleotide comprises at least three phosphorothioate linkages. In some embodiments, the palm-controlled oligonucleotide comprises at least four phosphorothioate linkages. In some embodiments, the palm-controlled oligonucleotide comprises at least five phosphorothioate linkages. Examples of such modified internucleotide phosphorus linkages are further described herein.

In some embodiments, the palm-controlled oligonucleotide comprises a different internucleotide phosphorus linkage. In some embodiments, the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least one modified internucleotide linkage. In some embodiments, the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least one phosphorothioate linkage. In some embodiments, the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least two phosphorothioate linkages. In some embodiments, the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least three phosphorothioate triester linkages. In some embodiments, the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least four phosphorothioate triester linkages. In some embodiments, the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least five phosphorothioate triester linkages. Examples of such modified internucleotide phosphorus linkages are further described herein.

In some embodiments, the phosphorothioate triester linkage comprises a pair of palmitic adjuvants, for example, for controlling the stereoselectivity of the reaction. In some embodiments, the phosphorothioate triester linkage does not comprise a palmitic adjuvant. In some embodiments, the phosphorothioate triester linkage is purposefully maintained until administration to the individual and/or purposefully maintains the phosphorothioate linkage during administration to the individual.

In some embodiments, the palm-controlled oligonucleotide is linked to a solid support. In some embodiments, the palm-controlled oligonucleotide is cleaved from the solid support.

In some embodiments, the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least two consecutive modified internucleotide linkages. In some embodiments, the palm-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least two consecutive phosphorothioate interester internucleotide linkages.

In some embodiments, the palm-controlled oligonucleotide is a block. In some embodiments, the palm-controlled oligonucleotide is a stereoblock. In some embodiments, the palm-controlled oligonucleotide is a P-modified block. In some embodiments, the palm-controlled oligonucleotide is a linked block.

In some embodiments, the palm-controlled oligonucleotides are alternating bodies. In some embodiments, the palm-controlled oligonucleotides are stereo-alternates. In some embodiments, the palm-controlled oligonucleotide is a P-modifying alternation. In some embodiments, the palm-controlled oligonucleotide is a linkage alternation.

In some embodiments, the palm-controlled oligonucleotide is a monomer. In some embodiments, the palm-controlled oligonucleotide is a stereosome. In some embodiments, the palm-controlled oligonucleotide is a P-modified monomer. In some embodiments, the palm-controlled oligonucleotide is a linked monomer.

In some embodiments, the palm-controlled oligonucleotide is a spacer.

In some embodiments, the palm-controlled oligonucleotide is a skip.

In some embodiments, the invention provides oligonucleotides comprising one or more modified internucleotide linkages independently having the structure of Formula I :

Wherein: P* is an asymmetric phosphorus atom and is R p or S p; W is O, S or Se; and X, Y and Z are each independently -O-, -S-, -N(-LR ¹ )- Or L; L is a covalent bond or a optionally substituted straight or branched chain C ₁ -C ₁₀ alkylene group, wherein one or more methylene units of L are optionally and optionally selected from the group consisting of Substituted group substitution: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ - , -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C( O) N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O- , -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-; R ¹ is halogen, R or optionally substituted C ₁ -C _{a 50} aliphatic group wherein one or more methylene units are optionally and independently substituted with a group selected from the group consisting of C ₁ -C ₆ alkyl, C ₁ -C ₆ alkylene , -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')- , -N(R') C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O - each R' is independently -R, -C(O)R, -CO ₂ R or -SO ₂ R, or: two R's together with the intercalating atom form an optionally substituted aryl, carbocyclic, a heterocyclic or heteroaryl ring; -Cy- is a divalent ring selected from the group consisting of a phenylene group, a carbocyclic group, an aryl group, a heteroaryl group, and a heterocyclic group; each R independently a hydrogen or a group optionally substituted with a C ₁ -C ₆ aliphatic group, a carbocyclic group, an aryl group, a heteroaryl group, and a heterocyclic group; Independently indicates the linkage to the nucleoside.

In some embodiments, L is a covalent bond or an optionally substituted straight or branched C ₁ -C ₁₀ alkylene group, wherein one or more methylene units of L are optionally replaced by the following : C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S- , -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N( R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')- , -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, - C(O)S-, -OC(O)- or -C(O)O-; R ¹ is halogen, R or optionally substituted C ₁ -C ₅₀ aliphatic, wherein one or more The base unit is optionally substituted with the following: optionally substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkylene, -C≡C-, -C(R') ₂ -, Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O) N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-,- OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-; each R' is independently -R, -C(O)R, -CO or -SO ₂ R ₂ R Or: two R's on the same nitrogen together with the intervening atom form an optionally substituted heterocyclic or heteroaryl ring, or two R's on the same carbon together with the intervening atom form an optionally substituted aryl group, a carbocyclic, heterocyclic or heteroaryl ring; -Cy- is a divalent ring selected from the group consisting of a phenylene group, a carbocyclic group, an extended aryl group, a heteroaryl group or a heterocyclic group; R is independently hydrogen or an optionally substituted group selected from a C ₁ -C ₆ aliphatic group, a phenyl group, a carbocyclic group, an aryl group, a heteroaryl group or a heterocyclic group; Independently indicates the linkage to the nucleoside.

In some embodiments, P * is an asymmetric phosphorous atom and R p or S p. In some embodiments, P * is R p. In other embodiments, P* is Sp . In some embodiments, the oligonucleotide comprises a nucleotide or a plurality of linkages of formula I, wherein P * is independently each R p or S p. In some embodiments, the oligonucleotide comprises a nucleotide or a plurality of inter-linkage of the formula I, wherein each P * is R p. In some embodiments, the oligonucleotide comprises one or more internucleotide linkages of Formula I , wherein each P* is Sp . In some embodiments, the oligonucleotide comprises at least one of Formula I of between nucleotide linkages, wherein P * is R p. In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I , wherein P* is Sp . In some embodiments, the oligonucleotide comprises at least one of Formula I of between nucleotide linkages, wherein P * is R p; between formula I and at least one of the nucleotide linkages, wherein P * is S p.

In some embodiments, W is O, S or Se. In some embodiments, W is O. In some embodiments, W is S. In some embodiments, W is Se. In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I , wherein W is O. In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I , wherein W is S. In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I , wherein W is Se.

In some embodiments, each R is independently selected from hydrogen or C ₁ -C ₆ aliphatic group, optionally a phenyl, carbocyclic, aryl, heteroaryl or heterocyclic group of the substituted group.

In some embodiments, R is hydrogen. In some embodiments, R is optionally substituted group selected from the group consisting of C ₁ -C ₆ aliphatic, phenyl, carbocyclyl, aryl, heteroaryl or heterocyclyl.

In some embodiments, R is the optionally substituted C ₁ -C ₆ aliphatic group. In some embodiments, R is optionally substituted alkyl of C ₁ -C _6. In some embodiments, R is optionally substituted straight or branched chain hexyl. In some embodiments, R is optionally substituted straight or branched chain pentyl. In some embodiments, R is optionally substituted straight or branched chain butyl. In some embodiments, R is optionally substituted straight or branched chain propyl. In some embodiments, R is optionally substituted ethyl. In some embodiments, R is optionally substituted methyl.

In some embodiments, R is optionally substituted phenyl. In some embodiments, R is substituted phenyl. In some embodiments, R is phenyl.

In some embodiments, R is optionally substituted carbocyclyl. In some embodiments, R is the optionally substituted C ₃ -C ₁₀ carbocyclyl. In some embodiments, R is optionally substituted monocyclic carbocyclyl. In some embodiments, R is optionally substituted cycloheptyl. In some embodiments, R is optionally substituted cyclohexyl. In some embodiments, R is optionally substituted cyclopentyl. In some embodiments, R is optionally substituted cyclobutyl. In some embodiments, R is optionally substituted cyclopropyl. In some embodiments, R is optionally substituted bicyclic carbocyclyl.

In some embodiments, R is optionally substituted aryl. In some embodiments, R is optionally substituted bicyclic aryl ring.

In some embodiments, R is optionally substituted heteroaryl. In some embodiments, R is optionally substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen. In some embodiments, R is a substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an unsubstituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen.

In some embodiments, R is optionally substituted 5 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is optionally substituted 6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, R is an optionally substituted 5 membered monocyclic heteroaryl ring having 1 heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, the R is selected from pyrrolyl, furyl or thienyl.

In some embodiments, R is an optionally substituted 5 membered heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is an optionally substituted 5 membered heteroaryl ring having one nitrogen atom and another heteroatom selected from sulfur or oxygen. Exemplary R groups include optionally substituted pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl or isoxazolyl.

In some embodiments, R is a 6 membered heteroaryl ring having 1-3 nitrogen atoms. In other embodiments, R is optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms. In some embodiments, R is optionally substituted 6-membered heteroaryl ring having 2 nitrogen atoms. In certain embodiments, R is a 6 membered heteroaryl ring substituted with one nitrogen. Exemplary R groups include optionally substituted pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl or tetrazinyl.

In certain embodiments, R is an optionally substituted 8-10 membered bicyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is optionally substituted 5,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R is optionally substituted 5,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is optionally substituted 5,6-fused heteroaryl ring having one heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted thiol group. In some embodiments, R is optionally substituted azabicyclo[3.2.1]octyl. In certain embodiments, R is optionally substituted 5,6-fused heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is optionally substituted azaindolyl. In some embodiments, R is optionally substituted benzimidazolyl. In some embodiments, R is optionally substituted benzothiazolyl. In some embodiments, R is optionally substituted benzoxazolyl. In some embodiments, R is optionally substituted carbazolyl. In certain embodiments, R is optionally substituted 5,6-fused heteroaryl ring having 3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In certain embodiments, R is optionally substituted 6,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is optionally substituted 6,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having one heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is optionally substituted quinolinyl. In some embodiments, R is an optionally substituted isoquinolyl. According to one aspect, R is an optionally substituted 6,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen or sulfur. In some embodiments, R is quinazoline or quinoxaline.

In some embodiments, R is optionally substituted heterocyclyl. In some embodiments, R is optionally substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is a substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an unsubstituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, R is optionally substituted heterocyclyl. In some embodiments, R is optionally substituted 6-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 6 membered partially unsaturated heterocyclic ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 6 membered partially unsaturated heterocyclic ring having 2 oxygen atoms.

In certain embodiments, R is a 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is oxiranyl, oxetane, tetrahydrofuranyl, tetrahydropyranyl, oxetanyl, aziridine, azetidinyl, Pyrrolidinyl, piperidinyl, azepanyl, thietyl, thietane, tetrahydrothiophenyl, tetrahydrothiopyranyl, thiaheptanyl, Dioxolane, oxathiolanyl, oxazolidinyl, imidazolidinyl, thiazolidinyl, dithiolanyl, dioxanyl, morpholinyl, oxathia Cyclohexane, piperazinyl, thiomorpholinyl, dithiaalkyl, dioxaheptyl, oxazepine, oxazepine, dithiaheptyl, two Azacycloheptyl, dihydrofuranone, tetrahydropipedone, oxetanone, pyrrolidinyl, piperidinone, azepanone, dihydrothiophenone, Tetrahydrothiopiperidone, thiacyclopentanone, oxazolidinone, oxazepine, oxazepine, dioxolane, dioxane Keto group, dioxepanone, oxathiolane group, oxapipetanone, oxazetanone, thiazolidinone, buprofezinyl, thiazepinone Base, imidazolidinone, tetrahydropyrimidinyl, diazepanone, imidazolidinone, oxazolidinedione, thiazolidinedione, dioxolanedione, Oxetane ketonedione, piperazinedione, morpholinanone, sulfur Morpholine dione group, tetrahydropyranyl, tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl, piperazinyl, pyrrolidinyl, tetrahydrothienyl, or tetrahydro-pyran-sulfur group. In some embodiments, R is optionally substituted 5 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In certain embodiments, R is optionally substituted 5-6 membered partially unsaturated monocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is optionally substituted tetrahydropyridyl, dihydrothiazolyl, dihydrooxazolyl or oxazolinyl.

In some embodiments, R is an optionally substituted 8-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted porphyrin group. In some embodiments, R is an optionally substituted isoindolyl group. In some embodiments, R is optionally substituted 1,2,3,4-tetrahydroquinoline. In some embodiments, R is optionally substituted 1,2,3,4-tetrahydroisoquinoline.

In some embodiments, each R 'is independently -R, -C (O) R, -CO 2 R , or -SO ₂ R, or: two R on the same nitrogen' atom to form therewith an optionally inserted along Substituted heterocyclic or heteroaryl rings, or two R's on the same carbon, together with the intervening atoms, form an optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl ring.

In some embodiments, R 'is -R, -C (O) R, -CO 2 R , or -SO ₂ R, wherein R is as defined above and described herein.

In some embodiments, R' is -R, wherein R is as defined and described above and herein. In some embodiments, R' is hydrogen.

In some embodiments, R' is -C(O)R, wherein R is as defined above and described herein. In some embodiments, R 'is -CO ₂ R, wherein R is as defined above and described herein. In some embodiments, R 'is -SO ₂ R, wherein R is as defined above and described herein.

In some embodiments, two R's on the same nitrogen, together with the intervening atoms, form an optionally substituted heterocyclic or heteroaryl ring. In some embodiments, two R's on the same carbon, together with the intervening atoms, form an optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl ring.

In some embodiments, -Cy- is an optionally substituted divalent ring selected from the group consisting of a phenylene group, a carbocyclic group, an extended aryl group, a heteroaryl group, or a heterocyclic group.

In some embodiments, -Cy- is an optionally substituted phenyl group. In some embodiments, -Cy- is an optionally substituted carbocyclic group. In some embodiments, -Cy- is an optionally substituted aryl group. In some embodiments, -Cy- is an optionally substituted heteroaryl. In some embodiments, -Cy- is an optionally substituted heterocyclic group.

In some embodiments, X, Y, and Z are each independently -O-, -S-, -N(-LR ¹ )- or L, wherein L and R ¹ are each independently as defined above and described below .

In some embodiments, X is -O-. In some embodiments, X is -S-. In some embodiments, X is -O- or -S-. In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I , wherein X is -O-. In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I , wherein X is -S-. In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I , wherein X is -O-; and at least one internucleotide linkage of Formula I , wherein X is -S-. In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I , wherein X is -O-; and at least one internucleotide linkage of Formula I , wherein X is -S-; And at least one internucleotide linkage of formula I , wherein L is an optionally substituted straight or branched chain C ₁ -C ₁₀ alkylene group, wherein one or more methylene units of L are optionally and independently Substituted by the following: C ₁ -C ₆ alkylene, C ₁ -C ₆ -alkylene, -C≡C-, -C(R') ₂ -, -Cy-, -O- , -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')- , -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N( R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O )-, -C(O)S-, -OC(O)- or -C(O)O-.

In some embodiments, X is -N(-LR ¹ )-. In some embodiments, X is -N (R ¹⁾ -. In some embodiments, X is -N(R')-. In some embodiments, X is -N(R)-. In some embodiments, X is -NH-.

In some embodiments, X is L. In some embodiments, X is a covalent bond. In some embodiments, X is or optionally substituted straight or branched C ₁ -C ₁₀ alkyl, wherein one or more methylene units of L are optionally and independently replaced by: Substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, -SS -, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R') C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S (O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O ) S-, -OC(O)- or -C(O)O-. In some embodiments, X is optionally substituted C ₁ -C ₁₀ alkyl or C ₁ -C ₁₀ extended alkenyl. In some embodiments, X is a methylene group.

In some embodiments, Y is -O-. In some embodiments, Y is -S-.

In some embodiments, Y is -N(-LR ¹ )-. In some embodiments, Y is -N (R ¹⁾ -. In some embodiments, Y is -N(R')-. In some embodiments, Y is -N(R)-. In some embodiments, Y is -NH-.

In some embodiments, Y is L. In some embodiments, L is a covalent bond. In some embodiments, Y is or optionally substituted straight or branched chain C ₁ -C ₁₀ alkyl, wherein one or more methylene units of L are optionally replaced by the following: optionally Substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, -SS -, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R') C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S (O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O ) S-, -OC(O)- or -C(O)O-. In some embodiments, Y is optionally substituted C ₁ -C ₁₀ alkyl or C ₁ -C ₁₀ extended alkenyl. In some embodiments, Y is a methylene group.

In some embodiments, Z is -O-. In some embodiments, Z is -S-.

In some embodiments, Z is -N(-LR ¹ )-. In some embodiments, Z is -N (R ¹⁾ -. In some embodiments, Z is -N(R')-. In some embodiments, Z is -N(R)-. In some embodiments, Z is -NH-.

In some embodiments, Z is L. In some embodiments, Z is a covalent bond. In some embodiments, Z is or optionally substituted straight or branched C ₁ -C ₁₀ alkyl, wherein one or more methylene units of L are optionally replaced by the following: optionally Substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, -SS -, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R') C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S (O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O ) S-, -OC(O)- or -C(O)O-. In some embodiments, Z is optionally substituted C ₁ -C ₁₀ alkyl or C ₁ -C ₁₀ extended alkenyl. In some embodiments, Z is a methylene group.

In some embodiments, L is a covalent bond or an optionally substituted straight or branched C ₁ -C ₁₀ alkylene group, wherein one or more methylene units of L are optionally replaced by the following : optionally substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkylene, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S- , -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N( R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')- , -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, - C(O)S-, -OC(O)- or -C(O)O-.

In some embodiments, L is a covalent bond. In some embodiments, L is optionally substituted straight or branched chain C ₁ -C ₁₀ alkylene, wherein one or more methylene units of L are optionally and independently substituted by: the substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenylene ^{group, - C≡C -, -C (R} ') 2 -, - Cy -, - O -, - S -, - SS- , -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C (O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S( O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O) S-, -OC(O)- or -C(O)O-.

In some embodiments, L has the structure -L ¹ -V-, wherein: L ¹ is an optionally substituted group selected from the group consisting of: , , , , C ₁ -C ₆ alkylene, C ₁ -C ₆ alkylene, carbocyclyl, aryl, C ₁ -C ₆ heteroalkyl, heterocyclic and heteroaryl; V system Selected from -O-, -S-, -NR'-, C(R') ₂ , -SS-, -BSSC-, Or a group selected from the group consisting of C ₁ -C ₆ alkylene, aryl, C ₁ -C ₆ heteroalkyl, heterocyclyl and heteroaryl; A is =0. =S, =NR' or =C(R') ₂ ; B and C are each independently -O-, -S-, -NR'-, -C(R') ₂ -, or selected from C ₁ - a C ₆ alkyl, carbocyclyl, aryl, heterocyclyl or heteroaryl substituted group; and each R' is independently as defined above and described herein.

In some embodiments, L ¹ is , , , ,

In some embodiments, L ¹ is Wherein the ring Cy' is an optionally substituted aryl group, a carbocyclic group, a heteroaryl group or a heterocyclic group. In some embodiments, L ¹ is replaced as appropriate . In some embodiments, L ¹ is .

In some embodiments, L ^{1 is} coupled to X. In some embodiments, L ¹ is an optionally substituted group selected from the group consisting of: , , , And the sulfur atom is attached to V. In some embodiments, L ¹ is an optionally substituted group selected from the group consisting of: , , , And the carbon atom is attached to X.

In some embodiments, L has the following structure: Wherein: E is -O-, -S-, -NR'- or -C(R') ₂ -; Is a single bond or a double bond; two R ^L1 together with the two carbon atoms to which they are bonded form an optionally substituted aryl, carbocyclic, heteroaryl or heterocyclic ring; and each R' is independently as defined above And as described here.

In some embodiments, L has the following structure: Wherein: G is -O-, -S- or -NR'; It is a single bond or a double bond; and R ^L1 is formed with two bound thereto together with the two carbon atoms of the optionally substituted aryl group, C ₃ -C ₁₀ carbocyclic, heteroaryl or heterocyclic ring.

In some embodiments, L has the following structure: Wherein: E is -O-, -S-, -NR'- or -C(R') ₂ -; D is =N-, =C(F)-, =C(Cl)-, =C(Br )-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ ) -; and each R' is independently as defined above and described herein.

In some embodiments, L has the following structure: Where: G is -O-, -S- or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ )-.

In some embodiments, L has the following structure: Wherein: E is -O-, -S-, -NR'- or -C(R') ₂ -; D is =N-, =C(F)-, =C(Cl)-, =C(Br )-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ ) -; and each R' is independently as defined above and described herein.

In some embodiments, L has the following structure: Where: G is -O-, -S- or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ )-.

In some embodiments, L has the following structure: Wherein: E is -O-, -S-, -NR'- or -C(R') ₂ -; Is a single bond or a double bond; two R ^L1 together with the two carbon atoms to which they are bonded form an optionally substituted aryl group, a C ₃ -C ₁₀ carbocyclic ring, a heteroaryl group or a heterocyclic ring; and each R' independent The ground is as defined above and described herein.

In some embodiments, L has the following structure: Wherein: G is -O-, -S- or -NR'; Is a single bond or a double bond; two R ^L1 together with the two carbon atoms to which they are bonded form an optionally substituted aryl group, a C ₃ -C ₁₀ carbocyclic ring, a heteroaryl group or a heterocyclic ring; and each R' independent The ground is as defined above and described herein.

In some embodiments, L has the following structure: Wherein: E is -O-, -S-, -NR'- or -C(R') ₂ -; D is =N-, =C(F)-, =C(Cl)-, =C(Br )-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ ) -; and each R' is independently as defined above and described herein.

In some embodiments, L has the following structure: Where: G is -O-, -S- or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ )-; and each R' is independently as above Defined and described here.

In some embodiments, L has the following structure: Wherein: E is -O-, -S-, -NR'- or -C(R') ₂ -; D is =N-, =C(F)-, =C(Cl)-, =C(Br )-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ ) -; and each R' is independently as defined above and described herein.

In some embodiments, L has the following structure: Where: G is -O-, -S- or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ )-; and each R' is independently as above Defined and described here.

In some embodiments, L has the following structure: Wherein: E is -O-, -S-, -NR'- or -C(R') ₂ -; Is a single bond or a double bond; two R ^L1 together with the two carbon atoms to which they are bonded form an optionally substituted aryl group, a C ₃ -C ₁₀ carbocyclic ring, a heteroaryl group or a heterocyclic ring; and each R' independent The ground is as defined above and described herein.

In some embodiments, L has the following structure: Wherein: G is -O-, -S- or -NR'; Is a single bond or a double bond; two R ^L1 together with the two carbon atoms to which they are bonded form an optionally substituted aryl group, a C ₃ -C ₁₀ carbocyclic ring, a heteroaryl group or a heterocyclic ring; and each R' independent The ground is as defined above and described herein.

In some embodiments, L has the following structure: Wherein: E is -O-, -S-, -NR'- or -C(R') ₂ -; D is =N-, =C(F)-, =C(Cl)-, =C(Br )-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ ) -; and each R' is independently as defined above and described herein.

In some embodiments, L has the following structure: Where: G is -O-, -S- or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ )-; and R' is as defined above and Described here.

In some embodiments, L has the following structure: Wherein: E is -O-, -S-, -NR'- or -C(R') ₂ -; D is =N-, =C(F)-, =C(Cl)-, =C(Br )-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ ) -; and each R' is independently as defined above and described herein.

In some embodiments, L has the following structure: Where: G is -O-, -S- or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO ₂ )-, =C(CO ₂ -(C ₁ -C ₆ aliphatic))- or =C(CF ₃ )-; and R' is as defined above and Described here.

In some embodiments, L has the following structure: Wherein the phenyl ring is substituted as appropriate. In some embodiments, the phenyl ring is unsubstituted. In some embodiments, the phenyl ring is substituted.

In some embodiments, L has the following structure: Wherein the phenyl ring is substituted as appropriate. In some embodiments, the phenyl ring is unsubstituted. In some embodiments, the phenyl ring is substituted.

In some embodiments, L has the following structure: among them: It is a single bond or a double bond; and R ^L1 is formed with two bound thereto together with the two carbon atoms of the optionally substituted aryl group, C ₃ -C ₁₀ carbocyclic, heteroaryl or heterocyclic ring.

In some embodiments, L has the following structure: Wherein: G is -O-, -S- or -NR'; It is a single bond or a double bond; and R ^L1 is formed with two bound thereto together with the two carbon atoms of the optionally substituted aryl group, C ₃ -C ₁₀ carbocyclic, heteroaryl or heterocyclic ring.

In some embodiments, E is -O-, -S-, -NR'-, or -C(R') _2- , wherein each R' is independently as defined above and described herein. In some embodiments, E is -O-, -S-, or -NR'-. In some embodiments, E is -O-, -S-, or -NH-. In some embodiments, E is -O-. In some embodiments, E is -S-. In some embodiments, E is -NH-.

In some embodiments, G is -O-, -S-, or -NR', wherein each R' is independently as defined above and described herein. In some embodiments, G is -O-, -S-, or -NH-. In some embodiments, G is -O-. In some embodiments, G is -S-. In some embodiments, G is -NH-.

In some embodiments, L is -L ³ -G-, wherein: L ³ is optionally substituted C ₁ -C ₅ alkyl or alkenyl, wherein one or more methylene units are optionally Independently by -O-, -S-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -S(O)-, -S (O) ₂ - or Substitution; and wherein G, R' and ring Cy' are each independently as defined above and described herein.

In some embodiments, L is -L ³ -S-, wherein L ^{3 is} as defined above and described herein. In some embodiments, L is -L ³ -O-, wherein L ^{3 is} as defined above and described herein. In some embodiments, L is -L ³ -N(R')-, wherein L ³ and R' are each independently as defined above and described herein. In some embodiments, L is -L ³ -NH-, wherein L ³ as described and R 'are each independently as defined above and herein.

In some embodiments, L ³ is optionally substituted C ₅ alkyl or alkenyl, wherein one or more methylene units are optionally taken through -O-, -S-, -N ( R')-, -C(O)-, -C(S)-, -C(NR')-, -S(O)-, -S(O) ₂ - or Substitution, and R' and ring Cy' are each independently as defined above and described herein. In some embodiments, L ³ is optionally substituted C ₅ alkyl. In some embodiments, -L ³ -G- is .

In some embodiments, L ³ is optionally substituted C ₄ alkyl or alkenyl, wherein one or more methylene units are optionally taken through -O-, -S-, -N ( R')-, -C(O)-, -C(S)-, -C(NR')-, -S(O)-, -S(O) ₂ - or Substitutions, and R' and Cy' are each independently as defined above and described herein.

In some embodiments, -L ³ -G- is , ,

In some embodiments, L ³ is optionally substituted C ₃ alkyl or alkenyl, wherein one or more methylene units are optionally taken through -O-, -S-, -N ( R')-, -C(O)-, -C(S)-, -C(NR')-, -S(O)-, -S(O) ₂ - or Substitutions, and R' and Cy' are each independently as defined above and described herein.

In some embodiments, -L ³ -G- is , , ,

In some embodiments, L is . In some embodiments, L is or . In some embodiments, L is or .

In some embodiments, L ³ is optionally substituted C ₂ alkyl or alkenyl, wherein one or more methylene units are optionally taken through -O-, -S-, -N ( R')-, -C(O)-, -C(S)-, -C(NR')-, -S(O)-, -S(O) ₂ - or Substitutions, and R' and Cy' are each independently as defined above and described herein.

In some embodiments, -L ³ -G- is , wherein G and Cy' are each independently as defined above and described herein. In some embodiments, L is .

In some embodiments, L is -L ⁴ -G-, wherein L ⁴ is optionally substituted C ₁ -C ₂ alkylene; and G is as defined above and described herein. In some embodiments, L is -L ⁴ -G-, wherein L ⁴ is the optionally substituted C ₁ -C ₂ alkylene; G as described herein and as defined above; and G is connected to R ^1. In some embodiments, L is -L ⁴ -G-, wherein L ⁴ is optionally substituted methylene; G is as defined above and described herein; and G is attached to R ¹ . In some embodiments, L is -L ⁴ -G-, wherein L ⁴ is methylene; G is as defined above and described herein; and G is attached to R ¹ . In some embodiments, L is -L ⁴ -G-, wherein L ⁴ is optionally substituted -(CH ₂ ) ₂ -; G is as defined above and described herein; and G is attached to R ¹ . In some embodiments, L is -L ⁴ -G-, wherein L ⁴ is -(CH ₂ ) ₂ -; G is as defined above and described herein; and G is attached to R ¹ .

In some embodiments, L is or , where G is as defined above and described herein, and G is attached to R ¹ . In some embodiments, L is , where G is as defined above and described herein, and G is attached to R ¹ . In some embodiments, L is , where G is as defined above and described herein, and G is attached to R ¹ . In some embodiments, L is or Wherein the sulfur atom is attached to R ¹ . In some embodiments, L is or Wherein the oxygen atom is attached to R ¹ .

In some embodiments, L is , or , where G is as defined above and described herein.

In some embodiments, L is -SR ^L3 - or -SC(O)-R ^L3 -, wherein R ^L3 is an optionally substituted straight or branched chain C ₁ -C ₉ alkylene group, wherein one or more The methylene units are optionally substituted by the following: optionally substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ -extended alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C (O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O -, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S( O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-, wherein R' and -Cy- are each independently as defined above and Described here. In some embodiments, L is -SR ^L3 - or -SC(O)-R ^L3 -, wherein R ^L3 is optionally substituted C ₁ -C ₆ alkylene. In some embodiments, L is -SR ^L3 - or -SC(O)-R ^L3 -, wherein R ^L3 is optionally substituted C ₁ -C ₆ extended alkenyl. In some embodiments, L is -SR ^L3 - or -SC(O)-R ^L3 -, wherein R ^L3 is optionally substituted C ₁ -C ₆ alkylene, wherein one or more methylene units Optionally, independently substituted C ₁ -C ₆ alkenyl, extended aryl or heteroaryl substituted. In some embodiments, in some embodiments, R ^L3 is optionally substituted by the -S- (C ₁ -C ₆ alkenylene _{group) -, - S- (C 1} -C 6 alkylene) -, -S- (C ₁ -C ₆ alkylene) - or an arylene group - (C _{1 -C6} alkylene) -, - S-CO- extending aryl - (C ₁ -C ₆ alkylene) - or -S-CO-(C ₁ -C ₆ alkylene)-arylene-(C ₁ -C ₆ alkylene)-.

In some embodiments, L is , , ,

In some embodiments, L is . In some embodiments, L is . In some embodiments,

In some embodiments, the sulfur atom in the L embodiment described above and herein is attached to X. In some embodiments, examples of a sulfur atom and L described here are connected to the above embodiment R ^l.

In some embodiments, R ¹ is halo, R or optionally substituted C ₁ -C ₅₀ aliphatic, wherein one or more methylene units are optionally and optionally substituted by the following: optionally substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, - N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O) -, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S- , -OC(O)- or -C(O)O-, wherein each variable is independently as defined above and described herein. In some embodiments, R ¹ is halo, R, or optionally substituted C ₁ -C ₁₀ aliphatic, wherein one or more methylene units are optionally and optionally substituted by the following: optionally substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, - N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O) -, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S- , -OC(O)- or -C(O)O-, wherein each variable is independently as defined above and described herein.

In some embodiments, R ¹ is hydrogen. In some embodiments, R ¹ is halogen. In some embodiments, R ¹ is -F. In some embodiments, R ¹ is -Cl. In some embodiments, R ¹ is -Br. In some embodiments, R ¹ is -I.

R ¹ is R, wherein R is as defined above and described herein.

In some embodiments, R ¹ is hydrogen. In some embodiments, R ¹ is an optionally substituted group selected from the group consisting of C ₁ -C ₅₀ aliphatic, phenyl, carbocyclyl, aryl, heteroaryl or heterocyclyl.

In some embodiments, R ¹ is optionally substituted C ₁ -C ₅₀ aliphatic. In some embodiments, R ¹ is an optionally substituted C ₁ -C ₁₀ aliphatic group. In some embodiments, R ¹ is an optionally substituted C ₁ -C ₆ aliphatic group. In some embodiments, R ¹ is optionally substituted C ₁ -C ₆ alkyl. In some embodiments, R ¹ is an optionally substituted straight or branched chain hexyl. In some embodiments, R ¹ is an optionally substituted straight or branched chain pentyl. In some embodiments, R ¹ is an optionally substituted straight or branched chain butyl. In some embodiments, R ¹ is an optionally substituted straight or branched chain propyl group. In some embodiments, R ¹ is an optionally substituted ethyl. In some embodiments, R ¹ is optionally substituted methyl.

In some embodiments, R ¹ is optionally substituted phenyl. In some embodiments, R ¹ is substituted phenyl. In some embodiments, R ¹ is phenyl.

In some embodiments, R ¹ is an optionally substituted carbocyclic group. In some embodiments, R ¹ is optionally substituted C ₃ -C ₁₀ carbocyclyl. In some embodiments, R ¹ is an optionally substituted monocyclic carbocyclyl. In some embodiments, R ¹ is optionally substituted cycloheptyl. In some embodiments, R ¹ is optionally substituted cyclohexyl. In some embodiments, R ¹ is optionally substituted cyclopentyl. In some embodiments, R ¹ is optionally substituted cyclobutyl. In some embodiments, R ¹ is optionally substituted cyclopropyl. In some embodiments, R ¹ is an optionally substituted bicyclic carbocyclyl.

In some embodiments, R ¹ is an optionally substituted C ₁ -C ₅₀ polycyclic hydrocarbon. In some embodiments, R ¹ is optionally substituted C ₁ -C ₅₀ polycyclic hydrocarbon, wherein one or more methylene units are optionally replaced by the following: optionally substituted C ₁ -C ₆ alkyl, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R' )-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R ')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S (O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC( O)- or -C(O)O-, wherein each variable is independently as defined above and described herein. In some embodiments, R ¹ is replaced as appropriate . In some embodiments, R ¹ is . In some embodiments, R ¹ is replaced as appropriate

In some embodiments, R ¹ is an optionally substituted C ₁ -C ₅₀ aliphatic group comprising one or more optionally substituted polycyclic hydrocarbon moieties. In some embodiments, R ¹ is optionally substituted C ₁ -C ₅₀ aliphatic, which comprises one or more optionally substituted polycyclic hydrocarbon moieties, wherein one or more methylene units are optionally And independently substituted by C ₁ -C ₆ alkyl, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, - O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R' )-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O) N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC (O)-, -C(O)S-, -OC(O)- or -C(O)O-, wherein each variable is independently as defined above and described herein. In some embodiments, R ¹ is optionally substituted C ₁ -C ₅₀ aliphatic, which includes one or more optionally substituted , , or . In some embodiments, R ¹ is . In some embodiments, R ¹ is . In some embodiments, R ¹ is . In some embodiments, R ¹ is . In some embodiments, R ¹ is .

In some embodiments, R ¹ is an optionally substituted aryl. In some embodiments, R ¹ is an optionally substituted bicyclic aryl ring.

In some embodiments, R ¹ is optionally substituted heteroaryl. In some embodiments, R ¹ is an optionally substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen. In some embodiments, R ¹ is a substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is an unsubstituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen.

In some embodiments, R ¹ is an optionally substituted 5 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is an optionally substituted 6-membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, R ¹ is an optionally substituted 5 membered monocyclic heteroaryl ring having 1 heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is selected from pyrrolyl, furyl or thienyl.

In some embodiments, R ¹ is an optionally substituted 5 membered heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R ¹ is an optionally substituted 5 membered heteroaryl ring having one nitrogen atom and another heteroatom selected from sulfur or oxygen. Exemplary R ¹ groups include optionally substituted pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl or isoxazolyl.

In some embodiments, R ¹ is a 6-membered heteroaryl ring having 1-3 nitrogen atoms. In other embodiments, R ¹ is optionally having 1-2 nitrogen atoms of the substituted 6-membered heteroaryl ring. In some embodiments, R ¹ is an optionally substituted 6-membered heteroaryl ring having 2 nitrogen atoms. In certain embodiments, R ¹ is a 6-membered heteroaryl ring substituted with one nitrogen. Exemplary R ¹ groups include optionally substituted pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl or tetrazinyl.

In certain embodiments, R ¹ is an optionally substituted 8-10 membered bicyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is an optionally substituted 5,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R ¹ is having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur optionally substituted in the 5,6-fused heteroaryl ring. In certain embodiments, R ¹ is an optionally substituted 5,6-fused heteroaryl ring having one heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is an optionally substituted thiol group. In some embodiments, R ¹ is optionally substituted azabicyclo[3.2.1]octyl. In certain embodiments, R ¹ is an optionally substituted 5,6-fused heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is optionally substituted azaindenyl. In some embodiments, R ¹ is an optionally substituted benzimidazolyl group. In some embodiments, R ¹ is an optionally substituted benzothiazolyl group. In some embodiments, R ¹ is an optionally substituted benzoxazolyl group. In some embodiments, R ¹ is optionally substituted carbazolyl. In certain embodiments, R ¹ is an optionally substituted 5,6-fused heteroaryl ring having 3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In certain embodiments, R ¹ is an optionally substituted 6,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is an optionally substituted 6,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R ¹ is having one heteroatom independently selected from nitrogen, oxygen, or sulfur optionally substituted in the 6,6-fused heteroaryl ring. In some embodiments, R ¹ is optionally substituted quinolinyl. In some embodiments, R ¹ is an optionally substituted isoquinolyl. According to one aspect, R ¹ is an optionally substituted 6,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen or sulfur. In some embodiments, R ¹ is quinazoline or quinoxaline.

In some embodiments, R ¹ is an optionally substituted heterocyclic group. In some embodiments, R ¹ is optionally substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is a substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is an unsubstituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, R ¹ is an optionally substituted heterocyclic group. In some embodiments, R ¹ is an optionally substituted 6-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is an optionally substituted 6 membered partially unsaturated heterocyclic ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is an optionally substituted 6 membered partially unsaturated heterocyclic ring having 2 oxygen atoms.

In certain embodiments, R ¹ is a 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R ¹ is oxiranyl, oxetane, tetrahydrofuranyl, tetrahydropentanyl, oxetanyl, aziridine, azetidinyl , pyrrolidinyl, piperidinyl, azepanyl, thiacyclopropane, thietane, tetrahydrothiophenyl, tetrahydrothiopyranyl, thiecycloheptyl, dioxane Pentocyclo, oxathiolanyl, oxazolidinyl, imidazolidinyl, thiazolidinyl, dithiolanyl, dioxanyl, morpholinyl, oxacyclohexane Alkyl, piperazinyl, thiomorpholinyl, dithiaalkyl, dioxepane, oxazepine, oxazepine, dithiaheptyl, diaza Cycloheptyl, dihydrofuranone, tetrahydropipedone, oxetan, pyrrolidinyl, piperidinone, azepanone, dihydrothiophenone, tetrahydrogen Thiopidone, thiaheptanone, oxazolidinone, oxazepine, oxazepinone, dioxolone, dioxanone , dioxepanthone, oxathiolane, oxathioone , oxathiane, thiazolidinone, thiazinone, thiazepinone, imidazolidinone, tetrahydropyrimidinone, diazepanone, imidazolidinone Base, oxazolidinedione, thiazolidinedione, dioxolanedione, oxathiolaneone, piperazinedione, morpholindionion, thiomorpholine Diketo, tetrahydropentanyl, tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl, piperazinyl, pyrrolidinyl, tetrahydrothiophenyl or tetrahydrothiopyranyl. In some embodiments, R ¹ is an optionally substituted 5 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In certain embodiments, R ¹ is an optionally substituted 5-6 membered partially unsaturated monocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R ¹ is optionally substituted tetrahydropyridyl, dihydrothiazolyl, dihydrooxazolyl or oxazolinyl.

In some embodiments, R ¹ is an optionally substituted 8-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R ¹ is an optionally substituted porphyrin group. In some embodiments, R ¹ is an optionally substituted isoindolyl group. In some embodiments, R ¹ is an optionally substituted 1,2,3,4-tetrahydroquinoline. In some embodiments, R ¹ is an optionally substituted 1,2,3,4-tetrahydroisoquinoline.

In some embodiments, R ¹ is optionally substituted C ₁ -C ₁₀ aliphatic, wherein one or more methylene units are optionally and independently substituted by C ₁ -C as appropriate ₆ alkyl, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R' )-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R ')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S (O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC( O)- or -C(O)O-, wherein each variable is independently as defined above and described herein. In some embodiments, R ¹ is the optionally substituted C ₁ -C ₁₀ aliphatic group, wherein one or more methylene units optionally and independently be replaced by the following: selection of optionally -Cy -, - O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R' )-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O) N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -OC (O)- or -C(O)O-, wherein each R' is independently as defined above and described herein. In some embodiments, R ¹ is the optionally substituted C ₁ -C ₁₀ aliphatic group, wherein one or more methylene units optionally and independently be replaced by the following: selection of optionally -Cy -, - O-, -S-, -SS-, -N(R')-, -C(O)-, -OC(O)- or -C(O)O-, wherein each R' is independently as above Definitions and as described herein.

In some embodiments, R ¹ is , , , , (Ga1NAc), , CH ₃ -, , , ,

In some embodiments, R ¹ is CH ₃ -, , ,

In some embodiments, R ¹ comprises a terminally substituted -(CH ₂ ) ₂ - moiety, which is attached to L. Examples of such R ¹ groups are described below:

In some embodiments, R ¹ comprises a terminally substituted -(CH ₂ )- moiety, which is attached to L. Exemplary R ¹ groups of this type are described below:

In some embodiments, R ¹ is -SR ^L2, where R ^L2 is the optionally substituted C ₁ -C ₉ aliphatic group, wherein one or more methylene units optionally and independently be replaced by the following: as the Substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, - SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R'C(O)N(R')-,-N(R')C(O)-,-N(R')C(O)O-,-OC(O)N(R')-,- S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C( O) S-, -OC(O)- or -C(O)O-, wherein R' and -Cy- are each independently as defined above and described herein. In some embodiments, R ¹ is -SR ^L2, wherein a sulfur atom in the group L of a sulfur atom.

In some embodiments, R ¹ is -C (O) -R ^L2, where R ^L2 is the optionally substituted C ₁ -C ₉ aliphatic group, wherein one or more methylene units are independently and optionally Substituted by C ₁ -C ₆ alkyl, C ₁ -C ₆ alkenyl, -C≡C-, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R ')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O) -, -C(O)S-, -OC(O)- or -C(O)O-, wherein R' and -Cy- are each independently as defined above and described herein. In some embodiments, R ¹ is —C(O)—R ^L2 , wherein carbonyl is attached to G in the L group. In some embodiments, R ¹ is —C(O)—R ^L2 , wherein the carbonyl group is attached to a sulfur atom in the L group.

In some embodiments, R ^L2 is optionally substituted C ₁ -C ₉ aliphatic. In some embodiments, R ^L2 is optionally substituted C ₁ -C ₉ alkyl. In some embodiments, R ^L2 is optionally substituted C ₁ -C ₉ alkenyl. In some embodiments, R ^L2 is optionally substituted C ₁ -C ₉ alkynyl. In some embodiments, R ^L2 is optionally substituted C ₁ -C ₉ aliphatic, wherein one or more methylene units are optionally and independently replaced by -Cy- or -C(O)-. In some embodiments, R ^L2 is an optionally substituted C ₁ -C ₉ aliphatic group wherein one or more methylene units are optionally and -Cy-substituted. In some embodiments, R ^L2 is an optionally substituted C ₁ -C ₉ aliphatic group wherein one or more methylene units are optionally and optionally substituted with a substituted heterocyclic group. In some embodiments, R ^L2 is an optionally substituted C ₁ -C ₉ aliphatic group wherein one or more methylene units are optionally and independently substituted with a substituted aryl group. In some embodiments, R ^L2 is optionally substituted C ₁ -C ₉ aliphatic, wherein one or more methylene units are optionally and independently substituted with a substituted heteroaryl group. In some embodiments, R ^L2 is optionally substituted C ₁ -C ₉ aliphatic, wherein one or more methylene units are optionally substituted C ₃ -C ₁₀ carbon as appropriate Cyclic replacement. In some embodiments, R ^L2 is an optionally substituted C ₁ -C ₉ aliphatic group, wherein two methylene units are optionally and independently replaced by -Cy- or -C(O)-. In some embodiments, R ^L2 is an optionally substituted C ₁ -C ₉ aliphatic group, wherein two methylene units are optionally and independently replaced by -Cy- or -C(O)-. Exemplary R ^L2 groups are described below:

In some embodiments, R ¹ is hydrogen, or an optionally substituted group selected from the group consisting of: , -S-(C ₁ -C ₁₀ aliphatic), C ₁ -C ₁₀ aliphatic, aryl, C ₁ -C ₆ heteroalkyl, heteroaryl and heterocyclic. In some embodiments, R ¹ is , Or -S-(C ₁ -C ₁₀ aliphatic group). In some embodiments, R ¹ is ,

In some embodiments, R ¹ is selected from the group consisting of -S-(C ₁ -C ₆ aliphatic), C ₁ -C ₁₀ aliphatic, C ₁ -C ₆ heteroaliphatic, aryl, heterocyclyl And optionally substituted groups of heteroaryl groups.

In some embodiments, R ¹ is , , ,

In some embodiments, the sulfur atom of the R ¹ embodiment described above and herein is a sulfur atom, G, E or -C(O)- moiety in the L embodiment described above and herein. connection. In some embodiments, described herein above and in the examples of R ¹ -C embodiment (O) - portion of the embodiment of a sulfur atom, G, E, or -C and with the above embodiments where L of (O) - Partial connection.

In some embodiments, -LR ¹ is any combination of the L embodiment and the R ¹ embodiment described above and herein.

In some embodiments, -LR ¹ is -L ³ -GR ¹ , wherein each variable is independently as defined above and described herein.

In some embodiments, -LR ¹ is -L ⁴ -GR ¹ , wherein each variable is independently as defined above and described herein.

In some embodiments, -LR ¹ is -L3-GSR ^L2 , wherein each variable is independently as defined above and described herein.

In some embodiments, -LR ¹ is -L ³ -GC(O)-R ^L2 , wherein each variable is independently as defined above and described herein.

In some embodiments, -LR ¹ is , , or Wherein R ^L2 is optionally substituted C ₁ -C ₉ aliphatic, wherein one or more methylene units are optionally and independently substituted by the following substituted C ₁ -C ₆ alkyl , C ₁ -C ₆ alkenylene ^{group, - C≡C -, -C (R} ') 2 -, - Cy -, - O -, - S -, - SS -, - N (R') -, - C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-, and each G is independently as defined above and described herein.

In some embodiments, -LR ¹ is -R ^L3 -SSR ^L2 , wherein each variable is independently as defined above and described herein. In some embodiments, -LR ¹ is -R ^L3 -C(O)-SSR ^L2 , wherein each variable is independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -LR ¹ has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, L has the following structure: Wherein the variables are independently as defined above and described herein.

In some embodiments, -XLR ¹ has the following structure:

Wherein: the phenyl ring is optionally substituted, and R ¹ and X are each independently as defined above and described herein.

In some embodiments, -LR ¹ is , , , , (GalNAc), , CH ₃ -, , , ,

In some embodiments, -LR ¹ is:

In some embodiments, -LR ¹ is CH ₃ -, , . In some embodiments, -LR ¹ is ,

In some embodiments, -LR ¹ comprises a -(CH ₂ ) ₂ - moiety substituted at the end, which is attached to X. In some embodiments, -LR ¹ comprises a terminal -(CH ₂ ) ₂ moiety attached to X. Examples of such a -LR ¹ part are described below:

In some embodiments, -LR ¹ comprises a terminally substituted -(CH ₂ )- moiety, which is attached to X. In some embodiments, -LR ¹ comprises a terminal -(CH ₂ )- moiety attached to X. Examples of such a -LR ¹ part are described below:

In some embodiments, -LR ¹ is

In some embodiments, -LR ¹ is CH ₃ -, , And X is -S-.

In some embodiments, -LR ¹ is CH ₃ -, , , X is -S-, W is O, Y is -O-, and Z is -O-.

In some embodiments, R ¹ is , , , , , , Or -S-(C ₁ -C ₁₀ aliphatic group).

In some embodiments, R ¹ is , , ,

In some embodiments, X is -O- or -S-, and R ¹ is , Or -S-(C ₁ -C ₁₀ aliphatic group).

In some embodiments, X is -O- or -S-, and R ¹ is , , -S-(C ₁ -C ₁₀ aliphatic) or -S- (C ₁ -C ₅₀ aliphatic).

In some embodiments, L is a covalent bond and -LR ¹ is R ¹ .

In some embodiments, -LR ^{1 is} not hydrogen.

In some embodiments, -XLR ¹ is R ¹ , , , , -S-(C ₁ -C ₁₀ aliphatic) or -S-(C ₁ -C ₅₀ aliphatic).

In some embodiments, -XLR ¹ has Structure, of which Partially replaced as appropriate. In some embodiments, -XLR ¹ is . In some embodiments, -XLR ¹ is . In some embodiments, -XLR ¹ is . In some embodiments, -XLR ¹ has a structure in which X' is O or S, and Y' is -O-, -S- or -NR'-, and Partially replaced as appropriate. In some embodiments, Y' is -O-, -S-, or -NH-. In some embodiments, for . In some embodiments, for . In some embodiments, for . In some embodiments, -XLR ¹ has Structure, where X' is O or S, and Partially replaced as appropriate. In some embodiments, for . In some embodiments, -XLR ¹ is ,among them Replaced as appropriate. In some embodiments, -XLR ¹ is ,among them Replaced. In some embodiments, -XLR ¹ is ,among them Unsubstituted.

In some embodiments, -XLR ¹ is R1-C(O)-SL ^x -S-, wherein L ^x is selected from , , , and a group that has been replaced as appropriate. In some embodiments, L ^x is , , , and . In some embodiments, -XLR ¹ is (CH ₃ ) ₃ CSSL ^x -S-. In some embodiments, -XLR ¹ is R ¹ -C(=X')-Y'-C(R) ₂ -SL ^x -S-. In some embodiments, -XLR ¹ is RC(=X')-Y'-CH ₂ -SL ^x -S-. In some embodiments, -XLR ¹ is

As will be appreciated by those skilled in the art, many of the -XLR ¹ groups described herein can be cleaved and can be converted to -X- after administration to an individual. In some embodiments, -XLR ¹ is cleavable. In some embodiments, -XLR ¹ is -SLR ¹ and is converted to -S- after administration to an individual. In some embodiments, the enzyme of the individual drives the transformation. As is known to those skilled in the art, the method of determining whether a -SLR ¹ group is converted to -S- after administration is widely known and practiced in the art, including those used to study drug metabolism and pharmacokinetics. method.

In some embodiments, the internucleotide linkage having the structure of Formula I is ,

In some embodiments, the internucleotide linkage of Formula I has the structure of Formula Ia :

Wherein the variables are independently as defined above and described herein.

In some embodiments, the internucleotide linkage of Formula I has the structure of Formula Ib :

Wherein the variables are independently as defined above and described herein.

In some embodiments, the internucleotide linkage of Formula I is a thiophosphate triester linkage having the structure of Formula Ic :

Wherein: P* is an asymmetric phosphorus atom and is R p or Sp ; L is a covalent bond or a substituted straight or branched chain C ₁ -C ₁₀ alkyl, wherein one or more of L methylene units optionally and independently replaced by the following: the optionally substituted C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenylene group, -C≡C -, - C (R ') 2 -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-; R ¹ is halogen, R or optionally substituted C ₁ -C ₅₀ An aliphatic group in which one or more methylene units are optionally and independently substituted by C ₁ -C ₆ alkyl, C ₁ -C ₆ alkenyl, -C≡C-, as appropriate. , -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C (NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N( R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-; each R' is independently - R, -C(O)R, -CO ₂ R or -SO ₂ R, or: two R's on the same nitrogen together with the intervening atoms form an optionally substituted heterocyclic or heteroaryl ring, or on the same carbon The two R's together with the intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl ring; -Cy- is selected from the group consisting of a phenylene group, a carbocyclic group, an extended aryl group, and an extended heteroaryl group. a divalent ring optionally substituted with a heterocyclic group; each R is independently hydrogen or selected from a C ₁ -C ₆ aliphatic group, a phenyl group, a carbocyclic group, an aryl group, a heteroaryl group or a heterocyclic ring. a group replaced by a situation as appropriate; Independently indicates a linkage to a nucleoside; and when L is a covalent bond, R ^{1 is} not -H.

In some embodiments, the internucleotide linkage having the structure of Formula I is ,

In some embodiments, the internucleotide linkage having the structure of Formula Ic is

In some embodiments, the invention provides a palm-controlled oligonucleotide comprising one or more phosphodiester linkages, and one or more modified nucleosides having Formula Ia , Ib or Ic Interacid linkage.

In some embodiments, the invention provides a palm-controlled oligonucleotide comprising at least one phosphodiester internucleotide linkage and at least one phosphorothioate triester linkage having the structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising at least one phosphodiester internucleotide linkage and at least two phosphorothioate triester linkages having the structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising at least one phosphodiester internucleotide linkage and at least three phosphorothioate triester linkages having the structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising at least one phosphodiester internucleotide linkage and at least four phosphorothioate triester linkages having the structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising at least one phosphodiester internucleotide linkage and at least five phosphorothioate triester linkages having the structure of Formula Ic .

In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAGGGGCACAGACTTC. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein the sequence is more than 50% identical to GGCACAAGGGCACAGACTTC. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein the sequence is more than 60% identical to GGCACAGGCCACCAGTCTC. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein the sequence is more than 70% identical to GGCACAGGGCAACACTCT. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein the sequence is more than 80% identical to GGCACAGGGCAACACTCT. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein the sequence is more than 90% identical to GGCACAGGGCAACACTCT. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein the sequence is GGCACAAGGGCACAGACTTC has a consistency of over 95%. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAGGGGCACAGACTTC. In some embodiments, the invention provides a pair of palm controlled oligonucleotides having the sequence of GGCACAGGGGCACAGACTTC.

In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage has a pair of palm-linked phosphorus. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage has the structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein each internucleotide linkage has a structure of formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein each internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein each internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence present in GGCACAAGGGCACAGACTTC, wherein each internucleotide linkage is .

In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage has a pair of palm-linked phosphorus. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage has the structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAAGGGCACAGACTTC, wherein each internucleotide linkage has a structure of formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAAGGGCACAGACTTC, wherein each internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAAGGGCACAGACTTC, wherein each internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAAGGGCACAGACTTC, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence of GGCACAAGGGCACAGACTTC, wherein each internucleotide linkage is .

In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGGGCACAGACTTC, wherein at least one internucleotide linkage has a pair of palm-linked phosphorus. In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGGGCACAGACTTC, wherein at least one internucleotide linkage has the structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein each internucleotide linkage has the structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGGGCACAGACTTC, wherein at least one internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGGGCACAGACTTC, wherein each internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGGGCACAGACTTC, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGGGCACAGACTTC, wherein each internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGGGCACAGACTTC, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGGGCACAGACTTC, wherein each internucleotide linkage is .

In some embodiments, the present invention provides a chiral controlled oligonucleotide having a sequence of GGCACAAGGGCACAGACTTC, wherein the at least one phosphorus linkage is R p. One of ordinary skill will appreciate that in certain embodiments in which the palm-controlled oligonucleotide comprises an RNA sequence, each T is independently and optionally replaced by U. In some embodiments, the present invention provides a chiral controlled oligonucleotide having a sequence of GGCACAAGGGCACAGACTTC, wherein each linkage is a phosphorus-R p. In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGCGCACAGACTTC, wherein at least one of the linked phosphorus is Sp . In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein each linked phosphorus is Sp . In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a block. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a stereoblock. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a P-modified block. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a linked block. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotides are alternations. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a stereo-alternate. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a P-modified alternation. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a linkage alternation. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a monomer. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a stereomonomer. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a P-modified monomer. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a linked monomer. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a spacer. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein the oligonucleotide is a skip.

In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein each cytosine is optionally and independently replaced with 5-methylcytosine. In some embodiments, the invention provides a palm-controlled oligonucleotide having a sequence of GGCACAGGGGCACAGACTTC, wherein at least one cytosine is optionally and independently replaced with 5-methylcytosine. In some embodiments, the invention provides a palm-controlled oligonucleotide having the sequence of GGCACAGGGGCACAGACTTC, wherein each cytosine is optionally and independently replaced with 5-methylcytosine.

In some embodiments, the palm-controlled oligonucleotide is designed such that one or more nucleotides comprise a phosphorus modification that is susceptible to "autorelease" under certain conditions. That is, under certain conditions, a particular phosphorus modification is designed such that it self-cleaves from the oligonucleotide to yield, for example, a phosphodiester, such as naturally occurring DNA and the phosphodiesters present in the RNA. In some embodiments, such modifications phosphorous having the structure of -OLR ^1, wherein L and R ^{1 are} independently as hereinbefore defined and described herein. In some embodiments, the self-releasing group comprises N-morpholinyl. In some embodiments, the self-releasing group is characterized by the ability to deliver an agent to an internucleotide phosphorus linking group that facilitates further modification of the phosphorus atom, such as desulfurization. In some embodiments, the reagent is water and is further modified to hydrolyze to form a phosphodiester such as naturally occurring DNA and RNA.

In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein (non-limiting examples include any of the sequences disclosed in any of the tables). In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence that is more than 50% identical to any of the sequences disclosed herein. In some embodiments, the invention provides a pair of palm controlled oligonucleotides comprising sequences having greater than 60% identity to any of the sequences disclosed herein. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence that is more than 70% identical to any of the sequences disclosed herein. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence that is more than 80% identical to any of the sequences disclosed herein. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence that is more than 90% identical to any of the sequences disclosed herein. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising a sequence that is more than 95% identical to any of the sequences disclosed herein. In some embodiments, the invention provides a pair of palm controlled oligonucleotides comprising any of the sequences disclosed herein. In some embodiments, the invention provides a pair of palm controlled oligonucleotides having any of the sequences disclosed herein.

In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage has a pair of palm-linked phosphorus. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage has a structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein each internucleotide linkage has a structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein each internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein the internucleotide linkages are . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein the internucleotide linkages are .

In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage has a pair of palm-linked phosphorus. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage has a structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein each internucleotide linkage has a structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein each internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein the internucleotide linkages are . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide comprising any of the sequences disclosed herein, wherein the internucleotide linkages are .

In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein at least one internucleotide linkage has a pair of palm-linked phosphorus. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein at least one internucleotide linkage has the structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein each internucleotide linkage has the structure of Formula I. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein at least one internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein each internucleotide linkage has a structure of Formula Ic . In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the internucleotide linkages are . In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein at least one internucleotide linkage is . In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein each internucleotide linkage is .

In some embodiments, the present invention provides a chiral controlled oligonucleotide having any of the sequences disclosed herein, wherein the at least one phosphorus linkage is R p. One of ordinary skill will appreciate that in certain embodiments in which the palm-controlled oligonucleotide comprises an RNA sequence, each T is independently and optionally replaced by U. In some embodiments, the present invention provides a chiral controlled oligonucleotide having any of the sequences disclosed herein, wherein each linkage is a phosphorus-R p. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein at least one of the linked phosphorus is Sp . In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein each linked phosphorus is Sp . In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a block. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a stereoblock. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a P-modified block. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a linked block. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotides are alternations. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a stereo-alternate. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a P-modifying alternation. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a linkage alternation. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a monomer. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a stereomonomer. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a P-modified monomer. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a bonded monomer. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a spacer. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein the oligonucleotide is a skip.

In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein each cytosine is optionally and independently replaced with 5-methylcytosine. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein at least one cytosine is optionally and independently replaced with 5-methylcytosine. In some embodiments, the invention provides a palm-controlled oligonucleotide having any of the sequences disclosed herein, wherein each cytosine The situation is and independently replaced by 5-methylcytosine.

In various embodiments, any of the sequences disclosed herein can be combined with one or more of the following as disclosed herein or known in the art: backbone linkage mode; backbone-to-palm center mode; And main chain P modification mode; base modification mode; sugar modification mode; main chain linkage mode; main chain to palm center mode; and main chain P modification mode.

In some embodiments, the palm-controlled oligonucleotide is designed such that the resulting pharmaceutical properties are improved via one or more specific modifications at the phosphorus. It is well documented in the art that certain oligonucleotides rapidly degrade by nucleases and exhibit poor cellular uptake through the cytoplasmic cell membrane [Poijarvi-Virta et al, Curr. Med. Chem. (2006), 13 (28) ); 3441-65; Wagner et al, Med. Res. Rev. (2000), 20 (6): 417-51; Peyrottes et al, Mini Rev. Med. Chem. (2004), 4 (4): 395 -408; Gosselin et al, (1996), 43(1): 196-208; Bologna et al, (2002), Antisense & Nucleic Acid Drug Development 12: 33-41]. For example, Vives et al, Nucleic Acids Research (1999), 27(20): 4071-76, found that the third butyl SATE pro-oligonucleotide appears to be compared to the parent oligonucleotide. Significantly increased cell permeability.

In some embodiments, the modification at the linkage phosphorus is characterized by its ability to be converted to a phosphodiester by one or more esterase, nuclease, and/or cytochrome P450 enzymes, such as naturally occurring DNA and RNA. The phosphodiesters present therein include, but are not limited to, the enzymes listed in Table 1A below.

In some embodiments, the modification at the phosphor produces a P-modified moiety characterized by a current drug, for example, a P-modifying moiety that facilitates delivery of the oligonucleotide to a desired location prior to removal. For example, in some embodiments, the P-modified moiety is produced by pegylation at the linkage phosphorus. Those skilled in the relevant art will appreciate that a variety of PEG chain lengths are suitable and that the choice of chain length will be determined in part by the results sought to be achieved by pegylation. For example, in some embodiments, PEGylation is performed to reduce RES absorption and prolong the in vivo circulating life of the oligonucleotide.

In some embodiments, the PEGylation reagent used in accordance with the present invention has a molecular weight of from about 300 g/mol to about 100,000 g/mol. In some embodiments, the PEGylation reagent has a molecular weight of from about 300 g/mol to about 10,000 g/mol. In some embodiments, the PEGylation reagent has a molecular weight of from about 300 g/mol to about 5,000 g/mol. In some embodiments, the PEGylation reagent has a molecular weight of about 500 g/mol. In some embodiments, the PEGylation reagent has a molecular weight of about 1000 g/mol. In some embodiments, the PEGylation reagent has a molecular weight of about 3000 g/mol. In some embodiments, the PEGylation reagent has a molecular weight of about 5000 g/mol.

In certain embodiments, the PEGylation reagent is PEG500. In certain embodiments, the PEGylation reagent is PEG1000. In certain embodiments, the PEGylation reagent is PEG3000. In certain embodiments, the PEGylation reagent is PEG5000.

In some embodiments, the P-modified portion is characterized in that it acts as a PK enhancer, such as a lipid, a pegylated lipid, and the like.

In some embodiments, the P-modified portion is characterized in that it acts as an agent that promotes cell entry and/or escape of the endosome, such as a membrane-disrupting lipid or peptide.

In some embodiments, the P-modifying moiety is characterized in that it acts as a targeting agent. In some embodiments, the P-modifying moiety is or comprises a targeting agent. As used herein, the phrase "targeting agent" is used in conjunction with a payload (eg, an oligonucleotide or oligonucleotide composition) and also interacts with a target site of interest such that the interest is The degree of binding to the targeting agent is much greater than the degree of degree observed under otherwise similar conditions when the payload is not bound to the targeting agent, to the entity of interest. The targeting agent can be or comprise any of a variety of chemical moieties including, for example, small molecule moieties, nucleic acids, polypeptides, carbohydrates, and the like. The targeting agent is further described by Adarsh et al., "Organelle Specific Targeted Drug Delivery-A Review", International Journal of Research in Pharmaceutical and Biomedical Sciences, 2011, page 895.

Examples of such targeting agents include, but are not limited to, proteins (eg, transferrin), oligos Peptides (eg, oligopeptides containing both cyclic and acyclic RGD), antibodies (single and polyclonal antibodies, eg, IgG, IgA, IgM, IgD, IgE antibodies), sugars/carbohydrates (eg, monosaccharides and/or oligos) Sugar (mannose, mannose-6-phosphate, galactose and the like), vitamins (eg, folate) or other small biomolecules. In some embodiments, the targeting moiety is a steroid molecule (eg, bile acids, including cholic acid, deoxycholic acid, dehydrocholic acid; corticosterone; digoxigenin; testosterone; cholesterol; cationic steroids For example, a corticosterone having a trimethylaminomethylmercapto group via a double bond at the 3 position of the corticosterone ring, etc.). In some embodiments, the targeting moiety is a lipophilic molecule (eg, an alicyclic hydrocarbon, a saturated and unsaturated fatty acid, a wax, a guanidine, and a polyalicyclic hydrocarbon such as a davidintine and a Buckminster Fuller Buckminsterfullerene). In some embodiments, the lipophilic molecule is a steroid such as vitamin A, retinoic acid, retinal or dehydroretinal. In some embodiments, the targeting moiety is a peptide.

In some embodiments, P is a modified portion of ^a targeting agent --XLR formula, wherein X, L and R ^{1 are} each as defined in formula I.

In some embodiments, the P-modified portion is characterized in that it facilitates cell-specific delivery.

In some embodiments, the P-modified portion is characterized in that it belongs to one or more of the above categories. For example, in some embodiments, the P modification moiety acts as a PK enhancer and a targeting ligand. In some embodiments, the P-modifying moiety is filled with a current drug and an endosomal eliminator. Those skilled in the relevant art will recognize that many other such combinations are possible and are encompassed by the present invention.

Nucleic base

In some embodiments, the nucleobase present in the provided oligonucleotide is a native nucleobase or a modified nucleobase derived from a natural nucleobase. Examples include, but are not limited to, uracil, thymine, adenine, cytosine and guanine, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, each of which is protected by a thiol protecting group. 5-iodouracil, 2,6-diaminopurine, aza-cytosine, pyrimidine analogs (such as pseudoisomers and pseudouracils) and other modified nucleobases, such as 8-substituted hydrazines, Astragalus or hypoxanthine (the latter two are natural degradation products). Exemplary modified nucleobases are disclosed in Chiu and Rana, RNA , 2003 , 9 , 1034-1048; Limbach et al., Nucleic Acids Research , 1994 , 22 , 2183-2196; and Revankar and Rao, Comprehensive Natural Products Chemistry , 7th Volume, 313.

Compounds represented by the following formula are also encompassed as modified nucleobases:

Wherein R ⁸ is an optionally substituted straight chain selected from the group consisting of an aliphatic group, an aryl group, an arylalkyl group, an aryloxyalkyl group, a carbocyclic group, a heterocyclic group or a heteroaryl group having 1 to 15 carbon atoms. Or a branched chain group, which includes, by way of example only, a methyl group, an isopropyl group, a phenyl group, a benzyl group or a phenoxymethyl group; and R ⁹ and R ¹⁰ are each independently selected from a linear or branched aliphatic group. Optionally substituted groups of a base, a carbocyclic group, an aryl group, a heterocyclic group, and a heteroaryl group.

Modified nucleobases also include expanded nucleobases in which one or more aryl rings, such as phenyl rings, have been added. Covers the Glen Research Directory (www.glenresearch.com); Krueger AT et al., Acc.Chem.Res. , 2007 , 40 , 141-150; Kool, ET, Acc.Chem. Res. , 2002 , 35 , 936-943 Benner SA et al, Nat. Rev. Genet . , 2005 , 6 , 553-543; Romesberg, FE et al, Curr. Opin. Chem. Biol , 2003 , 7 , 723-733; Hirao, I., Curr. Nucleobase substitutions as described in Opin. Chem. Biol. , 2006 , 10 , 622-627, as applicable to the synthesis of the nucleic acids described herein. Some examples of such extended nucleobases are shown below:

Herein, modified nucleobases also encompass structures that are not considered nucleobases but are otherwise moieties such as, but not limited to, corrin or porphyrin derived rings. Porphyrin-derived base substitutions have been described in Morales-Rojas, H and Kool, ET, Org. Lett. , 2002, 4 , 4377-4380. An example of a porphyrin-derived ring is shown below, which can be used as a base substitution:

In some embodiments, the modified nucleobase has any of the following substituted structures:

In some embodiments, the modified nucleobase is fluorescent. Examples of such fluorescently modified nucleobases include phenanthrene, anthraquinone, stilbene, isoxanthin, isoxanthopterin, terphenyl, trithiophene, benzotrithiophene, fragrant Beans, lumazine, tethered stilbene, benzouracil and naphthouracil, as shown below:

In some embodiments, the modified nucleobase is unsubstituted. In some embodiments, the modified nucleobase is substituted. In some embodiments, the modified nucleobase is substituted such that It contains, for example, a hetero atom, an alkyl group or a linking moiety attached to a fluorescent moiety, a biotin or avidin moiety or other protein or peptide. In some embodiments, the modified nucleobase is not a nucleobase in the most classical sense, but functions like a "universal base" of a nucleobase. A representative example of such a universal base is 3-nitropyrrole.

In some embodiments, other nucleosides can also be used in the methods disclosed herein and include nucleosides covalently bonded to a modified sugar with a modified nucleobase or nucleobase. Some examples of nucleosides having modified nucleobases include 4-ethenylcytidine nucleosides; 5-(carboxyhydroxymethyl)uridine; 2'- O -methylcytidine nucleoside; 5-carboxylate Methylamine methyl-2-thiouridine; 5-carboxymethylamine methyluridine; dihydrouridine; 2'- O -methyl pseudouridine; β, D-galactoside Q core Glycoside; 2'- O -methylguanosine; N ⁶ -isopentenyladenosine; 1-methyladenosine; 1-methyl pseudouridine; 1-methylguanosine; 1-methylinosine ; 2,2-dimethylguanosine; 2-methyladenosine; 2-methylguanosine; N ⁷ -methylguanosine; 3-methyl-cytosine nucleoside; 5-methylcytosine nucleus Glycosides; 5-hydroxymethylcytosine; 5-methylmercaptocytosine; 5-carboxycytosine; N ⁶ -methyladenosine; 7-methylguanosine; 5-methylamine ethyl uridine ; 5-methoxyamine methyl-2-thiouridine; β, D-mannosidyl Q nucleoside; 5-methoxycarboxymethyluridine; 5-methoxyuridine; 2-A Thio- N ⁶ -isopentenyladenosine; N -((9-β,D-ribofuranosyl-2-methylthioindol-6-yl)aminecarbenyl)threonine; N - ((9-β, D-ribofuranosyl-6-yl) -N -methylamine-mercapto)threonine; uridine-5-oxyacetic acid Methyl ester; uridine-5-oxyacetic acid (v); pseudouridine; Q nucleoside; 2-thiocytidine nucleoside; 5-methyl-2-thiouridine; 2-thiouridine 4-thiouridine; 5-methyluridine; 2'- O -methyl-5-methyluridine; and 2'- O -methyluridine.

In some embodiments, the nucleoside comprises a 6'-modified bicyclic nucleoside analog having ( R ) or ( S ) versus palmar at the 6' position and comprising the analogs described in U.S. Patent No. 7,399,845. In other embodiments, the nucleoside comprises a 5' modified bicyclic nucleoside analog having a ( R ) or ( S ) pair of palms at the 5' position and comprising a similarity as described in U.S. Patent Application Publication No. 20070287831 Things.

In some embodiments, the nucleobase or modified nucleobase comprises one or more biological components Sub-binding moiety, such as an antibody, antibody fragment, biotin, avidin, streptavidin, receptor ligand or chelating moiety. In other embodiments, the nucleobase or modified nucleobase is 5-bromouracil, 5-iodouracil or 2,6-diaminoguanidine. In some embodiments, the nucleobase or modified nucleobase is modified by substitution with a fluorescent or biomolecule binding moiety. In some embodiments, the substituent on the nucleobase or modified nucleobase is a fluorescent moiety. In some embodiments, the substituent on the nucleobase or modified nucleobase is biotin or avidin.

Representative US patents that teach the preparation of the modified nucleobases mentioned above, as well as certain of the other modified nucleobases, include, but are not limited to, the above-referenced U.S. Patent No. 3,687,808, and the United States. Patent Nos. 4,845,205, 5,130,30, 5,134,066, 5,175,273, 5,367,066, 5,432,272, 5,457,187, 5,457,191, 5,459,255, 5,484,908, 5,502,177, 5,525,711 , 5,552,540, 5,587,469, 5,594,121, 5,596,091, 5,614,617, 5,681,941, 5,750,692, 6,015,886, 6,147,200, 6,166,197, 6,222,025, 6,235,887, No. 6, 380, 368, No. 6, 528, 640, No. 6, 639, 062, No. 6, 617, 438, No. 7, 045, 610, No. 7, 427, 672, and No. 7, 495, 088, each of which is incorporated herein by reference in its entirety.

In some embodiments, the base is optionally substituted A, T, C, G or U, wherein one or more -NH _{2 are} independently and optionally replaced by -C(-LR ¹ ) ₃ , one or Multiple -NH-, independently and optionally by -C(-LR ¹ ) ₂ -, one or more =N- independently and optionally by -C(-LR ¹ )-, one or more = CH- independently and optionally by =N-, and one or more =O are independently and optionally replaced by =S, =N(-LR ¹ ) or =C(-LR ¹ ) ₂ , two of which More than -LR ¹ optionally forms a 3-30 membered bicyclic or polycyclic ring having 0-10 heteroatom ring atoms with its intervening atoms. In some embodiments, the modified base is optionally substituted A, T, C, G or U, wherein one or more -NH _{2 are} independently and optionally replaced by -C(-LR ¹ ) ₃ , One or more -NH-, independently and optionally by -C(-LR ¹ ) ₂ -, one or more =N- independently and optionally by -C(-LR ¹ )-, one or more =CH- independently and optionally by =N-, and one or more =O are independently and optionally replaced by =S, =N(-LR ¹ ) or =C(-LR ¹ ) ₂ , where two or more -LR ¹ inserted thereto atoms optionally form a ring or 3-30 membered bicyclic ring atoms having 0-10 heteroatoms together, wherein the modified base is different from the natural A, T, C, G And U. In some embodiments, the base is A, T, C, G or U, as appropriate. In some embodiments, the modified base is substituted A, T, C, G, or U, wherein the modified base is different from native A, T, C, G, and U.

In some embodiments, the modified nucleotide or nucleotide analog is any of the modified nucleotides or nucleotide analogs described in any one of the following: Gryaznov, S; Chen, J .-KJAm.Chem.Soc. 1994, 116, 3143; Hendrix et al. 1997 Chem. Eur. J. 3: 110; Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Jepsen et al. 2004 Oligo. : 130-146; Jones et al. J. Org. Chem. 1993, 58, 2983; Koizumi et al. 2003 Nuc. Acids Res. 12: 3267-3273; Koshkin et al. 1998 Tetrahedron 54: 3607-3630; Kumar et al. 1998 Bioo .Med. Chem. Let. 8: 2219-2222; Lauritsen et al. 2002 Chem. Comm. 5: 530-531; Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; Mesmaeker et al. Angew. Chem., Int. Ed. Engl. 1994, 33, 226; Morita et al. 2001 Nucl. Acids Res. Suppl 1:241-242; Morita et al. 2002 Bioo Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem. Lett. 2211-2226; Nielsen et al. 1997 Chem. Soc. Rev. 73; Nielsen et al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Obika et al. 1997 Tetrahedron Lett. 38(50): 8735-8; Obika et al. 1998 Tetrahedron Lett. 39: 5401-5404 Pallan et al. 2012 Chem.Comm.48: 8195-8197; Petersen et al. 2003 TRENDS Biotech.21: 74-81; Rajwanshi et al. 1999 Chem.Commun.1395-1396; Schultz et al. 1996 Nucleic Acids Res. 24: 2966; Seth et al. 2009 J. Med. Chem. 52: 10-13; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al. 2010 J. Org. 75:1569-1581; Seth et al. 2012 Bioo. Med. Chem. Lett. 22:296-299; Seth et al. 2012 Mol. Ther-Nuc. Acids.1, e47; Seth, Punit P; Siwkowski, Andrew; Allerson , Charles R; Vasquez, Guillermo; Lee, Sam; Prakash, Thazha P; Kinberger, Garth; Migawa, Michael T; Gaus, Hans; Bhat, Balkrrshen et al. Nucleic Acids Symposium Series (2008), 52(1), 553- 554; Singh et al. 1998 Chem. Comm. 1247-1248; Singh et al. 1998 J. Org. Chem. 63: 10035-39; Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Sorensen 2003 Chem. Comm. 2130-2131; Ts'o et al. Ann. NY Acad. Sci. 1988, 507, 220; Van Aerschot et al. 1995 Angew. Chem. Int. Ed. Engl. 34: 1338; Vasseur et al. J. Am. Soc. 1992, 114, 4006; WO 20070900071; WO 20070900071; or WO 2016/079181.

sugar

In some embodiments, the provided oligonucleotide comprises one or more modified sugar moieties other than the native sugar moiety.

The most common naturally occurring nucleotides comprise a ribose sugar linked to a nucleobase adenosine (A), cytosine (C), guanine (G), and thymine (T) or uracil (U). Modified nucleotides are also contemplated in which a phosphate group or a linked phosphate in a nucleotide can be attached to each position of the sugar or modified sugar. As a non-limiting example, a phosphate group or a linked phosphorus can be attached to the 2', 3', 4' or 5' hydroxyl moiety of the sugar or modified sugar. Nucleotides as described herein and having modified nucleobases are also contemplated in this context. In some embodiments, a nucleotide comprising an unprotected -OH moiety or a modified nucleotide is used in accordance with the methods of the invention.

