JP2003525605A - Green fluorescent protein of Renilla reniformis and its mutants - Google Patents

Abstract

  (57) [Summary] The present invention relates to recombinant polynucleotides encoding green fluorescent protein (GFP) from Renilla reniformis, as well as polynucleotides encoding variants and fusion polypeptides of Renilla reniformis GFP. The present invention further relates to vectors encoding Renilla reniformis GFP and variants and fusions thereof, and cells containing and / or expressing the vectors. The invention also relates to recombinant Renilla reniformis GFP polypeptides and fusion polypeptides and variants thereof, and methods of making and using the polypeptides both in vivo and in vitro.

Description

Detailed Description of the Invention

BACKGROUND OF THE INVENTION [0001] Aequorea victo, a type of jellyfish
The green fluorescent protein (GFP) from ria, Owan jellyfish has become an extremely useful tool for tracking and quantifying biological entities in the fields of biochemistry, molecular and cell biology, and medical diagnostics ( Chalfie et al., 1994, Sc.
ience 263: 802-805; Tsiem, 1998, Ann. Rev
． Biochem. 67: 509-544). No cofactors or substrates are required for fluorescence, so the protein can be used in a wide variety of organisms and cell types. GFP has been used as a reporter gene to study gene expression in vivo by inserting it downstream of a test promoter. This green fluorescent protein has also been used to study subcellular localization of many proteins by directly fusing the test protein to GFP, which was used in both cell cultures and animals. Has become the reporter of choice for monitoring the infection efficiency of viral vectors in E. coli. In addition, many gene modifications
Performed to obtain mutants whose spectral shifts correspond to changes in the cellular environment such as pH, ion influx, and phosphorylation status of cells. Perhaps the most promising role of GFP as a cell indicator is its application to fluorescence resonance energy transfer (FRET) technology. FRET occurs in a fluorophore whose emission spectrum overlaps the second excitation spectrum. When the fluorophores are in close proximity, a "donor"
Excitation of the fluorophore causes the "acceptor" to emit light. Therefore, these fluorophore pairs are useful for monitoring cellular interactions. G
Fluorescent proteins such as FP or variants thereof are useful for in vivo or in vitro protein-protein interaction analysis if their fluorescence emission and excitation spectra can overlap for FRET. The donor and acceptor fluorescent proteins can be made as fusions with the proteins one wishes to analyze for interactions. The application of these types of GFP is particularly effective for high throughput analysis. The readout is direct and independent of subcellular localization.

Purified Aequorea Victoria GFP absorbs blue light with a maximum excitation wavelength at 395 nm and a minimum peak at 470 nm and emits green fluorescence with an emission wavelength of about 510 nm and a minimum peak near 540 nm. Is a monomeric protein of approximately 27 kDa (Ward et al., 1979, Photochem. Pho.
tobiol. Rev. 4: 1-57). The maximum excitation of Aequorea Victoria GFP is not within the wavelength range of standard fluorescence detection optics. Moreover, the width of the excitation and emission spectra of Aequorea victoria GFP is not well suited for use in applications involving FRET. To be useful in FRET applications, the excitation and emission spectra of fluorophores are preferably high and narrow rather than low and broad. There is a need in the art for GFP proteins that can use standard fluorescein excitation and detection optical lenses. There is also a need for GFP proteins with narrow, preferably non-overlapping spectral peaks.

The use of Aequorea victoria GFP as a reporter for gene expression studies is very common, but is hampered by the relatively low quantum yields (fluorophore brightness is related to extinction coefficient and fluorescence quantum yield). Determined as the product). Generally, the Aequorea Victoria GFP coding sequence must be linked to a strong promoter, such as the CMV promoter, or a strong exogenous regulator, such as the tetracycline transcription activation system, to produce an easily detectable signal. This makes it difficult to use GFP as a reporter to probe the activity of natural promoters responsive to endogenous regulators. Clearly GFP due to stronger strength
The sensitivity of other applications of the technology also increases. There is a need in the art for GFP proteins with higher quantum yields.

Another drawback of Aequorea Victoria GFP involves the variation of its spectral characteristics due to changes in pH. At high pH (pH 11-12), wild-type aequorea
Victoria GFP loses its absorbance at 395 nm and its excitation amplitude, 470 nm
(Ward et al., 1982, Photochem. Photobio).
l. 35: 803-808). Aequorea victoria fluorescence quenches even at acidic pH around pKa 4.5. There is a need in the art for GFPs that exhibit fluorescence that is less sensitive to pH fluctuations.

Furthermore, because of their greater utility in a wide range of applications, in the art, compared to Aequorea Victoria GFP, for organic solvents, detergents and proteases often used in biological tests, GF showing increased stability of fluorescent features
P protein is required. Also, in the field, Equorea Victoria GFP
There is a need for GFP proteins that are more likely to be soluble in a wider variety of cell types and less likely to non-specifically interfere with endogenous proteins.

Many modifications to Aequorea Victoria GFP have been made with the aim of enhancing the utility of the protein. For example, modifications were made to enhance the brightness of the fluorescence emission, or the features of the excitation or emission spectra or both spectra. The purpose of some of these modification approaches described is the Renil reniformis (Renil) in its excitation and emission spectra and fluorescence intensity.
Note that it was to make a similar Aequorea victoria GFP by the GFP of La reniformis, Renilla).

References for Aequorea victoria mutants exhibiting altered fluorescence characteristics include, for example: Heim et al. (1995, Nature 373: 663-6.
64) enhances fluorescence intensity of polypeptide, S6 of Aequorea Victoria
Regarding the mutation at 5. The S65T mutation to Aequorea victoria GFP is said to "ameliorate its main problem and make its spectrum more like Renilla."

Chaltie (1995, Photochem. Photobiol. 62)
: 651-656) note that the S65T mutant of Aequorea Victoria, the most intense fluorescent mutant of Aequorea Victoria known at the time, is not as potent as Renilla reniformis GFP. .

Further literature on Aequorea Victoria mutants can be found in, for example, Ehrig.
Et al., 1995, FEBS Lett. 367: 163-166); Surpin
Et al., 1987, Photochem. Photobiol. 45 (supplementary issue): 95
S; Delagrave et al., 1995, Bio Technology 13:
151-154; and Yang et al., 1996, Gene 173: 19-23.
including.

Patents and patent applications relating to Aequorea Victoria GFP and variants thereof include: US Pat. No. 5,874,304 discloses aequorea victoria GFP variants, which are said to alter the spectral characteristics and fluorescence intensity of polypeptides. U.S. Pat. No. 5,968,738 discloses aequorea victoria GFP variants, which are said to have altered spectral characteristics. One of the mutations, V163A, is said to increase the fluorescence intensity. US Pat. No. 5,804,387 discloses aequorea victoria mutants, which are said to have increased fluorescence intensity, particularly in response to excitation by laser light at 488 nm. US Pat. No. 5,625,048 discloses the Aequorea victoria mutant, which is said to have altered spectral characteristics, as well as several mutants which are said to have increased fluorescence intensity. Related US Pat. No. 5,777,079 discloses additional combinations of mutations that are said to provide the Aequorea Victoria GFP polypeptide with increased fluorescence intensity. International patent application (PCT) number W
O98 / 21355 is WO97 / 20078, WO97 / 42320
And WO 97/11094, a mutant of Aequorea victoria GFP said to have increased fluorescence intensity is disclosed. PCT application number 98 /
06737 discloses variants said to have altered spectral characteristics, some of which are said to have increased fluorescence intensity.

In addition to Aequorea victoria, GFP has been identified in a variety of other coelenterates and anemones, but two GFPs, from Aequorea victoria (Prasher, 1992, Gene 111: 229-).
233) and Renilla mulleri from Renilla (W.
Only O99 / 49019) has been cloned.

SUMMARY OF THE INVENTION The present invention provides a recombinant polynucleotide encoding GFP derived from Renilla reniformis, a polynucleotide encoding mutants and fusion polypeptides of Renilla reniformis GFP, and the polynucleotide. And methods of using the polypeptides.

More specifically, the invention includes a recombinant polynucleotide comprising the sequence of SEQ ID NO: 1.

[0014] In one embodiment, the recombinant polynucleotide comprising the sequence of SEQ ID NO: 1 further comprises a sequence encoding at least one fused heterologous polypeptide domain.

The present invention further includes a recombinant vector comprising a polynucleotide sequence encoding Renilla reniformis GFP.

In one embodiment, the sequence encoding Renilla reniformis GFP is SEQ ID NO: 1.

In another embodiment, the recombinant vector is selected from the group consisting of plasmids, bacteriophages, viruses and retroviruses.

The present invention further includes cells comprising a recombinant polynucleotide encoding Renilla reniformis GFP.

The present invention further includes cells comprising a polynucleotide sequence encoding Renilla reniformis GFP, or a recombinant vector comprising the polynucleotide sequence of SEQ ID NO: 1.

The present invention further includes an isolated recombinant polypeptide comprising the amino acid sequence of SEQ ID NO: 2.

The invention further encompasses a recombinant polypeptide comprising the amino acid sequence of Renilla reniformis GFP or a variant thereof and at least one fused heterologous polypeptide domain.

In one embodiment, at least one fused heterologous polypeptide domain is fused to the amino terminus of Renilla reniformis GFP or variants thereof.

In another embodiment, at least one fused heterologous polypeptide domain is fused to the carboxy terminus of Renilla reniformis GFP or variants thereof.

[0024] In another embodiment, at least one fused heterologous polypeptide domain is fused to Renilla reniformis GFP or a variant thereof via a linker sequence.

The invention further comprises the steps of a) introducing into the cells a recombinant vector comprising a polynucleotide sequence encoding the Renilla reniformis GFP, b) culturing the cells of step (a), and c). Isolating Renilla reniformis GFP from the cells, the method comprising the steps of producing Renilla reniformis GFP.

[0026]   In one embodiment, the cells are bacterial cells.

[0027]   In another embodiment, the cells are eukaryotic cells.

In a preferred embodiment, the eukaryotic cell is selected from the group consisting of yeast, insect cells, and mammalian cells. The mammalian cells are preferably human.

[0029]   In another embodiment, the polynucleotide sequence is a humanized sequence.

The invention further includes a polynucleotide encoding an altered Renilla reniformis GFP polypeptide with increased fluorescence intensity relative to wild-type Renilla reniformis GFP.

In one embodiment, the polypeptide is amino acids 64-69 of SEQ ID NO: 2.
In the amino acid sequence defined by the wild-type Renilla reniformis GF
Compared to P, it has at least one mutation.

The invention further includes a polynucleotide encoding a Renilla reniformis GFP polypeptide having an excitation spectrum that is detectably distinguishable from the excitation spectrum of wild-type Renilla reniformis GFP.

The invention further provides Renilla reniformis GFP having an emission spectrum that is detectably distinguishable from the emission spectrum of wild-type Renilla reniformis GFP.
Includes polynucleotides that encode polypeptides.

The invention further provides a method of detecting protein-protein interactions, comprising: a) a first polypeptide domain and a first Renilla reniformis GF.
Providing a first fusion polypeptide comprising a P-derived polypeptide and a second fusion polypeptide comprising a second polypeptide domain and a second Renilla reniformis GFP-derived polypeptide, wherein: The emission spectrum of the first Renilla reniformis GFP-derived polypeptide is
A spectrum overlapping with the excitation spectrum of the Reniformis GFP-derived polypeptide, wherein the second Renilla reniformis GFP-derived polypeptide is distinguishable from the fluorescence emitted by the first Renilla reniformis GFP-derived polypeptide. Wherein the first Renilla reniformis GFP-derived polypeptide may be excited by a spectrum of light that does not excite fluorescence emission by the second Renilla reniformis GFP-derived polypeptide, b) the first Mixing the fusion polypeptide of claim 2 and the second fusion polypeptide of c.
) Irradiating the mixture of step (b) with a spectrum of light that excites the first Renilla reniformis GFP-derived polypeptide and emits fluorescence, but not the second Renilla reniformis GFP-derived polypeptide. D) detecting fluorescence emission from said second Renilla reniformis GFP-derived polypeptide, wherein said fluorescence emission from said second Renilla reniformis GFP polypeptide is said first Demonstrating protein-protein interactions between the polypeptide domain and said second polypeptide domain.

[0035]   In one embodiment, the method is performed in living cells.

The invention further provides a method for determining the location of a polypeptide of interest in a cell, wherein the polynucleotide sequence encoding said polypeptide of interest is known, and
) Linking said polynucleotide sequence encoding said polypeptide of interest with a polynucleotide encoding Renilla reniformis GFP such that the linked polynucleotide sequences are fused in frame; b) said ligation The method comprises the steps of introducing the polynucleotide sequence into a cell, and c) determining the position of the polypeptide encoded by the linked polynucleotide sequence.

[0037]   In one embodiment, the method is performed in living cells.

The present invention further provides a method for identifying cells into which a recombinant vector has been introduced, which comprises
) Introducing into the cell population a recombinant vector encoding Renilla reniformis GFP; b) illuminating the cell population with light within the excitation spectrum of Renilla reniformis GFP; and c) in the cell population. Detecting fluorescence in the emission spectrum of Renilla reniformis GFP, and thereby identifying cells into which the recombinant vector has been introduced.

[0039]   In one embodiment, GFP is expressed as a fusion polypeptide.

[0040]   In another embodiment, GFP is expressed as a separate polypeptide.

[0041]   In another embodiment, the cells are identified by FACS analysis.

The invention further provides a method of monitoring the activity of transcriptional regulatory sequences, the method comprising the steps of: a)
The nucleic acid sequence containing the transcriptional regulatory sequence is the Renilla reniformis GF of SEQ ID NO: 2.
Operably linked to a nucleic acid sequence encoding P to form a reporter construct, b) introducing the reporter construct into a cell, and c) detecting Renilla reniformis GFP fluorescence in the cell. And wherein the fluorescence reflects the activity of the transcriptional regulatory sequence.

The invention further provides a method of detecting a modulator of a transcriptional regulatory sequence, the method comprising the steps of:
) The nucleic acid sequence containing the transcriptional regulatory sequence is labeled with Renilla reniformis G of SEQ ID NO: 2.
Operably linked to a nucleic acid sequence encoding FP to form a reporter construct, wherein said transcriptional regulatory sequence is responsive to the presence of said modulator, and b) introducing said reporter construct into a cell. And c) detecting Renilla reniformis GFP fluorescence in the cells, wherein the fluorescence indicates the presence of the modulator.

In one embodiment, the modulator is selected from the group consisting of hormone or lipid soluble transcription modulators, growth factors, and heavy metals.

