TW201406777A - Use of PEDF-derived polypeptides for promoting muscle or tendon regeneration or arteriogenesis - Google Patents

Abstract

Disclosed herein is a synthetic peptide, which has an amino acid sequence that has 20-39 amino acid residues. The synthetic peptide has at least 80% amino acid sequence identity to SEQ ID NO: 1, and includes at least 20 consecutive residues that has at least 90% amino acid sequence identity to residues 11-30 of SEQ ID NO: 1. Also disclosed herein are pharmaceutical compositions containing the synthetic peptide; and applications thereof. According to various embodiments of the present disclosure, the synthetic peptide is useful in promoting muscle or tendon regeneration, and/or arteriogenesis in a subject.

Description

Use of pigmented epithelial-derived factor-derived multi-peptide to promote muscle or tendon regeneration or arterial angiogenesis

The present invention relates to the treatment of tissue damage, and in particular to the use of a synthetic peptide derived from a pigment epithelium-derived factor (PEDF) to promote muscle or tendon tissue regeneration or to promote arterial angiogenesis for the treatment of tissue damage. .

Muscle tissue can be divided into skeletal muscle, myocardial or smooth muscle. The muscles are able to repair the damage they are exposed to. In the case of skeletal muscle, after injury, skeletal muscles remove the damaged muscle fibers and synthesize new muscle fibers through a spontaneous process. However, in the case of certain tissue damage, this spontaneous tissue repair mechanism may not occur, or its degree of repair is insufficient to completely repair the damage to the tissue. For example, certain pathological factors or genetic defects may cause tissue to fail to heal completely; common pathological factors such as severe injury, old age, muscle disuse, cancer and tissue ischemia; the above genetic defects such as muscle Atrophic disease (muscular dystrophy). Tissue failure to repair can result in permanent loss of muscle mass, disease progression, and loss of tissue function.

Tendons are flexible, bundled fibrous connective tissue that is commonly used to connect muscle to bone. Tendon damage usually leads to inflammation and degeneration or weakening of the tendon, which may eventually lead to tendon rupture. Tendon repair is a long and complicated process that usually takes months or even more than a year, during which time the tendon tissue slowly turns into a braid from fibrous. This sickle tissue can It can reduce the elasticity and mobility of the tendon and make the possibility of re-injury high. Tendon-derived stem cell (TSC) and bone marrow-derived mesenchymal stem cell (BM-MSC) have limited autologous healing effects on tendonitis lesions.

Ischemia is also a common cause of significant tissue damage. Tissue damage caused by ischemia can cause myocardial infarction, stroke and other diseases. Cells are usually able to repair minor damage caused by transient ischae; however, prolonged ischemia usually causes irreversible cell damage, which in turn leads to cell death. In the case of prolonged ischemia, even if the blood circulation is re-established, the function of the damaged cells cannot be fully recovered. In addition, loss of function usually occurs earlier than cell death.

To date, no methods have been developed to effectively treat damaged and functionally disabled tissues or to assist in the regeneration of such tissues. Therefore, there is a need in the related art to propose a method for promoting tissue regeneration. In particular, it is desirable to provide pharmaceutical compositions and methods that promote arterial angiogenesis in order to promote blood flow in or near the damaged tissue region, thereby allowing tissue function to return to near normal levels.

SUMMARY OF THE INVENTION The Summary of the Disclosure is intended to provide a basic understanding of the present disclosure. This Summary is not an extensive overview of the disclosure, and is not intended to be an SUMMARY OF THE INVENTION A simplified summary of the content is presented to give the reader a basic understanding of the disclosure. This Summary is not an extensive overview of the disclosure, and is not intended to be an

The present invention is based, at least in part, on the discovery that PEDF-derived synthetic peptides can promote muscle regeneration, tendon regeneration, or arterial angiogenesis in a body. Thus, the PEDF-derived synthetic peptides described herein are useful as a formulation or agent for the treatment of tissue damage, particularly tissue damage caused by ischemia.

In view of the above, an aspect of the present invention relates to a synthetic peptide for promoting regeneration of muscles or tendons in a body.

According to various embodiments of the present specification, the synthetic peptide is 20-39 amino acid residues in length, and the sequence thereof is at least 80% identical to the sequence number: 1. Furthermore, the above amino acid sequence comprises at least 20 contiguous amino acid residues, the sequence of which is at least 90% identical to the amino acid residues 11-30 of SEQ ID NO: 1, such that the synthetic peptide can be used to promote a body Regeneration of muscles or tendons in the body.

In an optional embodiment, the above synthetic peptide has at least four consecutive amino acids having the same sequence as the amino acid residues 11-14 of SEQ ID NO: 1. Non-limiting examples of such synthetic peptides include amino acid sequences such as SEQ ID NO: 1 (39-mer), SEQ ID NO: 2 (34-mer), SEQ ID NO: 3 (29-mer), SEQ ID NO: 5 (24-mer), SEQ ID NO: 6 (20-mer), SEQ ID NO: 8 (MO 29-mer) and SEQ ID NO: 9 (MO 20-mer). According to some embodiments of the invention, the amino acid sequence of the above synthetic peptide is SEQ ID NO: 3 (29-mer), SEQ ID NO: 5 (24-mer) or Serial number: 6 (20-mer) is shown as either.

In another aspect of the invention, a pharmaceutical composition for promoting regeneration of muscle or tendon in a body is provided. The individual/patient can be any mammal, including a human.

According to an embodiment of the present invention, the pharmaceutical composition comprises any of the synthetic peptides according to the above aspect/embodiment of the present invention, and the synthetic peptide is present in an amount sufficient to promote muscle or tendon regeneration in the individual. The pharmaceutical composition also includes a pharmaceutically acceptable carrier that can be used to carry the synthetic peptide.

In an optional embodiment of the present invention, the pharmaceutically acceptable carrier may be a polymer material such as alginate, gelatin, collagen or polylactic acid/glycolic acid copolymerization. (poly(lactide-co-glycolide), referred to as PLGA).

According to an optional embodiment of the invention, the synthetic peptide is present in the pharmaceutical composition in an amount of from about 1 to 100 μM; preferably about 10 μM.

In still another aspect of the invention, a method is presented that can be used to promote regeneration of muscles or tendons in an individual adjacent to a damaged area or the damaged area. The individual/patient can be any mammal, including a human.

In one embodiment, the method comprises administering to a therapeutic region of the subject a therapeutically effective amount of a synthetic peptide according to the above aspect/embodiment of the invention, wherein the therapeutic region is adjacent to the damaged region, thereby promoting The individual is regenerated in the body adjacent to the damaged area or muscle or tendon therein.

In an optional embodiment, the above synthetic peptide can be prepared according to A pharmaceutical composition according to the above aspect/embodiment of the invention. In actual practice, the composition can be administered by intradermal injection.

According to certain embodiments, the individual may be due to muscle damage, muscle wasting, muscular dystrophy, amyotrophic lateral sclerosis, tendon injury, tissue ischemia, cerebral ischemia, peripheral arteries Causes of damage to muscles or tendons in the injured area, such as peripheral arterial diseases or myocardial infarction.

Furthermore, the present invention provides, in another aspect, a synthetic peptide for promoting arterial angiogenesis in a body.

According to various embodiments of the present specification, the synthetic peptide is 20-39 amino acid residues in length, and the sequence thereof is at least 80% identical to the sequence number: 1. Furthermore, the above amino acid sequence comprises at least 20 contiguous amino acid residues, the sequence of which is at least 90% identical to the amino acid residues 11-30 of SEQ ID NO: 1, such that the synthetic peptide can be used to promote a body Intra-arterial angiogenesis.

In an optional embodiment, the above synthetic peptide has at least four consecutive amino acids having the same sequence as the amino acid residues 11-14 of SEQ ID NO: 1. Non-limiting examples of such synthetic peptides include amino acid sequences such as SEQ ID NO: 1 (39-mer), SEQ ID NO: 2 (34-mer), SEQ ID NO: 3 (29-mer), SEQ ID NO: 5 (24-mer), SEQ ID NO: 6 (20-mer), SEQ ID NO: 8 (MO 29-mer) and SEQ ID NO: 9 (MO 20-mer). According to some embodiments of the invention, the amino acid sequence of the above synthetic peptide is SEQ ID NO: 3 (29-mer), SEQ ID NO: 5 (24-mer) or Serial number: 6 (20-mer) is shown as either.

In another aspect of the invention, a pharmaceutical composition for promoting arterial angiogenesis in a body is provided. The individual/patient can be any mammal, including a human.

According to an embodiment of the present invention, the pharmaceutical composition comprises any of the synthetic peptides according to the above aspect/embodiment of the present invention, and the synthetic peptide is present in an amount sufficient to promote arterial angiogenesis in the individual. The pharmaceutical composition also includes a pharmaceutically acceptable carrier that can be used to carry the synthetic peptide.

In an optional embodiment of the present invention, the pharmaceutically acceptable carrier may be a polymer material such as alginate, gelatin, collagen or polylactic acid/glycolic acid copolymerization. (poly(lactide-co-glycolide), referred to as PLGA).

According to an optional embodiment of the invention, the synthetic peptide is present in the pharmaceutical composition in an amount of from about 1 to 100 μM; preferably about 10 μM.

In still another aspect of the invention, a method is presented that can be used to promote arterial angiogenesis in an individual adjacent to an ischemic region or the ischemic region. The individual/patient can be any mammal, including a human.

In one embodiment, the method comprises administering to a therapeutic region of the subject a therapeutically effective amount of a synthetic peptide according to the above aspect/embodiment of the invention, wherein the therapeutic region is adjacent to the ischemic region, whereby Promoting angiogenesis in the body adjacent to the ischemic region or therein.

In an optional embodiment, the above synthetic peptide can be formulated into a pharmaceutical composition according to the above aspects/embodiments of the invention. In actual operation The composition can be administered by intradermal injection.

According to certain embodiments, the individual may be due to muscle damage, muscle wasting, muscular dystrophy, amyotrophic lateral sclerosis, tendon injury, tissue ischemia, cerebral ischemia, peripheral arteries Causes of blood flow in the ischemic area, such as peripheral arterial diseases or myocardial infarction.

The basic spirit and other objects of the present invention, as well as the technical means and implementations of the present invention, will be readily apparent to those skilled in the art of the invention.

The description of the embodiments of the present invention is intended to be illustrative and not restrictive. The features of various specific embodiments, as well as the method steps and sequences thereof, are constructed and manipulated in the embodiments. However, other specific embodiments may be utilized to achieve the same or equivalent function and sequence of steps.

