TW201321753A - Method for detecting flaviviridae virus infection - Google Patents

Abstract

A method for detecting Flaviviridae virus infection in the present invention includes the steps of providing a biological sample containing a complex including at least two proteins, nonstructural protein 1 and thrombin or nonstructural protein 1 and prothrombin, providing a capture antibody to bind to one of the two proteins, providing a detection antibody to bind to the other of the two proteins and determining infection by reaction result of the capture antibody while both of the antibodies bind to the complex. The present invention also provides another method for detecting Flaviviridae virus infection.

Description

Method for detecting virus infection of Flaviviridae

The invention relates to a method for detecting a virus infection, in particular to a method for detecting a virus infection of a Flaviviridae.

In our country, members of the Flavividae family have always been the subject of concern by experts. Because of these members, encephalitis, encephalomyelitis, dengue fever and other systemic infections can affect public health.

Dengue virus (Dengue virus, referred to as of DENV) belonging to the Flaviviridae family (family Flaviviridae), flaviviruses (Flavivirus) a virus, according to their antigenic properties and can be divided into four serotypes of DENV-1, DENV-2 , DENV-3 and DENV-4.

Dengue virus infection may cause symptoms such as Dengue hemorrhage fever/dengue shock syndrome (DHF/DSS) or Dengue fever (DF). Clinical signs of dengue hemorrhagic fever/shock syndrome include fluid loss, increased hematocrit, thrombocytopenia, and hypovolemic shock. Although the pathogenesis of dengue hemorrhagic fever/shock syndrome has not been well documented, there is now much evidence that hemorrhage in this DHF patient is associated with factors such as thrombocytopenia, loss of the coagulation system, and endothelial systemic disease.

The dengue virus contains about 1,100 base pairs. According to its coding, there are mainly three structural proteins, capsid protein C, membrane protein M, and envelope protein E. And 7 other nonstructural proteins (NS): NS1, NS2a, NS2b, NS3, NS4a, NS4b and NS5. According to the current research, NS1 is not only an important protein in the transfection of dengue virus infection, but also closely related to symptoms caused by dengue fever such as DHF.

NS1 is a glycosylated protein of 46 to 50 kDa. Since the infected NS1 protein can be found in infected mammals, it is detected whether the patient is infected with dengue virus. Detection of the presence of NS1 protein in patients is a fairly effective target.

Currently, dengue virus infection detection techniques or kits are commercially available using an NS1 specific antibody (anti-NS1 antibody) and detected by immunological means. However, in the prior art, whether the virus is isolated from the patient or the reverse transcription-polymerase chain reaction is used to determine the type of the infected virus, it is extremely time consuming, costly, and highly dependent on the laboratory equipment. The means of detection that can be carried out are quite narrow in scope.

In addition, the above detection methods must also be operated in a rigorous environment to avoid a slight inadvertent contamination and affect the diagnosis. More importantly, there is a lack of sensitivity in the innate NS1 alone. For patients with early infection or mild infection, most of them cannot provide high-accuracy test results, which often cause misdiagnosis or delay during the better treatment period. And other serious consequences.

Therefore, how to provide a high-sensitivity and high-accuracy detection method for the infection of the Flavivirida virus including dengue virus has become one of the important topics in the field of medical and public health.

In view of the above problems, the object of the present invention is to provide a detection method for high sensitivity, high accuracy and rapid detection of Flaviviridae virus, in particular, a detection method for dengue virus.

Non-structural protein 1 (NS1) protein is ubiquitous in organisms or cells infected with Flaviviridae virus, and it is exemplified by the experiments of the present invention that NS1 has a very high proportion with blood coagulation factors such as thrombin (thrombin). ) or prothrombin binding, it is considered that NS1 and thrombin, or the binding of NS1 to prothrombin as a target for detecting a Flaviviridae virus infection in a patient is an effective means. Thus, the present invention provides a method for detecting a Flaviviridae virus infection by the combination of NS1 with thrombin or prothrombin.

To achieve the above object, the present invention provides a method for detecting a Flaviviridae virus infection, comprising providing a biological sample comprising a complex comprising at least a non-structural protein 1 and a thrombin diprotein, or a non-structural protein 1 with a prothrombin two protein; providing a capture antibody that binds to one of the two proteins; providing a detection antibody that binds to the two proteins; and when the antibody is captured and detected After the antibody binds to the complex, the result is judged by the reaction of the detection antibody.

