TW201115146A - Biomarkers for predicting response of esophageal cancer patient to chemoradiotherapy - Google Patents

Abstract

The present invention relates to novel genetic markers associated with response of a patient with esophageal cancer (ECa) to chemoradiation therapy, and particularly to methods and kits for predicting an ECa patient's response to chemoradiation therapy by genotyping of the markers.

Description

201115146 - , VI. Description of the invention: [Technical field to which the invention pertains] The present invention relates generally to genetic markers, and more particularly to single nuclear buds associated with the response of esophageal cancer patients to chemical and radiotherapy. (single nucleotide polymorphism). [Prior Art] Esophageal cancer (ECa) has become the sixth leading cause of cancer death in the world, and its incidence continues to increase throughout the world. Unfortunately, most esophageal cancer patients are already at the end of the initial diagnosis and are not suitable for therapeutic surgical removal. Recently, multim〇daiity thempies have been tried to improve the resectability of tumors and the long-term survival rate of patients. Among them, the use of concurrent ehemorndMon therapy (CCRT) followed by esophagogastrectomy (esophagogastrectomy) in neoadjuvant therapy has been widely used in the current clinical practice. However, patients have been found to have individual differences in response to CCRT, which in turn affects treatment outcomes. Patients who have a complete response to CCRT tend to have an increased survival rate', but the survival rate of patients who do not respond significantly to CCRT may be reduced by treatment-related toxicity and delay in surgical resection. Although research has focused on biomarkers related to the response of patients to chemotherapy and radiation therapy (Pharmacogenomics journal 2009; 9:202-7; Cancer Lett 2008; 260:109-17; and to J Ca. 2008; 123:826- 30), but no reliable genetic markers have yet been obtained. At the heart, there is still a need to provide genetic markers that can modulate the response of this ECa patient to this radiotherapy method and thus help to avoid unnecessary treatment and to determine the most appropriate treatment for the patient. ', [Summary of the invention] The secret aspect of the 'brief supply—the anti-touch method of the radiation-based radiation therapy for the cancer patients, including the test sample taken from the face, g 3 201115146 single nucleotide polytype Identification of the genotype of a sexual (SNP) marker selected from the group consisting of rs4954256, rsl6863886, and combinations thereof, wherein the presence of the C allele of rs4954256, the presence of the G allele of rsi6863886, or both The presence of the person is an indicator of an increased likelihood of complete response to chemical and radiotherapy. In another aspect, the invention provides a kit for performing the methods described herein, which comprises one or more polynucleotides for genotyping for rs4954256, rsl6863886, or a combination thereof. In one embodiment, the kit is for use in the first set of isolated polyacids for genotyping of rsl6863886. In another embodiment, the kit comprises a second set of isolated polynucleotides for genotyping for rs4954256. Various specific examples of the invention are detailed below. Other features of the present invention will be apparent from the following detailed description of various embodiments and claims. In the case of a person skilled in the art, it is believed that those having ordinary skill in the art to which the present invention pertains may utilize the invention in its broadest scope. Accordingly, the following description is to be considered as illustrative only and not limiting the scope of the invention. X [Embodiment] One invention provides two SNP markers, rs4954256 and rsl6863886, which