The invention further provides a method of screening for inhibitors of transcriptional regulatory sequences, the method comprising:
a) operably linking a nucleic acid sequence comprising said transcriptional regulatory sequence to a nucleic acid sequence encoding Renilla reniformis GFP of SEQ ID NO: 2 to form a reporter construct, and b) introducing said reporter construct into a cell. C) contacting the cell with a candidate inhibitor of the transcriptional regulatory sequence, d) detecting Renilla reniformis GFP fluorescence in the cell, wherein the candidate inhibitor A decrease in fluorescence as compared to the fluorescence detected in the presence includes indicating that the candidate inhibitor inhibits the activity of the transcriptional regulatory sequence.

The invention further provides a method of making a fluorescent molecular weight marker, comprising: a) Renilla reniformis GFP, such that the linked molecule encodes a fusion polypeptide.
In-frame linking a nucleic acid sequence encoding a nucleic acid sequence encoding a polypeptide having a known relative molecular weight; b) introducing the linked nucleic acid sequence of (a) into a cell; ) Isolating said fusion polypeptide from said cell, wherein said fusion polypeptide is a relative molecular weight marker.

The invention further comprises a polynucleotide encoding Renilla reniformis GFP or a variant of Renilla reniformis GFP, comprising at least one humanized codon sequence.

The invention further includes a humanized polynucleotide that encodes Renilla reniformis GFP or a variant of Renilla reniformis GFP.

In one embodiment, the humanized polynucleotide comprises the sequence of SEQ ID NO: 3.

The present invention further includes a recombinant vector containing a humanized Renilla reniformis GFP polynucleotide.

The present invention further includes cells comprising a recombinant vector comprising a humanized Renilla reniformis GFP polynucleotide.

The term “renilla reniformis green fluorescent protein” or “renilla reniformis GFP” as used herein means the polypeptide of SEQ ID NO: 2 or a fluorescent variant thereof. Renilla reniformis GFP variants include the polypeptide of SEQ ID NO: 2 having one or more mutations, including insertions or deletions of one or more amino acids at the N- or C-terminus of the polypeptide or in the coding sequence. To do. The mutants of Renilla reniformis GFP retain the ability to emit light when excited by light within a particular portion of the spectrum and are excited or released by the wild-type Renilla reniformis GFP of SEQ ID NO: 2. The light may be emitted by or in a portion of the spectrum that is detectably different from that portion of the spectrum. In addition to mutants that show different excitation or emission spectra, Renilla
Reniformis GFP variants include variants that exhibit increased fluorescence intensity relative to wild-type Renilla reniformis GFP.

The term “variant thereof” when used in reference to a Renilla reniformis polynucleotide coding sequence means that the sequence has one or more nucleotide differences relative to the sequence of the wild-type Renilla reniformis coding sequence. Is meant to have. Renilla
A variant of the Reniformis polynucleotide sequence is the Renilla reniformis GF
It encodes a P polypeptide or a variant thereof. Variants of the Renilla reniformis polynucleotide coding sequence include humanized polynucleotide coding sequences. Mutant polynucleotides are non-humanized Renilla reniformis GF
Directs expression of an amount of fluorescent polypeptide that is at least equal to or greater than the amount expressed from an equal amount of P polynucleotide sequences or from equal numbers of copies.

The term “humanized polynucleotide” or “humanized sequence” refers to 5
Above, 10 or above, 20 or above, 50 or above, 75 or above, 100 or above, 125 or above, 1
The codons of one or more non-human polypeptide (ie, a polypeptide not naturally expressed in human) polynucleotide coding sequences, including 50 or more, 200 or more, or even all, are expressed in human cells. By a more preferred codon sequence. With 3 codon groups, there are 64 possible combinations of 4 DNA nucleotides, so the genetic code overlaps as much as 20 amino acids. Each different codon for a particular amino acid encodes the incorporation of that amino acid into the polypeptide. But within a particular species,
There is likely to be a preference for certain overlapping codons to encode a particular amino acid. The "codon preference" of Renilla reniformis differs from that of humans (this codon preference is usually based on differential expression levels of tRNAs containing the corresponding anticodon sequences). In order to obtain a highly expressed non-human gene product in human cells, it is advantageous to change one or more unfavorable codons to a preferred codon sequence in human cells. Table 1 shows preferred codons for human expression.
It is preferred for human expression if the codon sequence is to the left of the particular codon sequence in the table. Optimally, but not necessarily, less preferred codons in non-human polynucleotide coding sequences are humanized by changing them to the most preferred codons for amino acids in human gene expression. The amount of fluorescent polypeptide expressed in human cells from the humanized GFP polynucleotide sequence is the same as the amount expressed per mass or copy number of non-humanized GFP polynucleotides, or the amount of fluorescence or fluorescence per cell. At least double in terms of strength.

The term “humanized codon” as used herein refers to the expression in human cells relative to the codons encoded by the non-human organism from which the non-human polypeptide was derived. By codon sequence within a polynucleotide sequence encoding a non-human polypeptide that has been altered to a preferred codon sequence. Species-specific codon preference results, in part, from differences in the expression of tRNA molecules with appropriate anticodon sequences. That is, one factor in species-specific codon preference is the relationship between codons and the amount of corresponding anticodon tRNA expressed.

It should be understood that any of the recombinant vectors of the present invention may include a humanized polynucleotide encoding Renilla reniformis GFP or variants thereof. Similarly, any of the cells of the invention may be administered to Renilla reniformis G.
It may include a vector containing a humanized polynucleotide encoding FP or a variant thereof. Also, all claimed methods using polynucleotides encoding Renilla reniformis GFP can be carried out with humanized polynucleotides encoding Renilla reniformis GFP or variants of Renilla reniformis GFP. Should be understood. Finally, any Renilla reniformis GFP polypeptide of the present invention may be expressed from a humanized Renilla reniformis GFP polynucleotide coding sequence.

The term “wild-type Renilla reniformis GFP” as used herein means the polypeptide of SEQ ID NO: 2.

“Increased fluorescence intensity” or “increased brightness” as used herein
The term means a fluorescence intensity or brightness that is higher than that exhibited by wild type Renilla reniformis GFP under a particular set of conditions. In general, an increase in fluorescence intensity or brightness means that the fluorescence of the mutant is higher than wild-type Renilla
Compared to Reniformis GFP, at least 5% or more, preferably 10%, 20
%, 50%, 75%, 100% or more, or 5 times, 10 times, 20 times, 50 times or 100 times or more intensity or brightness.

The term “fused heterologous polypeptide domain” as used herein is fused in-frame to Renilla reniformis GFP or variants thereof,
By an amino acid sequence of two or more amino acids. The fused heterologous domain is Renilla
It may be linked to the N- or C-terminus of the Reniformis GFP polypeptide or variant thereof.

The term “amino-terminally fused” as used herein refers to the linkage of a polypeptide sequence to the amino-terminus of another polypeptide. The linkage may be linear or mediated by a short (eg, about 2-20 amino acids) linker peptide.

The term “carboxy terminally fused” as used herein refers to the linkage of a polypeptide sequence to the carboxy terminal of another polypeptide. The linkage may be linear or may be mediated by a linker peptide.

The term “linker sequence” as used herein refers to a short (eg, about 1-20 amino acid) sequence of amino acids that is not part of the sequence of two polypeptides that connect. . The linker sequence is attached on its amino terminus to a polypeptide or polypeptide domain and on its carboxy terminus to another polypeptide or polypeptide domain.

The term “excitation spectrum” as used herein refers to a wavelength or group of wavelengths of light that, when absorbed by a fluorescent polypeptide molecule of the present invention, cause fluorescent emission by that molecule. .

The term “emission spectrum” as used herein means the wavelength or groups of wavelengths of light emitted by a fluorescent polypeptide.

The term “identifiable” or “detectably identified” as used herein refers to
A standard filter set allows the excitation of one form of the polypeptide without exciting another particular polypeptide, or, similarly, a standard filter set allows the emission of one polypeptide to be different. It means that it can be distinguished from the emission spectrum of the thing. In general, distinguishable or detectably distinct excitation or emission spectra have peaks that differ by 1 nm, preferably by 2, 3, 4, 5, 10 or more nm.

The term “fusion polypeptide” as used herein refers to two derived from two or more proteins not found in nature that are physically linked by peptide bonds.
It means a polypeptide consisting of one or more amino acid sequences.

The term “emission spectrum overlaps with the excitation spectrum” as used herein refers to the wavelength or the wavelength at which light emitted by one fluorescent polypeptide causes excitation and emission by another fluorescent polypeptide. It means a wavelength group.

The term “cell population” as used herein refers to a plurality of cells that are preferred but not necessarily of the same type or strain.

The term “discrete polypeptide” as used herein means a polypeptide that is not expressed as a fusion polypeptide.

The term “FACS analysis” as used herein refers to a method of sorting cells, ie fluorescence activated cell sorting, in which cells are stained with one or more fluorescent markers. Or is expressing it. In this method, cells are passed through a device that excites and detects fluorescence from the marker (s). When detecting fluorescence in a specific spectral portion by a cell, the FACS device can separate the cell from cells that do not express the fluorescence spectrum.

The term “lipid soluble transcription modulator” as used herein is capable of crossing the cell membrane (nucleus or cytoplasm) and has a positive or negative effect on the transcription of one or more genes or constructs. , Means a composition.

The term “operably linked” as used herein refers to the connection of a particular coding sequence to a particular transcriptional regulatory sequence, so that transcription of the coding sequence occurs and is regulated by the regulatory sequence. Means to be done.

The term “reporter construct” as used herein encodes a detectable molecule linked to a transcriptional regulatory sequence that confers regulatory transcription on a polynucleotide encoding the detectable molecule. By polynucleotide construct is meant. The detectable molecule is Renilla reniformis GFP or a variant thereof.

The term “responsive to the presence of a modulator” as used herein means that a particular transcriptional regulatory sequence is turned on and off in the presence of a particular compound. As used herein, gene expression is when the polypeptide encoded by the gene sequence (eg, a GFP polypeptide or a variant thereof) is detectable above background, or, alternatively, the polypeptide is , When it is detectable in an increased amount relative to that detected in the absence of a particular modulator compound,
"Enter". In this regard, "increasing amount" is at least 10%, preferably 20%, 50%, 75%, 100% or more of background detection, or even 5-fold, 10-fold, 20-fold, 50-fold, or Background detection is the amount of signal observed in the absence of modulator compound, meaning 100-fold or more.

The term “modulator of a transcriptional regulatory sequence” as used herein means a compound or chemical moiety that causes a change in expression levels from a transcriptional regulatory sequence. Preferably, the change is at least 10%, 20%, 50%, 75%, 100% or even 5-fold, 10-fold, 2 compared to the absence of the particular modulator.
Detectable as an increase or decrease in detection of reporter molecule or reporter molecule activity, which is a 0-fold, 50-fold, or 100-fold or more increased or decreased level of reporter signal.

The term “inhibitor of a transcriptional regulatory sequence” as used herein refers to a compound or chemical entity that causes a decrease in the amount of reporter molecule or reporter molecule activity expressed from a particular transcriptional regulatory sequence. Means The term "reduced" as used herein, when used in reference to detecting a reporter molecule or reporter molecule activity, means that the detectable activity is the amount detected in the absence of a particular compound or chemical entity. By at least 10%, 20%, 50%, 75%, or even 1
It means a decrease of 00% (ie no expression). The term “candidate inhibitor” as used herein means a compound or chemical moiety that is tested for inhibitory activity in an assay.

[Detailed Description] The present invention relates to GFP derived from Renilla reniformis. The polynucleotide sequence encoding Renilla reniformis GFP was labeled with Renilla reniformis G.
Disclosed herein are polypeptide sequences of FP and variants thereof.

Renilla reniformis GFP polynucleotides were isolated by PCR amplification using a Renilla reniformis cDNA library prepared with lambda phage. The full length coding sequence was isolated, sequenced and inserted into a variety of different expression vectors.

Also disclosed herein is a method of making a Renilla reniformis GFP polypeptide or variant thereof, which method comprises introducing into a cell an expression vector encoding Renilla reniformis GFP or a variant thereof, Culturing the cells and isolating the GFP polypeptide or variant.

[I. Methods of Making the Renilla reniformis GFP Polynucleotides and Polypeptides Described in the Invention] Many methods, including molecular, cellular and biochemical approaches, have been combined to provide the invention disclosed herein. Polynucleotides encoding Renilla reniformis GFP can be synthesized by direct chemical synthesis, library screening and PC.
It can be obtained by any of several different methods, including R amplification. Renilla
The Reniformis GFP polypeptide may be obtained by expression from the recombinant polynucleotide sequence in a suitable organism. Useful variants of the Renilla reniformis GFP polypeptide are made in a similar fashion after introducing mutations into the polynucleotide sequence encoding wild-type Renilla reniformis GFP. The methods required to make and use the Renilla reniformis GFP polynucleotides, polypeptides and variants thereof of the present invention are discussed in detail below.

[A. Isolation of Renilla reniformis GFP polypeptide sequence] [1. Renilla reniformis cDNA Library Preparation] It is known in the art how to make libraries with many different vectors capable of infecting eukaryotic cells, including, for example, bacteriophage, plasmids, and viruses. Any known library construction method that yields large full-length clones of the expressed gene can be used to provide a template for isolating GFP-encoding polynucleotides from Renilla reniformis.

The following methods were used for the libraries used to isolate the GFP encoding polynucleotides disclosed herein. Poly (A) RNA was added to Chomczyn
ski, P and Sacchi, N (1987, Anal. Biochem. 1
62: 156-159) and prepared from Renilla reniformis organisms. The cDNA was prepared using the ZAP-cDNA synthesis kit (Stratagene serial number 200400) according to the manufacturer's recommended protocol and inserted between the EcoRI and XhoI sites of the vector λZAPII. The resulting library contained 5 × 10 ⁶ individual primary clones with an insert size range of 0.5.
~ 3.0 kb with an average insert size of 1.2 kb. The library was amplified once as a template for PCR reaction before use.

[2. Isolation of Renilla reniformis GFP coding sequence by PCR] The Renilla reniformis GFP coding sequence was isolated by polymerase chain reaction (PCR) amplification from within the cDNA library described herein. Many PCR methods are known to those of skill in the art. Thermocycling PCR (Mullis and Fal
oona, 1987, Methods Enzymol, 155: 335-35.
0; See also PCR Protocol, 1990, Academic Press, San Diego, Calif., For a review of PCR methods).
Multiple cycles of DNA replication, catalyzed by a dependent DNA polymerase, are used to amplify the target sequence of interest. Briefly, the oligonucleotide primer is
They are selected to anneal to one side of the sequence to be amplified and the opposite strand. The primer is annealed and extended using a template-dependent thermostable DNA polymerase, then heat denatured to anneal the primer to both the initial template sequence and the newly extended template sequence, and then the primer Extend.
Repetition of the cycle results in exponential amplification of the sequence between the two primers.

