TW201120448A - Method for assessing adverse drug reaction based on presence of particular T-cell receptors - Google Patents

Abstract

A method for assessing a risk of a patient for developing a cutaneous adverse reaction in response to a carbamazepine drug or an allopurinol drug based on presence of a T-cell receptor that includes a V β 11 chain having ISGSY or GLAGVDN as its nDn domain or a T-cell receptor that includes a V β 13A chain having YSPGR or FRDTGT as its nDn domain. Also disclosed herein are oligonucleotides or antibodies for detecting the nDn domains mentioned above and diagnostic kits containing the oligonucleotides or antibodies.

Description

201120448 VI. Description of the Invention: [Technical Field of the Invention] The present invention relates to a method for assessing the risk of a drug causing an adverse skin reaction, and more particularly to an assessment of the risk of skin adverse reactions caused by an azide or a steroid drug. method. [Prior Art] It is prudent to consider the administration of a conventional drug or a first-line drug that may cause a fatal drug allergy. According to Gomes et al., 2005, a variety of drug allergic reactions with varying degrees of influence, such as hypersensitivity syndrome (HSS), Steven-Johnson syndrome (SJS), toxic epidermis, are known. Toxic epidermal necrolysis 'TEN. Symptoms of allergic syndrome include, skin treatment, diffuse maculopapular eruptions, exfoliative dermatitis, eosinophilia, atypical circulating lymphocytes, leukocytosis (leukocytosis), acute hepatocellular injury, and worsen renal function. Stevens-Strong Syndrome and Toxic Epidermal Dissolution are characterized by biistering exanthema of purpuric macules and target-like lesions with varying degrees of mucosa Mucosal involvement and skin detachment. Stevens-Strong Syndrome is defined as less than 10% of the body surface area with skin collapse; Stevens_Strong Syndrome/Toxic Epidermal Dissolution is 1〇~3〇% of the body surface 201120448 product; toxic epidermis The lysis is more than 30% of the body surface area. Stevens-Strong Syndrome and Toxic Epidermal Dissolution have a mortality rate of 10 to 50% and are the most serious drug allergy disorder. Carbamazepine (CBZ) is a highly effective and frequently used anti-caries drug, but it often causes a drug reaction that is harmful to the skin. One out of every thousand to tens of thousands of Caucasians who use ammonia sulphate for the first time triggers a cutaneous adverse drug reaction. The sputum-aspiration drug is the most important cause of Asians suffering from Stevens-Johnson syndrome. In addition, Gomes et al., 2005, pointed out that the anti-gout drug allopurinol is another cause of drug reactions that are harmful to the skin, especially severe cutaneous adverse reactions (SCAR). HSS, SJS, and TEN) 〇 Clinical practice shows that the pathogenesis of drug allergy is immune mediators (Roujeau et al., 2004). In addition, according to pharmacogenomic research, such as anti-transcriptional inhibitors (abacavir, HLA-B57), gout prevention drugs such as isodecyl alcohol drugs (all〇purin〇l, HLA-B* 5 801) and anti-drugs Epileptic drugs such as carbamazepine (HLA-B*1502) have clearly linked the deep association between human leukocyte antigen-B (HLA-B) and drug allergy in drug allergy studies. Please also refer to the relevant content of U.S. Patent 7,470,513, Chung et al., 2004 and Hung et al., 2005. However, it remains to be seen which T cell receptors and whether there are other important molecules involved in the T cell-mediated drug allergic reaction. 5 SUMMARY OF THE INVENTION The present invention is based on unexpected experimental results: (1) T cell receptors having an ISGSY or GLAGVDN peptide sequence in the nDn region of the complementarity determining segment 3 (CDR3) of the variant β chain vβΐΐ Νβ 11 -ISGSY and νβ 11 -GLAGVDN are associated with methotrexate-induced Stevens-Strong Syndrome/CBZ-induced SJS/TEN. (2) In the nDn region of the complementarity determining segment 3 (CDR3) of its variant β-chain Vpl3A, the τ cell receptors VP13A-YSPGR and νβΠΑ-FRDTGT having YSPGR or FRDTGT peptide sequences are induced by isodecyl alcohol drugs. A severe skin adverse reaction (Allopurinol-induced SCAR) is associated. Accordingly, the present invention provides a method for assessing the risk of a skin adverse reaction caused by a patient with a carbamazepine drug or an allopurinol drug. The method comprises at least three steps: (1) taking a sample containing T cells from a patient (eg, a peripheral blood mononuclear cell sample); (ii) detecting a T cell receptor νβΙΙ in the aforementioned sample. The presence of ISGSY, vpll-GLAGVDN, Vpi3A-YSPGR or V|313A-FRDTGT; and (iii), based on the presence of the T cell receptor to assess the risk of skin adverse reactions. The presence of τ cell receptor νβ 11 -ISGSΥ or νβ 11 -GLAGVDN represents that the patient (eg, an individual with HLA-B* 1502) is a methotrexate drug that causes skin adverse reactions (Stevens _ Johnson & Johnson syndrome) Or a risk group for toxic epidermal lysis. The presence of sputum cells as VP13A-YSPGR or Vpl3A-FRDTGT ^ This patient (eg 'individuals with HLA-B*5801') belongs to sputum 201120448 sterol drugs cause severe skin adverse reactions (eg allergic syndrome, Steven) Risk group of s- Johnson syndrome or toxic epidermal lysis. In one embodiment, the presence of the T cell receptors νβΙΙ-ISGSY, νβΙΙ-GLAGVDN, VP13A-YSPGR^νβ13Α·FRDTGT can be detected by simultaneous quantitative polymerase chain reaction (real-time PCR), which is a quantitative quantitative polymerization. The enzyme linkage reaction uses an oligonucleotide chain which is specifically hybridized to the nucleotide sequence of the aforementioned nDn region or its complementary sequence. The simultaneous determination of each of the linkage reactions can be combined with the use of an immunoassay to increase the accuracy of detection. The immunoassay uses antibodies specific for νβΐΐ or νβ13Α. In another embodiment, the sputum cell receptor can be detected by using an antibody that specifically binds to the aforementioned nDn region. The present invention is further advantageous in that it is used to speculate the aforementioned oligonucleotide/antibody of the aforementioned T cell receptor. The invention further provides a kit consisting essentially of the aforementioned oligonucleotide/antibody described above, for example, comprising at least one essential nucleotide/antibody confirming the presence of at least one of the aforementioned T cell receptors, for example: (i) Detect The oligonucleotide/antibody of the aforementioned T cell receptor is tested, and optionally, (ii) at least one additional nucleotide/antibody is detected to detect at least one endogenous sequence as a control group. In addition, the scope of the invention also includes detecting the aforementioned oligonucleotide or the aforementioned antibody of the tau cell receptor to produce a test for evaluating the occurrence of skin reaction caused by methotrexate or isodecyl drug. (4) Use. The details of at least one embodiment of the invention are set forth in 201120448. Other features and advantages of the present invention will be apparent from the following description of the drawings and the detailed description and the claims. [Embodiment], this statement is based on the presence of a T cell receptor νβΙΙ-ISGSY or νβΙΙ-GLAGVDN based on the presence of a patient (eg, Mongolian species) to assess the patient's skin dysfunction caused by the ammonia sputum aspiration drug. The method of risk of reaction. The inclusion of any of the aforementioned cellular devices indicates that the patient has a higher risk of causing skin adverse reactions. Patients with both the T cell receptor and human leukocyte antigen - B* 1502 (HLA-B * 1502) are at higher risk. ISGSY (for example, translated by 5'-atctcaggttcctac-3) and GLAGVDN (for example, translated by 5'-gggttagcgggagttgacaac-3') with azide-aza-producing drugs to induce Stevens-Johnson syndrome or toxic epidermal lysis (CBZ- Induced SJS or TEN) The nDn region of the associated T cell receptor γβΐ 1 chain. The term "ammonia 醯 醯 呼 药物" refers to a compound having the following main structural formula and its derivatives,

