TW201239091A - Sandpaper mutants of Bacillus and methods of their use to enhance plant growth, promote plant health and control diseases and pests - Google Patents

Abstract

The present invention relates to novel strains of Bacillus and methods of their use for enhancing the growth, promoting plant health or controlling diseases or pests of a plant.

Description

201239091 VI. Description of the Invention [Technical Fields of the Invention] The present invention relates to the field of bacterial mutant strains and their ability to enhance plant growth, promote plant health, and control plant diseases and pests. [Prior Art]

Bacillus contains a variety of bacteria that form endospores, which have numerous uses in the fields of agriculture and animal nutrition (and other fields). Several strains of bacilli are currently marketed for use as plant growth promoters and/or as biological control agents for insect pests and diseases (see, for example, Masaaki Morikawa, Beneficial Biofilm Formation by Industrial Bacteria Bacillus subtilis and Related Species," Journal of Bioscience and Bioengineering (2006) 1 0 1 ( 1 ): 1 -8,

Kloepper, et al., “Induced Systemic Resistance and

Promotion of Plant Growth by Bacillus spp., ”

Phytopathology (2 004) 94( 1 1 ): 1 2 5 9 - 1 266). These organic and environmentally friendly alternatives have been widely accepted by the agricultural and horticultural industries as they are effective as plant growth promoters and as biopesticides. Bacillus subtilis is a Gram-positive soil bacterium commonly found in the rhizosphere of plants. Bacillus subtilis is similar to many bacterial species and can exhibit two different growth patterns, namely a free-floating planktonic growth pattern and a biofilm model of fixation, in which the aggregated cells secrete extracellular matrices to attach to each other and/or Attached to the surface (Branda, et al., Fruiting Body Formation by Bacillus subtilis," P ro c. 201239091

Natl. Acad. Sci. USA (200 1 ) 98:11621-11626; Hamon and Lazazzera, “The Sporulation Transcription Factor SpoOA is Required for Biofilm Development in Bacillus subtilis,” Mol. Microbiol. (2001) 52:847-860 ◊ The pathways used by bacteria such as Bacillus subtilis to establish biofilms are extremely diverse, and vary widely among different strains and under different environmental conditions (Bais, et al., Biocontrol of Bacillus subtilis Against Infection of ArabidopsisRoots by Pseudomonas syringae is Facilitated by Biofilm Formation and Surfactin Production," Plant Physiol. (2004) 134:307-3 19; Lemon et al., "Biofilm Development with an Emphasis on

Bacillus subtilis, ” (2008) Current Topics in

Microbiology and Immunology (2008) 322:1 - 1 6)» However, it has recently been discovered that biofilms formed by specific strains of Bacillus subtilis and related strains may help control infections caused by plant pathogens (Morikawa (2006), Ibid.) The morphology and chemical composition of biofilms vary with strains and strains. The form of viscous colonies occurring in wild-type Bacillus subtilis strains and the production of polyglutamic acid have been found to be associated with enhanced biofilm formation, whereas the flat-dried colony morphology that occurs in cultured (or laboratory) strains has been Found to be associated with reduced biofilm formation. See Stanley, N. and Lazazzera, B. “Defining the Genetic Differences Between Wild and Domestic Strains of Bacillus subtilis that Affect Poly-D-DL-Glutamic Acid Production and Biofilm Formation, 201239091

Molecular Microbiology (2005) 5 7(4): 1 1 43 - 1 1 5 8 of 1M5

page. The literature of Branda (ibid., 2001) describes the lack of non-viscous colony morphology of biofilms, such as flat, small, dry colonies that grow to the side and eventually fuse with each other, resulting in a lack of aerial structures. Small colonies. However, the Stanley literature describes a Bacillus subtilis hybrid with a loss-of-function mutation at the swrA locus, which forms a flat, dry colony and exhibits enhanced biofilm formation. (The combination of the hybrid strain culture strain and the DNA derived from the wild strain responsible for the morphology of the cohesive colony.) Applicants have found that the wild type Bacillus strain having reduced or lost functional mutation at the swrA locus produces flat, dry colonies, The colony forms a strong biofilm, and the prepared fermented product composed of the cells enhances plant health, resulting in stronger root colonization and control of plant diseases and pests such as nematodes compared to strains containing the wild-type swrA gene. . Both economic agriculture and home gardening can benefit from the use of different and improved sources of strains of bacteria to enhance plant growth, promote plant health, control plant pests and diseases, and provide alternatives to chemical nematicides. The present invention provides a novel type of such bacterial strains and methods of using them to manipulate the biofilm to improve their use. SUMMARY OF THE INVENTION The present invention provides a composition comprising a variant of a spore-forming bacterium, wherein the variant has a function of causing damage to clustering and promoting plant health promotion at the swrA gene compared to a strain containing the wild-type swrA gene. Mutations, which may also result in sandpaper cells or colony morphology consisting of flat, dry, high-density and very coarse cells or colonies of 201239091; more robust root colonization; and/or early index in liquid media Long-chain cells are formed during the period. This mutation is referred to herein as a swrA mutation, and cells having these swrA mutations are referred to as swrA cells.

In the composition of the variant of the spore-forming bacteria, the swrA-cells constitute at least about 3.5% of the total cells of the composition, and at least 70% of the sprA_ cell line spores. The present invention further provides the composition, wherein the swrA. cell accounts for at least 1% of the total cells of the composition, or at least 50% of the total cells of the composition, or 1 of the total cells of the composition. 00%. The invention further provides such compositions wherein at least about 80%, at least about 85%, or at least about 90% of the SwrA cells and/or total cell spores of the composition.

In some embodiments, the sporulating bacteria are from the genus Bacillus. In other embodiments, the bacteria are from Bacillus species in the B. subtilis branch (see Figure 6). In still other embodiments, the strain is selected from the group consisting of B. pumilus, B. atrophaeus, B. amyloliquefaciens, Bacillus subtilis (Β·subtilis) Or B. licheniformis (B. Lichenformis). In still other embodiments, the Bacillus species is Bacillus subtilis QST713.

The invention provides a composition comprising a swrA' cell, wherein loss of the swrA function can be the result of any mutation that disturbs, interferes, or otherwise adversely affects its function. Examples of such mutations include, but are not limited to, at least one nucleobase pair change in the start codon of swrA, and/or at least one nucleobase pair deletion in swrA-8-201239091, and/or in swrA Insertion of at least one nucleobase pair, and/or disruption of the swrA promoter or other control elements of swrA, and/or any other gene or gene type event that causes loss of swrA function (eg, transposon, overexpression, dominant negative mutation, RNAi, antisense, gene knockout, gene knock-in, etc.)

The present invention relates to the use of a composition comprising a spore-forming bacterial cell having a mutation at a swrA homologous gene, wherein the mutation reduces the clustering ability of the bacterial cell compared to an isogenic bacterial cell which does not have the mutation. In one embodiment, the clustering ability is measured by growth on a non-liquid surface. The spore-forming bacterial cell having a mutation at the swrA homologous gene may be a Bacillus species from the Bacillus subtilis branch. In one embodiment, the bacterial cell line forming the bun is wild type. In another embodiment, the Bacillus species is selected from the group consisting of Bacillus pumilus, Bacillus acnes, Bacillus aeruginosa, Bacillus subtilis or Bacillus licheniformis. The spore-forming bacterial cell having a mutation at the swrA homologous gene has a plurality of characteristics compared to the bacterial cell having no such mutation, including at least one of the following: (i) forming a more robust biofilm, (ii) a flatter, drier, and thicker biofilm, and (iii) a long chain formed in a liquid medium in response to shear forces (which create a high vortex environment). In other embodiments, the more robust biofilm further comprises one or more of the following features as compared to an isogenic cell that does not have the mutation: (i) a vegetative cell having a larger diameter of at least about 1.5 times, ( Π) cells with excess cell coat, (iii) large 201239091 white (electronically transparent) area when viewed by a transmission electron microscope, (iv) AQ30002 organism as shown in Figure 12, 13 or 14 Membrane, and (v) forming a long chain of cells in a liquid medium.

In one embodiment, the swrA homolog has at least about 90% identity to the swrA wild type gene of the same bacillus species as the bacterial cell comprising the mutation. In another embodiment, the swrA homolog has at least about 95% identity, at least about 96% identity, at least about the same as the swrA wild-type gene of the same bacillus species as the bacterial cell having the mutation. 9 7 % consistency, at least about 8% consistency, or at least about 99% consistency. In still another embodiment, the wild-type swrA gene line having at least about 99% sequence identity to the swrA homologous gene is derived from the same strain as the bacterial cell having the mutation. In yet another embodiment, the swrA homolog has at least about 90% identity to any of the swrA nucleotide sequences provided by SEQ ID ΝΟ: 1 and 5 to 〇.

In another embodiment, the mutation in the swrA homolog is located at one or more positions corresponding to positions 26 to 34 of the swrA gene as set forth in SEQ ID NO: 1 or at a position corresponding to SEQ ID: The position of one or more positions 1 to 3 of the swrA gene shown in 1. In a variant, the mutation is inserted or deleted. In one embodiment, the composition of the spore-forming bacterial cell comprises at least 3.5% of the total bacterial cells in the composition, and/or at least about 70% of the sporulated bacterial cell line in the composition. spore. In another embodiment, the invention includes a spore-forming bacterium -10- 201239091

A composition of swrA_ cells, wherein the swrA. cells comprise at least 3.5% of the total bacterial cells in the composition, and/or at least about 70% of the spore-forming bacterial cell line spores. In some embodiments, the swrA activity has been reduced by means other than mutation of the swrA gene. SwrA activity can be reduced by various agents, including small molecules, drugs, chemicals, compounds, siRNA, ribozymes, antisense. Oligonucleotide 'swrA inhibitory antibody, swrA inhibitory peptide, aptamer or mirror aptamer. In one embodiment, the mutation of the swrA gene in the swrA. cell is located at one or more positions corresponding to positions 26 to 34 of the swrA gene as shown in SEQ ID NO: 1 or in correspondence with SEQ ID. :1 indicates the position of one or more positions 1 to 3 of the swrA gene. In a variant, the mutation is inserted or deleted. In another aspect, the swrA. cell line is the result of knockout of the gene of the swrA gene. In one embodiment, the sporulated bacterial cell line of the present invention has a mutant Bacillus subtilis QST713 bacterial cell and a composition thereof at the swrA gene. In one aspect, the Bacillus subtilis QS T7 13 bacterial cell comprises a change in at least one nucleic acid base pair in the initiation codon and/or insertion or deletion of at least one nucleic acid base pair in the swrA gene. In other aspects, insertions or deletions in the swrA gene occur at one or more base pairs at positions 26 to 34 of SEQ ID ΝΟ:1. In another aspect, the SwrA· cell line of B. subtilis QST713 is selected from strains AQ30002 (I卩QST30002) and strain AQ30004 (β[3 QST30004), respectively registered numbers NRRL B-5042 1 and NRRL B-50455. . In still another aspect of the present invention, the subtilis bud -11 - 201239091 sp. QST713 having a swrA gene mutation is wild type epsC, sfp and degQ. In another aspect, Bacillus subtilis QST713 having the mutation is in addition to the mutation to B. subtilis QST713 as an isogenic cell. In some embodiments, the B. subtilis QST713 cell having the mutation in the composition comprises at least about 3.5% of the total bacterial cells in the composition.

The present invention provides a composition comprising one or more strains of Bacillus subtilis selected from strains AQ30002 (ie QST30002) and strain AQ30004, respectively registered numbers NRRL B-5042 1 and NRRL B-5 045 5 (ie QST30004) »

In one embodiment, the spore-forming bacterial cell line having a mutation at the swrA homologous gene is from a Bacillus subtilis branch and comprises a wild-type sfp homolog. In another embodiment, the bacterial cells further comprise a wild-type degQ homologous gene and a wild-type epsC homologous gene. In one aspect, the sfp homolog, the degQ homolog, and the epsC homolog have at least about 90% sequence identity to each of the sfp, degQ, and epsC genes from any of the following bacteria: B. pumilus, B. atrophaeus, B. amyloliquefaciens, B. subtilis, B. Lichenformis, Bacillus aeruginosa (B. aerophilus), B. stratosphericus, B. safensis, B. altitudinus, B. vallismortis, salt-tolerant spores B. halotolerans, B. mojavensis, Bacillus sinensis (B· -12- 201239091 sonorensis) or B. aerius. In another aspect, the at least about 90% of the sequence identity is relative to B. subtilis strain 3610, Bacillus liquefaciens (B.

Amyloliquefaciens) strain FZB42, B. pumilus SAFR-03 2 'B. Lichen formis strain 14580 or B. atrophaeus strain 1942 sfp gene, degQ gene And epsC genes. In still another aspect, the sfp homolog has at least about 90% sequence identity to SEQ ID NO: 11, the epsC homolog has at least about 90% sequence identity to SEQ ID NO: 12, and The degQ homolog has at least about 90% sequence identity to SEQ ID NO:13. In still another aspect, the sequence identity described in this paragraph is at least about 95%, at least about 6%, at least about 7%, at least about 8%, or at least about 9%. The invention further provides any sporulated bacteria or compositions of the invention additionally comprising a modulation inert or other modulating ingredient, such as polysaccharides (starch, maltodextrin, methylcellulose), proteins (such as whey proteins, peptides, Gum), sugars (lactose, trehalose, sucrose), fats (lecithin, vegetable oil, mineral oil), salts (sodium chloride, calcium carbonate, sodium citrate), and citrate (clay, amorphous bismuth) Stone, gas phase / precipitated vermiculite, citrate). In some embodiments, such as those embodiments in which the composition is applied to the soil, the compositions of the present invention comprise a carrier that facilitates the incorporation of the composition into the soil, such as water or mineral or organic materials such as peat. In some embodiments, such as those embodiments in which the composition is used for seed treatment or as a root infusion, the carrier facilitates attachment of the composition to the seed or root. A binder or binder. In another embodiment in which the composition is used as a seed treatment, the modulating component is a pigment. In other compositions, the modulating component is a preservative.

The present invention further provides any of the compositions of the present invention further comprising at least one other active ingredient or agent in addition to the swrA. cells. These other active ingredients or agents may be chemical substances or another bacterial species. Examples of suitable active ingredients or agents include, but are not limited to, herbicides, fungicides, fungicides, insecticides, nematicides, acaricides, plant growth regulators, plant growth stimulators, and fertilizers. The present invention further provides a composition wherein the swrA· cells comprise from about 1χ1〇2 cfu/g to about lxio10 cfu/g in the composition. The invention further provides such compositions, wherein the swrA-cell comprises at least 1 x 106 cfu/g, or comprises at least 1χ1〇7 cfu/g, or comprises at least c8 cfu/g, or comprises at least c9 cfu/g.

The present invention includes a yeast product of the spore-forming bacteria of the present invention and a composition comprising the fermented product. In one aspect, the fermented product includes spore-forming bacterial cells, their metabolites, and residual fermentation broth. In other aspects, the spore-forming bacterial cells of the yeast product are mostly spores. In another aspect, the composition comprising the fermented product further comprises a modulating inerting agent and a modulating component as described herein. In some embodiments, the concentrated fermentation broth is washed, for example, by a diafiltration process to remove residual broth and metabolites such that the lysate is mostly spore. The invention also provides for treating plants to enhance plant health (such as by promoting plant health, increasing resistance to abiotic stress, or enhancing plant activity - 14 - 201239091

And/or a method of controlling a plant disease and/or controlling a plant pest, wherein the method comprises administering one or more compositions of the invention or a spore-forming bacteria of the invention to the plant, a portion of the plant, and/or the The location around the plant, such as the growth base of plants. Thus, for example, the invention further provides such methods in which the compositions of the invention are applied to soil. For example, the composition can be applied before, during, or after exposure of the plant or plant part to the soil. As with other examples, the methods of the present invention include, but are not limited to, applying the composition using methods such as soil surface pouring, long handle insertion, injection, chemical irrigation, or daytime application. The method of the invention can be applied to any plant part. Examples of such plant parts include, but are not limited to, seeds, roots, bulbs, tubers, bulbs, slips, and rhizomes. The compositions of the present invention and spore-forming bacteria can be used to control plant-parasitic nematodes such as, for example, root-knot nematodes, cyst nematodes, root rot nematodes, and ring-shaped nematodes, including Meloidogyne spp. Heterodera spp. 'Globodera spp., Pratylenchus spp. and CriconemelU spp. In some embodiments, the target is a root-knot nematode such as M. incognita (M. incognita), M. javanica (K. javanica), northern root M. hapla (Northern root knot nematode), and M. arenaria (Peanut root knot nematode). In some embodiments, the symptoms and/or nematode are reduced by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least About 60%, at least -15-201239091, about 70%, at least about 80%, or at least about 90%.

In another aspect, the uses, methods, spore-forming bacteria at the swrA homologous gene, and compositions have increased crop yield compared to untreated plants, crops, fruits, or vegetables. From about 10% to about 20%, from about 10% to about 30%, from about 10% to about 40%, from about 10% to about 90%, from about 20% to about 80%, from about 30% to about 70%, about 40% to about 60%, or about 5% or more, about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% % or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more. In another aspect, the methods and compositions described herein increase crop yield by about 5%, about 10%, about 20%, about 30% by weight compared to untreated plants, crops, fruits, or vegetables. 40%, about 50%, about 60%, about 70%, about 80%, or about 90%.

Representative plants that can be treated with the compositions of the present invention include, but are not limited to, the following monocots and dicots: bulb vegetables, cereals (such as wheat, barley, rice), corn (maize), citrus fruits (such as grapes) Pomelo, lime and orange), cotton and other fiber crops, melons, fruit and vegetables, leafy vegetables (such as celery, head lettuce, leaf lettuce, and spinach), beans (such as soybeans, green beans, chickpeas, lentils) ), oilseed crops, peanuts, pome fruit (such as apples and pears), stone fruit (such as almonds, pecans and walnuts), root vegetables, tuber vegetables, bulbous vegetables, tobacco, strawberries and other berries, Cabbage vegetables (such as broccoli, cabbage), grapes, plants for the production of raw materials (such as awns, bamboo), pineapples, and flowering plants, flowerbed plants and ornamental plants (such as ferns-16- 201239091 plants and hosta plants) ). The compositions of the present invention can also be used to treat multi-year plants 'including planting crops such as bananas and those found in forests, parks or landscaping environments. When used as a seed, the compositions of the present invention are applied at an application rate of from about 2 to about 1 x 10 cfu per seed, depending on the size of the seed. In some embodiments, the application rate is from 1 X 1 〇 3 to about 1 M07 cfu per seed.

When used as a soil treatment, the compositions of the present invention and spore-forming bacterial cells can be applied as soil surface dredging, long handle insertion, injection, and/or application to the daytime or mixed with irrigation water. The pour soil treatment can be applied during planting, sowing, after sowing, after transplanting, or at any stage of plant growth, which is about 4 x 10 Ou to about 8 1012 cfu per acre (acre). In some embodiments, the application rate is from about 1 M 012 to about 6 x 1012 cfu per acre. The application rate applied to the daytime treatment at the time of planting is about every 5 rows of row feet 2·5χ101() to about 5X1011 cfu. In some embodiments, the application rate is from about 6 x 1 OIQ to about 4 x 1011 Cfu per 1000 rows. Those skilled in the art will know how to adjust the application rate for sprinkling treatment (where the application rate is lower but more often) and other less common soil treatments. The compositions of the invention and spore-forming bacterial cells can be mixed with other chemical and non-chemical additives, adjuvants and/or treatments, including but not limited to chemical and non-chemical fungicides, insecticides, killings Agents, nematicides, fertilizers, nutrients, minerals, auxins, growth stimulators and the like. -17- 201239091

The present invention provides substantially pure culture and/or biologically pure culture of sandpaper cells isolated from a mixture of different cell types. By way of example, the present invention provides such substantially pure culture and/or biologically pure culture wherein the mixture of different cell types is deposited as QST713 number NRRL B21661. The present invention provides Bacillus subtilis strains AQ30002 (i.e., QST30002) and AQ30004 (艮卩QST30004) having substantially pure culture and/or biologically pure culture registration numbers NRRL B-5042 1 and NRRL B-50455, respectively. The present invention provides a substantially pure cultured and/or biologically pure cultured Bacillus subtilis strain having Bacillus subtilis strain AQ3 0002 having a accession number of NRRL B-5042 1 and NRRL B-5045 5, respectively (ie QST3) 0002) and all physiological and morphological features of AQ30004 (ie QST3 0004).

The present invention also provides a progeny of any of the cultures of the present invention in substantially pure culture and/or biologically pure culture, wherein the culture has a hay with accession numbers NRRL B-5042 1 and NRRL B-50455, respectively. All physiological and morphological characteristics of Bacillus strain AQ30002 (IP QST30002) fQ AQ30004 (IP QST3 0004). The invention also provides compositions comprising one or more of the substantially pure cultured and/or biologically pure cultured SwrA cells of the invention. DETAILED DESCRIPTION OF THE INVENTION All of the published materials, patents, and patent applications (including any drawings and appendices) herein are hereby incorporated by reference in their entirety as if the Individually pointed out to be included by reference. The following description includes information useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or art of the invention of the invention, or any of the disclosures of the invention in particular or implied.

The SERENADE® product (US EPA registration number 69592-12) contains a unique proprietary strain of Bacillus subtilis (strain QST7 13) and many different lipopeptides that work synergistically to destroy disease pathogens and provide superior resistance Microbial activity. The SERENADE® product is used to protect plants such as vegetables, fruits, nuts and vine crops against diseases such as fire blight, gray mold, acid rot, rust, sclerotinia, powdery mildew, bacterial spot disease and White mold. The SERENADE® product has a liquid or dry formulation specification that can be applied as a foliar and/or 'soil treatment. Copies of product marks for SERENADE® products (including SERENADE® ASO, SERENADE® MAX, and SERENADE® SOIL) approved by the US Environmental Protection Agency (US EPA) may be labeled with the US Pesticide Information Retrieval System (NPIRS®) USEPA/OPP Pesticide Product The system (PPLS) is publicly available. SERENADE® ASO (Organic Aqueous Suspension) contains 1.34% dry QST713 as active ingredient and 98.66% other ingredients. SERENADE® ASO is formulated to contain QST713 with a minimum of 1 x 1 〇9 cfu/g, however the maximum content of QST713 has been determined to be 3.3xl0u cfu/g. Alternative commercial names for SERENADE® ASO include SERENADE® BIOFUNGICIDE, S E R ΕΝ A D E® S ΟIL and -19- 201239091 SERENADE® GARDEN DIS E A S E. Additional information can be found in the product designation of SERENADE® ASO and the product designation of SERENADE® SOIL approved by U.S. EP A on January 4, 2010, each of which is incorporated herein by reference.

SERENADE®MAX contains 14.6% dry (^ 713 as active ingredient and 85.4% other ingredients. SERENADE®MAX is formulated to contain QST713 with a minimum of 7.3M09 cfu/g ' However, the maximum content of QST713 has been determined to be 7.9xl 〇1<} cfu/g. Other information can be found in the US EPA-approved product designation of SERENADE®MAX, which is hereby incorporated by reference in its entirety. Wild type Bacillus subtilis QST713, its mutant, the supernatant, and The lipopeptide metabolites and methods for using the same to control plant pathogens and insects are fully described in U.S. Patent Nos. 6,060,05 1, 6,1 03, 2 2 8 ' 6,291,426 ' 6, 4 1 7,1 6 3 and 6,6 3 8,9 1 0, these

Each of the patents is specifically and completely incorporated by reference in its entirety herein. In these U.S. patents, the strain is called AQ713, which is synonymous with QST7 13 "Bacillus subtilis QST713 has been deposited on May 7, 1997 in accordance with the provisions of the Budapest Treaty on the international recognition of the preservation of microorganisms for the purposes of patent procedures. Reference B21661 is registered with NRRL» Any QST713 referred to in this specification refers to Bacillus subtilis QST713 (ie AQ713) as present in SERENADE® preparations, deposited under the accession number NRRL B21661, or in a bioreactor Prepared under conditions that stimulate the production of SERENADE® products. When the application of the above-mentioned U.S. Patent Application No. -20-201239091 09/0 74,8 70 is filed in 1 M8, the strain is named as Bacillus subtilis according to the traditional physiological, biochemical and morphological methods. Bacillus subtilis). Since then, the taxonomy of Bacillus species has evolved, especially as advances in genomics and sequencing techniques have led to the fact that most of the current species names are based on the sequence of DNA rather than the method used in 1988. After the ratio of protein sequences derived from B. amyloliquefaciens FZB42, Bacillus subtilis 168 and QST713, approximately 95%

The protein found in Bacillus aeruginosa FZB42 is 85% or more identical to the protein found in QST713; however, only 35% of the protein in Bacillus subtilis 168 has 85% or more of the protein in QST713. High consistency. However, even though it is more dependent on genomics, there is still a classification ambiguity in the relevant scientific literature and regulatory documents, showing an understanding of the Bacteriological taxonomy that has changed over the past 15 years. For example, pesticide products based on Bacillus subtilis strain FZB24 are closely related to QST 713, but are classified as Bacillus subtilis var. amyloliquefaciens in the US EPA document. . Due to these naming complexities, this particular Bacillus is named according to the literature as B. subtilis, B. amyloliquefaciens and B. subtilis var. amyloliquefaciens. . Therefore, we retain the name B. subtilis of QST713 instead of changing the name to B. amyloliquefaciens (B amyloliquefaciens) ° - 201239091 if only based on current sequence comparisons and inferred taxonomy.