The scientific and technical terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention pertains, unless otherwise defined herein. In addition, the singular noun used in this specification covers the plural of the noun in the case of no conflict with the context; the plural noun of the noun is also included in the plural noun used.

Although the numerical ranges and parameter boundaries used to define the broader scope of the invention are The approximate values have been presented to the relevant values of the specific embodiments as precisely as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range. Alternatively, the term "about" means that the actual value falls within the acceptable standard error of the average, depending on the considerations of those of ordinary skill in the art to which the invention pertains. Except for the experimental examples, or unless otherwise explicitly stated, all ranges, quantities, values, and percentages used herein are understood (eg, to describe the amount of material used, the length of time, the temperature, the operating conditions, the quantity ratio, and the like. Are all modified by "about". Therefore, unless otherwise indicated to the contrary, the numerical parameters disclosed in the specification and the appended claims are intended to be At a minimum, these numerical parameters should be understood as the number of significant digits indicated and the values obtained by applying the general carry method.

The term "peptide" as used herein refers to a polymer composed of amino acid residues. The word "synthetic peptide" means that the peptide does not contain intact protein molecules found in nature. The reason why such a peptide is "synthetic" is that it is obtained by humans using technical means such as chemical synthesis, recombinant genetic techniques or segmentation of the entire antigen. In the present specification, any amino acid residue based on the position in a peptide is counted from the N-terminus of the peptide.

The term "stem cell" as used herein means that the cell retains the ability to proliferate without substantial differentiation under certain conditions and is capable of differentiating into more specific or highly differentiated cells under certain conditions.

The various parts of the word "proliferation" or "proliferation" herein refer to the situation in which the number of cells in a population increases through cell division.

The term "muscle cells" as used herein refers to any cell that contributes to muscle tissue and includes myoblasts, satellite cells, myotubes, and myofibrils. (myofibril tissues). The term "muscle regeneration" as used herein refers to any process in which new muscle fibers are formed by muscle progenitor cells. Multiple indicators can be used to assess the regeneration of muscles in or adjacent to the injured area, such as the number of muscle fibers, diameter (size), wet weight and/or protein content in or near the damaged area. In addition, muscle regeneration can be observed through the proliferative activity of muscle cells and/or satellite cells in or near the injured area.

In the present specification, the term "tendon" refers to a fibrous tissue formed by collagen fibers arranged in parallel and closely connected, which can connect muscles to bones. The recovery process of tendon injury is a very slow process, and usually a scar is formed, which causes the tendon to become defective and unable to return to normal or original tendon function. Here, the term "tendon regeneration" refers to the production of type I ollagen during the recovery of tendon, and the newly formed collagen fibers are parallel to the direction of tension, thus restoring the process Scar formation is minimized. The number of organized fibrils in or near the lesion area can be used to assess the extent of tendon regeneration. In addition, it can also be observed through the proliferative activity of tendon stem cells in or near the injured area. Check the condition of tendon regeneration.

In this specification, the term "arteriogenesis" is not the same as "angiogenesis". Angiogenesis refers to the process of forming microvessels from existing blood vessel branches; these newly formed microvessels are not vascular smooth muscle cells (vSMCs) and are therefore relatively fragile and easily broken. Such microvasculature is unable to undergo a vasculature remodeling process and thus cannot supply and/or restore an appropriate blood flow cycle to the damaged area or adjacent areas. In contrast to angiogenesis, arterial angiogenesis refers to the proliferation of endothelial cells and smooth muscle cells from existing arterial lines, and the in situ recruitment and expansion of collateral arteries. These newly formed arteries or collateral arteries can develop into a network of arteries (or collaterals) that can form a natural bypass that has supplied sufficient blood to damaged or ischemic tissue or inflammatory sites.

The term "ischemia" refers to a condition in any tissue and/or organ that results from a lack of oxygen supply and/or because of abnormal accumulation of metabolites. This is usually caused by abnormal perfusion, which causes an imbalance in oxygen supply and demand. A variety of conditions are known to cause such abnormal perfusion, such as atherosclerosis, restenotic lesions, anemia, stroke or clogged arteries. It can cause insufficient oxygen in tissues (eg, muscle heart or brain). However, the ischemic condition is not limited to the above-mentioned organs or tissues, but may occur in any organ/tissue.

"Promotion" and its various tenses (such as promotion or promotion) refer to a positive change here; in particular, a positive change that is statistically significant. In one embodiment, the change in front refers to an increase of at least 10% compared to a reference standard.

The "Percent% amino acid sequence identity" as used herein for the synthetic peptide sequence refers to the amino acid residue of the candidate synthetic peptide and the amino acid of a reference polypeptide. The percentage of residues that are identical. When performing the above alignment, the candidate synthetic peptide can be side by side with the reference polypeptide, and a gap is introduced as necessary to form the highest sequence similarity of the two sequences, and when calculating the similarity, the Amino acid residues of conservative substitutions are taken into account. A variety of methods are available for the above-described side-by-side, such as publicly available software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR). Those skilled in the art to which the present invention pertains may select appropriate parameters and calculation methods when performing side-by-side to obtain an optimal arrangement. In the present specification, sequence comparison between diamine acid sequences is carried out using the protein-protein BLAST analysis software Blastp provided by the National Center for Biotechnology Information (NCBI). Amino acid sequence similarity of a candidate amino acid sequence A compared to a reference amino acid sequence B (also referred to herein as sequence A and sequence B have a specific percentage (%) of amino acid sequence similarity Degree) is calculated as follows: Where X is the identity of the same amino acid residue obtained by aligning the sequences A and B with Blastp software, and Y is the total number of amino acid residues of the shorter of the A and B sequences.

By pharmaceutically acceptable carrier herein is a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, a diluent ( A diluent, an excipient, a solvent, or an encapsulating material that can be used to carry or transport a target component from one organ or part of the body to another organ or part of the body. By "acceptable" carrier is meant that it may be compatible with the other ingredients in the composition. The carrier can be in the form of a solid, semi-solid, liquid, cream or capsule.

In this specification, the various parts of speech and tense (eg, treat, treating, or treatment) refer to prophylactic (eg, prophylactic), healing, or palliative treatment. The term "therapeutic" may be used to refer to the administration or administration of a composition presented herein to a subject which may have a medical condition, symptom, disease or disorder associated with the condition or is susceptible to a condition, with a view to being able to partially or Completely alleviating, ameliorating, alleviating, or delaying the onset, hindering the progression, reducing the severity, and/or reducing the incidence of a particular abnormality and/or condition. Individuals who are not indicative of signs of disease, abnormality, and/or condition and/or individuals presenting early signs may also be treated with a view to reducing the risk of developing pathological changes associated with the disease, disorder, and/or condition. In the present specification, when one or more symptoms or clinical indicators are reduced, the treatment is generally considered to be "effective." Or, effective treatment means a reduction or pause in the progression of a disease. That is, "treatment" includes not only improving symptoms or reducing disease indicators, but also covering the original In the case of no treatment, it is highly probable that the progression of the disease or the deterioration of the symptoms will stop or slow down. Beneficial or clinical outcomes include, but are not limited to, relief of one or more symptoms, reduction in disease severity, stabilization of the disease state (eg, no deterioration), delay or delay in disease progression, partial or complete improvement in disease status Or alleviation, the above includes symptoms, degrees, status or progression that are detectable or undetectable.

As used herein, the term "effective amount" means that the amount of a component is sufficient to induce a desired response or effect. The term "therapeutically effective amount" means that the therapeutic agent is present in an amount sufficient to produce the desired "effective treatment" as defined above. The particular therapeutically effective amount depends on a variety of factors, such as the particular condition being treated, the physiological condition of the individual (eg, the individual's weight, age, or sex), the type of mammal or animal being treated, the duration of treatment, current therapy (if The nature of any) and the specific formulation and structure of the compound or derivative thereof used. A therapeutically effective amount also means that the toxic or negative effect of the compound or composition is less than the positive effect of the compound or composition.

The terms "patient" or "individual" are used herein to mean a mammal (including a human) that can receive the synthetic peptide, pharmaceutical composition and/or method of the present invention for treatment. Unless otherwise indicated, "individual" generally includes males and females.

Pigment epithelium-derived factor (PEDF) is a multifunctional secreted protein with anti-angiogenic, anti-tumorigenic and neurotrophic functions. . The human PEDF protein (SEQ ID NO: 14) is a size of approximately 50 kDa a secreted protein with 418 amino acids. It is known that the 34-mer fragment of PEDF (corresponding to residues 44-77 of PEDF) and the 44-mer fragment (corresponding to residues 78-121 of PEDF) have anti-angiogenic and neurotrophic properties, respectively.

This specification is based, at least in part, on the discovery that synthetic peptides derived from PEDF can promote muscle or tendon regeneration and arterial angiogenesis in a body. In particular, the present invention is the first to discover the association between the local administration of this PEDF-derived synthetic peptide and the recovery of damaged or ischemic muscle or tendon tissue and the formation of arteries (or collaterals) in or near the ischemic area. Another innovative feature of the present invention is that the synthetic peptide proposed herein has a maximum of only 39 amino acid residues, which is much shorter than the full length PEDF described in the prior art; therefore, the present invention overcomes the clinical use of conventional proteins. Frequently faced dilemmas such as high manufacturing costs, low bioavailability, and poor pharmacokinetics. Thus, these synthetic peptides can be used to treat muscle or tendon injuries as well as ischemic tissues or organs.

Accordingly, one aspect of the present invention relates to a synthetic peptide for promoting regeneration of muscle or tendon in a body. Another aspect of the invention relates to a synthetic peptide for promoting arterial angiogenesis in a body. Embodiments suitable for either or both of the above aspects are described below.

According to various embodiments of the present specification, the synthetic peptide has 20 to 39 amino acid residues, and the amino acid sequence thereof has at least 80% amino acid sequence similarity to SEQ ID NO: 1 (LSVATALSALSLGAEQRTESIIHRALYYDLISSPDIHGT). For example, this synthetic peptide The similarity to the amino acid sequence of SEQ ID NO: 1 may be about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97. , 98, 99 or 100%. In addition, the synthetic peptide comprises at least 20 contiguous amino acid residues having at least 90% amino acid sequence similarity to SEQ ID NO: 1 from 11 to 30 residues. Specifically, the 20 consecutive amino acid residues may have a similarity to the amino acid sequence of the 11th to 30th residues of SEQ ID NO: 1 of about 90, 91, 92, 93, 94, 95, 96, 97. , 98, 99 or 100%.

