TW201625666A - Targeting molecule and use thereof - Google Patents

Abstract

The problem to be solved by the present invention is providing a targeting molecule and the like, which targets a target cell. The target cell is selected from a group consisting of a free stellate cell, a myoblast cell, a cancer-associated fibroblast cell, a tumor cell and a STRA6 (stimulated by retinoic acid gene) expression cell. In order to solve the aforementioned problem, the present invention provides a targeting molecule; a targeting agent, vector, complex and pharmaceutical composition containing the targeting molecule; a method for treating, checking, diagnosing or monitoring a disease associated with the aforementioned cell; and a method for marking, detecting or imaging the aforementioned cell. The targeting molecule is selected from a group consisting of (1) a peptide containing an amino acid sequence of a cell RBP (retinol conjugated protein) binding domain; (2) a peptide variation having a targeting capability equal to that of the peptide of (1); and (3) a peptide analog having a targeting capability equal to that of the peptide of (1) or (2).

Description

Targeting molecule and its use

The present invention relates to a target molecule; a target agent, a carrier, a complex and a pharmaceutical composition containing the target molecule; a method for treating, inspecting, diagnosing or monitoring a disease associated with the aforementioned cell; a method for labeling, detecting or angiizing a cell, or the like; the target molecule, which targets a target cell, the target cell being selected from a stellate cell, a myofibroblast, a cancer-associated fibroblast, a tumor cell And a group of STRA6 expressing cells.

Although humans have overcome many diseases by chemotherapeutics, it is known that chemotherapeutics performed by low-molecular agents cause side effects due to the action of drugs other than cells that become therapeutic targets. upset. In recent years, in order to overcome this drawback, development of technology for delivering a drug to a desired cell is being developed.

The countermeasure 1 for delivering a drug to a desired cell includes a target molecule specific for the cell. For example, a retinoid or a derivative thereof is known to be specific for extracellular matrix-producing cells, cancer-associated fibroblasts, and cancer cells in stellate cells, lung, bone marrow, kidney, and intestinal tract. Functionalization of the target molecule Patent Documents 1 to 9, Non-Patent Document 1). However, there is still a need for further targeting molecules.

[Previous Technical Document] (Patent Literature)

Patent Document 1: WO 2006/068232

Patent Document 2: WO 2008/120815

Patent Document 3: WO 2009/036368

Patent Document 4: WO 2009/116257

Patent Document 5: WO 2010/014117

Patent Document 6: WO 2010/026766

Patent Document 7: WO 2010/029760

Patent Document 8: WO 2011/158933

Patent Document 9: WO 2013/073667

(Non-patent literature)

Non-Patent Document 1: Sato et al., Nat Biotechnol. 2008;26(4):431-42

An object of the present invention is to provide a targeting molecule; a targeting agent, a carrier, a complex and a composition comprising the same; a method for treating a disease associated with the cell; and labeling the cell a method or the like; the target molecule, which targets a target cell, The target cells were selected from the group consisting of free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and retinoic acid-activating protein 6 (STRA6) expressing cells.

In order to solve the above problems, the present inventors have continued to intensively study and found that a peptide containing an amino acid sequence of a cell-binding region of retinol-binding protein (RBP) functions as a specificity for stellate cells and the like. The function of the molecule is targeted, and the present invention has been completed.

That is, the present invention relates to the following.

<1> A target molecule which targets a target cell which is selected from the group consisting of astrocytes, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells. Wherein the target molecule is selected to be free (1) a peptide comprising an amino acid sequence of a cell-binding region of RBP, and (2) a peptide having the same targeting ability as the peptide of (1) The variant peptide, and (3) a group consisting of a peptide mimetic having the same targeting ability as the peptide of (1) or (2).

<2> The target molecule according to the above <1>, wherein the cell-binding region is a loop of the RBP, a loop 2, and a functional fragment of the loop 1 and the loop 2.

<3> The target molecule according to <1> or <2> above, wherein the cell binding region comprises an amino acid sequence selected from SEQ ID NOs: 3 and 4.

The target molecule according to any one of the above-mentioned <1> to <3>, wherein the amino acid sequence selected from the sequence numbers 3, 4, and 6 to 13 is included.

The target molecule according to any one of the above-mentioned <1> to <4> wherein the peptide mimetic is based on the reverse-reverse of the peptide of (1) or (2) (retro- Inverso) type peptide.

<6> A targeting agent comprising the targeting molecule according to any one of <1> to <5> above, wherein the target cell is targeted, and the target cell is selected as a free star. A group of cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells.

<7> A vector which delivers a substance to a target cell which has been subjected to targeting by the target molecule according to any one of the above <1> to <5>, and the target cell selects a free star A group of cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells.

<8> A complex represented by the formula (1): X-Y-Z (1)

In the formula, X is a target moiety, which comprises the target molecule of any one of <1> to <5> above; Y is a binding moiety; Z is a functional part comprising a substance selected from the group consisting of free drugs, labels and carriers.

<9> The complex according to the above <8>, wherein the carrier further comprises a drug and/or a label.

<10> A composition comprising the targeting molecule according to any one of the above <1> to <5>, the targeting agent according to <6> above, The carrier according to the above <7>, and the group comprising the complex according to the above <8> or <9>.

<11> The composition according to the above <10>, which comprises a medicament for treating a disease associated with a target cell, the target cell being selected from a stellate cell, a myofibroblast, a cancer-associated A group consisting of fibroblasts, tumor cells, and STRA6 expressing cells.

<12> The composition according to the above <11>, wherein the disease is a group selected from the group consisting of free fibrosis and neoplastic diseases.

The composition according to the above <10>, which comprises a drug for controlling the activity or proliferation of a target cell for controlling the activity or proliferation of the target cell, wherein the target cell selects a free stellate cell, A group consisting of myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells.

<14> The composition according to the above <10>, which is used for delivering a substance to a target cell, the target cell being selected from a stellate cell, a muscle fiber mother A group consisting of cells, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells.

<15> The composition according to the above <10>, which comprises a marker for labeling, detecting or contrasting a target cell, the target cell being selected from a stellate cell, a myofibroblast, a cancer-associated fibroblast , a group of tumor cells and STRA6 expressing cells.

<16> The composition according to the above <10>, which comprises a marker for inspecting, diagnosing or monitoring a disease associated with a target cell selected from a stellate cell, a myofibroblast, a cancer-associated fiber A group consisting of mother cells, tumor cells, and STRA6 expressing cells.

<17> A method of treating a disease associated with a target cell, wherein the target cell is selected from the group consisting of astrocytes, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells, wherein The method comprising the step of: the composition according to the above <8> or <9>, or the composition according to <11> or <12> above, which comprises the effective amount of the drug for treating the disease. , cast to the object that will be deemed necessary.

<18> A method for labeling, detecting or angiating a target cell or a tissue comprising the same, the target cell being selected from a stellate cell, a myofibroblast, a cancer-associated fibroblast, a tumor cell, and a STRA6 expression cell a group comprising: the method comprising the composition according to the above <8> or <9>, or the composition according to the above <15>, comprising the effective dose of the label, Give this as an object of necessity.

<19> A method for examining, diagnosing, or monitoring a disease associated with a target cell selected from the group consisting of astrocytes, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells a method comprising the step of: administering a composition according to the above <8> or <9>, or a composition according to the above <16>, comprising an effective dose of the label, This is considered an essential object.

According to the present invention, a peptide having excellent processability can be utilized as a target molecule, and the degree of freedom of dosage form design is increased, and a wider variety of target preparations can be developed. Further, according to the present invention, since various drugs can be specifically delivered to fibrosis, tumors, and the like to treat cells of a disease that is difficult, it is expected to contribute greatly to medical and veterinary medicine.

Fig. 1 shows the transfection efficiency of siRNA in rat hepatic stellate cells (HSC) using loops 1 to 3 of RBP as a target molecule, and the target gene of siRNA, namely rat HSP47 The degree of inhibition is expressed in the chart. The vertical axis is the relative amount of expression of rat HSP47 relative to the internal standard rat GAPDH, with untreated cells as 100. In the graph, each means: "VL" is a group of various rings that use retinol instead of RBP (ie, VA/LipoTrust/siRNA), and "L" uses DMSO instead of RBP. The various ring groups (i.e., LipoTrust/siRNA), "w/o LT" is a group that does not contain LipoTrust ^TM SR, and uses a mixture of siRNA and peptide, "NT" is an untreated group.

Fig. 2 is a siRNA transfection efficiency when rat hepatic stellate cells (HSC) using RBP loop 1 or a fragment thereof as a target molecule, and the target gene of siRNA is also a rat. A graph indicating the degree of inhibition of HSP47. The vertical axis is the relative amount of expression of rat HSP47 relative to the internal standard rat GAPDH, with untreated cells as 100. In the chart, each means: "VA" is a group that uses retinol to replace various peptides (ie, VA/LipoTrust/siRNA), and "(-)VA" uses DMSO instead of various wins. group of peptide (i.e., LipoTrust / siRNA), "siRNA + VA 'is free LipoTrust ^TM SR, while the group using mixtures of siRNA retinol," NT "is the untreated group.

Figure 3 shows the transfection efficiency of siRNA in rat hepatic stellate cells (HSC) using RBP loop 1 (L1) or its mutant peptide (E3K6, D3K4, D3K12) as the target molecule. A graph represented by the degree of inhibition of the target gene of siRNA, that is, rat HSP47. The vertical axis is the relative amount of expression of rat HSP47 relative to the internal standard rat GAPDH, with untreated cells as 100. In the chart, each means: "VA" is a group that uses retinol to replace various peptides (ie, VA/LipoTrust/siRNA), and "(-)VA" uses DMSO instead of various wins. The group of peptides (ie, LipoTrust/siRNA), "NT" is an untreated group.

Figure 4 shows siRNA in rat hepatic stellate cells (HSC) using RBP loop 1 (L1) or its retro-inverso (RI) as a target molecule. The transfection efficiency is a graph represented by the degree of inhibition of the target gene of siRNA, that is, rat HSP47. The vertical axis is the relative amount of expression of rat HSP47 relative to the internal standard rat GAPDH, with untreated cells as 100. In the chart, each means: "VA" is a group that uses retinol to replace various peptides (ie, VA/LipoTrust/siRNA), and "(-)VA" uses DMSO instead of various wins. The group of peptides (ie, LipoTrust/siRNA), "NT" is an untreated group.

Figure 5 is a graph showing the transfection efficiency of siRNA in rat stellate cells (HSC) using RBP loop 1 (L1) or its scrambled peptide as a target molecule. A graph showing the degree of inhibition of the target gene of siRNA, that is, rat HSP47. The vertical axis is the relative amount of expression of rat HSP47 relative to the internal standard rat GAPDH, with untreated cells as 100. In the chart, each means: "scr" is a group that uses scrambled peptides, and "VA" is a group that uses retinol to replace various peptides (ie, VA/LipoTrust/siRNA). "DMSO" is a group in which DMSO is used in place of various peptide peptides (ie, LipoTrust/siRNA), and "NT" is an untreated group.

Figure 6 shows the transfection efficiency of siRNA in the human fibrosarcoma cell line HT-1080 using RBP loop 1 (L1) as the target molecule, and the target gene of siRNA, namely human HSP47 A graph indicating the degree of inhibition. The vertical axis represents the untreated cells as 100 The relative amount of human HSP47 relative to the internal standard human GAPDH. In the chart, each means: "scr" is a group that uses scrambled peptides, and "VA" is a group that uses retinol to replace various peptides (ie, VA/LipoTrust/siRNA). "DMSO" is a group that uses DMSO to replace various peptides (ie, LipoTrust/siRNA), "NT" is an untreated group, and "1st" and "2nd" are the first results of the same content experiment. The second result.

In the present specification, all technical terms and scientific terms used in the present specification have the same meanings as generally understood by those of ordinary skill in the art to which the invention pertains, unless otherwise defined. All patents, applications, published applications, and other publications (including online information) referred to in this specification are hereby incorporated by reference in their entirety.

One aspect of the present invention relates to a target molecule which targets a target cell selected from a stellate cell, a myofibroblast, a cancer-associated fibroblast, a tumor cell, and a STRA6 expressing cell. a group consisting of, wherein the target molecule is selected to be free (1) a peptide comprising an amino acid sequence of a cell binding region of RBP, and (2) having the same targeting as the peptide of (1) The ability of the peptide variant peptide, and (3) a group consisting of a peptide mimetic having the same targeting ability as the peptide of (1) or (2).

In the present specification, "targeted molecule" means a molecule having a targeting ability, which facilitates delivery of a substance that has been bound to the target molecule. Achieve specific targets. In the present invention, the target is a target cell, which selects a group consisting of free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells, and the target molecule of the present invention has Promotes the ability to deliver substances that have been bound to this target molecule to such target cells, ie, has the ability to target. The term "promoting ... delivery" as used herein means that a substance is rapidly and/or largely delivered to a target cell and/or ingested as compared to a case where a target molecule is not present, for example, A labeled molecule to which a label or a drug is attached, or a labeled molecule comprising a composition comprising a label or a drug, is added to the culture of the target cell by the presence of the label after the specific time The effect of the drug or the drug can be easily confirmed by comparison with a case where a label or a drug to which a target molecule is not bound is added (for example, refer to Examples 2 to 6 of the present specification). In the case where the target molecule is present, the amount of the label in the target cell or the action of the drug is promoted as compared with the case where the target molecule does not exist. The degree of increase is not limited, and may be, for example, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 40% or more, 50% or more, 60%. The above, 70% or more, 80% or more, 90% or more, 100% or more, 150% or more, 200% or more, 300% or more. Further, the amount of the label in the target cell in the case where the target molecule is present, or the action of the drug is preferably accompanied by a statistically significant difference as compared with the case where the target molecule is not present. increase.