Other modified sugars can also be incorporated into the provided oligonucleotides. In some embodiments, the modified saccharide contains a 2 'position of one or more substituents, comprising one of the following _{persons: - F; -CF 3, -CN} , -N 3, -NO, -NO 2, -OR', -SR' or -N(R') ₂ , wherein each R' is independently as defined above and described herein; -O-(C ₁ -C ₁₀ alkyl), -S-(C ₁ -C ₁₀ alkyl), -NH-(C ₁ -C ₁₀ alkyl) or -N(C ₁ -C ₁₀ alkyl) ₂ ; -O-(C ₂ -C ₁₀ alkenyl), -S-( C ₂ -C ₁₀ alkenyl), -NH-(C ₂ -C ₁₀ alkenyl) or -N(C ₂ -C ₁₀ alkenyl) ₂ ; -O-(C ₂ -C ₁₀ alkynyl), -S -(C ₂ -C ₁₀ alkynyl), -NH-(C ₂ -C ₁₀ alkynyl) or -N(C ₂ -C ₁₀ alkynyl) ₂ ; or -O-(C ₁ -C ₁₀ alkylene )-O-(C ₁ -C ₁₀ alkyl), -O-(C ₁ -C ₁₀ alkylene)-NH-(C ₁ -C ₁₀ alkyl) or -O-(C ₁ -C ₁₀ stretching Alkyl)-NH(C ₁ -C ₁₀ alkyl) ₂ , -NH-(C ₁ -C ₁₀ alkyl)-O-(C ₁ -C ₁₀ alkyl) or -N (C ₁ -C ₁₀ Alkyl)-(C ₁ -C ₁₀ alkylene)-O-(C ₁ -C ₁₀ alkyl), wherein the alkyl, alkylene, alkenyl and alkynyl groups may be substituted or unsubstituted. Examples of substituents include, but are not limited to, -O(CH ₂ ) _n OCH ₃ and -O(CH ₂ ) _n NH ₂ (where n is from 1 to about 10), MOE, DMAOE, DMAEOE. Modified sugars as described in WO 2001/088198 and Martin et al, Helv. Chim. Acta , 1995 , 78 , 486-504 are also encompassed herein. In some embodiments, the modified sugar comprises one or more groups selected from the group consisting of substituted decyl groups, RNA cleavage groups, reporter genes, fluorescent labels, intercalators, and drug motility for improved nucleic acids. A group of properties, a group for improving the pharmacodynamic properties of a nucleic acid, or other substituents having similar properties. In some embodiments, one or more of the 2', 3', 4', 5' or 6' positions of the sugar or modified sugar are modified, including at the 3'-terminal nucleotide or at 5 The 3' position of the sugar in the 5' position of the '-terminal nucleotide.

In some embodiments, the ribose 2'-OH replaced with a substituent, the substituent comprises one of the following _{persons: -H, -F; -CF 3,} -CN, -N 3, -NO, -NO 2 , -OR', -SR' or -N(R') ₂ , wherein each R' is independently as defined above and described herein; -O-(C ₁ -C ₁₀ alkyl), -S-(C _1- C ₁₀ alkyl), -NH-(C ₁ -C ₁₀ alkyl) or -N(C ₁ -C ₁₀ alkyl) ₂ ; -O-(C ₂ -C ₁₀ alkenyl), -S- (C ₂ -C ₁₀ alkenyl), -NH-(C ₂ -C ₁₀ alkenyl) or -N(C ₂ -C ₁₀ alkenyl) ₂ ; -O-(C ₂ -C ₁₀ alkynyl), - S-(C ₂ -C ₁₀ alkynyl), -NH-(C ₂ -C ₁₀ alkynyl) or -N(C ₂ -C ₁₀ alkynyl) ₂ ; or -O-(C ₁ -C ₁₀ -alkylene -O-(C ₁ -C ₁₀ alkyl), -O-(C ₁ -C ₁₀ alkyl)-NH-(C ₁ -C ₁₀ alkyl) or -O-(C ₁ -C ₁₀ Alkyl)-NH(C ₁ -C ₁₀ alkyl) ₂ , -NH-(C ₁ -C ₁₀ alkyl)-O-(C ₁ -C ₁₀ alkyl) or -N (C ₁ -C ₁₀ alkyl)-(C ₁ -C ₁₀ alkylene)-O-(C ₁ -C ₁₀ alkyl), wherein the alkyl, alkylene, alkenyl and alkynyl groups may be substituted or unsubstituted. In some embodiments, 2'-OH is replaced by -H (deoxyribose). In some embodiments, 2'-OH is replaced by -F. In some embodiments, 2'-OH is replaced by -OR'. In some embodiments, 2'-OH is replaced by -OMe. In some embodiments, 2'-OH is replaced with -OCH ₂ CH ₂ OMe.

Modified sugars also include locked nucleic acids (LNA). In some embodiments, the two substituents on the sugar carbon atom together form a divalent moiety. In some embodiments, the two substituents are on two different sugar carbon atoms. In some embodiments, the formed divalent moiety has the structure -L- as defined herein. In some embodiments, -L- is -O-CH ₂ -, wherein -CH ₂ - optionally substituted. In some embodiments, -L- is -O-CH ₂ -. In some embodiments, -L- is -O-CH(Et)-. In some embodiments, -L- is between C2 and C4 of the sugar moiety. In some embodiments, the locked nucleic acid has the structure shown below. The locked nucleic acid of this structure is indicated below, wherein Ba represents a nucleobase or a modified nucleobase as described herein, and wherein R ^2s is -OCH ₂ C4'-.

In some embodiments, the modified sugar is ENA, such as those described in, for example, Seth et al, J Am Chem Soc., October 27, 2010; 132 (42): 14942-14950. In some embodiments, the modified sugar is any one of the sugars present in the xenonucleic acid (XNA), such as arabinose, anhydrous hexitol, threose, 2'-fluoroarabinose , or cyclohexene.

The modified sugar includes a sugar mimetic such as a cyclobutyl or cyclopentyl moiety in place of a pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent No. 4,981,957: No. 5,118,800: Nos. 5,319,080 and 5,359,044. Some of the modified sugars covered include sugars in which the oxygen atoms in the ribose ring are replaced by nitrogen, sulfur, selenium or carbon. In some embodiments, the modified sugar is a modified ribose wherein the oxygen atom in the ribose ring is replaced by a nitrogen, and wherein the nitrogen is optionally replaced by an alkyl group (eg, methyl, ethyl, isopropyl, etc.) .

Non-limiting examples of modified sugars include glycerol, which forms a glycerol nucleic acid (GNA) analog. An example of a GNA analog is shown below and described in Zhang, R et al, J. Am. Chem Soc. , 2008, 130 , 5846-5847; Zhang L et al, J Am . Chem. Soc , 2005, 127 , 4174 -4175 and Tsai CH et al., PNAS , 2007, 14598-14603 (X=O ^- ):

Another example of a flexible nucleic acid (FNA) based on a mixed acetal aminal of a GNA-derived analog is described in Joyce GF et al, PNAS , 1987, 84 , 4398-4402; and Heuberger BD and Switzer C, J. Am Chem Soc. , 2008, 130 , 412-413, and is shown below:

Other non-limiting examples of modified sugars include heptamanosyl (6' to 4'), pentofuranosyl (4' to 2'), pentamigosaccharyl (4' to 3') or four. Furanosyl (3' to 2') sugars. In some embodiments, the hexanofuranosyl (6' to 4') saccharide has any of the following formulae: Wherein X ^s corresponds to the P modifying group "-XLR ¹ " described herein and Ba is as defined herein.

In some embodiments, the pentamigosaccharyl (4' to 2') sugar has any of the following formulae: Wherein X ^s corresponds to the P modifying group "-XLR ¹ " described herein and Ba is as defined herein.

In some embodiments, the pentamigosyl (4' to 3') sugar has any of the following formulae: Wherein X ^s corresponds to the P modifying group "-XLR ¹ " described herein and Ba is as defined herein.

In some embodiments, the tetrapentanosyl (3' to 2') sugar has any of the following formulae: Wherein X ^s corresponds to the P modifying group "-XLR ¹ " described herein and Ba is as defined herein.

In some embodiments, the modified sugar has any of the following formulae: Wherein X ^s corresponds to the P modifying group "-XLR ¹ " described herein and Ba is as defined herein.

In some embodiments, one or more hydroxyl groups in the sugar moiety are optionally and independently replaced by halogen, R'-N(R') ₂ , -OR' or -SR', wherein each R' is independently as above Defined and described here.

In some embodiments, the sugar mimetic is as shown below, wherein X ^s corresponds to the P modifying group "-XLR ¹ " described herein, Ba is as defined herein, and X ^{1 is} selected from -S-, - Se-, -CH _2- , -NMe-, -NEt- or -NiPr-.

In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10 of the sugar in the palm-controlled oligonucleotide composition %, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43% 44%, 45%, 46%, 47%, 48%, 49%, 50% or more (eg, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%) , 95% or more, including these percentages, have been modified. In some embodiments, only the hydrazine residue is modified (eg, about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12) %, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49% 50% or more [eg, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more] the hydrazine residue is modified). In some embodiments, only the pyrimidine residue is modified (eg, about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12) %, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45% , 46%, 47%, 48%, 49%, 50% or more [eg, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more) The pyrimidine residue is modified). In some embodiments, both purine and pyrimidine residues are modified.

Modified sugars and sugar mimetics can be prepared by methods known in the art including, but not limited to: A. Eschenmoser, Science (1999), 284: 2118; M. Bohringer et al ., Helv. Chim. Acta (1992), 75: 1416-1477; M. Egli et al, J. Am. Chem. Soc. (2006), 128 (33): 10847-56; A. Eschenmoser Chemical Synthesis: Gnosis to Prognosis, C. Chatgilialoglu and V.Sniekus ed, (Kluwer Academic, Netherlands, 1996 ), p. 293; K.-U.Schoning et al., Science (2000), 290: 1347-1351; A.Eschenmoser et al., Helv.Chim. Acta (1992), 75: 218; J. Hunziker et al, Helv. Chim. Acta (1993), 76: 259; G. Otting et al , Helv. Chim. Acta (1993), 76: 2701; K. Groebke Et al , Helv. Chim. Acta (1998), 81: 375; and A. Eschenmoser, Science (1999), 284: 2118. Modifications to the 2' modification can be found in Verma, S et al . , Annu. Rev Biochem. 1998, 67 , 99-134 and all references therein. Specific modifications to ribose can be found in the following references: 2'-fluoro (Kawasaki et al, J. Med. Chem., 1993, 36 , 831-841), 2'-MOE (Martin, P. Helv. Chim. Acta 1996, 79 , 1930-1938), "LNA" (Wengel, J. Acc. Chem. Res. 1999, 32, 301-310). In some embodiments, the modified sugar is any of the sugars described in PCT Publication No. WO 2012/030683, which is incorporated herein by reference, and which is incorporated herein by reference. To Figure 30. In some embodiments, the modified sugar is any of the modified sugars described in any one of the following: Gryaznov, S; Chen, J.-KJAm. Chem. Soc. 1994, 116, 3143; Hendrix et al. Human 1997 Chem. Eur. J. 3: 110; Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Jepsen et al. 2004 Oligo. 14: 130-146; Jones et al. J. Org. Chem. 1993, 58 , 2983; Koizumi et al. 2003 Nuc. Acids Res. 12: 3267-3273; Koshkin et al. 1998 Tetrahedron 54: 3607-3630; Kumar et al. 1998 Bioo. Med. Chem. Let. 8: 2219-2222; Lauritsen et al. 2002 Chem. Comm. 5: 530-531; Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; Mesmaeker et al. Angew. Chem., Int Ed. Engl. 1994, 33, 226; Morita et al. 2001 Nucl. Acids Res. Supplement 1: 241-242; Morita et al. 2002 Bioo. Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem. Lett. 2211-2226; Nielsen et al. Chem. Soc. Rev. 73; Nielsen et al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Obika et al. 1997 Tetrahedron Lett. 38 (50): 8735-8; Obika et al. 1998 Tetrahedron Lett. 39:5401-5404; Pallan et al. 2012 Chem. Comm. 48: 8195-8197; Petersen Human 2003 TRENDS Biotech. 21: 74-81; Rajwanshi et al. 1999 Chem. Commun. 1395-1396; Schultz et al. 1996 Nucleic Acids Res. 24: 2966; Seth et al. 2009 J. Med. Chem. 52: 10-13 ; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al. 2010 J. Org. Chem. 75: 1569-1581; Seth et al. 2012 Bioo. Med. Chem. Lett. 22: 296-299 Seth et al. 2012 Mol. Ther-Nuc. Acids.1, e47; Seth, Punit P; Siwkowski, Andrew; Allerson, Charles R; Vasquez, Guillermo; Lee, Sam; Prakash, Thazha P; Kinberger, Garth; Migawa, Michael T; Gaus, Hans; Bhat, Balkrishen et al. Nucleic Acids Symposium Series (2008), 52(1), 553-554; Singh et al. 1998 Chem. Comm. 1247-1248; Singh et al. 1998 J. Org. .63:10035-39; Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Sorensen 2003 Chem. Comm. 2130-2131; Ts'o et al. Ann. NY Acad. Sci. 1988, 507, 220; Van Aerschot Et al. 1995 Angew. Chem. Int. Ed. Engl. 34: 1338; Vasseur et al. J. Am. Chem. Soc. 1992, 114, 4006; WO 20070900071; WO 20070900071; or WO 2016/079181.

In some embodiments, the modified sugar moiety is an optionally substituted pentose or hexose moiety. In some embodiments, the modified sugar moiety is an optionally substituted pentose moiety. In some embodiments, the modified sugar moiety is an optionally substituted hexose moiety. In some embodiments, the modified sugar moiety is an optionally substituted ribose or hexitol moiety. In some embodiments, the modified sugar moiety is an optionally substituted ribose moiety. In some embodiments, the modified sugar moiety is an optionally substituted hexitol moiety. In some embodiments, an exemplary modified internucleotide linkage and/or a sugar system is selected from the group consisting of: HNA PNA 2'-Fluorine N3'-P5'-Aminophosphate LNA β-D-oxygen-LNA 2'-O, 3'-C-linked double ring PS-LNA β-D-thio-LNA β-D-amino-LNA xylo-LNA[c] α-L-LNA ENA β-D-ENA Indoleamine linked LNA Methyl phosphonate-LNA ( R,S )-cEt ( R,S )-cMOE ( R,S )-5'-Me-LNA S-Me cLNA methylene-cLNA 3'-Me-α-L-LNA R-6'-Me-α-L-LNA S -5'-Me-α-L-LNA R -5'-Me-α-L-LNA

In some embodiments, R ¹ is R as defined and described. In some embodiments, R ² is R. In some embodiments, R ^e is R. In some embodiments, R ^e is H, CH ₃ , Bn, COCF ₃ , benzamyl, benzyl, indol-1-ylcarbonyl, indol-1-ylmethyl, 2-aminoethyl. In some embodiments, exemplary modified internucleotide linkages and/or glycosides are selected from the group consisting of: Ts'o et al. Ann. NY Acad. Sci. 1988 , 507, 220; Gryaznov, S;. Chen, J. -KJAm.Chem.Soc 1994, 116,3143;. Mesmaeker et al Angew.Chem, Int.Ed.Engl 1994, 33,226;. . Jones et al J.Org.Chem 1993. , 58, 2983; Vasseur et al. J. Am. Chem. Soc. 1992 , 114, 4006; Van Aerschot et al. 1995 Angew. Chem. Int. Ed. Engl. 34: 1338; Hendrix et al. 1997 Chem. Eur. .3:110; Koshkin et al. 1998 Tetrahedron 54: 3607-3630; Hyrup et al. 1996 Bioorg. Med. Chem. 4:5; Nielsen et al. 1997 Chem. Soc. Rev. 73; Schultz et al. 1996 Nucleic Acids Res. 24:2966; Obika et al. 1997 Tetrahedron Lett. 38(50): 8735-8; Obika et al. 1998 Tetrahedron Lett. 39: 5401-5404; Singh et al. 1998 Chem. Comm. 1247-1248; Kumar et al. 1998 Bioo . Med. Chem. Let. 8: 2219-2222; Nielsen et al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Seth et al. people 2010 J.Org.Chem.75: 1569-1581; Singh et al. 1998 J.Org.Chem.63: 10035-39 Sorensen 2003Chem.Comm.2130-2131; Petersen et al. 2003 TRENDS Biotech.21: 74-81; Rajwanshi et al. 1999 Chem.Commun.1395-1396; Jepsen et al. 2004 Oligo.14: 130-146; Morita et al. 2001 Nucl. Acids Res. Supplement 1: 241-242; Morita et al. 2002 Bioo. Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem. Lett. 2211-2226; Koizumi et al. 2003 Nuc .Acids Res. 12: 3267-3273; Lauritsen et al. 2002 Chem. Comm. 5: 530-531; Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; WO 20070900071; Seth et al., Nucleic Acids Symposium Series (2008), 52(1), 553-554; Seth et al. 2009 J. Med. Chem. 52: 10-13; Seth et al. 2012 Mol. Ther-Nuc. Acids.1, e47; Pallan et al. People 2012 Chem. Comm. 48: 8195-8197; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al. 2012 Bioo. Med. Chem. Lett. 22: 296-299; WO 2016/079181 US 6,326,199; US 6,066,500; and US 6,440,739, the bases and sugar modifications of each of which are incorporated herein by reference.

Oligonucleotides

In some embodiments, the invention provides a palm-controlled oligonucleotide and oligonucleotide composition. For example, in some embodiments, the provided compositions contain one or more individual oligonucleotide types of a predetermined amount, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone chain Link mode; 3) main chain versus palm center mode; and 4) main chain P modification mode. In some embodiments, a particular oligonucleotide type can be defined as follows: 1A) base identity; 1B) base modification pattern; 1C) sugar modification pattern; 2) backbone linkage mode; 3) backbone pair Sexual center mode; and 4) main chain P modification mode. In some embodiments, oligonucleotides of the same oligonucleotide type are identical.

As described herein, the invention provides various oligonucleotides. In some embodiments, the invention provides oligonucleotides comprising greater than about 50%, 60, which are shared with sequences present in the exemplary oligonucleotides provided, such as those listed in the tables. %, 70%, 75%, 80%, 85%, 90%, 95% consistent sequence. In some embodiments, the oligonucleotide provided is WV-1092. In some embodiments, the oligonucleotide provided is WV-2595. In some embodiments, the oligonucleotide provided is WV-2603. In some embodiments, the invention provides an oligonucleotide comprising or consisting of a sequence present in an exemplary oligonucleotide provided. In some embodiments, the invention provides an oligonucleotide comprising or consisting of a sequence present in WV-1092. In some embodiments, the invention provides an oligonucleotide comprising or consisting of a sequence present in WV-2595. In some embodiments, the invention provides an oligonucleotide comprising or consisting of a sequence present in WV-2603. In some embodiments, the provided oligonucleotide further comprises one or more native phosphate linkages and one or more modified internucleotide linkages. In some embodiments, the provided oligonucleotide comprises two or more native phosphate linkages. In some embodiments, the provided oligonucleotides comprise two or more consecutive native phosphate linkages. In some embodiments, the provided oligonucleotides comprise two or more modified internucleotide linkages. In some embodiments, the provided oligonucleotides comprise two or more consecutive modified internucleotide linkages. In some embodiments, the provided oligonucleotides comprise 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 More or more consecutive modified internucleotide linkages. In some embodiments, the provided oligonucleotide comprises 5 or more consecutive modified internucleotide linkages. In some embodiments, the provided oligonucleotide comprises 5 or more consecutive modified internucleotide linkages. In some embodiments, the provided oligonucleotides comprise 6 or more consecutive modified internucleotide linkages. In some embodiments, the provided oligonucleotides comprise 7 or more consecutive modified internucleotide linkages. In some embodiments, the provided oligonucleotide comprises 8 or more consecutive modified internucleotide linkages. In some embodiments, the provided oligonucleotide comprises 9 or more consecutive modified internucleotide linkages. In some embodiments, the provided oligonucleotides comprise 10 or more consecutive modified internucleotide linkages. In some embodiments, at least one of the modified internucleotide linkages is a palm-controlled internucleotide linkage because the oligonucleotides having the same sequence and chemical modifications within the composition are The modified internucleotide linkages share the same configuration R p or S p at the palmitic phosphorus atom. In some embodiments, at least two modified internucleotide linkages are controlled to palmarity. In some embodiments, at least one modified internucleotide linkage in a continuous modified internucleotide linkage region is controlled to palmarity. In some embodiments, at least two modified internucleotide linkages within a continuous modified internucleotide linkage region are controlled by palmarity. In some embodiments, each modified internucleotide linkage within a continuous modified internucleotide linkage region is controlled to palmarity. In some embodiments, each modified internucleotide linkage is controlled to palmarity. In some embodiments, the oligonucleotides are provided comprising (S p) x R p ( S p) y mode, wherein x and y are each independently 1 to 20, and the sum of x and y is from 1 to 50 . In some embodiments, x and y are each independently 2-20. In some embodiments, at least one of x and y is greater than 5, 6, 7, 8, 9, or 10. In some embodiments, the sum of x and y is greater than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, the provided oligonucleotides comprise one or more chemical modifications as presented in the exemplary oligonucleotides provided. In some embodiments, the provided oligonucleotides comprise one or more base modifications as presented in the exemplary oligonucleotides provided. In some embodiments, the provided oligonucleotides comprise one or more sugar modifications as presented in the exemplary oligonucleotides provided. In some embodiments, the sugar modification is a 2' modification. In some embodiments, the sugar is modified to LNA. In some embodiments, the sugar is modified to ENA. In some embodiments, the provided oligonucleotide is a palm-controlled oligonucleotide. In some embodiments, the invention provides oligonucleotide compositions comprising the provided oligonucleotides. In some embodiments, the provided oligonucleotide composition is a palm-controlled oligonucleotide composition.

In some embodiments, the provided oligonucleotide is a monomer. In some embodiments, the provided oligonucleotide is a P-modified monomer. In some embodiments, the provided oligonucleotides are stereosomes. In some embodiments, the provided oligonucleotide is a stereosome that configures Rp . In some embodiments, the provided oligonucleotide is a stereomonomeric configuration of Sp .

In some embodiments, the provided oligonucleotides are alternating bodies. In some embodiments, the provided oligonucleotides are P-modified alternations. In some embodiments, the provided oligonucleotides are stereo-alternates.

In some embodiments, the provided oligonucleotides are block. In some embodiments, the provided oligonucleotide is a P-modified block. In some embodiments, the oligonucleotides provided are stereoblocks.

In some embodiments, the provided oligonucleotide is a spacer.

In some embodiments, the provided oligonucleotide is a skip.

In some embodiments, the provided oligonucleotide is a semi-mer. In some embodiments, the half-mer is a sequence having a 5' or 3' end sequence having an oligonucleotide that does not have structural features in the remainder of the oligonucleotide. In some embodiments, the 5' or 3' end has or comprises 2 to 20 nucleotides. In some embodiments, the structural feature is a base modification. In some embodiments, the structural feature is a sugar modification. In some embodiments, the structural feature is a P modification. In some embodiments, the structural feature is stereochemistry of inter-nucleotide linkages. In some embodiments, the structural feature is or comprises a base modification, a sugar modification, a P modification, or a stereochemistry, or a combination thereof, to a palmitic internucleotide linkage. In some embodiments, the semi-mers share a commonly modified oligonucleotide for each sugar moiety of the 5' end sequence. In some embodiments, the half-mers share a commonly modified oligonucleotide for each sugar moiety of the 3' end sequence. In some embodiments, the common sugar modification of the 5' or 3' end sequence is not shared by any other sugar moiety in the oligonucleotide. In some embodiments, an exemplary half-mer is an oligonucleotide comprising a substituted or unsubstituted 2'-O-alkyl sugar modified nucleoside, a bicyclic sugar modified nucleoside, beta -D- ribonucleosides or ribonucleoside-deoxy-β-D- (e.g. by modifying the 2'-MOE nucleosides and LNA ^TM or by ENA ^TM of the bicyclic sugar modified nucleosides) and the other end comprises a sequence having different sugars Sequence of a portion of a nucleoside such as a substituted or unsubstituted 2'-O-alkyl sugar modified nucleoside, a bicyclic sugar modified nucleoside or a natural nucleoside. In some embodiments, the provided oligonucleotides are a combination of one or more of a monomer, an alternation, a block, a spacer, a semimer, and a skip. In some embodiments, the provided oligonucleotides are a combination of one or more of a monomer, an alternation, a block, a spacer, and a skip. For example, in some embodiments, the provided oligonucleotides are alternations and spacers. In some embodiments, the nucleotides provided are spacers and skips. Those skilled in the art of chemistry and synthesis will recognize that many other modes are combined and are only commercially available and/or synthetically feasible for the components required to synthesize the provided oligonucleotides according to the methods of the present invention. limit. In some embodiments, the semi-polymer structure provides advantageous benefits, as illustrated by Figure 29. In some embodiments, the provided oligonucleotide is a 5'-hemimer comprising a modified sugar moiety in the 5' end sequence. In some embodiments, the provided oligonucleotide is a 5'-hemimer comprising a modified 2'-saccharide moiety in the 5' end sequence.

In some embodiments, the provided oligonucleotides comprise one or more optionally substituted nucleotides. In some embodiments, the provided oligonucleotides comprise one or more modified nucleotides. In some embodiments, the provided oligonucleotides comprise one or more optionally substituted nucleosides. In some embodiments, the provided oligonucleotides comprise one or more modified nucleosides. In some embodiments, the provided oligonucleotides comprise one or more optionally substituted LNAs.

In some embodiments, the provided oligonucleotides comprise one or more optionally substituted nucleobases. In some embodiments, the provided oligonucleotides comprise one or more optionally substituted natural nucleobases. In some embodiments, the provided oligonucleotides comprise one or more optionally substituted nucleobases. In some embodiments, the provided oligonucleotide comprises one or more 5-methylcytidine nucleosides, 5-hydroxymethylcytidine nucleosides, 5-methylmercaptocytosine or 5-carboxycytosine . In some embodiments, the provided oligonucleotide comprises one or more 5-methylcytosine nucleosides.

In some embodiments, the provided oligonucleotides comprise one or more optionally substituted sugars. In some embodiments, the provided oligonucleotides comprise one or more optionally substituted naturally occurring DNA and sugars present in the RNA. In some embodiments, the provided oligonucleotides comprise one or more optionally substituted ribose or deoxyribose. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted ribose or deoxyribose sugars, wherein one or more of the ribose or deoxyribose moieties are optionally halogenated, R', -N(R') ₂ , -OR' or -SR' substitution, wherein each R' is independently as defined above and described herein. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose sugar is optionally and independently via halogen, R', -N (R ') ₂ , -OR' or -SR' substitution, wherein each R' is independently as defined above and described herein. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose sugar is optionally substituted with a halogen. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose sugar is optionally substituted with one or more -F. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose sugar is optionally substituted with -OR', wherein each R' Independently as defined above and described herein. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose sugar is optionally substituted with -OR', wherein each R' Independently a C ₁ -C ₆ aliphatic group substituted as appropriate. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose sugar is optionally substituted with -OR', wherein each R' Independently a C ₁ -C ₆ alkyl group substituted as appropriate. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose sugar is optionally substituted with -OMe. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose sugar is optionally replaced by -O-methoxyethyl .

In some embodiments, the provided oligonucleotide is a single-stranded oligonucleotide.

In some embodiments, the oligonucleotides provided are mixed oligonucleotide strands. In certain embodiments, the provided oligonucleotides are partially mixed oligonucleotide strands. In certain embodiments, the oligonucleotides provided are fully mixed oligonucleotide strands. In certain embodiments, the provided oligonucleotide is a double stranded oligonucleotide. In certain embodiments, the oligonucleotides provided are three strands of oligonucleotide (eg, a triple helix).

In some embodiments, the provided oligonucleotide is a chimeric oligonucleotide. For example, in some embodiments, the provided oligonucleotides are DNA-RNA chimeras, DNA-LNA chimeras, and the like.

In some embodiments, any of the structures comprising the oligonucleotides depicted in WO 2012/030683 can be modified according to the methods of the invention to provide a palm-controlled variant thereof. For example, in some embodiments, the palm-controlled variant is included in any of the linked phosphorus Stereochemical modification at one or more and/or P modification at any one or more of the linked phosphorus. For example, in some embodiments, a particular nucleotide unit of an oligonucleotide selected in advance in WO2012/030683 is stereochemically modified at a linked phosphate of the nucleotide unit and/or in a nucleotide unit. The P is modified by bonding the phosphorus. In some embodiments, the palm-controlled oligonucleotide has any of the structures depicted in Figures 26-30. In some embodiments, the palm-controlled oligonucleotide is a variant (eg, a modified version) of any of the structures depicted in FIGS. 26-30. The disclosure of WO 2012/030683 is incorporated herein by reference in its entirety.

In some embodiments, the provided oligonucleotide is a therapeutic agent.

In some embodiments, the provided oligonucleotide is an antisense oligonucleotide.

In some embodiments, the provided oligonucleotide is an anti-gene oligonucleotide.

In some embodiments, the provided oligonucleotide is a decoy oligonucleotide.

In some embodiments, the provided oligonucleotide is part of a DNA vaccine.

In some embodiments, the provided oligonucleotides are immunomodulatory oligonucleotides, such as immunostimulatory oligonucleotides and immunosuppressive oligonucleotides.

In some embodiments, the provided oligonucleotide is an adjuvant.

In some embodiments, the provided oligonucleotide is an aptamer.

In some embodiments, the oligonucleotide provided is a ribonuclease.

In some embodiments, the oligonucleotide provided is a DNase (DNAzyme/DNA enzyme).

In some embodiments, the oligonucleotide provided is an siRNA.

In some embodiments, the provided oligonucleotide is a microRNA (miRNA).

In some embodiments, the provided oligonucleotides are ncRNAs (non-coding RNAs), including long non-coding RNAs (lncRNAs) and small non-coding RNAs, such as piwi-interacting RNA (piRNA).

In some embodiments, the provided oligonucleotide is complementary to a structural RNA (eg, a tRNA).

In some embodiments, the provided oligonucleotide is a nucleic acid analog, such as GNA, LNA, PNA, TNA, GNA, ANA, FANA, CeNA, HNA, UNA, ZNA or N-morpholinyl.

In some embodiments, the provided oligonucleotide is a P-modified prodrug.

In some embodiments, the oligonucleotides provided are primers. In some embodiments, the primers are used to amplify nucleic acids in a polymerase-based chain reaction (ie, PCR). In some embodiments, the primers are used in any known variant of PCR, such as reverse transcription PCR (RT-PCR) and real-time PCR.

In some embodiments, the provided oligonucleotides are characterized by the ability to modulate ribonuclease H activation. For example, in some embodiments, by three-dimensional control of the presence of phosphorothioate analogs of nucleic adjusted RNase H activation, wherein the natural DNA / RNA ratio susceptible stereoisomer or R p and R the same vulnerability to stereoisomers of p, R p off than the corresponding S stereoisomer stereoisomers susceptible p.

In some embodiments, the provided oligonucleotides are characterized by the ability to indirectly or directly increase or decrease protein activity or inhibit or promote protein expression. In some embodiments, the provided oligonucleotides are characterized in that they are useful for controlling cell proliferation, viral replication, and/or any other cellular signaling process.

In some embodiments, the provided oligonucleotides are from about 2 to about 200 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 180 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 160 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 140 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 120 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 100 nucleotide units in length. In some embodiments, the provided oligo The length of the nucleotide is from about 2 to about 90 nucleotide units. In some embodiments, the provided oligonucleotides are from about 2 to about 80 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 70 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 60 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 50 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 40 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 30 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 29 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 28 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 27 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 26 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 25 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 24 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 23 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 22 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 21 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 2 to about 20 nucleotide units in length.

In some embodiments, the provided oligonucleotides are from about 4 to about 200 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 180 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 160 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 140 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 120 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 100 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 90 nucleotide units in length. In some embodiments, provided Oligonucleotides are from about 4 to about 80 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 70 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 60 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 50 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 40 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 30 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 29 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 28 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 27 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 26 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 25 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 24 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 23 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 22 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 21 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 4 to about 20 nucleotide units in length.

In some embodiments, the provided oligonucleotides are from about 5 to about 10 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 10 to about 30 nucleotide units in length. In some embodiments, the provided oligonucleotides are from about 15 to about 25 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or 25 nucleotide units.

In some embodiments, the oligonucleotide is at least 2 nucleotide units in length. In some embodiments, the oligonucleotide is at least 3 nucleotide units in length. In some embodiments, the oligonucleotide is at least 4 nucleotide units in length. In some embodiments, the oligo The length of the nucleotide is at least 5 nucleotide units. In some embodiments, the oligonucleotide is at least 6 nucleotide units in length. In some embodiments, the oligonucleotide is at least 7 nucleotide units in length. In some embodiments, the oligonucleotide is at least 8 nucleotide units in length. In some embodiments, the oligonucleotide is at least 9 nucleotide units in length. In some embodiments, the oligonucleotide is at least 10 nucleotide units in length. In some embodiments, the oligonucleotide is at least 11 nucleotide units in length. In some embodiments, the oligonucleotide is at least 12 nucleotide units in length. In some embodiments, the oligonucleotide is at least 13 nucleotide units in length. In some embodiments, the oligonucleotide is at least 14 nucleotide units in length. In some embodiments, the oligonucleotide is at least 15 nucleotide units in length. In some embodiments, the oligonucleotide is at least 16 nucleotide units in length. In some embodiments, the oligonucleotide is at least 17 nucleotide units in length. In some embodiments, the oligonucleotide is at least 18 nucleotide units in length. In some embodiments, the oligonucleotide is at least 19 nucleotide units in length. In some embodiments, the oligonucleotide is at least 20 nucleotide units in length. In some embodiments, the oligonucleotide is at least 21 nucleotide units in length. In some embodiments, the oligonucleotide is at least 22 nucleotide units in length. In some embodiments, the oligonucleotide is at least 23 nucleotide units in length. In some embodiments, the oligonucleotide is at least 24 nucleotide units in length. In some embodiments, the oligonucleotide is at least 25 nucleotide units in length. In some other embodiments, the oligonucleotide is at least 30 nucleotide units in length. In some other embodiments, the oligonucleotide is a double helix of complementary strands of at least 18 nucleotide units in length. In some other embodiments, the oligonucleotide is a double helix of complementary strands of at least 21 nucleotide units in length.

In some embodiments, the 5' end and/or the 3' end of the provided oligonucleotide are modified. In some embodiments, the 5' end and/or the 3' end of the provided oligonucleotide is modified by an end-capped portion. Examples of such modifications, including end-capped portions, are widely described herein and in the art, such as, but not limited to, those described in U.S. Patent Application Publication No. US 2009/0023675 A1. Etc.

In some embodiments, oligonucleotides characterized by 1) a common base sequence and length, 2) a common backbone linkage pattern, and 3) a common backbone to an oligonucleotide type oligonucleotide of the palm center pattern have the same chemistry structure. For example, it has the same base sequence, the same nucleoside modification pattern, the same backbone linkage mode (ie, an internucleotide linkage type pattern, such as a phosphate, a phosphorothioate, etc.), the same backbone The palm center mode (ie, the bond-phosphor stereochemistry ( R p/ S p) mode) and the same main chain phosphorus modification mode (for example, the mode of the "-XLR ¹ " group in Formula I ).

Exemplary oligonucleotides and compositions

In some embodiments, the paired palm-controlled oligonucleotides provided comprise a sequence of milwaxine or a portion of the sequence. Mipermology is based on the following base sequence GCCT/UCAGT/UCT/UGCT/UT/UCGCACC. In some embodiments, any one or more of the nucleotides or linkages can be modified in accordance with the present invention. In some embodiments, the invention provides a palm-controlled oligonucleotide having a G' - C *-C* -U *-C*-d linkage by a 3'→5' phosphorothioate A -dG-d T -dC-dT-dG-d mC -dT-dT-dmC-G*-C*-A*-C*-C* sequence [d=2'-deoxygenation, *=2 '-O-(2-methoxyethyl)]. Exemplary modified Mibomei sequences are described throughout the application including, but not limited to, the sequences in Table 2.

In certain embodiments, the oligonucleotide provided is a milwagen-derived monomer. In certain embodiments, the provided oligonucleotide is a berberine monomer that configures Rp . In certain embodiments, the provided oligonucleotide is a Mipermeimer monomer configured to Sp .

Exemplary antagonistic palmetto controlled oligonucleotides comprising the Mipermeis sequence or a portion of this sequence are depicted in Table 2 below.

In some embodiments, the invention provides oligonucleotides and/or oligonucleotide compositions suitable for use in the treatment of Huntington's disease, for example selected from the group consisting of:

In Tables N1 through N4, * indicates only stereotactic phosphorothioate linkages; *S indicates S p phosphorothioate linkages, *R indicates R p phosphorothioate linkages, all unlabeled The linkage is a natural phosphate linkage, m in front of the base represents 2'-OMe, d2AP represents 2-aminoindole, and dDAP represents 2,6-diaminopurine.

In some embodiments, the invention provides oligonucleotides and/or oligonucleotide compositions suitable for use in the treatment of Huntington's disease, for example selected from the group consisting of:

In Tables N1A through N4A, * indicates only stereotactic phosphorothioate linkages; *S indicates S p phosphorothioate linkages, *R indicates R p phosphorothioate linkages, all unlabeled The linkage is a natural phosphate linkage, m in front of the base represents 2'-OMe, d2AP represents 2-aminoindole, and dDAP represents 2,6-diaminopurine.

In some embodiments, the provided oligonucleotide compositions are oligonucleotide-controlled oligonucleotide compositions of the oligonucleotide types listed in Table N1A, Table N2A, Table N3A, and Table N4A. Each oligonucleotide comprising a HTT sequence described herein represents an HTT oligonucleotide that is designed, constructed, and tested in various assays (eg, in vitro assays) in accordance with the present invention. For example, each of the HTT oligonucleotides listed in any of Table N1A, Table N2A, Table N3A, Table N4A, and Table 8 or elsewhere herein are designed, constructed, and ex vivo according to the present invention. test. Each of the HTT oligonucleotides described herein was tested, inter alia, in a dual luciferase reporter gene assay. In some embodiments, further in vitro and in vivo assays are performed on HTT oligonucleotides found to be particularly effective in dual luciferase assays. In some embodiments, the provided compositions are selected from the group consisting of WVE120101, WV-2603, WV-2595, WV-1510, WV-2378, and WV-2380; each found to be very effective, examples For example, as demonstrated in the in vitro dual luciferase reporter gene assay according to the present invention. In some embodiments, the compositions provided are selected from the group consisting of WV-1092, WV-1497, WV-1085, WV-1086, ONT-905, and WV-2623; each is found to be very effective, for example, as in Demonstrated in the in vitro dual luciferase reporter gene assay according to the invention. Various other HTT oligonucleotides have also been shown to be particularly effective. In some embodiments, the provided compositions have WV-1092. In some embodiments, the provided compositions have WV-1497. In some embodiments, the provided compositions have WV-1085. In some embodiments, the provided compositions have WV-1086. In some embodiments, the provided compositions have ONT-905. In some embodiments, the provided compositions have WV-2623.

The invention provides compositions comprising or consisting of a plurality of provided oligonucleotides (e.g., a palm-controlled oligonucleotide composition). In some embodiments, all of the oligonucleotides provided are of the same type, that is, all have the same base sequence, a backbone linkage mode (ie, an internucleotide linkage type pattern, For example, phosphates, phosphorothioates, etc.), the main chain-to-palm center mode (ie, the bond-phosphor stereochemistry ( R p/ S p) mode) and the main chain phosphorus modification mode (for example, in the formula I-- XLR ¹ "group mode". In some embodiments, all oligonucleotides of the same type are identical. However, in various embodiments, the provided compositions generally comprise a plurality of oligonucleotide types in terms of a predetermined relative amount.

In some embodiments, a provided composition comprises a predetermined amount of an oligonucleotide selected from a table. In some embodiments, the provided compositions comprise a predetermined amount of oligonucleotides selected from Tables N1 through N4. In some embodiments, the provided compositions comprise a predetermined amount of WV-1092. In some embodiments, the provided compositions comprise a predetermined amount of WV-2595. In some embodiments, the provided compositions comprise a predetermined amount of WV-2603. In some embodiments, the provided composition comprises a predetermined amount of mG*SmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAmCmUmU*SmC, wherein the oligonucleotide has a free 5'-OH and 3'-OH, m in front of the base indicates 2'-OMe modification in the nucleoside containing the base, *S indicates S p phosphorothioate linkage, *R indicates R p sulfur Phosphophosphate linkages, and all unlabeled linkages are natural phosphate linkages. In some embodiments, the provided composition comprises a predetermined amount of mG*SmGmGmUmC*SC*ST*SC*SC*SC*SC*SA*SC*RA*SG*SmAmGmGmG*S mA, wherein the oligonucleotide has Free 5'-OH and 3'-OH, m in front of the base indicates 2'-OMe modification in the nucleoside containing the base, *S indicates S p phosphorothioate linkage, *R indicates R p The phosphorothioate linkages and all unlabeled linkages are natural phosphate linkages. In some embodiments, the provided composition comprises a predetermined amount of mG*SmUmGmCmA*SC*SA*SC*SA*SG*ST*SA*SG*RA*ST*SmGmAmGmG*S mG, wherein the oligonucleotide has Free 5'-OH and 3'-OH, m in front of the base indicates 2'-OMe modification in the nucleoside containing the base, *S indicates S p phosphorothioate linkage, *R indicates R p The phosphorothioate linkages and all unlabeled linkages are natural phosphate linkages.

In some embodiments, the provided palm-controlled oligonucleotide composition is a palmitic pure milbean-mei composition. In other words, in some embodiments, the provided palm-controlled oligonucleotide composition provides milavirin as a single diastereomer in terms of the configuration of the linked phosphorus. In some embodiments, the palm-controlled oligonucleotide composition provided is a palmine-promoting composition that is uniform in palmarity. In other words, in some embodiments, each linking each phosphorus were highly bomei m S p configuration of green phosphorous linkages were highly R p or m bomei configuration of Health.

In some embodiments, the provided palm-controlled oligonucleotide composition comprises one or more combinations of the provided oligonucleotide types. Those skilled in the art of chemistry and medical technology will recognize that the selection and amount of each of the one or more types of provided oligonucleotides in the compositions provided will depend on the intended use of the composition. In other words, the skilled artisan will design the palm-controlled oligonucleotide composition provided such that the amount and type of oligonucleotide provided therein provides the composition as generally desirable. Characteristics (eg, biologically desirable, therapeutically desirable, etc.).

In some embodiments, a pair of palm-controlled oligonucleotide compositions are provided comprising a combination of two or more of the provided oligonucleotide types. In some embodiments, the provided palm-controlled oligonucleotide composition comprises a combination of three or more provided oligonucleotide types. In some embodiments, the provided palm-controlled oligonucleotide composition comprises a combination of four or more provided oligonucleotide types. In some embodiments, the provided palm-controlled oligonucleotide composition comprises a combination of five or more provided oligonucleotide types. In some embodiments, a pair of palm-controlled oligonucleotide compositions are provided comprising a combination of six or more of the provided oligonucleotide types. In some embodiments, a pair of palm-controlled oligonucleotide compositions are provided comprising a combination of seven or more of the provided oligonucleotide types. In some embodiments, a pair of palm-controlled oligonucleotide compositions are provided comprising a combination of eight or more of the provided oligonucleotide types. In some embodiments, the provided palm-controlled oligonucleotide composition comprises a combination of nine or more provided oligonucleotide types. In some embodiments, the provided palm-controlled oligonucleotide composition comprises a combination of ten or more provided oligonucleotide types. In some embodiments, the provided palm-controlled oligonucleotide composition comprises a combination of fifteen or more provided oligonucleotide types.

In some embodiments, the provided palm-controlled oligonucleotide composition is a combination of a certain amount of R p configured for a palm-like uniformity of imipenem and a certain amount of S p-configuration with a palm-like uniformity of imipenex. .

In some embodiments, the palm-controlled oligonucleotide composition provided is a quantity of R p configured to palm-like uniformity of imipenem, a certain amount of S p configuration to palm-like uniformity of imipenmei and certain A combination of one or more of the desired diastereomeric forms of palmitic pure Mibomei.

In some embodiments, the types of oligonucleotides provided are selected from those of the type described in PCT/US2013/050407, which is incorporated herein by reference. In some embodiments, the provided palm-controlled oligonucleotide composition comprises an oligonucleotide of the type selected from the group of PCT/US2013/050407.

Exemplary methods for preparing oligonucleotides and compositions

The present invention provides methods for making a palm-controlled oligonucleotide and a palm-controlled composition comprising one or more specific nucleotide types. In some embodiments, the phrase "oligonucleotide type" as used herein has the definition of a particular base sequence, a backbone linkage mode, a backbone-to-palm central mode, and a backbone phosphorus modification mode (eg, "- An oligonucleotide of the XLR ¹ "group". The oligonucleotides having the commonly named "type" are structurally identical to each other in terms of the base sequence, the backbone linkage mode, the backbone-to-palm center mode, and the backbone phosphorus modification mode. In some embodiments, an oligonucleotide of the oligonucleotide type is the same.

In some embodiments, the properties of the palm-controlled oligonucleotides provided in the present invention differ from the properties of the corresponding stereoregular oligonucleotide mixture. In some embodiments, the lipophilicity of the palm-controlled oligonucleotide is different from the lipophilicity of the stereoregular oligonucleotide mixture. In some embodiments, the palm-controlled oligonucleotides have different residence times on HPLC. In some embodiments, the peak residence time for the palm-controlled oligonucleotide can be significantly different from the peak residence time of the corresponding stereoregular oligonucleotide mixture. Certain pairs of palm-controlled oligonucleotides will be largely, if not completely, lost during the purification of oligonucleotides using HPLC, as commonly done in such techniques. Certain pairs of palm-controlled oligonucleotides will be largely, if not completely, lost during the purification of oligonucleotides using HPLC, as commonly done in such techniques. One of the results was that some of the diastereomers (some pairs of palm controlled oligonucleotides) of the mixture of stereoregular oligonucleotides were not tested in the assay. Another result is that between the batch and the batch, due to unavoidable instrumental and human error, it is assumed that "pure" stereoregular oligonucleotides will have inconsistent compositions, where the diastereoisomers in the composition The structure and its relative amount and absolute amount vary from batch to batch. The palm-controlled oligonucleotides and the palm-controlled oligonucleotide compositions provided in the present invention solve such problems, such as in the form of a single diastereomer in a palm-controlled manner. A palm-controlled oligonucleotide is synthesized, and the palm-controlled oligonucleotide composition comprises one or more individual oligonucleotide types of a predetermined amount.

Those skilled in the art of chemistry and synthesis will appreciate that the synthetic methods of the present invention provide some degree of control during the various synthetic steps of the provided oligonucleotides such that each nucleotide unit of the oligonucleotide can be designed in advance and Or alternatively, to have a specific stereochemistry at the linked phosphorus and/or to have specific modifications at the linked phosphorus, and/or specific bases, and/or specific sugars. In some embodiments, the provided oligonucleotides are designed and/or selected in advance to have a specific stereocenter combination at the linkage between the internucleotide linkages.

In some embodiments, provided oligonucleotides made using the methods of the invention are designed and/or determined to have a particular combination of linked phosphorus modifications. In some embodiments, provided oligonucleotides made using the methods of the invention are designed and/or determined to have a particular base combination. In some embodiments, provided oligonucleotides made using the methods of the invention are designed and/or determined to have a particular sugar combination. In some embodiments, provided oligonucleotides made using the methods of the invention are designed and/or determined to have a particular combination of one or more of the above structural features.

The method of the invention exhibits a high degree of palmity control. For example, the methods of the invention help to control the stereochemical configuration of each single linked phosphorus within the provided oligonucleotide. In some embodiments, the methods of the invention provide an oligonucleotide comprising one or more modified internucleotide linkages independently having the structure of Formula I.

In some embodiments, the methods of the invention provide an oligonucleotide that is a milwacamere monomer. In some embodiments, the methods of the invention provide an oligonucleotide that is a berberine monomer that configures Rp . In some embodiments, the methods of the invention provide an oligonucleotide that is a configuration of Sp .

In some embodiments, the methods of the invention provide a palm-controlled oligonucleotide composition, i.e., an oligonucleotide composition comprising a predetermined amount of individual oligonucleotide types. In some embodiments, the palm-controlled oligonucleotide composition comprises an oligonucleotide type. In some embodiments, the palm-controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, the palm-controlled oligonucleotide composition comprises a plurality of species Oligonucleotide type. Exemplary palm-controlled oligonucleotide compositions made in accordance with the present invention are described herein.

In some embodiments, the method of the present invention provides a palm pure milbean-mei composition in terms of the configuration of the bonded phosphorus. In other words, in some embodiments, the method of the present invention provides a composition of milavines, wherein in the configuration of the linked phosphorus, milbemide is present in the composition as a single diastereomer.

In some embodiments, in terms of the configuration of the linked phosphorus, the method of the present invention provides a milwax composition that is uniform in palmarity. In other words, in some embodiments, the method of the present invention provides a composition of milavines, wherein in the configuration of the linked phosphorus, all of the nucleotide units have the same stereochemistry, eg, all nucleotide units are in the bond R p are all associated configuration at phosphorus or all of the nucleotide units are all in the S p configuration at phosphorus linkage.

In some embodiments, the palm-controlled oligonucleotides provided are more than 50% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 55% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 60% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 65% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 70% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 75% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 80% pure. In some embodiments, the palm-controlled oligonucleotides provided are more than about 85% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 90% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 91% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 92% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 93% pure. In some embodiments, the palm-controlled oligonucleotides provided are more than about 94% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 95% pure. In some embodiments, the palm-controlled oligonucleotides provided are more than about 96% pure. In some embodiments, the palm-controlled oligonucleotides provided are more than about 97% pure. In some embodiments, the provided palm-controlled oligonucleotide is more than about 98% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 99% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 99.5% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 99.6% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 99.7% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 99.8% pure. In some embodiments, the palm-controlled oligonucleotide provided is more than about 99.9% pure. In some embodiments, the provided palm-controlled oligonucleotide is more than at least about 99% pure.

In some embodiments, the palm-controlled oligonucleotide composition is a composition designed to comprise a single oligonucleotide type. In certain embodiments, the compositions are about 50% diastereomerically pure. In some embodiments, the compositions are about 50% diastereomerically pure. In some embodiments, the compositions are about 50% diastereomerically pure. In some embodiments, the compositions are about 55% diastereomerically pure. In some embodiments, the compositions are about 60% diastereomerically pure. In some embodiments, the compositions are about 65% diastereomerically pure. In some embodiments, the compositions are about 70% diastereomerically pure. In some embodiments, the compositions are about 75% diastereomerically pure. In some embodiments, the compositions are about 80% diastereomerically pure. In some embodiments, the compositions are about 85% diastereomerically pure. In some embodiments, the compositions are about 90% diastereomerically pure. In some embodiments, the compositions are about 91% diastereomerically pure. In some embodiments, the compositions are about 92% diastereomerically pure. In some embodiments, the compositions are about 93% diastereomerically pure. In some embodiments, the compositions are about 94% diastereomerically pure. In some embodiments, the compositions are about 95% diastereomerically pure. In some embodiments, the compositions are about 96% diastereomerically pure. In some embodiments, the compositions are about 97% diastereomerically pure. In some embodiments, the compositions are about 98% diastereomerically pure. In some embodiments, the compositions are about 99% diastereomeric Isomerism is pure. In some embodiments, the compositions are about 99.5% diastereomerically pure. In some embodiments, the compositions are about 99.6% diastereomerically pure. In some embodiments, the compositions are about 99.7% diastereomerically pure. In some embodiments, the compositions are about 99.8% diastereomerically pure. In some embodiments, the compositions are about 99.9% diastereomerically pure. In some embodiments, the compositions are at least about 99% diastereomerically pure.

In particular, the present invention recognizes the challenges of stereoselective (rather than stereotactic or racemic) preparation of oligonucleotides. In particular, the invention provides for the stereoselective preparation of oligonucleotides comprising a plurality (eg, more than 5, 6, 7, 8, 9 or 10) of internucleotide linkages, and in particular comprising a plurality (eg, Methods and reagents for more than 5, 6, 7, 8, 9, or 10) oligonucleotides linked to palmitic nucleotides. In some embodiments, the diastereoselective formation of the oligonucleotide is less than 90:10, 95:5, 96:4, 97:3, or 98:2 when stereospecifically or racemicly prepared. At least one pair of palmitic internucleotide linkages. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, diastereoselective selection of greater than 90:10, 95:5, 96:4, 97:3, or 98:2 Sexual formation of each pair of palmitic internucleotide linkages. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with diastereoselectivity greater than 95:5. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with a diastereoselectiveness greater than 96:4. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with a diastereoselectiveness greater than 97:3. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with diastereoselectivity greater than 98:2. In some embodiments, for stereoselective or palm-controlled preparation of oligonucleotides, each pair of palmitic internucleotide linkages is formed with a diastereoselectiveness greater than 99:1. In some embodiments, the diastereoselective selectivity of the internucleotide linkages in the oligonucleotide can be measured via model reaction, for example, in substantially identical or similar strips. Dimers are formed under the dimer, wherein the dimer has the same internucleotide linkage as the palmitic internucleotide linkage, and the dimer 5'-nucleoside is linked to the palmitic nucleotide The nucleoside at the 5' end is the same, and the 3'-nucleoside of the dimer is identical to the nucleoside linked to the 3' end of the palmitic internucleotide.

In some embodiments, the palm-controlled oligonucleotide composition is a composition designed to comprise a plurality of oligonucleotide types. In some embodiments, the methods of the invention allow for the generation of a library of palm-controlled oligonucleotides such that any one or more of the pre-selected amounts can be associated with any one or more other pairs of palm-controlled oligonucleotide types. The palm-controlled oligonucleotide types are mixed to produce a palm-controlled oligonucleotide composition. In some embodiments, the preselected amount of oligonucleotide type is a composition having any of the above diastereomeric purity.

In some embodiments, the invention provides methods for making a palm-controlled oligonucleotide comprising the steps of: (1) coupling; (2) capping; (3) modification; (4) removal Blocking the substrate; and (5) repeating steps (1) through (4) until the desired length is achieved.

In describing the methods provided, the term "loop" has its ordinary meaning as understood by one of ordinary skill. In some embodiments, one of steps (1) through (4) is referred to as a cycle.

In some embodiments, the invention provides a method for making a palm-controlled oligonucleotide composition comprising the steps of: (a) providing a first amount of a first pair of palm controlled oligonucleotides; (b) Providing a quantity or one of a plurality of other palm-controlled oligonucleotides as appropriate.

In some embodiments, the first pair of palm controlled oligonucleotides are of the oligonucleotide type as described herein. In some embodiments, the one or more other pair of palm controlled oligonucleotides are one or more of the oligonucleotide types as described herein.

Those skilled in the relevant chemical and synthetic arts will recognize that when using the method of the present invention The structural differences of the provided oligonucleotides and the versatility and degree of control of the stereochemical configuration during synthesis. For example, after completion of the first cycle, the latter cycle can be performed using nucleotide units that are individually selected for the next cycle, in some embodiments, comprising a different base than the first cycle nucleobase and/or A nucleobase and/or a sugar of a sugar. Similarly, the pair of palmitic aids used in the coupling step of the latter cycle may be different from the palmitic aids used in the first cycle such that the second cycle produces phosphorous linkages of different stereochemical configurations. In some embodiments, the stereochemistry of the linked phosphorus in the newly formed internucleotide linkage is controlled by the use of stereochemically pure amino phosphate. Alternatively, the modifying reagent used in the modification step of the latter cycle may be different from the modifying reagent used in the first or previous cycle. The cumulative effect of this iterative assembly method allows for the structural and configurational height adjustment of the components of the provided oligonucleotide. Another advantage of this method is that the capping step minimizes the formation of "n-1" impurities which would otherwise make the separation of the provided oligonucleotides extremely challenging, especially in longer lengths. Oligonucleotides.

In some embodiments, an exemplary cycle for making a method for a palm-controlled oligonucleotide is shown in the exemplary flow described in the present invention. In some embodiments, an exemplary cycle for making a method for a palm controlled oligonucleotide is shown in Scheme 1. In some embodiments, Represents a solid support and, as appropriate, a portion of the growth-to-palm control oligonucleotide attached to the solid support. The illustrated palmitic adjuvant has the structure of formula 3-I: It is further described below. A "cap" is any chemical moiety introduced into a nitrogen atom by a capping step, and in some embodiments, an amine protecting group. One of ordinary skill in the art will appreciate that in the first cycle, there may be only one nucleoside attached to the solid support at the beginning, and it may be desirable to perform a cyclical exit prior to removal of the barrier. As is known to those skilled in the art, B ^PRO is a protected base used in oligonucleotide synthesis. The various steps of the cycle depicted above in Scheme I are further described below.

Synthesis on a solid support

In some embodiments, the synthesis of the provided oligonucleotides is performed on a solid phase. In some embodiments, the reactive groups present on the solid support are protected. In some embodiments, the reactive groups present on the solid support are unprotected. During oligonucleotide synthesis, the solid support is treated with various reagents over several synthetic cycles to achieve a stepwise extension of the growing oligonucleotide chain with individual nucleotide units. As used herein, a nucleoside unit that is directly linked to a solid support at the end of the chain is referred to as a "first nucleoside." The first nucleoside is bound to the solid support via a linking moiety, which is also a divalent group, having a covalent bond between the CPG, polymer or other solid support and the nucleoside. The linking group remains intact during the synthetic cycle performed to assemble the oligonucleotide strand and is cleaved after strand assembly, releasing the oligonucleotide from the vector.

Solid carriers for solid phase nucleic acid synthesis include those described in, for example, U.S. Patent Nos. 4,659,774, 5,141,813, 4,458,066, U.S. Patent Nos. 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679. No. 5,132,418; U.S. Patent Nos. 5,047,524, 5,262,530 to Andus et al.; and U.S. Patent No. 4,725,677 to Koster (issued to RE. In some embodiments, the solid phase is an organic polymeric carrier. In some embodiments, the solid phase is an inorganic polymeric carrier. In some embodiments, the organic polymer carrier is polystyrene, amine methyl polystyrene, polyethylene glycol-polystyrene graft copolymer, polypropylene decylamine, polymethacrylate, polyvinyl alcohol, Highly crosslinked polymers (HCP) or other synthetic polymers, carbohydrates (such as cellulose and starch) or other polymeric carbohydrates, or other organic polymers and any copolymers, composites or combinations of the above inorganic or organic materials. In some embodiments, the inorganic polymeric carrier is ceria, alumina, controlled polyglass (CPG, which is a silicone carrier), or amine propyl CPG. Other suitable solid carriers include fluorosolid carriers (see for example WO/2005/070859), long chain alkylamine (LCAA) controlled microporous glass (CPG) solid supports (see for example SPAdams, KSKavka, EJ Wykes, SB Holder and GRGalluppi). , J Am. Chem. Soc. , 1983 , 105 , 661-663; GRGough, MJ Bruden and PTGilham, Tetrahedron Lett. , 1981 , 22 , 4177-4180). Membrane supports and polymer membranes (see, for example, Innovation and Perspectives in Solid Phase Synthesis, Peptides, Proteins and Nucleic Acids, Chapter 21, pages 157-162, 1994, Roger Epton, ed., and U.S. Patent No. 4, 923, 901) are also suitable for the synthesis of nucleic acids. . After formation, the membrane can be chemically functionalized for nucleic acid synthesis. In addition to attaching a functional group to the membrane, in some embodiments, a linking group or spacer group attached to the membrane is also used to minimize steric hindrance between the membrane and the synthetic chain.

Other suitable solid carriers include those solid carriers known in the art to be suitable for use in solid phase processes, including, for example, PrimerTM 200 support, controlled microporous glass (CPG), grass-based controlled micropores. Glass for sale in glass (see, for example, Alul et al, Nucleic Acids Research , 1991 , 19 , 1527), amine-based polyethylene glycol derivatization carrier TentaGel vector (see, for example, Wright et al, Tetrahedron Lett. , 1993 , 34 , 3373) And Poros-a copolymer of polystyrene/divinylbenzene.

Surface activated polymers have proven useful in the synthesis of natural and modified nucleic acids and proteins on a number of solid support media. The solid support material can be any polymer that is suitably uniform in porosity, has sufficient amine content, and is sufficiently flexible to withstand any incidental manipulation without loss of integrity. Examples of suitable materials selected include nylon, polypropylene, polyester, polytetrafluoroethylene, polystyrene, polycarbonate, and nitrocellulose. Other materials may serve as solid carriers depending on the designer's design. In view of some designs, for example, a cladding metal, particularly gold or platinum, may be selected (see, for example, U.S. Publication No. 20010055761). In one embodiment of oligonucleotide synthesis, for example, a nucleoside is anchored to a solid support functionalized with a hydroxyl or amine residue. Alternatively, the solid support is derivatized to provide an acid labile trialkoxytrityl group such as trimethoxytrityl (TMT). Without being bound by theory, it is expected that the presence of a trialkoxytrityl protecting group will allow initial detritylation to occur under conditions commonly used on DNA synthesizers. For faster release of the oligonucleotide material in a solution containing ammonia, a glycolate linkage is optionally introduced onto the support.

In some embodiments, the provided oligonucleotides are alternatively synthesized from the 5' to 3' direction. In some embodiments, the nucleic acid is linked to the solid support via the 5' end of the growth nucleic acid, thereby presenting its 3' group for reaction, ie, using 5'-nucleoside amino phosphate or in an enzymatic reaction (eg, , using nucleoside 5'-triphosphate linkage and polymerization). When considering 5' to 3' synthesis, the iterative steps of the present invention remain unchanged (i.e., with respect to capping and modification of palmitic phosphorus).

Bonding part

The solid support is attached to the compound comprising the free nucleophilic moiety using a linking moiety or a linking group, as appropriate. Suitable linking groups are known, such as short molecules used to attach a solid support to a functional group (eg, a hydroxyl group) of an initial nucleoside molecule in a solid phase synthesis technique. In some embodiments, the linking moiety is a butyric acid linking group or a succinate linking group (-CO-CH ₂ -CH ₂ -CO-) or a sulfhydryl linking group (-CO-) CO-). In some embodiments, the linkage moiety and the nucleoside are bonded together via an ester linkage. In some embodiments, the linking moiety and the nucleoside are bonded together via a guanamine bond. In some embodiments, the linking moiety links the nucleoside to another nucleotide or nucleic acid. Suitable linking groups are disclosed, for example, in Oligonucleotides And Analogues A Practical Approach , Ekstein, F. Ed., IRL Press, NY, 1991 , Chapter 1; and Solid-Phase Supports for Oligonucleotide Synthesis, Pon, RT , Curr. Prot. Nucleic Acid Chem. , 2000 , 3.1.1-3.1.28.

A compound comprising a free nucleophilic moiety is linked to another nucleoside, nucleotide or nucleic acid using a linking moiety moiety. In some embodiments, the linkage moiety is a phosphodiester linkage. In some embodiments, the linkage moiety is an H -phosphonate moiety. In some embodiments, the linkage moiety is a modified phosphorous linkage as described herein. In some embodiments, the oligonucleotide is ligated to a solid support using a universal linker (UnyLinker) (Ravikumar et al, Org . Process Res Dev , 2008 , 12 (3), 399-410). In some embodiments, other universal linking groups (Pon, RT , Curr. Prot Nucleic Acid Chem. , 2000 , 3.3.1 - 1.28) are used. In some embodiments, various orthogonal linking groups (such as disulfide linking groups) are used (Pon, RT , Curr. Prot. Nucleic Acid Chem. , 2000 , 3.1.1-3.1.28).

In particular, the present invention recognizes that a linking group that is compatible with a set of reaction conditions employed in oligonucleotide synthesis can be selected or designed. In some embodiments, to avoid oligonucleotide degradation and to avoid desulfurization, the auxiliary group is selectively removed prior to removal of the protecting group. In some embodiments, the DPSE group can be selectively removed by F ^- ion. In some embodiments, the invention provides a linking group that is stable under conditions of DPSE deprotection, such as 0.1 M TBAF in MeCN, 0.5 M HF-Et ₃ N in THF or MeCN. In some embodiments, the linking group provided is an SP linking group. In some embodiments, the invention demonstrates that the SP linking group is stable under conditions of DPSE deprotection, such as 0.1 M TBAF in MeCN, 0.5 M HF-Et ₃ N in THF or MeCN; It is also stable under anhydrous basic conditions such as om1M DBU in MeCN.

In some embodiments, exemplary linking groups are:

In some embodiments, the butadienyl linking group, the Q linking group, or the oxalyl linking group is unstable under conditions in which F ^- one or more DPSE deprotecting groups are used.

General conditions - solvent for synthesis

The synthesis of the provided oligonucleotides is generally carried out in an aprotic organic solvent. In some embodiments, the solvent is a nitrile solvent, such as acetonitrile. In some embodiments, the solvent is a basic amine solvent such as pyridine. In some embodiments, the solvent is an ether solvent such as tetrahydrofuran. In some embodiments, the solvent is a halogenated hydrocarbon such as dichloromethane. In some embodiments, a solvent mixture is used. In certain embodiments, the solvent is a mixture of any one or more of the foregoing various types of solvents.

In some embodiments, when the aprotic organic solvent is not basic, a base is present in the reaction step. In some embodiments in which a base is present, the base is an amine base such as pyridine, quinoline or N,N -dimethylaniline. Examples of other amine bases include pyrrolidine, piperidine, N -methylpyrrolidine, pyridine, quinoline, N,N -dimethylaminopyridine (DMAP) or N,N -dimethylaniline.

In some embodiments, the base is not an amine base.

In some embodiments, the aprotic organic solvent is anhydrous. In some embodiments, the anhydrous aprotic organic solvent is freshly distilled. In some embodiments, the freshly distilled anhydrous aprotic organic solvent is a basic amine solvent such as pyridine. In some embodiments, the freshly distilled anhydrous aprotic organic solvent is an ether solvent such as tetrahydrofuran. In some embodiments, the freshly distilled anhydrous aprotic organic solvent is a nitrile solvent, such as acetonitrile.

For palm reagents / for palm auxiliaries

In some embodiments, stereoselectivity is imparted to the palmitic agent when making a palm-controlled oligonucleotide. In accordance with the methods of the present invention, a variety of different antagonistic agents can be used by those skilled in the art and herein also referred to as palmitic adjuvants. Examples of such palmitic agents are described herein and in Wada I, II and III mentioned above. In certain embodiments, the palmitic agent is as described by Wada I. In some embodiments, the palmitic agent used in accordance with the methods of the invention has the formula 3-I : Wherein W ¹ and W ² are any one of -O-, -S- or -NG ⁵ -, U ₁ and U ₃ are bonded to U ₂ via a single bond, double bond or a bond, if present or Carbon atoms bonded to each other (if r is 0). U ₂ is -C-, -CG ⁸ -, -CG ⁸ G ⁸ -, -NG ⁸ -, -N-, -O- or -S-, wherein r is an integer from 0 to 5 and no more than two impurities The atoms are adjacent. When either of U ₂ is C, a reference must be formed between the second instance of U ₂ (which is C) or with one of U ₁ or U ₃ . Similarly, when either of U ₂ is CG ⁸ , a double is formed between the second instance of U ₂ (which is -CG ⁸ - or -N-) or with one of U ₁ or U ₃ key.

In some embodiments, -U ₁ (G ₃ G ₄ )-(U ₂ ) _r -U ₃ (G ₁ G ₂ )- is -CG ³ G ⁴ -CG ¹ G ² -. In some embodiments, -U ₁ -(U ₂ ) _r -U ₃ - is -CG ³ =CG ¹ -. In some embodiments, -U ₁ -(U ₂ ) _r -U ₃ - is -C≡C-. In some embodiments, -U ₁ -(U ₂ ) _r -U ₃ - is -CG ³ =CG ⁸ - CG ¹ G ² -. In some embodiments, -U ₁ -(U ₂ ) _r -U ₃ - is -CG ³ G ⁴ -O-CG ¹ G ² -. In some embodiments, -U ₁ -(U ₂ ) _r -U ₃ - is -CG ³ G ⁴ -NG ⁸ -CG ¹ G ² -. In some embodiments, -U ₁ -(U ₂ ) _r -U ₃ - is -CG ³ G ⁴ -N-CG ² -. In some embodiments, -U ₁ -(U ₂ ) _r -U ₃ - is -GG ³ G ⁴ -N=CG ⁸ -GG ¹ G ² -.

As defined herein, G ¹ , G ² , G ³ , G ⁴ , G ⁵ and G ^{8 are} independently hydrogen or are selected from alkyl, aralkyl, cycloalkyl, cycloalkylalkyl, heterocyclyl, a heteroaryl- and aryl-substituted group; or two of G ¹ , G ² , G ³ , G ⁴ and G ⁵ are G ⁶ (which together form up to about 20 ring atoms) Substituted saturated, partially unsaturated or unsaturated carbocyclic or heteroatom containing ring which is monocyclic or polycyclic and fused or unfused). In some embodiments, the ring thus formed is substituted with a pendant oxy, thioketo, alkyl, alkenyl, alkynyl, heteroaryl or aryl moiety. In some embodiments, when the ring formed by the two G ⁶ together is substituted, it is substituted by a bulky moiety sufficient to impart stereoselectivity during the reaction.

In some embodiments, the ring formed by the two G ⁶ together is optionally substituted cyclopentyl, pyrrolyl, cyclopropyl, cyclohexenyl, cyclopentenyl, tetrahydropyranyl or piperidine. Azinyl. In some embodiments, the ring formed by the two G ⁶ together is optionally substituted cyclopentyl, pyrrolyl, cyclopropyl, cyclohexenyl, cyclopentenyl, tetrahydropyranyl, pyrrole. Pyridyl or piperazinyl.

In some embodiments, G ¹ is optionally substituted phenyl. In some embodiments, G ¹ is phenyl. In some embodiments, G ² is methyl or hydrogen. In some embodiments, G ¹ is optionally substituted phenyl and G ² is methyl. In some embodiments, G ¹ is phenyl and G ² is methyl.

In some embodiments, r is zero.

In some embodiments, W ¹ is -NG ⁵ -. In some embodiments, one of G ³ and G ⁴ together with G ⁵ forms an optionally substituted pyrrolidinyl ring. In some embodiments, one of G ³ and G ⁴ together with G ⁵ forms a pyrrolidinyl ring.

In some embodiments, W ² is -O-.

In some embodiments, the palmitic reagent is a compound of formula 3-AA:

Wherein the variables are independently as defined above and described herein.

In some embodiments of Formula 3AA, W ¹ and W ^{2 are} independently -NG ⁵ -, -O-, or -S-; G ¹ , G ² , G ³ , G ^{4 ,} and G ^{5 are} independently hydrogen, or Optionally substituted group selected from alkyl, aralkyl, cycloalkyl, cycloalkylalkyl, heterocyclyl, heteroaryl or aryl; or G ¹ , G ² , G ³ , G ⁴ And both of G ⁵ are G ⁶ (supplementally substituted, up to about 20 ring atoms, optionally substituted saturated, partially unsaturated or unsaturated carbocyclic or hetero atom containing ring, which is monocyclic or polycyclic, thick Not or not fused, and no more than four of G ¹ , G ² , G ³ , G ⁴ and G ⁵ are G ⁶ . Similar to the compound of formula 3-I, any of G ¹ , G ² , G ³ , G ⁴ or G ⁵ may optionally be pendant oxy, thioketo, alkyl, alkenyl, alkynyl, heteroaryl Substituted by a aryl or aryl moiety. In some embodiments, such substitutions induce stereoselectivity when making a palm-controlled oligonucleotide.

In some embodiments, the provided palmar agent has The structure. In some embodiments, the provided palmar agent has The structure. In some embodiments, the provided palmar agent has The structure. In some embodiments, the provided palmar agent has The structure. In some embodiments, the provided palmar agent has The structure. In some embodiments, the provided palmar agent has The structure. In some embodiments, the provided palmar agent has The structure. In some embodiments, the provided palmar agent has The structure.

In some embodiments, W ¹ is -NG ⁵ , W ² is O, and G ¹ and G ³ are each independently hydrogen or selected from C _1-10 aliphatic, heterocyclic, heteroaryl, and aryl. Optionally substituted G ² is —C(R) ₂ Si(R) ₃ , and G ⁴ and G ⁵ together form up to about 20 ring atoms, optionally substituted, partially unsaturated or not A saturated hetero atom-containing ring which is monocyclic or polycyclic, fused or unfused. In some embodiments, each R is independently selected from hydrogen or C ₁ -C ₆ aliphatic group view, carbocyclyl, aryl, heteroaryl and heterocyclyl where the group of the substituted group. In some embodiments, G ² is —C(R) ₂ Si(R) ₃ , wherein —C(R) ₂ — is optionally substituted —CH ₂ —, and each R of —Si(R) ₃ Independently, a group selected from the group consisting of a C _1-10 aliphatic group, a heterocyclic group, a heteroaryl group, and an aryl group. In some embodiments, at least one R of -Si(R) ₃ is independently a optionally substituted C _1-10 alkyl group. In some embodiments, at least one R of -Si(R) ₃ is independently phenyl optionally substituted. In some embodiments, one R of -Si(R) ₃ is independently phenyl optionally substituted, and the other two R are each independently optionally substituted C _1-10 alkyl. In some embodiments, one R of -Si(R) ₃ is independently a optionally substituted C _1-10 alkyl group, and the other two R are each independently an optionally substituted phenyl group. In some embodiments, G ² is optionally substituted -CH ₂ Si(Ph)(Me) ₂ . In some embodiments, G ² is optionally substituted -CH ₂ Si(Me)(Ph) ₂ . In some embodiments, G ² is —CH ₂ Si(Me)(Ph) ₂ . In some embodiments, G ⁴ and G ⁵ together form an optionally substituted saturated 5-6 membered ring containing a nitrogen atom attached to G ⁵ . In some embodiments, G ⁴ and G ⁵ together form an optionally substituted saturated 5-membered ring containing a nitrogen atom. In some embodiments, G ¹ is hydrogen. In some embodiments, G ³ is hydrogen. In some embodiments, both G ¹ and G ³ are hydrogen.

In some embodiments, the palmitic agent has one of the following formulas:

In some embodiments, the palmitic agent is an amino alcohol. In some embodiments, the palmitic agent is an amino thiol. In some embodiments, the palmitic agent is an aminophenol. In some embodiments, the palmitic reagent is ( S )- and ( R )-2-methylamino-1-phenylethanol, (1 R , 2 S )-ephedrine or (1 R , 2 S ) 2-Methylamino-1,2-diphenylethanol.

In some embodiments of the invention, the palmitic reagent is a compound of the formula:

As illustrated herein, when used to prepare a palmitic internucleotide linkage, stereochemically pure palmitic reagents are typically employed to achieve stereoselectivity. In particular, the present invention provides stereochemically pure palmitic agents, including those having the structure.

The choice of a palmitic reagent (e.g., the isomer represented by Formula Q or its stereoisomer R) allows for specific control of the palmity of the linked phosphorus. Thus, the R p or Sp configuration can be selected in each synthesis cycle to control the overall three-dimensional structure of the palm-controlled oligonucleotide. In some embodiments, a chiral oligonucleotides are controlled with R p stereogenic center. In some embodiments of the invention, the palm-controlled oligonucleotides all have a Sp stereocenter. In some embodiments of the present invention, it is independently or S p R p each chiral phosphorous linkages in the oligonucleotide controlled. In some embodiments of the present invention, the respective chiral phosphorous linkages in the oligonucleotide controlled independently R p or S p, and R p is at least one and at least one of which is S p. In some embodiments, the selected R p and S p nucleotide center to impart specific three-dimensional configuration of an upper chiral controlled oligonucleotides. Examples of such selections are described in further detail herein.

In some embodiments, the palmitic reagents used in accordance with the present invention are selected for their ability to be removed at a particular step in the cycle depicted above. For example, in some embodiments, it is desirable to remove the palm test during the modification step of the bond phosphorus. Agent. In some embodiments, it is desirable to remove the palmitic agent prior to the modification step of the linked phosphorus. In some embodiments, it is desirable to remove the palmitic agent after the modification step of the linked phosphorus. In some embodiments, it is desirable to remove the palmar agent after the first coupling step occurs but before the second coupling step occurs such that during the second coupling (and other subsequent coupling steps are the same), the palmar agent is not Present on growing oligonucleotides. In some embodiments, the palmitic agent is removed during the "removal of the barrier" reaction, which occurs after the bonding phosphorus modification, but before the start of the subsequent cycle. Exemplary removal methods and reagents are described herein.

In some embodiments, removal of the palmity aid is achieved upon performing the modification and/or removal of the barrier step, as shown in Scheme I. It may be advantageous to combine the removal of the palmitic auxiliary with other transformations such as modification and removal of the barrier. One of ordinary skill will appreciate that the saved steps/conversions can increase overall synthesis efficiency, such as in terms of yield and product purity, especially for longer oligonucleotides. An example of the removal of a palmitic aid during modification and/or removal of a barrier is illustrated in Scheme I.

In some embodiments, the palmitic agent used in accordance with the methods of the invention is characterized in that it can be removed under certain conditions. For example, in some embodiments, the palmitic reagent is selected for its ability to be removed under acidic conditions. In certain embodiments, the palmitic agent is selected for its ability to be removed under weakly acidic conditions. In certain embodiments, the palmitic agent is removed for its aid by means of an E1 elimination reaction (eg, because a cationic intermediate is formed on the palmitic reagent under acidic conditions, resulting in a palmitic reagent from the oligonucleoside) The ability to remove by acid cleavage) is chosen. In some embodiments, the palmitic agent is characterized by having a structure that is recognized to be able to adapt or contribute to the E1 elimination reaction. Those skilled in the relevant art will appreciate which structures are envisioned to facilitate such elimination reactions.

In some embodiments, the palmitic agent is selected for its ability to be removed with a nucleophile. In some embodiments, the palmitic reagent is directed against an amine nucleophile In addition to the ability to choose. In some embodiments, the palmitic reagent is selected for its ability to be removed with a nucleophile other than an amine.

In some embodiments, the palmitic agent is selected for its ability to be removed with a base. In some embodiments, the palmitic reagent is selected for its ability to be removed with an amine. In some embodiments, the palmitic agent is selected for its ability to be removed with a base other than an amine.

Other palmitic adjuvants and their uses can be found, for example, in Wada I (JP 4348077; WO2005/014609; WO2005/092909), Wada II (WO2010/064146), Wada III (WO2012/039448), and palm control (WO2010/ 064146) and so on.

activation

The non-preferential H -phosphonate moiety is treated with a first activating reagent to form a first intermediate. In one embodiment, a first activating reagent is added to the reaction mixture during the condensation step. The use of the first activating reagent depends on the reaction conditions, such as the solvent used in the reaction. Examples of the first activating reagent are phosgene, trichloromethyl chloroformate, bis(trichloromethyl)carbonate (BTC), ethylene dichloride, Ph ₃ PCl ₂ , (PhO) ₃ PCl ₂ , N , N ' -Bis(2-oxo-3-oxazolidinyl)phosphinium chloride (BopCl), 1,3-dimethyl-2-hexafluorophosphate (3-nitro-1,2,4- Triazol-1-yl)-2-pyrrolidin-1-yl-1,3,2-diazepine (MNTP) or 3-nitro-1,2,4-triazole-1-hexafluorophosphate Base-gin (pyrrolidin-1-yl)indole (PyNTP).

