TW201114894A - A novel promoter and applications thereof - Google Patents

Abstract

The present invention relates to a novel promoter found in the upstream region of the myosin light chain-2 (mylz2) gene, and applications thereof. The promoter according to the invention exhibits an enhanced promoter activity, which is useful for producing transgenic animals, particularly fluorescent fish.

Description

201114894 VI. Description of the Invention: [Technical Field to Which the Invention Is Applicable] Gene The present invention relates to a novel promoter derived from zebrafish myosin light chain 2 (2) and uses thereof. [Prior Art] Gene touch is widely used in the field of biotechnology. _Technology, basin-based techniques, through the human-fashioned way, can be expressed in the human body cells or Newton cell towels to modify the animal's genes = Or give _ performance traits. Base-transfer technology is one of the most actively used technologies in animal husbandry, especially for cattle. ^ To improve varieties, increase growth rate, and improve meat quality' In general, squamous human DNA regulates its performance. Promoter sequence. Choosing the appropriate promoter can be used as a function of the following method: 'In the _ _ in the _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ Most of the regulatory elements are from mice or viruses, which makes the research institute Ai: 2 body ^ after all, there is a virus-derived DNA fragment. In recent years, the study of ali_fish transgenic fish has been fully prepared. The genes and the regulatory elements used are derived from ^: the fish that have been successfully transferred to the scorpion can change the characteristics of some genes, but not with the genes from other species. Section. Performance In this f-domain, there is a need to find potential promoters, and soaps are used in animal genetic technology, especially fish. SUMMARY OF THE INVENTION The present invention provides an isolated nucleic acid molecule. The thief is riding a shout. The nucleic acid fragment isolated from the tree; the m invention provides a recombinant vector comprising a first-nuclear=segment from the nuclear sequence of se(10)n〇:1 to also the recombinant vector of the present invention further comprising a second nucleic acid fragment , 1 =!; egg, polymorphic: and f is connected to the first - nucleic acid fragment ί. Root two μ first nuclear I tablets #also encode an exogenous protein 戋 multi-code == quality of the second nucleic acid fragment of the recombinant vector of the invention, the method of the invention can be used to prepare transgenic fish, especially It is the specific example of the work (4). The detailed description and patent application of each of the other specific examples of the present invention are merely illustrative; rather than the embodiment of the invention, the section of the invention mainly separates from the upstream sequence of the zebrafish mylz2 gene and initiates the activity of the prismatic activity. The nucleic acid fragment of the nucleic acid fragment can be used to prepare the transcriptional fragment of the nucleic acid fragment. ίίίί is limited to fish, especially the fluorescent fish - 匕栝仁不201114894 The word "一" used in this article, unless otherwise specified, Refers to the quantity of at least one (one or more). As used herein, the term "nucleic acid molecule" or "nucleic acid" refers to a polymer of nucleomonomers which may be single or double stranded, linear or cyclic, deoxyribonucleic acid (DNA) or ribonucleic acid. (rna). A nucleomonomer includes a phosphate moiety, a glycosyl moiety, and a base moiety. Common bases of nucleotides include guano (G), adenine (A), cytosine (C), thymidine (T), and uracil (u) 'where adenine and thymine or Uracil pairing 'and bird wing ° 1» order paired with cell shouts. As used herein, "isolated nucleic acid molecule" refers to a nucleic acid that has been purified from a source of natural organisms or a nucleic acid produced by chemical synthesis or PCR amplification techniques. For purification methods, chemical synthesis methods and PCR amplification techniques of nuclear rafts, see Molecular Cloning: A Laboratory Manual, Second Edition, c〇ld