As used herein, "stellate cells" refers to cells that are typically star-shaped with vitamin A (VA) storage capacity. Due to this nature, "stellate cells" are also called "vitamin A storage cells." As stellate cells, although liver hepatic stellate cells (also known as Ito cells) are well-known, outside the liver, it is known that the same cells exist in the pancreas or vocal cords (for example, refer to Madro et al., Med Sci Monit. 2004 Jul;10(7):RA166-70,Jaster,Mol Cancer.2004 Oct 06;3(1):26,Fuja et al.,Cell Tissue Res.2005;322(3):417- 24, etc., the stellate cells of the present invention comprise such cells. It is known that stellate cells are activated by stimulation such as inflammation, and become phenotypes of myofibroblasts characterized by the expression of α- smooth muscle actin ( α SMA), and are proliferated to cause fibrosis. Collagen (for example, Fallowfield and Iredale, Expert Opin Ther Targets. 2004 Oct; 8(5): 423-35, above Madro et al., 2004, Jaster, 2004, etc.). The stellate cells of the present invention comprise both unactivated quiescent stellate cells and activated stellate cells.

In the present specification, "muscle fibroblast" refers to a fibroblast characterized by the expression of α SMA and appears in various organs. Myofibroblasts are thought to be differentiated from mesenchymal cells such as fibroblasts present in various organs or circulating blood, and are involved in various organ fibrosis or various organ regeneration (for example, Selman et al. , Ann Intern Med. 2001 Jan 16; 134 (2): 136-51, etc.). Myofibroblasts can be identified by immunostaining using a detectable labeled anti- α- SMA antibody or the like.

In the present specification, "cancer-associated fibroblast (CAF)" means a fibroblast that is present in and/or around a cancer lesion and is α- SMA (smooth muscle actin)-positive (see, for example, Patent Document 2) . CAF is considered to assist in the proliferation of cancer cells existing in the vicinity thereof, and participate in the development of cancer and the like. The CAF can be identified by immunostaining or the like using a labeled anti- α- SMA antibody which can detect cancer tissues or cells isolated from cancer tissues.

CAF has been confirmed for various cancers such as colorectal cancer, lung cancer, prostate cancer, breast cancer, stomach cancer, cholangiocarcinoma, and basal cell carcinoma.

In the present invention, whether or not a certain cell is CAF is determined by the following method. That is, cells that are present in and/or around the cancer lesion are labeled with a CAF, that is, a labeled antibody against α- SMA, for example, FITC-labeled anti- α- SMA antibody or Cy3-labeled anti- α- SMA. The antibody was immunostained, and the α- SMA was detected as CAF.

The cancer accompanying CAF in the present invention is not particularly limited, and examples thereof include brain tumor, head and neck cancer, breast cancer, lung cancer, esophageal cancer, gastric cancer, duodenal cancer, appendic cancer, colon cancer, rectal cancer, liver cancer, and pancreatic cancer. , gallbladder cancer, cholangiocarcinoma, anal cancer, kidney cancer, ureteral cancer, bladder cancer, prostate cancer, penile cancer, testicular cancer, uterine cancer, ovarian cancer, vulvar cancer, vaginal cancer, skin cancer and other solid cancer. Further, although CAF is typically accompanied by a cancer, it may be a malignant solid tumor other than cancer, such as fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, as long as it has the same property. Rhabdomyosarcoma, leiomyosarcoma, Angiosarcoma, Kaposi's sarcoma, lymphangiosarcoma, synovial sarcoma, chondrosarcoma, osteosarcoma, and the like, are also included in the scope of the present invention.

CAF, can exist in various organs present in the above cancer, for example, brain, head and neck, chest, limbs, lung, heart, thymus, esophagus, stomach, small intestine (duodenum, jejunum, ileum), large intestine (colon, cecum) , appendix, rectum), liver, pancreas, gallbladder, anus, kidney, ureter, bladder, prostate, penis, testis, uterus, ovary, vulva, vagina, skin, striated muscle, smooth muscle, synovium, cartilage, bone, thyroid, Adrenal gland, peritoneum, mesentery, etc.

In the present specification, "tumor" includes benign tumors and malignant tumors (cancers). In the present invention, "cancer" includes both epithelial malignant tumors and non-epithelial malignant tumors, for example, undefined, including fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, angiosarcoma. , Kaposi's sarcoma, lymphangiosarcoma, synovial sarcoma, chondrosarcoma, osteosarcoma, etc.; brain tumor, head and neck cancer, breast cancer, lung cancer, esophageal cancer, stomach cancer, duodenal cancer, appendix cancer, colorectal cancer, rectum Cancer, liver cancer, pancreatic cancer, gallbladder cancer, cholangiocarcinoma, anal cancer, kidney cancer, ureteral cancer, bladder cancer, prostate cancer, penile cancer, testicular cancer, uterine cancer, ovarian cancer, genital cancer, vaginal cancer, skin cancer, etc. Carcinoma; also leukemia or malignant lymphoma.

The tumor cells of the present invention can exist in any part of the body, for example, brain, head and neck, chest, limbs, lung, heart, thymus, esophagus, stomach, small intestine (duodenum, jejunum, ileum), large intestine (colon, cecum) , appendix, rectum), liver, pancreas, gallbladder, anus, kidney, ureter, The lymphatic system of the bladder, prostate, penis, testis, uterus, ovary, vulva, vagina, skin, striated muscle, smooth muscle, synovium, cartilage, bone, thyroid, adrenal gland, peritoneum, mesentery, bone marrow, blood, vascular system, lymph nodes, etc. Lymph and the like.

As used herein, "STRA6 expressing cells" means cells which express STRA6 on the cell surface. STRA6 (stimulated by retinoic acid 6) is a high affinity receptor for RBP (retinol binding protein) present on the cell surface. Therefore, the target molecule of the present invention based on the peptide of the amino acid sequence of the cell-binding region of RBP is considered to have the ability to target STRA6-expressing cells. STRA6 is considered to have a function of taking up retinol transported by RBP into cells. STRA6, its performance in cancer cells (eg, colorectal cancer cells), retinal pigment epithelial (RPE) cells, Sertoli cells, stellate cells, etc. (Sun and Kawaguchi, Int Rev Cell Mol Biol.2011 ;288:1-41).

Since the gene sequence of STRA6 is conventional (for example, GenBank accession numbers AY359089, AY358748 (human), NM_001029924 (rat), AF062476 (mouse), etc.), antibodies are also being developed, so the performance of STRA6 can be known by conventional methods. A nucleic acid or protein detection method, for example, an immunoprecipitation method using an anti-STRA6 antibody, an EIA (enzyme immunoassay) (for example, an ELISA (emzyme-linked immunosorbent assay), etc.), or a RIA (radio immuno assay) (for example, IRMA (immunoradiometric assay), RAST (radioallergosorbent test), RIST (radioimmunosorbent test), Western blotting, immunohistochemistry, immunocytochemistry, flow cytometry, using nucleic acids encoding STRA6 or It is a variety of hybridization methods, a northern blotting method, a Southern blotting method, various PCR methods, and the like, which are unique fragments or nucleic acid transcription products (for example, mRNA) or splicing products for specific hybridization. The performance of STRA6 is better at the protein level, but it can also be replaced by gene level detection. Therefore, the "STRA6 expressing cells" in the present invention are not only cells in which STRA6 is expressed, but also any cells in which the expression of STRA6 is confirmed by the above method.

In one aspect, the target cells are selected from the group consisting of stellate cells, myofibroblasts, cancer-associated fibroblasts, and tumor cells. In a particular aspect, the target cells are selected from the group consisting of stellate cells, myofibroblasts, and cancer-associated fibroblasts. In further specific aspects, the target cells are selected from the group consisting of stellate cells and myofibroblasts.

As used herein, "RBP" refers to extracellular protein present in the blood, ie, serum RBP. RBP is a conventional protein whose presence is confirmed in various animal species, and its nucleic acid sequence and amino acid sequence can be obtained from a database such as GenBank. For example, the nucleic acid sequences of human RBP are each registered under GenBank accession number NM_006744 (SEQ ID NO: 1), and the amino acid sequence is registered under GenBank accession number NP_006735 (SEQ ID NO: 2). However, between biological individuals, due to the possibility of lossless The amino acid sequence or the gene sequence variation in the physiological function of the protein, the RBP or RBP gene in the present invention is not limited to a nucleic acid or a protein having the same sequence as the known sequence, and may include the same sequence. 1 or more, typically 1 or several, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases or A different sequence of amino acids. The RBP in the present invention may also be any animal species, preferably a vertebrate, more preferably a mammal, and particularly preferably a human RBP.

In the present specification, the "cell binding region of RBP" means an RBP region involved in binding to a target cell in the present invention.

In one aspect, the cell binding region of RBP is selected from the group consisting of loops 1-3 and functional fragments thereof. Rings 1-3 are ring structures that protrude around the pocket opening of the RBP containing retinol. For example, in human RBP, the amino acid sequences of SEQ ID NO: 2 are 46th to 59th, respectively. Composition of ~89 and 107-121 amino acids. The functional fragment of the loops 1 to 3 is one of the loops 1 to 3, and has the ability to target the target cells. For example, as described in Example 2 of the present specification, a plurality of loops are produced. Different fragments of 1 to 3 can be found by investigating whether or not this has a targeting ability to target cells. For example, a specific aspect of the functional fragment of loop 1 of human RBP in the present invention is a fragment containing the minimal functional region, that is, the amino acid sequence of SEQ ID NO: 6.

In a preferred aspect, the cell binding region of the RBP is selected from the group consisting of loop 1, loop 2, and functional fragments thereof. In a more preferred aspect, the cell binding region of the RBP is selected from the group consisting of Loop 1 and the functional fragment. In a particular aspect, Ring 1 and Ring 2 are human RBPs. For example, each has an amino acid sequence of SEQ ID NOs: 3 and 4. In a particular aspect, the functional fragment of loop 1 of human RBP consists of an amino acid sequence selected from SEQ ID NOs: 6-13.

In the present specification, the phrase "the peptide of the amino acid sequence of the cell-binding region of RBP" (hereinafter, simply referred to as "the peptide containing the cell-binding region") means the cell-binding region including the above-mentioned RBP. An amino acid sequence, and any peptide having the ability to target the target cell. Therefore, the peptide is not only composed of the amino acid sequence of the cell-binding region of the RBP, but also includes the N-terminus, the C-terminus of the amino acid sequence contained in the cell-binding region of the RBP or both. Amino acid sequence. The additional amino acid sequence includes any one that does not lose the targeting ability of the peptide. Whether the additional amino acid sequence loses the ability to target the peptide, and can be obtained by a peptide containing an amino acid sequence of an additional amino acid sequence and a cell binding region of RBP, and a cell binding region only by RBP. An experimental comparison of the targeting ability of the peptide consisting of the amino acid sequence and the amino acid sequence of the RBP-free cell-binding region, or the stereo of the peptide containing the additional amino acid sequence Structural analysis or stereo structure prediction, etc. are evaluated. For example, the ability of the peptide containing the amino acid sequence of the additional amino acid sequence to bind to the amino acid sequence of the RBP (ie, the ability to deliver the substance bound to the peptide to the target cell) is more than RBP only. The peptide composed of the amino acid sequence of the cell-binding region has a low delivery ability and is equivalent to or fails to reach the peptide of the amino acid sequence of the cell-binding region containing no RBP, or From stereostructure analysis or stereostructure prediction, it is apparent that the additional amino acid sequence binds the cells of RBP When the region is hidden, it can be evaluated that the additional amino acid sequence loses the targeting ability of the peptide.

The peptide containing the cell-binding region is typically 10 amino acids or more, preferably 10 to 50 amino acids, more preferably 10 to 30 amino acids, and even more preferably 10 ~20 amino acids are long, especially 10 to 14 amino acids are long.

The peptide containing the cell-binding region can also be modified in a range that does not cause loss of the targeting ability of the peptide. Whether the modification results in loss of the targeting ability of the peptide, and can be achieved by an unmodified peptide containing a cell binding region, a modified peptide containing a cell binding region, and an unmodified peptide having no cell binding region. An experimental comparison of the targeting ability was evaluated. For example, a modified peptide containing a cell-binding region has a lower targeting ability than a non-modified peptide-containing region, and has a targeting ability with an unmodified peptide that does not contain a cell-binding region. In the case of equal or unsuccessful, it can be evaluated that its modification results in loss of the targeting ability of the peptide. The modification may also be carried out on all of the amino acids of the peptide, or on a portion of the amino acid. Where the modification is carried out on a portion of the amino acid, it can also be carried out on a particular type of amino acid, or on a particular position of the amino acid. Although it is not intended to limit the type or position of the amino acid to be modified, it is considered that there is a high possibility that the modification of the amino acid other than the smallest functional region of the peptide containing the cell-binding region does not cause the peptide to be labeled. Loss of targeting ability. Non-limiting examples of the modification of the peptide containing the cell-binding region include, for example, biotinylation, myristylation, octylation, palmitoylation, acetylation, maleidinization, and Base, C Addition of thiolation, amide, esterification, farnesylation, geranylation, phosphorylation, sulfation, palmitoylation, PEGylation, various labels (for example, as described in the present specification) Wait.

