TW201031757A - Methods and systems for identifying polynucleotide sequences with translational self-cleavage activity - Google Patents

Abstract

Provided herein are methods and systems for identifying 2A-like sequences with translational self-cleavage activity in an insect expression system.

Description

201031757 VI. Description of the Invention: [Technical Field of the Invention] The present invention relates to a method and/or system for identifying a polynucleotide having a translation level self-cleaving activity. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to methods and/or systems for identifying polynucleic acid having a similar 2 A sequence using a fluorescence distribution pattern in an insect expression system. [Prior Art] Double-cistronic or poly-cistronic expression vectors have a wide range of uses', for example, can be used to make non-homologous oligomeric proteins, gene therapy, cell tissue engineering, etc., and allow for a molar number. The square 'equimolar' to represent different target proteins. Current methods for creating poly-cistronic expression vectors include the use of internal rib〇some entl*y Site (IRES), multiple promoters, and linkages with or without cellular protease positions. Fusion protein. However, these methods have encountered some difficulties in practical applications. The IRES itself is quite large, so only a few vectors can be used, such as viral vectors or vectors containing jumpers. In addition, the order in which genes are transcribed may also significantly reduce the performance of downstream genes (Hennecke, M_, et al., (2001) A/ac/e/c.

Res. 29: 3327-3334; Fux, C. et alM (2004) BiotechnoL Bioeng. 86: 174-87) 〇 The production of fusion proteins may result in poor function of the fusion protein due to improper protein folding or cell transport mechanisms. The use of multiple promoters makes the fast-linking between the reporter gene and the target gene expression 201031757 less tight (Gaken, 丄, et al., (2000) Gene 77?er· 7: 1979-1985; De Felipe, P., (2004) Genet Vacc. Then 2: 1-12) ° The recently proposed method involves the creation of 2A or similar-2A cis-acting hydrolase elements (CHYSEL) using foot-and-mouth disease virus (FMDV). A multi-cistronic expression vector that produces multiple proteins from the same transcript (Szymczak, AL, et al., (2004) A/ai. Biotechnol. 22: 589-594; de Felipe, P., et al (1999) Gene Then 6: 198-208; Amrani, A” et al_, (2004) P/ani P/7ys/o/. 135: 16-24). Many viruses can be encoded to produce multiple 2A Or a protein similar to the -2A sequence that is cleaved into a separate protein product (Palmenberg, AC, et al., (1992) Wro/ogry 190: 754-762; Donnelly, M_L. L., et al., ( 2001) J. Gen. Virol. 82: 1027-1041; Ryan, MD et al., (1991) J. Ge/i V/ra/· 72: 2727-2732). This similar -2A sequence contains Asp -Va 丨川 e-Glu-X-Asn-Pro-Gly-Pro epitope, I cut the connection between glycine and arginine (Palmenberg, AC (1990) vAnmy. Rev: Microbiol. 44: 603-623; Hahn, H. and Palmenberg, AC, (1996) J. V/ro/ 70: 6870-6875). This incision mechanism may be caused by a ribosome hopping mechanism, which causes the ribosome activity to be trimmed by a similar -2A sequence, which prevents the production of glycine and auxin. Peptide bonds. Therefore, proteins located upstream of the -2A sequence will be released and their downstream genes will be translated (de Felipe, P. et al., (2003) J. Biol. Chem. 278: 11441-11448 Donnelly, MLL, et al., (2001) J. Gen. 82: 1013 - 1025). Most of the similar -2A sequences are found on viruses that infect mammalian cells, and only a few similar -2A sequences are found in insect viruses. In addition, in the insect expression system, the currently known virus-like-2A sequence is still not completely cleaved between mRNA translations, resulting in its individual upstream and downstream target peptides 201031757, or the protein cannot be fully expressed. Therefore, it is not necessary to find a kind of similar--2A sequence to improve the improved upstream and downstream protein of the scorpion I cut off. The code is effective and easy to use. -2Λ sequence, this side, no way to find potential. ^ ^ J method and / or system is through the unique sound of the sound in the sound of the sound of the μ system, such as 2 sequences, whether it is similar to the desire The _2α sequence standard can solve the problem that the Yu Yuchun has to solve the problem in the field. SUMMARY OF THE INVENTION Insects exhibit multinuclei for use in ribosomal hopping in the genus. The invention is characterized by a method and/or system for identifying a bacterium that can be transcribed during mRNA translation. Thus, one of the objects of the present invention is to provide a method for identifying a similar _2A sequence in an insect system. The method comprises the steps of: (a) transfecting an insect cell with a recombinant vector comprising: a promoter; a first polynucleotide operably linked to the promoter and encoded to produce a secreted protein; a candidate sequence operably linked to the first polynucleotide; and a second polynucleotide, operatively linked to the candidate sequence and encoded to produce a fluorescent Protein; and 201031757 • (b) Determine whether the candidate sequence has a translational level of self-cutting based on a pattern of light exhibited by the insect cell if the fluorescent 疋 is evenly distributed within the insect cell (including the nucleus) 'The candidate sequence is the similar _2a sequence; if the fluorescence exhibits a donut shape and is confined to the cell shuttle or secreted into the extracellular medium, then the candidate sequence is not the similar _2A sequence. In a preferred embodiment, the candidate sequence is isolated from the genus Perina nuda Picoma-like virus

