TW200928363A - A rapid detection method for identification of poisonous mushroom - Google Patents

Abstract

The present invention relates to a method for the rapid identification of an ingredient of poisonous mushroom and the primer pairs, probes and a reference material, specifically used for identifying the poisonous mushroom in samples. The method, primer pairs, probes and reference material of the invention can be applied to the detection of the poisonous mushroom in food poison or other products.

Description

200928363 IX. Description of the invention: [Technical field to which the invention pertains] The present invention relates to a test method which can be used as a rapid identification method for toxic mushroom components, and a primer pair and a probe capable of specifically detecting a toxic mushroom in a sample. Reference materials and can be used in the detection of food poisoning or other products. [Prior Art] φ Ο Wild mushrooms are called alfalfa and belong to higher fungi. They are slightly shaped like umbrellas and grow in trees or grasses. They can grow in spring, summer and autumn. Non-toxic mites are edible, their taste is delicious, nutritious, and some have medicinal value. However, some cockroaches contain toxins that endanger people's health and even cause death. Toxins contained in toxic mites, some can be detoxified by high-heat cooking methods, while others cannot be destroyed by general methods. Toxicity and toxicity can be roughly divided into three categories, of course, there are other types of toxicity reports, but the following three categories are still the most in the case of poisoning: 1. Gastroenteritis-type toxin: can be caused within 30 minutes to 3 hours after eating. Symptoms such as nausea, abdominal pain, thirst, and vomiting. Although the lethality is not high, there are many types. More than half of the poisoning incidents in Taiwan, Sakamoto, mainland China and Southeast Asia were caused by eating these poisons (IV). Among them, fluorescing mushrooms, powdered mushrooms, and poisonous powdered mushrooms accounted for the majority, and Taiwan’s green running ring The case of mushroom poisoning is the most. 2-Nerve psychedelic shame · Straight winter 4, the toxin component acts on the nervous system of mammals. The main symptoms are sweating, sensation and paralysis. About 30 poisons can cause such poisoning. The most important thing is poison riding. This toxin 124497.doc 200928363 was originally found in the poisonous fly amanita mushroom, and later also found in the genus Capreolus, the genus of the genus, the genus Leopard, the genus of the genus, the genus of the genus, the genus of the genus It is a saprophytic fungus. 3. The original pulp type toxin. It is mainly composed of brown scale mushroom, autumn helmet mushroom and amanita poisonous crane paste @, spring crane! It is caused by the scales of the crane. The main symptoms are nephritis, cholera-like symptoms and liver disorders.

The Taiwan region is rich in wild fungi resources. In terms of agaric fungi, there are more than 300 species. In terms of geographical distribution, there are widely distributed species in the world, northern hemisphere species, tropical and subtropical species, temperate and high mountains, and Taiwan. Endemic. According to the statistics of the Food and Health Department of the Department of Health, every year in Taiwan, there are incidents of poisoning caused by ingestion of poison and benefits. It is often the people who collect the wild poisons themselves. After eating, they sing, diarrhea and heart, and even have diaphragmatic muscles. , liver dysfunction and symptoms of acute hepatic edema, and finally died of respiratory failure. For example, on April 6, 1996, construction workers in Pingzhen City, Taoyuan, were poisoned after collecting a large amount of wild amanita silk food; on August 12, 1998, the people inadvertently ate the poison of the red loan to become poisoned; on September 3, 1998, the people In the eating garden, the green hoop is reduced in poisoning, etc. However, the identification of the current (four) categories is mainly based on the external type of identification, and is assisted by the inspection of running and other microscopic features, such as the color of the color of the buds and the way of the pleats. , bacterial ring, fungus, pseudo roots, fertility habits, etc. 'Re-check the book borrow or search form (Zhou Wenneng 'Taiwan wild Z introduction, net http.//WWw imue e{Ju tw/~ grab b: If the specimen lacks integrity due to sampling, cooking or other processing, or if the body is broken due to improper storage, the body is broken, discolored or discolored (loss of original color), it cannot be effectively identified according to the traditional method. I24497. Doc 200928363 In recent years, the development of molecular biology science has evolved rapidly. DNA-based biotechnology has been widely used to study the flora and fauna and human races and the biodiversity accumulated during species evolution (diversityov). Ertime). Each organism contains its own unique DNA sequence (except for some RNA viruses)' and whether or not the sample remains intact, or has been destroyed by processing or mixed with it, as long as it still retains a considerable amount of DNA. It can be detected. Therefore, the use of modern molecular biotechnology to detect the unique DNA sequence of organisms is a tool for taxonomic identification. At present, DNA-based species identification techniques include the following examples: (1) Southern blotting (Southern blotting) (2) Restriction fragment length polymorphism (RFLP); (3) Random amplified polymorphic DNAs (RAPD); (4) Amplified fragment length polymorphism (AmPlified fragment) Length polymorphism 'AFLP) '(5) DNA sequencing; (6) PCR and (7) real-time PCR 4. Current meristem bioassay technology for oyster mushrooms 'including PCR 'Such as