In the present specification, the "variant peptide of the peptide having the same targeting ability as the peptide of the amino acid sequence of the cell binding region of RBP" (hereinafter, simply referred to as "variant peptide") a case), a peptide having a cell-binding region, particularly a cell-binding region, having one or more (for example, several) amino acid variations, including having the same or more Any peptide that is superior to the targeting ability of this. Examples of the mutation include, for example, deletion, substitution, and addition of an amino acid, and the number of amino acids to be mutated, and in the case of a cell-binding region, for example, it may be 1 to 10 or 1 to 9 Ranges of 1~8, 1~7, 1~6, 1~5, 1~4, 1~3, 1~2. More specifically, the number of amino acids to be mutated in the cell-binding region may be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. The number of amino acids to be mutated is in a portion other than the cell binding region of the peptide containing the cell-binding region, as long as the binding ability of the peptide is not lost in the portion, The variation of the region may also be more than the above.

The substitution of the amino acid can also be a preservative substitution. Preservative substitution is a well-known concept in the art, meaning that the original amino acid is replaced by another amino acid having similar physicochemical properties in a manner that does not substantially alter the function of the peptide. The physicochemical property of an amino acid is characterized by its side chain, so an example of a preservative substitution is a package. Containing a substitution for an amino acid having a side chain that belongs to the same group as the original amino acid. Amino acids, by virtue of the structure or nature of the side chains, can be classified into: groups with basic side chains (ionic acid, arginine, histidine, etc.), groups with acidic side chains (Asparagus) Amino acid, glutamic acid, etc.), group of non-charged polar side chains (aspartic acid, glutamic acid, serine, threonine, tyrosine, etc.), with non-polar side chains Groups (glycine, alanine, valine, leucine, isoleucine, valine, phenylalanine, methionine, tryptophan, cysteine, etc.). Therefore, as a preservative substitution, substitution of the amino acids belonging to each of the above groups may be mentioned. Non-limiting examples of preservative substitutions include, for example, lysine and arginine, serine and threonine, glutamic acid and aspartic acid, glutamic acid and aspartic acid. And the substitution of amidinoic acid with amino acids in each group consisting of leucine and isoleucine.

Whether the variant peptide has the same or better targeting ability than the peptide containing the cell binding region, for example, is not limited, and the marker peptide or the drug variant peptide or the cell binding region is added. a peptide, or a variant peptide that incorporates a marker or a drug-containing composition or a peptide containing a cell-binding region is added to a culture of a target cell, and a target cell to which a variant peptide is added The presence of the marker or the effect of the drug after a certain period of time can be easily confirmed by comparison with the case where the peptide containing the cell-binding region is added. The amount of the label in the target cell when the variant peptide is added, or the effect of the drug, is as long as the same as the addition of the peptide containing the cell binding region, or When increased, the variant peptide becomes a targeting ability having the same or better than the peptide containing the cell binding region.

As used herein, "peptide mimetic" means a substance that has the same properties or function as a specified peptide (especially a naturally occurring alpha peptide), particularly a side chain that can be mimicked with a specified peptide. A material with a spatial arrangement of functional groups of the same topology. The peptide mimetic is not limited, and examples thereof include a reverse-reverse peptide and the like. A reverse-reverse peptide is an amino acid having a chirality opposite to that of the amino acid of the reference peptide (for example, if the amino acid of the reference peptide is L-form, it is a D-form) The amino acid is bonded in the reverse order of the amino acid sequence of the reference peptide, and has a topological structure of the same side chain as the reference peptide.

The target molecule of the present invention can be any conventional method for producing a peptide or a peptide mimetic, and is not limited, for example, a chemical synthesis method such as a solid phase synthesis method or a liquid phase synthesis method, or genetic engineering. It is produced by a synthetic method or the like (for example, refer to N. Leo Benoiton, Chemistry of Peptide Synthesis, CRC Press, 2005, etc.).

A further aspect of the invention relates to a targeting agent (or a targeting composition) comprising a targeting molecule of the invention for targeting a target cell, the target cell selection A group consisting of free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells.

In the present specification, "agent" and "composition" mean a mixture of plural components (eg, compounds) that are used interchangeably. The "agent" and the "composition" may be those for a specific use, and in this case, a component suitable for the use may be appropriately included.

The targeting agent of the present invention has the ability to promote delivery of a substance that has been bound to the targeting agent to a target cell (targeting ability). Here, the targeting ability means the same ability as described for the targeting molecule of the present invention, that is, means that the substance is rapidly and/or massively compared to when the targeting agent is not present. The ability to deliver to target cells and/or to ingest.

The targeting agent of the present invention, in addition to the target molecule of the present invention, may also contain components useful for the interaction of substances (e.g., drugs, carriers, labels, etc.) delivered to the target cells, and is not limited, for example, It may also include a linker or the like. The linker is not particularly limited as long as it can bond the target molecule to the carrier, and any conventional one can be used. Examples of the linking agent which can be contained in the targeting agent of the present invention include a peptide linking agent such as Glycine-Glycine-Glycine (triglycine), glycerin, polyethylene glycol, and polypropylene glycol. A non-peptide linking agent such as a biodegradable polymer such as a glycol-propylene glycol copolymer, a polyvinyl alcohol, a monosaccharide, a polysaccharide, a polyester, a polyether or a polylactic acid.

Another aspect of the present invention relates to a vector which delivers a substance to a target cell which has been subjected to targeting by a target molecule of the present invention, the target cell being selected from a stellate cell, a myofibroblast, a group consisting of cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells Target cells. In addition, in the following, a vector which has been subjected to targeting by the target molecule of the present invention is referred to as a "targeted vector", and a vector which has not been subjected to targeting of the target molecule of the present invention is simply referred to as a carrier. "Vector" to distinguish between.

As used herein, "carrier" means a substance that facilitates the transport of one or more substances (eg, drugs, labels, etc.) carried from one part of the body to a target cell or tissue. And/or delivery to or within the target cells. The carrier may be composed of a single compound or a plurality of compounds of the same or different species. In a preferred aspect, the vector can be targeted by the targeting molecule of the invention, and can include any of the conventional ones. The carrier which is a target of this target (that is, an active target) is not limited, and examples thereof include a carrier having a linear or branched linear structure such as a polymer carrier, or a liposome. a carrier having a particulate structure such as a dendrimer, a nanoparticle, or a polymeric micelle (particle carrier) (for example, Marcucci and Lefoulon, Drug Discov Today. 2004 Mar 1; 9(5): 219-28, Torchilin, Eur J Pharm Sci. 2000 Oct; 11 Suppl 2: S81-91, etc.). The carrier can be cationic or non-cationic (e.g., anionic, neutral). In one aspect, the carrier is cationic. Further, the carrier may be a lipoplex or a polyplex which can form a substance with the carrier. The Lipoplex is, for example, between a cationic lipid and a substance having a negative charge (for example, a nucleic acid such as DNA), and the polyplex is formed, for example, between a multivalent cation and a substance having a negative charge.

The carrier of the present invention is not limited, and for example, a lipid, a polymer or the like may be used as a constituent component.

Non-limiting examples of the lipid include phospholipids such as glycerophospholipids; sphingolipids such as sphingomyelin; sterols such as cholesterol; vegetable oils such as soybean oil and poppy seed oil; mineral oil; egg yolk lecithin and the like. Lecithins and the like. More specific examples of the lipid include dimyristoyl phospholipid choline (DMPC), dipalmitoyl phospholipid choline (DPPC), distearyl phospholipid choline (DSPC), and Oil-based phospholipids, ethanolamine (DOPE), dilaurinyl phospholipid choline (DLPC), sterols such as cholesterol, N-( α -trimethylammonioethyl)-dido-12-D- Glutamic acid (TMAG), N, N', N'', N'''-tetramethyl-N, N', N'', N'''-tetra-spermine spermine (TMTPS), 2 , 3-dioleyloxy-N-[2 (spermine carboxamide) ethyl]-N,N-dimethyl-1-propanyl ammonium trifluoroacetate (DOSPA), N-[1-( 2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), bis-octadecyldimethylammonium chloride (DODAC), brominated dodecyl Ammonium (DDAB), 1,2-dioleoxy-3-trimethylammoniopropane (DOTAP), 3β-[N-(N',N'-dimethylaminoethane)amine-methyl sulfhydryl Cholesterol (DC-Chol), 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE), O,O'-bis-tetradecyl-N -( α -trimethylammonioethylamino)diethanolamine (DC-6-14) or the like. The lipid may be a cationic lipid or a non-cationic lipid such as an anionic lipid or a neutral lipid. In one aspect, the carrier of the invention comprises a cationic lipid. The cationic lipid is particularly useful for introducing a negatively charged nucleic acid molecule or the like into a cell.

Other non-limiting examples of the lipid include cationic lipids and PEG-binding lipids (PEG-lipids) described in WO 2012/170952, and ionizable lipids described in WO 2013/185116.

The aforementioned cationic lipid is a compound represented by Formula I: Wherein R ₁ and R ₂ are independently selected from the group consisting of C ₁₀ -C ₁₈ alkyl, C ₁₂ -C ₁₈ alkenyl, and oleyl; R ₃ and R ₄ are independently selected from C ₁ ~ a group consisting of C ₆ alkyl groups and C ₂ ~C ₆ alkanols; X is selected from the group consisting of -CH ₂ -, -S-, and -O-, or absent; Y is selected from -(CH ₂ ) _n -, -S(CH ₂ ) _n -, -O(CH ₂ ) _n -, thiophene, -SO ₂ (CH ₂ ) _n -, and ester; n = 1 to 4; a = 1 ~4; b=1~4; c=1~4; Z is a relative ion.

Non-limiting examples of the above cationic lipids include the following.

Non-limiting examples of the PEG-lipid include, for example, 1,2-dimyristyl-sn-glycero-3-phosphoethanolamine-N-PEG (PEG-DMPE), 1,2-dipalmitoyl group. -sn-glycerol-3-phosphoethanolamine-N-PEG (PEG-DPPE), 1,2-distearoyl-sn-glycerol-3-phosphoethanolamine-N-PEG (PEG-DSPE), 1,2 - Dioleyl-sn-glycerol-3-phosphoethanolamine-N-PEG (PEG-DOPE), PEG Ceramide and the like. The molecular weight of PEG is not particularly limited, and is, for example, about 550 to about 2,000, and more specifically, about 550, about 750, about 1,000, about 1250, about 2,000, and the like. Non-limiting examples of PEG include PEG 550, PEG 750, PEG 1000, PEG 1250, PEG 2000, and the like.

The aforementioned ionizable lipid is a compound represented by Formula II or a pharmaceutically acceptable salt thereof: Wherein n and m are independently 1, 2, 3 or 4; R ₁ and R _{2 are} independently C ₁₀ -C ₁₈ alkyl or C ₁₂ -C ₁₈ alkenyl; X is -CH ₂ -, S, O, N or absent; L is C _1~4 alkyl, -SC _1~4 alkyl, -OC _1~4 alkyl, -OC(O)-C _1~4 alkyl, -S( O) ₂ -C _1~4 alkyl group, Or

Non-limiting examples of the ionizable lipids include the following.

The carrier of the present invention may further comprise one or more lipids. In one aspect, the carrier of the invention comprises a cationic lipid and an ionizable lipid. In a particular aspect, the carrier of the invention comprises a cationic lipid, an ionizable lipid, and a PEG-lipid. Non-limiting examples of the combination of the lipids contained in the carrier of the present invention include, for example, a combination of HEDC and S104; HEDC, S104, DOPE, cholesterol, and PEG-DMPE. Combination; combination of DODC, DOPE, cholesterol and PEG-lipid; combination of HEDODC, DOPE, cholesterol and PEG-lipid; combination of DC-6-14, DOPE and cholesterol. Specific non-limiting examples of the combination of the lipids contained in the carrier of the present invention include HEDC: S104 (molar ratio of 1:1), HEDC: S104: DOPE: cholesterol: PEG-DMPE (4: 4) : 6:5:1 molar ratio), DODC: DOPE: cholesterol: PEG-lipid (25:5:19:1 molar ratio), HEDODC:DOPE:cholesterol:PEG-lipid (25:5:19 : 1 molar ratio), DC-6-14: DOPE: cholesterol (4:3:3 molar ratio) and the like.

Non-limiting examples of the polymer include cationic polymerization of polyethylene glycol (PEG), polyethyleneimine (PEI), or poly-lysine (for example, poly-L-isoamine (PLL)). (polyvalent cation); non-cationic polymer such as polylactic acid (PLA), polyglycolic acid (PGA), lactic acid-glycolic acid copolymer (PLGA), and/or derivatives thereof.

In the present invention, "targeting with a target molecule" means that a target molecule is capable of exerting its target for a substance to be induced to a target cell (for example, a carrier such as a carrier, a drug, a label, or the like). The way to target the ability to interact (for example, to make a bond). Non-limiting examples of the interaction between the target molecule and the substance to be induced to the target cell include, for example, a covalent bond, an ionic bond, an electrostatic bond, a hydrophobic bond, a van der Waals force, and an avidin-biotin bond. Any of the conventional chemical bonds. The target molecule may also exist outside of the substance to be induced to the target cell, as described below. For example, in a manner possible to interact with the target cells, at least a portion that interacts with the target cells (eg, a functional portion of loops 1-3 of RPB, particularly a functional portion of loop 2, including The amino acid sequence of SEQ ID NO: 6 is exposed. As a method of exposing at least a portion of the target molecule that participates in interaction with the target cell to the outside of the carrier, for example, mixing the target molecule with a substance to be induced to the target, or The target molecule is bonded to a substance that should be induced to the target, and the like.