As identified by the two-stage All-Generation Correlation Study (GWAS), these SNPs were significantly associated with complete CCRT responses in patients with ECa and provided predictive accuracy of mobility. All technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art, unless otherwise defined. In this context, the phrase "a" refers to one or more (and even one) of the terms of the lexical grammar. 3 The term "polynucleotide", "nucleic acid", or "nucleic acid molecule" as used by the syllabus. Red polymer from the nuclear unit, including naturally occurring nucleic acids, 4 201115146 such as deoxyribonucleic acid ( "DNA" and ribonucleic acid ("RNA"), ^^acid analogs include those with non-naturally occurring nucleotides. Polynucleotides: s to produce 'for example' using an automated DNA synthesizer. The term "nucleic acid" ^nucleic acid molecule generally refers to a large polynucleotide. It is clear that when the oxalic acid fragment is represented by a DNA sequence (ie, A, T, G, c), it also includes the capture of eight sequences (ie, eight, 11, (}, (::), In the beans, "11 replaces "Τ". The term "separation" as used in the text refers to nucleic acids (such as DNA or coffee) and is observed on the 5th day, respectively, with the #DNAs or RNAs present in the natural source of the macromolecule. Separated molecule. As used herein, the term "isolated" also refers to a substance that is substantially free of cellular material, viral material, or culture medium when prepared by recombinant DNA techniques, or is substantially free of chemical species when chemically synthesized. Nucleic acids of bulk molecules or other chemicals. Meanwhile, "isolated nucleic acids" are intended to include nucleic acid fragments which are not in the form of fragments in nature and which are not found in nature. λ The term "allele" as used herein is Refers to a variant of a nucleotide sequence. Bialelic polymorphism has two forms. As far as the allelic form is concerned, a diploid organism can be a homotype (h〇m〇zyg〇). Us) or heterotype combination (heterozygous). The term "SNP" as used herein refers to a single nucleotide polymorphism in DNA. SNPs are usually followed by highly conserved sequences that are mutated only in population members of 1/1000. The alleles and §, the individual may be a homotypic combination or a heterotypic combination. In some cases, the SNP may be referred to as "cSNP", indicating that the nucleotide sequence containing the SNp is an amino acid "encoding" sequence. It can be produced by the substitution of a nucleotide at a polymorphic site by a different nuclear acid. The substitution can be a transmutation or a transversion. A homologous substitution is one nucleotide and another.嘌: a substitution of a nucleotide, or a substitution of a pyrimidine by another pyrimidine. A heterologous substitution is a substitution of a pyrimidine' or vice versa. For example, as in a particular chromosomal location, in a population A member has adenine (A), and another member of the group has a cell bite (C) at the same position, then this position is a 201115146: the middle of it... the name of this 1 fascinating s Is quoted from the National Center for Biotechnology Information (N At dirty 1 Center for Biotechnological Inf 〇 ti〇n, Nm The official reference SNp (5) 1 identification mark specified by each unique SNP. The public can consult the database at the local TM. The term "genotype identification" used in this article refers to a book. The allele. The "gfp" for gene labeling of a sample or individual may include alleles on the individual or multiple SNPs: for example, 'in-genetic-specific nuclear audition A can be A in some faces and c in other individuals. The individual with A in this position has the a allele ' and the individual with C has the c allele. In diploid production, an individual has two sequences containing the polymorphic position. Thus, an individual may have an =A allele and a c allele, or two copies of the A J gene or two C alleles. In a particular group, each of the alleles can be rotated at different frequencies. It has the same record of the same c, and its basic level is 〇:; there are two copies of A, etc. ^, body 疋Α allotype _ type combination, its genotype is from; another one allele The individual is a heterotypic combination, whose genotype is. Chem〇radiati〇n 'erapy', 'chemoradiotherapy', 'Ch_irradiation', and 'combined chemical and radiotherapy J mnt ehem_iati() n therapy, ccrt )" is used interchangeably here to combine a combination of remedies and radiotherapy. ^ ίο, the "complete response" to ccrt refers to the complete slowness of the tumor, such as the unmeasurable symptoms, such as the residual tumor imltimior under the microscope, and the roughly visible residual tumor (gr〇s do w threat (four) edited tumor ), or the progression of the tumor. 6 201115146 9 The term "primer" as used herein refers to a specific oligonucleotide sequence which is complementary to a nucleotide sequence of interest and which is used to hybridize to a nucleotide sequence of interest. The primer system serves as a starting point for the polymerization of nucleotides catalyzed by DNA polymerase, rna polymerase, or reverse transcriptase. * The term "probe" as used herein refers to a defined nucleic acid fragment (or a nucleotide analog fragment, eg, a polynucleotide as defined herein) that can be used to identify a particular polynucleus present in a sample. A nucleotide sequence comprising a nucleotide sequence that is complementary to a particular polynucleotide sequence to be recognized. In one aspect, the invention provides a method for predicting the response of an esophageal cancer patient to chemical and radiotherapy comprising genotyping of a SNP marker for a test sample taken from the patient's marker selected from the group consisting of rs4954256, rsl6863886 And a combination of the combinations, wherein the presence of the C allele of rs4954256, the presence of the G allele of rsl6863886, or the presence of both is an indication of an increased likelihood of complete response to chemical and radiotherapy. Table 1 shows the naturally occurring nucleotide sequence (SEqIDN〇: 1) containing rs4954256 and the nucleotide sequence containing rsl6863886 (SEQ ID NO: 2) taken from the NCBI database (human, & (10) 0 like). ), wherein the nucleotides in parentheses in the sequence are polymorphic nucleotides. The sequences of Table 1 show that the polymorphic nucleotide of rs4954256 is located at position 27 of SEQ ID NO: 1, and the polymorphic nucleotide of rsl6863886 is located at position 27 of SEQ ID NO: 2. Table 1 - SNP · _ nucleotide sequence ^ rs4954256 atattggagagttaacagagagaatgcc [C/T] aaaactggaaaaacaaaaacttcaa (SEQ ID NO: 1) rsl 6863886 aatggtgtcccttgaaggctatctgt[C/T]tgcttttggataaaatggacagaag (SEQ ID NO: 2) SNP rs4954256 is located on chromosome 2q21. In the middle of 3, it belongs to the sub-family of SMARTAL1. The N-terminus of Zi^A milk contains a helicase 201115146 (hdicase) followed by a Zinc finger. However, '== 阙Zinc layer mice encode amphetamine oxime-based synthesis of H. = Regulatory subunit of the body. _2 coding training 丄 1 1, block acid ester) - specific phosphohydrolase, 1 can function S1PI = lysine. Both the G and the G protein biofilms are used to find any ms molecules of the cancer, including the part of the gene sequence to be tested. Because of wood, if this is a sample of cells, tissues, or uterus, or may be biological material like 去 liquid, milk, tears, saliva, hair, skin, tissue, or the nucleic acid sample of the method of the present invention Can be added to the sample or sample. In the test sample of the county (4), the method of the present invention is carried out by the genotype identification of the test for esophageal cancer patients, wherein the possibility of the chat mark is increased; Therapy has a complete reaction test, it is a kind of real money, the invention of the green _ Wei esophageal cancer patients