In one embodiment of the invention, the synthetic peptide has 39 amino acid residues, the sequence of which is as shown in SEQ ID NO: 1. In the experimental examples below, this synthetic peptide was also referred to as a 39-mer. Such a 39-mer peptide is a shorter variant of the known 44-mer fragment from human PEDF (PEDF residues 78-121).

The experiments previously performed by the inventors of the present invention (e.g., U.S. Patent Application Serial No. 13/428,996, the entire contents of which is incorporated herein by reference in its entirety) There are several other short PEDF synthetic peptides from this 39-mer that are effective in promoting muscle or tendon regeneration and/or arterial angiogenesis in a body.

For example, it can be seen from the experimental examples of the following application that the 34-mer synthetic peptide as shown in SEQ ID NO: 2 (ALSALSLGAEQRTESIIHRALYYDLISSPDIHGT) is effective for promoting muscle or tendon regeneration and/or arterial angiogenesis in an individual. The 34-mer synthetic peptide corresponds to amino acid residues 88-121 of human PEDF; the 34-mer and 39-mer amino acids are calculated according to the amino acid sequence similarity calculation method described above. sequence The column similarity is 100%, and the amino acid sequence residues of amino acids 6-25 of the 34-mer and the amino acid residues 11-30 of the 39-mer are also 100% similar.

In addition, the following experimental examples demonstrate that the 29-mer synthetic peptide represented by SEQ ID NO: 3 (SLGAEQRTESIIHRALYYDLISSPDIHGT) can effectively promote muscle or tendon regeneration in an individual and promote arterial angiogenesis. This 29-mer synthetic peptide corresponds to amino acid residues 93-121 of human PEDF; its similarity to the amino acid sequence of 39-mer is 100%, and the amine of No. 1-20 of 29-mer The amino acid sequence has a similarity to the amino acid sequence of the amino acid residues 11-30 of the 39-mer.

In some experiments, a 24-mer synthetic peptide can also effectively promote muscle or tendon regeneration and arterial angiogenesis in an individual; the 24-mer sequence is shown in SEQ ID NO: 5 (SLGAEQRTESIIHRALYYDLISSP) and is equivalent to human PEDF No. 93-116 amino acid residue. In addition, the 24-mer sequence is identical to the amino acid residues 11-30 of the 39-mer (amino acid sequence similarity: 100%) and is similar to the amino acid sequence similarity of the 39-mer. It is also 100%.

In some experiments, the 20-mer shown in SEQ ID NO: 6 (SLGAEQRTESIIHRALYYDL) is also effective in promoting muscle or tendon regeneration and arterial angiogenesis in an individual. The sequence of this 20-mer corresponds to the amino acid residue of human PEDF No. 93-112, which is identical to the amino acid residues 11-30 of the 39-mer (amino acid sequence similarity: 100%) And its similarity to the amino acid sequence of the 39-mer is also 100%.

The experimental examples disclosed in the present application and the prior application also show that two other short, synthetic peptides derived from mouse PEDF are also effective in promoting muscle or tendon regeneration and/or arterial angiogenesis in an individual. The first synthetic peptide derived from mouse is referred to in this specification as Mo 29-mer, the sequence of which is shown in SEQ ID NO: 8 (SLGAEHRTESVIHRALYYDLITNPDIHST), which has a similarity to the 39-mer amino acid sequence of 83. %, and its first 20 amino acid residues have a similarity to the amino acid sequence of the 11- to 30-residue of the 39-mer. Another synthetic peptide derived from mouse PEDF is called Mo 20-mer and its sequence is shown as SEQ ID NO: 9 (SLGAEHRTESVIHRALYYDL). The amino acid sequence residues of the Mo 20-mer and the 39-mer or 39-mer amino acid residues are all 90% similar.

In an optional embodiment, the above synthetic peptide has at least four consecutive amino acids having the same sequence as the amino acid residues 11-14 of SEQ ID NO: 1. The experimental results conducted by the inventors of the present invention show that the amino acid residues No. 11-14 of the sequence of SEQ ID NO: 1 (i.e., SLGA) play an important role in maintaining the physiological function of the short PEDF synthetic peptide. For example, the various experimental examples presented below show that an 18-mer synthetic peptide (EQRTESIIHRALYYDLIS; SEQ ID NO: 7) without this SLGA fragment fails to promote arterial angiogenesis in an individual. Furthermore, it can be found from the experimental examples contained in the present application and the prior application that the 25-mer synthetic peptide (EQRTESIIHRALYYDLISSPDIHGT; SEQ ID NO: 4) is not effective in promoting muscle or tendon regeneration and/or arterial angiogenesis in an individual.

Any of the conventional techniques can be utilized to synthesize the synthetic peptides described herein, For example, t-BOC or FMOC protects alpha-amino groups. Both methods employ a stepwise synthesis starting with the C-terminus of the peptide, each time adding an amino acid. Other known solid phase peptide synthesis (SPPS) methods can also be utilized to synthesize the synthetic peptides described herein.

Also included within the scope of the invention are other synthetic peptides that have conservative substitutions compared to the 39-mer. Here, the term "conservative substitution" refers to the replacement of a residue with another biologically similar residue. Illustrative of conservative substitutions include substitutions of hydrophilic residues (such as isoleucine, valine, leucine, and methionine) with each other, or similar polar residues (such as arginine and lysine; Or glutamic acid and aspartate) replacement with each other, and other similar modes of substitution. "Conservative substitution" as used herein also refers to the use of a substituted amino acid to replace an unsubstituted amino acid, as long as the antibody reactive with the substituted amino acid can also react with the original amine. The base acid can be used for an immune reaction.

The various synthetic peptides described in the above embodiments may also be formulated into pharmaceutical compositions for promoting muscle or tendon regeneration and/or arterial angiogenesis in an individual, the pharmaceutical composition being within the scope of another aspect of the present invention. .

According to an embodiment of the present invention, the pharmaceutical composition comprises any one of the synthetic peptides according to the above aspect/embodiment of the present invention, and the synthetic peptide is present in an amount sufficient to promote muscle or tendon regeneration and/or arteries in the individual. Angiogenesis. This pharmaceutical composition also includes a pharmaceutically acceptable carrier suitable for use in the synthetic peptide.

In selecting a pharmaceutically acceptable carrier suitable for delivery of a synthetic peptide, It is primarily necessary to consider the route of administration of the pharmaceutical composition. According to an optional embodiment of the invention, the pharmaceutical composition can be administered by intramuscular injection. In this case, a sterile aqueous solution may be utilized as a pharmaceutically acceptable carrier, and the aqueous solution is preferably an isotonic solution with the recipient's blood. For example, the active ingredient may be dissolved or suspended in water containing a physiologically compatible substance such as sodium chloride, glycine, and the like, and the pH thereof may be buffered. The physiological conditions are compatible to obtain an aqueous solution which is then sterilized.

In an optional embodiment, the synthetic peptide can also be formulated in a sustained release dosage form to ensure that the pharmaceutical composition provides a longer-lasting therapeutic effect. A variety of polymeric materials are known to extend drug release, examples of which include, but are not limited to, alginate, gelatin, collagen, and polylactic acid/glycolic acid copolymers.

According to some experimental examples of the present invention, the synthetic peptide is embedded in a matrix composed of cross-linked seaweed, and the final concentration of the synthetic peptide is about 1-100 μM; It is about 10 μM. For example, the concentration of the above synthetic peptide may be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55. , 60, 65, 70, 75, 80, 85, 90, 95 or 100 μM.

The compositions of the present invention may also contain various additives known in the art. For example, solvents (including small amounts of ethanol) can be used to stabilize certain drugs. Other optional pharmaceutically acceptable additives include: opacifiers, antioxidants, perfumes, colors, gelling agents, thickeners, stabilizers, surfactants, and the like. Other substances may also be added to prevent the composition from being stored Deterioration, such as the addition of antibacterial agents to inhibit the growth of microorganisms such as yeasts and molds. Permeation enhancers and/or irritating additives may also be included in the compositions of the present invention.

In still another aspect, the invention provides a method for promoting muscle or tendon regeneration in or adjacent to a lesion of a body; and another aspect of the invention relates to ischemia for a body A method of promoting arterial angiogenesis in or adjacent to a region. In any of the above embodiments, the individual/patient can be any mammal, including a human. Embodiments suitable for either or both of the above aspects are described below.

In one embodiment, the method for promoting regeneration of muscle or tendon comprises administering to a therapeutic region of the subject a therapeutically effective amount of a synthetic peptide according to the above aspect/embodiment of the present invention, wherein the therapeutic region is Adjacent to the damaged area, thereby promoting regeneration of the muscle or tendon adjacent to the damaged area or the body thereof.

In another embodiment, the method of promoting arterial angiogenesis comprises administering to a therapeutic region of the subject a therapeutically effective amount of a synthetic peptide according to the above aspect/embodiment of the invention, wherein the therapeutic region is adjacent The ischemic region is thereby promoted angiogenesis in the body adjacent to the ischemic region or therein.

In an optional embodiment, the synthetic peptide can be formulated into the pharmaceutical compositions described above in the aspects/embodiments of the invention. In actual practice, the composition can be administered by intradermal injection.

According to some embodiments, the individual may be due to muscle damage, muscle waste Use, muscular dystrophy, amyotrophic lateral sclerosis, tendon injury, tissue ischemia, cerebral ischemia, peripheral arterial disease, or myocardial infarction, etc., cause blood flow in the ischemic area to be blocked.

A number of experimental examples are set forth below to illustrate certain aspects of the present invention, and the present invention may be practiced by those of ordinary skill in the art. These examples should not be construed as limiting the scope of the invention. It is believed that the skilled artisan, after reading the description set forth herein, may fully utilize and practice the invention without undue interpretation. All publications cited herein are hereby incorporated by reference in their entirety.