Spring Harbor Laboratory Press ’ SambrookJ et al., 1989,

And Current Protocols in Molecular Biology, Frederick M.A 4 authored '2001 ' John Wiley & Sons, Inc. The nucleic acid molecules of the present invention can be obtained by those skilled in the art in accordance with conventional techniques, and the methods are described in the following examples. As used herein, "operably linked" or similar terms refers to the manner in which a regulatory sequence is linked to another nucleotide sequence encoding a particular gene product such that the nucleotide sequence is subjected to the control or regulation of regulatory sequences, The gene product is expressed under appropriate conditions. Stomach As used herein, "recombinant" is used to describe a sequence in which a nucleic acid molecule contains a non-natural link. The recombinant nucleic acid molecule can be in the form of a vector which can include one or more structural sequences encoding the gene and regulatory sequences for expression of the gene, such as a 'promoter sequence. The types of carriers include, but are not limited to, plastids, vesicles, bacilli, YAC or PAC, and the like. The screaming body can perform the performance or copy the introduced gene sequence. Typically, in the recombinant vector, the structural sequence of the coding gene is operably linked to a regulatory sequence such that when the recombinant vector is introduced into a suitable host, the structural sequence of the coding gene is regulated in the regulatory sequence of the regulatory sequence. Regulatory sequences can include, but are dilute to, the promoter phase, the origin of replication, or the sequence of secretion messages. . In Ma Yu #核ΐίΓ编码..." or a similar term thereof is a column that can be used as a template under appropriate conditions to express the gene's 疋' due to the degeneracy of gene coding (consisting of three nuclear phytic acids) Sex: Different gene codes can encode the same amino acid residue, for example, G blood r is day = (= =: production: = base acid residue usually, knowledge: can use routine techniques and known The gene code is biased == usage) to obtain the corresponding nucleotide sequence and its degenerate sequence. Therefore, the (4) acid sequence still includes its degenerate sequence (may be ω = provide - the species scorpion thief molecule, which is composed of seq early sequence lin. Specifically (four), the nucleic acid of the present invention is the upstream sequence of the imylz2 gene, and its length is In the prior art, the promoter activity of liters can be used to express operably linked to the H. According to an embodiment of the invention, the nucleic acid molecule has better promoter activity with other promoters; in particular, L9 kb The activity of the promoter fragment was about 2.8 times higher (as listed in Example 3). The present invention provides a shamming body comprising a first nuclear S ϋ nucleic acid fragment by seqidn〇: 1 The (4) acid sequence of the im-recombination of the present invention comprises a second nucleic acid fragment, U = and operably linked to the first nucleic acid fragment. According to the present invention, the second nucleic acid fragment is expressed by the first nucleic acid fragment. According to the present invention, the discovery acid fragment can be (4) the performance of the money or give a new table 2 to increase the growth rate, improve the meat quality, improve the disease resistance and the ability, the color, the color, or enhance the ornamental value. A specific implementation state of the external volume accounted for two The acid fragment encodes an exogenous protein or polypeptide, for example, the protein shell can be made into an aquarium fish, or the exogenous 201114894 egg protein can be made into a disease-resistant fish to increase fish viability. Mothers ϊ ί ί 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 YFP) Two columns such as 'enhanced secondary protein (EGFP), enhanced (wp). The amino acids and cores of these proteins have been woven. For example, the red fluorescent protein has the nucleus of SEQ ID NO: 2, the amino acid sequence of SEQ ID NO: 3 (Fig. 4).