The genotype identification of the second rsl6863886 was carried out, wherein the presence of the SNP W allele was an indicator of a complete increase in the chemical and radiotherapy. In a specific example, the method of the present invention is carried out by genotyping the combination of rs4954256 and rsl6863886 for an esophageal cancer patient sample, wherein the C allele of rs4954256 and the rsi6863886 are both due to the existence of both An indicator of an increase in the susceptibility to complete chemistry and occlusion therapy. Specifically, a patient who is evaluated for the possibility of a total response to chemotherapy and radiotherapy according to the method of the present invention is a human adult having esophageal cancer. In general, 8 201115146 is partially specific in every f, or 55 years old, but under 70 years old. In addition, or Japanese disease from money /, the patients described in this article are Asian patients, especially China. In some embodiments, the patient is a male. Imitation: ^; ^ production is known to have a number of methods can be used to determine the specific SNP in the sample, the law can be used - or a variety of oligo-nuclear thief probes or primers, _ pairs to = more than ^ ^ = cross = increase two The nucleosides of the present invention can be used to carry out the method of the present invention, such as 'partially complementary to one of the target polynucleic acids, and the nucleus acid of the 1 ρ knife, which includes The SNP 4 is set up, wherein the presence of a specific nucleus acid in the SNP, the SNP can be determined by whether the probe is conjugated or not. This method can further include causing the target to nucleate. The nucleotide of the ίί is contacted with the endonuclease, and the cleavage of the probe is detected. The nucleoside acid present according to the 'site is complementary to the corresponding nucleotide of the 5 hai plate needle. However, the μ Ϊ oligonucleotide acid-binding analysis can identify the polymorphic position in the presence of the Ϊ 可 可 可 可 可 可 可 可 可 可 可 可 上游 上游 上游 及 及 上游 上游 上游 上游 上游 上游 上游 上游 上游 上游 上游 上游 上游 上游 , , One of the probes includes a terminal acid neodymium complementary to the nuclear acid present in the SNP. When the terminal end of the probe is complementary to the presence of the nucleotide acid, the lion hybrid will include the terminal nuclear acid. Thus, in the presence of the junction, the upstream and lower nucleotides can be joined. Thus, the presence or absence of the ligation product can be an indicator of the presence of the nucleotide at the SNp site. An example of such a face analysis is the SNpiex system (Applied Biosystems, Foster City, CA). Nucleic acid can also be used as a primer, for example, an extension reaction in which the product of the prolongation reaction (or no product) is an indicator of nuclear presence. Further, a primer pair for amplifying a portion including a target polynuclear microparticle of a SNP can be used, and the nucleus acid of the SNp health can be detected. Here, available methods include the 201115146 method that can be easily changed to a high throughput format, a multiple form (multiplexed), or both. The primer extension or amplification product can be detected and/or sequenced directly, indirectly, using a variety of methods known in the art. The sequencing products of the SNP can be sequenced using conventional sequence methods, such as the dideoxy-mediated chain termination method, also known as the Sanger Method, and the chemical degradation method. Called the Maxam-Gilbert Method. The invention may use flux-to-high throughput systems known in the art to analyze SNPs such as the Mass ArrayTM system (Sequen(R), San CA), the BeadArrayTM SNP genotyping system (SanDieg(R), CA), and Affymetrix. GeneChip® Human Mapping 500K Array (Affymetrix, Inc., Santa Clara, CA). The SNP detection method used to implement the present invention generally utilizes selectivity. As used herein, the term "selective hybridization" or the like refers to hybridization under moderately stringent or highly stringent conditions such that a nucleotide sequence will be biased to bind to a selected nucleotide sequence (compared to In the case of unrelated nucleotide sequences, the degree of bias is large enough to identify the presence of nucleotides in SNp. It is clear that some degree of non-specific hybridization side is unavoidable, but as long as there is sufficient selectivity for the hybridization of the target nucleotide sequence, it can be distinguished by non-specific heterosexual effects. The non-specific hybridization is then acceptable, for example, at least about 2 times higher selectivity, generally at least about 3 times = higher selectivity, usually at least about 5 times higher selectivity, specific In terms of at least about 1 fold higher selectivity, in terms of paste, the selectivity is determined by the amount of the labeled nucleotide raised to the target nucleic acid molecule compared to the binding to the non-target nucleic acid molecule. A nucleic acid molecule that is, in particular, a non-target nucleic acid molecule but substantially similar (ie, 'homologous'). The conditions for performing selective hybridization may be determined empirically, or may be based, for example, on the relative GC:AT content of the hybrid oligonucleotide and its sequence to be hybridized, the length of the hybrid oligonucleotide, and the oligonucleotide and i The number of mismatches (if any) of the sequences to be hybridized is carried out (see, for example, Sambrook et al., 200 molecular selection: laboratory manual (chest (10) & c/clear _ noodles/), third Edition, c〇ldSpringHarb〇r 201115146