As explained in more detail herein, as a result of the present invention, we now understand that the culture of QST713 is actually a mixture of wild-type cells and a relatively small number of variant cell lines, which we named "sandpaper cells." Thus, in accordance with the present invention, we now know that QST713 in a SERENADE® preparation or a QST713 cell line grown in a bioreactor consists of a mixed population of wild-type cells and sandpaper cells, the mixing ratio of such cells and SERENADE® preparations. The proportion of cells is the same or similar (see, eg, Figure 4). As described in detail herein, we refer to these variants as "sandpaper" cells based on the morphology of their colonies, as shown in Figure 1. Sandpaper cells form colonies on the nutrient gel, which appear to be highly dense, hydrophobic, flat, dry and very "rough" in morphology and physiology, and very difficult to remove from the gum. Cell adhesion can be qualitatively observed or can be measured by crystal violet staining as described by Stanley et al., supra. In addition to forming this unique colony morphology on nutritious vegetable gum, sandpaper cells form a compact biofilm (or a more robust biofilm) on the surface such as the root, as shown in Figures 12, 13 and 14 through the 30002 root. image. In one embodiment, the sandpaper cells have enhanced film strength and can be tested as described in Example 8. In another embodiment, the sandpaper cells form long-chain cells in the liquid medium of the early exponential phase in addition to some single cells and short chains, as shown in Figure 2, but do not aggregate in the liquid medium. Block or Forming Biofilms In yet another embodiment, sandpaper cells exhibit enhanced biofilm development, beginning to form biofilms in response to shear forces even in liquid media. In still another embodiment, the sandpaper cells have an extracellular envelope, as described in Example 9 and the image of the 30002 colonization root in Figure -22-201239091

Shown. In one embodiment, the observation is based on comparison to an isogenic cell having a wild-type swrA gene. In another embodiment, the observation is based on the requirement that the wild-type gene or the homologous gene line form a biofilm, ie, sfp, compared to a cell having the same species as the wild-type gene or the homologous gene. swrA, epsC and degQ. As used herein, the term "isogenic J refers to any two cells or individuals (eg, strains) having the same genotype." Based on the present invention, we now know QST713 in SERENADE® preparations (see, for example, Example 1, Figure 1 and Figure 2) or the QST7 13 cell line grown in a bioreactor consists of a mixed population of wild-type cells and sandpaper cells, the mixing ratio of which is the same or similar to the ratio of cells in SERENADE® (see eg implementation) Example 3 and Figure 4). The cluster motion system allows the bacteria to move rapidly and collectively on the solid surface (J. Henrichsen, “Bacterial Surface

Translocation: ASurvey and a Classification,” B acteriol Rev. (1 972) 3 6:478-503. Several different genes and operons have been found to be associated with the ability of the genus Bacillus. Jinens et al. (Kearns , et al.) ( Genes Governing Swarming in Bacillus subtilis and

Evidence for a Phase Variation Mechanism Controlling Surface Motility, Molecular Microbiology (2004)

52(2): 3 57-3 69) It was found that the laboratory strain 168 of Bacillus subtilis and the related laboratory strain PY79 each had a gene reading frame shift mutation which caused damage to the clustering movement, and they named the gene as swrA. Alternative names for swrA in the scientific literature include yvzd and swrAA. The swrA mutation (ie, swrA_) in these two laboratory strains is eight A at nucleotide 34: T -23- 201239091

A Α:Τ base pair is inserted into the homopolymer fragment of the base pair (all SwrA nucleotide sequences are numbered according to our number in Figure 5). This insertion is expected to disrupt gene function by causing a shift in the reading frame and a truncated protein. This wild-type (functional; i.e., swrA+) sequence (i.e., without insertion) can be found in unacquired strain 3610 and strains that have regained clustering ability. Applicants have established that the QST7 13 sandpaper cells have mutations in the swrA gene, as discussed in detail in Example 5. These swrA' cells have impaired clustering ability. Surprisingly, when applied to plants or soils, they promote plant health. Other genes including sfp, epsC, swrA, degQ and plastid genes called rapP are also involved in biofilm formation. See McLoon, A., et al., " Tracing the Domestication of a Biofilm-Forming Bacterium" Journal of Bacteriology, Apr. 201 1 2027-

2034. The cultured B. subtilis strain designated 168 formed a damaged biofilm and smooth, shallow colonies without clustering ability. The term "culture" as used herein to describe a bacterial strain refers to a derivative, mutant strain having screening characteristics that make them suitable for use in laboratory tests, such as high competability, auxotrophy, input and insertion of genetic material, Lack of clustering or film formation. Conversely, the term "wild type J" used herein to describe a bacterial strain refers to a strain that has been isolated from nature but has not been actively screened for laboratory manipulation. The literature described by McLoon is used to repair strain 168. Experiments on biofilm formation and clustering ability. First repair sfp mutation, then repair epsC mutation, then repair swrA mutation, and then repair degQ mutation. In each step, biofilm formation is gradually repaired and becomes almost equivalent to -24 - 201239091

Biofilm formation in a wild type B. subtilis strain designated 3610. Finally, the rapP gene on the plastid is inserted into the otherwise completely repaired strain, resulting in the formation of a biofilm that is indistinguishable from the biofilm of 3610. McLoon et al., page 2032, stated, "Our conclusion is that strains with wild-type alleles of sfp, epsC and swrA are more robust than corresponding strains with swrA mutations. The biofilm is formed, so swrA also contributes to the formation of strong biofilms." Surprisingly, according to the present invention, the strain lacking the swrA function forms a more robust biofilm than the parent strain having the wild type swrA, as opposed to the discovery of Mellon. Mellon et al. did not describe the cell of the only mutant biofilm-forming gene, swrA, and thus did not describe the enhanced biofilm phenotype described herein.

"Wild type" means a phenotype that occurs in nature and/or is named as "a typical form of wild-type J that is known to be isolated." Here, the term "wild type" is used. Synonyms include "wildtype", "wild-type", "+" and "wt". The wild type is generally considered to be the product of a standard, "normal" allele of a particular gene at one or more loci, relative to those produced by non-standard, "mutant" or "mutation" alleles. . In general and as used herein, the most common allele of a particular strain or isolate (i.e., the one with the highest gene frequency) is considered to be the wild type allele. "QST713 wild type" or "QST713 wild type swrA +" and its synonym (such as "QST713 swrA +", "QST wild type", "QST713 wt", etc.) used herein means having the ability to express the coded The functional swrA protein of the swrA-25-201239091 gene (ie, swrA+) of Bacillus subtilis. Therefore, these terms refer to the wild type QST713 cell line of 100% swrA + . Wild type QST713 also has other genes recognized in the literature as being associated with biofilm formation: epsC, degQ, and sfp. SEQ ID NO: 11 is the nucleotide sequence 歹IJ of the sfp gene in wild type QST713. SEQ ID NO: 12 is the nucleotide sequence of the epsC gene in wild type QST713. SEQ ID NO: 13 is the nucleotide sequence of the degQ gene in wild type QST713.

The microorganisms and specific strains described herein are naturally isolated and grown under the artificial conditions described herein, such as culture or scale-up manufacturing processes such as fermentation, unless otherwise specifically stated. The sequence listing attached to this application provides a list of various Bacillus species and strains, as also shown in Figures 5A, 5B and 5C. Table 1 below lists the SEQ ID NO and corresponding strains. All sequences are nucleotide sequences, except for SEQ ID NO: 2 which is an amino acid sequence.

SEQUENCE ID NO. Strain η, 12 and 13 Bacillus subtilis QST713 2 B. subtilis QST713 3 B. subtilis AQ30002 4 B. subtilis AQ30004 5 Bacillus amyloliquefaciens FZB42 6 Bacillus pumilus SAFR-032 7 B. subtilis 3610 8 B. pumilus 2808 9 Bacillus atrophes (Β· Atrophaeus) 1942 10 B. Lichenformis 14580 -26- 201239091

The present invention relates to a spore-forming bacterium having the swrA gene, and more particularly to a mutant strain of such a bacterium having one or more mutations at the swrA gene. The mutation results in failure to express the encoded swr A protein and/or Or the non-functional swrA gene of the functional swrA protein cannot be encoded, wherein the mutation and the variant having the mutation are referred to herein as swrA. The present invention also encompasses spore-forming bacteria in which the swrA activity has been reduced by means other than the mutation of the swrA gene, such as transcription from activation of the swrA gene, transcription of the swrA gene, post-transcriptional message processing, translation of swrA mRNA, translation Post-protein treatment, to other points in the progression of actual protein activity, inhibits swrA activity. Any agent or system that inhibits swrA activity is contemplated by the present invention, including small molecules, drugs, chemicals, compounds, siRNA, ribozymes, antisense oligonucleotides, swrA inhibitory antibodies, swrA inhibitory peptides, dominant Negative mutations, aptamers or mirror aptamers. Cells in which the swrA activity has been reduced by means other than the mutation of the swrA gene are also referred to as swrA. The swrA cells of the present invention have an impaired clustering ability and an ability to promote plant health as compared with cells having a wild-type swrA gene. In some embodiments, the swrAjfl cell loses all or substantially all of its clustering ability. In some embodiments, the ability to cluster is reduced compared to the ability of a bacterial cell that does not have a mutation in the swrA homologous gene. In some embodiments, the clustering ability is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least About 90%. The clustering ability can be determined by the method described in Example 7 and quantitatively compared by measuring the bacterial growth diameter of -27-201239091 on the centrally inoculated "aggregate" board. See Figure 7.

In other embodiments, in addition to the above features, the swrA_ cells have one or more of the following characteristics compared to cells having the wild-type swrA gene: sandpaper cells or colony morphology (as described above); A closely attached biofilm is formed on the root; and during the early exponential growth, some long-chain cells are formed in the liquid medium, lacking aggregates or biofilm formation, which indicates that the environmental signal of the biofilm is formed (ie, exposed to The ability of a solid surface). The swrAlfl cells form a tight biofilm on the surface, such as the root, and have enhanced adhesion to non-liquid surfaces such as the roots, referred to herein as "more robust biofilms." In one aspect, the non-liquid surface is a solid surface; in other aspects it is a semi-solid surface. The relative adhesion of the roots can be analyzed by biofilm disruption as described in Example 9, roots are grown in acacia, removed from the gum and visualized by optical microscopy. In another embodiment, the more robust biofilm comprises cells having excess cell coat and/or large white (electro-transparent) regions when viewed by a transmission electron microscope. See the image of 30002 in Figure 14. In one aspect of this embodiment, the average diameter of cells in the more robust biofilm is greater than at least about 1.5 times or greater than at least about 2 times the average diameter of cells that do not have the swrA mutation. See image of 30002 in Figure 14. In some embodiments, the cell morphology of the biofilm formed on a non-liquid surface, such as the root, is analyzed by the method described in Example 9. In yet another embodiment, the swrA- cells may also have enhanced biofilm development when exposed to shear forces in the liquid medium. These shear forces are described in Example 1. Appropriate bacterial cells used as control cells to compare the characteristics of the swrA·bacterial cells may be different. For example, in one embodiment, the comparison of the above characteristics is performed between a bacterial cell having the mutation and an isogenic bacterial cell having no such mutation. In another embodiment, the comparison is between bacterial cells having the mutation and bacterial cells of the same species that do not have the mutation but also comprise the wild-type allele of the biofilm-forming genes Sfp, epsC and degQ. In between.

In some embodiments, the sprA sporulation-forming bacteria are of the genus Bacillus. In other embodiments, they are from the genus Bacillus. In this embodiment, the spore-forming bacterial cell or the bacterium having the swrA mutation may (i) be derived from a Bacillus subtilis branch, as defined below, (ii) have one or more mutations in the swrA homologous gene, and (iii) having an impaired clustering ability and enhanced plant health promoting ability, and optionally one or more of the other features described in the preceding paragraphs. The term "Bacillus subtilis branch" as used herein is partially described in Figure 6, which includes strains that have been completely sequenced and determined to have the possibility to have a swrA homologous gene, and the current 尙 no genome sequence data but Species with a swrA homologous gene are assumed based on their close parental relationship. In addition, the term "Bacillus subtilis branch" contains those that are not identified here but are well known by those skilled in the art (including interactive best BLAST matching methods) to be known to contain swrA homologs. Bacillus species of the gene. If homologous sequences are separated by speciation events, they are homologous genes: when a species is divided into two distinct species, a separate copy of a single gene in the forming species is referred to as a homologous gene. Different homologous gene systems -29- 201239091

Genes that are similar to each other because they transmit a single gene that originated in the last common ancestor by vertical transmission. The strongest evidence that two similar genes are homologous genes is the result of a genetic analysis of the gene line. A homologous gene of a gene found in the same branch and containing a homologous gene group originating from a gene of a common ancestor. Homologous genes usually, but not always, have the same function. Interactive best BLAST matching methods are the most commonly used strategies to identify possible homologous gene pairs. This method assumes that if two similar proteins from two species interact in each other's protein bodies to produce the best BLAST match, then they are homologous pairs. See Rivera, M.C., et al., Genomic Evidence for Two Functionally Distinct Gene Classes, " Proc. Natl. Acad. Sci. USA (95): 6239-44 (May 1 998). For example, the applicant's cross-species swrA analysis showed an optimal BLAST match in SwrA in Bacillus subtilis, Bacillus licheniformis, Bacillus licheniformis, Bacillus licheniformis, and Bacillus pumilus, even in two The overall percent identity of the swrA protein between the species (Bacillus amyloliquefaciens and Bacillus pumilus) was only 70%. In one embodiment, the species in the B. subtilis branch include, but are not limited to, Bacillus brevis, Bacillus atrophus, Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus licheniformis, Bacillus aeruginosa, stratiform spores Bacillus, Bacillus brevis, Bacillus licheniformis, Bacillus lentus, Bacillus salt-tolerant, Bacillus murmur, Bacillus thuringiensis, Bacillus airborne, and (ii) one in the swr A gene Or a variety of mutant Bacillus subtilis QST713 wild type swrA + mutant and strain -30- 201239091 strain. SwrA mutations of the invention include, but are not limited to, one or more nucleobase insertions, one or more nucleobase deletions, one or more nucleic acid changes (including initiation codon changes), one or more transposon insertions, wild type The gene of the swr A gene is attenuated and/or gene knocked. Those skilled in the art will appreciate that the gene includes regulatory regions such as promoters, transcribed regions, and other functional sequence regions.

The population of spore-forming bacteria can be screened for naturally occurring cells having mutations in the swrA homologous gene, as described in Example 24. Alternatively, some techniques of genetics and molecular biology can be used to reduce the expression of swrA in transcription and translation to produce swrA cells with reduced clustering ability and robust biofilm formation. In some embodiments, the swrA' cells may have one or more other characteristics as described above (formation of some long chains in the liquid medium but not aggregated or biofilm formation, and altered in the root biofilm) Cell morphology). Antisense RNA, RNAi and ribozyme can be engineered and introduced into the cell to reduce the expression of swrA or other genes that are positive regulators, such as ¢7 D and σ A. These transcription factors are known to recognize and directly bind to the swrA promoter (Calvio, et al., "Autoregulation of swr A A and Motility in

Bacillus subtilis, ” Journal of Bacteriology (2 00 8) 1 90:5720-5728). The negative regulator of swrA can also be used to reduce the expression of swrA. For example, FlgM (a σϋ specific anti-sigma factor (Fredrick) And Helmann, F1 gM is a primary regulator of sigmaD activity, and its absence restores motility to a 201239091 sinR mutant," Journal of Bacteriology ( 1 996) 1 78:70 1 0-70 1 3)) can be overexpressed Reduce the performance of swrA. Another strategy is to use a reverse allele mutation or a dominant negative mutation. Since swrA may act as a dimer or multimer (Dan Kearns, personal communication, 2011), by mutation and wild type The heterodimeric swrA of the swrA unit may no longer function. An example of a genetic engineering technique for reducing the performance of swrA is in Example 25. In the context of the use of the invention, the term "location" is used herein. The position of the amino acid within the nucleotide or amino acid sequence within the nucleic acid sequence. The term "correspondence" is used herein to mean that the position is not limited to the number of the preceding nucleotide or amino acid. For example, the location of a given nucleotide that may be deleted in the present invention may vary, as the shrA gene includes a promoter and/or any other regulatory sequence, such as in the 5'-non-translated region (UTR). Or deletion of genes or additional nucleotides. Thus, as used herein, "corresponding position" or "corresponding to" a nucleotide sequence or a position of a particular position of an amino acid sequence means that the sequence in question is by standard methods and, for example, SEQ ID ΝΟ:1 When the nucleotide sequence or the amino acid sequence of SEQ ID NO: 2 (e.g., the reference sequence) is aligned, with the indicated position or sometimes with the nucleotide sequence of SEQ ID N: 1 or SEQ ID NO: 2 The portion of the amino acid sequence exhibits a position of significant homology. For example, different strains of the genus Bacillus have a nucleotide sequence similar to the swrA gene and/or the swrA protein, but differ from the reference sequence, particularly as compared to the reference sequence, which may contain different, less or More nucleotides or amino acids. For example, a sequence segment with a problem similar to SEQ ID ΝΟ: 1 or 2 can be easily determined by using the established software measurement by the standard -32-201239091 quasi-computer alignment technique, for example, using the parameter setting to "standard" or "pre- Set ClustalW.

In some embodiments, the swrA mutation in the spore-forming bacterial strain occurs at a nucleotide position that causes an amino acid change, the amino acid change corresponding to the following conserved protein set forth in SEQ ID NO: At least one of the positions: position 1 to 17, position 19 to 20, position 22, position 25 to 29, position 31 to 33, position 36 to 39, position 41 to 48, position 50 to 51, position 53, position 56 Position 58, position 60, position 61, positions 64 to 65, positions 67 to 69, positions 71 to 86, position 88, position 95, position 97, positions 99 to 113, and position 116. The alignment of these conservative positions in Figure 5C is indicated by an asterisk. In still other embodiments, the mutation occurs at a position that causes a change in the amino acid that changes in response to at least one of the following conserved protein positions: position 1 to 17, location 7 1 to 8 6 and positions 99 to 1 13. In addition, the nucleotide change (becoming a swrA mutation) should impair the ability of the cells to aggregate and/or enhance their ability to promote plant health as compared to cells having the wild-type swrA gene. In some embodiments, the mutation will also result in the following characteristics that are different from wild-type cells: sandpaper cell morphology, more robust root colonization, and/or formation of long chains in liquid medium without aggregates, as described above . In other embodiments, the swrA mutation occurs at a position corresponding to positions 1 to 100, 1 to 50, 1 to 40, or 7 to 40 of any one of SEQ ID NO: 1 and 5 to 10.

In some embodiments, the swrA. cell has at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95 with the swrA gene of SEQ ID - 33 - 201239091 NO: 1. % consistent with the swrA gene. In a specific embodiment, the wild-type version of the swrA. bacterium having a sequence identity of at least about 60% to about 95% to SEQ ID ΝΟ: 1 has a swrA protein homologous to the SEQ ID NO: 2 gene. .

In one embodiment, the microorganism corresponds to position 26 to 34 (8 A: T base pair homopolymer fragments) or positions 1 to 3 of the swrA gene as set forth in SEQ ID NO: 1. The position of one or more of the codons has a mutation. In some instances, the mutation is inserted or deleted. Examples of deletion positions 26 to 34 are the mutated swrA gene shown in SEQ ID NO. In a mutant example, the initiation codon is mutated to a non-start codon, which produces a non-functional swrA transcript for translation such as S E Q ID Ν Ο : 4.

In another embodiment, the swrA-cell has at least about 85%, at least about 90%, or at least about 95% of the swrA wild-type gene of the same strain of the same Bacillus species and some of the embodiments. The sequence identity of the swrA gene. In some embodiments, the swrA· cells have a swrA· gene having sequence identity to the swrA wild type gene of the same Bacillus species, and the Bacillus species belong to a Bacillus subtilis branch. In some embodiments, the Bacillus strains are Bacillus brevis, Bacillus acnes, Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus licheniformis, Bacillus aeruginosa, Bacillus licheniformis, Bacillus thuringiensis, High altitude Bacillus, Bacillus lentus, Bacillus salt-tolerant, Bacillus murmur, Bacillus thuringi or Bacillus airborne. In still other embodiments, the swrA. cell has at least about 85%, at least about 90%, or at least one or more of the sequences set forth in SEQ ID NO: 1 and 5 to 10, or At least about 95% of the sequence identity of the mutant swrA gene.

In one embodiment, a spore-forming bacterial cell having mutations at the swr A homologous gene (including those within the Bacillus subtilis branch) comprises a wild-type sfp homologous gene. In other embodiments, the spore-forming bacterial cells also comprise wild-type degQ and epsC homologous genes. In still other embodiments, the sporulated bacterial cell line derived from any of the above embodiments is Bacillus subtilis or Bacillus amyloliquefaciens derived from the wild type QST713 sfp, epsC and degQ genes, respectively Provided herein are SEQ ID ΝΟ: Π, 12 and 13. The homologous genes sfp, epsC and degQ genes derived from other strains including the swrA nucleotide sequence provided here (sequence table and/or Fig. 5Α, Β and C) can be via GenBank and Various documents (including the McLoon literature cited above) are publicly available. In one embodiment, the wild-type degQ, epsC and sfp homologous genes are respectively associated with Bacillus amyloliquefaciens FZB42, Bacillus pumilus SAFR-032, Bacillus subtilis 3610, Bacillus acnes 1 942 and Bacillus licheniformis 1 45 8 One of the degQ, epsC and sfp genes of 0 has at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% of the sequence consistent. Sex. In the aspect of determining sequence identity, the spore-forming bacterial cell line having the mutation at the swrA homologous gene is identical to the strain of one of the above reference strains. -35- 201239091 The percentage of swrA cells in a particular composition of the invention will vary depending on the particular purpose and method of administration of the composition. The total cells in the compositions and methods of the present invention may comprise different cell types (eg, a combination of bacterial and non-bacterial cells), or bacterial cells that may include two or more species, or may include two or more species of Bacillus species. The cells, or Bacillus subtilis cells, which may be two or more different genotypes or strains, or may be two or more different genotypes or strains of Bacillus amyloliquefaciens, or cells having one or more different swrA mutations. In some embodiments, the percentage of cells in the total cells in the compositions and methods of the invention will be at least 3.5%, or at least 3.6%, or at least 3.75%, or at least 3.8%, or at least 3.9%. Or at least 4 ° / 〇, or at least 5%, or at least 6%, or at least 7%, or at least 8%, or at least 9%, or at least 10%, or at least 5%, or at least 20% Or at least 25%, or at least 30%, or at least 35%, or at least 40%, or at least 45%, or at least 5%, or at least 5%, or at least 60%, or At least 6 5 %, or at least 70%, or at least 7 5 %, or at least 80%, or at least 8 5 %, or at least 90%, or at least 9.5 %, or at least 98%, or at least 99 %, or 100%. In some embodiments of the invention, all cells present in a particular composition or used in a particular method are swrA cells (i.e., 100% swrA-cells). In some embodiments, the percentage of swrA cells in the total cells of the compositions and methods of the invention will range from about 3.5% to about 99.9%. In another embodiment, the percentage will be from about 5% to about 99%. In another embodiment, the percentage will be from about 10% to about 9 9%. -36- 201239091

In some embodiments, the number of colony forming units (cfu) per gram (g) of the swrA cells in the composition and method of the present invention will be at least 1 x 10 7 cfu / g, or at least 1 χ 1 〇 8 cfu / g, Or at least 1χ109 cfu/g′ or at least 2χ109 cfu/g′ or at least 3χ109 cfu/g, or at least 4χ109 cfu/g, or at least 5χ109 cfu/g, or at least 6χ109 cfu/g, or at least 7χ109 cfu/g, or At least 8xl01G cfu/g, or at least 8. 5χ101() cfu/g, or at least 9xl〇1() cfu/g, or at least 9.5><101() cfu/g, or at least 1χ10η cfu/g, or At least 2x1ο11 cfu/g, or at least 3x1ο11 cfu/g, or at least 4Χ1011 cfu/g, or at least 5Χ1011 cfu/g, or at least 6x10m cfu/g, or at least 7x1ο11 cfu/g, or at least 8xlOu cfu/g, or at least 9X1011 cfu/g, or at least c12 cfu/g, or at least lxlO13 cfu/g, or at least c14 cfu/g. In other embodiments, the total amount of the swrA cells in the compositions and methods of the invention is based on the relative or actual dry basis weight of the swrA cells in the total composition. In some embodiments, the total amount of the swrAjfl cells in the compositions and methods of the present invention is based on the cfu/g ° of the swrA_ cells in the composition. The invention also includes promoting plant health, enhancing plant growth, and And a method of controlling plant pests and diseases by administering one or more novel mutant strains and strains of the spore-forming bacteria (including bacilli as described above), or their non-cellular preparations, or the like Metabolites to plants or plant parts (such as seeds, roots, rhizomes, bulbs, bulbs, or tubers), or by application to the location where the plant or part of the plant is grown (such as soil). -37- 201239091

As used herein, "plant health" refers to the state of a plant which is judged individually by a number of aspects or by a combination of aspects. An important indicator of the state of the plant is the crop yield. "Crops" and "fruits" are considered to be any plant products that are further utilized after harvest, such as generally recognized fruits, vegetables, nuts, cereals, seeds, wood (for example, forestry), flowers (for example, gardens) , the horticulture industry as an example), etc., that is, any of the economically priced products produced by the plant. Another indicator of the state of the plant is plant vigor. The plant vigor can also be displayed in a number of ways, some of which are visible, such as leaf color, fruit color and appearance, amount of dead basal leaves and/or leaf size, plant weight, plant height 'degree of plant dumping (falling) Number, intensity and productivity of tillers, panicle length, root system range, root strength, degree of nodules (especially rhizob nodules), ~ germination, emergence, flowering, time of grain ripening and / or aging, protein content, Sugar content and similar indicators. Another indicator of plant status is the tolerance or resistance of plants to both biological and abiotic stress factors.

