TW201443230A - Microorganism having carbon dioxide fixation pathway introduced thereto - Google Patents

Abstract

Disclosed is a microorganism having a pathway comprising: an enzymatic reaction from glyoxylate to glycine; an enzymatic reaction from glycine to serine; and an enzymatic reaction from serine to pyruvate or 3-hydroxypyruvate. Disclosed is a microorganism having a pathway comprising: at least one enzymatic reaction selected from the group consisting of an enzymatic reaction from phosphoenolpyruvate and CO2 to oxaloacetate and an enzymatic reaction from pyruvate and CO2 to oxaloacetate; an enzymatic reaction from oxaloacetate to malate; an enzymatic reaction from malate to malyl-CoA; an enzymatic reaction from malyl-CoA to glyoxylate and acetyl-CoA; an enzymatic reaction from glyoxylate and pyruvate to 4-hydroxy-2-oxoglutarate; an enzymatic reaction from 4-hydroxy-2-oxoglutarate to 4-oxoglutaconate; and an enzymatic reaction from 4-oxoglutaconate to 2-oxoglutarate.

Description

Microbes with a fixed path of carbon dioxide

The present invention relates to a microorganism into which a carbon dioxide fixation path is introduced, and a method for producing a substance using the microorganism.

Acetyl-CoA is an extremely important intermediate in the metabolic pathway of microorganisms. A wide variety of metabolites are produced via acetaminophen A. Such a substance produced by the acetaminophen coenzyme A is known, for example, as L-glutamic acid, L-glutamic acid, L-proline, L-arginine, L-leucine, L- Amino acids such as isoleucine; acetic acid, propionic acid, butyric acid, caproic acid, citric acid, 3-hydroxybutyric acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2-hydroxyisobutyric acid Organic acids such as methacrylic acid and poly-3-hydroxybutyric acid; alcohols such as isopropyl alcohol, ethanol, and butanol; acetone, polyglutamic acid, and the like.

2-sided oxyglutaric acid (α-ketoglutaric acid) is also an extremely important intermediate in the metabolic pathway of microorganisms. From 2-sided oxyglutaric acid (α-ketoglutaric acid), it can be converted into various substances such as L-glutamic acid, L-glutamic acid, and L-arginine. 2-Phenyloxyglutaric acid is a metabolite on the TCA cycle (tricarboxylic acid cycle) produced by the sugar via Ethylene CoA.

Ethylene coenzyme A is produced in many microorganisms using sugars such as glucose as a carbon source. Sugar is converted to pyruvate via the Embden-Meyerhof pathway, the Entner-Doudoroff pathway, the five-carbon sugar phosphate pathway, etc., which is called the glycosylation pathway. Pyruvate is pyruvate decarboxylase or pyruvate-formate cleavage. The action of the enzyme (pyruvic acid-formic acid lyase) or the like is converted into acetaminophen coenzyme A. At this time, carbon dioxide or formic acid is produced as a by-product, so that not all of the carbon derived from the sugar is fixed to the acetaminophen coenzyme A. For example, if glucose is used as a starting material to produce 2-oxooxyglutaric acid, one molecule of 2-sided oxyglutaric acid is usually produced via acetaminophen A, at which time one molecule of CO _{2 is} released. . That is, the yield of acetaminophen coenzyme A affects the yield of various compounds produced by using acetaminophen coenzyme A as an intermediate product. Several studies have been conducted to re-fix carbon dioxide to increase the production of acetaminophen coenzyme A.

Within the microorganism, several pathways for fixing carbon dioxide as a carbon source are known (Applied and Environmental Microbiology, 2011; 77(6): 1925-1936). Specifically, a Calvin-Benson cycle, a reducing TCA cycle, a Wood-Ljungdahl route, a 3-hydroxypropionic acid cycle, a 4-hydroxybutyric acid cycle, etc. are mentioned. Calvin-Benson cycle present in the plant or bacterial photosynthesis, CO ₂ fixation system cycle consists of about 12 kinds of enzymes consisting of, from the ribulose-1,5-bisphosphate carboxylase (of RubisCO) fixed CO _2, and eventually the production of glycerol Aldehyde 3-phosphate. The reductive TCA cycle, which is a cycle observed by anaerobic or microaerobic bacteria such as green sulfur bacteria, is composed of 11 enzymes characterized by a CO ₂ fixing enzyme with ferredoxin as a coenzyme. (Acetyl-CoA carboxylase, 2-oxo-glutaric acid synthase, pyruvate is produced from CO ₂ by a reaction in the opposite direction to the usual TCA cycle. Wood- The Ljungdahl pathway is a pathway observed by anaerobic microorganisms such as acetic acid-producing bacteria. It consists of nine enzymes, which are used to reduce CO ₂ or coenzyme formic acid using formate dehydrogenase or CO dehydrogenase, and finally converted to acetamyl CoA. The 3-hydroxypropionic acid cycle is a cycle observed in the genus Chloroflexus, consisting of 13 enzymes, and immobilized CO ₂ by the action of acetaminophen A (procarbazine A) carboxylase. And acetaminophen coenzyme A is produced by the enzyme A (Kylonyl Coenzyme A), etc. The 4-hydroxybutyric acid cycle is present in the path of archaea, etc., using pyruvate synthase, B. Coenzyme A (procarbazine A) carboxylase, phosphoenolpyruvate carboxylase (p The reaction of hosphoenolpyruvic acid carboxylase fixes CO ₂ and produces acetaminophen coenzyme A via 4-hydroxybutyridinase A or the like.

Some people have reported some ideas to try to introduce a fixed carbon dioxide pathway into a useful compound to produce microorganisms and to produce useful substances. International Publication No. 2009/094485 and International Publications 2010/071697 discloses the proposal to produce acetaminophen coenzyme A from carbon dioxide using a microorganism introduced into a path similar to the path of the Wood-Ljungdahl of acetic acid bacteria. Further, International Publication No. 2009/046929 discloses that a microorganism introduced with a hydrogenase and a tetrahydrofolate lyase is used to produce lactic acid from carbon dioxide. Further, International Publication No. 2011/099006 proposes a cycle of fixing CO 2 via a carbonation fixation reaction on acetamidine CoA or a reduction reaction of propylene glycol Kyrene A. German Patent Application Publication No. 102007059248 teaches the production of acetamyl coenzyme A using a route similar to the 4-hydroxybutyric acid cycle.

However, the well-known carbonation fixed path, from the viewpoint of fixing CO 2 and producing a useful chemical derived from acetaminophen A, cannot be said to be efficient. For example, the Calvinist cycle is well known in the natural carbonation cycle of carbonation, but the reaction of RubisCO, which is fixed by carbon dioxide, is slow, and it is observed that the oxidative decomposition of such side reactions is not an efficient enzyme ( Journal of Bioscience and Bioengineering, 2002; 94(6): 497-505). The path disclosed by Wood-Ljungdahl, International Publication No. 2009/094485, the path disclosed in International Publication No. 2010/071697, and the path disclosed in International Publication No. 2009/046929, including the path of reducing CO ₂ to CO or formic acid However, the enzyme which catalyzes such a strong reduction reaction often acts only in a reducing environment, and the reduction reaction is difficult to achieve under normal conditions, and the enzyme is not easily introduced into microorganisms other than the absolutely anaerobic microorganism. The reductive TCA cycle, in the reduction reaction using pyruvate synthase and the reduction reaction using 2-oxo-glutaric acid synthase, requires the ferredoxin as a strong reducing power of the electron acceptor, and the reaction is difficult to carry out. The 4-hydroxybutyric acid cycle, the 3-hydroxypropionic acid cycle, the route described in International Publication No. 2009/046929, and the route described in International Publication No. 2011/099006, which utilizes the reduction of amber 醯Coenzyme A or the propylene dioxime coenzyme. A reduces the reduction reaction of such a carboxylic acid or its (thio) ester, but such a reaction is generally difficult in terms of an enzyme reaction, and it is desirable to avoid the fermentation path as much as possible (Nature, 2008; 451: 86-89). , Nature Chemical Biolory, 2011; 7: 445-452). The 4-hydroxybutyric acid cycle is a dehydration reaction by dehydration of 4-hydroxybutyrate coenzyme A or dehydration of 3-hydroxypropionic acid, but such a reaction often occurs in competition with a reverse reaction (hydration) if it is in water. problem. The 4-hydroxybutyric acid cycle, the 3-hydroxypropionic acid cycle, and the reductive TCA cycle use the action of propionate-coenzyme A synthase and pyruvate synthetase to convert the produced coenzyme A into a cycle. Other substances, so the point of view from the production of acetaminophen A is not considered to be efficient.

Furthermore, when introducing the above-mentioned cycle to a microorganism and attempting to produce a certain substance, it is necessary to consider the number of enzymes constituting the cycle, or the number of enzyme activities to be re-given. The more the enzymes that make up the cycle or the number of enzymes given, the more difficult it is to construct and control the circulation, and the burden on the microorganisms increases. For example, if the Wood-Ljungdahl path is to be introduced into Escherichia coli, at least 9 genes must be introduced. It is extremely difficult to introduce and construct a material production path in a manner that can control most of the genes in such a range. The circulation of a small number of enzymes is constructed by introducing a small number of genes, which is obviously advantageous in terms of the construction cycle and in combination with the material production path originally possessed by microorganisms.

Therefore, in order to fix CO ₂ and convert it to acetamyl coenzyme A, it is preferable that: 1) the activity of each enzyme constituting the cycle is sufficiently high, 2) the cycle of the enzyme containing no acetaminophen coenzyme A, and 3) the number of enzymes re-given Less, the cycle is simple and better. However, in the cycle of producing acetaminophen coenzyme A from CO ₂ reported so far, there is no cycle satisfying all the conditions of 1) to 3), and the lack of realization is lacking. Based on this, no microorganisms actually used in the industry have actually been given the enzyme activity as proposed in the above-mentioned literatures, and a carbon sequestration cycle has been constructed, and CO _{2 is} converted into acetamyl coenzyme A, and the acetaminophen A conversion is further performed. An example of a useful compound.

Moreover, the fixed path of carbonic acid reported so far, such as malonic acid semialdehyde, often passes through an intermediate having an aldehyde group which is highly toxic to living organisms. To date, there has been no path to satisfy the conditions of the above 1) to 3) and to pass such a substance having toxicity as an intermediate product having an aldehyde group. Moreover, when the purpose is to increase the production amount of 2-oxooxyglutaric acid, from the viewpoint of the production of 2-oxoethoxyglutaric acid, it is preferable not only to make the production of acetaminophen coenzyme A efficient, but also to It is possible to increase the efficiency of the pathway from acetamyl CoA to 2-sided oxyglutaric acid.

If the yield of the acetaminophen coenzyme A is increased, the yield of the substance derived from the acetaminophen coenzyme A (for example, glutamic acid, isopropyl alcohol, etc.) is also increased (International Publication No. 2012/069247). Thus the effect of CO ₂ is fixed path can be evaluated by an amount of material from the acetyl coenzyme A.

The present invention has been developed based on the above circumstances.

An object of the first invention is to provide a microorganism useful for efficiently producing ethylene coenzyme A by utilizing carbon dioxide. Further, an object of the first invention is to provide a method for producing an effective metabolite of acetaminophen coenzyme A and acetaminophen coenzyme A using the microorganism.

An object of the second invention is to provide a microorganism useful for producing 2-oxooxyglutaric acid with good efficiency by using carbon dioxide. Further, a second aspect of the invention provides a method for producing 2-oxoxyglutaric acid or glutamic acid using the microorganism.

The first invention for solving the above problems is as follows.

[A1] A microorganism having a pathway comprising an enzyme reaction selected from the group consisting of at least one of the following groups (a) and (b), and the following (c), (d), (e) , (f) and (g) the enzyme reaction, and the enzyme reaction selected from the following (h), the following (i), (j), (k) and (n) enzyme reactions, and the following (i And (j), (l), (m), and (n) at least one of the group consisting of: (a) an enzyme reaction of phosphoenolpyruvate to oxaloacetate; (b) acetone Acid to grass 醯 acetic acid enzyme reaction; (c) grass 醯 acetic acid to malic acid enzyme reaction; (d) malic acid to apple 醯 coenzyme A enzyme reaction; (e) apple 醯 coenzyme A to glyoxylic acid and acetamidine Coenzyme A enzyme reaction; (f) glyoxylic acid to glycine acid enzyme reaction; (g) glycine to serine acid enzyme reaction; (h) serine to pyruvate enzyme reaction; (i) (j) 3-hydroxypyruvate to glyceric acid enzyme reaction; (k) glyceric acid to 2-phosphoglycerate enzyme reaction; (l) glyceric acid to 3 - an enzyme reaction of phosphoglycerate; (m) an enzyme reaction of 3-phosphoglycerate to 2-phosphoglycerate; (n) an enzyme reaction of 2-phosphoglycerate to phosphoenolpyruvate.

[A2] The microorganism according to [A1], wherein the aforementioned (d), (e), and (f) are an enzyme reaction.

[A3] The microorganism according to [A1] or [A2], wherein the microorganisms which are not present in any of the following (o), (p), (q), (r) and (s), the following (o), ( None of p), (q), and (r) is given or given to one or more of the following (o), (p), (q), and (r), and生产能力Coenzyme A production capacity enhancement: (o) a fixed cycle of carbonic acid with a reaction of propionate A to malonate semialdehyde or 3-hydroxypropionic acid; (p) with acetamyl coenzyme A and CO ₂ to pyruvate a fixed cycle of carbonic acid for the reaction of the enzyme; (q) a fixed cycle of carbonic acid with an enzyme reaction of croton coenzyme A with CO ₂ to ethyl propylene dioxime coenzyme A or pentene dioxime coenzyme A; (r) having CO ₂ to formic acid The carbonic acid fixation cycle of the enzyme reaction; (s) is at least one selected from the group consisting of malate thiokinase and apple sputum coenzyme A lyase.

[A4] The microorganism according to any one of [A1] to [A3], which has an enzyme selected from at least one of the group consisting of the following (a2) and (b2), and the following (c2) The enzymes of (d2), (e2), (f2), and (g2), and the enzyme selected from the following (h2), the following (i2), (j2), (k2), and (n2), And at least one of the following groups of enzymes (i2), (j2), (l2), (m2), and (n2): (a2) is selected from the group consisting of pyruvate kinase and pyruvate carboxylase, At least one of a group consisting of phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase; (b2) pyruvate carboxylase; (c2) malate dehydrogenase; (d2) malate Thiokinase; (e2) apple 醯 coenzyme A lyase; (f2) glycine transaminase; (g2) glycine cracking system and serine hydroxymethyltransferase; (h2) serine dehydratase; (i2) a serine transaminase; (j2) hydroxypyruvate reductase; (k2) glycerate 2-kinase; (12) glycerate 3-kinase; (m2) phosphoglycerate mutase; (n2) enolase.

[A5] The microorganism according to any one of [A1] to [A4], which is obtained by imparting a malothiokinase, an apple coenzyme A lyase, and a glycine transaminase.

[A6] The microorganism according to any one of [A1] to [A5], wherein the microorganism belongs to a microorganism of the intestinal bacteria family or a microorganism belonging to a rod-shaped type.

[A7] The microorganism according to any one of [A1] to [A6], wherein the microorganism is a microorganism belonging to the genus Escherichia or a bacterium of the genus Pantoea, or a bacterium belonging to the genus Corynebacterium Microorganisms of coryneform bacteria.

[A8] A process for producing isopropanol comprising producing an isopropanol from a carbon source material using the microorganism of any one of [A1] to [A7].

[A9] A method for producing acetone, which comprises producing acetone from a carbon source material using the microorganism of any one of [A1] to [A7].

[A10] A method for producing glutamic acid, comprising producing a glutamic acid from a carbon source material using the microorganism according to any one of [A1] to [A7].

[A11] A method for producing acetaminophen coenzyme A, comprising the steps of: culturing a step of contacting a microorganism of any one of [A1] to [A7] with a carbon source material and culturing; recovering step, recovering the obtained by the contact The purpose of the production.

[A12] The method for producing a coenzyme A according to [A11], further comprising a supply step of at least one selected from the group consisting of carbonate ions, hydrogen carbonate ions, carbon dioxide gas, and a reducing agent. For the culture medium used for culture.

[A13] The method for producing a coenzyme A according to [A11] or [A12], further comprising a gas supply step of recovering a carbon dioxide-containing gas generated by the culture, and using the gas for culture Medium supply.

[A14] A method for producing a metabolite of acetaminophen coenzyme A as an intermediate product, comprising the steps of: culturing a step of contacting a microorganism of any one of [A1] to [A7] with a carbon source material and culturing; A recovery step that recovers the metabolites obtained from the contact.

[A15] The method for producing a metabolite of acetaminophen coenzyme A as an intermediate product according to [A14], further comprising a supply step, which is selected from the group consisting of carbonate ions, hydrogen carbonate ions, carbon dioxide gas, and a reducing agent. At least one of the groups is supplied to the culture medium used for culture.

[A16] a method for producing a metabolite of acetaminophen coenzyme A as an intermediate product according to [A14] or [A15], further comprising a gas supply step of recovering a carbon dioxide-containing gas generated by the culture, and This gas is supplied to a medium for culture.

[A17] The method for producing a metabolite of acetaminophen coenzyme A as an intermediate product according to any one of [A14] to [A16], wherein the metabolite of acetaminophen coenzyme A as an intermediate product is isopropyl alcohol, Acetone, or glutamic acid.

The second invention for solving the above problems is as follows.

[B1] A microorganism having a path of an enzyme reaction comprising the following (t), (u), (v), (w), (x), (y), and (z): (t) selected from the group consisting of phosphoric acid the enzyme reaction of at least one kind of the group consisting of enzymes pyruvate and CO ₂ reacted to oxaloacetic acid, pyruvic acid and the enzyme reaction with CO ₂ to oxaloacetic acid in it; (U) oxaloacetic acid to malic acid The enzyme reaction; (v) the enzyme reaction of malic acid to apple 醯 coenzyme A; (w) the enzyme reaction of apple 醯 coenzyme A to glyoxylic acid and acetamidine coenzyme A; (x) glyoxylic acid and pyruvic acid to 4- Enzyme reaction of hydroxy-2-oxo-glutaric acid; (y) enzyme reaction of 4-hydroxy-2-oxo- glutaric acid to 4-oxo-pentenoic acid; (z) 4-side oxygen The enzyme reaction of pentenoic acid to 2-oxoethoxyglutaric acid.

[B2] The microorganism according to [B1], wherein the enzyme reaction of the above (t) is selected from the group consisting of pyruvate kinase and pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate At least one of the groups consisting of carboxykinases The enzyme reaction of (u) is catalyzed by malate dehydrogenase, the enzyme reaction of (v) is catalyzed by malate thiokinase, and the enzyme reaction of (w) is catalyzed by apple coenzyme A lyase, (x The enzyme reaction is catalyzed by 4-hydroxy-2-oxo glutaric acid aldolase, and the enzyme reaction of (y) above is catalyzed by 4-hydroxy-2-oxoglutarate dehydratase, the aforementioned (z) The enzyme reaction is catalyzed by 4-sided oxyglutaconate reductase.

[B3] The microorganism of [B1] or [B2], wherein the microorganism belongs to a microorganism of the enterobacteriaceae or a microorganism belonging to a coryneform bacterium.

[B4] The microorganism according to any one of [B1] to [B3], wherein the microorganism is a microorganism belonging to the enterobacteria of the genus Pantoea, or a microorganism belonging to the bacterium of the genus Corynebacterium.

[B5] A method for producing 2-oxooxyglutaric acid, comprising the steps of: culturing a microorganism of any one of [B1] to [B4] in contact with a carbon source material, and culturing; recovering step, recycling The product of interest for this contact.

[B6] The method for producing 2-sided oxyglutaric acid according to [B5], further comprising a supply step selected from the group consisting of carbonate ions, hydrogen carbonate ions, carbon dioxide gas, and reducing agent At least one of the above is supplied to the culture medium used for culture.

[B7] The method for producing 2-sided oxyglutaric acid according to [B5] or [B6], further comprising a gas supply step of recovering a carbon dioxide-containing gas generated by the culture, and the gas is Medium supply for culture.

[B8] A method for producing glutamic acid, comprising the steps of: culturing, contacting a microorganism of any one of [B1] to [B4] with a carbon source material, and culturing; recovering step, recovering the obtained by the contact Gluten acid.

According to the first invention, there is provided a useful microorganism for producing acetamidine coenzyme A with good efficiency by using carbon dioxide. Further, according to the first aspect of the invention, the use of the microorganism described above for the production of acetaminophen coenzyme A and A method for producing a useful metabolite of acetaminophen coenzyme A.

According to the second invention, there is provided a useful microorganism for producing 2-oxooxyglutaric acid with good efficiency by using carbon dioxide. Further, according to the second aspect of the invention, there is provided a process for producing 2-oxoxyglutaric acid or glutamic acid using the microorganism.

Fig. 1 is a view showing the outline of the glycine path of the first invention.

Fig. 2 is a view showing the path of the enzyme on the glycine pathway of the first invention.

Figure 3A shows the amino acid conserved between microorganisms in the amino acid sequence of glycine transaminase.

Figure 3B shows the amino acid conserved between microorganisms in the amino acid sequence of glycine transaminase.

Figure 3C shows the amino acid conserved between microorganisms in the amino acid sequence of glycine transaminase.

Figure 3D shows the amino acid conserved between microorganisms in the amino acid sequence of glycine transaminase.

Figure 3E shows the amino acid conserved between microorganisms in the amino acid sequence of glycine transaminase.

Figure 3F shows the amino acid conserved between microorganisms in the amino acid sequence of glycine transaminase.

Figure 3G shows the amino acid conserved between microorganisms in the amino acid sequence of glycine transaminase.

Fig. 4 is a view showing the outline of the route of producing 2-oxooxyglutaric acid of the second invention.

Hereinafter, embodiments of the present invention will be described. The description and examples are illustrative of the invention and are not intended to limit the scope of the invention.

In the present specification, the term "step" means not only an independent step, but even if it cannot be clearly distinguished from other steps, it is included in the term as long as the intended purpose of the step can be achieved.

In the present specification, the numerical range represented by "~", the values stated before and after "~" each represent the range of the minimum and maximum values.

In the present invention, when the amount of each component in the composition is mentioned, when a substance which is present in each component of the composition is mostly present, unless otherwise specified, it means the total of the majority of the substances present in the composition. the amount.

<<First invention>>

The microorganism having a carbon dioxide fixation path via glycine according to the first aspect of the invention includes a microorganism including the following enzyme reaction (hereinafter also referred to as "acetamide coenzyme A producing microorganism"); and is selected from the following (a) and (b) An enzyme reaction of at least one of the group consisting of, and the following (c), (d), (e), (f), and (g) enzyme reactions, and an enzyme selected from the following (h) Reaction, group (i), (j), (k), and (n) enzyme reactions, and groups of (i), (j), (l), (m), and (n) enzyme reactions At least one of them.

(a) An enzyme reaction of phosphoenolpyruvate to oxaloacetate.

(b) The enzyme reaction of pyruvic acid to oxaloacetate.

(c) The reaction of the acetic acid to malic acid enzyme.

(d) The enzyme reaction of malic acid to apple coenzyme A.

(e) Enzyme reaction of cocoA to glyoxylic acid and coenzyme A.

(f) Enzymatic reaction of glyoxylic acid to glycine.

(g) An enzyme reaction of glycine to serine.

(h) Enzyme reaction of serine to pyruvate.

(i) Enzyme reaction of serine to 3-hydroxypyruvate.

(j) An enzyme reaction of 3-hydroxypyruvate to glycerate.

(k) Enzyme reaction of glycerate to 2-phosphoglycerate.

(l) An enzyme reaction of glycerate to 3-phosphoglycerate.

(m) an enzyme reaction of 3-phosphoglycerate to 2-phosphoglycerate.

(n) Enzyme reaction of 2-phosphoglycerate to phosphoenolpyruvate.

Acetyl coenzyme A first invention by producing microorganism having a predetermined path comprising the enzyme reaction, the glucose metabolism can produce the CO ₂ and be secured efficiently supplied from the outside of the CO _2. Further, the acetaminophen-CoA producing microorganism of the first invention can convert CO ₂ into acetamyl coenzyme A with good efficiency.

By producing a microorganism using the acetaminophen C of the first invention or a method for producing a microorganism using acetam coenzyme A, and by further imparting a predetermined enzyme activity to the microorganism, Good efficiency in the production of acetaminophen coenzyme A and useful metabolites from acetamyl coenzyme A (eg isopropanol, ethanol, acetone, citric acid, itaconic acid, acetic acid, butyric acid, (poly-) 3-hydroxybutyric acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2-hydroxyisobutyric acid, methacrylic acid, (poly)glutamic acid, glutamic acid, arginine, ornithine, citrulline, Leucine, isoleucine, valine, etc.).

<<2nd invention>>

The microorganism having a 2-sided oxyglutaric acid production route according to the second aspect of the invention (hereinafter sometimes referred to as "2-side oxyglutaric acid producing microorganism") has the following (t), (u), (v) , (w), (x), (y), and (z) microorganisms in the path of the enzyme reaction.

The at least one enzyme by a group of the reaction (t) is selected from ₂ enzyme phosphoenol pyruvate and oxaloacetic acid to react CO, and CO enzymes pyruvate and ₂ to oxaloacetic acid in the configuration of the reaction.

(u) The reaction of the acetic acid to malic acid enzyme.

(v) Enzyme reaction of malic acid to apple coenzyme A.

(w) Enzyme reaction of cocoA to glyoxylic acid and coenzyme A.

(x) Enzymatic reaction of glyoxylic acid and pyruvic acid to 4-hydroxy-2-oxo-glutaric acid.

(y) an enzyme reaction of 4-hydroxy-2-oxo glutaric acid to 4-oxomethoxyglutaryl.

(z) An enzyme reaction of 4-oxooxyglutaconic acid to 2-oxo-glutaric acid.

2- 2-oxo-glutaric acid invention by producing microorganism having a predetermined path comprising the enzyme reaction, the glucose metabolism can produce the CO.'S ₂ and be secured efficiently supplied from the outside of the CO _2. Further, the 2-sided oxyglutaric acid producing microorganism of the second invention can produce 2-oxooxyglutaric acid and glutamic acid with good efficiency.

The method for producing 2-oxooxyglutaric acid of the second invention is provided by the 2-side oxyglutaric acid producing microorganism of the second invention.

2-sided oxyglutaric acid is converted to glutamic acid by a transfer reaction of an amine group. Therefore, the production method of the glutamic acid of the second invention can be provided by the same method as the route of the glutamic acid fermentation described in the "Handbook of Fermentation" (Kyoritsu Publishing), etc., by the production of the microorganism of the 2-oxyloxyglutaric acid of the second invention. .

The meaning of the terms used in the present specification and the present invention will be described below.

In the present specification, "circulation" means switching from any substance on the path to another substance via a path, and finally converting to a path that is the same as the start.

In the present specification, "path" means a series of reactions caused by an enzyme reaction and/or a spontaneous chemical reaction in a fermentation tank. The path can be a loop or not. Therefore, the carbonic acid fixed path (carbon dioxide fixed path) includes a carbonic acid fixed cycle (carbon dioxide fixed cycle).

In the present invention, "carbon dioxide (CO ₂ ) fixation" refers to conversion of CO ₂ produced by sugar metabolism and/or CO ₂ supplied from the outside into an organic compound. CO ₂ can also be HCO ₃ ^- . In this specification, "carbon dioxide (CO ₂ ) fixation" is sometimes referred to as "carbonation fixation".

In the present invention, the term "enzyme" includes a "factor" which does not exhibit enzyme activity when not specified.

In the present invention, the "inactivation" of the enzyme activity refers to the activity of the enzyme measured by various existing measurement systems, and the enzyme activity of the microorganism before the inactivation is 100, which is 1/10 or less.