The PnV) gene also comprises a polynucleotide of sequence number: 1. The polynucleotide sequence identified by the method of the present invention can be used to generate an amino acid sequence comprising a sequence number: 2, comprising a translational level self-cleaving position between glycine and valine acid, and Its translation level self-cleavage activity is as high as 100%, indicating that the secretory protein and the fluorescent protein are produced in a ratio of approximately 1:1. In another preferred embodiment, the candidate sequence is a Perina nuda Picoma-like virus (PnV) gene isolated and comprises a polynucleotide of SEQ ID NO: 3, which can be encoded. The sequence contains an amino acid sequence of sequence number: 4. In one example, the fluorescent protein is an enhanced green fluorescent protein (EGFP); and the secreted protein is a secreted alkaline phosphatase (SEAP). Another object of the present invention is to provide an insect system for identifying a similar 2 A sequence having a translational level of self-cleavage activity. The system comprises: an insect cell transfected with a recombinant vector comprising: a promoter; a first polynucleotide operably linked to the promoter and encoding to produce a secretion a protein; 201031757 • a candidate sequence operably linked to the first capacitive nucleotide; and a second polynucleotide operably linked to the candidate sequence and encoding to generate a fluorescent In the protein; 2, a fluorescent pattern exhibited by the insect cell observed under a fluorescence microscope determines whether the candidate sequence is a -2-like -2A sequence' if the fluorescence is uniformly distributed in the In the insect = cell (including the nucleus), the candidate sequence is the similar _2A sequence. If the fluorescence exhibits a donut shape and is confined to the cytoplasmic space outside the nucleus or is secreted into the extracellular medium, then the candidate The sequence is not this similar -2A sequence. The details of one or more embodiments of the present invention are set forth in the Detailed Description of the invention, and the description of the embodiments of the invention. It is to be understood that the invention is not intended to be limited [Embodiment] Unless otherwise stated, all the meanings of the terms mentioned herein are consistent with the understanding and understanding of those having ordinary knowledge in the field of microorganisms and recombinant DNA technology. Hereinafter, a system and/or method for identifying a similar 2A sequence having a translation-level self-cleaving activity will be described with reference to the accompanying drawings. An embodiment for identifying a sequence having a similar 2 A in a quenching system is provided in accordance with an embodiment of the present invention. The method comprises the following steps: (a) transfecting a cell with a recombinant vector comprising the following sequence: a promoter; a nucleoside nucleoside operably linked thereto The promoter is conjugated to produce a knife/reactive protein; a candidate sequence operably linked to the first-time acid; and a second polynucleotide operably linked to the candidate sequence and encoded Generating a fluorescent protein, and (b) determining, based on a fluorescent pattern exhibited by the insect cell, whether the candidate sequence has a trans-layered self-cleaving activity' if the fluorescence is uniformly distributed within the insect cell ( Including the nucleus, the candidate sequence is a similar _2A sequence; if the fluorescence exhibits a donut shape and is confined to a space outside the nucleus or secreted into the extracellular medium, the candidate sequence is not the similar -2A sequence. . For the present invention, a sequence similar to 2A having a translational level of self-cleavage activity is a DNA or cDNA of a virus, preferably from the miniviridae famUy), including but not limited to enterovirus, nasal disease #, hepatic virus, cardiomyopathy , aphth〇VlrUS, parech〇virus, erbovirus, prubivirus, teschovirus, picovirus (pic〇rna_like) ^And). "Translati 〇nal self clevage activity" herein means a sequence of translational effects of self-protein cleavage or cleavage of a cleavage product by cleavage of its c-terminus. Sequence similarity, secondary or tertiary structure-similarity between any known 2A sequence (eg, 2A sequence found in cardiovirus and aphthous virus genomes, for example, 2A sequence of foot-and-mouth disease virus) Or if there are any reserved sequence regions to pick out potential or candidate sequences similar to the 2 A sequence. In a preferred embodiment, the candidate sequence of 201031757 is isolated from the eucalyptus urophylla virus gene according to sequence similarity and comprises a polynucleotide sequence of sequence number: i or 3, the polynucleoside The acid sequence is at least 8%, 81%, 82%, 83%, 84%, 86%, 87%, 88%, 890/0, 90%, 91%, 92%, and any known 2A sequence, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 1% are the same. The candidate sequences selected according to the above methods were co-transferred into the recombinant vector together