The target vector of the present invention may also be labeled with one or two or more target molecules. In one aspect, the targeted vector of the present invention is targeted by a target amount of a target molecule that is targeted to the target cell. The specific amount of the target molecule (for example, the molar ratio with respect to the constituent component of the carrier) which is effective for the targeting of the target vector of the present invention can be investigated, for example, by using the method described in Example 2, etc. It is determined by the targeting ability of the vector to which the target molecule is labeled with different amounts. The amount of the target molecule which is effective for the targeting of the target vector of the present invention is not limited, and for example, it may be 1000 with respect to the constituent component of the carrier (the main component when a plurality of constituent components are contained): 1~1:1000, 100:1~1:100, 50:1~1:50, 40:1~1:40, 30:1~1:30, 25:1~1:25, 20:1~ 1:20, 10:1~1:10, 8:1~1:8, 6:1~1:6, 5:1~1:5, 4:1~1:4, 3:1~1: 3 or 2:1~1:2 Mo Erbi.

The carrier to be carried on the target carrier of the present invention is not particularly limited, but is preferably a size that can physically move from the site to the site where the target cells are present. Therefore, the present invention It is needless to say that a target carrier can transport molecules such as atoms, compounds, proteins, and nucleic acids, and can transport carriers, virions, cells, drug release systems composed of one or more elements, and objects such as micromachines. The aforementioned delivery material preferably has properties which may have some influence on the target cells, for example, including labeling the target cells (for example, labeling), or controlling the activity or proliferation of the target cells (for example, enhancing or inhibiting the target cells). ) (such as drugs).

Targeting by a targeting molecule in the target vector of the present invention can be achieved by mixing the vector with the target molecule in a specific ratio, or by binding the target molecule to the constituent component of the carrier. Achieved. Several methods are known for binding a target molecule to a vector (for example, Torchilin, Nat Rev Drug Discov. 2005 Feb; 4(2): 145-60, Nobs et al., J Pharm Sci. 2004 Aug; 93 (8): 1980-92, Marcucci and Lefoulon, 2004, etc.). The binding of the target molecule to the constituent components of the carrier may also be carried out after the preparation of the carrier, or may be carried out for the specific constituent components before the preparation of the carrier, or may be carried out in the preparation of the carrier. Further, the target molecule may be directly bonded to the constituent component of the carrier or may be bound by a linker.

Another aspect of the invention relates to a composite represented by the formula (1): X-Y-Z (1)

Wherein X is a target moiety comprising a target molecule of the invention; Y is a binding moiety; Z is a functional moiety comprising a substance selected from the group consisting of free drugs, labels and carriers.

The target moiety in the complex of the present invention may be composed of the target molecule of the present invention, or a linker suitable for binding to the binding moiety may be attached to the target molecule of the present invention. The target molecule of the present invention contained in the target moiety may be modified to such an extent that it does not impair the ability to target, in order to be suitable for binding to the binding moiety. Linkers or modifications suitable for chemical bonding to a particular substance are well known in the art (e.g., Torchilin, 2005, Nobs et al., 2004, Marcucci and Lefoulon, 2004, etc.). Further, the target portion may contain a single target molecule or a plurality of target molecules. When the target moiety contains a plurality of target molecules, the target molecules may be the same or different. Moreover, the target moiety can be combined with a single functional moiety by a single binding moiety, but can also be combined with a plurality of functional moieties by a single or multiple binding moiety. Where the target moiety is combined with a plurality of binding moieties and/or functional moieties, the binding moieties and/or functional moieties may be the same or different.

The binding moiety in the complex of the present invention may be a chemical bond or a linker. The chemical bond includes a known bond of a covalent bond, an ionic bond, an electrostatic bond, a hydrophobic bond, a van der Waals force, an avidin-biotin bond, and the like. A linker is a chemical moiety through which a target moiety and a functional moiety can be bonded by a chemical bond. A linker that is suitable for the chemical bonds of a particular two different materials is well known in the art. Non-limiting examples of the linking agent include, for example, Glycine-Glycine-Glycine (triglycine) and other peptide linkers, glycerin, polyethylene glycol, polypropylene glycol, ethylene glycol-propylene glycol copolymer, polyvinyl alcohol, monosaccharides, polysaccharides, polyester A non-peptide linker such as a biodegradable polymer such as polyether or polylactic acid.

The binding moiety can also be combined with a single target moiety or with a plurality of target moieties. Further, the binding portion may be combined with a single functional portion or with a plurality of functional portions. When the binding moiety is combined with a plurality of labeled moieties and/or functional moieties, the targeting moieties or functional moieties may be the same or different.

The drug contained in the functional part in the complex of the present invention is not particularly limited, and includes any one related to the target cell. The drug may be interacting with the target cell itself, or with the surrounding environment of the target cell, for example, with a non-target cell existing around the target cell, or an intercellular substance (eg, an extracellular matrix) ) to interact. In one aspect, the drug is to control the activity or proliferation (eg, inhibition, maintenance, or promotion) of the target cell. In a particular aspect, the drug inhibits the activity or proliferation of the target cell. Specific examples of the drug are not limited, and examples thereof include a TGF β (Transforming Growth Factor-beta) inhibitor, a HGF (Hepatocyte growth factor) or a production promoting substance thereof, and a PPAR γ (Peroxisome proliferator-activated receptor gamma). a ligand, an vasopressin inhibitor, a PDGF (Platelet-derived growth factor) inhibitor, a relaxin or a production-promoting substance thereof, a substance which inhibits the production and/or secretion of an extracellular matrix component, a cell activity inhibitor, and cell proliferation inhibition Substance, apoptosis-inducing substance, collagen decomposition-promoting substance, inhibitor of collagen decomposition-promoting substance, PAI-1 (Plasminogen activator inhibitor-1) inhibitor, α 1 anti-trypsin inhibitor, and vasoconstrictor inhibitor Wait.

The TGF β inhibitor is not limited, and examples thereof include a truncated TGF β type II receptor (Qi et al., Proc Natl Acad Sci US A. 1999; 96(5): 2345-9), soluble TGF β. Type II receptor (George et al., Proc Natl Acad Sci US A. 1999; 96(22): 12719-24), TGF β activity inhibitory substance such as anti-TGF β antibody, or RNAi against TGF β (RNA interference A TGF β such as a molecule, a riboside or an antisense nucleic acid produces an inhibitory substance, a carrier expressing the same, and the like. In one aspect, TGF β-inhibiting substances hinder the activity of TGF β 1 and / or production.

The production-promoting substance of HGF or relaxin is not limited, and examples thereof include nucleic acids encoding HGF or relaxin, expression constructs containing the same, and expression vectors containing the same.

The PPARγ ligand is not limited, and examples thereof include 15-deoxy-Δ12, 14-prostaglandin J2, nitrolinoleic acid, oxidized LDL (Low density lipoprotein), long-chain fatty acid, and class 20 An endogenous ligand for carbonic acid; or a thiazolidinedione-based agent such as troglitazone, pioglitazone, rosiglitazone, baglitazone, gliglitazone, or a non-steroidal anti-inflammatory drug Exogenous ligands, etc.

The vasopressin inhibitor is not limited, and examples thereof include telmisartan, losartan, valsartan, candesartan cilexetil, and omeprazole. An angiotensin receptor antagonistic substance such as tann ester or irbesartan. Angiotensin I contains angiotensin I, II, III and IV. Further, the vasopressin receptor is not limited, and examples thereof include angiotensin-type 1 receptor (AT1).

The PDGF inhibitory substance is not limited, and examples thereof include a PDGF activity inhibitory substance such as an anti-PDGF antibody, a PDGF-producing inhibitory substance such as an RNAi molecule of PDGF, a riboside or an antisense nucleic acid, and the like.

The substance which inhibits the production and/or secretion of the extracellular matrix component is not limited, and examples thereof include collagen, proteoglycan, prion protein, fibronectin, thrombin sensitive protein, osteopontin, and osteonectin. A substance having an inhibitory effect on the expression of an extracellular matrix component such as elastin, a substance such as a riboside or an antisense nucleic acid; or a substance having a dominant negative effect such as a dominant negative variant; and a carrier expressing the same. The drug which inhibits the production and secretion of collagen is not limited, and for example, a collagen-specific molecule which is necessary for intracellular delivery and molecular maturation which is common to the synthesis process of collagen of various types can be mentioned. An inhibitory substance of HSP (Heat shock protein) 47, for example, an RNAi molecule of HSP47 (for example, an siRNA molecule described in WO 2011/072082), an HSP47 such as a riboside or an antisense nucleic acid, or an inhibitory substance; or It is a substance having a dominant negative effect such as a dominant negative variant of HSP47; such a carrier is expressed.

The cell proliferation inhibiting substance is not limited, and examples thereof include an alkylating agent (for example, ifosfamide, nitustine, cyclophosphamide, and up to Carba ren, melphalan, remustine, etc.; anti-tumor antibiotics (eg, idamycin, pan-imycin, daunorubicin, doxorubicin, pirarubicin, bleomycin, senti Neomycins, bishydroxyindoles, mitomycin C, etc.; metabolic antagonists (eg, Gemcitabine, Enoxacitabine, Cytarabine, Tegafur-Uracil, Tegafur-Gimoster) Potassium oxonate compounding agent, deoxyfluorouridine, hydroxyurea, fluorouracil, aminomethyl folate, hydrazine, etc.; chlorhexidine, erinodine, venosamine, paclitaxel, paclitaxel, vinca Alkaloids such as neobase, vindesine, and vinblastine; and platinum complexes such as carboplatin, cisplatin, and nedaplatin; statins such as lovastatin and simvastatin.

The cell activity-inhibiting substance is not limited, and examples thereof include a sodium channel-blocking substance such as amiloride.

The apoptosis inducing agent is not limited, and examples thereof include a compound 861, a mycotoxin, and atorvastatin.

The collagen degradation-promoting substance is not limited, and examples thereof include various collagenases or production-promoting substances thereof. Examples of the collagenase are not limited, and examples thereof include MMP families such as MMP (Matrix metalloproteinase) 1, 2, 3, 9, 13, and 14. The production-promoting substance of collagenase is not limited, and examples thereof include a nucleic acid encoding a collagenase, an expression construct containing the same, and a expression vector containing the same.

The inhibitory substance of the collagen degradation-promoting substance is not limited, and examples thereof include TIMP (Tissue inhibitor of metalloproteinase, TIMP1, TIMP2, etc.). Therefore, The substance which inhibits the same substance is not limited, and examples thereof include a TIMP activity inhibitory substance such as an antibody against TIMP, an RNAi molecule against TIMP (for example, an siRNA molecule described in WO 2012/044620), riboside, and antisense. A TIMP such as a nucleic acid generates an inhibitory substance, a carrier expressing the same, and the like.

The PAI-1 inhibitor is not limited, and examples thereof include a PAI-1 activity inhibitor such as an antibody against PAI-1, a PAI-1 RNAi molecule, a riboside, an antisense nucleic acid, and the like. , such as the carrier of such a.

As α 1 antitrypsin inhibiting substances, and is not limited, for example, include the inhibitors PAI-1 activity of α 1 antitrypsin antibodies against α 1 antitrypsin the RNAi molecule, ribose meat on the back of an animal, antisense nucleic acids, etc. The α 1 antitrypsin produces an inhibitory substance, a carrier expressing the same, and the like.

The vasoconstrictor inhibitory substance is not limited, and examples thereof include angiotensinogen activity inhibitory substance such as an antibody against angiotensinogen, vasoconstriction against angiotensinogen RNAi molecule, riboside, and antisense nucleic acid. The primogen produces a hindrance substance, a carrier that expresses the same, and the like.

In the present specification, an RNAi molecule means any molecule having RNAi activity, for example, not limited, and includes siRNA (small interfering RNA), miRNA (micro RNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA). , piRNA (Piwi-interacting RNA), rasiRNA (repeat associated siRNA) and other RNA and these changes body. Further, the nucleic acid in the present specification is a complex comprising RNA, DNA, PNA, or the like.

As used in this specification, a label refers to any substance that can be detected by itself or directly or indirectly with the label. The label can be selected from any of those well known to those of ordinary skill in the art, such as gases or substances that generate gases under physiological conditions, any radioisotope, magnetic, nuclear magnetic resonance elements (eg, hydrogen, Phosphorus, sodium, fluorine, etc., substances that affect the relaxation time of elements of nuclear magnetic resonance (such as metal atoms or compounds containing them), substances (such as antibodies) that bind to labeled substances, fluorescent substances, fluorescent substances a group, a chemiluminescent substance, an enzyme, biotin or the derivative, avidin or the derivative.

In the present specification, the mark may be a detectable person, and includes any mark that can be detected by any of the existing detection means. The detection method is not limited, and examples thereof include a naked eye, an optical inspection device (for example, an optical microscope, a fluorescence microscope, a phase contrast microscope, an in vivo imaging device, etc.), and an X-ray device (for example, X alone). Line device, CT (computed tomography) device, etc., MRI (magnetic resonance imaging) device, nuclear medicine examination device (scintillation device, PET (positive emission tomography) device, SPECT (single photon emission computed tomography) Photography, single photon emission computed tomography), ultrasonic inspection device, thermal imaging device, and the like. Markers suitable for each detection method are those having ordinary knowledge in the technical field to which the invention pertains. For example, it is described in Lecchi et al., Q J Nucl Med Mol Imaging. 2007; 51(2): 111-26.

Examples of the label suitable for detection by the naked eye and the optical inspection device include various fluorescent markers and luminescent markers.