For example, 10,11-dihydro-5H-diphenyl/b,f/azepine-5-carboxamide (10,ll-dihydro-5H-dibenso/b,f/azepine-5-carboxam ide). Examples of amidoxime drugs are, for example, but not limited to, carbamazepine, Oxcarbazepine (OXCBZ), and likikazepine 201120448 (Licarbazepine). Please refer to the relevant contents of U.S. Patent No. 7,47,513 and U.S. Patent Application Publication No. 20080145846. Further, β is a method based on the presence or absence of a sputum cell receptor vpl3A-YSPGR or νβ13Α-FRDTGT in a patient (eg, Mongolian species) to assess the risk of skin adverse reactions induced by isodecyl alcohol in the patient. . The inclusion of any of the aforementioned tau cell receptors indicates that the patient has a high risk of causing skin adverse reactions. Patients with both the sputum cell receptor and human leukocyte antigen-B*5801 (HLA-B*5801) have a higher risk of 0 YSPGR (eg by 5'-tactctcccgggagg-3, translation) and FRDTGT (eg by 5 '_ttccgggacacgggcact·3, translation) is the nDn region of the vβ 13 A chain of T cell receptors that are associated with severe dermatological drugs (SCAr). The term "isosterol drug" means a compound having the following main structural formula and a derivative thereof,

For example, [3,4-d]pyrimidine-4,6(5H,7H)-dione ([3,4-d]pyrimidine-4,6(5H,7H)-dione). Examples of isodecyl alcohols are, for example, but not limited to, allopurinol and Oxypurinol. Whether the T cell receptor νβΙΙ-ISGSY, νβΙΙ-GLAGVDN, Vpl3A-YSPGR or νβ13Α-FRDTGT can be detected by conventional methods, for example, simultaneous quantitative polymerase chain reaction, immunoassay or a combination thereof. 201120448 In one embodiment, the presence of the aforementioned tau cell acceptor is detected using an oligonucleotide strand that is specifically hybridized to a target sequence, eg, a sequence that transcribes ISGSY, GLAGVDN, YSPGR, or FRDTGT or Its complementary sequence. Essentially the oligonucleotide strand contains at least 15 nucleotides (eg, 20, 25, 30 or 50) and at least 80% identity to the complement of the target sequence (eg, at least 90%, 95% or 98) %). Preferably, the oligonucleotide strand forms a corresponding base pair with the entire target sequence and optionally comprises a V (variation) or J (junction) region. The oligonucleotide strand can be used as a probe to detect the presence of a target sequence by a hybrid reaction. "Specific heterozygous" means that under the condition of stringent and stringent heterozygous conditions, the oligonucleotide strand can form a corresponding base pair with the target sequence. The so-called stringent heterozygous conditions included a heterozygous reaction in a mixture of 68 ° C, 5 times SSC/5 times Denhardt's solution, and a mixture of 0.2 times SSC / 0.1 times SDS at room temperature. The so-called appropriate hybridization conditions include 3 times SSC cleaning at 42 °C. Salt concentration and temperature are variable parameters to optimize the specificity of the oligonucleotide strand and the target sequence. Experimental conditions for other heterozygous reactions are known in the art, such as Sambrook et al., 1989 'Molecular Cloning 'A laboratory Manual ' Cold Spring Harbor Press N. Y'Ausubel et al., (eds), 1995 ' Current Protocols in Molecular Biology (John Wiley & Sons, NY) at Unit 2.10 has relevant content. In order to improve the accuracy of detecting T cell receptors, the aforementioned method comprising an oligonucleotide chain can be combined with an immunoassay containing an antibody that specifically binds to vpll or νβ13Α. In another embodiment, an isolated antibody that specifically binds to one of the aforementioned nDn regions: ISGSY, GLAGVDN, YSPGR or FRDTGT is used to detect the presence of the aforementioned T cell receptor. "Antibody" means an immunoglobulin or a functional segment thereof, for example, F(ab')2, Fab', F(ab)2 that specifically binds to its cognate antigen. Or Fab. The antibody may be a monoclonal antibody, a polyclonal antibody, a chimeric antibody or a humanized antibody. It can also be a single chain antibody such as a single chain variant region fragment (scFv). By "isolated antibody" is meant an antibody that has substantially detached from its naturally associated molecules, i.e., the native molecule comprises up to 20% of the dry weight of the antibody preparation. The above-mentioned antibodies can be produced by a known method. For example, please refer to Harlow and Lane (1988), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York. In general, the aforementioned nDn region (peptide chain) can be prepared by chemical synthesis or by recombinant to form part of a fusi〇n polypeptide. The peptide chain or the fused polypeptide chain can be coupled to a carrier protein (e.g., KLH, keyhole limpet hemocyanin), mixed with an adjuvant, and injected into the host animal. Next, antibodies produced in the animal can be purified by affinity chromatography. Commonly used host animals include rabbits, mice, guinea pigs, and rats. Depending on the host animal chosen, there are a variety of adjuvants that can be used to boost the immune response, including Freund's adjuvant (complete or partial formulation), mineral gels such as aluminum hydroxide (aluminum hydroxide) ), CpG, surface activating substances such as detached 201120448 lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, pupils Serum protein (KLH, keyhole limpet hemocyanin) and dinitrophenol. Useful human adjuvants include BCG (bacille Calmette-Guerin) and a strain of Bacillus licheniformis antibodies, ie, heterogeneous populations of antibody molecules present in the serum of an animal that causes an immune response. Homogeneous populations) can be prepared by standard hybridoma techniques (eg, Kohler et al. (1975) Nature 256, 495, Kohler et al. (1976) Eur. J. Immunol. 6, 511 ' Kohler et Al. (1976) Eur J Immunol 6, 292 and Hammerling et al. (1981) Monoclonal Antibodies and T Cell Hybridomas, Elsevier, NY). In particular, monoclonal antibodies can be obtained by techniques for preparing antibody molecules by continuous cell lines in any culture. For example, in Kohler et al. (1975) Nature 256, 495 'US Patent No. 4, 376, 110, the human B-cell hybridoma technique (Kosbor et al. (1983)), Immunol Today 4, 72, Cole Et al. (1983) Proc. Natl. Acad. Sci. USA 80, 2026 and the African EBV-hybridoma technique Cole et al. (1983) and monoclonal antibody and cancer therapy (Monoclonal) Antibodies and Cancer Therapy), described in Alan R. Liss, Inc., pp. 77-96). The antibody may belong to any immunolymphoid species such as IgG, IgM, IgE, 12 201120448