with the other two reporter genes. The term "reporter gene" is used herein to mean a gene that has its own unique characteristics, such as a fluorescent expression pattern or secretion capacity in a host cell, such that the candidate gene of the invention can be defined in accordance with the invention. The conditions (which will be detailed below) are identified. In the present invention, the expression pattern of the reporter gene, for example, in the host cell, the fluorescence expression pattern or the secretion ability is used as an indicator for determining whether a candidate sequence is a similar 2A sequence as desired. In a preferred embodiment, the recombinant vector is genetically engineered to sequentially comprise the following =:-promoter; - a reporter gene operably linked to the promoter and encoding a secreted protein a candidate sequence operably linked to the first polynucleotide; and a first reporter gene operably linked to the candidate sequence and encoding to produce a fluorescent protein. The term "promoter" refers to a nucleic acid sequence having the ability to initiate transcription of a sequence encoded downstream of its sequence. Promoters can be inducible or subtle. The promoters that can be used in the insect cell expression system are the horn horn (?1 冲1 (11^), 1-1 〇, %39, 41 and 162 promoters, and preferably the polyhedrin promoter." Linking (〇州物=ed)--the word represents a linkage in a recombinant vector, encoding a transcriptional and translational control sequence, such that when the molecule (eg, translationally activated protein) The control sequence can be combined to express the multi-peptide. The first reporter gene can encode a secreted protein, such as a secreted alkaline phosphatase (SEAP). The second reporter gene can encode a fluorescent protein. Including, but not limited to, green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), blue fluorescent protein (BFP), enhanced yellow fluorescent protein (enhanced yellow fluorescent protein) Protein, EYFP), pink anemone fluorescent protein, amFP), rabbit fluorescein fluorescent protein, zFP), disc anemone fluorescent protein (Dzseosoma fluoresce Nt protein, dsFP), C7avw/arza fluorescent protein (cFP), luciferase (eg, firefly luciferase), remiformis luciferase, and hornbeam fluorescein Prime enzyme wwe / / erz · luciferase). In one example, the first reporter gene encodes a SEAP' and the second reporter gene encodes an EGFP. Suitable viral vectors may be derived from baculoviruses including, but not limited to, AcMNPV califomica nuclear polyhedrosis virus) 'PnMNPV (Perina nuda multinucleocapsid nuclear polyhedrosis vims) > BmNPV (Bombyx mori nuclear polyhedrosis virus) > LdMNPV {Lymantria i /wpar multinucleocapsid nuclear polyhedrosis virus) ^ OpMNPV {Orgyia pseudotsugata multicapsid nucleopolyhedrovirus). A recombinant vector prepared according to a preferred embodiment of the present invention is used to transfect an insect system, such as the autumn army worm IPBL-sf2 1 cell line. However, other insect expression systems can also be used. Those with ordinary knowledge in this field will be able to solve the 201031757 _ solution, if the candidate sequence is incorporated into the above fusion nucleic acid (ie, a nucleic acid of one sequence: the first reporter gene; the sequence contains the reporter gene) is a similar = And the second can exhibit the first and second reports respectively, which will be secreted proteins and fluorescent proteins, and the VIIIv protein product is delivered to the extracellular medium, and the serotonin === protein Finally, it will be inside the cell. Conversely, such as "continue to remain in the host, the selected sequence is not - a similar 2 / into ^ ^; ^ = two reporter proteins in the nucleic acid are linked to each other and the first: reporter protein and white. This fusion protein will eventually rely on the traditional time-consuming and laborious egg sequencing test for the connected eggs. In the preferred embodiment, the protein alone produces a two == distribution pattern, representing = sequence = two columns - thus producing and secreting - a large fusion protein' rather than two single-sense + 4* unique proteins Therefore, the fluorescence is limited to the distribution pattern of the donut shape in the two compartments outside the field cell 2. In the enamel, in the preferred embodiment of the enamel or in the candidate sequence, there is a multi-peptide of the similar/α-sequence of the 'm', and the amino acid of the 编号? The peptide has a self-cutting position between 2010 and 3,057,757 between glycine and valine. In another preferred embodiment, the alternative 2A-like sequence or candidate sequence comprises a polynucleotide sequence of 3:3, which encodes a multi-win of the amino acid sequence of column number 4. Peptide. Moreover, the methods and/or systems of the present invention can also produce two protein products in a balanced or molecular manner, i.e., two reports are manufactured in substantially the same amount. In a preferred embodiment, the amount of secretion produced by the first reporter gene is encoded by the second reporter gene.