As a specific fluorescent mark, it is not limited, for example, a Cy ^TM series (for example, Cy ^TM 2, 3, 5, 5.5, 7, etc.), a DyLight ^TM series (for example, DyLight ^TM 405, 488, 549, 594, 633 can be used). , 649, 680, 750, 800, etc.), Alexa Fluor ^(R) series (eg Alexa Fluor ^(R) 405, 488, 549, 594, 633, 647, 680, 750, etc.), HiLyte Fluor ^TM series (eg HiLyte Fluor ^TM 488, 555, 647, 680, 750, etc.), ATTO series (eg, ATTO 488, 550, 633, 647N, 655, 740, etc.), FAM, FITC, Texas Red, GFP, RFP, Qdot, and the like. As a fluorescent marker suitable for a living body image, for example, a wavelength which is high in bio-penetration and is not easily affected by the fluorescence of the home, for example, a person who emits a near-infrared wavelength or a person whose fluorescence intensity is high may be mentioned. The fluorescent label is not limited, and examples thereof include a Cy ^TM series, a DyLight ^TM series, an Alexa Fluor ^(R) series, a HiLyte Fluor ^TM series, an ATTO series, Texas Red, GFP, RFP, Qdot, and the like. Such as derivatives and so on.

The specific luminescent label is not limited, and for example, luminol, luciferin, leukotriene, aequor, or the like can be used.

Examples of the mark suitable for detection by the X-ray device include various kinds of developers. The specific developer is not limited, and for example, an iodine atom, an iodide ion, an iodine-containing compound, or the like can be used.

Examples of the label suitable for detection by an MRI apparatus include an element of nuclear magnetic resonance or a substance which affects the relaxation time of an element of nuclear magnetic resonance. The elements of nuclear magnetic resonance include, for example, hydrogen, phosphorus, sodium, fluorine, and the like. The substance which affects the relaxation time of the element of the nuclear magnetic resonance is not limited, and various metal atoms and a compound containing one or two or more kinds of the metal atoms may, for example, be one or two or more kinds of the metal atom. The complex and so on. Specifically, it is not limited, and for example, ruthenium (III) (Gd (III)), ruthenium-88 ( ⁸⁸ Y), indium-111 ( ¹¹¹ In), and these and di-ethyltriamine pentaacetic acid can be used. (DTPA), tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA), (1,2-ethanediyldiazo)tetraacetic acid (EDTA), ethylenediamine, 2 , 2'-bipyridyl (bipy), 1,10-morpholine (phen), 1,2-bis(diphenylphosphino)ethane (DPPE), 2,4-pentanedione (acac), grass A complex of a ligand such as an acid salt (ox), superparamagnetic iron oxide (SPIO), manganese monoxide (MnO), or the like.

As a marker suitable for detection by a nuclear medicine test apparatus, for example, various radioisotopes and a compound containing one or two or more kinds of such radioisotopes include, for example, one or two or more complexes of the radioisotope. Wait. The radioisotope is not limited, and for example, 鎝-99m ( ^99m Tc), indium-111 ( ¹¹¹ In), iodine-123 ( ^123I ), iodine-124 ( ^124I ), iodine-125 ( ^125I ) can be used. ), iodine-131 ( ¹³¹ I), 铊-201 ( ²⁰¹ Tl), carbon-11 ( ¹¹ C), nitrogen-13 ( ¹³ N), oxygen-15 ( ¹⁵ O), fluorine-18 ( ¹⁸ F), Copper-64 ( ⁶⁴ Cu), gallium-67 ( ⁶⁷ Ga), 氪-81m ( ^81m Kr), 氙-133 ( ¹³³ Xe), 锶-89 ( ⁸⁹ Sr), 钇-90 ( ⁹⁰ Y), and the like. And, as a radioisotope containing compound has not been defined, for example, include ^{123 I-IMP, 99m Tc-} HMPAO, 99m Tc-ECD, 99m Tc-MDP, 99m Tc- tetrofosmin, ^99m Tc-MIBI, ^99m TcO ₄ ^- , ^99m Tc-MAA, ^99m Tc-MAG3, ^99m Tc-DTPA, ^99m Tc-DMSA, ¹⁸ F-FDG, and the like.

The mark suitable for detection by the ultrasonic inspection apparatus is not limited, and examples thereof include a biocompatible gas or a substance that generates a gas under physiological conditions, a fatty acid, or a substance containing the substance. As a gas, it is not limited, such as air, rare gas, nitrogen, N ₂ O, oxygen, carbon dioxide, hydrogen, inert rare gas (such as helium, argon, neon or xenon), sulfur fluoride (such as sulfur hexafluoride, Difluorinated disulfide, trifluoromethyl sulfur pentafluoride), selenium hexafluoride, halogenated decane (such as tetramethyl decane), low molecular hydrocarbons (such as C _{1 ~ 7} alkane (methane, ethane, propane, butyl) Alkane, pentane, etc.), cycloalkane (cyclobutane, cyclopentane, etc.), alkene (such as ethylene, propylene, butylene, etc.), fluorine-containing gas, ammonia, etc.; as a substance which generates a gas under physiological conditions, It is not limited, for example, dodecafluoropentane (DDFP), perfluorocarbon which is vaporized under physiological conditions (JP-2010-138137), etc.; as a substance containing the above substance, a nanoside containing the above substance may be mentioned. Particles, liposomes, and the like. The fluorine-containing gas is not limited, and examples thereof include a halogenated hydrocarbon gas (for example, difluoromonochlorobromomethane, difluoromonochloromethane, difluoromethylene chloride, trifluoromethane bromide, trifluorochloromethane, pentafluorocarbon). Monochloroethane, tetrafluorodichloroethane, perfluorocarbon), fluorinated ketone (for example, perfluoroacetone, etc.), fluorinated ether (for example, perfluoroethyl ether, etc.).

The perfluorocarbon is not limited, and examples thereof include perfluoroalkanes (for example, perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoro-n-butane, perfluoropentane, and perfluorocarbon). Hexane, perfluoroheptane, etc.; perfluoroolefin (for example, perfluoropropene, perfluorobutene (for example, perfluorobut-2-ene, etc.), perfluorobutadiene, etc.); perfluoroalkyne (for example, Perfluorobutan-2-alkyne, etc.; perfluorocycloalkane (eg perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclobutane, perfluoro) Cyclopentane, perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluorocyclohexane, perfluoromethylcyclohexane, perfluorocycloheptane, etc.).

As a mark suitable for detection by an ultrasonic inspection device, it is also possible to use a commercially available person. The mark for ultrasonic inspection which is commercially available is not limited, and examples thereof include Albunex (Mallinckrodt), Echovist (SHU 454, Schering), Levovist (SHU 508, Schering), and Myomap (Quadrant) of the first generation. Quantison (Quadrant), Sonavist (Schering), Sonazoid (GE Healthcare), etc.; Generation 2 Definity/luminity (Bristol-Myers Squibb Medical Imaging), Imagent-imavist (Alliance), Optison (GE Healthcare), biSphere/cardiosphere ( POINT Biomedical), SonoVue (BR1, Bracco), AI700/imagify (Acusphere), etc.; 3rd generation of Echogen (Sonus Pharmaceuticals), etc. (Reddy et al., World J Gastroenterol.2011 Jan 7;17(1):42-8). Further, in addition to the above, it is suitable for the detection by the ultrasonic inspection device, in addition to the above, in Japanese Patent Laid-Open No. Hei 5-194278, Japanese Patent Application Laid-Open No. Hei 8-310971, No. Hei 8-151335, JP-A-2002-308802, WO 2004/069284, WO Also recorded in 2005/120587 and so on.

The label included in the functional portion of the composite of the present invention is not particularly limited, and can be selected from any of the above-mentioned labels. Further, the drug contained in the functional portion of the complex of the present invention may be labeled by any of the above-mentioned labels. The carrier contained in the functional portion of the complex of the present invention is also not particularly limited, and can be selected from any of the above carriers. The carrier may also carry one or more of the above drugs and/or markers.

The drug, the label and/or the carrier contained in the functional portion of the complex of the present invention may be modified to the extent that it does not impair its function in order to be suitable for binding to the binding moiety. Modifications suitable for chemical bonding to a particular substance are well known in the art. Non-limiting examples of the modification include, for example, a modification for forming a disulfide bond (for example, thiolation), a modification for click chemistry (for example, azidation, acetylation, or the like) to form avidin. Modification of biotin linkages (eg, ovalization, biotinylation, etc.).

The functional portion may also comprise a single label, drug or carrier, and may also comprise a plurality of labels, drugs or carriers or combinations thereof. Where the functional portion encompasses a plurality of labels, drugs or carriers, these may be the same or different. Moreover, in the functional part, a single binding part can also be combined through a single binding part, or through a single or The complex binding portion, the complex target portion is combined. When the functional moiety is combined with a plurality of binding moieties and/or a targeting moiety, the binding moiety and/or the targeting moiety may be the same or different.

In one aspect, the complex of the invention has the form of a compound. Non-limiting examples of the complex of the present invention having a form of a compound include, for example, a target molecule that is permeable to a linker (or is not permeable), a labeled compound or a therapeutic compound, or a labeled compound and / or a carrier compound (for example, a polymer) to which the therapeutic compound is bound, and the like. In other aspects, the composite of the present invention has the form of a composition. Non-limiting examples of the complex of the present invention having a form of a composition include, for example, a carrier molecule that is permeable to a linker (or is not permeable), and a carrier composition to which a labeled compound or a therapeutic compound is bound ( For example, liposomes, etc.

Another aspect of the present invention relates to a composition comprising a component selected from the group consisting of a targeting molecule, a targeting agent, a target carrier, and a complex of the present invention. The composition of the present invention may contain, in addition to the target molecule, the target agent, the target carrier and/or the complex of the present invention, an additional component such as a component suitable for the purpose (for example, an active ingredient such as a drug) , or additives such as labels, excipients, etc.). The composition of the present invention may also be a pharmaceutical composition for the treatment of diseases. The pharmaceutical composition of the present invention may further contain one or two or more pharmaceutically acceptable additives (e.g., a surfactant, a carrier, a diluent, an excipient, etc.). Pharmaceutically acceptable additives are well known in the pharmaceutical arts, for example, Remington's, which is described in the specification as a whole. Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA (1990), and the like.

The complex and the composition of the present invention are capable of specifically delivering a drug or the like to a target cell selected from the group consisting of astrocytes, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells. Or it is around, so it is possible to use a disease associated with the target cell, for example, a treatment of a fibrous or neoplastic disease. When used for this purpose, the complex and composition of the present invention are drugs for treating the disease, and for example, include a drug which inhibits the activity or proliferation of a target cell. The composite and composition of the present invention to be used for this purpose may also be referred to as a treatment compound or a treatment agent (or a treatment composition).

In the present specification, "disposal" is a medically acceptable all-type prophylactic and/or therapeutic intervention for the purpose of curing, temporary relief or prevention of diseases. For example, "disposal" in the present specification encompasses medically permissible interventions for various purposes, including delay or cessation of disease development associated with target cells, decline or disappearance of lesions, prevention of recurrence or recurrence of the disease, and the like. .

Therefore, the therapeutic compound or the treating agent of the present invention comprises a therapeutic compound or a therapeutic agent (or a therapeutic composition) for treating a disease associated with a target cell, and for preventing and targeting cells A compound or preventive agent (or a preventive composition) for the prevention of a disease.

The disease associated with stellate cells is not limited, and examples thereof include liver fibrosis, cirrhosis, pancreatic fibrosis, and vocal cord scar formation. Fibrosis such as vocal cord mucosal fibrosis and fibrosis of the larynx (see Patent Document 1).

The disease associated with myofibroblasts is not limited, and examples thereof include liver fibrosis, cirrhosis, vocal cord scar formation, vocal cord mucin fibrosis, laryngeal fibrosis, pulmonary fibrosis, pancreatic fibrosis, and myelofibrosis. Myocardial infarction, myocardial fibrosis after myocardial infarction, myocardial fibrosis, endomyocardial fibrosis, spleen fibrosis, mediastinal fibrosis, submucous fibrosis, intestinal fibrosis (eg, accompanied by inflammatory bowel disease) Etc.), retroperitoneal fibrosis, uterine fibrosis, scleroderma, mammary fibrosis, and other organ fibrosis.

The disease associated with cancer-associated fibroblasts is not limited, and examples thereof include brain tumors, head and neck cancer, breast cancer, lung cancer, esophageal cancer, gastric cancer, duodenal cancer, appendic cancer, colon cancer, rectal cancer, liver cancer, and pancreas. Cancer, gallbladder cancer, cholangiocarcinoma, anal cancer, kidney cancer, ureteral cancer, bladder cancer, prostate cancer, penile cancer, testicular cancer, uterine cancer, ovarian cancer, genital cancer, vaginal cancer, skin cancer, fibrosarcoma, malignant fibrous Solid tumors of histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, angiosarcoma, Kaposi's sarcoma, lymphangiosarcoma, synovial sarcoma, chondrosarcoma, osteosarcoma, and the like.

The disease associated with the tumor cells is not limited, and for example, it can be exemplified in any part of the body such as the brain, the head and neck, the chest, the extremities, the lungs, the heart, the thymus, the esophagus, the stomach, the small intestine (duodenum, jejunum, ileum). ), large intestine (colon, cecum, appendix, rectum), liver, pancreas, gallbladder, anus, kidney, ureter, bladder, prostate, penis, Any benign tumor in the testicular, uterus, ovary, vulva, vagina, skin, striated muscle, smooth muscle, synovium, cartilage, bone, thyroid, adrenal gland, peritoneum, mesentery, bone marrow, blood, vascular system, lymphatic system, etc. A neoplastic disease such as a malignant tumor. Non-limiting examples of malignant tumors include fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, angiosarcoma, Kaposi's sarcoma, lymphangiosarcoma, synovial sarcoma, chondrosarcoma, Sarcoma such as osteosarcoma; brain tumor, head and neck cancer, breast cancer, lung cancer, esophageal cancer, stomach cancer, duodenal cancer, appendix cancer, colon cancer, rectal cancer, liver cancer, pancreatic cancer, gallbladder cancer, cholangiocarcinoma, anal cancer, kidney cancer , ureteral cancer, bladder cancer, prostate cancer, penile cancer, testicular cancer, uterine cancer, ovarian cancer, vaginal cancer, vaginal cancer, skin cancer, etc.; and leukemia and malignant lymphoma.