In addition to thermocycling PCR, there are many other nucleic acid sequence amplification methods that can be used to amplify and isolate the GFP-encoding polypeptides described in this invention from Renilla reniformis cDNA libraries. These are, for example, isothermal 3SR (is
othermal 3SR) (Gingereras et al., 1990, Annales de Bi
Ologie Clinique, 48 (7): 498-501; Guatel.
li et al., 1990, Proc. Natl. Acad. Sci. USA, 87: 1
874), and a DNA ligase amplification reaction (LAR), which allows the exponential increase of specific short sequences by the activity of any one of several bacterial DNA ligases (Wu and Wallace). , 1989, Genomi
cs, 4: 560). The entire contents of both of these documents are incorporated herein by reference.

Renilla reniformis cDNA library from Renilla reniformis G
The following approach was taken to amplify the sequence encoding FP. The Renilla reniformis GFP coding sequence was labeled with 5'primer 5'-AATTATTA.
GAATTCACCATGGGTGAGTAAACAAATATTGAAGAAC
-3 'and 3'primers 5'-ATAATATCTCGAGTTAAAC
Amplification was performed using CCATTCGTGTAAGGATCC-3 '. The 5'primer contains an EcoRI recognition site that facilitates subsequent cloning of the amplified fragment, followed by the Kozak consensus translation initiation sequence ACCATGG. The 3'primer contains an XhoI recognition site which facilitates cloning of the amplified fragment. Oligonucleotides can be purchased from any of a number of vendors (eg Life Technologies, Operon Technologies). Alternatively, the oligonucleotide primer may be, for example, a phosphotriester (Narang, SA, et al., 1979, M.
eth. Enzymol. 68:90; and U.S. Pat. No. 4,356,270), phosphodiesters (Brown et al., 1979, Meth. Enzymol.
68: 109) and phosphoramidite (Beaucage, 1993, Met.
h. Mol. Biol. 20:33), and may be synthesized using methods known in the art. The entire contents of each of these documents are incorporated by reference.

PCR was performed using 1 × TaqPlus Precision Buffer (Stratagene), 25
0 μM each dNTP, 200 nM each PCR primer, 2.5 U TaqPl
It was carried out in a reaction volume of 50 μl containing us Precision enzyme (Stratagene) and approximately 3 × 10 ⁷ λ phage particles from the amplified cDNA library described above. The reaction was performed in a Robocycler gradient 40 (Stratagene) as follows. 95 ° C for 1 minute (1 cycle), 95 ° C for 1 minute, 53 ° C for 1 minute, 72 ° C for 1 minute (40 cycles), and 72 ° C for 1 minute (1 cycle). The reaction products were separated on a 1% agarose gel and a band of about 700 bp was cut out.
Purified using Strataprep DNA gel extraction kit (Stratagene). Other methods of isolating and purifying amplified nucleic acid fragments are known to those of skill in the art. PCR
The fragment was subcloned by digestion with EcoRI and XhoI to completion and inserted into the retroviral expression vector pFB (Stratagene) creating the vector pFB-rGFP. Both strands of the cloned GFP fragment were completely sequenced. The coding polynucleotide and amino acid sequence are shown in FIG. 1, respectively.
And 2 are presented. Renilla Reniformis and R.M. The Murreli GFP coding sequence is 83% homologous and the proteins share an 88% identical amino acid sequence.

[3. Isolation of Renilla reniformis GFP-encoding polynucleotide by library screening] Another method for isolating the GFP-encoding polynucleotide according to the present invention is GFP.
Screening of expression libraries, such as the lambda phage expression library, for clones that exhibit fluorescence within the emission spectrum of GFP when illuminated with light within the excitation spectrum of. In this way, clones can be identified directly from within the large pool. Standard methods for seeding lambda phage expression libraries and inducing expression of the polypeptide encoded by the insert are well established in the art.
Screening by fluorescence excitation and emission is performed as described herein below using a spectrofluorometer or even visual identification of fluorescent plaques. Either way, fluorescent plaques can be picked up and used to reinfect one or more fresh cultures to provide pure cultures from which GFP insert sequences can be determined and subcloned.

As another alternative, the polynucleotide may be chemically synthesized by one of skill in the art, if the sequence for the desired polynucleotide is available. The same synthetic method used to prepare the oligonucleotide primers (above) can be used to synthesize the GFP gene coding sequence of the present invention. In general, this means that several shorter sequences (about 10
0 nt or less), then annealed, ligated,
This is done by creating a full length coding sequence.

[B. Preparation of Renilla reniformis GFP polypeptide and mutant thereof] [0138] Renilla reniformis GFP polypeptide (for example, a polypeptide having the amino acid sequence of SEQ ID NO: 2) and its mutation from a recombinant vector containing the GFP-encoding polynucleotide of the present invention Body preparation can be done in many ways known to those skilled in the art. For example, a plasmid, bacteriophage or virus can be introduced into prokaryotic or eukaryotic cells by any of the many methods known to those of skill in the art. After introducing the Renilla reniformis GFP-encoding polynucleotide into prokaryotic or eukaryotic cells, the expressed GFP polypeptide may be isolated using methods known in the art or described herein below. Also described herein below are useful vectors, cells, methods of introducing the vectors into cells, and methods of detecting and isolating GFP polypeptides and variants thereof.

[1. Vectors Useful in the Invention] There are a wide variety of vectors known and available in the art that are useful for expressing the GFP polypeptides described herein or variants thereof. The choice of a particular vector obviously depends on the intended use of the GFP polypeptide or variant thereof. For example, the vector of choice must be capable of driving the expression of the polypeptide in the desired cell type, whether the cell is prokaryotic or eukaryotic. Many vectors contain sequences that allow both prokaryotic vector replication and eukaryotic expression of the operably linked gene sequences.

Vectors useful according to the invention are capable of autonomous replication, ie the vector, eg a plasmid, is present extrachromosomally, the replication of which is not necessarily directly linked to the replication of the host cell genome. Alternatively, replication of the vector may be linked to replication of the host chromosomal DNA, eg, the vector may integrate into the chromosome of the host cell, as achieved by a retroviral vector.

Vectors useful according to the invention preferably include a sequence operably linked to the GFP coding sequence, capable of transcription and translation of the GFP sequence. The sequences that allow transcription of the linking GFP sequence include a promoter and, optionally, enhancer elements or elements that allow strong expression of the linking sequence. The term "transcriptional regulatory sequence" refers to any additional sequence that confers on a nucleic acid sequence operably linked to a promoter the desired expression characteristics (eg, high level expression, inducible expression, tissue or tissue specific expression). Means a combination of.

The selected promoter may be any DNA sequence that is transcriptionally active in the host cell of choice, derived from a gene normally expressed in the host cell, or from a gene normally expressed in another cell or organism. May be. Examples of promoters include, but are not limited to: A) Prokaryotic promoter-E. Coli lac, tac or t
rp promoter, λ phage P _R or P _L promoter, bacteriophage T7, T3, Sp6 promoter, Bacillus subtilis alkaline protease promoter,
And B. Stearothermophilus maltogenic amylase promoter, etc .; B) Eukaryotic promoter-yeast promoter, such as GAL1, GAL4 and other glycolytic gene promoters (eg, Hiltzeman et al., 1980, J. Biol.
． Chem. 255: 12073-12080; Alber & Kawasaki.
1982, J. Mol. Appl. Gen. 1: 419-434), LEU2
Promoters (Martinez-Garcia et al., 1989, Mol Gen
Genet. 217: 464-470), alcohol dehydrogenase gene promoter (Young et al., 1982, microbial genetic engineering for chemicals, H.
Ollaender et al., Plenum Press, NY) or the TPII promoter (US Pat. No. 4,599,311); insect promoters such as the polyhedrin promoter (US Pat. No. 4,745,051; Vasuveda).
n et al., 1992, FEBS Lett. 311: 7-11), P10 promoter (Vlak et al., 1988, J. Gen. Virol. 69: 765-776).
, Autographa calfornica polyhedrosis virus basic protein promoter (EP 397485), baculovirus immediate early gene promoter gene 1 promoter (US Pat. Nos. 5,155,037 and 5,162,222), baculovirus 39K. Delayed early gene promoter (see also US Pat. Nos. 5,155,037 and 5,162,222) and OpMNPV immediate early promoter 2; mammalian promoter-SV40.
Promoter (Subramani et al., 1981, Mol. Cell. Biol
． 1: 854-864), metallothionein promoter (MT-1; Palm)
iter et al., 1983, Science 222: 809-814), adenovirus 2 major late promoter (Yu et al., 1984, Nucl. Acids R).
es. 12: 9309-21), cytomegalovirus (CMV) or other viral promoters (Tong et al., 1998, Anticancer Res.
18: 719-725), or even the endogenous promoter of the gene of interest in the particular cell type.

The selected promoter may also be linked to sequences that are inducible or tissue-specific. For example, the addition of tissue-specific enhancer elements upstream of the promoter of choice may make the promoter more active in a particular tissue or cell type. Alternatively, or in addition, inducible expression can include, for example, thermal changes (temperature sensitivity),
This can be achieved by linking the promoter to any of a number of sequence elements that can be induced by treatment with a chemical (eg, metal ion or IPTG inducible) or by addition of an antibiotic inducer (eg, tetracycline). Regulatable expression is achieved, for example, using an expression system that is drug-inducible (eg, tetracycline, rapamycin or hormone-induced). Particularly suitable for use in mammalian cells, drug regulatable promoters include tetracycline regulatable promoters, and glucocorticoid steroid-, sex hormone steroids-, ecdysone-, lipopolysaccharide (LPS)-and isopropylthio. It contains a galactoside (IPTG) regulatable promoter. A regulatable expression system for use in mammalian cells is ideally, but not necessarily, a transcriptional regulator that binds (or does not bind) a non-mammalian DNA motif in response to a modulator, and , Should contain regulatory sequences that are responsive only to this transcriptional regulator.

One well-suited inducible expression system for the regulated expression of the GFP polypeptides of the invention or variants thereof is the tetracycline-regulatable expression system, which establishes the efficiency of the E. coli tetracycline resistance operon. To be done. Tetracycline and te
Although the binding constant between the t repressors is high, tetracycline's toxicity to mammalian cells is low, which does not affect cell growth rate or morphology, in eukaryotic cell culture or in mammals. The system can be adjusted by the concentration. Binding of the tet repressor to the operator occurs with high specificity.

There are variants of the tet-regulatable system that allow for positive or negative regulation of gene expression by tetracycline. In the absence of tetracycline or a tetracycline analog, the wild-type bacterial tet repressor protein causes negative regulation of the gene driven by the promoter containing the repressor binding element from the tet operator sequence. Gossen & Bujard (1995, S
science 268: 1766-1769. Also, International Patent Application No. WO96 / 0
1313) describe a tet-regulatable expression system that takes advantage of this positive regulation by tetracycline. In this system, tetracycline binds to the tet repressor fusion protein, rtTA, preventing it from binding to the tet operator DNA sequence, thus allowing transcription and expression of only the linked gene in the presence of drug.

This positive tetracycline-regulatable system provides one means of stringent, transient regulation of GFP polypeptides of the invention or variants thereof (G
Ossen & Bujard, 1995, supra). Currently tet operator (te
tO) sequences are known to those skilled in the art. For a review, readers should read: Protein-Nucleic Acid Interactions, "Topics in Molecular and Structural Biology," Saanger & Hei.
edited by nemann (Macmillan, London), Volume 10, 143-162.
See section. Typically, the nucleic acid sequence encoding the GFP polypeptide is located downstream of multiple tetO sequences. Generally, 5-10 such tetO sequences are used in direct repeat sequences.

In addition to tetracycline-regulatable systems, many other options exist for the regulated or inducible expression of GFP polypeptides or variants thereof described in this invention. For example, the E. coli lac promoter is responsive to lac repressor (lac) DNA joined by a lac operator sequence. The elements of the operator system are heterogeneous and functional, and inhibition of lacI binding to the lac operator by IPTG has been widely used to provide inducible expression in both prokaryotic and more recently eukaryotic cell lines. ing. Furthermore, Rivera et al. (1
996, Nature Med. 2: 1028-1032) describes a rapamycin-regulated transcription activator system that provides transcriptional activation dependent on rapamycin. The system has low baseline expression and high induction ratio.

Another option for regulated or inducible expression of GFP polypeptides or variants thereof involves the use of thermoresponsive promoters. Activation is induced by incubation of cells transfected with a temperature-sensitive transactivator-regulated GFP construct at an acceptable temperature prior to administration. For example, transcription regulated by a co-transfected temperature-sensitive transcription factor that is only active at 37 ° C can be used when cells are first switched, eg at 32 ° C, and then to 37 ° C to induce expression.