The ratio of ❹ is about 1:1. Another embodiment of the 1st protein in the right second month provides a system for identifying similar 28-sequences with self-cleavage activity of j = l level. this

If a two-in-one insect cell, which is transfected with a recombinant vector comprising the following sequence: a promoter; a first polynucleotide operably linked to the promoter and encoded to produce a "point"; a candidate sequence operably linked to the human acid, and a second polynucleotide operably linked to the candidate sequence and encoding to produce a fluorescent protein; A fluorescent pattern is expressed to determine the candidate sequence, which is a similar -2 sequence, J, if the fluorescence is evenly distributed within the insect cell (including the nucleus), then the candidate sequence is the sequence; If the fluorescence exhibits a donut shape and the brown limit, ', or the sputum is secreted into the extracellular medium, the candidate sequence is not the similar -2 Α sequence. The skilled person knows that the skilled person has the right tools to use the reporter gene and the insect cell disclosed in the invention to provide the virus vector in the set of ΐ1, to construct the required weight, and enzyme reagent for use. Amplify the number of cells in the virus, use 12 201031757 to transfect or transform the reagents of the target cells, and explain the instructions, tapes, CDs, VCDs, or DVDs used to explain the use of the set. The methods and content of the present invention are set forth below by way of the non-limiting embodiments disclosed. After reading these examples, those skilled in the art will readily be able to deduce further variations of the embodiments of the invention. Example 1 Constructing a performance carrier

1.1 pBac-S-Rhir-E φ was used to construct pBac-Drhir-E vector according to Chen et al. (S/oc/?e/77· anc/B/o〆^/Res. Co/T7/m/· 2005 335; 616-623) A similar approach was used to construct the pBac-S-Rhir-E vector, but in which the DsRed gene was replaced by the SEAP gene. Therefore, the pBac-S-Rhir-E vector sequentially contains the SEAPS gene, the IRES sequence of rice/rice virus (R/?opa/os/p/7i/mpad/' virus, RhPV) and the EGFP reporter gene.

1.2 pBac-SEFP In the pBac_Drhir-E vector, the SEAP gene and the EGFP φ gene were ligated in-framed fused (Chen et al., Biochem. and Biophy.lRes. Commu. 2005 335 ; 616-623). Briefly, the SEAP gene fragment from pGS-HCV plastid (Lee ei a/., S/oiec/7/?o· and β/oensf. 2005 90:656-672) was first polymerase chain The reaction is via a forward primer, 5,-ATATAAGATCTCCACCATGCTGCTGCTGTGCTGCTGCTG GG-3' (sequence number: 5, the bottom line is the Sichuan position) and the reverse primer, 5,-AATTCAGATCTGGTGTCTGCTCGAAGCGGCCGGC-3,

(Sequence number: 6 ‘ bottom line is 8 g/N position), and amplified. Two GG nucleosides were added to the reverse primer so that the 3'-end of the SEAP 13 201031757 gene and the 5'-end of the EGFP gene were ligated in the translational framework. After PCR, the 16 kb, cleaved §eAP gene fragment was transferred into the sputum-cut pBac-Drhir-E plastid, and the resulting plastid was named pBac-Drhir-SEFP. The DsRed reporter gene, the RhPV IRES sequence, and the fusion gene of SEAP and EGFP are sequentially included. Next, the pBac-S-Rhir-E plasmid was cleaved with 8a/?7HI and Sa/丨 restriction enzyme to remove the SEAP-Rhir-EGFP fragment therein. Similarly, the pBac_DRhir-SEAP plasmid was cleaved with 丨 and Sa/I restriction enzymes to remove the • SEAP_EGFP fusion fragment. Next, the SEAP-EGFP fusion fragment was transfected into the pBac-S-Rhir-E plasmid and the Sa/丨 restriction enzyme cleavage site, and the resulting plasmid was named pBac-SEFP.