IgA, IgD and subclass. The fused cell tumor of the present invention for producing a monoclonal antibody can be cultured in vitro (ζ>2 νζ>0) or VZ_VO in vivo. In vivo (/w v/vo) culture can produce high titers of monoclonal antibodies and is therefore a more advantageous method of preparation. In addition, the preparation of chimeric antibodies also has a variety of developed techniques for ffi'WMorrison et al. (1984) Proc. Natl. Acad. Sci. USA 81,6851, Neuberger et al. (1984) Nature 312, 604 and Takeda et Al. (1984) Nature 314:452. A chimeric anti-system refers to a molecule in which different portions of the molecule are derived from different animal species, such as a region of variability derived from a mouse monoclonal antibody and having a constant region of human immunoglobulin. In addition, techniques for preparing single-chain antibodies (U.S. Patent Nos. 4,946,778 and 4,704,692) may employ a phage or yeast database for the preparation of single-stranded variable region fragment (scFv) antibodies. The single-stranded variable region fragment (scFv) anti-system binds the heavy chain fragment and the light chain fragment of the variant region (Fv region) via an amino acid bridge. Furthermore, antibody fragments can be produced by conventional techniques. For example, the fragment includes, but is not limited to, an F(ab')2 fragment which can be decomposed by an antibody molecule by pepsin, and a disulfide bond which can be destroyed by F(ab')2. Fab fragment. Antibodies can be humanized by conventional techniques in the art. For example, a monoclonal antibody containing the desired binding specificity can be subjected to a personification procedure by a company in the market (Scotgene, Scotland; and Oxford Molecular, Palo Alto, Calif). A pure human antibody, as expressed in a gene-transforming animal, is also suitable for use in the present invention (Green et al. (1994) Nature 201120448

Genetics 7, 13 and U.S. Patent Nos. 5,545,806 and 5,569,825). The scope of the invention also encompasses a T cell receptor comprising at least one oligonucleotide chain or at least one antibody

Vpll-ISGSY, νβΙΙ-GLAGVDN, Vpl3A-YSPG^° or Vpi3A-FRDTGT kits. The kit may further comprise ' additional nucleus acid bonds/antibodies to detect the nucleotide sequence or antigen of the endogenous control group (i.e., the negative control group, the positive control group, or a combination thereof). An oligonucleotide chain or antibody which is not related to the detection of the aforementioned T cell receptor does not belong to the present invention. Those skilled in the art will be able to maximize the use of the present invention in accordance with the teachings of the present invention without any modification. All documents cited in this specification are hereby incorporated by reference. The following examples are intended to be illustrative of the invention and are not intended to limit the invention in any way. The correlation between the specific specific tau cell receptors and the carbamazepine or allopurinol in the skin of these two examples is: ', [Materials and Methods] Patient characteristics obtained from the Chang Gung Hospital of the consortium, 5 ammonia nitrogen exhalation / epilepsy caused the Stevens Johnson & Johnson syndrome bundle (CBZ / OXCBZ-SJS), 8 taking ammonia Patients with sputum abortion (CB^) for at least 3 months without any adverse reactions with ammonia, sputum/deficiency, and 47 healthy and without any history of ammonia snoring Blood samples were collected from subjects (including 29 individuals with HLA-B*1502 with 201120448 and 18 individuals with no HLA-B*1502). This study has been approved by the local ethics committee and approved by all participants in the study. The clinical data of the aforementioned ammonia-nitrogen-induced respiratory syndrome in patients with Stevens-Strong Syndrome (CBZ/-SJS) are shown in Table 1 below: Clinical and HLA dual genes in CBZ-SJS/ΤΕΝ patients and CBZ-resistant patients. Case number HLA-A HLA-B HLA-Cw Type of drug allergic reaction S1 1101/1102 1502/3802 0702/0801 SJS Controlled S2 0203/1101 1502/4601 0102/0801 SJS Controlled S3 0201/1101 1502/ 8101 0801/0801 SJS Controlled S4 0201/1101 1502/5401 0304/0801 SJS/TEN Controlled S5 1 101/3001 1502/1302 0602/0702 SJS Attack S6 1101/1102 1502/5801 0702/0801 SJS Attack S7 1101/ 3101 1502/1301 0801/0801 SJS Attack S8 1 101/3001 1502/1302 0602/0801 SJS Attack T1 1101/1102 1502/4001 0702/0801 Resistance - T2 0207/1101 1502/4601 0103/0801 Resistance - This experiment Seven blood samples of the 201120448 body that did not exhibit HLA-B*5801 and two HLA-B*5801 patients who participated in the study had been collected. Eight blood samples from patients with severe skin adverse reactions (SCAR) who were induced by allopurinol were obtained from Chang Gung Memorial Hospital, and all of them were individuals with HLA-B*5801. Some of the information series on patients are shown in Table 2 below: Table 2: Clinical and HLA dual genetic data for patients with SCAR induced by isodecyl alcohol

