CN103555850B - Specific primer, kit and method for detecting Lonsdalea quercina subsp.populi - Google Patents
Specific primer, kit and method for detecting Lonsdalea quercina subsp.populi Download PDFInfo
- Publication number
- CN103555850B CN103555850B CN201310556831.2A CN201310556831A CN103555850B CN 103555850 B CN103555850 B CN 103555850B CN 201310556831 A CN201310556831 A CN 201310556831A CN 103555850 B CN103555850 B CN 103555850B
- Authority
- CN
- China
- Prior art keywords
- primer
- european
- populi
- pcr amplification
- specific primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific primer for detecting Lonsdalea quercina subsp.populi. The specific primer consists of a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is CTCTGCTAAATCGGGGACGG; the nucleotide sequence of the reverse primer is CACGAGCTTTCTTCTCGTCC. The invention also provides a kit based on the specific primer and a method for detecting the Lonsdalea quercina subsp.populi through the specific primer. The specific primer, the kit and the method have the advantages of high accuracy and high sensitivity, are capable of quickly and easily judging whether the Lonsdalea quercina subsp.populi exists in a sample, and provide an effective way for field investigation and disease monitoring of Populus euramericana canker disease.
Description
Technical field
The present invention relates to phytopathogen detection field, particularly, the present invention relates to a kind of Auele Specific Primer, test kit and method for detecting European-American Poplar Peptic Ulcers germ.
Background technology
European-American Poplar Pathogenic Fungus of Canker is accredited as Lonsdalea quercina subsp.populi by analysis, and belonging to subspecies of L.quercina, be new record Species and subspecies, and the European-American Poplar Peptic Ulcers caused by it is new forest-crop disease in China in China.This germ only has report in China and Hungary at present, and other country has no report.European-American Poplar kind 107 poplar that this disease is extensively cultivated in China Henan, partial area, Shandong and Poplar Zhonglin-46 generally occur, sickness rate is generally 10 ~ 30%, the standing forest diseased plant rate that disease is serious reaches more than 70%, susceptible trees produce a large amount of bleeding, loss trees nutrient, makes the trees volume of timber and other that part can be utilized to reduce; Meanwhile, due to phloem local necrosis, cause disease portion limb and die ack, having a strong impact on the healthy growth of trees, even cause death.This disease has more now completely healthy European-American Poplar standing forest, cannot according to first year disease a situation arises judging disease in the coming year.And disease is once occur, be difficult to again control.Therefore, carry out early detection to pathogenic bacteria, and take corresponding measure controlling disease to occur, the control for disease is most important.
Often there is a lot of miscellaneous bacteria in bacterial isolate bacterium from the diseased tissues of this disease according to a conventional method, affects the accurate separation of pathogenic bacteria.Meanwhile, this germ and other bacteriums cannot be made a distinction according to form.Therefore, conventional disease screening technology is difficult to make qualification to the pathogenic bacteria of this disease rapidly and accurately.So set up the detection technique of European-American Poplar Pathogenic Fungus of Canker, especially early stage Fast Detection Technique is particularly important and urgent.
Summary of the invention
The object of the present invention is to provide a kind of Auele Specific Primer detected for European-American Poplar ulcer bacteria Lonsdalea quercina subsp.populi PCR, adopt this primer can carry out early detection to European-American Poplar Pathogenic Fungus of Canker, detection specificity is strong, highly sensitive, easy handling, reliable results.
For achieving the above object, present invention employs following technical scheme:
The present invention is by analyzing on the basis of European-American Poplar ulcer bacteria infB gene order, and devise Auele Specific Primer, described Auele Specific Primer is made up of forward primer and reverse primer, and its nucleotide sequence is as shown in sequence table SEQ ID NO1/SEQ ID NO2:
The nucleotide sequence (SEQ ID NO1) of forward primer is: CTCTGCTAAATCGGGGACGG; The nucleotide sequence (SEQ ID NO2) of reverse primer is: CACGAGCTTTCTTCTCGTCC.