According to the invention, the "increased yield" of a plant, in particular an agricultural, forestry and/or horticultural plant, means that the yield of the product of the individual plant is the same as that of the plant but not the composition of the invention. The yield of the same product produced is increased by a measurable amount. According to the invention, it is preferred that the yield be increased by at least 0.5%, or at least 1%, or at least 2%, or at least 4%, or at least 5%, or at least 10% compared to a suitable control. In another preferred embodiment, the invention provides the use of a composition of the invention to increase the yield and/or promote vigor of a plant, such as an agricultural, forestry and/or horticultural plant. •38- 201239091

The invention further provides a method of increasing the yield and/or promoting the activity of a plant, the method comprising treating the plant with the composition of the invention or a spore-forming bacterium, the location where the plant grows or is expected to grow (ie, the location of the plant) and / or the propagule from which the plant grows. In some embodiments, the treated plant line grown at the site of the treated plant is grown in an environment that is physiologically stressed by the growing plant. Such conditions may be cold temperatures (eg, 15 t or less), drought conditions, low soil nutrients (eg, low levels of nitrogen and/or potassium and/or phosphate or other inorganic micronutrients) and/or increased, non- Ideal soil salinity. According to the invention, "enhancing plant vigor" means that certain crop characteristics are increased or enhanced by measurable or noticeable factors as compared to the same conditions in which the plant is not applied to the composition of the invention. the amount. Enhancing plant vigor can have the following enhanced plant characteristics in addition to others: (a) enhancing the vigor of the plant, (b) enhancing the quality of the plant and/or the plant product, such as increasing protein content, and (c) enhancing Visual appearance, (d) delayed aging, (e) improved root growth and/or better development of the root system (eg, determined by dry mass of the root), (f) enhanced nodules (especially rhizob nodules), (g) Longer panicles, (h) larger leaves, (i) fewer dead basal leaves, (j) increased chlorophyll content, (k) extended photosynthesis activity, (1) increased or enhanced plants Stand density, (m) less plant dumping (falling), (η) increased plant weight, (〇) increased plant height, (Ρ) tiller increase, U) stronger and/or more productive (〇 less productive points, (s) enhanced photosynthesis activity and/or enhanced pigment content and thus greener foliage color, (t) earlier and/or enhanced germination, (u) promotion And / or more consistent and / or earlier emergence, (v) -39 - 201 239091 Increased stem growth, (w) earlier flowering, (X) earlier results, (y) earlier grain ripening, (z) less fertilizer required, (aa) less seed required.

The compositions of the invention may also be used to control plant pathogens, such as phytopathogenic fungi, including, for example, various soil-borne and/or seed-derived pathogens, such as Aphanomyces cochlioides, Parasiticus (Cylindrocladium parasiticum), Fusarium avenaceum, Fusarium culmorum, Phytophthora capsici, Phytophthora cinnamomi, Pythium ultimum, Lithium nucleus Rhizoctonia solani, Sclerotinia sclerotiorum, Sclerotinia minor, Sclerotium rolfsii, Ustilago hordei, Stagonospora nodorum , Aspergillus fumigatus, Verticillium dahli ae, Tapesia yal 1 unde, Alternaria alternate, and Penicillium exp an sum. In one embodiment, the controllable soil-borne pathogen system is Phytophthora capsici, sclerotium, and Parasiticus. The compositions of the present invention may also be used to control plant pests, including plant-parasitic nematodes such as, for example, root-knot nematodes, nematodes, root rot nematodes, and ringworms, including Meloidogyne spp. Heterodera spp., Globodera spp., Pratylenchus spp., and Criconemella spp. The composition can also be used to control the genus C. elegans-40- 201239091 (Tylenchulus semipenetrans), Trichodorus SPP., L〇ngidorus spp., Rotylenchulus spp. Xiphinema spp., Belonolaimus spp. (such as 8· longicaudatus), Criconemoides spp., Tylenchorhynchus spp., Nematode Genus (Hoplolaimus spp.), genus Rotylenchus spp., Helicobacter

(Helicotylenchus spp.), Radopholus spp. (such as R. citrophilis and R. simi 1 is), Dity 1 enchussp p. and others Plant parasitic nematodes. In some embodiments, the target is a cystic nematode, such as Heterodera glycines (soybean cyst nematode), Heterodera schachtii (beet cyst nematode) , Heterodera avenae (Cereal cyst nematode), Meloidogyne incognita (cotton (or southern) root-knot nematode), potato gold nematode (Globodera rostochiensis) and potato White worm (Globodera pallida) (potato cyst nematode). In other embodiments, 'the genus root-knot nematode' such as M. inc 〇gnita (C. elegans), M. javanica (M. javanica) ), M. hapla (Northern root-knot nematode), and peanut root-knot nematode (Μ · arenaria) (Peanut root knot nematode). As used herein, the term "control" refers to the killing or inhibition of the growth of microorganisms' or to plant pests (such as nematodes) means killing, reducing the amount and / -41 - 201239091

Or reduce growth, eating or normal physiological development, including root-knot nematodes as an example of the ability to penetrate the roots and develop within the roots. An effective amount is capable of measurably reducing the amount of (i) microbial growth, or (Π) for plant pests, pest growth, feeding, exercise, fertility, or (iii) particularly parasitic nematodes In the case of pests, root penetration, root maturation, and/or nematode infection cause normal normal physiological development and symptoms. In some embodiments, the symptom and/or plant pathogen or plant pest (such as a nematode) is reduced by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, At least about 50%, at least about 60%, at least about 70%, at least about 80% 'or at least about 90% »

Novel variants and strains of the genus Bacillus according to the invention may be spores (which are dormant), vegetative cells (which are growing), transitional cells (which transition to sporulation during the growth phase), or all of these Combinations of cells of the type are present in the compositions of the invention. In some embodiments, the composition comprises predominantly spores. In some embodiments, the sprA of the spore has a percentage of cells of at least about 7%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 8 4 %, at least about 85 %, at least about 8 6 %, at least about 8 7 %, at least about 8 8 %, at least about 89 %, at least about 90%, at least about 95 % » Bacillus sp. Novel variants and metabolites of the strain include lipopeptides such as iturin, surfactin, plipastatin, fengycin and agrastatin. And other compounds with antibacterial properties. The lipopeptide metabolites of QST713 are described in detail in U.S. Patent Nos. 6,291,426 and 6,63,9 1 0 -42 to 201239091. See also Marc Ongena and Philippe Jacques, "Bacillus Lipopeptides: Versatile Weapons for Plant Disease Biocontrol," Trends in Microbiology (March 1, 2008) Volume 16, Issue 3, 115-125.

The compositions of the present invention can be obtained by cultivating novel variants and strains of the genus Bacillus by methods well known in the art, including the use of media and other methods as described in U.S. Patent No. 6,060,05. Large-scale microbial culture methods include immersion fermentation, solid fermentation, or liquid surface culture. At the end of the fermentation, the bacilli cells begin to change from the growth phase to the sporulation phase due to the depletion of nutrients. Therefore, most of the end products of the fermentation are spores, metabolites and residual fermentation medium. The natural life cycle of sporulation-forming bacterium cells, including Bacillus subtilis, usually begins with the cell's nutritional constraints. The fermentation system is configured to obtain high amounts of bacillus colony forming units and to promote sporulation. Bacterial cells, spores and metabolites produced by fermentation in the medium can be used directly or concentrated by conventional industrial methods such as centrifugation, tangential flow filtration, depth filtration and evaporation. The mash and the lysate concentrate are referred to herein as "fermented products". The composition of the present invention includes a fermented product. In some embodiments, the concentrated fermentation broth is washed, for example, by a diafiltration process to remove residual fermentation broth and metabolites. The broth or broth concentrate can be dried using conventional drying techniques or methods, with or without the addition of a carrier, such as spray drying, freeze drying, tray drying, fluid bed drying, drum drying, or evaporation. . The formed dried article can be further processed to a specific particle size or physical format by, for example, honing or granulating. The carrier liquid as described below can be added after drying.

The novel variants of the genus Bacillus of the present invention and the cell-free preparation of the broth of the strain can be obtained by any method known in the art, such as extraction, centrifugation and/or filtration of the fermentation broth. Those skilled in the art will appreciate that the so-called cell-free preparation is not completely cell-free, but rather largely cell-free or substantially cell-free, depending on the technique used to remove the cell (e.g., centrifugation speed). The formed cell-free preparation can be dried and/or prepared with ingredients that facilitate its application to the plant or plant growth medium. The above-described method for concentrating the mash and drying technique can also be used for cell-free preparations.

The metabolite of Bacillus subtilis can be obtained according to the method as described in U.S. Patent No. 6,060,05. As used herein, the term "metabolite" means a semi-pure and pure or substantially pure metabolite, or a metabolite that has not been isolated from Bacillus subtilis. In some embodiments, after the cellulase is centrifuged to prepare a cell-free preparation, the metabolite can be purified by size exclusion filtration, such as Sephadex resin including LH-20, G1 0, G15, and G25, according to The molecular weight valve 値 separates the metabolite into different components, such as a molecular weight of less than about 2000 Daltons, less than about 1 500 Daltons, less than about 1000 Daltons, etc., since the lipopeptides are between 800 Daltons. Up to 1 600 daltons. The above-described concentration method and drying technique for modulating the fermentation broth can also be applied to metabolites. The composition of the present invention may include a modulation inerting agent added to a composition comprising a cell, a cell-free preparation or a metabolite to promote effect and stability -44 - 201239091

And availability' and/or facilitate processing, packaging and end-use applications. The modulating inerting agents and ingredients may include carriers, stabilizers, nutrients or physical property modifiers' which may be added individually or in combination. In some embodiments, the carrier can include liquid materials such as water, oils, and other organic or inorganic solvents and solid materials such as minerals, polymers, or bio-derived or chemically synthesized polymer composites. In some embodiments, the carrier facilitates adhesion of the composition to a plant component such as a seed or root binder or adhesive. See, for example, Taylor, A.G., et al., "Concepts and Technologies of Selected Seed Treatments" Annu. Rev.

Phytopathol· 28: 3 2 1 -3 3 9 (1 990). The stabilizer may include an anti-caking agent, an antioxidant, a desiccant, a protectant or a preservative. The nutrients may include sources of carbon, nitrogen, and phosphorus such as the sugars 'polysaccharides, oils, proteins, amino acids, fatty acids, and phosphates. The physical property modifier may include an extender, a wetting agent, a thickener, a pH adjuster, a rheology modifier, a dispersant, an adjuvant, a surfactant, an antifreeze or a pigment. In some embodiments, the composition comprising cells, cell-free preparations or metabolites produced by fermentation can be used directly with water as a diluent or not with water without any other preparation. In some embodiments, the modulating inerting agent is added after concentration of the broth and during drying and/or after drying. In some embodiments, the compositions of the present invention are used to treat a wide variety of agricultural and/or horticultural crops, including those grown for seed, product, landscaping, and crops grown for seed production. . Representative plants which can be treated with the compositions of the present invention include, but are not limited to, the following: amaranth, bulb vegetables, cereals, citrus, cotton, melons, fruit-45-201239091 vegetable vegetables, leafy vegetables, beans, oil Seed crops, peanuts, pome fruit, rhizome vegetables, tuber vegetables, bulbous vegetables, stone fruit, tobacco, strawberries and other berries, and various ornamental plants.

The compositions of the present invention can be applied as foliar sprays, as seeds/roots/tubers/roots/bulls/balloons/cuttings and/or as soil treatment. The seed/root/tuber/root/bulb/bulb/cutting can be treated before, during or after planting. When used as a seed, the compositions of the present invention are applied at an application rate of from about 1 M02 to about 1 x 7 Cfu per seed, depending on the size of the seed. In some embodiments, the application rate is from about 3 to about 1 x 10 6 cfu per seed. When used as a soil treatment, the compositions of the present invention can be applied as soil surface dredging, long handle insertion, injection, and/or application to the daytime or mixed with irrigation water. The pour soil treatment can be applied during planting, sowing, after sowing, after transplanting, or at any stage of plant growth, which is about 4 χ 10 η to about 8 χ 1012 cfu per acre (acre). In some embodiments, the application rate is from about 1 X 1 〇 |2 to about 6 X 1 0 12 cfu per acre. In some embodiments, the application rate is from about 6 1012 to about 8 x 1012 cfu per acre. The application rate applied to the daytime treatment at the time of planting is about 2.5 x l 01 G to about 5 χ 1011 cfu per 1 000 rows of row feet. In some embodiments, the rate of application is from about 1 000 rows per inch to about 4 M011 cfu. In other embodiments, the rate of application is about every 10,000 lines of 呎 3 · 5 χ 1 0 1 1 to about every 10,000 lines of 5x10" cfu. Those skilled in the art will know how to adjust the application rate for sprinkling treatment (where the application rate is lower but more often) and other less common soil treatments. -46- 201239091

The compositions of the present invention may be combined with other chemical and non-chemical additives, adjuvants and/or treatments, including but not limited to chemical and non-chemical fungicides, insecticides, acaricides, nematicides, Fertilizers, nutrients, minerals, auxins, growth stimulators and the like. In some embodiments, the compositions of the present invention further comprise an insecticide, an acaricide, a nematicide 'fertilizer, a nutrient, a mineral, an auxin, a growth stimulant, and the like. In other embodiments, the compositions of the present invention are applied in turn with other treatments, for example as part of a spray schedule. In still other embodiments, the compositions of the invention are applied to the plants at the same time as the other treatments. In some embodiments wherein the composition is for controlling plant diseases and/or promoting plant health, the composition is mixed with a treatment plan containing at least one bactericide, and further comprises a treatment meter containing at least one bactericide. Draw, or be applied simultaneously with a treatment plan containing at least one bactericide, or as part of a treatment plan containing at least one bactericide. Common fungicides include, but are not limited to, strobilurin, chelating amines, sulfonamides, phenylsulfonamides, azoles, nitrogen heterocycles, dimethyl sulfoxide Classes, o-phthalimides, urethanes, thiocarbamates, formamidines, antibiotics, aromatics, anthraquinones, organochlorine compounds, organometallics, organophosphorus compounds Classes, nitrophenyl compounds, thioheterocyclic compounds, ureas, inorganics and others (for example, benzacril, carvorie, plant essential oil extract, cedar leaf oil, bitter oil, Chloropic acid, DBCP, dipyridone, dexamethasone, metzoxolon, oxolinic acid, spirocycline, -47- 201239091

Creamy urea cyanide, fenfenin). Calcium chlorate, thicyofen, dithane, ch 1 oroth al an i 1 , dichlorophen, dicloran, nitrothal -isopropyl), bronopol, diphenylamine, mildiomycin, oxin-copper, cyflufenamide (eg N-(cyclopropylmethoxyimine) -(6-Difluoromethoxy-2,3-difluorophenyl)-methyl)-2-phenylacetamidine), UK-2A (antibiotic isolated from Streptomyces 517-02), RANTantm (Ishihara Industry Co., Ltd.) and microbial-based products include, but are not limited to, Bacillus subtilis products, Bacillus pumilus products (such as those based on Bacillus brevis QST2 808tm, which are commercially available from AgraQuest). SONATA® or BALLAD®) and Streptomyces products (such as those based on Streptomyces AQ4800TM). Detailed information on AQ4800TM (AgraQuest), SON AT A®, and BALLAD® (AgraQuest) can be found in U.S. Patents 6,524,577, 6,852,317, 6,245,551, 6,586,231 and 6,63 5,245. Each of the patents and patent disclosures cited herein are hereby incorporated by reference in its entirety in its entirety in the entirety in the entirety in the extent of The spheroids include, but are not limited to, azoxystrobin, dimoxystrobin, enestroburin, flu (fluoxastrobin, kresoxim-methyl). , metominostrobin, picoxystrobin, pyraclostrobin, pyroxastrobin, trifloxystrobin, cephalosporin 48 - 201239091

(orysastrobin), methyl (2-chloro-5-[l-(3-methylbenzylimino)-ethyl]benzyl)-carbamate, methyl (2-chloro) -5-[l-(6-methylpyridin-2-ylmethoxyimino)ethyl]benzyl)carbamate, methyl 2-(o-(2,5-dimethyl) Phenoxymethylene)phenyl)-3-methoxyacrylate, 2-(2-(6-(3-chloro-2-methyl-phenoxy)-5-fluoro-pyrimidine- 4-yloxy)phenyl)-2-methoxyimino-N-methyl-acetamide 3-methoxy-2-(2-(N-(4-methoxyphenyl)) -cyclopropanecarboimine mercaptosulfanylmethyl)-phenyl)-methyl acrylate. Carboxylamamines include, but are not limited to, carboquinones (eg, bixafen, boscalid, carboxin, fenhexamid, furazolidinol) (furametpyr), isopyrazam, isotianil, metsulfovax, oxycarboxin 'pyracarbolid', penthiopyrad (penthiopyrad) ), sedaxane (racemic cis and trans isomers), thifluzamide, tiadinil, N-(4'-bromobiphenyl-2-yl) )-4-difluoromethyl-2-methylthiazole-5-carboxyguanamine, N-(4'-trifluoromethyl-biphenyl-2-yl)-4-difluoromethyl-2-methyl Thiazole-5-carboxamide, N-(4'-chloro-3'-fluorobiphenyl-2-yl)-4-difluoro-methyl-2-methylthiazole-5-carboxamide, N -(3',4'-Dichloro-4-fluorobiphenyl-2-yl)-3-difluoromethyl-1-methylpyrazole-4-carboxyguanamine, N-(2-(l, 3-dimethylbutyl)-phenyl)-1,3-dimethyl-5-fluoro-1H-pyrazole-4-carboxyguanamine, N-(4'-chloro-3', 5-di Fluorobiphenyl-2-yl)-3-difluoromethyl-1-methyl-1H-pyrazole, 4-carboxyguanamine, N-(4' -Chloro-3',5-difluorobiphenyl-2-yl)-3-trifluoromethyl-1-methyl-1H-pyrazole-4-carboxyguanamine, N-(3',4'- Dichloro-4-fluorobiphenyl-2-yl)-3-difluoromethyl-1-methylpyrene-49- 201239091

Azole 4-carboxyguanamine, N-(4'-(3,3-dimethylbutyn-1-yl)-1,1'-biphenyl-2-yl)-3-difluoromethyl- 1-methylpyrazole-4-carboxyguanamine, N-(4'-(3,3-dimethylbutyn-1-ylbiphenyl-2-yl)-3-trifluoromethyl-1- Methylpyrazole-4-carboxyguanamine, N-(4'-(3,3-difluorobutyn-1-ylbiphenyl-2-yl)-3-difluoromethyl-1-methylpyridyl Oxazole-4-carboxyguanamine, N-(4'-(3,3-difluorobutyn-1-yl)-1,1'-biphenyl-2-yl)-3-trifluoromethyl-1 -methylpyrazole-4-carboxyguanamine, 2-chloro-N-(4'-(3,3-dimethylbutyn-1-ylbiphenyl-2-yl)-3-pyridinecarboxamide , N-(2-cyanophenyl)-3,4-dichloroisothiazol-5-carboxamide, N-cis-2-bicyclopropyl-2-yl-phenyl)-3-difluoro Methyl-1-methyl-1H-pyrazole-4-carboxamide, N-(trans-2 -bicyclopropyl-2-phenyl)-3-difluoromethyl-1-methyl- 1H-pyrazole-4-carboxyguanamine, benaxaxyl, metalaxyl, mefenoxam, ofurace and oxadixyl, carboxy Acid morphomorpholine (such as dimethomorph and flumorph), benzoic amine (such as benzoxamic acid, fluorobiphenyl) (fl Umetover), fluopicolide, fluopyram, tioxymid, trichlamide, zarilamide, N-acetonylbenzene Formamides (including zoxamide and other related compounds described and/or claimed in U.S. Patent No. 5,304,572, and N-(3-ethyl-3), 5-5-trimethyl-cyclohexyl)-3-carbamimidoyl-amino-2-hydroxybenzamide, benzamidine aniline (eg, benodanil, flutolanil) , mebenil, mepronil, salicylanilide and tecloftalam, indoleamine-50- 201239091

(furanilide) (eg, fenfuram, furalaxyl, furcarbanil, and methfuroxam), furamide (eg, ring) Cyclosuramid, and furamine (furmecyclox), nicotinamide (eg 2-chloro-N-(l,l,3-trimethyl-indan-4-yl)-nicotine Indoleamine, N-(l-(5-bromo-3-chloro-pyridin-2-yl)ethyl)-2,4-dichloro-nicotinium amide, 2-amino-4-methyl-thiazole 5-5-carboxamide, and N-((5-bromo-3-chloropyridin-2-yl)-methyl)-2,4-dichloro-nicotinamide), sulfonamide (eg N- (4-Chloro-2-nitrophenyl)-N-ethyl-4-methyl-benzenesulfonamide, penthiopyrad, isopyrazam, 1-methyl- Pyridox-4-ylcarboxamide, and other carboxyguanamines (eg, chloraniformethan, carpropamid, cyflufenamid, diclocymet) , ethaboxam, fenoxanil, mandipropamid, silthiofam, N-(2-(4-[3-(4-chlorophenyl) )prop-2-ynyloxy] 3-methoxyphenyl)ethyl)-2-methanesulfonylamino-3-methyl-butanamine, oxytetracycline, N-(2-(4-[3-(4-chlorophenyl) ) prop-2-ynyloxy]-3-methoxyphenyl)ethyl)-2-ethane-sulfonylamino-3-methylbutanamine, N-(6-methoxy- Pyridin-3-yl)cyclopropanecarboxylic acid decylamine). Sultonidines include, but are not limited to, flusulfamides. Phenylsulfonamides include, but are not limited to, dichlofuanid and tolyfluanid. Azolines include, but are not limited to, triazoles (eg, azaconazole, bitertanol, sputum sputum 201239091 (bromuconazole) cyproconazole, difenoconazole, ene Beer: diniconazole, diniliconazole-M, enilconazole, epoxiconazole • etaconazole, fenbuconazole, flusilazole, Fluotrimazole, fluquinconazole 'flutriafol' furfurazole, furconazole-cis, hexaconazole, guanamine Ibexonazole, ipconazole, metconazole, myclobutanil, paclobutrazol, penconazole, propiconazole, prothiotoxin Prothioconazole, quinconazole, simeconazole, tebuconazole, tetraconazole, Triadimenol, triadimefon, triazbutil, triticonazole, enezolazole

(uniconazole), 1-(4-chlorophenyl)-2-([1,2,4]triazol-1-yl)-cycloheptanol, and amisulbrom), imidazoles For example, climazole, clatumrimazole, cyazofamid, fenapanil, glyodin, imazalil, oxpoconazole , pefurazoate, prochloraz, triazoxide, triflumizole, and 2-chloro-5-((4-chloro-2-methyl-5-() 2,4,6-trifluorophenyl))imidazol-1-yl)pyridine), benzimidazoles (eg benomyl-52-201239091 (benomyl), carbendazim, clofenazole (chlofenazole) , cypendazole, debacarb, fuberidazole, mercarbinizid, rabenazole, and thiabendazole, oxazolidine Pyrimidines (eg 5-chloro-7-(4-methyl-indole D-l-yl)-6-(2,4,6-trifluorophenyl)-[1,2,4]-triazole And -[1,5&]_pyrimidine!1, 6-

(3,4-dichlorophenyl)-5-methyl[1,2,4]triazolo[l,5-a]pyrimidin-7-ylamine, 6-(4-tertiary-butylbenzene 5-)-5-methyl[1,2,4]triazolo[l,5-a]pyrimidine-7,ylamine,5-methyl-6-(3,5,5-trimethylhexyl)[1 , 2,4]triazolo[ua]pyrimidin-7-ylamine, 5-methyl-6-octyl-[1,2,4]triazolo[l,5-a]pyrimidin-7-yl Amine, 5-ethyl-6-octyl-[1,2,4]triazolo[1,5-&]pyrimidine-2,7-diamine, 6-ethyl-5-octyl-[ 1,2,4]triazolo[l,5-a]pyrimidin-7-ylamine, 5-ethyl-6-octyl-[1,2,4]triazolo[l,5-a] Pyrimidin-7-ylamine, 5-ethyl-6-(3,5,5-trimethylhexyl)-[1,2,4]triazolo[1,5-a]pyrimidin-7-ylamine , 6-octyl-5-propyl-[1,2,4]triazolo[l,5-a]pyrimidin-7-ylamine, 5-methoxymethyl-6-octyl-[1, 2,4]triazolo[l,5-a]pyrimidin-7-ylamine, 6-octyl-5-trifluoromethyl-[1,2,4]-triazolo[l,5-a ]-pyrimidin-7-ylamine, 5-trifluoromethyl-6-(3,5,5-trimethylhexyl)-[1,2,4]triazolo[1,5-&pyrimidine -7-ylamine, and 2-butoxy-6-iodo-3-propylchroman-4-one), and other azoles (eg, bentaluron, etridiazole, and Hymexazo 1 e) ° Nitrogen heterocycles include, but are not limited to, pyridines (eg, buthiobate), two batches of dipyrithone, fluazinam, and pyridinitril. ), steep spotted moon bow (pyrifenox), 201239091

Pyroxychlor, pyroxyfur, 2,3,5,6-tetrachloro-4-methylsulfonylpyrimidine, 3,4,5-trichloro-pyridine-2,6 -dicarbonitrile, and 3-[5-(4-chlorophenyl)-2,3-dimethylisoxazol-3-yl]pyridine), pyrimidines (for example, bupirimate) , cyprodinil, diflumetorim, dimethirimol, ethirimol, ferimzone, fenarimol, fen Mepanipyrim, nuarimol, triarimol, and pyrimethanil, piperazine (such as triforine), piperidine (such as benzene rust)芬propidin and piperalin) 'graggs (such as fludioxonil and fenpiclonil), morpholines (such as aldimorph, bacteriostatic ( Benzamorph), dodemorph, fenpropimorph, and tridemorph, nitrapyrin, quinoline (eg ethoxyqquin, c Acidic quinoline vinegar (halacrinate), 8- 8 - hydr ο X yqui η ο 1 inesu 1 fate, quinaceto 1 and quinoxyfen, and terpenoids (eg, benquinox, tetrachlorobenzoquinone) (chloranil), dichlone, and dithianon, quinoxaline (eg, chinomethionat, chlorquinox, and chlorpyrifos) (thioquinox)), and other nitrogen heterocycles (such as acibenzolar-S-methyl, anilazine, diclomezine, fenamidone, thiazetocin) Flutianil, octhiminone, propylidene-54- 201239091

(probenazole), proquinazid, pyroquilon, thiadifluor 'tricyclazole, N,N-dimethyl-3-(3-bromo- 6-fluoro-2-methyl tl 哄-1-sulfonyl)-[1,2,4]triazole sulfonamide, 3-(4-chlorophenyl)-1-(2,2,2 -trifluoroethyl)-1,2,4-triazin-6(1H)-one, 3-(4.chlorophenyl)-1-(2,2,2-trifluoroethyl)-4, 5-dihydro-1,2,4-triazin-6(1H)-one, 6-(4-chlorophenyl)-2-(2,2,2-trifluoroethyl)-1,2, 4-triazin-3(1H)-one, 6-(4-chlorophenyl)-2-(2,2,2-trifluoroethyl)-4,5-dihydro-1,2,4- Triazine-3(1 H)-one. Dimethyl imines include, but are not limited to, chlozolinate, dichlozoline, iprodione, iso valedione, myclozolin, procymidone (procymidone), vinclozolin, famoxadone, and fluoroimide. Phthalic imines include, but are not limited to, captafol, captan, ditalimfos, folpet, and thiochlorfenphim. Carbamates include, but are not limited to, diethofencarb, flubenthiavalicarb, iprovalicarb, propamocarb, furophanate, methyl Thiophanate methyl, 3-(4-chlorophenyl)-3-(2-isopropoxycarbonylamino-3-methylbutyrylamido)-propionate, 4-fluorophenyl N -(l-(l-(4-cyanophenyl)ethanesulfonyl)-butan-2-yl)carbamate, and 3-iodo-2-propynylbutylcarbamate (idobao). Thiocarbamates include, but are not limited to, sulfacarb-55-201239091 (methasulfocarb) and pr〇thiocarb.