Tissue-specific promoters may also be used to advantage in the GFP encoding constructs of the invention. A wide variety of tissue-specific promoters are known. The term "tissue-specific" as used herein allows for the detection of transcriptionally active (ie, the promoter's polypeptide product) in cells or tissues in an organism in which a particular promoter is less than all. Directs the expression of sufficient ligated sequences to
Means that. Tissue-specific promoters are preferably active in only one cell type, but can be active in, for example, a particular cell type class or lineage (eg, hematopoietic cells). Tissue-specific promoters useful in the present invention are substantially and similar to the manner or pattern of expression of genes linked to the native promoter, and are necessary and sufficient for the expression of operably linked nucleic acid sequences in a manner or pattern. Contains an array that is. The following is a non-exclusive list of tissue-specific promoters, and references containing sequences necessary to achieve the expression characteristic of the promoters in their respective tissues, all of which are The contents are incorporated herein by reference. Examples of tissue-specific promoters useful for Renilla reniformis GFP of the present invention are as follows: Bowman et al., 1995.
Proc. Natl. Acad. Sci. USA 92, 12115-1211
9 describes the brain-specific transferrin promoter, the synapsin I promoter is neurospecific (Schoch et al., 1996, J. Biol. Chem.
． 271, 3317-3323); the necdin promoter is post-mitotic nerve-specific (Uetsuki et al., 1996, J. Biol. Chem. 271, 9).
18-924); the neurofilament light promoter is nerve-specific (Cha
rron et al., 1995, J. Am. Biol. Chem. 270, 30604 to 306
10); the acetylcholine receptor promoter is neuron-specific (Wood et al.,
1995, J. Biol. Chem. 270, 30933-30940); the potassium channel promoter is highly firing nerve-specific (Gan et al., 1996.
J. Biol. Chem. 271, 5859-5865), chromogranin A
The promoter is neuroendocrine cell-specific (Wu et al., 1995, AJ Cl
in. Invest. 96, 568-578), the von Willebrand factor promoter is brain endothelium-specific (Aird et al., 1995, Proc. Natl.
Acad. Sci. USA 92, 4567-4571), the flt-1 promoter is endothelium-specific (Morishita et al., 1995, J. Biol. C.
hem. 270, 27948-27953), the preproendothelin-1 promoter is endothelial, endothelial and muscle specific (Harats et al., 1995, J.
． Clin. Invest. 95, 1335-1344), and the GLUT4 promoter is skeletal muscle specific (Olson and Pessin, 1995, J. B.
iol. Chem. 270, 23491-23495), the slow / fast acting troponin promoter is specific for slow / fast acting myofibrils (Corin et al., 1995.
, Proc. Natl. Acad. Sci. USA 92, 6185-6189.
); The actin promoter is smooth muscle-specific (Shimizu et al., 199).
5, J. Biol. Chem. 270, 7631-7643) and the myosin heavy chain promoter is smooth muscle specific (Kallmeier et al., 1995, J. Bi.
ol. Chem. 270, 30949-30957); the E-cadherin promoter is epithelial specific (Henning et al., 1996, J. Biol. Che.
m. 271, 595-602), and the cytokeratin promoter is keratinocyte-specific (Alexander et al., 1995, B. Hum. Mol. Gen.
et. 4, 994-999), the transglutaminase 3 promoter is keratinocyte-specific (J. Lee et al., 1996, J. Biol. Chem. 2).
71, 4561-4568), and the bullous pemphigoid antigen promoter is basal keratinocyte-specific (Tamai et al., 1995, J. Biol. Chem. 270).
, 7609-7614), and the keratin 6 promoter is proliferative epidermis-specific (
Ramirez et al., 1995, Proc. Natl. Acad. Sci. USA
92, 4783-4787), the collagen 1 promoter is hepatic stellate and skin / tendon fibroblast-specific (Houglum et al., 1995, J. Clin.
Invest. 96, 2269 to 2276), the type X collagen promoter is
Specific for hypertrophic chondrocytes (Long & Linsenmayer, 1995,
Hum. Gene Ther. 6, 419-428), the Factor VII promoter is liver-specific (Greenberg et al., 1995, Proc. Natl.
Acad. Sci. USA 92, 12347-1235), the fatty acid synthase promoter is liver and adipose tissue specific (Soncini et al., 1995).
J. Biol. Chem. 270, 30339-3034), the carbamoylphosphate synthase I promoter is specific for portal hepatocytes and the small intestine (Chr.
istoffels et al., 1995, J. Am. Biol. Chem. 270, 2493
2-24940), the Na-K-Cl transport promoter is kidney (Henle loop) -specific (Igarashi et al., 1996, J. Biol. Chem. 271,
9666-9674), the capture receptor A promoter is macrophage and bubble cell specific (Horvai et al., 1995, Proc. Natl. Acad.
． Sci. USA 92, 5391-5395), the glycoprotein IIb promoter is megakaryocyte and platelet specific (Block & Poncz, 1995,
Stem cells 13, 135-145), the yc chain promoter is hematopoietic cell-specific (Markiewicz et al., 1996, J. Biol. Chem. 271, 1).
4849-14855), the CD11b promoter is specific to mature bone marrow cells (Dziennis et al., 1995, Blood 85, 319-329).

Any tissue-specific transcriptional regulatory sequence known in the art may be used to benefit the vector encoding Renilla reniformis GFP or variants thereof.

In addition to promoter / enhancer elements, the vectors useful in the present invention may further include suitable terminators. The terminator may be, for example, human growth hormone terminator (Palmiter et al., 1983, supra) or, in yeast or fungal hosts, TPII (Alber & Kawasaki, 1982, supra) or ADH3 terminator (McKnight et al., 1985, EMBO J. et al. 4: 209
3-2099).

Vectors useful in the invention can also include polyadenylation sequences (eg, SV40 or Ad5E1b poly (A) sequences) and transcription enhancer sequences (eg, from adenovirus VA RNA). Further, the vectors useful in the present invention may encode a signal sequence that directs the recombinant polypeptide to a particular cell compartment,
Alternatively, it may encode a signal that directs the secretion of the recombinant polypeptide.

Coordinated expression of different genes from the same promoter in a recombinant vector has been shown in
IRE, including internal ribosomal entry site of poliovirus type 1 from SBC-1
This can be accomplished using the S element (Dirks et al., 1993, Gene 12).
8: 247-9). Internal ribosome binding site (IRES) elements are used to create multigenic or polycistronic messages. The IRES element can bypass the ribosomal scanning mechanism of 5′-methylated Cap-dependent translation and initiate translation at internal sites (Pelletier and Sonenberg, 198).
8, Nature 334: 320-325). 2 of the Picanovirus family
IRES elements from one member (polio and encephalomyocarditis), and IRES from mammalian messages (Macejak and Sarnow, 199).
1, Nature 353: 90-94). Either of the above
It may be used according to the invention in the Renilla reniformis GFP vector.

IRES elements can be linked to heterologous open reading frames. I
Multiple open reading frames can be transcribed together, each separated by RES, creating a polycistronic message. With the IRES element,
Each open reading frame can access a ribosome for efficient translation. Thus, multiple genes, one of which is the Renilla reniformis GFP gene, can be efficiently expressed using one promoter / enhancer and transcribed one message. Any heterologous open reading frame can be linked to the IRES element. In the context of the present invention, this means any selection protein and any second reporter gene (or selection marker gene) one wishes to express. Thus, expression of multiple proteins can be achieved with simultaneous monitoring, eg, through GFP production.

Vectors useful in the present invention may also include a selectable marker that allows identification of cells that have received a functional copy of the GFP-encoding gene construct. In its simplest form, it is selected in that it can detect cells expressing the GFP construct by illuminating cells or cell lysates with light of the appropriate wavelength and measuring the fluorescence emitted at the expected wavelength. The GFP sequence itself linked to the promoter can be considered as a selectable marker. Alternatively, the selectable marker may comprise an antibiotic resistance gene such as a neomycin, bleomycin, zeocin or phleomycin resistance gene, or it may be a gene whose product complements a defect in the host cell, for example dihydrofolate dehydrogenate. It may comprise a gene encoding a reductase (DHFR) or, for example in yeast, the Leu2 gene. Alternatively, the selectable marker may, in some cases, be the luciferase gene or the chromogenic substrate converting enzyme gene, eg the β-galactosidase gene.

The GFP coding sequence according to the present invention may be expressed as a free polypeptide, or often as a fusion with another polypeptide. Those of ordinary skill in the art, given the polynucleotide sequence disclosed herein (SEQ ID NO: 1), are Renilla reniformis GF.
It is presumed that a gene containing a sequence encoding P or a fluorescent variant thereof and a sequence containing one or more polypeptides or polypeptide domains of interest can be easily prepared. It is understood that the fusion of the GFP coding sequence and the sequence encoding the polypeptide of interest maintains the reading frame of all involved polypeptide sequences. The term “polypeptide of interest” or “domain of interest” as used herein means any polypeptide or polypeptide domain to which the GFP molecule of the invention is fused. The fusion of the GFP polypeptide of the invention with the polypeptide of interest may be through ligation of the GFP sequence to the N- or C-terminus of the fusion pair, or the GFP sequence may also be of interest if desired. Can be inserted in-frame between the N and C termini of the polypeptide. A fusion containing a GFP polypeptide of the invention need not contain only one polypeptide or domain in addition to GFP. Rather, any number of domains of interest may be linked in any way, so long as the GFP coding region retains its reading frame and the coding polypeptide retains fluorescent activity under at least one set of conditions. One non-limiting example of the conditions includes physiological salt concentration (ie about 90 mM), near neutral pH and 37 ° C.

[A. Plasmid Vector] Any plasmid vector capable of expressing the GFP coding sequence of the present invention in the selected host cell type is acceptable for use in the present invention. The plasmid vector useful in the present invention may have any or all of the above-described vector features useful in the present invention. Plasmid vectors useful in the present invention include, but are not limited to, the following examples. Bacteria-pQE70, pQE60, pQE-9 (Qiagen) pBs, Phagescript, psiX174, pBluescriptSK, pBsKS,
pNH8a, pNH16a, pNH18a, pNH46a (Stratagene),
pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia), eukaryotic-pWLneo, pSV2cat, pOG4.
4, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any other plasmid or vector may be used as long as it is replicable and viable in the host.

[B. Bacteriophage Vector] There are many known bacteriophage-derived vectors useful in the present invention. Most important of these are lambda-based vectors, such as lambda ZapII or lambda-Zap express vectors (Stratagene), capable of inducible expression of the polypeptide encoded by the insert. Others include filamentous bacteriophage, such as the M13-based vector family.

[C. Viral Vectors Many different viral vectors are useful in the present invention to
Any viral vector capable of introducing and expressing sequences encoding Reniformis or variants thereof is acceptable for use in the methods of the invention. Viral vectors that can be used to deliver foreign nucleic acids to cells are retroviral vectors,
Includes, but is not limited to, adenovirus vectors, adeno-associated virus vectors, herpes virus vectors, and Semliki Forest virus (α virus) vectors. Defective retroviruses have been well characterized for use in gene transfer (for review see Miller, AD (1990) Blood 76:
271). Protocols for making recombinant retroviruses and infecting cells with the virus in vitro or in vivo include current protocols in molecular biology,
Ausubel, F.M. M et al. (Green) Publishing Publishing Ass
ocates (1989), chapters 9.10-9.14 and other standard laboratory manuals. Details of retrovirus production and host cell transduction for use in the methods of the invention are also provided in Example 1 below.

In addition to retroviral vectors, adenovirus can be engineered such that it encodes and expresses the gene product of interest, but is inactivated with respect to its dual performance in the normal lytic virus life cycle ( For example, Berkner et al., 1988, Bi
oTechniques 6: 616; Rosenfeld et al., 1991, Sc.
ience 252: 431-434; and Rosenfeld et al., 1992.
, Cell 68: 143-155). Adenovirus Ad5 type dl324
Alternatively, suitable adenovirus vectors obtained from other adenovirus strains (eg, Ad2, Ad3, Ad7, etc.) are known to those skilled in the art. Adeno-associated virus (A
AV) is a naturally defective virus that requires another virus, such as adenovirus or herpes virus, as a helper virus for efficient replication and a productive life cycle (for a review, Muzyczka et al., 1992). , Cu
rr. Topics. in Micro. and Immunol. 158: 9
7-129). Traschin et al. (1985, Mol. Cell. Bio.
l. 5: 3251-260), and nucleic acids can be introduced into cells using AAV vectors. A wide variety of nucleic acids can be introduced into different cell types using AAV vectors (eg, Hermonat et al., 1984, Proc. Natl.
． Acad. Sci. USA 81: 6466-6470; and Trasch.
in et al., 1985, Mol. Cell. Biol. 4: 2072-2081).

Finally, high levels of expression were obtained, the culture conditions were simple compared to mammalian cell cultures, and the post-translational modifications made by insect cells were similar to those made by mammalian cells. Therefore, introduction and expression of foreign genes is often desirable in insect cells. Infection with baculovirus vectors is widely used for the introduction of foreign DNA into insect cells such as Drosophila S2 cells. Other insect vector systems include, for example, the expression plasmid pIZ / V5-His (Invitrogen) and other variants of the pIZ / V5 vector encoding other tags and selectable markers. Insect cells are readily transfectable using lipofection reagents, and there are lipid-based transfection products (eg from PanVera) that are particularly optimized for transfection of insect cells.

[2. Host Cells Useful in the Present Invention] Any cell into which a recombinant vector having Renilla reniformis GFP or a mutant thereof can be introduced (the vector here can drive the expression of a GFP or GFP mutant sequence) is the present invention. Useful in. That is, from the wide variety of uses for the GFP molecule of the present invention, any cell capable of expressing and preferably detecting the GFP molecule of the present invention is a suitable host. Suitable vectors for the introduction of GFP coding sequences into host cells from a variety of different organisms (both prokaryotic and eukaryotic) are described herein above or known to those of skill in the art.

Host cells can be prokaryotic, such as any of many bacterial strains, or include yeast or other fungal cells, insect or amphibian cells, or, for example, rodent, monkey or human cells. It can be eukaryotic, such as a mammalian cell. The GFP-expressing cells of the invention can be primary cultured cells, such as primary human fibroblasts or keratinocytes, or can be established cell lines such as NIH3T3, 293T or CHO cells. Moreover, mammalian cells useful for expressing the GFP of the present invention can be phenotypically normal or can be oncogenically transformed. It will be appreciated by those of skill in the art that the host cell type of choice can be readily established and maintained in culture.

[3. Introduction of GFP Encoding Vector into Host Cell] The GFP encoding vector can be introduced into the selected host cell by any of a number of suitable methods known to those skilled in the art. For example, the GFP construct may be infected, in the case of E. coli bacteriophage vector particles such as λ or M13, or
It may be introduced into suitable bacterial cells by any of the many transformation methods for plasmid vectors or bacteriophage DNA. For example, standard calcium chloride mediated bacterial transformation is still commonly used to introduce naked DNA into bacteria (Sambrook et al., 1989, Molecular Cloning, Experimental Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY) may also use electroporation (Ausubel et al., 1989, supra).

For the introduction of GFP-encoding constructs into yeast or other fungal cells, chemical transformation methods are commonly used (eg Rose et al., 1990, Methods of Yeast Genetics, Coal Spring Harbor Laboratory Press). , Cold Spring Harbor, NY
). For example, in the transformation of Saccharomyces cerevisiae, the cells are treated with lithium acetate to achieve a transformation efficiency of about 10 ⁴ colony forming units (transformed cells) per μg of DNA. The transformed cells are then isolated on a selection medium suitable for the selection marker used. Alternatively, or in addition, the plate or filters picked up from the plate can be scanned for GFP fluorescence to identify transformed clones.

The method used to introduce the Renilla reniformis GFP encoding vector into the mammal depends on the form of the vector. In plasmid vectors, DNA encoding Renilla reniformis GFP or variants thereof may be transfected with a number of transfections, including, for example, lipid-mediated transfection (“lipofection”), DEAE dextran-mediated transfection, electroporation or calcium phosphate precipitation. Can be introduced by any of the methods. These methods are described, for example, in Au.
Subel et al., 1989, supra.

A wide variety of lipofection reagents and methods suitable for transient transfection of transformed and non-transformed or primary cells are widely available, which allows lipofection to constructs, eukaryotic cells, especially It is an attractive method to introduce into mammalian cell culture. For example, Lipofect AMINE (registered trademark) (
Life Technologies) or Lipotakshi® (Stratagene) kits are available. Other companies that provide reagents and methods for lipofection are
Includes Bio-Rad Laboratories, Clontech, Glen Research, Invitrogen, JBL Scientific, MBI Fermentus, PanVera, Promega, Quantum Biotechnology, Sigma-Aldrich, and Wako Chemical USA.

The Renilla reniformis GFP encoding vector was cloned into Drosophila Schn.
Transfection is also performed by lipofection for introduction into insect cells such as eider2 cells (S2) cells, Sf9 or Sf21 cells.