In the present invention, the "decrease" of the enzyme activity means a state in which the activity of the enzyme is significantly lowered when the gene encoding the enzyme is treated by the gene recombination technique, compared with the state before the treatment.

In the present invention, the "enhancement" of the enzyme activity broadly means that the activity of various enzymes in the microorganisms is enhanced after the strengthening. The method of the enhancement is not particularly limited as long as it can increase the activity of various enzymes of the microorganism, and it is reinforced by the enzyme gene introduced into the cell from outside the cell, and enhanced by the expression of the enzyme gene in the cell. And the combination of these.

In order to enhance the introduction of the enzyme gene from the outside of the cell into the cell, specifically, a gene encoding an enzyme which is more active than the enzyme originally possessed by the host is introduced from the cell of the host by gene recombination technology. In the cell, the enzyme activity is added by the introduced enzyme gene, or the enzyme activity of the host is replaced by the enzyme activity, and the number of enzyme genes originally introduced by the host or the enzyme gene introduced into the cell from the outside of the cell is increased. And combinations of these.

In the enhancement of the expression of the enzyme gene in the cell, the activation of the enzyme sequence which enhances the expression of the enzyme gene from the host cell into the cell and the activation of the enzyme gene retained by the host on the genome are mentioned. Sub-boosting enhances the expression of the enzyme gene, replaces the promoter of the enzyme gene retained by the host on the genome with other promoters to enhance the expression of the enzyme gene, and combinations thereof.

In the present invention, the "giving" of the enzyme activity is broadly defined as the activity of the enzyme which is introduced into the cell from the outside of the cell to the microorganism in which the enzyme gene is not found. The method to be administered is not particularly limited as long as it can provide the activity of the enzyme to be targeted to the microorganism, and can be carried out by a genetic recombination technique. Specifically, it can be exemplified by transformation using a plastid having an enzyme gene, introduction of an enzyme gene into a genome, and combinations thereof. The introduced enzyme gene may be either the same or a different species for the host cell.

The "energy" of the enzyme activity of the cycle or pathway of material metabolism refers to the result of giving enzyme activity, and functionally constructs a cycle or path of metabolism of the substance, which can be selected according to the host.

In the present specification, the carbonic acid fixation cycle "is not allowed to function even if it is provided", and refers to a microorganism which does not find a target enzyme activity, and introduces an enzyme gene from the outside and imparts an enzyme activity to the target, but the carbonic acid fixation cycle Does not work. "Carbonation fixed cycle does not work", the test using the calibrated CO ₂ can be utilized, and no label from CO ₂ is detected in the metabolites in the cycle or substances from such metabolites, or no circulation is observed. The substance of the metabolite in the middle is indirectly controlled by a phenomenon such as an increase in the sugar yield or the like.

The promoter used in the "enhancement" or "enhancement" of the enzyme activity is not particularly limited as long as it can express the gene, and a constitutive promoter or an inducible promoter can be used.

For the method of determining whether the microorganism has an enzyme gene to be a subject, for example, KEGG (Kyoto Encyclopedia of Genes and Genomes; http://www.genome.jp/kegg/) or NCBI (National Center for Biotechnology Information; http:/ /www.ncbi.nlm. Nih.gov/gene/) Information on the genetics of microbes. Further, the present invention uses only genetic information of microorganisms deposited by KEGG or NCBI.

In order to introduce a gene into the cell from outside the cell, it is necessary to prepare the genomic DNA, cleave and link DNA, transform, PCR (polymerase chain reaction), design and synthesis of oligonucleotides used as primers. The method can be carried out according to the usual methods known to those skilled in the art. These methods are described in Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989) and the like.

In the present invention, a term such as "genetic recombination technology" is used to cause a base sequence by inserting another DNA into a base sequence of a natural gene, or by substituting or deleting a part of a gene or a combination thereof. The changes are all included, for example, to obtain the result of the mutation.

In the present invention, a microorganism in which the activity of a factor or an enzyme is inactivated means a microorganism which is impaired in the activity of a factor or an enzyme by a certain method. Such microorganisms can be produced by disrupting, for example, a gene (gene disruption) encoded as the factor or enzyme.

In the gene disruption of the present invention, in order to prevent the function of a gene from being exerted, it is exemplified that a DNA is inserted into the gene, and a part of the gene is substituted or deleted, and the base sequence is mutated. As a result of gene disruption, for example, the gene cannot be transcribed into mRNA, the protein cannot be translated, or the amino acid sequence of the translated protein is mutated or deleted due to incomplete transcription of the transcribed mRNA, and the original function cannot be exerted.

The production of a gene disrupted strain can be carried out as long as it can obtain a strain that does not exhibit the damaged strain of the enzyme or protein. Methods for gene disruption are reported to have various methods (natural breeding, addition of mutants, ultraviolet irradiation, radiation irradiation, introduction of random mutations, insertion or transfer of transposons, site-specific gene disruption), but can only destroy a specific gene. The viewpoint is preferably to destroy the gene using the same recombination. Using the same method of recombination, documented in Journal of Bacteriology, 1985; 161(3): 1219-1221, Journal of Bacteriology, 1995; 177(6): 1511-1519, Proceedings of the National Academy of Sciences of the United States of America, 2000; 97(12): 6640-6645), those of ordinary skill in the art can readily implement these methods and their applications.

In the present invention, "not (born)" means that there is no host microorganism in nature.

In the present invention, "host" refers to a microorganism that is a subject to introduce one or more genes from the outside.

In the present invention, "host" refers to a result of introducing one or more genes from the outside, and is capable of exerting the function of the gene.

In the present invention, the "host" may also have a production route for useful metabolites. The "useful metabolite" in the present invention is a general term for the main metabolites in the metabolic pathway of microorganisms such as alcohols, amino acids, organic acids, and terpenes. The "host" has the ability to produce useful metabolites, as long as it has the ability to produce useful metabolites by using a method.

The enzyme classifications referred to in this specification are classified according to the report of the International Union of Biochemistry (IUB) Enzyme Committee. The "Enzyme Number" is based on the enzyme number reported by the IUB Enzyme Commission.

The "metabolic product of acetaminophen coenzyme A as an intermediate product" and "(useful) metabolite derived from acetamyl coenzyme A" in the present invention means a (useful) metabolite produced by acetaminophen coenzyme A in a metabolic pathway. The general term. As the alcohol, for example, isopropyl alcohol, ethanol, butanol. As the amino acid, for example: L-glutamic acid, L-glutamic acid, L-arginine, L-ornithine, L-citrulline, L-leucine, L-isoleucine , L-proline. As the organic acid, for example, 2-sided oxyglutaric acid, 3-hydroxybutyric acid, poly-3-hydroxybutyric acid, polyglutamic acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2 - Hydroxyisobutyric acid, methacrylic acid, citric acid, acetic acid, propionic acid, butyric acid, caproic acid, mevalonic acid, and the like. Terpenes such as isoprene, squalene, steroids, carotenoids and the like. Further, for example, acetone or the like can be mentioned.

The "production of acetaminophen coenzyme A" in the present invention means that a substance is converted into acetaminophen coenzyme A on a metabolic pathway. Acetyl-CoA is a metabolic intermediate that rapidly transforms into a wide variety of substances in the metabolic pathway. Therefore, the amount of acetaminophen coenzyme A does not necessarily increase, but it can be detected from acetaminophen A. The indirect effect of the CO ₂ -derived label of the substance or the substance derived from the coenzyme A is increased in sugar yield or the like. There are various factors for the conversion of acetaminophen A to other substances (the amount of coenzyme, base mass, metabolic change, etc.), so the production of acetaminophen A is not necessarily the same as all The amount of the substance derived from Coenzyme A is proportional, but if the production route for producing a specific substance from Ethylene Coenzyme A is strengthened, or the production path for producing a specific substance from Ethylene Coenzyme A is originally strong (for example, the production of glutamic acid described later) In the case of microorganisms, since the conversion efficiency of acetaminophen A to the downstream is not easily affected by external factors, the production efficiency of the specific substance can be regarded as an indicator of the production efficiency of acetaminophen A.

The "metabolic product of 2-sided oxyglutaric acid as an intermediate product" and "(useful) metabolite derived from 2-sided oxyglutaric acid" in the present invention means that the metabolic pathway is via 2- A general term for (useful) metabolites produced by oxoglutaric acid. In the present invention, "production of 2-oxooxyglutaric acid" means conversion of a substance to 2-sided oxyglutaric acid in a metabolic pathway.

The invention is described in more detail below.

<<Acetylamine A production microorganisms>>

The acetaminophen-CoA producing microorganism of the first invention has a simple and practical production route of acetaminophen coenzyme A which is converted to acetamyl-CoA by immobilizing CO ₂ . The route through the glycine (hereinafter sometimes referred to as "glycine path") possessed by the microorganism of the acetaminophen-CoA production of the present invention will be described with reference to Fig. 1 .

As shown in Fig. 1, the glycine pathway has an enzyme reaction selected from at least one of the group consisting of the following (a) and (b), and the following (c), (d), (e) , (f) and (g) the enzyme reaction, and the enzyme reaction selected from the following (h), the following (i), (j), (k) and (n) enzyme reactions, and the following (i At least one of the group consisting of enzyme reactions of (j), (l), (m), and (n).

(a) An enzyme reaction of phosphoenolpyruvate to oxaloacetate.

(b) The enzyme reaction of pyruvic acid to oxaloacetate.

(c) The reaction of the acetic acid to malic acid enzyme.

(d) The enzyme reaction of malic acid to apple coenzyme A.

(e) Enzyme reaction of cocoA to glyoxylic acid and coenzyme A.

(f) Enzymatic reaction of glyoxylic acid to glycine.

(g) An enzyme reaction of glycine to serine.

(h) Enzyme reaction of serine to pyruvate.

(i) Enzyme reaction of serine to 3-hydroxypyruvate.

(j) An enzyme reaction of 3-hydroxypyruvate to glycerate.

(k) Enzyme reaction of glycerate to 2-phosphoglycerate.

(l) An enzyme reaction of glycerate to 3-phosphoglycerate.

(m) an enzyme reaction of 3-phosphoglycerate to 2-phosphoglycerate.

(n) Enzyme reaction of 2-phosphoglycerate to phosphoenolpyruvate.

The above (a), for example, the reaction of the reaction by phosphoenolpyruvate carboxylase, the reaction of phosphoenolpyruvate carboxykinase, the reaction of pyruvate kinase and pyruvate carboxylase .

The aforementioned (b) is reacted, for example, by an enzyme of pyruvate carboxylase.

In the above (c), for example, an enzyme reaction via malate dehydrogenase.

The aforementioned (d), for example, is reacted by an enzyme of malic acid thiokinase.

In the above (e), for example, an enzyme reaction is carried out via an apple coenzyme A lyase.

In the above (f), for example, an enzyme reaction via glycine transaminase.

The above (g) is, for example, an enzyme reaction via a glycine cracking system and a serine hydroxymethyltransferase.

The aforementioned (h), for example, is reacted by an enzyme of a serine dehydratase.

The aforementioned (i), for example, an enzyme reaction via a serine transaminase.

The aforementioned (j), for example, an enzyme reaction via hydroxypyruvate reductase.

The aforementioned (k), for example, is mediated by an enzyme of glyceric acid 2-kinase.

The aforementioned (l), for example, is mediated by an enzyme of glycerate 3-kinase.

The aforementioned (m), for example, an enzyme reaction of a phosphoglycerate mutase.

The aforementioned (n), for example, is reacted with an enolase-based enzyme.

In the glycine pathway, the conversion of serine to pyruvate may be an enzyme reaction directly converted from serine (the reaction of (h) above) or an enzyme reaction via 3-hydroxypyruvate conversion (including The aforementioned (i) and its downstream reaction).

When the conversion of serine to pyruvate is an enzyme reaction (including the above (i) and its downstream reaction), which is converted by 3-hydroxypyruvate, the conversion of glyceric acid to 2-phosphoglycerate may be derived from glyceric acid. The directly converted enzyme reaction (the reaction of (k) described above) may also be an enzyme reaction (including the reactions of the above (1) and (m)) which is converted via 3-phosphoglycerate.

In addition, in the glycine pathway, pyruvic acid can be converted to acetaminophen coenzyme A by pyruvate to acetoin coenzyme A (preferably the enzyme reaction by pyruvate dehydrogenase), or via pyruvate to grass. The enzyme reaction of indoleacetic acid (the reaction of the above (b) is preferably an enzyme reaction by pyruvate carboxylase).

An ideal aspect of the microorganism having a glycine pathway in the present invention, comprising: an enzyme selected from at least one of the group consisting of the following (a2) and (b2), and the following (c2), (d2) , (e2), (f2) and (g2) enzymes, and enzymes selected from the following (h2), the following (i2), (j2), (k2) and (n2) enzymes, and the following ( At least one of the groups consisting of the enzymes of i2), (j2), (l2), (m2), and (n2). The enzyme reaction of the following enzymes on the glycine pathway is shown in Figure 2.

(a2) selected from the group consisting of pyruvate kinase (Pyk) and pyruvate carboxylase (Pyc), phosphoenolpyruvate carboxylase (Ppc), and phosphoenolpyruvate carboxykinase (Pck) At least one of them.

(b2) Pyruvate carboxylase (Pyc).

(c2) Malate dehydrogenase (Mdh).

(d2) Malate thiokinase (Mtk).

(e2) Apple coenzyme A lyase (Mcl).

(f2) Glycine transaminase (Gta).

(g2) Glycolic acid cleavage system (Gcs) and serine hydroxymethyltransferase (Shmt).

(h2) Serine dehydratase (Sda).

(i2) Serine transaminase (Sga).

(j2) hydroxypyruvate reductase (YcdW).

(k2) Glycerate 2-kinase (GarK).

(l2) Glyceric acid 3-kinase (GlxK).

(m2) Phosphoglycerate mutase (Gpm).

(n2) Enolase (Eno).

Among the above enzymes, Pyc, Ppc, and Pck serve as fixation of CO ₂ .

The material conversion in the glycine pathway shown in Figure 1 is explained in detail below.

Pyruvate carboxylase (Pyc) and phosphoenolpyruvate carboxylase (Ppc) are among the highly active classes of carbonate-fixed enzymes. For example, the specific activity of RubisCO for photosynthetic use in plants is about 3-20 U/mg (Journal of Biological Chemistry, 1999; 274(8): 5078-5082, Salvucci MEat al., Analytical Biochemistry, 1986; 153(1) :97-101) In contrast, it has been reported that pyruvate carboxylase or phosphoenolpyruvate carboxylase is 30 U/mg in coliforms and 100 to 150 U/mg in high (Journal of Biological Chemistry, 1972; (18): 5785-5792, Bioscience, Biotechnology, and Biochemistry, 1995; 59(1): 140-142, Biochimica et Biophysica Acta, 2000; 1475(3): 191-206).

Moreover, the glycine pathway does not contain an enzyme that consumes acetaminophen A. Therefore, the glycine pathway can be said to be an ideal path for immobilizing CO ₂ and converting it to acetamyl CoA.

The enzyme which consumes acetaminophen coenzyme A refers to an enzyme which is converted to another substance by using acetaminophen coenzyme A as a substrate, for example, acetaminophen coenzyme A carboxylase and pyruvate synthase. The enzyme which does not have the aforementioned consumption of acetaminophen coenzyme A in the circulation means a closed cycle in which the acetaminophen coenzyme A is returned to the acetaminophen coenzyme A via the cycle without the enzyme which consumes the acetaminophen coenzyme A. Further, the substance which is converted by the enzyme which consumes the acetaminophen coenzyme A does not return to the acetaminophen coenzyme A but is converted into another product (for example, when the final product of the isopropanol production path is converted to isopropanol), Due to the non-closed cycle, it is not included in the "cycle containing enzymes that consume acetaminophen A." Closed circulation refers to the conversion from any substance in the cycle to another substance through the cycle, and finally to a cycle of the same substance as the original.

Acetyl Coenzyme A carboxylase is classified as enzyme No. 6.4.1.2, which is a generic term for the enzyme which is converted from acetaminophen A and CO ₂ to propionate coenzyme A.

Pyruvate synthase is classified as enzyme No. 1.2.7.1, which is a generic term for an enzyme that converts acetaminophen A to pyruvate.

Furthermore, the benefits of the glycine pathway can be exemplified by the fact that it is independent of the glycosylation system and can be combined with various other glycolytic pathways. For example, the production of NADPH in the five-carbon sugar/phosphoric acid pathway is high, and it is commonly used in the production of substances (Japanese Patent Publication No. 2007-510411), which is independent of the glycine pathway and can be easily combined.

In the glycine pathway, malate dehydrogenase (Mdh) and hydroxypyruvate reductase (YcdW) consume NADH (or NADPH) as a reducing power. When glyoxylic acid is converted to glycine, the glycine dehydrogenase is directly or indirectly consumed by other amino acids by using an aminotransferase such as glyoxylamine transferase, which is equivalent to 1 NADH. (or NADPH) reducing power. The glycine cracking system consumes NAD ⁺ (or NADP ⁺ ) and is converted to NADH (or NADPH). When converting a serine to 3-hydroxypyruvate, NAD ⁺ is indirectly consumed by other amino acids by using a serine dehydrogenase directly or by using an aminotransferase such as a serine aminotransferase. Or NADP ⁺ ) and convert to NADH (or NADPH).

Malate thiokinase (Mtk), glycerate 2-kinase (GarK), glycerate 3-kinase (GlxK), and pyruvate carboxylase (Pyc) consume ATP. When ammonia is incorporated into the metabolic system, ATP is sometimes consumed. Pyruvate kinase (Pyk) produces ATP.

Therefore, the glycine acid pathway is in the case of using phosphoenolpyruvate as a starting material, "phosphoenolpyruvate + 2 coenzyme A + CO ₂ + 3 NAD (P) H + 3 ~ 5 ATP → 2 B醯Coenzyme A+3NAD(P) ⁺ +3~5ADP”. In the case of using pyruvic acid as a starting material, it is "pyruvate + 2 coenzyme A + CO ₂ + 3 NAD (P) H + 4 ~ 6 ATP → 2 acetamyl coenzyme A + 3 NAD (P) ⁺ + 4 ~ 6 ADP".

In the fermentation route using acetaminophen coenzyme A as an intermediate product, the budget of the oxygen-consuming route during fermentation is shown in Table 1. In these fermentations, it is assumed that a reduced coenzyme such as NADH is generated on the fermentation path and that it returns to the oxidized coenzyme due to the action of oxygen. Therefore, if the produced reduced coenzyme can be consumed by the glycine path without being consumed by oxygen, the reducing power generated in the fermentation can be effectively utilized in the production cycle of the acetaminophen coenzyme A, and it can be expected that the CO ₂ is fixed and converted into a product.

The above-mentioned reduced coenzymes, such as NADH, NADPH, FADH ₂ , FMNH ₂ , reduced hydroquinone coenzymes and the like, are involved in redox coenzymes and refer to reduced state coenzymes. The above reduced coenzyme preferably means NADH or NADPH, more preferably NADH. The oxidized coenzyme is an oxidized form of a reduced coenzyme, such as NAD ⁺ , NADP ⁺ , FAD, FMN, oxidized hydroquinone coenzyme, etc., preferably NAD ⁺ or NADP ⁺ , more preferably NAD ⁺ .

As shown in Table 1, the fermented fermentation on the left side of the fermentation often requires a large amount of oxygen, so a large amount of ventilation and strong agitation are required, which is related to an increase in equipment costs or electricity costs. If the glycine pathway is introduced into the material production system, excess reducing power can be consumed instead of oxygen consumption, so that excessive aeration and agitation can be alleviated, and the cost of fermentation production can be expected.

In order to complement the reducing power of the glycine pathway, the reducing power can also be imparted by adding a substance capable of generating a reducing power or supplying energy from the outside. For example, a substance having a high degree of reduction (for example, hydrogen, a sulfite, an alcohol, or a paraffin) is used as a substrate, a reducing energy is directly supplied by electro-culture, a reducing power is supplied by a photochemical reaction of a living body, or the like. If it can supplement the reducing force from the outside, even if it is not The fermentation of the reduced coenzyme is generally produced in Table 1, and the carbonation fixation path of the present invention can also be driven.

The enzyme contained in the glycine pathway of Fig. 1 will be described in detail below (see Fig. 2).

Pyruvate kinase (Pyk), classified as the enzyme number 2.7.1.40, is a generic term for the enzymes that produce pyruvate and ATP from phosphoenolpyruvate and ADP. For example, Corynebacterium glutamicum and other Corynebacterium bacteria, Escherichia coli and other Escherichia bacteria, Pantoea ananatis and other Pantoea bacteria sources.

As the pyruvate kinase gene (pyk), a DNA having a base sequence encoding a gene of pyruvate kinase obtained from the above microorganism, or a synthetic DNA sequence synthesized based on a known base sequence can be used. The DNA having a base sequence of a gene belonging to the genus Corynebacterium such as Corynebacterium glutamicum, Escherichia coli such as Escherichia coli, or Pantoea ananatis is exemplified.

Pyruvate carboxylase (Pyc) is classified as enzyme No. 6.4.1.1, which is a generic term for an enzyme that converts pyruvate and carbon dioxide into oxaloacetate. During the reaction, ATP is consumed and ADP and phosphoric acid are produced. For example, from the bacterium belonging to the genus Corynebacterium such as Corynebacterium glutamicum, and Mycobacterium smegmatis (Mycobacterium smegmatis).

As the gene (pyc) of pyruvate carboxylase, a DNA having a base sequence encoding a gene of pyruvate carboxylase obtained from the above microorganism, or a synthetic DNA sequence synthesized based on a known base sequence can be used. The DNA which has a base sequence of a gene of a bacterium belonging to the genus Mycobacterium such as Corynebacterium glutamicum or Mycobacterium smegmatis (Mycobacterium smegmatis) is exemplified.

Phosphoenolpyruvate carboxylase (Ppc) is classified as the enzyme number 4.1.1.31, which is a generic term for converting phosphoenolpyruvate and carbon dioxide into an enzyme of oxalic acid and phosphoric acid. For example, from Corynebacterium glutamicum and other Corynebacterium bacteria, Escherichia coli and other Escherichia bacteria, Pantoea ananatis and other Pantoea bacteria, Hyphomicrobium methylovorum (Hyphomicrobium) Methylovorum), such as Hyphomicrobium, Starkeya novella (Starkeya novella), Starkeya, Rhodopseudomonas sp. (Rhodopseudomonas sp.), Rhodopseudomonas, Streptomyces coelicolor (Streptomyces coelicolor), etc. Streptomyces is a bacterium.

As the gene (ppc) of phosphoenolpyruvate carboxylase, a DNA having a base sequence encoding a gene encoding phosphoenolpyruvate carboxylase obtained from the above microorganism, or a base sequence according to the known one can be used. Synthetic synthetic DNA sequence. The ideal ones include bacteria of the genus Corynebacterium such as Corynebacterium glutamicum, bacteria of the genus Escherichia such as Escherichia coli, Pantoea ananatis, Hyphomicrobium methylovorum (Hyphomicrobium methylovorum), and Hypomicrobium, Starkeya novella. (Starkeya novella), such as Starkeya genus, Rhodopseudomonas sp. (Rhodopseudomonas sp.) and other Rhodopseudomonas genus bacteria, Streptomyces coelicolor (Streptomyces coelicolor) and other strains of the gene of the genus Streptomyces DNA.

Phosphoenolpyruvate carboxykinase (Pck) is classified as the enzyme number 4.1.1.32, the enzyme number 4.1.1.38, and the enzyme number 4.1.1.49, which is a generic term for the enzyme which converts phosphoenolpyruvate and carbon dioxide into oxaloacetate. At this time, the enzyme number 4.1.1.32 is accompanied by a reaction for converting GDP into GTP, the enzyme number 4.1.1.38 is accompanied by a reaction for converting phosphoric acid into pyrophosphoric acid, and the enzyme number is 4.1.1.49, and ADP is converted into ATP. For example, from the genus Actinobacillus, such as Actinobacillus succinogenes (Actinobacillus succinogenes), Mycobacterium genus such as Mycobacterium smegmatis (Mycobacterium smegmatis), and trypanosoma such as Trypanosoma brucei (Trypanosoma brucei).

The phosphoenolpyruvate carboxykinase gene (pck) can be synthesized by using the DNA of the base sequence of the gene encoding the phosphoenolpyruvate carboxy kinase obtained from the above microorganism or by synthesizing the base sequence thereof. DNA sequence. Ideally, Actinobacillus succinogenes (Actinobacillus succinogenes) and other actinomycetes, Mycobacterium Smegmatis (Mycobacterium smegmatis) and other species of the genus Trypanosoma, Trypanosoma brucei (Trypanosoma brucei) and other species of the genus Trypanosoma.

Malate dehydrogenase (Mdh) is classified as the enzyme number 1.1.1.37, which is a generic term for the enzyme that produces malic acid from grass phthalic acid using NADH. For example, from Corynebacterium glutamicum and other bacteria of the genus Corynebacterium, such as Escherichia coli.

The malic acid dehydrogenase gene (mdh) can be obtained by using the DNA of the base sequence of the gene encoding the malate dehydrogenase obtained from the above microorganism or a synthetic DNA sequence synthesized by a known base sequence. The ideal one is, for example, a DNA having a base sequence of a gene derived from Corynebacterium glutamicum, a bacterium belonging to the genus Escherichia such as Escherichia, and a gene derived from a Pantoea bacterium such as Pantoea ananatis.

Malate thiokinase (Mtk) is classified as enzyme No. 6.2.1.9, which is a generic term for the enzyme that converts malic acid and coenzyme A into apple 醯 coenzyme A. In the reaction, one molecule of ATP is consumed, and one molecule of ADP and phosphoric acid are produced. This enzyme consists of a major unit of about 400 amino acids and a small unit of 300 amino acids. There are usually large-order units and small-order units in the gene. In this specification, for the sake of simplicity, the large-order unit is mtkB, and the small-order unit is mtkA. As a specific activity of this enzyme, an example of a purified enzyme of 2.5 U/mg has been reported (Analytical Biochemistry, 1995; 227(2): 363-367).

Malate thiokinase is a pathway of utilization mainly found in C1 carbon sources such as methane (Journal of Bacteriology, 1994; 176(23): 7398-7404) and 3-hydroxypropionic acid pathway (Archives of Microbiology, 1989; 151: 252-256). ) the enzyme. In the genome, the apple chymase A lyase gene is present in the vicinity of the malate thiokinase gene, and the malic acid thiokinase gene present in this manner is ideal.

Malate thiokinase, for example, Methylobacterium extorquens (Methylobacterium extorquens) and other sources of Methylobacteria (SEQ ID NO: 1 and SEQ ID NO: 2), Hyphomicrobium methylovorum (Hyphomicrobium methylovorum) (SEQ ID NO: 3 and SEQ ID NO: 4), Hyphomicrobium denitrificans (Hyphomicrobium denitrificans) (SEQ ID NO: 5 and SEQ ID NO: 6) and other sources of Hyphomicrobium, Rhizobium sp. (Rhizobium sp.) NGR234 and other Rhizobium sources (SEQ ID NO: 7 and SEQ ID NO: 8), Granulibacter Sources of genus Nitrosomonas such as Bethesdensis (Granulibacter bethesdensis) (sequence number 9 and SEQ ID NO: 10), Nitrosomonas europaea (Nitrosomonas europaea), etc. (SEQ ID NO: 11 and SEQ ID NO: 12), Methylococcus capsulatus (Methylococcus capsulatus), etc. Methylococcus species (SEQ ID NO: 13 and SEQ ID NO: 14), gammaproteobacteria border source (SEQ ID NO: 15 and SEQ ID NO: 16).