Dithiocarbamates include, but are not limited to, azthiram, carbamorph, cufraneb, cuprobam, dazomet, disulfide (disulfuram), ferbate, mancozeb, maneb, milneb, metiram, metam, dexamethasone Nabam), propineb, tecoram, thiram, zineb, and ziram. Formamidines include, but are not limited to, N'-(4-(4-chloro-3-trifluoromethyl-phenoxy)-2,5-dimethylphenyl)-N-ethyl-N-methyl Formamidine, N'-(4-(4-chloro-3-trifluoromethylphenoxy)-2,5-dimethyl-phenyl)-N-ethyl-N-methylformamidine, N '_(2-Methyl-5-trifluoromethyl-4-(3-trimethyl-decyl-propoxy)phenyl)-N-ethyl-N-methylformamidine, and N' -(5-Difluoromethyl-2-methyl-4-(3-trimethyl-decylpropoxy)phenyl)-N-ethyl-N-methylformamidine.

Antibiotics include, but are not limited to, aureofungin, blasticidin-S, griseofulvin, kasugamycin, natamyein, polyoxygen Polyoxin, polyoxorim, streptomycin, and validamycin A. Aromatic species include, but are not limited to, biphenyl, chloroneb, and cresol. Terpenoids include, but are not limited to, dodine, iminoctadine triacetate, diin octapeptide (iminoctadine - 56-201239091 tris (albesilate)), and guazatine acetate. Organochlorine compounds include, but are not limited to, bithionol, chlorothalonil, phthalide, hexachlorobenzene, pencycuron, pentachlorophenol , perchlorocyclohex-2-en-1-one, and quintozene (PCNB).

Organometallics include, but are not limited to, fentin salts, decafintin, and tributyltin oxide. Organophosphorus compounds include, but are not limited to, 1-propylpropyl phosphate, edifenphos, fenitropan, fosetyl, fosetyl-aluminum, Hexylthiofos, ipr 〇benf 〇s, ph 〇sdiphe η, triamph 〇s, pyrazophos, methyl chlorpyrifos Tolclofos-methyl), phosphorous acid and salts thereof. Nitrophenyl compounds include, but are not limited to, binapacryl, chlordiazepine, dichloran, dinocap, dinobuton, and meptyldinocap. Dioctoton, dinopenton, dinosulfon, dinotorbon, DNOC, sultropen, and tecnazene (TCNB). Thioheterocyclic compounds include, but are not limited to, isoprothiolane and dithianon. Ureas include, but are not limited to, pencycuron and quinazimi-57-201239091 (quinazimid). Inorganic fungicides include, but are not limited to, Bordeaux mixture, copper acetate, copper hydroxide, copper oxide, King copper, basic copper sulfate, sulfur, sodium hydrogencarbonate, and potassium hydrogencarbonate.

In some embodiments in which the composition is used to promote plant health, the composition is mixed with at least one fertilizer, nutrient, mineral, auxin, growth stimulating agent, and the like or additionally comprises the above In at least one, the composition is referred to below as a plant health composition. A plant health composition/compound is a composition or compound comprising one or more substances or biological organisms which are capable of maintaining and/or promoting the health of the plant. The composition/compound promotes plant health, vigor, productivity, quality of flowers and fruits, and/or stimulates, maintains or enhances plant resistance to biological and/or abiotic stimuli/stress.

Conventional plant health compositions and/or compounds include, but are not limited to, plant growth regulators (ie, plant growth stimulants, plant growth-long conditioning compositions, plant growth regulators, plant growth regulators) and plant activators (ie, plants) Activator, plant enhancer, pest control agent). The plant health composition in the present invention may be natural or synthetic. Plant growth regulators include, but are not limited to, fertilizers, herbicides, plant hormones, bacterial agents, and derivatives thereof. Fertilizer systems usually provide three major phytonutrients (nitrogen, pity, potassium, often abbreviated as NPK) in different proportions, or secondary phytonutrients (calcium, sulfur, magnesium), or trace elements that have a role in plant or animal nutrition ( Or micronutrients) (boron, chlorine 'clock, iron, fresh, copper, molybdenum and (in some -58- 201239091

The composition of selenium in the country. Fertilizers can be organic or inorganic. Naturally occurring organic fertilizers include, but are not limited to, manure, manure, peat moss, seaweed, sewage, and bird droppings. The cover crop is also grown as a green manure to enrich the soil and the soil (via nutrient transfer) phosphorus content via atmospheric nitrogen fixation of the nodule on the root. Processed organic fertilizers from natural sources include compost (green waste), blood meal and bone meal (from organic meat production sites) and seaweed extracts (alginates and others). Fertilizers can also be divided into a large number of elements and trace elements according to their concentration in the dry matter of the plant. A large number of elements are consumed in large amounts in plant tissues and are usually present in integers or tens of percent (on a dry matter basis) of 'the main components including nitrogen (N), phosphorus (P) and potassium (K) (when the elements are Deliberately mixed when called NPK fertilizer or compound fertilizer). There are many kinds of micro-elements that are required to have a concentration between 5 and 1 part per million (ppm). Plant trace elements include iron (Fe), manganese (Mn), boron (B), copper (Cu), molybdenum (Mo), nickel (Ni), chlorine (Cl), and zinc (Zn). Plant hormones (ie phytohormones) and derivatives thereof include, but are not limited to, abscisic acid 'auxin, interleukin, gemcitabine, brassinolide, salicylic acid, jasmonate, plants Peptide hormones, polyamines, nitric oxide and levone lactone. Plant activators are natural or synthetic substances that stimulate, maintain or enhance the resistance of plants to biological and/or abiotic stimuli/pressure, including but not limited to acibenzolar, arbenazole. ), isotianil, salicylic acid, azeiaic acid, hymexazol, brassinolide, forchlorfenuron, benzothiadiazole (benzothiadiazole) (eg, -59-201239091 ACTIGARD® 50WG), microbial or microbial-derived excitons, more plant activators are described in U.S. Patents 6,849,576, 5,950,361, 6,884,759, 5,554,576, 6,100,092, 6,207,882, 6,355,860, 5,241,296, 6,369,296, 5,527,783, and 6,987,130.

Microorganisms or chemical compounds derived from microorganisms and peptides/proteins (e.g., elicitors) can also be used as plant activators. Non-limiting exemplary exciton lines: branched-/3-polydextrose, chitin oligomer, lytic pectinase, elicitor activity independent of enzyme activity (eg endo-xylanase, elicitin, PaNie) ), avr gene products (eg AVR4, AVR9), viral proteins (eg, viral coat protein, allergen (Harpin)), flagellin, protein or peptide toxin (eg, vitamins), glycoproteins, invertase glycopeptide fragments , clove lactide, Nod factor (lipid chitosan oligosaccharide), FAC (fatty acid amino acid conjugate), ergosterol, bacterial toxin (eg coronatine), and dihydrosphingosine analog mycotoxins (eg, fumonisin B1). More excitons are described in Howe et al., Plant Immunity to Insect Herbivores, Annual Review of Plant Biology, 2008, vol. 59, pp. 41-66 'Stergiopoulos, Fungal Effector Proteins Annual Review of Phytopathology, 2009, vol. 4 7, pp. 2 3 3-263, and Bent et al., Elicitors, Effectors, and R Genes: The New Paragigm and a Lifetime Supply of Questions,

Annual Review of Plant Biology, 2007, vol. 45, pp. 3 99-436 〇 More non-limiting exemplary plant health composition/compound description -60- 201239091

In the following US Patents: 4,751,226,4,889,551, 4,456,467 5,763,366, 4,219,351, 4,394,151 4,913,725 RE33976, 4,959,093, 6,645,916, 4,152,429 4,462,821, 4,704,160, 3,979,201 4,505,736 4,422,865, 5,919,448 4,431,442, 4,824,473 4,185,990, 5,837,653 4,701,207, 4,717,732 4,716,174, 4,720,502, 4,717,734, 6,261,996 4,701,463 4,728,657 4,636,514 4,717,733 4,73 1,3 72, 5,168,059 > 4,261,730, 5,861,360 4,066,435, 4,210,439, 5,006,148, 4,906,280 4,160,660 > 4,439,224, 5,123,951 4,094,664 4,902,815, 4,036,629, 4,534,785, 4,212,664 4,880,622, 4,144,047 4,336,060 4,308,054 4,515,618, 4,525,200, 4,579,582, 5,554,580 4,840,660, 4,268,299 4,534,786, 5,589,438 4,596,595, 5,468,720, 6,083,882, 6,306,797 4,226,615, 4,509,973, RE2943 9 , 4,025,3 3 1 6,242,3 8 1 , 4,3 26,8 7 8 , 4,259,104 , 5,518,994 5,446,013 , 3,713,805 , 4, 75,5213, 4,3 97,678 4,762, 549 6,984,609 , 4,808,207 , 4,943,3 1 0 4,481,026 , 7,270,823 , 4,592,772 , 5,3 46,8 79 5,627,134 , 4,439,225 , 4,931,082 > 4,554,010 4,057,413 , 4,072,495 , 4,364,768 , 7,544,821 5,523,275 , 5,525,576 , 7,404,959 , 4,619,685 201239091 4.1 5 7, 2 5 5 4,5,5,5,5,5,5,5,5,5,5,5,5,5,5,5,5,5 4,726,8 5,849,666 6,649,568 4,246,020 4,859,231 4,964,894 4,992,093 35 4,969,948 4,672,112 5,015,283 6,727,205 5,656,571 4,976,771 5,617,671 4,427,43 6 4,48 6,2 19 14 5,006,153 5,854,179 4,588,435 3,940,4 5,741,521 6,569,809 4,243,405 5,709,871 7,078,369 4,954,157 4,356,022 4,879,291 4,130,409 4,921,529 4, 05943 1 6,750,222 4.067.722 4,812,159 4,293,3 3 1 4,148,624 4,863,505 4,857,545 3,912,492 5,801,123 4.285.722 7,005,298 5,925,596 4,857,649 4,741 , 768 5,700,760 4,606,756 4,978,386 6,884,758 4,519,163 4,093,664 4,776,874 4,530,715 4,494,982 4,765,823 4,171,213 4,732,605 3,905,799 3,979,204 4,737,498 4,227,918 4,999,043 4,217,129 5,211,738 5,510,321 4.504.3 04 6.3 3 1,5 06 5,922,646 4,723,984 4,888,048 -62- 201239091

4,113,463, 4,846,8 8 3 , 5,154,751 , 4.349.3 7 7 , 4,043,792 , 6,4 1 0,48 3 , 4,806,143 , 5.1 3 1,940 , 4,799,950 , 4,525,203 , 4,685,957 , 4,770,692 , 6,45 8,746 , 4,68 1,900 5.3 3 2,7 1 7 , 4.1 04,052 , 5,053,072 , 4,889,946 , 4,961,775 , 5,635,451 , 7,479,47 1 , 4.1 24,369 , 4,909,832 , 4,547,2 1 4 , 5,086,187 , 4,959,097 , 4,090,862 , 4,586,947 , 6,93 9,83 1 , 5,922,648 , 4,8 8 6,544 , 4,1 9 3,7 88 , 4,963,180 , 4,391,628 , 5,63 7,5 5 4 , 4,78 7,93 0 , 3,989,525 , 5,679,62 1 , 5,222,59 5, 4,622,064, 5,186,736, 5,323,906, 5,25 3,7 5 9 , 4,975,112, 5,015,284, 5,03 9,3 3 4, 4,744,817, 4,808,213, 4,711,658 5.3 7 1,065 6,906,006 4,239,528 5.03 0,270, 6,069,114, 4,923,502, RE31550, 4.3 3 7,080, 4,908,353, 5,312,740, 4,240,823, 5,902,772, 6,995,015, 5.3 5 1,8 3 1 , 4,902,332 , 4.3 49,3 78 ' 5,529,976 , 4,311,514 , 5,658,854 , 4,925,480 , 5,0 90,992 ' 4,764,202 , 4,507,140 , 4,960,45 3 4.620.8 67 4,292,072 6.2 84,7 1 1 4,844,730 6.8 6 1,3 8 9 6,07 1,8 60 4,1 27,402 4,63 7,8 28 4.5 60, 7 3 8 3,985,541 5.428.002 4.5 8 8 8 8 8 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5,701,699 5,466,460 5.977.023 4,602,938 4.8 7 1,3 8 7 6.23 9,07 1 4,73 4,1 26 4,943,311 4,87 1,3 89 5,25 8,3 60 5,29 8,48 0 5,22 5,496,794 6,76 7,8 1,3 16 0,45 7 65 4.8 8 6.265.217 4,818,271 5,292,533 4,557,754 4,973,690 4,518,415 4,895,589 4,102,667 4,740,231 6,465,394 5.559.218 7,326,826 5,211,736 4,846,873 4,507,141 4,999,046 4,401,458 5,198,254 4,153,442 4,233,056 5,470,819 4,772,310 5,022,916 4,735,651 5,710,103 5,869,424 4,047,923 5,346,068 4,772,309 4,786,312 4,960,456 5.763.495 4,812,165 5,783,516 4.678.496 4,729,783 5,106,409 4,936,892 4,936,901 4,554,017 5,419,079 5,747,421 4,808,7 4,849,007 4,614,534 4,640,706 4,797,152 22 5,160,364 6,508,869 5,110,344 4,764,624 4,770,688 4,911,746 7,198,811 4,897,107 4,606,753 5.3 4.3 24,7 10 77,407 5,679,620 4.802.909 5,714,436 4.334.909 5,026,418 4,554,007 4,789,394 5,073,187 4,565,875 5,112,386 4,615,725 4,894,083 4,957,535 4,647,302 5,858,921 -64-201239091

4,599,448, 4,938,791, 4,491,466 4,812,162, 7,427,650, 4,684,396, 4,201,565 4,636,247, 4,925,482, 4,486,218, 6,570,068 5,045,108, 4,3 3 6,05 9 , 4,983,208, 4,954,162 4,921,528, 4,8 26,5 3 1 , 4,661,145 , 4,935,049 , 4,515,619 % 4,810,283, 4,988,382% 4,584,008, 4,227,915 > 4,875,922, 4,988,383 \ 4,886,545, 5,602,076, 4,229,442, 4,525,201 5,034,052 > 5,104,443, 3,620,919, 4,164,405, 5,703,016, 5,1 02,443, 4,618,360, 6,5 69,8 08, 4,919,704, 4,584,013 4,775,406 5,631,208 4,909,835, 4,178,166, 4,183,742, 6,225,260 > 5,318,945 > 4,623,382, 5,053,073 4,693,745, 4,875,930 5,696,053 4,221,584, 4,975,459 > 4,601,746, 4,185,991, 4,871,390, 4,863,503, 5,073,184, 5,262,389 \ 5,061,311, 4,966,622, 6,228,808 5,057,146, 4,849,009 4,939,278, 4,481,365, 4,333,758, 4,741,754, 4,41 1,685 > 4,455,162, 7,291,199 > 5,252,542, 4,470,840, 4,227,911, 4,959,093, and 5,1 23,951. Each of the patents and patent publications cited herein is hereby incorporated by reference in its entirety in its entirety in its entirety in its entirety herein Bacterial bacterial agents comprise a composition of beneficial bacteria that are typically used to inoculate soil during planting. Such bacterial agents include nitrogen-fixing bacteria or rhizobium. Soybean slow -65- 201239091

Bradyrhizobia japonicum is commonly used for soybean seeding, HIS Bradyrhizobia Vigna or Bradyrhizobia Arachis for peanuts. Other Rhizobium can be used in other crops: Rhizobium leguminosarum for peas, lentils, beans, alfalfa and clover, Rhizobium loti, Rhizobium pea and slow-growing Rhizobium for various Legumes. In one embodiment, the composition of the invention is admixed with at least one bacterial microbial agent or additionally comprises at least one bacterial microbial agent, and then applied to the soil or seed. In another embodiment, the composition and the bacterial agent are applied simultaneously or sequentially to the plant, plant part or locus of the plant or plant part.

In some embodiments, the composition of the present invention is mixed with an insecticide spray plan, further comprises the insecticide spray plan, or is applied simultaneously with the pesticide spray plan, or as the kill Part of the insect spray application is applied. Suitable insecticides include neonicotinoid insecticides such as 1-(6-chloro-3-pyridylmethyl)-N-nitroimidazolidine-2-ylideneamine (imidacl〇prid), 3 -(6-chloro-3-pyridylmethyl)-1,3-thiazolidine-2.ylidene cyanamide (thiacloprid), 1-(2-chloro-1,3-thiazole-5 -ylmethyl)-3-methyl-2-nitroindole (clothianidin) 'nitempyran, N.sup.l-[(6-chloro-3-pyridine) A Base]-N_sup.2-Aeration-N.sup.l-Methylacetamidine (acetamiprid), 3-(2-chloro-1,3-thiazol-5-ylmethyl)-5- Methyl-1,3,5-oxadione-4-ylidene (-nitro)amine (thiamethoxam), and 1-methyl-2-nitro-3-(tetrahydro-3) Furanmethyl) hydrazine (dinotefuran). -66- 201239091

In some embodiments wherein the composition is for controlling nematodes, the composition further comprises a treatment plan containing at least one other nematicide, or is mixed with the treatment plan containing the at least one other nematicide, Or administered concurrently with the treatment plan containing at least one other nematicide, or as part of a treatment schedule containing at least one other nematicide. The term "nematicidal agent" as used herein includes nematode control agents, such as those which kill nematodes and those which inhibit the growth and/or development of nematodes. The second nematicide can be a chemical or biological nematicide. The term "chemical nematicide" is used herein to exclude fumigants. The term "smoke agent" includes a broad range of pesticide chemicals that are applied to the soil prior to planting and diffused through the soil (soil air and/or soil moisture). Administration as a gas (such as methyl bromide), a volatile liquid (such as chloropicrin), or a volatile solid (such as dazomet). In some embodiments, the chemical or biological nematicide is a commercially available synthetic product that is in a tank mix with the compositions of the present invention. In other embodiments, the chemical or biological nematicide is mixed with the Bacillus base composition of the present invention prior to conditioning such that the active ingredients ultimately form a modulated article. The chemical nematicides used in such mixtures are urethanes, urethanes and organophosphorus nematodes. Urethane nematicides include benomyl, carbofuran, (FURADAN®), carbosulfan, and cloethocarb. Amidosyl amides include alanycarb, aldicarb (TEMIK® or as a part of Syngenta's -67-201239091 AVICTA® Complete Pak seed treatment), dexame ( Aldoxycarb) (STANDAK®), oxamyl (VYDATE®), thiodicarb (part of the AERIS® seed treatment system from Bayer CropScience), and tirpate. Organophosphorus nematocidal agents include fensulfothion (DANSANIT®), ethoprop (MOCAP®), diamidafos, fenamiphos, fosthietan, fo Pamamidon, cadusafos, chlorpyrifos, dichlofenthion, dimethoate, fosthiazate, heterophos, esamido Fuku (ismidofos), 依松松

(isazofos), phorate, phosphocarb, terbufos, thionazin, triazophos, imicyafos, and mecarphon . The names in parentheses after each compound are representative commercial modulators of the above various compounds. Other chemical nematicides that can be used in such mixtures include spirotetramat (MOVENTO®), MON37400 nematicide, and fiproni 1 (fiproni 1). Biological nematicides include chitin and urea mixtures; compost extracts and compost teas (both aerated and unaerated); include Myrothecium verrucaria and/or a composition of a metabolite (such as DITERA® for commercial use); a composition comprising Pae cilomyces including P. lilacinus (such as commercial MELOCON® or BIOACT®); Pasteurella (Pasteuri a) includes -68- 201239091

P. usgae and compositions comprising such bacteria (e.g., commercial ECEEM®); bacteria of the genus Bacillus firmus (including CNC 1- 1 582, 1995) May 29 曰 Deposited at the National Microbial Culture Preservation Center of Pasteur Institute, France, and commercial VOTIVO, for example, Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus (included on NRRL on January 14, 1999) a strain of B-30087 and a mutant thereof, and a Bacillus cereus and a composition comprising one or more of the above bacteria; a nematocidal Streptomyces such as Streptomyces lydicus and a bacterium comprising the same Compositions (such as commercial ACTINOVATE®); and nematophagous fungi, including Duddingtonia flagrans such as strain T-89 (in GNC VB "Vector" Russian virus and biotechnology center (Curtus, Novosibirsk region) Registered by F-8 82), Paecilomyces lilacinus, and Arthrobotrys oligospora. Biological nematicides also include plant nematicides such as tartary buckwheat plants (including seeds or oils derived from the plants) or azidirachtin-based products, secondary metabolites of tartary buckwheat seeds, sesame oil products (such as DRAGONFIRE®), carvacrol, and plant extract-based products (such as NEMA-Q® from Quillajasaponaria). Biological nematicides also include isolated compounds produced by bacteria, such as bacteriocins (a family of chemical compounds produced by Streptomyces aver men tilis) including abamectin (by Abyssin) The combination of avermectin Bla and Blb) and avermectin B2a, and allergen protein (originally identified in Erwinia amylovora) include allergen EA and -69 - 201239091 allergen beta /3 .

The Bacillus base composition of the present invention can be applied independently or with one or more other chemical and non-chemical fungicides, insecticides, acaricides, nematicides, fertilizers, nutrients, minerals, auxins, growth stimuli The agents and/or plant health products are administered in combination. In some embodiments, the swrA. cell line is associated with at least one fungicide, insecticide, acaricide, nematicide, fertilizer, nutrient, mineral, auxin, growth stimulator, and/or plant health The articles are prepared together and the co-modulated product is applied to the plant, plant part or plant location. In some embodiments, the composition of the present invention is obtained from a commercially available fungicide, insecticide, acaricide, nematicide, fertilizer, nutrient, mineral, auxin, growth stimulant And/or a formulation of the plant health product is mixed and applied to the plant, plant part and/or plant location. In other embodiments, the composition of the invention is based on the application of the commercially available fungicide, insecticide, acaricide, nematicide, fertilizer, camp II, mineral, auxin, The preparation of the growth stimulating agent and/or the plant health product is applied to the plant, plant part and/or plant location immediately before or after. In other embodiments, the composition of the present invention is a fungicide, an insecticide 'acaricide, a nematicide, a fertilizer, a nutrient, a mineral, an auxin, a growth stimulant obtained from a commercially available route. And/or a modulator of the plant health product is applied in turn to the plant, plant part and/or plant location. In one example, the Bacillus subtilis-based composition is applied as a seed or as a daytime or pour-on treatment, as described in more detail herein. In some cases of the above embodiments, the fungicide, insecticide acaricide or nematicide agent obtained from the commercial-70-201239091 route is recommended to be used below the product label. Fungal, insecticide, acaricide or nematicide are applied as a ratio at the time of independent treatment. In one aspect of this embodiment, the fungicide, insecticide, acaricide, and/or nematicide chemical is a chemical. On the other hand, the chemical has poisoning concerns and may be “gradually abolished” by relevant government agencies in one or more countries.

In other embodiments, the compositions of the present invention are applied to plants, plant parts, and/or plant loci after application of the fumigant. The fumigant can be applied by a long handle injection, usually at least 8 inches below the surface of the soil. The liquid preparation of the fumigant can also be applied by surface drip irrigation chemical irrigation to bring the fumigant to a depth of 8 inches or less below the surface of the soil. The treated soil bed is covered with a plastic cloth to maintain the fumigant in the soil for several days. This is done before planting and is ventilated before planting. The bacillus-based composition described herein will be applied after the venting period, either before, during or after planting. In some cases, the smog is below the recommended ratio on the product label. Apply. Fumigants (including fumigant nematicides) include halogenated hydroxys such as chloropicrin (CHLOR-0-PIC®), methyl bromide (METH-0-GAS®) and combinations thereof (such as BR0M) -0-GAS® and TERR-O-GAS®), 1,3-dichlorophenol (TELONE® II, TELONE® EC, CURFEW®) and a combination of 1,3-dichlorophenol and chloropicrin (TELONE® C-17, TELONE® C-35, and INLINE®), methyl iodide (MIDAS®), methyl isocyanate release such as sodium methyldithiocarbamate (VAPAM®, SOILPREP®, METAM-71) 201239091 SODIUM®), l,3· a combination of dichlorophenol and methyl isocyanate (VORLEX®), and a carbon disulfide releaser such as sodium tetrathiocarbonate (ENZONE®) and dimethyl disulfide or DMDS (PALADINO) ®). Commercial modulating agents for the various fumigants described above are provided in parentheses following the chemical name.

The compositions of the present invention may also be administered as part of an Integrated Pest Management ("IPM") program. These plans are described in various publicly available materials, in particular those published by the University Cooperative Promotion Department. In the case of nematode control, such crops include crop rotation, cultivation and cultivation measures, and transplanting using crops that are not the target of the nematode. For example, the Bacillus-based composition described herein can be applied after mustard or other nematode-inhibiting crop growth season.