1.3 pBac-S-PV2Al-E The SEAP-PV2A1 gene fragment from pBac_DsRed-PnV-SEAP-RhPV-EGFP plastid was passed through the positive-direction primer by polymerase chain reaction (PCR), S'-AATGGATCCGCTAGCCCACCATGCTGCTGCTGCTGCTG-parameter 3' (SEQ ID NO: 7, bottom line is BamHI position) and reverse primer, S^AATAGMCTAAGGGTCCGGGGATTTGACTCAACATCTCC ATCCACAGTCAAATCCGGAACCCACCCCTGGGCTGTCTGC TCGAAGCGGCC-3, (sequence number: 8, bottom line is the Sichuan position) force σ to amplify. The amplified SEAP-PnV2Al sequence and PCR2.1 (IUSA) were used for TA transfer, and the resulting plasmid was named PCR2.1/SEAP-PnV2Al. The PCR2.1/SEAP-PnV2Al plasmid was cleaved with SamAVI and Bgf, and the SEAP-PnV2Al sequence was removed. Then, the cut SEAP-PnV2Al sequence was ligated to the BamAY丨 and β〇ιchuan enzyme-cutting positions in the 14 201031757 pBac-S-Rhir-E plastid, and the obtained plastid was named pBac-S- PnV2Al-E. 1.4 Construction of the recombinant vector The S. IPBL-sf21 cell line was cultured in TNM-FH medium containing 8% heat-inactivated fetal bovine serum until it had grown to a single layer of cells (about 2×10 5 cells/ Culture wells. 0.8 pg of Example 1.1 (pBac-S-Rhir-E), 1.2 (pBac-SEFP), 1.3 ❿ (pBac-S) using Ιμΐ CellfectinTM Transfection Reagent (Invitrogen Corp., Carlsbad, California) The plastid of -PnV2Al-E) and the linearized Bac-N-Blue baculovirus DNA (0·25μδ) were transfected into the aforementioned monolayer, overgrown sf21 cells. The transfected cells were cultured in a non-fetal The bovine serum was cultured in TNM-FH medium for 12 hours, and then continued to be cultured in TNM-FH medium containing 8% heat-inactivated fetal bovine serum. If Bac-N-Blue baculovirus DNA and 3 plastids , ie, the plastid genes of Example 1·1 (pBac-S-Rhir-E), 1.2 (pBac-SEFP), 1.3 (pBac-S-PnV2Al-E), homologous recombination, will produce new recombinant bacilli Expression vectors, these newly formed recombinant vectors can be screened by conventional endpoint dilution methods by means of green fluorescence emitted from the co-expressed EGFP protein. The selected recombinant vectors were named vAc-S-Rhir-E, vAc-SEFP and vAc-S-PnV2AI-E, respectively. Figure 1 shows the structure of the above three recombinant vectors, including (A) vAc-S-Rhir-E; (B) vAc-SEFP and (C) vAc-S-PnV2AI-E. The promoter used in the present invention is a polyhedrin promoter (hereinafter referred to as Pph). In addition, 'recombinant vAc- is used. S-Rhir-E and vAc-SEFP virus-expression vectors were used as control controls for the vAc-S-PnV2AI-E vector. 15 201031757 Example 2 Identification of sequences similar to 2A 2.1 Depending on the fluorescing mode If the similar PnV2A sequence screened in the recombinant vector of Example 1.4 does not have ribosome skipping activity, the SEAP gene, PnV2A-like sequence and EGFP gene will be expressed in the same translation, ie, the fusion protein. The sequence contains SEAP, a fusion protein similar to PnV2A peptide and EGFP, and this fusion protein will eventually be secreted outside the cell because of the SEAP, so that the green fluorescence emitted from EGFP will be limited to φ outside the nucleus and eventually Secreted to the outside of the cell. Conversely, if it is screened out Similar activity PnV2A hopping sequence contains ribosomes, then translation thereof is cut off from the sequences similar PnV2A. Therefore, SEAP and EGFP will each be expressed in a separate protein form, and EGFP will remain in the cells, so that the green fluorescence emitted from EGFP will be evenly distributed in the cells (including the nucleus) and will not be secreted outside the cell. Sf21 cells (2xl05 cells/culture Φ wells, 24 culture wells) transfected with vectors of vAc-S-Rhir-E, vAc-SEFP and vAc-S-PnV2AI-E, respectively, were treated with 300 ml of lysis reagent ( 1 mM potassium phosphate (pH 7.8), 1 mM EDTA, 10% Triton X-100 and 7 mM β-hydrogenthioethanol) were lysed for 10 minutes. Then, it was centrifuged at 128,000 rpm for 30 minutes, and a small amount of the supernatant was taken out for fluorescence measurement. The fluorescence spectrum of EGFP was measured by a Cary Eclipse fluorescence spectrometer (Varian) at an excitation light wavelength of 488 nm and a divergent light wavelength of 507 nm. Figure 2 