As the malate thiokinase, from the viewpoint of the production efficiency of the useful substance via the acetaminophen coenzyme A, the source of the genus Hyphomicrobium (SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6) is particularly preferred. , Rhizobium source (SEQ ID NO: 7 and SEQ ID NO: 8), Nitrosomonas source (SEQ ID NO: 11 and SEQ ID NO: 12), Methylococcus origin (SEQ ID NO: 13 and SEQ ID NO: 14), and gammaproteobacteria Source (sequence number 15 and serial number 16).

Hyphomicrobium source (sequence number 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6), Rhizobium source (SEQ ID NO: 7 and SEQ ID NO: 8), and Nitrosomonas source (sequence) Each of the malate thiokinases of No. 11 and SEQ ID NO: 12) has 65% to 80% identity with each other. Methyl thiol kinase (SEQ ID NO: 13 and SEQ ID NO: 14) derived from Methylococcus is 70% to 80% identical to malate thiokinase (SEQ ID NO: 15 and SEQ ID NO: 16) derived from the gammaproteobacteria community.

As the gene for malate thiokinase (mtk), a DNA having a base sequence of a gene encoding a malate thiokinase obtained from the above microorganism or a synthetic DNA sequence synthesized based on a known base sequence can be used. The ideal ones include Methylobacterium extorquens and other sources of Methylobacteria (SEQ ID NO: 17 and SEQ ID NO: 18), Hyphomicrobium methylovorum, Hyphomicrobium denitrificans, and other sources of Hyphomicrobium, Rhizobium sp. NGR234, and other Rhizobium sources, Granulibacter. Sources of the genus Granulibacter such as bethesdensis, Nitrosomonas europaea, etc. Methylococcus capsulatus and other DNAs derived from the base sequence of the gene derived from the genus of the gammaproteobacteria. From the viewpoint of the production efficiency of the coenzyme A, it is preferred to have a Hypha microbium source (SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22), and Rhizobium source (SEQ ID NO: 23 and SEQ ID NO: 24), Granulibacter genus source (SEQ ID NO: 25 and SEQ ID NO: 26), Nitrosomonas source (SEQ ID NO: 27 and SEQ ID NO: 28), and Methylococcus origin (SEQ ID NO: 29 and SEQ ID NO: 30), The DNA of the base sequence of the gene of the gammaproteobacteria boundary (SEQ ID NO: 31 and SEQ ID NO: 32). Particularly preferred is a source of Hypha microbium (sequence number 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22), Rhizobium source (SEQ ID NO: 23 and SEQ ID NO: 24, source of Nitrosomonas) The DNA of the base sequence of the gene (SEQ ID NO: 27 and SEQ ID NO: 28), the source of the genus Methylococcus (SEQ ID NO: 29 and SEQ ID NO: 30), and the source of the gammaproteobacteria (SEQ ID NO: 31 and SEQ ID NO: 32).

Apple coenzyme A lyase (Mcl), classified as enzyme number 4.1.3.24, refers to the enzyme that produces glyoxylic acid and acetoacetin A from apple coenzyme A. For example: Methylobacterium extorquens and other sources of Methylobacteria, Hyphomicrobium methylovorum, Hyphomicrobium denitrificans and other sources of Hyphomicrobium, sources of Chloroflexus aurantiacus, Nitrosomonas europaea and other sources of Nitrosomonas, Methylococcus capsulatus, etc. A source of methylococcus. The specific activity of the cocoa lyase A lyase was reported to be 28.1 U/mg in Methylobacterium extorquens (Biochemical Journal, 1974; 139(2): 399-405).

As an apple coenzyme A lyase, from the viewpoint of the production efficiency of acetaminophen A, for example, it has a source of methyl bacillus (sequence number 33), a source of genus Hyphomicrobium (sequence number 34, and a sequence number). 35) An enzyme of the amino acid sequence of the genus Nitrosomonas (SEQ ID NO: 36) and the source of the genus Methylococcus (SEQ ID NO: 37).

As the gene (mcl) of the cocoA cleavage enzyme of apple sputum, a synthetic DNA sequence synthesized from the above-mentioned microorganism and having a base sequence encoding a gene encoding the cocoA lyase A cleavage enzyme or a base sequence known from the same can be used. . Ideal for example with Methylobacterium extorquens DNA of the base sequence of a gene derived from the gene of Mycobacterium, such as Mycobacterium, Hyphomicrobium methylovorum, Hyphomicrobium denitrificans, or Chloroflexus aurantiacus. From the viewpoint of the production efficiency of the acetaminophen coenzyme A, for example, DNA having a gene derived from the genus Methylbacter and a base sequence of a gene derived from the genus Aspergillus is particularly preferable.

An example of the base sequence of the gene derived from the genus Methylobacterium is a base sequence of the Methylobacterium extorquens-derived gene (SEQ ID NO: 38) and a base sequence of a gene derived from the genus Mycelium, and examples thereof include The base sequence of the Hyphomicrobium methylovorum source gene (SEQ ID NO: 39), the base sequence number of the Hyphomicrobium denitrificans-derived gene sequence 40), and the base sequence of the gene derived from Nitrosomonas are exemplified by the Nitrosomonas europaea-derived gene. The base sequence (SEQ ID NO: 41) and the base sequence of the gene derived from the genus Methylococcus are exemplified by the base sequence of the Methylococcus capsulatus-derived gene (SEQ ID NO: 42).

Glycine transaminase (Gta) refers to an enzyme which transfers an amine group to glyoxylic acid and converts it to glycine by a compound having an amine group (a second amine or a first amine). Among the enzymes classified as the enzyme number 2.6.1 group, an enzyme having glyoxylic acid as a matrix can be cited. For example, 2.6.1.*; *=4, 35, 44, 45, 60, 63 and 73 can be cited. Also, in the enzyme group of 2.6.1.*;*=2,7,12,13,14,15,18,19,27,38,40,42,57,64,72, and 78, it is also reported Have the same activity. The glycine transaminase sometimes has the activity of the serine transaminase described later.

In the present invention, glycine dehydrogenase (Gdh) is included in glycine transaminase, and the gene of glycine dehydrogenase (gdh) is also included in the gene of glycine transaminase.

Specific examples of the glycine transaminase are classified into, for example, an enzyme number: 2.4.1.44 or 2.6.1.45, a methylcocci source such as Methylococcus capsulatus (Methylococcus capsulatus) (SEQ ID NO: 43), and a colorobacteria such as Allochromatium vinosum (Allochromatium vinosum). Source (SEQ ID NO: 44), Hahella chejuensis (Hahella chejuensis) and other sources of Hahella (SEQ ID NO: 45), Candidatus Ruthia magnifica (Candidatus Ruthia magnifica), etc. Candidatus Ruthia source (SEQ ID NO: 46), Methylomonas methanica (Methylomonas methanica), etc. Basomosal source (SEQ ID NO: 47), Sources of Mycobacterium spp. such as Methylomicrobium alcaliphilum (Methylomicrobium alcaliphilum), such as Methylbacteria source (SEQ ID NO: 48), Marinobacter sp. (Marinobacter sp.), etc. (SEQ ID NO: 49), Psychrobacter arcticus (Psychrobacter arcticus) (SEQ ID NO: 50), Alteromonas macleodii (Alteromonas macleodii) and other sources of Alternhes (SEQ ID NO: 51), Glaciecola sp. (Glaciecola sp.) source (SEQ ID NO: 52), Cycloclasticus sp. Source (SEQ ID NO: 53), Nitrosococcus oceani (Nitrosococcus oceani) and other sources of nitrite (sequence number 54), Thioalkalivibrio sp. (Thioalkalivibrio sp.) source (SEQ ID NO: 55), Colwellia psychrerythraea (Colwellia psychrerythraea) and other Colwellia Source (SEQ ID NO: 56, SEQ ID NO: 57), Ferrimonas balearica (Ferrimonas balearica), etc. (Source: SEQ ID NO: 58), Shewanella oneidensis (Shewanella oneidensis) and other sources of Shewanella (sequence number 59), Photobacterium profundum ( Photobacterium profundum) No. 60), Vibrio cholerae (Vibrio cholerae) (SEQ ID NO 61), Vibrio fischeri (Vibrio fischeri) (SEQ ID NO 62) like those derived from the genus Vibrio. In addition, there are Volvox genus (sequence number 63) such as Volvox carteri (Volvox carteri) classified as Enzyme No. 2.6.1.4. More desirable examples are the source of Methylococcus (SEQ ID NO: 43) and the source of Chromosome (SEQ ID NO: 44). 3A to 3G show amino acids which are conserved among microorganisms in the amino acid sequence of glycine transaminase.

The glycine transaminase gene (gta) can be a synthetic DNA sequence synthesized from the above-mentioned microorganism and having a base sequence encoding a gene of a glycine transaminase or a base sequence synthesized according to the known base sequence. Preferred examples include a source of Methylococcus capsulatus (SEQ ID NO: 64), a source of Allochromatium (Allochromatium) such as Allochromatium vinosum (SEQ ID NO: 65), and a source of Volvox (Volvox carteri) (SEQ ID NO: 66) ) source of bacteria. In the present invention, the gene of glycine dehydrogenase is also considered to be a gene included in glycine transaminase. More preferably, it is a source of a genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus

The gene (gdh) of glycine dehydrogenase can be synthesized by using the DNA of the base sequence of the gene encoding the glycine dehydrogenase obtained from the above microorganism or by a known base sequence thereof. Synthetic DNA sequences. The DNA which has a base sequence of a gene derived from a bacterium belonging to Mycobacterium tuberculosis, Mycobacterium smegmatis, or a bacterium belonging to the genus Hyphomicrobium, such as Hyphomicrobium vulgare, may be mentioned.

Glycosylation system (Gcs) is a generic term for a series of enzymes that convert glycine, tetrahydrofolate, and NAD ⁺ into 5,10-methylenetetrahydrofolate, NH ₃ , CO _{2 ,} and NADH. . It is composed of proteins called H-protein, P-protein, L-protein, and T-protein (Molecular and Cellular Biochemistry, 1973; 1(2): 169-187). P-protein, L-protein and T-protein are classified into enzyme numbers 1.4.4.2, 1.8.1.4, and 2.1.2.10, respectively. For example, Escherichia bacteria such as Escherichia coli (SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69 and SEQ ID NO: 70), Pantoea ananatis and other Pantoea bacteria (SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73 and No. 74) Source.

As a glycosidic acid-cleaving gene group (gcs), a DNA having a base sequence of a gene encoding a glycosidic acid-cleaving enzyme group obtained from the above microorganism or a synthesis of a base sequence synthesized therefrom can be used. DNA sequence. Preferred examples include Escherichia bacteria such as Escherichia coli (SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, and SEQ ID NO: 78), and Pantoea ananatis (SEQ ID NO: 79, SEQ ID NO: 80, and sequence). No. 81 and SEQ ID NO: 82) DNA of the base sequence of the gene of interest.

The 5,10-methylenetetrahydrofolic acid produced by the glycosylation of the glycine is reacted with a new glycine to convert to a serine. That is, due to the action of the glycine cracking system and the serine hydroxymethyltransferase, the glycine acid 2 molecule and NAD ^{+ are} converted into serine, NH ₃ , CO ₂ and NADH.

Serine hydroxymethyltransferase (Shmt), classified as enzyme No. 2.1.2.1, is a generic term for enzymes that produce 5,10-methylenetetrahydrofolate and glycine to produce serine and tetrahydrofolate. For example, Corynebacterium glutamicum and other Corynebacterium bacteria, Escherichia coli and other Escherichia bacteria, Pantoea ananatis and other Pantoea bacteria sources.

The gene (shmt) of a serine hydroxymethyltransferase can be synthesized by using the DNA of the base sequence of the gene encoding the gene of the serine hydroxymethyltransferase obtained from the above microorganism or by a known base sequence thereof. Synthetic DNA sequences. The DNA of the base sequence of a gene derived from a bacterium belonging to the genus Corynebacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea genus such as Pantoea ananatis is preferably used.

Serine dehydratase (Sda), classified as enzyme No. 4.3.1.17, is a generic term for the enzyme that produces pyruvate and ammonia from serine. In the enzyme of enzyme number 4.3.1.19, there are cases where the same activity is reported. For example, Corynebacterium glutamicum and other Corynebacterium bacteria, Escherichia coli and other Escherichia bacteria, Pantoea ananatis and other Pantoea bacteria sources.

The gene (sda) of the serine dehydratase can be a synthetic DNA sequence synthesized from the above-mentioned microorganism and having a base sequence of a gene encoding a serine dehydratase or a base sequence synthesized according to the known base sequence. The DNA of the base sequence of a gene derived from a bacterium belonging to the genus Corynebacterium such as Corynebacterium glutamicum, an Escherichia bacterium such as Escherichia coli, or a Pantoea genus such as Pantoea ananatis is preferably used.

Serine transaminase (Sga) refers to an enzyme which transfers an amine group from a serine to a compound having a carbonyl group (keto or aldehyde group) and is converted to 3-hydroxypyruvate. Among the enzymes classified as the enzyme number 2.6.1 group, enzymes using serine acid as a matrix can be mentioned. For example, it is reported that the same activity is reported in the enzyme populations of 2.6.1.51 and 2.6.1.45, 2.6.1.44 and 2.6.1.35, respectively. Further, the activity of the aforementioned glycine transaminase may be present. For example: Methylococcus capsulatus and other sources of methylococcus. In the present invention, serine 2-dehydrogenase is also considered to be included in the serine transaminase.

The gene of the serine transaminase (sga) can be a synthetic DNA sequence synthesized from the above-mentioned microorganism and having a base sequence encoding a gene of a serine transaminase or a base sequence synthesized according to the known base sequence. Preferred examples include those having a Methylococcus capsulatus source such as Methylococcus capsulatus. In the present invention, the gene of the serine 2-dehydrogenase is also considered to be included in the gene of the serine transaminase.

Serine 2-dehydrogenase (Sdh), classified as enzyme No. 1.4.1.7, is a generic term for the enzyme that produces 3-hydroxypyruvate and ammonia from serine. For example: plant sources such as Petroselinum crispum (carton).

The gene for the serine 2-dehydrogenase (sdh) can be synthesized by using the DNA of the base sequence of the gene encoding the gene of the serine 2-dehydrogenase obtained from the above microorganism or by a known base sequence thereof. Synthetic DNA sequences. The ideal one may include DNA having a base sequence of a plant-derived gene such as Petroselinum crispum (caraway).

Hydroxypyruvate reductase (YcdW), classified as enzyme number 1.1.1.81, is a generic term for an enzyme that converts hydroxypyruvate to glycerate using NADH or NADPH as a coenzyme. For example, bacteria belonging to the genus Escherichia such as Escherichia coli, and Pantoea genus such as Pantoea ananatis.

The hydroxypyruvate reductase gene (ycdW) can be a synthetic DNA sequence synthesized from the above-mentioned microorganism and having a base sequence of a gene encoding a hydroxypyruvate reductase or a base sequence synthesized according to the known base sequence. The ideal one is, for example, a DNA having a base sequence of a gene derived from an Escherichia bacterium such as Escherichia coli or a gene derived from a Pantoea bacterium such as Pantoea ananatis.

Glyceric acid 2-kinase (Gark), classified as enzyme number 2.7.1.165, is a generic term for an enzyme that converts glycerate to 2-phosphoglycerate. One molecule of ATP is consumed and one molecule of ADP and phosphoric acid are produced. For example, Corynebacterium glutamicum and other bacteria of the genus Corynebacterium, such as Escherichia coli.

The glycerol 2-kinase gene (garK) can be obtained by using the DNA of the base sequence of the gene encoding the glycerate 2-kinase obtained from the above microorganism or a synthetic DNA sequence synthesized by a known base sequence. The ideal one is, for example, a DNA having a base sequence of a gene derived from Corynebacterium glutamicum, a bacterium belonging to the genus Escherichia such as Escherichia, and a gene derived from a Pantoea bacterium such as Pantoea ananatis.

Glyceric acid 3-kinase (GlxK), classified as the enzyme number 2.7.1.31, is a generic term for an enzyme that converts glycerate to 3-phosphoglycerate. One molecule of ATP is consumed and one molecule of ADP and phosphoric acid is produced. For example, Corynebacterium glutamicum and other bacteria of the genus Corynebacterium, such as Escherichia coli.

The glycerate 3-kinase gene (glxK) can be obtained by using the DNA of the base sequence of the gene encoding the glycerate 3-kinase obtained from the above microorganism or a synthetic DNA sequence synthesized by a known base sequence. The ideal one is, for example, a DNA having a base sequence of a gene derived from Corynebacterium glutamicum, a bacterium belonging to the genus Escherichia such as Escherichia, and a gene derived from a Pantoea bacterium such as Pantoea ananatis.

Phosphoglycerate mutase (Gpm), classified as enzyme No. 5.4.2.1, is a generic term for an enzyme that converts 3-phosphoglycerate to 2-phosphoglycerate. For example, Corynebacterium glutamicum and other Corynebacterium bacteria, Escherichia coli and other Escherichia bacteria, Pantoea ananatis and other Pantoea bacteria sources.

The gene (gpm) of the phosphoglycerate mutase can be a synthetic DNA sequence synthesized from the above-mentioned microorganism and having a base sequence of a gene encoding a phosphoglycerate mutase or a base sequence synthesized according to the known base sequence. The ideal one is, for example, a DNA having a base sequence of a gene derived from Corynebacterium glutamicum, a bacterium belonging to the genus Escherichia such as Escherichia, and a gene derived from a Pantoea bacterium such as Pantoea ananatis.

Enolase (Eno), classified as enzyme No. 4.2.1.11, is a generic term for an enzyme that converts 2-phosphoglycerate into phosphoenolpyruvate. For example, Corynebacterium glutamicum and other Corynebacterium bacteria, Escherichia coli and other Escherichia bacteria, Pantoea ananatis and other Pantoea bacteria sources.

The gene (eno) of the enolase can be a synthetic DNA sequence synthesized from the above-mentioned microorganism and having a base sequence encoding the gene of the enolase or a base sequence synthesized according to the known base sequence. The ideal one is, for example, a base sequence of a gene derived from Corynebacterium glutamicum, a bacterium belonging to the genus Escherichia such as Escherichia coli, or a gene of Pantoea genus such as Pantoea ananatis. DNA.

Pyruvate dehydrogenase (Pdh), classified as enzyme No. 1.2.4.1, is a generic term for enzymes that produce acetaminophen coenzyme A, CO ₂ , and NADH from pyruvate, CoA, and NAD ⁺ . For example, Corynebacterium glutamicum and other Corynebacterium bacteria, Escherichia coli and other Escherichia bacteria, Pantoea ananatis and other Pantoea bacteria sources.

The gene of pyruvate dehydrogenase (pdh) can be a synthetic DNA sequence synthesized from the above-mentioned microorganism and having a base sequence of a gene encoding a pyruvate dehydrogenase or a base sequence synthesized according to the known base sequence. The DNA of the bacterium belonging to the genus Corynebacterium such as Corynebacterium glutamicum, the bacterium belonging to the genus Escherichia coli such as Escherichia coli, and the gene derived from the genus Pantoea bacterium such as Pantoea ananatis may be mentioned.

Since the enzyme on the path of the glycine is not possessed, the microorganism produced by the acetaminophen A of the present invention can be obtained by imparting an enzyme not possessed to the microorganism which does not form the glycine pathway.

Among the bacteria of the genus Escherichia, for example, Escherichia coli does not possess malic acid thiokinase, apple sputum coenzyme A lyase and glycine transaminase, so as long as at least the malic acid thiokinase, apple sputum coenzyme A cleavage The enzyme and glycine transaminase can be used.

Pantoea bacteria, such as Pantoea ananatis, do not possess malate thiokinase, apple sputum coenzyme A lyase and glycine transaminase, so as long as at least malate thiokinase, apple sputum coenzyme A lyase and glycine transaminase The enzyme can be.

Among the rod-shaped bacteria, for example, Corynebacterium glutamicum does not possess malic acid thiokinase, apple sputum coenzyme A lyase, glycine transaminase, glycine cracking system, and serine transaminase, so as long as at least apples are given Acid thiokinase, apple sputum coenzyme A lyase, glycine transaminase and glycine cracking system can be used.

The 2-sided oxyglutaric acid producing microorganism of the second invention has a route of fixing CO ₂ and producing 2-sided oxyglutaric acid. Further, the microorganism may have a pathway for producing glutamic acid from the purpose of 2-sided oxyglutaric acid. The route of 2-sided oxyglutaric acid possessed by the 2-sided oxyglutaric acid producing microorganism of the second invention (hereinafter sometimes referred to as "2-side oxyglutaric acid production route" will be described with reference to FIG. ). Hereinafter, the path shown in FIG. 4 may be referred to as "the path of FIG. 4".

The path of Figure 4 contains the following (t), (u), (v), (w), (x), (y) and (z) enzyme reactions.

by at least one enzyme of the group consisting of the reaction (t) by the enzyme in the reaction is selected from phosphate and pyruvate to CO ₂ of oxaloacetic acid, pyruvic acid and the enzyme and CO ₂ oxaloacetic acid to the reaction.

(u) The reaction of the acetic acid to malic acid enzyme.

(v) Enzyme reaction of malic acid to apple coenzyme A.

(w) Enzyme reaction of cocoA to glyoxylic acid and coenzyme A.

(x) Enzymatic reaction of glyoxylic acid and pyruvic acid to 4-hydroxy-2-oxo-glutaric acid.

(y) an enzyme reaction of 4-hydroxy-2-oxo glutaric acid to 4-oxomethoxyglutaryl.

(z) An enzyme reaction of 4-oxooxyglutaconic acid to 2-oxo-glutaric acid.

The reaction of the above (t) is, for example, phosphoenolpyruvate carboxylase (Ppc); phosphoenolpyruvate carboxykinase (Pck); pyruvate kinase (Pyk) and pyruvate carboxylase (Pyc); pyruvate carboxylate Enzyme (Pyc); catalyzed.

The reaction of the aforementioned (u) is catalyzed, for example, by malate dehydrogenase (Mdh).

The reaction of the aforementioned (v) is catalyzed, for example, by malate thiokinase (Mtk).

The reaction of the aforementioned (w) is catalyzed, for example, by the apple 醯 coenzyme A lyase (Mcl).

The reaction of the above (x) is catalyzed, for example, by 4-hydroxy-2-oxooxyglutaric acid aldolase.

The reaction of the above (y) is catalyzed, for example, by 4-hydroxy-2-oxoglutaric acid dehydratase.

The reaction of the aforementioned (z) is catalyzed, for example, by 4-sided oxyglutaconate reductase.

The enzyme reaction of 2-sided oxyglutaric acid to glutamic acid is catalyzed by, for example, glutamate synthase as is the usual route of glutamic acid fermentation.

The acetaminophen coenzyme A produced in the middle of the route of Fig. 4 can be converted into 2-oxooxyglutaric acid and glutamic acid by the TCA cycle in the same manner as the usual glutamic acid fermentation route. That is, it can be reacted with acetoin coenzyme A with oxalic acid to citric acid, citric acid to aconitase, aconitate to isocitrate, isocitric acid to 2-oxyl pentane The acid enzyme reacts to convert to 2-sided oxyglutaric acid, which is then converted by the enzyme reaction of 2-sided oxyglutaric acid to glutamic acid. For glutamic acid.

Path of FIG. 4, when phosphoenol pyruvate or pyruvate is converted into oxaloacetic acid fixing CO _2. On the other hand, the pathway of Figure 4 does not include an enzyme reaction that releases CO ₂ . Therefore, from the viewpoint of carbon yield, the path of Fig. 4 can be said to be an extremely efficient path.

The pathway of Figure 4 converts the reduced coenzyme to oxidation in the enzyme reaction of converting oxalic acid to malic acid and the enzyme reaction from 4-oxoxy glutaconate to 2-oxoglutaric acid. The form of the coenzyme requires a reducing power. Therefore, an increase in the yield of 2-sided oxyglutaric acid or glutamic acid can be expected by combining the path possessed by the microorganism of the present invention with the route capable of supplying a reduced coenzyme.

The enzyme activity of the 2-sided oxyglutaric acid producing microorganism can be appropriately selected as long as it can functionally construct a 2-sided oxyglutaric acid production route, and can be appropriately selected in accordance with the scope of the present specification in accordance with the host microorganism. Since some of the enzymes on the route of Figure 4 are not possessed, it is necessary to impart unowned enzymes to microorganisms that do not form the pathway of Figure 4. Among the bacteria of the genus Corynebacterium, for example, Corynebacterium glutamicum does not find each enzyme that catalyzes the reaction of each enzyme of malic acid to 2-oxoglutaric acid, so that each of these enzymes can be given to Corynebacterium glutamicum.

The microorganism produced by the acetaminophen A in the first invention is preferably a microorganism which is not found in any of the following (o), (p), (q), (r) and (s), and the following (o), (p), (q) and (r) are not given, or even if one or more of the following (o), (p), (q), and (r) are given no effect, but strengthened B The microorganism capable of coenzyme A production is preferred. The 2-side oxyglutaric acid producing microorganism of the second invention is also the same.

(o) A fixed cycle of carbonic acid having an enzyme reaction from propionate A to malonic acid semialdehyde or 3-hydroxypropionic acid.

(p) A fixed cycle of carbonic acid having a reaction from acetaminophen A to CO ₂ to pyruvate.

(q) A carbonation fixation cycle having an enzyme reaction from croton coenzyme A to CO ₂ to ethyl propylene dioxime coenzyme A or pentene dioxime coenzyme A.

(r) A fixed cycle of carbonic acid having an enzyme reaction from CO ₂ to formic acid.

(s) is at least one selected from the group consisting of malate thiokinase and apple sputum coenzyme A lyase.

The "enhanced acetaminophen coenzyme A production capacity" in the present invention means that the CO ₂ can be efficiently converted into acetaminophen coenzyme A compared to a microorganism which does not contain the path possessed by the microorganism of the present invention.

In the present specification, "(o) a fixed cycle of carbonic acid having an enzyme reaction from propylenediamine coenzyme A to malonic acid semialdehyde or 3-hydroxypropionic acid" means the following cycle of (1) to (7).

(1) Figure 1 of International Publication No. 2011/099006: Ethylene coenzyme A is converted to B by propionate coenzyme A, 3-hydroxypropionic acid, propyl sulfonamide CoA, malic acid, and apple coenzyme A醯 Coenzyme A cycle.

(2) Figure 4A of International Publication No. 2011/099006: Ethylene coenzyme A is converted to B by propionate coenzyme A, malonate semialdehyde, β-alanine, malic acid, and apple coenzyme A.醯 Coenzyme A cycle.

(3) Figure 4B, 16 or 18 of International Publication No. 2011/099006: Acetyl-CoA via propionate A, hydroxypropionic acid, (R)-lactic acid or (S)-lactic acid, malic acid The apple coenzyme A is converted into a cycle of acetaminophen coenzyme A.

(4) The cocoa coenzyme A shown in Fig. 8 of International Publication No. 2011/099006 is reconverted to the copolyformase A, malonate semialdehyde or hydroxypropionic acid, pyruvic acid, malic acid, and apple cocoa coenzyme A. The cycle of acetaminophen coenzyme A.

(5) International Publication No. 2011/099006, shown in Fig. 9A, 9B or 9C: acetaminophen coenzyme A via propionate coenzyme A, hydroxypropionic acid, 2-ketoglutaric acid, malic acid, cocoon coenzyme A is then converted to the cycle of acetaminophen A.

(6) Figure 9D or 9F of International Publication No. 2011/099006: acetaminophen coenzyme A via propylene dioxime coenzyme A, hydroxypropionic acid, methyl propylene dioxime coenzyme A, malic acid, apple quinone coenzyme A Change to the cycle of acetaminophen A.

(7) Figure 17 of International Publication No. 2011/099006: acetaminophen coenzyme A via propionate coenzyme A, malonate semialdehyde or hydroxypropionic acid, methyl propylene dioxime coenzyme A, pyruvic acid, grass Indoleacetic acid, malic acid, and apple sputum coenzyme A are then converted into a cycle of acetaminophen coenzyme A.