As a disease associated with STRA6 expressing cells, in addition to the above-mentioned tumor cell-related diseases, there are also diseases associated with cells selected from the group consisting of RPE cells, Settle cells, and stellate cells, and for example, a retina Pigment degeneration, age-related macular degeneration, Settl's cell tumor, stellate cell tumor, and the like.

The complexes and compositions of the present invention may be used to control the activity or proliferation (eg, inhibition, maintenance, or promotion) of target cells selected from free stellate cells, myofibroblasts, and cancer-associated fibroblasts. A group consisting of tumor cells and STRA6 expressing cells, in which case a drug that inhibits the activity or proliferation of the target cells is included.

The target molecule, the target agent, the target carrier, the complex and the composition of the present invention may be used for delivering the substance to the target cell, The target cells were selected from the group consisting of free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells. The substance to be delivered is not particularly limited, and for example, the above-mentioned carrier which can be carried by the target carrier of the present invention and the above-mentioned drug contained in the functional part of the complex of the present invention are described in the present specification. Marks in, etc. The delivery of the substance can be carried out in vitro or in vivo.

The complex and the composition of the present invention are capable of delivering a marker to a target cell, and the target cell is selected from the group consisting of astrocytes, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells. The group can be used to label the target cell or the tissue containing the cell. There is also a case where the composite of the present invention and the composition to be used for this purpose are referred to as a labeling compound or a labeling agent (or a labeling composition). The labeling compound or labeling agent of the present invention comprises a label. A non-limiting example of a mark includes the above-mentioned representative. The labeling compound or labeling agent of the present invention can be used for detection or imaging of the above-mentioned target cells or tissues containing the cells. The labeling agent of the present invention to be used for this purpose is particularly referred to as a detecting compound or a detecting agent (or a detecting composition), or a contrast compound or a contrast agent (or a contrast composition). .

Labeling, detection or imaging of cells or tissues can be performed in vitro or in vivo. Further, the detection or imaging of the cells or tissues may be carried out non-destructively, preferably non-invasively. Here, "non-destructively" means that the tissue to be detected or contrasted is not destroyed, and for example, if the tissue to be the target is the liver, the laparotomy is included. Dirty, or an image of the liver surface obtained by an endoscope, but not included to cut the liver to explore its interior. Further, "non-invasively" means non-intentional injury to a living body to detect a marker contained in a detecting agent or a contrast agent, and typically includes a test from the outside of the body, but also includes from the oral cavity, A natural opening such as a nasal cavity, an anus, a urethra, an ear canal, or a vagina is inserted into a detector such as an endoscope or an ultrasonic probe for detection.

The labeling compound or labeling agent of the present invention can be used for examination or diagnosis of a disease associated with a target cell. For example, when a stellate cell or a myofibroblast is known to proliferate in a fibrotic lesion, if there is a large amount of a marker detected in a certain tissue, a large number of stellate cells or myofibroblasts may exist there. The tissue is invaded by fibrosis (for example, refer to Patent Document 7). Further, cancer-associated fibroblasts or tumor cells are located in a cancer tissue or a tumor tissue, and as long as a large number of markers are detected in a specific part of the body of the subject, it is an indicator that cancer or tumor exists in the site. There is also a labeling compound or labeling agent of the present invention to be used for this purpose, in particular, an inspecting compound or an inspecting agent (or an inspecting composition), or a diagnostic compound or a diagnostic agent (or a diagnostic component). Situation). Here, the examination of the disease, for example, comprises comparing the measured indicator (eg, the signal intensity from the labeling agent) to a specific reference (eg, a specific cutoff value), based on the result of the disease-related examination (eg, positive or Negative test results, etc., but do not include identification of the disease. Therefore, the examination of the disease is not necessary for the judgment of the physician. On the other hand, the diagnosis of a disease involves the physician identifying the disease based on a variety of information.

The labeling compound or labeling agent of the present invention can be used in the monitoring of diseases associated with target cells. There is a case where the labeling compound or the labeling agent of the present invention to be used for this purpose is specifically referred to as a monitoring compound or a monitoring agent (or a monitoring composition). Here, the monitoring of the disease means that the evolution of the disease in a specific subject, for example, the mitigation, aggravation, persistence, and the like of the disease, is monitored over time.

The detection compound, the detection agent, the contrast compound, and the contrast agent of the present invention can be used in a case where a target cell exhibits a characteristic behavior in a specific disease, for example, it is not limited, such as a target cell in a specific disease. In the case of abnormal proliferation, examination, diagnosis, or monitoring of the disease can be used. This particular disease encompasses diseases associated with target cells. Therefore, the compound for detection, the detecting agent, the compound for contrast, and the contrast agent of the present invention may be one aspect of the test compound, the test agent, the diagnostic compound, the diagnostic agent, the monitoring compound or the monitoring agent of the present invention. .

The labeling compound or labeling agent of the present invention can be used for evaluating the effect on the treatment of diseases associated with target cells. There is a case where the labeling compound or the labeling agent of the present invention to be used for this purpose is particularly referred to as an evaluation compound or an evaluation agent (or an evaluation composition).

The complexes and compositions of the present invention may be administered by various routes including oral and parenteral, for example, without limitation, orally, intravenously, intramuscularly, subcutaneously, locally, rectally, and arterially. Intraluminal, intraventricular, intraventricular, transmucosal, transdermal, intranasal, intraperitoneal, intrapulmonary, and intrauterine routes can also be administered in a dosage form suitable for each route of administration. Agent. The dosage form and the preparation method can be appropriately selected from any known person (for example, refer to the standard pharmacy, Watanabe et al., Nan Jiang Tang, 2003, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA (1990). )Wait).

For example, the dosage form suitable for oral administration is not limited, and examples thereof include a powder, a granule, a tablet, a capsule, a liquid, a suspension, an emulsion, a gel, a syrup, and the like, and are suitable as The dosage form of the parenteral administration may, for example, be a solution injection, a suspension injection, an emulsion injection, or a preparation injection such as a preparation for injection. The preparation for parenteral administration can be in the form of an aqueous or non-aqueous isotonic sterile solution or suspension.

The composite and the composition of the present invention may be supplied in any form, but from the viewpoint of preservation stability, it may be prepared in a form that can be used, for example, at a medical site or in the vicinity thereof, by a physician and / Or provided by a pharmacist, a caregiver, or other medical support staff. In this case, the composite and the composition of the present invention are provided in one or two or more containers, and the container contains at least one constituent element necessary for the composite and the composition, and is used, for example, 24 before use. Within a few hours before, preferably within 3 hours, and then preferably prepared at the current use. At the time of preparation, generally available reagents, solvents, dispensing devices, and the like can be suitably used in the preparation place.

A still further aspect of the present invention also relates to a kit or assembly, and a target carrier, composite or composition of the present invention provided in the form of such a kit or component, or a necessary constituent element thereof; The kit or component comprises the target carrier, complex or composition of the present invention, or a constituent thereof, for preparing the target carrier, complex and composition of the present invention; a target cell; for controlling the activity or proliferation of a target cell; for treating, examining, diagnosing or monitoring a disease associated with the target cell; for labeling, detecting or imaging the target cell or the tissue containing the cell; Used to evaluate the effect of treatment on diseases associated with target cells.

The components of the targeted vector, complex or composition of the present invention contained in the kit or assembly of the present invention are as described above for the targeted vector, complex or composition of the present invention. The kit may further include, in addition to the above, instructions for the preparation of the target carrier, the complex or the composition of the present invention and the method of use (for example, a method of administration, etc.), for example, recording Media for instructions and methods of use, such as flexible disks, CDs, DVDs, Blu-ray discs, memory cards, USB memory, etc. Further, the kit or component of the present invention may contain all of the constituent elements of the target carrier, composite or composition of the present invention, but does not necessarily include all of the constituent elements. Therefore, the kit or component of the present invention may not contain a reagent or a solvent which is generally available on the medical site or in an experimental setting, such as sterile water, physiological saline, glucose solution or the like.

Another aspect of the invention relates to a method for controlling the activity or proliferation of a target cell selected from the group consisting of free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6 expressing cells. For the group consisting of, the method contains a step that will contain The complex or composition of the present invention which is an effective amount of a drug which controls the activity or proliferation of the aforementioned target cells is administered to a subject, or a cell or tissue, which is regarded as necessary. Here, the control of the activity or proliferation of the target cell comprises inhibition, maintenance or promotion of the activity or proliferation. Therefore, the effective dose in the above method is, for example, an amount which can inhibit, maintain or promote the activity or proliferation of the target cells. The maintenance of the activity or proliferation of the target cell includes maintaining the activity or proliferation of the target cell in a state of being inhibited or promoted over time, and maintaining the activity or proliferation in an initial state. The cells or tissues to which the complex or composition of the present invention is administered typically contain target cells, may be present in the living body, or may be present in the living body. Thus, the aforementioned method comprising the step of administering the complex or composition of the present invention to a cell or tissue comprises performing in vitro, ex vivo or in vivo.

A further aspect of the invention relates to a method for treating a disease associated with a target cell which comprises free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells and STRA6 expressing cells. In the group, the method comprises a step of administering a complex or a composition of the present invention containing an effective amount of a drug for treating the aforementioned disease to a subject which is deemed necessary. Here, the effective dose is, for example, an amount which prevents the onset and recurrence of the disease or cures the disease. The disease associated with the target cell and the drug for treating the disease are as described above for the compound for treatment of the present invention and the treating agent.

A further aspect of the invention relates to a method for labeling, detecting or imaging a target cell or a tissue containing the cell, the label The target cells are selected from the group consisting of free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells, and the method comprises a step of including a labeled effective amount of the complex of the present invention or It is a composition that is administered to the object, or cell or tissue, which is considered necessary. Here, the effective dose is, for example, an amount which can be detected by detecting a target cell or a target tissue. Further, as the mark in the above method, for example, those described in the present specification can be used. The cells or tissues to which the complex or composition of the present invention is administered may also contain target cells, may be present in the living body, or be present in the living body. Thus, the aforementioned method comprises the step of administering a complex or composition of the invention to a cell or tissue, including in vitro, ex vivo or in vivo.

A further aspect of the invention relates to a method for detecting, diagnosing or monitoring a disease associated with a target cell selected from the group consisting of free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells and STRA6 A group consisting of cells, the method comprising a step of administering a complex or composition of the invention comprising an effective amount of the marker to a subject deemed necessary. Here, the effective dose is, for example, an amount which can be detected by detecting a target cell or a target tissue. Further, as the label in the pre-recording method, for example, those described in the present specification can be used; the disease associated with the target cell is as described above for the compound for treatment of the present invention and the treating agent. The examination, diagnosis or monitoring of the disease associated with the target cell can also be carried out in a specific disease by the target cell exhibiting characteristic behavior in the disease, for example, without limitation. In the case of seemingly abnormal proliferation, The effective dose of the complex or composition of the present invention is carried out by detecting or imaging the target cells.

A further aspect of the invention relates to a method for evaluating the effect of treatment of a disease associated with a target cell selected from a stellate cell, a myofibroblast, a cancer-associated fibroblast, a tumor A group consisting of cells and STRA6-expressing cells, the method comprising the step of administering a complex or composition of the present invention comprising an effective amount of the marker to a subject deemed necessary. Here, the effective dose is, for example, an amount which can be detected by detecting a target cell or a target tissue. Further, as the label in the above method, for example, those described in the present specification can be used; the disease associated with the target cell is as described above for the compound for treatment of the present invention and the treating agent.

Another aspect of the invention relates to a method for delivering a substance to a target cell, the target cell comprising free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells. Group, the method comprises two steps, one step is to target the substance with the target molecule, the target agent or the target vector of the present invention; in one step, the target substance is labeled Targeted to the subject or media containing the target cells. The substance to be delivered is not particularly limited, and examples thereof include a label, a drug, and a carrier which may also contain a label and/or a drug. The method of delivery of the present invention comprises performing in vitro, in vitro or in vivo.

The effective dose of the complex or composition of the present invention in the various methods of the present invention preferably does not adversely affect the benefits derived from administration. a composite of the invention in various methods of the invention or It is an effective dose of the composition, which can be appropriately determined according to an in-vitro test using cultured cells or the like; and an experimental animal such as a mouse, a rat, a dog, or a pig; and a test in a disease model animal, such a test method is It is quite well known to those of ordinary skill in the art to which the invention pertains.

The specific amount of the complex or composition administered to the subject in the method of the present invention may take into account various conditions regarding the subject to be administered, such as the type of the target, the purpose of the method, the therapeutic content, and the disease. The type, the severity of the symptoms, the general health status of the subject, the age, the weight, the sex of the subject, the diet, the period and frequency of the administration, the medicine being used, the responsiveness to the treatment, and the compliance with the treatment are determined. . The total daily dose of the complex or the composition of the present invention is not limited, and may be, for example, about 1 μg/kg to about 1000 mg/kg kg, about 10 μg/kg to about 100 mg/kg kg, or about 100 μg/ Kg ~ about 10mg / body weight kg. Alternatively, the amount administered can also be calculated based on the surface area of the patient.

As a route of administration, various routes including oral and parenteral, including, for example, oral, intravenous, intramuscular, subcutaneous, topical, rectal, intraarterial, intraportal, intraventricular, transmucosal, and meridian Pathways, intranasal, intraperitoneal, intrapulmonary and intrauterine.