The present invention also provides a kind of test kit for European-American Poplar ulcer bacteria Lonsdalea quercina subsp.populi, and described test kit comprises above-mentioned primer.Described test kit can also comprise PCR reaction kit.PCR reaction kit can obtain from commercial channels, also can oneself configuration.
The present invention still further provides a kind of method detecting European-American Poplar ulcer bacteria Lonsdalea quercina subsp.populi, and described method comprises the steps:
1) picking test strains bacterium colony or extraction test strains genomic dna are as pcr amplification template, adopt above-mentioned primer to carry out pcr amplification;
2) agarose gel electrophoresis analysis is carried out to the product of pcr amplification.
The amplification system of PCR reaction is 20 μ l, and reaction system is: 2 × NI-Taq PCR MasterMix 10.0 μ l, test strains genomic dna 1.0 μ l, 10 μMs/L primer (SEQ ID NO1/SEQ ID NO2) each 1 μ l, ddH
2o 7.0 μ l.
In the above-mentioned methods, when picking test strains bacterium colony is as pcr amplification template, the condition of pcr amplification is 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 30-35 circulation; Last 72 DEG C extend 6min.
In the above-mentioned methods, when extracting test strains genomic dna as pcr amplification template, the condition of pcr amplification is: 94 DEG C of denaturation 3min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 30-35 circulation; Last 72 DEG C extend 6min.
In the above-mentioned methods, the concentration of sepharose is 1 ~ 1.5%(g/mL), the voltage of agarose gel electrophoresis is 4 ~ 6v/cm, and the agarose gel electrophoresis specific band of European-American Poplar ulcer bacteria bacterial strain appears at 341bp place.
The present invention utilizes bioinformation and Biological Knowledge, screened by series of experiments, find that infB gene has and other bacterium difference specific position, and utilize this specific site to design and filter out corresponding primer, utilize this to primer pair Brenneria quercina ATCC29281, Lonsdalea quercina subsp.iberica LMG26264, Lonsdalea quercina subsp.britannica LMG26267 tri-strain reference culture and other bacterium totally 47 bacterial strains carry out specificity verification.Test-results shows, this primer can only obtain the band of 341bp from European-American Poplar ulcer bacteria bacterial strain.Other bacterial strain, particularly three strains and the very approximate reference culture of European-American Poplar Peptic Ulcers germ are without band.Utilize the European-American Poplar ulcer bacteria bacterial strain in this primer pair different sources area all can obtain the band of 341bp, show that this specific position of this gene is suitable as the specific position of European-American Poplar ulcer bacteria Molecular Detection, the Auele Specific Primer based on this site can carry out diagnosis and detection exactly to European-American Poplar Peptic Ulcers.
Detection method accuracy is high, highly sensitive, and whether it quickly and easily can exist European-American Poplar ulcer bacteria in judgement sample, and be the field investigation of European-American Poplar Peptic Ulcers, disease monitoring provides effective means.
The present invention can detect pathogenic bacteria fast, accurately, easily from Tissues of Poplar Clones.European-American Poplar cultivation wide scope, the possibility infected by Peptic Ulcers pathogenetic bacteria is very large, and application the present invention carries out early detection to pathogenic bacteria, provides important foundation, production has a wide range of applications for controlling European-American Poplar Peptic Ulcers.
Accompanying drawing explanation
Fig. 1 is the experimental result that the present invention detects European-American Poplar ulcer bacteria;
Fig. 2 is the sensitivity experiment result of detection method;
Fig. 3 is the detected result of the present invention to European-American Poplar Poplar Zhonglin-46 plant tissue.
Embodiment
With the drawings and specific embodiments, the present invention is further detailed explanation below.
One, design of primers and synthesis
The design of Auele Specific Primer SEQ ID NO1/SEQ ID NO2: analysis is compared to the infB gene order in the infB gene of the European-American Poplar ulcer bacteria in GenBank and other subspecies of Lonsdalea quercina and other sibling species, devises a pair Auele Specific Primer SEQ ID NO1/SEQ ID NO2.
Primer its specificity of BLAST analysis verification in GenBank again of design.
All primers entrust Tian Yihuiyuan bio tech ltd, Beijing to synthesize.