After transfection with the Renilla reniformis GFP-encoding vector of the present invention, eukaryotic cells (preferably mammalian cells, but not necessarily mammalian cells) that have successfully incorporated the construct (intra-chromosomal) are transferred. , As described above, by treating the transfected cell population with a selective agent such as an antibiotic whose resistance gene is encoded by the vector, or directly using, for example, FACS of the cell population or fluorescence scanning of adherent cells. Selection by selective screening. Frequently, both types of screens can be used, where negative selection is used to construct and F
Enhance cells on cells that have taken up ACS or use fluorescence scanning to further enhance GFP-expressing cells or identify specific clones of cells, respectively. For example, negative selection with the neomycin analog G418 (Life Technologies) can be used to identify cells that have received the vector, and fluorescence scanning can be used to increase the number of Renilla reniformis GFP or GFP variants. The expressing cells or clones of cells can be identified.

[4. Preparation of Antibody Reactive with Renilla reniformis GFP] An antibody that binds to a GFP polypeptide encoded by the polynucleotide of the present invention is useful, for example, in protein purification and protein association assays.
Antibodies useful in the invention can include whole antibodies, antibody fragments, multifunctional antibody aggregates, or substrates that generally contain one or more specific binding sites from the antibody. The antibody fragment is F
It may be a fragment such as a v, Fab or F (ab ′) ₂ fragment or a derivative thereof, eg a single chain Fv fragment. The antibody or antibody fragment may be non-recombinant, recombinant or humanized. The antibody may be an immunoglobulin isotype such as IgG, IgM, etc. Furthermore, aggregates, polymers, derivatives and conjugates of immunoglobulins or fragments thereof can be used as appropriate.

The GFP-derived peptide used to induce the specific antibody is preferably at least 5
It has an amino acid sequence of one amino acid and more conveniently at least 10 amino acids. Advantageously, the peptide is identical to a region of the native Renilla reniformis GFP protein or variant thereof, which further comprises the entire amino acid sequence of Renilla reniformis GFP (SEQ ID NO: 2) or variant thereof. obtain.

For the production of antibodies, various hosts including goat, rabbit, rat, mouse, etc.
It can be immunized by injection with a peptide or polypeptide having a sequence derived from the GFP polypeptide of the invention. Depending on the host species, various adjuvants may be used to increase the immune response. The adjuvants include, but are not limited to, Freund's adjuvant, mineral gels such as aluminum hydroxide, and surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol.

To produce polyclonal antibodies, the antigen (ie the Renilla reniformis GFP polypeptide, variant thereof, or peptide fragment obtained therefrom) is conjugated to a conventional carrier to render it immunogenic. Can be increased, yielding antisera to the peptide-carrier conjugate. A short sequence of amino acids corresponding to a GFP polypeptide of the invention may be fused with an amino acid from another protein, such as keyhole limpet hemocyanin or GST, either by expressing as a fusion product or by chemical linkage. , Antibodies are raised against the chimeric molecule.
Coupling of peptides to carrier proteins and immunization is described by Dymecki et al., 1992, J. Am. Biol. Chem. 267: 4815. Serum can be titrated against the polypeptide antigen by an ELISA or, alternatively, by dot or spot blot (Boersma &
Van Leeuwen, 1994, J. Am. Neurosci. Methods.
51:37). Useful sera are described, for example, in Green et al., 1982, Cell, 2
React strongly with the appropriate peptide by ELISA, following the procedure 8: 477.

Techniques for preparing monoclonal antibodies are known, and monoclonal antibodies are described in Arn
It can be prepared using an antigen, preferably conjugated to a carrier, as described in heiter et al., 1981, Nature, 294: 278. Monoclonal antibody
Typically obtained from hybridoma tissue cultures or from ascites fluid obtained from animals into which hybridoma tissue has been introduced. Monoclonal antibody-producing hybridomas (or polyclonal sera) can be screened for antibodies that bind to the target protein according to methods known in the art.

[5. Variant of Renilla reniformis GFP described in the present invention] The present invention is, for example, FRET rather than wild-type Renilla reniformis GFP of amino acid sequence SEQ ID NO: 2 encoded by the polynucleotide of SEQ ID NO: 1.
And a method of identifying a mutant Renilla reniformis GFP that is even better suited for use in a method of using S. Wild-type GFP isolated directly from the Renilla reniformis organism has a quantum yield 3-6 times higher than that of Aequorea Victoria GFP. As shown in Example 4 herein, the Renilla reniformis GFP polypeptide produced in mammalian cells from the recombinant nucleic acid sequences of the invention has spectral features that are nearly indistinguishable from the native polypeptide, That is, the recombinant Renilla reniformis of the present invention is 3 to 6 times brighter than Aequorea Victoria wild-type GFP expressed in the same cell type, and has an excitation and emission spectrum similar to that of the natural Renilla reniformis GFP protein. However, compared with Aequorea Victoria GFP, recombinantly produced A. Even if the brightness of Reniformis GFP is improved, it is desirable to identify a Renilla reniformis GFP mutant with enhanced brightness.

In addition to the Renilla reniformis GFP mutant with increased brightness, other modifications are of interest. For example, variants that exhibit shifts in the excitation and / or emission spectra are useful. This is because it allows the position or level of two or more polypeptides in the same cell to be monitored through simple fluorescence measurements. Also, GFP variants with excitation spectra that overlap, for example, the emission spectra of another GFP (wild type or variant) may also be useful in FRET-based assays. Alternatively, the GFP variant, whose spectral characteristics are responsive to changes in the environment such as pH or oxidation / reduction states, or to changes in phosphorylation states, can be used in the cells or even It is useful for studying extracellular changes.

[A. Mutagenesis Methods Useful According to the Invention Modifications to the Renilla reniformis GFP coding sequence can be random or targeted. In both cases, the choice is wild-type Renilla reniformis GF
Including monitoring individual clones for desired modifications, whether fluorescence enhancement, spectral shift, or other modifications relative to P.

Many random and site-directed mutagenesis methods are known in the art and are SEQ ID NO: 1
Any of those that result in modifications to the Renilla reniformis GFP coding sequence are applicable to making the mutant GFP of the invention. Some examples of both random and site-directed mutagenesis are described below.

Random Mutagenesis Random mutagenesis as described substantially in Meyer et al., 1985, Science 229: 242, using chemical mutagenesis, eg, using nitric acid, permanganate or formic acid. Mutations can be made and the entire of this document is incorporated herein by reference. According to the method of Meyer et al., A mutant population of single-chain Renilla reniformis GFP fragments was prepared, and then wild-type Renilla reniformis GF was prepared.
Amplify using the PCR primers used herein above for amplification of P. Amplification products with random mutations were cloned into an appropriate vector, transformed into bacteria, and colonies were altered fluorescence compared to wild-type Renilla reniformis GFP expressed or purified from the same vector in the same bacterial strain. Screen for features.

An alternative to chemical mutagenesis in creating random mutations is a mutagenizing bacterial strain, such as the XL1-Red E. coli strain (Stratagene), which is
It lacks polymerase proofreading activity and DNA repair machinery. The plasmid introduced into this or a similar bacterial strain becomes mutated during cell division. XL1-R
When a mutagenized bacterial strain such as ed is used, the plasmid containing the mutagenizing GFP sequence (ie, SEQ ID NO: 1) is transformed into the mutagenized bacterium for about 2 days (depending on the desired degree of mutagenesis, Proliferate (short or long term). Randomly mutated plasmids were isolated from cultures using standard methods and retransformed into non-mutagenized bacteria (eg E. coli strain DH5, Life Technologies), seeded and individually Get a colony of. The colonies are then screened for changes in the desired fluorescent characteristics relative to colonies expressing wild-type Renilla reniformis from the same plasmid of the same bacterial strain.

Another example of random mutagenesis is the so-called “error prone PCR method”.
As the name implies, the method amplifies specific sequences under conditions in which the DNA polymerase does not support high fidelity incorporation. Conditions that recommend error-prone incorporation in different DNA polymerases will vary, but one of skill in the art can determine the conditions for a particular enzyme. An important variable for many DNA polymerases in amplification fidelity is, for example, the type and concentration of divalent metal ions in the buffer. Therefore, the use of manganese ions and / or changes in magnesium or manganese ion concentration can be applied to affect the error rate of the polymerase. As with other methods, the mutagenized sequences are inserted into an appropriate vector, transformed into bacteria and screened for the desired characteristics.

Site-Directed or Targeted Mutagenesis There are many site-directed mutagenesis methods known in the art that can mutate specific sites or regions in a straightforward manner. These methods are conventional and PCR.
It is embodied in a number of commercially available kits for performing site-directed mutagenesis, including both C-based methods. An example is the site-directed mutagenesis kit based on Stratagene's Excite® PCR (catalog number 200).
502; PCR-based), and Stratagene's QuickChange® site-directed mutagenesis kit (catalog number 200518; PCR-based) and Chameleon® double-stranded site-specific Includes a mutagenesis kit (catalog number 200509).

Older site-directed mutagenesis known in the art relies on subcloning the mutating sequence into a vector, such as the M13 bacteriophage vector, which allows isolation of single-stranded DNA templates. In these methods, a mutagenic primer (ie, a primer that can anneal to the site of mutation but has one or more mismatched nucleotides at the site of mutation) is annealed to a single-stranded template, and then the mutagenic primer Polymerize the complement of the template starting from the 3'end. The resulting duplex was then transformed into host bacteria and plaques screened for the desired mutation.

More recently, site-directed mutagenesis has used the PCR method, which has the advantage of not requiring a single-stranded template. In addition, we have developed a method that does not require subcloning. Several tissues must be considered when performing PCR-based site-directed mutagenesis. First, it is desirable in these methods to reduce the number of PCR cycles to prevent the growth of unwanted mutations introduced by the polymerase. Second, selection must be used to reduce the number of mutant parent molecules that survive the reaction. Third, the extended PCR method is preferred in order to be able to use one PCR primer set. Fourth, because of the non-template-dependent end extension activity of some thermostable polymerases, it is often necessary to include an end polishing step in the procedure prior to blunt end ligation of PCR-generated mutant products.

The following protocol accommodates these considerations through the following steps. First, the template concentration used was approximately 1000-fold higher than that used in conventional PCR reactions, and the number of cycles was 25-30 to 5-1 without dramatically reducing product yield.
Can be reduced to zero. Second, the restriction endonuclease DpnI (recognition target sequence: 5
-Gm6ATC-3, where the A residue is methylated), the parent D
Select for NA. Because the most common E. coli strain Dam is
Is methylated at the sequence 5'-GATC-3 '. Third, Taq extender is used in the PCR mix to increase the proportion of long (ie, full length plasmid) PCR products. Finally, using Pfu DNA polymerase, T4DN
The ends of the PCR product are polished before intramolecular ligation with A ligase.
The method is detailed as follows.

[PCR-Based Site-Directed Mutagenesis] Plasmid template DNA (about 0.5 pmol) was added to 1 × mutagenesis buffer (20 m).
M Tris HCl, pH 7.5, 8 mM MgCl ₂ , 40 μg / ml BSA
), 12-20 pmol of each primer (those skilled in the art will consider mutagenesis if necessary, taking into account factors such as base composition, primer length and desired buffer salt concentration, which affect the annealing characteristics of the oligonucleotide primer. Primers can be designed; one primer must contain the desired mutation, one (same or the other) must contain a 5'phosphate to facilitate subsequent ligation), 250 μM of each dNTP, 2.5 U of Taq DNA polymerase,
And 2.5U Taq Extender (obtained from Stratagene: Niels
on et al. (1994) Strategies 7:27 and US Pat. No. 5,55.
No. 6,772)) to the PCR cocktail. PCR cycling is performed as follows: 1 cycle of 94 ° C for 4 minutes, 50 ° C for 2 minutes, 72 ° C for 2 minutes; then 1 minute at 94 ° C, 2 minutes at 54 ° C, 1 minute at 72 ° C. 5 to 10
cycle. Linear PCR incorporating parental template DNA and mutagenic primers
The prepared DNA was transformed with DpnI (10 U) and Pfu DNA polymerase (2.5 U
). This results in DpnI digestion of the parental template and hybrid DNA methylated in vivo, and removal of the non-templated Taq DNA polymerase extension base (s) on the linear PCR product by Pfu DNA polymerase. The reaction is incubated at 37 ° C for 30 minutes, then transferred to 72 ° C for an additional 30 minutes. D mutagenesis buffer (115 μl 1 ×) containing 0.5 mM ATP
Add to pnI digested Pfu DNA polymerase polished PCR product. This solution is mixed, 10 μl is taken out in a new centrifuge tube, and T4 DNA ligase (2-4 U) is added.
) Is added. The ligation is incubated at 37 ° C for 60 minutes or longer.
Finally, the treated solution is transformed into competent E. coli according to standard methods.

Limited Random Mutagenesis The sub-category of site-directed mutagenesis involves the use of random oligonucleotides to introduce random mutations into defined regions of specific sequences ( this is,"
"Limited random mutagenesis"). This is especially useful if one wishes to mutate any base in the region encoding the hexapeptide, for example. In general, the oligonucleotides used in this type of approach are: positively complementary to a region on either side of the linked, mutated region of the random or partially random oligonucleotide sequence corresponding to the mutated sequence, and , Having a constant nucleotide sequence immediately adjacent to the mutated region. One of the constant regions flanking the mutagenesis region should have restriction sites to facilitate replacement of the wild-type sequence with the mutagenesis sequence after mutagenesis. Ideally, the restriction site naturally occurs adjacent to the mutated region, but one of skill in the art may also introduce the restriction site by silent mutation without changing the coding sequence (eg, New England Biolabs (NE
B) In the catalog appendix, in particular, 282 / -2 of the 1998/1999 NEB catalog
See section 83 for a list of restriction sites that can be introduced by silent mutagenesis).

In a limited random mutagenesis procedure, mutagenesis oligonucleotides such as those described above were used in combination with selected counter-primers and wild-type or even previously mutated recombinant Renilla reniformis GFP construct template (wild-type). , Or alternatively, previously altered) to PCR amplify a pool of all randomly or semi-randomly mutated fragments at desired sites. The counter-primer can be selected to be 5'or 3'of the mutagenizing sequence of nucleotides to replace the wild type with the mutating sequence
It should have natural or engineered restriction sites that do not change the P coding sequence. Conveniently, the counter primer may be attached to the vector sequence immediately 5 ′ or 3 ′ of the GFP coding sequence. The amplified pool of mutant fragments is cleaved with a restriction enzyme that recognizes the respective sites of mutagenesis and counter-priming, and the pool contains a GFP coding sequence that is not amplified during the mutagenesis step (5 'or 3 ') Ligate in a similarly cut recombinant vector to create a pool of full-length GFP coding sequences randomly or semi-randomly mutated only on selected nucleotide sequences.