The frequency of administration varies depending on the properties of the preparation or composition to be used, and the conditions of the object as described above, and may be, for example, one or more times a day (that is, 2, 3, 4 or more times a day). Once a day, every few days (that is, every 2, 3, 4, 5, 6, 7 days, etc.), several times a week (for example, 2, 3, 4 times in one week, etc.), every 1 week Within, every few weeks (ie every 2, 3, 4 weeks, etc.).

The method of labeling, detecting, contrasting, inspecting, diagnosing, monitoring, and/or evaluating the present invention may further comprise detecting the label of the complex of the present invention or the label contained in the composition. The label may also be included in the composite or the composition at the time of detection, or may exist separately from the composite or the composition. The detection of the mark can be performed by any method capable of detecting the mark, and is not limited, for example, by a naked eye, an optical inspection device (for example, an optical microscope, a fluorescence microscope, a phase contrast microscope, a living body imaging device, etc.), an X-ray device. (for example, a simple X-ray device, a CT (computed tomography) device, etc.), an MRI (magnetic resonance imaging) device, a nuclear medical examination device (a scintillation imaging device, a PET device, a SPECT device, etc.), an ultrasonic inspection device, and a thermal imaging device. The tactics and so on. Markers suitable for each detection method are well known to those of ordinary skill in the art to which the invention pertains (for example, refer to Lecchi et al., 2007, etc.), and non-limiting examples have been described above.

In one aspect, the target cells are tested or imaged in vivo. The detection or contrast is not limited, and it is possible to use an optical inspection apparatus (for example, a living imaging apparatus), an X-ray apparatus (for example, a simple X-ray apparatus, a CT (computed tomography) apparatus, etc.), and an MRI (magnetic resonance imaging). Any device that detects in vivo, such as a device, a nuclear medical examination device (a scintillation imaging device, a PET device, a SPECT device, etc.), an ultrasonic inspection device, and a thermal imaging device, and a marker suitable for the detection is also in the technical field of the invention. It is widely known to those of ordinary skill (see, for example, Lecchi et al., 2007, etc.).

By detecting or angiographically targeting the target cells, it is possible to determine the site of the target cell (for example, an organ or an organ) or a lesion of a disease associated with the target cell. Accordingly, the present invention also relates to a method of determining the presence of a target cell and/or a lesion of a disease associated with the target cell, comprising administering an effective dose of the labeled complex or composition of the invention, Give this as an essential object. This method can contribute to the diagnosis of diseases associated with target cells.

Further, by detecting the marker in a test tube or in vivo, it is possible to obtain information on the diagnosis of a disease associated with the target cell, such as the number and distribution of the target cells. Accordingly, the present invention is also directed to a method of assisting in the diagnosis of a disease associated with a target cell comprising administering an effective dose of the labeled complex or composition of the invention to a subject deemed necessary. The same method may further comprise providing information to the physician regarding the diagnosis of the disease associated with the target cell.

The method for inspecting and diagnosing a disease associated with a target cell of the present invention, and the method for assisting diagnosis of a disease associated with a target cell may further include a step of determining a result of the label in the subject and the reference The test results of the markers are compared. The detection result of the marker to be the reference may be, for example, a detection result (also referred to as a "negative criterion") of a marker in a subject (also referred to as a "negative subject") that is not known to have a disease associated with the target cell. Alternatively, the detection result (also referred to as "positive reference") of the marker in the subject (also referred to as "positive subject") having a disease associated with the target cell is known. The test result of the mark that becomes the reference can also be The average or median value of the test results in the plural negative or positive subjects.

Therefore, the method for examining a disease associated with a target cell of the present invention can, for example, further include a negative test in the case where the detection result of the marker in the subject is equivalent to (for example, not significantly different from) the negative criterion. The step of the result; and/or the step of presenting a positive test result if the test result of the mark in the subject is significantly higher than the negative reference; and/or the test result of the mark in the subject is equivalent to the positive reference (eg In the case where it is not significantly different, the steps of the positive test result are presented.

The detection results of the markers in the detection, contrast, examination, diagnosis, monitoring and/or evaluation methods of the present invention may also be the signal intensity and/or signal distribution of the detected markers.

The signal strength referred to herein refers to the intensity of various signals emitted from the mark, such as fluorescent signals, illuminating signals, magnetic signals, radioactive signals, etc., or similarly measured values, which are typically detected appropriately. Means to determine. Specific examples of the detecting means have been as described above. The signal strength can be obtained from the whole of the object, or from a specific part or region of the object. Further, the signal intensity may be an average value of the area or volume with respect to the portion to be measured, or may be an integrated value. When the signal strength changes over time, the signal strength in the method may be a certain time point, or may be integrated for a certain period. The increase in signal intensity may be a disease when the number of cells, activity, etc. of the target cell increases according to the development of the disease. Indicators of existence or development, on the contrary, weakening of signal intensity, can be indicators of disease improvement.

The signal distribution of the mark refers to the position information of the object that sends a signal from the mark, which may be 2 or 3 dimensions. By comparing the signal distribution with the positional relationship of the anatomical organs or the structural information of the tissues such as CT images, MRI images, and ultrasonic images, it is possible to find out from which tissue the signal is emitted. When the signal distribution changes over time, the signal distribution in the method may be a certain time point, or may be an operator for a certain period. When the presence of the target cell is expanded according to the development of the disease, the expansion of the signal distribution may be an indicator of the presence or development of the disease, and conversely, the reduction of the signal distribution may be an indicator of disease improvement.

In the method of the present invention, signal strength and signal distribution can also be combined for evaluation. By evaluating at what position a signal of how strong the intensity is detected, more accurate decisions and more accurate information can be provided.

The monitoring method of the present invention may further include comparing the detection result of the mark at the first time point with the detection result of the mark at the second time point after the first time point. For example, when the detection result is an index on the number of target cells (for example, signal intensity from a marker phagocytized to a target cell, signal distribution, etc.), the index at the second time point is smaller than the index at the first time point. It means that the number of target cells is reduced. If the disease associated with the target cells is worsened by the proliferation of the target cells, it means that the disease associated with the target cells has been improved. For example, here, if the signal intensity at the 2nd time point is lower than the signal intensity at the 1st time point, it is possible to propose a knot in which the disease is improving. Conversely, if the signal intensity at the 2nd time point is stronger than the signal intensity at the 1st time point, it can be said that the disease is worsening. Further, for example, if the signal distribution in the second time point is smaller than the signal distribution in the first time point, it is possible to propose a result that the disease is improving, and conversely, if the signal distribution in the second time point is smaller than that in the first time point If the signal distribution is to be expanded, it can be said that the disease is deteriorating.

The evaluation method of the present invention may further include a detection result of the mark at the first time point before the treatment, and a detection result of the mark at the second time point after the treatment after the first time point, or after the first treatment The detection result of the mark at the first time point is compared with the detection result of the mark at the second time point after the second treatment performed after the first treatment. For example, when the detection result is an index on the number of target cells (for example, signal intensity from a marker phagocytized to a target cell, signal distribution, etc.), the index at the second time point is smaller than the index at the first time point. It means that the number of target cells is reduced. If the disease associated with the target cells is caused by the proliferation of the target cells, the disease associated with the target cells has been improved, that is, the treatment is treated. The effect is positive. For example, if the signal intensity at the second time point is lower than the signal intensity at the first time point, the disease is improved by the treatment. Therefore, it is possible to propose that the treatment is progressing to success, and conversely, if the second When the signal intensity at the time point is stronger than the signal intensity at the first time point, the disease is deteriorated due to the treatment, and the result that the treatment is not successful or unsuccessful can be proposed. Further, for example, if the signal distribution in the second time point is smaller than the signal distribution in the first time point, the disease is improved by the treatment, and therefore, the result of the treatment being successful is proposed, and conversely, The signal distribution at 2 o'clock is the first time The distribution of the signal in the point is to be expanded, and the disease is deteriorating due to disposal, and the result of the treatment being less successful or unsuccessful can be proposed.

As used herein, the term "subject" refers to any biological individual, preferably an animal, more preferably a mammal, and even more preferably a human individual. In the present invention, the subject can be used as a sound (for example, without a specific or arbitrary disease), or as a patient suffering from certain diseases, but each of them is planning, checking, diagnosing, monitoring, etc. of the disease associated with the target cell. Typically, it refers to a subject suffering from or at risk of developing the disease; in the case of planning an evaluation of the effect of treatment of a disease associated with a target cell, it is typically referred to receiving treatment for the disease, or positive The object to accept.

[Examples]

The invention is illustrated in more detail by the following examples, which are intended to be illustrative and not restrictive.

<Example 1> Preparation of Targeted Molecule-Carrier Complex

As a target molecule, the following peptides were prepared:

All of the above peptides were obtained from Sigma-Genosys. As a positive control, vitamin A (all-trans retinol, Sigma Aldrich) was prepared. Vitamin A was dissolved in DMSO at a concentration of 10 mM to prepare a stock solution, which was stored frozen until use. As the carrier bound target molecules respectively containing the prepared liposome-forming cationic lipid LipoTrust ^TM SR DC-6-14 is (Hokkaido System Science), as a drug supported on a carrier, were prepared for the HSP47 of siRNA (HSP47C, Hokkaido System Science). The sequence of the siRNA is shown below (in the sequence, the small text indicates RNA, and the large text indicates DNA).

Stock: 5’ ggacaggccucuacaacuaTT 3’ (sequence number 14)

Antisense stock: 5’ uaguuguagaggccuguccTT 3’ (sequence number 15)

The siRNA was dissolved in nuclease-free water (Ambion, Cat. No. AM9937) at a concentration of 10 mg/ml to prepare a stock solution, which was stored frozen and used.

The liposome solution 10μl placed in microfuge tubes, the liposome solution is LipoTrust ^TM SR average cationic lipid is dissolved in a concentration of 1mM nuclease-free water (Ambion, Cat.No.AM9937) are obtained, for This was added 1 μl of a stock solution of each of the above peptides dissolved in DMSO at a specific concentration (for the experiment shown in Fig. 1 , 1.1 mM, 1.25 mM, 2.5 mM, 3.4 mM, 5 mM or 10 mM; 2 shows the results of the experiment, is 90 mM) or the above vitamin A stock solution, stirred with a vortex mixer for 15 seconds. To the mixture, 1.5 μl of the above siRNA stock solution was added and mixed, and then 17.5 μl of a 5% aqueous glucose solution (5% of sucrose solution, Otsuka Pharmaceutical Co., Ltd.) was added and mixed. The liposome-peptide (or vitamin A)-siRNA complex (lipoplex) solution thus obtained was allowed to stand at room temperature for 15 minutes. Further, as a control, a mixture was also prepared LipoTrust ^TM SR free of peptides with the siRNA.

<Example 2> Introduction of siRNA to stellate cells

Two days before the introduction of siRNA, hepatic stellate cells (HSC) prepared from rat liver were prepared according to the method of Schaefer et al. (Schaefer et al., Hepatology. 1987 Jul-Aug; 7(4): 680-7). ), uniformly seeded on a 6-well plate at a density of 0.2 × 10 ⁵ /well, and cultured in a serum containing 10% fetal bovine serum (Thermo HyClone, Cat. No. SH30070.03), 2% L-glutamate Acid (Sigma Aldrich, Cat. No. G7513) and 1% penicillin-streptomycin (Sigma Aldrich, Cat. No. G1146) Dulbecco's Modified Eagle Medium (D-MEM, Sigma Aldrich, Cat. No. D6546, below It is called "medium").

The medium was removed, and 900 μl of the medium was re-added to each well, and cultured at 37 ° C for 30 minutes or more. 100 μl of a 5% glucose aqueous solution was added to 30 μl of each of the various lipoplex solutions obtained in Example 1 to obtain 130 μl of the mixed solution, and 100 μl of the solution was added to the corresponding well. The final concentration of siRNA at this time was 11.5 μg/ml. After incubating at 37 ° C, 5% CO _{2 for} 30 minutes, the medium containing the lipoplex solution was removed, and the medium was replaced with a medium for 24 to 36 hours.

The extraction of total RNA from each sample was carried out using an RNeasy Mini kit (Qiagen). The medium was first removed, and a solution of RLT/2ME was prepared by mixing 2-mercaptoethanol (2ME, Wako) 1% (v/v) in a RLT solution attached to the RNeasy Mini kit beforehand, and this solution was injected at 350 μl per well. The total amount of cell lysate was homogenized by QIAshredder (Qiagen), and after centrifugation at 12000 rpm for 2 minutes at 4 ° C, total RNA was extracted according to the manufacturer's instructions. The obtained RNA was quantified by NanoDrop 2000 (Thermo Fisher Scientific), and cDNA was synthesized by RT-PCR. The reaction solution is composed of a mixture of 4 μl of a reverse transcriptase mixture (Super Script VILO Master Mix, Invitrogen, 11755-250) and 16 μl of total RNA (containing 100 to 500 ng of RNA) of each sample, respectively. The reaction was carried out at 25 ° C for 5 minutes, at 42 ° C for 60 minutes, and then at 85 ° C for 5 minutes, and then at 4 ° C.

The inhibition of HSP47 expression was analyzed by quantitative PCR. As a standard template, a 10-fold dilution series (stock solution, 10-fold dilution solution, and 100-fold dilution solution) using untreated cell samples was used. In each well of MicroAmp (Optical 96-well Reaction Plate, Applied Biosystems, Cat. No. 4306737), 22 μl of sterile water, 25 μl of Power SYBR ^(R) Green (Applied Biosystems, Cat. No. 4367669) and primers were added. A mixture of 1 μl of a mixture of 48 μl of premix was prepared. The primer mixes each contained 50 μM of the primer set for HSP47 shown below or for GAPDH which is an internal standard gene.