SEQ ID NO1：CTCTGCTAAATCGGGGACGG
SEQ ID NO2：CACGAGCTTTCTTCTCGTCC
Two, the foundation of PCR amplification method
1, PCR reaction system
PCR reaction system is 20 μ l, and reaction system is: 2 × NI-Taq PCR MasterMix 10.0 μ l, bacterium colony or plant genome DNA 1.0 μ l, 10 μMs/L primer (SEQ ID NO1/SEQ ID NO2) each 1 μ l, ddH
2o 7.0 μ l.
2, PCR reaction conditions
When picking test strains bacterium colony is as pcr amplification template, the condition of pcr amplification is 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 30 ~ 35 circulations; Last 72 DEG C extend 6min.
Extraction test strains genomic dna or plant tissue DNA are as pcr amplification template, and the condition of pcr amplification is: 94 DEG C of denaturation 3min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 30-35 circulation; Last 72 DEG C extend 6min.
Three, the specificity of European-American Poplar ulcer bacteria PCR method is determined
As shown in Figure 1, the Lonsdalea quercina subsp.populi bacterial strain preserved with 7 strains, for template, carries out pcr amplification detection, M:Marker DL100 in Fig. 1; 1-7 is respectively the European-American Poplar ulcer bacteria bacterial strain deriving from Beijing Forestry University's Forest Cultivation and the preservation of Protection room, and numbering is respectively N-5-1,4-4, A2210, A2213, A2223, BX001, BZ004, and 8 is blank.Result shows, all L.quercina subsp.populi(7 strain European-American Poplar Peptic Ulcers germs) all amplify band at 341bp place, blank, without band, illustrates that the method can detect all European-American Poplar ulcer bacterias collected.
Positive control is organized as with 7 bacterial strains N-5-1,4-4, A2210, A2213, A2223, BX001, BZ004 of European-American Poplar ulcer bacteria Lonsdalea quercina subsp.populi with the European-American Poplar of germ inoculation, belong to not of the same race with the different subspecies of the Lonsdalea quercina collected, Brenneria, and other different bacterial strain of participating in the experiment (specifically in table 1) belonged to carries out pcr amplification for template.
Table 1 is for screening the bacterial strain of primer specificity
Note: "+" represents electrophoresis amplification band; "-" represents electrophoresis amplification without band.
Result shows, only has positive control to have amplified band, and all the other demonstrate the specificity of this detection method all without amplified band.
Four, sensitivity experiment
Be 3.2 × 10 by concentration
7, 3.2 × 10
6, 3.2 × 10
5, 3.2 × 10
4, 3.2 × 10
3, 3.2 × 10
2, 3.2 × 10,3.2 × 10
0cfu/mL8 concentration gradient, as shown in Figure 2, M:Marker DL100 in Fig. 2,1 ~ 8 is respectively result: 3.2 × 10
7, 3.2 × 10
6, 3.2 × 10
5, 3.2 × 10
4, 3.2 × 10
3, 3.2 × 10
2, 3.2 × 10,3.2 × 10
0cfu/mL, 9: blank, result shows, and 3.2 × 10
3more than cfu/mL concentration all can be observed electrophoretic band.Through converting, this detection method lowest detectable limit is approximately 50 bacterial cells.
Five, the application experiment of European-American Poplar ulcer bacteria PCR method
1, plant genome DNA extract: add 1ml CTAB after liquid nitrogen grind away, 100 μ l10%SDS, water-soluble 60 DEG C 40 ~ 50 minutes.13000rpm is centrifugal, and 10min gets supernatant, and 800 μ l are in another centrifuge tube.Add the centrifugal 10min of equal-volume chloroform 13000rpm, get supernatant 400 μ l in another centrifuge tube.Add equal-volume primary isoamyl alcohol, leave standstill 4 DEG C of centrifugal 10min of 20min, 13000rpm, abandon supernatant, add 800 μ l75% alcohol, the centrifugal 3min of 13000rpm, abandons liquid, and the centrifugal 3min of 13000rpm, abandons liquid.Dry to alcohol-free taste, add 20 μ l ~ 40 μ lTE solution, be kept at-20 DEG C.