shows the fluorescence of Sf21 cells after transfection of Sf21 cells with (A) vAc-S-Rhir-E, (B) vAc-S-PnV2AI-E and (C) vAc-SEFP vectors, respectively. A photo of the distribution pattern. In Figure 2A, it was confirmed that in Sf21 cells transfected with vAc-S-Rhir-E, SEAP was 16 201031757 expressed by CAP-dependent transcription, and EGFP was expressed by _ RhPV IRES sequence. The green fluorescence emitted by EGFP is confined within the cell and evenly distributed. In Figure 2B, in the Sf21 cells transfected with vAc-S-PnV2AI-E, the green fluorescence distribution pattern was similar to that of the above-described Sf21 cells transfected with vAc-S-Rhir-E, representing PnV2A-like The sequence is self-cleavable, so the co-expressed EGFP is also distributed in the nucleus. In contrast, in Figure 2C, the Sf21 cells transfected with the vAc-SEFP vector exhibited a donut shape in the form of a fluorescence distribution pattern, representing that Sf21 cells synthesized a fusion protein (including SEAP and EGFP) and then Secreted outside the cell, so the fluorescence is confined to the nucleus and secreted into the matrix. In other words, if the 2A-like sequence screened in the baculovirus vector exhibits the same fluorescence distribution pattern as that after transfection with the vAc-SEFP vector, it means that the selected sequence is not a similar 2A-like sequence, and therefore cannot be Self-cutting or inducing ribosome skipping activity. 2.2 Screening based on Western blot analysis • Western blot analysis was used to confirm the translational level of self-cleavage activity of the selected PnV2A sequence. Briefly, Sf21 cells were transfected with the recombinant vectors of Example 1.4, including vAc-S-Rhir-E, vAc-S-PnV2AI-E and vAc_SEFP, respectively, after which the cells were lysed and SDS- PAGE is used to separate the protein product in the lysed cells, and the separated protein product is transferred to a polyvinyl fluoride membrane (PVDF, millipore). The PVDF membrane was blocked with Tris buffer (100 mM Tris, pH 7.4; 100 mM NaC® and 0.1% Tween 20) containing 5% bovine serum albumin (BSA, Sigma) for about 1 hour at room temperature. 17 201031757 After blocking the reaction, the PVDF membrane was allowed to react with anti-EGFP antibody (1:2000, BD Biosciences ClonTech, Palo Alto, CA) overnight at 4 °C. Thereafter, the PVDF membrane was washed 3 times with Tris buffer at room temperature for 5 minutes each time to completely remove unbound anti-EGFP antibody. Thereafter, the PVDF membrane was reacted with a horseradish peroxidase to form a secondary secondary antibody (1:2500, Jackson) at room temperature for about one hour. Thereafter, the PVDF membrane was washed 3 times with Tris buffer at room temperature for 5 minutes each time to completely remove the unbound secondary antibody. The results are shown in Figure 3. φ If the candidate PnV2A sequence can induce ribosome hopping, EGFP and SEAP will be expressed as two separate proteins, thus detecting an EGFP protein with a molecular weight of approximately 27 kDa. Conversely, if the candidate PnV2A sequence is unable to self-cleave, a fusion protein consisting of EGFP and SEAP with a molecular weight of approximately l〇〇kDa is detected. Figure 3 shows cells transfected with Sf21 cells with recombinant vectors including vAc-S-PnV2AI-E, vAc-SEFP and vAc-S-Rhir-E (Figures 1, 3 and 5, respectively) And the EGFP content in the extracellular matrix (differents 2, 4 and 6 on the map, respectively). Obviously, an EGFP protein with a molecular weight of about 27 kDa can be detected in the nucleus transfected with vAc-S-PnV2AI-E, indicating that the candidate sequence in vAc-S-PnV2AI-E is the desired PnV2A sequence, which can be self-existing. Cutting (compare the results of the first and second tracks in Figure 3). The cells transfected with vAc-S-Rhir-E also showed the same results as those transfected with vAc-S-PnV2AI-E (compare the results of lanes 5 and 6 in Fig. 3). As for the fourth lane in the figure, a fusion protein having a molecular weight of about 1 〇〇 kDa represents that EGFP and SEAP are fused to each other to form a large fusion protein. In addition, the results of the first and second tracks in Figure 3 also show that 18 201031757