Experimental example Materials and Methods

<material>

HEPES buffered DMEM medium (Dulbecco's modified Eagle's medium), fetal bovine serum (FBS), 0.25% trypsin, anti-BrdU antibody, MCDB131 medium, TRIzol and Dynabeads were purchased from Invitrogen (Carlsbad, CA). Ultrapure alginate (6000 Da), dimethyl sulfoxide (DMSO), bovine serum albumin (BSA), 5-bromo-2'-deoxyuridine (5-bromo-2) '-deoxyuridine, BrdU), Hoechst 33258 dye and Masson's Trichrome were purchased from Sigma-Aldrich (St. Louis, MO). Collagenase type I and type 2 neutral protease (dispase II) were purchased from Roche (Indianapolis, IN). Various fluorescent dyes - combined with secondary Antibodies were purchased from BioLegend (San Diego, CA). Hematoxylin and eosin (H&E) dyes were purchased from Merck (Rayway, NJ, USA). The anti-collagen 1A1 anti-system was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Matrigel was purchased from BD Biosciences (Bedford, MA). Anti-α-smooth muscle actin (anti-α-SMA) antibody (ab5694) and anti-nucleostemin anti-system were purchased from Abcam (Cambridge, MA). Anti-Pax7 antibody (GTX62311) was purchased from GeneTex (Taipei, Taiwan). Lectin B4 (IB4)-Alexa Fluor 568 fluorescent coupler was purchased from Molecular Probes (Eugene, OR).

Short synthetic peptides (including 29-mer (SEQ ID NO: 3), 25-mer (SEQ ID NO: 4), 24-mer (SEQ ID NO: 5), 20-mer (SEQ ID NO: 6), 18-mer ( SEQ ID NO: 7), Mo 29-mer (SEQ ID NO: 8) and Mo 20-mer (SEQ ID NO: 9)) were purchased from GenScript (Piscataway, NJ), and after synthesis, the N-terminal was cyanated (acetylated). The C-terminus is amidated to enhance stability and is characterized by mass spectrometry (purity >95%).

All animals used in the examples contained in this specification were housed in a cage with temperature and humidity control at a temperature of about 24 ° C to 25 ° C and a light dark cycle of 12 hours. Drinking water and standard rodent feed are provided for the meal during the test. The experimental plans were approved by the Ethics Committee of the Ma Rong Memorial Hospital (New Taipei City, Taiwan) and followed the national animal protection regulations.

<PEDF Synthetic peptide/seaweed formula and pill formulation>

Each synthetic peptide (29-mer, 25-mer, 24-mer, 20-mer, 18-mer, MO 29-mer or MO 20-mer) was rehydrated (5 mM) in DMSO. Thereafter, the stock solution was mixed with ultrapure alginate to obtain a 2% (w/v) alginate solution in which the final concentration of the PEDF synthase was about 10 μM. The alginate solution was then filtered through a membrane filter (pore size: 0.22 μm) and mixed with filtered calcium sulphate slurry (0.21 g of calcium sulphate per ml of distilled water) in a ratio of 25:1 (filtered algae per ml) The acid salt solution is mixed with 40 μL of calcium sulfate slurry). The mixture was allowed to stand at room temperature for 1 hour to allow the alginate to undergo a crosslinking reaction. The resulting sustained release formulation can then be used to treat muscle or tendon injuries and ischemia.

For a bolus delivery, a 5 mM stock solution was serially diluted to obtain a bolus formulation with a final concentration of 10 μM of PEDF peptide.

<Histology, Immunofluorescence and Quantitative Analysis>

The gracilis, adductor magnus, soleus and tibialis were fixed with 4% paraformaldehyde, then dehydrated with gradient ethanol, then embedded in paraffin. . The fixed sample was dewaxed with xylene and rehydrated with a gradient of ethanol. The tissue was cut into sections of about 5-μm. General histological analysis was performed using H&E dyes.

Dewaxed tissue sections were treated with 10% goat serum for about 1 hour. Blocked. Staining at 4 ° C with BrdU primary antibody (GTX42641; dilution ratio 1:50) or anti-type 1 collagen 1A1 primary antibody dilution ratio 1:50), then at room temperature with appropriate peroxidase - The reaction was carried out by peroxidase-labeled trophic immunoglobulin for about 30 minutes, and then reacted with 3,3'-diaminobenzidine (DAB) on a chromogen substrate for 2 minutes. Contrast staining was then carried out using hematoxylin. High-quality images (resolution 1208 X 960 pixels) were taken using a Nikon Eclipse 80i optical microscope for quantitative analysis.

The muscle fiber diameter is determined by H&E-stained muscle sections and quantified by the minimum distance between a pair of parallel lines tangent to the particle borders, which is the "minimal Feret's diameter". . After capturing images using a Nikon Eclipse 80i optical microscope, the minimum Feret diameter was calculated using Image-Pro Plus 4.5.1 software (Media Cybernetics). The number of fibers in each fiber Ferrite group (in units of 5 μm) was normalized based on the total number of muscle fibers in each photograph.

In order to confirm the number of centurally nucleated muscle fibers, the slice samples were stained with H&E and images were taken with the above apparatus. At least 100 dyed fibers are randomly selected in each photograph; if one or more nuclei in the fiber are not in a position close to the periphery of the fiber, the muscle fiber is determined to be a nuclear center shifting fiber. The data is expressed as a percentage of the total number of fibers counted. For each experimental group, 10 mice were selected and 6 slices were selected for each muscle site for calculation.

The dewaxed tendon tissue was stained with Manson's trichrome dye according to the manufacturer's instructions. For semi-quantitative analysis of collagen area, 10 fields were randomly selected from each slide sample under an optical microscope, and the sample was calculated using Image-Pro Plus 4.5.1 software. The area of the repaired area as a percentage of the area of the intact tendon (mm ² /mm ² ).

<Isolation and culture of tendon stem cells>

New Zealand white rabbits (6-8 months old, 3.0-4.0 kg) were used in this experiment. Cut along the rabbit's tendon attachment to obtain the Achilles tendon. After peeling off the tendon, cut the core of the tendon into small pieces. Add 3 mg/ml of type I collagenase and 4 mg/ml of neutral protease to DMEM-high glucose solution, add 100 ml of the tendon core fragment to 1 ml of the above solution, and perform at 37 °C. Hour hydrolysis reaction. The resulting cell suspension was then centrifuged at 1,000 rpm for 15 minutes, and the cell pellet was taken out and resuspended in DMEM growth medium supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 μM 2 - 2-mercaptoethanol with 100 U/ml penicillin and 100 μg/ml streptomycin. For subculture, 0.25% trypsin was used to collect nearly overgrown cells, and then subcultured cells at a density of 1×10 ⁵ were cultured in the medium.

<muscle stem cell proliferation analysis>

The 4th tendon stem cells were implanted into a gelatin coated slide at a density of 2×10 ⁵ cells per well, placed in a six-well plate, and added to the growth medium (DMEM + 10% FBS) for 24 hours, and then The medium was replaced with a basal growth medium containing only 5% FBS (control) or a PEDF synthetic peptide containing 5% FBS plus 50 nM (ie, 29-mer, 24-mer, 20-mer, 18-mer, Mo 29-mer or Mo 20-mer) and cultured for 24 hours. For BrdU labeling analysis, BrdU (final concentration 10 μM) was added to the culture system for approximately 4 hours. After fixation with 4% paraformaldehyde, the cells were placed in cold methanol for about 2 minutes and then treated with 1 N hydrogen chloride for about 1 hour at room temperature before immunofluorescence analysis. The phenotype of the tendon stem cells of the secondary 4 was determined by immunochemical analysis of the nucleostemin and the first type of collagen. Almost all of the proliferating tendon stem cells are nuclear stem cell factors and type I collagen-double positive cells.

<In vivo detection of DNA synthesis>

To detect cell proliferation, BrdU was redissolved in DMSO for use (80 mM). 10 μl of BrdU stock solution and 90 μl of PBS were mixed and intraperitoneally injected into mice, and the mice were euthanized after 16 hours. The rats were injected intraperitoneally with 150 μl of BrdU stock solution and 350 μl of PBS, and were also euthanized after 16 hours. BrdU was labeled with an anti-BrdU antibody and assessed for DNA synthesis.

<Immunofluorescence analysis>

The demineralized tissue sections or rabbit tendon stem cells (TSC) fixed with 4% paraformaldehyde were treated with 10% goat serum and 5% BSA for about 1 hour to block. Use anti-α-SMA (dilution ratio 1:100), IB4 (5 μg/ml), Primary antibodies with Pax7 (diluted 1:100), nuclear stem cell factor (diluted 1:100) or type 1 collagen 1A1 (diluted 1:50) were stained at 37 °C for 2 hours, then at room temperature The appropriate rose- or FITC-conjugated immunoglobulin is reacted for about 1 hour. The nuclei were contrast-stained using Hoechst 33258 (about 7 minutes). Images were taken using a Zeiss fluorescence microscope with a CCD camera and photographed using Axiovert software.

In each of the adducted long muscle samples, 10 regions were randomly selected to capture images (magnification: 200×), and the density of the small arteries (α-SMA positive cells surrounding the entire circumference of the blood vessel) was calculated. Positive cells in each sample were counted by an experimenter who did not know the treatment group beforehand and repeated three times; the values from the five samples were then averaged and expressed as arteriole density per square millimeter.

<Separation, culture and treatment of mesenchymal stem cells>

Primary rat bone marrow mesenchymal stem cells (BM-MSCs) were isolated from femurs of male Sprague-Dawley rats (300-450 g). The femur was removed in a sterile environment and the adhering tissue was excised, after which the DMEM medium was injected into the medullary cavity for rinsing. The collected bone marrow cells were cultured in a 100×15-mm Petri dish using DMEM medium (10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin) in a 5% carbon dioxide and 37 ° C environment. The culture was carried out for 2 weeks and fresh medium was replaced every 2-3 days. For subculture, 0.25% trypsin was used to collect nearly overgrown cells, and then 2×10 ⁵ subcultured cells were plated in each well of a 6-well plate and cultured in 10% FBS- In DMEM medium. Before treatment, cells were starved for 12 hours in DMEM medium supplemented with 1% FBS, and then 50 nM PEDF synthetic peptide (29-mer or 20-mer) was added to fresh 1% FBS-DMEM and cultured. 24 or 48 hours.

<RNA extraction and reverse transcription polymerase chain reaction>

Total RNA was extracted from the cells by TRIzol and treated with DNase I (Qiagen, Santa Clarita, CA) without ribohydrolysis (Rnase-free) to remove the genome. DNA was then purified using RNA purification kit Dynabeads. Add 1 μg of total RNA from BM-MSC to 200 units of reverse transcriptase in 20 μl of reaction buffer (containing 0.25 μg of random primer and 0.8 mM deoxyribonucleoside triphosphate (dNTPs)) (Roche , Mannheim, Germany), reacted at 42 ° C for 1 hour to reverse transcribe RNA into cDNA. In the subsequent PCR reaction, 2 μl of cDNA was taken as a reaction template.