2, with inoculate European-American Poplar ulcer bacteria and the plant tissue STb gene of reveal any symptoms for template, be organized as contrast with health plant, result as shown in Figure 3, M:Marker DL100 in Fig. 3; After the germ inoculation European-American Poplar that 1-3 is separated by N-5-1 bacterial strain and 2 Puyang oilfield of Henan from morbidity bark tissue the amplified band of extraction DNA; 4 is the DNA that healthy European-American Poplar bark tissue extracts; 5 is blank, found that the plant tissue of inoculation pathogenic bacteria can be observed target fragment, and normal healthy controls and the equal driftlessness fragment of blank.
Claims (8)
1. a species-specific primer, is characterized in that, described primer is made up of forward primer and reverse primer, and the nucleotides sequence of forward primer is classified as: CTCTGCTAAATCGGGGACGG; The nucleotides sequence of reverse primer is classified as: CACGAGCTTTCTTCTCGTCC;
Described primer is for detecting European-American Poplar ulcer bacteria
lonsdalea quercinasubsp.
populi.
2. one kind for detecting European-American Poplar ulcer bacteria
lonsdalea quercinasubsp.
populitest kit, it is characterized in that, described test kit comprises Auele Specific Primer according to claim 1.
3. Auele Specific Primer according to claim 1 is at detection European-American Poplar ulcer bacteria
lonsdalea quercinasubsp.
populiin application.
4. test kit according to claim 2 is at detection European-American Poplar ulcer bacteria
lonsdalea quercinasubsp
. populiin application.
5. one kind is detected European-American Poplar ulcer bacteria
lonsdalea quercinasubsp
. populimethod, said method comprising the steps of:
1) picking test strains bacterium colony or extraction test strains genomic dna are as pcr amplification template, adopt Auele Specific Primer described in claim 1 to carry out pcr amplification;
2) carry out agarose gel electrophoresis analysis to the product of pcr amplification, European-American Poplar Peptic Ulcers germ all can amplify the electrophoretic band of single 341bp.
6. method according to claim 5, is characterized in that, the amplification system of PCR reaction is 20 μ l, and reaction system is: 2 × NI-Taq PCR MasterMix 10.0 μ l, test strains genomic dna 1.0 μ l, 10 μMs/L primer each 1 μ l, ddH
2o 7.0 μ l, the concentration of sepharose is 1 ~ 1.5 g/100mL, and the voltage of agarose gel electrophoresis is 4 ~ 6v/cm.
7. the method according to claim 5 or 6, is characterized in that, when picking test strains bacterium colony is as pcr amplification template, the condition of pcr amplification is 94 DEG C of denaturation 5 min; 94 DEG C of sex change 30 s, 60 DEG C of annealing 30 s, 72 DEG C extend 1min, 30 ~ 35 circulations; Last 72 DEG C extend 6 min.
8. the method according to claim 5 or 6, is characterized in that, when extracting test strains genomic dna as pcr amplification template, the condition of pcr amplification is: 94 DEG C of denaturation 3 min; 94 DEG C of sex change 30 s, 60 DEG C of annealing 30 s, 72 DEG C extend 1min, 30 ~ 35 circulations; Last 72 DEG C extend 6 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310556831.2A CN103555850B (en) | 2013-11-11 | 2013-11-11 | Specific primer, kit and method for detecting Lonsdalea quercina subsp.populi |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310556831.2A CN103555850B (en) | 2013-11-11 | 2013-11-11 | Specific primer, kit and method for detecting Lonsdalea quercina subsp.populi |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103555850A CN103555850A (en) | 2014-02-05 |
| CN103555850B true CN103555850B (en) | 2015-05-20 |
Family
ID=50010193
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310556831.2A Expired - Fee Related CN103555850B (en) | 2013-11-11 | 2013-11-11 | Specific primer, kit and method for detecting Lonsdalea quercina subsp.populi |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103555850B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148232B (en) * | 2016-07-13 | 2019-06-11 | 北京林业大学 | The bacterium bacterial strain and its application of one plant of antagonism plant pathogenetic bacteria |
| CN109371110B (en) * | 2018-12-11 | 2020-06-09 | 山东农业大学 | LAMP (loop-mediated isothermal amplification) detection kit for bacterial canker pathogen of poplar |