Patient first group major histocompatibility complex second group major histocompatibility complex diagnosis HLA-A HLA-B HLA-Cw DRB 038 *3303/*0201 *5801/*4601 *0302/*0102 *0301 /*0901 HSS 153 *1101/*2402 *5801/*4001 *0302/*0702 *1101/*1202 HSS 166 *3303/*2402 *5801/*4001 *0302/*0304 *0301/*1101 HSS 314 * 3303/*3303 *5801/*5801 *0302/*0302 *0301/*1302 HSS 087 *3303/*2402 *5801/*4006 *0302/*0801 *0301/*1202 SJS 114 *3303/*2402 *5801 /*4801 *0302/*0801 *0301/*1101 SJS 069 *3303/*2402 *5801/*4803 *0302/*0801 *0301/*1202 TEN 448 *3303/*0201 *5801/*5101 *0302/ *1502 *1443/*1501 SJS/TEN Peripheral blood mononuclear cells (PBMC) were isolated from anticoagulant jk samples by density gradient centrifugation from Ficoll isopaque (Pharmacia Fine Chemicals, Piscataway, NJ) . The PBMCs were then placed in a heat inactivated fetal bovine serum (FBS) containing 10% dimercaptosulfoxide (DMSO) and stored in liquid 16 201120448 nitrogen. Part of PBMC was transformed by Epstein-Barr virus to establish a B lymphocyte cell line transformed with Epstein-Barr virus (FDIDI, http://www.flrdi.org.tw/index.htm). Human leukocyte antigen (HLA) gene morphological analysis Human leukocyte antigen dual gene A, B, C (HLA-A, B, C) is a sequence-specific oligonucleotide chain reversed ink method ( Reverse lineblots, DYNAL Biotech