In some embodiments, the site to be treated is identified prior to application of the composition of the invention to the plant, plant part or plant location. In the case of nematode control, the identification may be by visual observation of chlorosis, dwarfism, plaque or wilting (ie, symptoms of nutritional deficiencies), usually associated with knowledge of past worms, plant sampling and / or soil sampling discrimination. Plant sampling can be performed during the growing season or immediately after the final harvest. The plant is removed from the soil and the roots of the plant are examined to determine the nature and extent of the nematode problem in the field. In the case of root-knot nematodes, the severity of root mites is determined by measuring the proportion of root systems formed by the root system. Roots caused by root-knot nematodes can be distinguished from nodules caused by bacteria in nitrogen-fixing soils because roots cannot be easily separated from the roots. The number of root-knot nematodes in the soil increases with the severity of root mites. In some cases, the detection of any degree of root 瘿 represents -72- 201239091 Planting any susceptible crop (especially in or near the sampling area) can cause root-knot nematodes. Encapsulated nematodes can also be identified by plant sampling and examining the formation of cysts at the roots.

Soil sampling provides a means of determining the number of nematodes and/or nematode eggs that infect a certain amount of soil or roots. Soil sampling can be carried out at the time of the suspected initial discovery, at the final harvest, or at any point prior to planting the new crop, prior to the destruction of the crop of the previous crop. University Collaborative Promotion Program Provides soil sampling services, including the University of Florida, Oregon State University, and the University of Nebraska-Lincoln. In addition, these plans provide guidance on how to collect samples. For example, in a method of predicting sampling after harvest, in a regular zigzag pattern on a 5 or 10 acre area (depending on the crop price, the higher the price of the crop is sampled on the less acre area) Samples were collected from 6 to 10 inches of soil depth in 20 field locations. In a method of testing established plants, root and soil samples were obtained from suspected plants that developed symptoms but did not die or die (ie, rot) at a soil depth of 6 to 10 inches. In some embodiments, the identification involves an economical threshold for determining whether or not a pest or disease (such as a nematode) is reached, i.e., the point at which the expected economic loss is not processed beyond the processing cost. The economic valve varies depending on crop, geography, climate, planting time, soil type, and/or soil temperature. Several articles on this topic have been published and can be obtained from university collaboration promotion programs in different regions. See, for example, Robb, J.G., et al., ** Factors

Affecting the Economic Threshold for Heterodera schachtii Control in Sugar Beet, ” Economics of -73- 201239091

Nematode Control January-June 1 992, Hafez, S aad L.

Management of Sugar Beet Nematode," University of Idaho Current Information Series (CIS) 1 07 1 (1 998), and UC IPM Pest Management Guidelines: Tomato UCANR Publication 3 4 7 0 Nematodes A. Ploeg, N ematology, UC Riverside ( January 2008). The economic valve that determines the specific crop's specific time of year is a skill familiar to those of ordinary skill in the field.

In some embodiments, the soil sampling indicates that nematode infection will result in a yield of about 80%, about 90%, or about 915% of normal uninfected soil. In some embodiments, the economic valve of the nematode larvae per kg of soil sample is at least about 2, 50, at least about 300, at least about 500, at least about 750, at least about 1,000, at least about 2000, at least about 3000, at least about 4,000, at least about 5,000, or at least about 6000 Μ °

In some embodiments, the economical valve of the nematode eggs and larvae per 1 cm3 of soil is at least about 0.5, at least about 1 'at at least about 2, at least about 3, at least about 4. According to Hafez (1998) (ibid.), an envelope is estimated to have 500 viable eggs and larvae. The present invention also encompasses a method for identifying and/or producing a bacterial product for enhancing plant growth by screening cells of a Bacillus subtilis strain in a Bacillus subtilis branch, selecting a cell having a swrA gene mutation, and having the swrA mutation The cells produce fermented products. In some embodiments, screening requires inoculation of a strain of Bacillus, selection of individual bacterial colonies, isolation of DNA from each colony -74-201239091, and sequencing of the swrA gene using primers according to the swrA sequence provided in Figure 5" It will be well known to those of ordinary skill in the art. Exemplary primers and PCR conditions are as described in Example 24. In some embodiments, the cells are cultured prior to screening and cells having one or more of the following characteristics are selected: having a sandpaper morphology or an impaired clustering ability compared to wild-type cells. The clustering ability can be according to the embodiment 7

It is determined in the same manner as described. In other embodiments, the selecting step also involves selecting the cells having the swrA gene mutation, which cells have a greater ability to enhance plant health than wild type cells. In one aspect, the application relates to the application of the fermented product to a plant, to a portion of the plant and/or to the location of the plant, and comparing the plant to a reference plant to which the fermented product is not applied and/or the application originates from The growth of the reference plant of the mutated cell of the mutant isogenic cell. In still other embodiments, the screening involves screening for mutations in the swrA gene corresponding to positions 1 to 3 or positions 26 to 34 of SEQ ID ΝΟ:1. The screened swrA_ cells may have any of the mutations described herein with respect to the various swrA mutations. The present invention also encompasses a method of screening a bacterial product for enhancing plant growth. The method comprises (i) mutating a wild-type swrA gene derived from a bacterial cell of a Bacillus subtilis branch to produce a mutant bacterial cell. Incubating the mutated bacterial cells and observing the specific cell morphological characteristics' (iii) cultivating a wild-type swrA from a Bacillus subtilis-75-201239091 strain on a solid surface (such as acacia gum) a bacterial cell population of genes, and (iv) selecting bacterial cells having the morphology of the cells identified in step (ii) above. In some embodiments, the swrA mutation is produced by an antisense or transposon technique. A specific embodiment is provided as in Example 25. In another embodiment, the invention comprises a method for producing a plant growth promoting article, the method comprising:

a. cultivating a bacterial cell having a mutation at the swrA gene or a homologous gene thereof, wherein the mutation reduces the clustering ability of the cell when growing on a solid or non-liquid surface, compared to a bacterial cell not having the mutation, and b. Growing bacterial cells with the mutation to sporulation. In another aspect, the method further comprises drying the bacterial cell from step (b). In still another aspect, the method further comprises adding a carrier or modulating an inert agent. In another embodiment, the growing step occurs in a biological fermentation apparatus. In some embodiments, the bio-fermenter has a capacity of at least 2L.

Hosting Information QST713 Samples of wild-type swrA+, QST30002 (ie AQ30002) and QST30004 (ie AQ30004) have been deposited with the Agricultural Research Organisations Conservation Centre at the National Agricultural Applications Research Centre of the US Department of Agriculture's Agricultural Research Centre (Address 1815) North University Street, Peoria, IL 61604). The QST713 wild type swrA + (registered on October 5, 2010) was assigned the following deposit number: NRRL B-50420. QST30002 (registered on October 5, 2010) is assigned the following deposit number: NRRL Β-50421 » -76- 201239091 QST30004 (registered on December 6, 2) is assigned the following deposit number: NRRL B-5 045 5. In order to satisfy the simplification of 35 U.S.C. § 112 and to prove that the strain of the present invention is registered in accordance with the regulations described in 37 C.F.R. §§ 1.801 -1.809

With regard to such deposited Bacillus subtilis strains QST713 wild type swrA+, QST3 0002 and QST3 0004 (registered numbers NRRL B-50420, B-50421 and B-50455), the applicant hereby declares as follows: 1. During the undetermined period of this application, the acquisition of the present invention will be given at the request of the Director; 2_ after the patent is issued, the bacterial strains will be available to the public under the conditions specified in 37 CFR 1.808; 3. The deposit will be at 30 Maintained in public inventory during the year or within 5 years after the last request or during the executable period of the patent, whichever is longer; 4. The viability of the biological material at the time of storage will be tested; and 5 If the deposit cannot be obtained, it will be replaced. During the unresolved period of this application, the acquisition of this deposit will be made available to the person authorized by the Director of the Patent and Trademark Office in accordance with 37 C.F.R. § 1.14 and 35 U.S.C. § 122. In approving any patent application scope in this application, the restrictions on the public's access to such bacterial strains will be irrevocably removed in accordance with paragraph (b) of 37 CFR 1.808. The following examples are presented purely to illustrate the invention and are not intended to limit the invention. -77-201239091 [Embodiment] Example 1 - Identification of morphology of sandpaper mutants The first Bacillus subtilis cell line with sandpaper morphology was accidentally tested in the commercial batch of SERENADE® for routine quality control (QC) tests. Discovery and separation.

The sandpaper variant showed a different colony morphology from the QST7 13 wild type cells on the nutrient gelatin culture plate. The sandpaper cells form highly compact and hydrophobic colonies on the solid medium (see Figure 1 for a QST71 3 wild type and sandpaper colony image taken with a Keyence digital microscope). The names of these variants, "sandpaper", are given because their phenotypes are very tight, very "rough" and very difficult to remove from the growing agarwood gelatinous flat colonies (ie highly adherent colonies) ). Since then, it has been initially found that a single strain with a sandpaper morphology is initially isolated and selected for further characterization. This strain was named AQ30002.

In addition to having a unique colony morphology on solid media, AQ3 0002 was also observed to form long chain cells in liquid media during the early index. Conversely, QST7 13 wild-type cells form short chains or maintain a single cell during this same growth phase (compare microscopic images of Figure 2). AQ 30002 also shows a unique morphological response that grows in high shear liquid media. AQ3 0002 and QST713 show very similar morphology and growth habits when grown in a shaking liquid medium; however, if an object (such as a plastic micropipette tip) is placed in a test tube, the object is moved in the medium. The strong eddy seems to only stimulate -78- 201239091

The morphological transfer of AQ3 00 02 prevents the vegetative cells from separating (linking) after splitting and producing large filamentous agglomerates. This phenotype can be found by microscopy and direct observation of the culture tube after 8 to 9 hours of growth. The images provided in Figure 3 were compared and they were obtained as follows. AQ30002 and QST713 wild type glycerol preservation bacteria are grown overnight on nutritious agarwood boards. One colony on each plate was placed in an 8 ml snap cap test tube containing 3 ml of Luria gravy, and a 1 ml DN-free enzyme was placed in the inoculated tube. The tip of the pipette. One colony from each plate was also grown in a test tube under the same conditions as the micropipette tip. The test tube was shaken at 260 ° C at 3 7 ° C, and the growth was compared using an optical microscope after 8 to 9 hours. Several bacillus genes (e.g., sinR) have previously been identified as activators of biofilm production or (when mutated) as production genes for constitutive biofilms. According to a private communication from Dan Kearns (University of Indiana), when grown in liquid medium, the sinR mutant strains form a "blocky", and this mutant strain produces organisms at any time regardless of environmental signals. The idea of the membrane is the same. This property is not desirable for commercial development. It is generally believed that effector genes (such as SinR) will not be good commercial candidates downstream of biofilm production. Conversely, swrA appears to be part of a natural cell switch that allows Bacillus cells to adjust their environment. Although swrA has not previously been described as a biofilm-regulating gene, it has been thought to have the effect of transferring two different morphological states of cells in a liquid medium: single planktonic cells or long chains of connected cells (Kearns and Losick) , Cell Population -79- 201239091

Heterogeneity During Growth of Bacillus subtilis ” Genes and Development (2005): 19, pp3083-3094.) Consistent with this report, swrA mutant cells still respond to environmental signals. These cells grow when grown in liquid media. It becomes a single cell or chain, but does not seem to agglomerate or form a biofilm. Unexpectedly, when grown on root or solid medium, these cells begin to produce dense biofilms. This is the idea of the normal gene switch of the swrA line. Consistently, the switch is capable of transferring cells to produce different types of biofilms and (because it acts early in the pathway) still allows the cells to respond to environmental signals (eg, non-adherent growth when grown in liquid media and when Biofilm formation when growing in solid medium) Example 2 - Preparation of Bacillus subtilis QST713 whole broth in a bioreactor

It was observed that the B. subtilis QST7 13 culture medium grown in the bioreactor contained a small portion of sandpaper mutant cells. The preservation bacterial solution of Bacillus subtilis QST7 13 was cryopreserved in a vial of glycerol solution. To produce a whole mash in a bioreactor, thaw a vial of preserved bacteria and transfer the contents to a sterile vial containing appropriate medium such as Difco's nutrient broth. The bottle is cultured on a rotary shaker under conditions which promote growth of the organism, typically at a temperature between 25 ° C and 37 ° C and a rotational speed from 100 to 250 rpm. When the cell density in the bottle is high enough, the contents are transferred to freshly sterilized growth medium in the bioreactor. -80- 201239091

The bioreactor is controlled at a specific temperature, agitation, pH, and venting conditions to promote growth of the organism and performance of the active metabolite. Typical bioreactor settings include temperatures ranging from 25 ° C to 37 ° C, agitation rates from 200 to 1 000 rpm, buffered to maintain a pH between about 6 and 8, and between 0.2 and 1.0 Ventilation volume of VV. When cell growth and metabolite production are stopped (usually within 24 to 72 hours of culture), the culture broth is collected and then assayed for cell count and purity. After the tests are completed and accepted, the bacteria can be used in laboratory tests. Alternatively, preservatives and other additives such as thickeners and dispersions can be added to the bioreactor broth to simulate commercial articles for field trials. Implementation of 3-Quantification of sandpaper mutants in Bacillus subtilis QST7 13 Frequency of SERENADE® ASO from different commercial batches produced by AgraQuest (Davis, CA) diluted (1/10E + 6) and inoculated into nutritious agar Gum (NA) to obtain individual colonies. The sandpaper-like colony was confirmed to be a QST713 wild type mutant by 16S rDNA sequencing. The number of sandpaper colonies is quantified as a percentage of the total number of colonies produced. The presence of sandpaper colonies with characteristic colony morphology in the analyzed SERENADE® ASO commercial batch ranged from 〇.〇% to 1/3% (see Figure 4), in the analyzed SERENADE®MAX commercial lot. It is from 0.0% to 3.2%. As noted above, the EPA product label for SERENADE®MAX specifically states that the commercial product contains 14.6% dry QST713. If the commercial sample of 201239091 SERENADE®MAX contains up to 14.6% dry QST713 wild type/sand paper and at most only 3.2% of the 3 “variant strains, then the commercial sample of SERENADE®MAX contains at most (〇· 146x0.032) = 0.004672 = 0.4672% or less than 0.5% of dry sandpaper variants (ie swrA) 〇

QST713 cells derived from a single colony with wild-type morphology were also grown overnight in bottles with Luria broth, then diluted and seeded on nutrient gelatin to obtain individual colonies. The sandpaper colony was identified and the mutation frequency was calculated to be 1/16,000. This line is orders of magnitude higher than the frequency of spontaneous loss of functional mutations in other genes, and is consistent with the idea that the swrA is a variant locus in the hypermutation phase (D.B. Kearns et al., “Genes

Governing Swarming in Bacillus subtilis and Evidence for a Phase Variation Mechanism Controlling Surface

Motility, Molecular Microbiology (2004), 52:3 5 7-

36 9). The nucleotide sequences of the swrA genes of 6 individual sandpaper colonies were sequenced. All six colonies were negative for swrA. Therefore, we conclude that in QST713, all sandpaper colonies are negative for swrA. Implementation of 4-Quantification of Sandpaper-like Mutation Frequency in Commercial Bacillus Strains A variety of other commercial biopesticide preparations containing Bacillus strains were also analyzed to determine whether cells having sandpaper-like morphology could be identified. As used herein, "sand-like" or "sp-like" refers to cells having colony morphology similar to the colony morphology of QST713 sandpaper cells (see, for example, Figure 1) grown on nutrient gelatin. -82- 201239091 The commercial strain was grown in liquid medium, diluted, and inoculated with nutrient gelatin (NA) to obtain a single colony as described in Example 2. The frequency of sandpaper-like colonies in these commercial products ranged from 0% to 0.7% (see Table 2). Table 2 Frequency of sandpaper-like cells in representative bacilli commercial biopesticide Commercial plant species Colony number Sandpaper-like colony number Sandpaper-like colony percentage Kodiak GB03; B. subtilis 8,096 4 0.0494 Companion GB03; Bacillus subtilis (B. subtilis) 2,957 0 NA Taegro FZB24; Bacillus amyloliquefaciens 19,272 5 0.0259 Rhizovital FZB42; B. amyloliquefaciens 3,784 8 0.2114 FolioActive KTSB; B. subtilis 27,984 2 0.0071 Yield Shield GB34; B. pumilus 818 6 0.7335 The most common colony morphology of these non-sand-like colonies is as follows: Kodiak® - shiny, raised center and wrinkled edges.

Companion® - bulge, 3D transparent center, wrinkled edges; an alternative phenotype (ie morphology) other than this wild type is a large mass (a big mass) °

Taegro® - round, raised center and rough uneven edges; see also 3 QST713 wild-type colonies.

Rhizovital® - a plateau-like; dense, bulging, unlit center. FolioActive® - bright, bulging center and wrinkle edge; unlike the diversity of Kodiak®; 2 QST713 wild-type colonies are also visible.

Yield Shield® - The center of the ridge and the flat surrounding edge, with small annular bubbles in the surrounding edges; four QST713 wild-type colonies are also visible. -83- 201239091 We analyzed the swrA gene of all sandpaper-like variants in these commercial products, and unexpectedly all were wild-type (swrA + ). Therefore, the morphology of the cells other than QST7 13 is not sufficient to predict the swrA mutation and improve the health of the plant. Example 5 - Identifying Gene Mutations That Cause Morphology of Sandpaper

A genome-wide shotgun sequence with multiple QST71 3 variant isolates with sandpaper morphology was used to identify gene mutations that caused the sandpaper phenotype. In addition to the AQ30002 isolate originally derived from QST713, four other QST713 mutant strains (ie, AQ30003, AQ30004, AQ30005, and AQ30006) exhibiting the sandpaper phenotype were sequenced. Using the next generation sequencing technique provided by Illumina, Inc. (San Diego, Calif.), generate sequence reads that cover approximately 70-fold of the genome of each isolate, and with reference QST713 Wild type genome alignment

Published tools for mutation detection such as MAQ (Li, H., et al., Mapping Short DNA Sequencing Reads and Calling Variants Using Mapping Quality Scores, Genome Res. (2008) 18, 1 8 5 1 - 1 858) and BWA (Li, H. and Durbin R.,

Fast and Accurate Short Read Alignment with Burrows-Wheeler Transform, B i o i n f o r m a t i c s (2009) 25, 1 754-1 760) is used to identify possible mutation locations. The following statistical and biological assumptions were used to filter false positives: 1· All five sandpaper isolates (ie AQ3 0002 to AQ3 0006) -84- 201239091 It is highly unlikely that identical mutations will be presented at exactly the same position. 2. If all five isolates have identical mutations, it is most likely due to a sequencing error in the reference genome. 3. The sandpaper phenotype is most likely due to a single mutation in one gene. 4 Mutations may occur in the coding region.

5. Mutations can cause violent changes in proteins. A single base change is considered to be a single base change if the mutation changes the affected codon to a stop codon or the start codon to a non-start codon. If the mutation causes a shift in the reading frame, it is considered as insertion and deletion. 6- Mutations are unlikely to occur in essential genes. By using the above hypothesis during the analysis, swrA was identified as the only candidate gene that caused the sandpaper morphology mutation of QST713 cells. The swrA mutant allele recognized in the above-described sequenced sandpaper mutant is then subjected to the Sanger legal sequence (Sanger, F., et al., "DNA Sequencing with Chain-Terminating Inhibitors, " Proc. Atl. Acad. Sci· USA (1 977) 74,5463 -5467) This region was confirmed in each isolate. The comparison was derived from representative sandpaper isolates AQ3 0002 and AQ30004 and from various wild-type Bacillus strains including QST713. The sequence alignment of the swrA transcript is expected to be shown in Figure 5. The Sang's sequencing method confirms that the swrA sequence in QST713 conforms to the reference sequence generated by the next generation sequence. Figure 5 compares the expected coding sequences of interest with The expected coding sequence of the swrA of Bsub_3610, which is well known to those skilled in the art of bacilli genetics. -85- 201239091 This analysis also confirmed that AQ30002, AQ30003, and AQ3006 all contain a deletion of 1 bp in swrA, resulting in a shift in the reading frame. And premature stop codons (see AQ30002 in Figure 5), and in AQ30004 and AQ30005, the swrA start codon is mutated to another (non-initial) codon (see AQ3 0004 in Figure 5).

The homologous gene of swrA is only present in a few species of Bacillus. In order to identify members of the B. subtilis branch that may have the swrA gene, the full-length 16S rRNA gene of the closely related Bacillus species is aligned using the multi-sequence alignment program ClustalW. The ClustalW alignment is then converted to the PHY LIP format to generate a parent relationship tree (see Figure 6). The public gene database is then queried to identify which strain has a proven swrA homologous gene sequence, such as Bacillus pumilus, Bacillus atrophus, Bacillus licheniformis, Bacillus subtilis, and Bacillus licheniformis The double asterisk is shown in Figure 6. «SwrA is an unusually unique protein with no identifiable proteins or any predicted function outside of this group. Since the 16S rDNA comparison showed that this group of Bacillus species (Bacillus subtilis branch) is monogenic and the swrA gene line is present in all four of the branches, we conclude that this gene appeared early in this line, most likely All the species present in the group.

Kearns, et al. (" Genes Governing Swarming in

Bacillus subtilis and Evidence for a Phase Variation Mechanism Controlling Surface Motility, Molecular

Microbiology (2004) 52(2): 357-369) identifies two possible initiation codons, TTG and GTG. GTG is 35 bases upstream of TTG" -86- 201239091

After mutating the codons independently, they observed that only the mutated TTG prevented the expression of the downstream reporter gene, and therefore concluded that this was the true initiation codon. We note that there are different opinions in the literature on the prediction of the start codon of the swrA translation (for example, here the start of the swrA translation is predicted to be the upstream of the swrA gene of the Bacillus subtilis subsp. NCIB 3610 strain of GenBank No. ABV8 9964.1 75 bp (Fig. 5); see also Zeigler, et al., 2008, "The Origins of 168, W23, and Other Bacillus subtilis Legacy Strains, " J. Bacteriol. 1 90(2 1 ): 6983 -6995 Citations. In addition, the predicted start codons in Kearns, et al. (2 004, supra) are atypical. Therefore, we performed a comparative sequence analysis between the multiple species of Bacillus subtilis. The genetic structure between species such as Bacillus subtilis branches is known to be highly conserved, so this method provides strong confirmation of gene characteristics such as translation initiation sites or major gene regulatory sequence positions. We compared strain QST713 wild type, FZB42 (liquefaction) Bacillus amyloliquefaciens, AQ2 808 (Bacillus brevis) and B. subtilis subsp. Spizizenii (Genbank No. N C_01 4479) is 100 bp upstream of the TTG start codon reported here. We found that no other start codon ATG or the other can generate a reading frame to produce a TTG starting from the report here. The swrA polypeptide from which the codon is initiated. As known to those skilled in the art of bacterial genetics, many contingent loci (swrA appears to be one of them) use alternative initiation codons. See, for example, Annu. Rev. Genet. 2006) 40:3 07-3 3. Therefore, our conclusion is that the true translation starting point is located at -87- 201239091 by the JTG codon predicted by Kearns, et al. Example 6 - QST 7 1 3 continuous flow of sandpaper cells Subgenerational

QST713 sandpaper mutant strain (such as AQ3 0002) with deletion in the swrA gene sequence in trypsin-containing soy broth (TSB) medium (17 g/L pancreatic digestion casein, 3 g/L soy flour papain digest, 5 The bottle of g/L sodium chloride, 2.5 g/L dipotassium hydrogen phosphate, 2.5 g/L glucose) remained stable after 15 passages. QST713 wild-type revertant cells were not found when sandpaper cells were seeded in the flask for 15 times and then seeded on NA. These results show that the sandpaper mutant strain is truly stable and capable of multiplication. Example 7 - Complementarity Analysis Method of SwrA in AQ30002

Experiments were conducted to confirm that the swrA·mutation line caused the plant growth phenotype. Two include the swrA gene and the swrA gene plus 300 nucleotides upstream of the coding region and are designated PPen_swrA (ie, the swrA gene under the transcriptional control of the constitutive promoter) and endoPro_swrA (ie, in its own promoter) The construct of the swrA gene under the control of the sub-transcription is produced from QST71 3 SWrA + genomic DNA using a primer containing a restriction enzyme site, which is used to sub-select the DNA fragment to be designed to exist. In an integrated ligament (ICE) compatible plastid vector in B. subtilis MMB869 (Wiep Klaas Smits and Alan D. Grossman, "The Transcriptional Regulator Rok Binds A + T-Rich DNA and Is Involved in -88- 201239091

Repression of a Mobile Genetic Element in Bacillus subtilis,” PLoS Genetics (20 10) 6(11): el 00 1 207,

Catherine A. Lee, et al., Identification and

Characterization of int (integrase), xis (excisionase) and Chromosomal Attachment Sites of the Integrative and Conjugative Element ICEBsl of Bacillus subtilis, ”

Molecular Microbiology (2007) 66(6): 1 3 56- 1 3 69)° contains i) the swrA gene under the control of a constitutive promoter for the pPenjwrA construct or ii) for the endoPro_swrA construct itself The concentrated circular plastid DNA of the swrA gene under the transcriptional control of the promoter was transformed into the donor strain Bacillus subtilis MMB 869 by natural transformation. MMB 8 69 comprises a B. subtilis integrated ligated element (ICE Bsl) transposon (see Smits and Grossman, supra) which facilitates the movement of DNA that is selected in the plastid vector into the bacillus. This occurs by natural transformation, where the desired DNA construct is inserted between two domains homologous to the position in the Bacillus genome. To allow for natural transformation, the MMB 869 cell line was grown in SPC medium (SPC medium: 10 ml 10X Spizizen, 1 ml 50% glucose, 4 ml 5% yeast extract, 2.5 ml 1% casein amino acid, 1.6 Ml 2.5 mg/ml tryptophan, 0.5 ml 1 M MgS〇4; l〇X Spizizen salt: 2% (NH4)2S〇4, 14% anhydrous K2HP〇4,6°/.Κ2ΗΡ04 '1% citric acid three Sodium dihydrate, 0.2% Mg2SO4*7H20), transferred to SPII medium (1〇111110 and 3卩1262611, 1111150°/. glucose, 2 11115% yeast extract, 1 ml 1% casein amino acid, 1.6 ml 2.5 mg/ml tryptamine-89- 201239091 acid, 1 ml 50 mM CaCl2, 0.5 ml 1 M MgS〇4)' Centrifuged into pellets and resuspended in SPII medium. The MMB869 cells were then added to a small volume of ME solution (0.200 ml of 10X Spizizen salt, 0.020 ml of 200 mM EGTA, 1.7 80 ml of sterile deionized water) containing the purified plastid DNA. The cells and DNA mixture were incubated at 37 ° C for 1 hour with shaking.