The self-cleavage activity of the PnV2A sequence can be as high as 100% because almost no fusion protein is detected. 2.3 Screening based on secreted alkaline strontium phosphate (SEAP) activity Western blot analysis was used to confirm the translational level of self-cleavage activity of the similar PnV2A sequences screened.

The medium of Sf21 cells transfected with the recombinant vector of vAc-S-PnV2AI-E, vAc-SEFP or vAc-S-Rhi "-E" was separately collected and then centrifuged at φ 12,000 rpm for 10 seconds and stored in - The SEAP activity was measured at 20 ° C until the SEAP activity was measured. The SEAP activity was measured with the BD Great EscApe SEAP test kit (Cat. No. K2041-1, available from Clontech). The chemical cold counter (Mithras LB 940) was used for the measurement. Chemical luminescence intensity representative of SEAP activity. Figure 4 shows the SEAP activity exhibited by cells after transfection of Sf21 cells with recombinant vectors of vAc-S-Rhir-E, vAc-SEFP or vAc-S-PnV2AI-E, respectively. Intensity. It is clear that the SEAP activity in Sf21 cells transfected with vAc-S-PnV2AI-E is much higher. The SEAP activity in Sf21 cells transfected with vAc-SEFP is approximately 500-fold. Therefore, in vAc The candidate sequence selected in the -S-PnV2AI-E vector can successfully induce ribosomal hopping, avoiding interference defects caused by protein folding in the fusion protein, and does not affect the activity of the target protein. Interestingly, 'with vAc_S The SEAP activity in -PnV2AI-E transfected Sf21 cells was also much higher than in vAc- SEAP activity in Sf21 cells transfected with S-Rhir-E, while in vAc-S-Rhir-E transfected cells, SEAP and EGFP were also expressed as individual proteins. vAc-S-PnV2AI- The SEAP activity in E-transfected Sf21 cells was approximately 100-fold higher than the SEAP activity of 201031757 in Sf21 cells transfected with vAc-S-Rhir-E. The inventors believe that this may be due to a sequence similar to PnV2A. The mRNA is more stable than the mRNA of the RhPV IRES sequence. 2.4 Quantitative Green Fluorescence The amount of EGFP protein on the PVDF membrane can be quantified using a cold light kit (Piece). The results are shown in Figure 5, which shows vAc, respectively. Fluorescence pattern in Sf21 cells after transfection of Sf21 cells with S-Rhir-E, vAc-SEFP or vAc-S, PnV2AI, E recombinant vector. Similarly, p was transfected with vAc-S-PnV2AI-E The EGFP fluorescence intensity in Sf21 cells was much higher than that in Sf21 cells transfected with vAc-SEFP or vAc-S-Rhir-E, respectively. Therefore, it is clear that a similar PnV2A sequence fused to EGFP. The self-cleavage activity does not affect the fluorescence intensity of EGFP. Example 3 Another sequence similar to 2A identified by the method of Example 2 Another ❹2A-like sequence was identified and propagated according to the method disclosed in Example 2. The insect host cells transfected with this sequence also exhibited a donut-shaped fluorescence distribution pattern under a fluorescence microscope, and thus it was confirmed that the identified sequence was a sequence similar to 2A. This sequence was sequenced and found to contain a polynucleotide sequence of SEQ ID NO: 3 and was encoded to produce a multi-peptide comprising the amino acid sequence of SEQ ID NO: 4. Industrial Applicability The present invention utilizes a fluorescence distribution pattern generated by a host cell 20 201031757 to display a desired sequence similar to 2A after collectively exhibiting two protein-secretory proteins and fluorescent proteins in an insect host cell. First, the recombinant vector containing the sequence, the sequence, and the two reporter genes constructed by the method of the present invention is used to transfer the insect-derived primary cells, and then the fluorescent cells in the transformed insect host cells are observed under a fluorescence microscope. The light distribution pattern determines whether the selected candidate sequence is the desired 2A-like sequence. The donut-shaped fluorescence distribution pattern represents that the selected candidate sequence is not the desired 2A-like sequence. Conversely, the fluorescence pattern uniformly distributed within the cell means that the selected candidate sequence is the desired ❿ 2A-like. sequence. Accordingly, the present invention provides a simple and rapid screening method and/or system that can be used to identify sequences similar to 2a having translational level self-cleavage activity. While the invention has been described in detail herein with reference to the embodiments of the present invention, it will be understood that Such changes and modifications shall still be considered as the scope of the following patent application. BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic view showing the structure of a recombinant carrier of (A) VAC-S-Rhir-E, (B) VAOSEFP and (C) vAc-^PnV2AI-E; ! The fluorescent mode photographs of the cells expressed by the three recombinant vectors transfected with Sf21 cells are shown in the figure. Figure 3 shows the Sf2l measured by Western blot analysis. EGFP content in the nucleus; 21 201031757 Figure 4 is a bar graph illustrating the measured SEAP activity after transfection of 'Sf21 cells with the recombinant vector of Figure 1; and the histogram of Figure 5 is shown in Figure 1. The recombinant vector was used to transfect Sf21 cells to express the quantitative results of EGFP. [Main component symbol description] No component symbol

22 201031757 Sequence Listing <110> Private Chung Yuan University National Taiwan University <120> Method for identifying polynucleotides with translational level self-cleavable activity 舆 system <130>

<160〉 8 <170> Patentln version 3.3 <210> 1 <211> 60 <212> DNA

<213> perina nuda Picorna-like virus <400> 1

Gcccaggggt gggttccgga. tttgactgtg gatggagatg ttgagtcaaa tccc£gaccc 60 <210> 2 <211> 20 <212> PRT <213> perina nuda Picorna-like virus <400> 2