>, In a specific example, the recombinant vector of the present invention comprises the SEQ ID NO: 4 column, which covers the nucleotide sequence (promoter) of SEQ1DN〇: 1 and SEQ ID NO of the code red fluorescent protein: 2 nucleotide sequence. In addition, the novel of the present invention may optionally include other sequences having a specific function, for example, an origin of replication, a termination sequence, a marker gene for screening, for example, an antibiotic resistance gene, and the like. This is the domain that has the knowledge of t knowing! ^ The existing knowledge selects the appropriate sequence 1J, using the carrier of the conventional genetic engineering technology. (4) Genetic engineering techniques, such as polyhedral-reaction (pCR) amplification techniques, nucleic acid purification, enzymatic treatment of nucleic acids and nucleic acid fragments, and sequencing techniques, see Molecular Cloning: A Laboratory Manual A Current Protocols mMolecular Biology (ibid.). Specific carrier construction details are illustrated in the following examples. Accordingly, in yet another aspect, the invention provides a method of making a transgenic animal comprising introducing the recombinant vector described herein into an animal cell. According to the present invention, "transgenic animal" as used herein includes, but is not limited to, cattle, sheep, pigs, fish, shrimp, and the like which do not contain human lice. In particular, the transgenic animal according to the present invention is a fish, more specifically a fish species that is scientifically or commercially useful, including but not limited to zebrafish (Zebraflsh, such as Z) fine b rmb), Angelfish (angelflsh, such as colorful discos, ), blue scale fish (me (jaka), goldfish (goldfish), wrapped fish 201114894 (carp), jin (koi), mud autumn (i〇ach), Wu Guo Yu (1 叩诅), glassfish, catflsh, eel, tetra, goby, 〇 ami ami, gypnus (gUppy), swordfish (Xiphophorus), mulberry fish (Molly fish), and squid (pangasius). In a specific example, the transgenic animal according to the present invention is a zebrafish. The method of the present invention can be utilized. Standard techniques for transgenic genes, such as microinjection, eiectroporation, virus infection, and sperm-mediated gene transfer, to force the nucleic acid molecules of the invention into animals Gametes, fertilized eggs, embryos Within the nucleus or cytoplasm of a somatic cell, the nucleic acid molecule of the invention can continue to replicate in the embryo or cell, thereby producing a transgenic animal on the individual and its progeny cells. In a particular example, the transformation according to the invention The cloning animal is made by zebra, which is made by the female microinjection technique to introduce the recombinant vector into the squid cell. In a further description, the appropriate volume of the recombinant vector is aspirated using a capillary needle and injected into the single cell stage. The zebrafish are fertilized, and the injected A eggs are concentrated in a clean petri dish. As for the 28-inch incubator, the fry are produced at about 48 2'. Various conventional methods have been developed to identify or screen the bands. Animals with a transgenic gene, such as 'design a probe for recognizable transgenic genes, to detect whether there is a turn in the candidate animal by Northern blotting or Southern blotting (s〇 her embl〇tting) The sequence of silk, or the amplification of pcR for a specific nucleic acid paste. The animal of 敎 can be observed directly by eye. π(10) 尤 protein is in a specific example towel, the square wire of the present invention will The code fluorescent protein group vector is introduced into the fertilized fish, and the sister is connected to the table, and the fluorescent system is transferred to the sputum, and the _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ Detailed description and ^ 201114894 Example 1: Extraction of genomic DNA This experiment uses zebrafish (Zebrafish, i) a «z〇rm〇) as a material, using the commercial kit PureLinkTM Genomic DNA Mini Kit (Invitrogen, USA) Genomic DNA. Briefly, put the tissue into a microtube, add PureLinkTM Genomic Digestion Buffer and Protease κ, and decompose the tissue at 55 °C with occasional shaking, uniform reagents, until the tissue is completely decomposed, the process is about 1 to 4. hour. After centrifugation at room temperature, the supernatant was placed in a new microtube, RNase A was added, and a slight shock was applied. The mixture was allowed to stand at room temperature for 2 minutes. Add 200 μΐ of pureLinkTM genome disruption/binding buffer, mix well, then add alcohol (96-100%) and mix by shaking. The lysate is passed through a column by centrifugation. After washing, secondary water or pureLinkTM genome extraction buffer is added, and after standing, it is centrifuged to obtain purified genomic DNA. Example 2: The promoter design of the promoter fragment was synthesized by the Biotech Co., Ltd. and the Taiwan Biomedical Union. The sequence of the primer is as follows: ____ bow I subname.__序歹|J__ 5'mylz2 2.5kXhol CGCTCGAGATGCTGTGAAGTATTCTCTACTT _ (SEQ ID NO: 5)