Laboratory Press, Cold Spring Harbor, Ν.Υ.; and Ausubel et al., 1998 'Modern operational procedures for biomoleculars (Cw/re Home & J. Wiley & Sons Inc., New York 1988. In general 'Strict conditions are about 5-30 below the specified melting point (Tm) at the specified ionic strength and pH. (: or, strictly, the Tm is less than the specified sequence at a specified ionic force and pH. -15. For example, strict parental conditions are salt concentrations below about 1.0 Μ sodium (or other salts) ions are affected by sound _ to about i Μ雠 concentration, at about temperature versus short probe ( For example, 10 to 50 nucleotides) is at least about 25 〇c, and for long probes (eg, greater than 50 nucleotides) at least about 55 〇c. For long probes (eg, greater than 50) Illustrative non-strict or low-degree conditions of nucleotides may include 20 mM Tris, pH 8.5, 50 mM KC1, and 2 mM MgCl buffers and a reaction temperature of 25 ° C. 2

In accordance with the present invention, the methods described herein can be based on the genotype of rs4954256 and/or rsl6863886 to determine whether an esophageal cancer patient is more likely to have a complete response to chemical radiation therapy. As shown in the examples below, the c allele of rs4954256 and the G allele of rsl6863886 are protective alleles; they are more common than those of patients who do not fully respond to chemical and radiotherapy. Exist in the chemical and radiological secrets: in the private group, therefore, the presence of the C allele of rs4954256 or the G f gene of rsl6863886 indicates that the patients are fully responsive to chemical and radiotherapy. The possibility increases. Specifically, as the number of allele G alleles of rs4954256 increases, patients are more likely to have a full-scale response to chemical and radiotherapy (eg, at least 1.5, 2, 2.5, 3. 〇, 3.5, 4:0, 4·5, or 5.0 times chance). More specifically, with the increase in the number of the 3r gene of rs4954256, the patient has a chance of about 4.54 times the total antiretroviral disease of the G allele of the chemical cum ^_863886. Opportunities for chemical and radiotherapy to complete the 201115146 isolated polynucleotide, for example, can be used as a primer or probe for the genotype identification of the SNSP, which can be based on the SNPs and related nuclear sequences provided herein. The information readily determines the sequence of such polynucleotides. A variety of computer programs, such as SeqTo〇m〇cument vl 〇 (IBMS, fat), can be used to get the best primer/probe set. In a specific example, genotyping of rs4954256 is performed using a first primer pair, respectively, and having SEQ ID NOS: 3 and 4. In another specific case towel, the (four) two primers are paired with =16863886. The second primer pair has a new (10) NOS: 5 and 6. Table 2 shows the sequences of these primers. Table 2 引— rs495425fi "--- _ nucleotide sequence forward primer reverse primer rsl686388fi 5'-ACGTTGGATGTCTACCGTTTCCCGTATCTC-3, 3 ACGTTGGATGCCATATTGGAGAGTTAACAG-5, (SEQ ID NO: 3) (SEQ ID NO: 4) Primer reverse primer 5 -ACGTTGGATGCTGCTTAAGGCAATGGTGTC-3, 3 - ACGTTGGATGTTACTTTGGCCCTTCTGTCC-5, (SEQ ID NO: 5) (SEQ ID NO: 6) In another aspect, the invention provides a method for practicing the methods described herein , a group comprising one or more isolated thieves for the identification of rs4954256, rsl6863886, hydration. Specifically, the aliquots of + nucleotides serve as primers or probes for performing genotype analysis of the SNPs of the present invention. In some embodiments, the kits are PCR kits. In one example, the °C TCR kit includes: (4) primers for amplifying the SNPs described herein; and (b) buffers and enzymes, including DNA polymerases. In part f of the specific example, the sets are microarray sets. The kits include a probe attached to a solid support surface. These probes can be marked with the mark 可 可 可 2011 12 201115146. In particular, the specific probes, such probes, may also comprise a hybrid signal and/or a reagent, and a signal generated by hybridization of the probe with the target nucleic acid sequence. The materials and reagents of the microarray kits are placed in one or more of the present beta. The components of the trans-sleeve are generally in the appropriate containers. The skilled 1 artisan can target the nucleic acids of interest. It is easy to design and synthesize primers or neutrons in regions. The appropriate tweezers or probes for use in the present invention can be designed using any suitable method. The primers or probes are generally at least about 8 in length. Nucleotide. In one embodiment, the length of the primer or the scorpion is at least about 1 nucleotide. In a particular embodiment, the length of the primer or probe is at least about 12 nucleus. In an example, the length of the primer or probe is at least about 16, 17, 18, 19, 20, ^ 22 23 24, or 25 nucleotides. Although the maximum length of the probe can be the same as the target sequence of the target (according to Depending on the type of analysis used, 2 - and: less than about 5 度60, 65, or 70 nucleotides. In general, the length is at least about 3 nucleotides. In a particular embodiment, the length of the primer or probe is between about 18 and about 28 cores. However, in his specific example, such as nucleic acid _ and other examples of gamma gamma on the kebe, the probe length is long, such as about 30-70, 75, 80, 90, 100 nucleus in length. Glycosidic acid or above. In a consistent example, the kit of the present invention comprises a polynucleotide acid for the first-group separation of the 4954256. Specifically, the separated t has a singular ID N〇S : 3 and 4 primers. In another 'A, this set contains a flute for genotyping identification of rsl6863886 _