The present invention further provides a method for detecting a Flaviviridae virus infection, comprising providing a biological sample containing a non-structural protein 1; providing a thrombin or a prothrombin to form at least a non-structural protein 1 and coagulation An enzyme diprotein, or a complex of non-structural protein 1 and prothrombin diprotein; providing a capture antibody that binds to one of the two proteins; providing a detection antibody that binds to the two proteins; After the capture antibody and the detection antibody are combined with the complex, the result is judged by the reaction of the detection antibody.

In an embodiment of the invention, non-structural protein 1 and thrombin or non-structural protein 1 and prothrombin are intermingled.

In an embodiment of the invention, the biological sample is taken from a mammal.

In an embodiment of the invention, the biological sample is taken from a human.

In an embodiment of the invention, the non-structural protein 1 is a secreted protein or a membrane-linked protein.

In the embodiment of the present invention, the capture anti-system is a monoclonal antibody or a plurality of antibodies.

In the embodiment of the present invention, the detection anti-system is a single antibody or a plurality of antibodies.

In the present invention, the so-called "flavivirus" is mainly a virus capable of expressing non-structural protein 1 (NS1); preferably, a virus belonging to the genus Flavivirus and pesticis Further preferably, it is a virus of the genus Flavivirus, such as Yellow fever virus or Dengue virus (DENV). In one embodiment, the Flaviviridae virus is a dengue virus and includes various serotypes such as DENV-1, DENV-2, DENV-3, and DENV-4.

In the present invention, the term "biological" of a biological sample mainly includes an animal host which can be infected by a Flaviviridae virus, and preferably includes a mammal such as a human, a monkey, a mouse, a cow, a sheep, a dog, a cat, or Pigs, etc. In one embodiment, the organism refers to a human.

In the present invention, the so-called "biological sample" may have any form, mainly the range of the Flaviviridae virus in the individual, including blood, plasma, urine, or lymph, or blood, plasma. , urine, or nearby tissues or cells through which lymph fluid flows. Preferably, the biological sample contains cells which can be infected by the Flaviviridae virus, and the species comprises at least nerve cells, muscle cells, liver cells, endothelial cells, blood cells, or lymphocytes; preferably, the biological sample contains the mammalian endothelium. Cells or blood cells. The biological sample can be fresh, tissue cultured, or refrigerated or frozen. Furthermore, the biological sample may further increase the concentration or ratio of NS1 and thrombin or NS1 and prothrombin protein by purification, centrifugation, extraction, or concentration.

In summary, the method for detecting a Flaviviridae virus infection provided by the present invention can effectively detect whether it is infected with a flavivirus by combining a biological sample with a complex of NS1 and thrombin or prothrombin. In addition to the viral infection, it is more important that the detection method of the present invention provides higher sensitivity and accuracy than the conventional technique of using NS1 alone as a detection target.

Hereinafter, a method for detecting a Flaviviridae virus with high sensitivity and high accuracy according to the present invention will be described with reference to the related drawings.

The method for detecting a Flaviviridae virus infection method provided by the present invention is shown in FIG. 1 and includes providing a biological sample containing a complex comprising at least nonstructural protein 1 and blood coagulation. a thrombin diprotein, or a non-structural protein 1 and a prothrombin diprotein (step S11); providing a capture antibody that binds to one of the two proteins (step S12); providing a detection antibody, The system binds to the other of the two proteins (step S13); and when the capture antibody and the detection antibody bind to the complex, the result is judged by the reaction of the detection antibody (step S14).

In step S11 of the present embodiment, a biological sample is first obtained from an individual suspected of being infected by a Flaviviridae virus. If the individual is indeed infected, the biological sample contains a complex containing at least two proteins. It can be NS1 and thrombin, or NS1 and prothrombin. In this embodiment, the two proteins in the complex are intermingled with each other, that is, the structures of the two have a structure that can cooperate or covalently bond. In other embodiments, the two proteins may also be indirectly bound by other molecules. Of course, the complex may include both NS1 and thrombin, as well as NS1 and prothrombin, and regardless of the number of NS1, thrombin, or prothrombin, the binding relationship may be one NS1 and two thrombin or Prothrombin binding, or two or more NS1 and one thrombin or prothrombin are intermingled with each other, and the present invention is not limited thereto.