The carbonic acid fixed cycle of the above (1) to (7) has an enzyme reaction from propylenediamine coenzyme A to malonic acid semialdehyde or 3-hydroxypropionic acid. These reactions are catalyzed by malonate semialdehyde dehydrogenase or propionate coenzyme A reductase (International Publication No. 2011/099006). Reduction of such amber oxime coenzyme A or reduction of propylene dioxime coenzyme A. The reduction reaction of these carboxylic acids or their (thio) esters is generally difficult in terms of enzyme reaction, and it is said that it is preferable to avoid the fermentation path as much as possible ( Nature, 2008; 451: 86-89, Nature Chemical Biolory, 2011; 7: 445-452).

In the present specification, "(p) a fixed cycle of carbonic acid having an enzyme reaction of acetaminophen A and CO ₂ to pyruvic acid" means the following cycle of (8) to (10).

(8) Figure 1 of International Publication No. 2011/099006: Circulation of acetaminophen coenzyme A via pyruvate, phosphoenolpyruvate, oxalin acetic acid, malic acid, and apple sputum coenzyme A to acetaminophen A .

(9) Figure 7C, 7D or 7E of International Publication No. 2011/099006: a cycle in which acetaminophen coenzyme A is reconverted to acetaminophen coenzyme A via pyruvic acid, malic acid, and cocoon coenzyme A.

(10) Figure 9M of International Publication No. 2011/099006: A cycle in which acetaminophen coenzyme A is reconverted to acetaminophen coenzyme A via pyruvic acid, 2-ketoglutaric acid, malic acid, and apple sputum coenzyme A.

The carbonation fixation cycle of the above (8) to (10) has an enzyme reaction of acetaminophen A and CO ₂ to pyruvate. This reaction is catalyzed by pyruvate synthase (International Publication No. 2011/099006). The pyruvate synthase synthesis reaction of pyruvate requires the strong reducing power of the iron redox protein medium, the reaction is slow, and it is not resistant to oxygen. If it is not under extreme anaerobic conditions, the reaction does not proceed.

In the present specification, "(q) a fixed cycle of carbonic acid having an enzyme reaction of croton coenzyme A with CO ₂ to ethyl propylene dioxime coenzyme A or pentene dioxazole coenzyme A" means International Publication No. 2011/099006 Figure 9H or 9J: Acetone coenzyme A is reconverted to acetamyl coenzyme A via croton coenzyme A, ethyl propylene dioxime coenzyme A or pentene dioxime coenzyme A, oxaloacetic acid, malic acid, and apple sputum coenzyme A. The cycle.

Catalyzing the above conversion of croton coenzyme A and CO ₂ to ethyl propylene diamine coenzyme A or pentene quinone coenzyme A is croton coenzyme A carboxylase-reductase or methyl croton quinone coenzyme A carboxylase. Crotonase Coenzyme A carboxylase-reductase, high Km for carbonate (14 mM. Proceedings of the National Academy of Sciences of the United States of America, 2007; 104(25): 10631-10636), cannot be expected to be low Activity in the concentration domain. Further, the matrix crotonin coenzyme A can be produced by 3-hydroxybutyrate coenzyme A by dehydration reaction, but if such an enzyme is usually in an aqueous environment, the reverse reaction hydration reaction is advantageous, and sufficient speed cannot be expected. Further, methyl crotonin coenzyme A carboxylase, which is reported to be not so high in specific activity (0.2 to 0.6 U/mg. Archives of Biochemistry and Biophysics, 1994; 310(1): 64-75), There is also the problem that the production of the croton coenzyme A for the matrix is not expected to be sufficient.

In the present specification, "(r) a fixed cycle of carbonic acid having an enzyme reaction of CO ₂ to formic acid" means a cycle shown in Figure 5, 6, 13, or 14 of International Publication No. 2009/046929, that is, a combination of the following Cycle: the path of 5,10-methylenetetrahydrofolate by CO ₂ , formic acid, 5-methylmercaptotetrahydrofolate, and the reaction of 5,10-methylenetetrahydrofolate with glycine Serine and this serine is returned to the original by 3-hydroxypyruvate, glyceric acid, 3-phosphoglycerate, phosphoenolpyruvate, oxalic acid, malic acid, apple quinone coenzyme A, and glyoxylic acid. The cycle of glycine acid and the acetaminophen coenzyme A produced by malic acid and apple sputum coenzyme A return to the cycle of malic acid through the reaction of TCA cycle and isocitrate lyase.

The above-mentioned enzyme reaction from CO ₂ to formic acid must have a strong reducing power, and the reaction is slow and not resistant to oxygen, so the reaction does not proceed under extreme anaerobic conditions.

Malonate semialdehyde dehydrogenase, classified as enzyme number 1.2.1.18, is a generic term for the enzyme that converts propionate A to malonate semialdehyde.

The propylene dioxime coenzyme A reductase is a generic term for the enzyme which converts propylene diacetate coenzyme A into malonate semialdehyde or 3-hydroxypropionic acid.

Pyruvate synthase, classified as enzyme No. 1.2.7.1, is a generic term for an enzyme that converts acetaminophen A to pyruvate.

Crotonase Coenzyme A carboxylase-reductase, classified as the enzyme number 1.3.1.85, is a generic term for the enzyme that converts the crotonin-CoA to ethyl propylenediamine-CoA.

Methyl croton coenzyme A carboxylase, classified as enzyme No. 6.4.1.4, is a generic term for the enzyme that converts croton oxime A to pentene quinone coenzyme A.

The microorganisms to be hosted in the first invention and the second invention are preferably microorganisms which are not contained in any of the above (o), (p), (q), (r) and (s), for example, belonging to the intestinal bacteria family. Microorganisms, microorganisms belonging to coryneform bacteria, filamentous fungi, actinomycetes, and the like.

Examples of microorganisms belonging to the genus Enterobacter include Enterobacter, Erwinia, Escherichia, Klebsiella, Pantoea, and Providen. A bacterium belonging to the genus Providencia, Salmonella, Serratia, Shigella, Morganella or the like. Among them, microorganisms belonging to the genus Escherichia or Pantoea are preferred from the viewpoint of efficiently producing useful metabolites. Escherichia bacteria and Pantoea bacteria are closely related (Journal of General and Applied Microbiology, 1997; 43(6): 355-361, International Journal of Systematic Bacteriology, 1997; 47(4): 1061- 1067).

The bacterium belonging to the genus Escherichia is not particularly limited, and is, for example, Escherichia coli (E. coli). Specific examples of the Escherichia coli include Escherichia coli B (ATCC11303) of the wild type B strain of the prototype, Escherichia coli W3110 (ATCC27325) derived from the wild type strain K12 of the prototype, and Escherichia coli MG1655 (ATCC47076).

Representative strains of Pantoea bacteria include Pantoea ananatis (Pantoea ananatis), Pantoea stewartii (Pantoea stewartii), Pantoea agglomerans, Pantoea citrea (Pantoea citrea). Specifically, the following strains can be mentioned.

‧Pantoea ananatis AJ13355 strain (FERM BP-6614) (European Patent Application Publication No. 0952221)

‧Pantoea ananatis AJ13356 strain (FERM BP-6615) (European Patent Application Publication No. 0952221)

Further, these strains are described as Enterobacter agglomerans in the specification of European Patent Application Publication No. 0952221, but are now classified into Pantoea ananatis by the above-described base sequence analysis of 16S rRNA.

In recent years, bacteria belonging to the genus Enterobacter have been reclassified as Pantoea agglomerans (Pantoea). Agglomerans) or Pantoea dispersa (Pantoea dispersa), etc. (International Journal of Systematic Bacteriology, 1989; 39(3): 337-345). The genus belonging to the genus Erwinia is subdivided into Pantoea ananas (Pantoea ananas) and Pantoea stewartii (International Journal of Systematic Bacteriology, 1993; 43(1): 162-173).

Enterobacter bacteria, such as Enterobacter agglomerans (Enterobacter agglomerans), Enterobacter aerogenes (Enterobacter aerogenes), and the like. Specifically, the strain exemplified in the specification of European Patent Application Publication No. 952221 can be used. Representative strains of Enterobacter are Enterobacter agglomerans ATCC 12287 strain.

A rod-shaped bacterium refers to a microorganism belonging to the genus Corynebacterium, the genus Brevibacterium, or the genus Microbacterium, as defined in Bergey's Manual of Determinative Bacteriology, 8th ed., p599 (1974). Further, examples thereof include microorganisms classified as Brevibacterium, but are later classified as Corynebacterium (International Journal of Systematic Bacteriology, 1991; 41(2): 255-260), and belonging to the genus Brevibacterium Microorganisms. Examples of rod-shaped bacteria are listed below.

For example: Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium alkanolyticum, Corynebacterium callunae, Corynebacterium glutamicum, Corynebacterium lilium, Corynebacterium melassecola, Corynebacterium thermoaminogenes, Corynebacterium herculis, Brevibacterium divaricatum, Brevibacterium flavum, Brevibacterium immariophilum, Brevibacterium lactofermentum, Brevibacterium roseum, Brevibacterium saccharolitycum, Brevibacterium thiogenitalis, Corynebacterium ammoniagenes, Brevibacterium album, Brevibacterium selinum, Microbacterium ammoniaphilum.

As a microorganism belonging to a rod-shaped type, the following strains are included.

Corynebacterium acetoacidophilum ATCC13870, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium alkanolyticum ATCC21511, Corynebacterium callunae ATCC15991, Corynebacterium glutamicum ATCC 13020, 13032, 13060, Corynebacterium lilium ATCC15990, Corynebacterium melassecola ATCC17965, Corynebacterium thermoaminogenes AJ12340 (FERM BP-1539), Corynebacterium herculis ATCC13868, Brevibacterium divaricatum ATCC14020, Brevibacterium flavum ATCC13826, ATCC14067, AJ12418 (FERM BP-2205), Brevibacterium immariophilum ATCC14068, Brevibacterium lactofermentum (Corynebacterium glutamicum) ATCC 13869, Brevibacterium roseum ATCC 13825, Brevibacterium saccharolitycum ATCC 14066, Brevibacterium thiogenitalis ATCC 19240, Brevibacterium ammoniagenes ATCC 6871, ATCC 6872, Brevibacterium album ATCC 15111, Brevibacterium selinum ATCC 15112 and Microbacterium ammoniaphilum ATCC 15354.

The acetaminophen-CoA producing microorganism of the present invention may have various routes for producing a metabolite by using acetaminophen coenzyme A as an intermediate product, or may also enhance the enzyme activity associated with the path. The route may be exemplified by a route for producing isopropyl alcohol, a route for producing acetone, a route for producing glutamic acid, and the like. The following is directed to microorganisms having such pathways and capable of producing useful metabolites from acetamyl CoA.

- Microorganisms producing isopropanol, microorganisms producing acetone -

The microorganism of the present invention is a microorganism which produces microorganisms and has an isopropanol production route, for example, a microorganism having an isopropanol production path is used as a host, and the production of the microorganism of the present invention is carried out by the production of the microorganism, or The gene for the enzyme involved in the production route of the isopropanol in the production of the acetaminophen coenzyme A of the present invention is imparted or enhanced. Hereinafter, a microorganism having an isopropanol production path is sometimes referred to as an "isopropyl alcohol production microorganism", and an Escherichia coli having an isopropanol production route is referred to as "isopropanol production coliform".

Isopropanol production Escherichia coli has a coliform of the isopropanol production pathway, and refers to a coliform having the production capacity of isopropanol introduced by genetic recombination technology. Such an isopropyl alcohol production route can be used as long as it can produce isopropyl alcohol in the object coliform. Isopropanol production of Escherichia coli is preferably imparted or enhanced by four enzyme activities such as thiolase activity, coenzyme A transferase activity, acetamidine decarboxylase activity, and isopropanol dehydrogenase activity.

When acetone is produced by the production of microorganisms by the acetaminophen coenzyme A of the present invention, microorganisms having thiolase activity, coenzyme A transferase activity, and acetamidine decarboxylase activity in the isopropanol production pathway can be used. The microorganism does not have isopropanol dehydrogenase activity in the isopropanol production pathway.

The acetoin-CoA producing microorganism of the present invention is preferably a microorganism which is constructed by using a bacterium belonging to the genus Escherichia as a host.

An ideal example is the production of acetaminophen coenzyme A by imparting or enhancing thiolase activity, coenzyme A transferase activity, acetamidine decarboxylase activity, and isopropanol dehydrogenase activity to bacteria of the genus Escherichia. microorganism. The microorganism can be used to produce isopropanol with good efficiency.

Another example of an ideal aspect is an acetaminophen-CoA producing microorganism obtained by imparting or enhancing thiolase activity, coenzyme A transferase activity, and acetamidine decarboxylase activity to a bacterium belonging to the genus Escherichia. The microorganism can be used to produce acetone with good efficiency.

The following is a detailed description of the isopropyl alcohol production pathway and the enzymes that make up this pathway.

The thiolase, classified as the enzyme number 2.3.1.9, is a generic term for an enzyme that catalyzes the reaction of acetamidine coenzyme A to form acetamidine coenzyme A. For example: Clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium beijerinckii (Clostridium beijerinckii), Clostridium genus bacteria, Escherichia coli and other Escherichia bacteria, Halobacterium sp. bacterium, Zoogloea Ramigera (Zoogloea ramigera) and other bacteria such as Zoogloea, Rhizobium sp., Bradyrhizobium japonicum (Bradyrhizobium japonicum) and other bacteria such as Bradyrhizobium, Candida tropicalis (Candida tropicalis) (Candida) is a bacterium belonging to the genus Enterococcus, such as bacteria, Caulobacter crescentus (Caulobacter crescentus), Streptomyces collinus (Streptomyces collinus), and Enterococcus faecalis (Enterococcus faecalis). .

As the gene of the thiolase, the thiolase encoded by the above microorganism can be used. A DNA of a base sequence of a gene or a synthetic DNA sequence synthesized based on a known base sequence thereof. The ideal ones include Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium bacteria, Escherichia coli and other Escherichia bacteria, Halobacterium species, Zoogloea ramigera and other Zoogloea bacteria, Rhizobium species, Bradyrhizobium japonicum, etc. DNA of the base sequence of a gene derived from Rhizobium bacterium, Candida tropicalis, Candida genus, Caulobacter crescentus, Streptomyces collinus, etc., Enterococcus faecalis, etc. More preferably, it may be a DNA of a base sequence of a gene derived from a prokaryotic organism such as a bacterium belonging to the genus Clostridium and a bacterium belonging to the genus Escherichia, and particularly preferably a base sequence having a gene derived from Clostridium acetobutylicum or Escherichia coli. DNA.

Coenzyme A transferase, classified as enzyme No. 2.8.3.8, is a generic term for enzymes that catalyze the reaction of acetamidine acetic acid to produce acetic acid. For example: Clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium beijerinckii (Clostridium beijerinckii) and other Clostridium bacteria, Roseburia intestinalis (Roseburia intestinalis) and other species of Roseburia, Faecalibacterium prausnitzii (Faecalibacterium prausnitzii) It is a source of bacteria belonging to the genus Escherichia such as Trypanosoma, such as Trypanosoma brucei (Trypanosoma brucei) and Escherichia coli (Escherichia coli).

As the gene of the coenzyme A transferase, a DNA having a base sequence of a gene encoding a coenzyme A transferase obtained from the above microorganism or a synthetic DNA sequence synthesized by a known base sequence can be used. The ideal ones include Clostridium acetobutylicum, Clostridium acetobutylicum, Roseburia genus, Rosebaia genus, Faecalibacterium prausnitzii, Faecalibacterium, Streptococcus, Trypanosoma brucei, Trypanosoma, Escherichia coli, etc. The DNA of the base sequence of the gene. More preferably, it is a DNA of a base sequence of a gene derived from Clostridium genus and an Escherichia bacterium, and particularly preferably a DNA having a base sequence of a gene derived from Clostridium acetobutylicum and Escherichia coli.

Acetylacetate decarboxylase, classified as enzyme No. 4.1.1.4, is a generic term for the enzyme that catalyzes the reaction of acetone from ethyl acetate. For example, Clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium beijerinckii (Clostridium beijerinckii), etc., Clostridium genus bacteria, Bacillus polymyxa (Bacillus polymyxa) and other Bacillus genus bacteria.

As the gene of the acetamidine acetic acid decarboxylase, a DNA having a base sequence of a gene encoding a acetamidine acetate decarboxylase obtained from the above microorganism or a synthetic DNA sequence synthesized based on a known base sequence can be used. The DNA of the base sequence of a gene derived from a bacterium belonging to the genus Clostridium such as Clostridium acetobutylicum or a bacterium belonging to the genus Bacillus such as Bacillus polymyxa is exemplified. Particularly preferred is a DNA having a base sequence of a gene derived from Clostridium acetobutylicum.

Isopropanol dehydrogenase, classified as the enzyme number 1.1.1.80, is a generic term for the enzyme that catalyzes the reaction of producing isopropanol from acetone. For example; Clostridium beijerinckii (Clostridium beijerinckii) is a bacterial source of Clostridium.

As the gene for the isopropanol dehydrogenase, a DNA having a base sequence of a gene encoding an isopropanol dehydrogenase obtained from the above microorganism or a synthetic DNA sequence synthesized based on a known base sequence can be used. The ideal one may be a DNA having a base sequence of a gene derived from a bacterium belonging to the genus Clostridium of Clostridium beijerinckii.

From the viewpoint of enzyme activity, the above four enzymes are respectively selected from at least one of a group consisting of a bacterium belonging to the genus Clostridium, a bacterium belonging to the genus Bacillus, and a bacterium belonging to the genus Escherichia. More preferably, the thiolase and the coenzyme A transferase are of a bacterium belonging to the genus Escherichia, and the acetaminoacetate decarboxylase and the isopropanol dehydrogenase Clostridium are of a bacterial origin.

From the viewpoint of enzyme activity, the above four enzymes are each selected from at least one of the group consisting of Clostridium acetobutylicum, Clostridium beijerinckii, and Escherichia coli. The thiolase and coenzyme A transferase are each of Clostridium acetobutylicum or E. coli source, the acetamidine decarboxylase is a source of Clostridium acetobutylicum, and the isopropanol dehydrogenase is a better source of Clostridium beijerinckii; thiolase and coenzyme A transferase For the source of E. coli, the acetamidine decarboxylase is a source of Clostridium acetobutylicum, and the isopropanol dehydrogenase is more desirable as a source of Clostridium beijerinckii.

Coenzyme-derived coenzyme A transferase genes (atoD and atoA) and thiolase gene (atoB) form an operand on the coliform genome in the order of atoD, atoA, atoB (Journal of Bacteriology, 1987; 169 ( 1): 42-52). Therefore, the expression of the coenzyme A transferase gene and the thiolase gene can be simultaneously controlled by changing the promoter of atoD.

Therefore, the coenzyme A transferase activity and the thiolase activity are obtained from the host gene of the coliform gene of the host, and from the viewpoint of obtaining sufficient isopropanol production capacity, the promoter responsible for the expression of the two enzyme genes should be replaced by Other promoters and the like are preferred to enhance the performance of the two enzyme genes. Examples of the promoter used to enhance the expression of the coenzyme A transferase activity and the thiolase activity include an Escherichia coli-derived glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter. The GAPDH promoter derived from Escherichia coli is described in base number information 397-440 in the base sequence information of GenBank accession number X02662.

Examples of the production of Escherichia coli by isopropyl alcohol include the pIPA/B strain or the pIaaa/B strain which can produce isopropanol from a plant-derived material as disclosed in International Publication No. 2009/008377. The coliform includes: coenzyme A transferase activity and thiolase activity enhance the expression of various genes on the coliform gene and the indoleacetic acid decarboxylase activity and isopropanol dehydrogenase activity are enhanced by plastid introduction. The strain (described in the present specification is sometimes referred to as pIa/B::atoDAB strain). In addition, examples of the production of coliforms by isopropyl alcohol include the microorganisms described in International Publication No. 2009/094485, International Publication No. 2009/094485, International Publication No. 2009/046929, and International Publication No. 2009/046929.

Isopropanol produces coliform, which is also inactivated by the activity of the transcriptional repressor GntR, and has an isopropanol production pathway and an enzyme activity that exhibits an increase or decrease in isopropanol production capacity as a function of GntR activity inactivation. The pattern of the auxiliary enzyme group of isopropanol produces coliforms. Thereby, can Isopropanol is produced in higher yields.

In the present invention, the "auxiliary enzyme group" refers to one or more enzymes that affect the production capacity of isopropyl alcohol. The auxiliary enzyme group does not need to be composed of most enzymes, but can also be composed of one enzyme. The enzyme activity of the helper enzyme group is inactivated, activated or strengthened, and the "enzyme active pattern of the helper enzyme group" in the present invention means an increase in isopropanol production which can be obtained only by inactivating GntR activity. The enzyme activity pattern of each enzyme maintained or increased, including a combination of one or more enzymes.

As the enzyme activity pattern of the auxiliary enzyme group, the following patterns (i) to (iii) are preferable. Among them, the following (iii) is preferable from the viewpoint of the production capacity of isopropyl alcohol.

(i) Maintenance of glucose-6-phosphate isomerase (Pgi) activity, glucose-6-phosphate-1-dehydrogenase (Zwf) activity, and wild type of phosphogluconate dehydrogenase (Gnd) activity.

(ii) Inactivation of glucose-6-phosphate isomerase (Pgi) activity and enhancement of glucose-6-phosphate-1-dehydrogenase (Zwf) activity.

(iii) Inactivation of glucose-6-phosphate isomerase (Pgi) activity, enhancement of glucose-6-phosphate-1-dehydrogenase (Zwf) activity and inactivation of phosphogluconate dehydrogenase (Gnd) activity .

The aforementioned auxiliary enzyme group and its enzyme activity pattern are not limited to the above, and include inactivation of GntR activity, and if it is an auxiliary enzyme group and an enzyme activity pattern capable of increasing the production of isopropanol in isopropyl alcohol-producing coliforms, Included in the present invention.

The aforementioned GntR refers to a transcriptional control group associated with gluconic acid metabolism in the Entner-Doudoroff pathway as a negative transcription factor. GntR is a generic term for a GntR transcriptional repressor that inhibits the action of two gene groups (GntI and GntII) responsible for the uptake and metabolism of gluconic acid.

Glucose-6-phosphate isomerase (Pgi), classified as enzyme No. 5.3.1.9, is a generic term for an enzyme that catalyzes the reaction of D-fructose-6-phosphate from D-glucose-6-phosphate.

Glucose-6-phosphate-1-dehydrogenase (Zwf), classified as the enzyme number 1.1.1.49, is a catalyst for the formation of D-glucono-1,5-lactone-6- from D-glucose-6-phosphate. A general term for the enzymes that react with phosphoric acid. For example, Deinococcus radiophilus (Deinococcus radiophilus) and other bacteria such as Deinococcus, Aspergillus niger, Aspergillus aculeatus (Aspergillus aculeatus), etc., Acetobacter hansenii (Acetobacter hansenii), etc., Thermotoga Maritima (Thermotoga maritima) and other genus Thermococci, Cryptococcus neoformans (Cryptococcus neoformans) and other cryptococcus, Dictyostelium discoideum (Dictyostelium discoideum), etc., Pseudomonas fluorescens (Pseudomonas fluorescens), Pseudomonas aeruginosa (Pseudomonas aeruginosa) A source of bacteria belonging to the genus Escherichia such as Pseudomonas, Saccharomyces cerevisiae (Saccharomyces cerevisiae), Bacillus megaterium (Bacillus megaterium), and the like.

As the gene of glucose-6-phosphate-1-dehydrogenase (Zwf), a synthetic DNA sequence synthesized from the above-mentioned microorganism and having a base sequence encoding the gene of Zwf or a base sequence synthesized by the known base sequence can be used. . The ideal ones include Mycobacterium genus such as Deinococcus radiophilus (Deinococcus radiophilus), Aspergillus niger, Aspergillus aculeatus (Aspergillus aculeatus), Acetobacter hansenii (Acetobacter hansenii), and Thermotoga. Maritima (Thermotoga maritima) and other genus Thermococcal, Cryptococcus neoformans (Cryptococcus neoformans) and other cryptococcus, Dictyostelium discoideum (Dictyostelium discoideum, etc.) of the genus Dictyostelium, Pseudomonas fluorescens (Pseudomonas fluorescens), Pseudomonas aeruginosa (Pseudomonas aeruginosa DNA of the base sequence of a gene derived from a bacterium belonging to the genus Pseudomonas, Saccharomyces cerevisiae (Saccharomyces cerevisiae), Bacillus megaterium (Bacillus megaterium), or Escherichia coli such as Escherichia coli. The ideal one may include a gene derived from a prokaryotic organism such as an abnormal cocci, a bacterium belonging to the genus Corydalis, a bacterium of the genus Acetate, a genus Thermobacter, a Pseudomonas, a Bacillus, or a bacterium belonging to the genus Escherichia. DNA of the base sequence, especially DNA having the nucleotide sequence of the gene of Escherichia coli.

Phosphogluconate dehydrogenase (Gnd), classified as enzyme No. 1.1.1.44, is a generic term for an enzyme that catalyzes the reaction of D-ribulose-5-phosphate with CO ₂ from 6-phospho-D-gluconic acid.

The addition or enhancement of the above enzyme activity can be carried out by introducing a gene into a host, enhancing the promoter activity of an enzyme gene possessed by the host on the genome, replacing the promoter with another promoter, and a combination thereof.

The promoter of Escherichia coli producing isopropyl alcohol refers to a site where RNA polymerase having sigma factor binds and starts transcription. As long as the promoter can control the expression of the gene, it can be a promoter which continues to act as a strong promoter in the microorganism and which is not easily inhibited even in the presence of glucose. Specifically, a promoter of the GAPDH promoter or a serine hydroxymethyltransferase can be mentioned.

Among the coliforms producing isopropanol, the gene for lactate dehydrogenase (LdhA) (ldhA) may also have been destroyed. Thereby, even under the culture condition in which the oxygen supply is limited, the production of lactic acid is suppressed, and isopropyl alcohol can be produced with good efficiency. The culture condition in which the oxygen supply is limited is a case where the culture liquid is stirred to ventilate only the air, and generally refers to 0.02 vvm to 2.0 vvm (vvm; aeration capacity [mL] / liquid capacity [mL] / hour [minute] ), the speed is 200~600rpm. Lactate dehydrogenase (LdhA) is an enzyme that produces D-lactic acid and NAD from pyruvate and NADH.

- glutamic acid producing microorganisms -

The acetaminophen-CoA producing microorganism of the present invention may have various routes for producing glutamic acid by using acetaminophen coenzyme A as an intermediate product, or may also enhance the enzyme activity associated with the route.

The microorganism which produces microorganisms and has a glutamic acid production route according to the present invention, for example, can be obtained by constructing the acetaminophen-CoA production microorganism of the present invention by using a microorganism having a glutamic acid production route as a host, or The gene for conferring or enhancing the enzyme related to the glutamate production pathway in the production of the coenzyme A-producing microorganism of the present invention is obtained. Hereinafter, a microorganism having a glutamic acid production route is sometimes referred to as a "glutamic acid producing microorganism".

Examples of the glutamic acid producing microorganism include microorganisms having an L-amino acid-producing ability. Make Preferable specific examples of the glutamic acid producing microorganism include an Escherichia bacterium, a Pantoea bacterium belonging to the genus Bacterium, and a coryneform bacterium such as Corynebacterium glutamicum.