The PCR reaction has a reaction volume of 30 μl containing 15 μl of EconoTaq® PLUS GREEN 2× Master Mix (Lucigen® Corp.) and 1 μM of various primers with 2 μl of template DNA. The proliferative reaction of the synthetic cDNA was about 18-22 cycles (denaturation: 20 seconds, 94 ° C; adhesion: 30 seconds, 57 ° C: and polymerization: 40 seconds, 72 ° C). The number of cycles used for each primer set falls within the linear range of the extension. The primer set used to propagate the rat Tenomodulin (TNMD) gene (Registration No.: NM_022290) contains a forward primer (AGAATGAGCAATGGGTGGTC; SEQ ID NO: 10) and reverse primer (CTCGACCTCCTTGGTAGCAG; SEQ ID NO: 11), the PCR product size is about 240 bp. In addition, a rat glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene (Registration No.: X02231.1) was used as a housekeeping gene to standardize gene expression. The primer set for proliferating the GAPDH gene includes a forward primer (AGACAGCCGCATCTTCTTGT; SEQ ID NO: 12) and a reverse primer (CTTGCCGTGGGTAGAGTCAT; SEQ ID NO: 13), and the PCR product has a size of about 207 bp.

The PCR product was electrophoresed using 2% acacia gum containing ethidium bromide and developed by UV light. The PCR products were quantitatively analyzed by optical density method using a FUJI LAS-3000 system and Multi Gauge Ver. 1.01 software (Fujifilm, Tokyo, Japan).

<Statistical Analysis>

The results are expressed as mean ± standard error of the mean (SEM). Statistical comparisons were made using one-way ANOVA analysis. Statistically significant differences were obtained at P < 0.05 unless otherwise stated.

Experimental example 1

PEDF synthetic peptide can be continuously released from seaweed matrix

To determine the release kinetics of 29-mer and 20mer, 100 μg of FITC-bound PEDF synthetic peptide was mixed with 100 μL of alginate solution. Then, the hydrogel is prepared according to the procedure described in "Materials and Methods". Thereafter, 100 mg of a hydrogel and 1.5 ml of PBS (pH 7.4) were added to a microcentrifuge tube, and cultured at 37 ° C for 6 days in a rotary shake incubator (orbital shaking incubator). Centrifuge the microcentrifuge tube at the predetermined time point and take out 200 μL of the supernatant and store at -80 °C for subsequent analysis. Add 200 μL of fresh PBS to the centrifuge tube to make up the extracted supernatant. . A 96-well fluorimeter was used to determine the amount of FITC-bound PEDF synthetic peptide in the supernatant obtained. A standard curve was generated using a known concentration of unembedded FITC-peptide. The analysis used the data from three replicate experiments and compiled them in Figure 1.

As shown in Figure 1, the embedded PEDF synthetic peptide was continuously released from the alginic matrix during the 6-day test. More specifically, about 48% of the 29-mer and 35% of the 20-mer synthetic peptide remained in the alginate matrix 24 hours after the start of the test. Most (about 90%) of the 29-mer synthetic peptides were released four days before the test, and the rate of release was significantly slowed down, so a plateau was observed in the cumulative release profile. The release rate of the 20-mer synthetic peptide was slightly faster than that of the 29-mer, and about 90% of the 20-mer was released three days before the test.

Experimental example 2

Slow release of PEDF synthetic peptide can reduce ischemic injury

Ischemic muscle damage usually leads to local necrosis and loss of tissue and function. Therefore, ischemic animals are used in the following experimental examples. Models to explore whether topical administration of PEDF synthetic peptide/alginic gel formula (hereinafter referred to as "sustained release formulation") can promote the recovery of tissue or organ function of tissues or organs suffering from ischemic injury. In the following experimental examples, various conditions associated with ischemic injury were analyzed, for example, limb perfusion (limb perfusion), tissue necrosis, arterial angiogenesis, and neovascular sprouting.

In this experiment, six-week-old female C57BL/6 wild-type mice were used. The animals were intraperitoneally injected with a mixture of zoletil (6 mg/kg body weight) and xylazine (3 mg/kg body weight). To perform anesthesia. Remove the hair from the hind legs and buttocks with a depilatory cream. The unilateral external iliac artery and the femoral artery and peripheral blood vessels were ligated and excised to obtain hind limb ischemic mice. After the surgery, the mice were randomly divided into several experimental groups (the number of samples per group was 6) and the following treatments were respectively administered. In the blank control group, the mice were given 50 μl of blank seaweed gum; while in the pill control group, the mice received a pill formulation containing 29-mer. In the PEDF synthetic peptide/alginate treated group, the mice received a 50 μl sustained release formulation containing 29-mer, 24-mer or 20-mer, respectively. In addition, in the PEDF 18-mer control group, mice received a sustained release formulation containing a PEDF 18-mer synthetic peptide. Immediately after the operation, the drug is delivered to the gracilis muscle by a single intramuscular injection. The wound was washed with sterile physiological saline and sutured.

Experimental Example 2.1

Slow release of PEDF synthetic peptide can increase limb perfusion

Pre-operative (pre-operative; pre-OP), immediate post-operative (postoperative; post OP), and post-surgery using a Laser Doppler Perfusion Imaging (LDPI) analyzer (Moor Instruments, USA) Blood perfusion for a period of time. To minimize vasoconstriction due to anesthetic heat loss, animals were placed on a 37 ° C hot plate for 5 minutes prior to measurement. Figure 2 is a representative LDPI photograph showing the blood perfusion of the ischemic hind limbs during the four weeks after surgery, with dark blue representing a lower blood flow. In addition, the blood perfusion condition is represented by the LDPI index, which is the ratio of the blood flow of the surgically operated (ischemic) hind limb to the unoperated (non-ischemic) hind limb of the same animal, and the results are summarized in the third. Figure and Table 1 (n 6). Blood flow is represented by a change in the laser frequency (pixels of different colors).

As shown in Figure 3, as expected, local blood flow decreased immediately after surgery (postoperative) to approximately 8% of the non-ischemic hind limbs of the same animal in all treatment groups. In the blank control group (treated only with seaweed gum), A phenomenon of reperfusion that slowly grows over time is observed. In addition, it can be noted that the effect of bolus administration is similar to that of the blank control group, meaning that sustained release of the PEDF synthetic peptide may be necessary for the protective effect of these PEDF synthetic peptides. Furthermore, compared with the blank control group or the pill control group, the mice treated with the sustained release formulation containing the 18-mer synthetic peptide did not observe the increase of blood perfusion; the representative peptide of 18-mer could not be synthesized. Effective treatment of ischemic injury. In contrast, the blood perfusion of the PEDF-treated peptide treated by the present invention was significantly improved (compared with the blank control group, the pill control group and the PEDF 18-mer control group). It is said that animals treated with a slow release formulation containing 29-mer, 24-mer or 20-mer have a significant increase in blood flow (at least 60% of normal limbs) at about the second week after surgery. %). At the 4th week after surgery, the animals treated with the slow-release formula containing 29-mer, 24-mer or 20-mer had a good recovery of perfusion status, reaching about 105% and 92% of the normal limbs, respectively. Compared with 93%; the perfusion ratio of the blank control group was only about 50%, while the perfusion ratio of the pill control group was only about 55%.

Experimental Example 2.2

Slow release of PEDF synthetic peptide can prevent tissue necrosis induced by ischemia

In most hindlimb ischemia models, tissue located under the knee usually undergoes tissue necrosis. For example, after femoral resection, the tibialis anterior muscle located at the distal end of the femoral muscle of the treatment usually has a large amount of muscle necrosis and regeneration. After the sample is dyed by Manson's three-color dye, the intensity of the blue dye depends on the glue in the sample tissue. The content of the original protein fiber, while necrosis can lead to this fibrosis. Therefore, tissue samples were taken from the tibialis anterior muscles at the second and seventh weeks after surgery and treatment, respectively, and stained with Manson's trichrome stain to assess the degree of fibrosis (and necrosis). Figures 4A and 4B provide photographs of representative samples.

As shown in Fig. 4A, in the two weeks after the operation, the muscle tissue of the blank control group showed a large amount of fibrosis (blue stained area), and the animal treated by the sustained release formulation proposed by the present invention had fibers in the muscle tissue. The area is relatively small. In addition, it can be found in Fig. 4A that, at seven weeks after surgery, the sustained release formulation proposed herein can effectively reduce the area of necrosis and fibrosis, and thus the muscle tissue can be completely restored.

After ischemic injury, muscle fiber regeneration can be performed by satellite cell proliferation. One of the characteristics of newly generated muscle fibers is the centrally displaced nuclei. In addition, necrotic myofibrils appear in the necrotic area, which exhibits light eosinophilic cytoplasm and edema and lack of peripheral nuclei. As shown in Fig. 4B, in the mice treated with the sustained release formulation, the regeneration of myofibrils with centrally displaced nuclei was more pronounced than in the blank control mice two weeks after surgery. Referring to the photograph above in Figure 4B, the larger light red region of the blank control sample (compared to the 20-mer treated sample) represents the sustained release formulation proposed herein to be effective in preventing tissue necrosis. At 7 weeks after surgery, small muscle fiber bundles were observed in 15% of the tibialis anterior muscle of the blank control group, and fat droplets were staggered between them (Fig. 4B; lower left).

Statistical analysis of the number of lesions (necrotic and fibrotic areas) and the number of fibers displaced by the center of the nucleus for two weeks after surgery, summary of results Organized in Table 2. The area of the damaged area is expressed as a percentage (%) of the area of the total stained area, and the fiber displaced by the center of the core is expressed as a percentage (%) of the total number of calculated muscle fibers.

As can be seen from the data contained in Table 2, injection of the sustained release formulation set forth herein can substantially reduce tissue damage (compared to the blank or bolus control group). Specifically, the PEDF-treated group lesion area can be reduced to about 45-48% of the blank or pill control group. In addition, these data show that treatment with a 29-mer, 24-mer or 20-mer formulation increases the number of fibers displaced in the nucleus of the tibialis anterior muscle by about 3-3.7 fold (compared to the blank or bolus control group).

In summary, the results described in Experimental Example 2.2 show that treatment with a slow release formulation containing 29-mer, 24-mer or 20-mer can prevent tissue necrosis and fibrosis induced by ischemia, and thus promote Restoration of muscle tissue. In addition, the mice treated with the sustained release formulation proposed herein have better iliac muscle recovery, and can further demonstrate the effect of the sustained release formulation on promoting blood perfusion in ischemic limbs (see Experimental Example 2.1 above).