3' mylz2 2.5k A%el CGGCTAGCGTAGTGTCCTGTACTTGAGGGGC (SEQ ID NO: 6) _ --- Using the zebrafish genomic DNA as a template, add the above-mentioned positive and negative primers, DNA polymerase to the PCR tube, as follows: Buffer, dNTPs, etc. Reagent, content reagent content genomic DNA 100 ng 10X ThermoPd reaction buffer 2.5 μΐ lOmMdNTP 2 μΐ 5〇μΜ primer (5' my/z2 2.5k ^T2c>I) 0.25 μΐ 201114894 50 μΜ primer (3' –/z2 2.5kM ^I) 0.25 μΐ DNA polymerase (5 υ/μΙ〇 0.25 μΐ ddH20 is filled up to a total volume of 25 μΐ - 丨- Move the above PCR tube to a PCR reactor (Applied Biosystems 2700, USA) for PCR reaction The conditions are as follows: the initial denaturation reaction is 94 ° C for 5 minutes. The cycle of denaturation, bonding and extension reaction is 94 ° C for 30 seconds, 55 ° C for 30 seconds and 72 ° C for 2 minutes, repeating 35 cycles, and finally extending. The reaction was 72 ° C for 10 minutes. Finally, the reaction was terminated at 4 ° C. After the end of the PCR reaction, the PCR product was analyzed by agar gel electrophoresis, and the colloid containing the PCR product fragment of the predicted size was cut out to commercialize Gel/ PCRDNA Fragments Extraction Kit ( Geneaid, Taiwan), obtained purified PCR product. The purified PCR product was cloned into pCRII-TOPO-TA vector (Invitrogen), first screened by antibiotics of the transgenic strain, and then limited by Taipei Kelonex Biotechnology Co., Ltd. The company uses the nucleic acid sequence autosequencer (ABI) for sequencing work. At least 5 sequences are analyzed from the 5th and 3rd ends, and the strain is selected to confirm that it contains the recombinant vector pCRII-mylz2-2.5k. The recombinant vector carries a promoter fragment having the nucleotide sequence of SEQ ID NO: 1, hereinafter referred to as "2.5 kb promoter month." Figure 1 shows the nucleotide sequence of the 2.5 kb promoter fragment (-1 to -2504). Example 3: Construction of luminescent enzyme recombination carrier and promoter activity analysis Using the above recombinant vector pCRII-mylz2 2.5k as a template, one of the following 5' primers was used, plus 3, and the primer was used to increase the PCR by 2.5. Kb 竺叟 and its truncated fragments (2.3kb, 2.1kb and 1.9kb): _

Myiz2 2·5Κ 5' Sacl CGGAGCTCATGCTGTGAAGTATTCTCTA _____(SEQ ID NO: 7)

Mylz2 2*3K 5' Sacl CGGAGCTCTACTAATTGATGATTAGTTT ___ (SEQ ID NO: 8) 201114894 mylz2 2.1K5'&amp;cI CGGAGCTCTTGCCAGTTTAGTTCAGTCA __(SEQIDNO: 9) mylz2 1.9K 5' Sacl CGGAGCTCGTGTATTTTTTATGCAGCGG (SEQIDNO: 10) mylz2 promoter 3' Xhol CGCTCGAGGTAGTGTCCTGTACTTGAGG ___ (SEQ ID NO: 11) Promoter fragments of various lengths were separately selected into the pGL3 basal luminescence reporter vector (Promega 'United States)' to obtain recombinant pGL3 vectors containing promoter fragments of different lengths. The pRL_TK vector expressing the jellyfish luciferase gene was used as an internal control group, and the recombinant vector (containing a promoter fragment of different length) or the pGL3 basic vector (without the promoter fragment) in a ratio of 1:1, respectively. After mixing, the zebrafish fertilized eggs were introduced into the single cell stage by microinjection. The fertilized eggs were incubated at 28 ° C for 72 hours, and the promoter activity was measured in a commercial kit Dual_Ludferase 8 Repose II Assa: System (Promega ' USA). Briefly, '10 healthy embryos per group were added and 5 〇 μ1 passive lysis buffer was added to grind on ice. After centrifugation for 1 minute, a mixture of = 5 〇 μ1 luminescence enzyme analysis reagent π (1) was mixed, and a cold light meter (HU〇=Skan Ascent FL lumin_ter, Therm〇-Noga, ^ 2) was used to display the promoter activity analysis filament. The data is based on the flat (eight) Ας &quot; τ. 壬 now 'total three repeated experiments, using the SAS statistical program < 〇 二 = = secret US], statistical significance set in ρ &lt; 〇 · 〇 5 i H plant 13 sub-variant analysis (an〇va) for ί 础 贼 贼 ( ( 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四 四Preparation of fish) Recombinant vector pCRII_mylz2 2 5k cut 2 5 promoter fragments ί, 2 connected 1 can express the red camp light ―1^2·1 vector (C1_ch, USA), pick L correct strain, get Pmylz2 2.5K-DsRed recombinant vector (Fig. 3). / „Retraction of the needle volume (reduced by more than 30 doses (final) is about 2% of the redness), for single cells = spot reading (four) Microinjection. Inject the fish into the clean petri dish, add 4 gas tree pits and deflect it. Check the developmental shape and pick it every day. The material of developmental failure, waiting for the street 2 small ^ mother ^ red moon clearing, fish, and performance performance from which to select 6 transgenic gene candidates: 6 "two male fish 2, male fish 3, male fish 5, Male: Do not mate with wild-type zebrafish. The yield of the light-breeding progeny of the transgenic gene candidate fish is 18 23% Ο%, 〇%, 0%, and 5.88%, respectively. The firefly 0 is now strong. Then from the female preparation 1 Shanghai F1 towel, the first table, purified and stabilized the line, at least continue to multiply from one (four). The more even in the snout is also _f silk Now; phase: fish 'abdominal no obvious camp light performance = because, the sound of the sound based on the aquatic animal transfer research has great help ^ ^ system, especially for the preparation of the effect of significantly improving the performance of the camp ^ In the contribution of Laoguangyu. The industry of τ and mussels has considerable need for further elaboration. I believe that the inventors of the present invention can use the present invention based on the foregoing description to the best of them. 201114894 ί==ί is only Used as an illustration, not by any means [simplified description]