Examples of non-pivoted H -phosphonate moieties are the compounds shown in the above scheme. DBU represents 1,8-diazabicyclo[5.4.0]undec-7-ene. H ⁺ DBU can be, for example, an ammonium ion, an alkylammonium ion, a heteroaromatic iminium ion or a heterocyclic iminium ion, either of which is a primary, secondary, tertiary or quaternary ammonium ion; or a monovalent metal ion.

React with palmar reagent

After the first activation step, the activated non-preferable H -phosphonate moiety reacts with the palmitic reagent, and the palmitic reagent is represented by the formula (ZI) or (Z-I') to form the formula (Z- A palmitic intermediate of Va), (Z-Vb), (Z-Va') or (Z-Vb').

Stereospecific condensation step

The palmitic intermediate of formula Z-Va ((Z-Vb), (Z-Va') or (Z-Vb')) is treated with a second activating reagent and a nucleoside to form a condensation intermediate. The nucleoside can be on a solid support. Examples of the second activating reagent are 4,5-dicyanoimidazole (DCI), 4,5-dichloroimidazole, 1-phenylimidazolium trifluoromethanesulfonate (PhIMT), benzimidazole triflate BIT (BIT), benzotriazole, 3-nitro-1,2,4-triazole (NT), tetrazole, 5-ethylthiotetrazole (ETT), 5-phenylthiotetrazole (BTT) , 5-(4-nitrophenyl)tetrazole, N -cyanomethylpyrrolidinium trifluoromethanesulfonate (CMPT), N -cyanomethylpiperidinium trifluoromethanesulfonate, trifluoro N -cyanomethyldimethylammonium methanesulfonate. The palmitic intermediate of formula Z-Va ((Z-Vb), (Z-Va') or (Z-Vb')) can be isolated as a monomer. Typically, the Z-Va ((Z-Vb), (Z-Va') or (Z-Vb')) palmitic intermediates are not isolated and react with nucleosides or modified nucleosides in the same pot. A condensation intermediate to a palmitic phosphite compound is obtained. In other embodiments, when the method is performed via solid phase synthesis, the solid support comprising the compound is filtered from by-products, impurities, and/or reagents.

End capping step

If the final nucleic acid is larger than the dimer, the unreacted -OH moiety is blocked with a blocking group and the palmitic adjuvant in the compound can also be blocked with a blocking group to form a blocked condensation intermediate. If the final nucleic acid is a dimer, the capping step is unnecessary.

Modification step

The compound is modified by reaction with an electrophile. A modification step can be performed on the blocked condensation intermediate. In some embodiments, the modifying step is performed using a sulfur electrophile, a selenium electrophile, or a borating agent. Examples of the modification step are oxidation and vulcanization steps.

In some embodiments of the method, the sulfur electrophile is a compound having one of the formula: S ₈ (Formula ZB), Z ^z1 -SSZ ^z2 or Z ^z1 -SV ^z -Z ^z2 ; wherein Z ^z1 and Z ^{z2 is} independently alkyl, aminoalkyl, cycloalkyl, heterocyclic, cycloalkylalkyl, heterocycloalkyl, aryl, heteroaryl, alkoxy, aryloxy, heteroaryloxy , fluorenyl, decylamine, quinone or thiocarbonyl, or Z ^z1 and Z ^z2 together form a 3 to 8 membered alicyclic or heterocyclic ring which may be substituted or unsubstituted; V ^z is SO ₂ , O or NR ^f ; and R ^f is hydrogen, alkyl, alkenyl, alkynyl or aryl.

In some embodiments of the method, the sulfur electrophile is a compound of the formula ZA, ZB, ZC, ZD, ZE or ZF:

In some embodiments, the sulfurizing reagent is 3-phenyl-1,2,4-dithiazolin-5-one.

In some embodiments, the selenium electrophile is a compound having one of the following formulas: Se (formula ZG), Z ^z3 -Se-Se-Z ^z4 or Z ^z3 -Se-V ^z -Z ^z4 ; and Z ^{z4 z3} independently alkyl, aminoalkyl, cycloalkyl, heterocycloalkyl, cycloalkylalkyl, heterocycloalkyl, aryl, heteroaryl, alkoxy, aryloxy, heteroaryl Oxyl, decyl, decylamine, quinone or thiocarbonyl, or Z ^z3 and Z ^z4 together form a 3 to 8 membered alicyclic or heterocyclic ring which may be substituted or unsubstituted; V ^z is SO ₂ , S , O or NR ^f ; and R ^f is hydrogen, alkyl, alkenyl, alkynyl or aryl.

In some embodiments, the selenium electrophile is a compound of formula Z-G, Z-H, Z-I, Z-J, Z-K, or Z-L.

In some embodiments, the boronating agent is borane- N,N -diisopropylethylamine (BH ₃ DIPEA), borane-pyridine (BH ₃ Py), borane-2-chloropyridine (BH ₃ CPy) ), borane-aniline (BH ₃ An), borane-tetrahydrofuran (BH ₃ THF) or borane-dimethyl sulfide (BH ₃ Me ₂ S).

In some embodiments, after the modifying step, the pendant promoter group leaves the growing oligonucleotide strand. In some embodiments, the pendant builder group remains attached to the internucleotide phosphorus atom after the modification step.

In some embodiments of the method, the modifying step is an oxidizing step. In some embodiments of the method, the modifying step is an oxidation step using similar conditions as described above in this application. In some embodiments, the oxidation step is as disclosed in, for example, JP 2010-265304 A and WO 2010/064146.

Chain extension cycle and removal of protecting groups

The blocking condensation intermediate is removed from the blocking group to remove the blocking group at the 5' end of the growing nucleic acid strand to obtain a compound. The compound is then reintroduced into the chain extension cycle to form a condensation intermediate, a blocked condensation intermediate, a modified blocked condensation intermediate, and a modified capping intermediate of the 5' deprotection group. 5' after at least one round of chain extension cycle by removing the palmitic adjuvant ligand and other protecting groups (eg, nucleobases, modified nucleobases, sugars, and modified sugar protecting groups) The modified capping intermediate of the protecting group is removed to further remove the blocking group to obtain a nucleic acid. In other embodiments, the nucleoside comprising the 5'-OH moiety is an intermediate from the aforementioned chain extension cycle as described herein. In other embodiments, the nucleoside comprising the 5'-OH moiety is an intermediate obtained from another known nucleic acid synthesis method. In embodiments in which a solid support is used, the modified nucleic acid of the phosphorus atom is subsequently cleaved from the solid support. In certain embodiments, the nucleic acid remains attached to the solid support for purification purposes and is subsequently cleaved from the solid support after purification.

In other embodiments, the nucleoside comprising the 5'-OH moiety is an intermediate obtained from another known nucleic acid synthesis method. In other embodiments, the nucleoside comprising the 5'-OH moiety is an intermediate obtained from another known nucleic acid synthesis method as described in this application. In other embodiments, the nucleoside comprising the 5'-OH moiety is an intermediate obtained from another known nucleic acid synthesis process, the process comprising one or more cycles as shown in Scheme I. In other embodiments, the nucleoside comprising the 5'-OH moiety is an intermediate obtained from another known method of nucleic acid synthesis, the method comprising one or more cycles as shown in Schemes I-b, I-c or I-d.

In some embodiments, the invention provides oligonucleotide synthesis methods using stable and commercially available materials as starting materials. In some embodiments, the invention provides An oligonucleotide synthesis method using a non-pivotic starting material to produce a stereocontrolled, phosphorus atom modified oligonucleotide derivative.

In some embodiments, the methods of the invention do not cause degradation under the step of removing the protecting group. In addition, the method does not require a specific blocking agent to produce a phosphorus atom modified oligonucleotide derivative.

Condensation reagent

The condensation reagent (C _R ) to which the method according to the invention is applicable has any of the following formulae:

Wherein Z ¹ , Z ² , Z ³ , Z ⁴ , Z ⁵ , Z ⁶ , Z ⁷ , Z ⁸ and Z ^{9 are} independently selected from the group consisting of alkyl, aminoalkyl, cycloalkyl, heterocyclic, cycloalkyl Optionally substituted group of alkyl, heterocycloalkyl, aryl, heteroaryl, alkoxy, aryloxy or heteroaryloxy, or wherein Z ² and Z ³ , Z ⁵ and Z ⁶ , Z ⁷ and Z ⁸ , Z ⁸ and Z ⁹ , Z ⁹ and Z ⁷ , or Z ⁷ and any of Z ⁸ and Z ⁹ together form a 3 to 20 membered alicyclic or heterocyclic ring; Q ⁻ is a counter anion And LG is the leaving base.

In some embodiments, the counterion of the condensation reagent C _R is Cl ^- , Br ^- , BF ₄ ^- , PF ₆ ^- , TfO ^- , Tf ₂ N ^- , AsF ₆ ^- , ClO ₄ ^- or SbF ₆ ^- , wherein Tf For CF ₃ SO ₂ . In some embodiments, the leaving group of the condensation reagent C _R is F, Cl, Br, I, 3-nitro-1,2,4-triazole, imidazole, alkyltriazole, tetrazole, pentafluorobenzene Or 1-hydroxybenzotriazole.

Examples of condensation reagents for use in accordance with the methods of the present invention include, but are not limited to, pentafluorobenzamide chloride, carbonyl diimidazole (CDI), 1-mesitylenesulfonyl-3-nitrotriazole (MSNT), 1-ethyl-3-(3'-dimethylaminopropyl)carbodiimide hydrochloride (EDCI-HCl), benzotriazol-1-yloxy hexafluorophosphate (dimethylamino) )PyBOP, N , N' -bis(2-oxo-3-oxazolidinyl)phosphinium chloride (BopCl), 2-(1 H -7-azabenzotrifluoride) Zin-1-yl)-1,1,3,3-tetra (HATU) and O -benzotriazole hexafluorophosphate - N, N, N', N' - four (HBTU), DIPCDI; N , N' -bis(2-oxo-3-oxazolidinyl)phosphinium bromide (BopBr), 1,3-dimethyl-2-hexafluorophosphate Nitro-1,2,4-triazol-1-yl)-2-pyrrolidin-1-yl-1,3,2-diazepine (MNTP), 3-nitro-1 hexafluorophosphate, 2,4-triazol-1-yl-gin(pyrrolidin-1-yl)indole (PyNTP), prasopyrrolidine hexafluorophosphate (PyBrOP); tetrafluoroboric acid O- (benzotriazole-1- Base) - N, N, N', N' - four (TBTU); and tetramethylfluoroformamidine hexafluorophosphate (TFFH). In certain embodiments, the counterion of the condensation reagent C _R is Cl ^- , Br ^- , BF ₄ ^- , PF ₆ ^- , TfO ^- , Tf ₂ N ^- , AsF ₆ ^- , ClO ₄ ^- or SbF ₆ ^- , wherein Tf is CF ₃ SO ₂ .

In some embodiments, the condensation reagent is 1-(2,4,6-triisopropylbenzenesulfonyl)-5-(pyridin-2-yl)tetrazole, pentylene chloride, bromine hexafluorophosphate Pyrrolidinium, N , N' -bis(2-oxo-3-oxazolidinyl)phosphinium chloride (BopCl) or 2-chloro-5,5-dimethyl-2-oxooxy -1,3,2-dioxaphosphane. In some embodiments, the condensation reagent is N , N' -bis(2-oxo-3-oxazolidinyl)phosphinium chloride (BopCl). In some embodiments, the condensation reagent is selected from the group consisting of the condensation reagents described in WO/2006/066260.

In some embodiments, the condensation reagent is 1,3-dimethyl-2-(3-nitro-1,2,4-triazol-1-yl)-2-pyrrolidin-1-yl hexafluorophosphate -1,3,2-diazepine (MNTP) or 3-nitro-1,2,4-triazol-1-yl-p-(pyrrolidin-1-yl)indole (PyNTP):

Selection of bases and sugars for nucleoside coupling partners

As described herein, the nucleoside coupling partners used in accordance with the methods of the present invention may be identical to each other or may be different from each other. In some embodiments, the nucleoside coupling partners used in the synthesis of the provided oligonucleotides have the same structural and/or stereochemical configuration to each other. In some embodiments, each nucleoside coupling partner suitable for use in synthesizing the provided oligonucleotide does not have the same structural and/or stereochemical configuration as some other nucleoside coupling partners of the oligonucleotide. Exemplary nucleobases and sugars for use in accordance with the methods of the invention are described herein. Those skilled in the relevant chemical and synthetic arts will recognize that the nucleobases and sugars described herein are encompassed. Any combination of these is used in accordance with the method of the invention.

Coupling step

Exemplary coupling procedures and antagonistic reagents and condensation reagents for use in accordance with the present invention are described in particular in Wada I (JP 4348077; WO 2005/014609; WO 2005/092909), Wada II (WO 2010/064146), Wada III (WO 2012/039448) and For palm control (WO2010/064146). The palmitic nucleoside coupling partners used in accordance with the present invention are also referred to herein as "Wada amino acid esters." In some embodiments, the coupling partner has The structure wherein B ^PRO is a protected nucleobase. In some embodiments, the coupling partner has The structure wherein B ^PRO is a protected nucleobase. In some embodiments, the coupling partner has The structure, wherein B ^PRO is a protected nucleobase, and R ^{1 is} as defined and described herein. In some embodiments, the coupling partner has The structure, wherein B ^PRO is a protected nucleobase, and R ^{1 is} as defined and described herein. In some embodiments, R ¹ is the optionally substituted C ₁ - ₆ alkyl. In some embodiments, R ¹ is Me.

An exemplary palmitic amino phosphate as a coupling partner is depicted as follows:

Other examples are described in Palm Control (WO 2010/064146).

One of the methods for synthesizing a coupling partner is depicted in Scheme II below.

Scheme II. Exemplary synthesis of coupled partners.

In some embodiments, the coupling step comprises reacting the free hydroxyl group of the nucleotide unit of the oligonucleotide with the nucleoside coupling partner under conditions suitable for coupling. In some embodiments, the coupling step is prior to the step of removing the barrier group. For example, in some embodiments, blocking (ie, protecting) the 5' hydroxyl group of the growing oligonucleotide and for subsequent reaction with the nucleoside coupling partner, the blocking group must be removed.

After the appropriate hydroxyl group of the growing oligonucleotide has been removed from the blocking group, the carrier is washed and dried, ready for delivery of a solution comprising the palmitic agent and a solution comprising the activator. In some embodiments, the palmitic agent and the activator are delivered simultaneously. In some embodiments, co-delivering a solution containing a quantity of a palmitic agent (eg, an amino phosphate solution) and a quantity of activator is included in a polar aprotic solvent such as a nitrile solvent (eg, acetonitrile). Solution (eg, CMPT solution).

In some embodiments, the coupling step provides a crude product composition in which the palmitic phosphite product is present in a diastereomeric excess of >95%. In some embodiments, the palmitic phosphite product is present in a diastereomeric excess of >96%. In some embodiments, the palmitic phosphite product is present in a diastereomeric excess of >97%. In some embodiments, the palmitic phosphite product is present in a diastereomeric excess of >98%. In some embodiments, the palmitic phosphite product is present in a diastereomeric excess of >99%.

End capping steps:

The method provided for making a palm-controlled oligonucleotide comprises a capping step. In some embodiments, the capping step is a single step. In some embodiments, the capping step is two steps. In some embodiments, the capping step is more than two steps.

In some embodiments, the capping step comprises the step of capping the free amine of the palmility aid and capping any remaining unreacted 5' hydroxyl groups. In some embodiments, the free amine and unreacted 5' hydroxyl group of the palmitic adjuvant are capped with the same capping group. In some embodiments, the free amine and the unreacted 5' hydroxyl group of the palmitic adjuvant are capped with different capping groups. In certain embodiments, capping with a different capping group allows for the selective removal of one capping group during oligonucleotide synthesis, taking precedence over the other. In some embodiments, the capping of the two groups occurs simultaneously. In some embodiments, the capping of the two groups occurs over and over again.

In certain embodiments, the capping occurs repeatedly and comprises the first step of capping the free amine, followed by the second step of capping the free 5' hydroxyl group, wherein both the free amine and the 5' hydroxyl group are blocked with the same end group. The group is blocked. For example, in some embodiments, an anhydride (eg, phenoxyacetic anhydride, ie, Pac ₂ O) is used to cap the free amine of the palmitic adjuvant, followed by capping the 5' hydroxyl group with the same anhydride. In certain embodiments, the 5' hydroxyl capping occurs with the same anhydride under different conditions (eg, in the presence of one or more other reagents). In some embodiments, the capping of the 5' hydroxyl group occurs in the presence of an amine base-containing ether solvent (eg, THF containing NMI (N-methylimidazole)). The phrase "capping group" can be used interchangeably with the phrase "protecting group" and "blocking group" in this article.

In some embodiments, the amine capping group is characterized in that it is effective to cap the amine, thus preventing recombination and/or decomposition of the intermediate phosphite material. In some embodiments, the capping group is selected for its ability to protect the amine of the palmitic adjuvant to prevent intranucleotide linkages of intramolecular cleavage of the phosphorus molecule.

In some embodiments, the 5' hydroxy-terminated group is characterized in that it is effective to cap the hydroxy group, thus preventing "short body" (eg, "nm", m and n are integers and m < n; n The presence of impurities in the number of bases in the targeted oligonucleotides, which are oligonucleotide chains that fail to react in the first cycle but then react in one or more subsequent cycles. The reaction is produced. The presence of such shorts, particularly "n-1", has an adverse effect on the purity of the crude oligonucleotide and makes the final purification of the oligonucleotide cumbersome and generally low yield.

In some embodiments, a particular end group is selected based on the tendency to promote a particular type of reaction under particular conditions. For example, in some embodiments, the capping group is selected for its ability to promote an E1 elimination reaction that cleaves end groups and/or adjuvants from the growth oligonucleotide. In some embodiments, the capping group is selected for its ability to promote an E2 elimination reaction that cleaves the end groups and/or adjuvants from the growth oligonucleotide. In some embodiments, the capping group is selected for its ability to promote a beta-elimination reaction that cleaves the end group and/or adjuvant from the growing oligonucleotide.

Modification steps:

As used herein, the phrase "modifying step", "modification step" and "P-modification step" are used interchangeably and generally refer to any one or more The step of modifying the internucleotide linkage. In some embodiments, the modified internucleotide linkage has the structure of Formula I. The P modification step of the present invention occurs during assembly of the provided oligonucleotides rather than after assembly of the provided oligonucleotides. Thus, each nucleotide unit of the provided oligonucleotide can be individually modified at the linked phosphorus during the cycle in which the nucleotide unit is installed.

In some embodiments, a suitable P modification reagent is a sulfur electrophile, a selenium electrophile, an oxygen electrophile, a boration reagent, or an azide reagent.

For example, in some embodiments, the selenium reagent is an elemental selenium, a selenium salt, or a substituted diselenide. In some embodiments, the oxygen electrophile is an elemental oxygen, a peroxide, or a substituted peroxide. In some embodiments, the borating reagent is a borane-amine (eg, N,N -diisopropylethylamine (BH ₃ .DIPEA), borane-pyridine (BH ₃ .Py), borane-2- Chloropyridine (BH ₃ CPy), borane-aniline (BH _{3 .} An), borane-ether reagent (for example, borane-tetrahydrofuran (BH ₃ . THF)), borane-dialkyl sulfide reagent ( For example, BH ₃ .Me ₂ S), aniline-cyanoborane or triphenylphosphine-alkoxycarbonylborane. In some embodiments, the azide reagent comprises an azide group capable of undergoing subsequent reduction to provide an amine group.

In some embodiments, the P modifying reagent is a sulfurizing reagent as described herein. In some embodiments, the modifying step comprises vulcanizing the phosphor to obtain a phosphorothioate linkage or a phosphorothioate linkage. In some embodiments, the modifying step provides an oligonucleotide having an internucleotide linkage of Formula I.

In some embodiments, the present invention provides a sulfurizing agent, a method of making the same, and uses.

In some embodiments, the sulfurizing reagents are thiosulfonate reagents. In some embodiments, the thiosulfonate reagent has the structure of formula SI :

Wherein: R ^s1 is R; and R, L and R ¹ are each independently as defined and described above and herein.

In some embodiments, the sulfurizing agent is a bis(thiosulfonate) reagent. In some embodiments, the bis(thiosulfonate) reagent has the structure of formula S-II :

Wherein R ^s1 and L are each independently as defined and described above and herein.

As generally defined above, R ^s1 is R, wherein R is as defined and described above and herein. In some embodiments, R ^s1 is optionally substituted aliphatic, aryl, heterocyclyl or heteroaryl. In some embodiments, R ^s1 is an optionally substituted alkyl. In some embodiments, R ^s1 is an optionally substituted alkyl. In some embodiments, R ^s1 is methyl. In some embodiments, R ^s1 is cyanomethyl. In some embodiments, R ^s1 is nitromethyl. In some embodiments, R ^s1 is an optionally substituted aryl. In some embodiments, R ^s1 is optionally substituted phenyl. In some embodiments, R ^s1 is phenyl. In some embodiments, R ^s1 is p-nitrophenyl. In some embodiments, R ^s1 is p-methylphenyl. In some embodiments, R ^s1 is p-chlorophenyl. In some embodiments, R ^s1 is o-chlorophenyl. In some embodiments, R ^s1 is 2,4,6-trichlorophenyl. In some embodiments, R ^s1 is pentafluorophenyl. In some embodiments, R ^s1 is optionally substituted heterocyclyl. In some embodiments, R ^s1 is an optionally substituted heteroaryl.

In some embodiments, R ^s 1-S(O) ₂ S- is (MTS). In some embodiments, R ^s1 -S(O) ₂ S- is (TTS). In some embodiments, R ^s1 - S(O) ₂ S- is (NO ₂ PheTS). In some embodiments, R ^s1 -S(O) ₂ S- is (p-ClPheTS). In some embodiments, R ^s1 -S(O) ₂ S- is (o-ClPheTS). In some embodiments, R ^s1 -S(O) ₂ S- is (2,4,6-TriClPheTS). In some embodiments, R ^s1 -S(O) ₂ S- is (PheTS). In some embodiments, R ^s1 -S(O) ₂ S- is (PFPheTS). In some embodiments, R ^s1 -S(O) ₂ S- is (a-CNMTS). In some embodiments, R ^s1 -S(O) ₂ S- is (a-NO ₂ MTS). In some embodiments, R ^s1 - S(O) ₂ S- is (a-CF ₃ MTS). In some embodiments, R ^s1 -S(O) ₂ S- is (a-CF ₃ TS). In some embodiments, R ^s1 -S(O) ₂ S- is (a-CHF ₂ TS). In some embodiments, R ^s1 -S(O) ₂ S- is (a-CH ₂ FTS).

In some embodiments, the sulfurizing reagent has the structure of SI or S-II , wherein L is -SR ^L3 - or -SC(O)-R ^L3 -. In some embodiments, L is -SR ^L3 - or -SC(O)-R ^L3 -, wherein R ^L3 is optionally substituted C ₁ -C ₆ alkylene. In some embodiments, L is -SR ^L3 - or -SC(O)-R ^L3 -, wherein R ^L3 is optionally substituted C ₁ -C ₆ extended alkenyl. In some embodiments, L is -SR ^L3 - or -SC(O)-R ^L3 -, wherein R ^L3 is optionally substituted C ₁ -C ₆ alkylene, wherein one or more methylene units Optionally, independently substituted C ₁ -C ₆ alkenyl, extended aryl or heteroaryl substituted. In some embodiments, in some embodiments, R ^L3 is optionally substituted by the -S- (C ₁ -C ₆ alkenylene _{group) -, - S- (C 1} -C 6 alkylene) -, -S-(C ₁ -C ₆ alkylene)-arylene-(C ₁ -C ₆ alkylene)-, -S-CO-exylaryl-(C ₁ -C ₆ alkylene)- Or -S-CO-(C ₁ -C ₆ alkylene)-arylene-(C ₁ -C ₆ alkylene)-. In some embodiments, the sulfurizing reagent has the structure of SI or S-II , wherein L is -SR ^L3 - or -SC(O)-R ^L3 - and the sulfur atom is attached to R ¹ .

In some embodiments, the sulfurizing reagent has the structure of SI or S-II , wherein L is an alkylene group, an alkenyl group, an aryl group or a heteroaryl group.

In some embodiments, the sulfurizing reagent has a structure of SI or S-II , wherein L is , , or . In some embodiments, L , , or Wherein the sulfur atom is attached to R ¹ .

In some embodiments, the sulfurizing reagent has a structure of SI or S-II , wherein R ¹ is , , , or . In some embodiments, R ¹ is , , , or Where the sulfur atom is attached to L.

In some embodiments, the sulfurizing reagent has a structure of SI or S-II , wherein L is , , or Wherein the sulfur atom is attached to R ¹ ; and R ¹ is , , , or Where the sulfur atom is attached to L.

In some embodiments, the sulfurizing reagent has the structure of SI or S-II , wherein R ¹ is -SR ^L2 , wherein R ^{L2 is} as defined and described above and herein. In some embodiments, R ^L2 is selected from the group consisting of -S-(C ₁ -C ₆ alkylene)-heterocyclyl, -S-(C ₁ -C ₆ -alkylene)-heterocyclyl, -S- a optionally substituted group of (C ₁ -C ₆ alkylene)-N(R') ₂ , -S-(C ₁ -C ₆ alkylene)-N(R') ₃ wherein each R 'As defined above and described herein.

In some embodiments, -LR ¹ is -R ^L3 -SSR ^L2 , wherein each variable is independently as defined above and described herein. In some embodiments, -LR ¹ is -R ^L3 -C(O)-SSR ^L2 , wherein each variable is independently as defined above and described herein.

The bis(thiosulfonate) reagent of the exemplary formula S-II is depicted as follows:

In some embodiments, the sulfurizing agent is a compound having one of the following formulas: S ₈ , R ^s2 -SSR ^s3 or R ^s2 -SX ^s -R ^s3 , wherein: R ^s2 and R ^s3 are each independently selected from Aliphatic, aminoalkyl, carbocyclyl, heterocyclyl, heterocycloalkyl, aryl, heteroaryl, alkoxy, aryloxy, heteroaryloxy, decyl, decylamine, sulfonium An optionally substituted group of an amine or thiocarbonyl; or R ^s2 and R ^s3 together with the atom to which they are bonded form an optionally substituted heterocyclic or heteroaryl ring; X ^s is -S(O) ₂ - , -O- or -N(R')-; and R' is as defined above and described herein.

In some embodiments, the sulfurizing reagent is S ₈ , , , , , or . In some embodiments, the sulfurizing reagent is S ₈ , or . In some embodiments, the sulfurizing agent is .

Exemplary sulfurizing reagents are depicted in Table 5 below.

In some embodiments, the sulfurizing agent provided is used to modify the H-phosphonate. For example, in some embodiments, the H-phosphonate oligonucleotide is synthesized using a method such as Wada I or Wada II and modified with a sulfurizing reagent of formula SI or S-II : Wherein R ^S1 , L and R ¹ are each as described and defined above and herein.

In some embodiments, the present invention provides a method for synthesizing a phosphorothioate triester comprising the steps of: i) an H phosphonate having the following structure:

Wherein W, Y and Z are each as described and defined herein above and as defined herein, reacting with a decylating reagent to give a decyloxyphosphonate; and ii) vulcanizing the decyloxyphosphonate with the structure SI or S-II Reagent reaction: A thiophosphoric acid triester is obtained.

In some embodiments, a modification is introduced to the internucleotide linkage using a selenium electrophile instead of a sulfurization reagent. In some embodiments, the selenium electrophile is a compound having one of the following formulas: Se, R ^s2 -Se-Se-R ^s3 or R ^s2 -Se-X ^s -R ^s3 , wherein: R ^s2 and R ^S3 are each independently selected from the group consisting of aliphatic, aminoalkyl, carbocyclyl, heterocyclyl, heterocycloalkyl, aryl, heteroaryl, alkoxy, aryloxy, heteroaryloxy, fluorene a optionally substituted group of a group, a guanamine, a quinone or a thiocarbonyl group; or R ^s2 and R ^s3 together with the atom to which they are bonded form an optionally substituted heterocyclic or heteroaryl ring; X ^s is -S(O) ₂ -, -O- or -N(R')-; and R' is as defined and described above and herein.

In other embodiments, the selenium electrophile is a Se compound, KSeCN, , , or . In some embodiments, the selenium electrophile is Se or .

In some embodiments, the feature of the present invention using the curing agent that was transferred to a portion of the phosphorous is substituted during the vulcanization of sulfur (e.g., -SR), a single sulfur atom (e.g., -S ^-, or = S )in contrast.

In some embodiments, the sulfurizing agent used in accordance with the present invention is characterized in that the activity of the agent can be adjusted by modifying the agent with certain electron withdrawing or electron donating groups.

In some embodiments, the sulfurizing agent used in accordance with the present invention is characterized in that it is crystalline. In some embodiments, the sulfurizing agent used in accordance with the present invention is characterized by having a high degree of crystallinity. In certain embodiments, the characteristics of the sulfurizing agent used in accordance with the present invention are The ease of purification of the reagent via, for example, recrystallization. In certain embodiments, the sulfurizing agent used in accordance with the present invention is characterized in that it is substantially free of sulfur-containing impurities. In some embodiments, a sulfurizing agent that is substantially free of sulfur-containing impurities exhibits increased efficiency.

In some embodiments, the provided palm-controlled oligonucleotides comprise one or more phosphodiester linkages. To synthesize the pair of palm-controlled oligonucleotides, one or more modification steps are optionally replaced with an oxidation step to install the corresponding phosphodiester linkage. In some embodiments, the oxidizing step is performed in a manner similar to conventional oligonucleotide synthesis. In some embodiments, the oxidizing step comprises using I ₂ . In some embodiments, the oxidizing step comprises the use of I ₂ and pyridine. In some embodiments, the oxidation step comprises the use of 0.02MI ₂ containing THF / pyridine / water co-solvent system (70: 10-v / v / v: 20). An exemplary cycle is depicted in Scheme Ic.

In some embodiments, the phosphorothioate is formed directly by vulcanization with a sulfurizing agent such as 3-phenyl-1,2,4-dithiazolin-5-one. In some embodiments, the pendant builder group remains attached to the internucleotide phosphorus atom after direct mounting of the phosphorothioate. In some embodiments, it needs additional deprotection step to remove the chiral auxiliary (e.g., for DPSE-type chiral auxiliaries, the use of TBAF, HF-Et ₃ N, etc.).

In some embodiments, a phosphorothioate precursor is used to synthesize a palm-controlled oligonucleotide comprising a phosphorothioate linkage. In some embodiments, such a phosphorothioate precursor is . In some embodiments, Conversion to a phosphorothioate diester linkage after cyclic withdrawal during standard deprotection/release procedures. Examples are further described below.

In some embodiments, the provided palm-controlled oligonucleotides comprise one or more phosphodiester linkages and one or more phosphorothioate linkages. In some embodiments, the provided palm-controlled oligonucleotide comprises one or more phosphodiester linkages and one or more phosphorothioate linkages, wherein at least one phosphodiester linkage is associated Installed after all the phosphorothioate linkages from the 3' to 5' synthesis. To synthesize the pair of palm-controlled oligonucleotides, in some embodiments, one or more modification steps are optionally replaced with an oxidation step to install a corresponding phosphodiester linkage, and a phosphorothioate diester linkage Each of them is equipped with a phosphorothioate precursor. In some embodiments, the phosphorothioate precursor is converted to a phosphorothioate linkage after reaching the desired oligonucleotide length. In some embodiments, the deprotection/release step during or after the recycle exit converts the phosphorothioate precursor to a phosphorothioate linkage. In some embodiments, the phosphorothioate precursor is characterized by its ability to be removed by a beta elimination pathway. In some embodiments, the phosphorothioate precursor is . As understood by the ordinarily skilled artisan, phosphorothioate precursors are used during synthesis (eg, One of the benefits is that in certain conditions Stabilized than phosphorothioate.

In some embodiments, the phosphorothioate precursor is a phosphorus protecting group as described herein, such as 2-cyanoethyl (CE or Cne), 2-trimethyldecylethyl, 2-nitroB Base, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-( N -tert-butylformamido)-1-propyl, 4-sided oxypentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4 - N -Methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[ N -methyl- N- (2-pyridyl)]aminoethyl, 2-( N -A Indenyl, N -methyl)aminoethyl, 4-[ N -methyl- N- (2,2,2-trifluoroethyl)amino]butyl. Examples are further described below.

The synthesis of the reagent to be vulcanized is described herein and in the Examples section.

As noted above, in some embodiments, the sulfidation occurs under conditions that cleave the palmitic agent from the growing oligonucleotide. In some embodiments, the sulfidation occurs under conditions that do not cleave the palmitic agent from the growth oligonucleotide.

In some embodiments, the sulfurizing reagent is dissolved in a suitable solvent and passed to the column. In certain embodiments, the solvent is a polar aprotic solvent, such as a nitrile solvent. In some embodiments, the solvent is acetonitrile. In some embodiments, a sulfurizing reagent (eg, a thiosulfonate derivative as described herein) is mixed with BSTFA (N,O-bis-trimethyldecyl-trifluoroacetamide) A vulcanization reagent solution is prepared in a nitrile solvent (for example, acetonitrile). In some embodiments, the BSTFA is not included. For example, the inventors have discovered that a vulcanizing agent of relatively high reactivity of the formula R ^s2 -SS(O) ₂ -R ^s3 can often successfully participate in the sulfurization reaction in the absence of BSTFA. As an example, the inventors have demonstrated that BSTFA is not required if R ^s2 is p-nitrophenyl and R ^s3 is methyl. In light of this disclosure, those skilled in the art will be able to readily determine other conditions and/or sulfurizing agents that do not require BSTFA.

In some embodiments, the vulcanization step is performed at room temperature. In some embodiments, the vulcanization step is performed at a low temperature such as about 0 ° C, about 5 ° C, about 10 ° C, or about 15 ° C. In some embodiments, the vulcanization step is performed at a high temperature greater than about 20 °C.

In some embodiments, the sulfurization reaction is carried out for from about 1 minute to about 120 minutes. In some embodiments, the sulfurization reaction is carried out for from about 1 minute to about 90 minutes. In some embodiments, the sulfurization reaction is carried out for from about 1 minute to about 60 minutes. In some embodiments, the sulfurization reaction is carried out for from about 1 minute to about 30 minutes. In some embodiments, the sulfurization reaction is carried out for from about 1 minute to about 25 minutes. In some embodiments, the sulfurization reaction is carried out for from about 1 minute to about 20 minutes. In some embodiments, the sulfurization reaction is carried out for from about 1 minute to about 15 minutes. In some embodiments, the sulfurization reaction is carried out for from about 1 minute to about 10 minutes. In some embodiments, the sulfurization reaction is carried out for from about 5 minutes to about 60 minutes.

In some embodiments, the sulfurization reaction is carried out for about 5 minutes. In some embodiments, the sulfurization reaction is carried out for about 10 minutes. In some embodiments, the sulfurization reaction is carried out for about 15 minutes. In some embodiments, the sulfurization reaction is carried out for about 20 minutes. In some embodiments, the sulfurization reaction is carried out for about 25 minutes. In some embodiments, the sulfurization reaction is carried out for about 30 minutes. In some embodiments, the sulfurization reaction is carried out for about 35 minutes. In some embodiments, the sulfurization reaction proceeds about 40 minutes. In some embodiments, the sulfurization reaction is carried out for about 45 minutes. In some embodiments, the sulfurization reaction is carried out for about 50 minutes. In some embodiments, the sulfurization reaction is carried out for about 55 minutes. In some embodiments, the sulfurization reaction is carried out for about 60 minutes.

It was unexpectedly found that some of the vulcanized modified products produced by the process of the present invention were unexpectedly stable. In some embodiments, the unexpectedly stable product is a thiophosphoric acid triester. In some embodiments, the unexpectedly stable product is a para-controlled oligonucleotide comprising one or more internucleotide linkages having the structure of Formula I-c.

Those skilled in the relevant art will recognize that the sulfurization methods described herein and the sulfurizing agents described herein are also suitable for use in modifying H-phosphonate oligonucleotides, such as those described in Wada II (WO 2010/064146). They are the same.

In some embodiments, the sulfurization reaction has a gradual cure efficiency of at least about 80%, 85%, 90%, 95%, 96%, 97%, or 98%. In some embodiments, the sulfurization reaction provides at least 98% pure crude dinucleotide product composition. In some embodiments, the sulfurization reaction provides at least 90% pure crude tetranucleotide product composition. In some embodiments, the sulfurization reaction provides at least 70% pure crude dinucleotide product composition. In some embodiments, the sulfurization reaction provides at least 50% pure crude twenty nucleotide product composition.

After the modification step of the linked phosphorus is completed, the oligonucleotide undergoes another step of removing the barrier group to prepare for reentry into the cycle. In some embodiments, the palmitic aid remains intact after vulcanization and the barrier is removed during the subsequent step of removing the barrier. The step of removing the barrier must occur prior to re-entry. The process of removing the barrier, coupling, capping, and modification is repeated until the growth oligonucleotide reaches the desired length, at which point the oligonucleotide can be immediately cleaved from the solid support or remaining attached to the vector for purification purposes and later Lysis. In some embodiments, one or more protecting groups are present on one or more of the nucleotide bases, and cleavage of the oligonucleotides from the vector and removal of the bases occur in a single step. In some embodiments, one or more protecting groups are present on one or more of the nucleotide bases, and the cleavage of the oligonucleotide from the vector and the removal of the base occur in more than one step . In some real In the examples, the removal of the protecting group and the cleavage from the carrier occur under basic conditions using, for example, one or more amine bases. In certain embodiments, the one or more amine bases comprise propylamine. In certain embodiments, the one or more amine bases comprise pyridine.

In some embodiments, the cleavage and/or removal of the protecting group from the carrier occurs at a temperature of from about 30 °C to about 90 °C. In some embodiments, the cleavage and/or removal of the protecting group from the carrier occurs at a temperature of from about 40 °C to about 80 °C. In some embodiments, the cleavage and/or removal of the protecting group from the carrier occurs at a temperature of from about 50 °C to about 70 °C. In some embodiments, the cleavage and/or removal of the protecting group from the carrier occurs at a temperature of about 60 °C. In some embodiments, the cleavage and/or removal of the protecting group from the carrier occurs at ambient temperature.

Exemplary purification procedures are described herein and/or are generally known in the relevant art.

It is worth noting that the removal of the self-growth oligonucleotide during each cycle is advantageous for at least the following reasons: (1) It is not necessary to have a potentially sensitive functional group at the end of the oligonucleotide synthesis. The auxiliaries are removed in a separate step when installed on phosphorus; and (2) unstable phosphorus-assisted intermediates that are susceptible to side reactions and/or interfere with subsequent chemical reactions are avoided. Therefore, removal of the palmity aid during each cycle makes the overall synthesis more efficient.

Although the steps of removing the barrier in the case of cycling have been described above, other general methods are included below.

Step of removing the barrier

In some embodiments, the coupling step is prior to the step of removing the barrier group. For example, in some embodiments, blocking (ie, protecting) the 5' hydroxyl group of the growing oligonucleotide and for subsequent reaction with the nucleoside coupling partner, the blocking group must be removed.

In some embodiments, the blocking group is removed using acidification. In some embodiments, the acid is Brønsted acid or Lewis acid. Suitable Brnsted acid is carboxylic acid, alkyl sulfonic acid, aryl sulfonic acid, phosphoric acid and its derivatives, phosphonic acid and its derivatives, alkyl phosphate and its derivatives, aryl phosphate and its derivatives, Phosphonic acid, dialkylphosphinic acid and diarylphosphinic acid having a pKa (25 ° C in water) value of -0.6 (trifluoroacetic acid) in an organic solvent or water (in the case of 80% acetic acid) ) to 4.76 (acetic acid). The concentration of the acid used in the acidification step (1 to 80%) depends on the acidity of the acid. In consideration of acid strength, it must be considered that strong acid conditions will cause depurination/depyrimidine, wherein the thiol or pyrimidinyl base is cleaved from the ribose ring and or other sugar ring. In some embodiments, the acid is selected from the group consisting of R ^a1 COOH, R ^a1 SO ₃ H, R ^a3 SO ₃ H, , or Wherein R ^a1 and R ^a2 are each independently hydrogen or an optionally substituted alkyl or aryl group, and R ^a3 is an optionally substituted alkyl or aryl group.

In some embodiments, acidification is achieved by an organic solvent containing a Lewis acid. An example of such suitable Lewis acids is Zn(X ^a ) ₂ wherein X ^a is Cl, Br, I or CF ₃ SO ₃ .

In some embodiments, the acidifying step comprises adding an amount of a Brnsted acid or a Lewis acid that is effective to self-condense the intermediate to remove the barrier group without removing the ruthenium moiety.

Acids suitable for use in the acidification step also include, but are not limited to, organic solvents containing 10% phosphoric acid, organic solvents containing 10% hydrochloric acid, organic solvents containing 1% trifluoroacetic acid, 3% dichloroacetic acid or trichloroacetic acid. Organic solvent or water containing 80% acetic acid. The concentration of any Brnsted acid or Lewis acid used in this step is selected such that the concentration of the acid does not exceed the concentration that would cause cleavage of the nucleobase from the sugar moiety.

In some embodiments, the acidifying comprises adding an organic solvent comprising 1% trifluoroacetic acid. In some embodiments, acidifying comprises adding an organic solvent comprising from about 0.1% to about 8% trifluoroacetic acid. In some embodiments, the acidifying comprises adding an organic solvent comprising 3% dichloroacetic acid or trichloroacetic acid. In some embodiments, acidifying comprises adding an organic solvent comprising from about 0.1% to about 10% dichloroacetic acid or trichloroacetic acid. In some embodiments, the acidifying comprises adding an organic solvent comprising 3% trichloroacetic acid. In some embodiments, acidifying comprises adding an organic solvent comprising from about 0.1% to about 10% trichloroacetic acid. In some embodiments, acidifying comprises adding water containing 80% acetic acid. In some embodiments, the acidification comprises an addition comprising from about 50% to about 90%, or from about 50% to about 80%, from about 50% to about 70%, from about 50% to about 60%, from about 70% to about 90% Acetic acid water. In some embodiments, acidifying comprises further adding a cation scavenger to the acidic solvent. In certain embodiments, the cation scavenger can be triethyl decane or triisopropyl decane. In some embodiments, the barrier group is removed by acidification, and the acidification comprises the addition of an organic solvent containing 1% trifluoroacetic acid. In some embodiments, the barrier group is removed by acidification, and the acidification comprises the addition of an organic solvent containing 3% dichloroacetic acid. In some embodiments, the barrier group is removed by acidification, and the acidification comprises the addition of an organic solvent containing 3% trichloroacetic acid. In some embodiments, the blocking group is removed by acidification, and the acidification comprises the addition of dichloromethane containing 3% trichloroacetic acid.

In certain embodiments, the step of performing the method of the invention on a synthesizer and removing the barrier of the hydroxyl group of the growing oligonucleotide comprises passing a quantity of solvent to the synthesizer column, the column containing the oligo A solid carrier of a glycoside. In some embodiments, the solvent is a halogenated solvent (eg, dichloromethane). In certain embodiments, the solvent comprises a quantity of acid. In some embodiments, the solvent comprises an amount of an organic acid, such as trichloroacetic acid. In certain embodiments, the acid is present in an amount from about 1% to about 20% w/v. In certain embodiments, the acid is present in an amount from about 1% to about 10% w/v. In certain embodiments, the acid is present in an amount from about 1% to about 5% w/v. In certain embodiments, the acid is present in an amount from about 1 to about 3% w/v. In certain embodiments, the acid is present in an amount of about 3% w/v. The method of removing the hydroxyl group barrier is further described herein. In some embodiments, the acid is present in dichloromethane at 3% w/v.

In some embodiments, the palmitic aid is removed prior to the step of removing the barrier. In some embodiments, the palmitic aid is removed during the step of removing the barrier.

In some embodiments, the cycle exit is performed prior to the step of removing the barrier. In some embodiments, the cycle exit is performed after the step of removing the barrier.

General conditions for barrier/protective removal

Functional groups such as hydroxyl or amine moieties located on nucleobases or sugar moieties are conventionally (partially) blocked by a blocking (protective) group during synthesis and subsequently stripped of the barrier group. In general, the barrier group renders the chemical functional groups of the molecule inert to specific reaction conditions and can later be removed from the functional group in the molecule without substantially destroying the rest of the molecule (see, for example, Green and Wuts, Protective Groups in Organic Synthesis, 2nd edition, John Wiley & Sons, New York, 1991). For example, the amine group can be blocked with a nitrogen barrier group such as phthalimide, 9-fluorenylmethoxycarbonyl (FMOC), tritylsulfenyl, t- BOC, 4,4'- Dimethoxytrityl (DMTr), 4-methoxytrityl (MMTr), 9-phenylxanthene-9-yl (Pixyl), trityl (Tr) or 9-( P-methoxyphenyl) xanthine-9-yl (MOX). The carboxyl group can be protected as an ethyl group. The hydroxy group can be protected, such as tetrahydropyranyl (THP), tert-butyldimethyl decyl (TBDMS), 1-[(2-chloro-4-methyl)phenyl]-4-methoxy Piperidin-4-yl (Ctmp), 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp), 1-(2-chloroethoxy)ethyl, 3- Methoxy-1,5-dimethoxycarbonylpentan-3-yl (MDP), bis(2-acetoxyethoxy)methyl (ACE), triisopropyldecyloxymethyl ( TOM), 1-(2-cyanoethoxy)ethyl (CEE), 2-cyanoethoxymethyl (CEM), [4-( N -dichloroethylidene- N -methylamino) Benzyloxy]methyl, 2-cyanoethyl (CN), pentinomethoxymethyl (PivOM), ethlyloxymethyl (ALE). Other representative hydroxy blockers have been described (see, for example, Beaucage et al, Tetrahedron , 1992 , 46 , 2223). In some embodiments, the base-blocking group is an acid labile group such as trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 9 -Phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthene-9-yl (MOX). Chemical functional groups can also be blocked by inclusion in a precursor form. Therefore, the azide group can be regarded as a barrier form of the amine because the azide group is easily converted into an amine. Other representative protecting groups employed in nucleic acid synthesis are known (see, for example, Agrawal et al, Protocols for Oligonucleotide Conjugates, edited by Humana Press, New Jersey, 1994, Vol. 26, pp. 1-72).

Various methods for removing a barrier from a nucleic acid are known. In some embodiments, all of the barriers are removed. In some embodiments, a portion of the barrier is removed. In some embodiments, the reaction conditions can be adjusted to selectively remove certain barrier groups.

In some embodiments, a nucleobase blocker, if present, can be provided in the provided oligonucleotide The hydroxyl acid reagent is cleaved after assembly. In some embodiments, a nucleobase blocker, if present, can be cleaved under conditions that are neither acidic nor basic, such as by cleavage with a fluoride salt or hydrofluoric acid complex. In some embodiments, a nucleobase blocker, if present, can be cleaved in the presence of a base or a basic solvent after assembly of the provided oligonucleotide. In certain embodiments, one or more of the nucleobase blocking groups are characterized in that they can be cleaved in the presence of a base or a basic solvent after assembly of the provided oligonucleotide, but for the provided oligonucleotide The specific conditions of one or more of the early removal of the protecting group steps that occur during the assembly of the glycoside are stable.

In some embodiments, the nucleobase does not require a blocking group. In some embodiments, the nucleobase requires a blocking group. In some embodiments, certain nucleobases require one or more barrier groups, while other nucleobases do not require one or more barrier groups.

In some embodiments, the oligonucleotide is cleaved from the solid support after synthesis. In some embodiments, cleavage from the solid support comprises the use of propylamine. In some embodiments, cleavage from the solid support comprises the use of pyridine containing propylamine. In some embodiments, cleavage from the solid support comprises the use of pyridine containing 20% propylamine. In some embodiments, cleavage from the solid support comprises the use of anhydrous pyridine containing propylamine. In some embodiments, cleavage from the solid support comprises the use of anhydrous pyridine containing 20% propylamine. In some embodiments, cleavage from the solid support comprises the use of a polar aprotic solvent such as acetonitrile, NMP, DMSO, hydrazine, and/or lutidine. In some embodiments, cleavage from the solid support comprises the use of a solvent, such as a polar aprotic solvent; and one or more primary amines (eg, C _1-10 amines); and/or methoxyamine, hydrazine, and pure anhydrous ammonia. One or more.

In some embodiments, the protecting group for the de-oligonucleotide comprises the use of propylamine. In some embodiments, the protecting group for the de-oligonucleotide comprises the use of pyridine containing propylamine. In some embodiments, the protecting group for the de-oligonucleotide comprises the use of pyridine containing 20% propylamine. In some embodiments, the protecting group for the de-oligonucleotide comprises the use of an anhydrous pyridine containing propylamine. In some embodiments, the protecting group for the de-oligonucleotide comprises the use of anhydrous pyridine containing 20% propylamine.

In some embodiments, the protecting group of the oligonucleotide is removed during cleavage.

In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at about room temperature. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at elevated temperatures. In some embodiments, the protecting group from the solid support cleavage oligonucleotide or the oligodeoxynucleotide is above about 30 ° C, 40 ° C, 50 ° C, 60 ° C, 70 ° C, 80 ° C, 90 ° C or Executed at 100 °C. In some embodiments, the protecting group from the solid support cleavage oligonucleotide or the oligodeoxynucleotide is at about 30 ° C, 40 ° C, 50 ° C, 60 ° C, 70 ° C, 80 ° C, 90 ° C or 100 ° C. Execute. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at about 40-80 °C. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at about 50-70 °C. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at about 60 °C.

In some embodiments, the protecting group from the solid support cleavage oligonucleotide or the oligodeoxynucleotide is performed for more than 0.1 hr, 1 hr, 2 hr, 5 hr, 10 hr, 15 hr, 20 hr, 24 hr, 30 hr, or 40 hr. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 0.1 to 5 hrs. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 3-10 hr. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 5-15 hrs. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 10-20 hrs. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 15-25 hr. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 20-40 hrs. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 2 hr. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 5 hr. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 10 hr. In some embodiments, cleavage from a solid support The protecting group of the oligonucleotide or the de-oligonucleotide is performed for about 15 hr. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 18 hr. In some embodiments, the protecting group from the solid vector cleavage oligonucleotide or the oligodeoxynucleotide is performed for about 24 hr.

In some embodiments, the protecting group from the solid support cleavage oligonucleotide or the oligodeoxynucleotide is performed at room temperature for more than 0.1 hr, 1 hr, 2 hr, 5 hr, 10 hr, 15 hr, 20 hr, 24 hr, 30 hr or 40hr. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at room temperature for about 5-48 hr. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at room temperature for about 10-24 hr. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at room temperature for about 18 hr. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at elevated temperatures for more than 0.1 hr, 1 hr, 2 hr, 5 hr, 10 hr, 15 hr, 20 hr, 24 hr, 30 hr, or 40 hr. . In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at elevated temperatures for about 0.5 to 5 hrs. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at 60 ° C for about 0.5-5 hr. In some embodiments, the protecting group that cleaves the oligonucleotide or removes the oligonucleotide from the solid support is performed at about 60 ° C for about 2 hr.

In some embodiments, protecting the oligonucleotide from the solid support or removing the oligonucleotide comprises using propylamine and performing at room temperature or elevated for more than 0.1 hr, 1 hr, 2 hr, 5 hr, 10 hr, 15 hr, 20 hr 24hr, 30hr or 40hr. Exemplary conditions are pyridine containing 20% propylamine for about 18 hr at room temperature; and pyridine containing 20% propylamine for about 18 hr at 60 °C.

In some embodiments, the step of removing the pair of palmitic auxiliary groups is performed if the palmitic auxiliary group is still attached to the internucleotide phosphorus atom prior to cleavage from the solid support. In some embodiments, for example, one or more DPSE-type pairs of the pendant builder group are still attached to the internucleotide phosphorus atom during the oligonucleotide synthesis cycle. Conditions suitable for removal of the remaining pendant builder groups are widely known in the art, such as those described in Wada I, Wada II, Wada III, Palm Control, and the like. In some embodiments, the conditions for removing the DPSE-type palmitic aid are TBAF or HF-Et ₃ N, such as MeCN containing 0.1 MTBAF, THF or MeCN containing 05M HF-Et ₃ N, and the like. In some embodiments, the present invention recognizes that the linking group can be cleaved during the process of removing the palmitic auxiliary group. In some embodiments, the invention provides a linking group, such as an SP linking group, that provides better stability during removal of the palmitic adjuvant group. Certain linking groups provided by the present invention provide, inter alia, improved yield and/or purity.

In some embodiments, the activator is a "Wada" activator, that is, the activator is from any of the Wada I, II or III references cited above.

Exemplary activation groups are described below:

In some embodiments, the activating reagent is selected from

In some embodiments, an illustrative loop is depicted in Schemes I-b.

In some embodiments, an illustrative cycle is shown in flow I-c.

Scheme Ic. Installation of both phosphodiester and modified internucleotide linkages in a palm-controlled oligonucleotide.

In Scheme Ic, an oligonucleotide (or nucleotide, or an oligonucleotide comprising a modified internucleotide linkage) (C-1) on a solid support is coupled to an amino phosphate C-2 . After coupling and capping, an oxidation step is performed. After removal of the barrier group, a phosphodiester linkage is formed. The recycled product C-3 can be re-entered into Cycle C to install more phosphodiester linkages, or enter other cycles to install other types of internucleotide linkages, or to cycle out.

In some embodiments, in Scheme Ic, non-pivotic pure amino phosphate can be used in place of C-2. In some embodiments, DMTr protected beta-cyanoethylamino phosphate is used. In some embodiments, the amino phosphate used has the following structure:

In some embodiments, the use of a phosphorothioate diester precursor increases the stability of the oligonucleotide during synthesis. In some embodiments, the phosphorothioate diester precursor is used to improve the synthesis efficiency of the palm-controlled oligonucleotide. In some embodiments, the phosphorothioate diester precursor is used to improve the synthetic yield of the palm-controlled oligonucleotide. In some embodiments, the phosphorothioate diester precursor is used to improve product purity for palm-controlled oligonucleotide synthesis.

In some embodiments, the phosphorothioate diester precursor in the method mentioned above is . In some embodiments, Conversion to a phosphorothioate diester linkage during removal of the protecting group/release. In some embodiments, an illustrative loop is depicted in the flow Id. Further examples are depicted below.

Scheme Id. A phosphorothioate diester precursor in the synthesis of palm-controlled oligonucleotides.

As shown in Scheme Id, both phosphorothioate and phosphodiester linkages can be incorporated into the same pair of palm controlled oligonucleotides. As will be understood by those of ordinary skill, the methods provided do not require the phosphorothioate and phosphodiester to be continuous, and other internucleotide linkages can be formed between the two using the cycle as described above. In the process Id, the phosphorothioate diester precursor is installed. Instead of a phosphorothioate diester linkage. In some embodiments, the permutations increase the synthesis efficiency during certain steps, such as the oxidation step. In some embodiments, the use of a phosphorothioate diester precursor generally improves the stability of the palm-controlled oligonucleotide during synthesis and/or storage. After the withdrawal of the cycle, the phosphorothioate diester precursor is converted to a phosphorothioate diester linkage during removal of the protecting group/release. In some embodiments, the use of a phosphorothioate diester precursor is advantageous even when no phosphodiester linkage is present in the palm-controlled oligonucleotide, or when an oxidation step is not required during the synthesis.

As in Scheme Ic, in some embodiments, for a cycle comprising an oxidation step, a non-pivotic pure amino phosphate can be used. In some embodiments, DMTr protected beta-cyanoethylamino phosphate is used. In some embodiments, the amino phosphate used has The structure.

In some embodiments, the methods of the invention provide a palm-controlled oligonucleotide composition that is enriched with a particular oligonucleotide type.

In some embodiments, at least about 10% of the provided crude composition has a particular oligonucleotide type. In some embodiments, at least about 20% of the provided crude composition has a particular oligonucleotide type. In some embodiments, at least about 30% of the provided crude composition has a particular oligonucleotide type. In some embodiments, at least about 40% of the provided crude composition has a particular oligonucleotide type. In some embodiments, at least about 50% of the provided crude composition has a particular oligonucleotide type. In some embodiments, at least about 60% of the provided crude composition has a particular oligonucleotide type. In some embodiments, at least about 70% of the provided crude composition has a particular oligonucleotide type. In some embodiments, at least about 80% of the provided crude composition has a particular oligonucleotide type. In some embodiments, at least about 90% of the provided crude composition has a particular oligonucleotide type. In some embodiments, at least about 95% of the provided crude composition has a particular oligonucleotide type.

In some embodiments, at least about 1% of the provided compositions have a particular oligonucleotide Types of. In some embodiments, at least about 2% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 3% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 4% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 5% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 10% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 20% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 30% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 40% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 50% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 60% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 70% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 80% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 90% of the provided compositions have a particular oligonucleotide type. In some embodiments, at least about 95% of the provided compositions have a particular oligonucleotide type.

In some embodiments, an illustrative cycle is depicted in Schemes I-e below.

In some embodiments, X is an H or 2' modification. In some embodiments, X is H or -OR ¹ , wherein R ^{1 is} not hydrogen. In some embodiments, X is H or -OR ¹ , wherein R ¹ is optionally substituted C _1-6 alkyl. In some embodiments, X is H. In some embodiments, X is -OMe. In some embodiments, X is -OCH ₂ CH ₂ OCH ₃ . In some embodiments, X is -F.

In some embodiments, an illustrative loop is depicted in Flows I-f.

In some embodiments, X is an H or 2' modification. In some embodiments, X is H or -0R ^1, wherein R ¹ is not hydrogen. In some embodiments, X is H or -OR ¹ , wherein R ¹ is optionally substituted C _1-6 alkyl. In some embodiments, X is H. In some embodiments, X is -OMe. In some embodiments, X is -OCH ₂ CH ₂ OCH ₃ . In some embodiments, X is -F.

It will be understood by those skilled in the art that different types of cycles can be combined to provide complete control of the chemical modification and stereochemistry of the oligonucleotide. In some embodiments, for example, the oligonucleotide synthesis process can contain one or more loops A-F. In some embodiments, the methods provided comprise at least one cycle of using a DPSE type of palmitic aid.

In some embodiments, the invention provides methods for making the provided oligonucleotides and oligonucleotide compositions. In some embodiments, the method provided includes providing The provided palmitic reagent of the structure, wherein W ¹ is -NG ⁵ and W ² is O, and G ¹ and G ³ are each independently hydrogen or selected from a C _1-10 aliphatic group, a heterocyclic group, and a heteroaryl group. And optionally substituted groups of the aryl group, G ² is —C(R) ₂ Si(R) ₃ , and G ⁴ and G ⁵ together form up to about 20 ring atoms, optionally substituted, a partially unsaturated or unsaturated heteroatom-containing ring which is monocyclic or polycyclic, fused or unfused, wherein each R is independently hydrogen or is selected from a C ₁ -C ₆ aliphatic group, a carbocyclic group, Optionally substituted groups of aryl, heteroaryl and heterocyclic groups. In some embodiments, the provided palmar agent has , , or The structure. In some embodiments, a method provided comprises providing an amino phosphate comprising a portion from a palmitic agent, the pair of palmitic agents having , , , or A structure in which -W ¹ H and -W ² H or a hydroxyl group and an amine group are bonded to a phosphorus atom of an amino phosphate. In some embodiments, -W ¹ H and -W ² H or a hydroxyl group and an amine group are bonded to a phosphorus atom of an amino phosphate, for example, or in. In some embodiments, the amino phosphate has the structure: , , , . In some embodiments, R is a protecting group. In some embodiments, R is a DMTr. In some embodiments, G ² is —C(R) ₂ Si(R) ₃ , wherein —C(R) ₂ — is optionally substituted —CH ₂ —, and each R of —Si(R) ₃ Independently, a group selected from the group consisting of a C _1-10 aliphatic group, a heterocyclic group, a heteroaryl group, and an aryl group. In some embodiments, at least one R of -Si(R) ₃ is independently a optionally substituted C _1-10 alkyl group. In some embodiments, at least one R of -Si(R) ₃ is independently phenyl optionally substituted. In some embodiments, one R of -Si(R) ₃ is independently phenyl optionally substituted, and the other two R are each independently optionally substituted C _1-10 alkyl. In some embodiments, one R of -Si(R) ₃ is independently a optionally substituted C _1-10 alkyl group, and the other two R are each independently an optionally substituted phenyl group. In some embodiments, G ² is optionally substituted -CH ₂ Si(Ph)(Me) ₂ . In some embodiments, G ² is optionally substituted -CH ₂ Si(Me)(Ph) ₂ . In some embodiments, G ² is —CH ₂ Si(Me)(Ph) ₂ . In some embodiments, G ⁴ and G ⁵ together form an optionally substituted saturated 5-6 membered ring containing a nitrogen atom attached to G ⁵ . In some embodiments, G ⁴ and G ⁵ together form an optionally substituted saturated 5-membered ring containing a nitrogen atom. In some embodiments, G ¹ is hydrogen. In some embodiments, G ³ is hydrogen. In some embodiments, both G ¹ and G ³ are hydrogen. In some embodiments, G ¹ and G ³ are both hydrogen and G ² is —C(R) ₂ Si(R) ₃ , wherein —C(R) ₂ — is optionally substituted —CH ₂ —, and Each R of -Si(R) ₃ is independently an optionally substituted group selected from a C _1-10 aliphatic group, a heterocyclic group, a heteroaryl group, and an aryl group, and G ⁴ and G ⁵ are formed together. A nitrogen atom is optionally substituted to saturate a 5-membered ring. In some embodiments, the provided methods further comprise providing a fluorochemical reagent. In some embodiments, the provided fluorochemical reagent is removed from the oligonucleotide after synthesis or the product formed from the palmitic reagent. Various known fluorine-containing reagents can be employed in accordance with the present invention, including their F ^- sources for removing -SiR ₃ groups, such as TBAF, HF ₃ -Et ₃ N, and the like. In some embodiments, the fluorochemical reagent provides better results, such as reduced processing time, reduced temperature, reduced desulfurization, and the like, as compared to conventional methods such as concentrated ammonia. In some embodiments, with respect to certain fluorochemical reagents, the present invention provides a linking group for improved results, such as during removal of a palmitic reagent (or a product formed therefrom during oligonucleotide synthesis). The cleavage of the oligonucleotide from the vector is reduced. In some embodiments, the linking group provided is an SP linking group. In some embodiments, the present invention demonstrates that an alkali may be employed HF- complexes such as HF-NR _3, to control during the removal of the chiral agent (or from which the product formation during oligonucleotide synthesis) Cracking. In some embodiments, HF-NR ₃ is HF-NEt ₃ . In some embodiments, HF-NR ₃ allows the use of conventional linking groups, such as butadienyl linking groups.

Biological applications and use examples

In particular, the present invention recognizes that the properties and activities of oligonucleotides can be The palm-controlled oligonucleotide composition is provided to optimize its backbone for palm center mode. In some embodiments, the invention provides a palm-controlled oligonucleotide composition wherein the oligonucleotide has a common backbone-to-palm center mode that enhances its stability and/or biological activity. In some embodiments, the backbone provides an unexpectedly increased stability to the palm center mode. In some embodiments, the backbone provides surprisingly increased activity to the palm center mode. In some embodiments, the backbone provides increased stability and activity to the palm center mode. In some embodiments, when the oligonucleotide is used to cleave the nucleic acid polymer, the backbone of the oligonucleotide versus the palm center pattern itself unexpectedly alters the cleavage mode of the target nucleic acid polymer. In some embodiments, the backbone-to-palm central mode is effective to prevent cleavage at the secondary site. In some embodiments, the backbone forms a new cleavage site for the palm center pattern. In some embodiments, the backbone-to-palm central mode minimizes the number of cleavage sites. In some embodiments, the backbone-to-palm central mode minimizes the number of cleavage sites such that the target nucleic acid polymer cleaves only at one site within the target nucleic acid polymer sequence complementary to the oligonucleotide. In some embodiments, the backbone-to-palm center mode can enhance the efficiency of cleavage at the cleavage site. In some embodiments, the backbone of the oligonucleotide cleaves the target nucleic acid polymer against the palm center mode. In some embodiments, the backbone adds selectivity to the palm center mode. In some embodiments, the main chain versus palm center mode minimizes off-target effects. In some embodiments, the backbone increases selectivity for the palm center pattern, such as cleavage selectivity between target sequences that differ due to point mutations or single nucleotide polymorphisms (SNPs). In some embodiments, the backbone increases selectivity for the palm center pattern, such as cleavage selectivity between target sequences differing only by one point mutation or single nucleotide polymorphism (SNP).

It has been found, inter alia, that certain of the provided oligonucleotide compositions achieve unprecedented control of cleavage of the target sequence, for example by ribonuclease H cleavage of the target RNA. In some embodiments, the present invention demonstrates that the precise control of the chemical and stereochemical properties of an oligonucleotide is compared to a formulation that does not control stereochemical properties but is otherwise similar. In other words, improved activity of the oligonucleotide preparation can be achieved. In particular, the invention specifically demonstrates that the rate, extent and/or specificity of cleavage of a nucleic acid target to which the provided oligonucleotide hybridizes is improved.

In some embodiments, the invention provides various uses of oligonucleotide compositions. In particular, the present invention demonstrates that the properties of oligonucleotides can be greatly improved by controlling structural elements of the oligonucleotide, such as base sequences, chemical modifications, stereochemistry, and the like. For example, in some embodiments, the invention provides methods for highly selectively inhibiting transcripts of a target nucleic acid sequence. In some embodiments, the invention provides methods of treating an individual by inhibiting a transcript from a pathogenic replica (eg, a disease-causing dual gene). In some embodiments, the invention provides methods for designing and preparing oligonucleotide compositions wherein the activity and/or selectivity is unexpectedly enhanced when the transcript of the target sequence is inhibited. In some embodiments, the invention provides methods for designing and/or preparing oligonucleotide compositions that provide dual gene-specific inhibition of a transcript from a target nucleic acid sequence.

In some embodiments, the present invention provides a method for controlling a cleavage of a nucleic acid polymer, the method comprising the steps of: ???a nucleic acid polymer comprising a nucleotide sequence of a nucleotide sequence and an oligonucleoside comprising a specific oligonucleotide type The acid is contacted with a palm-controlled oligonucleotide composition characterized by: 1) a common base sequence and a length, wherein the common base sequence is or comprises a nucleic acid a sequence complementary to the target sequence present in the polymer; 2) a common backbone linkage mode; and 3) a common backbone-to-palm center mode; the composition is controlled by palmarity because of the specific base For substantially racemic preparations of oligonucleotides of base sequence and length, oligonucleotides of a particular oligonucleotide type are enriched in the composition.

In some embodiments, the present invention provides a method for modifying a cracking mode, The cleavage mode is a cleavage mode observed when a nucleotide sequence includes a nucleic acid polymer of a target sequence and a reference oligonucleotide composition comprising an oligonucleotide having a specific base sequence and length, the specific base The base sequence is or comprises a sequence complementary to the target sequence, the method comprising: contacting the nucleic acid polymer with a palm-controlled oligonucleotide composition having an oligonucleotide of a particular base sequence and length, the composition Controlled by palmarity, as a single oligonucleotide type of oligonucleotide is enriched in the composition relative to a substantially racemic formulation of an oligonucleotide having a particular base sequence and length. Such oligonucleotides are characterized by: 1) a particular base sequence and length; 2) a particular backbone linkage pattern; and 3) a specific backbone pair palm center pattern.

In some embodiments, the invention provides a method for controlling a cleavage of a nucleic acid polymer, comprising providing a palm-controlled oligonucleotide composition comprising an oligonucleotide having the following definition: 1) a common base sequence and a length, wherein the common base sequence is or comprises a sequence complementary to a sequence existing in the nucleic acid polymer; 2) a common backbone linkage mode; 3) a common backbone pair palm center pattern, The composition is a substantially pure single oligonucleotide preparation because at least about 10% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone pairing The central mode; and the nucleic acid polymer therein is cleaved in a cleavage mode different from the cleavage mode when providing an oligonucleotide composition that does not control the palmity.

As used herein, the cleavage mode of a nucleic acid polymer is defined by the number of cleavage sites, the location of the cleavage site, and the percent cleavage at each bit. In some embodiments, the cleavage mode has multiple cleavage sites and the percent cleavage at each bit is different. In some embodiments, the lysis mode has multiple cleavage sites and the percent cleavage at each bit is the same. In some real In the example, the lysis mode has only one cleavage site. In some embodiments, the cleavage modes differ from each other in that they have a different number of cleavage sites. In some embodiments, the lysis patterns differ from one another in that at least one cleavage site is different. In some embodiments, the cleavage modes differ from each other in that the percentage of cleavage at at least one co-cleavage site is different. In some embodiments, the cleavage modes differ from each other in that they have a different number of cleavage sites, and/or at least one cleavage site is different, and/or the cleavage percentage differs at at least one co-cleavage site.

In some embodiments, the present invention provides a method for controlling a cleavage of a nucleic acid polymer, the method comprising the steps of: ???a nucleic acid polymer comprising a nucleotide sequence of a nucleotide sequence and an oligonucleoside comprising a specific oligonucleotide type The acid is contacted with a palm-controlled oligonucleotide composition characterized by: 1) a common base sequence and a length, wherein the common base sequence is or comprises a nucleic acid a sequence complementary to the target sequence present in the polymer; 2) a common backbone linkage mode; and 3) a common backbone-to-palm center mode; the composition is controlled by palmarity because of the specific base For a substantially racemic preparation of a base sequence and a length of oligonucleotide, the oligonucleotide of a particular oligonucleotide type is enriched in the composition, and the contact is performed under conditions in which the nucleic acid polymer is cleaved .

In some embodiments, the invention provides a method for altering a first cleavage pattern of a nucleic acid polymer obtained using a first oligonucleotide composition, comprising providing a second pair of palm controlled oligonucleotides a composition, the second pair of palm-controlled oligonucleotide compositions comprising an oligonucleotide having the following definitions: 1) a common base sequence and a length, wherein the common base sequence is or is contained in a nucleic acid polymer a sequence complementary to the sequence present; 2) a common backbone linkage mode; 3) a common backbone-to-palm central mode, the composition being a substantially pure single oligonucleotide preparation, since at least about 10% of the oligonucleotides in the composition have a common base sequence and length, co-master a strand-linking mode and a common backbone-to-palm central mode; and wherein the nucleic acid polymer is cleaved in a cleavage mode different from the first cleavage mode.

In some embodiments, the invention provides a method for altering a cleavage mode, wherein the nucleotide sequence comprises a nucleic acid polymer of a target sequence and a reference comprising an oligonucleotide having a particular base sequence and length A cleavage pattern observed when the oligonucleotide composition is contacted, the specific base sequence being or comprising a sequence complementary to the target sequence, the method comprising: ligating the nucleic acid polymer with an oligonucleoside having a specific base sequence and length The acid is contacted with a palm-controlled oligonucleotide composition that is palm-controlled because of the substantially racemic formulation relative to an oligonucleotide having a particular base sequence and length. An oligonucleotide of a single oligonucleotide type is enriched in the composition, the oligonucleotide being characterized by: 1) a specific base sequence and length; 2) a specific backbone linkage pattern; and 3) Specific main chain versus palm center mode.

This contact is carried out under conditions in which the nucleic acid polymer is cleaved.

In some embodiments, the provided palm-controlled oligonucleotide composition reduces the number of cleavage sites within the target sequence. In some embodiments, the provided palm-controlled oligonucleotide composition provides a single site cleavage within the target sequence. In some embodiments, the palm-controlled oligonucleotide composition provides an enhanced rate of cleavage at a cleavage site within the target sequence. In some embodiments, the palm-controlled oligonucleotide composition provides enhanced efficiency at the cleavage site within the target sequence. In some embodiments, the palm-controlled oligonucleotide composition provides an increased conversion in cleavage of the target nucleic acid polymer. In some embodiments, the palm controlled oligonucleotide composition increases the percent cleavage at a site within or near the characteristic sequence element. In some embodiments, the palm-controlled oligonucleotide composition is increased in Percentage of lysis at the site near the mutation. In some embodiments, the palm-controlled oligonucleotide composition increases the percentage of cleavage at a site near the SNP. Exemplary embodiments of sites within or near the signature sequence element, near the mutation, near the SNP are described in the present invention. For example, in some embodiments, the nearby cleavage site is a cleavage site that is linked away from the 0, 1, 2, 3, 4, or 5 nucleotide linkages of the mutation; in some other embodiments, nearby The cleavage site is a cleavage site that is 0, 1, 2, 3, 4 or 5 nucleotides away from the SNP.

In some embodiments, the cleavage occurs in a cleavage mode that is different from the reference lysis mode. In some embodiments, the reference cleavage mode is the cleavage pattern observed when the nucleic acid polymer is contacted with a reference oligonucleotide composition under similar conditions. In some embodiments, the reference oligonucleotide composition is an uncontrolled palmarity of the oligonucleotides sharing the common base sequence and length of the palm-controlled oligonucleotide composition (eg, stereotactic) An oligonucleotide composition. In some embodiments, a reference oligonucleotide composition is a substantially racemic formulation that shares a common sequence and length of oligonucleotide.

In some embodiments, the nucleic acid polymer is RNA. In some embodiments, the nucleic acid polymer is an oligonucleotide. In some embodiments, the nucleic acid polymer is an RNA oligonucleotide. In some embodiments, the nucleic acid polymer is a transcript. In some embodiments, the oligonucleotides provided to the palm-controlled oligonucleotide composition form a double helix with the nucleic acid polymer to be cleaved.

In some embodiments, the nucleic acid polymer is cleaved by an enzyme. In some embodiments, the enzyme cleaves the duplex formed by the nucleic acid polymer. In some embodiments, the enzyme is ribonuclease H. In some embodiments, the enzyme is Dicer. In some embodiments, the enzyme is alpha protein. In some embodiments, the enzyme is Ago2. In some embodiments, the enzyme is within a protein complex. An exemplary protein complex is an RNA-induced silencing complex (RISC).

In some embodiments, the provided palm-controlled oligonucleotide composition comprises an oligonucleotide having a common backbone-to-palm central pattern, providing an unexpectedly high selection The ability to selectively target nucleic acid polymers that have only small sequence changes in the target region. In some embodiments, the nucleic acid polymer is a transcript from a dual gene. In some embodiments, the transcripts from different dual genes can be selectively targeted using the provided palm-controlled oligonucleotide composition.

In some embodiments, the provided palm-controlled oligonucleotide compositions and methods thereof are capable of accurately controlling the cleavage sites within the target sequence. In some embodiments, the cleavage site is around the sequence of the R p S p S p backbone to the palm center. In some embodiments, the cleavage site is upstream and adjacent to the sequence of the R p S p S p backbone to the palm center. In some embodiments, the cleavage site is within 5 base pairs upstream of the sequence of the R p S p S p backbone to the palm center. In some embodiments, the cleavage site is within 4 base pairs upstream of the sequence of the R p S p S p backbone to the palmar center. In some embodiments, the cleavage site is within 3 base pairs upstream of the sequence of the R p S p S p backbone to the palmar center. In some embodiments, the cleavage site is within 2 base pairs upstream of the sequence of the R p S p S p backbone to the palm center. In some embodiments, the cleavage site is within 1 base pair upstream of the sequence of the R p S p S p backbone to the palm center. In some embodiments, the cleavage site is downstream of and adjacent to the sequence of the R p S p S p backbone to the palm center. In some embodiments, the cleavage site is within 5 base pairs downstream of the sequence of the R p S p S p backbone to the palm center. In some embodiments, the cleavage site is within 4 base pairs downstream of the sequence of the R p S p S p backbone to the palmar center. In some embodiments, the cleavage site is within 3 base pairs downstream of the sequence of the R p S p S p backbone to the palmar center. In some embodiments, the cleavage site is within 2 base pairs downstream of the sequence of the R p S p S p backbone to the palmar center. In some embodiments, the cleavage site is within 1 base pair downstream of the sequence of the R p S p S p backbone to the palm center. The invention thus provides, inter alia, control of the cleavage site within the target sequence. In some embodiments, an exemplary cleavage is depicted in FIG. In some embodiments, the cleavage depicted in Figure 21 is referred to as cleavage at the site of two base pairs downstream of the sequence of the R p S p S p backbone to the palm center. As widely described in the present invention, the sequence of the R p S p S p main chain to the palm center may exist in ( N p) _m ( R p) _n ( S p) _t , ( N p) _t ( R p) _n ( S p) _m , ( S p) _m ( R p) _n ( S p) _t , ( S p) _t ( R p) _n ( S p) _m , ( R p) _n ( S p) _m , _{(R p) m (S p} ) n, (S p) m R p and / or R p (S p) of _m single or repeated unit, which is independently as hereinbefore defined and described herein. In some embodiments, the provided palm-controlled oligonucleotide composition is 2 base pairs downstream of the palmar center of the R p S p S p backbone in the target molecule (see, eg, Figure 21) A new cleavage site is formed where the new cleavage site is absent (undetectable) if a reference (eg, no control of palmarity) oligonucleotide composition is used. In some embodiments, the provided palm-controlled oligonucleotide composition enhances the R p S p S p backbone in the target molecule (see, eg, Figure 21) by 2 base pairs downstream of the palmar center Cleavage at the cleavage site where the percentage of cleavage occurring at such sites is higher than when using a reference (e.g., non-control palm) oligonucleotide composition. In some embodiments, the cleavage achieved at the site by the provided palm-controlled oligonucleotide composition is at least 2, 3, 4 of the cleavage achieved by the reference oligonucleotide composition. , 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500 or 1000 times (eg, when the percentage of cracking by site) Time measurement). In some embodiments, the R p S p S p backbone provided in the target molecule (eg, see Figure 21) provided by the palm-controlled oligonucleotide composition provides two bases downstream of the palmar center Cleavage at the cleavage site of the base pair is accelerated compared to when a reference (e.g., no palmarity) oligonucleotide composition is used. In some embodiments, the cleavage achieved by the provided palm-controlled oligonucleotide composition is at least 2, 3, 4, 5, 6, faster than the cleavage achieved by the reference oligonucleotide composition. 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500 or 1000 times. In some embodiments, the provided palm-controlled oligonucleotide composition is 2 base pairs downstream of the palmar center of the R p S p S p backbone in the target molecule (see, eg, Figure 21) The cleavage site is the cleavage site when a reference (eg, no palmarity) oligonucleotide composition is used. In some embodiments, the provided palm-controlled oligonucleotide composition is 2 base pairs downstream of the palmar center of the R p S p S p backbone in the target molecule (see, eg, Figure 21) The cleavage site is within one base pair of the cleavage site when a reference (eg, no control of palmity) oligonucleotide composition is used. In some embodiments, the provided palm-controlled oligonucleotide composition is 2 base pairs downstream of the palmar center of the R p S p S p backbone in the target molecule (see, eg, Figure 21) The cleavage site is within 2 base pairs of the cleavage site when a reference (eg, no control of palmity) oligonucleotide composition is used. In some embodiments, it is within 3 base pairs. In some embodiments, it is within 4 base pairs. In some embodiments, it is within 5 base pairs. In some embodiments, the provided palm-controlled oligonucleotide composition is cleavable at a base of 2 base pairs downstream of the palmar center of the R p S p S p backbone in the target molecule. One of the major cleavage sites when referring to (e.g., not controlling palmarity) oligonucleotide compositions. In some embodiments, such a site is the cleavage site that has the highest percent cleavage when a reference (eg, no control of palmarity) oligonucleotide composition is used. In some embodiments, the provided palm-controlled oligonucleotide composition is cleavable at a base of 2 base pairs downstream of the palmar center of the R p S p S p backbone in the target molecule. One of the cleavage sites with a higher rate of cleavage when referring to (e.g., not controlling for palmity) oligonucleotide compositions. In some embodiments, such a site is the cleavage site that has the highest rate of cleavage when a reference (eg, does not control palmarity) oligonucleotide composition is used.