Molecular Ecology (1993) 2, P.113, RFLP 'such as Mycological Society Newsletter, 41, P.14, AFLP', such as the 88th Annual Report of the Agricultural Committee of the Executive Yuan, the study of sputum, science and technology (1), the molecular source of Ganoderma lucidum The establishment of genetic DNA fingerprinting and DNA sequencing, such as Molecular Phylogeneticas and Evolution, 13(1), P.1, mainly for the biological evolution of the aphid, the relationship between the genetic relationship and classification, are not targeted at food poisoning. The test method for toxic mushrooms. In the various molecular biology techniques mentioned above, the most convenient method is the instant PCR method. 124497.doc 200928363 Fast' and the test results are the most accurate. When testing with immediate pCR, the extracted sample DN A should be prepared into a reaction solution, and placed in an instant PCR reactor for reaction and detection. The detection result can be interpreted within an hour. In addition, the real-time PCR technology is used in the specific primer pair (primer to increase the specific DNA fragment, synchronous detection with a specific probe (pr〇be), double confirmation of the correctness of the test results, and save the time and operation of the additional confirmation test At present, there is no immediate test method for toxic mushrooms in food poisoning cases. ❹ According to the research of the special funds of the Agricultural Committee of the Bank of Agriculture (4), the research shows that there are at least 100 kinds of toxic mites known at present. The public misunderstood the case of poisoning. Among them, the poisonous green pleats are like /0~the foot kisses the secret (4) ' ^ ^ Φ (Gymnopilus spectabilis)^ (Amanita v screams three kinds, which is the type of Taiwanese people who have a high rate of poisoning. When identifying the types of causes of poisoning in such food poisoning cases, the identification and the arrangement of the hyphae and hyphae by microscopic observation are carried out for identification (Exendment of the Special Biological Protection Center of the Agricultural Committee of the Executive Yuan)_Probiotics and Toadstools The article URL httP://natureksri.g0v.tw/tesriusr/internet/ muW), there is no simple and fast test method, so it usually takes time and again (four) clock or entity to be positive It is true that there is no residual test for the lack of integrity due to improper cooking or improper preservation. It is impossible to judge the toxic effect of food poisoning, which is the highest risk of food poisoning. Green (4), orange naked umbrella and E. sinensis, it is necessary to develop a rapid detection method based on molecular biology technology. [Abstract] I24497.doc 200928363 The present invention relates to a rapid identification sample. , the test method of toxic mushroom components, and the primer pair, probe and reference substance of the toxic mushroom in the sample can be specifically detected, and can be practically applied to the detection of food poisoning or other products. Providing a reference material for the selection of a plurality of target DNA fragments to construct a reference f-body, including a highly retained DNA fragment of the toxic green stalk, a highly retained DNA fragment of the orange naked umbrella, and an E. acuminatum Retaining DNA fragments. Because most of the poisonous mushrooms that cause food poisoning are not easy to obtain or collect, and the mushroom bodies are usually not easy to preserve (the carcass is perishable, It is difficult to obtain a positive control mushroom entity at each inspection. Therefore, in order to solve this problem, the present invention surprisingly found that the selection of the poisonous green mushroom, the orange naked umbrella and A special SDNA fragment of the species of A. sinensis and construct a reference plastid. This reference plastid can be used as a positive control reference for PCR or real-time PCR of toxic green shoots, orange naked umbrellas and E. sinensis. Substance, and this ginseng can be cultured in bacteria to preserve or mass-reproduce 'solving the problem that the mushroom body is not easy to obtain and preserve. According to the invention' The fragment is a southern DNA-preserving DNA fragment of the poisonous green mushroom. Preferably, the highly retained DNA fragment is a mitochondrial mtDNA fragment of cynomolgus, such as each subunit gene of ATP synthase, each subunit gene of NADH dehydrogenase, cytochrome, 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 or ITS2. Preferably, the highly retained DNA fragment is a fragment of 1824 rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 or ITS2 I24497.doc -10- 200928363. More preferably, the highly retained DNA fragment is ITS 1 of the poisonous green mushroom. Most preferably, the sequence of the highly retained DNA fragment of the cynomolgus is essentially composed of SEQ ID ΝΟ:1. The sequence of SEQ ID ΝΟ:1 is as follows: 5'-tgaggggtct gagagagtgg ctgacttgtc gggaattctc ccggatgtga ggactgcagt gtgaaagcac ggctctcttc t_3, according to the present invention, the specific DNA fragment of the selected orange-naked urchin species is a highly retained DNA fragment of the orange-naked umbrella. Preferably, the highly retained DNA fragment is a mitochondrial mtDNA fragment of an orange naked umbrella, such as each subunit gene of ATP synthase, each subunit gene of NADH dehydrogenase, cytochrome b gene, 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 or ITS2. Preferably, the highly retained DNA fragment is a fragment of 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 or ITS2. More preferably, the highly retained DNA fragment is ITS2 of an orange nude umbrella. Most preferably, the sequence of the highly preserved DNA fragment of the orange nude umbrella consists essentially of SEQ ID NO: 2. The sequence of SEQ ID NO: 2 is as follows: 5'-ttctaatggt ctggattggg ggtctttgct ggtttcgcaa gaaatcgctc cccttaaatg tattagccgg tgccctacgt ggactgtcta ctggtgtgat aattatctac gccgttagat gtctgcttta aatgggatgc g-3' According to the present invention, the specific DNA fragment of the selected E. aurantia species is Euclidean Aegis has a high degree of retention of DNA fragments. Preferably, the highly retained DNA fragment is a mitochondrial mtDNA fragment of A. rugulosa, such as each subunit gene of ATP synthase, each subunit gene of NADH dehydrogenase, cytochrome b gene, 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 or ITS2. Preferably, the highly retained DNA fragment is a fragment of Eurasian amanita I24497.doc 200928363 mitochondrial 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 or ITS2. More preferably, the highly retained DNA fragment is ITS2 of E. acuminata. Most preferably, the sequence of the highly retained DNA fragment of E. aurantia consists essentially of SEQ ID NO:3. The sequence of SEQ ID NO: 3 is as follows: 5'-tgataactat ttccacctgt gcatgatgtg tagatgccta ggatttgagg gaacagaggt ttttttttag tggcttttgt ttttataaat cgaggtgtct