The cells were seeded on LB kanamycin gelatin plates and grown overnight at 37 °C. Colonies on several LB-kanamycin plates were affixed to LB chloramphenicol plates to confirm that the plastid had been inserted by a double crossover event. The newly transformed donor MMB 869 strain was used to transfer the pPen_swrA and endoPro_swrA constructs to the AQ3 0002 swrA- strain, respectively, by conjugation. The MMB 8 69 donor strain containing the pPen_swrA and endoPro_swrA ICE constructs was grown overnight on LB kanamycin plates. AQ30002_strepR (AQ3 0002 containing the streptomycin resistance gene) was grown overnight on LB agar. A single colony of the pp en_swrA and endoPro_swrA MMB 869 strains was transferred to LB + kanamycin. A single colony of AQ3 0002_strepR was also transferred to LB + streptomycin. The three cultures were grown to an OD600 of approximately 1.0, diluted with fresh LB to OD600 0.02 'after growth at 37 ° C for about 1 hour, xylose was added to induce cleavage of the ICE construct and transfer to AQ30002_strepR 〇 cells via conjugation After regrowth at 37 ° C for 1 hour, the OD600 of these cultures was approximately 0.9. 2.5 ml of donor cells were mixed with 2.5 ml of AQ30002_strepR cells' vacuum filtered through a sterile membrane filter. -90- 201239091 Remove the filter from the filter set and transfer to SMS Acacia (25 ml of 10X Spizizen salt and 3.75 g of seaweed in a total of 250 ml of deionized water) using aseptic technique and overnight at 30 ° C to cultivate. The cells were harvested by rinsing the filter plate with 5 ml of IX Spizizen salt (1:10 diluted 10X Spizizen salt in sterile, deionized water). 100 μΐ cells were seeded onto LB kanamycin/streptomycin plates and cultured overnight at 37 以 to identify

AQ3 0002_StrepR joins the transfer bacteria. The remaining cell fluid was pelleted by centrifugation, resuspended in LB, and inoculated onto LB kanamycin/streptomycin plates. We hypothesized that the complementation of AQ30002 with the pPen_swrA construct or the endoPro_swrA construct would result in loss of the sandpaper phenotype and return to the viscous wild-type QST713 swrA+ phenotype. In addition to colony morphology, we confirmed this complementarity by assessing whether the added swrA gene rescued the AQ30002 cluster, such as Joyce E. Patrick and

Daniel B. Kearns ("Laboratory Strains of Bacillus subtilis Do Not Exhibit Swarming Motility," Journal of Bacteriology (2009) 191(22): 7129-7133). See Figure 7. We also measured root colonization of AQ3 0002 cells containing the pPen_swrA construct or the endoPro_swrA construct. Tomato seeds were first sterilized with 70% ethanol followed by 10% bleach. The seeds were then rinsed with sterile deionized water and placed in separate wells of a 48 well plate containing a small amount of sterile water. The seeds were germinated under light at room temperature (high intensity, set to 8 hours of light time) and used after 5 to 7 days. The roots of these sprouted seeds are soaked in phosphate buffered saline (PBS) -91 - 201239091

In the cell suspension. To normalize the concentration of the cell suspension, 0.01 OD 600 nm was used because this is QST713 producing approximately OD6OOnm 10 of 10E6 CFU/ml. After soaking, each germinated seed was then placed in a test tube containing 12 ml of sterile MS medium (2.215 g/L Murashige and Skoog (MS) salt, 1.5% sucrose '1% acacia pH 5.7), allowing It was grown under light for about 1 week at room temperature. Root colonization (biofilm formation on roots) was visually observed using a Keyence digital microscope and scored from zero (indicating no root colonization) to three (representing large root colonization). In each test, the root portion soaked in sterile water was used as a negative control. result

Insertion of the pPen_swrA gene ICE construct to AQ3 0002_strepR (referred to as AQ3 0002_pPen_swrA_ICE cells) produces bacterial cells with partial viscous morphology at very low frequencies. Each of the junction-transferred bacteria was collected and re-lined on each LB kanamycin/streptomycin plate for confirmation and future experiments. Most of the concomitant transfer bacteria maintain a sandpaper-like morphology or a mixture of sandpaper and viscous. Inserting the end〇Pr〇_SwrA ICE construct into AQ3 0002_strepR (called AQ3 0002_endoPro_swr A: ICE cells) produces bacterial cells with 100% viscous morphology. No sandpaper-like colonies were observed. Each isolate was collected and re-lined on each LB kanamycin/streptavim plate for confirmation and future experiments. These results are identical to the results of ICE insertion into AQ3 00 1 5_strepR, which is independent of QST-92-201239091 713 Strain-resistant strains (data not shown).

To confirm that AQ30002_strepR and AQ3 00 1 5_strepR maintain the original swrA mutation, and that the pPen_swrA'_ICE and endoPro_swrA_ICE constructs contain the wild-type version of swrA, the genomic DNA was purified from two separate isolates of each of the junctional transfer bacteria experiments, and PCR was performed to expand Increase the endogenous swrA locus and the swrA_ICE construct. These PCR products were sequenced to confirm that the endogenous swrA locus was mutated and that the swrA_ICE construct system was wild type. Further characterization of the AQ30002_endoPr〇_SwrA-_ICE cells included growth in liquid media to form long chains/cakings compared to AQ30002, and the ability of these strains to cluster with AQ3 0002 using qualitative and quantitative tests. AQ3 0002_endoPro_swrA__ICE cells exhibited a fuzzy and transparent nature compared to the height-linked/caking AQ 3 0002 when shaken overnight at 30 ° C and 250 rpm in LB liquid medium in 14 ml caps. To test the clustering ability, the overnight culture was inoculated on 0.7% LB acacia using an inoculating loop, and after drying, it was grown at 37 ° C for about 10 hours. After growth, the AQ30002_endoPro_swrA__ICE cells clustered on most plates to a similar extent to wild-type QST713, which is quite different from AQ3 0002 cells. The AQ3 0002_endoPro_swrA__ICE cells were cluster positive and were different from the AQ3 0002 strain (Figure 7). AQ3 0 0 02_endoPro_swrA-_ICE cells were clustered in a qualitative clustering assay at a rate similar to QST713 (data not shown). AQ30015_endoPro_swrA__ICE cells showed similar performance in all trials -93- 201239091 (data not shown).

The results of the root colonization test were consistent with those in the cell chain/caking and clustering experiments. In the root colonization test, AQ3 0002_endoPro_swrA__ICE cells did not colonize tomato roots, unlike the AQ30002 or AQ30002_strepR treatment groups (see Table 3 and Figure 8). In addition, the AQ30002_pPen_swrA_ICE treated biofilm appears to be more closely conforming to the biofilms of AQ3 0002 and AQ3 0002_strepR when viewing the biofilm of the best colonized root sample in each set of replicates, rather than the AQ30002_endoPro_swrA__ICE treatment group. Membrane (which appears to be similar to QST713 biofilm) (as shown in Figure 9). Table 3 Root colonization test results, each treatment 1 group has four replicas. Plant Root Treatment No. 1 Replica No. 2 Replica No. 3 Replica No. 4 Replica Average Water 0 2 0 0 0.5 OST713 2 2 2 2 2.0 AQ30002 2 2 No Root 3 2.3 AQ30002 strepR 3 No Root No Root 2 2.5 AQ30002 endoPro swrA ICE 2 0 0 0 0.5 AQ30002 pPen swrA ICE 3 0 2 2 1.8

Example 8 - Film strength of AQ3 0002 liquid culture Cultured bacteria grown on the surface of a liquid medium may form a film of a somewhat continuous film called a film. This membrane consists of microbial cells and a secreted extracellular matrix. Thus, the film represents a liquid/gas interface biofilm. As further described herein, film strength can be determined by a test that punctures the film to determine if the film is broken. -94- 201239091 Two replicates from the Bacillus subtilis strain QST713 wild-type swrA + colonies (ie 100% SwrA + cells, grown from a single colony) (named wtl and wt2) and from Bacillus subtilis strain AQ3 0 Two copies of the colony of 002 swrA· (named spl and sp2) were grown in pork soup medium or Piggy medium (l〇g/L glucose, 8g/L yeast extract, 8g/L pork soup pH 8.5) To the mid-logarithm. QST713 wild type swrA + and AQ30002 swrA_ have similar growth rates in pork soup medium (see

Figure 1 shows the growth curve of 〇). QST713 wild-type swrA + and AQ3 0002 swrA· also have similar antibiotic susceptibility, similar growth patterns in the temperature range of 15 ° C to 65 ° C, similar growth on blood vegetable gum, and BioLog phenotype Similar metabolic properties as determined by microarray technology (Hayward, California) (data not available). The two strains were grown in 20 ml of pork soup medium at 30 ° C, 200 rpm. Aliquots were diluted in 24-well plate of Tryptic Soy Broth (TSB) medium (17 g/L tryptic digestin, 3 g/L soy flour papain digest, 5 g/L sodium chloride, 2.5 g/ In L potassium dihydrogen phosphate, 2.5 g/L glucose, it was placed on a laboratory bench and allowed to grow for 3 days at room temperature. Two samples of each strain had 4 replicates, so each strain had a total of 8 membranes for examination. Each film was pricked three times until the tip of the micropipette touched the bottom of the plate. The number of intact films maintained after puncture is compared to the number of ruptures. Both strains formed a thin film after growth for 3 days in TSB medium. The eight films formed by QST713 wild-type swrA+ were all ruptured after puncture, and only four of the eight films formed by AQ30002 swrA_ were ruptured -95-201239091 (see Figure 11). Example 9 - Characteristics of AQ3 0002 biofilm after root colonization Tomato seeds were surface sterilized with 70% ethanol and 10% bleach followed by rinsing with sterile deionized water.

For sterile germination, the seeds are placed between two sterile filter papers and sterile deionized water is added. The well plate was sealed with a parafilm, and the plate was placed under light at room temperature (12 hours dark / 12 hours light) for 7 days, and sprouted seeds appeared. The roots of these sprouted seeds were immersed in a phosphate buffered saline (PBS) suspension of AQ30002 swrA· or QST713 wild-type swrA+ cells. To normalize the concentration of the cell suspension, 0.01 〇〇 D6 〇〇 nm was used because this is QST71 3 which produces about 10E6 CFU/ml of about 〇D6〇〇nin 値.

To allow for sterile growth and root colonization, after soaking, each germinated seed is then placed in a sterile MS medium containing 12. ml (2.215 g/L Murashige and Skoog (MS) salt, 1.5% sucrose, 1% acacia pH In the test tube of 5.7), it was allowed to grow for 10 days under light at room temperature. Root colonization was visually observed using a Keyence digital microscope. The water control group was colonized without roots. QST713 wild-type swrA+ colonizes the entire root including the tip, and the biofilm is very blurred. AQ3 0002 swrA_ also colonizes the entire root including the tip, which appears to be denser and appears to bind more tightly to the root than the QST71 3 wild type SwrA+ (see Figure 12). -96 - 201239091

To confirm that the AQ3 0002 swrA·biofilm on the root surface has more dense properties than the QST713 wild-type SwrA + biofilm, additional samples were prepared as described above. After 1 week of growth under light at room temperature, the roots of the QST713 wild-type swrA + or AQ30002 swrA· cells were dehydrated, dried, coated with gold, and observed by scanning electron microscopy (SEM). The AQ30002 swrA·biofilm on the root surface was again significantly more dense than the biofilm formed by QST713 wild-type swrA+ (see Figure 13). It should be noted that this method underestimates the diffusion properties of the wild-type biofilm because this structure shrinks significantly during ethanol dehydration. In order to further compare the characteristics of the AQ3 0002 swrA·biofilm and the QST713 wild-type swrA + biofilm on the root surface, additional root samples were cultured and grown as described above, and analyzed by optical microscopy as described below. The roots were carefully removed from the gelatin, fixed in Karnovsky's fixative for 15 minutes, and dehydrated with increasing amounts of ethanol to 100%. It is then dried at a critical point, oxidized and immersed in a resin. Some of the resin blocks were thick cut, methyl blue stained, mounted, and observed with a microscope at a magnification of 10 to 4 〇1. The water control group had no root colonization. QST713 wild-type swrA+ cells form a thin, loose layer around the roots. The lack of a distinct biofilm may be an anthropogenic result, and the wild-type biofilm with scrim characteristics is lost during removal from the gum or during the washing and dewatering steps. In contrast, AQ3 0002 cells form a thick membrane around the roots. See Figure I4. The mutant biofilm adhered to the root surface under the same preparation conditions, indicating that the biofilm is physically stronger than the wild type structure -97-201239091 tough and more adherent. At the same time, other fixed and embedded root samples were thinly cut, mounted and observed with a transmission electron microscope. The water control group showed no colonization, while the QST713 wild-type swrA+ cells looked like bacteriological cells in the textbook. The AQ30002 cells showed completely different morphology. The diameter of the AQ30002 cells was significantly greater than (0.83 μιη +/- 0.066;

ρ<0·05;η=14; Fisher's test) The diameter of the QST713 cell (0·52 μπι + /- 0.027; ιι=11). In addition, the AQ30002 cells show much more complex morphology, with large electron-penetrating (white) regions appearing in the center of these cells, which appear to be extra sheaths or cell walls. See Figure 14. Example 10 - AQ3 0002 for enhancing the growth of tomato, corn and wheat plants

Preparation of Bacillus subtilis QST713 (ie a mixture of wild-type and sandpaper cells as seen in SERENADE®, see Figure 4), AQ30002 (swrA_), independent QST713 gene variant (713var) and Bacillus pumilus QST2808 (synonymous name AQ2808) The whole broth of each strain was poured as a seed. Each strain was inoculated in a seed bottle containing Luri a broth (LB), and these strains were grown overnight at 30 ° C. The next day, aliquots from various sub-bottles were inoculated to soybean-based The medium is allowed to grow until sporulation. Before the seed is poured, the final concentration of the whole broth is diluted to the application rate of 64 oz/mu of the commercial SERENADE® product according to the CFU per ml. 64 ounces/mu means the number of colony forming units per seed - 98 - 201239091, or 2.2 χ 108 CFU/plant. The amount used herein is calculated based on the cfu/ml of the whole mash. Fill the tray (Hummert, catalog number 14-3128)

Seed Teeth Mixture 'Every Hole Seeded into One Seed' uses 'Spring Treat Hybrid' corn seed, 'Derkwin' wheat seed, and ‘QualiT 21’ tomato seed. Therefore, the test includes monocots (i.e., corn and wheat) and dicots (i.e., tomatoes). Each tray was then treated with 2 ml of whole lysate sample and the untreated control group received 2 ml of water. These trays were placed under high intensity light at room temperature (about 300 Einsteins, set to 16 hours light/8 hour dark period). Watering when needed. Do not use fertilizer. Two weeks after the seeds were poured, the plant growth promoting properties of tomato, corn and wheat plants were observed. The leaves and root tissue are then harvested and dried and weighed in a paper bag. Plants treated with AQ3 0002 appear greener, taller and healthier overall than plants treated with water (see Figures 15, 16, 17). The dry weight of all plant tissues treated with AQ3 0002 was significantly higher than the dry weight of the corresponding tissues of the untreated plants, with the same dry weight except for the corn roots (see Figures 18, 19, 20). Example 11 - Increased production of processed tomatoes treated with AQ3 0002 in the field Two separate field trials were conducted near Escalon, California and near San Luis Obispo, California. The processing is carried out with a tomato field. This material was applied to the plant as a -99-201239091 pouring treatment at the time of transplanting. Bacillus subtilis strain QST7 13 (ie a mixture of wild-type and sand-like cells visible in SERENADE®, see Figure 4) and AQ30002 swrA· in a bioreactor grown in soy-based medium, prepared Similar to commercial SERENADE® ASO products and applied at a concentration equivalent to 3.4 quarts per mu (qt/acre) of commercial products. The plant growth stimulating agent (PGS) was applied at 625 ml/acre, and the RIDOMILGOLD® SL (Syngenta) containing the active ingredient mefenoxam was applied at a rate of 1 pint/acre. A random complete zone set (RCB) design with four replicas per treatment group was used. Each replica represents approximately 2 lines χ 25 inches. In the trials conducted near Aiskaron, the total marketable yield of plants treated with AQ3 0002 was significantly higher than the total marketable yield of the untreated control (UTC) (see Figure 21). Although none of the tests conducted in St. Louis Obispo produced higher than the unlisted control group (data not shown), this test is not considered to be a symbol of plant AQ30002 treatment possible. The typical yield is increased. Tomatoes are usually not grown in the San Luis Obispo region, and the soil type and climate in the area are significantly different from those in California, where tomatoes are usually grown. In addition, the test did not result in geographic dislocations in traditional tomato growing areas and in the wrong time harvests leading to problematic results. Example 1 2 - Treatment of corn plants with A Q3 0002 in the field to reduce the percentage of lodging and reduce the incidence of stem rot (Pythium) Field experiment in the vicinity of Paynesville, Minnesota -100 - 201239091

(Paynesville, Minnesota) was carried out using a Zea mays indentata (concave corn) Dekalb variety 4DK2C26' plant. The material is treated as a day or T-band diluted in water for application to the plant. Fertilizers or any other product is not included in the tank mix except with the specific whole broth of the plant growth stimulant (PGS). Bacillus subtilis strain QST713 (ie a mixture of wild-type and sand-like cells as seen in SERENADE®, see Figure 4) and AQ30002 swrA_ in a bioreactor grown in soy-based medium, modulated to resemble Commercial SERENADE® ASO product, applied at a concentration equivalent to 3.4 quarts per mu (qt/acre) of commercial products. The plant growth stimulating agent (PGS) was administered at 625 ml/aCre. A random complete set (RCB) design with four replicas per treatment group was used. Each copy represents 4 lines χ 30 inches. The treated corn plants did not show significantly different yields from the untreated control group (data not provided). However, corn plants treated with AQ3 0002 swrAl showed significantly less lodging compared to those treated or untreated with QST 713 (see Figure 22). In addition, all treatment groups including AQ3 0002 swrA· significantly reduced the incidence of stem rot caused by Pythium compared to the untreated control (UTC) (see Figure 25). In another field trial, AQ30002 swrA, which was grown in a soy-based medium in a bioreactor and conditioned to simulate a commercial SERENADE® ASO product, was grown at a rate of 2 quarts per acre. The bacterial bacteria of the nodular bacteria (especially soybean slow-growing Rhizobium) are administered together during the day. Plants (including roots) were harvested after four months to compare the root nodules of the untreated and treated samples. See Figure 2 3 and 2 4 -101 - 201239091 results. Example 13 - AQ 3 0002 Activity against leaf disease Although not considered a treatment for leaf disease, AQ3 0002 swrA was observed to have activity against the following plant pathogens: Xanthomonas campestris pv. campestris Meng Luke! Colletotrichum orbiculare (Cucumber anthracnose), Botrytis cinerea (Phoebe gray mold), Sphaerotheca fuliginea (Cucumber powdery mildew), Pseudoperonospora cubensis (cucumber dew disease), Puccinia recondita (wheat leaf rust), Pseudomonas syringae pv_ tomato (pre-expanded bacterial leaf spot), and grass buckwheat Blumeria graminis f. sp. hordei (barley powdery mildew) (data not available). Example 14 - AQ30002 activity against soil diseases QST713 (ie a mixture of wild-type and sand-like cells seen in SERENADE®, see Figure 4) and AQ3 0002 swrA· strains are grown in bioreactors based on soy-based medium The whole broth was tested against the activity of Pythium ultimum and Rhizoctonia solani at 20% concentration. The plant pathogenic bacteria were prepared in a "cultivation bag" containing 200 g of the stone and 600 ml of potato dextrose (PD) broth from Fungi Perfecti. The bag is inoculated with a whole plate of P. solani or Rhizoctonia solani, approximately one week old, and allowed to grow for one week before use. -102- 201239091

The seed germination mixture was wetted with 100 ml of deionized water per liter of mixture, followed by 8 g of the inoculum of the lyophilized Rhizoctonia and a 64 g/L mixture of Pythium ultimum. The inoculated mixture was then placed in a 2.5 inch pot. Uninfected mixtures were also used as uninfected controls (U 1C). After infection and placement of the mixture into the basin, each of the pots in each treatment group was treated with an individual treatment of 1 〇 ml. After pouring, each pot was planted with approximately 65 saplings (variety: 'Johnny’s Broccoli for Sprouting', catalog number 2108) using a measuring spoon. The pot was placed under high-intensity light after being saturated with water, allowing it to be evaluated after one week of growth. Individual seedlings in each replicated group were calculated to obtain the number of germinated seedlings of each treatment group and each disease. The results were compared to the uninfected control group (UIC) and the infection control group (1C) to determine activity (see Figure 26). The disease control system is determined by the number of seedlings that are emerged and survived in the soil inoculated with the specific pathogen. A field trial was conducted to compare AQ 3 0 0 2 2 and QST 7 1 3 prepared as described in Examples 1 1 and 12 (ie, wild type and sandpaper-like cells in a ratio of approximately 2,000:1, such as SERENADE® It can be seen to combat the effects of various soil plant pathogens. In the test of Rhizoctonia solani and the Verticillium wilt of lettuce, the effect of AQ3 0002 on disease control seems to be better than that of QST713. (Specific results not provided.) In the disease prevention trial, the AQ30002 did not outperform all QST713. An in vitro test was performed to test the ability of AQ3 0002 to control another soil disease to sclerotium (Sclerotium rolfsii). The preliminary results show that -103- 201239091 AQ3 0002 is more effective against QST713 (ie, a mixture of wild-type and sand-like cells as seen in SERENADE®). (Results not provided.) Example 15 - AQ30002 against the intra-plant activity of Phytophthora capsici QST713 (ie a mixture of wild-type and sand-like cells seen in SERENADE®, see Figure 4) and AQ3 0002 swrA· strains were grown in In a bioreactor of soybean-based medium, the whole broth was tested against Phytophthora capsici at a concentration of 20%. The Phytophthora capsici is grown in V-8 agarensis, which releases zoospores from spores into sterile deionized water. The zoospores were then diluted to 2x1 0E4 zoospores/ml for inoculation (l〇ml/plant). Two-week-old green peppers (variety 'California Wonder') planted in the culture soil were treated with 10 ml of whole broth, and inoculated with Phytophthora capsici every other day. To monitor the development of the disease in green pepper plants and the protection provided by QST713 or AQ3 0002 swrA treatment, the plants were monitored over a period of 8 days. The chemical fungicide Aliette containing aluminum triethylphosphinate was also tested at concentrations of 3.2 mg/ml and 1.6 mg/ml. AQ30002 swrA-where the treatment of QST7 13 provides a greater amount of plant protection for plant survival over a longer period of time (see Figure 27). Example 16 - Plants treated with AQ3 0002 increased chlorophyll content from Bacillus subtilis QST713 (ie a mixture of wild-type and sand-like cells as seen in SERENADE®, see Figure 4) and AQ30002 -104- 201239091 swrAj strain The broth is prepared to be poured as a seed. Seed bottles containing Luria gravy (LB) were inoculated and grown overnight at 30 °C. The next day, 5 ml of the seed bottle was taken to inoculate the soybean-based medium. The bacteria in the bottle are grown until the sporulation is complete. Prior to seed treatment, the final concentration of whole broth was diluted to 4, 8, 16, 32, 64 and 128 oz/mu for commercial SERENADE® products based on CFU per ml.

Place the tray (Hummert, catalog number 14-3128) with a seed germination mixture and seed a seed into each well. Use QualiT 2 1 tomato seeds. Each tray was then treated with 2 ml of whole lysate sample and the untreated control group received 2 ml of water. These trays were placed under high intensity light at room temperature (approximately 300 Einsteins, set to 16 hours light/8 hour dark period). Watering when needed. Do not use fertilizer. The plant growth promoting characteristics of the tomato plants were observed 2 weeks after the seeds were poured. The chlorophyll content in the leaves was then quantified; 3 leaves were randomly selected in each treatment group to obtain 3 replicate samples by hole punching. The leaf sample was ground and extracted with 80% acetone (aq) and the OD6Q() nm of the extract was measured. Both treatments QST713 and AQ3 0002 swrA· had a very significant dose-dependent response, starting from about 16 〇Z/aCre until 128 〇Z/aCre resulted in greener and larger leaves compared to the H20 control group. At lower application rates (4 to 16 oz/acre), the AQ30002 swrA-treatment appears to be greener than the corresponding QST713 treatment. Comparison of QST713 and AQ3 0002 swrA# treated whole tomato plants and -105- 201239091 The images of individual leaves can be seen in Figures 28 and 29, respectively. In addition to visual observations, the chlorophyll content between the different application rates of QST713 and AQ30002 swrA·full broth was compared. Although not statistically significant, leaves collected from the AQ30002 swrA treatment group had a higher propensity for higher chlorophyll content than the QST713 treatment group at the corresponding application rate (except for 3 2 oz/acre, two of which appeared to have the same The amount of chlorophyll). See Figure 30. Example 17 - The activity of AQ 3 0002 for enhancing the growth of tomato plants is derived from Bacillus subtilis QST713 (i.e., a mixture of wild-type and sand-like cells as seen in SERENADE®, see Figure 4) and AQ30002 ^1^_ Whole mash fermentations were prepared for in situ seed treatment. A seed bottle containing Luria gravy was inoculated with a colony picked up from the NA pan, and these bottles were placed at 30 ° C and shaken at 200 rpm. On the next day, 5 ml of the seed bottle solution was taken to inoculate the medium 2. Medium 2 will contain 5% protein gland, 5% glucose, 3% yeast extract, 3% malt extract, 1.5% cottonseed extract '10% soy flour and 0.5% MgS04x 7H20. Prior to seed treatment, the final concentration of whole broth was diluted to a 64 oz/mu application rate for commercial SERENADE® products based on CFU per ml. 64 ounces/mu means the number of colony forming units per seed, or 2.2 MO8 CFU/plant. The amount used herein is calculated based on the cfu/ml of the whole mash. The tray (Hummert, catalog number 14-3128) is filled with -106- 201239091 seed germination mixture, one seed is planted in each hole. Use QualiT 2 1 tomato seeds. Each tray was then treated with 2 ml of whole lysate sample. The untreated control received 2 ml of water. These trays were placed under high intensity light at room temperature (approximately 300 Einsteins, set to 16 hours light/8 hour dark period). Watering when needed. Do not use fertilizer.