Ltd, Bromborough, UK). The ambiguities of genetic polymorphism are addressed by sequencing-based typing. The primer for amplifying the DNA (deoxyribonucleic acid) fragment of the HLA-A, B, and C genes by the polymerase chain reaction is (1) Binl-TA-M13F and Binl-CG- for the HLA-B dual gene. M13F and Bin3-M13R; (ii) Ainl-A-M13F, Ainl-G-M13F, Ainl-T-M13F and Ain3-62-M13R for HLA-A dual gene; and (iii) for HLA-C dual The genes used were 5Clnl-61 and 3BCln3-12. The genotyping of the first family of major histocompatibility-related gene A (MICA) genes was performed in exons 2, 3, 4 and 5 (exon). DNA sequencing is carried out. The resulting sequencing data was analyzed by SeqScape v2 (Applied Biosystems). Cell culture and its materials 17 201120448 Amplification of methotrexate nitrogen to initiate the experimental steps of ammonia-based (CBZ-specific) T cells obtained from patients with Stevens-Strong Syndrome or Toxic Epidermal Dissolution It is stated in the flow chart of the first figure. Briefly, peripheral blood mononuclear cells (PBMC) were isolated from anticoagulated blood samples by density gradient centrifugation from Ficoll isopaque (Pharmacia Fine Chemicals, Piscataway, NJ). Cell culture medium using 10% heat-inactivated human AB serum (sigma), 100 U/ml penicillin (penicillin), 100 gg/ml streptomycin (streptomycin) and 2 mM levorotamine (L) - glutamine, Gibco) in RPMI 1640 medium. The culture was enriched with human recombinant IL-2 (100 U/mL; R&D) for the culture of primary T-cell lines. B-lymphoblastoid cell lines (B-LCLs) are produced by Epstein-Barr virus in peripheral blood mononuclear cells of donors with Stevens-Strong Syndrome The supernatant of the Epstein-Barr virus-producing cell line is transformed and cultured in 10% human AB serum (sigma), 100 U/ml penicillin (penicillin), 100 pg/ml streptavidin Streptomycin and 2 mM RPMI 1640 medium of L-glutamine (Gibco). Fresh ammonia nitrogen (CBZ) stock solution (50 mg/mL) was prepared as dimethyl sulfoxide (DMSO) and diluted in culture before use. The chemicals used were purchased from Sigma Chemical Co. (Poole, Dorset, UK). Peripheral blood list 201120448 nuclear cell (PBMC) derived from patients with Stevens-Strong Syndrome, AQD-resistant patients, and healthy individuals with HLA-B*1502 from 8 methotrexate Co-culture with CBZ (25 pg/mL) in a 24-well tissue culture dish. After three days of culture, the growing cells were restimulated with radiation-irradiated (50 Gy) EBV-transformed autologous B cell lines and CBZ (25 pg/mL). Repeat this procedure 4 times every 7 to 10 days and last 4 to 6 weeks. 003+0) 8~1\ cell assay and separation Two-color fluorescence analysis was performed using a conventional experimental procedure. 2 x 105 proliferating T cells were washed twice in a centrifuge tube containing 1 ml of HBSS by centrifugation at 3,000 rpm for 1 minute. After the supernatant is drained, the anti-CD3 antibody (fluorescein isothiocyanate (FITC)-conjugated anti-CD3 antibody) and 10 μl phycoerythrin-labeled (Becton Dickinson Biosciences) will be purchased (Becton Dickinson Biosciences). A CD8 antibody (10 μl phycoerythrin (PE)-conjugated anti-CD8 antibody) was added to a centrifuge tube and pipetted up and down with a pipette to mix with cell pellets. After staining for 20 minutes in the dark at 4 ° C, the cells were washed twice with 1 mL of HBSS and then transferred to 5 mL polystyrene tubes containing 300 μl of HBSS. These prepared cells were then analyzed by a flow cytometer (FACScalibur cytofluorometer (Becton Dickinson Biosciences)) and its associated software (CellQuest software (Becton Dickinson Biosciences)). In order to characterize CD3+ or CD8+ cells displaying marker molecules, total lymphocytes are first classified by their relative scatter and 19 201120448 side scatter, and then separated by flow cytometry (FACS, BD Vantage (Becton Dickinson, San Jose, CA)) CD3+CD8+ T cells 0 Measure the cytokine concentration of the clear solution in the cell culture after 48 hours of culture, obtain the clear solution on the cell culture to link the immunosorbent by enzyme Analytical method (ELIS) was used to measure the concentration of cytokine. The CBZ-treated T cells and B-lymphoblastoid cell lines (B-LCLs) were cultured as a control solution. The interferon-gamma enzyme-linked immunosorbent assay kit (IFN-γ ELISA kit, BD PharMingen, San Diego, CA) was used to analyze the interferon-gamma (IFN-γ) released from the supernatant. After repeated dilution of the samples (1:4, 1:8 and 1:32; ν/ν), the cytokine stimuli were tested in the standard experimental procedure of the ELISA kit. This method measures the sensitivity of gamma interferon to 1 pg/mL. Complementary DNA (cDNA) preparation and spectratyping for analysis of T cell receptor beta-strand variants (TCRBV repertoire) Analysis of CBZ-specific T cell complementarity determining segment 3 (CDR3) In the second figure, and described in detail below. Total RNA was extracted using QIAamp® RNA. Blood Mini kit (Qiagen Inc" Valencia, CA) using transcriptor reverse transcriptase (Roche applied science) and oligodeoxyribose-pyrimidine chain (〇lig〇dT; ) 20 201120448 Reverse transcription of RNA into complementary DNA (cDNA) for primers. To analyze TCRBV transcript size patterns of T cell receptor β chain variant region (TCRBV), a T cell receptor was used. TCR-B chain constant region (TCRBC)-specific primer: GACAGCGGAAGTGGTTGCGGGGT and a set of 25 base pair T cell receptor beta-chain variant region specific primer (a set of 25 TCRBV-specific- Primers) Amplify the complementary DNA sample. Briefly, after an initial denaturation step of 10 minutes at 95 ° C, the reaction enters a 35-cycle polymerase chain reaction (PCR, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C 90) Second), followed by a final elongation step of 10 minutes at 72° C. Next, a portion of the unlabeled PCR product was extracted in a 10 μl “run-off” reaction solution for 5 cycles of the aforementioned extension step. The above reaction solution contained a 6-FAM-calibrated TCRBC primer (FAM_TGGGTTTGGAGAGCTCTGC) mixed with deionized formamide and size standard solution (GeneScan-500 LIZ size standard, Applied Biosystems). The length analysis of complementary DNA was performed using the ABI 3700 Analyzer and the software GeneMapper Analysis Software 3.0 according to the user manual. Interpretation of spectra types The method of analyzing the size distribution of complementarity determining segment 3 (CDR3) is a reported technique. Briefly, in the unscreened population of T cells, the spectral distribution of complementarity determining segment 3 is a standard Gaussian distribution with at least 201120448 six different lengths. Each of the rugged values represents a T cell receiver with the same number of nucleotides encoded by the TCR rearrangement. Spectral patterns are visually identified. If the number of identifiable peaks (the number of peaks is between 1 and 4) is different from the morphology of the Gaussian distribution, the spectral type is defined as skewed. When the biased profile contains a distinct single peak, it usually indicates the proliferation of the CDR3 of this length. The cloning and sequencing of the PCR product is performed by the PCR-MTM kit (Viogene). The PCR product of the cell receptor genotyping was purified. Next, these clean PCR replicas (amplicons) were ligated overnight with T4 DNA ligase and TA cloning vector pGEM-T Easy (Promega) at 4 °C. The transformed vector is transformed into JM-109 competent cells. 50 μL of 20 mg/ml X-gel and 50 μL of 100 mM IPTG were evenly sprinkled on the LB plate containing 50 pg/ml of ampicillin. The transformed cells were then plated on LB/ampicillin/IPTG/X-Gal plates and incubated overnight at 37 °C. White colonies were picked from the culture plates of each of the transformed PCR products for colony polymerase chain reaction (colony PCR) to amplify the genetic material using the primers: Ml 3-Forward (5,-CGCCAGGGTTTTCCCAGTCACGAC-3,) and