Atgttttatt acacttttta tggtattgga tgatttgtga acc-3' & The reference material of the present invention utilizes conventional molecular biology techniques (eg, PCR techniques) to utilize selected genetically engineered genes for various target gene manipulation techniques, including appropriate screening The selection marker and the transfer vector of the genetically replicating element can be completed using a commercially available kit. Preferably, the reference material of the invention is present in plastid form. Detection using the reference material of the present invention is carried out by re-sending the above vector into a host and replicating and proliferating by the DNA or RNA replication mechanism of the host. According to a preferred embodiment of the present invention, the reference material of the present invention is separately subjected to PCR amplification to enlarge the ITS fragments of three mushroom species such as toxic green mushroom, orange naked umbrella and E. sinensis; PCR is performed, the three-segment fragments are ligated and the three-in-one fragment is sent to a suitable vector using a known method or kit (e.g., TA cloning kit) and sent to the host. Another object of the present invention is to provide a primer pair which specifically hybridizes to a highly retained DNA fragment of a toxic green mushroom, and a probe which specifically hybridizes to a DNA fragment which hybridizes to the position of the individual primer of the primer pair. Specifically, the pair of primers is a pair of ITS1 primers that are specifically crossed to the toxic green mushroom, respectively, 124497.doc -12- 200928363 essentially by 5'-tga ggg gtc tga gag agt ggc tg-3' (SEQ ID NO: 4) An oligonucleotide sequence consisting of an oligonucleotide sequence consisting essentially of 5'-agagaga gag ccg tgc ttt cac act-3' (SEQ ID NO: 5). According to the present invention, the probe of ITS 1 which specifically hybridizes to P. ostreatus is substantially composed of 5'-tcc tea cat ccg gga gaa ttc. ccg ac -• 3' (SEQ ID NO: 6) Oligonucleotide sequence. After extracting 'DNA from the sample to be tested, PCR detection using the aforementioned primer pair or real-time PCR detection using the primer pair can directly detect whether the sample is poisonous © Green Pleurotus or Containing Poisonous Green Pleurotus The ingredients. The invention further provides a reference substance comprising a highly-retained DNA fragment of a P. oleracea hybridus that hybridizes to a primer pair of the invention. According to the present invention, the sequence of the highly retained DNA fragment of the P. oleracea is substantially composed of SEQ ID NO: 1.

A further object of the present invention is to provide a probe pair that specifically hybridizes to a high-preservation DNA fragment of an orange-naked umbrella, and a probe that specifically hybridizes to a DNA fragment between the hybridization positions of the individual primers of the primer pair. Specifically, the primer pair is a pair of ITS2 primers that specifically hybridize to the orange umbrella, which consists essentially of 5'- ttc taa tgg tet gga ttg ggg gtc-3' (SEQ ID NO: 7). An oligonucleotide sequence, and an oligonucleotide sequence consisting essentially of 5'- ege ate cca ttt aaa gca gac at -3' (SEQ ID NO: 8). According to the present invention, the probe of ITS2 which specifically hybridizes to the orange naked umbrella is an oligonucleoside consisting essentially of 5'-accggc taa tac att taa ggg gag ega t -3 SEQ ID NO: 9) Acid sequence. After the DNA is to be detected by the sample to be tested, PCR detection using the aforementioned primer pair or real-time PCR detection using the primer pair and the probe can specifically detect whether the sample is an orange naked umbrella or a component containing an orange nude umbrella. The present invention further provides 124497.doc -13 - 200928363 species comprising a high-preservation DNA fragment of an orange-naked umbrella that hybridizes to the primer pair of the present invention. According to the present invention, the sequence of the orange-naked umbrella highly-retaining DNA fragment consists essentially of SEQ ID NO: 2. A further object of the present invention is to provide a probe pair that specifically hybridizes to the Aegilops tausuiensis high-preserving DNA fragment, and a probe that specifically hybridizes to the DNA fragment between the hybridization positions of the individual primers of the aforementioned primer pair. In particular, the primer pair is a primer pair that specifically hybridizes to the T. 82 of E. acuminata.