In this embodiment, the biological sample is human serum and has multiple complexes at the same time, some of which contain NS1 and thrombin, and some of which contain NS1 and prothrombin. In addition, it should be particularly noted that NS1 is not limited to a form, and may be a secreted protein secreted to the outside of the cell or a membrane-associated protein bound to the surface of the host cell, and NS1 may be The present invention is not limited thereto, without a post-translational modification or a post-translational modification such as glycosyation or phosphorylation.

Next, the detection method of the present embodiment provides a capture antibody (step S12 of FIG. 1) and a detection antibody (step S13 of FIG. 1), respectively, with the two proteins in the above complex. One combination, that is, when the complex contains NS1 and thrombin, the capture antibody binds to one of NS1 or thrombin, and the detection antibody binds to another protein. The same is true for the complex containing NS1 and prothrombin.

The capture antibody and the detection antibody may be a single antibody or a plurality of antibodies, and in the experimental example of the present invention, a plurality of antibodies are used. For ease of detection, the capture antibody is preferably immobilized on a solid substrate, such as nylon, polystyrene, polyvinyl chloride, or nitrocellulose, polyvinylidene fluoride. A substrate made of a material such as polyvinylidene fluoride (PVDF), and the substrate may have various forms such as a perforated disk, a column, or a test paper. However, the complex of the capture antibody and the biological sample can also be bound in a suspension, and the separation of the capture antibody that binds to the complex and the capture antibody that is not bound to the complex, and the convenience of the user operation are considered. As a basis for selection, the invention is not limited thereto.

In this embodiment, the biological sample is preferably first contacted with the capture antibody, and then added to the detection antibody for action. Specifically, in the present embodiment, the capture antibody is an anti-NS1 antibody, and the detection antibody is an antithrombin or anti-prothrombin antibody. When the biological sample is added to the substrate immobilized with the capture antibody, the capture antibody is first NS1 is specifically bound and then added to the detection antibody to bind to thrombin or prothrombin. Of course, the capture antibody of the present invention may also be an antithrombin or anti-prothrombin antibody, and the capture anti-system is an anti-NS1 antibody, or when operating in a suspension, the three may be simultaneously bound.

For subsequent detection and analysis, the detection antibody preferably further incorporates a substance having a cue function, for example, a conjugate, such as an enzyme that reacts with the substrate to produce fluorescent or luminescent light. Such as firefly luciferase, bacterial luminescent enzyme, alkaline phosphatase, catalase, horseradish peroxidase (HRP), β-galactosidase, uric acid enzyme, or lactoperoxidase, Or fluorescent dyes and labels such as FITC (fluorescein isothiocynate), 5-carboxyfluorescein, 6-carboxyfluorescein, anthocyanin, or phycoerythrin ( Phycoerythrin), or rhodamine, or a radioisotope for radiation detection such as H ³ , C ¹¹ , C ¹⁴ , P ³² , S ³⁵ , I ¹²³ , I ¹²⁴ , I ¹²⁵ , I ¹³¹ , Tc ¹¹¹ , or Lu ^177, etc., or a combination of captured molecules such as biotin or the like can be utilized; in the experimental example of the present invention, HRP is used as a conjugate of the detection antibody. The related art regarding the bonding of the conjugate to the antibody and the reaction luminescence is understood by those skilled in the art and will not be described again. However, the detection antibody may also have no conjugate, but by providing another antibody, which can specifically bind to the detection antibody of the present invention, and the antibody also has a conjugate as a signal provider, when the present invention After the detection antibody is conjugated to the complex, the antibody is bound to the detection antibody for analysis, and the present invention is not limited thereto.

In step S14, when the capture antibody and the detection antibody are combined with the complex, the detection result can be judged by the reaction of the detection antibody. In detail, since only the capture antibody is immobilized on the substrate, and the detection anti-system permeation complex binds to the capture antibody, if the biological sample does not contain the detection target, it has NS1 and thrombin, or NS1 and prothrombin. The composite, after the removal step, there will be no signal to be detected. Therefore, whether or not the NS1 protein of the Flaviviridae virus is present in the biological sample and the content thereof can be discriminated by the presence or absence of the signal or the strength thereof to confirm whether the individual is infected with the Flaviviridae virus.