Experimental example 2.3

Sustained-release PEDF synthetic peptide can stimulate arterial angiogenesis and supply blood flow to ischemic tissue through collateral circulation

In the case of acute obstruction of the main artery (such as the coronary or femoral artery), the existing arterial connection can be used to bypass the obstruction site. This process is called "arterial angiogenesis" and has many differences from the "angiogenesis" process. From an anatomical point of view, these existing collateral arteries are microscopically thin, composed of an endothelial lining, an internal elastic lamina, and one or two smooth muscle cells. Vascular line; this structure is different from the microvessels generated during angiogenesis. Under normal circumstances, these native small arteries are not used to provide blood perfusion. However, after major arterial occlusion, these blood vessels greatly increase their lumen volume via growth and bypass the occlusion area, providing higher blood perfusion to the damaged ischemic area. In many organs or tissues in animals (such as hind limbs, heart, brain, kidney, etc.), when the main artery is chronically or acutely blocked, these collateral arteries can alleviate various adverse conditions that may occur subsequently. It is noted that arterial angiogenesis is not a simple process for passive expansion of existing collateral vessels; conversely, arterial angiogenesis involves the coupling of existing arteries through active proliferation and remodeling to form true collateral arteries. It is known that the vascular radius has a critical effect on blood flow; therefore, after adaptive growth, the collateral artery can deliver a relatively large amount of blood per unit time. Thus, stimulating arterial angiogenesis can protect the ischemic hind limbs or other organs more efficiently than tube births. Official (such as heart, brain, etc.). In contrast, angiogenesis refers to a microvascular process in which endothelial cells are formed by existing blood vessels, which does not help to provide higher blood perfusion to the damaged ischemic area. Thus, newly formed microvessels, regardless of their number, are less able to supply blood to potentially ischemic tissue than the increased blood flow of two or three collateral arteries.

In order to explore the effect of the sustained-release formulation proposed here on arterial angiogenesis, the adductor longus muscle of each treatment group was obtained two weeks after surgery (the depth was the same as the femoral artery resection position, and it is expected to appear there. Used to establish arterial angiogenesis in the collateral circulation). Vascular smooth muscle cells (α-SMA; brown) were stained to mark small arteries in the muscle section, and the nuclei were labeled with hematoxylin; see Figure 5 for representative photos. In addition, quantitative analysis was also performed, and the results were expressed as the number of α-SMA-positive arterioles per square millimeter (mm ² ) in the peri-injury region, as shown in Table 3.

These data show that compared to the blank and the pill control group, given here The sustained release formulation is provided to increase the density of the small arteries in the elongate muscles adjacent to the femoral artery removal. Thus, after acute blockade of blood supply, sustained release of PEDF synthetic peptides can provide arterial angiogenic activity to establish collateral circulation. Significantly increasing the lumen volume of these vessels through growth can promote perfusion of the damaged ischemic area; and such well-developed collateral circulation allows tissue or organs to recover from ischemic conditions.

Experimental Example 2.4

PEDF synthetic peptide can stimulate new blood vessel branches in complete tissue culture ( ex vivo )

To further confirm the development of new blood vessels promoted by the PEDF synthetic peptide, a rat aortic ring sprouting analysis was performed. The thoracic aortas (thoracic aortas) were removed from the euthanized rats and the fibroadipose tissue surrounding the aorta was gently stripped. The aorta was sectioned into a loop of approximately 2 mm in length, which was then embedded in a growth factor-reduced Matrigel. The colloid containing the aortic ring was placed in a 12-well well plate and incubated at 37 ° C for 30 minutes to polymerize the colloid. Add 1 ml of MCDB131 medium to Matrigel-containing culture medium containing 100 U/ml penicillin, 100 ng/ml streptomycin, 1% FBS, and different additives (50 ng/ml VEGF). -A, 20 ng/ml of FGF-2; or 50 ng/ml of 29-mer, 24-mer, 20-mer, Mo 29-mer, Mo 20-mer, 25-mer or 18-mer). The culture bodies were placed in a humidity-conditioned incubator for 4 days at 37 ° C, and fresh medium was replaced every 2 days. On the 4th day after the training, The situation of new blood vessel branches was observed using an inverted microscope platform (Leica) with bright-field optics; see Figure 6 for representative photographs. In addition, new blood vessel branches were quantified using the Image-Pro Plus 6.0 software (Dendrites program) and the results were expressed as multiples relative to the untreated aortic rings, as shown in Table 4. This experiment was repeated three times.

In the untreated control (UT), the medium was not added with any growth factors, and only a small amount of new blood vessel branching was observed on the fourth day. It can be noted that the addition of the control PEDF synthetic peptide (i.e., 25-mer and 18-mer) did not substantially promote new blood vessel branching compared to the untreated control group.

As expected, known angiogenic factors, including both VEGF and FGF2, substantially enhance neovascular branching. Samples treated with VEGF or FGF-2 The new blood vessel branches were about 3.4 times and about 3.5 times, respectively, of the untreated control group.

The data in Table 4 also shows that the PEDF synthetic peptides proposed here (including 29-mer, 24-mer, 20-mer, Mo 29-mer and Mo 20-mer) are more effective at stimulating new blood vessel branches than VEGF or FGF2. In addition, a double staining immunoassay was performed on these new blood vessels, and α-smooth muscle actin (a marker of small arterial wall smooth muscle cells (SMC)) and lectin B4 (IB4, a marker of endothelial cells) were labeled, respectively. Figure 7. As can be seen from Figure 7, samples treated with the PEDF synthetic peptide (29-mer or 20-mer) presented herein exhibited a phenotype of the arteriole with SMC coverage. In contrast, in the samples treated with the control PEDF 18-mer, it was almost difficult to observe the formation of the primary tubular tube and the proliferation of SMC. This result shows that the PEDF synthetic peptide according to the embodiment of the present invention is capable of stimulating neovascularization, and not only angiogenesis of microvessels containing only endothelial cells. In addition, the results of this experiment can also support the discussion of the PEDF synthetic peptide proposed here to stimulate arterial angiogenesis in vivo.

In summary, the results of Experimental Example 2 (including Experimental Examples 2.1 to 2.4) show that the PEDF synthetic peptide proposed here can effectively promote limb perfusion, reduce tissue necrosis and fibrosis, and promote arterial angiogenesis and new blood vessel branching. And thus administration of the above PEDF synthetic peptide (especially a sustained release formulation containing any of the PEDF synthetic peptides) can reduce ischemic injury and contribute to the recovery of the structure and function of the tissue or organ. When noted, previous studies have shown that human PEDF has a 34-mer fragment (PEDF 44-77) Residues have anti-angiogenic properties, and human PEDF has a 44-mer fragment (PEDF residues 78-121) with neurotrophic properties. However, the present invention demonstrates for the first time that a short PEDF fragment (containing at least the above 29-mer, 24-mer, 20-mer, Mo 29-mer and Mo 20-mer) has an arteriogenic-promoting activity.

Experimental example 3

Slow release of PEDF synthetic peptide can promote muscle regeneration

A single dose of bupivacaine was injected into the soleus muscle of the rat, causing myonecrosis in the rat, and this model was used to explore the effect of the PEDF synthetic peptide proposed herein on muscle regeneration. In this experiment, ten-week-old male Sprague-Dawley rats (average body weight of 312±11 g at the start of the experiment) were used, and the animals were intraperitoneally injected with zoletil (10 mg/kg body weight) for anesthesia. Remove the hair from the hind legs and buttocks with a depilatory cream. Thereafter, 0.5 ml of AstraZeneca was unilaterally injected into the soleus muscle of the animal using a disposable syringe and a 26-gauge needle. Briefly, the needle is inserted into the distal end of the soleus muscle, and then the needle is longitudinally retracted to the leading end while uniformly injecting the cardiocaine solution. During the slow withdrawal of the needle, the solution is injected over the full length of the muscle.

After the injection of dysproin, the rats were equally divided into four experimental groups (the number of samples per group was 10), and the following treatments were separately administered. In the blank control group, 50 μl of blank seaweed gum was administered to the mice. In the treatment group, given A 50 μl sustained release formulation of mice (containing 29-mer or 20-mer). The mice in the pill control group received a pill formulation (containing 29-mer). Immediately after the perfusion of the dysprosium, different treatments were applied to the soleus muscle of the animal by a single intramuscular injection.

On the 4th day after the injection of dysproin, histological analysis of the soleus muscle section showed that general muscle necrosis occurred in different groups. Muscle fiber disintegration and massive infiltration of inflammatory cells were observed in the soleus muscle sample (photograph) Not shown). Only a few muscle fibers in the surrounding area maintained a relatively normal structure; in the blank control group and the PEDF peptide-treated group, the degree of muscle fiber necrosis was similar. The above results show that dipyridamine causes the same degree of muscle fiber disintegration in different groups of original muscle fibers.

Experimental example 3.1

Slow release of PEDF synthetic peptide can promote cell proliferation

The process of muscle regeneration involves the proliferation of muscle fibers or muscle cells; in this experimental example, BrdU was introduced into the proliferating cell nucleus to observe the proliferation of muscle fibers. The proliferation of satellite cells is the key to muscle regeneration; therefore, staining is also performed on the target fish muscle, and muscle regeneration activity is explored by detecting the satellite cell marker Pax7. Detailed testing methods are described in the section "Materials and Methods". The number of BrdU-positive cells is indicated by a labeling index, which is the number of labeled cells divided by the total number of cells and expressed as a percentage (%). The labeling index (%) of Pax7-positive cells is the number of labeled cells divided by the total number of cells with nuclei. Muscle sections were taken from 10 mice in each experimental group, and each slice was taken Six parts were taken for quantitative analysis, and the results are summarized in Table 5.

As can be seen from Table 5, there were significantly more BrdU-positive cells in the wounds treated with the slow release formulation containing 29-mer or 20-mer (compared to mice treated with blank or pellet control). ). Regarding the proliferative activity of satellite cells, the data in Table 5 shows that the sustained release formulation proposed herein can result in a higher proportion of Pax7-positive cells compared to the blank and the pill control group. In summary, these data show that the sustained-release formulation proposed here can increase the proliferative activity of muscle fibers and/or satellite cells, which in turn promotes muscle regeneration.