St polynucleotide. Specifically, the "isolated polynucleosides" have the introduction of Ϊ^ NOS: 5 and 6, respectively. In yet another example, the sleeve of the invention comprises the first and second sets of isolated polynucleotides described above. According to the present invention, the kit may further comprise a reagent for the side, such as a reagent, such as (1) hydrazine to purify the nucleic acid; (7) 13 201115146 dNTPs 'depending on the situation, one or more special Labeled dNTps; (?) Synthetic labeling reagents such as 'chemically activated derivatives of fluorescent dyes, · (4) enzymes, =, reverse transcriptase, DNA polymerase, and the like; (5) Various buffering substrates, such as hybridization and washing buffers; (6) purification reagents and components of labeled probes, such as centrifuge tubes, etc., and (7) signal generation and detection reagents, such as the bond Yit Avidin-test luciferase co-light and its analogs. ▲In. In the example of the present invention, the kit of the present invention further includes a framework for the results of the detection and the 5 evaluation. Specifically, the specification is mentioned in the specification, and in the result of the identification of the genetic product, Liu Festival is. The presence of the allele and the G allele of Μ·3· is an indicator of an increased likelihood of complete response to chemotherapy and radiotherapy. More specifically, the instructions for use, as the number of C alleles of rs4954256 increases, will be able to assess the disease about 4.54 times; ^ touch: light relaxation therapy has a complete response, and the lion's G, etc. The increase in the number of genes will allow the assessment of the disease to be approximately 3 84 times more complete with chemical and radiotherapy. θ Various specific examples of the invention are detailed below. Other features of the invention will be apparent from the following detailed description of various specific examples. Example 1: Patient population and therapy The study included 90 patients with ECa, male, less than 7 years old, and received hospital-assisted CXRT, followed by esophageal surgery. All patients were signed with a sound, and the study was approved by the in-hospital review committee of the National Taiwan University Hospital. Peripheral blood samples from individual patients were taken before hand ^. The surrounding white blood cells are separated and stored for further testing. The treatment plan based on the shun turn-by-turn (5th day and 5th day of the week vomiting 5_ qi urinary (administering 225 meggars per day 2) and/or i pinging two ^ (mother week! day and 4th) 35 mg/m2), 4 〇〇〇 仏 仏 以 以 以 以 以 CC CC CC CC CC 新 新 CC CC CC : : : : : : : : : : : : : : : : : : : : : : : : : : : : : Gong A, g, nourishment, H-like performance status, acceptability, hand 14 201115146 Ϊίί's patient's disease, and the stomach or the end of the operation to take the operation of the food group, Qing estimated, the New CCRT patients are divided into two § Record / _ + complete response to the complete response, as well as the observed adverse reactions of the process. Table 3 summarizes the heart

Age (years) Average SD Smoking No data available Alcohol abuse No information on chewing betel nut No information 55.20 7.2836 54.87 8.2263 32 7 5 32 7 5 13 26 31 6 9 31 6 9 12 25 9 Example 2: Two stages Gene Correlation Study (GWAS) 二^ Perform a two-stage GWAS to identify the sputum available for predicting CCRT in ECa patients. Figure 1 shows the schematic flow of the study design. Stage 1 = Gewei 2006; 38:209-13 As suggested, stage 1 includes approximately 30%: the ethnic group. Therefore, 15 patients were randomly selected from CCRT complete responders (n=44) and no responders (n:=46). Table 4 summarizes the clinical features of this 30; C and the remaining 6 patients. S] 15 201115146