The above inventive principle can be applied to an enzyme-linked immunosorbent assay (ELISA) or a dot blotting method, preferably a sandwich enzyme immunosorbent assay (sandwich ELISA).

In addition, the present invention also provides another method for detecting a Flaviviridae virus infection, as shown in FIG. 2, the steps comprising: providing a biological sample containing non-structural protein 1 (step S21); providing a thrombin Or a prothrombin to form a complex comprising at least a non-structural protein 1 and a thrombin diprotein, or a non-structural protein 1 and a prothrombin diprotein (step S22); providing a capture antibody, which binds One of the two proteins (step S23); providing a detection antibody that binds to the other of the two proteins (step S24); and, after the capture antibody and the detection antibody bind to the complex, the result of the reaction by detecting the antibody (step S25).

The detection method is substantially the same as the foregoing detection method. For detailed description, reference may be made to the foregoing, but different from the foregoing method, in the step S21, the biological sample system comprises the NS1 protein, and the NS1 protein may be combined with thrombin or prothrombin. Protein, or an independent protein that has not yet been combined with thrombin or prothrombin. Next, in step S22, a relatively excessive amount of thrombin or prothrombin is provided to form a complex of NS1 with thrombin or prothrombin as a detection target. In this way, the NS1 protein of thrombin or prothrombin which is not in contact with the body in the biological sample can be effectively detected, or the ability of the original complex to be detected can be enhanced. In addition, the provided thrombin or prothrombin may be isolated or purified from the organism, or may be a functional protein synthesized by artificial synthesis, and such technical methods are generally known in the art. Can understand.

Hereinafter, the present invention provides a plurality of experimental examples represented by dengue viruses, and describes a method for detecting a Flaviviridae virus infection of the present invention, and proves that the detection method of the present invention can effectively improve the sensitivity and accuracy of detection. .

Experimental Example 1: The NS1 protein of dengue virus can bind to thrombin or prothrombin

Preparation of recombinant NS1 protein (recombinant NS1, rNS1) for the second serotype of dengue virus (PL046 virus strain), with a forward primer: CACATGGTGTCACTAGTATTGGTGGG and reverse primer: CTCGAGTCCGGCTGTGACCAAGGA amplified the full length of NS1 DNA The (full-length) sequence was ligated into the pET-43.1a (+) vector (Novagen, Madison, WI) to construct a recombinant plastid. This recombinant plasmid was transformed into E. coli (Rosetta strain) at a concentration of 1 mM of isopropyl-β-D-thiogalactopyranoside (isopropyl β-D-1-thiogalactopyranoside, Under induction of IPTG, E. coli was expressed as a (His) ₆ tag-rNS1 fusion protein. Next, purification was carried out by agarose gel (sepharose, GE Healthcare, Sweden, chelated with cobalt chloride at a concentration of 500 mM). Finally, the rNS1 protein concentration was quantified by the BCA (bicinchoninic acid) method (Thermo Scientific, Rockford, IL). Other process details of the above methods are understood by those skilled in the art and will not be described again.

ELISA for the binding of rNS1 to thrombin or prothrombin

Contains bovine thrombin (2 NIH units/ml), human prothrombin (2 μg/ml) (Haematologic Technologies, VT, USA), or controls histone alpha-casein (α-casein, 10 μg) /ml, sigma-Aldrich, CA, USA) Carbonate/bicarbonate coating buffer (0.5 M, pH 9.6) 50 μl of coating, respectively, to 96-well ELISA plate (GeneDireX) , Las Vegas, NV), placed overnight at a temperature of 4 ° C. Blocked with phosphate buffer saline (PBS) containing 1% bovine serum albumin (BSA). After the purification of the NS1 protein using ^{ImmunoProb TM Biotinylation Kit (Sigma-Aldrich} , CA, USA) joined biotin (Biotin), taking various concentrations NS1 engagement - biotinylated recombinant protein (biotinylated rNS1) was added to a cavity in at a temperature of 37 After 1 hour of action in a °C environment, a 200-fold dilution of streptavidin-horse peroxidase (steptavidin-HRP, R&D Systems, Minneapolis, MN) was added. Finally, the color was developed by 3,3',5,5'-tetramethylbenzedine (TMB) for 10 minutes, and the color reaction was terminated with a concentration of 2N sulfuric acid. The absorbance at 450 nm (OD ₄₅₀ ) was determined.