别 not a nucleotide sequence consisting essentially of 5 - kiss taa eta ttt cca cct gtg cat g-3' (SEQ ID NChlO), and consists essentially of 5,_cct tca ate caa taC cat a_3' (SEQ ID N〇: n) The oligonucleotide sequence consisting of. According to the present invention, the probe which specifically hybridizes to E. aeruginosa ITS2 is a nucleotide sequence consisting essentially of 5,-ata gac acc tcg att tat aaa aac aaa agc (SEQ ID NO: 12) . After extracting DNA from the sample to be tested, the above primer pair is used for pcR detection or the probe is subjected to real-time PCR detection using the primer pair, and the test can be specifically detected whether the sample is O. sinensis or contains Euclidean amanita. The ingredients of the bacteria. The present invention further provides a reference substance comprising a highly retained DNA fragment of E. aurantia that hybridizes to the primer pair of the present invention. According to the present invention, the sequence of the highly retained DNA fragment of the Aegilops elegans consists essentially of SEQ ID N::3. The invention provides a method for quickly identifying and detecting individual specificity test primer pairs, specialized probes, instant pcR reaction test solution formulas and reaction programs for poisonous green mushroom, orange naked umbrella and E. aurantia, and constructs a method for constructing The reference material was used in the positive control group. Yang|J uses the present invention to carry out the identification test of poisonous green pleats, orange naked umbrellas and E. aurantia food poisoning cases or other events, and is more convenient than the traditional type i24497.doc 14 200928363 state and growth characteristics identification method. Faster, more precise, and not identifiable due to lack of integrity of the specimen. In addition, the reference material for the positive control group of the toxic green mushroom, the orange naked umbrella and the A. sinensis is developed by the present invention, and can be solved and preserved by the colonization or large-scale reproduction of the mushroom body. The problem. [Embodiment] Embodiments Example 1 Specific primer and probe design and test

First, the source of the food is generally purchased from the major supermarkets and traditional markets in the Greater Taipei area. The poisonous green pleated mushroom is taken from the food poisoning case of the Food and Drug Administration of the Executive Yuan Department of Health, and the orange naked umbrella and the European family. Amanita is provided by the Special Biological Research and Conservation Center of the Agricultural Committee of the Executive Yuan, as shown in Table 1. Table 1. Comparison of DNA species of scorpion species Chinese name Common name NCBI Registration number Chlorophyllum sinensis mushroom Chlorophyllum molybdites AF482836 Orange nude umbrella Orange scale umbrella Gymnopilus spectabilis AY281012 E. sinensis Aoberwinklerana Self-sequencing edible goose Paste Amanita esculenta AY436451 Grey Amanita Amanita vaginata AJ889925 Agaric abalone, oyster mushroom, oyster mushroom, Pleurotus ostreatus AY636055 Apricot mushroom almond abalone Pleurotus eryngii DQ333235 Pleurotus citrinopileatus AY540318 Brazil Grune Agaricus blazei AY484697 124497 .doc 15 200928363 Agaricus Agaricus bisporus AF432885 Columnar mushroom, Agrocybe acrocybe cylindracea AY168826 Dancing ear 'Grifola frondosa AY854084 White fungus Tremella, Snow fungus, Tremella fuciformis AF444316 Cup coral fungus Clavicorona pyxidata AF336150 Golden needle禝兹,金丝益,金兹Flammulina velutipes AY854073 小包脚菇草益, China, Guangdong mushroom Volvariella volvacea AY632077 Lentinus edodes U33092 Hericium erinaceus U33092 Hericium erinaceus, locust mushroom, broccoli mushroom, yin and yang mushroom, Hericium erinaceus DQ185928, Hongxi mushroom, white peony root, real jade, fake pine mushroom, pine mushroom, etc. Hypsizygus marmoreus HMA494835 Coprinus comatus, Coprinus comatus AY854066 Auricularia auricularia, Auricularia polytricha Q The sequence of the above-mentioned European Amanita is self-sequenced and its sequence is as follows:

CTTATTGATATGCTTAAGTTCAGCGGGTAATCCTACCTG

ATTTGAGGTCGATTTTATCATTTCTCTCATTACCAGCAA

AATGCTCCAAAATGTTCCCCCCTTTTTTCATTTCCTGGTG

ATCAATCAACTTTATCACACCAATAAAGGTTCATAATCA

GCTTTTTGCTAATCCATTTCAGGAGAGCTAGTCCAAATA

AAATATGAACCTGCATACTCCCATACTCCAAAACTACTT

TCCAAATCATACTTCAGATAGTAGTTTTTGACAATATAA

TGACACTCAAACAGGCATGCTCCAAGGAATACCAAGGA

GCGCAAGATGCGTTCAAACATTCGATGATTCACTGAATT 124497.doc 16 200928363

CTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTC

ATCGATGCGAGAGCCAAGAGATCCATTGTTGAAAGTTG

TACTTTTATTTCTTTATAATTATTCCACGTTCACAAATCA

TCCAATACCATAAAAGTGTAATAAAACATAGACACCTC

GATTTATAAAAACAAAAGCCACTAAAAAAAAACCTCTG

TTCCCTCAAATCCTAGGCATCTACACATCATGCACAGGT

GGAAATAGTTATCAAATAAGCAAGAGACGTGCACATGT

GTCACAATTAAAATGTCACCAGCAACAGCCTCAAGCCTT

TTTGTATTATTGATTTCAATAATGATCCTTCCGCAGGTTC

ACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAA

TGACCAAGTTTGATCAGCTTCTCAGCAACAGAATGCCGT

TGCCGGCTCTCCAATGCCAATCCGGAGACCTCACTAAGC

CATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAG

GGCAGG II. DNA extraction and purification kit DNeasy® Plant Mini Kit (Qiagen, Hilden, Germany). III. PCR primers, probes and reagents According to the invention, the laboratory has specific ITS2 design specific probes and specific probes for ITS1, Orange® naked umbrella and E. aurantium. two. It is also commissioned by TIB Molbiol (Berlin, Germany). The 5' end of the probe was labeled with 6-carboxy-fluorescein and the 3' end was labeled with 6-carboxytetramethyl-rhodamine. The PCR reaction was performed with a DNA polymerase kit (PROtech Technologies, Inc. Taiwan) reagent kit. The PCR reaction for gp was taken with LightCycler-FastStart DNA Master Hybridization Probes (Roche Applied Science, Mannheim, Germany) reagent kit 0 124497.doc 200928363 Table 2 Primers and probes used in this example

Primer/probe sequence numbering sequence S,-3, special-&fj; coiled phase iChlorophyllummolybdites) Chloro-F Chloro-R Chloro-P SEQ ID NO:4 TgA ggg gTC TgA gAg AgT ITS /sense ggCTg ITS/ Antisense 81 SEQ ID NO: 5 AgAAgAgAgCCgTgCTTT ITS/antisense CACACT SEQ ID NO: 6 FAM-TCCTCACATCCgggA gAATTC CCg AC-TAMRA (Gymnopilus spectabilis') GY-F GY-R GY-P SEQ ID NO: 7 TTC TAA Tgg TCT ggA ITS /sense TTg ggg gTC ITS/antisense 131 SEQ ID NO: 8 CgC ATC CCA TTT AAA ITS/antisense gCA gAC AT SEQ ID NO: 9 FAM-ACC ggC TAATAC ATT TAA ggg gAg CgAT-TMR defeated male (Amanita) VAginata) Amantia-F Amantia-R Amantia-P SEQ ID NO: 10 TgA TAA CTA TTT CCA ITS/sense CCTgTgCATg ITS/antisense 143 SEQ ID NO: 11 CCT TCA CAA ATC ATC ITS/antisense CAATAC CAT A SEQ ID NO: 12 FAM-ATA gAC ACC TCg ATT TAT AAA AAC AAA AgC CAC-TMR ¥ Primer for reference plastid Amantia-FC Amantia-RC SEQ ID NO: 13 AATgggATg CgTgAT ITS /sense AAC TAT TTC ITS/antisense 174 SEQ ID NO: 14 TCAgAC CCCTCAggT TCACAAATCAT IV. Instrumentation PCR The reactor, type: ABI PRISM 9700 Sequence

Detector (Applied Biosystems, USA). That is, the time PCR reactor, model: LightCycler (Roche Applied Science, Mannheim, Germany) ° 124497.doc • 18 - 200928363 V. Detection method (1) Conditions of PCR reaction PCR reaction solution: 10 times PCR buffer solution.. ......................................5.0 μί

25 mM MgC12............................................... 4.0 pL

AmpliTaq DNA polymerase (5U/pL)................1 μί 2.5 mM dNTP.................... ...............................4 μΙ> 5 μΜ Introduction F ............ ......................................4 μί

5 μΜ primer R ............................................. ....4 pL template DNA (total 100 ng)..............................5.0 μί Sterile Pure water................................................ .......23 μί

total capacity................................................ ........50.0 pL PCR conditions:

Step Temperature Time 1. Initial denaturation 94 °C 5 min 2. Denaturation 94 °C 30 sec 3. Adhesion 60 °C 30 sec 4. Extension 72 °C 30 sec Step 2 to Step 4, a total of 35 cycles of reaction. 5. Final extension 72〇C 7 min Cool 4°C (2) Instant PCR-Roche Light Cycler Real-time PCR reaction solution: 124497.doc -19- 200928363

Master mix................................................ ...2.0 μί 25.mM MgCl2:.......................................... .....2.4 μΕ 5.0 μΜIntroduction F....................................... ......... 1.5 μί

5.0 μΜIntroduction R................................................ 1.5 pL • 3.3 pMTaqmqn probe.....................................1.5 μί

Template DNA (total lOOng)....................................5.0 pL Sterile pure water... .................................................6.1 Μΐ, total volume................................................ .........20.0 μί