The method for imparting or enhancing glutamic acid production ability by a microorganism includes, for example, a change in a manner of increasing and/or overexpressing the expression of a gene encoding L-glutamic acid biosynthetic enzyme. Examples of L-glutamic acid biosynthesis enzymes, such as glutamate dehydrogenase, glutamate synthase, glutamate synthase, isocitrate dehydrogenase, Aconitic acid hydratase, Citric acid synthase, phosphoenolpyruvate carboxylase, pyruvate carboxylase, pyruvate dehydrogenase, pyruvate kinase, phosphoenolpyruvate synthase, enolase, phosphoglycerol mutase, phosphoglycerol Acid kinase, glyceraldehyde-3-phosphate dehydrogenase, tricarbonose phosphate isomerase, fructose-2-phosphate aldolase, phosphofructokinase, glucose phosphate isomerase, and the like. Among these enzymes, the activity of one or more of citrate synthase, phosphoenolpyruvate carboxylase, and glutamate dehydrogenase is preferably increased, and all three enzyme activities are enhanced more preferably. . Such a glutamic acid producing microorganism is, for example, a glutamic acid producing microorganism described in JP-A-2005-278643.

L-glutamic acid-producing bacteria can have an ability to accumulate L-glutamic acid in an amount exceeding a saturated concentration of L-glutamic acid in a liquid medium when cultured under acidic conditions (hereinafter sometimes referred to as acidity) Microorganisms of L-glutamic acid accumulation capacity under conditions. For example, according to the method described in European Patent Publication No. 1078989, L-glutamine which accumulates more than a saturated concentration for the microorganism of the present invention by obtaining a strain which is resistant to L-glutamic acid in a low pH environment The ability of acid.

The microorganism having the ability to accumulate L-glutamic acid under acidic conditions, specifically, Pantoea ananatis AJ13356 strain (FERM BP-6615) and AJ13601 strain (FERM BP-7207) (refer to the specification of European Patent Application Publication No. 0952221 )Wait. Pantoea ananatis AJ13356 was deposited on February 19, 1998 at the Institute of Biotechnology and Industrial Technology of the Industrial Technology Institute of the Ministry of International Trade and Industry (now known as the Independent Administrative Corporation Product Evaluation Technology Base Agency Chartered Bio-Consignment Center (NITE-IPOD)) under the registration number FERM P-16645 deposit, on January 11, 1999, was transferred to the international deposit under the Budapest Treaty and given the registration number FERM BP-6615. Also, the same strain was identified as Enterobacter agglomerans (Enterobacter agglomerans) when separated, with Enteroba The name of cter agglomerans AJ13355 is registered, but in recent years, it has been classified into Pantoea ananatis (Pantoea ananatis) by reference to the nucleotide sequence analysis of 16S rRNA (see the examples). Further, strains AJ13356 and AJ13601 induced from AJ13355, which will be described later, are also deposited as Enterobacter agglomerans in the above-mentioned depository, but this specification is described as Pantoea ananatis. AJ13601 was established on August 18, 1999 at the Institute of Biotechnology and Industrial Technology of the Industrial Technology Institute of the Ministry of Economy, Trade and Industry (now known as the Independent Administrative Corporation Product Evaluation Technology Base Agency Chartered Bio-Consignment Center (NITE-IPOD)) under the registration number FERM P The -17156 deposit was transferred to the international deposit on July 6, 2000 based on the Budapest Treaty, and was assigned the registration number FERMBP-7207.

Other methods for imparting or enhancing the productivity of L-glutamic acid include a method of imparting tolerance to an organic acid analog or a respiratory inhibitor, or a method of imparting sensitivity to a cell wall synthesis inhibitor. For example, a method of imparting tolerance to monofluoroacetic acid (Japanese Patent Laid-Open Publication No. SHO-50-113209), a method of imparting adenine resistance or thymidine tolerance (Japanese Unexamined Patent Publication No. SHO 57-065198), and a method for weakening urease (Japanese Unexamined Patent Publication No. Publication No. No. No. No. No. No. No. 52-038088), a method of imparting resistance to benzopyrone or naphthoquinone (Japanese Patent Publication No. 52-038088) Japanese Laid-Open Patent Publication No. Sho 56-1889, and a method of imparting tolerance to HOQNO (JP-A-56-140895) and a method of imparting resistance to α-keto-malonic acid (JP-A-57-2689) A method of imparting susceptibility to guanidine (JP-A-56-35981), a method of imparting susceptibility to penicillin (Japanese Patent Laid-Open No. Hei 4-88994), and the like.

Specific examples of such a resistant bacteria include the following strains.

‧Brevibacterium flavum AJ3949 (FERMBP-2632; see Japanese Patent Laid-Open No. 50-113209)

‧Corynebacterium glutamicum AJ11628 (FERM P-5736; see Japanese Laid-Open Patent Publication No. SHO 57-065198)

‧ Brevibacterium flavum AJ11355 (FERM P-5007; refer to Japanese Patent Laid-Open No. 56-1889)

‧Corynebacterium glutamicumAJ11368 (FERM P-5020; see Japanese Patent Laid-Open No. 56-1889)

‧Brevibacterium flavumAJ11217 (FERM P-4318; refer to JP-A-57-26 Bulletin No. 89)

‧Corynebacterium glutamicumAJ11218 (FERM P-4319; see Japanese Patent Laid-Open No. 57-2689)

‧Brevibacterium flavum AJ11564 (FERM P-5472; see Japanese Patent Laid-Open No. 56-140895)

‧ Brevibacterium flavum AJ11439 (FERM P-5136; see Japanese Patent Laid-Open No. 56-35981)

‧Corynebacterium glutamicum H7684 (FERM BP-3004; see Japanese Patent Laid-Open No. 04-88994)

‧Brevibacterium lactofermentum AJ11426 (FERM P-5123; refer to Japanese Patent Laid-Open No. 56-048890)

‧Corynebacterium glutamicum AJ11440 (FERM P-5137; see Japanese Patent Laid-Open No. 56-048890)

‧Brevibacterium lactofermentum AJ11796 (FERM P-6402; see Japanese Patent Laid-Open No. 58-158192)

A preferred example of a microorganism having L-glutamic acid-producing ability is a glutamate dehydrogenase-enhanced bacterium, a glutamate synthase (glnA) activity-enhanced bacterium, a glutaminase gene Destroyed bacteria (European Patent Application Publication No. 1229121, No. 1424398). The activity of branide synthase is enhanced, and it can also be achieved by the destruction of glutamic acid adenyltransferase (glnE) and the destruction of PII control protein (glnB). Further, a strain having a variant glutamate synthase obtained by substituting a tyrosine residue belonging to the 397th position of the genus Escherichia and a glutamate synthase with another amino acid residue is also desirable. An example of an L-glutamic acid producing bacterium (U.S. Patent Application Publication No. 2003-0148474).

Other methods for imparting or enhancing L-glutamic acid production ability include a method of imparting 6-diazo-5-sideoxy-norglycine tolerance (Japanese Patent Laid-Open No. Hei-3-232497) A method of imparting resistance to yttrium methionine and a method of imparting resistance to α-keto maleic acid (Japanese Laid-Open Patent Publication No. SHO 56-151495). Specific examples of the rod-shaped bacteria having L-glutamic acid production ability include the following microorganisms.

‧Brevibacterium flavum AJ11573 (FERM P-5492; Japanese Patent Laid-Open No. 56-161495)

‧Brevibacterium flavum AJ11576 (FERM BP-10381; JP-A-56-161495)

‧ Brevibacterium flavum AJ12212 (FERM P-8123; Japanese Patent Laid-Open No. 61-202694)

Preferred examples of microorganisms producing proline, leucine, isoleucine, valine, arginine, citrulline, ornithine, and/or polyglutamic acid are described in JP-2010 Bulletin No. -41920. Further, microorganisms producing acetic acid, (poly) 3-hydroxybutyric acid, itaconic acid, citric acid, and butyric acid are described in the "Handbook of Fermentation" (Kyoritsu Publishing). The microorganism which produces the 4-amino-butyric acid, for example, the microorganism which introduces the glutamate decarbonate to the microorganism which produces glutamic acid (JP-A-2011-167097). The microorganism which produces a 4-hydroxybutyric acid, for example, a microorganism which introduces glutamic acid decarbonase, an aminotransferase, or an aldehyde dehydrogenase to a microorganism which produces glutamic acid (JP-A-2009-171960).

The microorganism for producing 3-hydroxyisobutyric acid may, for example, be a microorganism into which a route described in, for example, the pamphlet of International Publication No. 2009/135074 or the pamphlet of International Publication No. 2008/145737 is introduced. The microorganism for producing 2-hydroxyisobutyric acid may, for example, be a microorganism into which a route described in, for example, the pamphlet of International Publication No. 2009/135074 or International Publication No. 2009/156214 is introduced. Examples of the microorganism for producing 3-aminoisobutyric acid and/or methacrylic acid include microorganisms introduced into the route described in, for example, the pamphlet of International Publication No. 2009/135074.

The 2-sided oxyglutaric acid producing microorganism of the second invention may have various routes for producing a metabolite by using 2-sided oxyglutaric acid as an intermediate product, or may also enhance the enzyme activity associated with the route. As the route, a route for producing glutamic acid from 2-sided oxyglutaric acid can be cited. The route for producing glutamic acid from 2-oxooxyglutaric acid and the enzyme forming this pathway are as described above.

a microorganism producing glutamic acid from 2-sided oxyglutaric acid, for example, by having 2-sided oxygen The microorganism of the path of producing glutamic acid by glutaric acid is used as a host to construct the 2-sided oxyglutaric acid producing microorganism of the present invention; and the 2-sided oxyglutaric acid can be produced or strengthened by imparting or strengthening the present invention. a gene related to an enzyme of a pathway for producing glutamic acid by 2-sided oxyglutaric acid; a 2-side oxygen which can be produced by inhibiting the 2-sided oxyglutaric acid of the present invention The enzyme activity of the glutamic acid-producing pathway of glutamic acid is deactivated or deactivated.

As another example of the route for producing a metabolite derived from 2-oxooxyglutaric acid, a route for producing arginine, citrulline or ornithine can be cited ("Handbook of Fermentation" p40-p42; Kyoritsu Publishing). Specific examples of the microorganism having the production ability of arginine, citrulline, and ornithine include a coryneform bacterium such as Corynebacterium glutamicum.

As another example of the route for producing a metabolite derived from 2-oxoglutaric acid, a route for producing L-glutamic acid ("Handbook of Fermentation" p56 to p57; Kyoritsu Publishing) can be cited. Specific examples of the microorganism having the production ability of L-glutamic acid include a coryneform bacterium such as Corynebacterium glutamicum.

As another example of the route for producing a metabolite derived from 2-oxoglutaric acid, a route for producing L-glutamic acid ("Handbook of Fermentation" p141 to p145; Kyoritsu Publishing) can be cited. Specific examples of the microorganism having the production ability of L-glutamic acid include rod-shaped bacteria such as Corynebacterium glutamicum.

As another example of the route for producing a metabolite derived from 2-oxooxyglutaric acid, a route for producing polyglutamic acid ("Handbook of Fermentation" p373; Kyoritsu Publishing) can be cited. Specific examples of the microorganism having the production ability of L-glutamic acid include Bacillus anthracis, Bacillus licheniformis, and the like.

2-sided oxyglutaric acid is an intermediate product, and on the other hand, a strain having a production ability of 2-sided oxyglutaric acid itself is known ("Handbook of Fermentation" p56; Kyoritsu Publishing). Representative production strains include coryneform bacteria such as corynebacterium glutamicum, Pseudomonas fluorescens, Bacillus megaterium, Candida lipolytica, Serratia marcescens, and Escherichia coli.

<<Production method of acetaminophen coenzyme A, production method of metabolites using acetaminophen coenzyme A as an intermediate product>>

<<2-Side-oxyglutaric acid production method, production method of metabolites using 2-sided oxyglutaric acid as an intermediate product>>

The production method of the acetaminophen coenzyme A of the first invention and the production method of the metabolite of the acetaminophen coenzyme A as an intermediate product, comprising: a culturing step of contacting the microorganism of the first invention for producing acetaminophen coenzyme A with a carbon source material The culture; and the recovery step, recovering the product of interest obtained by the contact (acetamide coenzyme A, metabolite of acetaminophen coenzyme A as an intermediate product). Ethylene coenzyme A is used as a metabolite of an intermediate product such as acetone, isopropanol or glutamic acid. In the present invention, a metabolite of acetaminophen coenzyme A and acetaminophen coenzyme A as an intermediate product may be collectively referred to as a "product of interest".

According to each of the above production methods, the microorganism produced by the acetaminophen-CoA production microorganism of the first invention is contacted with the carbon source material, and the microorganism producing the acetaminophen coenzyme A can use the carbon source material and fix the carbon dioxide while producing the product with good efficiency. Production.

A method for producing a 2-sided oxoglutaric acid according to the second aspect of the invention, and a method for producing a metabolite of 2-sided oxyglutaric acid as an intermediate product, comprising: a culturing step of producing a 2-side oxygen in the second invention The microorganism of the glutaric acid is contacted and cultured with the carbon source material; and the recovery step recovers the product of interest obtained by the contact (2-sided oxyglutaric acid or 2-sided oxyglutaric acid as an intermediate product) metabolite). 2-sided oxyglutaric acid is used as a metabolite of an intermediate product such as glutamic acid. In the present invention, a metabolite of 2-sided oxyglutaric acid and 2-sided oxyglutaric acid as an intermediate product is sometimes referred to as a "product of interest".

According to each of the above production methods, since the 2-side oxyglutaric acid producing microorganism of the second invention is cultured in contact with a carbon source material, the 2-sided oxyglutaric acid producing microorganism can utilize the carbon source material and fix the carbon dioxide. , the production of the purpose of production with good efficiency.

The carbon source material is not particularly limited as long as it is a carbon source-containing material that can be used by microorganisms, and is preferably a plant-derived material. Plant-derived raw materials, including roots, stems, stems, branches, leaves, flowers, Organs such as seeds, plant bodies containing such organs, decomposition products of such plant organs, and carbon sources obtained from plant bodies, plant organs, or decomposition products thereof, may be utilized as carbon in microbial culture Sources are all included in plant-derived raw materials.

Examples of the carbon source contained in the plant-derived raw material include sugars such as starch, sucrose, glucose, fructose, xylose, and arabinose, and grass wood decomposition products containing a large amount of these components, cellulose hydrolyzate, and the like. And combinations of these, further, vegetable oil derived glycerol or fatty acid may also be included in the carbon source in the present invention.

The above-mentioned plant-derived raw material may preferably be a crop such as a cereal, and is particularly preferably, for example, corn, rice, wheat, soybean, sugar cane, sugar beet, cotton, etc., and a combination thereof, and the use form of the material is unprocessed product, and pressed. Juice, pulverized material, and the like are not particularly limited. Further, it may be in the form of only the above carbon source.

In the culture step, the contact of the microorganism with the plant-derived raw material is generally carried out by using a microorganism cultured in a medium containing the plant-derived raw material.

The contact density of the plant-derived raw material with the microorganism varies depending on the activity of the microorganism, and generally may be set to the initial sugar concentration relative to the mixture (including microorganisms in terms of the concentration of the plant-derived raw material in the medium). The total mass of the mixture of the carbon source materials is 20% by mass or less, and from the viewpoint of the sugar resistance of the microorganism, the starting sugar concentration is preferably set to 15% by mass or less. The other components are not particularly limited as long as they are added in an amount usually added to the culture medium of the microorganism.

Each of the production methods of the present invention may further comprise the step of supplying carbonate ions, hydrogencarbonate ions, carbon dioxide gas (carbonic acid gas) and/or a reducing agent to the medium for culture (hereinafter referred to as a supply step). Supplying carbonate ions, hydrogencarbonate ions, and/or carbon dioxide gas to the medium used for culture, thereby enhancing enzyme activities such as phosphoenolpyruvate carboxylase, pyruvate carboxylase, phosphoenolpyruvate carboxy kinase, and the like The fixed amount of large carbon dioxide can efficiently produce the intended product. The conditions such as the temperature and pH of the supply step can be applied to the same conditions as those of the culture step unless otherwise specified.

The carbonate ion or the hydrogencarbonate ion may be any one derived from a component capable of generating carbonate ions and/or hydrogencarbonate ions by supplying the medium. A component capable of generating carbonic acid ions and/or hydrogencarbonate ions, for example, sodium carbonate, sodium hydrogencarbonate, potassium carbonate, potassium hydrogencarbonate, ammonium carbonate, ammonium hydrogencarbonate, magnesium carbonate, calcium carbonate, or the like.

The amount of carbonate ions and/or hydrogencarbonate ions supplied to the medium is not particularly limited as long as the desired product can be efficiently produced. The total supply amount per 1 L of the medium is preferably 150 mmol or more. By supplying 150 mmol/L or more of carbonate ions and/or hydrogencarbonate ions, the yield of the intended product can be sufficiently increased. The total supply amount of the carbonate ion and/or the hydrogencarbonate ion per 1 L of the medium is more preferably 200 mmol or more.

Further, the total supply amount of the carbonate ion and/or the hydrogencarbonate ion per 1 L of the medium is preferably 5 mol or less. When the total supply amount per 1 L of the culture medium is 5 mol or less, there is no possibility that a large amount of carbonate ions or hydrogencarbonate ions which are not used in the culture step are used. The total supply amount of the carbonate ion and/or the hydrogencarbonate ion per 1 L of the medium is more preferably 3 mol or less, still more preferably 2 mol or less.

The method of supplying carbonate ions and/or hydrogencarbonate ions to the culture medium can be carried out according to a known method. The supply time may be at the start of the culture or in the culture, and is not particularly limited. Carbonate ions and/or hydrogencarbonate ions may be supplied at once or in separate portions.

The carbon dioxide gas may be any gas containing carbon dioxide, and may be, for example, air. The carbon dioxide concentration of the carbon dioxide gas is preferably at least the concentration of carbon dioxide in the air, more preferably 0.1 v/v% or more, still more preferably 1 v/v% or more.

Further, the carbon dioxide concentration is preferably 75 v/v% or less, more preferably 50 v/v% or less, still more preferably 25 v/v% or less.

The carbon dioxide gas can be dissolved in the medium by bubbling or the like. The average bubble diameter of the carbon dioxide gas supplied in the medium can be efficiently produced without any particular limitation. For example, carbon dioxide gas having an average cell diameter of 100 μm or more is preferred. If the carbon dioxide gas has an average cell diameter of 100 μm or more, the foaming property in the medium is extremely high. Increased, and the possibility that fermentation culture is difficult to continue is low. More preferably, it is a carbon dioxide gas having an average cell diameter of 200 μm or more, and more preferably a carbon dioxide gas having an average cell diameter of 500 μm or more. Further, carbon dioxide gas having an average cell diameter of 100 cm or less is preferred. If the average cell diameter is 100 cm or less, it is preferable to allow a sufficient amount of carbon dioxide to be dissolved in the medium. More preferably, it is a carbon dioxide gas having an average cell diameter of 50 cm or less, and more preferably a carbon dioxide gas having an average cell diameter of 20 cm or less.

The carbon dioxide gas can be supplied to the culture medium using a bubble generator which is usually used. A bubble generator, such as an air sparger or the like.

For the method of measuring the average cell diameter, for example, a method of measuring by a laser diffraction scattering method using a particle size distribution measuring device (for example, LS 13 320 manufactured by Beckman Coulter Co., Ltd.), or using a precise particle size distribution measuring device (for example, Multisizer 3 manufactured by Beckmancoulter Co., Ltd.) A method of measuring by a pinhole resistance method, a method of binarizing a shadow image using a high-speed camera, and the like.

The reducing agent is not particularly limited as long as it can reduce the components in the medium or the cells in the culture and the reducing agent itself is oxidized. For example: sulfides, carbon compounds, hydrogen, and the like. Sulfides, such as: sulfites (sodium sulfite, sodium hydrogen sulfite, potassium sulfite, ammonium sulfite, etc.), thiosulfate (sodium thiosulfate, potassium thiosulfate, etc.), salts of sulfide ions (vulcanization) Sodium, sodium hydrogen sulfide, potassium sulfide, ammonium sulfide, etc.), cysteine, sulfur dioxide, hydrogen sulfide, and the like. Carbon compounds such as alcohols, fatty acids, paraffin, carbon monoxide, and the like. The reducing agent is preferably a sulfide, and sodium sulfite, sodium hydrogen sulfite, sodium sulfide, and cysteine are preferred, and sodium sulfite is most preferred.

The concentration of the reducing agent to be supplied to the medium is not particularly limited as long as the desired product can be efficiently produced, and can be appropriately set in accordance with the components to be supplied. For example, the concentration of sodium sulfite is preferably 0.01 g/L or more per 1 L of the medium, more preferably 0.1 g/L or more, and still more preferably 1 g/L or more. Further, the concentration of the reducing agent to be supplied is preferably 50 g/L or less, more preferably 20 g/L or less, still more preferably 10 g/L or less.

Each of the production methods of the present invention may further comprise a gas supply step of supplying a gas containing carbon dioxide generated by the culture and supplying the gas to the culture medium for culture. That is, culture can be The carbon dioxide gas released as the exhaust gas in the base is again supplied to the medium, and is recycled.

The method of supplying the gas to the culture medium is not particularly limited as long as it is a generally usable method. For example, a method in which a gas is pressurized and ejected in a liquid by a ring-shaped or plate-like member having pores (in the case where the gas is air, a method called an aerator or a gas filling method) is called A method of supplying a hollow tube having a gap in the entire circumference of the ventilating tube, and a porous material having a large number of holes for generating fine bubbles such as air is provided at the front end portion of the tube made of plastic or stainless steel. Air blower (gas disperser) method, etc.

The content of the microorganism in the medium varies depending on the type and activity of the microorganism. Generally, the amount of the bacterial solution (OD660nm=4 to 8) cultured before the start of the culture is set to 0.1% by mass to 30% with respect to the culture solution. The mass % is preferably from 1% by mass to 10% by mass from the viewpoint of control of culture conditions.

The medium to be used for the culture of the microorganism is not particularly limited as long as it is a medium which is usually used, such as a carbon source, a nitrogen source, an inorganic ion, and an inorganic trace element, a nucleic acid, a vitamin, and the like which are required for the production of a microorganism.

The culture conditions in the culture step are not particularly limited, for example, under aerobic conditions, in the range of pH 4 to 9 (preferably pH 6 to 8) and temperature of 20 to 50 ° C (preferably 25 to 42 ° C). The culture is carried out under the conditions of controlling pH and temperature.

The aeration amount of the gas in the mixture containing the microorganism and the carbon source material is not particularly limited. When the gas uses only air, it is generally 0.02 vvm to 2.0 vvm (vvm; aeration capacity [mL] / liquid capacity [mL] / hour. [5], 50 to 600 rpm, from the viewpoint of suppressing physical damage to microorganisms, preferably from 0.1 vvm to 2.0 vvm, more preferably from 0.1 vvm to 1.0 vvm.

The culture step can be continued from the start of the culture until the consumption of the carbon source material in the mixture, or the activity of the microorganism disappears. During the incubation step, depending on the microorganisms in the mixture The number and the amount of the active material and the carbon source material vary, and it is generally carried out for 1 hour or longer, preferably 4 hours or longer. The culture step can be continued without any restriction by continuously feeding the carbon source material or the microorganism, but from the viewpoint of the treatment efficiency, it is usually 5 days or shorter, preferably 72 hours or shorter. Other conditions can be directly applied to the conditions normally used for cultivation.

The method for recovering the target product accumulated in the culture solution is not particularly limited. For example, the culture solution obtained by the culture step is a mixture of the target product and other components, so that, for example, the cells can be centrifuged from the culture solution. After the removal, the desired product is separated by a usual separation method such as distillation or membrane separation under the conditions of the type of the product to be used.

Further, each production method of the present invention may include a culture step before the culture step to make the microorganism to be used an appropriate number of bacteria or/and a moderately active state. The pre-culture step can be cultured in accordance with the culture conditions normally used for the type of microorganism.

-Isopropanol production method, acetone production method -

The method for producing isopropanol of the present invention and the method for producing acetone include the production of microorganisms using acetaminophen coenzyme A, and the production of isopropanol or acetone for each purpose from a carbon source material. That is, the method for producing isopropanol of the present invention and the method for producing acetone include the following steps: a step of cultivating the acetaminophen-CoA producing microorganism in contact with a carbon source material; and a production product which is obtained by using the aforementioned contact (different Recovery step for the recovery of propanol or acetone).

As a production process of acetaminophen coenzyme A used as a method for producing isopropanol, from the viewpoint of production efficiency of isopropyl alcohol, the thiolase activity and coenzyme A transferase activity as described above, which is an ideal form of acetaminophen coenzyme A production microorganism Ethyl acetate decarboxylase activity and isopropanol dehydrogenase activity are preferred.

As a production process of the acetone coenzyme A used as an acetone production method, from the viewpoint of the production efficiency of acetone, the above-mentioned thiolase activity, coenzyme A transferase activity, and acetamidine acetate are ideal as one of the acetaminophen coenzyme A producing microorganisms. Decarboxylase activity is preferred.

The isopropanol production method and the acetone production method preferably comprise the following steps: a culture step (sometimes Also referred to as "aeration culture step"), while supplying a gas to a mixture containing a mixture of acetaminophen coenzyme A producing microorganisms and a carbon source material, while cultivating a acetaminophen coenzyme A producing microorganism; and a target product recovery step, the mixture is cultured from the foregoing The product of the purpose of the step generation (isopropanol or acetone) is separated and recovered. By the aeration culture in the aeration culture step, the intended product is released into the mixture, and at the same time the mixture is evaporated, as a result of which the desired product can be easily separated from the mixture. Further, since the intended product is continuously separated from the mixture, it is possible to suppress an increase in the concentration of the intended product in the mixture. Therefore, it is not necessary to specifically consider the tolerance of the production of microorganisms by the coenzyme A to the intended product. The above matters can be directly applied to the culture conditions.

As a method for recovering the intended product in the above-described production recovery step, it is sufficient to collect the gas-like or droplet-shaped product which is evaded from the mixture by the culture. For example, it is preferable to contain a collecting member such as a sealed container which is generally used, and from the viewpoint of recovering only the intended product in high purity, it is preferable to include a step of contacting the product having the purpose of capturing the target product with the purpose of separating the product from the mixture. The method is preferred.

In the isopropanol production method or the acetone production method, the intended product can be recovered in a state in which the capture liquid or the mixture is dissolved. Examples of such a recovery method include the methods described in International Publication No. 2009/008377. When the intended product of the recovery is in the state of an aqueous solution, the present invention may further comprise a dehydration step. Dehydration of the intended product can be carried out according to the usual method. The purpose of the recovered product can be confirmed by a usual detection means such as HPLC. The purpose of the recovered product can be further refined as needed. The purification method may, for example, be distillation.

A device which can be applied to a production method of a target product which is recovered in a state in which a capture liquid or a mixture is recovered, for example, the production apparatus shown in Fig. 1 of International Publication No. 2009/008377. In the production apparatus, an injection tank for injecting a gas from the outside of the apparatus is connected to a culture tank containing a medium containing a microorganism for use and a plant-derived raw material, and the medium can be ventilated. The culture tank is connected to a collection tank that is used as a trapping liquid (collection liquid) via a connecting pipe. The product in the culture tank is evaded by aeration due to aeration, and can be easily separated from the culture medium, and at the same time, the gas or liquid moving toward the trap tank contacts the trapping liquid to generate bubbles, which are trapped by the trap. . According to this production apparatus, the intended product can be continuously and simply produced in a more refined form.

- glutamic acid production method -

The method for producing glutamic acid of the present invention comprises the steps of producing microorganisms by using acetaminophen coenzyme A to produce microorganisms or 2-oxoglutaric acid, and producing glutamic acid from a carbon source material. That is, the glutamic acid production method of the present invention comprises the steps of: culturing a step of contacting and cultivating the acetaminophen coenzyme A producing microorganism or the 2-sided oxyglutaric acid producing microorganism with the carbon source material; and recovering and recycling the foregoing The product of interest (glutamic acid) obtained by contact.