Mutations in a limited random mutagenesis approach are referred to as "random or semi-random". This is because the mutagenic sequences do not necessarily have to be completely random. Those skilled in the art will appreciate that no change (often possible with a third or “wobble” nucleotide) to limited change (only with intermediate and / or third nucleotides), as long as there are possible changes to the encoded peptide sequence. Recognizing that, for example, one, two, or all three nucleotides of a codon can be changed, with different consequences, ranging from affecting changes) to completely random changes (changes affecting all three nucleotides of a codon). is doing. Therefore, by maintaining certain nucleotides within the mutagenesis region and changing others (on all four possible nucleotides or one or more subsets thereof) Can be controlled. The thus mutagenized sequence is "semi-randomly" mutagenized. After cloning the mutant pool of Renilla reniformis GFP vector or its equivalent using a limited random mutagenesis method, the mutant pool is transformed into bacteria to induce expression and the clone is cloned to the desired characteristics. Screen for changes.

[B. Purification of Renilla reniformis GFP or a variant thereof] If necessary, Renilla reniformis GFP can be purified by Ward and Cormi
er (1979, J. Biol. Chem. 254: 781-788) and M.
atthews et al. (1977, Biochemistry 16: 85-91).
From a Renilla reniformis organism as described in, and the contents of both are incorporated herein by reference. Those skilled in the art can follow similar procedures for freeze-thaw thawing and
After preparation of the clarified lysate by centrifugation at 14,000 xg, it can be applied to bacterially expressed Renilla reniformis GFP or variants thereof. Briefly, Matth
The method used by Ews et al. and Ward and Cormier was described by continuous chromatography on DEAE-cellulose, Sephadex G-100, and DTNB (5,5′-dithiobis (2-nitrobenzoic acid)) Sepharose columns, and Includes dialysis against 1 mM Tris (pH 8.0), 0.1 mM EDTA. The dialysis fraction containing GFP (identified by fluorescence) is then acid treated to sediment the contaminants, then the supernatant is neutralized and then lyophilized. Low salt (first 10 mM
To 1 mM) and a pH range of 7.5 to 8.5 are important for maintaining activity during lyophilization. The lyophilized sample is resuspended in water, immediately centrifuged to remove less soluble contaminants and applied to a Sephadex G-75 column. GF
P is eluted with 1.0 mM Tris (pH 8.0), 0.1 mM EDTA. The sample was concentrated by partial lyophilization, dialyzed against 5 mM sodium acetate, 5 mM imidazole, 1 mM EDTA, pH 7.5 and then chromatographed on a DEAE Biogel A column equilibrated in the same dialysis buffer. Apply to the graph.
GFP is eluted with a continuous acid gradient from pH 6.0 to 4.9 in the same acetate / imidazole buffer. The fraction containing GFP is 1.0 mM Tris-HCl, 0.1 mM
After dialysis against EDTA, pH 8.0, the sample is partially lyophilized, concentrated and passed through a Sephadex G-75 (Superfine) column. Then GF
The P-containing fraction was treated with DEAE Biogel A in Tris / EDTA buffer pH 8.0.
Apply to the column and then elute in a continuous alkaline gradient from pH 8.5 to 10.5 formed with 20 mM glycine, 5 mM Tris HCl and 5 mM EDTA. The GFP-containing fraction contains substantially homologous Renilla reniformis GFP.

For screening applications that require less pure GFP preparations, recombinant Renilla reniformis or variants thereof can be purified from bacteria as follows.
Bacteria transformed with the recombinant GFP-encoding vector of the present invention are grown in Luria-Burtani medium containing the appropriate selection antibiotic (eg, 50 μg / ml ampicillin). If the vector allows, recombinant polypeptide expression is induced by the addition of a suitable inducer (eg 1 mM IPTG). Bacteria are harvested by centrifugation and lysed by freezing and thawing the cell pellet. Debris was removed by centrifugation at 14,000 xg and the supernatant equilibrated with 10 mM phosphate buffered saline (pH 7.0), Sephadex G-75 (Pharmacia, Piscataway, NJ). ) Put it on the column. Fractions containing GFP are identified by fluorescence emission at 506 nm when excited by light at 500 nm, or by excitation and emission at a series of spectra when purifying GFP variants with altered spectral characteristics. To do.

[C. Modifications to Renilla reniformis GFP Useful in the Invention] The Renilla reniformis chromophore center consists of amino acids 64-69 of the wild-type polypeptide having the sequence FQYGNR. Mutations in the amino acid sequence at one or more positions, or equivalents thereof, using, for example, standard site-directed or limited random mutagenesis, can result in enhanced fluorescence intensity or shifts in spectral features Can give rise to the body. Changes at sites outside the chromophore center can also affect the fluorescent properties of the polypeptide. For example, because Renilla reniformis survives at temperatures well below 37 ° C., mutations that stabilize the fluorescent form of the folded polypeptide at 37 ° C. are therefore necessary for human or mammalian cell culture or bacterial culture. The fluorescence of the polypeptide in the liquid can be enhanced. Moreover, although the chemistry of the Renilla reniformis GFP chromophore is nearly identical to that of the Aequorea Victoria GFP chromophore (Ward et al., 1980, Photochem. Ph.
otobiol. 31: 611-615), fluorescence characteristics including intensity and spectrum are quite different. This indicates that modifications outside the chromophore center have an effect on the fluorescent characteristics.

In addition to modifications that alter the coding sequence of wild-type Renilla reniformis GFP, the nucleic acid sequence encoding the polypeptide may be modified to enhance its expression in mammalian or human cells. The codon usage of Renilla reniformis is optimal for expression of Renilla reniformis, but not optimal for mammalian or human expression. Therefore, adaptation of sequences isolated from Renilla for expression in higher eukaryotes is more common in these systems because it modifies certain codons and is less preferred in mammalian or human systems. Including changing to what is used. This so-called "humanization" is accomplished by site-directed mutagenesis of less preferred codons, as described herein or as known in the art. A similar modification of the Aequorea Victoria GFP coding sequence is described in US Pat. No. 5,874.
, 304. The preferred codons for human gene expression are listed in Table 1. The codons in the table are arranged from left to right in the order of most use relative to human genes. Renilla reniformis GFP for preferred human genes
Those having ordinary skill in the art, after considering the codons of (SEQ ID NO: 1), will recognize that Renilla reniformis GF
It can be identified which codons of the P gene can be modified to achieve more efficient expression in human or mammalian cells. In particular, the underlined codons in the table are almost never used in known human genes, and when found in the Renilla reniformis sequence,
Therefore, we show the most important codons for modification to enhance expression efficiency in mammalian or human cells.

[0145]

[Table 1]

The left codons represent the most preferred for use in human genes, with human usage decreasing toward the right. Underlined codons are almost never used in human genes.

[6. Screening for Renilla reniformis GFP mutants with altered fluorescence characteristics or altered properties]

[0148]   One way to screen for changes in fluorescence characteristics is with mutated GFP sequences.
One transformed bacterial colony was removed from the plate with a pore size of 0.45 μm.
Nitrocellulose Membrane (Schleicher & Schuell, Keene, N
H) and pick up the membrane on a new agar / medium plate (eg amp ^r And lacI repressor gene and Renilla reniformis GFP
For a vector containing an alc operator upstream of the coding gene, 50 μg /
ml ampicillin, LB agar containing 1 mM IPTG), bacterial side up
Place and grow colonies on membrane. The membrane is then placed on the colony for fluorescence characteristics.
Scan for. Scanning is through an interference filter suitable for the desired excitation wavelength (
For example, available from CVI Laser, Inc. of Albuquerque, New Mexico.
Filter), 150 W xenon lamp (Xenon Corp., Wobur
n, Massachusetts) monochromatic radiation created by passing light
It can be carried out under irradiation with light. The light emitted from the irradiated colony is emitted at a wavelength of 500 nm.
With a cut-off, eg observable through a shot KV500 filter
It The same method of screening mutants for alterations in fluorescent signatures
Applicable regardless of randomization or targeting.

Another fluorescent scanning device is a scanning polychromatic light source (TI, Munich, Germany).
L. L. Photonics rapid monochromator) and integrated RGB color camera (such as Photonic Science Color Cool View). After the multi-wavelength excitation scanning, the image captured by the integrated color camera is subjected to image analysis and spec R
Software such as 4 (Signal Analytics, Inc., Vienna, VA, USA) can be used to determine the actual color of the emitted light.

Bacterial or eukaryotic (eg yeast or mammalian) cells expressing the variant are first treated with wild type, as there are many altered characteristics to be screened (eg fluorescence intensity, thermostability or spectral characteristics). Can be screened against control cells expressing the type, and then, if necessary, from colonies selected by cell selection,
Characterize the clarified lysate or purified polypeptide. In other altered characteristics (eg pH-sensitive or phosphorylation-dependent changes in fluorescence) purified polypeptides or at least clarified bacterial or eukaryotic cell lysates may be required for screening. If necessary, clarified lysate preparation and / or purification is performed according to the methods described herein or known in the art. Finally, the purified mutant or altered GFP polypeptide can be compared to wild-type Renilla reniformis GFP (native or recombinant) with respect to the characteristics to be modified. When screening for mutants of Renilla reniformis GFP with altered fluorescence intensity or brightness according to the present invention, at least the fluorescence of wild-type Renilla reniformis GFP (isolated from Renilla reniformis or expressed from the recombinant vector construct of the invention). Two
Look for fluorescence that is twice as intense or bright and three times, five times, ten times, twenty times, fifty times, or even 100 times more intense or brighter than the same molar amount of wild-type Renilla reniformis GFP.

When screening for Renilla reniformis GFP variants with altered spectral characteristics, one looks for a GFP polypeptide that exhibits an excitation or emission spectrum that is distinguishably or detectably distinguishable from the spectrum of the wild-type GFP polypeptide. Discriminating or detectably discriminating allows a standard set of filters to excite one form without exciting the other, or likewise, a standard set of filters produces a form of emission of some form. It means that another form of luminescence can be identified. Generally, the distinguishable excitation or emission spectra have peaks that have changed by more than 1 nm, preferably 2, 3, 4, 5, 10 nm, or more. The identifiable spectrum peak is also preferably narrow, about 5 nm or less, 7 nm or less, 10 nm or less, 15 nm or less, 20 nm or less, 50 nm or less, or 100.
The range of nm or less is covered. The maximum allowable width of a peak that is considered distinguishable is directly related to how the peak maximum has changed from the maximum of the distinguishing peak. In other words, the greater the variation between the peak wavelengths of the two fluorescent polypeptides, the broader the peaks can be and still be distinguishable. Conversely, the less the center-to-center variation of a peak, the narrower the peak must be to be distinguishable.

A particularly preferred spectral shift is a shift in the emission spectrum without a discernible shift in the excitation spectrum. The shift allows the excitation of two or more different GFPs with the same wavelength of light (or the same range of excitation wavelengths),
It allows the discrimination of the fluorescence of two or more GFPs based on the still different emission wavelengths.

Other preferred spectral shifts include those that are capable of FRET Renilla reniformis GFP as a donor or acceptor fluoroprotein. For example, the emission spectrum of the first fluorescent polypeptide is altered so that it overlaps the emission spectrum of the second fluorescent polypeptide, the spectral change defining a pair of fluorescent polypeptides of FRET. Both the first and second fluorescent polypeptides are G
It is preferably, but not necessarily, a FP polypeptide; when the non-GFP fluorescent polypeptide is a FRET donor or acceptor, it is preferred that the polynucleotide sequence of the fluorescent polypeptide is known.

If both fluorescent polypeptides of a FRET pair are Renilla reniformis GFP polypeptides, one or both polypeptides may be altered. That is, one may be wild-type Renilla reniformis GFP and the other may be variable, or
Both GFPs in the FRET pair can change. Wild-type Renilla reniformis GFP
If is a member of a pair, it can be a donor or acceptor member of the pair.

The utility of the Renilla reniformis GFP polypeptides of the invention may be enhanced,
Another altered characteristic is the altered stability of the polypeptide in vivo. As mentioned above, modifications that alter the folded stability of the fluorophore center of a polypeptide can alter the fluorescence intensity of the polypeptide. However, modifications that increase or decrease the half-life of the whole GFP polypeptide in vivo or in vitro, ie, those that affect polypeptide turnover or degradation, are also useful.
For example, increased stability may enhance detection of modified Renilla reniformis GFP by allowing larger pools of steady-state GFP to accumulate at specific rates of expression. Importantly, it is also useful for variants of Renilla reniformis GFP polypeptide with reduced stability in vivo or in vitro. For example, the responsiveness of a reporter assay for transcription is enhanced by a reporter molecule with a shorter half-life. In general, the shorter the biological half-life of the reporter molecule, the faster the new steady state is achieved and the more sensitive the assay when the transcription rate is increased or decreased.

[II. Uses of Renilla reniformis GFP and its variants according to the invention] The Renilla reniformis GFP and its variants according to the invention are useful in many different ways. In general, Renilla reniformis is useful for any process and assay that can be performed with Aequorea Victoria GFP. Moreover, due to its excellent spectral characteristics and fluorescence intensity, wild-type Renilla reniformis GFP is more useful in processes and assays than can be performed with Aequorea Victoria GFP. And finally, the altered, modified or mutated Renilla reniformis is even more useful for the particular application of fluorescent marker surgery.

Renilla reniformis GFP or variants thereof can be used as a selectable marker for identification of cells transfected or infected with a gene transfer vector. In this embodiment, cells transfected with a construct encoding GFP are exposed to light within the excitation spectrum and the fluorescence emission in the emission spectrum of GFP is detected to detect background of untransfected or infected cells. Can be identified against.

The utility of Renilla reniformis GFP as a reporter molecule results from properties such as easy detection, the ability to perform real-time detection in vivo, and the fact that introduction of a substrate is not necessary. The Renilla reniformis gfp gene therefore identifies transformed cells (eg, fluorescence activated cell sorting (FAC
S) or by fluorescence microscopy) to measure gene expression in vitro or in vivo and label specific cells in multicellular organisms (eg to study cell lineage)
, Fusion proteins can be labeled and localized, and used to study intracellular protein trajectories. Mutant Renilla reniformis GFP, which exhibits altered fluorescence characteristics in response to, for example, changes in pH, phosphorylation state or redox state,
Useful for studying changes in the parameter in vivo.

Renilla reniformis GFP may also be used in standard biological applications.
For example, they can be used as molecular weight markers on protein gels or Western blots in fluorimeter and FACS instrument calibrations, and as markers for microinjection into cells and tissues. In the method of making a fluorescent molecular weight marker, the Renilla reniformis GFP gene sequence is fused to one or more DNA sequences that encode a protein having a defined amino acid sequence, and the fusion protein is expressed from an expression vector. Expression results in a fluorescent protein of defined molecular weight or group of molecular weights that can be used as a marker.

Preferably, the purified fluorescent protein is subjected to size fractionation, such as by using a gel. Thereafter, the molecular weight of the unknown protein is determined by collecting a calibration curve from the fluorescent standard substance and decoding the unknown molecular weight from the curve.

[A. Use of Renilla reniformis GFP whose emission spectrum is changed] A plurality of reporter genes can be used simultaneously by amino acid substitution of Renilla reniformis GFP that produces different emission spectra. Different colors of Renilla reniformis GFP can be used to identify multiple cell populations or to track multiple cell types in mixed cell cultures, with the addition of additional substances or the need to fix or kill cells Without, differences in cell movement or migration can be visualized in real time.