The results are shown in Figure 3. Compared to α-casein, the addition of thrombin and prothrombin pores, a higher OD ₄₅₀ value can be measured, indicating that thrombin and prothrombin can bind to rNS1, and The concentration of rNS1 is increased, and the more thrombin and prothrombin are combined. Therefore, it was confirmed that rNS1 can bind to thrombin and prothrombin to form a complex.

Experimental Example 2: Sensitivity Test of Detection Method of Flaviviridae Virus Infection by the Detection Method of the Invention Test serum

The sera of 80 patients infected with dengue virus were obtained, of which 32 patients were infected with DENV-2 and 48 patients were infected with DENV-3. Separately, 22 sera of hepatitis C (HCV) patients and 12 healthy individuals were obtained as a control group.

Comparison of unbound NS1 and NS1-thrombin complexes

Each of the bovine thrombin containing 2 NIH units/ml or the carbonate of the control group α-casein (α-casein, 10 μg/ml, sigma-Aldrich, CA, USA) 55 μl of carbonate/bicarbonate coating buffer (0.5 M, pH 9.6), respectively, added to a 96-well ELISA plate (GeneDireX, Las Vegas, NV) and placed at a temperature of 4 ° C until overnight. . The wells were blocked with gelatin in PBS at a concentration of 0.25% at 37 ° C. After 1 hour of reaction, the plates were washed 3 times with PBST.

Further, the NS1-thrombin complex in the serum of the patient is individually detected by the detection method of the present invention. The 96-well EKISA disk was first covered with a rabbit anti-thrombin polyclonal antibody (GeneTex, 2 μg/ml, San Antonio, TX) as a capture antibody. Next, the serum used above is added to carry out the reaction. Mouse anti-NS1 serum (1000 times diluted) was added, and after washing, horseradish peroxidase-conjugated goat anti-mouse IgG antibody (HRP-conjugated goat anti mouse IgG antibody) was added as a detection antibody. 5000 times, Zymed, San Francisco, CA), and coloring and interpretation as in Experimental Example 1.

The serum of the dengue patients and the control group were diluted 10 times with PBST, added to the wells, and allowed to stand at a temperature of 37 ° C for 1 hour. Subsequently, a rabbit anti-NS1 polyclonal antibody (diluted 1000-fold, GeneTex, San Antonio, TX) was added, and then allowed to act at 37 ° C for 1 hour. Thereafter, a horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (diluted 5000-fold, Zymed, San Francisco, CA) was added for the reaction. After the reaction, the cells were washed, and then 50 μl of 3,3',5,5'-tetramethylbenzedine (TMB) was added for color development, and the absorbance value instrument VersaMax microplate reader (Molecular Devices, Crawley, West Sussex, UK) ) Interpret the OD ₄₅₀ value.

The test results were counted, and the values measured by the serum of healthy individuals were averaged ± 2 SD (standard deviation) as a threshold. Figure 4A is a statistical table showing the detection data of the NS1-thrombin complex and the unbound state of NS1 in the serum of the patient. As shown in Fig. 4A, about 30% of dengue patients can be tested for NS1 protein with unbound state, but with the method of the present invention, 78.8% of dengue patients can have serum NS1-clotting. The enzyme complex, in addition, only less than 18% of the patient's serum could not detect the unbound NS1 protein and the NS1-thrombin complex.

Comparison of test results of the detection method and commercialized set of the invention

Another 59 patients sera of dengue to commercial kit ^{Platelia TM Dengue NS1 Ag ELISA (Biorad} Laboratories, Marnes-La-Coquette, France) in serum of NS1 detected. This kit was tested by sandwich ELISA using a single antibody to capture NS1. The detection method of the present invention is as described above.