According to the present invention, the glutamic acid production method is such that the acetaminophen coenzyme A producing microorganism or the 2-sided oxyglutaric acid producing microorganism is contacted and cultured with the carbon source material, so the acetaminophen coenzyme A produces the microorganism or the 2-sided oxy group. The glutaric acid producing microorganism utilizes a carbon source material to produce glutamic acid with good efficiency while fixing carbon dioxide.

As the culture medium to be used, a usual medium containing a carbon source; a nitrogen source; an inorganic salt; an amino acid such as an amino acid or a vitamin can be used. Synthetic or natural media can be used. The carbon source and the nitrogen source used in the culture medium can be used in various types as long as they are cultured strains.

As the carbon source material, sugars such as glucose, glycerin, fructose, sucrose, maltose, mannose, galactose, starch hydrolyzate, and molasses can be used, and alcohols such as acetic acid, citric acid, and the like, and alcohols such as ethanol can be used alone or in combination with others. Use carbon sources together. As the nitrogen source, an ammonium salt such as ammonia, ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate or ammonium acetate; a nitrate or the like can be used. As the inorganic salt, a phosphate, a magnesium salt, a calcium salt, an iron salt, a manganese salt or the like can be used. Organic micronutrients, which can use amino acids, vitamins, fatty acids, nucleic acids, and peptones, casein amino acids, yeast extracts, soy protein decomposers, etc. When a nutrient-requiring mutant such as a base acid is used, it is preferred to supplement the nutrients required.

The culture is preferably controlled at a temperature of 20 to 45 ° C, a pH control of 3 to 9, and aeration culture. Further, as the pH adjustment, an inorganic or organic acidic, basic substance, ammonia gas or the like can be used. L-amine is accumulated in the culture solution or in the bacteria by preferably culturing for about 10 hours to 120 hours under such conditions. Base acid.

Further, in the case where the objective L-amino acid is L-glutamic acid, a liquid medium adjusted to the conditions for precipitation of L-glutamic acid may be used, and the L-glutamic acid may be precipitated while being cultured in the medium. Generate, accumulate. The conditions for the precipitation of L-glutamic acid are, for example, pH 4.0 to 5.0, preferably pH 4.0 to 4.5, more preferably pH 4.0 to 4.3, and particularly preferably acidic conditions of pH 4.0. Further, in order to balance the growth of microorganisms under acidic conditions and to efficiently precipitate L-glutamic acid, the pH is preferably 4.0 to 5.0, more preferably 4.0 to 4.5, still more preferably 4.0 to 4.3. Further, the culture at the above pH may be a part of the period of the culture.

After the completion of the culture, the method of taking the L-amino acid from the culture solution may be carried out by a known recovery method. For example, a method of performing concentrated crystallization after removing the cells from the culture solution or taking it by ion exchange chromatography or the like. When the culture is carried out under conditions in which L-glutamic acid is precipitated in the culture medium, the L-glutamic acid in the precipitated culture solution can be taken by centrifugation or filtration. In this case, L-glutamic acid dissolved in the medium can also be collected after crystallization.

Application of the microorganism of the invention to produce proline, leucine, isoleucine, valine, arginine, citrulline, ornithine, acetic acid, (poly) 3-hydroxybutyric acid, itaconic acid, The methods of citric acid, butyric acid, and polyglutamic acid are, for example, in the "Handbook of Fermentation" (Kyoritsu Publishing) p363~p364, p61~p63, p61~p63, p61~p63, p40~p42, p40~p42, p40~ Methods described in p42, p189~p192, p377~p378, p64~p65, p124~p125, p19~p23, p373.

A method for producing 4-aminobutyric acid by using the microorganism of the present invention, for example, a production method using a microorganism having a glutamic acid decarboxylase introduced into a glutamic acid producing microorganism (JP-A-2011-167097).

A method for producing 4-hydroxybutyric acid by using the microorganism of the present invention, for example, a microorganism in which a glutamic acid decarbonation enzyme, an aminotransferase, and an aldehyde dehydrogenase are introduced into a glutamic acid producing microorganism (JP-A-2009-171960) Production method of the bulletin.

A method for producing 3-hydroxyisobutyric acid using the microorganism of the present invention, for example, a method for producing a microorganism having a route introduced by International Publication No. 2009/135074 or International Publication No. 2008/145737.

A method for producing 2-hydroxyisobutyric acid using the microorganism of the present invention, for example, a method for producing a microorganism having a route introduced by International Publication No. 2009/135074 or International Publication No. 2009/156214.

A method for producing 3-aminoisobutyric acid and/or methacrylic acid by using the microorganism of the present invention, for example, a method for producing a microorganism into which the route described in International Publication No. 2009/135074 is introduced.

[Examples]

The invention will be described in detail below by way of examples. However, the invention is not limited to the embodiment.

In order to enable a promoter necessary for gene expression introduced from outside the cell, a promoter of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) derived from Escherichia coli can be used. The base sequence of the GAPDH promoter derived from Escherichia coli is described in 397-440 in the base sequence information of GenBank accession number X02662. The GAPDH promoter in the following examples refers to the above GAPDH promoter.

E. coli MG1655 is available from ATCC (American Type Culture Collection).

E. coli B (ATCC 11303) is available from ATCC.

The genetic DNA of Methylococcus capsulatus ATCC33009 (ATCC33009D-5) is available from ATCC.

Corynebacterium DSM 1412 is available from DSMZ (German Collection of Microorganisms and Cell Cultures).

[Example 1]

<Production of Escherichia coli B strain atoD gene-enhanced strain>

The entire base sequence of the genome DNA of Escherichia coli MG1655 is known (GenBank accession number U00096), and is encoded as a base of the gene of the coenzyme A transferase α subunit of Escherichia coli MG1655 (hereinafter sometimes referred to as "atoD"). Sequences have also been reported. That is, atoD is described as 2321469 to 2322131 of the Escherichia coli MG1655 gene sequence described in GenBank accession number U00096.

In order to obtain the GAPDH promoter, the genomic DNA of Escherichia coli MG1655 was used as a template, and CGCTCAATTGCAATGATTGACACGATTCCG (SEQ ID NO: 83) and ACAGAATTCGCTATTTGTTAGTGAATAAAAGG (SEQ ID NO: 84) were used as primers, and amplified by PCR. The obtained DNA fragments were restricted enzymes MfeI and EcoRI. Digestion, thereby obtaining a DNA fragment encoding the GAPDH promoter of about 100 bp.

The DNA fragment obtained was mixed with the plastid pUC19 (GenBank accession number X02514), which was digested with restriction enzyme EcoRI and further treated with alkaline phosphatase, and ligated with ligase, and competent for Escherichia coli DH5α strain (Toyobo ( The company DNA-903) was transformed to obtain a transformant grown on an LB agar plate containing 50 μg/mL ampicillin. Ten obtained colonies were cultured in LB liquid medium containing 50 μg/mL ampicillin at 37 ° C for one night, and the plastids were collected, and the GAPDH promoter was not excised when the restriction enzymes EcoRI and KpnI were digested, and the DNA sequence was confirmed. The person who has correctly inserted the GAPDH promoter is named pUCgapP. The obtained pUCgapP was digested with restriction enzymes EcoRI and KpnI.

In order to obtain atoD, the genomic DNA of Escherichia coli MG1655 was used as a template, and CGAATTCGCTGGTGGAACATATGAAAACAAAATTGATGACATTACAAGAC (SEQ ID NO: 85) and GCGGTACCTTATTTGCTCTCCTGTGAAACG (SEQ ID NO: 86) were used as primers to amplify by PCR, and the obtained DNA fragment was digested with restriction enzymes EcoRI and KpnI. This resulted in an atoD fragment of approximately 690 bp. This DNA fragment was mixed with pUCgapP digested with restriction enzymes EcoRI and KpnI, and ligated with ligase, and transformed into E. coli DH5α strain competent cell (Toyobo Co., Ltd. DNA-903), and obtained at 50 μg/mL Anbi. A transformant of LB agar plates grown in Xilin. The plastid was recovered from the obtained cells, and it was confirmed that the atoD was correctly inserted, and the plastid was named pGAPatoD.

Using the GCTCTAGATGCTGAAATCCACTAGTCTTGTC (SEQ ID NO: 87) and TACTGCAGCGTTCCAGCACCTTATCAACC (SEQ ID NO: 88) primers based on the gene information in the vicinity of 5' of the atoD of MG1655, the primer DNA of E. coli MG1655 was used as a template for PCR and put about 1.1 kbp. DNA fragment.

GGTCTAGAGCAATGATTGACACGATTCCG (SEQ ID NO: 89) prepared according to the sequence information of the GAPDH promoter of Escherichia coli MG1655, and GCGGTACCTTATTTGCTCTCCTGTGAAACG (SEQ ID NO: 90) prepared according to the sequence information of the atoD of Escherichia coli MG1655, and the plastid pGAPatoD was used as a template for PCR. A DNA fragment of about 790 bp composed of the GAPDH promoter and atoD was obtained.

The DNA fragment of about 1.1 kbp was digested with restriction enzymes PstI and XbaI, and the DNA fragment of about 790 bp was digested with restriction enzymes XbaI and KpnI, and the two fragments and the temperature-sensitive property pTH18cs1 (GenBank accession number AB019610) (Gene, 2000; 241: 185-191) A fragment obtained by digesting PstI and KpnI was mixed, and after binding with a ligase, the DH5α strain was transformed to obtain an LB agar plate containing 10 μg/mL of chloramphenicol grown at 30 ° C. Shaped body. The obtained colonies were cultured in an LB liquid medium containing 10 μg/mL of chloramphenicol at 30 ° C overnight, and the plastids were recovered from the obtained cells. This plasmid was transformed into Escherichia coli B (ATCC11303), and cultured on an LB agar plate containing 10 μg/mL of chloramphenicol at 30 ° C overnight to obtain a transformant. The obtained transformant was inoculated to an LB liquid medium containing 10 μg/mL of chloramphenicol, and cultured at 30 ° C overnight. The obtained cultured cells were spread on an LB agar plate containing 10 μg/mL of chloramphenicol, and cultured at 42 ° C to obtain colonies. The obtained colonies were cultured in an LB-free liquid medium containing no antibiotics at 30 ° C for 2 hours, and coated on an LB agar plate containing no antibiotic to obtain colonies grown at 42 ° C.

One hundred colonies were randomly picked from the colonies which appeared, and were grown on an LB agar plate containing no antibiotics and an LB agar plate containing 10 μg/mL of chloramphenicol to select a chloramphenicol-sensitive colony. Furthermore, approximately 790 bp fragment containing the GAPDH promoter and atoD was amplified by PCR from the chromosomal DNA of the selected colonies, and a strain in which the atoD promoter region has been substituted with the GAPDH promoter was selected, and the colonies satisfying the above conditions were named. Escherichia coli B strain atoD gene recombinant strain (hereinafter also referred to as "B::atoDAB strain").

[Embodiment 2]

<Production of plastid pIaz>

The acetamidine acetic acid decarboxylase of the genus Clostridium is described in GenBank accession number M55392, and the isopropanol dehydrogenase is described in GenBank accession number AF157307.

In order to obtain the GAPDH promoter, the genomic DNA of Escherichia coli MG1655 was used as a template, and CGAGCTACATATGCAATGATTGACACGATTCCG (SEQ ID NO: 91) and CGCCGCGCATGCTATTTGTTAGTGAATAAAAGG (SEQ ID NO: 92) were used as primers to be amplified by PCR, and the obtained DNA fragment was digested with restriction enzymes NdeI and SphI. A DNA fragment corresponding to the GAPDH promoter of about 110 bp was obtained. This DNA fragment was mixed with a fragment obtained by digesting the plastid pBR322 (GenBank accession number J01749) with restriction enzymes NdeI and SphI, and after binding with ligase, the competent cell of Escherichia coli DH5α strain (Toyobo Co., Ltd. DNA- 903) Transformation was carried out to obtain a transformant grown on an LB agar plate containing 50 μg/mL ampicillin. The obtained colonies were cultured in an LB liquid medium containing 50 μg/mL of ampicillin at 37 ° C for one night, and the plastids were recovered from the obtained cells to obtain plastid pBRgapP.

In order to obtain the isopropanol dehydrogenase gene, the gene DNA of Clostridium beijerinckiiNRRL B-593 was used as a template, and ASATTGCATGCTGGTGGAACATATGAAAGGTTTTGCAATGCTAGG (SEQ ID NO: 93) and ACGCGTCGACTTATAATATAACTACTGCTTTAATTAAGTC (SEQ ID NO: 94) were used as primers to be amplified by PCR, and the obtained DNA fragment was obtained by PCR. The restriction enzymes SphI and SalI were digested to obtain an isopropanol dehydrogenase fragment of about 1.1 kbp. The obtained DNA fragment was mixed with a fragment obtained by digesting the plastid pUC119 with restriction enzymes SphI and SalI, and after binding with a ligase, the competent cells of the Escherichia coli DH5α strain were transformed to obtain an ampicillin containing 50 μg/mL. A morph of the growth of LB agar plates. The obtained colony was cultured in an LB liquid medium containing 50 μg/mL of ampicillin at 37 ° C for one night, and the plastid was recovered from the obtained cells, and it was confirmed that IPAdh was correctly inserted, and the plasmid was named pUC-I.

a fragment containing IPAdh obtained by digesting plastid pUC-I with restriction enzymes SphI and EcoRI, The fragment obtained by digesting the plastid pBRgapP with restriction enzymes SphI and EcoRI was mixed, and after binding with ligase, the competent cells of Escherichia coli DH5α strain were transformed to obtain a growth of LB agar plates containing 50 μg/mL ampicillin. Form. The obtained colony was cultured in an LB liquid medium containing 50 μg/mL of ampicillin at 37 ° C for one night, and the plastid was recovered from the obtained cells, and it was confirmed that IPAdh was correctly inserted, and the plastid was named pGAP-I.

In order to obtain the acetaminoacetate decarboxylase gene, the genomic DNA of Clostridium acetobutylicum ATCC824 was used as a template, and amplification was carried out by PCR using ACGCGTCGACGCTGGTGGAACATATGTTAAAGGATGAAGTAATTAAACAAATTAGC (SEQ ID NO: 95) and GCTCTAGAGGTACCTTACTTAAGATAATCATATATAACTTCAGC (SEQ ID NO: 96) as primers, and the obtained DNA fragment was restricted enzyme SalI. And XbaI digestion, thereby obtaining an about 700 bp acetamidine decarboxylase fragment. The obtained DNA fragment was mixed with a fragment obtained by digesting the plastid pGAP-I with restriction enzymes SalI and XbaI, and after binding with a ligase, the competent cells of the Escherichia coli DH5α strain were transformed to obtain an Anbi containing 50 μg/mL. A transformant of LB agar plates grown in Xilin. The obtained colonies were cultured in an LB liquid medium containing 50 μg/mL of ampicillin at 37 ° C for one night, and the plastids were recovered from the obtained cells, and it was confirmed that adc was correctly inserted, and the plastid was named pIa.

In order to obtain the glucose 6-phosphate-1-dehydrogenase gene (zwf), the Escherichia coli B strain genomic DNA (GenBank accession number CP000819) was used as a template, and GCTCTAGACGGAGAAAGTCTTATGGCGGTAACGCAAACAGCCCAGG (SEQ ID NO: 97) and CGGGATCCCGGAGAAAGTCTTATGAAGCAAACAGTTTATATCGCC (SEQ ID NO: 98) were used. The primer was amplified by a PCR method, and the obtained DNA fragment was digested with restriction enzymes XbaI and BamHI, thereby obtaining a glucose hexaphosphate 1-dehydrogenase fragment of about 1500 bp. The obtained DNA fragment was mixed with a fragment obtained by digesting the plastid pIa with restriction enzymes XbaI and BamHI, and after binding with a ligase, the competent cells of the Escherichia coli DH5α strain were transformed to obtain an ampicillin containing 50 μg/mL. A morph of the growth of LB agar plates. The obtained colonies were cultured overnight at 37 ° C in LB liquid medium containing 50 μg / mL of ampicillin, and the obtained plastid was named pIaz.

[Example 3]

<Production of plastid pMWGKC>

The plastid pBRgapP was used as a template, and was amplified by PCR using CCGCTCGAGCATATGCTGTCGCAATGATTGACACG (SEQ ID NO: 99) and GCTATTCCATATGCAGGGTTATTGTCTCATGAGC (SEQ ID NO: 100) as primers, and the obtained DNA fragment was phosphorylated by T4 Polynucleotide Kinase (Takara), thereby obtaining GAPDH-containing promoter. DNA fragment of the child.

The plastid pMW119 (GenBank accession number AB005476) was treated with restriction enzymes AatII and NdeI, and the obtained DNA fragment was smoothed with KOD plus DNA polymerase (Takara) to obtain a DNA fragment containing the origin of replication of pMW119.

The DNA fragment containing the GAPDH promoter was mixed with the DNA fragment containing the origin of replication of pMW119, and after binding with ligase, the competent cells of Escherichia coli DH5α strain were transformed to obtain growth on LB agar plates containing 50 μg/mL ampicillin. Shaped body. The obtained colonies were cultured in an LB liquid medium containing 50 μg/mL of ampicillin at 37 ° C for one night, and the plastids were recovered from the obtained cells to obtain plastid pMWG.

In order to obtain the chloramphenicol resistance gene, pTH18cs1 (GenBank accession number AB019610) was used as a template, and TCGGCACGTAAGAGGTTCC (SEQ ID NO: 101) and CGGGTCGAATTTGCTTTCG (SEQ ID NO: 102) were used as primers to amplify by PCR, and the obtained DNA fragment was subjected to T4 Polynucleotide Kinase ( Takara) phosphorylation, thereby obtaining a DNA fragment containing a chloramphenicol resistance gene. Then, using pMWG as a template, CTAGATCTGACAGTAAGACGGGTAAGCC (SEQ ID NO: 103) and CTAGATCTCAGGGTTATTGTCTCATGAGC (SEQ ID NO: 104) were used as primers to amplify by PCR, mixed with a DNA fragment containing a chloramphenicol resistance gene, and ligated with ligase for Escherichia coli DH5α strain. Competent cells were transformed and transformed into morphs grown on LB agar plates containing 25 μg/mL chloramphenicol. The obtained colony was cultured in an LB liquid medium containing 25 μg/mL of chloramphenicol at 37 ° C overnight, and the obtained plastid was named pMWGC.

Using plastid pMWGC as a template, use CCTTTGGTTAAAGGCTTTAAGATC TTCCAGTGGACAAACTATGCC (SEQ ID NO: 105) and GGCATAGTTTGTCCACTGGAAGATCTTAAAGCCTTTAACCAAAGG (SEQ ID NO: 106) were amplified by PCR using primers, transformed into competent cells of Escherichia coli DH5α strain, and transformed into LB agar plates containing 25 μg/mL chloramphenicol. The obtained colony was cultured in an LB liquid medium containing 25 μg/mL of chloramphenicol at 37 ° C for one night, and the plastid was recovered from the obtained cells to obtain a plastid pMWGKC.

[Example 4]

<Production of Escherichia coli strain for evaluation>

The apple 醯CoA lyase gene (SEQ ID NO: 42) from Methylococcus capsulatus ATCC33009, the subunit β gene of malate thiokinase (SEQ ID NO: 30), and the subunit α gene of malate thiokinase (SEQ ID NO: 29) The PCR method amplifies the region covering the SD sequence (Shine dalgarno sequence) and the start codon to the translation stop codon, respectively. Since these three gene lines are continuous on the genome of Methylococcus capsulatus, they can be obtained for one fragment. The amplified fragment obtained is ligated under the control of the gap promoter possessed by plastid pMWGKC. The obtained plastid was named pMWGKC_mcl(Mc)_mtk(Mc).

For the glycine transaminase gene (SEQ ID NO: 64) from Methylococcus capsulatus ATCC33009, the region encompassing the SD sequence and the start codon to the translation stop codon was amplified by PCR. The amplified fragment obtained was ligated downstream of the malate thiokinase (mtk) sequence of the plastid pMWGKC_mcl(Mc)_mtk(Mc). The obtained plastid was named pMWGKC_mcl(Mc)_mtk(Mc)_gta(Mc).

The B::atoDAB strain was transformed using the plastid pIaz and the plastid pMWGKC or the plastid pMWGKC_mcl(Mc)_mtk(Mc)_gta(Mc), and named as EC/vec, EC/mtk_mcl_gta, respectively.

[Example 5]

< ¹³ C-labeled CO ₂ to isopropyl alcohol for verification >

100 mL of LB liquid medium was prepared in a 500 mL baffled Erlenmeyer flask, and utilized Autoclave sterilization at 121 ° C for 20 minutes. Ampicillin (final concentration: 50 μg/mL) and chloramphenicol (final concentration: 34 μg/mL) were added to the medium, and inoculated into EC/vec or EC/mtk_mcl_gta-platinum prepared in Example 4, and cultured at 30 ° C, 130 rpm. About 20 hours. The cells were separated from the culture solution by centrifugation (5000 G × 15 minutes), and the cells were resuspended in 10 mL of physiological saline to obtain a bacterial suspension.

In a 100 mL Erlenmeyer flask, 30 mL of M9 minimal medium containing 100 mM of ¹³ C-labeled sodium hydrogencarbonate, 50 g/L of glucose, 34 μg/mL of chloramphenicol, and 50 μg/mL of ampicillin was prepared. 3 mL of the above-mentioned bacterial suspension was inoculated in this medium, sealed with a lid, and cultured at 30 ° C, 100 rpm for 24 hours. The culture solution obtained was filtered under reduced pressure using a filter cartridge (ADVANTEC, KGS-47) equipped with a hydrophilic PTF filter (ADVANTEC, H050A047A, pore size: 0.5 μM, diameter: 47 mm), and separated into culture. The supernatant and the bacteria.

The filter membrane to which the cells were attached was immediately immersed in 1.6 mL of methanol (LC/MS grade) cooled to -20 ° C and stirred, and then allowed to stand at -20 ° C for 1 hour. After 1 hour, 1.6 mL of chloroform (HPLC grade) cooled to -20 ° C and 0.64 mL of pure water cooled to 4 ° C were added, and stirred with a vortex mixer for 30 seconds. Thereafter, the mixture was centrifuged at 4 ° C, and the supernatant was recovered to obtain a methanol extract of the cells. This was analyzed by LC-MS/MS to determine the molecular weight distribution of acetaminophen coenzyme A in the cells. The molecular weight distribution of acetaminophen coenzyme A is converted to the ratios of molecular weights 808, 809 and 810 of the mass spectrum peaks as M+0, M+1 and M+2, respectively.

The concentrated alcohol and acetone were taken out from the culture supernatant by distillation to obtain a raw material for molecular weight distribution measurement. The molecular weight distribution of isopropanol and ethanol in the culture supernatant was analyzed by GC-MS. The molecular weight distribution of isopropyl alcohol (IPA) was converted into the ratios of molecular weights 117, 118, and 119 of the peak of the mass spectrum as M+0, M+1, and M+2, respectively. The molecular weight distribution of ethanol (EtOH) is converted into the ratio of the molecular weights 103, 104, and 105 of the peak of the mass spectrum as M+0, M+1, and M+2, respectively.

The strain EC/mtk_mcl_gta has been introduced into the fixed path of carbonic acid. Compared with the control strain EC/vec, the ratio of the coenzyme A (M+0) which is not introduced into ¹³ C is low, and the 1 ^{13 13} C acetonitrile coenzyme A is introduced. The proportion of (M+1) is increased. Therefore, it was found that in the EC/mtk_mcl_gta strain, carbon derived from the ¹³ C-labeled carbonic acid was introduced into the acetaminophen coenzyme A.

[Embodiment 6]

<Acquisition of the plastid Pantoea ananatisPA strain>

The plastid RSFCPG was taken from Pantoea ananatis AJ13601 (patent deposited strain BP-7207). The plastid RSFCPG is a tetracycline tolerant substance that catalyzes the synthesis of L-glutamic acid, glutamate dehydrogenase, citrate synthase, and phosphoenolpyruvate carboxylase. (Japanese Laid-Open Patent Publication No. 2001-333769). Pantoea ananatis AJ417 (patent-registered strain BP-8646) was transformed into a CaCl ₂ method (Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press (2001)) using a plastid RSFCPG to contain 10 μg/mL. The LB medium of tetracycline was cultured to obtain Pantoea ananatis AJ417/RSFCPG (hereinafter sometimes referred to as "PA strain").

[Embodiment 7]

<Evaluation of the construction of Pantoea ananatis strain>

The PA strains prepared in Example 6 were transformed using pMWGKC or pMWGKC_mcl(Mc)_mtk(Mc)_gta(Mc), and each was named PA/vec, PA/mtk_mcl_gta.

[Embodiment 8]

<Using the Pantoea strain to test the introduction of ¹³ C-labeled CO ₂ to glutamic acid>

The target pantoea strain was precultured in an LB medium containing 30 μg/mL chloramphenicol, 120 μg/mL spectinomycin, and 15 μg/mL tetracycline at 220 rpm and 30 °C. The cells were recovered by centrifugation (5000 rpm × 5 minutes) from the previous culture solution. Prepare minimal medium for pantoea containing 100 mM sodium bicarbonate (labeled with ¹³ C), 20 g/L glucose, 30 μg/mL chloramphenicol, 120 μg/mL spectinomycin, 15 μg/mL tetracycline 17g/L Na ₂ HPO ₄ ‧12H ₂ O, 3g/L KH ₂ PO ₄ , 0.5g/L NaCl, 1g/L NH ₄ Cl, 10mM MgSO ₄ , 10μM CaCl ₂ , 50mg/L L-lysine, 50mg/ L L-Methionine, pH 6.0) 2 mL, the pre-cultured cells were adjusted to have an OD of 1 to 5 and added. After capping, the cells were cultured at 30 ° C and 220 rpm for 1 day. The culture solution was sampled periodically, and centrifuged (12,000 rpm × 3 minutes) to remove the cells, and the supernatant was filtered with a hydrophilic PTF filter (MILLIPORE, MSGVN2B50) to prepare a culture sample.

When the ¹³ C content in the glutamic acid of the culture sample is measured, an appropriate amount of the culture sample is freeze-dried or dried under reduced pressure, and then 500 μL of MTBSTFA+1% TBDMSCl (manufactured by Sigma Aldrich Co., Ltd., 375934) and 500 μL of anhydrous are added. DMF was heated at 80 ° C for 2 hours, centrifuged (14,000 rpm x 5 minutes), and the supernatant was analyzed by GC-MS (Agilent 7890A and 5975C). The area of the mass spectrum peak of the molecular weights 432, 433, and 434 of the structure in which the third butyl group of the derivatized glutamic acid was removed was measured. It is speculated that the molecular weight 432 is a structure in which all atoms are composed of the most common isotopes, and molecular weights 433 and 434 are structures further containing one or two neutrons. The peaks of the molecular weights 432, 433, and 434 are each taken as [M+0], [M+1], and [M+2], and the values of [M+1]/[M+0] are plotted on the x-axis, [M. The value of +2]/[M+0] is plotted on the y-axis and the analysis results can be resolved.

In the usual glutamic acid fermentation, ¹³ C derived from NaH ¹³ CO ₃ is introduced into the carbon of one or five positions of glutamic acid by ganotypic acetic acid, and thus is a value on the reference line. The baseline is obtained by the following formula.

x=(x ₀ -x ₀ ×α+α)/(1-α)

y=(y ₀ -y ₀ ×α+x ₀ ×α)/(1-α)

α represents the ratio of the ¹³ C isotope of carbon (the 1 or 5 position) from CO ₂ in glutamic acid {≒ ¹³ C/( ¹³ C+ ¹² C)}. x and y represent coordinates of any point on the reference line. x _0, y _0, the system assumes that the glutamic acid from the CO ₂ of carbon (carbon in any one of the one or glutamic 5) the ratio of the isotope ratio of ¹² C ratio is 100% which, other atoms The values of x and y when the natural isotope ratio is equal (i.e., the values of x and y when α = 0) are set to 0.358527 and 0.16822084314, respectively. If the above formula is resolved, the baseline is as follows.

y=x ₀ ‧x+y ₀ -x ₀ ²

In the original glutamate production pathway, ¹³ C from NaH ¹³ CO ₃ consists of phosphoenolpyruvate carboxylase (Ppc), pyruvate carboxylase (Pyc), phosphoenolpyruvate carboxy kinase (Pck). These carbonic acid immobilized enzymes are fixed and introduced into only one of the carbons at the 1 or 5 position of glutamic acid via grass hydrazine acetic acid. Here, the value of [M+1] and [M+2] will change depending on the ratio of ¹² CO ₂ to ¹³ CO ₂ in Ppc, but when the introduction point is 1 place, it will always be on the baseline. value. On the other hand, if the putative carbonation fixed path acts, ¹³ C will pass through both the grass 醯 acetic acid and the acetaminophen coenzyme A, so it may be introduced into the 1 and 5 positions of the glutamic acid carbon at the same time. The value of [M+2] is relatively high and should be a higher value than the baseline.