M13-Reverse (5, -TCACACAGGAAACAGCTATGA C-3'). Then, add exonuclease I (NEB) and shrimp alkaline phosphatase (Amersham) to the final 22 201120448 product mixture of the aforementioned colony polymerase chain reaction to remove the remaining dNTPs (go An oxyribonucleotide) and a primer, and a transcript amplified by the aforementioned colony polymerase chain reaction is purified. The above-mentioned final product mixture was reacted at 37 ° C for 30 minutes, and then at 80 ° C for 15 minutes to terminate the activation of the above two enzymes. Next, the purified product described above was sequenced using an ABI PRISM 3730 DNA Analyzer (Applied Biosystems, USA). The sequence of each of the colony polymerase chain reaction products was then imported into the IMGT website for comparison with the preset IMGT/V-QUEST reference directory set (IMGT/V-QUEST reference directory set). This analysis will present the gene fragments of V-J and V-D-J as well as the amino acid sequence of CDR3. Quantitative clonotypic analysis based on the frequency of occurrence of unique DNA sequences in the CDR3 region of the mutated beta strand of the T cell receptor to select the most dominant immunogeninous sputum in this immune response T cell clone. The software LightCylcer Probe Design2 is designed to clone specific primers and probes for identification of its unique CDR3. The plasmid template used in the quantitative polymerase chain reaction (qPCR) is the same as that used for CDR3 sequencing. Test the identification of each set of primers/probes and other groups of primers/probes for the target, and if necessary redesign 23 201120448 to ensure that there is no cross-reactivity. Synchronous quantitative polymerase chain reaction of cDNA samples was performed using Light Cycler Fast Start DNA Master SYBR Green I Kit (Roche) according to the instructions for its use. Briefly, 2.5 μl of cDNA was reacted with each primer at a final concentration of 〇·5 μΜ at an annealing temperature of 60 C. [Experimental results] (a) T cell receptors associated with the occurrence of Stevens-Strong Syndrome/Toxic Epidermal Symptoms induced by Aminoguanidine Nitrogen (CBZ) induced from Methotrexate-induced Strives-Strong Syndrome (CBZ-SJS) The T-cell receptor variability β-chain of drug-enriched CD8+ T cells often exhibits a skewed pattern. To understand the subpopulations of the 变异 cell receptor variability beta chain in the population of oligoclonally expanded T cells, we were in 8 CBZ-SJS patients and 2 CBZ resistant individuals. A spectral type analysis of CDR3 was performed to understand the T cell repertoire of patients with CBZ-SJS. In the fifth cycle, CD8+ T cells obtained from CBZ-SJS patients were classified to exhibit a skewed lineage posture, which represents the immunologically determined variant β-family of the restricted νβ family. Orthogoclonal expansions, such as 'All CBZ-SJS patients in this study showed νβΠ (patients with this biased type / all patients = 100%;); patients S S2, S3, S4 and S8 All showed Υβ13Α (with 24 201120448 patients with this biased type / all patients = 56%); patients S2, S5, S6, S7 and S8 all showed Vp14 (patients with this biased type / all patients = 56%) ); patients S2, S4, S6, S7, and S8 all showed νβΐ5 (patients with this biased type/all CBZ-SJS patients = 67%); patients S2, S5, S6, and S8 all showed νβ4 (with this) Patients with a biased posture / all CBZ-SJS patients = 50%). After careful contrast, the ratio of CD8/CD3 in peripheral blood mononuclear cells of CBZ-resistant individuals did not change after two weeks of culture. In addition, the survival of the whole tau cells obtained from CBZ non-allergic (resistance) individuals could not be maintained for more than 2 cycles; in the second cycle, it exhibited a Gaussian distribution of pedigree status, as in the control group of multiple T cell grievances. Kind of features. CDR3 sequence analysis to confirm the oligoselective proliferation of CD8+ T cell receptor V々ll in T cells of CBZ-SJS patients. The T cells benefit from the junctional regions of the β bond to confirm CBZ- Whether the T cell receptor variability beta chain of SJS patients contains a oligoselective population. A single colony with more than three identical sequences is defined as a clonal expansion phenomenon. After cloning more than 30 CDR3 sequences of clones in each sample, we found a CD8+ νβ11+ (also known as TRBV25-1*01) oligosity in CBZ-SJS patients. Sexual proliferation. Surprisingly, 5 of the 8 CBZ-SJS patients consistently represented more than 80% of the specific CD8+νβ11+ colonies (TCR νβΙΙ-ISGSY, the same nDn region in CDR3) with immunological dominance, The same sequence of 201120448 was not found in CBZ resistant individuals. Please refer to Table 3 below for 'TRBD2* (M, TRBJ2-1*01 and TRBV25-1*01 combinations are the most common in CBZ-induced T cells. Table 3: CBZ-induced CD4+ and CD8+T CDR3 sequences recognized in cells

Patient B-chain TRBV TRBD TRBJ CDR3 Frequency S1 S2S3 s4 s5s6s7s8

1 1 1 111 111 1 1 1 1 BB B BBBB'B'B'B'B DO B TRBV25-1D1 TRBD2TM TRBJ2-1TI1 CASSISGSYNEOFF 82% TRBV25-1[in TRBD2"02 TRBJ2-1*01 CASSGLAGVDmEQFF 18% TRBVzsm TRBD2T )1 TRBJ2-1*01 CASSISGSYf<ERFF 100% TRBV25-1S01 TRBD2TI1 TRBJ2-1*01 CASSfSGSYNEQFF 50% TRBV25H TRB 02=1)1 TRBJ2-1*01 CASSfSGSYNEOSF 42% TRBV25-1TM TRBD2*01 TRBJ2-5*01 CASSEYMGIQETQYF 8% TRBV25-1*01 TRB 02=1)2 TRBJ2-1*01 CASSGLAGVDNNEQFF 39% TRBvasi^oi TRB 02*01 TRBJ27*01 CASSLGYEQYF 22% TRBV25-1*01 TRBJ11*01 CASSDNTEAF F 11% TRBV25-1 :D1 TRBD2*01 TRBJ2-1TJ1 CASSISGSYNEOFF 100% TRBV25-1*01 TRBJ2-7*01 CASSAHEQYF 83% TRBV25-1TM TRBD1-01 TRBJ1*2T)1 CASSEWGEVGKGYTF 17% TRBV25-1*01 TRBD2*01 TRBJ2-1* 01 CASSISGSYNEOFF 100% TRBV25-n)1 TRBD1TH TRBJ2-7TJ1 CASSEDRSPYEQYF 100% patient-specific type of patient