ID and 2 show the nuclear_sequence of the promoter fragment (SEQ acid position.). Numerous buds representing the translational touch position ATG up-counting Figure 2 shows the results of cold-light enzyme activity analysis of the 2.5 kb promoter fragment of the present invention.

Fig. 3 is a view showing the structure of a pm2 '5K-DsRed recombinant vector for preparing a transgenic fish according to the present invention. Figure 4 shows the nucleotide sequence (SEQ ID NO: 2) and the amino acid sequence (SEQ ID NO: 3) of the red light photoprotein encoded by the pm2.5K-DsRed recombinant vector. Figures 5A and 5B show the nucleotide sequence of the pm2.5K-DsRed recombinant vector-expressed promoter to red fluorescent protein (SEQ ID NO: 4).

13 201114894 Sequence Listing &lt;11 〇&gt; Academia Sinica &lt;120&gt; Novel promoter fragment and its application &lt;160〉 11 &lt;170&gt; Patentln version 3.3

&lt;210&gt; 1 &lt;211&gt; 2504 &lt;212&gt; DNA &lt;213&gt; Zebrafish (Ζ&gt;α/Η·ο rerii)) &lt;220&gt;&lt;223>2.5 kb promoter

atgctgtgaa aaaatgttaa attgactaac caaatctctg cagggagtat taattcctca tctagcctga ttgggggatg atgaaaaagt aggcttagtc gtgtattttt atctgtcttt acattagatt accttttcaa tattagtgcc ccttgaggtt cccagtgaca caaaataact aatattaaat aattgttcaa gttttatctt tctgttttgt tattcatttt taggtactgt ccgacagact aagggggaca gattgtttag actgtcttaa tagtgtgctg agcttcccac cggcagagag gggtgtggtg aaaacctatt tatatatcag ctggattgaa caagataagc tttagactct caaacagtcc gtattctcta atgaagggat agcaattcag gacaactaca actacaatat atcaaatatc tctcaagaga agcaaatcat tacaaatttg cctttattaa tatgcagcgg taaattaata agtcagtaca aaggtacata taaaaatttt ttattatgga gtttacaccc tatgataacg acaaatttta aatttgtagg tcaattttgt ttaaatgcac caaaatgggc aaaataatgc cacaggatat aaacagtgac ctattttggt gcctcaaatt accatctaaa aaatggcacc agagagagag ggggcacttg ttcgattagg ccaggggcgt atccatcagg cagtattgat gtggctacag cttacgtccc cttatcttaa attttcaaag ctacaattca tactaattga aaatacgata accccatatg aaacgcgagt actaaaatgt tgttgacccc tcaggattcg atgcccatcc tttttaatag ctctcagaaa tttgtactta aagagaaaca cctttaaggt tttatttctg gtccaaaaac aaacagggaa ttgtaatttt gactaaaata caaaatacat tgtactcgat taatcttaaa caaattagtc tgatgaatta cacccacagc tctcttcatg aactgggaaa tcacagtcac agagagagag aaccgaaatc gctgatttga gaacaaatat atctatcact ctgctgctaa ctcattcatt catgtcctta ttctctaaaa ccaatcgact agtaatgttc tgattagttt aaacttgtga tcccatgctc attttatgtt acgaattagt tcacaaatct ccacagagga agttgcagcc gaagctatac taaaggtgcg aagggtccat cttttgtact acaaattttt agagtgaagc tactacaccc aaatcaagag tttgttgcaa ttattttaat tgcctatatt tactctgagc caattttgga taaagaaaga gacaagaaaa tgttccttat agggtccaac aaggggtaat tgaagtgacc agtgctgaat