The strain (PA/mtk_mcl_gta) that has been introduced into the fixed carbonation path shows a value higher than the baseline. On the other hand, the control strain (PA/vec) is roughly on the baseline. Therefore, it was found that in the PA/mtk_mcl_gta strain, ethylene coenzyme A was introduced with carbon derived from ¹³ C-labeled carbonic acid.

[Embodiment 9]

<Using pantothenic acid strain for glutamic acid production>

The amount of glutamic acid and the amount of by-product in the culture solution of Example 8 were measured. The glutamic acid in the culture sample was quantified using HPLC (Waters Corporation 2695) equipped with a NN-814 column (Showa Denko) and a UV/Vis detector (Waters Corporation 2489). For the quantification of glucose and other products in the filtrate, HPLC (Waters Corporation 2695) and RI detector (Waters Corporation 2414) equipped with a ULTRON PS-80H column (Shinhe Chemical Co., Ltd.) were used. The strain (PA/mtk_mcl_gta) into which the carbonation path was introduced showed a higher yield of glutamic acid than the control strain (PA/vec).

[Embodiment 10]

<Production of plastid pCASET>

Using pHSG298 (Takara) as a template, CGCCTCGAGTGACTCATACCAGGCCTG (SEQ ID NO: 107) and CGCCTCGAGGCAACACCTTCTTCACGAG (SEQ ID NO: 108) were used as primers to amplify by PCR, and the obtained DNA fragment was digested with restriction enzyme XhoI, and ligated with ligase for Escherichia coli DH5α. The plant competent cells (Toyobo Co., Ltd. DNA-903) were transformed to obtain a transformant grown on an LB agar plate containing 25 μg/mL of oxytetracycline. The plastid was recovered from the obtained cells, and the plastid which had been inserted into the recognition sequence of XhoI at pHSG298 was named pHSG298-XhoI.

In order to obtain the tac promoter, pKK223-3 (Pharmacia) was used as a template, and ATCATCCAGCTGTCAGGCAGCCATCGGAAG (SEQ ID NO: 109) and ATCCCCGGGAA were used. TTCTGTT (SEQ ID NO: 110) was amplified by PCR using the primer, and the obtained DNA fragment was digested with restriction enzymes PvuII and SmaI to obtain a DNA fragment encoding the tac promoter of about 0.2 kbp.

The DNA fragment encoding the tac promoter was mixed with a DNA fragment of about 2.4 kbp which was digested with restriction enzyme PvuII and treated with alkaline phosphatase, and ligated with ligase for Escherichia coli DH5α strain. Competent cells (Toyobo Co., Ltd. DNA-903) were transformed to obtain a transformant grown on an LB agar plate containing 25 μg/mL of oxytetracycline. The plastid was recovered from the obtained cells, and the lac promoter of pHSG298-XhoI was substituted with the tac promoter and the direction of the tac promoter and the original lac promoter became the same-oriented plastid pHSGT1.

In order to ligate the multiple selection sites of pHSG298 downstream of the obtained tac promoter of pHSGT1, pHSG298 was digested with restriction enzymes EcoRI and ClaI to obtain a DNA fragment of about 1.0 kbp containing the multiple selection sites of pHSG298. The obtained DNA fragment was mixed with a DNA fragment of about 1.7 kbp which was digested with restriction enzymes EcoRI and ClaI and further treated with alkaline phosphatase, and ligated with ligase, and competent cells for Escherichia coli DH5α strain ( Toyobo Co., Ltd. DNA-903) was transformed to obtain a transformant grown on an LB agar plate containing 25 μg/mL of oxytetracycline. The plastid was recovered from the obtained cells, and a plastid pHSGT2 which was linked downstream of the tac promoter to link the multiple selection sites of pHSG298 was obtained.

A DNA fragment (SEQ ID NO: 111) containing an origin of replication, repA and repB of pCASE1 (Applied Microbiology and Biotechnology, 2009; 81: 1107-1115) isolated from Corynebacterium casei JCM12072 was prepared by DNA synthesis. The sequence is as follows.

Sequence number 111:

The DNA fragment obtained by digesting the prepared DNA fragment with restriction enzyme XhoI, mixed with the DNA fragment which digested the plastid pHSGT2 with restriction enzyme XhoI and further treated with alkaline phosphatase, and bound with ligase, for Escherichia coli The DH5α strain competent cell (Toyobo Co., Ltd. DNA-903) was transformed to obtain a transformant grown on an LB agar plate containing 25 μg/mL of oxytetracycline. The plastid was recovered from the obtained cells, and the plastid having the DNA fragment containing the origin of replication of pCASE1, repA and repB, which was inserted into the XhoI recognition site of pHSGT2, was named pCASET. In the recovered pCASET, the direction of repA from pCASE1 and the tac promoter were opposite.

[Example 11]

<Production of Corynebacterium glutamicum strain for evaluation>

T-protein gene (SEQ ID NO: 75), H-protein (SEQ ID NO: 76), P-protein gene (SEQ ID NO: 77), L-protein gene (SEQ ID NO: 78) for glycine cracking from Escherichia coli MG1655 The region (gcs) covering each SD sequence and start codon to the translation stop codon was amplified by PCR. Further, for the glycine transaminase gene (SEQ ID NO: 64) derived from Methylococcus capsulatus, a region (gta) covering the SD sequence and the start codon to the translation stop codon was amplified by PCR. The two amplified fragments obtained are linked to the tac promoter possessed by the plastid pCASET. The obtained plastid was named pCASET_mcl(Mc)_mtk(Mc)_gcs(Ec)_gta(Mc).

Corynebacterium glutamicum DSM1412 (hereinafter sometimes referred to as "CG strain") was transformed by electroporation using either plastid pCASET or plastid pCASET_mcl(Mc)_mtk(Mc)_gcs(Ec)_gta(Mc). Each strain was applied to an LB agar medium containing 15 μg/mL of oxytetracycline, and the grown strain was used as a strain for evaluation. The evaluation strains were each named CG/vec, CG/mtk_mcl_gcs_gta.

[Embodiment 12]

<Improved introduction of ¹³ C-labeled CO ₂ to glutamic acid>

The rod strain prepared in Example 11 was evaluated in the same manner as in Example 8. The strain (CG/mtk_mcl_gcs_gta) which has been introduced into the fixed path of carbonic acid exhibits a value higher than the baseline. On the other hand, the control strain (CG/vec) is approximately on the baseline. Therefore, it was found that in the CG/mtk_mcl_gcs_gta strain, carbon derived from the ¹³ C-labeled carbonic acid was introduced in the acetaminophen coenzyme A.

[Example 13]

<Using Corynebacterium glutamicum for glutamic acid production>

The amount of glutamic acid in the culture solution of Example 12 can be measured in the same manner as in Example 9. As a result of the measurement, the strain (CG/mtk_mcl_gcs_gta) which has been given a fixed path of carbonic acid is displayed. Higher glutamic acid yield than the control strain (CG/vec).

According to the present invention, CO ₂ can be efficiently converted into acetam coenzyme A. Further, according to the present invention, substances derived from acetamyl Coenzyme A such as isopropyl alcohol, acetone, and glutamic acid can also be produced with good efficiency.

[Embodiment 14]

<Discussion of additives>

CG/mtk_mcl_gcs_gta constructed in Example 11 was used as the strain for evaluation, and sodium carbonate (labeled with ¹³ C) was not introduced, and carbonate, carbon dioxide gas or reducing agent was added to the medium, and Example 12 was used. The same method was used for the cultivation, and the analysis was carried out in the same manner as in Example 13. The strain (CG/mtk_mcl_gcs_gta) which has been given a fixed route of carbonic acid shows a high yield compared to the glutamate production amount of the control strain (CG/vec). The sugar yield was improved in the strains in which mtk and mcl and gcs and gta were introduced, compared with the control strain, and it was found that the amount of conversion to acetaminophen coenzyme A was increased, and the useful substance derived from acetaminophen coenzyme A was efficiently increased.

Carbonate, carbon dioxide gas or a reducing agent may be added to the culture medium as an additive, and culture and analysis may be carried out in the same manner. As a result of the analysis, in the test zone where the additive is supplied with carbonate, carbon dioxide gas or reducing agent, each has a higher yield of sugar than the test zone where no carbonate, carbon dioxide gas or reducing agent is supplied. That is, the supply of the CO ₂ fixed route, the supply of carbonate, carbon dioxide gas or reducing agent to the increase in sugar yield can be considered to be effective.

[Example 15]

<Production of Escherichia coli B strain atoD gene enhancement/pgi gene deletion strain>

The base sequence of the gene of the genome DNA of Escherichia coli MG1655 is known (GenBank accession number U00096), and the gene encoding the phosphoglucose isomerase of Escherichia coli (hereinafter sometimes referred to as "pgi") has also been reported. (GenBank accession number X15196).

In order to select the region near the gene encoding pgi (1,650 bp), CAGGAATT was synthesized. Four primers of CGCTATATCTGGCTCTGCACG (SEQ ID NO: 112), CAGTCTAGAGCAATACTCTTCTGATTTTGAG (SEQ ID NO: 113), CAGTCTAGATCATCGTCGATATGTAGGCC (SEQ ID NO: 114), and GACCTGCAGATCATCCGTCAGCTGTACGC (SEQ ID NO: 115). The primer of SEQ ID NO: 112 has an EcoRI recognition site on the 5' end side, and the primers of SEQ ID NO: 113 and SEQ ID NO: 114 have an XbaI recognition site on the 5' end side, and the primer of SEQ ID NO: 115 has a PstI recognition site on the 5' end side.

The genomic DNA of Escherichia coli MG1655 (ATCC700926) was prepared, and the obtained genomic DNA was used as a template, and PCR was carried out with the primer pair of SEQ ID NO: 112 and SEQ ID NO: 113, and a DNA fragment of about 1.0 kb was placed (hereinafter sometimes referred to as "pgi". -L fragment"). Further, PCR was carried out using the primer pair of SEQ ID NO: 114 and SEQ ID NO: 115, and a DNA fragment of about 1.0 kb (hereinafter sometimes referred to as "pgi-R fragment") was placed. The DNA fragments were separated and recovered by agarose electrophoresis, and the pgi-L fragment was digested with EcoRI and XbaI, and the pgi-R fragment was digested with XbaI and PstI. The two digested fragments were mixed with the digested material of the temperature sensitive property pTH18cs1 (GenBank accession number AB019610), EcoRI and PstI, and transformed with T4 DNA ligase, and transformed into E. coli DH5α strain competent cells (manufactured by Toyobo Co., Ltd.). A transformant obtained by growing on an LB agar plate containing 10 μg/mL chloramphenicol at 30 ° C was obtained. The plastid was recovered from the obtained transformant, and it was confirmed that the fragment adjacent to the 5' upstream of the gene encoding pgi and the fragment adjacent to the downstream of 3' were correctly inserted into pTH18cs1. The obtained plasmid was digested with XbaI, and then subjected to smooth terminal treatment with T4 DNA polymerase. The DNA fragment and the DNA fragment obtained by further smoothing the taumycin resistance gene obtained by digesting the pUC4K plastid (GenBank accession number X06404) (Pharmacia) with EcoRI were further subjected to T4 DNA polymerase, and the T4 DNA ligase was used. link. Thereafter, the competent cells of Escherichia coli DH5α strain were transformed, and a transformant obtained by growing on an LB agar plate containing 10 μg/mL of chloramphenicol and 50 μg/mL of oxytetracycline at 30 ° C was obtained. The plastid was recovered from the obtained transformant, and it was confirmed that the kopenomycin resistance gene was correctly inserted between the 5' upstream vicinity of the gene encoding pgi and the 3' downstream vicinity, and was named pTH18cs1-pgi.

The produced BTH18cs1-pgi was transformed into the B::atoDAB strain prepared in Example 1, and cultured on an LB agar plate containing 10 μg/mL of chloramphenicol and 50 μg/mL of oxytetracycline at 30 ° C overnight to obtain a transformant. . The obtained transformant was inoculated into LB liquid medium containing 50 μg/mL of oxytetracycline. Incubate overnight at 30 °C. Next, a part of this culture solution was partially applied to an LB agar plate containing 50 μg/mL of oxytetracycline to obtain colonies grown at 42 °C. The obtained colonies were cultured in an LB liquid medium containing 50 μg/mL of oxytetracycline, cultured at 30 ° C for 24 hours, and then applied to an LB agar plate containing 50 μg / mL of oxytetracycline to obtain colonies grown at 42 ° C.

100 colonies were randomly picked from the colonies that appeared, and each was grown on LB agar plates containing 50 μg/mL of oxytetracycline and LB agar plates containing 10 μg/mL of chloramphenicol, and only selected to contain oxytetracycline. Chloramphenicol-sensitive colonies grown on LB agar plates. Furthermore, PCR was carried out using the chromosomal DNA of the selected colony as a template, and a strain in which a 3.3 kbp fragment was substituted by a pgi gene substitution to a toxomycin resistance gene was selected, and the obtained strain was named as Escherichia coli B strain atoD gene. Intensive/pgi gene deletion strain (hereinafter sometimes referred to as "B::atoDAB△pgi strain").

[Example 16]

<E. coli B strain atoD gene potentiation/pgi gene deletion/gntR gene deletion strain>

The entire base sequence of the genome DNA of the Escherichia coli B strain is a well-known (GenBank accession number CP000819), and the nucleotide sequence of the gene encoding the transfer inhibitor GntR is described in the Escherichia coli B strain gene of GenBank accession number CP000819. The sequence is 3509184~3510179.

In order to select a region near the gene encoding gntR (gntR), four kinds of primers were synthesized, such as GGAATTCGGGTCAATTTTCACCCTCTATC (SEQ ID NO: 116), GTGGGCCGTCCTGAAGGTACAAAAGAGATAGATTCTC (SEQ ID NO: 117), CTCTTTTGTACCTTCAGGACGGCCCACAAATTTGAAG (SEQ ID NO: 118), and GGAATTCCCAGCCCCGCAAGGCCGATGGC (SEQ ID NO: 119). The primers of SEQ ID NO: 116 and SEQ ID NO: 119 each have an EcoRI recognition site on the 5' end side.

The genome DNA of the Escherichia coli B strain (GenBank accession number CP000819) was prepared, and the obtained gene DNA was used as a template, and PCR was carried out with the primer pair of SEQ ID NO: 116 and SEQ ID NO: 117, and a DNA fragment of about 1.0 kb was placed (hereinafter sometimes Called "gntR-L" segment"). Further, PCR was carried out by using the primer pair of SEQ ID NO: 118 and SEQ ID NO: 119, and a DNA fragment of about 1.0 kb (hereinafter sometimes referred to as "gntR-R fragment") was placed. The DNA fragments were separated and recovered by agarose electrophoresis, and the gntR-L fragment and the gntR-R fragment were used as a template, and PCR was carried out with the primer pair of SEQ ID NO: 116 and SEQ ID NO: 119, thereby placing a DNA fragment of about 2.0 kb ( Hereinafter, it is sometimes referred to as "gntR-LR fragment"). The gntR-LR fragment was separated and recovered by agarose electrophoresis, digested with EcoRI, and mixed with the EcoRI digest of the temperature-sensitive property pTH18cs1 (GenBank accession number AB019610) to obtain a T4 DNA ligase reaction. Thereafter, the competent cells of Escherichia coli DH5α strain (manufactured by Toyobo Co., Ltd.) were transformed, and a transformant grown at 30 ° C on an LB agar plate containing 10 μg/mL of chloramphenicol was obtained. The plastid was recovered from the obtained transformant, and it was confirmed that the gntLR fragment was correctly inserted into pTH18cs1, and this plastid was named pTH18cs1-gntR.

The plastid pTH18cs1-gntR obtained was transformed into the B::atoDABΔpgi strain prepared in Example 15, and cultured overnight at 30 ° C on an LB agar plate containing 10 μg/mL chloramphenicol to obtain a transformant. The obtained transformant was inoculated to an LB liquid medium containing 10 μg/mL of chloramphenicol, and cultured at 30 ° C overnight. Next, a part of this culture solution was partially coated on an LB agar plate containing 10 μg/mL of chloramphenicol to obtain colonies grown at 42 °C. The obtained colonies were cultured in an LB liquid medium at 30 ° C for 24 hours, and then coated on an LB agar plate to obtain colonies grown at 42 ° C.

100 colonies were randomly picked from the colonies that appeared, and were grown on LB agar plates and LB agar plates containing 10 μg/mL chloramphenicol to select chloramphenicol-sensitive colonies. Furthermore, PCR was carried out using the chromosomal DNA of the colony as a template, and a strain in which a fragment of about 2.0 kbp was amplified due to deletion of the gntR gene was selected, and the obtained strain was named as Escherichia coli B strain atoD gene potentiation/pgi gene. The deletion/gntR gene deletion strain (hereinafter sometimes referred to as "B::atoDAB△pgiΔgntR strain").

[Example 17]

<E. coli B strain atoD gene potentiation/pgi gene deletion/gntR gene deletion/gnd gene deletion strain>

In order to select the vicinity of the gene (gnd) encoding the phosphogluconate dehydrogenase, synthesis C Four kinds of primers, GCCATATGAATGGCGCGGCGGGGCCGGTGG (SEQ ID NO: 120), TGGAGCTCTGTTTACTCCTGTCAGGGGG (SEQ ID NO: 121), TGGAGCTCTCTGATTTAATCAACAATAAAATTG (SEQ ID NO: 122), and CGGGATCCACCACCATAACCAAACGACGG (SEQ ID NO: 123). The primer of SEQ ID NO: 120 has an NdeI recognition site on the 5' end side, and the primers of SEQ ID NO: 121 and SEQ ID NO: 122 have a SacI recognition site on the 5' end side, and the primer of SEQ ID NO: 123 has a BamHI recognition site on the 5' end side.

The genome DNA (GenBank accession number CP000819) of Escherichia coli B strain was prepared, and PCR was carried out using the primer pair of SEQ ID NO: 120 and SEQ ID NO: 121, and a DNA fragment of about 1.0 kb (hereinafter sometimes referred to as "gnd-L fragment") was placed. . Further, PCR was carried out using primer pairs of SEQ ID NO: 122 and SEQ ID NO: 123, and a DNA fragment of about 1.0 kb (hereinafter sometimes referred to as "gnd-R fragment") was placed. The DNA fragments were separated and recovered by agarose electrophoresis, and the gnd-L fragment was digested with NdeI and SacI, and the gnd-R fragment was digested with SacI and BamHI. The two digested fragments were mixed with the digested material of NdeI and BamHI of the temperature-sensitive property pTH18cs1 (GenBank accession number AB019610), and transformed with T4 DNA ligase, and then transformed into competent cells of Escherichia coli DH5α strain (manufactured by Toyobo Co., Ltd.). A transformant grown at 30 ° C with an LB agar plate containing 10 μg/mL chloramphenicol was obtained. The plastid was recovered from the obtained transformant, and it was confirmed that the fragment adjacent to the 5' upstream of the gene encoding gnd and the fragment adjacent to the downstream of 3' were correctly inserted into pTH18cs1, and the plastid was named pTH18cs1-gnd.

The plastid pTH18cs1-gud obtained was transformed into the B::atoDABΔpgiΔgntR strain prepared in Example 16 and cultured overnight at 30° C. on an LB agar plate containing 10 μg/mL chloramphenicol to obtain a transformant. The obtained transformant was inoculated in an LB liquid medium containing 10 μg/mL of chloramphenicol, and cultured at 30 ° C overnight. Then, one of the culture solutions was partially applied to an LB agar plate containing 10 μg/mL of chloramphenicol to obtain colonies grown at 42 °C. The obtained colonies were cultured in an LB liquid medium at 30 ° C for 24 hours, and then coated on an LB agar plate to obtain colonies grown at 42 ° C.

100 colonies were randomly picked from the colonies that appeared, and were grown on LB agar plates and LB agar plates containing 10 μg/mL chloramphenicol to select chloramphenicol-sensitive colonies. Furthermore, PCR was carried out using the chromosomal DNA of the colony as a template, and the selection was due to the deletion of the gnd gene. A strain of about 2.0 kbp was inserted, and the obtained strain was named as Escherichia coli B strain atoD gene potentiation/pgi gene deletion/gntR gene deletion/gnd gene deletion strain (hereinafter also referred to as "B::atoDAB△pgiΔgntR? Gnd strain").

[Embodiment 18]

<Production of plastid pMWGKC2>

In order to obtain the GAPDH promoter, the genomic DNA of Escherichia coli MG1655 was used as a template, and PCR amplification was carried out using CTACTAGTCTGTCGCAATGATTGACACGATTCCG (SEQ ID NO: 124) and GCTCGAATTCCCATATGTTCCACCAGCTATTTGTTAGTGAATAAAAGG (SEQ ID NO: 125) as primers, and the obtained DNA fragment was digested with restriction enzyme EcoRI, and The ends were phosphorylated with T4 Polynucleotide Kinase to obtain a DNA fragment containing the GAPDH promoter.

The plastid pMW119 (GenBank accession number AB005476) was digested with restriction enzyme NdeI and the ends were smoothed, digested with EcoRI, and the ends were dephosphorylated. The DNA fragment of pMW119 and the DNA fragment containing the GAPDH promoter were mixed, and after binding with ligase, the competent cells of Escherichia coli DH5α strain were transformed to obtain a growth of LB agar plates containing 50 μg/mL ampicillin. Form. The obtained colony was cultured in an LB liquid medium containing 50 μg/mL of ampicillin at 37 ° C for one night, and the plastid was recovered from the obtained cells to obtain plastid pMWG2.

In order to obtain the chloramphenicol resistance gene, pTH18cs1 (GenBank accession number AB019610) was used as a template, and TCGGCACGTAAGAGGTTCC (SEQ ID NO: 101) and CGGGTCGAATTTGCTTTCG (SEQ ID NO: 102) were used as primers to amplify by PCR, and the obtained DNA fragment was subjected to T4 Polynucleotide Kinase ( Takara) is phosphorylated to obtain a DNA fragment containing a chloramphenicol resistance gene. Thereafter, pMWG2 was used as a template, and CTAGATCTGACAGTAAGACGGGTAAGCC (SEQ ID NO: 103) and CTAGATCTCAGGGTTATTGTCTCATGAGC (SEQ ID NO: 104) were used as primers to be amplified by PCR, mixed with a DNA fragment containing a chloramphenicol resistance gene, and ligated with E. coli DH5α strain. Competent cells were transformed and transformed into morphs grown on LB agar plates containing 25 μg/mL chloramphenicol. Will get it The colonies were cultured overnight at 37 ° C in an LB liquid medium containing 25 μg / mL of chloramphenicol, and the obtained plastid was named pMWGC2.

Using plastid pMWGC2 as a template, CCTTTGGTTAAAGGCTTTAAGATCTTCCAGTGGACAAACTATGCC (SEQ ID NO: 105) and GGCATAGTTTGTCCACTGGAAGATCTTAAAGCCTTTAACCAAAGG (SEQ ID NO: 106) were used as primers to amplify by PCR, and transformed into competent cells of Escherichia coli DH5α strain, and obtained in LB containing 25 μg/mL chloramphenicol. A rotating body of agar plate growth. The obtained colonies were cultured in an LB liquid medium containing 25 μg/mL of chloramphenicol at 37 ° C for one night, and the plastids were recovered from the obtained cells to obtain plastid pMWGKC2.

[Embodiment 19]

<The construction of glycosyltransaminase from Methylococcus capsulatus ATCC33009 shows the construction of plastids>

The apple 醯CoA lyase gene from Methylococcus capsulatus ATCC33009, the subunit β gene of malate thiokinase, and the subunit α gene of malate thiokinase will cover each SD sequence and the start codon to the translation stop codon. The region was amplified by PCR using GGAATTCCATATGGCTGTTAAAAATCGTCTAC (SEQ ID NO: 126) and GCTCTAGATTAGAATCTGATTCCGTGTTC (SEQ ID NO: 127) as primers. A fragment obtained by cleaving the amplified fragment with NdeI and XbaI was ligated to a fragment obtained by cleaving the plastid pMWGKC2 produced in Example 18 with NdeI and XbaI, and ligated to the promoter of pMWGKC2-owned gap promoter. The obtained plastid was named pMWGKC2_mcl(Mc)_mtkAB(Mc).

The glycine transaminase gene (SEQ ID NO: 64) from Methylococcus capsulatus was amplified by PCR using GCTCTAGACGGAGAAAGTCTTATGCCTGGTCGCAACCATCT (SEQ ID NO: 128) and GGAATTCAAGCTTTTAGACTCGGGGCTGGATTACC (SEQ ID NO: 129) as primers. A fragment obtained by cleaving the amplified fragment with XbaI and HindIII is ligated to a fragment obtained by cleaving the plastid pMWGKC2_mcl(Mc)_mtkAB(Mc) with XbaI and HindIII, and is ligated to the plastid pMWGKC2_mcl(Mc)_mtkAB( Downstream of the malate thiokinase (mtk) sequence of Mc). The obtained plastid is named pMWGKC2_mcl(Mc)_ mtkAB(Mc)_gtaA.

[Example 20]

<The construction of glycosyltransaminase from Allochromatium vinosum to represent the structure of the plastid>

In order to obtain the glycine transaminase gene from Allochromatium vinosum, the amino acid sequence (SEQ ID NO: 44) of the glycine transaminase was used to prepare a base sequence optimized for Escherichia coli, SD. The sequence and the N-terminal side have an XbaI recognition sequence and a base sequence (SEQ ID NO: 130) having a HindIII recognition sequence at the C-terminus. The fragment obtained by cleaving the synthetic fragment with XbaI and HindIII was ligated to a fragment obtained by cleaving the plastid pMWGKC2_mcl(Mc)_mtkAB(Mc) with XbaI and HindIII, and ligated to the plastid pMWGKC2_mcl(Mc)_mtkAB( Downstream of the malate thiokinase (mtk) sequence of Mc). The obtained plastid was named pMWGKC_mcl(Mc)_mtkAB(Mc)_ALV.

[Example 21]

<Mt. and mcl are introduced into isopropyl alcohol to produce atoD gene potentiation/pgi gene deletion/gntR gene deletion/gnd gene deletion strain>

The competent cells of the plastids produced in Example 2 and the plastids produced in Examples 18 to 20 were transformed into the competent cells of the strain (B::atoDABΔpgiΔgntRΔgnd) produced in Example 17, The grown strain was obtained by coating on an LB agar medium containing 25 mg/L of chloramphenicol and 100 mg/L of ampicillin. These strains are summarized in Table 2.