Real-time PCR conditions: Step_Temperature Time 1. Initial denaturation _95jC_7min 2. Denaturation _95jC_7 sec 3. Bonding _60jC_8sec 4. Extension __72jC_15sec _Step 2 to Step 4, a total of 45 cycles of reaction. _ 5. Cooling _40jC_40sec ❹ VI. Test results PCR detection was performed on the toxic green mushroom specific primer pair. In all the tested mushrooms, only the toxic green mushroom showed PCR amplification products (Fig. 1). The real-time PCR detection of the toxic green mushroom specific primer pair and the probe was carried out. Only the toxic green mushroom in all the tested mushrooms showed an immediate PCR fluorescence amplification curve (Fig. 2), and the detection limit was 0.01% (Fig. 3). . The PCR was detected by the orange-naked umbrella specific primer pair, and only the orange naked umbrella showed PCR amplification products in all the tested mushrooms (Fig. 4). With orange yellow umbrella special 124497.doc •20- 200928363 sexual primer pair and probe for real-time PCR detection, all test stupid only orange yellow umbrella appeared real-time PCR fluorescence amplification curve (circle 5), detection limit can reach 0.001 %(Figure 6). PCR was performed using the E. sinensis specific primer pair. In all of the tested mushrooms, only the E. agarensis showed a PCR amplification product (Fig. 7). Real-time PCR detection was performed with Euclidean crane paste and bacteria-specific primer pairs and probes. Only the E. aurantiacus showed an instantaneous PCR fluorescence amplification curve (Fig. 8), and the detection limit was 0.001%.圊9). Example 2 Construction and Testing of Reference Materials I. Construction of reference plastids

According to the present invention, the reference plastid of the specific DNA fragment of the toxic green pleats, the orange naked umbrella and the E. grisea species is constructed, and the specific DNA fragment of the toxic green scorpion species selected in the scorpion is specific to the toxic green syllabus. The primer pair (seq m ΝΟ·4 and SEQ ID NO: 5) was subjected to the pCR toxic green pleats ITSkpCR amplification fragment (hereinafter referred to as the green (four) cloning fragment); the selected orange-yellow cynomolgus species specific DNA fragment was orange A pair of naked umbrella-specific primer pairs (SEQ ID NO: 7 and SEQ ID N: 8) were subjected to pcR to the pcR of the orange-naked umbrella m2 (hereinafter referred to as the orange-necked umbrella), and the selected Euclidean The special DNA fragment of the genus Helicover is a pair of E. acuminata-specific primers. (IV) 〇ID ΝΟ: 1〇 and SEQ ID N0.li,, n〇n υ.1 1) Entering the pCR of the Euclidean Goose PCR amplification fragment of Pasteurella ITS2 (hereinafter referred to as K. amanita selection). This laboratory design builds the reference plastid

Negative Zhao uses tailed primers SEQ ID NO: 13 and SEQ ID NO: i4, as shown in Table 2. The construction steps are as follows: 124497.doc 200928363 (I) Copying the amplified construct fragment (first PCR, see Figure 10) 1. Using the above-mentioned clostridium cultivar selection as template, primer pair SEQ ID NO: 4 and SEQ ID NO: 5 PCR was carried out (conditions of PCR reaction and PCR conditions were the same as in Example 1). 2. PCR was carried out on SEQ ID NO: 7 and SEQ ID NO: 8 using the primers selected from the above-mentioned orange naked umbrella as a template (the conditions of PCR reaction and PCR conditions are the same as in Example 1). 3. PCR was carried out on the SEQ ID NO: 13 and SEQ ID NO: 14 using the primers selected from the above A. rugulosa. The conditions of the PCR reaction and the PCR conditions were the same as in the first example. (2) Cloning of the cloning fragment (second PCR, see Figure 10) PCR of the SEQ ID NO: 7 and SEQ ID NO: 5 using the PCR amplification product of step (1) as a template (PCR reaction) The conditions and PCR conditions are the same as in the first embodiment, and a PCR-amplified DNA fragment ligating the above three cloning fragments can be obtained, and the order is orange-orange - umbrella-Euclidean botulinum-toxic green slightly. (iii) Building a reference plastid (see Figure 10)

The orange-naked umbrella of the second step of the second step - the E. sinensis - toxic green mushroom PCR amplification DNA fragment is recovered and purified, using TOPO TA