Other options involving the use of GFPs with altered emission spectra include tracking and determining the final location of multiple proteins within a cell, tissue or organism. Differential promoter analysis, which determines gene expression from two different promoters in the same cell, tissue or organism, is also possible with GFPs with different emission spectra, as well as FACS sorting of mixed cell populations.

In tracking intracellular proteins, the Renilla reniformis GFP mutants were used in a manner similar to fluorescein and rhodamine to tag interacting proteins or subunits and then their association. Are dynamically monitored in intact cells by FRET. The cells are illuminated with light at the excitation wavelength of the donor and the release by the acceptor is monitored to show protein-protein interactions of the tagged protein.

Techniques that can be used with the spectrally separable Renilla reniformis GFP derivatives include confocal microscopy, flow cytometry, and fluorescence activated cell sorting (FACS) using the dual excitation technique of modular flow. Is illustrated by.

[B. Use of Renilla reniformis GFP in Identification of Transfected Cells] Renilla reniformis GFP can be introduced as a selectable marker to identify transfected cells from the background of untransfected cells. Alternatively, Renilla reniformis GFP transfection can be used to pre-label isolated cells or populations of similar cells prior to exposing the cells to the environment in which the different cell types are present. By detecting GFP in the original cells only, the location of the cells can be determined and compared to the total cell population.

Cells transfected with exogenous DNA can be identified using the Renilla reniformis GFP of the invention without creating a fusion protein. The method is
It relies on the identification of cells that have received a plasmid or vector containing at least two transcription or translation units. The first unit codes and directs the expression of the desired protein, while the second unit codes and directs the expression of Renilla reniformis GFP or variants thereof. Co-expression of GFP from the second transcription or translation unit ensures that cells containing vector are detected and discriminated from cells without vector.

The Renilla reniformis GFP sequence of the present invention may also be fused to a DNA sequence encoding a select protein for direct labeling of the encoded protein with GFP. Expression of the Renilla reniformis GFP fusion protein in cells results in a fluorescently tagged protein, which is easily detectable. this is,
It is useful to ensure that the protein is produced by the host cell of choice. Thereby, the position of the selected protein can be determined whether it represents the natural position or whether the protein is artificially targeted to another position.

[C. Analysis of Transcriptional Regulatory Sequences The Renilla reniformis GFP gene of the present invention allows a series of transcriptional regulatory sequences to be tested for their suitability for use with a particular gene, cell or system. This applies to in vitro uses such as the identification of suitable transcriptional regulatory sequences used for recombinant expression and high level protein production, as well as in vivo uses such as preclinical studies or gene therapy in human subjects. .

In order to analyze transcriptional regulatory sequences, a control cell or line must first be established. In controls, positive results are established by the use of known and efficient promoters such as the CMV promoter. To test candidate transcriptional regulatory sequences, another cell or system was established, in which all conditions are the same except that different transcriptional regulatory sequences are present in the expression vector or gene construct.

GFP expression levels are determined after performing the assay for the same time period and under the same conditions as the control. This allows the strength or suitability of the candidate transcriptional regulatory sequences to be compared to standard or control transcriptional regulatory sequences.

Transcriptional regulatory sequences that can be tested in this manner also include candidate tissue-specific promoters and candidate inducible promoters. Testing tissue-specific promoters can identify optimal transcriptional regulatory sequences for use with particular cells. Again, this is useful both in vitro and in vivo. Optimization of the combination of specific transcriptional regulatory sequences and specific cell types in recombinant expression and protein production is often necessary to ensure that the highest level of expression possible.

The GFP encoded by the regulatory sequence test construct can optionally have a secretion signal fused to it so that GFP secreted into the medium can be detected.

The use of tissue-specific and inducible promoters is particularly effective in in vivo embodiments. When used for expression of a therapeutic gene in an animal, the use of the transcriptional regulatory sequence allows expression at a specific site and / or under defined conditions only in a specific tissue or group of tissues. Achieving tissue-specific expression is of particular importance in certain gene therapy applications, such as expression of cytotoxic agents, as is often used in cancer treatment approaches. Tissue-specific expression is also preferred in the expression of other therapeutic genes that have beneficial effects rather than cytotoxic effects. Because it can optimize the effect of the treatment. Suitable tissue-specific and inducible transcriptional regulatory sequences are known to those of skill in the art, eg, as described herein above.

[D. Use of Renilla reniformis GFP in Assays for Transcription Modulating Compounds Renilla reniformis GFP and variants thereof are useful in screening assays to detect compounds that modulate transcription. In this aspect of the invention, the Renilla reniformis GFP coding sequence is located downstream of a promoter known to be induced by the substance to be detected. Expression of GFP in cells is usually silent and is activated by exposing the cells to a composition containing a selection agent. The presence of a particular defined molecule can be determined, for example, when using a promoter responsive to lipid soluble transcription modulators, toxins, hormones, cytokines, growth factors or other defined molecules. For example, an estrogen responsive regulatory sequence can be linked to GFP to test for the presence of estrogen in the sample.

Any of the detection assays can be used to screen for agents that inhibit, repress or otherwise down regulate gene expression from a particular transcriptional regulatory sequence. Such a negative effect is detectable by the decrease in GFP fluorescence that occurs when gene expression is downregulated in response to the presence of inhibitors.

[E. Use of Renilla reniformis GFP and its variants in FACS analysis] Many conventional FACS methods require the use of fluorescent dye conjugated to purified antibody. Fusion proteins tagged with a fluorescent label are preferred over antibodies in FACS applications. Because cells do not need to be incubated with fluorescently labeled reagents and there is no background due to non-specific binding of antibody conjugates. GFP is particularly suitable for use in FACS because it is stable in fluorescence, species-independent, and requires no substrates or cofactors.

In other expression embodiments, the desired protein may be directly labeled with GFP by preparing and expressing the GFP fusion protein in cells. GFP also
As described above, it can be co-expressed from a second transcription or translation unit in an expression vector that expresses the desired protein. Thereafter, cells expressing a protein tagged with GFP or cells co-expressing GFP are detected and sorted by FACS analysis. The advantage of GFP from Renilla reniformis is that its excitation and emission spectra are possible with standard optical lenses and filter sets used for FACS analysis.

[F. Other Uses of Renilla reniformis GFP Fusion Protein] The Renilla reniformis GFP gene can be used as part of a fusion protein to identify the location of the labeled protein. The fusion of GFP with a foreign protein should retain both the fluorescence of GFP and the function of the host protein, such as physiological and / or tagging functions.

Both the amino and carboxy termini of GFP can be fused to virtually any desired protein to create distinguishable GFP fusions, the fusion optionally being mediated by a linker sequence. And retain the function of the fused pair.

The Renilla reniformis GFP fusion is useful for subcellular localization studies.
The localization test was previously performed by subcellular fractionation and immunofluorescence. But,
These techniques can only give a static indication of the position of a protein in a cell cycle moment. In addition, artifacts can be introduced when cells are fixed for immunofluorescence.
Therefore, it allows tracking of proteins throughout the entire cell cycle in individual cells,
The use of GFP to visualize proteins in living cells is an important technique.

Using Renilla reniformis GFP in real time under various conditions,
Intracellular protein trajectories in mammalian and human cells can be analyzed. Avoid artifacts that arise from fixed cells. In these applications, Renilla Reniformis G
FP is fused to a known protein to examine its subcellular location under different natural conditions.

[Examples] [Example 1 Preparation of infectious Renilla reniformis GFP retrovirus] For virus preparation, 3 μg of each vector pGPhisD (Stratagene), pVSV-G-puro (Stratagene), And pFB-r
It was carried out by co-transfection with GFP or the vector pFB-AvGFP. The latter vector contains an aequorea victoria GFP gene copy containing the insertion of the alanine codon GCT immediately after the methionine start codon, K
ozak consensus sequence and Ser → Thr at position 65 (relative to wt sequence)
Adapts to the inclusion of "red shift" amino acid substitutions. The vectors pGPhisD and pVSV-G-puro contain the viral proteins gag-pol and VSV-.
It encodes G, which is required in trans for virus production.

Transfections were performed using the MBS transfection kit (Stratagene) with some modifications. For each transfection, 2.
5 × 10 ⁶ 293T cells were seeded in 60 mm tissue culture dishes. The next day, the media was aspirated and 4 ml of pre-warmed DME supplemented with 7% MBS and 25 μM chloroquine (Sigma, St. Louis, MO) prior to transfection.
Exchanged for M. The DNA / CaPO ₄ transfection mixture was prepared according to the manufacturer's recommended protocol and added to the cells. After incubation for 3 hours, the medium was replaced with 4 ml of pre-warmed complete culture medium (DMEM with 10% fetal bovine serum (FBS)) supplemented with 25 μM chloroquine and incubated for 6-7 hours. Then, the medium was mixed with 4 ml of pre-warmed DMEM + 10% F.
Exchanged for BS. Incubate cells overnight (12-16 hours) and culture medium 3 m
Replaced with 1 pre-warmed DMEM + 10% FBS and virus collected overnight (
24 hours). 3 ml of viral supernatant was removed and filtered through a 0.45 μm filter. Supernatants were stored on ice for immediate use or frozen on dry ice and stored at -80 ° C.

Example 2 Transduction of Host Cells with Renilla reniformis GFP Retrovirus Stock One day before transduction, NIH3T3 cells were placed in a 6-well tissue culture dish at 1 × 10 ⁵ cells.
Cells / well were seeded in DMEM supplemented with 10% calf serum (CS).
The next day, viral supernatants were serially diluted in DMEM + 10% CS to a final volume of 1.0 ml / sample and supplemented with DEAE Dextran (Sigma, St. Louis, Mo., Catalog No. D9885). , The final concentration is 10 μg / m
It was set to l. Culture medium was removed from NIH3T3 cells and replaced with 1 ml of virus dilution. Each diluted virus sample was applied to wells containing NIH3T3 cells, incubated for 3 hours, then 1 ml of pre-warmed DMEM + 10.
% CS was added to each well, after which the plates were incubated for 2 days. Two
After days, the plates were washed twice with PBS, trypsinized, pelleted by centrifugation and resuspended in 1.0 ml PBS. Store the cell suspension on ice,
Analyzed within 1 hour by fluorescence activated cell sorting (FACS). FACS analysis was performed by Cytometry Research Services (Sorrento Valley, CA).

Example 3 Transfection of CHO Cells and Preparation of Extracts CHO cells were transfected with the plasmid pFB-rGFP and lipofectamine (BRL).
Was used according to the manufacturer's recommendations. Two days after transfection, soluble protein extracts from transfected and non-transfected CHO cells were first washed twice with PBS, then cells were washed with 0.
． Prepared by three freeze-thaw cycles in 25M Tris-HCl (pH 7.8). The lysate was clarified by high speed centrifugation, after which the supernatant was used for spectral analysis.

Example 4 Spectral Analysis of Recombinant Renilla reniformis GFP Excitation and emission spectral analyzes were determined using a Shimadzu RF-1501 spectrofluorometer. Excitation and emission scans were performed with equal amounts of total protein prepared from transfected or untransfected CHO cells. Background fluorescence was subtracted from scans of GFP-containing (transfected) extracts by normalizing to scans of untransfected extracts.

The fluorescence profile of the cloned Renilla reniformis protein was
To compare with that of purified native protein, excitation and emission scans were performed using soluble protein extracts from CHO cells transfected with the expression vector. As shown in FIG. 4, the fluorescence profile of the cloned protein is virtually identical to that reported for the native protein,
There is one major excitation peak at 500 nm (compared to 498 nm for native protein), characteristic of native RenillaGFP, followed by a vibrating shoulder at about 470 nm. The emission spectrum showed a single peak at 506 nm for the cloned protein, compared to a maximum at 509 nm for the native protein.

Example 5 Preparation of Humanized Renilla reniformis GFP Polynucleotides Expression of ectopic genes in cells of a particular species is dependent on the degree to which the polynucleotide sequence of the gene is endogenous to the selected cell type. Very often it is enhanced when it is altered to use codons that are preferred for the expressed gene. For example, "humanization" of the red-shifted Aequorea GFP dramatically enhanced fluorescence levels when expressed in mammalian cells (Yang, T.-T et al [199].
6] Nucl. Acids. Res. 24 [22]: 4592-4593).

The inventors have altered 166 of the 238 codons of the gene such that all codons of the resulting gene are biased towards high expression in human cells. Codon changes are described by Haas et al., 1996, Curr Biol. 6 [3]: 315-4593
It was based on the human codon usage priority described in. The codon usage preferences shown in Table 1 are equivalent to those in the Haas document.

Cell Culture 293, 293T and CHO cells were incubated at 37 ° C. in 5% CO ₂ with 10% fetal bovine serum (Gemini Bio-Products) and 1% glutamine in Dulbecco's modified Eagle's medium ( DMEM).

[Preparation of hrGFP Gene] The humanized recombinant GFP (hrGFP) nucleotide sequence is described in Haas, J.
Et al., 1996, Curr. Biol. 6 [3]: 315-324, thus all codons were selected based on their frequency of highly expressed genes in human cells. The sequence is shown in SEQ ID NO: 3 (see Figure 5). Figure 6 shows a sequence alignment of non-humanized recombinant Renilla reniformis GFP (SEQ ID NO: 1) and humanized Renilla reniformis GFP polynucleotide sequences. The humanized gene synthesizes a set of complementary and overlapping oligonucleotides,
This was prepared by annealing, ligating and subcloning. Both strands were fully sequenced and the mutations were corrected using the Quick Change Kit (Stratagene). The PCR fragment was digested with EcoRI and XhoI to completion and the Ec of the retroviral expression vector pFB (Stratagene) was digested.
Inserted between the oRI and XhoI sites, creating the vector pFB-hrGFP.
This vector was used for further analysis of the humanized gene.

[Viral Production] 293T cells were prepared by using 3 μg of each vector pGPhisD (Stratagene), pVSV-G-puro (Stratagene), and pFB-hrGF.
It was performed by co-transfection with P or the vector pFB-EGFP. The latter vector contains one copy of the fully humanized, red-shifted Aequorea Victoria GFP gene (EGFP). The vectors pGPhisD and pVSV-G-puro contain the viral proteins gag-pol and VS.
It encodes VG, which is required in trans for virus production. Transfections were performed using the MBS transfection kit (Stratagene) with some modifications. 2.5 × 10 ^{6 for} each transfection
293T cells were seeded in 60 mm tissue culture dishes. The next day, media was aspirated and replaced with 4 ml pre-warmed DMEM supplemented with 7% MBS and 25 μM chloroquine (Sigma, St. Louis, MO) prior to transfection. The DNA / CaPO ₄ transfection mixture was prepared according to the manufacturer's recommended protocol and added to the cells. After incubating for 3 hours,
The medium was 4 ml of pre-warmed complete culture medium (25 μM chloroquine supplemented)
It was replaced with DMEM containing 10% FBS) and incubated for 6 to 7 hours. The medium was then replaced with 4 ml of pre-warmed DMEM + 10% FBS. Cells were incubated overnight (12-16 hours) and medium was added to 3 ml of pre-warmed DM.
Exchanged with EM + 10% FBS and collected virus overnight (24 hours). 3 ml of viral supernatant was removed and filtered through a 0.45 μm filter. Supernatants were stored on ice for immediate use or frozen on dry ice and stored at -80 ° C.