Age (years) Average SD No data available Alcohol abuse Is there no information on the arm 榷榔 55 55.67 6.2526 54.6 7.8944 54.97 7.8580 55 8.5049 11 2 2 10 3 2 21 5 3 21 3 7 11 2 2 10 3 2 21 5 3 21 3 7

The protein imitation extraction is further extracted from the blood sample by 〇.5% observation and 200 μ_丁=理, so that it can be digested and digested with the identifiable digestion. Do not recognize m ^ Lin? The adaptor of the overhang is used as a link; the link is connected to i: a DNA fragment containing an adaptor = 曰ί i 4 . PCR conditions

St ^ biases it to a fragment of the size range of UG() bp. Fragmentation, labeling, and hybridization of the amplified DNA to the GeneChi_ =an Mapping 500K array (Aftymetrix, lnc., Santa Clara, 16 hours after the master was performed at 49 C) with Fiuidics station 450 &gt The array was washed monthly and scanned with the GeneChip Scanner 3000. Fisher's exact test was used to explore the correlation between individual SNPs and CCRT responses. According to the following two criteria: (丨) a limited genome There are at least three consecutive SNPs with an output value of <〇.0〇1; and 16 201115146 (2) the most significant SNp in this region (Pw gamma 2〇〇6; 66:1556_64), in stage 1 26 candidate SNPs were obtained. Phase 2

The genotypes of 26 candidate SNPs were further confirmed for all 9 patients according to the lPLEX protocol [using the MassARRAY system from Sequen(R) (San Dieg〇, USA). This analysis was carried out based on the adhesion reaction produced by the primer adjacent to the polymorphic site. PCR primers and extension primers were designed using the software SeqTool D〇cument vl 〇 (IBMS, Taiwan). The addition of a DNA polymerase plus a mixture of nucleotides and a terminator allows the primer to be extended through a polymorphic site and produce a product of a particular mass. Then use MassARRAY

The TyperAnalyzer v3.3 software (Sequenom) analyzes the quality of the primer extension product to determine the nucleotide sequence of the polymorphic site. For the two SNPs, rs4954256 and rsl6863886 'design the following primers for pCR amplification: 5'-ACGTTGGATGTCTAXX(}ITTC for rs4954256, X(}T ATCTC-3' and 3'-ACGTTGGATGCCATATTGGAGAGTTAAC AG-5, and for rsl6863886 5'-ACGTTGGATGCTGC TTAAGGCAATGGTGTC-3' and 3'-ACGTTGGATGTTACT TTGGCCCTTCTG TCC-5' were used. For the two SNPs, the following PCR conditions were used. 0.5 mM each primer '200 mM dNTP, 2.5 units of Taq polymerase, containing The enzyme standard polymerase buffer (1.5 mM MgC12), and 150 ng of genomic DNA. The total volume of the PCR mixture is 25 ml. The PCR temperature program is: denaturation at 95 ° C for 5 minutes; 95 ° C for 1 minute for 35 cycles, 55 ° C 1.75 minutes, and 72 ° C 1.75 minutes; and 72 ° C end extension 1 。 minutes. Using a 6% agarose gel, 50 W for 30 minutes for PCR products. Use MassARRAY TyperAnalyzer v3.3 Software (Sequenom,

San Diego, USA), to manually determine the classification of SNPs. An independent Fisher accuracy test was performed on the remaining 60 samples (outside the 30 samples in Phase 1). No significant differences were observed between the two populations (data not shown). Therefore, the collection is taken from the data of all 90 samples to obtain a better η in phase 2.

I S I 17 201115146 South statistical power (statistical power). Among the patients in stage 1 and 2, there was no significant difference in mean age between complete responders and adverse responders (data not shown). In addition, clinical features (including smoking, alcohol consumption, and chewing betel nut) were not significantly different between complete responders and adverse responders and were therefore not included in further analysis (data not shown). The genotypes of 30 patients in Phase 1 were confirmed with Sequenom data; 8 SNPs with high replication error rates and low s sell rates were excluded from further analysis. The sample in Phase 2 consisted of the 30 patients and the remaining 6 patients. At the same time, the problem of multiple experiments was solved using the Bonferroni correction in Phase 2. After the correction, the addition model showed two SNPs, rs4954256 and rsl6863886, which were significantly correlated with CCRT response (rs4954256: OR=3.84, 95% CI=1.56-9.43, p=0=0:002; rsl6863886: 〇 R = 4.54, 95% CI = 1.81-11.40, value = 9 χ ΙΟ 4). Table 5 lists the statistics of 18 candidate SNPs in stages 1 and 2. 18 201115146 Table 5 Stage 1* Stage 2** 0=90) Minor (/7=30) MAF5 Alleles Completely SNP Location Gene/?-Value §§ Responder/> Value §§ OR ( 95%CI) a rsl2713098 2pl6.3 XRXN1 A 7.64X10'5 0.500 0.3667 0.092 1.66 (0.87-3.17) rs4954256 2q21.3 ZRANB3 C 3.85xl0'5 0.2841 0.0930 0.002 3.84 (1.56-9.43) rsl6863886 2q36.1 Intergenic G 4.75xl0'7 0.2841 0.0870 9x1 O'4 4.54 (1.81-11.40) rs4284824 2q37.1 INPP5D C 5.35xl0'5 0.3182 0.4651 0.062 0.54 (0.29-1.01) rs4697204 4pl5.31 Intergene G 1.02X10·4 0.4886 0.3256 0.032 1.98 (1.05-3.74) rs 1876266 4ρ16·1 Intergenic V 1.7〇xl〇·4 0.3068 0.1413 0.012 2.88 ( 1.30-6.37) rs 1440971 7q32.1 Intergene C 1.73x1 O'5 0.2045 0.1047 0.093 1.99 (0.88-4.54) Rsl630140 9q22.2 Intergenic C 1.3 lx 10-4 0.1364 0.3023 0.010 0.32 (0.14-0.74) rs 1805740 12p31.13 PHC1 C 6.31X10·4 0.2955 0.2093 0.224 1.53 (0.78-3.00) rs4240039 Xpll.4 Intergene G 7.97XHT4 0.1364 0.2558 0.057 0.68 (0.39-1.17) rs4830776 Xp22.2 Intergenic C 1.23X10·4 0.2045 0.357 1 0.028 0.68 (0.42-1.10) rs5937044 Xql3.1 Intergene A 1.61X10-5 0.2954 0.2791 0.868 1.04 (0.65-1.66) rs927142 Xq21.31 Intergenic G 1.55xl (T5 0.5 0.444 1 1.12 (0.73-1.85) rs5990542 Xq21 .33 Intergenic C 1.31X10-4 0.5227 0.4286 0.226 1.21 (0.79-1.85) rs5910842 Xq24 Intergenic A 3.56xl0'7 0.5 0.3043 0.010 1.41 (0.92-2.15) rsl0521750 Xq25 Intergenic C 1·91χ10·6 0.5682 0.3810 0,015 1.46 (0.95-2.25) rs5951775 Xq27.3 Intergenic T 1.68X10-5 0.1591 0.0698 0.095 1.59 (0.78-3.24) rs!202918 Xq28 Intergenic A 4.53xl0'5 0.5114 0.3478 0.035 1.41 (0.92-2.15) ^MAF stands for secondary Allele frequency talks P-values taken from Fisher's accuracy test *p-values are calculated from data obtained from 30 patients using microarrays** Results in Phase 2 are based on mass spectrometry For the sample, the calculation OR represents the odds ratio and is calculated using the additive model. 19 201115146 In addition to the Fisher accuracy check, the C〇chran-Armitage trend check is also performed to confirm the secondary allele. Increase in number, rs4954256 value = 0.002) and rs L6863886 (/?-value = 6χ1 (Γ4) has a significant correlation with CCRT response. With the increase in the number of minor alleles, SNPrsl6863886 was significantly associated with a full CCRT response of 4.54x chance (95% confidence interval (ci)