Rat HSP47: 5' TGACCTGCAGAAACATCTGG 3' (forward primer, SEQ ID NO: 16)

5' AGGAAGATGAAGGGGTGGTC 3' (reverse primer, SEQ ID NO: 17)

GAPDH (internal standard, common to humans and rats)

5' ACCATCTTCCAGGAGCGAGA 3' (forward introduction, sequence number 18)

5' GCATGGACTGTGGTCATGAG 3' (reverse primer, sequence number 19)

In the corresponding wells, 2 μl of the template cDNA obtained from each sample was added, and the total amount was 50 μl. The disk was sealed with a film, and placed in an instant quantitative PCR device (7300 Real Time PCR System, Applied Biosystems), and reacted under the conditions of the following table.

[Table 2]

The results are shown in Figures 1~2. The graph shows the relative expression amount of HSP47 relative to GAPDH in each condition by treating untreated cells as 100. The smaller the value, the more the expression of HSP47 is suppressed, that is, the siRNA has been introduced efficiently. As shown in the first graph, in the case where the loop 1 and the loop 2 were used as the target molecules, the inhibition of the expression of the concentration-dependent HSP47 was observed, and in particular, the loop 1 was used as the target molecule. The inhibition rate caused by the complex showed that it was comparable to the sample of vitamin A. Further, as shown in the second graph, a peptide having a length of one amino acid gradually reduced from the N-terminus and the C-terminus of the loop 1 (peptide No. 10 and No. 10-1 to 10-6) was obtained. The inhibition rate caused by the complex used as a target molecule was shown to be comparable to that of Ring 1 and Vitamin A. The table below is a numerical example of the results shown in Figure 2.

[table 3]

*VA was at a final concentration of 7.7 μM, and each peptide was used at a final concentration of 69.2 μM.

As a result of the above, it is useful to display a peptide comprising a sequence of a cell binding portion of RBP as a target molecule for specifically delivering a drug or the like to a stellate cell.

<Example 3> Targeting by mutated peptide

In order to verify whether the targeting of stellate cells by RBP loop 1 is caused by the amino acid composition of the peptide or by the amino acid sequence, the rat liver star is used respectively. As the cells, the same experiment as in Example 2 was carried out using RBP loop 1 and the mutant peptide shown in the following table as the peptide. The lipoplex containing each peptide was prepared in the same manner as in Example 1 using a 10 mM peptide solution in DMSO, and the final concentration of the peptide was 7.7 μM, and the final concentration of the siRNA was 11.5 μg/ml. Contains holes in rat hepatic stellate cells.

[Table 4]

In addition, the mutant peptide 1 is substituted with the third amino acid of RBP ring 1 as glutamic acid, and the sixth glutamic acid is substituted with lysine; the mutant peptide 2 is the third lysine. Substituted as aspartic acid, the fourth aspartic acid was substituted with lysine; the mutant peptide 3 was replaced by the third lysine to aspartic acid, and the 12th aspartic acid was replaced by Amino acid. Thus, these variant peptides are identical in composition to the RBP ring 1 in the amino acid but differ in the amino acid sequence.

From the results shown in Fig. 3, since either of the groups using the mutant peptides 1, 2 and 3 as the target molecules is used, the RBP loop 1 is used as the target molecule. In contrast, the HSP47 gene showed a lower degree of inhibition, suggesting that the inhibition of gene expression is not the amino acid composition of RBP ring 1, but the amino acid sequence itself is more important.

<Example 4> Targeting of a mimetic by a peptide

In order to verify the peptide mimetic of the cell-binding portion of RBP, whether it acts as a target molecule for stellate cells, and using rat hepatic stellate cells as cells, respectively, using the reverse-reverse of RBP loop 1 Peptide (RI: d-INDQLFLGEPDKKA-decalamine (a peptide consisting of D-amino acid having the sequence opposite to SEQ ID NO: 3)) as a peptide mimetic, using RBP loop 1 (L1: sequence numbering) 3) As a control peptide, enter The same experiment as in Example 2 was carried out. In addition, the lipoplex containing each peptide was prepared in the same manner as in Example 1 using a 30 mM peptide solution in DMSO, and the final concentration of the peptide was 23.1 μM, and the final concentration of the siRNA was 11.5 μg/ml. Add to wells containing rat hepatic stellate cells.

From the results shown in Fig. 4, it is understood that the reverse-reverse type peptide has almost the same targeting ability as the RBP ring 1. The reverse-reverse type peptide has a spatial three-dimensional structure (topological structure) similar to the side chain of the parent peptide, and thus the result shows that it has the label of the stellate cell as described in Examples 1 to 3. The peptide mimetic of the same side chain topology of the peptide that acts to target the molecule also acts as a target molecule for the stellate cells.

<Example 5> Targeting by chaotic peptides

In order to confirm the targeting of stellate cells by RBP loop 1, it is not dependent on the amino acid composition of the peptide, but depends on the amino acid sequence, and uses rat hepatic stellate cells as cells. RBP loop 1 (L1: SEQ ID NO: 3) was used as a test peptide, and a scrambled peptide (scr: AKFQKLEPGDDLNI, SEQ ID NO: 23) having the same composition as the amino acid of the test peptide but having a different amino acid sequence was used as a comparison. The peptide was subjected to the same experiment as in Example 2. In addition, the lipoplex containing each peptide was prepared in the same manner as in Example 1 using a 10 mM peptide solution in DMSO, and the final concentration of the peptide was 7.7 μM, and the final concentration of the siRNA was 11.5 μg/ml. Add to wells containing rat stellate cells.

From the results shown in Fig. 5, since the HSP47 gene expression rate was significantly lowered relative to the group in which RBP loop 1 was used as the target molecule, the scrambled peptide was used as the target molecule. In the group, almost the same as the result of the group (VA(-)) in which the target molecule is not used, it is taught that, on the target, the amino acid composition of the RBP ring 1 is not the amino acid. The sequence itself is more important.

<Example 6> Targeting cancer cells

In order to verify whether the peptide of the cell-binding portion of RBP acts as a target molecule for cancer cells, HT-1080 cells of human fibrosarcoma cell line were used as cells, respectively, and RBP loop 1 (L1: sequence) was used. No. 3) As a test peptide, the same experiment as in Example 2 was carried out using a scrambled peptide (scr: AKFQKLEPGDDLNI, SEQ ID NO: 23) as a negative control peptide. In addition, the lipoplex containing each peptide was prepared in the same manner as in Example 1 using a 10 mM peptide solution in DMSO, and the final concentration of the peptide was 7.7 μM, and the final concentration of the siRNA was 11.5 μg/ml. Add to wells containing HT-1080 cells. In addition, the following is used as the primer set for HSP47 (the introduction group for GAPDH is the human or rat common to the use example 2).

Human HSP47: 5' TGACCTGCAGAAACACCTGG 3' (forward primer, SEQ ID NO: 24)

5' AGGAAGATGAAGGGGTGGTC 3' (reverse primer, sequence number 25)

From the results shown in Fig. 6, it is understood that the peptide of the cell-binding portion of RBP acts as a target molecule for cancer cells in the same manner as vitamin A. Since vitamin A is known to act as a target molecule for various cancer cells (see Patent Document 2), the results show that the peptides and peptide mimetics described in Examples 1 to 4 are also various The target molecules of cancer cells act.

As a result of the results of the examples 1 to 6, the target molecule of the present invention has the targeting ability equivalent to the vitamin A described in Patent Documents 1 to 9 and Non-Patent Document 1, and can be successfully applied to this. The uses described in the literature, for example, are applied to the treatment, detection, imaging, and diagnosis of various organ fibrosis or neoplastic diseases; markers of cells such as stellate cells, myofibroblasts, cancer-associated fibroblasts, and tumor cells, Detection and imaging.

Numerous modifications can be made without departing from the spirit of the invention, as understood by those of ordinary skill in the art. Therefore, the form of the invention described in the specification is to be construed as illustrative only and not limiting the scope of the invention.

<110> Nitto Denko Corporation

<120> Targeting molecule and use thereof

<130> F2584NDFM

<150> JP 2014-075953

<151> 2014-04-02

<160> 25

<170> PatentIn version 3.5

<210> 1

<211> 941

<212> DNA

<213> Homo Sapiens

<400> 1

<210> 2

<211> 200

<212> PRT

<213> Homo Sapiens

<400> 2

<210> 3

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic RBP loop 1

<400> 3

<210> 4

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic RBP loop 2

<400> 4

<210> 5

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic RBP loop 3

<400> 5

<210> 6

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Peptide No. 10

<400> 6

<210> 7

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Peptide No. 10-1

<400> 7

<210> 8

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Peptide No. 10-2

<400> 8

<210> 9

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Peptide No. 10-3

<400> 9

<210> 10

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Peptide No. 10-4

<400> 10

<210> 11

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Peptide No. 10-5

<400> 11

<210> 12

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Peptide No. 10-6

<400> 12

<210> 13

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Peptide No. 10-7

<400> 13

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of Combined DNA/RNA Molecule: HSP47 siRNA sense Strand

<400> 14

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of Combined DNA/RNA Molecule: HSP47 siRNA antisense Strand

<400> 15

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> rat HSP47 forward primer

<400>16

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> rat HSP47 reverse primer

<400> 17

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> GAPDH forward primer

<400> 18

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> GAPDH reverse primer

<400> 19

<210> 20

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Variant peptide E3K6

<400> 20

<210> 21

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Variant peptide D3K4

<400> 21

<210> 22

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Variant peptide D3K12

<400> 22

<210> 23

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Scquet peptide

<400> 23

<210> 24

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> human HSP47 forward primer

<400> 24

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> human HSP47 reverse primer

<400> 25

Claims (19)

A target molecule that targets a target cell, wherein the target cell selects a group consisting of a free stellate cell, a myofibroblast, a cancer-associated fibroblast, a tumor cell, and a STRA6 expression cell, wherein The target molecule is selected to be free (1) a peptide comprising an amino acid sequence of a cell binding region of RBP, and (2) a variant of the peptide having the same targeting ability as the peptide of (1) The peptide, and (3) a group consisting of a peptide mimetic having the same targeting ability as the peptide of (1) or (2). The target molecule of claim 1, wherein the cell binding region is a loop of loop 1, loop 2, and loop 1 and loop 2 of RBP. The target molecule of claim 1 or 2, wherein the cell binding region comprises an amino acid sequence selected from SEQ ID NOs: 3 and 4. The target molecule according to any one of claims 1 to 3, which comprises an amino acid sequence selected from SEQ ID NO: 3, 4, and 6-13. The target molecule according to any one of claims 1 to 4, wherein the peptide mimetic is a reverse-reverse peptide based on the peptide of (1) or (2). A targeting agent, comprising the targeting molecule according to any one of claims 1 to 5, for targeting a target cell, wherein the target cell selects free stellate cells and myofibroblasts , a group consisting of cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells. A vector which delivers a substance to a target cell which has been targeted by a target molecule as described in any one of claims 1 to 5, wherein the target cell is selected from a stellate cell or a myofibroblast , a group consisting of cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells. A complex represented by the formula (1): XYZ (1) wherein X is a target moiety comprising the target molecule of any one of claims 1 to 5; Y is a binding moiety Z is a functional part comprising a substance selected from the group consisting of free drugs, markers and carriers. The complex of claim 8, wherein the carrier further comprises a drug and/or a label. A composition comprising a targeting molecule according to any one of claims 1 to 5, wherein the targeting agent according to claim 6 is as described in claim 7 A carrier of the carrier and the complex as described in claim 8 or 9. The composition according to claim 10, which comprises a drug for treating a disease associated with a target cell, wherein the target cell selects free stellate cells, myofibroblasts, cancer-associated fibroblasts, A group of tumor cells and STRA6 expressing cells. The composition of claim 11, wherein the disease is a group consisting of selecting a free fibrosis and a neoplastic disease. The composition of claim 10, comprising a drug for controlling the activity or proliferation of the target cell for controlling the activity or proliferation of the target cell, wherein the target cell selects free stellate cells, myofibroblasts, A group consisting of cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells. The composition of claim 10, which is used for delivering a substance to a target cell, the target cell comprising free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells. Group. The composition of claim 10, comprising a marker for labeling, detecting or imaging the target cell, wherein the target cell selects free stellate cells, myofibroblasts, cancer-associated fibroblasts, tumor cells and STRA6 represents a group of cells. The composition of claim 10, comprising a marker for inspecting, diagnosing or monitoring a disease associated with a target cell, the target cell being selected from a stellate cell, a myofibroblast, a cancer-associated fibroblast, a tumor A group of cells and STRA6 expressing cells. A method of treating a disease associated with a target cell selected from the group consisting of astrocytes, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells, Wherein the method comprises the steps of: administering a composition according to claim 8 or 9 or a composition according to claim 11 or 12 to an effective dose comprising a drug for treating the disease, or administering the composition according to claim 11 or 12 This is considered an essential object. A method for labeling, detecting or imaging a target cell or a tissue comprising the target cell, the target cell being selected from a stellate cell, a myofibroblast, a cancer-associated fibroblast, a tumor cell, and a STRA6 expression cell a group comprising: wherein the method comprises the steps of: administering a composition according to claim 8 or 9 or a composition according to claim 15 to an effective dose comprising the marker, For the necessary objects. A method for examining, diagnosing or monitoring a disease associated with a target cell selected from the group consisting of astrocytes, myofibroblasts, cancer-associated fibroblasts, tumor cells, and STRA6-expressing cells, wherein The method comprises the steps of administering a composition according to claim 8 or 9 or a composition according to claim 16 containing an effective dose of the marker to the subject deemed necessary.