The plant growth promoting characteristics of the tomato plants were observed 2 weeks after the seeds were poured. We hypothesized that plants treated with AQ3 0002 would appear greener, taller, and healthier overall than those treated with water. We also assume that the dry weight of all plant tissues treated with AQ30002 will be significantly higher than the corresponding tissues of these untreated plants. However, these results show that culture group 2 (administered to plants as a control group) promotes plant health. Therefore, the applicant cannot obtain a definitive conclusion from this test. Example 18 - AQ30002 against the endophytic activity of Pythium ultimum and Rhizoctonia solani QST713 (ie a mixture of wild-type and sand-like cells seen in SERENADE®, see Figure 4) and AQ3 0002 swrA· strains grown in medium 2 (5% protein gland, 5% glucose, 3% yeast extract, 3% malt extract, 1.5% cottonseed extract, 10% soy flour and 0.5% MgS04x 7H20) The activity against the ultimate Pythium and Rhizoctonia solani was tested at a concentration of 2% by weight of the whole broth. The plant pathogenic strain was prepared in a "cultivation bag" containing 200 g of vermiculite and 600 ml of potato dextrose (PD) broth from Fungi Perfecti (Olympia, WA). -107- 201239091 The bag is inoculated with a whole plate of P. oleifera or Rhizoctonia solani, approximately one week old, and allowed to grow for one week before use. The seed germination mixture is moistened with 100 ml of deionized water per liter of mixture, followed by 8 g of inoculum per liter of the inoculum of Rhizoctonia solani and 64 g/L of the mixture of the ultimate Pythium infection, followed by 2.5 English. In the basin of the pot. Uninfected mixtures were also used as uninfected controls (UIC). After infection and placement of the mixture into the basin, each pot in each treatment group was topped with 1 〇 ml of each. After pouring, each pot was planted with approximately 65 snail seedlings (‘Johnny’s Broccoli for Sprouting’, catalog number 2108) using a measuring spoon. The seeds were covered with an uninfected culture soil and the pots were placed on a non-porous dish containing deionized water until all the pots were saturated with water. After the pot was saturated with water, it was placed under high-intensity light and allowed to grow for one week. Individual seedlings in each replicated group were calculated to obtain the number of germinated seedlings of each treatment group for each disease. The results were compared with the uninfected control group (UIC) and the infection control group (1C) to determine the activity. The disease control system is determined by the number of seedlings that are emerged and survived in the soil inoculated with the specific pathogen. In terms of disease prevention, this test did not differ from the results observed with the same strains grown on soybean basal medium. Example 19 - AQ3 000 2 against the intra-plant activity QST713 of Phytophthora capsici (ie a mixture of wild-type and sand-like cells seen in SERENADE®, see Figure 4) and AQ30002 swrA_ strain grown in medium 2 (5% protein Gland, 5% glucose, 3% yeast extract, 3% malt-108- 201239091 extract, 1 · 5 % cottonseed extract, 1 〇% soy flour and 〇. 5 % M g S Ο 4 χ 7H20 In the whole, the whole broth was tested against the activity of Phytophthora capsici at a concentration of 20%. The zoospores of Phytophthora capsici were prepared on V-8 carrageenan and diluted to 2χ104 zoospores/mi for inoculation (i〇mi/plant).

The two-week-old green pepper (variety 'California Wonder') planted in the culture soil was treated with 10 ml of whole broth, and the next day was inoculated with Phytophthora capsici. After one week, the total number of dead/not dead green peppers in each treatment group was calculated. Mortality was compared between the treated group and the infected control group (1C) and the uninfected control group. The chemical fungicide Aliette containing aluminum triethylphosphinate was tested at concentrations of 3.2 mg/ml and 1.6 mg/ml. To monitor the development of the disease in green pepper plants and the protection provided by QST713 or AQ3 00 02 treatment, the plants were monitored during 8 days. Treatment with AQ30002 compared to QST713 (i.e., a mixture of wild-type and sand-like cells visible in SERENADE®, results not shown) provides greater plant protection for plant survival over a longer period of time. Example 20 - Bacillus subtilis 3610 SwrA·mutant strain enhances tomato plant growth. 361 0WT Bacillus subtilis (ie, wild-type cells, here referred to as 3610 or 3610 WT) and 3610 swrA· individual lysate were prepared. To pour as a seed. The 3 6 1 0WT Bacillus subtilis strain is described in Kearns, 2004. The 3610 swrA_ mutant line refers to the swrA. mutation described in Kearns, 2004, which has 8 consecutive insertions of A:T base pairs at positions 26 to 34 of 3610. Each strain was drawn on a nutrient-yellow-109-201239091 gel (ΝΑ) and inoculated to the seed bottle after 3 days. A seed bottle containing Luri a gravy was inoculated with a colony picked up from a tray which was placed at 30 ° C and shaken at 200 rpm. The next day, 5 ml of the seed bottle was taken to inoculate the soybean-based medium. Prior to seed pouring, the final concentration of whole broth was diluted to a 64 oz/mu application rate for commercial SERENADE® products based on CFU per ml. 64 ounces/mu means the number of colony forming units per seed, or 2.2 M08 CFU per plant. The amount used herein is calculated based on the cfu/ml of the whole mash. The trays (Hummert, catalog number 14-3128) were filled with Sunshine No. 3 culture soil (Sun Gro Horticulture) (wet and sterilized for 1 hour, then ventilated for 3 days), seeded in each well a seed. Use ‘Spring Treat Hybrid’ corn seed, ‘Derkwin’ wheat seed, and ‘QualiT 21’ tomato seed. Therefore, the test includes monocots (i.e., corn and wheat) and dicots (i.e., tomatoes). Each tray was then treated with 2 ml of whole lysate sample and the untreated control group received 2 ml of water. The tray is absorbent from the bottom by placing the tray in a tray filled with water without holes. These trays were placed under high intensity light at room temperature (approximately 300 Einsteins, set to 16 hours light / 8 hour dark period). Watering when needed. Do not use fertilizer. The plant growth promoting characteristics of the tomato plants were observed 2 weeks after the seeds were poured. The surface area of the leaves is then quantified. The 3610 WT treated plants did not show greener or higher than the water treated plants. Conversely, plants treated with 3 6 1 0 swr A· appeared to be greener and taller than plants treated with 361 0WT from -110 to 201239091 (data not shown). These results were quantified to compare the leaf surface area of plants treated with 3610 swrA_ (Figure 31). In the comparison of five randomly selected tomato seedlings, the average chlorophyll content of the first true leaves of the 3610 plants did not show a higher chlorophyll content (Fig. 32).

Similar tests were conducted in wheat and corn. Based on qualitative observations, the 3610 WT treated plants and the 3610 swrA treated plants were similar in height and color, but both were higher and greener than the water treated control group. However, these differences are quite subtle in monocots (in short-term greenhouse trials) and therefore may not be identifiable by this qualitative test. Example 21 - 3610 swrA·Intra-plant activity against Phytophthora capsici 36×WT and 3610 swrA· strains as described above were grown in a soy-based medium in a bottle, the whole broth was at a concentration of 20% Tested against the activity of Phytophthora capsici. The Phytophthora capsici is grown on V-8 agar extract for 1 to 2 weeks. At the end of this period, the portion of the disc outside the inch was cut with sterile forceps and discarded. Sterile deionized water was added to the pan to the height of the submerged gelatin, and cultured for 2 days at room temperature to facilitate sporangia production. The plate was then placed at 4 ° C for one and a half hours and then placed at room temperature for one hour to release zoospores in the sporangia. The concentration of zoospores was quantified using a hemocytometer disk under a microscope, and three photographs were taken at random and the average number of zoospores was calculated. The zoospores were then diluted to 2x1 04 zoospores/ml for inoculation (10 ml/plant). -111 - 201239091 Two-week-old green peppers (variety 'California Wonder') planted in culture soil were treated with 10 ml of whole broth, and inoculated with Phytophthora capsici every other day. These plants were observed for 8 days. The ratio of the treated group to the infected control group (1C) and the uninfected control group was then compared (see Figure 33). The chemical fungicide Aliette containing aluminum triethylphosphinate was also tested at concentrations of 3.2 mg/ml and 1.6 mg/ml. The 3610 swrA' treatment provided a greater number of plant-to-plant survival plant protections over a longer period of time than the 3610 treatment (see Figure 33). Example 22 - Activity of AQ3 0002 against nematodes The cucumber seed Sudan variety was tested to determine the activity of AQ3 0002 against the root-knot nematode (root knot nematode). A 50 ml centrifuge tube containing 20 g of sand and an unmalted seed was treated with a different ratio of AQ30002 whole broth. In order to obtain the whole broth of AQ3 0002, AQ30002 was inoculated in a seed bottle containing Luria gravy (LB) and grown overnight at 3 °C. The next day, aliquots from various sub-bottles were inoculated into 200 ml soy-based medium in a 1 L shake flask to grow until spore formation. Briefly, the shaker flask is maintained at a temperature between 30 ° C and 32 ° C and the shaker is set at 200 to 220 rpm. After about 3 days of culture, when the cell growth and metabolite production are stopped, the cultured seed solution is collected to cause the treated seed to germinate and grow in the greenhouse. Four to five larvae of the root-knot nematode were inoculated in each test tube 4 to 5 days after treatment (DAT). On the 10th day after the treatment, the percentage of the young-112-201239091 seedlings formed roots was recorded at 0 to 4 points as described in Table 4.

The roots were then stained with acid fuchsin to observe nematode penetration and development and observed under a Leica dissecting microscope. In terms of nematode penetration, the total number of nematode larvae in each root was calculated. In terms of nematode development, the number of all fatty larvae including second instar larvae (J2) and third instar larvae (J3) was calculated. As described in Table 4, the nematode penetrated to the roots and the nematode developed after penetration. Details of the techniques utilized can be found in C.O. Omwega, et al., “A

Nondestructive Technique for Screening Bean Germ Plasm for Resistance to Meloidogyne incognita," Plant Disease (1988) 72(11): 970-972) Table 4 The score of the anti-nematode activity of the bacterial whole broth. The root 瘿 index is based on the root The percentage of root mites was formed. The penetration score was calculated as the total number of nematode larvae relative to the number of nematode larvae in the untreated control group (UTC). The developmental score was reflected in the nematode larvae in the roots (J2 late/J3) Total number. Roots; Index penetration score Development score 0 Sister y» \\ 0 Μ / > Λ\ 0 No 1 1 to 24% 1 1 to 10% 1 1 to 3 2 25 to 49% 2 11 to 50 % 2 3 to 10 3 5〇 to 74% 3 51 to 75% 3 11 to 30 4 > 75% 4 76 to 100% 4 > 30 Figure 34 shows the application of AQ30002 whole acid yeast to reduce root roots. It was shown that the application of various ratios of AQ30002 reduced root formation, penetration and development compared to the untreated control group. It should be noted that since these data are based on the above scoring system, dose anti-113- may not be observed. 201239091 should be. Example 23 - AQ3 0002 prevention The effect of the root-knot nematode of the eggplant was tested in tomato seeds to test the effect of AQ3 0002 on controlling the eggs of the root-knot nematode (K. javanica). The first batch of AQ300 02 was prepared in the bioreactor at different time points. And the second batch of AQ30002. Briefly, a small vial of the stock solution was thawed and transferred to a sterile vial containing Difco's nutrient broth, which was then placed on a rotary shaker. Culture (culture temperature between 28 ° C and 32 ° C, rotation speed 200 to 2 20 rpm) to promote cell growth and obtain high cell density, then add it to 12 L in a 20 L bioreactor Soybean is a substrate growth medium. The bioreactor is set to a temperature range of 30 ° C to 32 ° C, an agitation speed from 500 to 1 000 rpm, buffered to maintain a pH between 6 and 8, and Aeration between 0.5 and 1.0 VVM. After approximately 3 days of culture, the culture broth was collected when cell growth and metabolite production stopped. Three-week-old tomato plants were treated with AQ3 0002. The pot was placed in the greenhouse for 10 days, after which Inoculate 5000 root-knot nematode ("RKN") eggs in each pot. Harvesting plants 42 days after nematode inoculation. Collecting eggs from tomato roots using 1% NaOCl solution, such as Hussey RS, Barker KR, A Comparison of Methods of

Collecting Inocula of Meloidogyne spp., Including a New Technique," Plant Disease Reporter, 1973; 57: 1025-1028. AQ3 0002 reduces the number of eggs in the root-knot nematode-114-201239091 observed in each plant. These data are directly calculated for the number of eggs, non-use scoring system. The results compared with untreated samples (UTC) are shown in Figure 36. Example 24 - Screening for swrA-spontaneous mutations

Screening of the swrA_spontaneous mutant strain from the Bacillus subtilis branch can be carried out as follows. A single colony from a suitable acacia board was inoculated in 250 mL Luria broth (LB) liquid medium in a 1 liter bottle. The bacteria were incubated at 30 ° C for 20 to 20 hours on a rotary shaker at 200 rpm. The formed bacterial solution was serially diluted to 1×1〇3, 1×10 0δ, and 1×109 in a phosphate buffer solution, and each dilution of 100 μl was inoculated on a suitable acacia board at 37 ° C. Incubate for 12 to 16 hours. The dilution plates producing 150 to 200 single colonies were placed in a 4 °C refrigerator for 24 to 48 hours. After standing at 4 ° C for 24 to 48 hours, the possible swrA· isolates showed a clear white, sand-like morphology on the acacia board, whereas the isolates that did not exhibit this morphology of swrA+ usually became transparent. And it is difficult to see on the board. A possible swrA mutant was collected and cultured overnight at 30 ° C at 250 rpm in LB. Genomic DNA isolation was performed using the MoBio ultraClean® microbial DNA isolation kit centrifugation program provided by the MoBio kit. The mutant strain is identified by PCR and sequencing of the swrA locus, using the genomic DNA isolated as described above, and using the following Bacillus-specific PCR primers or the general primers of interest for the selected strains for PCR amplification. . Liquefaction laser powder Bacillus (Bacillus amyloliquefaciens) -115- 201239091 BA_swrA_PCRFAAACAATGAAAAAAGCCGTTCTGG BA_swrA_PCRR TCCGTGATAATCAAAAGGCC Bacillus pumilus (Bacillus pumilus) BP_swrA_PCRF AAAGAATGATCTTCAGCTAC BP_swrA_PCRRATTAAAAACAGACCGACCGC Bacillus licheniformis (Bacillus licheniformis) BL_swrA_PCRFCATAATGAATAGAATTGACCCG BL_swrA_PCRRGAAACCCAGCTTGTCTAAAG Bacillus subtilis (Bacillus subtilis) BS_swrA_PCRF AATGAAACTTTTGCAAGTTGCC BS_swrA_PCRR AATCGATATTCCGAGTCCAC of unidentified Bacillus strain

Bac_swrA_PCRF ACGCTKTAYAARTGGCTSAC Bac_swrA_PCRRTCATCCAKAYCGTVACATTDG The following is a list of PCR procedures and reaction conditions for amplifying approximately 150 nucleotides of the swrA locus plus 3' and 5' UTRs: PCR reaction component per reaction 2.5 μΐ gDNA - final reaction solution £ 250 ng

5 μΐ GoTAQ 5x Buffer - Final Reaction Solution IX

1 μΐ GoTAQ MgCl2 - final reaction solution 1 mM

0.5 μΐ 10mM dNTPs - final reaction solution 0.2 mM 0·2 5 μΐ 0.1 iiMol pre-primer - final reaction solution 1 pMol 0.2 5 μΐ 0.1 nMol reverse primer-final reaction solution 1 pMol

0.25 μΐ GoTAQ - final reaction solution IX -116- 201239091 15.25 μΐ Η2〇 Total reaction volume 25 μΐ The appropriate PCR cycle conditions are as follows: 941 2:00 minutes 94°C 0:30 minutes 5 5 t 0 : 3 0 minutes

72 °C 2:00 minutes 25 cycles 7 2 °C 5 : 0 0 minutes Maintain 4 °C constant temperature 5% PCR reaction solution was observed on 1% canola sugar colloid using appropriate DNA dye and ladder . The PCR product is a single strand of approximately 700 nucleotides long. 5 μΐ of the amplified DNA was cleaned with 2 μM of Exo Sap-It enzyme prior to sequencing. The cleaned amplicons were sequenced using a Sanger method to pre- or reverse PCR primers. The swrA locus sequence recognizes any nucleic acid alteration, sieving or insertion using a ClustalW sequence alignment tool compared to a wild-type reference strain (preferably the same species). Mutations in the swrA locus result in altered colony morphology, promoted chaining during liquid growth compared to wild-type swrA+, loss of clustering ability of clustered bacilli on 0.7% acacia, and/or Strong root biofilm formation. Example 25 - Antisense constructs of the swrA gene attenuated by various methods for producing a swrA mutant SwrA + Bacillus strain can be constructed by PCR from genomic DNA derived from QST7 13 or other swrA + bacilli by -117-201239091 Amplification of the reverse complement of the swrA coding region. The PCR primer is designed to have a restriction enzyme cleavage site compatible with the insertion of a previously constructed endoPro_swrA plastid vector designed to be integrated with the integrated junction element present in B. subtilis MMB 86 9 ( ICE) compatible (Wiep Klaas Smits and Alan D. Grossman, "The Transcriptional Regulator Rok Binds A + T-Rich DNA and Is Involved in Repression of a Mobile Genetic Element in Bacillus subti 1 is, PLoS Genetics (2 010) 6 ( 11): e 1 00 1 207 ; Catherine A. Lee, et al., Identification and characterization of int (integrase), xis (excisionase) and chromosomal attachment sites of the integrative and conjugative element ICEBsl of Bacillus subtilis, ” Molecular Microbiology ( 2007) 6 6(6): 1 3 5 6- 1 3 69). The swrA coding region is inserted by restriction enzyme digestion of the endoPr〇_SwrA plastid and inserted into the reverse complement of the swrA gene. The swrA antisense construct was confirmed to be correctly inserted into the plastid vector by sequencing the purified plastid DNA without the nucleic acid introduced by PCR. See Example 7. Mutations in the swrA locus result in altered colony morphology, promoted chaining during liquid growth compared to wild-type swrA+, loss of clustering ability of clustered bacilli on 0.7% acacia, and/or Strong root biofilm formation. The mariner class transposon TnYLB-1 (Le Breton, Y., Mohapatra, N. R., and W. G. Haldenwang, 2 0 0 6. In Vivo -118- 201239091

Random Mutagenesis of Bacillus subtilis by Use TnYLB-1, a mariner-B ased T r an sp o so n, Ap p 1. Environ . Microbiol. 72:3 27-3 3 3 ) can also be used to produce swrA · Mutant strain. Due to the presence of the Himar-1 transposase, the mariner recognizes, cleaves and inserts itself into two reverse insertion (IS) elements, and then carries any exogenous DNA located between the IS elements » ΤηYLB A modified mariner transposon for Bacillus. A kanamycin resistance marker is inserted between the IS elements to rapidly screen the insert. TnYLB is transmitted by the plastid pMarA (Le Breton et al., 2006 - supra). In addition to conferring resistance to the host bacillus kanamycin, insertion typically results in loss of function mutations due to disruption of the open reading frame. The swrA·mutant strain can be produced by screening for loss of clustering ability or morphology of sandpaper-like colonies and confirming insertion of the transposon into the swrA locus. The pMarA system was introduced into the swrA + Bacillus strain by electroporation, which encodes the mariner IS element, the kanamycin resistance gene, and the himarl gene other than the IS element (to ensure that the element is stably present in the genome). The pMarA plastid backbone has a mis (macrolide-lincomycin-streptostatin B) resistance gene to ensure loss of the pMarA plastid after translocation. It has a temperature sensitive starting point to allow mis or kanamycin screening. The swrA + bacillus strain containing the pMarA plastid was grown in 3 ml LB + mis overnight at room temperature on a Ferris wheel mixer. The S'wrA + bacillus strain containing the pMarA plastid was diluted and inoculated on LB (to determine total colony forming units) and LB containing 20 pg/ml kanamycin (to determine the number of transposed strains) and Incubate overnight at 45 °C. The colonies were repainted -119- 201239091 lined on LB plates and mis boards containing kanamycin. Colonies with kanamycin resistance/mis sensitivity were retained for further analysis. The possible translocation of the translocated sub-swrA locus has a sandpaper-like colony morphology and reduced clustering ability on the 7%·7% LB acacia board. When identifying a putative swrA transposon insertion, the exact position of the insertion is determined by reverse PC R (iPCR). The genomic DNA derived from the transposon mutant is isolated and digested by a high frequency restriction enzyme such as Sau3 AI or TaqI. The digested DNA is rejoined to form a circularized DNA fragment. When an primer designed into the TnYLB transposon is used, a fragment containing an IS element of the transposon and a cyclized fragment adjacent to the host genomic DNA successfully produces a PCR fragment. iPCR Bow Tweezers: 2507AGGAGGAATTCTACGGAAGTGTTAATTTCATAC 2508TCCATGCTCGAGGAAGAGC 2509ACAGAAAGTCTCGAGATCGTC 2510CTCCTGGATCCTCAATGGCTTTTTGGAAATCAG The iPCR product was purified and sequenced with an amplification primer. The sequence tag of each mutant strain is produced and aligned with the genome sequence near the swrA locus. Transposons containing the genomic DNA of the swrA locus may disrupt the function of swrA. Attenuation of the swrA locus by gene translocation results in altered colony morphology, promotes chaining during liquid growth compared to wild-type swrA+, and loss of clustering bacilli on 0.7% acacia, And/or more robust root biofilm formation. -120- 201239091 All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials (similar or equivalent to those described herein) can be used to practice or test the invention, the preferred methods and materials are described herein. All cited literature, patents, and patent disclosures are hereby incorporated by reference in their entirety for all purposes.

The disclosures discussed herein are limited to their disclosure prior to the filing date of this application. The present invention should in no way be considered as an admission that it does not have the benefit of the prior invention. While the invention has been described with respect to the specific embodiments of the present invention, it is understood that the invention may be further modified and this application is intended to cover any variations, uses or adaptations of the present invention in accordance with the principles of the invention. Modifications of the present disclosure, which are known or customary in the relevant fields of the invention, are applicable to the essential features set forth above and in the scope of the appended claims.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the colony morphology of QST713 wild type and QST713 sandpaper mutants grown on nutrient gelatin boards. Unlike wild-type colonies, the colony morphology of sandpaper mutants is highly dense and highly hydrophobic. Figure 2 shows images of AQ30002 swrA· and QST713 wild-type swrA + cells in exponential growth phase in liquid culture. Figure 3 shows images of AQ3〇0〇2 swrA] “3 0002 ” in liquid cultures affected by shear and QST713 wild type SwrA + cells (“713”) -121 - 201239091. The upper image shows a 40-fold magnification of the growth of the cells in the medium without the micropipette tip inserted into the medium. The lower image shows a 10-fold magnification of the cell growth of the pipette tip inserted into the medium. Figure 4 shows the quantification of sandpaper colonies in a representative commercial lot of SERENADE® ASO. Figure 5A shows the alignment of various swrA genomic DNAs containing the expected swrA transcript. Bsub_168 = B. subtilis strain 168: Bsub_3610 = B. subtilis strain 3610; QST713 = QST713 wild type; AQ30002 and AQ30004 = representative strain of the present invention; Bamy_FZB42 = liquefied Bacillus amyloliquefaciens B. amyloliquefaciens) strain FZB42; Bpum_S AFR-03 2 = B. pumilus strain SAFR-032; and Blic_14580 = B. Licheniformis strain 1 4580. Figure 5B shows the alignment of various swrA genomic DNAs containing the expected swrA transcript. The abbreviations are the same as in Figure 5A, and Batr_1 942 = B. atrophaeus strain 1 942 and Bpum_2808 = B. pumilus strain 2808 » Figure 5C shows the expected swrA transcripts from them The ratio of various swrA proteins. The abbreviations have the same meanings as in Figures 5A and 5B, and Bpum_7061 = B. pumilus 7061. Figure 6 shows the phylogenetic tree of the species in the B. subtilis branch (i.e., Bacillus subtilis and all of the close relatives evaluated by 16S rDNA comparison) and the related species included in the root of the tree. Species with complete genome sequences are indicated by an asterisk. An asterisk ("*") further indicates that the strain -122-201239091 lacks the swrA homologous gene, whereas the species marked with two asterisks ("**") contain the swr A homologous gene. Other unlabeled strains within the B. subtilis branch are presumed to have swrA homologous genes based on their close parental relationship, but the genomic sequence data for these strains are currently not publicly available. Figure 7 shows QST713 swrA+ ("QST713"), AQ3 0002 swrA_ ("AQ3 0002") and various constructs based on these strains

Photograph of a 0.7% LB acacia gum cluster test plate. Figure 8 shows QST713 swrA+ ("QST713"), AQ3 0002 swrA_ ("AQ3 0002"), and various root-level colonization evaluations based on constructs of these strains, in which wild-type swrA is supplemented in AQ3 0002 swrA· cells to reduce roots. Colonization ability. Figure 9 shows the root biofilm image captured by a digital optical microscope, in which the biofilms of AQ30002_endoPro_swrA_ICE (supplemented strain) and QST 7 1 3 swrA+ ("QST713") have similarities, AQ3〇〇〇2_pPen_swrA_ICE (partial supplement) and AQ30002 swrA ' ("AQ3 0002") is similar. Figure 1 shows the growth results of QST7 1 3 wild type swrA + and AQ30002 swrA · sandpaper type duplicate strains in 300 °C pork soup medium. Figure 11 shows QST713 Film strength test results for each of the two replication strains of wild-type swrA+ ("713 wt") and AQ3 0002 swrA· ("AQ3 0002"). Figure 12 shows Bacillus subtilis AQ30002 swrA' ("AQ30002") and QST713 wild The root image of the type swrA+ ("QST713 wt") -123- 201239091. Figure 13 shows scanning electron microscopy (SEM) images of Bacillus subtilis QST713 wild-type swrA + ("QST713") and AQ30002 swrA· ("AQ30002") biofilm-coated root surfaces. Figure 14 shows optical microscopy images of thin and thick sections of roots treated with water, B. subtilis QST713 wild type swrA + ("QST713") and AQ30002 swr A ("3 0002 ").