=1.81-11.40); while SNP rs4954256 was significantly associated with a full CCRT response of 3.84 times chance (95% CI = 1.56-9.43). In addition, according to the additive model, the correct rate of the Leaf-One-Out Cross Validation (LOOCV) used to predict the CCRT response was 64.37% (56 of 87 patients) for rs4954256, and It is 68.89% for rsl6863886 (62 out of 90 patients). Combining the two SNPs increased the predictive accuracy rate to 72.4% (63 of 87 patients). The sensitivity of this experiment (correct prediction of non-responders) and specificity (correctly predicted responders) were 70% and 75%, respectively. The positive predictive value was 71% and the negative predictive value was 73%. The regression coefficients for rs4954256 and rsl6863886 were 1.3572 and 1.5745, respectively. This indicates that the likelihood of a complete CCRT response increases as the number of minor alleles increases. These results indicate that rs4954256 and rsl6863886 are strongly associated with CCRT responses in patients with ECa and can be used to predict CCRT responses. This is the first two-stage GWAS to identify SNPs with high correct rates to predict CCRT responses to ECa. Two SNPs were found here, and rs4954256 and rsl6863886' were significantly associated with complete CCRT response (as the number of minor alleles increased) and provided a high level of predictive accuracy (72.41%). These gene phylogenetic polymorphisms determined in blood samples do not change over time 'as opposed to body mutations taken from tumor tissue (which will vary with disease progression)'. The use of the two SNPs described herein can assist in predicting the response of an ECa patient to a CCRT' and thus can determine the most appropriate treatment for the patient based on the predicted gentleman's fruit. BRIEF DESCRIPTION OF THE DRAWINGS The present invention, as well as the foregoing embodiments, will be more apparent in the context of the accompanying drawings. The purpose of the present invention is illustrated in the drawings and is now a preferred embodiment. However, it should be understood that the present invention does not recognize the preferred embodiment. In the drawings: Figure 1 shows a schematic flow of the example study design above. 21 201115146 Sequence Listing <110> National Taiwan University<120> Bios for predicting the response of esophageal cancer patients to chemical and radiotherapy ^ <130> NTTU0006TW <160> 6 <170> Patentln 3.5 Edition <210&gt 1 <211> 52 <212> DNA <213>Human sapiens <220><221><222> (1) .. (52) <400> 1 atattggaga gttaaca£ag Aatgccyaaa actggaaaaa caaaaacttc aa 52 <210> 2 <211> 52 <212> DNA <213> Human (Homo sapiens) <220> <221><222> (1) .. (52) <;400> 2 aatggtgtcc cttgaaggct atctgtytgc ttttggataa aatggacaga ag 52 <210〉 3 201115146

<211> 30 <212> DNA <213> artificial sequence <220><223> rs4954256's introduction <400> 3 acgttggatg tctaccgttt cccgtatctc 30 <210> 4 <211> 30 <212> DNA < 213 > artificial sequence < 220 < 223 > rs4954256 primer <400 > 4 gacaattgag aggttatacc gtaggttgca 30 <210> 5 <211> 30 <212> DNA < 213 > artificial sequence < 220> <223> rsl6863886 primer <400> 5 acgttggatg ctgcttaagg caatggtgtc 30

<210> 6 <211> 30 <212> DNA <213> artificial sequence <220>223> rs 16863886 Introduction 2 201115146 <400> 6 cctgtcttcc cggtttcatt gtaggttgca 30 3

Claims (1)

201115146 VII. Scope of Application: 1. A method for predicting the response of esophageal cancer patients to chemical and radiotherapy, comprising a single nucleotide polymorphism (SNP)-tagged gene from a test sample taken from the patient. Type identification, the marker is selected from the group consisting of rs4954256, rsl6863886, and combinations thereof, wherein the presence of the C allele of rs4954256, the presence of the G allele of rsl6863886, or the presence of both is for chemical cum Radiation therapy has an increased likelihood of a complete response. 2. The method according to claim 1, which comprises genotyping the rs4954256 to a test sample taken from the patient, wherein the presence of the C allele of the SNP marker is a possibility of complete reaction to chemical and radiotherapy Increased indicators. 3. The method of claim 1, which comprises genotyping rsl6863886 for a test sample taken from the patient' wherein the presence of the G allele of the SNP marker is a complete response to chemical and radiotherapy Increased indicators. 4. The method according to claim 1 which comprises genotyping a combination of rs4954256 and rsl6863886 for a test sample taken from the patient, wherein both the C allele of rs4954256 and the G allele of rsl6863886 are & It is an indicator of the increased likelihood of complete response to chemical and radiotherapy. 5. According to the method of claim 1, wherein the genotype identification of rs4954256 is performed using the first primer pair, the first primer pair has 8] £ (5 ID N〇s: 3 and 4. respectively. 6. According to the method of claim 1 , wherein the second primer pair is used to perform genotype identification of rsl6863886, and the second primer pair has SEQ IDN0S: 5 and 6 〇7, respectively, for implementing the kit according to the method of claim 1, which comprises a plurality of A polynucleotide for rs4954256, rsl6863886, or a combination thereof. & 201115146 8. The kit according to claim 7, which includes the first-fine separation for genotyping of rs4954256 9. The kit according to claim 8, wherein the isolated polynucleotides have the primers of SEQ ID NOS: 3 and 4, respectively. 1. The kit according to claim 7, which comprises A second set of isolated polynucleotides for genotyping for rsl6863886. 11. According to the set of claim 1 ,, the isolated polynucleotides have the primers of SEQ ID NOS: 5 and 6, respectively. 12. The set according to claim 7 'which is included to target rs4954256 A first set of isolated polynucleotides for genotyping, having SEqIDN〇s: 3 and 4, respectively, and a second set of isolated polynucleotides for genotyping of rsi6863886, respectively having SEQ IDNOS : 5 and 6. 13. According to the kit of claim 7, which contains the instructions for use, the results of the genotype identification are the C allele of rs4954256 and the G allele of rsi6863886 for chemical and radiotherapy. An indicator of the increased likelihood of complete response. 2