Experimental Example 3.2

Slow release of PEDF synthetic peptide can promote muscle fiber regeneration

During the process of muscle regeneration, the nuclei of newly formed muscle fibers are usually located at the center. Therefore, the percentage of muscle fibers displaced by the center of the nucleus can also be used as an indicator of the regenerative activity of the muscle. On the 7th day after the injection of dyscaine, the number of fibers displaced at the center of the nucleus was statistically analyzed, and the results are summarized in Table 6.

As can be seen from Table 6, the proportion of muscle fibers containing centrally displaced nuclei was higher in animals treated with a slow release formulation containing 29-mer or 20-mer compared to the blank or bolus control group. These results show that the sustained release formulation proposed herein can effectively promote muscle regeneration.

In addition, on day 14 after the injection of dyscaine, new muscle cells were formed in the soleus muscle to replace the necrotic muscle fibers in all experimental groups. However, in animals treated with a blank or pellet control group, many of the core-displaced fibers were still visible in the regenerated muscle (Fig. 8), which means that muscle regeneration in these groups has not been completed. Conversely, in animals treated with a slow release formulation containing 29-mer or 20-mer, the core of the nucleus displaced within the muscle section was significantly less. In summary, these data show that the sustained release of PEDF synthetic peptide is beneficial to the regeneration of muscle fibers.

Experimental Example 3.3

Slow release of PEDF synthetic peptide can promote the maturation of regenerated muscle fibers

In the later stages of the muscle regeneration process, the newly formed muscle fibers will begin to change. Big. Muscle samples were taken on the 14th day after the injury and the fiber diameters were measured according to the procedure described in the section "Materials and Methods". The results are summarized in Figure 9.

On average, animals treated with a slow release formulation containing 29-mer or 20-mer had larger muscle fiber diameters than animals in the blank or pill control group. In addition, the size distribution of the muscles of the 20-mer treated animals is very close to the size distribution of the intact muscles. Specifically, about 56.6% of the muscle fibers treated with 20-mer had a minimum Feret diameter of 15-25 μm, while uninjured animals had about 53.2% of the muscle fibers falling within this range; Below, the blank and pill control groups had a minimum Feret diameter of about 10-20 μm in the pill control group of about 59.6% and about 56.2% regenerated fiber, respectively. These data show that the sustained release formulation proposed here can effectively increase the quality of regenerated muscle.

In summary, the data presented in Experimental Example 3 (including Experimental Examples 3.1 to 3.3) confirm that the PEDF synthetic peptide proposed here can effectively promote the proliferation of muscle fibers and satellite cells, the regeneration of muscle fibers, and the maturation of regenerated muscle fibers; Administration of the PEDF synthetic peptide (especially a sustained release formulation containing any of the PEDF synthetic peptides) can effectively promote the muscle regeneration process and contribute to the recovery of muscle tissue structure and function. The present invention pioneered the discovery that short PEDF fragments (containing at least 29-mer and 20-mer) are capable of promoting muscle regeneration.

Experimental example 4

Slow release of PEDF synthetic peptide can promote tendon regeneration

In this experimental example, a rat tendon injury model was used to investigate the effect of the PEDF synthetic peptide proposed herein on tendon regeneration. Ten-week-old adult male Sprague-Dawley rats (50 in total, starting at 312 ± 11 g) were injected intraperitoneally with an injection of 10 mg per kilogram of body weight for anesthesia. . Next, insert the 18-gauge needle through the full thickness of the Achilles's left leg, and cross-cut the Achilles tendon about 1 cm above the calcaneum to get the left. Animal model of the Kiris 腱 defect. In this way, the horizontal wound obtained on both sides has intact tendon tissue, which can prevent the contraction of the two fracture ends.

Rats were randomly assigned to five experimental groups (10 per group) and received the following treatments, respectively. The mice in the blank control group received 150 μl of blank seaweed gum. Pills in the control group were given 150 μl of the pellet formulation (29-mer). In the PEDF treatment group, mice received 150 μl of a sustained release formulation (containing 29-mer, 24-mer or 20-mer), respectively. Immediately after the injury, each treatment was injected subcutaneously into the adjacent tendon lesion, and the wound was washed with sterile physiological saline and sutured.

Experimental example 4.1

Slow release of PEDF synthetic peptide can promote tendon healing

At the 3rd week after the tendon injury, histological analysis was performed to observe the tendon recovery, and a representative photograph is shown in Fig. 10. Figure 10 above shows the recovery of the animals in the blank control group. It can be seen that between the two fracture ends, scar tissue composed of irregular fibers is formed, and the stained collagen in the scar tissue is formed. The protein bundle (pink) is very small. Compared Next, after treatment with a slow-release formulation containing 29-mer, there was less scar tissue in the healing tissue formed between the two fracture ends of the tendon (compared to the blank control sample), and there was a mature collagen bundle (pink) It extends to the tendon lesion; in addition, in some areas, the tendon fibers from the two fracture ends appear to be joined (photograph below in Figure 10). Furthermore, in the 29-mer treated group, the fibrous tissue in the scar appeared to be relatively regular and arranged in parallel.

Figure 11 is a photograph of histological analysis of higher magnification. As can be seen from the photograph, the normal tendon contains relatively few cells between the collagen fibers, and the nuclei are almost elongated. In the blank and the pill control group, after three weeks of recovery, more fibroblasts (fibroblasts, characterized by round or spindle-shaped fibroblast-like nuclei) were observed in the tendon, and new formation was observed. The collagen fiber structure is more irregular (the undestroyed tissue in the photo is marked with an asterisk (*)). These changes in morphology showed poor healing of tendon wounds in the blank and pill control groups.

In contrast, Figure 11 shows that in the tendon treated with the sustained release formulation proposed herein, a thin, elongated nuclei can be seen in the healing region, which is similar in morphology to the nuclei of mature tenocytes. The collagen fibers are regularly arranged in parallel with the native tendon (deep pink); the above pattern represents a better healing of the tendon wound. These results show that the sustained release formulation proposed here is beneficial for the healing of tendon wounds.

In addition, samples were stained with Manson's trichrome dye to evaluate the structure and arrangement of collagen fibers. Representative sample photographs are shown in Figure 12. In the uninjured tendon, the collagen fibers are substantially parallel to each other (Fig. 12 left). Conversely, in the blank control group, within the recovery area of the injured tendon Collagen fibers are arranged in an irregular pattern (in Figure 12; the edges of the wound are marked with an asterisk (*)). However, in the injured tendon treated with the sustained release formulation proposed herein, regular arrangement of collagen fibers was observed, and the direction was approximately the same as that of the uninjured tendon tissue outside the injured edge (Fig. 12 right; wound edge) Marked with an asterisk (*)). These highly regularly arranged collagen fibers mean that the animals treated with the sustained release formulation set forth herein have better tendon wound healing.

In addition, the percentage (%) of collagen in the regeneration area was evaluated by quantitative analysis, and the results are summarized in Table 7.

As can be seen from Table 7, the animals in the PEDF (29-mer, 24-mer or 20-mer) treated group had higher collagen content in the regeneration area (compared to the blank or the pill control group). These data show that administration of the sustained release formulation set forth herein promotes collagen biosynthesis in the wound area.

In addition, the first type of collagen in the sample was immunostained, and the nuclei were stained with hematoxylin. The representative sample photograph is shown in Fig. 13, wherein the lower graph is an enlarged view of the dotted line portion of the upper graph. It is conceivable that the collagen fibers in the uninjured tendon have a good cross-linking with each other, and Therefore, anti-collagen 1A1 antibodies may not easily recognize these collagen fibers. Therefore, in the photograph on the left of Fig. 13, only a very small amount of collagen type I (brown) was observed. By comparing the photos of the blank control group (Fig. 13) with the photos of the PEDF treatment group (Fig. 13 right), it can be found that the content of type I collagen (brown) in PEDF-treated animals is higher than that in the blank. Animals in the control group.

In conclusion, these results show that administration of a sustained-release formulation containing the PEDF synthetic peptide can stimulate the biosynthesis of type I collagen in cells in injured tendon tissue, and contribute to healing the deposition of collagen in damaged tissues, and It can promote the arrangement of collagen fibers more regularly, thus facilitating tendon regeneration.

Experimental example 4.2

PEDF synthetic peptide can induce proliferation of tendon stem cells in vitro

It is known that in the process of tendon healing, tendon stem cells (TSCs) are expanded and differentiated into tendon cells. To investigate whether the PEDF synthetic peptide proposed herein can induce tendon stem cells to proliferate in vitro, the steps described in the "Materials and Methods" section were used to isolate and culture tendon stem cells. The purity of the tendon stem cells (nearly 100%; data not shown) was confirmed by the use of tendon stem cell markers (nuclear stem cell factor) and tendon stem cells to express the characteristics of type 1 collagen. Cell proliferation was confirmed by pulse labeling with BrdU for 2 hours. The BrdU-positive cells were quantitatively analyzed by the method described above, and the results are summarized in Table 8.

These results show that the PEDF synthetic peptide (29-mer, 24-mer, 20-mer, Mo 29-mer or Mo 20-mer) is cultured in comparison with tendon stem cells cultured in the control medium. The proliferation activity of the tendon stem cells in the medium is preferred. In addition, it can also be noted that the Mo 29-mer and Mo 20-mer used herein are derived from the mouse PEDF peptide, and the sequence similarity between the two sequences and the 11-30 amino acid residues of the 39-mer. Not 100%; however, the effect of these two sequences on promoting mitosis is comparable to that of short PEDF synthetic peptides from human PEDF (eg, 29-mer, 24-mer, and 20-mer).

Experimental example 4.3

Sustained-release PEDF synthetic peptide promotes in vivo viability of tendon stem cells after injury to tendon

Samples were taken from each group of animals in Experimental Example 4.1, and the nuclear stem cell factor was stained (green) to investigate whether the sustained release formulation proposed herein can promote the tendon dryness in the process of tendon wound healing. Cell proliferation. For quantitative analysis, 10 microscopic fields were randomly selected from the samples of each experimental group and images were taken, and then calculated in all cells (contrast staining with Hoechst 33258; blue), nuclear stem cell factor-positive cells The percentages are summarized in Table 9.

These data show that there are more nuclear stem cell factor-positive tendon stem cells in animals treated with 29-mer, 24-mer or 20-mer (compared to animals in the blank and pill control groups). By comprehensively analyzing the experimental results of Experimental Examples 4.1 and 4.3, it was found that the phenomenon of promoting tendon stem cell expansion in vivo was promoted by administering the sustained-release formulation proposed herein, and the tendon recovery was better (compared to the natural recovery process). The phenomena can echo each other.