Ala Gin Gly Trp Val Pro Asp Leu Thr Val Asp Gly Asp Val Glu Ser 1 5 10 15

Asn Pro Gly Pro 20

<210> 3 <211> 60 <212> DNA <213> perina nuda Picorna-like virus <400> 3 attggtggtg ggcagaagga tttgacacaa gatggtgaca tcgagtcgaa tcctgggccc 60 23 201031757 "<210〉 4

<211> 20 ' <212> PRT <213> perina nuda Picorna-like virus <400> 4 lie Gly Gly Gly Gin Lys Asp Leu Thr Gin Asp Gly Asp He Glu Ser 15 10 15

Asn Pro Gly Pro 20

<210> 5 <211> 41 <212> DNA <213> Artifical DNA <400> 5 atataagatc tccaccatgc tgctgctgtg ctgctgctgg g 41 <210> 6 <211> 34 <212> m

<213〉 Artifical DNA

<400〉 6 aattcagatc tggtgtctgc tcgaagcggc cggc 34

<210> 7 <211> 38 <212> DNA <213> artifical DNA <400> 7 aatggatccg ctagcccacc atgctgctgc tgctgctg

<210〉 8 <211〉 90 <212〉 DNA 24 38 201031757

<213> artifical DNA • <400> 8 aatagatcta agggtccggg gatttgactc aacatctcca tccacagtca aatccggaac ccacccctgg gctgtctgct cgaagcggcc

Claims (1)

201031757 VII. Scope of Application: 1. A method for identifying a class of 2A sequences in an insect system comprising: (a) transfecting an insect cell with a recombinant vector comprising the following sequences: a first polynucleotide operably linked to the promoter and encoding to produce a secreted protein; a candidate sequence operably linked to the first φ-nucleotide; and a second a polynucleotide operably linked to the candidate sequence and encoding to produce a fluorescent protein; and (b) determining whether the candidate sequence has a translational level self based on a fluorescent pattern exhibited by the insect cell Cleavage activity, if the fluorescence is evenly distributed within the insect cell (including the nucleus), then the candidate sequence is the similar _2A sequence; if the fluorescence is in the shape of a donut and is confined to the nucleus or secreted to In an extracellular medium, the candidate sequence is not the similar _2A sequence. 2. The method of claim 1, wherein the candidate sequence is a nucleoside isolated from a Perina nuda Picoma-like virus (PnV) and comprising a SEQ ID NO: 1 or 3. acid. 3. The method of claim 2, wherein the candidate sequence encodes a multi-peptide comprising a sequence of amino acid sequences of number 2 or 4, including one Glycine 26 201031757 Translational level self-cutting position between acid and proline. 4. The method for translating the level of the candidate sequence of the third candidate sequence of the patent application, wherein the self-cutting activity of the cockroach is up to the ratio of the production of the eighth liter, the method described in item 4 of the patent scope, Lizhong knife The 4-sex protein and the fluorescent protein are approximately 丨·'. ❹ 6. The method of claim 1, wherein the insect cell 疋 行 军 ( (&amp; 叹 化 ~ heart) iPBL-sf21 cells 0 7. The method of claim 1 Wherein the secreted protein is secreted alkaline phosphatase (SEap). 8. The method of claim 1, wherein the fluorescent protein is enhanced green fluorescent protein (EGFP). 9. An insect system for identifying a similar-2A sequence having a translational level of self-cleavage activity, comprising: an insect cell transfected with a recombinant vector comprising the following sequences: a first polynucleotide operably linked to the promoter and transcribed to produce a secreted protein; a candidate sequence operably linked to the first polynucleotide; and 27 201031757 a nucleotide, which is operably linked to the candidate sequence and encoded to produce a fluorescent protein; and a fluorescent pattern exhibited by the insect cell to determine whether the candidate sequence is the similar _2A sequence If the camp light is uniformly distributed within the insect cell (including the nucleus), then the candidate 1 column is similar to the -2A sequence; if the glory presents a donut shape and is confined to the nucleus or secreted outside the cell In the medium, the candidate sequence is not the similar _2a sequence. The system of claim 9, wherein the candidate sequence is a nucleoside isolated from a perina nuda Plcoma_like virus (pnv) and comprising a sequence number: t or 3. acid. 11. The system of claim 1, wherein the candidate sequence encodes a multi-peptide comprising a sequence number: 2 or 4 amino acid sequence comprising one bit Translational level self-cutting position between glycine and valine. 12. The system of claim </ RTI> wherein the candidate sequence has a translation level self-cleaving activity of up to 1%. 13. The system of claim 12, wherein the secretory protein and the fluorescent protein are produced in a ratio of about 1:1. The system of claim 9, wherein the system of claim 9 is wherein The λ worm cell 疋 行 行 ( S S S 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010. 16. The system of claim 9, wherein the fluorescent protein is enhanced green fluorescent protein (EGFP). 29