In some embodiments, the provided palm-controlled oligonucleotide composition enhances cleavage at one or more sites, eg, relative to a reference (eg, does not control palmar/stereoregular) For the nucleotide composition. In some embodiments, the provided palm-controlled oligonucleotide composition is selectively enhanced for cleavage at a single site relative to a reference (eg, without controlling a palm/stereoregular) composition. In some embodiments, the palm-controlled oligonucleotide composition enhances cleavage at the site by providing a higher rate of cleavage. In some embodiments, the palm-controlled oligonucleotide composition enhances cleavage at the site by providing a higher percentage of cleavage at the site. The percent cleavage at the site can be determined by a variety of widely known and practiced methods in the art. In some embodiments, the percent cleavage at the site is determined by analysis of the cleavage product, such as by HPLC-MS, as shown in Figures 18, 19, and 30; see also an exemplary cleavage map, such as 9, FIG. 10, FIG. 11, FIG. 14, FIG. 22, FIG. 25 and FIG. In some embodiments, the enhancer is relative to a reference oligonucleotide set For the compound. In some embodiments, the booster is relative to another cleavage site. In some embodiments, the cleavage at the enhanced site of the palm-controlled oligonucleotide composition is provided, which is the preferred cleavage site for the reference oligonucleotide composition. In some embodiments, a preferred cleavage site or set of preferred cleavage sites is a site having a relatively high percentage of lysis compared to one or more other cleavage sites. In some embodiments, a preferred cleavage site can indicate the preference of the enzyme. For example, with respect to ribonuclease H, when a DNA oligonucleotide is used, the resulting cleavage site can indicate the preference of ribonuclease H. In some embodiments, the provided cleavage at the site of the palm-controlled oligonucleotide composition is enhanced, which is the preferred cleavage site for the enzyme. In some embodiments, the provided cleavage at the site of the palm-controlled oligonucleotide composition is not a preferred cleavage site for the reference oligonucleotide composition. In some embodiments, the provided cleavage at the site of the palm-controlled oligonucleotide composition is enhanced, which is not the cleavage site of the reference oligonucleotide composition; effectively creating a new cleavage site At the point, the new cleavage site was not present when the reference oligonucleotide composition was used. In some embodiments, the provided palm-controlled oligonucleotide composition enhances cleavage at a site within a mutation or SNP 5 base pair targeted thereby, thereby increasing undesirable oligonucleotides Selective cleavage of glycosides. In some embodiments, the provided palm-controlled oligonucleotide composition enhances cleavage at a site within a mutation or SNP 4 base pair targeted thereby, thereby increasing undesirable target oligo Selective cleavage of glycosides. In some embodiments, the provided palm-controlled oligonucleotide composition enhances cleavage at a site within a mutation or SNP 3 base pair targeted thereby, thereby increasing undesirable target oligo Selective cleavage of glycosides. In some embodiments, the provided palm-controlled oligonucleotide composition enhances cleavage at a site within a mutation or SNP 2 base pair targeted thereby, thereby increasing undesirable target oligo Selective cleavage of glycosides. In some embodiments, the provided palm-controlled oligonucleotide composition enhances cleavage just at the site of the targeted mutation or SNP upstream or downstream, thereby increasing undesirable oligonucleotides of interest. Selective cleavage (eg, Figure 22, panel D, muRNA).

In some embodiments, the provided palm-controlled oligonucleotide composition inhibits cleavage at one or more sites, eg, relative to a reference (eg, does not control palmar/stereoregular) oligo For the glycoside composition. In some embodiments, the provided palm-controlled oligonucleotide composition is selectively inhibited from cleavage at a single site relative to a reference (eg, without controlling a palm/stereoregular) composition. . In some embodiments, the palm-controlled oligonucleotide composition inhibits cleavage at the site by providing a lower rate of cleavage. In some embodiments, the palm-controlled oligonucleotide composition inhibits cleavage at the site by providing a lower percentage of cleavage at the site. In some embodiments, the inhibition is relative to a reference oligonucleotide composition. In some embodiments, the inhibition is relative to another cleavage site. In some embodiments, the cleavage at the inhibition site of the palm-controlled oligonucleotide composition is provided, which is the preferred cleavage site for the reference oligonucleotide composition. In some embodiments, a preferred cleavage site or set of preferred cleavage sites is a site having a relatively high percentage of lysis compared to one or more other cleavage sites. In some embodiments, a preferred cleavage site can indicate the preference of the enzyme. For example, with respect to ribonuclease H, when a DNA oligonucleotide is used, the resulting cleavage site can indicate the preference of ribonuclease H. In some embodiments, the provided cleavage at the site of inhibition of the palm-controlled oligonucleotide composition is the preferred cleavage site for the enzyme. In some embodiments, the provided cleavage at the inhibition site of the palm-controlled oligonucleotide composition is not a preferred cleavage site for the reference oligonucleotide composition. In some embodiments, the provided palm-controlled oligonucleotide composition is provided to inhibit all cleavage sites of the reference oligonucleotide composition. In some embodiments, the provided palm-controlled oligonucleotide composition generally enhances cleavage of the target oligonucleotide. In some embodiments, the provided palm-controlled oligonucleotide composition generally inhibits cleavage of a non-target oligonucleotide. In some embodiments, the provided palm-controlled oligonucleotide composition provides for cleavage of the target oligonucleotide and inhibition of cleavage of the non-target oligonucleotide. Using Figure 22, Panel D, for example, the target oligonucleotide for cleavage is a muRNA, and the non-target oligonucleotide is a wtRNA. In an individual who contains a diseased tissue containing a mutation or SNP, The target oligonucleotide for cleavage may be a transcript containing a mutation or SNP, and the non-target oligonucleotide may be a normal transcript free of mutations or SNPs, such as those transcripts expressed in healthy tissues.

In some embodiments, the reference oligonucleotide composition is a stereoregular oligonucleotide composition. In some embodiments, the reference oligonucleotide composition is a stereospecific composition of oligonucleotides in which all of the internucleotide linkages are phosphorothioate. In some embodiments, the reference oligonucleotide composition is a DNA oligonucleotide composition having all phosphate linkages.

In some embodiments, in addition to the backbone-to-palm central mode described herein, the provided oligonucleotides optionally comprise modified bases, modified sugars, modified backbone linkages And any combination thereof. In some embodiments, the provided oligonucleotides are monomeric, alternan, block, spacer, semimer, and skip. In some embodiments, provided oligonucleotides comprise one or more monomeric, alternan, block, spacer, semimer or skip moiety or any combination thereof. In some embodiments, the oligonucleotides provided are semi-polymers other than the backbone-to-palm center mode herein. In some embodiments, in addition to the backbone to palmar center mode herein, the oligonucleotide provided is a 5'-hemimer containing a modified sugar moiety. In some embodiments, the provided oligonucleotide is a 5'-hemimer containing a 2'-modified sugar moiety. Suitable modifications are widely known in the art, such as those described in the present application. In some embodiments, the modification is 2'-F. In some embodiments, the modification is 2'-MOE. In some embodiments, the modification is s-cEt.

In some embodiments, the invention provides a method for inhibiting a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences are present in a population, the target sequence and the like sequence each containing a specificity A nucleotide signature sequence element that defines a target sequence relative to a similar sequence, the method comprising the steps of: contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide composition comprising an oligonucleotide having: : 1) a common base sequence and length; 2) a common backbone linkage mode; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a target nucleic acid sequence, the composition being characterized by its transcription with a nucleic acid sequence comprising the target nucleic acid sequence When the system is in contact, the transcript of the target nucleic acid sequence is inhibited to a greater extent than is observed by similar nucleic acid sequences.

In some embodiments, the invention provides a method for inhibiting a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences are present in a population, the target sequence and the like sequence each containing a specificity A nucleotide signature sequence element that defines a target sequence relative to a similar sequence, the method comprising the steps of: contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide composition comprising an oligonucleotide having: : 1) a common base sequence and length; and 2) a common backbone linkage pattern; 3) a common backbone pair palmar central pattern; wherein the common base sequence is or comprises a complementary sequence element that defines the target nucleic acid sequence Sequence, the composition is characterized in that when it is contacted with a system comprising a target nucleic acid sequence and a transcript of a similar nucleic acid sequence, the transcript of the target nucleic acid sequence is inhibited to a greater extent than that observed with a similar nucleic acid sequence.

In some embodiments, the common base sequence is or comprises a sequence that is 100% complementary to a characteristic sequence element. In some embodiments, inhibition can be assessed by various suitable assays known to those of ordinary skill in the art. In some embodiments, the assay is a ribonuclease H assay as described in the present invention, which can be used to assess cleavage of sequences present in a transcript of a target nucleic acid sequence comprising a characteristic sequence element and transcripts of similar sequences The cleavage of the sequences present in the sequence is used to assess inhibition. In some embodiments, the transcript of the target nucleic acid sequence is inhibited to a greater extent than is observed by any of the similar nucleic acid sequences. In some embodiments, exemplary target sequences and similar sequences are described in the present invention.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide A characteristic sequence element that defines a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising an oligonucleotide having the following Composition contact: 1) a common base sequence and length; and 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by When it is in contact with a system comprising a target dual gene and a transcript of another pair of genes of the same nucleic acid sequence, the transcript of the specific dual gene is inhibited to a greater extent than is observed by another pair of genes of the same nucleic acid sequence. degree.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide A characteristic sequence element that defines a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising a particular oligonucleotide type Contacting the palm-controlled oligonucleotide composition, the oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common Main chain versus palm center mode; the composition is controlled for palmarity because it has the same base sequence and is long For substantially racemic preparations of oligonucleotides, the oligonucleotides of a particular oligonucleotide type are enriched in the composition; wherein the common bases of the oligonucleotides of a particular oligonucleotide type A sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by a specific dual when it is contacted with a system comprising a target dual gene and a transcript of another pair of genes of the same nucleic acid sequence The transcript of the gene is inhibited to a greater extent than is observed by the other pair of genes of the same nucleic acid sequence.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide A characteristic sequence element that defines a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising a particular oligonucleotide type Contacting the palm-controlled oligonucleotide composition, the oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common Main chain-to-palm central mode; the composition is palm-controlled because of the specific oligo in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length Nucleotide type oligonucleotide enrichment; wherein the common base sequence of an oligonucleotide of a particular oligonucleotide type is or comprises a complementary to a characteristic sequence element defining a particular dual gene a sequence characterized in that, when it is contacted with a system comprising a target dual gene and a transcript of another pair of genes of the same nucleic acid sequence, the transcript of the specific dual gene is inhibited to a greater extent than the same nucleic acid sequence The degree of inhibition observed by a pair of even genes, This contact is performed under conditions that allow the composition to inhibit the transcript of a particular dual gene.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide A characteristic sequence element that defines a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising an oligonucleotide having the following Composition contact: 1) a common base sequence and length; 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by When it is contacted with a system comprising a transcript of the same target nucleic acid sequence, it exhibits inhibition of the transcript of a particular dual gene to the extent that: a) greater than the absence of the composition; b) another dual gene greater than the same nucleic acid sequence The degree of inhibition observed; or c) greater than the absence of the composition, and greater than the other pair of identical nucleic acid sequences The degree of inhibition observed by the gene.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide A characteristic sequence element that defines a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising a particular oligonucleotide type Contact with a palm-controlled oligonucleotide composition, the particular oligonucleotide type The oligonucleotides are characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone-to-palm center mode; the composition is controlled by palmarity because An oligonucleotide of a particular oligonucleotide type in the composition is enriched relative to a substantially racemic formulation of an oligonucleotide having the same base sequence and length; wherein a particular oligonucleotide type The common base sequence of the oligonucleotide is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by its display when it is contacted with a system comprising a transcript of the same target nucleic acid sequence The transcript of a particular dual gene is inhibited to the extent that: a) greater than the absence of the composition; b) greater than the degree of inhibition observed by another pair of genes of the same nucleic acid sequence; or c) greater than when the composition is absent, and The degree of inhibition observed by another pair of genes greater than the same nucleic acid sequence.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual gene, wherein a plurality of dual genes are present in the population, each of which contains a specific nucleotide A characteristic sequence element that defines a dual gene relative to other dual genes of the same target nucleic acid sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising a particular oligonucleotide type Contacting the palm-controlled oligonucleotide composition, the oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common Main chain to palm center mode; The composition is palm-controlled because of the specific oligonucleotide type of oligonucleoside in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length. Acid enrichment; wherein the common base sequence of an oligonucleotide of a particular oligonucleotide type is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized in that it contains the same target Upon systemic contact of a transcript of a nucleic acid sequence, it is shown to inhibit the transcript of a particular dual gene to the extent that a) is greater than the absence of the composition; b) the degree of inhibition observed by another pair of genes greater than the same nucleic acid sequence Or c) greater than the degree of inhibition observed in the absence of the composition and greater than the other dual gene of the same nucleic acid sequence, which is performed under conditions that permit the composition to inhibit the transcript of the particular dual gene.

In some embodiments, the transcript is inhibited by cleavage of the transcript. In some embodiments, the specific nucleotide signature sequence elements are in an intron. In some embodiments, a specific nucleotide signature sequence element is in an exon. In some embodiments, the specific nucleotide signature sequence element is partially in an exon and partially in an intron. In some embodiments, a specific nucleotide signature sequence element comprises a mutation that distinguishes between a pair of even genes and other dual genes. In some embodiments, the mutation is a deletion. In some embodiments, the mutation is an insertion. In some embodiments, the mutation is a point mutation. In some embodiments, the specific nucleotide signature sequence element comprises at least one single nucleotide polymorphism (SNP) that distinguishes between a pair of even genes and other dual genes.

In some embodiments, the target nucleic acid sequence is a gene of interest.

In some embodiments, the invention provides a method for a gene comprising at least one single nucleotide polymorphism (SNP) in a dual gene-specific inhibitory sequence, the method comprising providing a palm-controlled oligonucleoside An acid composition comprising an oligarch having the following definition Nucleotide: 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is fully complementary to the sequence present in the transcript from the first pair of genes, but is transcribed from the second pair of genes. Sequences in which the corresponding sequences are not complementary, wherein the sequences present in the transcripts comprise SNP sites; 2) a common backbone linkage pattern; 3) a common backbone pair palmar central pattern, the composition being substantially a pure single oligonucleotide preparation, as at least about 10% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common backbone-to-palm center mode; The symmetry of a pair of even genes is inhibited by at least five times greater than the transcript from the second pair of genes.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: contacting a sample comprising a transcript of the gene of interest with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and length; 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by When the target dual gene is systematically contacted with the transcript of another pair of genes of the same gene, the transcript of the specific dual gene is inhibited to at least twice the degree of inhibition observed by the other pair of genes of the same gene.

In some embodiments, the invention provides a method for specifically inhibiting a transcript of a target gene for a dual gene, for which a plurality of dualities are present within the population Genes each containing a specific nucleotide signature sequence element that defines the dual gene relative to other dual genes of the same target gene, the method comprising the steps of: constituting a sample comprising the transcript of the target gene with a specific oligo Nucleotide-type oligonucleotides are contacted with a palm-controlled oligonucleotide composition of the particular oligonucleotide type characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone-to-palm central mode; the composition is controlled by palmarity because of substantially racemization relative to oligonucleotides having the same base sequence and length In the case of a formulation, the composition is enriched in an oligonucleotide of the particular oligonucleotide type; wherein the common base sequence of the oligonucleotide of the particular oligonucleotide type is or comprises a feature defining a particular dual gene A sequence complementary to a sequence element, the composition characterized in that, when it is contacted with a system comprising a target dual gene and a transcript of another pair of genes of the same gene, the transcript of the specific dual gene is inhibited At least 2-fold greater than to another of the same gene inhibition observed degree of alleles.

In some embodiments, the invention provides a method for specifically inhibiting a transcript of a target gene for a dual gene, for which a plurality of dual genes are present in a population, each of which contains a specific nucleotide signature sequence element The element defines the dual gene relative to other dual genes of the same target gene, the method comprising the steps of: aligning a sample comprising the transcript of the target gene with an oligonucleotide comprising a particular oligonucleotide type The controlled oligonucleotide composition is contacted, and the oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone pair Palm center mode; The composition is palm-controlled because the composition is enriched in the particular oligonucleotide type relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length. a nucleotide; wherein the common base sequence of the oligonucleotide of the particular oligonucleotide type is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by When the dual gene and the transcript of another pair of genes of the same gene are contacted, the transcript of the specific dual gene is inhibited to at least 2 times greater than the degree of inhibition observed by another pair of genes of the same gene, the contact system Execution is performed under conditions that permit the composition to inhibit transcripts of the particular dual gene.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: reacting a sample comprising a transcript of the target gene with an oligonucleotide comprising a particular oligonucleotide type The oligonucleotides of the particular oligonucleotide type are characterized by: 1) a common base sequence and length; 2) a common backbone linkage pattern; 3) a common backbone pair Sex central mode; the composition is palm-controlled because of the specific oligonucleotide type in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length Oligonucleotide enrichment; wherein the common base sequence of an oligonucleotide of a particular oligonucleotide type is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition Characterized in that, when combined with other performance goals for the alleles of the same gene and transcription product of the allele At systemic contact, the transcript of a particular dual gene is inhibited to a degree that is at least 2-fold greater than that observed for another pair of genes of the same gene that determines the conditions under which the composition is allowed to inhibit the expression of a particular dual gene. Execute.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: contacting a sample comprising a transcript of the gene of interest with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and length; and 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by Upon systemic exposure of a transcript of a gene of interest, it is shown to inhibit the expression of a transcript of a particular dual gene to the extent that: a) the amount of transcript from a particular dual gene detected is at least 2-fold different, the presence of the composition Reduced by a factor of 2 relative to the absence of the composition; b) at least greater than that observed for the other pair of genes of the same gene 2 times; or c) the amount of transcripts detected from a particular dual gene is at least 2-fold different, the composition is reduced by a factor of 2 compared to the absence of the composition, and is more than another pair of genes of the same gene. The degree of inhibition observed was at least 2 times greater.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: Contacting a sample comprising a transcript of a gene of interest with a palm-controlled oligonucleotide composition comprising an oligonucleotide of a particular oligonucleotide type, the characteristics of the oligonucleotide of the particular oligonucleotide type It consists of: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone-to-palm center mode; the composition is controlled by palmarity because it has the same base sequence And a substantially racemic preparation of oligonucleotides of a length, wherein the oligonucleotide of a particular oligonucleotide type is enriched in the composition; wherein the common base of the oligonucleotide of the particular oligonucleotide type The base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by inhibiting transcription of a particular dual gene to the extent that it contacts the system of the transcript of the target gene Performance of the substance: a) the amount of transcript from the specific dual gene detected is at least 2-fold different, the composition is reduced by a factor of 2 compared to the absence of the composition; b) the other pair of genes of the same gene Observed inhibition At least 2 times greater; or c) the amount of transcripts detected from a particular dual gene differs by at least 2 fold, the composition is reduced by a factor of 2 relative to the absence of the composition, and is greater than the other of the same gene The degree of inhibition observed by the dual gene is at least 2-fold greater.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: reacting a sample comprising a transcript of the target gene with an oligonucleotide comprising a particular oligonucleotide type The oligonucleotide of the particular oligonucleotide type is characterized by the control oligonucleotide composition being: 1) common base sequence and length; 2) common backbone linkage mode; 3) common backbone versus palm center mode; the composition is palm-controlled because of the same base sequence and length For a substantially racemic preparation of an oligonucleotide, the oligonucleotide of a particular oligonucleotide type is enriched in the composition; wherein the common base sequence of the oligonucleotide of a particular oligonucleotide type Or comprising a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized in that, when it is contacted with a system that exhibits a transcript of the gene of interest, it exhibits inhibition of the transcript of the particular dual gene to the extent that Performance: a) the amount of transcripts from a particular dual gene detected is at least 2-fold different, the composition is reduced by a factor of 2 compared to the absence of the composition; b) is observed over another pair of genes of the same gene The degree of inhibition is at least 2 times greater; or c) the amount of transcripts detected from a particular dual gene is at least 2-fold different, and the composition is reduced by a factor of 2 compared to the absence of the composition, and is greater than the same gene Another pair Observed because of the large degree of inhibition of at least 2-fold, allowing this contact is determined based on the composition inhibits performed under conditions of a specific allele of the transcript.

In some embodiments, the invention provides a method for specifically inhibiting a transcript from a target gene for a dual gene, wherein a plurality of dual genes each having a specific nucleotide signature sequence are present in the population An element that defines a dual gene relative to other dual genes of the same target gene, the method comprising the steps of: reacting a sample comprising a transcript of the target gene with an oligonucleotide comprising a particular oligonucleotide type The oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and a length; 2) a common backbone linkage mode; 3) a common backbone versus palm center mode; the composition is palm-controlled because it is substantially external to an oligonucleotide having the same base sequence and length In the case of a racemic formulation, the oligonucleotide of a particular oligonucleotide type is enriched in the composition; wherein the common base sequence of the oligonucleotide of a particular oligonucleotide type is or comprises and defines a specific dual gene A sequence complementary to a characteristic sequence element, the composition being characterized by, when contacted with a system expressing a transcript of the gene of interest, which exhibits inhibition of the expression of a transcript of a particular dual gene to the extent that: a) detected The amount of transcript from a particular dual gene differs by at least a factor of two, and in the presence of the composition, is reduced by a factor of 2 relative to the absence of the composition; b) is at least 2-fold greater than that observed for the other pair of genes of the same gene; Or c) the amount of transcripts from a particular dual gene detected is at least 2-fold different, the composition is reduced by a factor of 2 relative to the absence of the composition, and is observed by another pair of genes of the same gene. Degree of inhibition At least 2-fold, of the contact based determination executed at inhibiting composition allows performance of a particular allele of conditions.

As described herein, in some embodiments, in the methods provided, the contact system is performed under conditions that determine that the composition is allowed to inhibit transcripts of a particular dual gene. In some embodiments, the contact system is performed under conditions that determine that the composition is allowed to inhibit the performance of a particular dual gene.

In some embodiments, the transcript of a particular dual gene is inhibited to a greater extent than when the composition is absent. In some embodiments, the degree of inhibition of the transcript of a particular dual gene is at least 1.1 times greater than when the composition is absent, as the amount of transcript from the specific dual gene detected is relative to the absence of the composition in the presence of the composition. The composition is at least 1.1 times lower. In some embodiments, the extent is at least 1.2 times. In some embodiments, the extent is at least 1.3 times. In some embodiments, the extent is at least 1.4 times. In some embodiments, degree At least 1.5 times. In some embodiments, the extent is at least 1.6 times. In some embodiments, the extent is at least 1.7 times. In some embodiments, the extent is at least 1.8 times. In some embodiments, the extent is at least 1.9 times. In some embodiments, the extent is at least 2 times. In some embodiments, the extent is at least 3 times. In some embodiments, the extent is at least 4 times. In some embodiments, the extent is at least 5 times. In some embodiments, the extent is at least 6 times. In some embodiments, the extent is at least 7 times. In some embodiments, the extent is at least 8 times. In some embodiments, the extent is at least 9 times. In some embodiments, the extent is at least 10 times. In some embodiments, the extent is at least 11 times. In some embodiments, the extent is at least 12 times. In some embodiments, the extent is at least 13 times. In some embodiments, the extent is at least 14 times. In some embodiments, the extent is at least 15 times. In some embodiments, the extent is at least 20 times. In some embodiments, the extent is at least 30 times. In some embodiments, the extent is at least 40 times. In some embodiments, the extent is at least 50 times. In some embodiments, the extent is at least 75 times. In some embodiments, the extent is at least 100 times. In some embodiments, the extent is at least 150 times. In some embodiments, the extent is at least 200 times. In some embodiments, the extent is at least 300 times. In some embodiments, the extent is at least 400 times. In some embodiments, the extent is at least 500 times. In some embodiments, the extent is at least 750 times. In some embodiments, the extent is at least 1000 times. In some embodiments, the extent is at least 5000 times.

In some embodiments, the degree of inhibition of a transcript of a particular dual gene is greater than the degree of inhibition observed by another pair of genes of the same nucleic acid sequence. In some embodiments, the degree of inhibition of a transcript of a particular dual gene is at least 1.1 fold greater than that observed by another pair of genes of the same nucleic acid sequence. In some embodiments, the extent is at least 1.2 times. In some embodiments, the extent is at least 1.3 times. In some embodiments, the extent is at least 1.4 times. In some embodiments, the extent is at least 1.5 times. In some embodiments, the extent is at least 1.6 times. In some embodiments, the extent is at least 1.7 times. In some embodiments, the extent is at least 1.8 times. In some embodiments, the extent is at least 1.9 times. In some In the examples, the degree is at least 2 times. In some embodiments, the extent is at least 3 times. In some embodiments, the extent is at least 4 times. In some embodiments, the extent is at least 5 times. In some embodiments, the extent is at least 6 times. In some embodiments, the extent is at least 7 times. In some embodiments, the extent is at least 8 times. In some embodiments, the extent is at least 9 times. In some embodiments, the extent is at least 10 times. In some embodiments, the extent is at least 11 times. In some embodiments, the extent is at least 12 times. In some embodiments, the extent is at least 13 times. In some embodiments, the extent is at least 14 times. In some embodiments, the extent is at least 15 times. In some embodiments, the extent is at least 20 times. In some embodiments, the extent is at least 30 times. In some embodiments, the extent is at least 40 times. In some embodiments, the extent is at least 50 times. In some embodiments, the extent is at least 75 times. In some embodiments, the extent is at least 100 times. In some embodiments, the extent is at least 150 times. In some embodiments, the extent is at least 200 times. In some embodiments, the extent is at least 300 times. In some embodiments, the extent is at least 400 times. In some embodiments, the extent is at least 500 times. In some embodiments, the extent is at least 750 times. In some embodiments, the extent is at least 1000 times. In some embodiments, the extent is at least 5000 times.

In some embodiments, the transcript of a particular dual gene is inhibited to a greater extent than when the composition is absent, and to a greater extent than is observed by another pair of genes of the same nucleic acid sequence. In some embodiments, the degree of inhibition of a transcript of a particular dual gene is at least 1.1 fold greater than when the composition is absent, and at least 1.1 fold greater than the degree of inhibition observed for another dual gene of the same nucleic acid sequence. In some embodiments, each multiple is independently as described above.

In some embodiments, the system is a composition comprising a transcript. In some embodiments, the system is a composition comprising transcripts from different dual genes. In some embodiments, the system can be in vivo or ex vivo, and any of these can include one or more cells, tissues, organs, or organisms. In some embodiments, the system comprises one or more cells. In some embodiments, the system includes one or more organizations. In some embodiments, the system comprises one or more organs. In some embodiments, the system comprises one or more organisms. In some embodiments, the system is an individual.

In some embodiments, inhibition of transcripts or inhibition of the expression of a dual gene that transcribes a transcript can be measured in an in vitro assay. In some embodiments, a sequence from a transcript and comprising a specific nucleotide signature sequence element is used in the analysis in place of the full length transcript. In some embodiments, the analysis is a biochemical analysis. In some embodiments, the assay is a biochemical assay in which a nucleic acid polymer (eg, a transcript or a sequence from a transcript and comprising a specific nucleotide signature sequence element) is tested in a palm-controlled oligonucleotide composition Lysis by enzymes in the presence.

In some embodiments, the provided pair of palm-controlled oligonucleotide compositions are administered to an individual. In some embodiments, the individual is an animal. In some embodiments, the individual is a plant. In some embodiments, the individual is a human.

In some embodiments, with respect to dual gene-specific inhibition of a transcript from a particular dual gene, the transcript is cleaved at a site near a sequence difference (eg, a mutation) within a specific nucleotide signature element, the sequence difference Transcripts from specific dual genes can be distinguished from transcripts from other dual genes. In some embodiments, the transcript is selectively cleaved at a site near such sequence differences. In some embodiments, the percentage of cleavage of the transcript at a site near such sequence differences is higher than when using an oligonucleotide composition that does not control palmarity. In some embodiments, the transcript is cleaved at a site with sequence differences. In some embodiments, the transcript is cleaved only at a site with sequence differences within the specific nucleotide signature element. In some embodiments, the transcript is cleaved at a site within 5 base pairs downstream or upstream of the sequence difference. In some embodiments, the transcript is cleaved at a site within 4 base pairs downstream or upstream of the sequence difference. In some embodiments, the transcript is cleaved at a site within 3 base pairs downstream or upstream of the sequence difference. In some embodiments, the transcript is cleaved at a site within 2 base pairs downstream or upstream of the sequence difference. In some embodiments, the transcript is cleaved at a site within 1 base pair downstream or upstream of the sequence difference. In some embodiments, the transcript is at a position within 5 base pairs downstream of the sequence difference Lysis. In some embodiments, the transcript is cleaved at a site within 4 base pairs downstream of the sequence difference. In some embodiments, the transcript is cleaved at a position within 3 base pairs downstream of the sequence difference. In some embodiments, the transcript is cleaved at a site within 2 base pairs downstream of the sequence difference. In some embodiments, the transcript is cleaved at a site within 1 base pair downstream of the sequence difference. In some embodiments, the transcript is cleaved at a position within 5 base pairs upstream of the sequence difference. In some embodiments, the transcript is cleaved at a position within 4 base pairs upstream of the sequence difference. In some embodiments, the transcript is cleaved at a position within 3 base pairs upstream of the sequence difference. In some embodiments, the transcript is cleaved at a position within 2 base pairs upstream of the sequence difference. In some embodiments, the transcript is cleaved at a position within 1 base pair upstream of the sequence difference. In the absence of the palm-controlled oligonucleotide composition and method thereof provided by the Applicant in the present invention, such precise control of the cleavage pattern and resulting high selectivity from transcripts of a particular dual gene Suppression will be impossible.

In some embodiments, the invention provides methods for treating an individual or preventing a disease in a subject by specifically inhibiting a transcript from a particular dual gene, such as a dual gene that causes or can cause disease. In some embodiments, the invention provides a method for treating an individual having a disease comprising administering to the individual a pharmaceutical composition comprising a palmitic controlled oligonucleotide composition, wherein from causing or contributing to a disease The transcript of the dual gene is selectively inhibited. In some embodiments, the invention provides a method for treating an individual afflicted with a disease comprising administering to the individual a pharmaceutical composition comprising a palm-controlled oligonucleotide composition, wherein the disease-derived dual gene is derived The transcript is selectively inhibited. In some embodiments, the invention provides a method for treating an individual afflicted with a disease comprising administering to the individual a pharmaceutical composition comprising a palm-controlled oligonucleotide composition, wherein the disease-derived dual gene is derived The transcript is selectively inhibited. In some embodiments, the invention provides a method for treating an individual afflicted with a disease comprising administering to the individual a pharmaceutical composition comprising a palm-controlled oligonucleotide composition, wherein the disease-related duality is The transcript of the gene is selectively inhibited. In some embodiments, the invention provides A method for preventing a disease in an individual by specifically inhibiting a transcript derived from a specific dual gene which causes disease. In some embodiments, the invention provides methods for preventing a disease in a subject by specifically inhibiting a transcript from a particular dual gene that increases the risk of the disease in the individual. In some embodiments, a method provided comprises administering to a subject a pharmaceutical composition comprising a palm-controlled oligonucleotide composition. In some embodiments, the pharmaceutical composition further comprises a pharmaceutical carrier.

In some embodiments, the nucleotide signature sequence comprises a mutation that defines a target sequence relative to other similar sequences. In some embodiments, a nucleotide signature sequence comprises a point mutation that defines a target sequence relative to other similar sequences. In some embodiments, the nucleotide signature sequence comprises a SNP that defines a target sequence relative to other similar sequences.

In some embodiments, the invention provides a method for the preparation of an oligonucleotide composition for selectively inhibiting a transcript of a target nucleic acid sequence, the method comprising providing an oligonucleotide composition comprising a predetermined amount Oligonucleotides of a particular oligonucleotide type, characterized by: 1) a common base sequence; 2) a common backbone linkage mode; and 3) a common backbone pair palm center mode, which includes ( S p) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , wherein m, n, t, N p are each independently as defined and described herein; wherein the target nucleic acid sequence comprises a characteristic sequence element defining a target nucleic acid sequence relative to a similar nucleic acid sequence; wherein the common base sequence is a DNA cleavage pattern and The stereotactic random cleavage mode has a sequence of cleavage sites in or near the characteristic sequence elements.

In some embodiments, the invention provides a method for the preparation of an oligonucleotide composition for selectively inhibiting a transcript of a target nucleic acid sequence, the method comprising providing an oligonucleotide composition comprising a predetermined amount Oligonucleotides of a particular oligonucleotide type, characterized by: 1) a common base sequence; 2) a common backbone linkage mode; and 3) a common backbone pair palm center mode, which includes ( S p) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , wherein m, n, t, N p are each independently as defined and described herein; wherein the target nucleic acid sequence comprises a characteristic sequence element defining a target nucleic acid sequence relative to a similar nucleic acid sequence; wherein the common base sequence is a DNA cleavage pattern and The stereotactic random cleavage mode has a sequence of major cleavage sites in or near the characteristic sequence elements.

In some embodiments, the common backbone-to-palm center mode includes ( S p) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) as described above _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m . In some embodiments, the backbone comprises a common chiral center mode as described above _{(S p) m (R p} ) n. In some embodiments, the common backbone-to-palm center mode comprises ( R p) _n ( S p) _m as described above. In some embodiments, the common backbone-to-palm center mode comprises ( N p) _t ( R p) _n ( S p) _m as described above. In some embodiments, the common backbone-to-palm center mode includes ( S p) _t ( R p) _n ( S p) _m as described above. In some embodiments, n is one. In some embodiments, m>2. In some embodiments, n is 1 and m>2. In some embodiments, t>2. In some embodiments, n is 1, m > 2, and t > 2.

In some embodiments, oligonucleotides of a particular oligonucleotide type have a wing-core structure. In some embodiments, oligonucleotides of a particular oligonucleotide type have a core-wing structure. In some embodiments, oligonucleotides of a particular oligonucleotide type have a wing-core-wing structure. In some embodiments, each sugar moiety in the wing region has a sugar modification. In some embodiments, each sugar moiety in the wing region has a 2' modification. In some embodiments, the sugar moiety of each flap in the region having a 2 'modification, wherein the 2' modification is a 2'-OR ^1, wherein R ¹ is the optionally substituted C _1-6 alkyl. In some embodiments, each sugar moiety in the wing region has a 2'-OMe. In some embodiments, each wing independently comprises a palmar internucleotide linkage and a native phosphate linkage. In some embodiments, the palmitic internucleotide linkage is a phosphorothioate. In some embodiments, on the wing - Core - wing structure, as WV-1092, the 5 'flap having at its 5' end nucleotide and S p between the 3 'ends of each of the two linkage and phosphate ester linkages between the person and the 3 'wing has at its 3' rest of the linkage between the end of the S p internucleotide linkage, and the nucleotide is a phosphate. Other embodiments of the wings and/or core (e.g., sugar modification, stereochemistry, etc.) are described in the present invention.

Common base sequences having sequences of cleavage sites within or adjacent to a target nucleic acid sequence as a DNA cleavage mode and/or a stereoregular cleavage mode are broadly described in the present invention. In some embodiments, the cleavage site in or near the target nucleic acid sequence is a cleavage site in the vicinity of a mutation that defines a target sequence relative to a similar sequence. In some embodiments, the cleavage site within or adjacent to the target nucleic acid sequence is a cleavage site near a SNP that defines a target sequence relative to a similar sequence. In some embodiments, as described above, there is a linkage between 0, 1, 2, 3, 4, 5 nucleotides away from the mutation or SNP near the mutation or SNP. Other embodiments are described above in the present invention.

In some embodiments, the common base sequence is a sequence of a DNA cleavage mode and/or a stereoregular cleavage mode having a major cleavage site within or adjacent to the target nucleic acid sequence. In some embodiments, the primary cleavage site is defined by absolute cleavage at the site (% of lysis at the site compared to the total target sequence). Other illustrative examples of major cleavage sites are described in the present invention. In some embodiments, as illustrated by Figure 33, the common base sequence (P12) can be identified by comparing the cleavage maps of the different sequences complementary to the characteristic sequence elements.

In some embodiments, the invention provides a method for preparing an oligonucleotide composition comprising a specific sequence of oligonucleotides, the composition providing selective inhibition of a transcript of a target sequence, comprising providing a specific oligo A palm-controlled oligonucleotide composition of a nucleotide type oligonucleotide characterized by: 1) a common base sequence identical to a particular sequence; 2) a common backbone linkage mode; and 3) a common main chain versus palm center mode, which includes ( S p) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , wherein: each n and t are independently 1, 2, 3, 4, 5, 6, 7, or 8; m is 2, 3, 4, 5 , 6, 7 or 8, and each N p is independently R p or Sp .

Diseases involving pathogenic dual genes are widely known in the art and include, but are not limited to, the diseases described in the following: Hohjoh, Pharmaceuticals 2013, 6 , 522-535; U.S. Patent Application Publications US 2013/0197061; Østergaard et al, Nucleic Acids Research 2013, 41 (21), 9634-9650; and Jiang et al, Science 2013, 342 , 111-114. In some embodiments, the disease is Huntington's disease. In some embodiments, the disease is human hypertrophic cardiomyopathy (HCM). In some embodiments, the disease is dilated cardiomyopathy. In some embodiments, the pathogenic dual gene is a dual gene of myosin heavy chain (MHC). In some embodiments, the exemplary disease is selected from the group consisting of:

In some embodiments, exemplary targets and diseases that can be treated by the provided palm-controlled oligonucleotide compositions and methods include:

In some embodiments, the oligonucleotide compositions and techniques described herein are particularly useful for treating Huntington's disease. For example, in some embodiments, the invention defines a stereochemically controlled oligonucleotide composition that directs cleavage of a nucleic acid associated with Huntington's disease (eg, ribonuclease H-mediated cleavage). In some embodiments, the compositions direct Huntington's disease-associated dual genes of a particular target sequence preferentially cleavage relative to one or more (eg, all non-Huntington's disease-related) other dual genes of the sequence.

In some embodiments, a method of treating or preventing Huntington's disease in an individual comprising administering to the individual a palm-controlled oligonucleotide composition comprising an oligonucleotide of a particular oligonucleotide type, The oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; and 3) a common backbone pair palm center mode; Controlled by palmarity, oligonucleotides of a particular oligonucleotide type are enriched in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length. In some embodiments, the oligonucleotides of a particular oligonucleotide type are the same. In some embodiments, the provided compositions are palm-controlled oligonucleotide compositions.

SNPs associated with Huntington's disease are widely known in the art. In some embodiments, the common base sequence is complementary to a nucleic acid sequence comprising a SNP associated with Huntington's disease. In some embodiments, the provided compositions selectively inhibit transcripts from disease-causing dual genes. In some embodiments, the provided compositions selectively cleave transcripts from disease-causing dual genes. Exemplary SNPs (target Huntington's sites) that can be targeted by the provided compositions are described herein.

In some embodiments, the target Huntington site is selected from the group consisting of rs9993542_C, rs362310_C, rs362303_C, rs10488840_G, rs363125_C, rs363072_A, rs7694687_C, rs363064_C, rs363099_C, rs363088_A, rs34315806_C, rs2298967_T, rs362272_G, rs362275_C, rs362306_G, rs3775061_A, rs1006798_A, rs16843804_C, rs3121419_C , rs362271_G, rs362273_A, rs7659144_C, rs3129322_T, rs3121417_G, rs3095074_G, rs362296_C, rs108850_C, rs2024115_A, rs916171_C, rs7685686_A, rs6844859_T, rs4690073_G, rs2285086_A, rs362331_T, rs363092_C, rs3856973_G, rs4690072_T, rs7691627_G, rs2298969_A, rs2857936_C, rs6446723_T, rs762855_A, rs1263309_T, rs2798296_G , rs363096_T, rs10015979_G, rs11731237_T, rs363080_C, rs2798235_G and rs362307_T. In some embodiments, the target Huntington site is selected from the group consisting of rs34315806_C, rs362273_A, rs362331_T, rs363099_C, rs7685686_A, rs362306_G, rs363064_C, rs363075_G, rs2276881_G, rs362271_G, rs362303_C, rs362322_A, rs363088_A, rs6844859_T, rs3025838_C, rs363081_G, rs3025849_A, rs3121419_C, rs2298967_T , rs2298969_A, rs16843804_C, rs4690072_T, rs362310_C, rs3856973_G, rs2530595_C, rs2530595_T and rs2285086_A. In some embodiments, the target Huntington site is selected from the group consisting of rs34315806_C, rs362273_A, rs362331_T, rs363099_C, rs7685686_A, rs362306_G, rs363064_C, rs363075_G, rs2276881_G, rs362271_G, rs362303_C, rs362322_A, rs363088_A, rs6844859_T, rs3025838_C, rs363081_G, rs3025849_A, rs3121419_C, rs2298967_T , rs2298969_A, rs16843804_C, rs4690072_T, rs362310_C, rs3856973_G and rs2285086_A. In some embodiments, the target Huntington site is selected from the group consisting of rs362331_T, rs7685686_A, rs6844859_T, rs2298969_A, rs4690072_T, rs2024115_A, rs3856973_G, rs2285086_A, rs363092_C, rs7691627_G, rs10015979_G, rs916171_C, rs6446723_T, rs11731237_T, rs362272_G, rs4690073_G, and rs363096_T. In some embodiments, the target Huntington site is selected from the group consisting of rs362267, rs6844859, rs1065746, rs7685686, rs362331, rs362336, rs2024115, rs362275, rs362273, rs362272, rs3025805, rs3025806, rs35892913, rs363125, rs17781557, rs4690072, rs4690074, rs1557210, rs363088 , rs362268, rs362308, rs362307, rs362306, rs362305, rs362304, rs362303, rs362302, rs363075, rs2530595 and rs2298969. In some embodiments, the target Huntington site is selected from the group consisting of rs362267, rs6844859, rs1065746, rs7685686, rs362331, rs362336, rs2024115, rs362275, rs362273, rs362272, rs3025805, rs3025806, rs35892913, rs363l25, rs17781557, rs4690072, rs4690074, rs1557210, rs363088 , rs362268, rs362308, rs362307, rs362306, rs362305, rs362304, rs362303, rs362302, rs363075 and rs2298969. In some embodiments, the target Huntington site is selected from:

In some embodiments, the palm-controlled oligonucleotide composition is targeted to two or more sites. In some embodiments, the two or more sites targeted are selected from the sites listed herein. In some embodiments, the targeted SNP is rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In some embodiments, the targeted SNP is rs362307, rs7685686, rs362268, or rs362306. In some embodiments, the targeted SNP is rs362307. In some embodiments, the targeted SNP is rs7685686. In some embodiments, the targeted SNP is not rs7685686. In some embodiments, the targeted SNP is rs362268. In some embodiments, the targeted SNP is rs362306.

In some embodiments, the palm-controlled oligonucleotide composition is capable of distinguishing between two dual genes of a particular SNP.

Both the WVE120101 and WV-1092 palm-controlled oligonucleotide compositions were able to distinguish between the wt version and the mutant version of SNP rs362307, which differed by one nt; WVE120101 and WV-1092 were combined with palm-controlled oligonucleotides. Significantly blocked the gene expression of the mutant dual gene, but did not block the gene expression of the wt-pair gene, while the stereoregular oligonucleotide composition WV-1497 could not significantly distinguish between the wt-pair gene and the mutant-type dual gene (see Figure 39D).

The palm-controlled oligonucleotide composition WV-2595 was also able to distinguish between the C-pair gene and the T-pair gene in SNP rs2530595, which differed by only one nt. The palm-controlled WV-2595 oligonucleotide composition significantly blocked the gene expression of the T-pair gene, but did not significantly block the gene expression of the C-pair gene, and the stereoregular oligonucleoside that could not significantly distinguish the dual gene The acid composition WV-2611 is different (see Figure 39F).

The palm-controlled oligonucleotide composition WV-2603 was able to distinguish between the C-pair gene and the T-pair gene of SNP rs362331, which differed by only one nt. The palm-controlled WV-2603 oligonucleotide composition significantly blocks the gene expression of the T-pair gene, but does not block the gene expression of the C-pair gene, and does not significantly distinguish the stereo-random oligonucleotide of the dual gene. Composition WV-2619 is different (see Figures 39A, 39B, 39C, and 39E).

In some embodiments, the provided composition for treating Huntington's disease is selected from Table N1, Table N2, Table N3, or Table N4. In some embodiments, the provided composition for treating Huntington's disease is selected from Table N1. In some embodiments, the provided composition for treating Huntington's disease is selected from Table N2. In some embodiments, the provided composition for treating Huntington's disease is selected from Table N3. In some embodiments, the provided composition for treating Huntington's disease is selected from Table N4. In some embodiments, the provided composition for treating Huntington's disease is selected from Table N1A, Table N2A, Table N3A, or Table N4A. In some embodiments, the provided group for treating Huntington's disease The compound is selected from Table N1A. In some embodiments, the provided composition for treating Huntington's disease is selected from Table N2A. In some embodiments, the provided composition for treating Huntington's disease is selected from Table N3A. In some embodiments, the provided composition for treating Huntington's disease is selected from Table N4A. In some embodiments, the provided compositions are selected from the group consisting of oligonucleotides having the sequences of WVE120101, WV-2603, WV-2595, WV-1510, WV-2378, and WV-2380; each of these It has been constructed and found to be very effective, for example, as demonstrated in in vitro dual luciferase reporter gene analysis. In some embodiments, the provided composition is a palm-controlled oligonucleotide composition of WVE120101, WV-2603, WV-2595, WV-1510, WV-2378, or WV-2380. In some embodiments, the provided composition is a palm-controlled oligonucleotide composition of WV-1092. In some embodiments, the provided composition is a WV-1510 pair of palm controlled oligonucleotide compositions. In some embodiments, the provided composition is a palm-controlled oligonucleotide composition of WV-2378. In some embodiments, the provided composition is a palm-controlled oligonucleotide composition of WV-2380. In some embodiments, the provided composition is a palm-controlled oligonucleotide composition of WV-2595. In some embodiments, the provided oligonucleotides comprise a base sequence, a backbone linkage pattern, a backbone to palm center pattern, and/or a chemical modification of any of the oligonucleotides disclosed herein (eg, The pattern of base modification, sugar modification, etc.).

In some embodiments, the provided compositions are not a combination of ONT-451, ONT-452, or ONT-450. In some embodiments, the provided compositions are not a composition of ONT-451. In some embodiments, the provided compositions are not a composition of ONT-452. In some embodiments, the provided compositions are not a composition of ONT-450. In some embodiments, the composition does not contain a predetermined amount of ONT-451 or ONT-452. In some embodiments, the composition does not contain a predetermined amount of ONT-451. In some embodiments, the composition does not contain a predetermined amount of ONT-452. In some embodiments, the oligonucleotide type is not ONT-451 or ONT-452. In some embodiments, the oligonucleotide type is not ONT-451. In a In some embodiments, the oligonucleotide type is not ONT-452. In some embodiments, the composition is not a palm-controlled oligonucleotide composition of ONT-451 or ONT-452. In some embodiments, the composition is not a pair of palm-controlled oligonucleotide compositions of ONT-451. In some embodiments, the composition is not a pair of palm-controlled oligonucleotide compositions of ONT-452.

In some embodiments, the methods provided improve the symptoms of Huntington's disease. In some embodiments, the methods provided slow the onset of Huntington's disease. In some embodiments, the methods provided slow the progression of Huntington's disease. In some embodiments, the method provided stops the progression of Huntington's disease. In some embodiments, the method provided cures Huntington's disease according to clinical criteria.

In some embodiments, the invention provides methods of identifying a patient for a given oligonucleotide composition. In some embodiments, the invention provides methods for stratifying a patient. In some embodiments, the methods provided comprise identifying mutations and/or SNPs associated with a disease-causing dual gene. For example, in some embodiments, a method is provided comprising identifying SNPs in an individual associated with an expanded CAG repeat sequence associated with Huntington's disease or causing Huntington's disease. In some embodiments, the methods provided comprise identifying SNPs in an individual that are associated with more than 35 CAG repeats in the Hennington protein. In some embodiments, the methods provided comprise identifying SNPs in an individual that are associated with more than 36 CAG repeats in Huntingtin. In some embodiments, the methods provided comprise identifying SNPs in an individual that are associated with more than 37 CAG repeats in Huntingtin. In some embodiments, the methods provided comprise identifying SNPs in an individual that are associated with more than 38 CAG repeats in Huntingtin. In some embodiments, the methods provided comprise identifying SNPs in an individual that are associated with more than 39 CAG repeats in Huntingtin. In some embodiments, the methods provided comprise identifying SNPs in an individual that are associated with more than 40 CAG repeats in Huntingtin.

In some embodiments, the individual has a SNP in the Huntington's gene. In some embodiments, the individual has a SNP, wherein one of the dual genes is aligned with the extended CAG repeat A closed mutant Huntingtin protein. In some embodiments, the individual has a SNP as described herein. In some embodiments, the individual has a SNP selected from the group consisting of rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In some embodiments, the individual has a SNP selected from the group consisting of rs362307, rs7685686, rs362268, or rs362306. In some embodiments, the individual has a SNP selected from the group consisting of rs362307. In some embodiments, the individual has a SNP selected from the group consisting of rs7685686. In some embodiments, the individual has a SNP selected from the group consisting of rs362268. In some embodiments, the individual has a SNP selected from the group consisting of rs362306.

In some embodiments, the oligonucleotide of the provided composition has a sequence that is complementary to a sequence comprising a SNP from a disease-causing dual gene (mutant), and the composition selectively inhibits the pathogenic dual gene expression. In some embodiments, the SNP is rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In some embodiments, the SNP is rs362307, rs7685686, rs362268, or rs362306. In some embodiments, the SNP is rs362307. In some embodiments, the SNP is rs7685686. In some embodiments, the SNP is rs362268. In some embodiments, the SNP is rs362306. In some embodiments, the SNP is rs2530595. In some embodiments, the SNP is rs362331.

As will be understood by those of ordinary skill in the art, various methods can be used to monitor the course of treatment. In some embodiments, the mutant HTT (mHTT) can be assessed from cerebrospinal fluid (Wild et al, Quantification of mutant Huntingtin protein in cerebrospinal fluid from Huntington's disease patients, J Clin Invest. 2015; 125(5): 1979-86 ) and can be used to monitor treatment. In some embodiments, the method can be used to determine and/or optimize a regimen, monitor a pharmacodynamic endpoint, and/or determine a dose and frequency, and the like.

It will be understood by those skilled in the art that the methods provided are applicable to any similar target that contains mismatches. In some embodiments, the mismatch is between the maternal gene and the paternal gene. Other exemplary targets for inhibiting and/or blocking gene expression, including dual gene-specific inhibition and/or blocking gene expression, can be any genetic abnormality associated with any disease, such as a mutation. In some embodiments, a target or group of targets is selected from a genetic determinant of a disease, such as, for example, Xiongg et al., The human splicing code reveals new insights into the genetic determinants of disease. Science, Vol. 347, No. 6218 DOI: As disclosed in 10.1126/science.1254806. In some embodiments, the mismatch is between the mutant and the wild type.

In some embodiments, the provided palm-controlled oligonucleotide compositions and methods are used to selectively inhibit mutated oligonucleotides in a disease. In some embodiments, the disease is cancer. In some embodiments, the provided palm-controlled oligonucleotide compositions and methods are used to selectively inhibit mutated transcripts in cancer. In some embodiments, the provided palm-controlled oligonucleotide compositions and methods are used to inhibit KRAS transcripts. An exemplary target KRAS site comprises G12V=GGU->GUU position 227G->U, G12D=GGU->GAU position 227G->A and G13D=GGC->GAC position 230G->A.

In some embodiments, the provided palm-controlled oligonucleotide compositions and methods provide dual gene-specific inhibition of transcripts in an organism. In some embodiments, the organism comprises a gene of interest in which two or more dual genes are present. For example, a normal gene in an individual has a wild-type gene, and in a diseased tissue such as a tumor, the same gene is mutated. In some embodiments, the invention provides a palm-controlled oligonucleotide composition and method for selectively inhibiting a dual gene (eg, a dual gene comprising a mutation or a SNP). In some embodiments, the invention provides treatments that have higher efficacy and/or low toxicity and/or other benefits as described in this application.

In some embodiments, the provided palm-controlled oligonucleotide composition comprises an oligonucleotide of the oligonucleotide type. In some embodiments, the provided palm-controlled oligonucleotide composition comprises an oligonucleotide of only one oligonucleotide type. In some embodiments, a palm-controlled oligonucleotide composition provided is provided with an oligonucleotide of only one oligonucleotide type. In some embodiments, the provided palm-controlled oligonucleotide composition comprises oligonucleotides of two or more oligonucleotide types. In some embodiments, using the Such compositions provide methods that target more than one target. In some embodiments, a palm-controlled oligonucleotide composition comprising two or more oligonucleotide types targets two or more targets. In some embodiments, a palm-controlled oligonucleotide composition comprising two or more oligonucleotide types targets two or more mismatches. In some embodiments, a single oligonucleotide type targets two or more targets, such as mutations. In some embodiments, the target region of an oligonucleotide type oligonucleotide comprises two or more "target sites", such as two mutations or SNPs.

In some embodiments, the oligonucleotides provided in the palm-controlled oligonucleotide composition optionally comprise modified bases or sugars. In some embodiments, the provided palm-controlled oligonucleotide composition is provided without any modified bases or sugars. In some embodiments, the provided palm-controlled oligonucleotide composition is provided without any modified bases. In some embodiments, the oligonucleotides provided in the palm-controlled oligonucleotide composition comprise modified bases and sugars. In some embodiments, the oligonucleotides provided in the palm-controlled oligonucleotide composition comprise modified bases. In some embodiments, the oligonucleotides provided in the palm-controlled oligonucleotide composition comprise modified sugars. Modified bases and sugars for oligonucleotides are widely known in the art and include, but are not limited to, the modified bases and sugars described herein. In some embodiments, the modified base is 5-mC. In some embodiments, the modified sugar is a 2' modified sugar. Suitable 2' modifications of oligonucleotide sugars are widely known to those of ordinary skill in the art. In some embodiments, the 2' modification includes, but is not limited to, 2'-OR ¹ , wherein R ^{1 is} not hydrogen. In some embodiments, the 2' modification is 2'-OR ¹ , wherein R ¹ is an optionally substituted C _1-6 aliphatic group. In some embodiments, the 2' modification is 2'-MOE. In some embodiments, the modification is 2'-halogen. In some embodiments, the modification is 2'-F. In some embodiments, the modified base or sugar can further enhance the activity, stability, and/or selectivity of the palm-controlled oligonucleotide composition, the palm-controlled oligonucleotide composition The common backbone provides unexpected activity, stability and/or selectivity for the palm center mode.

In some embodiments, the provided palm-controlled oligonucleotide composition is provided without any modified sugar. In some embodiments, the provided palm-controlled oligonucleotide composition is provided without any 2' modified sugar. In some embodiments, the present inventors have unexpectedly discovered that by using a palm-controlled oligonucleotide composition, the modified sugar will no longer be required for control of stability, activity, and/or cleavage mode. Additionally, in some embodiments, the present inventors have surprisingly discovered that the conversion, and/or control of stability, activity, and cleavage mode of a palm-controlled oligonucleotide composition of an oligonucleotide that does not contain a modified sugar. In terms of delivering better characteristics. For example, in some embodiments, it has been unexpectedly discovered that a palm-controlled oligonucleotide composition of an oligonucleotide having no modified sugar is compared to an oligonucleotide containing a modified sugar. For the composition, dissociation from the cleavage product is much faster and provides a significantly increased conversion.

In some embodiments, the oligonucleotides provided to the palm-controlled oligonucleotide composition of interest provided by the methods provided have structures as broadly described in the present invention. In some embodiments, the oligonucleotide has a wing-core-wing structure as described. In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( Sp ) _m R p as described. In some embodiments, provided in common backbone chiral controlled oligonucleotide compositions of the chiral centers contained mode (S p) ₂ R p. In some embodiments, provided in common backbone chiral controlled oligonucleotide compositions comprising the sum of the chiral centers patterns _{(S p) m (R p} ) n. In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( R p) _n ( S p) _{m as described} . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises R p( S p) _m as described. In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises R p( S p) ₂ . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) _m ( R p) _n ( S p) _{t as described} . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) _m R p( S p) _{t as described} . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) _t ( R p) _n ( S p) _{m as described} . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) _t R p( S p) _{m as described} . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises S p R p S p S p. In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) ₂ R p( S p) ₂ . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) ₃ R p( S p) ₃ . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) ₄ R p( S p) ₄ . In some embodiments, provided in common backbone chiral controlled oligonucleotide compositions of the chiral centers contained mode _{(S p) t R p (} S p) 5. In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises S p R p( S p) ₅ . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) ₂ R p( S p) ₅ . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) ₃ R p( S p) ₅ . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) ₄ R p( S p) ₅ . In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises ( S p) ₅ R p( S p) ₅ . In some embodiments, the common backbone has only one Rp for the palm center pattern and the other internucleotide linkages are each Sp . In some embodiments, the common base length is greater than 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 32, 35, 40, 45 or 50, as described in the present invention. In some embodiments, the common base length is greater than 10. In some embodiments, the common base length is greater than 11. In some embodiments, the common base length is greater than 12. In some embodiments, the common base length is greater than 13. In some embodiments, the common base length is greater than 14. In some embodiments, the common base length is greater than 15. In some embodiments, the common base length is greater than 16. In some embodiments, the common base length is greater than 17. In some embodiments, the common base length is greater than 18. In some embodiments, the common base length is greater than 19. In some embodiments, the common base length is greater than 20. In some embodiments, the common base length is greater than 21. In some embodiments, the common base length is greater than 22. In some embodiments, the common base length is greater than 23. In some embodiments, the common base length is greater than 24. In some embodiments, the common base length is greater than 25. In some embodiments, the common base length is greater than 26. In some embodiments, the common base length is greater than 27. In some embodiments, the common base length is greater than 28. In some embodiments, the common base length is greater than 29. In some embodiments, the common base length is greater than 30. In some embodiments, the common base length is greater than 31. In some embodiments, the common base length is greater than 32. In some embodiments, the common base length is greater than 33. In some embodiments, the common base length is greater than 34. In some embodiments, the common base length is greater than 35.

In some embodiments, the provided palm-controlled oligonucleotide composition provides a higher conversion. In some embodiments, the cleavage product from the nucleic acid polymer has a faster dissociation rate from the oligonucleotide provided to the palm-controlled oligonucleotide composition than the oligonucleotide from the reference oligonucleotide composition. For example, an oligonucleotide assembly that does not control palmarity. In some embodiments, the provided palm-controlled oligonucleotide composition can be provided in lower unit doses, and/or total doses, and/or less than oligonucleotides that do not control palmarity. Dosage is administered.

In some embodiments, the palm-controlled oligonucleotide composition is complementary to the sequence of the nucleic acid polymer within its common base sequence or its common base sequence when compared to the reference oligonucleotide composition. Less cleavage sites are provided in the sequence. In some embodiments, the palm-controlled oligonucleotide composition provides fewer cleavage sites in the sequence of the nucleic acid polymer that is complementary to its common base sequence. In some embodiments, the nucleic acid polymer is selectively cleaved at a single site within a sequence complementary to a sequence within a common base sequence or a common base sequence of the palm-controlled oligonucleotide composition. In some embodiments, the cleavage position of the palm-controlled oligonucleotide composition in a sequence complementary to a sequence within a common base sequence or a common base sequence of the palm-controlled oligonucleotide composition The point provides a higher percentage of lysis. In some real In the embodiment, the palm-controlled oligonucleotide composition provides a higher percentage of cleavage at a cleavage site within a sequence complementary to the common base sequence of the palm-controlled oligonucleotide composition. In some embodiments, the site with a higher percentage of lysis is the cleavage site when the reference oligonucleotide composition is used. In some embodiments, the site with a higher percentage of lysis is the cleavage site that is not present when the reference oligonucleotide composition is used.

Surprisingly, it has been found that as the number of cleavage sites in the complementary sequence decreases, the rate of cleavage can unexpectedly increase and/or a higher percentage of lysis can be achieved. As illustrated in the examples of the present invention, there is provided a palm-controlled oligonucleotide composition which produces less cleavage sites within the complementary sequence of the target nucleic acid polymer, and in particular provides a palm-like cleavage of a single site cleavage. The controlled oligonucleotide composition provides an extremely high rate of cleavage and a very low level of residual uncleaved nucleic acid polymer. These results are in sharp contrast to the general teachings of the art, and in the general teachings of the art, more cleavage sites have been pursued to increase the rate of cleavage.

In some embodiments, the rate of cleavage is increased by a factor of 1.5 for a palm-controlled oligonucleotide composition compared to a reference oligonucleotide composition. In some embodiments, the rate of cleavage is increased by at least 2 fold. In some embodiments, the rate of cleavage is increased by at least 3 fold. In some embodiments, the rate of cleavage is increased by at least 4 fold. In some embodiments, the rate of cleavage is increased by at least 5 fold. In some embodiments, the rate of cleavage is increased by at least 6 fold. In some embodiments, the rate of cleavage is increased by at least 7 fold. In some embodiments, the rate of cleavage is increased by at least 8 fold. In some embodiments, the rate of cleavage is increased by at least 9 fold. In some embodiments, the rate of cleavage is increased by at least 10 fold. In some embodiments, the rate of cleavage is increased by at least 11 fold. In some embodiments, the rate of cleavage is increased by at least 12 fold. In some embodiments, the rate of cleavage is increased by at least 13 fold. In some embodiments, the rate of cleavage is increased by at least 14 fold. In some embodiments, the rate of cleavage is increased by at least 15 fold. In some embodiments, the rate of cleavage is increased by at least 20 fold. In some embodiments, the rate of cleavage is increased by at least 30 fold. In some embodiments, the rate of cleavage is increased by at least 40 fold. In some embodiments, the rate of cleavage is increased by at least 50 fold. In some In the examples, the rate of cleavage is increased by at least 60 fold. In some embodiments, the rate of cleavage is increased by at least 70 fold. In some embodiments, the rate of cleavage is increased by at least 80 fold. In some embodiments, the rate of cleavage is increased by at least 90 fold. In some embodiments, the rate of cleavage is increased by at least 100 fold. In some embodiments, the rate of cleavage is increased by at least 200 fold. In some embodiments, the rate of cleavage is increased by at least 300 fold. In some embodiments, the rate of cleavage is increased by at least 400 fold. In some embodiments, the rate of cleavage is increased by at least 500 fold. In some embodiments, the rate of cleavage is increased by at least more than 500 fold.

In some embodiments, the palmitic controlled oligonucleotide composition provides a lower level of residual uncleaved target nucleic acid polymer compared to the reference oligonucleotide composition. In some embodiments, it is 1.5 times less. In some embodiments, it is at least 2 times less. In some embodiments, it is at least 3 times less. In some embodiments, it is at least 4 times less. In some embodiments, it is at least 5 times less. In some embodiments, it is at least 6 times less. In some embodiments, it is at least 7 times less. In some embodiments, it is at least 8 times less. In some embodiments, it is at least 9 times less. In some embodiments, it is at least 10 times less. In some embodiments, it is at least 11 times less. In some embodiments, it is at least 12 times less. In some embodiments, it is at least 13 times less. In some embodiments, it is at least 14 times less. In some embodiments, it is at least 15 times less. In some embodiments, it is at least 20 times less. In some embodiments, it is at least 30 times less. In some embodiments, it is at least 40 times less. In some embodiments, it is at least 50 times less. In some embodiments, it is at least 60 times less. In some embodiments, it is at least 70 times less. In some embodiments, it is at least 80 times less. In some embodiments, it is at least 90 times less. In some embodiments, it is at least 100 times less. In some embodiments, it is at least 200 times less. In some embodiments, it is at least 300 times less. In some embodiments, it is at least 400 times less. In some embodiments, it is at least 500 times less. In some embodiments, it is at least 1000 times less.

As discussed in detail herein, the invention provides, inter alia, a palm-controlled oligonucleotide composition, meaning that the composition contains a plurality of at least one type of oligonucleotide. Each particular "type" of oligonucleotide molecule is preselected (eg, predetermined) in the following respects The structural elements are: (1) base sequence; (2) main chain linkage mode; (3) main chain versus palm center mode; and (4) main chain P modification mode. In some embodiments, provided oligonucleotide compositions contain oligonucleotides prepared in a single synthetic process. In some embodiments, the provided compositions contain oligonucleotides having more than one pair of palmar configurations within a single oligonucleotide molecule (eg, wherein different residues along different oligonucleotides have different stereochemistry) In some such embodiments, the oligonucleotides can be obtained in a single synthetic process without the need for a secondary binding step to produce individual oligonucleotide molecules containing more than one pair of palm configurations.

Oligonucleotide compositions as provided herein can be used as reagents for modulating a variety of cellular processes and machinery including, but not limited to, transcription, translation, immune response, epigenetics, and the like. Furthermore, oligonucleotide compositions as provided herein can be used as reagents for research and/or diagnostic purposes. It will be readily apparent to one of ordinary skill in the art that the present disclosure herein is not limited to a particular use, but is applicable to any situation where a synthetic oligonucleotide is desired. The compositions provided are especially useful in a variety of therapeutic, diagnostic, agricultural, and/or research applications.

In some embodiments, provided oligonucleotide compositions comprise oligonucleotides comprising one or more structural modifications as described in detail herein and/or residues thereof. In some embodiments, provided oligonucleotide compositions comprise oligonucleotides comprising one or more nucleic acid analogs. In some embodiments, provided oligonucleotide compositions comprise oligonucleotides comprising one or more artificial nucleic acids or residues (eg, nucleotide analogs), including but not limited to: peptide nucleic acids (PNA), locked nucleic acid (LNA), N-morpholinyl, threose nucleic acid (TNA), glycol nucleic acid (GNA), arabinose (ANA), 2'-fluoroarabose nucleic acid (FANA), cyclohexyl Enzymatic nucleic acid (CeNA), anhydrous hexitol nucleic acid (HNA) and/or unlocked nucleic acid (UNA), threose nucleic acid (TNA) and/or xenogeneic nucleic acid (ZNA), and any combination thereof.

In any embodiment, the invention is applicable to oligonucleotide-based modulation of gene expression, immune responses, and the like. Thus, a stereospecifically defined oligonucleotide composition of the invention comprising a predetermined type of oligonucleotide (i.e., which is palm-controlled, and optionally palm pure) It can be used instead of the conventional stereo random or the palm impure counterpart. In some embodiments, the provided compositions exhibit enhanced effects and/or reduced side effects. Certain embodiments of the biological and clinical/therapeutic applications of the present invention are explicitly discussed below.

The various palm-controlled oligonucleotide compositions provided can be administered using a variety of dosing regimens. In some embodiments, a plurality of unit doses are administered at intervals of a certain period of time. In some embodiments, a given composition has a recommended dosing regimen that can involve one or more doses. In some embodiments, the dosing regimen comprises a plurality of doses each separated by a period of the same length; in some embodiments, the dosing regimen comprises a plurality of doses and at least two different times for separating the individual doses segment. In some embodiments, all doses within the dosing regimen have the same unit dose amount. In some embodiments, different doses within a dosing regimen have different amounts. In some embodiments, the dosing regimen comprises administering a first dose in a first dose, followed by one or more doses in a second dose different than the first dose. In some embodiments, the dosing regimen comprises administering the first dose in a first dose, followed by one or more doses the same or different from the first dose (or another prior dose) The second (or subsequent) dose is administered. In some embodiments, the dosing regimen comprises administering at least one unit dose for at least one day. In some embodiments, the dosing regimen comprises administering more than one dose over a period of at least one day and sometimes more than one day. In some embodiments, the dosing regimen comprises administering a plurality of doses over a period of at least one week. In some embodiments, the time period is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 2,324, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more (eg, about 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more weeks. In some embodiments, the dosing regimen comprises administering one dose per week for more than one week. In some embodiments, the dosing regimen comprises administering one dose per week for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more (eg, about 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more) weeks. In some embodiments, the dosing regimen comprises administering one dose every two weeks for more than two weeks. In some embodiments, the dosing regimen comprises administering one dose every two weeks for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more (eg , about 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more) of the time period. In some embodiments, the dosing regimen comprises administering one dose per month for one month. In some embodiments, the dosing regimen comprises administering one dose per month for more than one month. In some embodiments, the dosing regimen comprises administering one dose per month for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more months. In some embodiments, the dosing regimen comprises administering one dose per week for about 10 weeks. In some embodiments, the dosing regimen comprises administering one dose per week for about 20 weeks. In some embodiments, the dosing regimen comprises administering one dose per week for about 30 weeks. In some embodiments, the dosing regimen comprises administering one dose per week for 26 weeks. In some embodiments, the palm-controlled oligonucleotide composition is administered according to a dosing regimen that differs from the oligonucleotides of the same sequence that do not control palmarity (eg, stereoregular). The dosing regimen employed for the composition of the palmitic controlled oligonucleotide composition differs from the composition and/or the same sequence. In some embodiments, the palm-controlled oligonucleotide composition is administered according to a dosing regimen, such as an oligonucleotide that does not control palmarity (eg, stereoregular) with the same sequence. The composition is reduced in comparison to a lower overall exposure over a specified unit time, involving one or more lower unit doses, and/or including a smaller amount within a specified unit time. dose. In some embodiments, the palm-controlled oligonucleotide composition is administered according to a dosing regimen that lasts for a longer period of time than the same sequence does not control palmarity (eg, stereotactic) The nucleotide composition is long. Without wishing to be bound by theory, the Applicant indicates that in some embodiments, shorter dosing regimens and/or longer between doses The time period can be attributed to improved stability, bioavailability and/or efficacy to the palm-controlled oligonucleotide composition. In some embodiments, the dosage regimen for the palm-controlled oligonucleotide composition is longer than the corresponding oligonucleotide composition that does not control palmity. In some embodiments, the palm-controlled oligonucleotide composition is shorter in a period of time between at least two doses than a corresponding oligonucleotide composition that does not control palmarity. Without wishing to be bound by theory, the Applicant indicates that in some embodiments, longer dosing regimens and/or shorter periods between doses may be attributed to improvements in palm-controlled oligonucleotide compositions. Security.

A single dose can contain a variety of amounts of palm-controlled oligonucleotides in varying amounts, depending on the requirements of the application. In some embodiments, a single dose contains about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300 or more (eg, about 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, One type of palm controllable oligonucleotide of 850, 900, 950, 1000 or more mg. In some embodiments, a single dose contains about 1 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 5 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 10 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 15 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 20 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 50 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 100 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 150 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 200 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 250 mg of one type of palm-controlled oligonucleotide. In some embodiments, a single dose contains about 300 mg of one type of palm-controlled oligonucleotide. In some embodiments, the palm-controlled oligo Glucuronide is administered in a single dose and/or total dose in a lower amount than does not control the palmitic oligonucleotide. In some embodiments, the palm-controlled oligonucleotide is administered in a single dose and/or total dose in a lower amount than the palmitic oligonucleotide is not attributed to the improved efficacy. In some embodiments, the palm-controlled oligonucleotide is administered in a single dose and/or total dose in a higher amount than does not control the palmitic oligonucleotide. In some embodiments, due to improved safety, the palm-controlled oligonucleotide is administered in a single dose and/or total dose in a higher amount than does not control the palmitic oligonucleotide.

Biologically active oligonucleotide

Oligonucleotide compositions as provided herein can comprise single-stranded and/or multi-stranded oligonucleotides. In some embodiments, a single-stranded oligonucleotide contains a self-complementary portion that hybridizes under relevant conditions such that even a single-stranded oligonucleotide, as used, can at least partially have a double-stranded feature. In some embodiments, the oligonucleotides included in the provided compositions are single, double or triple. In some embodiments, the oligonucleotides included in the provided compositions comprise a single-stranded portion and a multi-stranded portion within the oligonucleotide. In some embodiments, as indicated above, individual single-stranded oligonucleotides can have a double-stranded region and a single-stranded region.

In some embodiments, provided compositions include one or more oligonucleotides that are fully or partially complementary to a strand: a structural gene, a gene control and/or a termination region, and/or a self such as a viral or plastid DNA Copy the system. In some embodiments, provided compositions include one or more oligonucleotides that are or act as siRNA or other RNA interference agents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, self-cleaving RNA , ribonuclease, fragments thereof and/or variants thereof (such as peptidyl transferase 23S rRNA, ribonuclease P, class I and class II introns, GIR1 branch ribonuclease, lead enzyme, lead) Ribonuclease, hammerhead ribonuclease, HDV ribonuclease, mammalian CPEB3 ribonuclease, VS ribonuclease, glmS ribonuclease, CoTC ribonuclease, etc.), microRNA, microRNA mimic, super miR, aptamer, anti-miR, antagonistic miR, Ul-attached protein, triploid-forming oligonucleotide, RNA activator, long non- Encoding RNA, short non-coding RNA (eg, piRNA), immunomodulatory oligonucleotides (such as immunostimulatory oligonucleotides, immunosuppressive oligonucleotides), GNA, LNA, ENA, PNA, TNA, HNA , TNA, XNA, HeNA, CeNA, morpholine nucleic acid, G-helix (RNA and DNA), antiviral oligonucleotides, and decoy oligonucleotides.

In some embodiments, provided compositions include one or more mixed (eg, chimeric) oligonucleotides. In the context of the present invention, the term "mixing" broadly refers to a mixed structural component of an oligonucleotide. A mixed oligonucleotide may refer to, for example, (1) an oligonucleotide molecule having a mixed type of nucleotide, such as a partial DNA and a partial RNA (for example, DNA-RNA) in a single molecule; (2) a pair of complementary pairs Different kinds of nucleic acids, such that intramolecular or intermolecular or intramolecular and intermolecular DNA:RNA base pairing occurs; (3) oligonucleotides containing two or more backbone or internucleotide linkages .

In some embodiments, provided compositions include one or more oligonucleotides comprising more than one type of nucleic acid residue in a single molecule. For example, in any of the embodiments described herein, the oligonucleotide can comprise a DNA portion and an RNA portion. In some embodiments, an oligonucleotide can comprise an unmodified portion and a modified portion.

The provided oligonucleotide compositions can include oligonucleotides comprising any of a variety of modifications, such as described herein. In some embodiments, for example, a particular modification is selected based on the intended use. In some embodiments, it is desirable to modify one or both strands of a double-stranded oligonucleotide (or a double-stranded portion of a single-stranded oligonucleotide). In some embodiments, two (or portions) include different modifications. In some embodiments, the two strands comprise the same modification. Those skilled in the art will appreciate that the degree and type of modification achieved by the methods of the present invention allows multiple modification substitutions to occur. Examples of such modifications are described herein and are not intended to be limiting.

The phrase "antisense strand" as used herein refers to an oligonucleotide that is substantially or 100% complementary to a sequence of interest of interest. The phrase "antisense strand" includes an antisense region formed by two separate strands of two oligonucleotides and a single molecule oligonucleotide capable of forming a hairpin or dumbbell type structure. The terms "antisense stock" and "guide strand" are used interchangeably herein. use.

The phrase "sense stock" refers to an oligonucleotide having a nucleotide sequence that is identical or identical to a target sequence such as a messenger RNA or DNA sequence. The terms "sense stock" and "passenger strand" are used interchangeably herein.

"Target sequence" means any nucleic acid sequence to be modulated for expression or activity. The target nucleic acid can be DNA or RNA, such as endogenous DNA or RNA, viral DNA or viral RNA, or other RNA encoded by a gene, virus, bacterium, fungus, mammal or plant. In some embodiments, the sequence of interest is associated with a disease or condition. In some embodiments, the target sequence is or comprises a portion of the Huntington's gene. In some embodiments, the target sequence is or comprises a portion of a Huntington's gene containing a SNP.

"Specific hybridization" and "complementary" means that a nucleic acid can form a hydrogen bond with another nucleic acid sequence by a conventional Watson-Crick or other non-traditional type. With respect to the nuclear molecule of the present invention, the binding free energy of the nucleic acid molecule to its complementary sequence is sufficient to allow the relevant function of the nucleic acid to continue, such as RNAi activity. The determination of the binding free energy of a nucleic acid molecule is well known in the art (see, for example, Turner et al., 1987, CSH Symp. Quant. Biol . LIT, pp. 123-133; Frier et al., 1986, Proc. Nat. Acad. Sci USA 83: 9373-9377; Turner et al, 1987, /. Ain. Chem. Soc. 109:3783-3785).