Clonotypes) to identify CBZ-SJS Southern risk groups that do not exhibit HLA-BV502 in order to assess the clinical potential of patient-specific CDR3s. 'We observe which CBZ-restricted clonotypes are only available. PBMCs in patients with CBZ-SJS now do not appear in individuals with CBZ resistance (all patients are in the onset). A simultaneous quantitative polymerase chain reaction was used to detect single colony types in the cDNA of PBMCs in CBZ-S JS patients and healthy individuals. 26 201120448

Because of the similarity between HLAB*1502 and Stevens-Strong Syndrome (SJS) in structurally similar drugs such as epilepsy (0xcarbazepine, OXCBZ), we have PBMC in CBZ-SJS patients and OXCBZ-SJS patients. Vpll/ISGSY distant bodies were found. In the results of this experiment, we found that the cDNA of PBMC in 93% (14/15) of patients with CBZ/OXCBZ-SJS contained νβΙΙ/ISGSY colonies. However, no Υβΐΐ/ISGSY colonies were detected in 8 CBZ/OXCBZ resistant individuals and individuals not expressing HLAB*1502. It is worth noting that we found U.8% (4/29) performance

Individual individuals of HLAB*1502 have νβΙΙ/ISGSY colonies in their PBMCs and these individuals are considered to be at high risk of CBZ-SJS because of their CBZ-restricted clonotype. Referring to Figure 3b, a similar pattern was observed in the analysis of νβΠ/GLAGVDN colonies. These results show that lymphocytes in PBMC and skin blisters contain a special subpopulation of oligoclonal CD8+ T cells that reproduce significantly in response to antigen stimulation (CBZ+ antigen). In addition, this particular T cell colony (νβΙΙ-ISGSY or νβΙΙ-GLAGVDN) can be used as a marker for the existing HLA-B*1502 individuals in CBZ-SJS. (b) T-cell receptors associated with allopurinol-induced severe skin adverse reactions (SCAR). Drug inducers from patients with severe skin adverse reactions (SCAR) induced by allopurinol (allopurinol) Drug-enriched T cell receptors for CD4+ and CD8+ T cells 27 201120448 The mutated beta chain often exhibits a skewed pattern. Pedigree analysis was used to understand T cell receptor use in patients with allopurin〇1_SCAR. The experimental results showed that in the CD4+ T cells induced by isodecyl alcohol drugs, the tau cell receptor family Vpl3A was the only one expressed. What's more, the tau cell receptor group dominates half of the patients, including HSS153, SJS087, ΤΕΝ069, and SJS/TEN448. The PCR product amplified by the 5-terminal primer of the V_reg 〇n Specific and the 3-terminal primer of the C-region specific may contain more than one different V-(D)-J recombination and The transcript of the CDR3 sequence of the CDR3 sequence, further identifying, by ph〇ning and sequencing, which T cell transcript is present in the isopropanol drug-induced It is necessary for the T cell receptor of CD 4 + T cells to be in νβ 13A. In addition, T cell receptors νβ-2, 3, 4, 5A, 7, 15, 17, 18, and 22 are also present in more than half of the experimental individuals, so these sputum cell acceptor populations are also selected for Further cloning and sequencing. On the other hand, isobutamol drug-induced CD8+ T cells also exhibited similar T cell receptor and CDR3 expression patterns. After stimulation with isodecyl alcohol drugs, only a portion of the T cell receptor population is proliferated and becomes a population dominated by immunity. These T cell receptors may all be associated with isodecyl alcohol drugs. Using the aforementioned experimental method, only νβ13Α was found to be normally expressed in vitro-stimulated CD8+ sputum cells (HS8166 and SJS/TEN448 CD8+ sputum cells were insufficient for CDR3 pedigree analysis). Therefore, the sputum cell receptor νβ13Α 28 201120448 of CD8+ Τ cells was selected for cloning and sequencing. CDR3 sequence analysis to confirm the proliferation of CD4+ and CD8+ τ cell receptor νβ13Α in patients with SCAR induced by isoflurane drug (aU〇purin〇l) 接合 Τ Τ 受 受 受 ( ( ( ( ( ( ( jun Nai regions) to determine whether the variant β-chain proliferation of T cell receptors recognized in patients with aii〇purinol_ScAR contains a population of oligods. See Table 4 below. Surprisingly, the CD4+ Τ cells of HSS314, CD4+ T cells of ΤΕΝ069, and CD8+ Τ cells of HSS153 recognize the CDR3 sequence of Vpi3A-CASSYSPGRNEQFF. The CD4+ T cells of HSS314 and the CD4+ T cells of HSS153 recognized the CDR3 sequence of another Vpl3A-CASSFRDTGTEAFF. Table 4: Sequences of CDR3 recognized in CD4+ and CD8+ T cells induced by isodecyl alcohol drugs