The Cloning (Invitrogen Corporation, Carlsbad, California, USA) kit performs reference plastid construction, the steps of which are performed in accordance with the set of procedures. 2. Confirmation of constructing the reference plastid (see Figure Π) Send the reference plastid to the DN A sequence, and the sequence is compared to confirm the reference quality 124497.doc -22- 200928363 The body does cover the poisonous green pleats itS1, the orange naked umbrella ITS2 And a DNA fragment of E. sinensis 1TS2. BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a PCR specificity test of a pair of primers for detecting toxic green mushroom of the present invention; Μ is a molecular marker; the second channel is a mushroom; the second channel is a mushroom; the third channel is abalone I The fourth track is fungus; the fifth lane is white fungus; the sixth lane is mushroom; the seventh is the chicken leg mushroom; the eighth is the monkey mushroom; the 9th is the coral mushroom; the second is the Hongxi mushroom; u road is poisonous green mushroom; the 12th road is Brazilian mushroom; the 13th road is small Baoji mushroom; the 14th road is columnar Tiantou mushroom; The road is a negative control group. "" Fig. 2 is a real-time specific test of the primer pair and the probe for detecting the poisonous green mushroom of the present invention. Fig. 3 is a view showing the instantaneous detection limit of the primer pair and the probe for detecting the poisonous green mushroom of the present invention. Figure 4 is a primer specific test for the detection of orange naked umbrella of the present invention; % is a sub-scorpion mark; the first track: true oyster mushroom; the second track: oyster mushroom; the third track: grass benefit; the fourth track · wolf Heads; 5th: Brazil Mills; 6th: Willow Mushrooms; 7th: Pleurotus eryngii; 8th: Flammulina; 9th: Maitake; 1st Road: Hongxiz; 11 Road: Bai Zi; 12th Road: Xiangzi; 13th Road: White Mushroom; 14th Road • Mushroom; 15th Road: Snow Ear; 16th Road: Fungus, 17th Road: Coral Mushroom; 18th Road · · Poisonous green lobster; 19th · Orange 稞 umbrella; 20th: Euclidean amanita; 21st: negative control group. Figure 5 is a specific test of a TaqMan probe for the detection of orange naked umbrellas of the present invention. J24497.doc -23- 200928363 Figure 6 shows the detection limit of the TaqMan probe used for the detection of orange naked umbrella. Figure 7 is a primer specific test for the detection of E. grisea in the present invention; ^ is a molecular marker; the first lane: true Jiyi; the second lane: Xiuzhen μ; the third lane: grass; fourth lane: wolf Heads; 5th: Brazil Moz; "Tao: Liu &H; 7th: Apricot Baoji; 8th: Jinzhengyi; 9th: Wurong; 10th: Hongxi Mushroom; No. 11: White mushroom; No. 12: Shiitake; No. 13: ❹ Meibaiyi; No. 14: Artichoke; No. 15: Snow ear; No. 16: Fungus; No. 17: Coral mushroom; Road: Poisonous green mushroom; No. 19: orange naked umbrella, No. 20: E. agarensis; No. 21: Negative control group. Figure 8 is the specificity of TaqMan probe for detection of E. aurantia in the present invention. Figure 9 shows the detection limit of the TaqMan probe for the detection of E. acuminata according to the present invention. Figure 10 is a diagram of the orange-naked umbrella, E. acuminata and φ toxic green mushroom species of the reference plastid of the present invention. Specific DNA fragment sequence. Figure 11 is a flow chart of constructing a reference plastid of the present invention. 124497.doc 24· 200928363 Sequence Listing <110> Administration Department Department of Health Food and Drug Inspection <120> The detection method <130> 124497 <140><141> 2007-12-20 <160> ❹ 14 <170> Patentln version 3.3 <210><211><212><213> 1 81 DNA Chlorophyllum molybdites < 400 > 1 tgaggggtct gagagagtgg ctgacttgtc gggaattctc ccggatgtga ggactgcagt gtgaaagcac ggctctcttc t G < 210 > < 211 > < 212 > < 213 > 2 141 DNA Gymnopilus spectabilis < 400 2 ttctaatggt ctggattggg ggtctttgct ggtttcgcaa gaaatcgctc Cccttaaatg tattagccgg tgccctacgt ggactgtcta ctggtgtgat aattatctac gccgttagat gtctgcttta aatgggatgc g 124497-sequence table.doc 200928363 <210> 3 <211> 143

<212> DNA <213> Amanita virosa <400> 3 tgataactat ttccacctgt gcatgatgtg tagatgccta ggatttgagg gaacagaggt ttttttttag tggcttttgt ttttataaat cgaggtgtct atgttttatt acacttttta 120 tggtattgga tgatttgtga acc 〇<210> 4 <211> 23 <212>DNA <213>Labor<220><223> Intro <400> 4 tgaggggtct gagagagtgg ctg

<210> 5 <211> 24 <212>DNA <213> Labor <220><223> Introduction <400> 5 agaagagagc cgtgctttca cact <210> 6 124497 - Sequence Listing.doc 200928363 <;211> 26 <212>DNA<213>manual<220><223>probe<400> 6 tcctcacatc cgggagaatt cccgac <210> 7 <211>

〇 <212>DNA <213> Labor <220><223> Introduction <400> 7 ttctaatggt ctggattggg ggtc

<210> 8 <211> 23 <212> DNA <213> Labor <220><223> Introduction <400> 8 cgcatcccat ttaaagcaga cat <210> 9 <211> 28 <212 〉 DNA 124497- Sequence Listing.doc 200928363 <213>Labor<220><223>Probe<400> 9 accggctaat acatttaagg ggagcgat <210> 10 <211> 25 <212>DNA <213> Artificial

<220><223> Introduction <400> 10 tgataactat ttccacctgt gcatg <210> 11 <211> 25 <212>DN A <213>manual<220><223> Introduction <400 〉 11 ccttcacaaa tcatccaata ccata <210> 12 <211> 33 <212>DN A <213> Artificial 124497 - Sequence Listing.doc 200928363 <220><223> Probe <400> 12 atagacacct cgatttataa Aaacaaaagc cac ' <210>13 <211> 24

' <212>DNA <213>Artificial 〇 <220〉 <223> Primer <400> 13 aatgggatgc gtgataacta tttc <210> 14 <211> 26 <212>DNA <213>