ttacagcatc aataagggtt gaacaacata gcaaccctcc tctaacttta tcaaattgag ttagtcaacg ataatgcaaa tttagaatag tgaagataga aaacctatta gcatgtatta agcatatatg tcgtacgaat gtcttcattc atgagccacc ctacactggg aatgttatat caagctgtca attgatacct ttttaggtac atcatttgga taaatctgga atatttatat aagcaaaaca tatttagctt aaatatagct cactgagaga actgtaatta acaagaagga agggaatgca agagagcaag gcctgccttc atcaaccact tacgtgcttg gggtgaggt ttgccagttt c atgggcatgg actatactag aagacaccag atcattggct ccatccaaca ggggagggag ttatgtgatt cgagacatgc agtattcttt ataatgttta tatgagttaa ttttacatta aagcaattaa agtacacccc agttcagtca tagccactaa attttctttt aactcatcca aaacacccaa ttgtgcatat ctgcggtggt caaaagtata taatatatac aaggtaccac gcttatttaa gttattgaaa atggaaaaaa tatttaaatt gtttaataaa tggagaaaaa tctgtttttc gcaaaacaag caacaaactc gagcgctcaa ccaaaaaaaa cagagggctg tccacagggc ataggtcgat ccatgtggac gaaaagcatt aacgtcctct caaaaaatct agtaatcctg ttgcgtcccc gtatgaagct aggccgctgc 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 1 201114894 catcagtatc agattcatcc cattccaaga ctccaatagc tatttctgag cactgtaaga 2340 tgatagtaca tcccagccgg tgtccctcca tcactttccc cctacctcat agttttgcct 2400 ctttctctct cggtctgcta tttcccaaac ctcacttaag gttgggtcta taattcgcaa 2460 ggggccttcg tcagtatata agcccctcaa gtacaggaca ctac 2504 &lt;210&gt; 2 &lt;211&gt; 678 &lt;212&gt ; DNA &lt; 213 &gt; &lt; 220> &lt; 223 &gt; red fluorescent nucleotide sequence &lt; 400 &gt; 2 atggcctcct ccgagaacgt catcaccgag ttcatgcgct tcaaggtgcg catggagggc 60 accgtgaacg gccacgagtt 120 cacaacaccg cgagatcgag ggcgagggcg agggccgccc ctacgagggc tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180 ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc 240 gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300 gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360 aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420 atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480 acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540 tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600 atcacctccc acaacgagga ctacaccatc gtggagcagt Acgagcgcac cgagggccgc 660 caccacctgt tcctgtag 678 &lt;210>3 &lt;211&gt; 225 &lt;212&gt;Protein&lt;213&gt;&lt;220&gt;&lt;223&gt; Red fluorescylamino acid sequence &lt;400&gt; 3 MASSE NVITE FMRFKVRMEG TVNGHEFEIE GEGEGRPYEG HNTVKLKVTK GGPLPFAWDI 60 LSPQFQYGSK VYVKHPADIP DYKKLSFPEG FKWERVMNFE DGGVATVTQD SSLQDGCFIY 120 KVKFIGVNFP SDGPVMQKKT MGWEASTERL YPRDGVLKGE THKALKLKDG GHYLVEFKSI 180 YMAKKPVQLP GYYYVDAKLD ITSHNEDYTI VEQYERTEGR HHLFL 225 &lt; 210> 4 &lt; 211 &gt; 3261 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 220 &gt;&lt;223&gt; Artificial sequence &lt;400&gt; 4 201114894