Μβ sample name TRABV TRBJ TRBD CDR3 Β13Α 314CD4 28*01 2-7*01 2*02 CASSLPGRSYEQYF 6-5*01 2-1*01 2*02 CASSYSPGRNEQFF 28*01 2-7*01 1*01 CASSSSGTGAYEQYF 6-1 *01 1-1*01 1*01 CASSFRDTGTEAFF 069CD4 6-5*01 2-1*01 2*02 CASSYSPGRNEQFF 153CD4 6-1*01 1-1*01 roi CASSFRDTGTEAFF 448CD4 6-1*01 1-1*01 1*01 CASSALWTEAFF 153CD8 6-5*01 2-1*01 2*02 CASSYSPGRNEQFF 114CD8 6-5*01 2-1*01 2*02 CASSFGLAGGEQFF 28*01 1-4*01 1*01 CASLDRGNEKLFF 29 201120448 as before Said, CDR3 is the most important antigen contact site for T cell receptors. Also, all cDNAs used for CDR3 lineage analysis were heterologous. The allopurinol drug is induced, so these similar T cell receptors are responsible for the identification of allopurinol. It will be apparent to those skilled in the art that various changes can be made in accordance with the embodiments of the present invention without departing from the spirit of the invention. Therefore, it is to be understood that the invention is not intended to limit the invention, but is intended to cover the modifications in the spirit and scope of the invention. 30 201120448 [Simple description of the diagram] The first diagram is a flow chart to show the flow of amplifying CBZ-associated T cells of CBZ-SJS patients. The second figure is a schematic diagram showing the profiling procedure of the CDR3 of the T cell receptor. The third a graph shows the frequency of existence of νβΙΙ-ISGSY. The third b-picture shows the frequency of existence of νβΙΙ-GLAGVDN. [Explanation of main component symbols] None 31 201120448 References 1. Marrack, P. & Kappler, J. The T cell receptor. Science (New York, N.Y238, 1073-1079 (1987). 2. Padovan, E. , et al. Expression of two T cell receptor alpha chains: dual receptor T cells. Science 262, 422-424 (1993). 3. Neveu, B., et al. Selection of high-avidity CD8 T cells correlates with control of Hepatology 48, 713-722 (2008). 4. Collette, A., et al. A profound alteration of blood TCRB repertoire allows prediction of cerebral malaria. J Immunol 173, 4568-4575 (2004). Haskins, K. Pathogenic T-cell clones in autoimmune diabetes: more lessons from the NOD mouse. Adv Immunol 87, 123-162 (2005). 6. Gomes, ER & Demoly, P. Epidemiology of hypersensitivity drug reactions. Current Opinion in allergy and clinical immunology 5, 309-316 (2005). 7. Roujeau, JC Clinical heterogeneity of drug hypersensitivity. Toxicology 209, 123-129 (2005). 8. Chung, WH, et al. Medical genetics: a markerFor Stevens-Johnson syndrome. Nature 428, 486 (2004). 9. Hung, SI, et al. HLA-B*5801 allele as a genetic marker for severe cutaneous adverse reactions caused by allopurinol. Proceedings of the National Academy of Sciences of The United States of America 102, 32 201120448 4134-4139 (2005). 33

Claims (1)

201120448 VII. Patent application scope: 1. A method for assessing the risk of skin dysfunction caused by ammonia sputum aspiration drug, which comprises: obtaining a sample containing τ cells from a patient; detecting variability in the aforementioned sample The presence of a T cell receptor of the β chain vβΐΐ, wherein the variant β chain vβΐΐ has an ISGSY or GLAGVDN peptide sequence in the nDn region of its complementarity determining segment 3 (CDR3); and depending on the presence of the T cell receptor Assess the risk of skin adverse reactions. 2. The method of claim 1, wherein the detection system utilizes a simultaneous quantitative polymerase chain reaction to verify the presence of the nDn region. 3. The method of claim 2, wherein the detecting further comprises detecting the presence of νβΐι with a νβΐι-specific antigen. 4. The method of claim 1, wherein the detection system utilizes an immunoassay to specifically bind an antigen to the aforementioned nDn region. 5. The method of claim 1, wherein the aforementioned patient is an individual exhibiting human leukocyte antigen-B*1502 (Human Leukocyte Antigen, HLA-B* 1502). 6. The method of claim 1, wherein the skin adverse reaction is Stevens-Strong Syndrome or Toxicity 34 201120448 Dermatolysis. 7. The method of claim 1, wherein the aforementioned T cell-containing sample is a peripheral blood mononuclear cell sample. 8. An isolated oligonucleotide chain, wherein the oligonucleotide chain is specifically hybridized to a nucleotide sequence that mimics an ISGYS peptide chain or a GLAGVDN peptide chain or a complement thereof. 9. The oligonucleotide chain of claim 8, wherein the nucleotide sequence encoding the ISGSY peptide chain is: 5'-atctcaggttcctac-3'; the aforementioned translation of the GLAGVDN peptide chain The nucleotide sequence is: 5'-gggttagcgggagttgacaac_3'. 10. An isolated antibody that is specifically linked to an ISGSY peptide chain or a GLAGVDN peptide chain. A kit for assessing the risk of occurrence of an adverse skin reaction, which consists essentially of an oligonucleotide chain as described in claim 8 of the patent application. 12. A method for assessing the risk of a skin sputum response in a patient caused by an isodecyl alcohol drug, comprising: obtaining a sample containing T cells from a patient; detecting T cell receptors having a variant β chain VpuA in said sample The presence of the mutator β chain Vp13A having the YSPGR or FRDTGT peptide sequence in the nDn region of its complementarity determining segment 3 (CDR3); and assessing the skin imperfect response based on the presence of the T cell receptor 35 201120448 Risk of birth. 13. The method of claim 12, wherein the detection system utilizes a simultaneous quantitative polymerase chain reaction to verify the presence of the nDn region. 14. The method of claim 13, wherein the detecting further comprises detecting the presence of νβ13Α with a νβ13Α-specific antigen. 15. The method of claim 12, wherein the detection system utilizes an immunoassay to specifically bind an antigen to the aforementioned nDn region. 16. The method of claim 12, wherein the aforementioned patient is an individual exhibiting human leukocyte antigen-B*5801 (HLA-B*5801). 17. The method of claim 12, wherein the skin adverse reaction is Stevens-Strong Syndrome or Toxic Epidermal Dissolution. 18. The method of claim π, wherein the aforementioned T cell-containing sample is a peripheral blood mononuclear cell sample. 19. An isolated oligonucleotide chain, wherein the oligonucleotide chain is specifically hybridized to a nucleotide sequence that mimics a YSPGR peptide chain or a FRDTGT peptide chain or a complement thereof. 20. The oligonucleotide chain according to claim 19, wherein the nucleotide sequence for translating the YSPGR peptide chain is: 5'-tactctcccgggagg-3'; the aforementioned FRDTGT peptide is translated 36 201120448 The nucleotide sequence of the chain is: 5'-ttccgggacacgggcact-3'. 21. An isolated antibody that is specifically linked to a YSPGR peptide chain or a FRDTGT peptide chain. 22. A kit for assessing the risk of occurrence of an adverse skin reaction, which consists essentially of an oligonucleotide chain as described in claim 19 of the scope of the patent application. a 37