The percent complement indicates the percentage of adjacent residues in the nucleic acid molecule that can form a hydrogen bond (eg, Watson-Cricket base pairing) with the second nucleic acid sequence (eg, 5, 6, 7, 8, 9 in 10) 10 is 50%, 60%, 70%, 80%, 90% and 100% complementary). "Perfectly complementary" or 100% complementary means that all adjacent residues of the nucleic acid sequence will form hydrogen bonds with the same number of adjacent residues in the second nucleic acid sequence. Sub-perfect complementarity refers to the case where some but not all of the nucleoside units can form a hydrogen bond with each other. "Substantially complementary" means that the polynucleotide strands exhibit a complementarity of 90% or greater, excluding regions of the polynucleotide strand that are selected for non-complementarity (such as overhangs). Specific binding requires a sufficient degree of complementarity to avoid oligomerization Non-specific binding of the non-target sequence under conditions suitable for specific binding, for example in the case of in vivo analysis or therapeutic treatment, under physiological conditions, or in the case of in vitro analysis, in performing such analysis Under the conditions. In some embodiments, the non-target sequence differs from the corresponding target sequence by at least 5 nucleotides.

When used as a therapy, the provided oligonucleotides are administered as a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of the provided oligonucleotide or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable inactive ingredient selected from the group consisting of pharmaceutically acceptable A diluent, a pharmaceutically acceptable excipient, and a pharmaceutically acceptable carrier. In another embodiment, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ocular administration, intrathecal administration, or menstrual administration. Ear cast. In another embodiment, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ocular administration, or otic administration. In other embodiments, the pharmaceutical composition is a tablet, a pill, a capsule, a liquid, an inhalant, a nasal spray solution, a suppository, a suspension, a gel, a gel, a dispersion, a suspension, a solution, an emulsion, an ointment, and a wash. Agent, eye drop, ear drop, or preparation containing artificial cerebrospinal fluid. In other embodiments, the pharmaceutical composition is a tablet, a pill, a capsule, a liquid, an inhalant, a nasal spray solution, a suppository, a suspension, a gel, a gel, a dispersion, a suspension, a solution, an emulsion, an ointment, and a wash. Agent, eye drops or ear drops. In some embodiments, the pharmaceutical composition comprises cerebrospinal fluid. In some embodiments, the pharmaceutical composition comprises artificial cerebrospinal fluid. In some embodiments, a pharmaceutical composition comprises an oligonucleotide, wherein the sequence of the oligonucleotide comprises a sequence that targets a portion of the Huntington's gene. In some embodiments, the sequence targets a portion of a Huntington's gene comprising a SNP. In some embodiments, the base sequence of the oligonucleotide, the backbone linkage pattern, the backbone to palm center pattern, and/or the sugar modification pattern are or comprise bases of any of the oligonucleotides disclosed herein. Sequence, backbone linkage mode, backbone to palm center mode, and/or sugar modification mode, and the oligonucleotides are included in a pharmaceutical composition comprising any of the components of the pharmaceutical compositions disclosed herein. In some In an embodiment, the oligonucleotide targets a Huntington's gene (for example, a non-limiting example, a SNP in a Huntington's gene), and the base sequence of the oligonucleotide, the backbone linkage pattern, and the backbone-to-palm center pattern And/or the sugar modification mode is or comprises a base sequence, a backbone linkage pattern, a backbone pair palm center pattern, and/or a sugar modification pattern of any of the oligonucleotides disclosed herein, and the oligonucleotide comprises In a pharmaceutical composition comprising a cerebrospinal fluid, and the pharmaceutical composition is administered by intrathecal administration.

Pharmaceutical composition

When used as a therapy, the oligonucleotide or oligonucleotide compositions provided herein are administered as a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of the provided oligonucleotide or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable inactive ingredient selected from the group consisting of pharmaceutically acceptable Acceptable diluents, pharmaceutically acceptable excipients, and pharmaceutically acceptable carriers. In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ocular administration, intrathecal administration, or transdermal administration. Cast. In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ocular administration, or otic administration. In some embodiments, the pharmaceutical composition is a tablet, a pill, a capsule, a liquid, an inhalant, a nasal spray solution, a suppository, a suspension, a gel, a gel, a dispersion, a suspension, a solution, an emulsion, an ointment, a wash. Agent, eye drop, ear drop, or preparation containing artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition is a tablet, a pill, a capsule, a liquid, an inhalant, a nasal spray solution, a suppository, a suspension, a gel, a gel, a dispersion, a suspension, a solution, an emulsion, an ointment, a wash. Agent, eye drops or ear drops. In some embodiments, the provided compositions comprise cerebrospinal fluid. In some embodiments, the provided compositions comprise artificial cerebrospinal fluid.

In some embodiments, the invention provides a pharmaceutical composition comprising a palmitic controlled oligonucleotide or composition thereof, in admixture with a pharmaceutically acceptable excipient. Those skilled in the art will recognize that pharmaceutical compositions include medicinal properties of palm-controlled oligonucleotides. Acceptable salts or combinations thereof are as described above.

Various supramolecular nanocarriers can be used to deliver nucleic acids. Exemplary nanocarriers include, but are not limited to, liposomes, cationic polymer composites, and various polymers. Another method of complexing nucleic acids with various polycations for intracellular delivery; this method involves the use of PEGylated polycations, polyvinylamine (PEI) complexes, cationic block copolymers, and dendrimers. Several cationic nanocarriers, including PEI and polyamidoamine dendrimers, help release the contents from the endosomes. Other methods include the use of polymeric nanoparticles, polymeric micelles, quantum dots, and lipid complexes.

In addition to the exemplary delivery strategies described herein, other nucleic acid delivery strategies are also known.

In therapeutic and/or diagnostic applications, the compounds of the invention may be formulated for a variety of modes of administration, including systemic and topical or regional administration. Techniques and formulations are generally found in Remington, The Science and Practice of Pharmacy, (20th Edition 2000).

The oligonucleotides provided and compositions thereof are effective over a wide dosage range. For example, in the treatment of an adult, a dosage of from about 0.01 to about 1000 mg, from about 0.5 to about 100 mg, from about 1 to about 50 mg, and from about 5 to about 100 mg per day is an example of a usable dosage. The precise dose will depend on the route of administration, the form of administration of the compound, the individual to be treated, the weight of the individual to be treated, and the preferences and experience of the attending physician.

Pharmaceutically acceptable salts are generally well known to those of ordinary skill and may include, for example, but are not limited to, acetate, benzsulfonate/besylate, benzoate, bicarbonate, hydrogen tartrate, Bromide, calcium edetate, carnsylate, carbonate, citrate, ethylenediaminetetraacetate, edisylate, estolate, B a sulfonate, a fumarate, a gluceptate, a gluconate, a glutamate, a behenamide, a hexylresorcinate, Hydrabamine, hydrobromide, hydrochloride, hydroxynaphthoate, iodide, isethionate, lactic acid Salt, lactobionate, malate, maleate, mandelate, methanesulfonate, mucate, naphthalenesulfonate, nitrate, pamoate (enbo acid) (embonate), pantothenate, phosphate/diphosphate, polygalacturonate, salicylate, stearate, basic acetate, succinate, sulfate, tannic acid Salt (tannate), tartrate or tea chlorate (teoclate). Other pharmaceutically acceptable salts can be found, for example, in Remington, The Science and Practice of Pharmacy (20th Edition 2000). Preferred pharmaceutically acceptable salts include, for example, acetates, benzoates, bromides, carbonates, citrates, gluconates, hydrobromides, hydrochlorides, maleates, Methanesulfonate, naphthalenesulfonate, pamoate (enpo acid salt), phosphate, salicylate, succinate, sulfate or tartrate.

Depending on the particular condition being treated, the agents may be formulated as a liquid or solid dosage form and administered systemically or topically. Such agents can be delivered, for example, in a timed release or sustained low release form as known to those skilled in the art. Formulation and administration techniques can be found in Remington, The Science and Practice of Pharmacy (20th Edition 2000). Suitable routes may include oral, buccal, by inhalation spray, sublingual, rectal, transdermal, transvaginal, transmucosal, nasal or enteral administration; parenteral delivery, including intramuscular, subcutaneous, and intramedullary Internal injection and intrathecal, direct indoor, intravenous, intra-articular, intrasternal, intrasynovial, intrahepatic, intralesional, intracranial, intraperitoneal, intranasal or intraocular injection or other modes of delivery.

In some embodiments of the methods or compositions of the invention, the composition comprising the oligonucleotide is administered via intrathecal administration. In some embodiments of the methods or compositions of the invention, the composition comprising the oligonucleotide comprises artificial cerebrospinal fluid and is administered via intrathecal administration. In some embodiments of the methods or compositions of the invention, the composition comprising the oligonucleotide comprises one or more components of artificial cerebrospinal fluid (eg, NaCl, NaHCO ₃ , KCl, NaH ₂ PO ₄ , MgCl _{2 ,} and glucose) And administered via intrathecal administration. In some embodiments of the methods or compositions of the invention, the composition comprising the oligonucleotide comprises one or more components of artificial cerebrospinal fluid (eg, NaCl, NaHCO ₃ , KCl, NaH ₂ PO ₄ , MgCl _{2 ,} and glucose) And administered via intrathecal administration, wherein the sequence of the oligonucleotide comprises a sequence that targets a portion of the Huntington's gene. In some embodiments of the methods or compositions of the invention, the composition comprising the oligonucleotide comprises two or more components of artificial cerebrospinal fluid (eg, NaCl, NaHCO ₃ , KCl, NaH ₂ PO ₄ , MgCl) ₂ and glucose) and administered via intrathecal administration, wherein the sequence of the oligonucleotide comprises a sequence that targets a portion of the Huntington's gene. In some embodiments of the methods or compositions of the invention, the composition comprising the oligonucleotide comprises three or more components of artificial cerebrospinal fluid (eg, NaCl, NaHCO ₃ , KCl, NaH ₂ PO ₄ , MgCl ₂ And glucose) and administered via intrathecal administration, wherein the sequence of the oligonucleotide comprises a sequence that targets a portion of the Huntington's gene. In some embodiments, the provided oligonucleotides comprise a base sequence, a backbone linkage pattern, a backbone to palm center pattern, and/or a chemical modification of any of the oligonucleotides disclosed herein (eg, The pattern of base modification, sugar modification, etc.). In some embodiments, the sequence targets a portion of a Huntington's gene comprising a SNP.

For injection, the agents of the invention may be formulated in aqueous solutions, such as physiologically compatible buffers such as Hank's solution, Ringer's solution or physiological saline buffer. And diluted. For such transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

It is within the scope of the invention to formulate the compounds disclosed herein using a pharmaceutically acceptable inert carrier for the practice of the present invention as a dosage suitable for systemic administration. The compositions of the invention, especially those formulated in solution, may be administered parenterally, such as by intravenous injection, by appropriate selection of carriers and suitable manufacturing specifications.

The compounds can be formulated into dosages suitable for oral administration using pharmaceutically acceptable carriers well known in the art. Such carriers may allow the compounds of the invention to be formulated into lozenges, pills, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by the subject (eg, patient) to be treated.

For nasal or inhalation delivery, the agents of the invention may also be obtained by those skilled in the art. The method is known to be formulated, and may include, for example, but not limited to, examples of substances which dissolve, dilute or disperse substances such as physiological saline, preservatives such as benzyl alcohol, absorption enhancers, and fluorocarbons.

In certain embodiments, the oligonucleotides and compositions are delivered to the CNS. In certain embodiments, the oligonucleotides and compositions are delivered to the cerebrospinal fluid. In certain embodiments, the oligonucleotides and compositions are administered to the brain parenchyma. In certain embodiments, the oligonucleotides and compositions are delivered to the animal/individual by intrathecal administration or intraventricular administration. The widespread distribution of the oligonucleotides and compositions described herein in the central nervous system can be achieved by intraparenchymal administration, intrathecal administration, or intraventricular administration.

In certain embodiments, parenteral administration is by injection, such as by syringes, pumps, and the like. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection system is administered directly to the tissue, such as the striatum, caudate, cortex, hippocampus, and cerebellum.

In certain embodiments, the method of specifically localizing a pharmaceutical agent, such as by rapid injection, reduces the median effective concentration (EC50) by 20, 25, 30, 35, 40, 45 or 50 fold. In certain embodiments, the pharmaceutical agent is an antisense compound as further described herein. In certain embodiments, the target tissue is brain tissue. In certain embodiments, the target tissue is striatal tissue. In certain embodiments, reducing the EC50 is desirable because it reduces the dosage required to achieve pharmacological outcome in a patient in need thereof.

In certain embodiments, the antisense oligonucleotide is delivered by injection or infusion, every month, every two months, every 90 days, every 3 months, every 6 months; twice a year or year once.

Pharmaceutical compositions suitable for use in the present invention include compositions comprising an effective amount of the active ingredient in an amount effective to achieve its intended purpose. Determination of an effective amount is well within the capabilities of those skilled in the art (particularly in light of the detailed disclosure provided herein).

In addition to the active ingredient, such pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers including excipients and auxiliaries which aid in the treatment of the active compound The preparation used in school. Formulations for oral administration may be in the form of lozenges, dragees, capsules or solutions.

Pharmaceutical preparations for oral use can be obtained by combining the active compound with a solid excipient, optionally grinding the resulting mixture and, if necessary, processing the mixture of granules after adding suitable auxiliaries to obtain a lozenge or dragee core. Suitable excipients are especially fillers, such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth, methyl Cellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose (CMC) and/or polyvinylpyrrolidone (PVP: povidone). If necessary, a disintegrating agent such as cross-linked polyvinylpyrrolidone, agar or alginic acid or a salt thereof such as sodium alginate may be added.

The dragee core has a suitable coating. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol (PEG) and/or titanium dioxide, paint liquors. And suitable for organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the lozenge or dragee coating to identify or characterize different combinations of active compound doses.

Pharmaceutical preparations which can be used orally include a co-insertion capsule made of gelatin and a sealed soft capsule made of gelatin and a plasticizer such as glycerol or sorbitol. The co-injection capsules may contain the active ingredient in admixture with a filler such as lactose, a binder such as starch, and/or a lubricant such as talc or magnesium stearate, and optionally a stabilizer. In soft capsules, the active compound can be dissolved or suspended in a suitable liquid such as a fatty oil, liquid paraffin or liquid polyethylene glycol (PEG). In addition, stabilizers can be added.

Depending on the particular condition or disease condition to be treated or prevented, other therapeutic agents can be administered with the oligonucleotides of the invention, which are typically administered to treat or prevent the condition. For example, chemotherapeutic agents or other anti-proliferative agents can be combined with the oligonucleotides of the invention to treat proliferative diseases and cancer. Examples of known chemotherapeutic agents include, but are not limited to, adriamycin, dexamethasone, vincristine, ring Cyclophosphamide, fluorouracil, topotecan, paclitaxel, interferon and platinum derivatives.

The functions and advantages of these and other embodiments of the invention will be more fully understood from the examples described herein. The following examples are intended to illustrate the benefits of the invention, but do not exemplify the full scope of the invention.

Lipid

In some embodiments, provided oligonucleotide compositions further comprise one or more lipids. In some embodiments, the lipid is bound to the provided oligonucleotide in the composition. In some embodiments, two or more identical or different lipids can be joined to one oligonucleotide via the same or different chemical means and/or positions. In some embodiments, a composition can comprise an oligonucleotide as disclosed herein (for non-limiting examples, a palm-controlled oligonucleotide composition, or an oligonucleotide sequence comprising The sequence of any of the disclosed oligonucleotides, the composition of the sequence or the pair of palm-controlled oligonucleotide compositions, or the oligonucleotide sequences comprising the disclosure of Table 8 or any other table herein A sequence of any oligonucleotide, a composition of the sequence or a pair of palm-controlled oligonucleotide compositions of the sequence, and the like, and a lipid. In some embodiments, the provided oligonucleotides comprise a base sequence, a backbone linkage pattern, a backbone to palm center pattern, and/or a chemical modification of any of the oligonucleotides disclosed herein (eg, A pattern of base modification, sugar modification, etc., and binding to a lipid. In some embodiments, provided compositions comprise the oligonucleotides and lipids disclosed herein, wherein the lipid binds to the oligonucleotide.

In some embodiments, the invention provides a composition comprising an oligonucleotide and a lipid. In accordance with the present invention, a variety of lipids can be employed in the art provided.

In some embodiments, the lipid comprises a R ^LD group, wherein R ^LD is an optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently Substituted by a group selected as follows: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkylene, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C (R') ₂ -, -Cy-, -O-, -S-, - SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR' )-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R') C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N( R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein: each R' is independently -R , -C(O)R, -CO ₂ R or -SO ₂ R, or: two R's together with the intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl ring; -Cy a divalent ring which is optionally substituted with a carbocyclic group, an extended aryl group, a heteroaryl group and a heterocyclic group; and each R is independently hydrogen or a C ₁ -C ₆ aliphatic group Optionally substituted group of phenyl, carbocyclyl, aryl, heteroaryl or heterocyclyl.

In some embodiments, the lipid comprises an R ^LD group, wherein R ^LD is an optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently Substituted by a group selected as follows: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkylene, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C (R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR' )-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R') C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N( R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein: each R' is independently -R , -C(O)R, -CO ₂ R or -SO ₂ R, or: two R's together with the intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl ring; -Cy a divalent ring which is optionally substituted with a carbocyclic group, an extended aryl group, a heteroaryl group and a heterocyclic group; and each R is independently hydrogen or a C ₁ -C ₆ aliphatic group Optionally substituted group of phenyl, carbocyclyl, aryl, heteroaryl or heterocyclyl.

In some embodiments, the lipid comprises an R ^LD group, wherein R ^LD is an optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently Substituted by a group selected as follows: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkylene, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C (R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR' )-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R') C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')-, -N( R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein: each R' is independently -R , -C(O)R, -CO ₂ R or -SO ₂ R, or: two R's together with the intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl ring; -Cy a divalent ring which is optionally substituted with a carbocyclic group, an extended aryl group, a heteroaryl group and a heterocyclic group; and each R is independently hydrogen or a C ₁ -C ₆ aliphatic group Optionally substituted group of phenyl, carbocyclyl, aryl, heteroaryl or heterocyclyl.

In some embodiments, R ^LD is optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated aliphatic, wherein one or more methylene units are optionally and independently selected from the following Substituted group substitution: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -and Cy-. In some embodiments, R ^LD is optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic, wherein one or more methylene units are optionally and independently selected from the following Substituted group substitution: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -and Cy-. In some embodiments, R ^LD is a hydrocarbyl group consisting of carbon and hydrogen atoms. In some embodiments, R ^LD is optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic, wherein one or more methylene units are optionally and optionally selected from the following Substituted group substitution: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkylene, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ - and -Cy-. In some embodiments, R ^LD is optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic, wherein one or more methylene units are optionally and independently selected from the following Substituted group substitution: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -and Cy-. In some embodiments, R ^LD is a hydrocarbyl group consisting of carbon and hydrogen atoms.

In some embodiments, R ^LD is an optionally substituted C ₁₆ -C ₄₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently selected from the following Substituted group substitution: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -and Cy-. In some embodiments, R ^LD is optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic, wherein one or more methylene units are optionally and independently selected from the following Substituted group substitution: C ₁ -C ₆ alkylene, C ₁ -C ₆ alkenyl, -C≡C-, C ₁ -C ₆ heteroaliphatic moiety, -C(R') ₂ -and Cy-. In some embodiments, R ^LD is a hydrocarbyl group consisting of carbon and hydrogen atoms.

The aliphatic group of R ^LD can be of various suitable lengths. In some embodiments, it is C ₁₀ -C ₈₀ . In some embodiments, it is C ₁₀ -C ₇₅ . In some embodiments, it is C ₁₀ -C ₇₀ . In some embodiments, it is C ₁₀ -C ₆₅ . In some embodiments, it is C ₁₀ -C ₆₀ . In some embodiments, it is C ₁₀ -C ₅₀ . In some embodiments, it is C ₁₀ -C ₄₀ . In some embodiments, it is C ₁₀ -C ₃₅ . In some embodiments, it is C ₁₀ -C ₃₀ . In some embodiments, it is C ₁₀ -C ₂₅ . In some embodiments, it is C ₁₀ -C ₂₄ . In some embodiments, it is C ₁₀ -C ₂₃ . In some embodiments, it is C ₁₀ -C ₂₂ . In some embodiments, it is C ₁₀ -C ₂₁ . In some embodiments, it is a C ₁₂ -C _22. In some embodiments, it is C ₁₃ -C ₂₂ . In some embodiments, it is C ₁₄ -C ₂₂ . In some embodiments, it is C ₁₅ -C ₂₂ . In some embodiments, it is C ₁₆ -C ₂₂ . In some embodiments, it is C ₁₇ -C ₂₂ . In some embodiments, it is C ₁₈ -C ₂₂ . In some embodiments, it is C ₁₀ -C ₂₀ . In some embodiments, the lower end of the range is C ₁₀ , C ₁₁ , C ₁₂ , C ₁₃ , C ₁₄ , C ₁₅ , C ₁₆ , C ₁₇ or C ₁₈ . In some embodiments, the upper ends of the range are C ₁₈ , C ₁₉ , C ₂₀ , C ₂₁ , C ₂₂ , C ₂₃ , C ₂₄ , C ₂₅ , C ₂₆ , C ₂₇ , C ₂₈ , C ₂₉ , C ₃₀ , C ₃₅ , C ₄₀ , C ₄₅ , C ₅₀ , C ₅₅ or C ₆₀ . In some embodiments, it is _C10 . In some embodiments, it is C ₁₁ . In some embodiments, which is C _12. In some embodiments, it is _C13 . In some embodiments, it is C ₁₄ . In some embodiments, it is C ₁₅ . In some embodiments, it is C ₁₆ . In some embodiments, it is C ₁₇ . In some embodiments, it is C ₁₈ . In some embodiments, it is _C19 . In some embodiments, which is C _20. In some embodiments, it is C ₂₁ . In some embodiments, it is _C22 . In some embodiments, it is _C23 . In some embodiments, it is _C24 . In some embodiments, it is _C25 . In some embodiments, it is _C30 . In some embodiments, it is _C35 . In some embodiments, it is _C40 . In some embodiments, it is C ₄₅ . In some embodiments, it is _C50 . In some embodiments, it is C ₅₅ . In some embodiments, it is C ₆₀ .

In some embodiments, the lipid comprises no more than one R ^LD group. In some embodiments, the lipid comprises two or more R ^LD groups.

In some embodiments, the lipid binds to the biologically active agent, optionally via a linking group, such as a moiety comprising a R ^LD group. In some embodiments, the lipid binds to the biologically active agent, optionally via a linking group, such as a moiety comprising no more than one R ^LD group. In some embodiments, the lipid binds to the biologically active agent, optionally via a linking group, such as an R ^LD group. In some embodiments, the lipid binds to the biologically active agent, optionally via a linking group, such as a moiety comprising two or more R ^LD groups.

In some embodiments, R ^LD is an optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated lipid chain. In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic chain.

In some embodiments, R ^LD is an optionally substituted C ₁₀ -C ₄₀ linear saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, R ^LD is a C ₁₀ -C ₄₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more C _1-4 aliphatic groups. In some embodiments, the lipid comprises a C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more C _1-4 aliphatic group. In some embodiments, R ^LD is a C ₁₀ -C ₄₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more C _1-2 aliphatic groups. In some embodiments, the lipid comprises a C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more C _1-2 aliphatic group. In some embodiments, R ^LD is a C ₁₀ -C ₄₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more methyl groups. In some embodiments, the lipid comprises a C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more methyl groups.

In some embodiments, R ^LD is an unsubstituted C ₁₀ -C ₄₀ linear saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid comprises an unsubstituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, lipid comprises no more than one of the optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid comprises two or more of the optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, R ^LD is an optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated lipid chain. In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic chain.

In some embodiments, R ^LD is an optionally substituted C ₁₀ -C ₆₀ linear saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, R ^LD is a C ₁₀ -C ₆₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more C _1-4 aliphatic groups. In some embodiments, the lipid comprises a C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more C _1-4 aliphatic group. In some embodiments, R ^LD is a C ₁₀ -C ₆₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more C _1-2 aliphatic groups. In some embodiments, the lipid comprises a C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more C _1-2 aliphatic group. In some embodiments, R ^LD is a C ₁₀ -C ₆₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more methyl groups. In some embodiments, the lipid comprises a C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more methyl groups.

In some embodiments, R ^LD is an unsubstituted C ₁₀ -C ₆₀ linear saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid comprises an unsubstituted C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, lipid comprises no more than one of the optionally substituted C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid comprises two or more of the optionally substituted C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, R ^LD is an optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated lipid chain. In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated aliphatic chain.

In some embodiments, R ^LD is an optionally substituted C ₁₀ -C ₈₀ linear saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid comprising of optionally substituted C ₁₀ -C ₈₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, R ^LD is a C ₁₀ -C ₈₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more C _1-4 aliphatic groups. In some embodiments, the lipid comprises a C ₁₀ -C ₈₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more C _1-4 aliphatic group. In some embodiments, R ^LD is a C ₁₀ -C ₈₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more C _1-2 aliphatic groups. In some embodiments, the lipid comprising ₁₀ -C ₈₀ straight chain C saturated or partially unsaturated aliphatic chain, optionally substituted with one or more C _1-2 aliphatic group. In some embodiments, R ^LD is a C ₁₀ -C ₈₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more methyl groups. In some embodiments, the lipid comprises a C ₁₀ -C ₈₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more methyl groups.

In some embodiments, R ^LD is an unsubstituted C ₁₀ -C ₈₀ linear saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid comprising ₁₀ -C ₈₀ without straight-chain saturated or partially unsaturated substituted aliphatic chain of C.

In some embodiments, lipid comprises no more than one, as the case ₁₀ -C ₈₀ straight chain saturated or partially unsaturated substituted aliphatic chain of C. In some embodiments, the lipid comprises two or more of the optionally substituted C ₁₀ -C ₈₀ straight chain saturated or partially unsaturated aliphatic chain.

In some embodiments, R ^LD is or comprises a C ₁₀ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₀ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₁ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₁ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₂ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₂ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₃ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₃ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₄ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₄ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₅ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₅ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₆ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₆ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₇ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₇ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₈ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₈ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₉ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₁₉ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₀ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₀ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₁ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₁ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₂ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₂ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₃ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₃ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₄ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₄ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₅ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₅ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₆ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₆ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₇ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₇ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₈ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₈ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₉ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₂₉ partially unsaturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₃₀ saturated linear aliphatic chain. In some embodiments, R ^LD is or comprises a C ₃₀ partially unsaturated linear aliphatic chain.

In some embodiments, the lipid has the structure of R ^LD -OH. In some embodiments, the lipid has the structure of R ^LD -C(O)OH. In some embodiments, R ^LD is

In some embodiments, the lipid is lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid. (DHA or cis-DHA), tallow acid, arachidonic acid and dilinoleic acid. In some embodiments, the lipid is lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid. (DHA or cis-DHA), trumpetic acid and dilinoleic acid. In some embodiments, the lipid has the structure:

In some embodiments, the lipid is any of the following, consists of or consists of any of the following. At least partially hydrophobic or amphiphilic molecules, phospholipids, triglycerides, diglycerides, monoglycerides, fat-soluble vitamins, sterols, fats and waxes. In some embodiments, the lipid is any of the following: fatty acids, glycerol Lipids, glycerophospholipids, sphingolipids, sterol lipids, prenol lipids, glycolipids, polyketones, and other molecules.

According to the present invention, lipids can be incorporated into the provided techniques via a variety of methods. In some embodiments, the lipid is physically mixed with the provided oligonucleotide to form the provided composition. In some embodiments, the lipid is chemically bound to the oligonucleotide.

In some embodiments, the provided compositions comprise two or more lipids. In some embodiments, the provided oligonucleotides comprise two or more binding lipids. In some embodiments, the two or more binding lipids are the same. In some embodiments, two or more binding lipids are different. In some embodiments, the provided oligonucleotide comprises no more than one lipid. In some embodiments, the oligonucleotides of the provided compositions comprise different types of binding lipids. In some embodiments, the oligonucleotides of the provided compositions comprise lipids of the same type.

The lipid may optionally be bound to the oligonucleotide via a linking group. According to the present invention, various types of linking groups in the art can be employed. In some embodiments, the linking group comprises a phosphate group, which can be used, for example, to bind the lipid via a chemical manner similar to that employed in oligonucleotide synthesis. In some embodiments, the linking group comprises a guanamine, ester or ether group. In some embodiments, the linking group has the structure of -L-. In some embodiments, after binding to the oligonucleotide, the lipid forms a moiety having the structure of -LR ^LD , wherein L and R ^LD are each independently as defined and described herein.

In some embodiments, -L- comprises a divalent lipid chain. In some embodiments, -L- comprises a phosphate group. In some embodiments, -L- comprises a phosphorothioate group. In some embodiments, -L- having _{-C (O) NH- (CH 2} ) 6 -OP (= O) (S -) - of the structure.

Lipids can be bound to the oligonucleotide at various suitable positions via a linking group, as appropriate. In some embodiments, the lipid is bound via a 5'-OH group. In some embodiments, the lipid is bound via a 3 '-OH group. In some embodiments, the lipid is bound via one or more sugar moieties. In some embodiments, the lipid is bound via one or more bases. In some implementations In one embodiment, the lipid is incorporated via one or more internucleotide linkages. In some embodiments, an oligonucleotide may contain multiple binding lipids that are independently joined via their 5'-OH, 3'-OH, sugar moiety, base moiety, and/or internucleotide linkage.

In some embodiments, the lipid is bound to the oligonucleotide via a linking moiety as appropriate. It is generally understood by those skilled in the art that various techniques can be employed to bind lipids to oligonucleotides in accordance with the present invention. For example, with respect to lipids comprising a carboxyl group, the lipids can be bound via a carboxyl group. In some embodiments, the lipid is linked via a linking group having a structure of -L-, wherein L is as defined and described in Formula I. In some embodiments, L comprises a phosphodiester or a modified phosphodiester moiety. In some embodiments, the compound formed by lipid binding has a structure of (R ^LD -L-) _x -(oligonucleotide), wherein x is 1 or an integer greater than 1, and R ^LD and L are each independently As defined and described herein. In some embodiments, x is one. In some embodiments, x is greater than one. In some embodiments, the oligonucleotide is an oligonucleotide. For example, in some embodiments, the conjugate has the following structure:

In some embodiments, the linking group is selected from the group consisting of: an uncharged linking group; a charged linking group; a linking group comprising an alkyl group; a linking group comprising a phosphate; a branched linking group; an unbranched linking group a linking group comprising at least one cleavage group; a linking group comprising at least one redox cleavage group; a linking group comprising at least one phosphate-based cleavage group; a linkage comprising at least one acid cleavage group a group; a linking group comprising at least one ester-based cleavage group; and a linking group comprising at least one peptide-based cleavage group.

In some embodiments, the lipid does not bind to the oligonucleotide.

In some embodiments, the present invention relates to compositions and related methods of oligonucleotide and lipid composition comprising the lipids containing C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain, wherein the lipid is bound to Biologically active agent. In some embodiments, the present invention relates to compositions comprising a lipid and an oligonucleotide composition of the related compositions and methods, the lipid comprises C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted with a Or a plurality of C _1-4 aliphatic group substitutions wherein the lipid binds to the biologically active agent.

In some embodiments, the present invention relates to compositions and related methods of oligonucleotide and lipid composition comprising the lipids containing C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain wherein no lipid binding To biologically active agents. In some embodiments, the present invention relates to compositions comprising a lipid and an oligonucleotide composition of the related compositions and methods, the lipid comprises C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted with a Or a plurality of C _1-4 aliphatic group substitutions wherein the lipid does not bind to the biologically active agent.

In some embodiments, the composition comprises an oligonucleotide selected from the group consisting of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma - Linoleic acid, docosahexaenoic acid (cis-DHA), trumpetine acid, arachidonic acid and dilinoleyl group, wherein the lipid does not bind to the biologically active agent. In some embodiments, the composition comprises an oligonucleotide selected from the group consisting of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma - linoleic acid, docosahexaenoic acid (cis-DHA), trumpetine acid, and dilinoleyl group, wherein the lipid does not bind to the biologically active agent.

In some embodiments, the composition comprises an oligonucleotide selected from the group consisting of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma - linoleic acid, docosahexaenoic acid (cis-DHA), trumpetine acid, arachidonic acid and dilinoleyl group, wherein the lipid binds to the biologically active agent. In some embodiments, the composition comprises an oligonucleotide selected from the group consisting of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma - linoleic acid, docosahexaenoic acid (cis-DHA), trumpetic acid and dilinoleic acid, wherein the lipid binds to the organism Learn the active agent.

In some embodiments, the composition comprises an oligonucleotide selected from the group consisting of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma - linoleic acid, docosahexaenoic acid (cis-DHA), trumpetine acid, arachidonic acid and dilinoleyl group, wherein the lipid directly binds to the biologically active agent (no linking group insertion) Between lipids and biologically active agents). In some embodiments, the composition comprises an oligonucleotide selected from the group consisting of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma - linoleic acid, docosahexaenoic acid (cis-DHA), trumpetic acid and dilinoleyl, in which the lipid binds directly to the biologically active agent (no linker is inserted into the lipid and biology) Between the active agents).

In some embodiments, the composition comprises an oligonucleotide selected from the group consisting of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma - linoleic acid, docosahexaenoic acid (cis-DHA), trumpetine acid, arachidonic acid and dilinoleic acid, wherein the lipid is indirectly bound to the biologically active agent (the linking group is inserted into the lipid Between the biologically active agent). In some embodiments, the composition comprises an oligonucleotide selected from the group consisting of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma - linoleic acid, docosahexaenoic acid (cis-DHA), trumpetine acid and dilinoleyl group, wherein the lipid is indirectly bound to the biologically active agent (the linking group is inserted into the lipid and biologically active) Between the agents).

A linking group is a moiety that joins two portions of the composition; to a non-limiting example, the linking group of the oligonucleotide to the lipid is physically linked.

Non-limiting examples of suitable linking groups include: uncharged linking groups; charged linking groups, linking groups comprising alkyl groups; linking groups comprising phosphates; branched chain linking groups; unbranched linking groups; a linking group comprising at least one cleavage group; a linking group comprising at least one redox cleavage group; a linking group comprising at least one phosphate-based cleavage group; a linking group comprising at least one acid cleavage group Contains at least a linking group based on an ester-cleaving group; a linking group comprising at least one peptide-based cleavage group.

In some embodiments, the linking group comprises an uncharged linking group or a charged linking group.

In some embodiments, the linking group comprises an alkyl group.

In some embodiments, the linking group comprises a phosphate. In various embodiments, the phosphate ester can also displace bridging oxygen by using nitrogen (bridged aminophosphate), sulfur (bridged phosphorothioate), and carbon (bridged methylene phosphonate) (ie, It is modified by linking the phosphate to the nucleoside oxygen. Displacement can occur at either the attached oxygen or the two linked oxygen. When the bridged oxygen is the 3'-oxygen of the nucleoside, it can be replaced with carbon. When the bridging oxygen is 5'-oxygen of the nucleoside, it can be replaced with nitrogen. In various embodiments, the phosphate-containing linking group comprises any one or more of the following: a phosphorodithioate, an amino phosphate, a borane phosphonate, or a compound of formula (I): (I) wherein R ^{3 is} selected from the group consisting of OH, SH, NH ₂ , BH ₃ , CH ₃ , C _1-6 alkyl, C _6-10 aryl, C _1-6 alkoxy and C _6- io aryloxy a group wherein the C _1-6 alkyl group and the C _6- ioaryl group are unsubstituted or, as the case may be, independently substituted with 1 to 3 groups independently selected from a halogen group, a hydroxyl group and NH ₂ ; and R ^{4 is} selected from O, S, NH or CH ₂ .

In some embodiments, the linking group comprises a direct bond or an atom such as oxygen or sulfur, a unit such as NR ¹ , C(O), C(O)NH, SO, SO ₂ , SO ₂ NH or an atom such as Chain: substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroaryl Alkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl , alkarylalkyl, alkarylalkenyl, alkarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl,alkenylarylalkynyl,alkynylarylalkyl,alkynyl Arylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl,alkylheteroarylalkynyl,alkenylheteroarylalkyl,alkenylheteroarylene , alkenyl heteroaryl alkynyl, alkynyl heteroarylalkyl, alkynyl heteroarylalkenyl, alkynyl heteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, Alkylheterocyclyl alkynyl, alkenylheterocyclylalkyl, alkenylheterocyclyl , alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkyl a heteroaryl, alkenyl heteroaryl, alkynyl heteroaryl group, wherein one or more methylene groups may be O, S, S(O), SO ₂ , N(R ₁ ) ₂ , C(O), a cleavage linking group, a substituted or unsubstituted aryl group, a substituted or unsubstituted heteroaryl group, a substituted or unsubstituted heterocyclic ring, or a terminal; wherein R ¹ is hydrogen, sulfhydryl, or a lipid A group-based or substituted aliphatic group.

In some embodiments, the linking group is a branched chain linking group. In some embodiments, the branching point of the branched chain linking group can be at least trivalent, but can be a tetravalent, pentavalent, or hexavalent atom, or a group that exhibits such multivalentity. In some embodiments, the branch points are --N, --N(Q)-C, --O--C, --S--C, --SS--C, --C(O)N (Q)-C, --OC(O)N(Q)-C, --N(Q)C(O)--C or --N(Q)C(O)O--C; where Q Each occurrence is independently H or optionally substituted alkyl. In other embodiments, the branching point is a glycerol or glycerol derivative.

In one embodiment, the linking group comprises at least one cleavable linking group.

By way of a non-limiting example, the cleavable linkage group is sufficiently stable outside of the cell, but it cleaves upon entry into the target cell, releasing two portions of the linker group that are held together. By way of a non-limiting example, the cleavable linkage group is cleaved in the target cell or in a first reference condition (which may, for example, be selected for use in simulating or representing intracellular conditions) than in the individual's blood or in a second reference. Conditions (which may, for example, be selected to mimic or represent conditions present in blood or serum) are at least 10 times or more, at least 100 times faster. The cleavable linking group is sensitive to the cleavage agent, such as pH, redox potential or the presence of degrading molecules. In general, lysing agents are more common or higher in activity or activity in the interior of cells than in serum or blood. presence. Examples of such degradation agents include: selective redox agents for specific or no substrate specificity, including, for example, oxidative or reductase or reducing agents present in cells, such as thiols, which can be reduced by reduction a redox cleavable linking group; an esterase; an endosome or reagent that establishes an acidic environment, such as a pH of 5 or less; can be used as a universal acid, peptidase (which can be a receptor specific) And phosphatase to hydrolyze or degrade an enzyme that cleaves a linking group.

By way of a non-limiting example, a cleavable linking group such as a disulfide bond can be pH sensitive. The human serum has a pH of 7.4 and the average intracellular pH is slightly lower, in the range of about 7.1-7.3. The endosomes have a more acidic pH, in the range of 5.5-6.0, and the lysosome has an acidic or even stronger pH of about 5.0. Some of the linking groups will have a cleavable linkage group that cleaves at a suitable pH, thereby releasing the cationic lipid from the ligand within the cell or releasing it into the desired compartment of the cell.

By way of non-limiting example, a linking group can include a cleavable linking group that can be cleaved by a particular enzyme. The type of cleavable linking group incorporated into the linking group can depend on the cell to be targeted. For example, a ligand that targets the liver can be linked to a cationic lipid via a linking group that includes an ester group. Liver cells are rich in esterases, and thus the linking group will cleave more efficiently in liver cells than in cell types that are not rich in esterase. Other cell types rich in esterase include cells of the lung, kidney cortex and testis.

By way of a non-limiting example, a linking group can contain peptide bonds that can be used in targeting cell types rich in peptidases, such as liver cells and synoviocytes.

By way of a non-limiting example, the applicability of a candidate cleavable linking group can be assessed by testing the ability of the degradation agent (or condition) to cleave the candidate linking group. It is also desirable to test the ability of the candidate cleavable linking group to resist cleavage in the blood or in contact with other non-target tissues. Thus, the relative cleavage sensitivity between the first and second conditions can be determined, wherein the first condition is selected to indicate lysis in the target cell and the second condition is selected to indicate in other tissues or biological fluids (eg, blood or serum) Lysis. Assessment can be in cell-free systems, cells, cell culture Performed in a nutrient, organ or tissue culture or whole animal. It can be adapted for initial evaluation in cell-free or culture conditions and confirmed by further evaluation throughout the animal. By way of a non-limiting example, the cleavage of a candidate compound in a cell (or under in vitro conditions selected for simulating intracellular conditions) is greater than in blood or serum (or in vitro conditions selected for use in simulating extracellular conditions). ) at least 2, 4, 10 or 100 times faster.

In some embodiments, the linking group comprises a redox cleavable linking group. By way of non-limiting example, one type of cleavable linking group is a redox cleavable linking group that is cleaved after reduction or oxidation. A non-limiting example of a reducing cleavable linking group is a disulfide linking group (--S--S--). To determine if a candidate cleavable linking group is suitable for "reducing a cleavable linking group" or for example, whether it is suitable for use with a particular iRNA moiety and a particular targeting agent, the methods described herein may be contemplated. By way of a non-limiting example, an agent known in the art to mimic the rate of cleavage observed in a cell (e.g., a target cell) is evaluated by incubation with dithiothreitol (DTT) or other reducing agent. Candidate. Candidates can also be evaluated under conditions selected for simulating blood or serum conditions. As a non-limiting example, candidate compounds are cleaved up to 10% in blood. By way of a non-limiting example, the candidate compound is degraded in the cell (or under in vitro conditions selected for simulating intracellular conditions) than in the blood (or in vitro conditions selected for use in simulating extracellular conditions) ) Fast at least 2, 4, 10 or 100 times. The rate of cleavage of the candidate compound can be determined using standard enzyme kinetic assays under conditions selected for simulating intracellular media and compared to conditions selected for use in simulating extracellular mediators.

In some embodiments, the linking group comprises a phosphate-based cleavable linking group that is cleaved by a reagent that degrades or hydrolyzes the phosphate group. An example of a reagent for cleavage of a phosphate group in a cell is an enzyme in a cell, such as a phosphatase. Examples of phosphate-based linking groups are --O--P(O)(ORk)-O--, --O--P(S)(ORk)-O--, --O-- P(S)(SRk)-O--,--S--P(O)(ORk)-O--,--O--P(O)(ORk)-S--,--S- -P(O)(ORk)-S--,--O--P(S)(ORk)-S--,--S--P(S)(ORk)-O--,--O --P(O)(Rk)-O--,--O-- P(S)(Rk)-O--,--S--P(O)(Rk)-O--,--S--P(S)(Rk)-O--,--S- -P(O)(Rk)-S--, --O--P(S)(Rk)-S--. Other non-limiting examples are -O--P(O)(OH)--O--, -O--P(S)(OH)--O--, -O--P(S )(SH)--O--,--S--P(O)(OH)--O--,--O--P(O)(OH)--S--,--S- -P(O)(OH)--S--,--O--P(S)(OH)--S--,--S--P(S)(OH)--O--, --O--P(O)(H)--O--,--O--P(S)(H)--O--,--S--P(O)(H)-- O--,--S--P(S)(H)--O--,--S--P(O)(H)--S--,--O--P(S)( H)--S--. Another non-limiting example is --O--P(O)(OH)--O--.

In some embodiments, the linking group comprises an acid cleavable linking group that is a linking group that cleaves under acidic conditions. By way of non-limiting example, an acid cleavable linkage group is cleaved in an acidic environment having a pH of about 6.5 or less (e.g., about 6.0, 5.5, 5.0 or less) or by an enzyme such as may be used as a general acid. The reagent is cleaved. In cells, specific low pH organelles, such as endosomes and lysosomes, can provide a cleavage environment for acid cleavable linkage groups. Examples of acid cleavable linking groups include, but are not limited to, esters of hydrazine, esters, and amino acids. The acid cleavable group can have the formula -C=NN--, C(O)O or -OC(O). In another non-limiting example, when the carbon (alkoxy) attached to the oxygen of the ester is an aryl group, it is a substituted alkyl or tertiary alkyl group such as dimethylpentyl or tert-butyl. .

In some embodiments, the linking group comprises an ester-based linking group. By way of a non-limiting example, an ester-based cleavable linking group is cleaved by an enzyme such as an esterase and a guanylase in a cell. Examples of ester-based cleavable linking groups include, but are not limited to, alkyl, alkyl, and alkynyl esters. The ester cleavable linkage group has the formula -C(O)O-- or -OC(O)--. Such candidates can be evaluated using methods similar to those described above.

In some embodiments, the linking group comprises a peptide-based cleavage group. Peptide-based cleavable linking groups are cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linkage groups are peptide bonds formed between amino acids to obtain oligopeptides (eg, dipeptides, tripeptides, etc.) and polypeptides. By way of a non-limiting example, the peptide-based cleavable group does not include amidino (--C(O)NH--). The guanamine group can be formed between any alkyl, alkenyl or alkynyl groups. Peptide bonds are formed between amino acids to form specific types of indoleamine bonds of peptides and proteins. By way of non-limiting example, peptide-based cleavage groups can be limited to formation between amino acids to produce peptide and protein peptide bonds (i.e., guanamine linkages) and do not include the entire guanamine functionality. By way of non-limiting example, a peptide-based cleavable linkage group can have the formula -NHCHR ^A C(O)NHCHR ^B C(O)-, wherein R ^A and R ^B are two adjacent amine groups R group of acid. Such candidates can be evaluated using methods similar to those described above.

Any of the linking groups reported in the art can be used, as non-limiting examples include those linking groups described in U.S. Patent Application Serial No. 20,150,265,708.

A non-limiting example of a method of binding a lipid to an oligonucleotide is presented in Example 1.

A non-limiting example of a linking group is a C6 amine linking group.

Targeting component

In some embodiments, the provided compositions further comprise a targeting component (targeting compound or moiety). The targeting component may or may not bind to the lipid or biologically active agent. In some embodiments, the targeting component binds to the biologically active agent. In some embodiments, the biologically active agent binds to the lipid and the targeting component. As described herein, in some embodiments, the biologically active agent is the provided oligonucleotide. Thus, in some embodiments, provided oligonucleotide compositions further comprise targeting elements in addition to lipids and oligonucleotides. Various targeting components, such as lipids, antibodies, peptides, carbohydrates, and the like, can be used in accordance with the present invention.

In accordance with the present invention, targeting components can be incorporated into the provided techniques via a variety of methods. In some embodiments, the targeting component is physically mixed with the provided oligonucleotide to form the provided composition. In some embodiments, the targeting component is chemically bound to the oligonucleotide.

In some embodiments, the provided compositions comprise two or more targeting components. In some embodiments, the provided oligonucleotides comprise two or more binding targeting components. In some embodiments, the two or more binding targeting components are the same. In some embodiments, two or more binding targeting components are different. In some embodiments, provided The oligonucleotide comprises no more than one targeting component. In some embodiments, the oligonucleotides of the provided compositions comprise different types of binding targeting components. In some embodiments, the oligonucleotides of the provided compositions comprise the same type of targeting component.

The targeting component can optionally be bound to the oligonucleotide via a linking group. According to the present invention, various types of linking groups in the art can be employed. In some embodiments, the linking group comprises a phosphate group, which can be used, for example, to chemically bind the targeting component via a chemical approach similar to that employed in oligonucleotide synthesis. In some embodiments, the linking group comprises a guanamine, ester or ether group. In some embodiments, the linking group has the structure of -L-. The targeting component can be bound via a linking group that is the same or different from the lipid.

The targeting component can be bound to the oligonucleotide at various suitable positions via a linking group, as appropriate. In some embodiments, the targeting component is bound via a 5'-OH group. In some embodiments, the targeting component is bound via a 3 '-OH group. In some embodiments, the targeting component is bound via one or more sugar moieties. In some embodiments, the targeting component is joined via one or more bases. In some embodiments, the targeting component is incorporated via one or more internucleotide linkages. In some embodiments, an oligonucleotide may contain multiple binding targeting components independently via its 5'-OH, 3'-OH, sugar moiety, base moiety, and/or internucleotide linkage. Combine. The targeting component and lipid can be combined at the same, adjacent, and/or spaced apart locations. In some embodiments, the targeting component binds at one end of the oligonucleotide and the lipid binds at the other end.

In some embodiments, the oligonucleotide in the palm-controlled oligonucleotide composition is an antisense oligonucleotide. In some embodiments, the sequence of the oligonucleotide comprises or consists of the sequence of any of the oligonucleotides disclosed herein. In some embodiments, the provided oligonucleotides comprise a base sequence, a backbone linkage pattern, a backbone to palm center pattern, and/or a chemical modification of any of the oligonucleotides disclosed herein (eg, The pattern of base modification, sugar modification, etc.). In some embodiments, the sequence of the oligonucleotide comprises or consists of the sequence of any of the oligonucleotides disclosed in Table 8.

In some embodiments, the antisense oligonucleotide is involved in ribonuclease H-mediated cleavage Oligonucleotides; for example, an antisense oligonucleotide hybridizes to a portion of a target mRNA in a sequence-specific manner to target mRNA for cleavage by ribonuclease H. In some embodiments, an antisense oligonucleotide is capable of distinguishing between different genes of the same gene or target. In some embodiments, an antisense oligonucleotide is capable of distinguishing between a wild type and a mutant dual gene of interest. In some embodiments, the antisense oligonucleotide is involved in a large amount of ribonuclease H-mediated cleavage of the mutant dual gene, but is involved in much less ribonuclease H-mediated cleavage of the wild-type dual gene (eg, There is no ribonuclease H-mediated cleavage of the wild-type dual gene involved in the target. In some embodiments, an antisense oligonucleotide is capable of participating in ribonuclease H-mediated cleavage of a nucleic acid comprising a mutation. In some embodiments, the antisense oligonucleotide targets a mutant dual gene. In some embodiments, the antisense oligonucleotide targets a mutant dual gene of the Huntington gene.

In some embodiments, an antisense oligonucleotide is capable of distinguishing between a wild type and a mutant dual gene of a target in the Huntingtin gene.

In some embodiments, the present invention relates to a method for inhibiting the expression of a mutant Huntington's gene in a mammal comprising preparing a lipid-containing and oligonucleotide (for example, a non-limiting example, targeting a Huntington's gene) A composition of an antisense oligonucleotide of a mutant dual gene) and a composition for administration to a mammal.

A method of treating a disease caused by an overexpression of a mutant Huntingtin gene, the method comprising administering an antisense oligo comprising a lipid and an oligonucleotide (for example, a non-limiting example, a mutant dual gene that targets a Huntington gene) A composition of nucleotides).

A method of treating Huntington's disease, comprising administering a composition comprising a lipid and an oligonucleotide, which is a non-limiting example, an antisense oligonucleotide that targets a mutant dual gene of a Huntington gene.

A method for treating signs and/or symptoms of Huntington's disease in an individual by providing a lipid-containing and oligonucleotide (for example, a non-limiting example, targeting the Huntington's gene A composition of an antisense oligonucleotide of a mutant dual gene) and administering to the subject a therapeutically effective amount of the composition.

A method of administering an oligonucleotide to an individual in need thereof, comprising the steps of providing a composition comprising an oligonucleotide and a lipid, and administering to the individual a composition, wherein the biologically active compound is an oligonucleotide ( By way of non-limiting example, an antisense oligonucleotide that targets a mutant dual gene of the Huntington gene, and wherein the lipid is any of the lipids disclosed herein.

A method of treating a disease in a subject, the method comprising the steps of providing a composition comprising an oligonucleotide and a lipid and administering to the individual a therapeutically effective amount of the composition, wherein the biologically active compound is an oligonucleotide A limiting example is an antisense oligonucleotide that targets a mutant dual gene of a Huntington gene, and wherein the lipid is any of the lipids disclosed herein, and wherein the disease is any of the diseases disclosed herein.

A method of inhibiting the expression of a mutant Huntington gene in a mammal, the method comprising preparing an antisense oligonucleotide comprising a lipid and an oligonucleotide (for example, a non-limiting example, a mutant dual gene that targets a Huntington's gene) Composition and the step of administering the composition to a mammal.

A method of administering a biologically active agent to an individual in need thereof, comprising the steps of providing a composition comprising a biologically active agent and a lipid, and administering to the individual a composition, wherein the biologically active compound is an oligonucleoside An acid (for example, a non-limiting example, an antisense oligonucleotide that targets a mutant dual gene of a Huntington gene), and wherein the lipid is any of the lipids disclosed herein.

A method of treating Huntington's disease in an individual, the method comprising the steps of providing a composition comprising a biologically active agent and a lipid, and administering to the individual a therapeutically effective amount of the composition, wherein the biologically active compound is an oligonucleotide (A non-limiting example, an antisense oligonucleotide that targets a mutant dual gene of a Huntington gene), and wherein the lipid is any of the lipids disclosed herein.

A method for mediating ribonuclease H-mediated cleavage of a nucleic acid comprising a mutant Huntington gene in a mammal, the method comprising preparing a composition comprising a lipid and an antisense oligonucleotide and administering to a mammal The step of the composition.

A method of treating a disease caused by a Huntington's gene mutation, the method comprising administering a composition comprising a lipid and an antisense oligonucleotide, wherein the oligonucleotide is capable of participating in a ribonuclease H-mediated cleavage comprising the mutated nucleic acid .

A method for treating the signs and/or symptoms of Huntington's disease in an individual by providing an antisense comprising a lipid and an oligonucleotide (for example, a non-limiting example, a mutant dual gene that targets the Huntington's gene A composition of oligonucleotides and administering to the individual a therapeutically effective amount of the composition.

A method of administering an oligonucleotide to an individual in need thereof, comprising the steps of providing a composition comprising an oligonucleotide and a lipid, and administering to the individual a composition, wherein the oligonucleotide is capable of participating in a nucleic acid comprising the mutation Ribonuclease H mediated cleavage, and wherein the lipid is any of the lipids disclosed herein.

A method of treating Huntington's disease in an individual, wherein the disease or condition is related to a genetic mutation, the method comprising the steps of providing a composition comprising an oligonucleotide and a lipid and administering to the individual a therapeutically effective amount of the composition, wherein Nucleotides can be involved in ribonuclease H-mediated cleavage of a nucleic acid comprising a mutation, and wherein the lipid is any of the lipids disclosed herein.

A method for mediating ribonuclease H-mediated cleavage of a nucleic acid comprising a mutant Huntington gene in a mammal, the method comprising preparing a composition comprising a lipid and an antisense oligonucleotide and administering to a mammal The step of the composition.

A method of treating a disease associated with a Huntington's gene mutation, the method comprising administering a composition comprising a lipid and an antisense oligonucleotide, wherein the antisense oligonucleotide is capable of participating in a ribonuclease H mediated by a nucleic acid comprising the mutation Cracking.

A method of treating a disease caused by a Huntington gene mutation, the method comprising And a composition comprising a lipid and an oligonucleotide, wherein the oligonucleotide is capable of participating in ribonuclease H-mediated cleavage of the nucleic acid comprising the mutation.

A method for treating the signs and/or symptoms of Huntington's disease in an individual by providing an antisense comprising a lipid and an oligonucleotide (for example, a non-limiting example, a mutant dual gene that targets the Huntington's gene A composition of oligonucleotides and administering to the individual a therapeutically effective amount of the composition.

A method of administering an oligonucleotide to an individual in need thereof, comprising the steps of providing a composition comprising an oligonucleotide and a lipid, and administering to the individual a composition, wherein the oligonucleotide is capable of participating in a nucleic acid comprising the mutation Ribonuclease H mediated cleavage, and wherein the lipid is any of the lipids disclosed herein.

A method of treating Huntington's disease in an individual, wherein the Huntington's disease is related to a Huntington's gene mutation, the method comprising the steps of providing a composition comprising an oligonucleotide and a lipid and administering to the individual a therapeutically effective amount of the composition, wherein Nucleotides can be involved in ribonuclease H-mediated cleavage of a nucleic acid comprising a mutation, and wherein the lipid is any of the lipids disclosed herein.

A method for mediating ribonuclease H-mediated cleavage of a nucleic acid comprising a mutant Huntington gene in a mammal, the method comprising preparing a composition comprising a lipid and an antisense oligonucleotide and administering to a mammal A step of a composition wherein the lipid is any of the lipids disclosed herein, and wherein the sequence of the antisense oligonucleotide comprises or consists of any of the antisense oligonucleotides disclosed herein (eg, in Table 8) The sequence of the nucleotide. In some embodiments, the provided oligonucleotides comprise a base sequence of any of the oligonucleotides disclosed herein (eg, in Table 8), a backbone linkage pattern, a backbone-to-palm center pattern, and / or a pattern of chemical modifications (eg, base modifications, sugar modifications, etc.).

A method of treating a disease associated with a Huntington's gene mutation, the method comprising administering a composition comprising a lipid and an antisense oligonucleotide, wherein the antisense oligonucleotide is capable of participating in a ribonuclease H mediated by a nucleic acid comprising the mutation Cleavage, wherein the lipid is as disclosed herein Any of the lipids, and wherein the sequence of the antisense oligonucleotide comprises or consists of the sequence of any of the antisense oligonucleotides disclosed herein (eg, in Table 8).

A method of treating a disease caused by a Huntington's gene mutation, the method comprising administering a composition comprising a lipid and an oligonucleotide, wherein the oligonucleotide is capable of participating in a ribonuclease H-mediated cleavage comprising the mutated nucleic acid, wherein A lipid is any of the lipids disclosed herein, and wherein the oligonucleotide comprises or consists of the sequence of any of the antisense oligonucleotides disclosed herein (eg, in Table 8).

A method for treating the signs and/or symptoms of Huntington's disease in an individual by providing an antisense comprising a lipid and an oligonucleotide (for example, a non-limiting example, a mutant dual gene that targets the Huntington's gene A composition of an oligonucleotide and administering to the individual a therapeutically effective amount of a composition, wherein the lipid is any of the lipids disclosed herein, and wherein the sequence of the oligonucleotide comprises or consists of: , Table 8) Sequences of any of the antisense oligonucleotides disclosed.

A method of administering an oligonucleotide to an individual in need thereof, comprising the steps of providing a composition comprising an oligonucleotide and a lipid, and administering to the individual a composition, wherein the oligonucleotide is capable of participating in a nucleic acid comprising the mutation Ribonuclease H mediated cleavage, and wherein the lipid is any of the lipids disclosed herein, wherein the lipid is any of the lipids disclosed herein, and wherein the sequence of the oligonucleotide comprises or consists of: For example, the sequence of any of the antisense oligonucleotides disclosed in Table 8).

A method of treating Huntington's disease in an individual, wherein the Huntington's disease is related to a Huntington's gene mutation, the method comprising the steps of providing a composition comprising an oligonucleotide and a lipid and administering to the individual a therapeutically effective amount of the composition, wherein A nucleotide can be involved in ribonuclease H-mediated cleavage of a nucleic acid comprising a mutation, and wherein the lipid is any of the lipids disclosed herein, and wherein the oligonucleotide comprises or consists of: herein (eg, a table) 8) The sequence of any of the antisense oligonucleotides disclosed.

In some embodiments, the provided oligonucleotides comprise any of the disclosures disclosed herein The pattern of the base sequence of the oligonucleotide, the backbone linkage mode, the backbone-to-palm center mode, and/or chemical modification (eg, base modification, sugar modification, etc.).

In some embodiments, an oligonucleotide composition comprises a plurality of oligonucleotides that share: 1) a common base sequence; 2) a common backbone linkage pattern; and 3) a common backbone phosphorus modification pattern; One or more of the plurality of oligonucleotides are individually bound to the lipid.

In some embodiments, the palm-controlled oligonucleotide composition comprises a plurality of oligonucleotides that share: 1) a common base sequence; 2) a common backbone linkage pattern; and 3) a common backbone Phosphorus modification mode; wherein: the composition is controlled by palmarity because a plurality of oligonucleotides share the same stereochemistry at one or more inter-nucleotide linkages; one of the plurality Or a plurality of oligonucleotides are individually bound to the lipid; and one or more of the plurality of oligonucleotides are optionally and individually bound to the targeting compound or moiety.

In some embodiments, the antisense oligonucleotide is in a pair of palm-controlled oligonucleotide compositions. In some embodiments, the oligonucleotide is in a pair of palm-controlled oligonucleotide compositions.

The various oligonucleotides are listed in Table 8. Many of these oligonucleotides are capable of participating in the ribonuclease H-mediated cleavage of the human Huntington gene, as described in U.S. Patent Application Serial Nos. 62/195,779 and 5/4/16, the application of which application Serial No. As shown in the information presented in U.S. Patent Application Serial No. 62/331,960, the entireties of each of each of And; as shown in the information presented here.

A variety of oligonucleotides are particularly capable of participating in human Huntington's gene targets or mutant variants thereof (including WV-1092, WVE120101, WV-2603 or WV-2595) or any other nucleic acid disclosed herein (including but not limited to) Ribonuclease H mediated cleavage of each of those listed in Table 8.

Any oligonucleotide or palmetto controlled oligonucleotide composition can be combined with any of the methods or compositions disclosed herein (eg, any pharmaceutical composition, modification and/or use and/or method of manufacture) use.

In some embodiments, the present invention provides the following embodiments:

A palm-controlled oligonucleotide composition comprising an oligonucleotide having the following definitions: 1) a common base sequence and length; 2) a common backbone linkage pattern; and 3) a common master In a chain-to-palm central mode, the composition is a substantially pure single oligonucleotide preparation because the predetermined amount of oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern, and a common The main chain is in the palm center mode.

2. A palm-controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type, characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode And 3) a common backbone-to-palm central mode; the composition is palm-controlled, as compared to a substantially racemic formulation of oligonucleotides having the same base sequence and length, The oligonucleotide of a particular oligonucleotide type in the composition is enriched.

2a. A palmitic controlled oligonucleotide composition comprising an oligonucleotide of a particular oligonucleotide type, characterized in that: 1) a common base sequence and length; 2) a common backbone linkage mode; and 3) a common backbone-to-palm central mode; the composition is palm-controlled because it has the same base sequence and For a substantially racemic formulation of a length oligonucleotide, the oligonucleotide of the particular oligonucleotide type is enriched in the composition, wherein the oligonucleotide targets the mutant Huntington gene and is From about 10 to about 50 nucleotides, wherein the backbone linkage comprises at least one phosphorothioate, and wherein the backbone-to-palm center mode comprises at least one pair of palmar centers in the Rp configuration and at least one in the form of Sp The shape of the center of the palm.

3. A palmitic controlled oligonucleotide composition comprising an oligonucleotide having the following definitions: 1) a common base sequence and length; 2) a common backbone linkage pattern; and 3) a common master In a chain-to-palm central mode, the composition is a substantially pure single oligonucleotide preparation because at least about 10% of the oligonucleotides in the composition have a common base sequence and length, a common backbone linkage pattern And the common main chain to the palm center model.

4. The composition of any of the preceding embodiments, wherein the oligonucleotide comprises one or more wing regions and a common core region, wherein: each wing region independently has two or more bases Length, and independently and optionally, includes one or more pairs of palmitic internucleotide linkages; and the core region independently has the length of two or more bases and independently comprises one or more pairs of palms Interlinking between nucleotides.

5. An oligonucleotide composition comprising a predetermined amount of oligonucleotides comprising one or more wing regions and a common core region, wherein: each wing region independently has two or More base lengths, and independently and optionally one or more pairs of palmitic internucleotide linkages; The core region independently has the length of two or more bases and independently comprises one or more pairs of palmitic internucleotide linkages, and the common core region has: 1) a common base sequence and length; a common main chain linkage mode; and 3) a common main chain versus palm center mode.

6. An oligonucleotide composition comprising a predetermined amount of oligonucleotides comprising one or more wing regions and a common core region, wherein: each wing region independently has two or More base lengths, and independently and optionally one or more pairs of palmar internucleotide linkages; the core regions independently have the length of two or more bases and independently comprise one Or a plurality of palmitic internucleotide linkages, and the core region has: 1) a common base sequence; 2) a common backbone linkage mode; 3) a common backbone pair palm center mode; and 4) a common master Chain phosphorus modification mode.

The composition of any of the preceding embodiments, wherein the oligonucleotide of the oligonucleotide type comprises at least one wing region and a core region, wherein: each wing region independently has two or more The length of the bases, and independently and optionally one or more pairs of palmar internucleotide linkages; the core regions independently have the length of two or more bases and independently comprise one or a plurality of palmar internucleotide linkages; and at least one nucleotide in the mid-wing region is different from at least one nucleotide of the core region, wherein the difference is in one or more of the following: 1) a backbone Bonding; 2) mode of the main chain to the palm center; 3) sugar modification.

The composition of any of the preceding embodiments, wherein the oligonucleotides are defined by a mode having a common backbone phosphorus modification.

8. The composition of any of the preceding embodiments, wherein the composition comprises a predetermined amount of an oligonucleotide of an individual oligonucleotide type, wherein the oligonucleotide type is defined by: 1) a base sequence 2) the main chain linkage mode; 3) the main chain to the palm center mode; and 4) the main chain phosphorus modification mode.

9. The composition of any of the preceding embodiments, wherein the oligonucleotides having a common base sequence are the same oligonucleotide type, characterized by a base sequence, a backbone linkage pattern, a backbone pair Palm center mode and main chain phosphorus modification mode.

10. The composition of any of the preceding embodiments, wherein the composition comprises a predetermined amount of two or more oligonucleotides of the individual oligonucleotide type, wherein the oligonucleotide type is defined by : 1) base sequence; 2) main chain linkage mode; 3) main chain versus palm center mode; and 4) main chain phosphorus modification mode.

11 An oligonucleotide composition which is palm-controlled because the composition contains a predetermined amount of an oligonucleotide of an individual oligonucleotide type, wherein the oligonucleotide type is defined by: 1) Base sequence; 2) main chain linkage mode; 3) main chain versus palm center mode; and 4) main chain phosphorus modification mode.

The composition of any of the preceding embodiments, wherein the composition comprises two or more individual oligonucleotide types.

13. The composition of any of the preceding embodiments, wherein the oligonucleotide type is comprised of a base identity, a base modification mode, a sugar modification mode, a backbone linkage mode, a backbone-to-palm center mode, and The main chain phosphorus modification mode is defined.

14. The composition of any of the preceding embodiments, wherein the oligonucleotides having the common sequence have the same structure.

15. The composition of any of the preceding embodiments, wherein the oligonucleotides of the same oligonucleotide type have the same structure.

16. The composition of any of the preceding embodiments, wherein the oligonucleotides have one wing.

17. The composition of any of the preceding embodiments, wherein the oligonucleotides are hemimeric bodies having a wing-core structure.

18. The composition of any of the preceding embodiments, wherein the oligonucleotides are those having a core-wing structure.

19. The composition of any of embodiments 1 to 15, wherein the oligonucleotides have two wings.

The composition of any of embodiments 1 to 15, wherein the oligonucleotides are spacers having a wing-core-wing structure.

21. The composition of any of the preceding embodiments wherein the wing comprises a palmitic internucleotide linkage.

22. The composition of any of the preceding embodiments, wherein each wing independently comprises a palmar internucleotide linkage.

23. The composition of any of embodiments 1 to 17 and 19 to 22, wherein the wing of the 5' end of the core comprises a palmitic internucleotide linkage at the 5' end of the wing.

24. The composition of any of embodiments 1 to 16 and 18 to 22, wherein the core 3' The wing of the end contains a pair of internucleotide linkages at the 3' end of the wing.

25. The composition of any of the preceding embodiments, wherein the wing has only one pair of palmitic internucleotide linkages, and the other internucleotide linkages of the wings are each a native phosphate linkage ( ).

26. The composition of any of the preceding embodiments, wherein the palmitic internucleotide linkage has the structure of Formula I.

27. The composition of any of the preceding embodiments, wherein the palmitic internucleotide linkage has the structure of Formula I, and wherein X is S and Y and Z are O.

28. The composition of any of the preceding embodiments wherein the interphalangeal internucleotide linkage is a phosphorothioate linkage.

29. The composition of any of the preceding embodiments, wherein the inter-nucleotide linkage is Sp .

30. The composition of any of the preceding embodiments, wherein each pair of palmitic internucleotide linkages is Sp .

31. Examples 1 to 29 of a composition according to any one of the embodiments, wherein the inter-nucleotide linkage is chiral R p.

32. Examples 1 to 28 of any one of composition embodiments, wherein the inter-nucleotide linkage chiral as R p.

The composition of any of embodiments 1 to 31, wherein the wing comprises a Sp phosphorothioate linkage.

The composition of any of embodiments 1 to 31, wherein each wing independently comprises a Sp phosphorothioate linkage.

35. The composition of any of embodiments 1 to 17, 19 to 31 and 33 to 34 wherein the wing is at the 5' end of the core and the wing has a Sp phosphorothioate linkage.

36. The composition of any of embodiments 1 to 17, 19 to 31 and 33 to 35, wherein the wing is at the 5' end of the core and the wing has a Sp phosphorothioate linkage at the 5' end of the wing.

The composition of any of embodiments 1 to 17, 19 to 31, and 33 to 36, wherein the wing is at the 5' end of the core, and the wing has a Sp phosphorothioate linkage at the 5' end of the wing, and The other internucleotide linkages of the wing are each a natural phosphate linkage ( ).

38. The composition of any of embodiments 1 to 16, 18 to 31 and 33 to 34, wherein the wing is at the 3' end of the core and the wing has a Sp phosphorothioate linkage at the 3' end of the wing.

39. The composition of any of embodiments 1 to 16, 18 to 31, 33 to 34 and 38, wherein the wing is at the 3' end of the core and the wing has a Sp phosphorothioate linkage at the 3' end of the wing. Union.

40. The composition of any of embodiments 1 to 16, 18 to 31, 33 to 34 and 38 to 39, wherein one wing is at the 3' end of the common core and the wing has S p sulfur at the 3' end of the wing Phosphophosphate linkages, and the other internucleotide linkages of the wings are each a natural phosphate linkage ( ).

The composition of any of embodiments 1 to 29 and 31 to 40, wherein the wing comprises an Rp phosphorothioate linkage.

42. The composition of any of embodiments 1 to 29 and 31 to 40, wherein each wing independently comprises an Rp phosphorothioate linkage.

43. The composition of any of embodiments 1 to 17, 19 to 29, and 31 to 42, wherein the wing is at the 5' end of the core and the wing has an Rp phosphorothioate linkage.

44. The composition of any of embodiments 1 to 17, 19 to 29 and 31 to 43, wherein the wing is at the 5' end of the core and the wing has an Rp phosphorothioate linkage at the 5' end of the wing.

The composition of any of embodiments 1 to 17, 19 to 29, and 31 to 44, wherein the wing is at the 5' end of the core, and the wing has an Rp phosphorothioate linkage at the 5' end of the wing, and The other internucleotide linkages of the wing are each a natural phosphate linkage ( ).

The composition of any of embodiments 1 to 16, 18 to 29, and 31 to 42, wherein the wing is at the 3' end of the core and the wing has an R p phosphorothioate.

47. The composition of any of embodiments 1 to 16, 18 to 29, and 31 to 42, wherein the wing is at the 3' end of the core and the wing has an Rp phosphorothioate linkage at the 3' end of the wing.

48. The composition of any of embodiments 1 to 16, 18 to 29, and 31 to 42, wherein one wing is at the 3' end of the common core and the wing has an Rp phosphorothioate linkage at the 3' end of the wing. And the other internucleotide linkages of the wing are each a natural phosphate linkage ( ).

49. The composition of any of embodiments 1 to 28, wherein the wing is at the 5' end of the core and the 5' end nucleotide linkage is a pair of palmitic internucleotide linkages.

Examples 1 to 50. The composition of any one of embodiment 28, wherein the core wings 5 'end and the 5' end of the internucleotide linkage to S p chiral inter-nucleotide linkages.

Examples 1 to 51. The composition of any one of embodiment 28, wherein the core wings 5 'end and the 5' end of the internucleotide linkage as R p chiral inter nucleotide linkage.

The composition of any one of embodiments 1 to 28 and 49 to 51, wherein the wing is at the 3' end of the core, and the 3' terminal internucleotide linkage is a pair of palmitic internucleotide linkages .

53. Examples 1 to 28, and 49 to 51 in any one of the composition, wherein the core wings 3 'end and 3' end internucleotide linkage is between the S p chiral nucleotide Bonding.

The composition of any one of embodiments 1 to 28 and 49 to 51, wherein the wing is at the 3' end of the core, and the 3' end nucleotide linkage is between R p and palmar nucleotide Bonding.

The composition of any of the preceding embodiments, wherein each wing independently comprises a natural phosphate linkage ( ).

The composition of any of the preceding embodiments, wherein each wing independently comprises two or more natural phosphate linkages ( ).

The composition of any of the preceding embodiments, wherein each wing independently comprises two or more natural phosphate linkages, and all of the natural phosphate linkages are continuous.

58. The composition of any of the preceding embodiments wherein the wings have three or more The length of multiple bases.

59. The composition of any of the preceding embodiments, wherein one wing has a length of four or more bases.

60. The composition of any of the preceding embodiments, wherein one wing has a length of five or more bases.

61. The composition of any of the preceding embodiments, wherein one wing has a length of six or more bases.

62. The composition of any of the preceding embodiments, wherein one wing has a length of seven or more bases.

63. The composition of any of the preceding embodiments, wherein one wing has a length of eight or more bases.

64. The composition of any of the preceding embodiments, wherein one wing has a length of nine or more bases.

65. The composition of any of the preceding embodiments, wherein one wing has a length of ten or more bases.

The composition of any of the preceding embodiments, wherein each wing independently has a length of three or more bases.

67. The composition of any of the preceding embodiments, wherein each wing independently has a length of four or more bases.

68. The composition of any of the preceding embodiments, wherein each wing independently has a length of five or more bases.

The composition of any of the preceding embodiments, wherein each wing independently has a length of six or more bases.

The composition of any of the preceding embodiments, wherein each wing independently has a length of seven or more bases.

71. The composition of any of the preceding embodiments, wherein each wing independently has The length of eight or more bases.

The composition of any of the preceding embodiments, wherein each wing independently has a length of nine or more bases.

73. The composition of any of the preceding embodiments, wherein each wing independently has a length of ten or more bases.

The composition of any of embodiments 1 to 57, wherein the wing has a length of two bases.

The composition of any of embodiments 1 to 57, wherein the wing has a length of three bases.

The composition of any of embodiments 1 to 57, wherein the wings have a length of four bases.

77. The composition of any of embodiments 1 to 57, wherein the wings have a length of five bases.

The composition of any of embodiments 1 to 57, wherein the wings have a length of six bases.

The composition of any of embodiments 1 to 57, wherein the wings have a length of seven bases.

The composition of any of embodiments 1 to 57, wherein the wings have a length of eight bases.

The composition of any of embodiments 1 to 57, wherein the wings have a length of nine bases.

The composition of any of embodiments 1 to 57, wherein the wings have a length of ten bases.

The composition of any of embodiments 1 to 57, wherein the wings have a length of 11 bases.

The composition of any of embodiments 1 to 57, wherein the wing has 12 bases The length.

The composition of any of embodiments 1 to 57, wherein the wings have a length of 13 bases.

The composition of any of embodiments 1 to 57, wherein the wings have a length of 14 bases.

The composition of any of embodiments 1 to 57, wherein the wings have a length of 15 bases.

The composition of any of embodiments 1 to 11 and 15 to 76, wherein each wing has the same length.

89. The composition of any of the preceding embodiments, wherein the wing is defined by a sugar modification relative to the core.

90. The composition of any of the preceding embodiments, wherein each wing independently comprises a modified sugar moiety.

The composition of any of the preceding embodiments, wherein each of the flavonoid moieties is independently a modified sugar moiety.

The composition of any of the preceding embodiments, wherein the modified sugar moiety comprises a high affinity sugar modification.

The composition of any of the preceding embodiments, wherein the modified sugar moiety has a 2' modification.

The composition of any of the preceding embodiments, wherein the modified sugar moiety comprises a bicyclic sugar modification.

The composition of any of the preceding embodiments, wherein the modified sugar moiety comprises a bicyclic sugar modification having an -L- or -O-L- bridge linking two ring carbon atoms.

96. The embodiment of any of the foregoing one embodiment of the composition, wherein the modified sugar moiety comprises' bicyclic sugar modified bridge having the _{4'-CH (CH 3) -O} -2.

97. Examples 1 to 93 of a composition according to any one of the embodiments, wherein the modified sugar moiety comprises a 2 'modification, wherein the 2' modification is a 2'-OR ^1.

The composition of any one of embodiments 1 to 93, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is 2'-OR ¹ , wherein R ¹ is optionally substituted C _{1 -6} alkyl.

The composition of any one of embodiments 1 to 93, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is 2'-MOE.

The composition of any one of embodiments 1 to 93, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is 2'-OMe.

The composition of any one of embodiments 1 to 96, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is S- cEt.

The composition of any one of embodiments 1 to 93, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is FANA.

The composition of any one of embodiments 1 to 93, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is an FRNA.

The composition of any of embodiments 1 to 92, wherein the modified sugar moiety has a 5' modification.

The composition of any one of embodiments 1 to 92, wherein the modified sugar moiety is R- 5'-Me-DNA.

106. The composition of any of embodiments 1 to 92, wherein the modified sugar moiety is S- 5'-Me-DNA.

The composition of any one of embodiments 1 to 92, wherein the modified sugar moiety is FHNA.

108. The composition of any of the preceding embodiments, wherein the individual sugar moieties are modified.

109. The composition of any of the preceding embodiments, wherein all modified glycan moieties within the wing have the same modification.

110. The composition of any of the preceding embodiments, wherein all modified glycan moieties have the same modification.

The composition of any one of embodiments 1 to 108, wherein the at least one modified glycoside moiety is different from the other modified glycan moiety.

The composition of any of the preceding embodiments, wherein the wing comprises a modified base.

113. The composition of any of the preceding embodiments, wherein the wing comprises 2S-dT.

114. The composition of any of the preceding embodiments, wherein the core region has a length of five or more bases.

The composition of any of the preceding embodiments, wherein the core region has a length of six or more bases.

116. The composition of any of the preceding embodiments, wherein the core region has a length of seven or more bases.

117. The composition of any of the preceding embodiments, wherein the core region has a length of eight or more bases.

The composition of any of the preceding embodiments, wherein the core region has a length of nine or more bases.

119. The composition of any of the preceding embodiments, wherein the core region has a length of ten or more bases.

120. The composition of any of the preceding embodiments, wherein the core region has a length of 11 or more bases.

The composition of any of the preceding embodiments, wherein the core region has a length of 12 or more bases.