gaattcgccc ataatgcaaa tttagaatag tgaagataga aaacctatta gcatgtatta agcatatatg ttgccagttt tcgtacgaat gtcttcattc atgagccacc ctacactggg aatgttatat caagctgtca attgatacct ttttaggtac atcagttgga taaatctgga atatttatat aagcaaaaca tatttagctt aaatatagct cactgagaga actgtaatta acaagaagga agggaatgca agagagcaag gcctgccttc tcaaccactc acgtgcttgt ggtgaggtca catggccatg actaggaaaa accagaacgt tggctcaaaa caacaagtaa gggagttgcg tgattgtatg catgcaggcc ctgagcactg ctcatagttt gtctataatc ctagccgaag accatggcct ttcgctcgag agtattcttt ataatgttta tatgagttaa ttttacatta aagcaattaa agtacacccc agttcagtca tagccactaa attttctttt aactcatcca aaacacccaa ttgtgcatat ctgcggtggt caaaagtata taatatatac aaggtaccac gcttatttaa gttattgaaa atggaaaaaa tatttaaatt ccaaaaaaaa gtttaataaa tggggaaaaa tctgtttttc gcaaaacaag caacaaactc gagcgctcaa ggcgaattct cctccgagaa atgctgtgaa agagggctgt ccacagggca taggtcgatc tggacgggtg gcattaaaac cctcttatat aatctctgga tcctgcaaga tcccctttag aagctcaaac gctgccatca taagatgata tgcctctttc agcaaggggc aaaatgttaa attgactaac caaatctctg cagggagtat tctagcctga ttgggggatg atgaaaaagt aggcttagtc gtgtattttt atctgtcttt acattagatt accttttcaa tactagtgcc ccttgaggtt cccagtgaca caaaataact aatattaaat aattgttcaa gttttatctt tctgttttgt tattcatttt taggtactgt ccgacagact aagggggaca gattgtttag ctgtcttaag agtgtgctga gcttcccaca ggcagagaga tggtgggggc ctattttcga atcagccagg ttgaaatcca taagccagta actctgtggc agtcccttac gtatcagatt gtacatccca tctctcggtc cttcgtcagt gcagtcgacg cgtcatcacc gtattctcta atgaagggat agcaattcag gacaactaca actacaatat atcaaatatc tctcaagaga agcaaatcat tacaaatttg taattcctca cctttattaa tatgcagcgg taaattaata agtcagtaca aaggtacata taaaaatttt ttattatgga gtttacaccc tatgataacg acaaatttta aatttgtagg tcaattttgt ttaaatgcac caaaatgggc aaaataatgc cacaggatat aaacagtgac ctattttggt cctcaaattt ccatctaaaa aatggcacct gagagagaga acttgaaccg ttagggctga ggcgtgaata tcaggatcta ttgatctgct tacagctcat gtccccatgt catcccattc gccggtgtcc tgctatttcc atataagccc gtaccgcggg gagttcatgc cttatcttaa attttcaaag ctacaattca tactaattga aaatacgata accccatat g aaacgcgagt actaaaatgt tgttgacccc tcaggattcg atgcccatcc tttttaatag ctctcagaaa tttgtactta aagagaaaca cctttaaggt tttatttctg gtccaaaaac aaacagggaa ttgtaatttt gactaaaata caaaatacat tgtactcgat taatcttaaa caaattagtc tgatgaatta cacccacagc ctcttcatga actgggaaaa cacagtcact gagagagtgc aaatcttaca tttgaaataa aatatgaaca tcactgcaac gctaatctaa tcatttcaaa ccttattagt caagactcca ctccatcact caaacctcac ctcaagtaca cccgggatcc gcttcaaggt ttctctaaaa ccaatcgact agtaatgttc tgattagttt aaacttgtga tcccatgctc attttatgtt acgaattagt tcacaaatct ccacagagga agttgcagcc gaagctatac taaaggtgcg aagggtccat cttttgtact acaaattttt agagtgaagc tactacaccc aaatcaagag tttgttgcaa ttattttaat tgcctatatt tactctgagc caattttgga taaagaaaga gacaagaaaa tgttccttat gggtccaaca aggggtaatt gaagtgaccg tgaatatggg gcatcactat gggttaagac acataatcat cctccccatc ctttagggga ttgagttatg caacgcgaga atagctattt ttccccctac ttaaggttgg ggacactacg accggtcgcc gcgcatggag 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 138 0 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 201114894 ggcaccgtga acggccacga gttcgagatc gagggcgagg gcgagggccg cccctacgag 2700 ggccacaaca ccgtgaagct gaaggtgacc aagggcggcc ccctgccctt cgcctgggac 2760 atcctgtccc cccagttcca gtacggctcc aaggtgtacg tgaagcaccc cgccgacatc 2820 cccgactaca agaagctgtc cttccccgag ggcttcaagt gggagcgcgt gatgaacttc 2880 gaggacggcg gcgtggcgac egtgacccag gactcctccc tgcaggacgg ctgcttcatc 2940 tacaaggtga agttcatcgg cgtgaacttc ccctccgacg gccccgtgat gcagaagaag 3000 accatgggct gggaggcctc caccgagcgc ctgtaccccc gcgacggcgt gctgaagggc 3060 gagacccaca aggccctgaa gctgaaggac ggcggccact acctggtgga gttcaagtcc 3120 atctacatgg ccaagaagcc cgtgcagctg cccggctact actacgtgga cgccaagctg 3180 gacatcacct cccacaacga ggactacacc atcgtggagc agtacgagcg caccgagggc 3240 cgccaccacc tgttcctgta g 3261 &lt; 210 & gt 5 &lt;211&gt; 31 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; DNA primer (5, mylz2 2.5k Xhol) &lt;400&gt; 5 cgct Cgagat gctgtgaagt attctctact t 31 &lt;210&gt; 6 &lt;211> 31 &lt;212>DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; DNA primer (3' mylz2 2.5k Nhel) &lt;400&gt; 6 cggctagcgt Agtgtcctgt acttgagggg c 31 &lt;210&gt; 7 &lt;211&gt; 28 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; DNA primer (mylz2 2.5K 5' SacI) &lt;400&gt; 7 cggagctcat gctgtgaagt Attctcta 28 201114894 &lt;210&gt; 8 &lt;211&gt; 28 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; DNA primer (mylz2 2.3K5'SacI) &lt;400&gt; 8 cggagctcta ctaattgatg attagttt 28