Experimental example 4.4

PEDF synthetic peptide can induce the production of tendon-like cells from mesenchymal stem cells

Recent studies have shown that mesenchymal stem cells (MSCs) can be used to regenerate functional tendons. In this experimental example, bone marrow mesenchymal stem cells were cultured in control medium or contained PEDF. The medium of 29-mer or 20-mer was used to explore the ability of the PEDF synthetic peptide proposed herein to promote differentiation of bone marrow mesenchymal stem cells into tendon cells. The TNMD gene is abundantly expressed in tendons and is considered to be one of the most reliable phenotypic markers of the tendon cell lineage. Therefore, in this experiment, the differentiation of tendon cells was evaluated by the amount of TNMD expression. Representative photographs of RT-PCR analysis are shown in Figure 14.

The analysis results show that the PEDF synthetic peptide (such as 29-mer or 20-mer) proposed herein can effectively induce cell differentiation of tendon-like cells in the mesenchymal stem cells cultured in vitro. Since the mobilization and differentiation of mesenchymal stem cells are one of the possible mechanisms of tendon repair in vivo, the above results suggest that the PEDF synthetic peptide proposed here can promote the differentiation of mesenchymal stem cells into tendon cells. Repair tendon damage. These results also show that the PEDF synthetic peptide proposed here has potential for use in a scaffold matrix culture composed of mesenchymal stem cells to promote the synthesis of artificial tendons.

In summary, the data shown in Experimental Example 4 (including Experimental Examples 4.1 to 4.4) show that the PEDF synthetic peptide proposed here can effectively promote the biosynthesis of regularly arranged collagen (especially type I collagen) fibers and Proliferation of tendon stem cells; and thus administration of the PEDF synthetic peptide proposed herein (in particular, a sustained release formulation containing any of the PEDF synthetic peptides) can promote tendon regeneration and facilitate structural and functional aspects of tendon tissue Recovery. The present invention is the first to demonstrate that short PEDF peptide fragments (at least 29-mer and 20-mer) can promote tendon regeneration and also promote differentiation of mesenchymal stem cells into tendon cells.

In summary, the results of the above examples demonstrate that the PEDF synthetic peptides proposed herein (eg, 29-mer, 24-mer, 20-mer, Mo 29-mer, and Mo 20-mer) can promote the deficiency. Arterial angiogenesis in or adjacent to the blood region can also promote muscle and tendon regeneration in or adjacent to the injured region. Thus, the PEDF synthetic peptide proposed herein can be used as a therapeutic agent for promoting muscle and tendon wound healing and reducing ischemic injury.

Although the embodiments of the present invention are disclosed in the above embodiments, the present invention is not intended to limit the invention, and the present invention may be practiced without departing from the spirit and scope of the invention. Various changes and modifications may be made thereto, and the scope of the invention is defined by the scope of the appended claims.

The above and other objects, features, advantages and embodiments of the present invention will become more apparent and understood.

Figure 1 is a line graph showing the cumulative release of PEDF synthetic peptide from PBS in vitro at 37 °C. Results are expressed as mean ± standard deviation of three independent test results.

Figure 2 shows the laser Doppler perfusion image (LDPI), showing the blood perfusion of the ischemic hind limbs within 4 weeks after surgery.

Figure 3 is a line drawing showing the mice treated with a separate algae gel (blank control), a 29-mer, 24-mer, 20-mer or 18-mer sustained release formulation and a 29-mer pellet formulation. The results of blood flow perfusion analysis of the hind limbs. Fruit expressed as the mean ± standard deviation of three independent test results; n 6. * P <0.05; compared to the blank control group.

Figure 4A is a representative photograph of the tibia muscle sample stained with Manson's trichrome dye (original magnification: ×40); and Fig. 4B is a photograph of the same sample at a higher magnification for more clear presentation The degree of muscle necrosis at 2 weeks and 7 weeks after surgery was induced by surgery (original magnification: ×200).

Figure 5 is a representative immunomicrograph of the arterioles in the adductor longus two weeks after ischemia. The small arteries are labeled with anti-α-SMA (brown) and the nuclei are labeled with hematoxylin.

Figure 6 is a representative photograph of aortic ring cultures after four days of culture in different media. The media used were: basic MCDB131 medium (untreated control, UT) and the addition of known angiogenic factors (FGF2 or VEGF), control PEDF synthetic peptide (25-mer or 18-mer) or PEDF synthetic peptide according to embodiments of the invention (29-mer, 24-mer, 20-mer, Mo 29-mer or Mo 20- Mer) medium.

Figure 7 is a representative double immunostained photograph of aortic ring cultures after four days of culture in different media to observe media supplemented with different PEDF synthetic peptides (29-mer, 20-mer or 18-mer). In the case where vascular smooth muscle cells (vSMCs) grow outward from the aortic annulus. In the photograph, the endothelial cell line was labeled with Alexa Fluor 594-labeled lectin B4 (IB4; red, left), while vSMCs were labeled with anti-α-SMA (green; middle). The right side is the merged pattern (yellow). The nuclei were stained with Hoechst 33258. Original magnification: ×400. The photographs shown are representative photographs of four independent experiments.

Figure 8 is a representative H&E staining of the soleus muscle on day 14 after the injection of dariccaine.

Figure 9 is a line graph showing the distribution of muscle fiber diameters of muscles under different experimental conditions.

Fig. 10 is a representative photograph of the regenerated tissue (↑) inside the tendon 3 weeks after the injury. Original magnification: ×100.

Figure 11 is a representative H&E staining of the Achillis tendon 3 weeks after injury. Original magnification: ×400; scale bar: 50 μM. The photographs shown are representative photographs of three independent experiments.

Figure 12 is a representative photograph of a tissue section of collagen fibers stained with Manson's trichrome dye 3 weeks after injury. The asterisk (*) represents the uninjured area of the tendon. Original magnification: ×400; scale bar: 50 μM. The photographs shown are representative photographs of three independent experiments.

Figure 13 is a representative immunostained photograph of type I collagen (brown) 3 weeks after injury. The nucleus is labeled with hematoxylin. The area of the square is displayed at a higher magnification below. Scale bar: 50 μM. The photographs shown are representative photographs of three independent experiments.

Figure 14 is a representative electrophoresis photograph showing an example of an experimental example of the present invention showing that the PEDF synthetic peptide (29-mer and 20-mer) proposed herein can promote the expression of the hedgehog protein (TNMD) gene. The expression of the taumumodulin (TNMD) gene showed that BM-MSCs differentiated into tendon cells. The photographs shown are representative photographs of three independent experiments.

<110> Taiwan Christ Presbyterian Church Stables Social Welfare Foundation Stables Hospital <120> Use of pigment epithelium-derived factor-derived peptides to promote muscle or tendon regeneration or arterial angiogenesis <130> P2717-US <160> 14 <210> 1 <211> 39 <212> PRT <213> Artificial sequence <220><223> Synthetic peptide <400> 1 <210> 2 <211> 34 <212> PRT <213> Artificial sequence <220><223> Synthetic peptide <400> 2 <210> 3 <211> 29 <212> PRT <213> Artificial sequence <220><223> Synthetic peptide <400> 3 <210> 4 <211> 25 <212> PRT <213> Artificial sequence <220><223> Synthetic peptide <400> 4 <210> 5 <211> 24 <212> PRT <213> Artificial sequence <220><223> Synthetic peptide <400> 5 <210> 6 <211> 20 <212> PRT <213> Artificial sequence <220><223> Synthetic peptide <400> 6 <210> 7 <211> 18 <212> PRT <213> Artificial sequence <220><223> Synthetic peptide <400> 7 <210> 8 <211> 29 <212> PRT <213> Artificial sequence <220><223> Synthetic peptide <400> 8 <210> 9 <211> 20 <212> PRT <213> Artificial sequence <220><223> Synthetic peptide <400> 9 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220><223> Primer <400> 10 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <220><223> Primer <400> 11 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <220><223> Primer <400> 12 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <220><223> Primer <400> 13 <210> 14 <211> 418 <212> PRT <213> Homo sapiens <400> 14

Claims (10)

A synthetic peptide for promoting muscle regeneration, tendon regeneration or vascular arterial formation in a body, which is composed of an amino acid sequence of 20-39 amino acid residues in length, wherein the amino acid sequence And sequence number: 1 has at least 80% amino acid sequence similarity, and the amino acid sequence comprises at least 20 contiguous amino acid residues, which are the 11th to 30th amino acid residues of SEQ ID NO: 1. The group has at least 90% amino acid sequence similarity. The synthetic peptide of claim 1, wherein the synthetic peptide has at least four consecutive amino acid residues identical to the 11-14 amino acid residues of SEQ ID NO: 1. The synthetic peptide according to claim 2, wherein the amino acid sequence of the synthetic peptide is SEQ ID NO: 1 (39-mer), SEQ ID NO: 2 (34-mer), SEQ ID NO: 3 (29- Mer), SEQ ID NO: 5 (24-mer), SEQ ID NO: 6 (20-mer), SEQ ID NO: 8 (MO 29-mer) or SEQ ID NO: 9 (MO 20-mer) sequence. A pharmaceutical composition for promoting muscle regeneration, tendon regeneration or vascular arteriogenesis in a body comprising: an effective amount of the synthetic peptide as claimed in claim 1; and a pharmaceutically acceptable carrier. The pharmaceutical composition according to claim 4, wherein the pharmaceutically acceptable carrier is a polymer material selected from the group consisting of alginate, gelatin, collagen and polylactic acid/glycolic acid copolymer. . The pharmaceutical composition according to claim 5, wherein the polymer material is alginate. The pharmaceutical composition according to claim 4, wherein the synthetic peptide is present in an amount of from 1 to 100 μM. The pharmaceutical composition according to claim 7, wherein the synthetic peptide is contained in an amount of 10 μM. The pharmaceutical composition according to claim 4, wherein the synthetic peptide has at least four consecutive amino acid residues identical to the 11-14 amino acid residues of SEQ ID NO: 1. The pharmaceutical composition according to claim 10, wherein the amino acid sequence of the synthetic peptide is SEQ ID NO: 1 (39-mer), SEQ ID NO: 2 (34-mer), SEQ ID NO: 3 (29- Mer), SEQ ID NO: 5 (24-mer), SEQ ID NO: 6 (20-mer), SEQ ID NO: 8 (MO 29-mer) or SEQ ID NO: 9 (MO 20-mer) sequence.