[Example 22]

<Production of isopropyl alcohol>

As a pre-culture, a test tube containing the LB Broth, Miller culture solution (Difco 244620) containing 25 mg/L of chloramphenicol and 100 mg/L of ampicillin was inoculated, and each of the evaluation strains constructed in Example 21 was inoculated. The culture was carried out overnight at a temperature of 30 ° C and 120 rpm. The OD of the preculture was measured, and the cells equivalent to OD3.0 were recovered, suspended in a solution of 300 μl in a 0.9% NaCl solution, and 20 μl was inoculated into LB Broth containing ampicillin containing 5% glucose, 25 mg/L chloramphenicol, and 100 mg/L. The Miller culture solution was 20 mL of a 100 mL-capped baffled flask, and cultured at a culture temperature of 30 ° C and 120 rpm for 48 hours. The bacterial cell culture solution was sampled, and the cells were removed by centrifugation, and the accumulated amount of isopropyl alcohol (IPA), acetone, and major by-products (organic acid such as succinic acid) in the obtained culture supernatant was measured by HPLC. The results are shown in Tables 3 and 4.

The 48-hour isopropanol production amount was 4.8 g for the control strain (vec/atoDABΔpgiΔgntRΔgnd), and 7.2 g for the mtk+mcl introduction strain (MtkAB/atoDABΔpgiΔgntRΔgnd), GtaA+mtk+ Mcl introduced strain (MtkAB, GtaA/atoDAB△pgi△gntR△gnd) was 9.2g, ALV+mtk+mcl The inoculum (MtkAB, ALV/atoDAB Δpgi ΔgntR Δgnd) was 8.8 g.

The production amount of acetone in 48 hours, the control strain (vec/atoDABΔpgiΔgntRΔgnd) was 0.1 g, and the mtk+mcl introduced strain (MtkAB/atoDABΔpgiΔgntRΔgnd) was 0.2 g, GtaA+mtk+mcl. The introduced strain (MtkAB, GtaA/atoDABΔpgiΔgntRΔgnd) was 0.4 g, and the ALV+mtk+mcl-introduced strain (MtkAB, ALV/atoDABΔpgiΔgntRΔgnd) was 0.8 g.

It can be seen that the production of isopropyl alcohol and acetone is increased by introducing mtk and mcl and introducing glycine transaminase.

The sugar yield of isopropanol and acetone for 48 hours was 14.8% in the control strain (vec/atoDABΔpgiΔgntRΔgnd), and the mtk+mcl introduced strain (MtkAB/atoDABΔpgiΔgntRΔgnd) was 17.3. %, GtaA+mtk+mcl introduced strain (MtkAB, GtaA/atoDABΔpgiΔgntRΔgnd) was 20.5%, and ALV+mtk+mcl introduced strain (MtkAB, ALV/atoDABΔpgiΔgntRΔgnd) was 20.0%. From this, it was found that the conversion efficiency of sugar conversion to isopropanol and acetone was improved by introducing mtk and mcl and introducing glycine transaminase.

The 48-hour control strain (vec/atoDABΔpgiΔgntRΔgnd) was compared with the mtk+mcl-introduced strain (MtkAB/atoDABΔpgiΔgntRΔgnd), and the amount of lactic acid was decreased. It was found that mtk and mcl were introduced and glycine was introduced. GtaA+mtk+mcl introduction strain of transaminase (MtkAB, GtaA/atoDAB△pgi△ gntRΔgnd) and ALV+mtk+mcl introduced strain (MtkAB, ALV/atoDABΔpgiΔgntRΔgnd), and the amount of lactic acid was unexpectedly reduced.

[Example 23]

<Improvement of the introduction of ¹³ C-labeled CO ₂ to glutamic acid and production of glutamic acid by a pantoea strain using plastid pMWGKC2>

Pantoea ananatis PA strains were transformed using pMWGKC2 or pMWGKC2_mcl(Mc)_mtkAB(Mc)_gtaA, each named PA/vec2, PA/mtk_mcl_gta2.

In the same manner as in Example 8, the introduction of ¹³ C-labeled CO ₂ to glutamic acid was verified, and as a result, the strain (PA/mtk_mcl_gta2) which had been introduced into the carbonic acid fixation path exhibited a value higher than the baseline. On the other hand, the control strain (PA/vec2) is approximately on the baseline. Therefore, it was found that the PA/mtk_mcl_gta2 strain had introduced carbon from the ¹³ C-labeled carbonic acid in the acetaminophen coenzyme A. The production of glutamic acid was verified in the same manner as in Example 9, and as a result, the strain (PA/mtk_mcl_gta2) which had been introduced into the fixed path of carbonic acid had a higher yield of glutamic acid than the control strain (PA/vec).

[Example 24]

<4-Hydroxy-2-oxoethoxyglutarate dehydratase and 4-side oxyglutenoate reductase search>

In order to obtain 4-hydroxy-2-oxoglutaric acid dehydratase, it is sufficient to follow the method of screening enzymes from the environment. First, 4-hydroxy-2-oxo-glutaric acid or 4-sided oxypentenoic acid is used as a carbon source to culture a soil sample in nature, and to detach a microorganism capable of growing. Thereafter, the culture solution of the microorganism or the crude extract was reacted with 4-hydroxy-2-oxo-glutaric acid to confirm the production of 4-oxooxypentenoic acid by HPLC. Then, according to the method of protein purification such as sulfur precipitation and column chromatography, after the active enzyme is isolated, the N-terminal amino acid analysis is carried out, and the primer is designed according to the analyzed amino acid sequence, and the obtained microbial gene can be obtained. Enzyme gene.

The search for 4-oxoxy glutaconate reductase is also carried out in the same manner as above, and 4-sided oxyglutaconic acid or 2-sided oxyglutaric acid is used as a carbon source to culture natural soil samples and colonize Enzyme gene.

[Example 25]

<Construction of plastids using the enzyme of pMWGKC>

The apple 醯CoA lyase gene from Methylococcus capsulatus ATCC33009, the subunit β gene of malate thiokinase, and the subunit α gene of malate thiokinase will cover each SD sequence and the start codon to the translation stop codon. The region was amplified by PCR. Since these three gene lines are continuous in the genome of Methylococcus capsulatus, they can be obtained in one fragment. The amplified fragment obtained is linked to the promoter of the plastid pMWGKC. The obtained plastid is named pMWGKC_mcl_mtk.

The gene for 4-hydroxy-2-oxoglutarate dehydratase and the gene for 4-oxooxyglutenoate reductase (these genes can be obtained by the search method of Example 24) are carried out in the same manner as above. The region encompassing the SD sequence and the start codon to the translation stop codon is amplified by PCR. The amplified fragment obtained is ligated downstream of mtk of plastid pMWGKC_mcl_mtk and under the control of the gap promoter. The obtained plastid is named pMWGKC_mcl_mtk_enz.

[Example 26]

<Confirmation of enzyme activity>

The competent cells of Escherichia coli DH5α strain were transformed with plastid pMWGKC or plastid pMWGKC_mcl_mtk to obtain each transformant. The cells were cultured in an LB medium containing chloramphenicol, and the cells were disrupted by a cell shocker to obtain a crude extract of each of the cells. Using this crude bacterial extract, malic acid, acetaminophen coenzyme A and ATP were used as a matrix, and the continuous reaction of mtk and mcl was determined according to the method described in the literature (Journal of Bacteriology, 2001; 183(14): 4305-4316). Activity. As a result, the transformant of the control strain pMWGKC showed activity, and the transformant of pMWGKC_mcl_mtk showed activity. Therefore, the activity of the expressed proteins mcl and mtk can be confirmed.

[Example 27]

<Construction of Pantoea ananatis strain for evaluation>

For the Pantoea ananatisPA strain prepared in Example 6, the pMWGKC of Example 3 or the pMWGKC_mcl_mtk_enz of Example 25 was transformed by CaCl ₂ method or electroporation. Each strain was applied to an LB agar medium containing 30 μg/mL chloramphenicol and 15 μg/mL tetracycline, and the grown strain was used as an evaluation strain. The evaluation strains were each named PA/vec, PA/mcl_mtk_enz.

[Example 28]

<Using Pantoea ananatis for glutamic acid production>

The strain for evaluation prepared in Example 27 was cultured using a medium containing a carbon source, and as a result, the PA/mcl_mtk_enz strain was able to produce glutamic acid in a higher yield than the PA/vec strain of the control strain.

[Example 29]

<Construction of plastids for coryneform bacteria>

The gene encoding the coenzyme A cleavage enzyme from Methylococcus capsulatus ATCC33009, the subunit β gene of malate thiokinase, and the subunit α gene of malate thiokinase will cover each SD sequence and start codon to termination of translation. The region of the codon is amplified by PCR to obtain an enlarged fragment. These three gene lines are continuous on the genome of Methylococcus capsulatus, so they can be obtained in one fragment.

The gene for 4-hydroxy-2-oxoglutarate dehydratase and the gene for 4-oxooxyglutenoate reductase (these genes can be obtained by the search method of Example 24) in the same manner as described above. In the method, the region including the SD sequence and the start codon to the translation stop codon is amplified by a PCR method to obtain an amplified fragment.

From the gene of Pantoea ananatis AJ13601, for the gene of 4-hydroxy-2-oxoglutaric acid aldolase, the region including the SD sequence and the start codon to the translation stop codon will be amplified by PCR and amplified. Fragment.

The above three amplified fragments are ligated under the control of the promoter of the plastid pCASET. The obtained plastid is named pCASET_mcl_mtk_enz.

[Example 30]

<Production of Corynebacterium glutamicum strain for evaluation>

For Corynebacterium glutamicum DSM1412 (hereinafter also referred to as "CG strain"), pCASET or pCASET_mcl_mtk_enz was transformed by electroporation. Applying each strain to the inclusion The LB agar medium of 15 μg/mL of oxytetracycline was used as the strain for evaluation. The evaluation strains were each named CG/vec, CG/mcl_mtk_enz.

[Example 31]

<Using Corynebacterium glutamicum for glutamic acid production>

The strain for evaluation of Example 30 was cultured in a medium containing a carbon source, and as a result, the CG/mcl_mtk_enz strain was able to produce glutamic acid in a higher yield than the CG/vec strain of the control strain. Further, 2-sided oxyglutaric acid was also detected as an intermediate product. The total amount of glutamic acid and 2-sided oxyglutaric acid showed a higher value than the CG/vec strain of the control strain, and the CG/mcl_mtk_enz strain.

In the medium in which CG/mcl_mtk_enz is cultured, carbonate, carbon dioxide gas or a reducing agent is supplied, and glutamic acid and 2-oxoglutaric acid can be analyzed in the same manner as described above. In this case, the test zone in which carbonate, carbon dioxide gas or reducing agent is added as an additive shows a higher sugar yield than the test zone without addition. That is, it is considered that the supply of the carbonate, carbon dioxide gas or reducing agent to the strain which has been given the CO ₂ fixed route is effective for the improvement of the sugar yield.

According to the present invention, 2-sided oxyglutaric acid and a substance derived from 2-sided oxyglutaric acid such as glutamic acid can be produced with good efficiency.

The disclosure of Japanese Patent Application No. 2013-011537, filed on Jan.

All the documents, patent applications, and technical specifications described in this specification are incorporated in this specification with the same extent as the specifics and individual references when the documents, patent applications, and technical specifications are incorporated by reference. .

<110> Mitsui Chemicals Co., Ltd.

<120> Microorganisms with a fixed carbon dioxide path

<130> P001301431

<150> JP 2013-011537

<151> 2013-01-24

<150> JP 2013-011539

<151> 2013-01-24

<160> 130

<170> PatentIn version 3.5

<210> 1

<211> 296

<212> PRT

<213> Methylobacterium extorquens

<400> 1

<210> 2

<211> 390

<212> PRT

<213> Methylobacterium extorquens

<400> 2

<210> 3

<211> 387

<212> PRT

<213> Hyphomicrobium methylovorum

<400> 3

<210> 4

<211> 299

<212> PRT

<213> Hyphomicrobium methylovorum

<400> 4

<210> 5

<211> 299

<212> PRT

<213> Hyphomicrobium denitrificans

<400> 5

<210> 6

<211> 387

<212> PRT

<213> Hyphomicrobium denitrificans

<400> 6

<210> 7

<211> 299

<212> PRT

<213> Rhizobium sp.

<400> 7

<210> 8

<211> 394

<212> PRT

<213> Rhizobium sp.

<400> 8

<210> 9

<211> 298

<212> PRT

<213> Granulibacter bethesdensis

<400> 9

<210> 10

<211> 389

<212> PRT

<213> Granulibacter bethesdensis

<400> 10

<210> 11

<211> 295

<212> PRT

<213> Nitrosomonas europaea

<400> 11

<210> 12

<211> 390

<212> PRT

<213> Nitrosomonas europaea

<400> 12

<210> 13

<211> 300

<212> PRT

<213> Methylococcus capsulatus

<400> 13

<210> 14

<211> 389

<212> PRT

<213> Methylococcus capsulatus

<400> 14

<210> 15

<211> 298

<212> PRT

<213> Uncultivated gamma proteobacterium

<400> 15

<210> 16

<211> 392

<212> PRT

<213> Uncultivated gamma proteobacterium

<400> 16

<210> 17

<211> 891

<212> DNA

<213> Methylobacterium extorquens

<400> 17

<210> 18

<211> 1173

<212> DNA

<213> Methylobacterium extorquens

<400> 18

<210> 19

<211> 1161

<212> DNA

<213> Hyphomicrobium methylovorum

<400> 19

<210> 20

<211> 897

<212> DNA

<213> Hyphomicrobium methylovorum

<400> 20

<210> 21

<211> 900

<212> DNA

<213> Hyphomicrobium denitrificans

<400> 21

<210> 22

<211> 1164

<212> DNA

<213> Hyphomicrobium denitrificans

<400> 22

<210> 23

<211> 1185

<212> DNA

<213> Rhizobium sp.

<400> 23

<210> 24

<211> 900

<212> DNA

<213> Rhizobium sp.

<400> 24

<210> 25

<211> 897

<212> DNA

<213> Granulibacter bethesdensis

<400> 25

<210> 26

<211> 1170

<212> DNA

<213> Granulibacter bethesdensis

<400> 26

<210> 27

<211> 888

<212> DNA

<213> Nitrosomonas europaea

<400> 27

<210> 28

<211> 1173

<212> DNA

<213> Nitrosomonas europaea

<400> 28

<210> 29

<211> 903

<212> DNA

<213> Methylococcus capsulatus

<400> 29

<210> 30

<211> 1170

<212> DNA

<213> Methylococcus capsulatus

<400> 30

<210> 31

<211> 897

<212> DNA

<213> Uncultivated gamma proteobacterium

<400> 31

<210> 32

<211> 1179

<212> DNA

<213> Uncultivated gamma proteobacterium

<400> 32

<210> 33

<211> 324

<212> PRT

<213> Methylobacterium extorquens

<400> 33

<210> 34

<211> 321

<212> PRT

<213> Hyphomicrobium methylovorum

<400> 34

<210> 35

<211> 320

<212> PRT

<213> Hyphomicrobium denitrificans

<400> 35

<210> 36

<211> 316

<212> PRT

<213> Nitrosomonas europaea

<400> 36

<210> 37

<211> 320

<212> PRT

<213> Methylococcus capsulatus

<400> 37

<210> 38

<211> 975

<212> DNA

<213> Methylobacterium extorquens

<400> 38

<210> 39

<211> 963

<212> DNA

<213> Hyphomicrobium methylovorum

<400> 39

<210> 40

<211> 963

<212> DNA

<213> Hyphomicrobium denitrificans

<400> 40

<210> 41

<211> 951

<212> DNA

<213> Nitrosomonas europaea

<400> 41

<210> 42

<211> 963

<212> DNA

<213> Methylococcus capsulatus

<400> 42

<210> 43

<211> 395

<212> PRT

<213> Methylococcus capsulatus

<400> 43

<210> 44

<211> 395

<212> PRT

<213> Allochromatium vinosum

<400> 44

<210> 45

<211> 374

<212> PRT

<213> Hahella chejuensis

<400> 45

<210> 46

<211> 372

<212> PRT

<213> Candidatus Ruthia magnifica

<400> 46

<210> 47

<211> 388

<212> PRT

<213> Methylomonas methanica

<400> 47

<210> 48

<211> 387

<212> PRT

<213> Methylomicrobium alcaliphilum

<400> 48

<210> 49

<211> 389

<212> PRT

<213> Marinobacter sp.

<400> 49

<210> 50

<211> 391

<212> PRT

<213> Psychrobacter arcticus

<400> 50

<210> 51

<211> 373

<212> PRT

<213> Alteromonas macleodii

<400> 51

<210> 52

<211> 375

<212> PRT

<213> Glaciecola sp.

<400> 52

<210> 53

<211> 393

<212> PRT

<213> Cycloclasticus sp.

<400> 53

<210> 54

<211> 391

<212> PRT

<213> Nitrosococcus oceani

<400> 54

<210> 55

<211> 393

<212> PRT

<213> Thioalkalivibrio sp.

<400> 55

<210> 56

<211> 373

<212> PRT

<213> Colwellia psychrerythraea

<400> 56

<210> 57

<211> 373

<212> PRT

<213> Colwellia psychrerythraea

<400> 57

<210> 58

<211> 376

<212> PRT

<213> Ferrimonas balearica

<400> 58

<210> 59

<211> 377

<212> PRT

<213> Shewanella oneidensis

<400> 59

<210> 60

<211> 372

<212> PRT

<213> Photobacterium profundum

<400> 60

<210> 61

<211> 372

<212> PRT

<213> Vibrio cholerae

<400> 61

<210> 62

<211> 370

<212> PRT

<213> Vibrio fischeri

<400> 62

<210> 63

<211> 522

<212> PRT

<213> Volvox carteri

<400> 63

<210> 64

<211> 1188

<212> DNA

<213> Methylococcus capsulatus

<400> 64

<210> 65

<211> 1188

<212> DNA

<213> Allochromatium vinosum

<400> 65

<210> 66

<211> 1569

<212> DNA

<213> Volvox carteri

<400> 66

<210> 67

<211> 364

<212> PRT

<213> Escherichia coli

<400> 67

<210> 68

<211> 129

<212> PRT

<213> Escherichia coli

<400> 68

<210> 69

<211> 957

<212> PRT

<213> Escherichia coli

<400> 69

<210> 70

<211> 474

<212> PRT

<213> Escherichia coli

<400> 70

<210> 71

<211> 393

<212> PRT

<213> Pantoea ananatis

<400> 71

<210> 72

<211> 128

<212> PRT

<213> Pantoea ananatis

<400> 72

<210> 73

<211> 971

<212> PRT

<213> Pantoea ananatis

<400> 73

<210> 74

<211> 475

<212> PRT

<213> Pantoea ananatis

<400> 74

<210> 75

<211> 1095

<212> DNA

<213> Escherichia coli

<400> 75

<210> 76

<211> 390

<212> DNA

<213> Escherichia coli

<400> 76

<210> 77

<211> 2874

<212> DNA

<213> Escherichia coli

<400> 77

<210> 78

<211> 1425

<212> DNA

<213> Escherichia coli

<400> 78

<210> 79

<211> 1182

<212> DNA

<213> Pantoea ananatis

<400> 79

<210> 80

<211> 387

<212> DNA

<213> Pantoea ananatis

<400> 80

<210> 81

<211> 2916

<212> DNA

<213> Pantoea ananatis

<400> 81

<210> 82

<211> 1428

<212> DNA

<213> Pantoea ananatis

<400> 82

<210> 83

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 83

<210> 84

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 84

<210> 85

<211> 50

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 85

<210> 86

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 86

<210> 87

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 87

<210> 88

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 88

<210> 89

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 89

<210> 90

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 90

<210> 91

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 91

<210> 92

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 92

<210> 93

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 93

<210> 94

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 94

<210> 95

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 95

<210> 96

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 96

<210> 97

<211> 46

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 97

<210> 98

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 98

<210> 99

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 99

<210> 100

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 100

<210> 101

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 101

<210> 102

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 102

<210> 103

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 103

<210> 104

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 104

<210> 105

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 105

<210> 106

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 106

<210> 107

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 107

<210> 108

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 108

<210> 109

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 109

<210> 110

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 110

<210> 111

<211> 1352

<212> DNA

<213> Corynebacterium casei

<400> 111

<210> 112

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 112

<210> 113

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 113

<210> 114

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 114

<210> 115

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 115

<210> 116

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 116

<210> 117

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 117

<210> 118

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 118

<210> 119

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 119

<210> 120

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 120

<210> 121

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 121

<210> 122

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 122

<210> 123

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 123

<210> 124

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 124

<210> 125

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 125

<210> 126

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 126

<210> 127

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 127

<210> 128

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 128

<210> 129

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 129

<210> 130

<211> 1218

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic DNA

<400> 130

Claims (21)

A microorganism having a pathway comprising an enzyme reaction selected from the group consisting of at least one of the following groups (a) and (b), and the following (c), (d), (e), f) and (g) the enzyme reaction, and the enzyme reaction selected from the following (h), the following (i), (j), (k) and (n) enzyme reactions, and the following (i), At least one of the groups consisting of the enzyme reactions of j), (l), (m) and (n): (a) an enzyme reaction of phosphoenolpyruvate to oxaloacetate; (b) pyruvate to grass (c) an enzyme reaction of oxalic acid to malic acid; (d) an enzyme reaction of malic acid to cocoon A; (e) cocoa coenzyme A to glyoxylic acid and acetamidine coenzyme A Enzyme reaction; (f) enzyme reaction of glyoxylic acid to glycine; (g) enzyme reaction of glycine to serine; (h) enzyme reaction of serine to pyruvate; (i) serine An enzyme reaction to 3-hydroxypyruvate; (j) an enzyme reaction of 3-hydroxypyruvate to glycerate; (k) an enzyme reaction of glycerate to 2-phosphoglycerate; (1) glycerate to glycerol-3-phosphate Acid enzyme reaction; (m) 3-phosphoglycerate to 2-phosphoglycerate enzyme ; (N) 2- phosphoglycerate enzyme pyruvate to the phosphoric acid. The microorganism of claim 1, wherein the (d), (e), and (f) are enzyme reactions. A microorganism according to claim 1 or 2, wherein the following (o), (p), (q), (r), and (s) are not microorganisms, the following (o), (p) And (q) and (r) are not imparted, or even if one or more of the following (o), (p), (q), and (r) are given no effect, and the acetaminophen coenzyme A production capacity enhancement: (o) a fixed cycle of carbonic acid with a reaction of propionate A to malonate semialdehyde or 3-hydroxypropionic acid; (p) an enzyme having acetamyl coenzyme A and CO ₂ to pyruvate a fixed carbonic acid cycle of reaction; (q) a fixed cycle of carbonic acid having an enzyme reaction of croton coenzyme A with CO ₂ to ethyl propylene dioxime coenzyme A or pentene dioxime coenzyme A; (r) an enzyme having CO ₂ to formic acid The carbonation cycle of the reaction; (s) is at least one selected from the group consisting of malate thiokinase and apple sputum coenzyme A lyase. A microorganism according to claim 1 or 2, which has an enzyme selected from at least one of the group consisting of the following (a2) and (b2), and the following (c2), (d2), ( Enzymes of e2), (f2) and (g2), and an enzyme selected from the following (h2), the following (i2), (j2), (k2) and (n2), and the following (i2), (j2), (l2), (m2), and (n2) at least one of the group consisting of: (a2) selected from pyruvate kinase and pyruvate carboxylase, phosphoenolpyruvate carboxylate At least one of a group consisting of an enzyme, and a phosphoenolpyruvate carboxy kinase; (b2) pyruvate carboxylase; (c2) malate dehydrogenase; (d2) malate thiokinase; (e2) Apple coenzyme A lyase; (f2) glycine transaminase; (g2) glycine cracking system and serine hydroxymethyltransferase; (h2) serine dehydratase; (i2) serine Transaminase; (j2) hydroxypyruvate reductase; (k2) glycerate 2-kinase; (12) glycerate 3-kinase; (m2) phosphoglycerate mutase; (n2) enolase. A microorganism according to claim 1 or 2, which is obtained by administering malate thiokinase, apple sputum coenzyme A lyase, and glycine transaminase. The microorganism according to claim 1 or 2, wherein the microorganism belongs to a microorganism of the enterobacteriaceae or a microorganism belonging to a rod-shaped type. The microorganism according to claim 1 or 2, wherein the microorganism is a microorganism belonging to the enterobacteriaceae of the genus Escherichia or the genus Pantoea, or a rod belonging to the genus Corynebacterium Microorganisms of the type bacteria. A method for producing isopropanol, which comprises producing an isopropanol from a carbon source material using the microorganism according to any one of claims 1 to 7. An acetone production method comprising producing acetone from a carbon source material using the microorganism according to any one of claims 1 to 7. A method for producing glutamic acid, which comprises producing glutamic acid from a carbon source material using the microorganism according to any one of claims 1 to 7. A method for producing acetaminophen coenzyme A, comprising the steps of: culturing a microorganism to contact with a carbon source material according to any one of claims 1 to 7 and culturing; recovering step, recovering the purpose obtained by the contact Production. The method for producing a coenzyme A according to claim 11 of the patent application, further comprising a supply step of selecting at least one selected from the group consisting of carbonate ions, hydrogen carbonate ions, carbon dioxide gas, and a reducing agent. For the culture medium used for culture. The method for producing a coenzyme A according to claim 11 or 12 further includes a gas supply step of recovering a carbon dioxide-containing gas generated by the culture, and supplying the gas to the culture medium for culture. . A microorganism having a path of an enzyme reaction comprising (t), (u), (v), (w), (x), (y), and (z): (t) selected from phosphoenol acetone group consisting of enzymes, acids and CO ₂ to react oxaloacetic acid, pyruvic acid and the enzyme and CO ₂ to oxaloacetic acid in the reaction of the at least one enzyme by the reaction; (U) oxaloacetic acid to malic acid enzyme reaction (v) the enzyme reaction of malic acid to apple coenzyme A; (w) the enzyme reaction of cocoa coenzyme A to glyoxylic acid and acetoacetin A; (x) glyoxylic acid and pyruvic acid to 4-hydroxy-2 - an enzyme reaction of a side oxyglutaric acid; (y) an enzyme reaction of 4-hydroxy-2-oxo glutaric acid to 4-oxo pentenoic acid; (z) 4-oxoxypentene The enzyme reaction of diacid to 2-oxo-glutaric acid. The microorganism of claim 14, wherein the (t) enzyme reaction is selected from the group consisting of pyruvate kinase and pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate. Catalyzing at least one of the group consisting of carboxykinases, The (u) enzyme reaction is catalyzed by malate dehydrogenase, and the (v) enzyme reaction is catalyzed by malate thiokinase, and the (w) enzyme reaction is catalyzed by apple coenzyme A lyase. The enzyme reaction of x) is catalyzed by 4-hydroxy-2-oxooxyglutaric acid aldolase, and the enzyme reaction of (y) is catalyzed by 4-hydroxy-2-oxo-glutaric acid dehydratase, which The enzyme reaction of (z) is catalyzed by 4-oxooxypentadiate reductase. The microorganism according to claim 14 or 15, wherein the microorganism belongs to a microorganism of the enterobacteriaceae or a microorganism belonging to a rod-shaped type. The microorganism according to claim 14 or 15, wherein the microorganism is a microorganism belonging to the enterobacteria of the genus Pantoea, or a microorganism belonging to the bacterium of the genus Corynebacterium. A method for producing 2-oxooxyglutaric acid, comprising the steps of: culturing a microorganism contacting the carbon source material according to any one of claims 14 to 17 and culturing; recovering step, recovering Contact the production of the intended product. The method for producing 2-oxooxyglutaric acid according to Item 18 of the patent application, further comprising a supply step, which is selected from the group consisting of carbonate ions, hydrogen carbonate ions, carbon dioxide gas and reducing agent. At least one of the above is supplied to the culture medium used for culture. The method for producing 2-sided oxyglutaric acid according to claim 18 or 19, further comprising a gas supply step of recovering a carbon dioxide-containing gas generated by the culture, and using the gas for Culture medium supply. A method for producing glutamic acid, comprising the steps of: culturing a microorganism in contact with a carbon source material according to any one of claims 14 to 17 and culturing; and recovering the glutamine obtained by the contacting acid.