Figure 15 shows the results of a greenhouse test to measure plant growth enhancement, in which the maize line is AQ3 0002 swrA_("AQ30002"), QST713 ("QST713", which is the ratio of wild-type swrA + and sandpaper swrA' cells according to SERENADE® products. For mixtures, see, for example, Example 3 and Figure 4) or other Bacillus strains. The figure shows the corn planted 2 weeks after the seed was treated, and the application rate was normalized to 64 oz/mu (acre) equivalent to the CFU rate used in the experimental product.

Figure 16 shows the results of a greenhouse test for measuring plant growth enhancement, in which wheat is subjected to AQ30002 swrA' ( " AQ30002 ”), QST713 ("QST713", which is a mixture of wild-type swrA+ and sandpaper swrA·cells according to SERENADE® product ratio. See, for example, Example 3 and Figure 4) or other Bacillus strains. The figure shows the wheat planted 2 weeks after seed seeding, and the application rate is normalized to the equivalent of the experimental product. The CFU rate is 64 oz/mu (acre). Figure 17 shows the results of a greenhouse test to measure plant growth enhancement, in which the tomato is AQ30002 swrA' ("AQ30002"), QST7 1 3 ("QST713", which is wild type For the mixture of swrA+ and sandpaper swrA cells in the ratio of -124 to 201239091 SERENADE®, see, for example, Example 3 and Figure 4) or other treatments using a soy-based medium produced by a soybean-based medium. For the tomato planted 2 weeks after seed seeding, the application rate was normalized to 64 oz/mu (acre) equivalent to the CFU rate used in the experimental product. Figure 18 shows the measurement of corn Greenhouse Test Results of the dry weight of roots and stems, wherein the corn line by AQ3 0002 ( "AQ30002"),

QST713 ("QST713" ' is a mixture of wild-type swrA + and sandpaper swrAl cells in the ratio of SERENADE® products, see, for example, Example 3 and Figure 4) or other Bacillus strains produced using soybean-based medium . Figure 19 shows the results of a greenhouse test measuring the dry weight of wheat roots and stems, which are AQ30002 ("AQ30002"), QST713 ("QST713" 'which is wild-type swrA + with sandpaper swrA· cells according to SERENADE For a mixture of the proportions of the product, see, for example, Example 3 and Figure 4) or other treatments using a strain of Bacillus produced from a soy-based medium. Figure 20 shows the results of a greenhouse test measuring the dry weight of roots and stems of tomato, which was subjected to AQ3 0002 ("AQ3 0002"), QST713 ("QST713" 'which is wild-type swrA + and sandpaper swrA· cells. For a mixture of SERENADE® product ratios, see, for example, Example 3 and Figure 4) or other treatments using Bacillus strains produced from soy-based media. Figure 21 shows the results of a field test for measuring the yield of tomato for processing, -125- 201239091 The tomato system for processing is produced from a mixture of Bacillus subtilis strain QST7 13 (wild type swrA + and sandpaper SwrA· cells according to SERENADE® product ratio, See, for example, Example 3 and Figure 4) ("QST713") or AQ30002 swrA_ ("AQ3 0002") plants treated alone or in combination with a plant growth stimulating agent (PGS). The strain was produced using a soybean-based medium. The experiment was conducted in Escalon, California. The treatment labeled "Exp " represents a selective experimental condition. Measurements with the same letter indicate that there is no statistical difference at P = 0.05 using the ANOVA. Figure 22 shows a field trial measuring the percentage of lodging of corn plants (stem breaks below the ear), the maize plant line Bacillus subtilis strain QST713 (wild-type swrA + and sandpaper 3 evaluation [six-cell mixture according to SERENADE® product ratio, see eg example 3 and Figure 4) ("QST7 1 3") or AQ30002 swrA_ ("AQ30002") Treated alone or in combination with a plant growth stimulating agent (PGS). The strain was produced using a soybean-based medium. The experiment was performed in Paynesville, Minn. The treatment labeled "Exp" represents a selective experimental condition. Measurements with the same letter 値 indicate that there is no statistical difference at P = 0.10 with the analysis of variance (ANOVA). Figure 23 shows an image of the root of soybean from a plant treated with AQ30002 swrA_ ("QRD154") and a bacterial agent during planting. Figure 24 shows a soybean root image from an untreated plant. Figure 25 shows the measurement of Bacillus subtilis strain QST713 (wild type -126- 201239091

a mixture of swrA + and sandpaper swrA_ffl cells in the ratio of SERENADE® products, see for example Example 3 and Figure 4) ("QST713") or AQ30002 swrA· ("AQ30002") alone or in combination with plant growth stimulating agent (PGS) Field test results in controlling corn rot stem rot. The experiment was conducted in Paynesville, Minnesota. The treatment indicated as "Exp " represents a selective experimental condition. Measurements with the same letter indicate that there is no statistical difference at P = 〇.〇5 when using the variance analysis (ANOVA). Figure 26 shows a comparison of QST713 (wild-type swrA + with sandpaper swrA - a mixture of cells in the ratio of SERENADE® products, see eg Example 3 and Figure 4) ("QST713") and AQ30002 swrA· ("AQ30002") against Pythium ultimum And the results of a greenhouse test on the activity of the disease caused by Rhizoctonia solani. Each bar represents the average 値 of four measurements, and the error bars represent the standard deviation. Figure 27 shows QST713 (mixture of wild-type swrA + and sandpaper swrA· cells in SERENADE® product ratio, see, for example, Example 3 and Figure 4) ("QST713") and AQ3 0002 swrA_ (in the greenhouse test during the 8-day period) "AQ3 0002") The time course of the activity of green pepper wilting caused by Phytophthora capsici. Note that the uninfected control ("UIC") overlaps with the chemical bactericidal agent curve. Figure 28 shows the increasing doses of AQ3 0002 swrA· ("AQ30002") and QST713 (wild-type swr A + and sandpaper swr A - a mixture of cells in the ratio of SERENADE® products, see eg Example 3 and Figure 4) (" QST7 13") treated tomato plants. -127- 201239091 Figure 29 shows a mixture of increasing doses of AQ30002 swrA' ("AQ30002") and QST713 (wild-type swrA + and sandpaper swrA· cells in proportion to SERENADE® products, see eg Example 3 and Figure 4 ("QST713") Comparison of individual leaves of tomato plants treated. Figure 30 shows the increasing doses of AQ30002 swrA_ ("AQ30002") and QST713 (wild-type swrA + and sandpaper swrA cells in a mixture of SERENADE® products, see eg Example 3 and Figure 4) ("QST713") treatment Chlorophyll content of tomato plants. Figure 31 represents the average surface area (five replicates) of plants treated with 3610WT and 3610swrA_ (represented by 361 Oswr A in the figure). Figure 32 shows the chlorophyll readings of plants treated with 3610 WT and 3610 swrA_ (represented by 3610 swrA in the figure). The result was the average 値 chlorophyll content of the first true leaves of five randomly selected tomato seedlings. Figure 33 shows the activity of Phytophthora capsici against 3610WT and 3610swrA_ (indicated by 3610swrA in the figure) against green pepper. Figure 34 shows the effect of treating the roots of roots infected with root-knot nematodes with AQ30002 swrA· (“AQ30002”) whole broth. Figure 35 shows the effect of different ratios of AQ30002 swrA_ ("AQ30002") on seedlings infected with root-knot nematodes. In particular, the results show the extent to which roots are formed and the effects on line penetration and development. Figure 36 shows the nematode eggs per plant compared to untreated plants (represented by UTC in the figure) after treatment with different batches of AQ30002 swrA· ("AQ3 0002"). -128- 201239091 Sequence Listing <110> AgraQuest Inc. <120> I-wing «Wen «Jianxian et al. to promote plants TW 100 147738 201M2-21 <150> US61/425.742 <151&gt 2010-12-21 <150> US61/505.023 <151> 2011-07-06 <150> US61/511,522 <151> 2011-07-25 <150> US61/556,039 <151>; 2011-11-04 <160〉 13

<170> Patentln version 3.5

<210> 1 <211> 351 <212> DNA dl3> Bacillus subtilis (Baci 1 lus subti 1 is) <400> 1 60 120 180 240 300 351 ttgaagaggg caagtattgt gcgtgaaaaa aaatattatg aattagtgga acaactaaaa gacagaacaa aagacgtcac attttcatca acaaaagcac taagtcttct tatgctgttc agcagatacc tggtcaatta cacaaatgtt gaatgcgttc acgaaatcaa tgaagagtgt gcgaagcatt atttcactta cttaatgaaa aaccataaac gtttaggaat taatctgacg gatattaagc ggtccatgct tctgatcagc ggcgtgatcg aggtggaggt tgaccactat ctgaaagatt tctctctctc aaatgtaacg ttgtggatga cggaagagag a

<210> 2 <211> 117 <212> PRT <213> Bacillus subtil is <400> 2

Met Lys Arg Ala Ser lie Val Arg Glu Lys Lys Tyr Tyr Glu Leu Val 15 10 15

Glu Gin Leu Lys Asp Arg Thr Lys Asp Val Thr Phe Ser Ser Thr Lys 20 25 30

Ala Leu Ser Leu Leu Met Leu Phe Ser Arg Tyr Leu Val Asn Tyr Thr 35 40 45

Asn Val Glu Cys Val His Glu lie Asn Glu Glu Cys Ala Lys His Tyr 50 55 60

Phe Thr Tyr Leu Met Lys Asn His Lys Arg Leu Gly lie Asn Leu Thr 65 70 75 80

Asp lie Lys Arg Ser Met Leu Leu lie Ser Gly Val lie Glu Val Glu 85 90 95 201239091

Val Asp His Tyr Leu Lys Asp Phe Ser Leu Ser Asn Val Thr Leu Trp 100 105 110

Met Thr Glu Glu Arg 115

<210> 3 <211> 350 <212> DNA <213> Bacillus licheniformis (Baci 1 lus subti 1 i s><400> 3 ttgaagaggg caagtattgt gcgtgaaaaa aatattatga attagtggaa caactaaaag 60 acagaacaaa agacgtcaca ttttcatcaa caaaagcact aagtcttctt atgctgttca 120 gcagatacct ggtcaattac acaaatgttg aatgcgttca cgaaatcaat gaagagtgtg 180 cgaagcatta tttcacttac ttaatgaaaa accataaacg tttaggaatt aatctgacgg 240 atattaagcg gtccatgctt ctgatcagcg gcgtgatcga ggtggaggtt gaccactatc 300 tgaaagattt ctctctctca aatgtaacgt tgtggatgac ggaagagaga 350 < 210 > 4 < 211 > 351 < 212 > DNA < 213 > Bacillus subtilis (Bacillus subti 1 is) < 400 > 4 ttcaagaggg caagtattgt gcgtgaaaaa aaatattatg aattagtgga acaactaaaa 60 gacagaacaa aagacgtcac attttcatca acaaaagcac taagtcttct tatgctgttc 120 agcagatacc tggtcaatta cacaaatgtt gaatgcgttc acgaaatcaa tgaagagtgt 180 gcgaagcatt atttcactta cttaatgaaa aaccataaac gtttaggaat taatctgacg 240 gatattaagc ggtccatgct tctgatcagc ggcgtgatcg aggtggaggt tgaccactat 300 ctgaaagatt tct Ctctctc aaatgtaacg ttgtggatga cggaagagag a 351 <210> 5 <211> 351 <212> DNA <2Ϊ3> Bacillus amyloliquefaciens <400> 5 ttgaagaggg caagtattgt gcgtgaaaaa aaatattatg aattagtgga acaactaaaa 60 gaccgaacaa aagacgttac attttcatca acaaaagcac taagtcttct tatgctgttc 120 agcagatacc tggtcaatta cacaaatgtt gaatgtgttc acgatatcaa tgaggagtgt 180 gcaaagcatt atttcaccta cttaatgaaa aaccataaac gtttaggaat caatctgacg 240 gatattaaac ggtccatgct tttgatcagc ggtgtaatcg aggtggaagt cgaccactat 300 ctgaaagatt tctctctttc aaatgtgacg ttgtggatga cggaagagag a 351

≪ 210 > 6 < 211 > 351 < 212 > DNA < 2Ϊ3 > Bacillus pumilus (Bacillus pumilus) < 400 > 6 ttgaaaaggg caagtattgt gagagagaaa aaatattacg agttggtaga ggagcttaag 60 201239091 agtcgtacga aagatgtgac gttttccgct agcaggtact tggtcaatta cacaacggta gctgagatat acttcaatta tttaatggat gacatcaaga gatcgatgca Gctgcttggc ttaaaagatt tttcactgtc gaatgtcaca acaaaggcat taagtctgct catgctgtta gaatcagtcg acgaaataga tgaagactgt aatcataaga gacttggtat aaacttaacc ggcatactag atgtagatgt caatcactac ctttggatga atcaggagaa a ^ >>> 1A li 11 <2<2<2<2 7 351

DNA Bacillus subtilis <220><221> misc_feature <222> (345)..(345) <223> n is a, c, g, or t <400> 7 ttgaagaggg caagtattgt gcgtgaaaaa aaatattatg aattagtgga acaattaaaa gacagaacac aagacgtaac attttcagct acaaaagcac taagtcttct tatgctgttc agcagatatt tggtcaatta caccaatgtc gaatcagtaa atgacattaa tgaggaatgc gccaaacatt attttaacta cttaatgaaa aaccataagc gattaggaat taatctgaca gatataaaaa ggtcgatgca tctaatcagc gggttattgg atgtggatgt aaaccactat ttaaaggatt tttcactatc gaatgtcacg ctgtggatga cgcangagag a

<210> 8 <211> 351 <212> DNA <213> Bacillus brevis (Bad 1 lus purai lus ><400> 8 ttgaaaaggg caagtattgt gagagagaaa aaatattacg agttggtaga ggagcttaag agtcgtacga aagatgtgac gttttcggct acaaaggcat taagtctact catgctgtta agcaggtact tggtcaatta Cacaacggta gaatcagtcg acgagatcga tgaagactgt gctgagatat acttcaatta tttaatggat aatcataaga gacttggtat aaacttaacc gacatcaaga ggtccatgca gcttctcggc ggcatactag atgtagatgt gaatcactat ttaaaagatt tttcactgtc gaatgtcaca ctttggatga atcaggagaa a

<210> 9 <211> 351 <212> DNA <213> Baci 1 lus atrophaeus <400> 9 ttgaagaggg caagtattgt gcgtgaaaaa aaatactatg aattagtgga acaattaaaa gaccgaacac aagacgtaac attttcagct acaaaagcac taagtcttct aatgctcttt agcagatatt tagtcaatta cacaaatgta gaatcagtga acgatattaa tgaggaatgc gccgagcatt attttaatta tttaatgaaa aatcataaac ggttgggaat caatctgaca gacataaaac gatcaatgct cctcatcggc ggtgtgttgg acgtcgaggt aaaccattat ttaaaggatt tctctctgtc taatgtgacg ctctggatga atcaggagag a < 210 > 10 201239091 < 211 > 351 < 212 > Wk < 213 > Bacillus licheniformis (Bacillus licheniformis) < 400 > 10 ttgaaaaggg caagtattgt gagagagaaa aaatactatg aattagtgga gttcgatcac aagacgttac gttttccgct acaaaggcag taggattgct agcagatacc tcgtgaacta cacttcggtc gaaagtgtgg aagatattaa gcggaacttt atttcaacta cttgatggac aaccacaagc ggctcggcat gacatcaagc ggtcaatgca gctgatagga gatattcttg atgtcgaggt ctgaaagatt tttctttgtc gaatgtgacg ctttggatga gccaggagaa < 210 > 11 < 211 > 672 < 212 > DNA < 2Ϊ3 > cumyl Wei Bacillus (Baci 1 lus subti 1 is) < 400 > 11 atgaagattt acggagtata tatggaccgc ccgctttctg caggggaaga atggcggccg tgtccgccga aaagcgggaa aaatgccggc gcttttacca gctcaccgca ccttgatcgg cgacatgctg atccgcaccg ctgcggcgaa cttgatccgg ccgggatttc attcggcgtc caggaatacg gaaagccgta cttccggaca tgcactttaa catttcccac tccgggcgct ggatcgtgtg tcaaaaccga tcggcattga tattgaaaaa atgaagcccg gcacgattga cggttttttt cgccgacgga atacagtgat ctgcaagcga aacaccccga gattattttt accatctgtg gtcgatgaaa gaaagcttta tcaagcaggc ctttccctgc cgcttgattc attcagcgtc cgccttaaag acgacggcca gagctcccgg acggacatga accttgtttc atccgcacat atgatgcgga aagctggccg tttgtgcggc gcatcccgat ttttgtgacg ggattgagat gaaaagctgc tg < 210 > 12 < 211 > 1791 < 212 > DNA di3 > comprising get spores Bacillus subtil is <400> 12 atgatttttg cattggatac gtatctcgtt ttactttccg ttgttatagg tttgaggatt cttatcactt ttatgactcc ggagcgttgc tgctgactgc ttgatcagcc atcatgtatg cgcttttatg tttcaccagt ataagcaggt acgggaatag gcgagctgct tgatctgctg aaggggatca cgctgtccgc gccgccgtcc aatacggggt gttccacacg attttgttcc ggctgttggc atggttcagc tattgttcat cggaggaagc cggatgattt cacgggtgct atcggcagga agcaaaatga ctcttcccgg gcgctgatca tcggcgcagg acgctgctcg tccgtcagct tacccagaaa aacgatctcg gaatcatgcc attgatgatg atcagacaaa gcataagctt gaaatcatgg gcctgcccgt aaagaaagca ttatgccggc ggtgcagagg ctgagaattc accatatcat gcagttaaaa 60 tatgctgttc 120 tgaggattgc 180 caatctgacc 240 caatcattac 300 a 351 ggatcggatg 60 taaggaggat 120 ggcttacgga 180 Catccccgcg 240 cgccgttgat 300 tatcgccaaa 360 tcagcagacc 420 cggaaaaggg 480 tgtgtccatt 540 cgaggagtat 600 gaaaacgtat 660 672 atatcaattt 60 cgtgagcatg 120 atggacgtac 180 agctgtgaca 240 cgtcagctgg 300 gaaagaaacg 360 tgcgggaggg 420 tgtggctttt 480 catcggcgga 540 cattgccatt 600

-4 -

(Bacillus subtil is) 201239091 ccgtctcttt gcacccatga gcttcagacg ttatacaaag aatgtgtgca gacgggcgcc catattaaaa tcatgccgca atttgatgag atcctgctcg gaacgcaggc tgccggacac atcagagatg taaaagccga agatctgctc ggcagaaagc cggtcaccct tgatacgagc aaaatttctg acagcatcaa gggaaaaacg attctggtca cgggcgccgg cggctcaatc ggttctgaga tctgccgcca gatcagcgcg tttcttccgc gggaaatcgt ccttctcggc cacggggaga acagcattca ttccgtacat accgagctgt ccgcacgctt cggcaaagag gtgctctttc acgcggagat cgccgatatt caggacagag ataaaatctt tgctttgatg aaaaaatacg agccgcacgt cgtctatcat gcggctgccc ataaacatgt gccgttaatg gaacataatc cggaagaagc cgttaaaaac aacattatcg gcacgaaaaa tgtcgccgaa gccgccgaca tgtgcggaac ggaaacattc gtgctgattt cttctgacaa agcggtcaat ccggccaatg tcatgggcgc gacgaaacgg tttgcggaaa tggtcatcat gaacctcgga aaggtcagca gcaccaaatt cgccgccgtc cgtttcggaa atgtgctcgg aagccgcggc agcgtcattc cgattttcaa aaagcagatt gaaaaaggcg gacccgtcac cgtcacgcac ccggcgatga caagatattt tatgacgatt cccgaagcgt caagactcgt cattcaggcg ggggcgcttg caaaagggcg gcagattttc gttctggata t gggagaacc cgtcaaaatc gtcgatctgg ccaaaaacct gattcattta tcaggctata cgacagaaca gattcccatc gaattctccg gcatccgtcc gggagaaaag atgtatgaag aattgctgaa tcataatgaa gtacatacgg agcagatttt tccgaaaatc catatcggga aagcggtgga cgggaattgg gccgtactca tccgttttat ggaggaattc agccgtctgc ctgaagaaga gctgagaaaa aggctgtttg aggcgatcga atcagtacat gaagaagcgg ccgcaggcgt g < 210 > 13 < 211 > 138 < 212 > < 213 ><400> 13 gtggaaaaca aattagaaga agtaaagcaa ttattattcc gacttgaaaa tgatatcaga gaaacaaccg actcattacg aaacattaac aaaagcattg atcagctcga taaattctca tatgcaatga aaatttct 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1791 60 120 138

Claims (1)

201239091 VII. Patent application scope 1. A composition comprising a spore-forming bacterial cell having a mutation at a jwrj homologous gene, wherein the mutation reduces the population of the bacterial cell compared to an isogenic bacterial cell not having the mutation Aggregating ability, and wherein at least about 70% of the bacterial cell line is spore. 2. The composition of claim 1, wherein the spore-forming bacterial cell line of the mutation is from a Bacillus species in the B. subtilis branch. 3. The composition of claim 1, wherein the spore-forming bacterial cells having the mutation comprise at least 3.5% of the total bacterial cells in the composition. 4. The composition of claim 2, wherein the spore-forming bacterial cell having the mutation comprises a wild-type homologous gene. 5. The composition of claim 4, wherein the spore-forming bacterial cell having the mutation further comprises a wild-type rfegg homologous gene and a wild-type epC homologous gene. 6. The composition of claim 5, wherein the j/p homologous gene, the degg homologous gene, and the homologous gene are each Bacillus subtilis (1^//), Bacillus amyloliquefaciens (5) · __&> gene of Bacillus brevis (5. puwi/wi), Bacillus licheniformis (5· /icAewi/orwi·?) or Bacillus atrophicus (5. airopAflei/·?) , the gene and the epC gene have a sequence identity of at least about 90%. 7. The composition of claim 2, wherein the mutation another 201239091 results in a more robust formation than the bacterial cell of the same gene without the mutation. Biofilm 8. 8 The composition of claim 7 wherein the more robust biofilm is flatter, drier and thicker than the biofilm system of the genetically modified bacterial cell not having the mutation. 9. The composition of any one of clauses 1 to 8 wherein the swrj homologous gene is at least about 90% identical to the svvrZ wild type gene of the same bacillus species as the bacterial cell having the mutation. The composition of claim 9 wherein the swd homolog has at least about 95% identity to the swd wild type gene of the same bacillus species as the bacterial cell having the mutation. 11. The composition of claim 10, wherein the wild type gene line is from the same strain of the bacterial cell having the mutation. 12. The composition of claim 9 wherein the strain is It is selected from the group consisting of Bacillus brevis (5·, B. aureus (5. flirop/jaewi), Bacillus liquefaciens (S. a/nWo/kwe/acien·?), Bacillus subtilis (5. 5Μ6η·/ί· ί) or Bacillus licheniformis (5. licheniformis) ° 13. The composition of claim 2, wherein the homologous gene is in the nucleotide sequence as provided in SEQ ID NO: 1 and 5 to 10 Either of which has a consistency of at least about 90%. 14. The composition of claim 2, wherein the mutation is located at position 26 to 2 - 201239091 corresponding to the gene as set forth in SEQ ID NO: 1. Position of one or more of 3 4 or located at one or more positions corresponding to positions 1 to 3 of the swd gene as shown in SEQ ID ΝΟ: 1. 15. Treating plants to enhance plant growth and promotion A method of plant health or controlling a plant disease, wherein the method comprises applying the composition of any one of claims 1 to 14 to the plant, a part of the plant and/or the location of the plant. 16. The method of claim 15, wherein the method comprises applying the composition to the soil. 17. The method of claim 15, wherein the plant part is selected from the group consisting of a seed, a root, a bulb, a tuber, a bulb, or a rhizome. 18·- Bacillus subtilis QST713 (storage number NRRL B-50420) swa·, cells. 19. The svvr of claim 18, wherein the cell comprises a change in at least one nucleic acid tester in the initiation codon and/or insertion or deletion of at least one nucleic acid base pair in the gene. 20. The swr of claim 19, wherein the insertion or deletion in the swd gene occurs at one or more of the base positions 26 to 34 of SEQ ID ΝΟ:1. 21. The cells of claim 18, which are selected from strains NRRL Β-5042 1 and NRRL Β-50455, respectively, strain AQ30002 (m QST30002) or strain AQ30004 (I卩 QST30004). A composition comprising the swrf cell of any one of claims 18 to 21 -3- 201239091 23. A method of treating a plant to enhance plant growth, promote plant health, and control plant diseases and pests Wherein the method comprises administering a swr{ cell according to any one of claims 18 to 21, or a composition as in claim 22, to the plant, a part of the plant and/or the plant location. -4-