Example 6 Evaluation of Expression of Renilla reniformis GFP from Humanized Polynucleotide Sequence The humanized Renilla reniformis GFP coding sequence described in Example 5 was
It was tested for expression in several human, rodent and monkey cell lines. The fluorescence level was found to be substantially higher with the humanized rGFP (hrGRP) gene compared to that of rGFP. hrGFP or humanized redshift Aequ
In a direct comparison between cell populations with a single copy of the proviral expression cassette encoding oreaGFP (EGFP), we found that the relative fluorescence intensities were
We found equality between the two genes.

[Viral Transduction] One day before transduction, 293 cells (human) or CHO cells (hamster) were
DM supplemented with 10% FBS at 1 × 10 ⁵ cells / well in a well tissue culture dish
Seeded in EM. The next day, viral supernatants were serially diluted in DMEM + 10% FBS to a final volume of 1.0 ml / sample and supplemented with DEAE Dextran (Sigma, St. Louis, Mo., Catalog No. D-9885) to give a final concentration. 1
It was set to 0 μg / ml. The culture medium was removed from the target cells and replaced with 1 ml of virus diluent. Apply each diluted virus sample to wells containing target cells and
Incubate for hours, then 1 ml pre-warmed DMEM + 10% FBS
Was added to each well and the plates were then incubated for 2 days. After 2 days, plates were washed twice with PBS, trypsinized, pelleted by centrifugation and resuspended in 1.0 ml PBS. Cell suspensions were stored on ice and analyzed by fluorescence activated cell sorting (FACS) within 1 hour. FACS analysis was performed by Cytometry Research Services (Sorrento Barry, CA).

Comparison of rGFP and hrGFP Expression In Vivo In order to determine whether the sequence changes introduced into the Renilla reniformis GFP gene enhance expression, the hrGFP coding sequence was inserted into vector pFB and obtained. The vector pFB-hrGFP was transfected side-by-side into CHO cells using the parental vector pFB-rGFP gene. Fluorescence microscope (excitation 450
Visual inspection of transfected cells by ~ 490 nm, emission 520 nm) revealed a dramatic fluorescence enhancement of the hrGFP gene compared to rGFP (data not shown). CHO cells were then placed at 2 with equal multiplicity of infection (MOI).
2 days after infection, transduced cells were fluorescent activated cell sorting (FACS; excitation 488 nm; emission 515-545n).
m). As shown by the results in FIG. 7, most of the cell population transduced with pFB-hrGFP fluoresces with about 2-3 higher luminance than the cells with pFB-rGFP.

Relative fluorescence was compared from cells with one copy of the proviral element encoding rGFP, hrGFP, or EGFP. 293 cells were infected at low MOI and 2 days after infection the fluorescence level was analyzed by FACS. As shown in FIG. 8, supernatants diluted 1: 1000 or higher yielded a target cell population in which about 10% or less of the cells were transduced, where the majority of the cells contained 1 copy. Expected to have a proviral element. In the transduced cell population, the total fluorescence intensity of the cell population was comparable for hrGFP and EGFP expression vector. The fluorescence of rGFP was significantly lower than the latter two genes. Similar results for HeLa, C
Obtained for experiments on HO, COS7 and NIH3T3 cells (data not shown).

Other Embodiments Other embodiments will be apparent to those skilled in the art. It should be understood that the foregoing detailed description is provided for clarity only and is exemplary only. The spirit and scope of the present invention is not limited to the above examples, but is covered by the following claims.

[Brief description of drawings]

1 shows the coding sequence of Renilla reniformis (also referred to as R. reniformis) GFP, SEQ ID NO: 1.

[Fig. 2]   FIG. 2 shows the amino acid sequence of Renilla reniformis GFP, SEQ ID NO: 2.

FIG. 3 is a schematic of Renilla reniformis GFP expressed in transduced cells. The shaded peaks represent the uninfected cell population and the shaded peaks represent cells transduced with GFP expressing virus. In this experiment, 44 of the transduced cell population
% Showed fluorescence above background.

FIG. 4 shows the fluorescence spectrum of recombinant Renilla reniformis GFP. The spectra were measured using a bandwidth of 10 nm. The y-axis scale of the two peaks was normalized so that the fluorescence profiles had equal amplitude.

FIG. 5 shows the sequence of the humanized Renilla reniformis GFP polynucleotide sequence (SEQ ID NO: 3).

FIG. 6 shows a sequence alignment between unhumanized Renilla reniformis GFP and humanized Renilla reniformis GFP. Vertical lines indicate homology between humanized and non-humanized genes. Gap is hr
The nucleotides that have been altered to create the GFP gene are shown.

FIG. 7: Unhumanized or Humanized Renilla reniformis GF
5 shows the relative fluorescence of CHO cells transduced with a retroviral vector carrying P. Cells were infected with undiluted supernatant containing virus obtained from the two GFP vectors or medium alone (no virus).

FIG. 8 shows the relative fluorescence of 293 cells with one copy of the proviral element,
From this, rGFP, hrGFP or EGFP is expressed. The UR value% indicates the number of cells that emit fluorescence above the background. "No virus" control raw U
R% was 0.15% and was subtracted from the value for the total cell population.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12N 1/21 C12P 21/02 C 5/10 C12Q 1/02 C12P 21/02 C12N 15/00 ZNAA C12Q 1 / 02 5/00 A (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), CA, JP (72) Inventor Soji, Joseph A. Wyming, USA 83014, Wilson, Pine Meadow Road 5320 F Term (reference) 4B024 AA11 BA80 CA04 CA07 DA02 EA02 EA03 EA04 FA01 GA11 HA01 HA11 4B063 QA01 QA20 QQ08 QQ13 QQ43 QQ79 QR43 QR48 QR59 QR66 QR77 QR80 QS05 QS11 QX02 4B064 AG01 CA02 CA06 CA10 CA19 CC24 DA13 4B065 AA01X AA72X AA86X AA90X AA91X AA93X AA95X AB01 AC14 BA02 CA24 CA46 4H045 AA10 BA10 CA20 EA50 FA72 FA73 FA74

Claims (41)

[Claims] 1. A recombinant polynucleotide encoding a green fluorescent protein (GFP) of Renilla reniformis or a mutant thereof. 2. The recombinant polynucleotide of claim 1 comprising the sequence of SEQ ID NO: 1. 3. The polynucleotide of claim 1, further comprising a sequence encoding at least one fused heterologous polypeptide domain. 4. A recombinant vector comprising a polynucleotide sequence encoding a Renilla reniformis GFP. 5. The recombinant vector of claim 4, wherein the sequence encoding the Renilla reniformis GFP is SEQ ID NO: 1. 6. The recombinant vector of claim 4, wherein the vector is selected from the group consisting of plasmids, bacteriophages, viruses and retroviruses. 7. A cell comprising a recombinant polynucleotide encoding a Renilla reniformis GFP. 8. A cell containing the recombinant vector of claim 4 or claim 5. 9. An isolated recombinant polypeptide comprising the amino acid sequence of SEQ ID NO: 2. 10. A recombinant polypeptide comprising the amino acid sequence of a Renilla reniformis GFP or variant thereof and at least one fused heterologous polypeptide domain. 11. The recombinant polypeptide of claim 10, wherein said at least one fused heterologous polypeptide domain is fused to the amino terminus of said Renilla reniformis GFP or variant thereof. 12. The recombinant polypeptide of claim 10, wherein said at least one fused heterologous polypeptide domain is fused to the carboxy terminus of said Renilla reniformis GFP or variant thereof. 13. The recombinant polypeptide of claim 11 or 12, wherein said at least one fused heterologous polypeptide domain is fused to said Renilla reniformis GFP or variant thereof via a linker sequence. . 14. A) introducing a recombinant vector containing a polynucleotide sequence encoding a GFP of Renilla reniformis into cells, b) culturing the cells of step (a), and c) Renilla reniformis. Isolating GFP from the cells, and the method for producing Renilla reniformis GFP. 15. The method of claim 14, wherein the cells are bacterial cells. 16. The method of claim 14, wherein the cell is a eukaryotic cell. 17. The method of claim 16, wherein the eukaryotic cell is selected from the group consisting of yeast, insect cells, and mammalian cells. 18. The method of claim 17, wherein the mammalian cell is human. 19. The method of claim 14, wherein the polynucleotide sequence is a humanized sequence. 20. A polynucleotide encoding a modified Renilla reniformis GFP polypeptide with increased fluorescence intensity as compared to wild-type Renilla reniformis GFP. 21. The polypeptide has at least one mutation in the amino acid sequence defined by amino acids 64 to 69 of SEQ ID NO: 2 as compared to GFP of wild type Renilla reniformis. Polynucleotides. 22. The G of Renilla reniformis having an excitation spectrum that is detectably discriminated from the excitation spectrum of GFP of wild-type Renilla reniformis.
A polynucleotide encoding an FP polypeptide. 23. A Renilla reniformis G having an emission spectrum that is detectably discriminated from an emission spectrum of a wild-type Renilla reniformis GFP.
A polynucleotide encoding an FP polypeptide. 24. A method for detecting a protein-protein interaction comprising: a) a first polypeptide domain and a first Renilla reniformis GFP.
Providing a first fusion polypeptide comprising a derived polypeptide and a second fusion polypeptide comprising a second polypeptide domain and a second Renilla reniformis GFP derived polypeptide, wherein said first fusion polypeptide comprises The emission spectrum of the one Renilla reniformis GFP-derived polypeptide overlaps with the excitation spectrum of the second Renilla reniformis GFP-derived polypeptide, and the second Renilla reniformis GFP-derived polypeptide is the above-mentioned first Emits fluorescence having a spectrum distinguishable from the fluorescence emitted by the Renilla reniformis GFP-derived polypeptide, wherein the first Renilla reniformis GFP-derived polypeptide is the second Renilla reniformis GFP-derived polypeptide. Excited fluorescence emission by peptides B) mixing the first fusion polypeptide and the second fusion polypeptide, and c) mixing the mixture of step (b) with the first Renilla reniformis GFP. Irradiating with a spectrum of light that excites the derived polypeptide and emits fluorescence, but does not excite the second Renilla reniformis GFP-derived polypeptide; and d) the second Renilla reniformis GFP-derived polypeptide. Detecting fluorescence emission from the second Renilla reniformis GFP polypeptide, wherein the fluorescence emission from the second Renilla reniformis GFP polypeptide is a protein between the first polypeptide domain and the second polypeptide domain. Demonstrating an interaction with a protein. 25. The method of claim 24, carried out in living cells. 26. A method of determining the location of a polypeptide of interest in a cell, wherein the polynucleotide sequence encoding said polypeptide of interest is known, and a) the linked polynucleotide sequences are in-frame. Ligating the polynucleotide sequence encoding the polypeptide of interest so that it is fused with a polynucleotide encoding Renilla reniformis GFP; and b) introducing the ligated polynucleotide sequence into a cell. And c) determining the position of the polypeptide encoded by the linked polynucleotide sequences. 27. The method of claim 26, practiced in living cells. 28. A method for identifying cells into which a recombinant vector has been introduced, comprising the steps of: a) introducing a recombinant vector encoding Renilla reniformis GFP into the cell population; and b) introducing the cell population into Renilla. Irradiating with light within the excitation spectrum of Reniformis GFP; and c) detecting fluorescence in the emission spectrum of Renilla reniformis GFP in the cell population, thereby identifying cells into which the recombinant vector has been introduced. Including the method. 29. The method of claim 28, wherein the GFP is expressed as a fusion polypeptide. 30. The method of claim 28, wherein the GFP is expressed as a separate polypeptide. 31. The method of claim 28, wherein the cells are identified by FACS analysis. 32. A method of monitoring the activity of a transcriptional regulatory sequence, comprising: a) operably linking a nucleic acid sequence comprising said transcriptional regulatory sequence to a nucleic acid sequence encoding Renilla reniformis GFP of SEQ ID NO: 2. Forming a reporter construct, b) introducing the reporter construct into cells, c) detecting Renilla reniformis GFP fluorescence in the cells,
Wherein the fluorescence reflects the activity of the transcriptional regulatory sequence. 33. A method of detecting a modulator of a transcriptional regulatory sequence, comprising: a) operably linking a nucleic acid sequence comprising said transcriptional regulatory sequence to a nucleic acid sequence encoding Renilla reniformis GFP of SEQ ID NO: 2. Forming a reporter construct, wherein said transcriptional regulatory sequence is responsive to the presence of said modulator, b) introducing said reporter construct into a cell, and c) Renilla reniformis in said cell. Detecting GFP fluorescence,
Wherein the fluorescence indicates the presence of the modulator. 34. The method of claim 33, wherein the modulator is selected from the group consisting of hormones, growth factors, and heavy metals. 35. A method of screening for inhibitors of transcriptional regulatory sequences, comprising: a) operably linking a nucleic acid sequence comprising said transcriptional regulatory sequence to a nucleic acid sequence encoding Renilla reniformis GFP of SEQ ID NO: 2. Forming a reporter construct, b) introducing the reporter construct into a cell, c) contacting the cell with a candidate inhibitor of the transcriptional regulatory sequence, and d) renilla in the cell. -Detecting Reniformis GFP fluorescence,
Wherein a decrease in fluorescence relative to fluorescence detected in the absence of said candidate inhibitor indicates that said candidate inhibitor inhibits the activity of said transcriptional regulatory sequence. 36. A method of making a fluorescent molecular weight marker, comprising: a) a nucleic acid sequence encoding Renilla reniformis GFP having a known relative molecular weight such that the linked molecule encodes a fusion polypeptide. In frame ligation to a nucleic acid sequence encoding a polypeptide, b) introducing the ligated nucleic acid sequence of (a) into a cell, and c) isolating the fusion polypeptide from the cell. Wherein the fusion polypeptide is a relative molecular weight marker. 37. A polynucleotide encoding a Renilla reniformis GFP or a variant of Renilla reniformis GFP, comprising at least one humanized codon sequence. 38. A humanized polynucleotide wherein the polynucleotide encodes a Renilla reniformis GFP or a variant of Renilla reniformis GFP. 39. The humanized polynucleotide of claim 37, wherein said polynucleotide comprises the sequence of SEQ ID NO: 3. 40. A recombinant vector comprising the polynucleotide according to any one of claims 37 to 39. 41. A cell containing the recombinant vector of claim 40.