122. The composition of any of the preceding embodiments, wherein the core region has a length of 13 or more bases.

123. The composition of any of the preceding embodiments, wherein the core region has 14 The length of more than one base.

124. The composition of any of the preceding embodiments, wherein the core region has a length of 15 or more bases.

125. The composition of any of 1 to 113, wherein the core region has a length of five bases.

126. The composition of any of 1 to 113, wherein the core region has a length of six bases.

127. The composition of any of 1 to 113, wherein the core region has a length of seven bases.

The composition of any one of 1 to 113, wherein the core region has a length of eight bases.

129. The composition of any of 1 to 113, wherein the core region has a length of nine bases.

130. The composition of any of 1 to 113, wherein the core region has a length of ten bases.

The composition of any one of 1 to 113, wherein the core region has a length of 11 bases.

The composition of any one of 1 to 113, wherein the core region has a length of 12 bases.

133. The composition of any of 1 to 113, wherein the core region has a length of 13 bases.

134. The composition of any of 1 to 113, wherein the core region has a length of 14 bases.

135. The composition of any of 1 to 113, wherein the core region has a length of 15 bases.

136. The composition of any of the preceding embodiments, wherein the core region does not have any What 2' decoration.

153. The composition of any of the preceding embodiments, wherein each core sugar moiety is not modified.

138. The composition of any of the preceding embodiments, wherein each sugar moiety of the core region is a native DNA sugar moiety.

139. The composition of any of the preceding embodiments, wherein the core region comprises a pair of palmitic internucleotide linkages.

The composition of any of the preceding embodiments, wherein the internucleotide linkages of the core regions are inter-nucleotide linkages.

141. The composition of any of the preceding embodiments wherein each of the internucleotide linkages of the core region is a pair of palmitic internucleotide linkages having the structure of Formula I.

142. The composition of any of the preceding embodiments wherein each of the internucleotide linkages of the core region is a pair of palmitic internucleotide linkages having the structure of Formula I, and wherein X is S, and Y And Z is O.

143. The composition of any of the preceding embodiments, wherein the internucleotide linkages of the core regions are inter-nucleotide linkages having the structure of Formula I, and wherein one -LR ^{1 is} not -H.

144. The composition of any one of embodiments 1 to 142, wherein the internucleotide linkages of the core regions are phosphorothioate linkages.

145. The embodiment according to any one of the foregoing embodiments of the composition, wherein the backbone of the core region comprises a chiral center mode _{(S p) m (R p} ) n, wherein m is 1-50, and n is 1 10.

146. The embodiment of any one of the foregoing embodiments of the composition, wherein the backbone of the core region comprises a chiral center mode _{(S p) m (R p} ) n, wherein m is 1-50, n is 1-10 And m>n.

147. The embodiment as claimed in any one of the embodiments of the composition, wherein the backbone of the core region comprises a chiral center mode _{(S p) m (R p} ) n, wherein m is 2,3,4,5,6 , 7 or 8, and n is 1.

148. Examples 1-144 in the composition according to any one of the embodiments, wherein the backbone of the core region comprises a chiral center mode _{(R p) n (S p} ) m, wherein m is 1-50 and n is 1 -10.

149. The composition of any one of embodiments 1 to 144 and 148, wherein the core-to-palm center mode of the core region comprises R p( S p) _m , wherein m is 2, 3, 4, 5, 6, 7 or 8.

The composition of any one of embodiments 1 to 144 and 148 to 149, wherein the core-to-palm center mode of the core region comprises R p( S p) ₂ .

151. The composition of any one of embodiments 1 to 144, wherein the core-to-palm center mode of the core region comprises ( N p) _t ( R p) _n ( S p) _m , where t is 1- 10, n is 1-10, m is 1-50, and each N p is independently R p or Sp .

152. The composition of any one of embodiments 1 to 144 and 151, wherein the core-to-palm center mode of the core region comprises ( S p ) _t ( R p) _n ( S p) _m , where t is 1-10, n is 1-10, and m is 1-50.

153. The composition of any one of embodiments 1 to 144 and 151 to 152, wherein n is one.

154. The composition of any one of embodiments 1 to 144 and 151 to 153, wherein t is 2, 3, 4, 5, 6, 7, or 8.

155. The composition of any of embodiments 1 to 144 and 151 to 154, wherein m is 2, 3, 4, 5, 6, 7, or 8.

156. The composition of any one of embodiments 1 to 144 and 151 to 155, wherein at least one of t and m is greater than 5.

157. The composition of any of the preceding embodiments, wherein the core-to-palm center mode of the core region comprises S p S p R p S p S p.

158. The composition of any of the preceding embodiments, wherein 50% or more of the palmar internucleotide linkages in the core region have a Sp configuration.

159. The composition of any of the preceding embodiments, wherein 60% or more of the palmar internucleotide linkages in the core region have a Sp configuration.

160. The composition of any of the preceding embodiments, wherein 70% or more of the palmar internucleotide linkages in the core region have a Sp configuration.

161. The composition of any of the preceding embodiments, wherein 80% or more of the palmar internucleotide linkages in the core region have a Sp configuration.

162. The composition of any of the preceding embodiments, wherein 90% or more of the palmar internucleotide linkages in the core region have a Sp configuration.

163. The embodiment according to any one of the foregoing embodiments of the composition, between which the core region of each nucleotide linkage having only one chiral R p, the core region and the core region of additional nucleotides The inter linkages are each S p .

164. The composition of any of the preceding embodiments, wherein the base portions of the core are not modified.

165. The composition of any one of embodiments 1 to 163, wherein the core region comprises a modified base.

166. The composition of any one of embodiments 1 to 163, wherein the core region comprises a modified base, wherein the modified base is substituted with A, T, C or G.

167. The composition of any one of embodiments 1 to 164, wherein each of the base moieties in the core region is independently selected from the group consisting of A, T, C, and G.

168. The composition of any of embodiments 1 to 163, wherein the core region is a DNA sequence, the phosphate linkage of which is independently replaced by a phosphorothioate linkage.

169. The composition of any of the preceding embodiments, wherein the oligonucleotides are single stranded.

170. The composition of any of the preceding embodiments, wherein the oligonucleotides are antisense oligonucleotides, antagonistic miRs, microRNAs, microRNA precursors, anti-miR, super miR, ribonuclease , Ul attached protein, RNA activator, RNAi agent, decoy oligonucleotide, triploid-forming oligonucleotide, aptamer or adjuvant.

171. The composition of any of the preceding embodiments, wherein the oligonucleotides are Antisense oligonucleotides.

172. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 10 bases.

173. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 11 bases.

174. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 12 bases.

175. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 13 bases.

176. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 14 bases.

177. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 15 bases.

178. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 16 bases.

179. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 17 bases.

The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 18 bases.

181. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 19 bases.

182. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 20 bases.

183. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 21 bases.

184. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides Has a length greater than 22 bases.

185. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 23 bases.

186. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 24 bases.

187. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length greater than 25 bases.

188. The composition of any of the preceding embodiments, wherein the oligonucleotides have a length of less than about 200 bases.

189. The composition of any of the preceding embodiments, wherein the oligonucleotides have a length of less than about 150 bases.

190. The composition of any of the preceding embodiments, wherein the oligonucleotides have a length of less than about 100 bases.

191. The composition of any of the preceding embodiments, wherein the oligonucleotides have a length of less than about 50 bases.

192. The composition of any of the preceding embodiments, wherein the oligonucleotides have a length of less than about 40 bases.

193. The composition of any of the preceding embodiments, wherein the oligonucleotides have a length of less than about 30 bases.

194. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 10 bases in length.

195. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 11 bases in length.

196. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 12 bases in length.

197. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides It has a length of 13 bases.

198. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 14 bases in length.

199. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 15 bases in length.

The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length of 16 bases.

The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length of 17 bases.

The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 18 bases in length.

203. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 19 bases in length.

The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 20 bases in length.

205. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 21 bases in length.

The composition of any one of embodiments 1 to 171, wherein the oligonucleotides have a length of 22 bases.

207. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 23 bases in length.

208. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 24 bases in length.

209. The composition of any one of embodiments 1 to 171, wherein the oligonucleotides are 25 bases in length.

210. The composition of any of the preceding embodiments, wherein the oligonucleotide type is not ( S p, S p, R p, S p, S p, R p, S p, S p, R p , S p, S p)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] or ( R p, R p, R p, R p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, R p, R p, R p, R p, R p)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC(5R-(SSR)3-5R), wherein the underlined nucleotide is modified by 2'-MOE.

211. The composition of any of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from the group consisting of: ( S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] or ( R p, R p, R p, R p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, R p, R p, R p, R p, R p)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC(5R-(SSR)3-5R), wherein the underline nucleotides are 2 '-MOE decoration.

The composition of any of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from the group consisting of:

Where lowercase letters indicate 2'OMe RNA residues; uppercase letters indicate 2'OH RNA residues; and bold and " s " indicate phosphorothioate moieties;

Wherein lower case letters indicate 2'-OMe RNA residues; upper case letters indicate RNA residues; d = 2'-deoxygen residues; and "s" indicates a phosphorothioate moiety;

Wherein lower case letters indicate 2'-OMe RNA residues; upper case letters indicate RNA residues; d = 2'-deoxygen residues; "s" indicates phosphorothioate moieties;

Wherein lower case letters indicate 2'-OMe RNA residues; upper case letters indicate 2'-F RNA residues; d = 2'-deoxygen residues; and "s" indicates a phosphorothioate moiety;

213. The composition of any of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from the group consisting of: d[A _R C _S A _R C _S A _R C _S A _R C _S A _R C], d[C _S C _S C _S C _R C _R C _S C _S C _S C _S C], d[C _S C _S C _S C _S C _S C _S C _R C _R C _S C] d[C _S C _S C _S C _S C _S C _R C _R C _S C _S C], wherein R is an R p phosphorothioate linkage and S is a S phosphorothioate linkage.

214. The composition of any of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from the group consisting of: GGA _R T _S G _R T _S T _R ^m C _S TCGA, GGA _R T _R G _S T _S T _R ^m C _R TCGA, GGA _S T _S G _R T _R T _S ^m C _S TCGA, where R is an R p phosphorothioate linkage and S is a S p phosphorothioate linkage, all The other linkage is PO, and each ^m C is a 5-methylcytosine modified nucleoside.

215. The composition of any of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from the group consisting of T _k T _k ^m C _k AGT ^m CATGA ^m CT _k T ^m C _k ^m C _k , The nucleosides with the following "k" are followed by (S)-cEt modification, R is the Rp phosphorothioate linkage, S is the Sp phosphorothioate linkage, and each ^m C is 5-A. A cytosine-modified nucleoside, and all internucleoside linkages are phosphorothioates (PS), and its stereochemical mode is selected from the group consisting of RSSSRSRRRS, RSSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRRSSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSSRSRSRSR, RSSRSRSSRS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.

215a. The composition of any of the preceding embodiments, wherein the common backbone pair palm center mode comprises SSR, RSS, SSRSS, SSRSSR, RSSSRSRRRS, RSSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS , SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSRRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSSRSRSRSR, RSSRSRSSRS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR or SSSSRRRRSR.

215b. The composition of any of the preceding embodiments, wherein the common backbone pair palm center mode comprises SSRSS, SSRSSR, RSSRSRSRRS, RSSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSSSSSS, RRRRSSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR RRRRSSSSRS, SRRSRRRRRR, RSSRSRRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSSRSRSRSR, RSSRSRSSRS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR or SSSSRRRRSR.

215c. The composition of any of the preceding embodiments, wherein the common backbone pair palm center mode comprises RSSSRSRRRS, RSSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR , RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSSRSRSRSR, RSSRSRSSRS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR or SSSSRRRRSR.

216. The composition of any of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from the group consisting of T _k T _k ^m C _k AGT ^m CATGA ^m CT T _k ^m C _k ^m C _k , The nucleosides with the following "k" are followed by (S)-cEt modification, R is the Rp phosphorothioate linkage, S is the Sp phosphorothioate linkage, and each ^m C is 5-A. a cytosine-modified nucleoside, and all of the internucleoside linkages in the bottomed core are phosphorothioate (PS), and the stereochemical mode is selected from the group consisting of RSSSRSRRRS, RSSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSSSSSS, RRRRSSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSRRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSSRSRSRSR, RSSRSRSSRS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.

217. The composition of embodiment 215 or 216, wherein each phosphorothioate moiety of each of the nucleotides comprising the (S)-cEt modification is stereospecific.

218. The composition of any of the preceding embodiments, wherein the base sequence is or comprises a sequence complementary to the target sequence, wherein the cleavage mode provided by the composition when contacted with the nucleic acid polymer comprising the target sequence The reference cleavage mode was changed compared to the reference oligonucleotide composition.

219. The composition of any of the preceding embodiments wherein the nucleic acid polymer is RNA and the reference oligonucleotide composition is a substantially racemic formulation of oligonucleotides sharing a common sequence and length.

The composition of any of the preceding embodiments, wherein the nucleic acid polymer is RNA, and the reference oligonucleotide composition is an uncontrolled palm nucleus that shares a common sequence and length of oligonucleotides Glycoside composition.

221. The composition of any of the preceding embodiments, wherein the modified cleavage mode has a cleavage site that is less than the reference cleavage mode.

222. The composition of any of the preceding embodiments, wherein the modified cleavage mode has only one cleavage site within the target sequence, and the reference cleavage mode has within the target sequence There are two or more cleavage sites.

223. The composition of any of the preceding embodiments, wherein the base sequence of the oligonucleotide is or comprises a sequence complementary to a characteristic sequence element relative to the same target gene present in the population The other dual gene defines a specific dual gene of the target gene, and the composition is characterized in that the transcript of the specific dual gene is inhibited when it contacts the system of the target dual gene and the transcript of the other dual gene representing the same gene. The degree of inhibition is at least 2-fold greater than that observed for the other pair of genes of the same gene.

224. The composition of any of the preceding embodiments, wherein the base sequence of the oligonucleotide is or comprises a sequence complementary to a characteristic sequence element relative to the same target gene present in the population Other dual genes define a specific dual gene of a target gene characterized in that, when contacted with a system that expresses a transcript of the gene of interest, it exhibits inhibition of the expression of a transcript of a particular dual gene to the extent that: a) The amount of transcript detected from a particular dual gene is found to differ by at least a factor of 2, and the composition is reduced by a factor of 2 relative to the absence of the composition; b) the degree of inhibition observed by another pair of genes of the same gene is greater At least 2 times; or c) the amount of transcripts detected from a particular dual gene is at least 2-fold different, the composition is reduced by a factor of 2 compared to the absence of the composition, and the other pair of genes is identical to the same gene The degree of inhibition observed was at least 2 times greater.

225. The composition of any of the preceding embodiments, wherein the base sequence comprises a sequence that is complementary to a characteristic sequence element of the target, wherein the characteristic sequence element defines a target sequence relative to a similar sequence.

226. The composition of any of the preceding embodiments, wherein the base sequence of the core region comprises a sequence that is complementary to a characteristic sequence element of the target, wherein the characteristic sequence element defines a target sequence relative to a similar sequence.

227. The composition of any of the preceding embodiments wherein the target sequence is a sequence comprising a mutation and the analogous sequence is a wild type sequence.

228. The composition of any of the preceding embodiments, wherein the characteristic sequence element defines a particular dual gene of the target sequence relative to other dual genes of the same target sequence.

229. The composition of any of the preceding embodiments, wherein the characteristic sequence element defines a particular dual gene of the target gene relative to other dual genes of the same target gene.

230. The composition of any of the preceding embodiments, wherein the sequence is 100% complementary to the signature element.

231. The composition of any of the preceding embodiments, wherein the position 11, 12 or 13 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the characteristic sequence element.

232. The composition of any of embodiments 1 to 230, wherein the position 11 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the characteristic sequence element.

233. The composition of any of embodiments 1 to 230, wherein the position 12 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the characteristic sequence element.

234. The composition of any of embodiments 1 to 230, wherein the position 13 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the characteristic sequence element.

235. The composition of any of embodiments 1 to 230, wherein the position 8, 9, or 10 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the characteristic sequence element.

236. The composition of any of embodiments 1 to 230, wherein the position 8 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the characteristic sequence element.

237. The composition of any one of embodiments 1 to 230, wherein the position 9 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the characteristic sequence element.

238. The composition of any of embodiments 1 to 230, wherein the position 10 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the characteristic sequence element.

239. The composition of any of embodiments 1 to 230, wherein the position 6, 7, or 8 in the core region as counted from the 5' end of the core region is aligned with the characteristic sequence element.

240. The composition of any of embodiments 1 to 230, wherein the position 6 in the core region as counted from the 5' end of the core region is aligned with the characteristic sequence element.

241. The composition of any of embodiments 1 to 230, wherein the position 7 in the core region as counted from the 5' end of the core region is aligned with the characteristic sequence element.

242. The composition of any of embodiments 1 to 230, wherein the position 8 in the core region as counted from the 5' end of the core region is aligned with the characteristic sequence element.

243. The composition of any of embodiments 1 to 230, wherein the position 3, 4 or 5 in the core region as counted from the 3' end of the core region is aligned with the characteristic sequence element.

244. The composition of any of embodiments 1 to 230, wherein the position 3 in the core region as counted from the 3' end of the core region is aligned with the characteristic sequence element.

245. The composition of any of embodiments 1 to 230, wherein the position 4 in the core region as counted from the 3' end of the core region is aligned with the characteristic sequence element.

246. The composition of any of embodiments 1 to 230, wherein the position 5 in the core region as counted from the 3' end of the core region is aligned with the characteristic sequence element.

247. The composition of any of the preceding embodiments, wherein the common base sequence or base sequence of the oligonucleotide type is a DNA cleavage mode having a cleavage site in or near the characteristic sequence element of the target nucleic acid sequence The sequence of points.

248. The composition of any of the preceding embodiments, wherein the DNA cleavage mode is a cleavage mode of an oligonucleotide composition of the DNA oligonucleotide having the sequence, wherein each oligonucleotide in the composition Has the same structure.

249. The composition of any of the preceding embodiments, wherein the common base sequence or base sequence of the oligonucleotide type is a stereoregular cleavage mode having in or near the characteristic sequence element of the target nucleic acid sequence The sequence of the cleavage site.

The composition of any of the preceding embodiments, wherein the stereoregular cleavage mode is a cleavage mode of a stereoregular composition of oligonucleotides having the sequence, wherein each internucleotide linkage is sulphur Phosphate.

251. The composition of any of the preceding embodiments, wherein the cleavage site in or near the characteristic sequence element of the target nucleic acid sequence is in the core region.

252. The composition of any of the preceding embodiments, wherein the cleavage site is in the vicinity of a characteristic sequence element of the target nucleic acid sequence.

253. The composition of any of the preceding embodiments, wherein the cleavage site in the vicinity is a cleavage site that is linked away from the 0, 1, 2, 3, 4 or 5 nucleotides of the signature element.

254. The composition of any of the preceding embodiments, wherein the cleavage site in the vicinity is a cleavage site that is 0 nucleotides away from the signature sequence element.

255. The composition of any of the preceding embodiments, wherein the cleavage site in the vicinity is a cleavage site that is 1 nucleotide linkage away from the characteristic sequence element.

256. The composition of any of the preceding embodiments wherein the cleavage site in the vicinity is a cleavage site that is 2 nucleotides away from the signature element.

257. The composition of any of the preceding embodiments wherein the cleavage site in the vicinity is a cleavage site that is 3 nucleotides away from the signature sequence element.

258. The composition of any of the preceding embodiments, wherein the cleavage site in the vicinity is a cleavage site that is 4 nucleotides away from the signature sequence element.

259. The composition of any of the preceding embodiments, wherein the cleavage site in the vicinity is a cleavage site that is 5 nucleotides away from the signature sequence element.

260. The composition of any of the preceding embodiments, wherein the cleavage site in the vicinity is the cleavage site 5' to the cleavage site.

261. The composition of any of the preceding embodiments wherein the cleavage site in the vicinity is the cleavage site 3' to the cleavage site.

261. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is the primary cleavage site.

262. The composition of any of the preceding embodiments, wherein the characteristic sequence element The cleavage site in or near is the relative major cleavage site.

263. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is a relative major cleavage site, wherein greater than 40% of the total cleavage occurs at the site.

264. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is a relative major cleavage site, wherein greater than 50% of the total cleavage occurs at the site.

265. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is a relative major cleavage site, wherein greater than 60% of the total cleavage occurs at the site.

266. The composition of any of the preceding embodiments, wherein the cleavage site in or near the characteristic sequence element is a relative major cleavage site, wherein greater than 70% of the total cleavage occurs at the site.

267. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is a relative major cleavage site, wherein greater than 80% of the total cleavage occurs at the site.

268. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is a relative major cleavage site, wherein greater than 90% of the total cleavage occurs at the site.

269. The composition of any of the preceding embodiments, wherein the cleavage site in or near the characteristic sequence element is a relative major cleavage site, wherein greater than 95% of the total cleavage occurs at the site.

270. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is a relative major cleavage site, wherein greater than 100% of the total cleavage occurs at the site.

271. The composition of any of the preceding embodiments, wherein the characteristic sequence element The cleavage site in or near is the absolute major cleavage site, wherein more than 5% of the total target is cleaved at this site.

272. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 10% of the total target is cleaved at the site.

273. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 15% of the total target is cleaved at the site.

274. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 20% of the total target is cleaved at the site.

275. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 25% of the total target is cleaved at the site.

276. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 30% of the total target is cleaved at the site.

277. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 35% of the total target is cleaved at the site.

278. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 40% of the total target is cleaved at the site.

279. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 45% of the total target is cleaved at the site.

280. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 50% of the total target is cleaved at the site.

281. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 60% of the total target is cleaved at the site.

282. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 70% of the total target is cleaved at the site.

283. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 80% of the total target is cleaved at the site.

284. The composition of any of the preceding embodiments, wherein the cleavage site within or adjacent to the characteristic sequence element is an absolute major cleavage site, wherein greater than 90% of the total target is cleaved at the site.

285. The composition of any of the preceding embodiments wherein the relative or absolute major cleavage site is determined by ribonuclease H assay.

286. The composition of any of the preceding embodiments, wherein the characteristic sequence element comprises a single nucleotide polymorphism (SNP) or mutation.

287. The composition of any of the preceding embodiments, wherein the characteristic sequence element comprises a single nucleotide polymorphism.

288. The composition of any of the preceding embodiments, wherein the characteristic sequence element is a single nucleotide polymorphism.

289. The composition of any of the preceding embodiments, wherein the single nucleotide polymorphism is a single nucleotide polymorphism associated with Huntington's disease.

290. The composition of any of the preceding embodiments, wherein the single nucleotide polymorphism Like the single nucleotide polymorphism found in the Huntington gene.

291. The composition of any of the preceding embodiments, wherein the single nucleotide polymorphism is selected from the group consisting of rs362307, rs7685686, rs362268, rs2530595, rs362331 or rs362306.

291a. The composition of any of the preceding embodiments wherein the single nucleotide polymorphism is selected from the group consisting of rs362307, rs7685686, rs362268 or rs362306.

292. The composition of any of the preceding embodiments wherein the single nucleotide polymorphism is rs362307.

293. The composition of any of the preceding embodiments wherein the single nucleotide polymorphism is rs7685686.

294. The composition of any of the preceding embodiments wherein the single nucleotide polymorphism is rs362268.

295. The composition of any of the preceding embodiments wherein the single nucleotide polymorphism is rs362306.

295a. The composition of any of the preceding embodiments, wherein the single nucleotide polymorphism is rs2530595.

295b. The composition of any of the preceding embodiments wherein the single nucleotide polymorphism is rs362331.

296. The composition of any one of embodiments 1 to 290, wherein the single nucleotide polymorphism is in an exon.

297. The composition of any of embodiments 1 to 290, wherein the single nucleotide polymorphism is in the intron.

298. The composition of any one of embodiments 1 to 290, wherein the composition is selected from the group consisting of Table N1, Table N2, Table N3, Table N4, and Table 8.

298a. The composition of any one of embodiments 1 to 290, wherein the composition is selected from the group consisting of Tables N1, N2, Table N3, and Table N4.

299. The composition of any one of embodiments 1 to 290, wherein the composition is selected from the group consisting of Table N1A, Table N2A, Table N3A, Table N4A, and Table 8; and WV-1092, WVE120101, WV-2603, and WV -2595.

299a. The composition of any one of embodiments 1 to 290, wherein the composition is selected from the group consisting of Table N1A, Table N2A, Table N3A, and Table N4A.

300. The composition of any of embodiments 1 to 290, wherein the composition is WV-1092.

300a. The composition of any of embodiments 1 to 290, wherein the composition is WVE120101.

300b. The composition of any of embodiments 1 to 290, wherein the composition is WV-2603.

300c. The composition of any of embodiments 1 to 290, wherein the composition is WV-2595.

301. The composition of any of embodiments 1 to 290, wherein the composition is not ONT-450, ONT-451 or ONT-452.

The composition of any of the preceding embodiments, wherein the characteristic sequence element comprises a mutation.

303. The composition of any of the preceding embodiments, wherein the characteristic sequence element is a mutation.

The composition of any of the preceding embodiments, wherein the oligonucleotide is at least 95% complementary to the mutant dual gene.

305. The composition of any of the preceding embodiments wherein the oligonucleotide is 100% complementary to the mutant dual gene.

306. The composition of any of the preceding embodiments, wherein the oligonucleotide is at least 95% complementary to a target sequence comprising a SNP, wherein the SNP is associated with a disease.

307. The composition of any of the preceding embodiments, wherein the oligonucleotide comprises The target sequence of the SNP is 100% complementary, with SNPs associated with disease.

307a. The composition of any of the preceding embodiments wherein the oligonucleotide selectively reduces the RNA content of the mutant dual gene.

308. A pharmaceutical composition comprising a composition according to any of the preceding embodiments and a pharmaceutical carrier.

</ RTI> The composition of any one of the preceding claims, further comprising cerebrospinal fluid.

309. The composition of any of the preceding claims, further comprising artificial cerebrospinal fluid.

310. A method for controlling cleavage of a nucleic acid polymer, the method comprising the steps of: controlling a nucleotide sequence comprising a nucleic acid sequence of a target sequence and an oligonucleotide comprising a specific oligonucleotide type The oligonucleotide composition is contacted and characterized by: 1) a common base sequence and a length, wherein the common base sequence is or comprises a sequence complementary to a target sequence existing in the nucleic acid polymer; 2) a common backbone linkage a mode; and 3) a common backbone-to-palm central mode; the composition is palm-controlled, as compared to a substantially racemic formulation of an oligonucleotide having a particular base sequence and length, The oligonucleotide of a particular oligonucleotide type in the composition is enriched.

310a. A method for cleavage of a nucleic acid having a base sequence comprising a target sequence, the method comprising the steps of: (a) Having a nucleic acid having a base sequence comprising a target sequence and an oligonucleotide comprising a specific oligonucleotide type Contact of a palmitic controlled oligonucleotide composition of a glycoside, characterized by: 1) a common base sequence and a length, wherein the common base sequence is or comprises a sequence complementary to a target sequence in the nucleic acid; 2) a common backbone linkage mode; and 3) a common backbone-to-palm central mode; the composition is palm-controlled because it is substantially relative to an oligonucleotide having a particular base sequence and length In the case of a racemic formulation, an oligonucleotide of a particular oligonucleotide type is enriched in the composition, wherein the oligonucleotide targets a mutant Huntington gene and is from about 10 to about 50 nucleotides in length. Wherein the backbone linkage comprises at least one phosphorothioate, and wherein the backbone-to-palm center mode comprises at least one pair of palmar centers in the Rp configuration and at least one palm center in the Sp configuration.

310b. A method for cleavage of a nucleic acid having a base sequence comprising a target sequence, the method comprising the steps of: (a) Having a nucleic acid having a base sequence comprising a target sequence and an oligonucleotide comprising a specific oligonucleotide type Contact of a palmitic controlled oligonucleotide composition of a glycoside, characterized by: 1) a common base sequence and a length, wherein the common base sequence is or comprises a sequence complementary to a target sequence in the nucleic acid; 2) a common backbone linkage mode; and 3) a common backbone versus palm center mode; the composition is palm-controlled because it is substantially external to the oligonucleotide having the particular base sequence and length In the case of a racemic formulation, the oligonucleotide of the particular oligonucleotide type is enriched in the composition, wherein the oligonucleotide targets a mutant Huntingtin gene and the length is from about 10 to about 50 nucleosides An acid, wherein the backbone linkage comprises at least one phosphorothioate, and wherein the backbone-to-palm center mode comprises at least one pair of palmar centers in the Rp configuration and at least one pair of palm centers in the Sp configuration; (b) by ribonuclease H or RNA interference mechanism Transduction, nucleic acid cleavage.

311. The method of embodiment 310, wherein the contacting is performed under conditions in which cleavage of the nucleic acid polymer occurs.

312. The method of any one of embodiments 310 to 311, wherein the lysis is The same as the cleavage mode of the reference cleavage mode observed when the nucleic acid polymer is contacted with the reference oligonucleotide composition under similar conditions.

313. A method for altering a cleavage mode by contacting a nucleic acid polymer comprising a target sequence in a nucleotide sequence with a reference oligonucleotide composition comprising an oligonucleotide having a specific base sequence and length As observed, the specific base sequence is or comprises a sequence complementary to the target sequence, the method comprising: a nucleic acid polymer and a palm-controlled oligonucleotide having a specific base sequence and length of the oligonucleotide Contact with a glycoside composition that is palm-controlled because of the single oligonucleoside in the composition relative to a substantially racemic formulation of an oligonucleotide having a particular base sequence and length Acid type oligonucleotides are characterized by: 1) specific base sequence and length; 2) specific backbone linkage mode; and 3) specific backbone pair palm center mode.

314. The method of embodiment 313, wherein the contacting is performed under conditions in which cleavage of the nucleic acid polymer occurs.

315. The method of any one of embodiments 312 to 314, wherein the reference oligonucleotide composition is a substantially racemic formulation of oligonucleotides that share a common sequence and length.

316. The method of any one of embodiments 312 to 314, wherein the reference oligonucleotide composition is an oligonucleotide control composition that does not control the palmity of the oligonucleotide of the common sequence and length.

317. The method of any one of embodiments 312 to 316, wherein the cleavage mode provided by the palmitic controlled oligonucleotide composition is different from the reference cleavage mode, except that it is in the nucleic acid polymer The target sequence present has fewer cleavage sites than the reference cleavage mode.

318. The method of embodiment 317, wherein the cleavage mode provided by the palm-controlled oligonucleotide composition is present in the nucleic acid polymer as compared to the reference cleavage mode There is a single cleavage site within the target sequence.

319. The method of embodiment 318, wherein the single cleavage site is the cleavage site in the reference cleavage mode.

320. The method of embodiment 318, wherein the single cleavage site is a cleavage site that is not in the reference cleavage mode.

The method of any one of embodiments 312 to 316, wherein the cleavage mode provided by the palmitic controlled oligonucleotide composition is different from the reference cleavage mode, except that it increases at the cleavage site The percentage of cracking.

322. The method of embodiment 321 wherein the cleavage site with increased percent cleavage is the cleavage site in the reference cleavage mode.

323. The method of embodiment 321 wherein the cleavage site with an increased percentage of lysis is a cleavage site that is not in the reference cleavage mode.

324. The method of any one of embodiments 310 to 323, wherein the target nucleic acid polymer provided to the palm-controlled oligonucleotide composition has a higher cleavage rate than the reference oligonucleotide composition.

325. The method of any one of embodiments 310 to 324, wherein the rate of cleavage is at least 5 times higher.

326. The method of any one of embodiments 310 to 325, wherein the remaining uncleaved target nucleic acid polymer provided to the palm controlled oligonucleotide composition is present in a lower amount than the reference oligonucleotide composition .

327. The method of any one of embodiments 310 to 326, wherein the remaining unlysed target nucleic acid polymer is at least 5 times lower.

328. The method of any one of embodiments 310 to 327, wherein the cleavage product from the nucleic acid polymer is dissociated from an oligonucleotide of a particular oligonucleotide type in the palm-controlled oligonucleotide composition The rate is faster than the oligonucleotide from the reference oligonucleotide composition.

329. A method for inhibiting transcripts from a target nucleic acid sequence, a nucleic acid sequence in which one or more similar nucleic acid sequences are present in a population, each of which has a specific nucleotide signature sequence element that defines a target sequence relative to a similar sequence, the method comprising the steps of: including a target A sample of a transcript of a nucleic acid sequence is contacted with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and length; and 2) a common backbone linkage pattern; wherein the common base sequence is Or comprising a sequence complementary to a characteristic sequence element defining a target nucleic acid sequence, the composition being characterized in that the transcript of the target nucleic acid sequence is inhibited when it contacts a system comprising a target nucleic acid sequence and a transcript of a similar nucleic acid sequence The extent of inhibition is greater than that observed for similar nucleic acid sequences.

330. A method for inhibiting a transcript from a target nucleic acid sequence, wherein one or more similar nucleic acid sequences are present in a population, and the target sequence and similar sequences each comprise a specific nucleotide signature sequence element, It defines a target sequence relative to a similar sequence, the method comprising the steps of: contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and Length; and 2) a common backbone linkage mode; 3) a common backbone versus palm center mode; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a target nucleic acid sequence, the composition being characterized When it is contacted with a system comprising a target nucleic acid sequence and a transcript of a similar nucleic acid sequence, the transcript of the target nucleic acid sequence is inhibited to a greater extent than that observed with a similar nucleic acid sequence.

331. A method for inhibiting a transcript from a target nucleic acid sequence, wherein one or more similar nucleic acid sequences, target sequences and classes are present in the population The sequences each contain a specific nucleotide signature sequence element that defines a target sequence relative to a similar sequence, the method comprising the steps of: ligating a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide comprising an oligonucleotide having: Glycoside composition contacts: 1) a common base sequence and length; and 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular target sequence relative to a similar sequence, The composition is characterized in that when it is in contact with a system comprising a target dual gene and a transcript of another pair of genes of the same gene, the transcript of the specific dual gene is inhibited to a greater extent than the other pair of genes of the same gene. The degree of inhibition observed was at least 2 times greater.

332. A method for inhibiting a transcript from a target nucleic acid sequence, wherein one or more similar nucleic acid sequences are present in a population, and the target sequence and similar sequences each comprise a specific nucleotide signature sequence element, It defines a target sequence relative to a similar sequence, the method comprising the steps of: contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and Length; and 2) a common backbone linkage mode; 3) a common backbone versus palm center mode; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular target sequence relative to a similar sequence, the combination The feature is that when it is in contact with a system comprising a target dual gene and a transcript of another pair of genes of the same gene, the transcript of the specific dual gene is inhibited to a greater extent than the other pair of genes of the same gene. The degree of inhibition is at least 2 times greater.

333. A method for inhibiting transcripts from a target nucleic acid sequence, wherein A target nucleic acid sequence having one or more similar nucleic acid sequences in a population, each of the target sequence and the like comprising a specific nucleotide signature element that defines a target sequence relative to a similar sequence, the method comprising the steps of: including the target A sample of a transcript of a nucleic acid sequence is contacted with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and length; 2) a common backbone linkage pattern; wherein the common base sequence is or Comprising a sequence complementary to a characteristic sequence element that defines a particular target sequence relative to a similar sequence, the composition being characterized by, when contacted with a system comprising a transcript of the same target nucleic acid sequence, which exhibits inhibition of a particular target sequence to the extent that Transcripts: a) greater than the absence of the composition; b) greater than the degree of inhibition observed with similar sequences; or c) greater than the absence of the composition, and greater than the degree of inhibition observed with similar sequences.

334. A method for inhibiting a transcript from a target nucleic acid sequence, wherein one or more similar nucleic acid sequences are present in a population, and the target sequence and similar sequences each comprise a specific nucleotide signature sequence element, It defines a target sequence relative to a similar sequence, the method comprising the steps of: contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and Length; 2) a common backbone linkage mode; 3) a common backbone versus palm center mode; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular target sequence relative to a similar sequence, the composition Characterized by its inclusion phase Upon contact with a system of transcripts of a target nucleic acid sequence, it exhibits inhibition of a transcript of a particular target sequence to the extent that: a) greater than the absence of the composition; b) greater than the degree of inhibition observed with a similar sequence; or c) Greater than the absence of the composition, and greater than the degree of inhibition observed with similar sequences.

335. A method for inhibiting a transcript from a target nucleic acid sequence, wherein one or more similar nucleic acid sequences are present in a population, and the target sequence and similar sequences each comprise a specific nucleotide signature sequence element, It defines a target sequence relative to a similar sequence, the method comprising the steps of contacting a sample comprising a transcript of the gene of interest with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and length And 2) a common backbone linkage mode; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular target nucleic acid sequence, the composition being characterized by a transcript thereof and a target nucleic acid sequence When the system is in contact, it exhibits inhibition of the expression of a transcript of a particular target nucleic acid sequence to the extent that: a) the amount of transcript detected from a particular target nucleic acid sequence is at least 2-fold different, and the presence of the composition is less than The composition is 2 times lower; b) at least 2 times greater than the degree of inhibition observed with similar sequences; or c) detected from a specific target nucleus The amount of transcript sequences differ by at least 2-fold, 2-fold lower than in the absence composition is present in the composition and is larger than the degree of inhibition is similar to that observed sequence of at least 2-fold.

336. A method for inhibiting a transcript from a target nucleic acid sequence, wherein one or more similar nucleic acid sequences, target sequences and classes are present in the population The sequences each contain a specific nucleotide signature sequence element that defines a target sequence relative to a similar sequence, the method comprising the steps of: ligating a sample comprising a transcript of the gene of interest with an oligonucleoside comprising an oligonucleotide having: Acid composition contact: 1) common base sequence and length; and 2) common backbone linkage mode; 3) common backbone versus palm center mode; wherein the common base sequence is or contains and defines a specific target nucleic acid sequence A sequence complementary to a characteristic sequence element, characterized in that, when it is contacted with a system that expresses a transcript of a target nucleic acid sequence, it exhibits inhibition of the expression of a transcript of a particular target nucleic acid sequence to the extent that: a) detected The amount of transcript from a particular target nucleic acid sequence differs by at least a factor of two, two times lower in the presence of the composition than in the absence of the composition; b) at least two times greater than the degree of inhibition observed with a similar sequence; or c) The amount of transcript detected from a particular target nucleic acid sequence differs by at least a factor of 2, and is 2 times lower in the presence of the composition than in the absence of the composition, and is observed in comparison to similar sequences. Large extent made at least 2 times.

The method of any one of the preceding embodiments wherein the target sequence is a sequence comprising a mutation and the analogous sequence is a wild type sequence.

338. The method of any of the preceding embodiments, wherein the characteristic sequence element defines a particular dual gene of the target sequence relative to other dual genes of the same target sequence.

339. The method of any of the preceding embodiments, wherein the characteristic sequence element defines a particular dual gene of the target gene relative to other dual genes of the same target gene.

340. A method for specifically inhibiting a transcript from a target nucleic acid sequence, wherein a plurality of dual genes are present in a population, each of which contains a dual pair of other dual gene definitions relative to the same target nucleic acid sequence Gene specificity A nucleotide sequence member element, the method comprising the steps of: contacting a sample comprising a transcript of a target nucleic acid sequence with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and length And 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by its inclusion of the target dual gene and the same nucleic acid sequence When the system of another transcript of the dual gene is contacted, the transcript of the specific dual gene is inhibited to a greater extent than that observed by the other pair of genes of the same nucleic acid sequence.

341. A method for specifically inhibiting a transcript from a target nucleic acid sequence for a dual nucleic acid sequence, wherein a plurality of dual genes are present in the population, each of which contains a dual pair of other dual gene definitions relative to the same target nucleic acid sequence A specific nucleotide signature sequence element of a gene, the method comprising the steps of: ligating a sample comprising a transcript of a target nucleic acid sequence with a palm-controlled oligonucleotide comprising an oligonucleotide of a particular oligonucleotide type The oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone pair palm center mode; The composition is palm-controlled because of the oligonucleotides of a particular oligonucleotide type in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length. Concentration; wherein the common base sequence of an oligonucleotide of a particular oligonucleotide type is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by Transcription with another pair of genes comprising the target dual gene and the same nucleic acid sequence When the system is in contact, the transcript of the particular dual gene is inhibited to a greater extent than is observed by the other pair of genes of the same nucleic acid sequence.

342. A method for specifically inhibiting a transcript from a target gene in which a plurality of dual genes are present in a population, each of which contains a specificity of a dual gene relative to other dual genes of the same target gene. a nucleotide sequence element, the method comprising the steps of: contacting a sample comprising a transcript of a gene of interest with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and a length; 2) a common backbone linkage mode; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition characterized by being associated with another one comprising the target dual gene and the same gene When a systemic contact of a transcript of a dual gene is made, the transcript of the specific dual gene is inhibited to at least twice the degree of inhibition observed by the other pair of genes of the same gene.

343. A method for specifically inhibiting a transcript from a target gene in which a plurality of dual genes are present in a population, each of which contains a specificity of a dual gene relative to other dual genes of the same target gene. a nucleotide sequence element, the method comprising the steps of: contacting a sample comprising a transcript of a gene of interest with a palm-controlled oligonucleotide composition comprising an oligonucleotide of a particular oligonucleotide type, The oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone pair palm center mode; Palm controlled because of the same base sequence and length For substantially racemic preparations of oligonucleotides, the oligonucleotides of a particular oligonucleotide type are enriched in the composition; wherein the common bases of the oligonucleotides of a particular oligonucleotide type A sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition characterized by a specific dual gene when it is contacted with a system comprising a target dual gene and a transcript of another pair of genes of the same gene The transcript is inhibited to a degree that is at least 2-fold greater than that observed for the other pair of genes of the same gene.

344. The method of embodiment 340 or 342, wherein the contacting is performed under conditions that permit the composition to inhibit transcripts of the particular dual gene.

345. A method for specifically inhibiting a transcript from a target gene in which a plurality of dual genes are present in a population, each of which contains a specificity of a dual gene relative to other dual genes of the same target gene. a nucleotide sequence element, the method comprising the steps of: contacting a sample comprising a transcript of a gene of interest with a palm-controlled oligonucleotide composition comprising an oligonucleotide of a particular oligonucleotide type, The oligonucleotide of the particular oligonucleotide type is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone pair palm center mode; Palm-controlled because of the enrichment of oligonucleotides of a particular oligonucleotide type in the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length; The common base sequence of an oligonucleotide of a particular oligonucleotide type is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized by its duality with the performance target When a gene is systematically contacted with a transcript of another pair of genes of the same gene, the transcript of the specific dual gene is inhibited to the extent that the same gene is The degree of inhibition observed by a pair of even genes is at least 2 times.

346. The method of embodiment 345, wherein the contacting is performed under conditions that permit the composition to inhibit the performance of the particular dual gene.

347. The method of any one of embodiments 340 to 346, wherein the transcript of the specific dual gene is inhibited to a degree greater than the degree of inhibition observed by the other pair of genes of the same gene by at least 5, 10, 20, 50, 100, 200 or 500 times.

348. A method for specifically inhibiting a transcript from a target nucleic acid sequence, wherein a plurality of dual genes are present in a population, each of which contains a dual definition of other dual genes relative to the same target nucleic acid sequence A specific nucleotide signature sequence element of a gene, the method comprising the steps of: contacting a sample comprising a transcript of a target nucleic acid sequence with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base Sequence and length; 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition characterized by being associated with a nucleic acid sequence comprising the same target When the transcript is systemically contacted, it exhibits inhibition of the transcript of a particular dual gene to the extent that: a) greater than the absence of the composition; b) greater degree of inhibition than observed by another dual gene of the same nucleic acid sequence; or c Is greater than the degree of inhibition observed when the composition is absent and greater than the other pair of genes of the same nucleic acid sequence.

349. A method for specifically inhibiting a transcript from a nucleic acid sequence of a target nucleic acid sequence, wherein a plurality of dual genes are present in the population, each of which contains a dual pair of other dual gene definitions relative to the same target nucleic acid sequence A specific nucleotide signature sequence element of a gene, the method comprising the steps of: Contacting a sample comprising a transcript of a target nucleic acid sequence with a palm-controlled oligonucleotide composition comprising an oligonucleotide of a particular oligonucleotide type, the oligonucleotide of the particular oligonucleotide type It is characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone versus palm center mode; the composition is controlled by palmarity because it has the same base For substantially racemic preparations of sequences and lengths of oligonucleotides, oligonucleotides of a particular oligonucleotide type are enriched in the composition; wherein oligonucleotides of a particular oligonucleotide type are common The base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized in that when it is contacted with a system comprising a transcript of the same target nucleic acid sequence, it exhibits inhibition of the specific duality to the extent that a transcript of a gene: a) greater than when the composition is absent; b) greater than the degree of inhibition observed by another pair of genes of the same nucleic acid sequence; or c) greater than when the composition is absent, and greater than the same nucleic acid sequence a couple Because the degree of inhibition observed.

350. A method for controlling a cleavage of a nucleic acid polymer, the method comprising a nucleic acid polymer comprising a nucleotide sequence of a nucleotide sequence and an oligonucleotide or oligonucleotide according to any one of embodiments 540 to 574 The composition is in contact.

351. A method for inhibiting a transcript from a target nucleic acid sequence, wherein one or more similar nucleic acid sequences are present in a population, and the target sequence and the like sequence each contain a specificity relative to a target sequence defined by a similar sequence. A nucleotide-characteristic sequence element comprising contacting a sample comprising a transcript of a target nucleic acid sequence with an oligonucleotide or oligonucleotide composition according to any one of embodiments 540 to 574, wherein the oligonucleotide The base sequence of the nucleotide is or comprises a sequence complementary to a characteristic sequence element defining a target nucleic acid sequence.

352. A method for specifically inhibiting a transcript from a target nucleic acid sequence, wherein a plurality of dual genes are present in a population, each of which contains a dual definition of other dual genes relative to the same target nucleic acid sequence A specific nucleotide-characteristic sequence element of a gene, the method comprising contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide or oligonucleotide composition as in any one of embodiments 540 to 574, Wherein the base sequence of the oligonucleotide is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene.

353. A method for specifically inhibiting a transcript from a target nucleic acid sequence, wherein a plurality of dual genes are present in a population, each of which contains a dual definition of other dual genes relative to the same target nucleic acid sequence A specific nucleotide-characteristic sequence element of a gene, the method comprising contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide or oligonucleotide composition as in any one of embodiments 540 to 574, Wherein the base sequence of the oligonucleotide is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the oligonucleotide or oligonucleotide composition is characterized in that it comprises a target dual gene and the same gene When the system of another dual gene transcript is contacted, the transcript of the specific dual gene is inhibited to a degree at least 2 times greater than that observed by the other pair of genes of the same gene.

354. A method for specifically inhibiting a transcript from a nucleic acid sequence of a target nucleic acid sequence, wherein a plurality of dual genes are present in the population, each of which contains a dual pair of other dual gene definitions relative to the same target nucleic acid sequence A specific nucleotide-characteristic sequence element of a gene, the method comprising contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide or oligonucleotide composition as in any one of embodiments 540 to 574, Wherein the base sequence of the oligonucleotide is or comprises a sequence complementary to a characteristic sequence element defining a specific dual gene, and the oligonucleotide or oligonucleotide composition is characterized in that it is associated with the expression target dual gene and the same gene When a systemic transcript of another dual gene is contacted, the transcript of the specific dual gene is inhibited to a greater extent than the other pair of the same gene. The degree of inhibition observed is at least 2 times greater.

355. A method for specifically inhibiting a transcript from a nucleic acid sequence of a target nucleic acid sequence, wherein a plurality of dual genes are present in the population, each of which contains a dual definition of other dual genes relative to the same target nucleic acid sequence A specific nucleotide-characteristic sequence element of a gene, the method comprising contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide or oligonucleotide composition as in any one of embodiments 540 to 574, Wherein the base sequence of the oligonucleotide is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the oligonucleotide or oligonucleotide composition is characterized by its transcription with a nucleic acid sequence comprising the same target When the system is contacted, it exhibits inhibition of the transcript of a particular dual gene to the extent that: a) greater than the absence of the composition; b) greater than the degree of inhibition observed by another pair of genes of the same nucleic acid sequence; or c) Greater than the degree of inhibition observed when the composition is absent and greater than the other pair of genes of the same nucleic acid sequence.

356. A method for specifically inhibiting a transcript from a nucleic acid sequence of a target nucleic acid sequence, wherein a plurality of dual genes are present in the population, each of which contains a dual pair of other dual gene definitions relative to the same target nucleic acid sequence A specific nucleotide-characteristic sequence element of a gene, the method comprising contacting a sample comprising a transcript of the target nucleic acid sequence with an oligonucleotide or oligonucleotide composition as in any one of embodiments 540 to 574, Wherein the base sequence of the oligonucleotide is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the oligonucleotide or oligonucleotide composition is characterized in that it is identical to the transcription of the same target nucleic acid sequence When the system is contacted, it exhibits inhibition of the transcript of a particular dual gene to the extent that: a) greater than the absence of the composition; b) greater than the degree of inhibition observed by another pair of genes of the same nucleic acid sequence; or c) Greater than the other one of the same nucleic acid sequence when the composition is not present The degree of inhibition observed.

357. A method for specifically inhibiting a transcript from a target gene in which a plurality of dual genes are present in a population, each of which contains a specificity of a dual gene relative to other dual genes of the same target gene. a nucleotide sequence element, the method comprising the steps of: contacting a sample comprising a transcript of a gene of interest with an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and a length; And 2) a common backbone linkage pattern; wherein the common base sequence is or comprises a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition characterized by being in contact with a system expressing a transcript of the target gene At the time, it shows that the expression of the transcript of the specific dual gene is inhibited by the following degree: a) the amount of the transcript from the specific dual gene detected is at least 2-fold different, and the composition is reduced in the presence of the composition relative to the absence of the composition. 2 times; b) at least 2 times greater than the degree of inhibition observed by another pair of genes of the same gene; or c) detected from a particular pair The amount of gene transcript differ by at least 2-fold, 2-fold reduced relative to the absence of the composition present in the composition and is larger than another of the same gene inhibition of observed alleles of at least 2-fold extent.

358. A method for specifically inhibiting a transcript from a target gene in which a plurality of dual genes are present in a population, each of which contains a specificity of a dual gene relative to other dual genes of the same target gene. a nucleotide sequence element, the method comprising the steps of: contacting a sample comprising a transcript of a gene of interest with a palm-controlled oligonucleotide composition comprising an oligonucleotide of a particular oligonucleotide type, The oligonucleotide of this particular oligonucleotide type is characterized by: 1) common base sequence and length; 2) common backbone linkage mode; 3) common backbone versus palm center mode; the composition is palm-controlled because of the same base sequence and length For a substantially racemic preparation of an oligonucleotide, the oligonucleotide of a particular oligonucleotide type is enriched in the composition; wherein the common base sequence of the oligonucleotide of a particular oligonucleotide type Or comprising a sequence complementary to a characteristic sequence element defining a particular dual gene, the composition being characterized in that, when it is contacted with a system that exhibits a transcript of the gene of interest, it exhibits inhibition of the transcript of the particular dual gene to the extent that Performance: a) the amount of transcripts from a particular dual gene detected is at least 2-fold different, the composition is reduced by a factor of 2 compared to the absence of the composition; b) is observed over another pair of genes of the same gene The degree of inhibition is at least 2 times greater; or c) the amount of transcripts detected from a particular dual gene is at least 2-fold different, and the composition is reduced by a factor of 2 compared to the absence of the composition, and is greater than the same gene Another pair Because of the degree of inhibition observed at least 2 times.

359. The method of any of the preceding embodiments, wherein the amount of transcript from the specific dual gene detected is two times or more in the absence of the composition.

The method of any of the preceding embodiments, wherein the transcript of the other pair of genes of the same gene is at least 2 times greater than the transcript of the specific dual gene.

361. The method of any of the preceding embodiments, wherein the amount of transcript from the specific dual gene detected is two times or more in the absence of the composition, and the same gene The transcript of the other dual gene is at least 2 times greater than the transcript of the specific dual gene.

362. The method of any of the preceding embodiments, wherein the contacting is in determining an allowed group The compound is inhibited from inhibiting the transcript of a particular dual gene.

363. The method of any of the preceding embodiments, wherein the contacting is performed under conditions that determine that the composition is allowed to inhibit the performance of a particular dual gene.

364. The method of any one of the preceding embodiments wherein the transcript of the specific dual gene is inhibited to a degree of at least 5, 10, 20 based on the amount of the transcript from the specific dual gene detected. 50, 100, 200 or 500 times, present in the composition is 2 times lower than in the absence of the composition.

365. The method of any one of the preceding embodiments wherein the transcript of the particular dual gene is inhibited to a degree that is at least 5, 10, 20, 50 greater than the degree of inhibition observed by the other pair of genes of the same gene. 100, 200 or 500 times.

366. The method of any of the preceding embodiments, wherein the system is an in vitro or in vivo system.

366a The method of any of the preceding embodiments, wherein the method is performed ex vivo or in vivo.

367. The method of any of the preceding embodiments, wherein the system comprises one or more cells, tissues or organs.

368. The method of any of the preceding embodiments, wherein the system comprises one or more organisms.

369. The method of any of the preceding embodiments, wherein the system comprises one or more individuals.

370. The method of any of the preceding embodiments, wherein the transcript of the specific dual gene is cleaved.

371. The method of any of the preceding embodiments, wherein the specific nucleotide signature sequence element is present within the target nucleic acid sequence or an intron of the gene.

372. The method of any of the preceding embodiments, wherein the specific nucleotide signature sequence element is present within the target nucleic acid sequence or outside the gene.

373. The method of any one of the preceding embodiments wherein the specific nucleotide signature sequence element spans the target nucleic acid sequence or the exon and intron of the gene.

374. The method of any of the preceding embodiments, wherein the specific nucleotide signature sequence element comprises a mutation.

375. The method of any of the preceding embodiments wherein the specific nucleotide signature sequence element is a mutation.

376. The method of any of the preceding embodiments wherein the specific nucleotide signature sequence element comprises a SNP.

377. The method of any one of the preceding embodiments wherein the specific nucleotide signature sequence element is a SNP.

378. The method of any of the preceding embodiments wherein the oligonucleotide composition is administered to the individual.

379. The method of any one of the preceding embodiments wherein the target nucleic acid polymer or transcript is an oligonucleotide.

380. The method of any of the preceding embodiments wherein the target nucleic acid polymer or transcript is RNA.

381. The method of any of the preceding embodiments wherein the target nucleic acid polymer or transcript is a newly transcribed RNA.

382. The method of any of the preceding embodiments, wherein the oligonucleotide of the particular oligonucleotide type in the palm-controlled oligonucleotide composition forms a double helix with the nucleic acid polymer or transcript.

383. The method of any of the preceding embodiments wherein the nucleic acid polymer or transcript is cleaved by an enzyme.

384. The method of any of the preceding embodiments wherein the enzyme is ribonuclease H.

385. The method of any of the preceding embodiments, wherein the SNP is with Huntington's Disease-related SNP.

386. The method of any of the preceding embodiments wherein the SNP is a SNP present in the Huntingtin gene.

The method of any one of the preceding embodiments wherein the SNP is selected from the group consisting of rs362307, rs7685686, rs362268 or rs362306.

388. The method of any one of embodiments 310 to 387, wherein the SNP is rs362307.

389. The method of any one of embodiments 310 to 387, wherein the single nucleotide polymorphism is rs7685686.

390. The method of any one of embodiments 310 to 387, wherein the single nucleotide polymorphism is rs362268.

391. The method of any one of embodiments 310 to 387, wherein the single nucleotide polymorphism is rs362306.

392. The method of embodiments 310 to 391, wherein the position 11 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

393. The method of embodiments 310 to 391, wherein the position 12 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

394. The method of any one of embodiments 310 to 391, wherein the position 13 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

395. The method of embodiments 310 to 391, wherein the position 8 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

396. The method of embodiments 310 to 391, wherein the position 9 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

397. The method of embodiments 310 to 391, wherein the position 10 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

398. The method of any one of the preceding embodiments wherein the oligonucleotide comprises one or more wing regions and a common core region, wherein: Each wing region independently has a length of two or more bases, and independently and optionally includes one or more pairs of palmar internucleotide linkages; and the core region independently has two or more The length of the bases and independently contains one or more pairs of palmitic internucleotide linkages.

399. The method of any one of embodiments 310 to 398, wherein the position 6 in the core region as counted from the 5' end of the core region is aligned with the single nucleotide polymorphism.

The method of any one of embodiments 310 to 398, wherein the position 7 in the core region as counted from the 5' end of the core region is aligned with the single nucleotide polymorphism.

401. The method of any one of embodiments 310 to 398, wherein the position 8 in the core region as counted from the 5' end of the core region is aligned with the single nucleotide polymorphism.

The method of any one of embodiments 310 to 398, wherein the position 3 in the core region as counted from the 3' end of the core region is aligned with the single nucleotide polymorphism.

403. The method of any one of embodiments 310 to 398, wherein the position 4 in the core region as counted from the 3' end of the core region is aligned with the single nucleotide polymorphism.

404. The method of any one of embodiments 310 to 398, wherein the position 5 in the core region as counted from the 3' end of the core region is aligned with the single nucleotide polymorphism.

405. The method of any of the preceding embodiments wherein: each wing region independently has a length of two or more bases and independently comprises one or more pairs of palmar internucleotide linkages And one or more natural phosphate linkages; and the core region independently has the length of two or more bases, wherein each of the nucleotides in the core region is linked to the palm of the hand, and only the core region is a internucleotide linkage is R p, and the core region of each other internucleotide linkage is S p.

406. The method of any of the preceding embodiments, wherein the oligonucleotides are those having a wing-core structure.

407. The method of any one of embodiments 310 to 405, wherein the oligonucleotides are hemimers having a core-wing structure.

408. The method of any one of embodiments 310 to 405, wherein the oligonucleotides are spacers having a wing-core-wing structure.

409. The method of any of the preceding embodiments, wherein the content of the transcript from the disease-causing dual gene is selectively inhibited.

The method of any of the preceding embodiments, wherein the amount of protein translated from the transcript of the disease-causing dual gene is inhibited.

411. A method for treating or preventing Huntington's disease in an individual, the method comprising administering to the individual an oligonucleotide composition comprising an oligonucleotide having: 1) a common base sequence and a length; 2) Common main chain bonding mode.

412. A method for treating or preventing Huntington's disease in an individual comprising administering to the individual a palm-controlled oligonucleotide composition comprising an oligonucleotide of a particular oligonucleotide type, characterized in that : 1) a common base sequence and length; 2) a common backbone linkage mode; and 3) a common backbone-to-palm center mode; the composition is palm-controlled because of the same base sequence For substantially racemic preparations of oligonucleotides of length and length, oligonucleotides of a particular oligonucleotide type are enriched in the composition.

413. The method of embodiment 411 or 412, wherein the oligonucleotides comprise one or more wing regions and a common core region, wherein: each wing region independently has a length of two or more bases, And independently and optionally comprising one or more pairs of palmar internucleotide linkages; and the core region independently has the length of two or more bases and independently comprises one or more pairs of palmar nucleus Glycosylation linkages.

414. The method of any one of embodiments 411 to 4113, wherein: each wing region independently has a length of two or more bases and independently comprises one or more pairs of palmitic nucleotides Linking and one or more natural phosphate linkages; and the core region independently has the length of two or more bases, wherein the internucleotide linkages in the core region are palmar, core regions only one internucleotide linkage of R p, and the core region of each other internucleotide linkage is S p.

415. The method of any one of embodiments 411 to 414, wherein the oligonucleotides are hemimeric bodies having a wing-core structure.

416. The method of any one of embodiments 411 to 414, wherein the oligonucleotides are hemimers having a core-wing structure.

417. The method of any one of embodiments 411 to 414, wherein the oligonucleotides are spacers having a wing-core-wing structure.

418. The method of any one of embodiments 411 to 417, wherein the position 11 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

The method of any one of embodiments 411 to 417, wherein the position 12 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

420. The method of any one of embodiments 411 to 417, wherein the position 13 in the oligonucleotide as counted from the 5' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

The method of any one of embodiments 411 to 417, wherein the position 8 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

422. The method of any one of embodiments 411 to 417, wherein the position 9 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

423. The method of any one of embodiments 411 to 417, wherein the position 10 in the oligonucleotide as counted from the 3' end of the oligonucleotide is aligned with the single nucleotide polymorphism.

424. The method of any one of embodiments 411 to 417, wherein the position 6 in the core region as counted from the 5' end of the core region is aligned with the single nucleotide polymorphism.

425. The method of any one of embodiments 411 to 417, wherein The position 7 of the 5' end of the core region is aligned with the single nucleotide polymorphism.

426. The method of any one of embodiments 411 to 417, wherein the position 8 in the core region as counted from the 5' end of the core region is aligned with the single nucleotide polymorphism.

The method of any one of embodiments 411 to 417, wherein the position 3 in the core region as counted from the 3' end of the core region is aligned with the single nucleotide polymorphism.

428. The method of any one of embodiments 411 to 417, wherein the position 4 in the core region as counted from the 3' end of the core region is aligned with the single nucleotide polymorphism.

429. The method of any one of embodiments 411 to 417, wherein the position 5 in the core region as counted from the 3' end of the core region is aligned with the single nucleotide polymorphism.

430. The method of any one of embodiments 411 to 429, wherein the method improves the symptoms of Huntington's disease.

431. The method of any one of embodiments 411 to 429, wherein the method slows the onset of Huntington's disease.

432. The method of any one of embodiments 411 to 429, wherein the method slows the progression of Huntington's disease.

433. The method of any one of embodiments 411 to 432, wherein the individual has a SNP associated with Huntington's disease.

434. The method of any one of embodiments 411 to 433, wherein the individual has a SNP in the Huntington's gene of the individual.

435. The method of any one of embodiments 411 to 434, wherein the individual has a SNP, wherein one of the dual genes is a mutant Huntington associated with the extended CAG repeat.

436. The method of any one of embodiments 411 to 435, wherein the individual has a SNP selected from the group consisting of rs362307, rs7685686, rs362268, rs2530595, rs362331 or rs362306.

436a. The method of any one of embodiments 411 to 435, wherein the individual has an option SNP from rs362307, rs7685686, rs362268 or rs362306.

437. The method of any one of embodiments 411 to 436, wherein the individual has SNP rs362307.

438. The method of any one of embodiments 411 to 436, wherein the individual has SNP rs7685686.

439. The method of any one of embodiments 411 to 436, wherein the individual has SNP rs362268.

440. The method of any one of embodiments 411 to 436, wherein the individual has SNP rs362306.

The method of any one of embodiments 411 to 436, wherein the individual has SNP rs2530595.

The method of any one of embodiments 411 to 436, wherein the individual has SNP rs362331.

441. The composition of any one of embodiments 1 to 309, wherein the substantially racemic formulation of the oligonucleotide is prepared by non-stereoselective preparation.

442. The composition of any one of embodiments 1 to 309 and 441, wherein the substantially racemic formulation of the oligonucleotide is prepared by non-stereoselective preparation, wherein no palmitic adjuvant is used. A pair of internucleotide linkages are formed.

443. The composition of any one of embodiments 1 to 309 and 441 to 442, wherein the substantially racemic formulation of the oligonucleotide is prepared by non-stereoselective preparation, wherein less than 80:20 Diastereoselective formation forms at least one pair of palmitic internucleotide linkages.

444. The composition of any one of embodiments 1 to 309 and 441 to 443, wherein the substantially racemic formulation of the oligonucleotide is prepared by non-stereoselective preparation, wherein less than 90:10 Diastereoselective formation forms at least one pair of palmitic internucleotide linkages.

445. The composition of any one of embodiments 1 to 309 and 441 to 444, wherein the substantially racemic preparation of the oligonucleotide is prepared by non-stereoselective preparation, wherein Less than 95:5 diastereoselective selectivity forms at least one pair of palmitic internucleotide linkages.

446. The composition of any one of embodiments 1 to 309 and 441 to 445, wherein the substantially racemic formulation of the oligonucleotide is prepared by non-stereoselective preparation, wherein less than 97:3 Diastereoselective formation forms at least one pair of palmitic internucleotide linkages.

447. The composition of any of embodiments 1 to 309, wherein each pair of palmitic internucleotide linkages is formed with a diastereoselectivity of greater than 90:10.

448. The composition of any one of embodiments 1 to 309, wherein each pair of palmitic internucleotide linkages is formed with greater than 95:5 diastereoselectivity.

449. The composition of any one of embodiments 1 to 309, wherein each pair of palmitic internucleotide linkages is formed with greater than 96:4 diastereoselectivity.

The composition of any of embodiments 1 to 309, wherein each pair of palmitic internucleotide linkages is formed with a diastereoselectivity of greater than 97:3.

451. The composition of any of embodiments 1 to 309, wherein each pair of palmitic internucleotide linkages is formed with a diastereoselectivity greater than 98:2.

452. The composition of any of embodiments 1 to 309, wherein each pair of palmitic internucleotide linkages is formed with a diastereoselectivity greater than 98:2.

453. The composition of any one of embodiments 443 to 452, wherein the diastereoselective for forming a palmitic internucleotide linkage is formed by forming under the same or similar reaction conditions. Measurements were made for dinucleotide linkages between palmitic nucleotides and nucleosides flanked by palmitic internucleotide linkages.

454. A method for the preparation of an oligonucleotide composition for selectively inhibiting a transcript of a target nucleic acid sequence, comprising providing an oligonucleotide comprising a predetermined amount of an oligonucleotide of a particular oligonucleotide type a composition characterized by: 1) a common base sequence; 2) a common backbone linkage mode; and 3) a common backbone versus palm center mode, the mode comprising ( S p) _m ( R p) _n , ( R p) _n ( S p) _m , ( N p) _t ( R p) _n ( S p) _m or ( S p) _t ( R p) _n ( S p) _m , wherein: m is 1-50; n is 1-10; t is 1-50; each N p is independently R p or Sp ; wherein the target nucleic acid sequence comprises a characteristic sequence element defining a target nucleic acid sequence from a similar nucleic acid sequence; wherein the common base sequence is DNA cleavage The pattern and/or stereoregular lysis mode has a sequence of cleavage sites within or adjacent to the target nucleic acid sequence.

455. The method of embodiment 454, wherein the pattern comprises ( S p ) _m ( R p) _n .

The method of Example 456. Embodiment 454, wherein the pattern comprises _{(R p) n (S p} ) m.

457. The method of embodiment 454, wherein the pattern comprises ( N p) _t ( R p) _n ( S p) _m .

458. The method of embodiment 454, wherein the pattern comprises ( S p ) _t ( R p) _n ( S p) _m .

459. The method of embodiment 454, wherein the mode is a mode as in any of embodiments 145 to 157.

460. The method of any one of embodiments 454 to 458, wherein the cleavage site is in any one of embodiments 247 to 285.

461. The method of any of the preceding embodiments, wherein the oligonucleotide composition is a composition as in any one of embodiments 1 to 309 and 441 to 453.

462. The composition or method of any of the preceding embodiments, wherein the sequence of the oligonucleotide in the palm-controlled oligonucleotide composition comprises a sequence of any of the oligonucleotides described herein, Consisting of or being the sequence, or selected from Table N1A, Table N2A, Table N3A, Table N4A or Table 8; or WV-1092, WVE120101, WV-2603 or WV-2595.

463. A composition comprising a lipid and an oligonucleotide.

463a. The composition of any of the preceding embodiments, wherein the composition comprises a Or a plurality of lipids that bind to one or more oligonucleotides in the composition.

464. A composition comprising an oligonucleotide and a lipid selected from the list consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, Gamma-linolenic acid, docosahexaenoic acid (cis-DHA), trumpetine acid, arachidonic acid and dilinoleic acid.

464a. A composition comprising an oligonucleotide and a lipid selected from the list consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, Gamma-linolenic acid, docosahexaenoic acid (cis-DHA), trumpetine acid and dilinoleic acid.

465. A composition comprising an oligonucleotide and a lipid selected from the group consisting of:

466. A composition comprising a lipid and an oligonucleotide, wherein the lipid comprises a C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain, optionally substituted by one or more C _1-4 aliphatic group.

467. An oligonucleotide composition comprising a plurality of oligonucleotides, which share: 1) a common base sequence; 2) a common backbone linkage pattern; and 3) a common backbone phosphorus modification pattern; wherein one or more of the plurality of oligonucleotides are individually bound to the lipid.

468. A palm-controlled oligonucleotide composition comprising a plurality of oligonucleotides, which share: 1) a common base sequence; 2) a common backbone linkage pattern; and 3) a common backbone phosphorus a modification mode; wherein: the composition is controlled by palmarity because a plurality of oligonucleotides share the same stereochemistry at one or more inter-nucleotide linkages; one of the plurality A plurality of oligonucleotides are individually bound to the lipid; and one or more of the plurality of oligonucleotides are optionally joined to the targeting compound or moiety, as appropriate.

469. A method of delivering an oligonucleotide to a cell or tissue of a human subject, comprising: (a) providing a composition according to any of the preceding embodiments; and (b) administering the composition to a human subject , allowing the oligonucleotide to be delivered to the cells or tissues of the individual.

470. A method for delivering an oligonucleotide to a cell or tissue, comprising preparing a composition according to any of the preceding embodiments and treating the [contact] cell or tissue with the composition.

471. A method of modulating the amount of a transcript or gene product of a gene in a cell, the method comprising the step of contacting a cell with a composition according to any of the preceding embodiments, wherein the oligonucleotide is capable of modulating the transcript Or the content of the gene product.

472. A method for inhibiting the expression of a gene in a cell or tissue, comprising preparing a composition according to any of the preceding embodiments and treating the cell or tissue with the composition.

473. A method for inhibiting the expression of a gene in a cell or tissue of a mammal, comprising preparing a composition according to any of the preceding embodiments and administering the composition to a mammal.

474. A method of treating a condition caused by overexpression of one or more proteins in a cell or tissue of an individual, the method comprising administering to the individual a composition according to any of the preceding embodiments.

475. A method of treating a condition caused by a decrease, inhibition or deletion in the performance of one or more proteins in an individual, the method comprising administering to the individual a composition according to any of the preceding embodiments.

476. A method for producing an immune response in an individual, the method comprising administering to the individual a composition according to any of the preceding embodiments, wherein the biologically active compound is an immunomodulatory nucleic acid.

477. A method for treating the signs and/or symptoms of Huntington's disease by providing a composition according to any of the preceding embodiments and administering the composition to an individual.

478. A method of modulating the amount of ribonuclease H-mediated cleavage in a cell, the method comprising the step of contacting a cell with a composition according to any of the preceding embodiments, wherein the oligonucleotide is capable of modulating ribose The amount of nuclease H mediated cleavage.

479. A method of administering an oligonucleotide to an individual in need thereof, comprising the steps of providing a composition comprising the agent and a lipid, and administering the composition to the subject, wherein the agent is any of the agents disclosed herein. And wherein the lipid is any of the lipids disclosed herein.

480. A method of treating a condition in a subject, the method comprising the steps of providing a composition comprising a medicament and a lipid, and administering to the subject a therapeutically effective amount of a composition, wherein the agent is any of the agents disclosed herein, and wherein Lipids are any of the lipids disclosed herein Quality, and wherein the disease is any of the diseases disclosed herein.

481. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic chain.

482. The composition or method of any of the preceding embodiments, wherein the lipid comprises a C ₁₀ -C ₄₀ linear saturated or partially unsaturated lipid chain, as appropriate.

The composition or method of any of the preceding embodiments, wherein the lipid comprises a C ₁₀ -C ₄₀ linear saturated or partially unsaturated aliphatic chain, optionally substituted with one or more C _1-4 aliphatic groups .

484. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprises a non-substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

485. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprises no more than one of the optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

486. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprises two or more of the optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

487. The composition or method of any of the preceding embodiments, wherein the lipid does not comprise a tricyclic or polycyclic moiety.

488. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid having the structure R ¹ -COOH, wherein R ¹ is optionally substituted the C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic chain.

489. The composition or method of any one of embodiments 16, wherein the lipid is bound via its carboxyl group.

490. The composition or method of any of the preceding embodiments, wherein the lipid system is selected from the group consisting of:

491. The composition or method of any of the preceding embodiments, wherein the lipid binds to an oligonucleotide.

492. The composition or method of any of the preceding embodiments, wherein the lipid binds directly to the oligonucleotide.

493. The composition or method of any of the preceding embodiments, wherein the lipid is bound to the oligonucleotide via a linking group.

494. The composition or method of any of the preceding embodiments, wherein the linking group is selected from the group consisting of: an uncharged linking group; a charged linking group; a linking group comprising an alkyl group; a group; a branched chain linking group; an unbranched linking group; a linking group comprising at least one cleavage group; a linking group comprising at least one redox cleavage group; comprising at least one phosphate-based cleavage group a linking group; a linking group comprising at least one acid cleavage group; a linking group comprising at least one ester-based cleavage group; and a linking group comprising at least one peptide-based cleavage group.

495. The composition or method of any of the preceding embodiments, wherein the plurality of The nucleotides each individually bind to the same lipid at the same position.

496. The composition or method of any of the preceding embodiments, wherein the lipid is bound to the oligonucleotide via a linking group.

497. The composition or method of any one of the preceding embodiments, wherein one or more of the plurality of oligonucleotides are independently bound to a targeting compound or moiety.

498. The composition or method of any one of the preceding embodiments, wherein one or more of the plurality of oligonucleotides are independently bound to a lipid and a targeting compound or moiety.

499. The composition or method of any one of the preceding embodiments, wherein one or more of the plurality of oligonucleotides are independently bound to the lipid at one end and to the targeting compound or moiety at the other end.

The composition or method of any of the preceding embodiments, wherein the plurality of oligonucleotides share the same chemical modification pattern.

501. The composition or method of any one of the preceding embodiments, wherein the plurality of oligonucleotides share the same chemical modification pattern comprising one or more base modifications.

502. The composition or method of any one of the preceding embodiments, wherein the plurality of oligonucleotides share the same chemical modification pattern comprising one or more sugar modifications.

503. The composition or method of any of the preceding embodiments, wherein the common base sequence is capable of hybridizing to a transcript in a cell, the transcript comprising a mutation associated with a muscle disease, or a content, activity and/or Distribution is associated with muscle disease.

504. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is a nucleic acid.

505. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is an oligonucleotide.

506. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is an oligonucleotide that mediates exon skipping.

507. The composition or method of any of the preceding embodiments, wherein the oligonucleoside The acid is a stereospecific oligonucleotide that mediates exon skipping.

508. The composition or method of any one of the preceding embodiments, wherein the disease or condition is a muscle related disease or condition.

509. The composition or method according to any one of the embodiments of the preceding embodiments, wherein the lipid comprises of optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units of view And independently substituted with a group optionally substituted with a C ₁ -C ₆ alkylene group, a C ₁ -C ₆ alkylene group, a -C≡C-, a C ₁ -C ₆ heteroaliphatic group Part, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, - C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N (R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')- , -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently Defined and described herein.

510. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated aliphatic chain.

511. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₈₀ straight chain saturated or partially unsaturated aliphatic chain.

512. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic chain.

513. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain.

514. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic chain.

515. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

516. The composition or method according to any one of the embodiments of the preceding embodiments, wherein the lipid comprises of optionally substituted C ₁₀ -C ₆₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units of view And independently substituted with a group optionally substituted with a C ₁ -C ₆ alkylene group, a C ₁ -C ₆ alkylene group, a -C≡C-, a C ₁ -C ₆ heteroaliphatic group Part, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, - C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N (R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')- , -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently Defined and described herein.

517. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₈₀ saturated or partially unsaturated aliphatic chain.

518. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₆₀ straight chain saturated or partially unsaturated aliphatic chain.

519. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

520. The composition or method according to any one of the embodiments of the preceding embodiments, wherein the lipid comprises of optionally substituted C ₁₀ -C ₄₀ saturated or partially unsaturated aliphatic group, wherein one or more methylene units of view And independently substituted with a group optionally substituted with a C ₁ -C ₆ alkylene group, a C ₁ -C ₆ alkylene group, a -C≡C-, a C ₁ -C ₆ heteroaliphatic group Part, -C(R') ₂ -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, - C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N (R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) ₂ -, -S(O) ₂ N(R')- , -N(R')S(O) ₂ -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently Defined and described herein.

The composition or method of any of the preceding embodiments, wherein the lipid comprises a C ₁₀ -C ₄₀ saturated or partially unsaturated lipid chain, as appropriate.

522. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprising of optionally substituted C ₁₀ -C ₄₀ straight chain saturated or partially unsaturated aliphatic chain.

523. The composition or method of any of the preceding embodiments, wherein the composition further comprises one or more other components selected from the group consisting of a polynucleotide, a carbonic anhydrase inhibitor, a dye, an intercalator, Acridine, crosslinker, psoralen, mitomycin C, porphyrin, TPPC4, deporphyrin, cyanoporphyrin, polycyclic aromatic hydrocarbon phenazine, dihydrophenazine, artificial endonuclease, Chelating agents, EDTA, alkylating agents, phosphates, amines, sulfhydryls, PEG, PEG-40K, MPEG, [MPEG] ₂ , polyamino, alkyl, substituted alkyl, radiolabeled, enzyme , hapten biotin, transport/absorption enhancer, aspirin, vitamin E, folic acid, synthetic ribonuclease, protein, glycoprotein, peptide, molecules with specific affinity for synergistic ligands, antibodies, hormones, Hormone receptors, non-peptide substances, lipids, lectins, carbohydrates, vitamins, cofactors or drugs.

524. The composition or method of any of the foregoing embodiments of one embodiment, wherein the lipid comprises a C ₁₀ -C ₈₀ straight chain saturated or partially unsaturated aliphatic chain.

525. The composition or method of any one of the preceding embodiments, wherein the composition further comprises a linking group linking the oligonucleotide to the lipid, wherein the linking group is selected from the group consisting of: an uncharged linking group; a group; a linking group comprising an alkyl group; a linking group comprising a phosphate; a branched chain linking group; an unbranched linking group; a linking group comprising at least one cleavage group; comprising at least one redox cleavage group a linking group; a linking group comprising at least one phosphate-based cleavage group; a linking group comprising at least one acid cleavage group; a linking group comprising at least one ester-based cleavage group; comprising at least one based a linking group for the cleavage group of the peptide.

526. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is: an oligonucleotide or oligonucleotide composition or a palm-controlled oligo Nucleotide composition.

527. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is: an oligonucleotide or oligonucleotide composition or a palm-controlled oligo a nucleotide composition wherein the sequence of the oligonucleotide comprises any of those described herein The sequence of the oligonucleotide consists of or consists of the sequence.

528. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is: an oligonucleotide or oligonucleotide composition or a palm-controlled oligo A nucleotide composition wherein the sequence of the oligonucleotide comprises or consists of the sequence of any of the oligonucleotides listed in Table 4.

529. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is: an oligonucleotide or oligonucleotide composition or a palm-controlled oligo A nucleotide composition wherein the sequence of the oligonucleotide comprises or consists of a sequence of a splicing switching oligonucleotide.

530. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is: an oligonucleotide or oligonucleotide composition or a palm-controlled oligo A nucleotide composition wherein the sequence of the oligonucleotide comprises or consists of a sequence capable of skipping or mediating an oligonucleotide that skips an exon in the myostin gene.

531. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is a palm-controlled oligonucleotide composition.

532. The composition or method of any of the preceding embodiments, wherein the disease or condition is Huntington's disease.

533. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is capable of participating in ribonuclease H-mediated cleavage of the mutant Huntington gene mRNA.

534. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises, consists of, or is: a sequence of any of the oligonucleotides disclosed herein.

535. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is capable of distinguishing between a wild type and a mutant Huntington's dual gene.

536. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is capable of participating in ribonuclease H-mediated cleavage of the mutant Huntington gene mRNA.

537. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises, consists of, or is: the sequence of any of the oligonucleotides disclosed in Table 4.

538. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is: an oligonucleotide or oligonucleotide composition or a palm-controlled oligo A nucleotide composition wherein the sequence of the oligonucleotide comprises the sequence consisting of or consisting of any of WV-1092, WV-2595 or WV-2603.

539. The composition or method of any one of the preceding embodiments wherein the sequence of the oligonucleotide comprises any one or more of the following: base sequence (including length); chemistry for sugar and base moieties Modification mode; main chain linkage mode; natural phosphate linkage, phosphorothioate linkage, phosphorothioate linkage mode and combination thereof; main chain to palm center mode; The mode of the stereochemistry (Rp/Sp) of the linkage; the main chain phosphorus modification mode; the modification mode of the phosphorus atom between the nucleotides, such as -S ^- and -LR ^{1 of the} formula I.

540. An oligonucleotide comprising greater than about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95 in proportion to the sequences present in the exemplary oligonucleotides provided. A sequence of % consistency.

541. The oligonucleotide of embodiment 540, wherein the exemplary oligonucleotide provided is WV-1092.

542. The oligonucleotide of embodiment 540, wherein the exemplary oligonucleotide provided is WV-2595.

543. The oligonucleotide of embodiment 540, wherein the exemplary oligonucleotide provided is WV-2603.

544. An oligonucleotide according to any of the preceding embodiments, wherein the oligonucleotide comprises a sequence present in the exemplary oligonucleotide provided.

545. An oligonucleotide according to any of the preceding embodiments, wherein the oligonucleotide consists of the sequence present in the exemplary oligonucleotide provided.

546. The oligonucleotide of any of the preceding embodiments, wherein the oligonucleotide comprises one or more native phosphate linkages and one or more modified internucleotide linkages.

547. The oligonucleotide of embodiment 546, wherein the oligonucleotide is an oligonucleotide of any one of embodiments 540 to 545.

548. The oligonucleotide of any of the preceding embodiments, wherein the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more natural phosphate linkages .

549. An oligonucleotide according to any of the preceding embodiments, wherein the oligonucleotide comprises one or more modified internucleotide linkages.

550. An oligonucleotide according to any of the preceding embodiments, wherein the oligonucleotide comprises two or more modified internucleotide linkages.

551. An oligonucleotide according to any of the preceding embodiments, wherein the oligonucleotide comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more modified internucleotide linkages.

552. An oligonucleotide according to any of the preceding embodiments, wherein the oligonucleotide comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more modified internucleotide linkages.

553. The oligonucleotide of any of the preceding embodiments, wherein the oligonucleotide comprises 10 or more modified internucleotide linkages.

554. The oligonucleotide of any of the preceding embodiments, wherein at least one of the modified internucleotide linkages is a palm-controlled internucleotide linkage because the composition has the chemical modification of the same sequence and oligonucleotide linkages share the same configuration of R p or S p chiral phosphorus atom between the modified nucleotides.

555. The oligonucleotide of any of the preceding embodiments, wherein the at least two modified internucleotide linkages are controlled to palmarity.

556. An oligonucleotide according to any of the preceding embodiments, wherein at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20 repairs The internucleotide linkages are controlled by palmarity.

557. The oligonucleotide of any of the preceding embodiments, wherein the at least one modified internucleotide linkage in the continuous modified internucleotide linkage region is controlled to palmarity.

558. An oligonucleotide according to any of the preceding embodiments, wherein at least two modified internucleotide linkages in a continuous modified internucleotide linkage region are controlled by palmarity .

559. The oligonucleotide of any one of the preceding embodiments, wherein the continuous modified internucleotide linkage region is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 modified internucleotide linkages are controlled for palmarity.

560. The oligonucleotide of any of the preceding embodiments, wherein the modified internucleotide linkages within the continuous modified internucleotide linkage region are controlled by palmarity.

561. An oligonucleotide according to any of the preceding embodiments, wherein each modified internucleotide linkage is controlled to palmarity.

562. The embodiment of any one of the preceding embodiments oligonucleotide, wherein the oligonucleotide comprises providing (S p) x R p ( S p) y mode, where x and y are each independently a 1- 20, and the sum of x and y is 1-50.

563. An oligonucleotide according to any of the preceding embodiments, wherein x and y are each independently 2-20.

564. An oligonucleotide according to any of the preceding embodiments, wherein at least one of x and y is greater than 5, 6, 7, 8, 9, or 10.

565. An oligonucleotide according to any of the preceding embodiments, wherein the sum of x and y is greater than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

566. An oligonucleotide according to any of the preceding embodiments, wherein the oligonucleotide provided Glycosylates contain one or more chemical modifications.

567. An oligonucleotide according to any of the preceding embodiments, wherein the oligonucleotide provided comprises one or more base modifications.

568. The oligonucleotide of any of the preceding embodiments, wherein the provided oligonucleotide comprises one or more sugar modifications.

569. The oligonucleotide of any of the preceding embodiments, wherein the sugar modification is a 2' modification.

570. The oligonucleotide of any of the preceding embodiments, wherein the sugar is modified to LNA.

571. The oligonucleotide of any of the preceding embodiments, wherein the oligonucleotide provided is a para-controlled oligonucleotide.

572. The oligonucleotide of any of the preceding embodiments, wherein the oligonucleotide binds to a targeting component.

573. An oligonucleotide composition comprising an oligonucleotide according to any of the preceding embodiments.

573a. The composition of embodiment 573, wherein the composition is a palm-controlled oligonucleotide composition comprising a predetermined amount of oligonucleotide.

574. The composition of any one of the preceding embodiments, or the method of any one of the preceding embodiments, further comprising a selective agent selected from the group consisting of: a population of one or more compounds selected from the group consisting of a dopamine transporter (DAT), a serotonin transporter (SERT), and a norepinephrine transporter (NET); a dopamine reuptake inhibitor ( DRI), selective serotonin reuptake inhibitor (SSRI), norepinephrine reuptake inhibitor (NRI), norepinephrine-dopamine reuptake inhibitor (NDRI) and serotonin-norepinephrine-dopamine a group consisting of a reuptake inhibitor (SNDRI); a triple reuptake inhibitor, norepinephrine dopamine dual reuptake inhibitor, a serotonin single reuptake inhibitor, norepinephrine alone a group of absorption inhibitors and dopamine single reuptake inhibitors; and by dopamine reuptake inhibitors (DRI), norepinephrine-dopamine reuptake inhibitors (NDRI), and serotonin-norepinephrine-dopamine reabsorption A group of inhibitors (SNDRI).

575. A method for treating or preventing Huntington's disease in an individual comprising administering to the individual an oligonucleotide or composition according to any of the preceding embodiments.

575a. The method of any one of the preceding embodiments wherein the oligonucleotide or composition is administered via intrathecal administration.

576. A method for the preparation of an oligonucleotide comprising providing a palmitic agent having the structure of formula 3-AA.

577. A method for preparing an oligonucleotide comprising providing a palmitic agent having the structure: , , , ,

The method of any of the preceding embodiments, wherein the pair of palmitic agents are palm pure.

579. A method of preparing an oligonucleotide, comprising providing a compound derived from the compound having the structure comprising any one of the embodiment of the preceding embodiment of part of the chiral agent, and wherein -W ¹ H - W ² H or a hydroxyl group and an amine group form a bond with a phosphorus atom of an amino phosphate.

580. The method of embodiment 579, wherein the compound has the structure:

581. The method of embodiment 580, wherein R attached to 5'-O is a hydroxy protecting group.

582. The method of embodiment 581 wherein the hydroxy protecting group is DMTr.

583. The method of embodiment 582, wherein B ^PRO is a protected nucleobase.

584. The method of embodiment 583, wherein the nucleobase is selected from the group consisting of A, T, C, and G A nucleobase that is optionally substituted.

585. The method of any of the preceding embodiments wherein W ¹ is -NG ⁵ and W ² is O.

586. A method according to any one of the preceding embodiments wherein G ¹ and G ³ are each independently hydrogen or optionally selected from the group consisting of C _1-10 aliphatic, heterocyclic, heteroaryl and aryl a substituted group, G ² is -C(R) ₂ Si(R) ₃ , and G ⁴ and G ⁵ together form up to about 20 ring atoms, optionally substituted, partially unsaturated or unsaturated. Atomic ring which is monocyclic or polycyclic, fused or unfused.

587. The method of any one of the preceding embodiments wherein each R is independently hydrogen or optionally selected from the group consisting of C ₁ -C ₆ aliphatic, carbocyclyl, aryl, heteroaryl and heterocyclyl Substituted group.

588. In some embodiments, G ¹ is hydrogen.

The method of any of the preceding embodiments, wherein G ² is -C(R) ₂ Si(R) ₃ , wherein -C(R) ₂ - is optionally substituted -CH ₂ -, and Each R of -Si(R) ₃ is independently an optionally substituted group selected from the group consisting of a C _1-10 aliphatic group, a heterocyclic group, a heteroaryl group, and an aryl group.

The method of any of the preceding embodiments, wherein at least one R of -Si(R) ₃ is independently a C _1-10 alkyl group optionally substituted.

The method of any of the preceding embodiments, wherein at least one R of -Si(R) ₃ is independently a optionally substituted phenyl group.

The method of any of the preceding embodiments, wherein one R of -Si(R) ₃ is independently a C _1-10 alkyl group optionally substituted, and the other two R are each independently as appropriate Substituted phenyl.

593. The method of any of the preceding embodiments wherein G ² is optionally substituted -CH ₂ Si(Me)(Ph) ₂ .

594. The method of any one of the preceding embodiments wherein G ² is -CH ₂ Si(Me)(Ph) ₂ .

595. A method as claimed in any one of embodiments embodiment, where G ³ is hydrogen.

The method of any of the preceding embodiments, wherein G ⁴ and G ⁵ together form an optionally substituted saturated 5-6 member ring containing a nitrogen atom.

The method of any of the preceding embodiments, wherein G ⁴ and G ⁵ together form an optionally substituted saturated 5-membered ring containing a nitrogen atom.

598. The method of any one of the preceding embodiments wherein the

599. The method of any of the preceding embodiments, comprising providing a fluorochemical reagent.

The method of any one of the preceding embodiments wherein the fluorochemical reagent is TBAF.

601. The method of any of the preceding embodiments, comprising using a linking group that is stable to TBAF conditions for removal of the palmitic agent.

602. The method of any one of the preceding embodiments wherein the linking group is an SP linking group.

603. The method of any one of embodiments 576 to 599, wherein the fluorine-containing reagent is HF-NR ₃ .

604. The method as described in Example 603, wherein the fluorine-containing agent is HF-NEt _3.

Example 603 or 604. 605. The method of embodiment, which comprises the use of stable conditions for the removal of ₃ HF-NR palm of linker reagents.

606. The method of any one of embodiments 603 to 605, wherein the linking group is a butadienyl linking group.

Instance

The above is illustrative of certain non-limiting embodiments of the invention. Therefore, it should be understood that the embodiments of the invention described herein are merely illustrative of the application of the principles of the invention. References to the details of the embodiments shown herein are not intended to limit the scope of the claims.

Example 1. In vitro metabolic stability of human chimerism in pre-incubated rat whole liver homogenate

This example describes the comparison of the stability of the whole rat liver homogenate in vitro with the combination of milavirin (stereochemical mixture) and milwagen's palm-controlled oligonucleotide composition ("palmative beauty"). . This method is particularly useful for screening compounds for predicting half-life in vivo.

As known in the art, it is known that it is a 20mer oligonucleotide whose base sequence is antisense to a part of the lipoprotein B gene, as described in ISIS 301012 (sold under the trade name Kynamro). Mibomei inhibits lipoprotein B gene expression, possibly by targeting mRNA. Mibo Meisheng has the following structure: G*-C*-C*-U*-C*-dA-dG-dT-dC-dT-dG-dmC-dT-dT-dmC-G*-C*-A* -C*-C*

[d=2'-deoxygenated, *=2'- O- (2-methoxyethyl)]

Contains 3'→5' phosphorothioate linkages. Thus, it has a ribose residue modified with 2'-O-methoxyethyl at both ends and has a deoxyribose residue in the middle.

The palmitic pure milporin analogs tested in this example included 3'→5' phosphorothioate linkages. In some embodiments, the analog tested comprises one or more residues modified with 2'-O-(2-methoxyethyl); in some embodiments, the analogs tested include only 2 '-Deoxygen residue. Specific test analogs have the structures set forth in Tables 3 and 4 below.

Program: We use the program reported by Geary et al. (Oligonucleotides, Vol. 20, No. 6, 2010) with some modifications.

Test System: Six male Sprague-Dawley rats (Rattus norvegicus) were supplied by Charles River Laboratories, Inc., (Hollister, CA) and received at SNBL USA.

Tissue Collection: Animals were acclimated to the study room for two days prior to tissue collection. At the time of tissue collection, the animals were anesthetized by intraperitoneal (IP) injection of a sodium pentobarbital solution. Liver perfusion was performed by administration of 500 mL of refrigerated physiological saline per animal via the portal vein. After perfusion, the liver was dissected and maintained on ice. The liver was broken into small pieces and then weighed.

Liver tissue homogenate preparation: The ground pieces of the liver tissue were transferred to a 50 mL centrifuge tube and weighed. A refrigerated homogenization buffer (100 mM Tris pH 8.0, 1 mM magnesium acetate, antibiotic-antimycotic) was added to each tube so that each tube of the tube contained 5 mL of buffer. The QIAGEN TissueRuptor tissue homogenizer was used to homogenize the liver/buffer mixture while maintaining the tube on ice. The protein concentration of the liver homogenate pool was determined using Pierce BCA protein analysis. The liver tissue homogenate was divided into 5 mL aliquots, transferred to appropriately sized labeled vials and stored at -60 °C.

Incubation conditions: A 5 ml aliquot of frozen liver tissue homogenate (protein concentration = 22.48 mg/ml) was thawed and incubated at 37 ° C for 24 hours. Six eppendorf tubes (2 ml) were used for each of the oligomers in Table 1 and 450 μl of homogenate was added to each tube. 50 μl of ASO (200 μM) was added to each tube. Immediately after mixing, 125 μl of (5×) stop buffer (2.5% IGEPAL, 0.5 M NaCl, 5 mM EDTA, 50 mM Tris, pH=8.0) and 12.5 μl were added to one tube at 0 hour time point. 20 mg/ml proteinase K (Ambion, #AM2546). The remaining reaction mixture was incubated at 37 ° C on a VWR incubation microplate shaker at 400 rpm. After incubation for the indicated time period (1, 2, 3, 4, and 5 days), 125 μl of (5×) stop buffer (2.5% IGEPAL, 0.5 M NaCl, 5 mM EDTA, 50 mM Tris, pH=8.0) and 12.5 were used. Each mixture was treated with 20 mg/ml proteinase K (Ambion, #AM2546).

Treatment and bioassay: 27-mer oligonucleotide ISIS 355868 (5'- GC GTTT GCTCTT CTTCTTGCGTTTT TT -3') (bottom line base modified by MOE) was used as a quantitative internal standard for palmitic beauty. 50 μl of internal standard (200 μM) was added to each tube, followed by 250 μl of 30% ammonium hydroxide and 800 μl of phenol: chloroform: isoamyl alcohol (25:24:1). After mixing and centrifugation at 600 rpg, the aqueous layer was evaporated to 100 μl in vacuo and loaded onto a Sep Pak column (C18, 1 g, WAT 036905). All aqueous washes (2 x 20 ml) were tested by rapid ion exchange on a Sep pak column to ensure the absence of product. The 50% ACN (3.5 ml) was used to dissolve the oligonucleotides and metabolites and the column was further washed with 70% CAN (3.5) to ensure no residue on the column. Five fractions were collected for each sequence. The washing solutions 1, 2, 3, ACN 1 and 2 used the Visiprep system (Sigma, part number: 57031-U).

Ion exchange method

Buffer A = 10 mM Tris HCl, 50% ACN, pH = 8.0

Buffer B=A+800mM NaClO4

Column = DNA pac 100

Column temperature 60 ° C

A washing method was used after each round (described in M9-Exp21), the same buffer as above was used and 50:50 (methanol: water) was used in the buffer line C.

The acetonitrile eluate was concentrated to dryness and dissolved in 100 [mu]l water and analyzed using RPHPIPC.

Dissolving agent A = 10 mM tributylammonium acetate, pH = 7.0

Dissolving agent B=ACN (HPLC grade, B& J)

Column: XTerra MS C18, 3.5μm, 4.6×50mm, part number: 186000432

Protection column from Phenomenex, part number: KJ0-4282

Column temperature = 60 ° C

HPLC gradient:

For the analytical RP HPLC, 10 μl of this stock solution was added to 40 μl of water and 40 μl was injected.

Discussion: Predicting antisense and 2' modifications in siRNA stabilizes these molecules and increases their retention in plasma and tissues compared to wild-type DNA and siRNA.

2'-MOE wing-core-wing design in Mibo Meisheng. The first generation antisense oligonucleotide used in the first antisense clinical trial has 2'-deoxyribonucleotide residues and thio Phosphate ester internucleoside linkages. A second generation antisense oligonucleotide is subsequently produced, which is commonly referred to herein as the "5-10-5 2'-MOE wing-core-wing design" because five (5) residues at each end are '-O-methoxyethyl (2'-MOE) modified residue and the middle ten (10) residues are 2'-deoxyribonucleotides; between the nucleotides of the oligonucleotides The linkage is a phosphorothioate. These "5-10-5 2'-MOE wing-core-wing" oligonucleotides exhibited significant performance improvements over the first generation (PCT/US2005/033837). Designing a wing-core-wing-based motif such as 2-16-2, 3-14-3, 4-12-4 or 5-10-5 to improve the stability of the nuclease to a nuclease, and at the same time be a ribose Nuclease activity maintains sufficient DNA structure.

Pair of palm pure oligos. The present invention provides for palm pure oligos and in particular demonstrates that the choice of stereochemistry can itself improve oligonucleotide stability (i.e., with residues such as 2'MOE modifications) Base modification is irrelevant). Indeed, the present invention demonstrates that a palmitic pure phosphorothioate oligonucleotide can provide the same or better stability than the corresponding 2' modified stereotactic phosphorothioate compound.

In some embodiments, the palm pure oligonucleotide tested has a general structure XYX in stereochemistry, wherein it contains a wing "X" region (typically about 1-10 residues long), all of which The residues have the same stereochemistry, and the regions are flanked by core "Y" regions in which the stereochemistry is different. In various embodiments, about 20-50% of the nucleotide analogs in the oligonucleotides tested are not the substrate of RNase H. The ability to control the stereochemistry of phosphorothioates in DNA protects the oligomer from nuclease degradation while maintaining the ribonuclease active site. One such design is ONT-154, in which the wing of the oligonucleotide has been chemically stabilized by the S phosphorothioate and has little retained Rp phosphorothioate of ribonuclease H (Molecular Cell). , 2007). The crystal structure of human ribonuclease H complexed with DNA/RNA duplexes shows that the phosphate ester binding pocket of the enzyme produces contact with four adjacent phosphate esters of DNA. The first three contacts appear to be stronger than the fourth and prefer the Pro-R/Pro-R/Pro-S oxygen atom of each of the three phosphates. Combining the stability advantage from the stereochemistry of Sp with the ribonuclease H active site, several sequence competition/or improved 2' modifications can be designed. According to the rat liver homogenate stability test, compare the reasonable (for palm control) design (ONT-87 and ONT-154) of Mibo Meisheng (ONT-41) with or without 2' modification ( table 1 and FIG. 1), it is apparent 'modifications and chiral be carefully controlled by R p and S p 2 is removed via phosphorothioate, oligonucleotides can improve the stability of these nucleotides, which affect living later In vivo efficacy.

Example 2. Exemplary pair of palm-controlled siRNA molecules

Although contrary to the teachings of the art, the present invention recognizes that stereochemistry of internucleotide linkages can be employed to increase oligonucleotide stability via a palm-controlled oligonucleotide composition. Sex and activity. The pair of palm-controlled oligonucleotide compositions can provide results that are much superior to oligonucleotide compositions that do not control palmarity, as demonstrated in the present invention.

There are two reports on the crystal structure of RNA complexed with human Algu-2 protein (hAgo2): The Crystal Structure of Human Argonaute-2, Science, 2012 (PDB-4ei3); and The Structure of Human Argonaute-2 in Complex With miR -20a Cell, 2012 PDB-4f3t). In addition, the crystal structure of Let-7 RNA complexed with human Alco-1 protein (hAgo-1) has been reported: The Making of a Slicer: Activation of Human Argonaute-1, Cell Rep. 2013 (PDB-4krf).

Based on the information contained in these publications, it is expected that some judgments regarding the advantageous preferences of the stereochemistry of internucleotide phosphate linkages when replacing phosphodiester bonds with phosphorothioate diester bonds can be derived. These advantages can be associated with significantly improved efficacy, stability, and other pharmacological properties. Based on this, the computer program Pymol was used to locate all polar interactions between the proteins of all three structured crystalline RNAs and the internucleotide phosphodiester linkages. Negative interactions with distances greater than 3.5 Å are ignored.

The results of this analysis are summarized in Table 1. The specific phosphorus atom of the phosphodiester backbone on the RNA is assigned a Pro(R) or Pro(S) configuration based on the assumption that the polar group on the amino acid residue will be in the phosphorothioate diester analog. A very similar bond is formed between the corresponding phosphate oxygen atom. Therefore, the sulfur substitution will replace the unique stereochemistry ((Sp) or (Rp) absolute configuration) of the phosphorus atoms in the pendant element by the non-bridged oxygen.

It should be noted that there is excellent agreement between the two structures in which hAgo-2 is complexed with RNA. In addition, there is excellent agreement between the structure of hAgo-1 and hAgo-2 complexed with RNA, indicating that the configuration employed by the RNA molecule is highly conserved between the two proteins. Any conclusions or rules formed based on the results of this analysis are possible and, therefore, are effective for both protein molecules.

It can be seen that except for the polar interaction between the phosphodiesters at positions 9 and 10 of the phosphate ester and via hAgo-2 (Cell 2012), which specifically uses Pro(Rp) preference with Arg351 and Arg710, respectively. There is typically more than one polar interaction at any of the phosphodiester groups.

However, shorter distances (corresponding to stronger interactions) and the number of bonds per oxygen may indicate the main interaction of Pro(Rp) or Pro(Sp) oxygen, resulting in several interactions, which is a stereochemistry. The main interaction of type or other type. The interaction between the phosphodiesters at the following phosphate sites is within this group: 2 (Sp), 3 (Rp), 4 (Rp), 6 (Rp), 8 (Sp), 19 (Rp), 20 (Sp) and 21 (Sp).

In the remaining interactions, there appears to be no preference for a particular stereochemistry to be preferred over the other, so the preferred stereochemistry may be (Sp) or (Rp).

The interactions formed between phosphate diesters at position 5 (Rp or Sp) and 7 (Rp or Sp) are within this class.

Regarding the interaction of other phosphate backbones, there is no crystal structure information, so the stereochemistry at these locations can be similarly (Rp) or (Sp) until the empirical data shows a difference.

For this purpose, Table 6 contains a number of non-limiting exemplary siRNA general constructs that are contemplated to utilize this stereochemical preference at the individual phosphorothioate dibasic.

*Numbers indicate the phosphate position from the 5' end of the antisense strand of siRNA (eg, #2 is between nucleotides 1 and 2 and #21 is between nucleotides 20 and 21). (Sp) and (Rp) represent the stereochemistry of the phosphorus atom bonded between the phosphorothioate (PS) diester nucleotides at the indicated positions. PO represents a phosphodiester internucleotide linkage at the indicated position.

Exemplary siRNAs include, but are not limited to, siRNAs with a Sp configuration on the 3' and 5' ends of the antisense strand of the siRNA duplex, which are conferred in human serum or biological fluids. Increased stability unprecedentedly. The same Sp configuration of the palmitic phosphorothioate at the 3' and 5' ends of the antisense strand of the siRNA duplex provides an unprecedented increase in biological potency due to increased affinity for the Ago2 protein, which results in Increased activity within the RISC RNAi silencing complex.

In one embodiment, a single pair of palmitic phosphorothioate motifs are introduced independently into each position along the antisense or sense strand of the siRNA molecule. With respect to 21mer, this provides 80 unique sequences containing (Sp) or (Rp) pairs of palm-controlled glycosyl phosphate groups. When independently double helix, 1600 unique combinations of siRNA were made.

Transfection of siRNA to palm siRNA molecules

Hep3B or HeLa cells at 2.0 × 10 ⁴ cells / hole density of cells transfected in 96-well plate counter. The siRNA was transfected with the lipofectamine RNAiMax (Life Technologies, Cat. No. 13778-150) using the manufacturer's protocol, but with a reduced amount of lipofectamine RNAiMax, 0.2 μl/well. Twelve 1:3 siRNA double helix dilutions were created starting at 1 μM. 10 μl of 10×siRNA double helix was then lipid-complexed with 9.8 μl of serum-free medium and 0.2 μl of lipofectamine RNAiMax/well of the prepared mixture. After 10-15 minutes of incubation, 80 μl of EMEM cell growth medium (ATCC, 30-2003) containing 2.0 × 10 ⁴ cells was added to make the final volume 100 μl/well. Two separate transfection events were performed for each dose.

24 hours after transfection, of Hep3B or HeLa cell lysate and purification of mRNA siRNA targeted use MagMAX ^TM -96 Total RNA Isolation kit (Life Technologies, AM1830); High Capacity cDNA Reverse Transcription kit, ribonuclease The inhibitor (Life Technologies, 4374967) synthesized 15 μl of cDNA. The gene expression was assessed by real-time PCR using a probe master mix (Roche, 04 707 494 001) on a Lightcycler 480 (Roche) according to the manufacturer's protocol.

IC50 and data analysis

Each value was calculated using the ΔΔCt method. Samples were normalized to hGAPDH and calibrated to simulate transfected and untreated samples. A stereo random molecule was used as a control. Data are expressed as the mean of 2 replicates obtained using Graphpad Prism. The data was fitted with a four parameter linear regression curve and the bottom and top were limited to constants 0 and 100, respectively, to calculate the relative IC50.

This example demonstrates that target gene expression is successfully inhibited using an siRNA agent consisting of a palm controlled oligonucleotide as described herein. In particular, this example describes the hybridization of individual oligonucleotide strands prepared by palm-controlled synthesis as described herein to provide a double-stranded palm-controlled siRNA oligonucleotide composition. This example further demonstrates that cells are successfully transfected with such agents and, in addition, target gene expression is successfully inhibited.

In vitro metabolic stability of human PCSK9 siRNA duplexes with sterically controlled phosphorothioate diester linkage in human serum

The 10 μ M siRNA duplexes of 90% human serum (50 μ L, Sigma, H4522 ) were incubated at 37 ℃ 24 hours. Preparation 0min time point (50 μ L) and PBS control incubation time (50 μ L), where 10 μ M siRNA duplexes incubated at 37 [deg.] C in 90% 1 × PBS (50 μ L) for 24 hours. After completion of cultivation, each time to a point, adding 10 μ L of a stop solution (0.5M NaCl, 50mM TRIS, 5mM EDTA, 2.5% IGEPAL), followed by addition of 3.2 μ L proteinase K (20mg / mL, Ambion) . The samples were incubated at 60 ° C for 20 minutes and then centrifuged at 2000 rpm for 15 min. Analysis of the final reaction mixture directly in denaturing IEX HPLC (injection volume of 50 μ L). The % degradation of each siRNA was determined using the ratio of the integration zones at 24 h and 0 min.

It has been observed that the stereochemical configuration of a single phosphorothioate at position 21 (3' end) of the antisense strand of siRNA and the sense strand has a key influence on the stability of the duplex when cultured in human serum (Fig. 1). As shown in Figure 1 and as determined by the integration ratio of the degradation mode, the (Rp, Rp) siRNA double helix exhibited a considerable 55.0% degradation after 24 h. The stereotactic random mixture of phosphorothioates in stereotactic siRNA showed 25.2% degradation after 24 h. (Sp/Sp) siRNA showed only a slight 7.3% degradation after 24 h. This suggests that the stereochemistry of phosphorothioate confers a powerful effect on therapeutic siRNA. Other example materials are presented in Figures 2, 3, 4 and 5.

It was observed that pure constructs perspective view of the position of the respective element a phosphorothioate group along the backbone of the different potency (IC ₅₀ value). Was also observed, depending on any of the thio phosphate group element is a single position (Sp) Or (Rp) may be, to obtain ₅₀ different values of IC. The effect of stereochemistry on stability is equally clear and is carried out using the human serum or human liver cytosolic extract or Snake Venom phosphodiesterase described above or by an isolated endonuclease or an exonuclease. distinguish.

Some design rules can be based on the data obtained in the above examples. Such design information can be applied to the introduction of multiple pairs of palmothiophosphate linkages within the antisense and/or sense strands of the siRNA, as described below. The present invention recognizes that increasing the amount of palmitic phosphorothioate in the antisense and/or sense strands of the siRNA, introduction at the appropriate position, and proper stereochemistry will promote potency and in vitro metabolism of the siRNA construct. The stability is greatly improved and translated into therapeutic siRNA with greatly enhanced pharmacology.

An exemplary palm-controlled siRNA oligonucleotide targeting PCSK9

The type 9 proprotein convertase subtilisin/kexin (PCSK9) is an enzyme involved in cholesterol metabolism. PCSK9 binds to the receptor of low density lipoprotein (LDL), triggering its destruction. Although the LDL that binds to the receptor is also eliminated when the receptor is destroyed, the net effect of PCSK9 binding actually increases the LDL content because the receptor will otherwise circulate back to the cell surface and remove more cholesterol. .

Several companies are developing therapeutic agents that target PCSK9. Of particular relevance to the present invention, Isis Pharmaceuticals, Santaris Pharma, and Alnylam Pharmaceuticals are each developing a nucleic acid agent that inhibits PCSK9. Isis Pharmaceuticals product antisense oligonucleotides have been shown to increase LDLR expression in mice and reduce circulating total cholesterol levels (Graham et al. "Antisense inhibition of proprotein convertase subtilisin/kexin type 9 reduces serum LDL in hyperlipidemic mice". J. Lipid Res. 48 (4): 763-7, April 2007). Initial clinical trials of Alnylam Pharmaceuticals' ALN-PCS revealed that RNA interference provides an efficient PCSK9 inhibition mechanism (Frank-Kamenetsky et al. "Therapeutic RNAi targeting PCSK9 acutely lowers plasma cholesterol in rodents and LDL cholesterol in nonhuman primates". Proc.Natl Acad Sci. USA 105 (33): 11915-20, August 2008).

In some embodiments, although the results are known to be reversed, the present invention recognizes that a stereochemical configuration or another stereochemically configured phosphorothioate motif can be rationally designed, via a palm-controlled oligo The glycoside composition utilizes increased potency, stability, and other pharmacological qualities. To reinforce this concept, Table 3 contains exemplary stereochemically pure constructs based on siRNA sequences that target PCSK9 messenger RNA.

In this exemplary embodiment, a single pair of palmitic phosphorothioate motifs are introduced independently into each position along the antisense or sense strand of the siRNA molecule. With respect to 21mer, this provides 80 unique sequences containing (Sp) or (Rp) pairs of palm-controlled glycosyl phosphate groups. When independently double helix, 1600 unique combinations of siRNA were made.

In other exemplary embodiments, a single pair of palmitic phosphorothioate motifs are along The antisense or sense strands of the siRNA molecule are introduced independently into each position while retaining the 3'-(Sp) phosphorothioate linkage. With respect to 21mer, this provides an additional 80 unique sequences containing (Sp) or (Rp) pairs of palm-controlled glycosyl phosphate groups. When independently double helix, 1600 unique combinations of siRNA were made.

In other exemplary embodiments, a plurality of pairs of palmothiophosphate units are introduced independently at several positions along the antisense or sense strand of the siRNA molecule according to the code set forth in Table 7, while retaining 3' - (Sp) phosphorothioate linkage.

Note: lower case letters indicate 2'-OMe RNA residues; upper case letters indicate RNA residues; d = 2'-deoxygen residues; and "s" indicates phosphorothioate moieties.

A synthetic example of a human PCSK9 siRNA antisense strand with a pair of palmitic phosphorothioate internucleotide linkages and all internucleotide linkages to palmitic phosphorothioate.

Note: lower case letters indicate 2'-OMe RNA residues; upper case letters indicate RNA residues; d = 2'-deoxygen residues; and "s" indicates phosphorothioate moieties.

Example 3. Stereo pure FOXO-1 antisense analog. Rational design-puppet controlled antisense oligonucleotide composition

A novel type of ribonuclease H receptor spacer designed for novel design using the nuclease stability determined in vivo and in the whole rat liver homogenate model in which the palm-to-palmit phosphorothioate is internucleotide-linked. Thereby, the external flanking sequence is composed of unmodified DNA and the internal void core is modified by 2' chemical modification (2'OMe, 2'MOE, 2'LNA, 2'F, etc.). Finally, this design extends to a completely unmodified DNA therapeutic oligonucleotide in which the cautious control of the phosphorothioate backbone imparts suitable pharmacological properties to the ribonuclease H therapeutic oligonucleotide.

The use of a triad phosphate repeat motif designed after studying the crystal structure of human ribonuclease H has also been employed. The crystal structure of ribonuclease H has been previously disclosed (Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse Transcription, Noottny et al, Molecular Cell, Vol. 28, No. 2, 264-276, 2007 , pdb file: 2qkb). In particular, the present invention recognizes the importance of internucleotide linkage stereochemistry of oligonucleotides in, for example, the context herein. When performing a computer simulation analysis of this structure using the program Pymol, Applicants discovered that the phosphate binding pocket of human ribonuclease H1 produces polar contact with three adjacent phosphate esters of the composite DNA, and preferably with the three phosphoric acids. Each of the esters interacts with a respective oxygen atom of Pro-R/Pro-R/Pro-S (or with Pro-S/Pro-S/Pro-R). Based on this observation, we have designed two repeating (RRS) and (SSR) triad phosphorothioate motifs as the palm-like architecture of the designed ribonuclease H receptor. Applicants have also designed other internucleotide linkage stereochemistry patterns. As illustrated by the results of the examples provided herein, the provided palm-controlled oligonucleotides of the oligonucleotide type comprising certain backbone internucleotide linkage patterns (backbone to palmar central mode) are provided. The composition provides significantly increased activity and/or kinetics. 5'- The RSS-3' backbone is particularly well-suited for the sequence of the palm center and results in unexpected results, as described in the present invention.

In the novel design, an increased Sp-to-palm backbone (for enzyme stability and other pharmacologically beneficial properties) and (RRS) or (SSR) repeating triad-to-palm backbone motifs (for enhancement) are also employed. As a combination of the properties of the ribonuclease H receptor; "S" indicates a Sp phosphorothioate linkage and "R" indicates an Rp phosphorothioate linkage.

Another alternative design is based on the increased amount of Sp in the extended repeating motif of the palmitic phosphorothioate backbone, such as: (SSSR) _n , SR(SSSR) _n , SSR(SSSR) _n , SSR (SSSR) _n , (SSSSR) _n , SR(SSSSR) _n , SSR(SSSSR) _n , SSR(SSSSR) _n , SSSR(SSSSR) _n , (SSSSSR) _n , SR(SSSSSR) _n , SSR(SSSSSR) _n , SSR (SSSSSR) _n , SSSR (SSSSSR) _n , SSSSR (SSSSSR) _{n ,} etc., where n = 0-50, depending on the number of linkages between the individual nucleotides; "S" indicates the S p phosphorothioate linkage And "R" represents an R p phosphorothioate linkage. In some embodiments, n is zero. In some embodiments, R is 1-50. In some embodiments, R is one. In some embodiments, the common backbone-to-palm center mode of the palm-controlled oligonucleotide composition provided comprises a motif as described herein. In some embodiments, the primitive is in the core region. In some embodiments, n is zero. In some embodiments, R is 1-50. In some embodiments, R is one. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5.

Another alternative design is based on the "reverse" architecture of the stereo backbone ("stereo invert-mer"). These designs are based on the inversion of the stereochemistry of the palmitic phosphorothioate, exposing some of the Sp -rich motifs to the 5' and 3' ends of the oligonucleotide and to the middle of the oligonucleotide. And having repeated stereochemical primitives positioned on both sides in a reverse image manner, such as: SS(SSR) _n (SSS)(RSS) _n SS; SS(SSR) _n (SRS)(RSS) _n SS; SS(SSR) _n (SSR)(RSS) _n SS;SS(SSR) _n (RSS)(RSS) _n SS;SS(RSS) _n (SSS)(SSR) _n SS;SS(RSS) _n (SRS) (SSR) _n SS; SS(RSS) _n (SSR)(SSR) _n SS; SS(RSS) _n (RSS)(SSR) _n SS, etc., where n=0-50, depending on the internucleotide linkage The number of associations depends. "S" indicates Sp phosphorothioate linkage and "R" indicates Rp phosphorothioate linkage. In some embodiments, the common backbone-to-palm center mode provided for the palm-controlled oligonucleotide composition comprises a motif as described herein. In some embodiments, the primitive is in the core region. In some embodiments, n is zero. In some embodiments, n is one. In some embodiments, n is 1-50. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5.

Initial screening Synthesis: Overview of Oligonucleotide Synthesis on DNA/RNA Synthesizer MerMade-12 (2'-Deoxygenation and 2'-OMe Cycles)

Stereotactic random PS oligonucleotides designed with DNA-2'-OMe-DNA (7-6-7):

ONT-141 d(CsCsCsTsCsTsGs)gsaststsgsasd(GsCsAsTsCsCsA)

ONT-142 d(AsAsGsCsTsTsTs)gsgststsgsgsd(GsCsAsAsCsAsC)

ONT-143 d(AsGsTsCsAsCsTs)tsgsgsgsasgsd(CsTsTsCsTsCsC)

ONT-144 d(CsAsCsTsTsGsGs)gsasgscststsd(CsTsCsCsTsGsG)

ONT-145 d(AsTsAsGsCsCsAs)tstsgscsasgsd(CsTsGsCsTsCsA)

ONT-146 d(TsGsGsAsTsTsGs)asgscsastscsd(CsAsCsCsAsAsG)

ONT-147 d(CsCsAsTsAsGsCs)csaststsgscsd(AsGsCsTsGsCsT)

ONT-148 d(GsTsCsAsCsTsTs)gsgsgsasgscsd(TsTsCsTsCsCsT)

ONT-149 d(CsCsAsGsGsGsCs)ascstscsastsd(CsTsGsCsAsTsG)

ONT-150 d(GsCsCsAsTsCsCs)asasgstscsasd(CsTsTsGsGsGsA)

ONT-151 d(GsAsAsGsCsTsTs)tsgsgststsgsd(GsGsCsAsAsCsA)

ONT-152 d(CsTsGsGsAsTsTs)gsasgscsastsd(CsCsAsCsCsAsA)

ONT-183 d(CsAsAsGsTsCsAs)cststsgsgsgsd(AsGsCsTsTsCsT)

ONT-184 d(AsTsGsCsCsAsTs)cscsasasgstsd(CsAsCsTsTsGsG)

ONT-185 d(AsTsGsAsGsAsTs)gscscstsgsgsd(CsTsGsCsCsAsT)

ONT-186 d(TsTsGsGsGsAsGs)cststscstscsd(CsTsGsGsTsGsG)

ONT-187 d(TsGsGsGsAsGsCs)tstscstscscsd(TsGsGsTsGsGsA)

ONT-188 d(TsTsAsTsGsAsGs)astsgscscstsd(GsGsCsTsGsCsC)

ONT-189 d(GsTsTsAsTsGsAs)gsastsgscscsd(TsGsGsCsTsGsC)

ONT-190 d(CsCsAsAsGsTsCs)ascststsgsgsd(GsAsGsCsTsTsC)

ONT-191 d(AsGsCsTsTsTsGs)gststsgsgsgsd(CsAsAsCsAsCsA)

ONT-192 d(TsAsTsGsAsGsAs)tsgscscstsgsd(GsCsTsGsCsCsA)

ONT-193 d(TsGsTsTsAsTsGs)asgsastsgscsd(CsTsGsGsCsTsG)

ONT-194 d(AsTsCsCsAsAsGs)tscsascststsd(GsGsGsAsGsCsT)

ONT-195 d(GsGsGsAsAsGsCs)tststsgsgstsd(TsGsGsGsCsAsA)

ONT-196 d(CsTsCsCsAsTsCs)csastsgsasgsd(GsTsCsAsTsTsC)

ONT-197 d(AsAsGsTsCsAsCs)tstsgsgsgsasd(GsCsTsTsCsTsC)

ONT-198 d(CsCsAsTsCsCsAs)asgstscsascsd(TsTsGsGsGsAsG)

ONT-199 d(TsCsCsAsAsGsTs)csascststsgsd(GsGsAsGsCsTsT)

ONT-200 d(CsCsTsCsTsGsGs)aststsgsasgsd(CsAsTsCsCsAsC)

ONT-201 d(AsCsTsTsGsGsGs)asgscststscsd(TsCsCsTsGsGsT)

ONT-202 d(CsTsTsGsGsGsAs)gscststscstsd(CsCsTsGsGsTsG)

ONT-203 d(CsAsTsGsCsCsAs)tscscsasasgsd(TsCsAsCsTsTsG)

ONT-204 d(TsGsCsCsAsTsCs)csasasgstscsd(AsCsTsTsGsGsG)

ONT-205 d(TsCsCsAsTsCsCs)astsgsasgsgsd(TsCsAsTsTsCsC)

ONT-206 d(AsGsGsGsCsAsCs)tscsastscstsd(GsCsAsTsGsGsG)

ONT-207 d(CsCsAsGsTsTsCs)cststscsastsd(TsCsTsGsCsAsC)

ONT-208 d(CsAsTsAsGsCsCs)aststsgscsasd(GsCsTsGsCsTsC)

ONT-209 d(TsCsTsGsGsAsTs)tsgsasgscsasd(TsCsCsAsCsCsA)

ONT-210 d(GsGsAsTsTsGsAs)gscsastscscsd(AsCsCsAsAsGsA)

Biological DNA of the original DNA-2'-OMe-DNA (7-6-7) designed in HepG2 cells: (d uppercase) = DNA; lowercase = 2'-OMe; s = phosphorothioate .

Stereotactic random PS oligonucleotides with 2'-OMe-DNA-2'OMe(3-14-3) design: (d uppercase letters) = DNA; lowercase letters = 2'-OMe; s = thiophosphoric acid ester.

ONT-129 cscscsd(TsCsTsGsGsAsTsTsGsAsGsCsAsTs)cscsa

ONT-130 asasgsd(CsTsTsTsGsGsTsTsGsGsGsCsAsAs)csasc

ONT-131 asgstsd(CsAsCsTsTsGsGsGsAsGsCsTsTsCs)tscsc

ONT-132 csascsd(TsTsGsGsGsAsGsCsTsTsCsTsCsCs)tsgsg

ONT-133 astsasd(GsCsCsAsTsTsGsCsAsGsCsTsGsCs)tscsa

ONT-134 tsgsgsd(AsTsTsGsAsGsCsAsTsCsCsAsCsCs)asasg

ONT-135 cscsasd(TsAsGsCsCsAsTsTsGsCsAsGsCsTs)gscst

ONT-136 gstscsd(AsCsTsTsGsGsGsAsGsCsTsTsCsTs)cscst

ONT-137 cscsasd(GsGsGsCsAsCsTsCsAsTsCsTsGsCs)astsg

ONT-138 gscscsd(AsTsCsCsAsAsGsTsCsAsCsTsTsGs)gsgsa

ONT-139 gsasasd(GsCsTsTsTsGsGsTsTsGsGsGsCsAs)ascsa

ONT-140 cstsgsd(GsAsTsTsGsAsGsCsAsTsCsCsAsCs)csasa

ONT-155 csasasd(GsTsCsAsCsTsTsGsGsGsAsGsCsTs)tscst

ONT-156 astsgsd(CsCsAsTsCsCsAsAsGsTsCsAsCsTs)tsgsg

ONT-157 astsgsd(AsGsAsTsGsCsCsTsGsGsCsTsGsCs)csast

ONT-158 tstsgsd(GsGsAsGsCsTsTsCsTsCsCsTsGsGs)tsgsg

ONT-159 tsgsgsd(GsAsGsCsTsTsCsTsCsCsTsGsGsTs)gsgsa

ONT-160 tstsasd(TsGsAsGsAsTsGsCsCsTsGsGsCsTs)gscsc

ONT-161 gststsd(AsTsGsAsGsAsTsGsCsCsTsGsGsCs)tsgsc

ONT-162 cscsasd(AsGsTsCsAsCsTsTsGsGsGsAsGsCs)tstsc

ONT-163 asgscsd(TsTsTsGsGsTsTsGsGsGsCsAsAsCs)ascsa

ONT-164 tsastsd(GsAsGsAsTsGsCsCsTsGsGsCsTsGs)cscsa

ONT-165 tsgstsd(TsAsTsGsAsGsAsTsGsCsCsTsGsGs)cstsg

ONT-166 astscsd(CsAsAsGsTsCsAsCsTsTsGsGsGsAs)gscst

ONT-167 gsgsgsd (AsAsGsCsTsTsTsGsGsTsTsGsGsGs) csasa

ONT-168 cstscsd(CsAsTsCsCsAsTsGsAsGsGsTsCsAs)tstsc

ONT-169 asasgsd(TsCsAsCsTsTsGsGsGsAsGsCsTsTs)cstsc

ONT-170 cscsasd(TsCsCsAsAsGsTsCsAsCsTsTsGsGs)gsasg

ONT-171 tscscsd(AsAsGsTsCsAsCsTsTsGsGsGsAsGs)cstst

ONT-172 cscstsd(CsTsGsGsAsTsTsGsAsGsCsAsTsCs)csasc

ONT-173 ascstsd(TsGsGsGsAsGsCsTsTsCsTsCsCsTs)gsgst

ONT-174 cststsd(GsGsGsAsGsCsTsTsCsTsCsCsTsGs)gstsg

ONT-175 csastsd(GsCsCsAsTsCsCsAsAsGsTsCsAsCs)tstsg

ONT-176 tsgscsd(CsAsTsCsCsAsAsGsTsCsAsCsTsTs)gsgsg

ONT-177 tscscsd(AsTsCsCsAsTsGsAsGsGsTsCsAsTs)tscsc

ONT-178 asgsgsd(GsCsAsCsTsCsAsTsCsTsGsCsAsTs)gsgsg

ONT-179 cscsasd(GsTsTsCsCsTsTsCsAsTsTsCsTsGs)csasc

ONT-180 csastsd(AsGsCsCsAsTsTsGsCsAsGsCsTsGs)cstsc

ONT-181 tscstsd(GsGsAsTsTsGsAsGsCsAsTsCsCsAs)cscsa

ONT-182 gsgsasd(TsTsGsAsGsCsAsTsCsCsAsCsCsAs)asgsa

2'-OMe-DNA-2'-OMe (3-14-3) designed for biological in vitro data in HepG2 cells:

Hit selection:

ONT-151 d(GsAsAsGsCsTsTs)tsgsgststsgsd(GsGsCsAsAsCsA)

ONT-198 d(CsCsAsTsCsCsAs)asgstscsascsd(TsTsGsGsGsAsG)

ONT-185 d(AsTsGsAsGsAsTs)gscscstsgsgsd(CsTsGsCsCsAsT)

ONT-142 d(AsAsGsCsTsTsTs)gsgststsgsgsd(GsCsAsAsCsAsC)

ONT-145 d(AsTsAsGsCsCsAs)tstsgscsasgsd(CsTsGsCsTsCsA)

ONT-192 d(TsAsTsGsAsGsAs)tsgscscstsgsd(GsCsTsGsCsCsA)

ONT-188 d(TsTsAsTsGsAsGs)astsgscscstsd(GsGsCsTsGsCsC)

Secondary screening. Chemical and stereochemical screening Overview of oligonucleotide synthesis on the DNA/RNA synthesizer MerMade-12 (stereoscopically defined Phosphorothioate 2'-deoxygenation and 2'-OMe cycle)

Examples for FOXO1 hit sequences:

Examples include (but are not limited to): ( S p, S p, S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, R p , S p, S p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, S p)d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA]

( S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, S p, S p, R p, R p, S p, R p, R p, S p, R p, R p, S p, S p, S p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, S p, R p, R p, S p, R p, R p, S p, R p, R p, S p, R p, R p, S p, S p, S p, S p)d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA]

( S p, S p, S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, S p, S p, S p)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]

( S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, S p, S p)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]

( S p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, S p)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]

( S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]

( S p, S p, S p, S p, S p, R p, R p, S p, R p, R p, S p, R p, R p, S p, S p, S p, S p, S p, S p)d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA]

( S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p)d[CsCsAsTsCsCsAs] (AsGsTsCsAsCs) _OMe d[TsTsGsGsGsAsG]

( S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p)d[AsTsGsAsGsAsTs] (GsCsCsTsGsGs) _OMe d[CsTsGsCsCsAsT]

( S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p)d[CsCsAsTsCsCsAs] (AsGsTsCsAsCs) _LNA d[TsTsGsGsGsAsG]

( S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p)d[AsTsGsAsGsAsTs] (GsCsCsTsGsGs) _LNA d[CsTsGsCsCsAsT]

( S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p)d[CsCsAsTsCsCsAs] (AsGsTsCsAsCs) _MOE d[TsTsGsGsGsAsG]

( S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p)d[AsTsGsAsGsAsTs] (GsCsCsTsGsGs) _MOE d[CsTsGsCsCsAsT]

( S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, R p, S p, S p)( CsCsAs ) _OMe d[TsCsCsAsAsGsTsCsAsCsTsTsGsGs]( GsAsG ) _OMe

( S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, R p, S p, S p)( AsTsGs ) _MOE d[AsGsAsTsGsCsCsTsGsGsCsTsGsCs]( CsAsT ) _MOE

( S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, S p, S p)( CsCsAs ) _LNA d[TsCsCsAsAsGsTsCsAsCsTsTsGsGs]( GsAsG ) _LNA

( S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, R p, S p, S p, S p, S p)( AsTsGs ) _OMe d[AsGsAsTsGsCsCsTsGsGsCsTsGsCs]( CsAsT ) _OMe

( S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]

( S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, S p)d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA]

( S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]

( S p, S p, S p, S p, R p, S p, S p, S p, S p, R p, S p, S p, S p, S p, R p, S p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, R p, S p, S p, S p, S p, R p, S p, S p, S p, S p, R p, S p, S p, S p, S p, S p)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]

( S p, S p, R p, S p, S p, S p, S p, R p, S p, S p, S p, S p, R p, S p, S p, S p, S p, R p, S p)d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA]

( S p, R p, S p, S p, S p, S p, R p, S p, S p, S p, S p, R p, S p, S p, S p, S p, R p, S p, S p)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]

( S p, S p, S p, S p, S p, R p, S p, S p, S p, S p, S p, R p, S p, S p, S p, S p, S p, R p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, R p, S p, S p, S p, S p, S p, R p, S p, S p, S p, S p, S p, R p, S p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, R p, S p, S p, S p, S p, S p, R p, S p, S p, S p, S p, S p, R p, S p, S p, S p, S p, S p)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]

( S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, S p, R p, S p, S p, R p, S p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, S p, R p, S p, S p, R p, S p, R p, S p, R p, S p, S p, R p, S p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, S p, R p, S p, S p, R p, S p, R p, S p, R p, S p, S p, R p, S p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, R p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, R p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, R p, S p, S p, R p, S p, S p, S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, S p, R p, S p, S p, R p, S p, S p, S p, R p, S p, S p, R p, S p, S p, S p, S p)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG]

( S p, S p, S p, S p, R p, S p, S p, R p, S p, R p, S p, R p, S p, S p, R p, S p, S p, S p, S p)( CsCs ) _OMe d[AsTsCsCsAsAs]( GsTsCs ) _OMe d[AsCsTsTsGsGsGs]( AsG ) _OMe

( S p, S p, S p, S p, R p, S p, S p, R p, S p, R p, S p, R p, S p, S p, R p, S p, S p, S p, S p)( CsCs ) _LNA d[AsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGs]( AsG ) _LNA

( S p, S p, R p, S p, S p, R p, S p, S p, S p, R p, S p, S p, S p, R p, S p, S p, R p, S p, S p)( CsCs ) _MOE d[AsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGs]( AsG ) _MOE

( S p, S p, R p, S p, S p, R p, S p, S p, S p, S p, S p, S p, S p, R p, S p, S p, R p, S p, S p)( CsCs ) _OMe d[AsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGs]( AsG ) _OMe

Example 4. Inhibition of nucleic acid polymers

In particular, the present invention provides a palm-controlled oligonucleotide composition and method thereof which, when used, for example, to inhibit the nucleic acid polymers via a cleavage nucleic acid polymer, in some cases, yields unexpected results. Examples include, but are not limited to, the examples presented herein.

Ribonuclease H assay

The rate of cleavage of the nucleic acid polymer by nuclease (e.g., cleavage of RNA by ribonuclease H) is critical for the use of oligonucleotides in therapeutic techniques such as antisense technology. Using our analysis, we have studied the control of oligodeoxynucleosides of specific oligonucleotide types ( P -diastereomers) when oligonucleotides of specific oligonucleotide types are bound to complementary RNAs. The rate of cleavage of the acid composition and analysis of its metabolites. The following results also illustrate the importance of the recognized cleavage mode of the present invention.

Ribonuclease H as used herein is a pan-expressing endonuclease of an RNA strand that hydrolyzes an RNA/DNA mixture. It plays an important role in the mode of action of antisense oligonucleotides. In some embodiments, the ribonuclease H cleavage rate is significantly reduced when the construct RNA is primed (Lima, WF, Venkatraman, M., Crooke, ST The Influence of Antisense Oligonucleotide-induced RNA Structure on Escherichia coli RNase H1 Activity The Journal Of Biological Chemistry 272 , No. 29, 18191-18199, (1997)). In addition, the 2'-MOE spacer design (5-10-5) provides a higher affinity for RNA targets, resulting in minimal conversion of antisense strands. The presence of a 2'-MOE modification in the wing also reduces the number of ribonuclease H cleavage sites.

To investigate the rate of RNA cleavage, the present invention provides a simple analysis for quantifying the length of RNA remaining after incubation with ribonuclease H. The provided methods provide, inter alia, 2' modified stereotactic random spacers, stereotactic random DNA oligonucleotide compositions and palmitic pure P -diastereomers (corresponding oligonucleosides) The relative RNase H cleavage rate of the acid type of the palm-controlled oligonucleotide composition) for different targets. Altering the 2' modified region and the stereochemistry in the DNA core provides information on how the stereochemistry in these regions affects the interaction of ribonuclease H with its receptor. The ribonuclease H reaction mixture was analyzed by LCMS at various time points to determine the mode of cleavage. In particular, the present invention provides nucleic acid polymer (e.g., RNA) cleavage rates and cleavage patterns (maps) that are critical for designing a stereochemical nucleic acid architecture for optimal activity (e.g., antisense activity).

device:

Alliance HPLC, 2489-TUV, 2695E - equipped with an autosampler

Cary100 (Agilent Technologies)

method:

DNA/RNA double helix preparation: Oligonucleotide concentration was determined by measuring the absorbance at 260 nm in water. DNA/RNA duplexes were prepared by mixing equal molar oligonucleotide solutions with a concentration of 10 [mu]M each. The mixture was heated in a water bath at 90 ° C for 2 minutes and allowed to cool slowly over a period of hours.

Human ribonuclease H protein expression and purification: Prof. Wei Yang obtained the human ribonuclease HC pure line from the laboratory of NIH Bethesda. A protocol for obtaining this human ribonuclease HC (residues 136-286) has been described (Nowotny, M. et al. Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse Transcription. Molecular Cell 28, 264-276 (2007)). Protein performance was performed by following the reported protocol, but the resulting protein was changed to have an N-terminal His6 tag. For protein expression, BL21 (DE3) E. coli cells were used in LB medium. The cells were grown at 37 ° C until the OD600 reached about 0.7. The culture was then cooled and 0.4 mM IPTG was added to induce protein expression overnight at 16 °C. Preparation of Escherichia coli by sonication in buffer A (40 mM NaH ₂ PO ₄ (pH 7.0), 1 M NaCl, 5% glycerol, 2.8 mM β-mercaptoethanol and 10 mM imidazole) supplemented with protease inhibitor (Sigma-Aldrich) Extract. The extract was purified by buffer A plus 60 mM imidazole using a Ni affinity column. The protein was eluted with a linear gradient of 60 to 300 mM imidazole. Protein peaks were collected and further purified on a Mono S column (GE Healthcare) with buffer B containing a gradient of 100 mM to 500 mM NaCl. The fraction containing ribonuclease HC was concentrated to 0.3 mg/ml in storage buffer (20 mM HEPES (pH 7.0), 100 mM NaCl, 5% glycerol, 0.5 mM EDTA, 2 mM DTT) and stored at -20 °C. The 0.3 mg/ml enzyme concentration corresponds to 17.4 μM based on the reported extinction coefficient (32095 cm ^-1 M ^-1 ) and MW (18963.3 Da unit).

Ribonuclease H assay: 5 μL of 10× ribonuclease H buffer was added to 25 μL of DNA/RNA duplex (10 μM) in a 96-well plate followed by the addition of 15 μL of water. The mixture was incubated at 37 ° C for several minutes, and then 5 μL of 0.1 μM enzyme stock solution was added to give a total volume of 50 μL, and the final substrate/enzyme concentration was 5 μM/0.01 μM (500:1), and further cultured at 37 °C. . Using these conditions, various ratios of DNA/RNA duplexes: ribonuclease H proteins were investigated to find the optimal ratio of study kinetics. At various time points, the reaction was quenched with 10 μL of 500 mM aqueous solution of EDTA disodium. At the 0 min time point, EDTA was added to the reaction mixture followed by the addition of the enzyme. Controls were performed to ensure that EDTA was able to successfully inhibit enzyme activity completely. After quenching all reactions, 10 μL of each reaction mixture was injected on an analytical HPLC column (XBridge C18, 3.5 μm, 4.6×150 mm, Waters part number 186003034). Kcat/Km can be measured by a variety of methods, such as FRET (Fluorescence Resonance Energy Transfer)-dependent ribonuclease H assays, using dual-labeled RNA and monitored by SpectraMax.

Solid phase extraction protocol for sample preparations for LCMS: The ribonuclease H reaction mixture was cleaned using a 96-well plate (Waters part number 186002321) and then the LCMS was run. Using a manifold (Millipore part number MSV MHTS00), the plates were equilibrated with 500 μL of acetonitrile and water under light vacuum. Take precautions so as not to dry the plate. About 50-100 μL of ribonuclease H reaction mixture was loaded into each well under light vacuum, followed by loading of a water wash (2 mL). Samples were recovered using 2 x 500 μL of 70% ACN/water. The recovered sample was transferred to a 2 mL centrifuge tube and concentrated in vacuo to dryness. Each dry sample was reconstituted in 100 μL of water and 10 μL was injected onto Acquity UPLC OST C18 1.7 μm, 2.1×50 mm (part number 186003949) for LCMS analysis.

For mass spectrometry, the quenched reaction mixture was cleaned using a _C18 96-well plate (Waters). The oligo was dissolved in 70% acetonitrile / water. The acetonitrile was evaporated in vacuo using a speed and the resulting residue was recovered in water for injection.

Dissolving agent A=50mM triethylammonium acetate

Dissolving agent B=acetonitrile

Column temperature = 60 ° C

Record UV at 254nm and 280nm

RP-HPLC gradient method

On the HPLC chromatogram, the peak area corresponding to the full length RNA oligomer (ONT-28) was integrated, normalized using DNA peaks and plotted against time (Figure 8). ONT-87 exhibits complementary RNA cleavage over other candidate products and in the form of the Bibodies of Mibo. Since all diastereomers in this figure have a 2'-MOE modified wing that does not activate the ribonuclease H enzyme, it is not intended to be limited by theory, and the applicant suggests that it is possible to Chemically indicates activity. The heterozygous strands containing ONT-77 to ONT-81 (including Mibomeisheng) showed very similar RNA cleavage rates. ONT-89 containing alternating Sp/Rp stereochemistry showed minimal activity under the conditions tested during the time period tested. In the MOE-modified oligonucleotides tested, the ONT-87 and ONT-88 units in the antisense strand exhibited increased activity compared to the rest of the heteroduplex. ONT-87 provides, inter alia, an unexpectedly high rate of cleavage and an unexpectedly low residual target RNA content. Other example data are shown in Figures 6 and 24.

In Vitro Oligonucleotide Transfection Analysis: Transfection assays are widely known and practiced by those of ordinary skill in the art. Exemplary schemes are described herein. Hep3B cells were reverse transfected in 96-well plates at a density of 18 x 10 ³ cells/well with lipofectamine 2000 (Life Technologies, Cat. No. 11668-019) using the manufacturer's protocol. For the dose response curve, eight 1/3 serial dilutions were used starting from 60 nM to 100 nM. 25 μL of the 6× oligonucleotide concentration was mixed with the prepared mixture of 0.4 μL of lipofectamine 2000 per well and 25 μL of serum-free medium Opti-MEM medium (Gibco, Cat. No. 31985-062). After incubation for 20 min, 100 μL of 180×10 ³ cells/ml suspended in 10% FBS was added to DMEM cell culture medium (Gibco, Cat. No. 11965-092) to make the final volume 150 μL/well. 24-48 hours after transfection, Hep3B cells were lysed by adding a 75 μL lysing mixture containing 0.5 mg/ml proteinase K, and the kit was treated with the QuantiGene sample for cultured cells (Affymetrix, catalog number QS0103). The target mRNA and GAPDH mRNA expression in cell lysates were measured using the Affymetrix QuantiGene 2.0 assay kit (catalog number QS0011) according to the manufacturer's protocol. T normalizes the performance of GAPDH mRNA for the same sample for the same mRNA; and compares the relative target/GAPDH content with transfection using only the lipofectamine 2000 (no oligonucleotide) control. A dose response curve was generated by GraphPad Prism 6 using a non-linear regression log (inhibitor), and the reaction curve fitted with a variable slope (4 parameters) was compared. See Figure 24, Figure 27, and Figure 29 for example results.

Example 5. The provided compositions and methods provide control of the cracking mode

The present inventors have unexpectedly discovered that the internucleotide linkage stereochemistry mode has an unexpected effect on the cleavage mode of the nucleic acid polymer. By varying the common backbone-to-palm central mode of the palm-controlled oligonucleotide composition, the number of cleavage sites, the percent cleavage of the cleavage site, and/or the position of the cleavage site are surprisingly independent and Change it in combination. As provided in the examples herein, the provided compositions and methods provide control of the cleavage mode of the nucleic acid polymer.

Various pairs of palm-controlled oligonucleotide compositions of different oligonucleotide types were tested using similar analytical conditions. An exemplary cleavage pattern of the target RNA sequence is presented in Figure 9. Certain backbone pairs of palm center patterns, such as those in ONT-87 and ONT-154, unexpectedly produce only one cleavage site in the target sequence. Furthermore, it has been surprisingly discovered that oligonucleotides that provide a single cleavage site, such as ONT-87 and ONT-154, provide an unexpectedly high rate of cleavage and an unexpectedly low level of residual target nucleic acid polymer. See also Figures 8, 10 and 11.

Example 6. Exemplary cleavage of FOXO1 mRNA

Oligonucleotide compositions targeting different regions of FOXO1 mRNA were tested in a cleavage assay as described above. In each case, the palm-controlled oligonucleotide composition is shown to provide a reference cleavage pattern relative to an oligonucleotide composition from the same common base sequence and length but not controlling palmarity. The cracking mode that was changed. See Figure 10 and Figure 11 for example results. As shown in Figure 12, the exemplary palm-controlled oligonucleotide composition provides a significantly faster rate of cleavage and unexpectedly when compared to a reference oligonucleotide composition that does not control palmarity. Low residual content of the ground. In some embodiments, as shown in Figure 11, the cleavage site is associated with the R p S p S p backbone to the palm center sequence. In some embodiments, the cleavage site is two base pairs upstream of R p S p S p .

Exemplary oligonucleotide compositions are listed below.

Example 7. Exemplary High Conversion for Palm Controlled Oligonucleotide Compositions

In the case of cleavage of a nucleic acid polymer fragment (eg, an RNA fragment) at a Tm greater than the physiological temperature of the oligonucleotide, product dissociation is inhibited and the oligonucleotide cannot be dissociated and other target strands are sought to form a double helix and result in a target strand. Lysis. The Tm of ONT-316 (5-10-5 2'-MOE spacer) at the complementary RNA was 76 °C. In an RNA sequence complementary to an oligonucleotide After one cleavage or several cleavage, the 2'-MOE fragment may still bind to the RNA and thus will not cause cleavage of other target molecules. When double-spiral with RNA, the heat melting temperature of the DNA strands is generally very low, such as ONT-367 (63 ° C) and ONT-392 (60 ° C). In addition, thermostability is often relatively uniformly distributed in DNA sequences compared to 2'-MOE modified oligonucleotides. In some embodiments, the oligonucleotides provided in the palm-controlled oligonucleotide composition are free of 2' modifications, such as 2'-MOE. In some embodiments, the oligonucleotides provided in the palm-controlled oligonucleotide composition without the 2' modification (such as 2'-MOE) have a 2' modification (such as 2'-MOE) The oligonucleotides are readily cleaved from the nucleic acid polymer cleavage fragment and have a higher conversion. In some embodiments, the invention provides a whole DNA design in which the oligonucleotide does not have a 2' modification. In some embodiments, an oligonucleotide that does not have a 2' modification has a higher nuclease (such as ribonuclease H) conversion for a palm-controlled oligonucleotide composition. In some embodiments, after cleavage, ribonuclease H is more readily dissociated from the duplex formed by the RNA and the provided oligonucleotide to the palm-controlled oligonucleotide composition. Using a similar protocol as described above, the conversion of two exemplary oligonucleotide-controlled oligonucleotide compositions of the oligonucleotide types ONT-367 and ONT-392 actually shows a reference oligo The nucleotide composition has a high conversion ratio (see Figure 13).

Example 8. Exemplary cleavage of FOXO1 mRNA

As illustrated in Figure 14, the palm-controlled oligonucleotide compositions of the present invention and methods thereof can provide controlled cleavage of nucleic acid polymers. In some embodiments, the palm-controlled oligonucleotide composition of the invention produces a modified cleavage pattern with respect to the number of cleavage sites, the location of the cleavage site, and/or the relative lysis percentage of the cleavage site. In some embodiments, a single site cleavage is provided for a palm-controlled oligonucleotide composition as exemplified by ONT-401 and ONT-406.

In some embodiments, only one RNA cleavage component is detected. Without intending to be limited by theory, the Applicant suggests that this observation can be attributed to the progressive nature of the ribonuclease H enzyme, which can cause multiple nicks on the same double helix, resulting in a very short 5'-OH 3'- OH Fragment.

Other pairs of palm-controlled oligonucleotide compositions were further tested. As noted above, the provided palm-controlled oligonucleotide compositions provide unexpected results, such as in terms of rate of lysis and % of RNA remaining in the DNA/RNA duplex. See Figures 15 through 17. Example analytical data is presented in Figures 18-20. Without intending to be limited by theory, the Applicant suggests that in some embodiments, cleavage may occur as depicted in FIG. In Figure 17, it was observed that the mentioned ONT-406 caused the duplex RNA to cleave at a rate slightly above the rate of the native DNA oligonucleotide ONT-415 having the same base sequence and length. Applicant proposes that the palm-controlled oligonucleotide composition of ONT-406 and other palm-controlled oligonucleotide compositions provided in the present invention have other preferred embodiments not possessed by the ONT-415 composition. Properties such as preferred in vitro and/or in vivo stability profiles. Other example data is presented in Figure 25. Moreover, as will be appreciated by those skilled in the art, the example data shown in Figures 26 and 27 demonstrate that the exemplary palm-controlled oligonucleotide compositions provided are especially designed to be via a backbone pair. When the palm center mode controls the cleavage mode, results are produced that are much superior to the reference oligonucleotide composition (e.g., stereoregular oligonucleotide composition). As exemplified in Figure 26, controlling the backbone-to-palm central mode can, in particular, selectively increase and/or reduce cleavage of existing cleavage sites when using DNA oligonucleotides, or form no when using DNA oligonucleotides. A new cleavage site exists (see Figure 25, ONT-415). In some embodiments, the cleavage site of the DNA oligonucleotide is indicative of an endogenous cleavage preference of ribonuclease H. As demonstrated in Figure 27, the provided palm-controlled oligonucleotide composition is capable of adjusting the target cleavage rate. In some embodiments, about 75% of the difference in cell viability results in a difference in cleavage rate, which can be controlled via the backbone to the palmar center mode. As provided in the present application, other structural features such as base modifications and their patterns, sugar modifications and their patterns, internucleotide linkage modifications and their modes, and/or any combination thereof, may be associated with the backbone-to-palm center Pattern combinations provide appropriate oligonucleotide characteristics.

Example 9. Exemplary dual gene-specific inhibition of mHTT

In some embodiments, the invention provides a palm-controlled oligonucleotide composition and method for transcripts that specifically inhibit the transcript of a particular dual gene with a selectivity that is superior to other dual genes. In some embodiments, the invention provides dual gene-specific inhibition of mHTT.

Figure 22 shows an exemplary versus palm-controlled oligonucleotide composition that specifically inhibits the transcript of one dual gene but does not inhibit the transcripts of other dual genes. Oligonucleotides 451 and 452 were tested against transcripts from the two dual genes exemplified using the biochemical assays described above. Similar procedures are also used to test for dual gene-specific inhibition in cell and animal models, such as Hohjoh, Pharmaceuticals 2013, 6 , 522-535; U.S. Patent Application Publication No. US 2013/0197061; and Østergaard et al, Nucleic Acids Research, 2013, 41 (21), as described in 9634-9650. In all cases, transcripts from the target dual gene are selectively inhibited in preference to transcripts from other dual genes. As will be appreciated by those skilled in the art, the example data shown in Figure 22 demonstrates that the exemplary palm-controlled oligonucleotide compositions provided are produced, especially when designed to control the cleavage mode via stereochemistry. The result is much better than the reference oligonucleotide composition (in this case, the stereoregular oligonucleotide composition). As demonstrated in Figure 22, the backbone-to-palm central mode can significantly alter the cleavage mode (Fig. 22C-E) and can employ a stereochemical mode to localize the cleavage site at the mismatch site (Fig. 22C-E), and/or The selectivity between the mutant and the wild type can be significantly improved (Fig. 22G-H). In some embodiments, the palm-controlled oligonucleotide composition is incubated with the target wtRNA and muRNA, and both duplexes are incubated with ribonuclease H.

Huntington's dual gene Tm

Example 10. Exemplary dual gene-specific inhibition of FOXO1

In some embodiments, the invention provides dual gene-specific inhibition of FOXO1.

Figure 23 shows an exemplary versus palm-controlled oligonucleotide composition that specifically inhibits the transcript of one dual gene but does not inhibit the transcripts of other dual genes. Oligonucleotides ONT-400, ONT-402 and ONT-406 were tested against transcripts from the two dual genes exemplified using the biochemical assay described above. Similar procedures are also used to test for dual gene-specific inhibition in cell and animal models, such as Hohjoh, Pharmaceuticals 2013, 6 , 522-535; US Patent Application Publication No. US 2013/0197061; Østergaard et al, Nucleic Acids Research 2013, 41 (21), 9634-9650; and Jiang et al, Science 2013, 342 , 111-114. The transcript from the target dual gene is selectively inhibited in preference to transcripts from other dual genes. In some cases, two RNAs containing mismatches were synthesized from ONT-388: ONT-442 (A/G, position 7) and ONT-443 (A/G, position 13) and made with ONT-396 The double helix is the ONT-414. A RNase H assay was performed to obtain the cleavage rate and cleavage profile.

Example 11. Certain Exemplary Oligonucleotides and Oligonucleotide Compositions

The thermal melting temperature of a stereoregular oligonucleotide having different 2' substitution chemistries in three different regions of FOXO1 mRNA when in a duplex with a complementary RNA. The concentration of each strand was 1 μM in 1×PBS buffer.

Other exemplary stereoregular oligonucleotide compositions are listed below.

Exemplary RNA and DNA oligonucleotides are listed below.

Exemplary palmitic pure oligonucleotides are presented below. In some embodiments, the invention provides a corresponding pair of palm-controlled oligonucleotide compositions of each of the following exemplary oligonucleotides.

Other exemplary oligonucleotides targeting FOXO1 are presented below with Tm. In some embodiments, the invention provides a corresponding pair of palm-controlled oligonucleotide compositions of each of the following exemplary oligonucleotides.

Example 12. Exemplary other controlled cleavage achieved by the provided palm-controlled oligonucleotide composition

As will be appreciated by those skilled in the art, the example data shown in Figure 26 demonstrates that the palm-controlled oligonucleotide compositions and methods thereof are provided as compared to, for example, stereoregular oligonucleotide compositions. Providing unexpected results with reference to the composition. In particular, a controlled cleavage mode can be produced for a palm-controlled oligonucleotide composition, including, but not limited to, controlling the location of the cleavage site, the number of cleavage sites, and the relative lysis percentage of the cleavage site. See also the example data presented in Figure 27.

Example 13. Stability of a palm-controlled oligonucleotide composition

As will be appreciated by those skilled in the art, the example data shown in Figure 26 demonstrates that the stability of the provided palm-controlled oligonucleotide composition can be adjusted by altering the backbone-to-palm center mode. See Figure 7 and Figure 28 for example information. Exemplary protocols for performing serum stability experiments are described below.

Protocol: P-stereochemically pure PS DNA (ONT-396-ONT-414 (from 3' to 5' end, single Rp)), stereotactic random PS DNA (ONT-367), whole Sp PS DNA (ONT- 421) and whole Rp PS DNA (ONT-455) were incubated in rat serum (Sigma, R9759) (0 h and 48 h) and analyzed by IEX-HPLC.

Incubation method: 5 μL of 250 μM of each DNA solution and 45 μL of rat serum were mixed and incubated at 37 ° C for each time point (0 h and 48 h). At each time point, the reaction was stopped by the addition of 25 μL of 150 mM EDTA solution, 30 μL of lysis buffer (erpicentre, MTC096H) and 3 μL of proteinase K solution (20 mg/mL). The mixture was incubated at 60 ° C for 20 minutes, followed by injection of 20 μL of the mixture into IEX-HPLC and analysis.

Incubation of control samples: 5 μL of a mixture of 250 μM of each DNA solution and 103 μL of 1×PBS buffer was prepared and 20 μL of the mixture was analyzed by IEX-HPLC as a control to check absolute quantification.

Exemplary analytical methods:

IEx-HPLC

A: 10 mM TrisHCl, 50% ACN (pH 8.0)

B: 10 mM TrisHCl, 800 mM NaCl, 50% ACN (pH 8.0)

C: Water-ACN (1:1, v/v)

Temperature: 60 ° C

Column: DIONEX DNAPac PA-100, 250×4mm

gradient:

washing:

Column temperature: 60 ° C.

Washing is performed each time the sample is manipulated.

The percentage of remaining PS DNA was calculated by analyzing the ratio from 0 h to 48 h using the integrated area of the HPLC chromatogram.

Example 14. Example analysis results (Figure 19)

Figure 19 Peak distribution (above, M12-Exp11 B10, ONT-354, 30min)

Peak assignment in Figure 19 (below, M12-Exp11 A10, ONT-315, 30min)

Example 15. Example analysis results (Figure 30)

Figure 30 Peak distribution (above, M12-Exp11 D2, ONT-367, 30min)

Figure 30 Peak distribution (below, M12-Exp21 NM Plate1 (pool) F11 ONT-406 30min)

Example 16. Illustrative Preparation of Linking Groups

In some embodiments, the SP linking group is prepared according to the following scheme:

Example 17. Exemplary Design of Base Sequences

As described in the present invention, the present invention recognizes the importance of base sequence pairs, for example, in providing a palm-controlled oligonucleotide composition. In some embodiments, as exemplified herein, the invention provides methods of designing a base sequence for an oligonucleotide, such as an antisense oligonucleotide.