&lt;210&gt; 9 &lt;211&gt; 28 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; DNA primer (mylz2 2.1K5'SacI) &lt;400 9 28 cggagctctt gccagtttag ttcagtca &lt;210 10 &lt;211&gt; 28 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; DNA primer (mylz2 1 ·9Κ 5, SacI) &lt;400&gt; 10 cggagctcgt gtatttttta tgcagcgg 28 &lt;210> 11 &lt;;211&gt; 28 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; DNA primer (mylz2 promoter 3' Xhol) &lt;&gt;11 cgctcgaggt agtgtcctgt acttgagg 28 5

Claims (1)

201114894 VII. Patent Application Range: 1. An isolated nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 1, which has promoter activity. A recombinant vector comprising a first nucleic acid fragment consisting of the nucleotide sequence of SEQ ID NO: 1. 3. The recombinant vector of claim 2, further comprising a first-nuclear W segment&apos; encoded protein and operably linked to the first nucleic acid fragment. 4. The recombinant vector according to claim 3, wherein the second nucleic acid fragment encodes a foreign protein or polypeptide. 5. The recombinant vector according to claim 3, wherein the second nucleic acid fragment encodes a luminescent or fluorescein protein. 6. The recombinant vector according to claim 3, wherein the second nucleic acid fragment consists of the nucleotide sequence of SEQ ID NO: 2. 7. The recombinant vector according to claim 4, which comprises the nucleotide sequence of SEQ ID NO: 4. A method for producing a transgenic animal, which comprises introducing the recombinant vector of any one of claims 3 to 7 into a nucleus or cytoplasm of a gametophyte, a fertilized egg, an embryo or a somatic cell of an animal, such that the recombinant vector The nucleic acid molecules contained therein continue to replicate in the embryo or cell and are then expressed on the individual and its progeny cells; wherein the animal does not comprise humans. 9. The method of claim 8, which is for the preparation of a transgenic fish. 10. The method according to claim 9 wherein the recombinant vector is introduced into a fertilized egg of a fish using a microinjection technique. U_ According to the method of claim 9, wherein the fish is a zebrafish. 14