<220><223> primer <400> 14 tcagacccct caggttcaca aatcat 124497-sequence table.doc

Claims (1)

200928363 X 1. Patent application scope: A reference material, which includes a highly-retained DNA fragment of the poisonous green mushroom, a highly preserved DNA fragment of the orange-naked umbrella, and a highly-retained DNA fragment of E. aurantia. 2. For the reference substance of claim 1, the highly retained DNA fragment of the poisonous green mushroom is selected from the group consisting of the mitochondrial mtDNA fragment of A. sinensis, the subunit gene of ATP synthase, and NADH. Each subunit gene of hydrogenase, cytochrome b gene, 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 and ITS2. 3. For the reference substance of claim 1, the highly preserved DNA fragment of the poisonous green mushroom is selected from the group consisting of 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 and ITS2. 4. For the reference substance of claim 1, the highly retained DNA fragment of the poisonous green mushroom is ITS 1. 5. The reference substance of claim 1, wherein the height of the toxic green mushroom retains DNA 〇 6. 7. The sequence of the fragment consists essentially of SEQ ID NO. The reference material of claim 1, wherein the highly preserved DNA fragment of the orange naked umbrella is selected from the group consisting of a mitochondrial mtDNA fragment of an orange naked umbrella, each subunit gene of ATP synthase, and NADH dehydrogenase. Unit gene, cytochrome b gene, 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 and ITS2. The reference material of claim 1, wherein the highly preserved DNA fragment of the orange naked umbrella is selected from the group consisting of: 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 and ITS2. 124497.doc 200928363 8. The reference plastid of the request item ’ where the height of the orange naked umbrella retains the DNA fragment as ITS2. 9. The reference substance of claim 1, wherein the sequence of the highly preserved DNA fragment of the orange naked umbrella consists essentially of SEQ ID NO: 2. · 10. If the reference substance is requested, the highly retained DNA fragment of A. sinensis is selected from the group consisting of the mitochondrial mtDNA fragment of A. sinensis and the subunit gene of ATP synthase. , NADH dehydrogenase _ each subunit gene, cytochrome b gene, 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 and ITS2. Ϊ́ι·, as the reference substance of claim 1, wherein the highly retained DNA fragment of A. sinensis is selected from the group consisting of the mitochondrial 18S rDNA, 5.8S rDNA, 28S rDNA, IGS, ITS1 And ITS2. I2. The reference material of claim 1, wherein the highly retained DNA fragment of E. sinensis is ITS2. 13. A reference substance as claimed in the claims, wherein the sequence of the Aegilops tauschii 保留 DNA fragment consists essentially of SEQ ID NO: 3. Μ. A specific pair of hybrids to the toxic green mushroom, the primer pair, consisting essentially of 5,-tga ggg gtc tga gag agt ggc tg-3' (SEQ ID ΝΟ:4) and permeabilized An oligonucleotide sequence consisting of 5, _aga aga gag CCg tgc ttt cac act -3' (SEQ ID NO: 5). 1 5. A probe for ITS 1 that specifically hybridizes to toxic green mushroom, which is An oligonucleotide sequence consisting essentially of 5 -tcc tea cat ccg gga gaa ttc ccg ac -3, (SEQ ID NO: 6) 16. A reference material comprising a hybrid to the primer pair of claim 14 Toxic green I24497.doc 200928363 The height of the pleated mushroom retains the DNA fragment. 17. The reference material of claim 16, wherein the sequence of the highly retained DNA fragment consists essentially of SEQ ID ΝΟ: 1. 18. - Specific hybridization to The pair of ITS2 primers of the orange naked umbrella, which are essentially composed of 5'- ttc taa tgg tct gga ttg ggg gtc-3' (SEQ ID NO: 7) and substantially consist of 5'-cgc ate cca ttt aaa gca An oligonucleotide sequence consisting of gac at -3' (SEQ ID NO: 8). 19. A probe for ITS2 that specifically hybridizes to an orange umbrella, which is An oligonucleotide sequence consisting of 5'-acc ggc taa tac att taa ggg gag ega t -3' (SEQ ID NO: 9) 20. A reference substance comprising a primer pairing with claim 18 The height of the orange-naked umbrella retains the DNA fragment. 21. The reference material of claim 20, wherein the sequence of the highly-retained DNA fragment consists essentially of SEQ ID NO: 2. 22. - Specificity hybridization to Euclidean amanita a pair of ITS2 primers, which consist essentially of 5', tga taa eta ttt cca cct gtg cat g-3' (SEQ ID NO: 10) and consist essentially of 5'-cct tea ca ate ate caa tac An oligonucleotide sequence consisting of cat a-3' (SEQ ID NO: ll) 23. A probe that specifically hybridizes to E. aurantia ITS2, which is essentially ^ 5'-ata gac acc teg att tat Oligonucleotide sequence consisting of aaa aac aaa age cac-3' (SEQ ID NO: 12). 24. A reference material comprising a highly retained DNA fragment of E. aurantia that hybridizes to the primer pair of claim 22. 25. The reference substance of claim 24, wherein the sequence of the highly retained DNA fragment consists essentially of SEQ ID NO:3. 124497.doc