In some embodiments, bioinformatics is used in particular to design sequences for a target, such as a disease-associated mutant dual gene for Huntington's disease. This example describes exemplary steps that can be used to design antisense oligonucleotides for, for example, rs362268, rs362306, rs2530595, rs362331, rs362307, and the like. In some embodiments, the methods provided comprise the steps of examining sequence characteristics for off-target, binding affinity to a target, adjacent Gs, and a padiandromic moiety. In some embodiments, the methods provided comprise the step of examining the off-target effect in the presence of a mismatch. In some embodiments, sequences comprising characteristic sequence elements (eg, mutations, SNPs, etc.) present in the target and having the following lengths are used in an assay such as ribonuclease H assay, reporter gene analysis, etc.: about 10-1000 nuclei Glycosylates, for example, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 200, about 250, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1,000, about 2,000, about 3,000, about 4,000, about 5,000, and the like. In some embodiments, as in this example, a 40 bp flanking sequence is used for SNPs such as rs362268, rs362306, rs2530595, rs362331, rs362307, and the like. A plurality of such sequences can be readily assessed by the methods provided, for example from 6 to 12. The exemplary test sequences are listed below:

As described in the present invention and generally understood by those skilled in the art, in some embodiments, an assay such as the ribonuclease cleavage assay described herein is suitable for assessing one or more characteristics (eg, rate of lysis, Degree and / or selectivity). In some embodiments, the ribonuclease cleavage assay provides a cleavage pattern of the oligonucleotide composition. In some embodiments, a ribonuclease H assay can provide a DNA cleavage pattern for the sequence using a composition of DNA oligonucleotides having the same sequence. In some embodiments, all of the DNA oligonucleotides in the composition are identical to produce a DNA cleavage pattern. In some embodiments, a ribonuclease H assay can provide a stereospecific random cleavage pattern of the sequence when a stereospecific composition having the same sequence of total phosphorothioate oligonucleotides is used. In some embodiments, to generate a stereoregular lysis mode, all of the oligonucleotides in the stereoregular composition are identical. In some embodiments, a ribonuclease H assay can provide a stereospecific cleavage pattern for a palm-controlled oligonucleotide composition when a palm-controlled oligonucleotide composition is used. In some embodiments, to generate a cleavage pattern for a palm-controlled oligonucleotide composition, all oligonucleotides in the palm-controlled oligonucleotide composition are identical. In some embodiments, ribonuclease H analysis provides cleavage rate information. In some embodiments, the ribonuclease H assay provides a relative degree of cleavage, such as (cleavage at a certain site) / (all cleavage). In some embodiments, the ribonuclease H assay provides an absolute degree of cleavage: (a cleavage target at a certain site) / (all lysed and uncleaved targets). In some embodiments, ribonuclease H analysis provides selectivity. In some embodiments, ribonuclease H analysis provides information on the extent of inhibition.

In some embodiments, a ribonuclease H assay provides a rate of cleavage as exemplified herein. See Figure 31 for example results. P represents the mismatch position in the oligonucleotide from the 5' end.

Human ribonuclease H1 cleavage when the 25-mer RNA hybridized to a different phosphorothioate oligonucleotide targeting the rs362307 SNP was analyzed. WV-944 and WV-945 are 25mer RNAs including WT and mutant variants of rs362307, respectively. WV-936 to WV-941 are stereoscopic pure DNA, and WV-904 to WV-909 are stereotactic random DNA. All B. diploids were incubated with ribonuclease H1C in the presence of 1 x RNase H buffer at 37 °C. The reaction was quenched by 30 mM Na ₂ EDTA at a fixed time point. One tenth of this reaction mixture was injected on reverse phase HPLC and the peak area of the remaining full length RNA in the reaction mixture was measured at different time points. The rate of cleavage was determined by plotting these peak areas and individual time points. In some embodiments, a difference in cleavage rate is observed between WT RNA and mu RNA.

In some embodiments, as shown in FIG. 31, the position 11, 12 or 13 in the sequence as counted from its 5' end is aligned with the SNP, or the position in the sequence as counted from its 3' end. When 9 or 10 is aligned with the SNP, better pyrolysis selectivity is observed.

Example 18. Exemplary wing, core, wing-core, core-wing and wing-core-wing design

In particular, the present invention provides various embodiments of wing, core, wing-core, core-wing and wing-core-wing configurations. In some embodiments, it has been unexpectedly discovered that oligonucleotides comprising a phosphate linkage and a core comprising a phosphorothioate linkage provide unexpectedly increased cleavage efficiency and selectivity. For example, see Figures 32C, F, G, H, and the like.

Human ribonuclease H1 cleavage when the 25-mer RNA hybridized to a palm-controlled oligonucleotide composition differing from the targeted rs362307 SNP was analyzed. WV-944 and WV-945 are 25mer RNAs including WT and mutant variants of rs362307, respectively. WV-1085 to WV-1092 are stereoscopic pure 2'-OMe/DNA containing a PO/PS mixed backbone. All B. diploids were incubated with ribonuclease H1C in the presence of 1 x RNase H buffer at 37 °C. The reaction was quenched by 30 mM Na ₂ EDTA at a fixed time point. One tenth of this reaction mixture was injected on reverse phase HPLC and the peak area of the remaining full length RNA in the reaction mixture was measured at different time points. The rate of cleavage was determined by plotting these peak areas and individual time points.

In some embodiments, the 2'-OMe phosphate wing changes the rate and/or selectivity of cleavage. In some embodiments, the 2'-OMe phosphate wing changes the rate of cleavage and selectivity. In some embodiments, the 2'-OMe phosphate wing changes the rate or selectivity of cleavage. In some embodiments, The 2'-OMe phosphate wing changes the rate of cleavage. In some embodiments, the 2'-OMe phosphate wing changes the rate of cleavage of the mutant and wild-type dual genes. In some embodiments, the 2'-OMe phosphate wing changes the cleavage selectivity. In some embodiments, the 2'-OMe phosphate wing changes the cleavage mode.

In some embodiments, the incorporation of phosphate internucleotide linkages unexpectedly improves the rate and/or selectivity of cleavage. In some embodiments, the incorporation of phosphate internucleotide linkages unexpectedly improves the rate and selectivity of cleavage. In some embodiments, the incorporation of phosphate internucleotide linkages unexpectedly improves the rate or selectivity of cleavage. In some embodiments, the incorporation of phosphate internucleotide linkages unexpectedly improves the rate of cleavage. In some embodiments, the phosphate internucleotide linkage improves the rate of cleavage of the mutant and wild-type dual genes, but the modified degree mutant-type dual gene is greater than the wild-type dual gene. In some embodiments, the incorporation of phosphate internucleotide linkages unexpectedly improves cleavage selectivity.

In some embodiments, as evidenced by the materials exemplified herein, a stereo-pure oligonucleotide composition provides an unexpectedly high rate of cleavage and/or selectivity compared to a corresponding steric random composition; See stereo pure WV-1497/stereo random WV-1092, 905/937, 931/1087 and so on.

Example 19. Exemplary cleavage map

As described herein, in some embodiments, an assay, such as a RNase H assay, provides a cleavage map of a stereoregular or palm-controlled oligonucleotide composition. An exemplary cleavage map is shown in Figure 33, which illustrates a stereospecific cleavage pattern of a multi-base sequence. Other cleavage maps are presented in Figure 35, which in particular exemplifies a steric random cleavage pattern without a nucleoside modified base sequence (WV-905) and a nucleoside modified base sequence.

An exemplary cleavage mode for a palm controlled stereospecific oligonucleotide composition is presented in FIG. As described in the present invention, the primary cleavage site can be identified from the cleavage mode via analysis such as RNase H assay. For example, with respect to WV-937, the relative major cleavage site as assessed by (cleavage/total lysis of this site) and reflected by the length of the arrow, wild type Between GCGC and CCUU (2 nucleotides away from the SNP), and the mutant is between CUGU and GCCC (at the SNP site, 0 nucleotides away from the SNP). In some embodiments, the relative major cleavage site is not necessarily an absolute major cleavage site, which requires cleavage of a certain percentage of the total target (in this case, RNA) at that site. For example, in some embodiments, if it is desired to cleave more than 20% of the total target at a site to qualify the site as the primary cleavage site, then between WGC-937/wild type between GCGC and CCUU The site is not the major cleavage site (see Figure 32, M); if the threshold of the major site is the total target of 20% cleavage at the site, the WV-937/mutant is between CUGU and GCCC The site remains the primary cleavage site.

In some embodiments, different oligonucleotide compositions have different rates of cleavage. In some embodiments, a cleavage map is generated at different time points. For example, with respect to an oligonucleotide composition having a faster rate of cleavage, it can be earlier than an oligonucleotide composition having a slower rate of cleavage (eg, 30 minutes, 45 minutes, 60 minutes, etc.) (eg, 5 minutes, 10 minutes, 15 minutes, etc.) produces its cleavage profile.

In some embodiments, when a cleavage product of only one site can be identified by analytical methods such as HPLC, HPLC-MS, etc., the corresponding cleavage mode is considered to have a single cleavage site. In some embodiments, greater than about 90%, greater than about 91%, greater than about 92%, greater than about 93%, greater than about 94%, greater than about 95%, greater than about 96%, greater than about 97 occur at a single point. When the total lysis is greater than about 98%, greater than about 99%, or greater than about 99.5%, the corresponding lysis pattern can be considered to have a single cleavage site. In some embodiments, as understood by those of ordinary skill in the art, the selectivity in, for example, cells, tissues, organs, individuals, and the like, can be higher than that observed in ribonuclease H assays. In some embodiments, greater than about 90%, greater than about 91%, greater than about 92%, greater than about 93%, greater than about 94%, greater than about 95%, greater than about 96%, greater than greater than about 94%, in the ribonuclease H assay. A site of about 97%, greater than about 98%, greater than about 99%, or greater than about 99.5% of the total cleavage may be more selective in cells, tissues, organs, or individuals. In some embodiments, the ribonuclease H Sites having greater than about 90% total lysis in the assay can be the only cleavage site in a cell, tissue, organ or individual (eg, greater than about 99%, greater than about 99.5%, 100%, etc.).

In some embodiments, the absolute value of the remaining transcripts of a representative synthetic sequence of a target sequence and similar sequences (eg, RNA) or a target mutant gene and a wild-type dual gene that is a similar sequence can be compared (or Selective sequences thereof, such as the RNA sequences used in the examples described herein, are used to assess selectivity. In some embodiments, when the starting amounts are the same, the absolute amount of the remaining transcripts of the target sequence and similar sequences (or representative sequences thereof, such as the RNA sequences used in the examples described herein) can be assessed. Selectivity. In some embodiments, the selectivity can be assessed by the percent lysis of the transcripts of the target sequence and similar sequences (or representative sequences thereof, such as the RNA sequences used in the examples described herein). In some embodiments, the selectivity can be assessed by comparing the ratio of cleaved to uncleaved transcripts (or representative sequences thereof, such as the RNA sequences used in the examples described herein).

In some embodiments, the selectivity can be assessed by one or more of the assays exemplified herein. In some embodiments, the selectivity can be measured by ribonuclease H cleavage assay. For example, selective cleavage of a target (eg, RNA from a mutant dual gene) can be assayed by biochemical ribonuclease H cleavage assay, wherein cleavage of the mutant target sequence is compared to cleavage of the wild-type RNA sequence, And the selectivity can be expressed by the ratio of the cleavage ratio, the ratio of the mutant RNA to the wild-type RNA cleavage at a certain time point, or the ratio of the mutant RNA to the wild-type RNA remaining at a certain time point, or a combination thereof. In some embodiments, the time point is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 minutes or more than 60 minutes. In some embodiments, the time point is 10 minutes. In some embodiments, the time point is 15 minutes. In some embodiments, the time point is 20 minutes. In some embodiments, the time point is 25 minutes. In some embodiments, the time point is 30 minutes. In some embodiments, the time point is 35 minutes. In some embodiments, the time point is 40 minutes. In some embodiments, the time point is 45 minutes. In some embodiments, the time point is 50 minutes. In some embodiments, the time point is 55 minutes. In some embodiments, the time point is 60 minutes. In some embodiments, the time point is 60 minutes. Those of ordinary skill in the art will understand how to select a point in time, such as for the lysis shown in Figure 32, with one or more of the 5, 10, 15, 20, 20, 45 and 60 minutes being selected for selectivity. In some embodiments, the (e.g. wild-type) sequence of the IC ₅₀ ratio measured selectively by the target (e.g., mutant) and the non-target, for example according to the cell-based assays or animal models.

An exemplary HPLC-MS trace is presented in Figure 36. In some embodiments, exemplary ribonuclease H assay conditions are described below.

DNA/RNA double helix preparation: Oligonucleotide concentration was determined by measuring the absorbance at 260 nm in water. DNA/RNA duplexes were prepared by mixing equal molar oligonucleotide solutions with a concentration of 20 μM per strand. The mixture was heated in a water bath at 90 ° C for 2 minutes and allowed to cool slowly over a period of hours.

Human ribonuclease H protein expression and purification: Prof. Wei Yang obtained the human ribonuclease HC pure line from the laboratory of NIH Bethesda. A protocol for obtaining this human ribonuclease HC (residues 136-286) has been described (Nowotny, M. et al. Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse Transcription. Molecular Cell 28, 264-276 (2007)). Protein performance was performed by following the reported protocol, but the resulting protein was changed to have an N-terminal His6 tag. Regarding protein expression, BL21 (DE3) E. coli cells were used in LB medium. The cells were grown at 37 ° C until the OD _{600 nm} reached about 0.7. The culture was then cooled and 0.4 mM IPTG was added to induce protein expression overnight at 16 °C. Preparation of Escherichia coli by sonication in buffer A (40 mM NaH ₂ PO ₄ (pH 7.0), 1 M NaCl, 5% glycerol, 2.8 mM β-mercaptoethanol and 10 mM imidazole) supplemented with protease inhibitor (Sigma-Aldrich) Extract. The extract was purified by buffer A plus 60 mM imidazole using a Ni affinity column. The protein was eluted with a linear gradient of 60 to 300 mM imidazole. Protein peaks were collected and further purified on a Mono S column (GE Healthcare) with buffer B containing a gradient of 100 mM to 500 mM NaCl. The fraction containing ribonuclease HC was concentrated to 0.3 mg/mL in storage buffer (20 mM HEPES (pH 7.0), 100 mM NaCl, 5% glycerol, 0.5 mM EDTA, 2 mM DTT) and stored at -20 °C. The 0.3 mg/mL enzyme concentration corresponds to 17.4 μM based on the reported extinction coefficient (32095 cm ^-1 M ^-1 ) and MW (18963.3 Da unit).

10 μL of 10× ribonuclease H buffer was added to 25 μL of DNA/RNA duplex (20 μM) in a 96-well plate, followed by the addition of 30 μL of water. The mixture was incubated at 37 ° C for several minutes, and then 10 μL of 0.2 μM enzyme stock solution was added to give a total volume of 100 μL, and the final substrate/enzyme concentration was 10 μM/0.02 μM (500:1), and further cultured at 37 °C. . Various ratios of DNA/RNA double helix and ribonuclease H protein were previously investigated using these conditions to find this optimal ratio (500:1) for studying kinetics. The reaction was quenched with 7 μL of 500 mM aqueous solution of EDTA disodium at various time points. At the 0 min time point, EDTA was added to the reaction mixture followed by the addition of the enzyme. Controls were performed to ensure that EDTA was able to completely inhibit enzyme activity. After quenching all reactions, an analytical column (Agilent Poroshell 120 EC-C18 2.7 micron, 2.1 x 150 mm, part number 699775-902) was used and 10 [mu]L or 20 [mu]L of each reaction mixture was injected onto the LCMS-TOF. The ratio of the peak area of the remaining full length RNA to the DNA in each reaction mixture was normalized to the ratio at the time of the zero point reaction, thereby obtaining the remaining full length RNA%.

In some embodiments, exemplary HPLC conditions are: Eluent A = water containing 8 mM TEA, 200 mM HFIP

Dissolving agent B=50:50 (dissolving agent A: methanol)

Column temperature = 50 ° C

Automatic injection temperature = 4 ° C

Record UV at 254nm and 280nm

LC gradient method

Example 20. Exemplary Analysis for Assessing Oligonucleotides

In some embodiments, the invention provides reporter gene assays for assessing the properties of the provided oligonucleotides and compositions. In some embodiments, the reporter gene analysis provided is a dual luciferase assay, such as described below.

mRNA inhibition by oligonucleotides was determined using a dual Glo luciferase system: the psiCheck2 vector system from Promega is a commercially available vector encoding a single plastid firefly ( Photinus pyralis ) and the sea. Renilla Reniformis luciferase gene, which contains multiple selection sites for insertion of oligonucleotides encoding microRNA target sites in the 3' UTR of Renilla luciferase (or other colonization) Regulatory sequences, such as the target 3'UTR). A 250 base pair fragment containing the targeted region of interest and its reverse complement and having appropriate overhanging bases corresponding to the restriction enzyme used to digest the psiCheck vector was cloned into the psiCHECK-2 vector (Promega, C8021) Between NotI and XhoI restriction enzyme sites. The vector containing the insert is sequenced to confirm that the orientation of the insert is correct, extended and purified. A plurality of vectors are generated using the above design for the SNP of interest. In a typical co-transfection experiment, oligonucleotides and vectors were reverse transfected using Lipofectamine 2000 (Life Technologies) after the cells reached the appropriate density (30% to 40% confluency). The effect of the oligonucleotide on the target mRNA can be seen as early as 24 h after transfection, and these effects persist after 48 h. The luciferase activity of the cells was analyzed 24 hours or 48 hours after transfection of the psiCheck vector. Briefly, cells were washed with PBS, lysed in passive lysis buffer, luciferin reagent was added, and samples were read on a Spectramax M5 instrument (Molecular Devices). The measurement was carried out at a carrier concentration of 20 ng per well in a 96-well plate. Experiments were performed at various oligonucleotide concentrations (30, 10 and 3.3 nM) and at two time points (24 and 48 hours). Measure the relative content of Renilla luciferase versus firefly luciferase in untreated cells and cells treated with oligonucleotides targeting sea kidney (WV-975) to measure maximal Renilla resistance Gene expression. The control oligonucleotide (eg, WV-437, WV-993, etc.) is selected to normalize the R/F content. In some embodiments, the oligonucleotide is assessed in a Cos7 cell line using a dual luciferase reporter gene assay. In some embodiments, the cell line is co-transfected with the oligonucleotide and any psiCHECK2 plastid (including rs362307 (T) or rs362307 (C) SNP) for 24 hours. In some embodiments, rs362307(T) and rs362307(C) are referred to as mu and wt.

Various pairs of palm controlled and stereoregular oligonucleotide compositions were tested at 30 nM using dual luciferase assay. Regarding oligonucleotides containing mismatches at the same position (eg, positions 8, 9, 10, 11, 12, and 13 relative to the 5' end), maintaining a high content of the palm-controlled composition Measure.

In some embodiments, WV-1092 selectively inhibits the expression of the mutant sequence at 24 and/or 48 hours when tested at 30 nM, as shown by double luciferase reporter gene analysis. In some embodiments, WV-1092 is observed to have selectivity over other oligonucleotide compositions at 24 n and/or 48 hours at 30 nM (eg, WV-917, WV-1497, certain P12 stereo-oligo Nucleotides, etc.) several times. In some embodiments, at 30 nM, at 48 hours, WV-1092 maintains more than 90% of the wild type and reduces the mutant to about 30%, while WV-917 reduces the wild type to about 60%, and The mutant was reduced to approximately 30%. Oligonucleotides are tested under a variety of conditions (eg, concentration, time point, etc.) and exhibit improved properties such as activity, selectivity, and the like.

As will be understood by those of ordinary skill in the art, oligonucleotide characteristics such as activity, selectivity, etc. can be assessed by a variety of other assays, such as cell-based assays, animal models, and the like. In some embodiments, a similar procedure can be used to test for dual gene-specific inhibition in cell and animal models, such as Hohjoh, Pharmaceuticals 2013 , 6 , 522-535; US Patent Application Publication No. US 2013/0197061; Østergaard et al, Nucleic Acids Research 2013 , 41 (21), 9634-9650; Jiang et al, Science 2013 , 342 , 111-114; and US9006198. In some embodiments, the wild-type and mutant by assessing the selectivity of the allele IC ₅₀ values. Compositions provided, including those that target SNPs associated with Huntington's disease, can selectively inhibit disease-associated dual genes in preference to wild-type dual genes.

Example 21. Exemplary Methods for Preparing Oligonucleotides and Compositions abbreviation

AMA: H ₂ O (1:1, v/v) with concentrated NH ₃ -40% MeNH ₂

CMIMT: N -cyanomethylimidazolium trifluoromethanesulfonate

DBU: 1,8-diazabicyclo[5.4.0]undec-7-ene

DCA: dichloroacetic acid

DCM: dichloromethane, CH ₂ Cl ₂

DMTr: 4,4'-dimethoxytritylmethyl

DVB: Divinylbenzene

HCP: highly crosslinked polystyrene (containing 50% DVB, non-swellable polystyrene)

MeIm: N - methylimidazole

MQ: Water from the Milli-Q Reference

PhIMT: N -phenylimidazolium trifluoromethanesulfonate

POS: 3-phenyl-1,2,4-dithiazolin-5-one

PS200: Primer Vector 200, available from GE Healthcare

PS5G: Primer Vector 5G, available from GE Healthcare

TBAF: tetrabutylammonium fluoride

TBHP: tert-butyl hydroperoxide

TEAA: Triethylammonium acetate

Solid support: Test various types of solid supports (different nucleoside loading). In some embodiments, HCP>PS5G PS200 CPG. In some embodiments, the solid support is an HCP. In some embodiments, the solid support is PS5G. In some embodiments, the solid support is PS200. In some embodiments, the solid support is a CPG. For the nucleoside loading, various ranges (30-300 μmol/g) were tested. In some embodiments, a loading of 70-80 [mu]mol/g is preferred over others. In some embodiments, the nucleoside loading is 70-80 [mu]mol/g. CPG was purchased from various suppliers (GlenReseach, LinkTechnologies, ChemGenes, PrimeSynthesis, and 3-Prime).

Various linking groups can be tested and used. In some embodiments, the SP linking group is used during preparation of the palm-controlled oligonucleotide composition by using DPSE-type chemistry.

Various activators are prepared and/or purchased and evaluated. In some embodiments, for DPSE type chemistry, CMIMT is used.

Exemplary analytical conditions:

1) RP-UPLC-MS

System: Waters, Aquity UPLC I-Class, Xevo G2-Tof

Column: Waters, BEH C18, 1.7μm, 2.1×150mm

Temperature and flow rate: 55 ° C, 0.3 mL / min

Buffer: A: 0.1M TEAA; B: MeCN

Gradient: B%: 1-30%/30min

2) AEX-HPLC

System: Waters, Alliance e2695

Column: Thermo, DNAPac PA-200, 4×250mm

Temperature and flow rate: 50 ° C, 1 mL / min

Buffer: A: 20 mM NaOH; B: A + 1 M NaClO ₄

Gradient: B%: 10-50%/30min

An exemplary synthetic procedure for palmitic oligonucleotides (1 μmol scale):

Automated solid phase synthesis of palmitic oligonucleotides is performed according to the exemplary cycles shown herein. After the synthesis cycle, the resin was treated with 0.1 M TBAF in MeCN (1 mL) for 2 h at room temperature (usually 30 minutes sufficient), washed with MeCN, dried, and AMA (1 mL) added at 45 ° C for 30 min. . The mixture was cooled to room temperature and the resin was removed by membrane filtration. The filtrate was concentrated to about 1 mL under reduced pressure. The residue was diluted with 1 mL of H ₂ O and analyzed by AEX-HPLC and RP-UPLC-MS (exemplary conditions: reference analysis conditions).

As noted, TBAF treatment can provide better results, such as less desulfurization. In some embodiments, without intending to be limited by theory, the SP linking group provides better yield and/or purity via preferred stability during removal of the palmitic adjuvant as described. In some embodiments, it is not intended to be limited by theory, when a butyl dithiol linking group is used, a fluorine-containing reagent such as HF-NR ₃ (eg, HF-TEA (triethylamine)) is used in the palm of the hand. Less cracking during the removal of the adjuvant provides better yield and/or purity. In some embodiments, after synthesis, at 50 ℃, 1M TEA-HF containing the _{DMF-H 2 O (3:} 1, v / v; 1mL) treatment of the resin 2h. The PS5G vector was washed with MeCN, H ₂ O, and AMA (concentrated NH ₃ -40% MeNH ₂ (1:1, v/v)) (1 mL) was added and allowed to stand at 50 ° C for 45 min. The mixture was cooled to room temperature and the resin removed by membrane filtration (washed with 2mL H ₂ O). The filtrate was concentrated under reduced pressure until it became about 1 mL. The residue was diluted with 1 mL of H ₂ O and analyzed by AEX-HPLC and RP-UPLC-MS (conditions: reference analysis conditions).

An exemplary purification procedure for palmitic oligonucleotides (1 μmol scale): in some embodiments The crude oligonucleotide was purified by AEX-MPLC according to the following exemplary conditions:

System: AKTA Purifier-10

Column: TOHSOH, DNA STAT, 4.6×100mm

Temperature and flow rate: 60 ° C, 0.5 mL / min

Buffer: A: 20 mM Tris-HCl (pH 9.0) + 20% MeCN, B: A + 1.5 M NaCl

Gradient: B%: 20-70%/25CV (2%/CV)

All fractions were analyzed by analytical AEX-HPLC and the fractions containing more than 80% purity of the palmitic oligonucleotide were corrected and desalted using the following exemplary conditions by Sep-Pak Plus tC18 (WAT036800):

1. Adjust Sep-Pak Plus with 15 mL MeCN.

2. Flush the cartridge with 15 mL of 50% MeCN/MQ.

3. Use 30mL MQ to balance the barrel.

4. Load the sample and wash with 40 mL of MQ.

5. Dissolve the palmitic oligonucleotide with 10 mL of 50% MeCN/MQ.

The lysed sample was evaporated under reduced pressure to remove MeCN and lyophilized. The product was dissolved in MQ (1 mL) filtered through a 0.2[mu]m sieve syringe filter and analyzed. After the yield was calculated by UV absorbance, the formulation was lyophilized again.

Illustrative methods, conditions, and reagents are described, for example, in JP 2002-33436, WO 2005/092909, WO 2010/064146, WO 2012/039448, WO 2011/108682, WO 2014/010250, WO 2014/010780, WO 2014/012081, etc. Oligonucleotides and/or compositions provided.

Other exemplary oligonucleotides are listed below. In some embodiments, one or more of the following oligonucleotides are used as controls. In some embodiments, one or more of the following oligonucleotides are RNA sequences that are targets of lysis in one or more assays.

Example 22. Exemplary oligonucleotides.

Other exemplary oligonucleotides are listed in Table 8, below.

abbreviation:

2\': 2'

3\': 3'

5\': 5'

307: SNP rs362307

C6: C6 amine linking group

F, f: 2'-F

Htt, HTT: Huntington's gene or Huntington's disease

Lauric, Myristic, Palmic, Stearic, Oleic, Linoleic, alpha-Linoleic, gamma-Linoleic, DHA, Turbinaric, Dilinoleic: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha - Linoleic acid, γ-linolenic acid, docosahexaenoic acid, trumpetic acid, and linoleic acid.

muHtt or muHTT: mutant Huntington gene or gene product

OMe: 2'-OMe

O, PO: phosphodiester (phosphate)

*, PS: phosphorothioate

R, Rp: phosphorothioate in Rp configuration

S, Sp: phosphorothioate in the form of Sp

WV: WV-

WV-:WV

X: phosphorothioate, stereo random

Equivalent

Having described some of the illustrative embodiments of the present invention, it should be understood by those skilled in the art that the above description is only illustrative and not restrictive. Numerous modifications and other illustrative embodiments are within the scope of the invention and are intended to be within the scope of the invention. In particular, although many of the examples presented herein relate to a particular combination of method acts or system elements, it should be understood that the acts and their elements can be combined in other ways to accomplish the same objectives. It is not intended that the actions, elements, and features described in connection with one embodiment be excluded from the similar characters in other embodiments. In addition, with regard to one or more of the means and functional limitations described in the following claims, the means are not intended to be limited to the means disclosed herein for performing the described functions, but are intended to cover what is now known or later. In the context of any means of performing the described functions.

The use of ordinal terms such as "first", "second", "third", etc., in the scope of the patent application to modify the claim element itself does not imply any priority or priority of one claim element relative to another. Or order or perform a time sequence of method actions, but only as a label to distinguish one request item element having a certain name from another element having the same name (but using an ordinal term) to distinguish the request item elements. Similarly, the use of a), b), etc. or i), ii), etc., does not in itself mean any priority, priority or order of steps in the scope of the claims. Similarly, the use of such terms in the specification is not intended to mean any of the claimed priority, priority or order.

The foregoing written description is considered to be sufficient to enable those skilled in the art to practice the invention. The scope of the invention is not limited to the examples provided, as such examples are intended to be a single description of one aspect of the invention, and other embodiments that are functionally equivalent are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the <RTIgt; The various embodiments of the invention do not necessarily cover the advantages and objectives of the invention.

<110> Singapore Business Botao Life Science Co., Ltd.

<120> Oligonucleotide composition and method thereof

<130> 2010581-0257

<140>

<141>

<150> 62/331,960

<151> 2016-05-04

<150> 62/236,847

<151> 2015-10-02

<150> 62/195,779

<151> 2015-07-22

<160> 1553

<170> PatentIn version 3.5

<210> 1

<211> 105

<212> DNA

<213> Artificial sequence

<220>

<223> Description of Artificial Sequence: Synthetic Polynucleotide

<220>

<221> misc_feature

<222> (1)..(105)

<223> This sequence can cover 10-35 "cag" repeat units, some of which may not exist.

<400> 1

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 2

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 3

<210> 4

<211> 13

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 4

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 5

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 6

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 7

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 8

<210> 9

<211> 13

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 9

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 10

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 11

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 12

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 13

<210> 14

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 14

<210> 15

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 15

<210> 16

<211> 10

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 16

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 17

<210> 18

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 18

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 19

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 21

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 22

<210> 23

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 23

<210> 24

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 24

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 25

<210> 26

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 26

<210> 27

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 27

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 28

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 29

<210> 30

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 30

<210> 31

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 31

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 32

<210> 33

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 33

<210> 34

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 34

<210> 35

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 35

<210> 36

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 36

<210> 37

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 37

<210> 38

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 38

<210> 39

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 39

<210> 40

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 40

<210> 41

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 41

<210> 42

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<220>

<221> modified_base

<222> (4)..(4)

<223> t or u

<220>

<221> modified_base

<222> (8)..(8)

<223> t or u

<220>

<221> modified_base

<222> (10)..(10)

<223> t or u

<220>

<221> modified_base

<222> (13)..(14)

<223> t or u

<400> 42

<210> 43

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 43

<210> 44

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 44

<210> 45

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 45

<210> 46

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 46

<210> 47

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 47

<210> 48

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 48

<210> 49

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 49

<210> 50

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 50

<210> 51

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 51

<210> 52

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 52

<210> 53

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 53

<210> 54

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 54

<210> 55

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 55

<210> 56

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 56

<210> 57

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 57

<210> 58

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 58

<210> 59

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 59

<210> 60

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 60

<210> 61

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 61

<210> 62

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 62

<210> 63

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 63

<210> 64

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 64

<210> 65

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 65

<210> 66

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 66

<210> 67

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 67

<210> 68

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 68

<210> 69

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 69

<210> 70

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 70

<210> 71

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 71

<210> 72

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 72

<210> 73

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 73

<210> 74

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 74

<210> 75

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 75

<210> 76

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 76

<210> 77

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 77

<210> 78

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 78

<210> 79

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 79

<210> 80

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 80

<210> 81

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 81

<210> 82

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 82

<210> 83

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 83

<210> 84

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 84

<210> 85

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 85

<210> 86

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 86

<210> 87

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 87

<210> 88

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 88

<210> 89

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 89

<210> 90

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 90

<210> 91

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 91

<210> 92

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 92

<210> 93

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 93

<210> 94

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 94

<210> 95

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 95

<210> 96

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 96

<210> 97

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 97

<210> 98

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 98

<210> 99

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 99

<210> 100

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 100

<210> 101

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 101

<210> 102

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 102

<210> 103

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 103

<210> 104

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 104

<210> 105

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 105

<210> 106

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 106

<210> 107

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 107

<210> 108

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 108

<210> 109

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 109

<210> 110

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 110

<210> 111

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 111

<210> 112

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 112

<210> 113

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 113

<210> 114

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 114

<210> 115

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 115

<210> 116

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 116

<210> 117

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 117

<210> 118

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 118

<210> 119

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 119

<210> 120

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 120

<210> 121

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 121

<210> 122

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 122

<210> 123

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 123

<210> 124

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 124

<210> 125

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 125

<210> 126

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 126

<210> 127

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 127

<210> 128

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 128

<210> 129

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 129

<210> 130

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 130

<210> 131

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 131

<210> 132

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 132

<210> 133

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 133

<210> 134

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 134

<210> 135

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 135

<210> 136

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 136

<210> 137

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 137

<210> 138

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 138

<210> 139

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 139

<210> 140

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 140

<210> 141

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 141

<210> 142

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 142

<210> 143

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 143

<210> 144

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 144

<210> 145

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 145

<210> 146

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 146

<210> 147

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 147

<210> 148

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 148

<210> 149

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 149

<210> 150

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 150

<210> 151

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 151

<210> 152

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 152

<210> 153

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 153

<210> 154

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 154

<210> 155

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 155

<210> 156

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 156

<210> 157

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 157

<210> 158

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 158

<210> 159

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 159

<210> 160

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 160

<210> 161

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 161

<210> 162

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 162

<210> 163

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 163

<210> 164

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 164

<210> 165

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 165

<210> 166

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 166

<210> 167

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 167

<210> 168

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 168

<210> 169

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 169

<210> 170

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 170

<210> 171

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 171

<210> 172

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 172

<210> 173

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 173

<210> 174

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 174

<210> 175

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 175

<210> 176

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 176

<210> 177

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 177

<210> 178

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 178

<210> 179

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 179

<210> 180

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 180

<210> 181

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 181

<210> 182

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 182

<210> 183

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 183

<210> 184

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 184

<210> 185

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 185

<210> 186

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 186

<210> 187

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 187

<210> 188

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 188

<210> 189

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 189

<210> 190

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 190

<210> 191

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 191

<210> 192

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 192

<210> 193

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 193

<210> 194

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 194

<210> 195

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 195

<210> 196

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 196

<210> 197

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 197

<210> 198

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 198

<210> 199

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 199

<210> 200

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 200

<210> 201

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 201

<210> 202

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 202

<210> 203

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 203

<210> 204

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 204

<210> 205

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 205

<210> 206

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 206

<210> 207

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 207

<210> 208

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 208

<210> 209

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 209

<210> 210

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 210

<210> 211

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 211

<210> 212

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 212

<210> 213

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 213

<210> 214

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 214

<210> 215

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 215

<210> 216

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 216

<210> 217

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 217

<210> 218

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 218

<210> 219

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 219

<210> 220

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 220

<210> 221

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 221

<210> 222

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 222

<210> 223

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 223

<210> 224

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 224

<210> 225

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 225

<210> 226

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 226

<210> 227

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 227

<210> 228

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 228

<210> 229

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 229

<210> 230

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 230

<210> 231

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 231

<210> 232

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 232

<210> 233

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 233

<210> 234

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 234

<210> 235

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 235

<210> 236

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 236

<210> 237

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 237

<210> 238

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 238

<210> 239

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 239

<210> 240

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 240

<210> 241

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 241

<210> 242

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 242

<210> 243

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 243

<210> 244

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 244

<210> 245

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 245

<210> 246

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 246

<210> 247

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 247

<210> 248

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 248

<210> 249

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 249

<210> 250

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 250

<210> 251

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 251

<210> 252

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 252

<210> 253

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 253

<210> 254

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 254

<210> 255

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 255

<210> 256

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 256

<210> 257

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 257

<210> 258

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 258

<210> 259

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 259

<210> 260

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 260

<210> 261

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 261

<210> 262

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 262

<210> 263

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 263

<210> 264

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 264

<210> 265

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 265

<210> 266

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 266

<210> 267

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 267

<210> 268

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 268

<210> 269

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 269

<210> 270

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 270

<210> 271

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 271

<210> 272

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 272

<210> 273

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 273

<210> 274

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 274

<210> 275

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 275

<210> 276

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 276

<210> 277

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 277

<210> 278

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 278

<210> 279

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 279

<210> 280

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 280

<210> 281

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 281

<210> 282

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 282

<210> 283

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 283

<210> 284

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 284

<210> 285

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 285

<210> 286

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 286

<210> 287

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 287

<210> 288

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 288

<210> 289

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 289

<210> 290

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 290

<210> 291

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 291

<210> 292

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 292

<210> 293

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 293

<210> 294

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 294

<210> 295

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 295

<210> 296

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 296

<210> 297

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 297

<210> 298

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 298

<210> 299

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 299

<210> 300

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 300

<210> 301

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 301

<210> 302

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 302

<210> 303

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 303

<210> 304

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 304

<210> 305

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 305

<210> 306

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 306

<210> 307

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 307

<210> 308

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 308

<210> 309

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 309

<210> 310

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 310

<210> 311

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 311

<210> 312

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 312

<210> 313

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 313

<210> 314

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 314

<210> 315

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 315

<210> 316

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 316

<210> 317

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 317

<210> 318

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 318

<210> 319

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 319

<210> 320

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 320

<210> 321

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 321

<210> 322

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 322

<210> 323

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 323

<210> 324

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 324

<210> 325

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 325

<210> 326

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 326

<210> 327

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 327

<210> 328

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 328

<210> 329

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 329

<210> 330

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 330

<210> 331

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 331

<210> 332

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 332

<210> 333

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 333

<210> 334

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 334

<210> 335

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 335

<210> 336

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 336

<210> 337

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 337

<210> 338

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 338

<210> 339

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 339

<210> 340

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 340

<210> 341

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 341

<210> 342

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 342

<210> 343

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 343

<210> 344

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 344

<210> 345

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 345

<210> 346

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 346

<210> 347

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 347

<210> 348

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 348

<210> 349

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 349

<210> 350

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 350

<210> 351

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 351

<210> 352

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 352

<210> 353

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 353

<210> 354

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 354

<210> 355

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 355

<210> 356

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 356

<210> 357

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 357

<210> 358

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 358

<210> 359

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 359

<210> 360

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 360

<210> 361

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 361

<210> 362

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 362

<210> 363

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 363

<210> 364

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 364

<210> 365

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 365

<210> 366

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 366

<210> 367

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 367

<210> 368

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 368

<210> 369

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 369

<210> 370

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 370

<210> 371

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 371

<210> 372

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 372

<210> 373

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 373

<210> 374

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 374

<210> 375

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 375

<210> 376

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 376

<210> 377

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 377

<210> 378

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 378

<210> 379

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 379

<210> 380

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 380

<210> 381

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 381

<210> 382

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 382

<210> 383

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 383

<210> 384

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 384

<210> 385

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 385

<210> 386

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 386

<210> 387

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 387

<210> 388

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 388

<210> 389

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 389

<210> 390

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 390

<210> 391

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 391

<210> 392

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 392

<210> 393

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 393

<210> 394

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 394

<210> 395

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 395

<210> 396

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 396

<210> 397

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 397

<210> 398

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 398

<210> 399

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 399

<210> 400

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 400

<210> 401

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 401

<210> 402

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 402

<210> 403

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 403

<210> 404

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 404

<210> 405

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 405

<210> 406

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 406

<210> 407

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 407

<210> 408

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 408

<210> 409

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 409

<210> 410

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 410

<210> 411

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 411

<210> 412

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 412

<210> 413

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 413

<210> 414

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 414

<210> 415

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 415

<210> 416

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 416

<210> 417

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 417

<210> 418

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 418

<210> 419

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 419

<210> 420

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 420

<210> 421

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 421

<210> 422

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 422

<210> 423

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 423

<210> 424

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 424

<210> 425

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 425

<210> 426

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 426

<210> 427

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 427

<210> 428

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 428

<210> 429

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 429

<210> 430

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 430

<210> 431

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 431

<210> 432

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 432

<210> 433

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 433

<210> 434

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 434

<210> 435

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 435

<210> 436

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 436

<210> 437

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 437

<210> 438

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 438

<210> 439

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 439

<210> 440

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 440

<210> 441

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 441

<210> 442

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 442

<210> 443

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 443

<210> 444

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 444

<210> 445

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 445

<210> 446

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 446

<210> 447

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 447

<210> 448

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 448

<210> 449

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 449

<210> 450

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 450

<210> 451

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 451

<210> 452

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 452

<210> 453

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 453

<210> 454

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 454

<210> 455

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 455

<210> 456

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 456

<210> 457

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 457

<210> 458

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 458

<210> 459

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 459

<210> 460

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 460

<210> 461

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 461

<210> 462

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 462

<210> 463

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 463

<210> 464

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 464

<210> 465

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 465

<210> 466

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 466

<210> 467

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 467

<210> 468

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 468

<210> 469

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 469

<210> 470

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 470

<210> 471

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 471

<210> 472

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 472

<210> 473

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 473

<210> 474

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 474

<210> 475

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 475

<210> 476

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 476

<210> 477

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 477

<210> 478

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 478

<210> 479

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 479

<210> 480

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 480

<210> 481

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 481

<210> 482

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 482

<210> 483

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 483

<210> 484

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 484

<210> 485

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 485

<210> 486

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 486

<210> 487

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 487

<210> 488

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 488

<210> 489

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 489

<210> 490

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 490

<210> 491

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 491

<210> 492

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 492

<210> 493

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 493

<210> 494

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 494

<210> 495

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 495

<210> 496

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 496

<210> 497

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 497

<210> 498

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 498

<210> 499

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 499

<210> 500

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 500

<210> 501

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 501

<210> 502

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 502

<210> 503

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 503

<210> 504

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 504

<210> 505

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 505

<210> 506

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 506

<210> 507

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 507

<210> 508

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 508

<210> 509

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 509

<210> 510

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 510

<210> 511

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 511

<210> 512

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 512

<210> 513

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 513

<210> 514

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 514

<210> 515

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 515

<210> 516

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 516

<210> 517

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 517

<210> 518

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 518

<210> 519

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 519

<210> 520

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 520

<210> 521

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 521

<210> 522

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 522

<210> 523

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 523

<210> 524

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 524

<210> 525

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 525

<210> 526

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 526

<210> 527

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 527

<210> 528

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 528

<210> 529

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 529

<210> 530

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 530

<210> 531

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 531

<210> 532

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 532

<210> 533

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 533

<210> 534

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 534

<210> 535

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 535

<210> 536

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 536

<210> 537

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 537

<210> 538

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 538

<210> 539

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 539

<210> 540

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 540

<210> 541

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 541

<210> 542

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 542

<210> 543

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 543

<210> 544

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 544

<210> 545

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 545

<210> 546

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 546

<210> 547

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 547

<210> 548

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 548

<210> 549

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 549

<210> 550

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 550

<210> 551

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 551

<210> 552

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 552

<210> 553

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 553

<210> 554

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 554

<210> 555

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 555

<210> 556

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 556

<210> 557

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 557

<210> 558

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 558

<210> 559

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 559

<210> 560

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 560

<210> 561

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 561

<210> 562

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 562

<210> 563

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 563

<210> 564

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 564

<210> 565

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 565

<210> 566

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 566

<210> 567

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 567

<210> 568

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 568

<210> 569

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 569

<210> 570

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 570

<210> 571

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 571

<210> 572

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 572

<210> 573

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 573

<210> 574

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 574

<210> 575

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 575

<210> 576

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 576

<210> 577

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 577

<210> 578

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 578

<210> 579

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 579

<210> 580

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 580

<210> 581

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 581

<210> 582

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 582

<210> 583

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 583

<210> 584

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 584

<210> 585

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 585

<210> 586

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 586

<210> 587

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 587

<210> 588

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 588

<210> 589

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 589

<210> 590

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 590

<210> 591

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 591

<210> 592

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 592

<210> 593

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 593

<210> 594

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 594

<210> 595

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 595

<210> 596

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 596

<210> 597

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 597

<210> 598

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 598

<210> 599

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 599

<210> 600

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 600

<210> 601

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 601

<210> 602

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 602

<210> 603

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 603

<210> 604

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 604

<210> 605

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 605

<210> 606

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 606

<210> 607

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 607

<210> 608

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 608

<210> 609

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 609

<210> 610

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 610

<210> 611

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 611

<210> 612

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 612

<210> 613

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 613

<210> 614

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 614

<210> 615

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 615

<210> 616

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 616

<210> 617

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 617

<210> 618

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 618

<210> 619

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 619

<210> 620

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 620

<210> 621

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 621

<210> 622

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 622

<210> 623

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 623

<210> 624

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 624

<210> 625

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 625

<210> 626

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 626

<210> 627

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 627

<210> 628

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 628

<210> 629

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 629

<210> 630

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 630

<210> 631

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 631

<210> 632

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 632

<210> 633

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 633

<210> 634

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 634

<210> 635

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 635

<210> 636

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 636

<210> 637

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 637

<210> 638

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 638

<210> 639

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 639

<210> 640

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 640

<210> 641

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 641

<210> 642

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 642

<210> 643

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 643

<210> 644

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 644

<210> 645

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 645

<210> 646

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 646

<210> 647

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 647

<210> 648

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 648

<210> 649

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 649

<210> 650

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 650

<210> 651

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 651

<210> 652

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 652

<210> 653

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 653

<210> 654

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 654

<210> 655

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 655

<210> 656

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 656

<210> 657

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 657

<210> 658

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 658

<210> 659

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 659

<210> 660

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 660

<210> 661

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 661

<210> 662

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 662

<210> 663

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 663

<210> 664

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 664

<210> 665

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 665

<210> 666

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 666

<210> 667

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 667

<210> 668

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 668

<210> 669

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 669

<210> 670

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 670

<210> 671

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 671

<210> 672

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 672

<210> 673

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 673

<210> 674

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 674

<210> 675

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 675

<210> 676

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 676

<210> 677

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 677

<210> 678

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 678

<210> 679

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 679

<210> 680

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 680

<210> 681

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 681

<210> 682

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 682

<210> 683

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 683

<210> 684

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 684

<210> 685

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 685

<210> 686

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 686

<210> 687

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 687

<210> 688

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 688

<210> 689

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 689

<210> 690

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 690

<210> 691

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 691

<210> 692

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 692

<210> 693

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 693

<210> 694

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 694

<210> 695

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 695

<210> 696

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 696

<210> 697

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 697

<210> 698

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 698

<210> 699

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 699

<210> 700

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 700

<210> 701

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 701

<210> 702

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 702

<210> 703

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 703

<210> 704

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 704

<210> 705

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 705

<210> 706

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 706

<210> 707

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 707

<210> 708

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 708

<210> 709

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 709

<210> 710

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 710

<210> 711

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 711

<210> 712

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 712

<210> 713

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 713

<210> 714

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 714

<210> 715

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 715

<210> 716

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 716

<210> 717

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 717

<210> 718

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 718

<210> 719

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 719

<210> 720

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 720

<210> 721

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 721

<210> 722

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 722

<210> 723

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 723

<210> 724

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 724

<210> 725

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 725

<210> 726

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 726

<210> 727

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 727

<210> 728

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 728

<210> 729

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 729

<210> 730

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 730

<210> 731

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 731

<210> 732

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 732

<210> 733

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 733

<210> 734

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 734

<210> 735

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 735

<210> 736

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 736

<210> 737

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 737

<210> 738

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 738

<210> 739

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 739

<210> 740

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 740

<210> 741

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 741

<210> 742

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 742

<210> 743

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 743

<210> 744

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 744

<210> 745

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 745

<210> 746

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 746

<210> 747

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 747

<210> 748

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 748

<210> 749

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 749

<210> 750

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 750

<210> 751

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 751

<210> 752

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 752

<210> 753

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 753

<210> 754

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 754

<210> 755

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 755

<210> 756

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 756

<210> 757

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 757

<210> 758

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 758

<210> 759

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 759

<210> 760

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 760

<210> 761

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 761

<210> 762

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 762

<210> 763

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 763

<210> 764

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 764

<210> 765

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 765

<210> 766

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 766

<210> 767

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 767

<210> 768

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<222> Description of the artificial sequence: synthetic oligonucleotide

<400> 768

<210> 769

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 769

<210> 770

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 770

<210> 771

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 771

<210> 772

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<222> Description of the artificial sequence: synthetic oligonucleotide

<400> 772

<210> 773

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 773

<210> 774

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 774

<210> 775

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 775

<210> 776

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 776

<210> 777

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 777

<210> 778

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 778

<210> 779

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 779

<210> 780

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 780

<210> 781

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 781

<210> 782

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 782

<210> 783

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 783

<210> 784

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 784

<210> 785

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 785

<210> 786

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 786

<210> 787

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 787

<210> 788

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 788

<210> 789

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 789

<210> 790

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 790

<210> 791

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 791

<210> 792

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 792

<210> 793

<211> 35

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 793

<210> 794

<211> 35

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 794

<210> 795

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 795

<210> 796

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 796

<210> 797

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 797

<210> 798

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 798

<210> 799

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 799

<210> 800

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 800

<210> 801

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 801

<210> 802

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 802

<210> 803

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 803

<210> 804

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 804

<210> 805

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 805

<210> 806

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 806

<210> 807

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 807

<210> 808

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 808

<210> 809

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 809

<210> 810

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 810

<210> 811

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 811

<210> 812

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 812

<210> 813

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 813

<210> 814

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 814

<210> 815

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 815

<210> 816

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 816

<210> 817

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 817

<210> 818

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 818

<210> 819

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 819

<210> 820

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 820

<210> 821

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 821

<210> 822

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 822

<210> 823

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 823

<210> 824

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 824

<210> 825

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 825

<210> 826

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 826

<210> 827

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 827

<210> 828

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 828

<210> 829

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 829

<210> 830

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 830

<210> 831

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 831

<210> 832

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 832

<210> 833

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 833

<210> 834

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 834

<210> 835

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 835

<210> 836

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 836

<210> 837

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 837

<210> 838

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 838

<210> 839

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 839

<210> 840

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 840

<210> 841

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 841

<210> 842

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 842

<210> 843

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 843

<210> 844

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 844

<210> 845

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 845

<210> 846

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 846

<210> 847

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 847

<210> 848

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 848

<210> 849

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 849

<210> 850

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 850

<210> 851

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 851

<210> 852

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 852

<210> 853

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 853

<210> 854

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 854

<210> 855

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 855

<210> 856

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 856

<210> 857

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 857

<210> 858

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 858

<210> 859

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 859

<210> 860

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 860

<210> 861

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 861

<210> 862

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 862

<210> 863

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 863

<210> 864

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 864

<210> 865

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 865

<210> 866

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 866

<210> 867

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 867

<210> 868

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 868

<210> 869

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 869

<210> 870

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 870

<210> 871

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 871

<210> 872

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 872

<210> 873

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 873

<210> 874

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 874

<210> 875

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 875

<210> 876

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 876

<210> 877

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 877

<210> 878

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 878

<210> 879

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 879

<210> 880

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 880

<210> 881

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 881

<210> 882

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 882

<210> 883

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 883

<210> 884

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 884

<210> 885

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 885

<210> 886

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 886

<210> 887

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 887

<210> 888

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 888

<210> 889

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 889

<210> 890

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 890

<210> 891

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 891

<210> 892

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 892

<210> 893

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 893

<210> 894

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 894

<210> 895

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 895

<210> 896

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 896

<210> 897

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DA/RNA molecules: synthetic oligonucleotides

<400> 897

<210> 898

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 898

<210> 899

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 899

<210> 900

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 900

<210> 901

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 901

<210> 902

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 902

<210> 903

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 903

<210> 904

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 904

<210> 905

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 905

<210> 906

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 906

<210> 907

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 907

<210> 908

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 908

<210> 909

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 909

<210> 910

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 910

<210> 911

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 911

<210> 912

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 912

<210> 913

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 913

<210> 914

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 914

<210> 915

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 915

<210> 916

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 916

<210> 917

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 917

<210> 918

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 918

<210> 919

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 919

<210> 920

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 920

<210> 921

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 921

<210> 922

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 922

<210> 923

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 923

<210> 924

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 924

<210> 925

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 925

<210> 926

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 926

<210> 927

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 927

<210> 928

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 928

<210> 929

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 929

<210> 930

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 930

<210> 931

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 931

<210> 932

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 932

<210> 933

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 933

<210> 934

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 934

<210> 935

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 935

<210> 936

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 936

<210> 937

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 937

<210> 938

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 938

<210> 939

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 939

<210> 940

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 940

<210> 941

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 941

<210> 942

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 942

<210> 943

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 943

<210> 944

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 944

<210> 945

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 945

<210> 946

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 946

<210> 947

<211> 35

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 947

<210> 948

<211> 35

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 948

<210> 949

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 949

<210> 950

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 950

<210> 951

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 951

<210> 952

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 952

<210> 953

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 953

<210> 954

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 954

<210> 955

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 955

<210> 956

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 956

<210> 957

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 957

<210> 958

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 958

<210> 959

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 959

<210> 960

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 960

<210> 961

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 961

<210> 962

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 962

<210> 963

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 963

<210> 964

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 964

<210> 965

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 965

<210> 966

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 966

<210> 967

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 967

<210> 968

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 968

<210> 969

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 969

<210> 970

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 970

<210> 971

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 971

<210> 972

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 972

<210> 973

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 973

<210> 974

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 974

<210> 975

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 975

<210> 976

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 976

<210> 977

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 977

<210> 978

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 978

<210> 979

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 979

<210> 980

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 980

<210> 981

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 981

<210> 982

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 982

<210> 983

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 983

<210> 984

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 984

<210> 985

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 985

<210> 986

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 986

<210> 987

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 987

<210> 988

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 988

<210> 989

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 989

<210> 990

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 990

<210> 991

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 991

<210> 992

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 992

<210> 993

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 993

<210> 994

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 994

<210> 995

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 995

<210> 996

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 996

<210> 997

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 997

<210> 998

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 998

<210> 999

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 999

<210> 1000

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1000

<210> 1001

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1001

<210> 1002

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1002

<210> 1003

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1003

<210> 1004

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1004

<210> 1005

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1005

<210> 1006

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1006

<210> 1007

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1007

<210> 1008

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1008

<210> 1009

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1009

<210> 1010

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1010

<210> 1011

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1011

<210> 1012

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1012

<210> 1013

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1013

<210> 1014

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1014

<210> 1015

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1015

<210> 1016

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1016

<210> 1017

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1017

<210> 1018

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1018

<210> 1019

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1019

<210> 1020

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1020

<210> 1021

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1021

<210> 1022

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1022

<210> 1023

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1023

<210> 1024

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1024

<210> 1025

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1025

<210> 1026

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1026

<210> 1027

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1027

<210> 1028

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1028

<210> 1029

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1029

<210> 1030

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1030

<210> 1031

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1031

<210> 1032

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1032

<210> 1033

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1033

<210> 1034

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1034

<210> 1035

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1035

<210> 1036

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1036

<210> 1037

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1037

<210> 1038

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1038

<210> 1039

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1039

<210> 1040

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1040

<210> 1041

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1041

<210> 1042

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1042

<210> 1043

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1043

<210> 1044

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1044

<210> 1045

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1045

<210> 1046

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1046

<210> 1047

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1047

<210> 1048

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1048

<210> 1049

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1049

<210> 1050

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1050

<210> 1051

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1051

<210> 1052

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1052

<210> 1053

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1053

<210> 1054

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1054

<210> 1055

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1055

<210> 1056

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1056

<210> 1057

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1057

<210> 1058

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1058

<210> 1059

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1059

<210> 1060

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1060

<210> 1061

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1061

<210> 1062

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1062

<210> 1063

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1063

<210> 1064

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<222> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1064

<210> 1065

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1065

<210> 1066

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1066

<210> 1067

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1067

<210> 1068

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1068

<210> 1069

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1069

<210> 1070

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1070

<210> 1071

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1071

<210> 1072

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1072

<210> 1073

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1073

<210> 1074

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1074

<210> 1075

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1075

<210> 1076

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1076

<210> 1077

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1077

<210> 1078

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1078

<210> 1079

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1079

<210> 1080

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1080

<210> 1081

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1081

<210> 1082

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1082

<210> 1083

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1083

<210> 1084

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1084

<210> 1085

<211> 32

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1085

<210> 1086

<211> 32

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1086

<210> 1087

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1087

<210> 1088

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1088

<210> 1089

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1089

<210> 1090

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1090

<210> 1091

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1091

<210> 1092

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1092

<210> 1093

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1093

<210> 1094

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1094

<210> 1095

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1095

<210> 1096

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1096

<210> 1097

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1097

<210> 1098

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1098

<210> 1099

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1099

<210> 1100

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1100

<210> 1101

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1101

<210> 1102

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1102

<210> 1103

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1103

<210> 1104

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1104

<210> 1105

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1105

<210> 1106

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1106

<210> 1107

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1107

<210> 1108

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1108

<210> 1109

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1109

<210> 1110

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1110

<210> 1111

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1111

<210> 1112

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1112

<210> 1113

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1113

<210> 1114

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1114

<210> 1115

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1115

<210> 1116

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1116

<210> 1117

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1117

<210> 1118

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1118

<210> 1119

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1119

<210> 1120

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1120

<210> 1121

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1121

<210> 1122

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1122

<210> 1123

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1123

<210> 1124

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1124

<210> 1125

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1125

<210> 1126

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1126

<210> 1127

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1127

<210> 1128

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1128

<210> 1129

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1129

<210> 1130

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1130

<210> 1131

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<222> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1131

<210> 1132

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1132

<210> 1133

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1133

<210> 1134

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1134

<210> 1135

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1135

<210> 1136

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1136

<210> 1137

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1137

<210> 1138

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1138

<210> 1139

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1139

<210> 1140

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1140

<210> 1141

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1141

<210> 1142

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1142

<210> 1143

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1143

<210> 1144

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1144

<210> 1145

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1145

<210> 1146

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1146

<210> 1147

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1147

<210> 1148

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1148

<210> 1149

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1149

<210> 1150

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1150

<210> 1151

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1151

<210> 1152

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1152

<210> 1153

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1153

<210> 1154

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1154

<210> 1155

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1155

<210> 1156

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1156

<210> 1157

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1157

<210> 1158

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1158

<210> 1159

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1159

<210> 1160

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1160

<210> 1161

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1161

<210> 1162

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1162

<210> 1163

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1163

<210> 1164

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1164

<210> 1165

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1165

<210> 1166

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1166

<210> 1167

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1167

<210> 1168

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1168

<210> 1169

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1169

<210> 1170

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1170

<210> 1171

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1171

<210> 1172

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1172

<210> 1173

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1173

<210> 1174

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1174

<210> 1175

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1175

<210> 1176

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1176

<210> 1177

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1177

<210> 1178

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1178

<210> 1179

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1179

<210> 1180

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1180

<210> 1181

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1181

<210> 1182

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1182

<210> 1183

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1183

<210> 1184

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1184

<210> 1185

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1185

<210> 1186

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1186

<210> 1187

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1187

<210> 1188

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1188

<210> 1189

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1189

<210> 1190

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1190

<210> 1191

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1191

<210> 1192

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1192

<210> 1193

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1193

<210> 1194

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1194

<210> 1195

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<222> Description of the artificial sequence: synthetic oligonucleotide

<400> 1195

<210> 1196

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1196

<210> 1197

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1197

<210> 1198

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1198

<210> 1199

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1199

<210> 1200

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1200

<210> 1201

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1201

<210> 1202

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1202

<210> 1203

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1203

<210> 1204

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1204

<210> 1205

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1205

<210> 1206

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1206

<210> 1207

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1207

<210> 1208

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1208

<210> 1209

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1209

<210> 1210

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1210

<210> 1211

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1211

<210> 1212

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1212

<210> 1213

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1213

<210> 1214

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1214

<210> 1215

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1215

<210> 1216

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1216

<210> 1217

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1217

<210> 1218

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1218

<210> 1219

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1219

<210> 1220

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1220

<210> 1221

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1221

<210> 1222

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1222

<210> 1223

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1223

<210> 1224

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1224

<210> 1225

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1225

<210> 1226

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1226

<210> 1227

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1227

<210> 1228

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1228

<210> 1229

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1229

<210> 1230

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1230

<210> 1231

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1231

<210> 1232

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1232

<210> 1233

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1233

<210> 1234

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1234

<210> 1235

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1235

<210> 1236

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1236

<210> 1237

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1237

<210> 1238

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1238

<210> 1239

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1239

<210> 1240

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1240

<210> 1241

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1241

<210> 1242

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1242

<210> 1243

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1243

<210> 1244

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1244

<210> 1245

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1245

<210> 1246

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1246

<210> 1247

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1247

<210> 1248

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1248

<210> 1249

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1249

<210> 1250

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1250

<210> 1251

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1251

<210> 1252

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1252

<210> 1253

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1253

<210> 1254

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1254

<210> 1255

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1255

<210> 1256

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1256

<210> 1257

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1257

<210> 1258

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1258

<210> 1259

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1259

<210> 1260

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1260

<210> 1261

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1261

<210> 1262

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1262

<210> 1263

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1263

<210> 1264

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1264

<210> 1265

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1265

<210> 1266

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1266

<210> 1267

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1267

<210> 1268

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1268

<210> 1269

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1269

<210> 1270

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1270

<210> 1271

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1271

<210> 1272

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1272

<210> 1273

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1273

<210> 1274

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1274

<210> 1275

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1275

<210> 1276

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1276

<210> 1277

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1277

<210> 1278

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1278

<210> 1279

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1279

<210> 1280

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1280

<210> 1281

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1281

<210> 1282

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1282

<210> 1283

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1283

<210> 1284

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1284

<210> 1285

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1285

<210> 1286

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1286

<210> 1287

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1287

<210> 1288

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1288

<210> 1289

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1289

<210> 1290

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1290

<210> 1291

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1291

<210> 1292

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1292

<210> 1293

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1293

<210> 1294

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1294

<210> 1295

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1295

<210> 1296

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1296

<210> 1297

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1297

<210> 1298

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1298

<210> 1299

<211> 35

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1299

<210> 1300

<211> 35

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1300

<210> 1301

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1301

<210> 1302

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1302

<210> 1303

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1303

<210> 1304

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1304

<210> 1305

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1305

<210> 1306

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1306

<210> 1307

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1307

<210> 1308

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1308

<210> 1309

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1309

<210> 1310

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1310

<210> 1311

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1311

<210> 1312

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1312

<210> 1313

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1313

<210> 1314

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1314

<210> 1315

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1315

<210> 1316

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1316

<210> 1317

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1317

<210> 1318

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1318

<210> 1319

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1319

<210> 1320

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1320

<210> 1321

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1321

<210> 1322

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1322

<210> 1323

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1323

<210> 1324

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1324

<210> 1325

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1325

<210> 1326

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1326

<210> 1327

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1327

<210> 1328

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1328

<210> 1329

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1329

<210> 1330

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1330

<210> 1331

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1331

<210> 1332

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1332

<210> 1333

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1333

<210> 1334

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1334

<210> 1335

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1335

<210> 1336

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1336

<210> 1337

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1337

<210> 1338

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1338

<210> 1339

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1339

<210> 1340

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1340

<210> 1341

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1341

<210> 1342

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1342

<210> 1343

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1343

<210> 1344

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1344

<210> 1345

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1345

<210> 1346

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1346

<210> 1347

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1347

<210> 1348

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1348

<210> 1349

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1349

<210> 1350

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1350

<210> 1351

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1351

<210> 1352

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1352

<210> 1353

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1353

<210> 1354

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1354

<210> 1355

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1355

<210> 1356

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1356

<210> 1357

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1357

<210> 1358

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1358

<210> 1359

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1359

<210> 1360

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1360

<210> 1361

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1361

<210> 1362

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1362

<210> 1363

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1363

<210> 1364

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1364

<210> 1365

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1365

<210> 1366

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1366

<210> 1367

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1367

<210> 1368

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1368

<210> 1369

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1369

<210> 1370

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1370

<210> 1371

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1371

<210> 1372

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1372

<210> 1373

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1373

<210> 1374

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1374

<210> 1375

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1375

<210> 1376

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1376

<210> 1377

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1377

<210> 1378

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1378

<210> 1379

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1379

<210> 1380

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1380

<210> 1381

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1381

<210> 1382

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1382

<210> 1383

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1383

<210> 1384

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1384

<210> 1385

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1385

<210> 1386

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1386

<210> 1387

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1387

<210> 1388

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1388

<210> 1389

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1389

<210> 1390

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1390

<210> 1391

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1391

<210> 1392

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1392

<210> 1393

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1393

<210> 1394

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1394

<210> 1395

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1395

<210> 1396

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1396

<210> 1397

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1397

<210> 1398

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1398

<210> 1399

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1399

<210> 1400

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1400

<210> 1401

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1401

<210> 1402

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1402

<210> 1403

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNARNA molecules: synthetic oligonucleotides

<400> 1403

<210> 1404

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1404

<210> 1405

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1405

<210> 1406

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1406

<210> 1407

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1407

<210> 1408

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1408

<210> 1409

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1409

<210> 1410

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1410

<210> 1411

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1411

<210> 1412

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1412

<210> 1413

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1413

<210> 1414

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1414

<210> 1415

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1415

<210> 1416

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1416

<210> 1417

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1417

<210> 1418

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1418

<210> 1419

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1419

<210> 1420

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1420

<210> 1421

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1421

<210> 1422

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1422

<210> 1423

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1423

<210> 1424

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1424

<210> 1425

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1425

<210> 1426

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1426

<210> 1427

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1427

<210> 1428

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1428

<210> 1429

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1429

<210> 1430

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1430

<210> 1431

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1431

<210> 1432

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1432

<210> 1433

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1433

<210> 1434

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1434

<210> 1435

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1435

<210> 1436

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1436

<210> 1437

<211> 32

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1437

<210> 1438

<211> 32

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1438

<210> 1439

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1439

<210> 1440

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1440

<210> 1441

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1441

<210> 1442

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1442

<210> 1443

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1443

<210> 1444

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1444

<210> 1445

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1445

<210> 1446

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1446

<210> 1447

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1447

<210> 1448

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1448

<210> 1449

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1449

<210> 1450

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1450

<210> 1451

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1451

<210> 1452

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1452

<210> 1453

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1453

<210> 1454

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1454

<210> 1455

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1455

<210> 1456

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1456

<210> 1457

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1457

<210> 1458

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1458

<210> 1459

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1459

<210> 1460

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1460

<210> 1461

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1461

<210> 1462

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1462

<210> 1463

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1463

<210> 1464

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1464

<210> 1465

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1465

<210> 1466

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1466

<210> 1467

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1467

<210> 1468

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1468

<210> 1469

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1469

<210> 1470

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1470

<210> 1471

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1471

<210> 1472

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1472

<210> 1473

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1473

<210> 1474

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1474

<210> 1475

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1475

<210> 1476

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1476

<210> 1477

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1477

<210> 1478

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1478

<210> 1479

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1479

<210> 1480

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1480

<210> 1481

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1481

<210> 1482

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1482

<210> 1483

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1483

<210> 1484

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1484

<210> 1485

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1485

<210> 1486

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1486

<210> 1487

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1487

<210> 1488

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1488

<210> 1489

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<222> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1489

<210> 1490

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1490

<210> 1491

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1491

<210> 1492

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1492

<210> 1493

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1493

<210> 1494

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1494

<210> 1495

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1495

<210> 1496

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1496

<210> 1497

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1497

<210> 1498

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1498

<210> 1499

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1499

<210> 1500

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1500

<210> 1501

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1501

<210> 1502

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1502

<210> 1503

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1503

<210> 1504

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1504

<210> 1505

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1505

<210> 1506

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1506

<210> 1507

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1507

<210> 1508

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1508

<210> 1509

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthesis of oligonucleoside

<400> 1509

<210> 1510

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1510

<210> 1511

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1511

<210> 1512

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1512

<210> 1513

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1513

<210> 1514

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1514

<210> 1515

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1515

<210> 1516

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1516

<210> 1517

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1517

<210> 1518

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1518

<210> 1519

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1519

<210> 1520

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1520

<210> 1521

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1521

<210> 1522

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1522

<210> 1523

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1523

<210> 1524

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1524

<210> 1525

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1525

<210> 1526

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1526

<210> 1527

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1527

<210> 1528

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNARNA molecules: synthetic oligonucleotides

<400> 1528

<210> 1529

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1529

<210> 1530

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1530

<210> 1531

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1531

<210> 1532

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1532

<210> 1533

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1533

<210> 1534

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1534

<210> 1535

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1535

<210> 1536

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1536

<210> 1537

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1537

<210> 1538

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1538

<210> 1539

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1539

<210> 1540

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1540

<210> 1541

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1541

<210> 1542

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1542

<210> 1543

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1543

<210> 1544

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1544

<210> 1545

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1545

<210> 1546

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<220>

<223> Description of combined DNA/RNA molecules: synthetic oligonucleotides

<400> 1546

<210> 1547

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1547

<210> 1548

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1548

<210> 1549

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1549

<210> 1550

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1550

<210> 1551

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1551

<210> 1552

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Description of Artificial Sequence: Synthetic 6×His Label

<400> 1552

<210> 1553

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: synthetic oligonucleotide

<400> 1553

Claims (39)

A palm-controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type, characterized by: 1) a common base sequence and length; 2) a common backbone linkage mode; 3) a common backbone-to-palm central mode; the composition is palm-controlled because of the composition relative to a substantially racemic formulation of oligonucleotides having the same base sequence and length An oligonucleotide enriched in the particular oligonucleotide type, wherein the oligonucleotide targets a mutant Huntingtin gene and the length is from about 10 to about 50 nucleotides, wherein linkage main chain comprises at least one phosphorothioate backbone and wherein the chiral center R p mode comprises at least one chiral center and at least one chiral center S p pair. A palm-controlled oligonucleotide composition comprising an oligonucleotide having the following definitions: 1) a common base sequence and length; 2) a common backbone linkage pattern; and 3) a common backbone pair In a central mode, the composition is a substantially pure single oligonucleotide preparation because a predetermined amount of oligonucleotides in the composition have the common base sequence and length, the common backbone linkage mode, and the common a backbone-to-palm central mode; or a palm-controlled oligonucleotide composition comprising oligonucleotides having the following definitions: 1) a common base sequence and length; 2) a common backbone linkage mode ;and 3) a common backbone-to-palm central mode, the composition being a substantially pure single oligonucleotide preparation, since at least about 10% of the oligonucleotides in the composition have the common base sequence and length, The common main chain bonding mode and the common main chain versus palm center mode. The composition of claim 1, wherein the oligonucleotides comprise one or more wing regions and a common core region, wherein: each wing region independently has a length of two or more bases, and independently And optionally comprising one or more pairs of palmitic internucleotide linkages; and the core region independently has the length of two or more bases and independently comprises one or more pairs of palmitic nucleotides Bonding. The composition of claim 1, wherein the oligonucleotide of the oligonucleotide type comprises at least one wing region and one core region, wherein: each wing region independently has a length of two or more bases, and Independently and optionally comprising one or more pairs of palmitic internucleotide linkages; the core region independently has the length of two or more bases and independently comprises one or more pairs of palmitic nucleosides An acid linkage; and at least one nucleotide in the mid-wing region is different from at least one nucleotide of the core region, wherein the difference is in one or more of the following: 1) a backbone linkage; 2) a backbone For the palm center mode; 3) sugar modification. The composition of claim 1, wherein the oligonucleotides of the same oligonucleotide type have the same structure. The composition of claim 1, wherein the oligonucleotides comprise one or more natural phosphate linkages ( And one or more phosphorothioate linkages. The composition of claim 1, wherein the oligonucleotides comprise a wing-core-wing structure. The composition of claim 7, wherein the wing comprises a palmitic internucleotide linkage and a natural phosphate linkage ( ). The composition of claim 8, wherein the core comprises one or more phosphorothioate linkages. The composition of claim 6, wherein each of the oligonucleotides comprises a modified sugar moiety. The composition of claim 10, wherein the modified sugar moiety comprises a high affinity sugar modification. The composition of claim 10, wherein the modified sugar moiety has a 2' modification. The composition of claim 10, wherein the modified sugar moiety comprises a bicyclic sugar modification. Item 10 The composition of matter request, wherein the modified sugar moiety comprises of 2 'modifications, wherein the 2' modification is a 2'-OR ^1, wherein R ¹ is the optionally substituted C _1-6 alkyl. The composition of claim 10, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is 2'-MOE. The composition of claim 10, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is 2'-OMe. Item 10 The composition of matter request, wherein the modified sugar moiety comprises of 2 'modifications, wherein the 2' modification is S -cEt. The composition of claim 10, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is FANA. The composition of claim 10, wherein the modified sugar moiety comprises a 2' modification, wherein the 2' modification is an FRNA. The composition of claim 10, wherein the modified sugar moiety has a 5' modification. The composition of claim 1 or 2, wherein the oligonucleotides comprise one or more natural phosphate linkages, and the backbone pair palmar central pattern comprises ( S p) _t ( R p) _n ( S p _m ) wherein t is 2-10, n is 1, and m is 2-10, and at least one of t and m is greater than 5. The composition of claim 6, wherein the oligonucleotides comprise a backbone-to-palm central mode comprising: SSR, RSS, SSRSS, SSRSSR, RSSRSRSRRS, RSSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSSSS, RRRRSSSRSR, RRSSSRSRSR, SRSSSRSSSS , SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSSRSRSRSR, RSSRSRSSRS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR or SSSSRRRRSR. The composition of claim 22, wherein the oligonucleotides target a mutant Huntington gene comprising a single nucleotide polymorphism (SNP). The composition of claim 23, wherein the single nucleotide polymorphism is selected from the group consisting of rs362307, rs7685686, rs362268, rs2530595, rs362331, and rs362306. The composition of claim 1, wherein the oligonucleotides have a structure selected from the group consisting of Table N1A, Table N2A, Table N3A, Table N4A, and Table 8; and WV-1092, WV-2595, and WV-2603. The composition of claim 1, wherein the oligonucleotides are WV-1092. The composition of claim 1, wherein the oligonucleotides are WV-2595. The composition of claim 1, wherein the oligonucleotides are WV-2603. A method for controlling a cleavage of a nucleic acid polymer, the method comprising: a nucleic acid polymer comprising a nucleotide sequence of a target sequence and a palm-controlled oligonucleotide comprising an oligonucleotide of a specific oligonucleotide type Composition contact, the specific Oligonucleotide-type oligonucleotides are characterized by: 1) a common base sequence and a length, wherein the common base sequence is or comprises a sequence complementary to a target sequence present in the nucleic acid polymer; 2) a backbone linkage mode; and 3) a common backbone-to-palm central mode; the composition is palm-controlled because of the substantial elimination relative to the oligonucleotide having the particular base sequence and length For spin preparations, the composition is enriched with oligonucleotides of this particular oligonucleotide type. A method for cleavage of a nucleic acid having a base sequence comprising a target sequence, the method comprising the steps of: (a) aligning a nucleic acid having a base sequence comprising a target sequence with an oligonucleotide comprising a specific oligonucleotide type The palm-controlled oligonucleotide composition is contacted, and the oligonucleotide of the specific oligonucleotide type is characterized by: 1) a common base sequence and a length, wherein the common base sequence is or is contained in the nucleic acid a sequence complementary to the target sequence; 2) a common backbone linkage pattern; and 3) a common backbone-to-palm center mode; the composition is palm-controlled, as opposed to having the particular base sequence and For a substantially racemic formulation of a length oligonucleotide, the composition is enriched in an oligonucleotide of the particular oligonucleotide type, wherein the oligonucleotide targets a mutant Huntington gene and the length Is from about 10 to about 50 nucleotides, wherein the backbone linkages comprise at least one phosphorothioate, and wherein the backbone-to-palm center mode comprises at least one palm-like center in the Rp configuration and at least a palm center in the form of a Sp; and (b The cleavage of the nucleic acid is mediated by a ribonuclease H or RNA interference mechanism. The method of claim 30, wherein the method is performed ex vivo or in vivo. The composition of claim 1 or the method of claim 30, wherein the composition further comprises one or more other components selected from the group consisting of a polynucleotide, a carbonic anhydrase inhibitor, a dye, an intercalator, and an acridine. , cross-linking agent, psoralene, mitomycin C, porphyrin, TPPC4, texaphyrin, sapphyrin, polycyclic aromatic hydrocarbon phenazine, two Hydrophenazine, artificial endonuclease, chelating agent, EDTA, alkylating agent, phosphate, amine, sulfhydryl, PEG, PEG-40K, MPEG, [MPEG] 2, polyamine, alkyl, substituted Alkyl, radiolabeled marker, enzyme, hapten biotin, transport/absorption enhancer, aspirin, vitamin E, folic acid, synthetic ribonuclease, protein, glycoprotein, peptide, synergy A co-ligand molecule, antibody, hormone, hormone receptor, non-peptide substance, lipid, lectin, carbohydrate, vitamin, cofactor or drug with specific affinity. The composition of claim 1 or the method of claim 20, wherein the oligonucleotides are capable of participating in ribonuclease H-mediated cleavage of the mutant Huntington gene mRNA. The composition of claim 1 or the method of claim 20, wherein the base sequence, the backbone linkage mode, and/or the backbone-to-palm center mode of the oligonucleotides comprise or consist of: WV -1092, WV-2595 or WV-2603 base sequence, backbone linkage mode, and/or backbone-to-palm center mode. The composition of claim 1 or the method of claim 20, wherein the base sequence, the backbone linkage mode, and the backbone-to-palm center mode of the oligonucleotides comprise or consist of: WV-1092 The base sequence, the backbone linkage mode, and/or the backbone-to-palm center mode of any of WV-2595 or WV-2603. A composition comprising the composition of claim 1 and a selective agent selected from the group consisting of: specifically binding to one or more selected from the group consisting of a dopamine transporter (DAT), a serotonin transporter (SERT), and a group of compounds of a neurotransmitter transporter consisting of a group of norepinephrine transporters (NET); a dopamine reuptake inhibitor (DRI), Selective serotonin reuptake inhibitor (SSRI), norepinephrine reuptake inhibitor (NRI), norepinephrine-dopamine reuptake inhibitor (NDRI), and serotonin-norepinephrine-dopamine reuptake inhibition Group of agents (SNDRI); consisting of triple reuptake inhibitors, norepinephrine dopamine dual reuptake inhibitors, serotonin single reuptake inhibitors, norepinephrine single reuptake inhibitors, and dopamine single re-reagents a group of absorption inhibitors; and consists of dopamine reuptake inhibitor (DRI), norepinephrine-dopamine reuptake inhibitor (NDRI), and serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI) group. A method for preventing and/or treating Huntington's disease in an individual comprising administering to the individual a composition as claimed in claim 1. The composition of any of the preceding claims, further comprising artificial cerebrospinal fluid. An oligonucleotide, an oligonucleotide composition or a method selected from the group consisting of Examples 1 to 607.