At the same time, the infection detection and statistical results of the detection method and the commercialized kit of the present invention are shown in the statistical table of FIG. 4B. Among them, the criterion is that the value measured by the serum of a healthy individual is ± 2 SD (standard deviation). The results showed that in the serum of these 59 patients, the NS1-thrombin complex was detected in about 80% of the serum of dengue patients by the method of the present invention; the control commercial kit was only about 42% detected. The presence of NS1 protein in the serum of dengue patients shows that the detection method of the present invention has better sensitivity and accuracy than the prior art. *** in each figure indicates P <0.001; ** indicates P <0.01; * indicates P < 0.05.

In summary, the method for detecting a Flaviviridae virus infection provided by the present invention can effectively detect whether it is infected with a flavivirus by combining a biological sample with a complex of NS1 and thrombin or prothrombin. In addition to the viral infection, it is more important that the detection method of the present invention provides higher sensitivity and accuracy than the conventional technique of using NS1 alone as a detection target.

The above is intended to be illustrative only and not limiting. Any equivalent modifications or alterations to the spirit and scope of the invention are intended to be included in the scope of the appended claims.

S11~S14, S21~S25. . . step

1 is a flow chart of a method for detecting a Flaviviridae virus of the present invention;

2 is a flow chart of another method for detecting a Flaviviridae virus of the present invention;

Figure 3 is a graph showing the binding of rNS1 to thrombin or prothrombin in an experimental example of the present invention;

Figure 4A is a statistical table for detecting NS1-thrombin complex in serum and detecting unbound state NS1 by the detection method of the present invention;

Ag ELISA detection statistics dengue patient serum-detection method of the present invention and a commercial kit Platelia ^TM Dengue NS1 Figure 4B.

S11~S14. . . step

Claims (20)

A method for detecting a Flaviviridae virus infection, comprising: providing a biological sample comprising a complex comprising at least a non-structural protein 1 and a thrombin diprotein, or a non-structural protein 1 and prothrombin II a protein; providing a capture antibody that binds to one of the two proteins; providing a detection antibody that binds to the other of the two proteins; and, when the capture antibody and the detection antibody are combined with the complex, The result of the reaction of the detection antibody is judged. The method of detecting according to claim 1, wherein the non-structural protein 1 and the thrombin or the non-structural protein 1 and the prothrombin are intermingled with each other. The detection method according to the first aspect of the patent application, wherein the Flaviviridae virus is a Flavivirus genus. The method of detecting the invention according to claim 1, wherein the Flaviviridae virus is a dengue virus. The method of detecting according to claim 1, wherein the biological sample is taken from a mammal. The method of detecting according to claim 1, wherein the biological sample is taken from a human. The method of detecting according to claim 1, wherein the non-structural protein 1 is a secreted protein or a membrane-linked protein. The detection method according to claim 1, wherein the capture antibody system is a monoclonal antibody or a plurality of antibodies. The method of claim 1, wherein the detection system is a monoclonal antibody or a plurality of antibodies. The method of detecting according to claim 1, wherein the biological sample comprises blood, urine, or lymph. A method for detecting a Flaviviridae virus infection, comprising: providing a biological sample containing a non-structural protein 1; providing a thrombin or a prothrombin to form at least one of the non-structural protein 1 and the thrombin a protein, or a complex of the non-structural protein 1 and the prothrombin two protein; providing a capture antibody that binds to one of the two proteins; providing a detection antibody that binds to the other of the two proteins; When the capture antibody and the detection antibody are bound to the complex, the result is judged by the reaction of the detection antibody. The method of detecting according to claim 11, wherein the non-structural protein 1 and the thrombin or the non-structural protein 1 are intermingled with the prothrombin. The method of detecting the invention according to claim 11, wherein the Flaviviridae virus is a Flavivirus genus. The method of detecting the invention according to claim 11 is that the Flaviviridae virus is a dengue virus. The method of detecting according to claim 11, wherein the biological sample is taken from a mammal. The method of detecting according to claim 11, wherein the biological sample is taken from a human. The method of detecting according to claim 11, wherein the non-structural protein 1 is a secreted protein or a membrane-linked protein. The detection method according to claim 11, wherein the capture antibody system is a monoclonal antibody or a plurality of antibodies. The method of detecting according to claim 11, wherein the detection system is a monoclonal antibody or a plurality of antibodies. The method of detecting according to claim 11, wherein the biological sample comprises blood, urine, or lymph.