| CN111041124B (en) * | 2020-01-09 | 2022-07-05 | 北京林业大学 | LAMP primer and kit for detecting Neofusicoccum algeriense |
| CN114058720B (en) * | 2021-11-18 | 2023-07-21 | 中国林业科学研究院森林生态环境与保护研究所 | Primer probe combination, kit and detection method for detecting Lonsdalea pathogenic bacteria and application of primer probe combination |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101935708B (en) * | 2010-09-08 | 2012-04-11 | 福建省农业科学院植物保护研究所 | Carambola bacterial spot pathogenic bacteria molecule detection primer and detection method thereof |
-
2013
- 2013-11-11 CN CN201310556831.2A patent/CN103555850B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN103555850A (en) | 2014-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| van der Merwe et al. | Pectobacterium carotovorum subsp. brasiliensis causing blackleg on potatoes in South Africa | |
| Engelbrecht et al. | Development of a nested quantitative real-time PCR for detecting Phytophthora cinnamomi in Persea americana rootstocks | |
| CN103555850B (en) | Specific primer, kit and method for detecting Lonsdalea quercina subsp.populi | |
| CN111534621A (en) | Primer and detection method for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of colletotrichum gloeosporioides | |
| CN102586469B (en) | Loop-mediated isothermal amplification (LAMP) primers for detecting Phytophthora capsici and kit comprising primers | |
| CN107299147A (en) | A kind of how main rod spore bacterium of Rapid identification is to the drug-fast method of fluopyram and special primer pair | |
| CN109868324A (en) | One species-specific primer and its detection method | |
| Singh et al. | Quick and accurate detection of Fusarium oxysporum f. sp. carthami in host tissue and soil using conventional and real-time PCR assay | |
| CN104232748B (en) | Whether a kind of red bayberry nursery stock carries the rapid molecular detection method of wilting germ | |
| CN100588716C (en) | Detection primer for banana wilt germina number-four biological strain and method for detecting same | |
| CN103388026A (en) | Phomopsis longicolla Hobbs detection target, PCR primer composition thereof and applications of the detection target and the PCR primer composition | |
| Ridgway et al. | Development of an isolate-specific marker for tracking Phaeomoniella chlamydospora infection in grapevines | |
| CN111850155A (en) | Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection | |
| Maes et al. | Brenneria salicis, the bacterium causing watermark disease in willow, resides as an endophyte in wood | |
| Sharma et al. | PCR based assay for the detection of Alternaria brassicicola in crucifers | |
| CN112522254B (en) | Molecular marker for detecting tomato bacterial wilt resistance locus Bwr12 and application | |
| Zhang et al. | Genetic diversity of endangered Polyporus umbellatus from China assessed using a sequence-related amplified polymorphism technique | |
| CN103882108B (en) | Method for detecting temperature sensitive microspecies gx2 of F.moniliforme | |
| CN109517911A (en) | The double PCR detection primer and detection method of melon bacterial Acidovorax avenae subsp and leaf spot fungi | |
| CN103451298B (en) | Kit for detecting physiological races of brussels sprouts wilt pathogens I and II and detection method thereof | |
| CN102181544B (en) | Molecular detection method for pisolithus tinctorius of forest ectomycorrhizal fungi | |
| CN103114140B (en) | Zoysia salt tolerance major gene site qLF-2 molecular marking method | |
| CN104032003A (en) | Method for quantitatively detecting ustilaginoidea virens from seed-borne and soil-borne media | |
| Kamau | Phenotypic and molecular characterization of Pectobacterium and Dickeya species associated with blackleg and soft rot of potato in Kenya | |
| CN103525833B (en) | Gene, method used for identifying pathogenicity of Verticillium dahliae and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: He Wei Inventor after: Shang Jing Inventor before: Shang Jing Inventor before: He Wei |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: SHANG JING HE WEI TO: HE WEI SHANG JING |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150520 Termination date: 20201111 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |