TW200401036A - Method of detecting base substitution - Google Patents

Abstract

A chimeric oligonucleotide primer and a probe useful in detecting a base substitution on a gene; a method of detecting a base substitution on a gene with the use of the chimeric oligonucleotide probe; and a kit therefor.

Description

200401036 发明, Description of the invention: [Technical field to which the invention belongs] — The present invention relates to the use of chimeric oligonucleotides for probes and probes useful for detecting base substitution on genes A method for detecting a base replacement on a gene of a primer and a set for the method. [Prior art] It is known that the genetic codes contained in the genomes of organisms belonging to the same species are not the same 'and that there are differences in the gastric polymorphic base sequence. Those who have deleted or inserted 1 to 10 bases in more than one aspect, and those whose specific base sequences have been repeated are known to A. Those who replace one base with other bases are called single base substitutions ( single nucleotide polymorphism (SNp). If the early test base replacement polytype exists in a ratio of several hundred test bases to 100 000 test bases, it can be estimated that there are 3 million to 10 million SNPs in the human genome. SNP has attracted attention in the exploration of disease-related genes, its correlation with disease, and as an indicator for detecting differences in drug formation φ and γ, and the effect (effect, side effect) of the drug, and its detection methods are also being studied. . Previous SNP detection methods were classified as those based on hybrids, those based on primer extension, or those using substrate specificity of enzymes. Hybridization method 'is a method of detecting the presence or absence of a base substitution by hybridization of a nucleic acid sample and a probe. The method must find probes and hybridization conditions that can affect hybridization by only i base differences, so it is difficult to construct a highly reproducible detection system. The previous method is, for example, a mutation detection method using a circulating probe reaction (for example, refer to U.S. Patent No. 5,660,988). In this method, a nucleic acid probe having a cleavable bond of 83954 200401036 is hybridized with a nucleic acid molecule as a purpose. When there is no base substitution in the target nucleic acid molecule, the probe is cracked, and when there is a base substitution, the probe is not cracked. Thereafter, the amount of free fragments from the cleavage probe is measured and quantified to detect the replacement of the test sample. However, in this method, when the target nucleic acid is in a trace amount, since the absolute amount of the cleavage of the probe is small, it takes a long time for the cleavage to reach a quantifiable and detectable level. Another method is, for example, a mutation detection method using the TaqMan method (for example, refer to U.S. Patent No. 5,21,015 or U.S. Patent No.). In this method, pass-through materials 4, a Y use additional photochromic pigments and matting agents (TaqMan of Queencher is not needle. For this probing, you use two types of base substitution and those without base substitution. The The main tweet of Faxi 4 is: * In order to hybridize the probe with the nucleic acid molecule for the purpose, if the primer is long from the upstream α, the inert heart of the nucleic acid knife that is not intended to replace the probe will allow the probe The needle will be decomposed by the y-3 endonuclease activity of the DNA polymerase, and the base will be replaced. However, the alkali λ- " 'is detected in the fluorescence of the second side, and there is the so-called "must use 5-3 nuclear驮 Internally twisted active polymer acid is used for PCR, and the end of the round must be blocked to identify the nucleosides. It takes time to adjust the temperature, and the time required to detect the required chemical species is long. 1 and As a method of using enzymes, these methods f have the method of using UNA polymerase first, and then the primers for which the base part is replaced by, for example, (1), and the 3 ends are stuck to the detection A method for detecting the substitution of base A by using the base extension substitution t t from the primer extension reaction (eg Refer to the United States and the United States .., the substitution of the base with the test base to be detected ^: its 1 Le 5,13 7,806); the position of the base of the replacement is located from 3, the second from the end of 83,854 200401036 A method for detecting primer substitution at the nucleotide of the nucleic acid and elongating the reaction from the primer (for example, refer to International Publication No. 01/42498 Publication No. Hiroki) uses 3 terminal bonds to adhere to the base to be detected. There is a method of determining primers on the base adjacent to the base 3 adjacent to the base and judging the test base included in the primer to determine whether there is a mutation in the target portion and its base. DNA ligase is also used. This method detects the base substitution by making the terminal portion of the probe correspond to the base portion of the base substitution to be detected, and then detecting whether or not to hybridize with a probe adjacent thereto. The above uses DNA polymerase and DNA ligase Method, it is impossible to correctly detect the mismatch caused by the base substitution between the primer or the probe and the target nucleic acid. That is, "even if the enzyme such as Λ is mismatched with the primer or the probe," it will start to react. And give the wrong result. In case of false positive caused by the adhesion error between the target nucleic acid and the primer and the error of the ligase or polymerase used, it is necessary to strictly control the reaction conditions, especially the reaction overflow, and there are problems with reproducibility. One can use methods such as the Invader method (for example, refer to U.S. Patent No. 846,7,17) and other methods that utilize enzymes that have the activity of recognizing and cutting the special structure of double-stranded nucleic acids. To do so Those who have not already done so can design probes that have a presence (or non-existence) test base, and that it will form a structure that can be used as a raw material, and that the probe is cut off. Replacement. However, the method of using the enzyme that recognizes and cleaves the activity of the special structure of the double-stranded nucleic acid has a problem in sensitivity. That is, because the squared nucleic acid generates a method for making sea bass, soil π, and Feng Daocheng, one of them, the method can not be used from a trace amount of nucleic acid sample 83954 200401036 / find enough to replace the iridium test base. Although it can enhance jealousy, L 5 Tiger. * Of course, repeating the probe cut-off reverse amplitude. That is to say, in order to obtain a strong signal, the target nucleic acid must be called in advance. In other words, in this method, the amount of radon that is squeaked by the probe is small, and it cannot reach a small amount. , Because the degree is quite time-consuming. This method of measuring the amount of the cut off has no way to detect when the target nucleic acid is in a trace amount: Γ It is performed under strict temperature management conditions, and the connection of nucleic acids must be closely controlled, w 3 vm K 帛 has special enzymes for testing 敎, so the company is looking for a method to detect the replacement of test bases. Amylin (amylin, pancreatic islets; gluten meal protein; also known as islet starch & (_ΜΑΡΡ)), has been isolated and has been identified as indwelling in diarrhea (also known as insulin Non-dependent diabetes mellitus) The main physiological constituents of starch, such as pancreatic islets, are specifically expressed in pancreatic cells and can be secreted into the blood together with insulin (for example, With reference to Westermark P et al, PrOc Nati. Acad

Sci. USA, 84, 3881 to 3885 (1987) or Cooper G. J. S. et al., Proc. Natl. Acad · Sci. USA, 84, 8628 to 8632 (1987)). In patients with type 2 diabetes, the association of amyloid and type 2 diabetes has been noticed due to high-frequency observation of Dianfen powder deposition in the pancreatic islets. The complete sequence of amylin has been determined, and the gene has been reported to exist in the short arm ρ12.3. Of chromosome 12 (see, for example, Nishi M. et al. Mol. Endocrinol "3, 1775 ~ 1781 (1989)). In 2 In patients with type 2 diabetes, an ambiguous variant in which serine (AGC) at position 20 of the amyloid insoluble gene has been replaced with glycine (GGC) has been reported (see, for example, 83954 200401036. ¾ Sakagashira S. et al, Diabetes , 45, 1279-1281 (1996)) 〇 This mutation has been reported among Japanese, Chinese, Taiwan, Hong Kong, and Korean, but has not been reported among white people. The method for detecting this genetic mutation is to include the mutation The area of the part was amplified by PCR. The obtained amplified product was treated with the restriction enzyme Msp I, and then the amplified product was checked by cyclolipose gel electrophoresis to see if it was broken down (for example, according to Sakagashira s et al., Diabeks, C, 1279 ~ 1281 (1996)). As mentioned above, although there is a suggestion of the association between the starch insolubilin gene mutation and type 2 diabetes, there is no effective method for detecting the gene mutation. Aldehyde dehydrogenase (ALDH) is an acetaldehyde An enzyme that oxidizes to acetic acid. In the study, ALDH contains a plurality of isozymes, and their distribution in each tissue is different (for example, see Harada s. Et al, Life Science, 26, i 773 ~ i78〇 (1980)). Among them, 'ALDH2 mainly exists in The liver has a function as an alcohol metabolism enzyme. ALDH2 uses electrophoresis of liver extracts to find polymorphs such as active proteins and inactive proteins (for example, see Harada S. et al_, Am. J. Hum Genet · ' 3 2 '8 ~ 15 (1980))' But do not understand the relationship between this and alcohol tolerance (for example, refer to Harada S. et al., Lancet II, 982 (1981)). The sequence of the king of ALDH2 is well known, It has been reported that the glutamic acid (GAA) of exon u has been replaced by a missense variant of lysine (AAA). For example, refer to Para. &A; et al., Proc. Natl. Acad. Sci. USA, 8 1, 258-261 (1984). This mutation is endemic to the yellow race and has not been reported among Caucasians or Negro. As a method of detecting this genetic mutation, allele homology has been reported. Introduction_pcR method (for example, refer to Harada Koji, et al., Alcohol substitution 83954 -10- thanks to the liver '10, 1 ~ 5 (1 98 8))' restricted fragment Of polymorph (RFLP) method (see, for example Harada S. et al. Alcohol Alcohol ·, 28,11-13 (1993)), and PCR-SSCP (PCR- single strand conformational polymorphism changes shape) method (refer to e.g.

Harada S. et al. Alcohol Clin. Exp. Res., 23, 958 ~ 962 (1999)) 0 However, there is no effective method for detecting the mutation of this gene. [Summary of the Invention] The purpose of the present invention is therefore to provide an excellent means for accurately and reproducibly detecting base substitutions (for example, SNPs) using a trace amount of nucleic acid sample in order to solve the problems of the above methods. SUMMARY OF THE INVENTION The present inventors have completed the present invention by combining a technique for amplifying a target nucleic acid with a probe capable of detecting a target base substitution existing on the target nucleic acid 'to construct a rapid and sensitive method. The first invention of the present invention relates to a composition for detecting whether there is a base substitution in a specific base on a target nucleic acid, comprising: (a) a primer that can amplify a region containing the specific base on the target nucleic acid, the The primer contains at least a member selected from the group consisting of deoxyribonucleotides and ribonucleotides and ribonucleotides, and the ribonucleotides are arranged at the 3 'end or at least 2 of the 3' end side of the primer A chimeric oligonucleotide primer; (b) a probe that can hybridize to the target nucleic acid region containing the above-mentioned specific base, depending on whether the type of the above-mentioned specific base can be cleaved by the nuclease or not; c) DNA polymerase with strand replacement activity, and 83954-11-200401036 (d) Nuclease. The second invention of the present invention relates to a composition for detecting whether there is a base substitution in the 6 bases of a target nucleic acid, which comprises: 疋 () can increase the primers for a region containing a specific base on 勺 6 spoons of nucleic acid ^ The shirt contains at least two oligonucleotide primers characterized by members selected from the group of deoxyribonucleic susceptors; ㈦ can hybridize to the target nucleic acid region containing the above specific base, and depending on the above specific base Types of probes that can be cleaved or not cleaved by nucleases, and are not cleaved by DNA polymerase 5, 3, exonuclease activity; (c) DNA polymerase, and (d) nuclease . In the second aspect of the present invention, the DNA polymerase may be a DNAxk sigma enzyme having strand displacement activity. Furthermore, in the first and second inventions of the present invention, the probe is a probe containing a ribonucleotide: y: acid'nuclease may be a ribonuclease. The third invention of the hair Θ relates to a method for detecting base replacement, which is

The method for measuring the nucleic acid ^ -Ml rh B, whether there is a base substitution in the content test base, which is characterized by comprising a combination of the following components t τ, +, ^ .., and 3, and then Steps for detecting whether the probe in the composition is cut off: (a) the target nucleic acid, () to ^ 1 chimeric oligonucleotide primer, and the 3 'end side of the specific base of the target nucleic acid The base sequence is substantially complementary and contains at least a member selected from the group consisting of deoxyribonucleotides and nucleotide analogs, and a ribonucleoside-Λribose riboflavin is disposed at the 3, 31 or 31 end of the primer On the side, () can be hybridized with the region containing the above specific base on the nucleic acid, and 83954 200401036 depending on the type of the above specific base; needles with or without nuclease-cleaved probes Displacement-active DNA polymerase, and (e) nuclease. The fourth invention of the present invention relates to a method for detecting a base replacement. In a specific base on a nucleic acid for detecting tritium, the characteristic is to include a probe that contains the following ingredients: 8 inches t Steps from " composition, and then detecting whether the composition is cut off by your needle ... 〇) target nucleic acid, (b) at least 1 oligonucleotide primer, and / / will be levied as the target For the nucleic acid described above, the base sequence of the 3 'end of the soil is substantially complementary and contains at least a member selected from deoxyribonucleotides and nucleotide analogs. Base-region hybridization, and probes that can be cleaved or not cleaved by nucleases depending on the type of specific test substrate mentioned above, and will not be cleaved by DNA polymerase 5, 3, exonuclease activity ' (d) DMA polymerase, and (e) nuclease. In the fourth invention of the present invention, the DNA polymerase may have a strand displacement activity = NA polymerase. Furthermore, in the third and fourth inventions of the present invention, the composition may contain two kinds of primers, the probe is a probe containing ribonucleotides, and the nucleic acid 峙 may be a ribonuclease Η. The composition can be cultivated under isothermal conditions. The fifth invention of the present invention relates to a chimeric oligonucleotide primer having a base sequence described in SEQ ID NOs: 1, 2, 7 8 '13 and M of the Sequence Listing. 83954 -13-200401036 The sixth invention of the present invention relates to a nuclear aluminate primer having a base sequence described in SEQ ID NOs: 9, 10, 19, and 20 of the Sequence Listing. The seventh invention of the present invention relates to a chimeric oligonucleotide primer having a base sequence described in SEQ ID NOs: 3, 4, u, 12, 15, 15, 16, 21 and 22 of the Sequence Listing. The eighth invention of January relates to a composition for detecting whether there is a base substitution in a specific base on a target nucleic acid, which comprises: U) at least one chimeric oligonucleotide primer, which is related to the target nucleic acid The above-mentioned special feature: the test base sequence at the 3 terminal side of the test base is substantially complementary, and contains at least a member selected from deoxyribonucleotides and nucleotide analogs, and ribonucleosides in Western languages, and the ribonucleotide The probe is arranged at the 3, terminus or 3, terminus side of the primer, and (b) a probe that can select whether to hybridize to a target nucleic acid region containing the aforementioned specific base under specific temperature conditions. The ninth invention of the present invention relates to a method for detecting base substitution, which is based on the method of detecting whether there is a base substitution in a specific base on a nucleic acid, which is characterized by including cultivating a composition containing the following ingredients, and then Steps for detecting whether the probe in the composition is cleaved: (a) the target nucleic acid, () to (1) a chimeric oligonucleotide primer, and the base of the target nucleic acid on the 3 terminal side of the above-mentioned special alkaline earth The base sequence is substantially complementary, and contains at least a member selected from deoxyribonucleotides and nucleoside 醆 analogs and ribonucleotides', and the ribonucleotides are arranged at the 3, end or 3, of the primer, On the terminal side, (c) under specific temperature conditions, you can choose whether to hybridize to the target nucleic acid containing S3954 -14- the above specific test probe region (d) DN A polymerase, and 0) nuclease. [Embodiment] Detailed description of the invention In the present specification, the term “base substitution” refers to the replacement of a part of bases on a nucleic acid with other bases. The difference in genetic information between individuals based on the base set, the difference in genetic information is called polymorphism or variation. In addition, it is also called Xi in Taimi) and the so-called base substitution package S in the 5th brother's book is the above-mentioned polytype and mutation in the test base substitution. In addition, the base substitution that is artificially introduced into a nucleic acid is also included in the base substitution in this specification. In the base replacement described in this specification, the number of bases to be replaced is particularly limited, and one or more bases may be substituted. The invention is particularly suitable for the detection of genomic polymorphisms and mutations, especially the detection of SNPs (single base substitution polymorphisms) on genes. The present invention will be described in detail below. (1) The composition HM Ha σ t 'of the present invention is a composition for detecting whether there is a test group replacement in a specific test group on the target nucleic acid, which can increase the area of the target nucleic acid containing a specific base: Primer, 忒 primer is a member containing at least Ting self-deoxyribonucleotide and riboic acid analog and ribonucleotide, and the ribonucleotide is arranged at the 3 'end or 3' end side of the primer At least 2 kinds of chimeric oligonucleotide primers; (b) can hybridize to the target nucleic acid region containing the specific base mentioned above, and 83954 -15- 200401036 depending on the type of the specific test base can be visited without & needle · 2. Pseudotsuga sylvestris syllabary or non-slicing probes for DNA polymerases with strand replacement activity, and (d) nucleases. Also, "another sample-like center k of the composition of the present invention" is a conjugate for detecting whether there is a test group substitution in a specific test group on the target nucleic acid. 1 includes: (: the target nucleic acid may contain a specific test group. The regionally amplified primers contain at least two oligonucleotide primers selected from the group consisting of deoxynuclear masking acid and nuclear analogues with a 4-inch sign; (b) can be included with the target nucleic acid.士 a Hot. Mesh L, left dagger 3 hybridization of the above specific bases, and depending on the type of the above specific test base, can be combined with the cleavage enzyme cleavage enzyme or not, and will not be cut by DNA polymerase No. 5—Probe with r nuclear & exonuclease activity cleaved; (c) DNA polymerase, and wood pair '(d) nuclease. In the composition of the present invention—from t μ bases Is there such a thing as a specific composition on the target nucleic acid to detect whether there is a base substitution composition, which comprises: (a) at least one chimeric oligonucleotide with 3 bases #, /, The base sequence of the above-mentioned special soil J and the known side of the target nucleic acid is selected from the group consisting of deoxyribose ^^, complementary on the shellfish, and at least ribonucleotides of square tick and Nucleic acid, and the ribose copy #, the shellfish and ribonucleosides, and the 3 'end or 3, end side of the ° primer, () can hybridize to the region of the above specific test substrate under specific temperature conditions The probe is selected and included on the target nucleic acid. In addition, it is characterized by containing 83954 -16-200401036 ⑷ to M; oligonucleotide # acid primers, and the 3 'end of the specific test base of the target ㈣ The flanking base sequence is substantially complementary and contains at least a member selected from the group consisting of deoxyribonucleic acid: y: acid and ribonucleic acid analogs, and (b) can hybridize to a region containing the above specific base on the target nucleic acid, Depending on the type of the specific base, the probe can be cleaved or not cleaved by the nuclease. The aforementioned chimeric nucleotide-recruiting primers can be derived from DNA polymerases with strand displacement activity and can be derived from the above primers. In combination with the ribonucleotide cleaving nuclease present in the primer portion of the elongation, the nucleic acid as a template can be amplified under isothermal conditions. This method of nucleic acid amplification is called the IC AN method (isothermal and Chimeric primer-primed nucleic acid amplification method), The details are disclosed in International Publication No. 00/56877 and International Publication No. 02/16639. The design of the primers and the setting of the reaction conditions can be appropriately determined according to the purpose of these publications. In the present invention, primers are used that can amplify a region on the target nucleic acid that contains a specific base for the mutation to be detected. That is, a base sequence that can be used upstream and downstream of the specific base on the target nucleic acid can be used. Or primers that adhere to its complementary base sequence. By adding the target nucleic acid as a template, a DNA polymerase with strand displacement activity and a nuclease with the above-mentioned effect to the composition of the present invention, and isothermal By incubating under conditions, elongation products from the primers can be obtained. In the case where a composition containing two kinds of primers is used, the area lost by these primers can be specifically increased. Furthermore, the present invention also includes a case where only one type of primer is used. In this case, the primers are designed in such a way that the elongation products of the above primers include specific test bases for the mutations to be detected. That is, primers that are substantially complementary to the base sequence on the 3'-terminal side of the above-mentioned specific base on the target nucleic acid can be used. By continuously generating elongation products from the above primers, nucleic acids that can hybridize with the probes described below can be added to the stomach. "Complementary primers on ff" means that they can adhere to the nucleic acid used as a template under the reaction conditions used. Primer. Although the aforementioned chimeric oligonucleotide primer is not particularly limited, it is preferably used for detecting a variation of the amylin gene encoding the pancreatic islet amyloid protein and having the sequence number of the sequence listing 丨, 2, 7, and 8 Those who have recorded the base sequence, and those who have detected the aldehyde dehydrogenase (ALDH2) gene mutation and have the base sequences described in sequence numbers 13 and 14 of the sequence listing. Also, similarly, the oligonucleotide primers for detecting the variation of the starch insolubilin gene are preferably those having the base sequences described in SEQ ID NOs: 9 and 0 of the Sequence Listing, and for detecting the aldehyde dehydrogenase (ALDH2). Gene mutations and those having the base sequences described in SEQ ID NOs: 19 and 20 of the Sequence Listing. The probe contained in the above-mentioned composition of the present rabbit can hybridize with the target nucleic acid to be amplified. II by designing a probe so that the presence of a base substitution at a specific base on the target nucleic acid can be specifically cut or not specifically cut by nucleases, the index of the probe can be cut. , Detect the presence or absence of test base substitution. Although the nuclease of the probe to be cleaved is not particularly limited, for example, when a base complementary to the above-mentioned specific base or its surrounding bases is used as a probe of ribonucleic acid, it is appropriate to use an international publication No. 02/22831 5 A ribonuclease enzyme prepared by a method already described. In addition, as described above, probes useful for the detection of base substitutions and their cleavage 83954 -18-200401036 have been disclosed in U.S. Patent No. 5,660,988. As the aforementioned chimeric oligonucleotide primer, although there is no particular limitation, it is used for detecting the variation of the amylin gene encoding the pancreatic islet amyloid protein and having the sequence number 3, 4, and 丨Those having the base sequences described in 丨 and 12 'and those having a base sequence described in sequence number 15, 16, 21, and 22 for detecting a variation in the aldehyde dehydrogenase (ALDH2) gene are preferred. (2) Method for detecting base substitution of the present invention The method for detecting base substitution of the present invention is a method for detecting the presence or absence of base substitution in a specific base on a target nucleic acid using the composition described in the above (丨). . The nucleic acid amplification method used in the method of the present invention may be various methods using primers having a sequence complementary to the template nucleic acid. For example, a polymerase chain reaction method (PCR, US Patent Nos. 4,683,195, 4,683,202, and 4,800,159), a stock replacement type amplification method (8), 38, special

a flat 7-11471 No. 8) ’ICAN method (Isothermal and Chimeric Primer _ Started nucleic acid amplification method, see International Publication No. 00/56877) and other nucleic acid amplification methods. ^ In these methods, at the same time or after the amplification of the target nucleic acid, the target base substitution can be detected by hybridizing with the labeled probe in the presence of RNaseH. W In a preferred aspect of the present invention, there is no particular limitation on jy. The charge sign is a composition comprising the following components: (a) the target nucleic acid, (b) at least one chimeric nucleotide primer, which is related to the target The above-mentioned special features of the nucleotides 83954 -19-200401036 of the 3 'terminal side of the definite base are substantially complementary, and contain at least members and ribonucleosides that are far away from deoxyribonucleotides and ribonucleic acid analogs. Acid, and the ribonucleotide is arranged at the 3, end or 3, end side of the primer, (c) can hybridize to the target nucleic acid region containing the above specific base, and depending on the type of the above specific base, A nuclease-cleaved or non-cleaved probe, (d) a DNA polymerase having strand displacement activity, and (e) a nuclease; and a step of detecting whether the probe in the composition is cleaved. Yet another aspect is characterized by comprising cultivating a composition containing the following components: (a) the target nucleic acid, (b) at least one oligonucleotide primer, which is characterized by the above characteristics of the target nucleic acid, the test base 3, The terminal sequence of the test base is complementary in f and contains at least a distant deoxyribonucleic acid: y: a member of an acid and a nucleotide analog, (c) can hybridize to the target nucleic acid region containing the specific base described above And probes that can be cleaved or not cleaved by nucleases depending on the type of the above-mentioned specific bases, and will not be cleaved by the 5-3 'exonuclease activity of DNA * synthase, (d) DNA polymerization Enzyme, and (e) a nuclease; and k ′ is a step of whether the probe in the composition is cleaved. Moreover, the re-state is characterized by comprising cultivating a composition containing the following components: (a) the target nucleic acid, (b) at least one chimeric oligonucleotide ^: acid primer 'and the above-mentioned characteristics of the target nucleic acid: bases, 3, the test sequence on the terminal side is substantially complementary, and contains at least members from ribonucleic acid and ribonucleic acid analogues, and ribonucleic acid 83954 -20- 200401036 l, and the ribonucleotide is configured At the 3 'end or 3, end side of the primer, (c) a probe that can choose to hybridize to a region containing the above-mentioned specific base on the target nucleic acid under specific temperature conditions, (d) a DNA polymerase, and (e ) Nuclease; and a step of detecting whether the probe in the composition is cut off. Furthermore, another aspect is characterized by comprising cultivating a composition containing the following ingredients:. U) the target nucleic acid, _ (b) at least one oligonucleotide primer, which is substantially complementary to the base sequence of the 3 'end side of the specific base of the target nucleic acid, and contains at least one selected from deoxyribonucleic acid Members of acids and nucleotide analogs, (c) probes that can choose whether to hybridize to the target nucleic acid region containing the specific test substrate under specific temperature conditions, (d) DNA polymerase, and (e) nucleic acids An enzyme; and a step of detecting whether a probe in the composition is cleaved. · The oligonucleotide primers are not particularly limited as long as they can amplify a region containing the above-mentioned specific base on the target nucleic acid. Although not particularly limited, the chimeric oligonucleotide primer described in International Publication No. 02/16639 is preferably used. The Dn A primer may be used in the method of the present invention. Furthermore, in the method of the present invention, two kinds of oligonucleotide primers can be used. Although the DNA polymerase used in the above steps is not particularly limited, it is preferable to use one having strand displacement activity. There is no particular limitation on the nuclease 83954 21 200401036 '. However, from the viewpoint of cutting the ribonucleotide portion of the chimeric oligocopper I, ribonuclease is suitable for use in the present invention. 'σ is particularly good, such as the use of beauty test complementary to the above specific test base: the base as a ribonucleotide probe and the use of a composition containing only dinuclear I 核 (as a nuclease) Detection method. In addition, there are no special restrictions on the conditions of the reaction, as long as the conditions for the DNA polymerase and nuclease used to maintain # 月 望 活动 are suitable. The temperature of the dagger is determined by the enzymes and primers used, and the bond length of the probe. In particular, the use of thermostable enzymes at high temperatures (for example, 50 to Μ should be particularly preferred.) In the above reaction, the target nucleic acid that has been amplified is hybridized with the probe. Among them, a mismatched portion is formed between the non-positive nucleic acid of the base sequence of the target nucleic acid and the probe and the double-stranded nucleic acid of the probe. In the case of == instead of a probe having a wild-type test sequence, if there is a test substrate substitution in the target nucleic acid, a mismatched portion as described above is formed. At this time, by coexisting with a nuclease with mismatch sensitivity, only the mismatch will not be formed: the probe is cut. Furthermore, the reason is to set the reaction conditions and the bond length of the probe in such a way that the broken probe does not re-hybridize with the target nucleic acid, and the cut probe will be released from the target nucleic acid, and then 耜 & _ & & μ ... And the new probe hybridizes with the target nucleic acid and cuts the sample. Repeat this astounding SR. ^ Temple step knows that the probe will accumulate when the reactant is cut off. Although the above reaction is an example of a case where a probe having a wild-type test sequence is used. C. By using a probe having a test sequence that includes a test substrate substitution, the probe can also be used in the presence of a target nucleic acid that has a test substrate substitution. Cleaved / 83954 -22- 200401036 The aforementioned ribonuclease Η is susceptible to mismatches and is suitable for use in the present invention to cleave probes. When the DNA polymerase used is a 5 3 'exonuclease activity, the probe is decomposed regardless of whether it is mismatched or not. Therefore, from the viewpoint of preventing this phenomenon, those who are used as the above-mentioned probes should not be decomposed by the DNA polymerase 5-3 'exonuclease activity, that is, for 5 | ~ 3, exonuclease Probes that are resistant to enzyme activity are preferred. In one aspect, by adjusting the distance from the hybridization region of the primer used to the hybridization region of the probe, a probe that is resistant to 5, _3, exonuclease activity can be constructed. Also, in another aspect, a probe modified such that the probe is not decomposed by 5, 4 3 'exonuclease activity can be used. There are no special restrictions on the modification, such as dephosphorylation at the 5 'end, modification of the hydroxyl group at the 3 position of ribose, use of (α -s) nucleotides in which an oxygen atom bonded to a phosphoryl group is replaced by a sulfur atom, Use of peptide nucleic acids (PNA; Nature, 365, 566-568 (1993)), amine alkylation, pigments, fluorescent substances, luminescent substances, matting substances, various ligands (biotin and digitalis, etc.) The addition of enzymes, enzymes, etc., and the introduction of substitution groups to obtain steric disorders. This modification can be placed at either the 51-terminus or 51-terminus side of the probe if the above-mentioned resistance is obtained. Also, in another aspect, although the amplified target nucleic acid hybridizes with the probe, under certain temperature conditions, when the base sequence of the probe and the base sequence of the target nucleic acid are not correctly consistent, the target The double-stranded core St of the nucleic acid and the probe is very unstable. When the secret sequence of the probe and the base sequence of the target nucleic acid are exactly the same, the double-stranded nucleic acid of the target and the probe 83954 -23-200401036 nucleic acid. 4 persons w. The second effect is that only when a stable double strand is formed, the probe is cut off, so that the cut off probe does not re-hybridize with the target nucleic acid, and the reaction conditions and the chain length of the probe The cleaved probe will be released from the target nucleic acid, and then the new probe will hybridize with the target nucleic acid and be similarly cleaved. Repeat these steps, and the cleaved probe will accumulate. Although the reaction is an example of the case where a probe having a wild-type base sequence is used ', by using a probe having a base sequence that includes a base substitution: the probe can also be cleaved by the presence of the target nucleic acid of the base substitution. . In the above case, it is necessary to set specific temperature conditions so that the base sequence of the nucleic acid of the probe: the motif ticket is unceremoniously consistent; I: the private nucleus and the double-stranded nucleic acid of the probe are very Unstable; on the other hand, the probe base sequence and the target base line sequence are correct-the sentiment = 'make & nucleic acid and probe double. The temperature can be regarded as probe withering. Although not particularly limited, 70 < > c is exemplified below, and 65 is used. 〇 The following is preferred. For the means of cutting the detection probes, it is only possible to use the well-known nuclear analysis method. For example, by hunting electricity, water, or local liquid phase. Chromatography can detect cuts by changing the chain length of a needle. As a particularly good person, it includes, for example, a probe with her # &a; + aa + ^ φ ^ ( Fluorescent extinction by Zuo Beibei ## lL π < Waibei is not at a proper interval. Although this temple probe is intact, the cavity will not emit fluorescence, but it is being cut. It is broken so that the fluorescent substance and the matting substance are enough to emit camping light. In the case that the plasma is pulled apart, 6-FAM (6-carboxyfluorescent ABCYL (4_: methylamino azobenzyl),) (6 · „_Χ_ 83954 -24-200401036 Rhodamine mDABCYL, 6-FAM and Eclipse (manufactured by Epoch BioSciences), ROX and Eclipse, TET (Four Gas Fluorescein) and daBCYL, TET and Eclipse, etc. By using These probes can be directly observed by the reaction solution in the reaction to see if there is any test group substitution. Also, by using such as Smart Cycler (TAKARA Bi o Company-made) Amplified nucleic acid in a reaction test tube can be detected and quantified immediately after the test tube is closed. In one aspect of the invention, the amplified product is hybridized with the probe. And using the RNA part will be cut off by the RNaseH in the ic AN reaction solution and get fluorescence only when the pairing is completely correct, and the RNA part will not be cut off by the RNaseH when mismatching, and the fluorescence signal cannot be obtained, and the target can be detected. Substitution of bases in nucleic acids. Also, in another aspect, the probe is cleaved by RNaseH only when a stable double strand is formed with the target nucleic acid under specific temperature conditions, and the target nucleic acid can be detected. Test base substitution. The target nucleic acid used in the base substitution detection method of the present invention can use single-stranded and double-stranded nucleic acids, as well as DNA and RNA. Depending on the nuclease used, it is sometimes difficult to use. RNA is used as the target nucleic acid, but in this case, by using the RNA as a template to modulate the cDNA, and then using (:: 〇1 ^ 八 as the target nucleic acid 'can detect the base substitution on the RNA. In the present invention ' The sample containing the target nucleic acid is used for the detection reaction. Although the above-mentioned four materials are specifically limited, they can include all samples such as nucleic acids or organisms. For example, cells, tissues (bioassay samples, etc.), whole blood, corporate culture, Cerebrospinal fluid, semen, saliva, sputum pain, urine, pterygium, hair, cell culture, etc. Although the above-mentioned specimens are not particularly limited, they are preferably subjected to appropriate treatment such as shape of 83954 -25- 200401036. Female * t For example, the heart becomes a form that can carry out the ϋΝΑ polymerase reaction :, X for the use of this turtle. These processes include lysis of cells and extraction and purification of nucleic acids from the sample. Cells containing higher human animals usually have a diploid pair of chromosomes / so 'there may be base substitutions in specific bases on the chromosome,' "Tian Ke Ke a means that neither chromosome has a test base substitution. There are three types of homozygote (homotype), homozygous zygote (isotype) in which chromosome substitution is present on both chromosomes, and heterozygote zygote (heterotype) with chromosome substitution in test base. Nucleic acid samples prepared by cells in the body, by using the method for detecting base replacement of the present invention, can investigate any genotype on the gene, and investigate whether the genotype of the tadpole ("cell") Or shaped. Although there is no particular limitation; t ', for example, when two probes corresponding to four test bases are used for implementation, the condition of the hair month method is f, two kinds of k are detected in a nucleic acid sample from a cell with a genotype & The needle's riboic acid is cut off by the accompanying signal. On the other hand, in nucleic acid samples from cells with genotypes, only one probe was detected. Therefore, the method of the present invention is also useful for detecting base substitutions on opposite genes as described above. Although the chimeric nucleotide raising primers used in the method of the present invention are not particularly limited < to use VII, nuclear testing to encode the pancreatic islet-like amyloid protein; the mutation of the insoluble gene and the sequence list Sequence numbers 丨, 2, 7, and 8 β-containing base sequences, and those for detecting aldehyde dehydrogenase (ALDH2) gene mutations and having the base sequences described in sequence numbers 1 3 and 14 of the sequence listing are Better. In the same way, the oligonucleotide 83954 -26- 200401036 primers for detecting the variation of the starch insolubilin gene are used, and those having the base sequences described in SEQ ID NOs: 9 and 〖〇 in the Sequence Listing, and for detecting aldehyde dehydrogenation It is preferable that the enzyme gene is mutated and has the base sequences described in SEQ ID NOs: 19 and 20 of the sequence listing. Although the probe used in the present invention is not particularly limited ^, it has a sequence number 3, 4, i, and 12 for detecting the variation of the amyloid gene of the amyloid pancreatic islet-like amyloid protein. Those having a base test sequence as described, and those having a base sequence described in sequence number 15, 16, 21, and 22 of the sequence listing for detecting mutations in the aldehyde dehydrogenase (ALDH2) gene are preferred. (3) Kit for detecting base substitution of the present invention The present invention provides a kit for detecting the aforementioned base substitution of the present invention. In an embodiment, the kit contains the components of the composition of the present invention, that is: (a) to y 1 type of conjugated oligonucleotide primer, which is related to the 3rd end of the above-mentioned specific test base of the target nucleic acid The test base sequence on the side is substantially complementary and contains at least a member selected from the group consisting of deoxyribonucleic acid and ribonucleic acid and ribonucleic acid ', and the ribonucleic acid: y: the acid is arranged in 3 of the primer The end or 3, end, and (b) are probes that can hybridize to the target nucleic acid region containing the above-mentioned specific base, and depending on the type of the above-mentioned specific base, can be cleaved or not cleaved by a nuclease. Yet another aspect is a set containing the following: Rong 2) at least one nucleotide-priming primer complementary to the target nucleic acid of the above-mentioned special line 3, the terminal side of the base sequence, and ( b) It can hybridize to the target nucleic acid region containing the above specific bases, and depending on the type of the above specific bases, it can be cleaved or not cleaved by nucleases, and not be DNAaK synthase 5—31 Digester activity cut probe. 83954 -27- 200401036 Another aspect is a set containing the following: At least! Chimeric oligonucleotides primers, the base sequence of the 3 'end side of the above-mentioned special double soil of the target nucleic acid It is complementary to each other, and contains at least: members of self-deoxyribonucleotides and riboic acid analogs and ribobisides: and the ribonucleoside is disposed at the 3, end or 3, end side of the primer (B) Under specific temperature conditions, it is possible to choose whether or not to hybridize the probe to the target nucleic acid region in which the above specific bases are hybridized. 3 Furthermore, another aspect is a set containing the following: (a) at least one chimeric oligonucleotide primer, which is identical to the test sequence of the 3 'end of the test sequence of the target nucleic acid Complementary and at least a member selected from the group consisting of deoxyribonucleotides and nucleotide analogs, and 3 (b) under specific temperature materials, can choose whether to hybridize to the region of the target nucleic acid coated with the above specific bases Probe. 3 The above neodymium needle is, for example, a probe containing a wild-type base sequence or a probe showing a human: base substitution test sequence, and those containing these two types of probes: 3 have a knife corresponding to 4 types 4 kinds of probes for test base. These probes can be used for identification. Σ Although the chimeric oligonucleotide primers used in the set of the present invention are not particularly limited, they can be used for detecting mutations in the amylin gene encoding the pancreatic islet-like amyloid protein and having the sequence of the sequence listing No.], 2, 7 and 8 are based on the test sequence 'and those for the detection of the dehydrogenase (ALDH) gene mutation are listed in the sequence number 13 and 14 are based on the ㉟-based sequence of 83954 -28- In the same way, the primers for detecting mutations in the starch insolubilin gene are used for those having the base sequences described in SEQ ID NOs: 9 and 10 of the Sequence Listing, and those for detecting the aldehyde dehydrogenase (ALDH2) gene. It is preferred that the mutations have the base sequences described in SEQ ID NOs: 19 and 20 of the sequence listing. Although the probes used in the kit of the present invention are not particularly limited, the probes used for detecting the variation of the amylin gene encoding the pancreatic islet amyloid protein and having sequence numbers 3, 4 ', and 12 of the sequence listing are used. Those with a base sequence of $, and those with a base sequence described in sequence number 15, 16, 21, and 22 of the sequence listing for detecting a mutation in the aldehyde dehydrogenase (ALDH2) gene are preferred. The above set may contain other components used in the preparation of a DNA polymerase, a nuclease, a DNA polymerase substrate (i.e., dNTP), and a reaction solution. As described above, in the present invention, the target nucleic acid having the sequence of the base substitution to be investigated is amplified. Furthermore, the probe is cut off continuously depending on the presence or absence of the base substitution. As a sample, base substitution can be detected with high sensitivity. In addition, the detection of the target nucleic acid's size, hybridization, probe cutting, and signal resulting from the probe cutting can be performed in a single step, and a simple and rapid method for test base replacement is provided. Although the present invention is described in more detail by the following examples, the present invention is limited to the scope of the examples. Reference Example 1 In the examples, the unit numbers of heat-resistant RNaseH were dissolved by the following method: 83954 -29-200401036 Poly (rA) and poly (dT) (both manufactured by Amersham Pharmacia Biotech) were each dissolved in In 1 ml of 1 mM EDTA in 40 mM Tris-HCl buffer (pH 7.7), a poly (rA) solution and a poly (dT) solution were prepared. Then, the poly (^ A) solution was added to 4011 Hetin 143-: 9 (31 (port 117.7)) containing 4 mM MgCl2, 1 mM DTT, 0.003% BSA and 4% glycerol and the final concentration was 20 pg / m and adding poly (dT) solution to a final concentration of 30 pg / ml, reacting at 37 ° C for 10 minutes, cooling to 4 ° C, and preparing poly (rA) and poly ( dT) solution. To this poly (rA) -poly (dT) solution 100 μΐ, add 1 μΐ of any diluted enzyme solution, and react at 40 ° C for 10 minutes, and then add 0.5M EDTA 10 μ1 to stop the reaction. Then, the absorbance at 260 nm was measured. As a control group, '0.5M EDTA 10 μΐ was added to the above reaction solution, and the reaction was performed at 40 ° C for 10 minutes. Then the absorbance was measured. Then, the reaction was determined in the absence of EDTA. Obtain the absorbance minus the absorbance of the control group to find the difference (absorbance difference). That is, from the absorbance difference, the riboic acid released from the poly (rA) -poly (dT) hybrid through enzyme reaction can be calculated. The concentration of 1 unit of RNaseH is the amount of enzyme required to increase A26 () during 10 minutes, which is equivalent to 1 nmole of riboflavin. Unit = [Difference in absorbance x amount of reaction solution (ml)] / 〇〇152 > < (11〇 / 1〇〇) x Dilution rate Example 1 (1) Testing and review in the model system In the real-time ICAN response system of the chimeric probe, the detection method of SNP is selected as the detection target, and the pancreas insoluble gene encoding pancreatic islet amyloid shellfish is selected. The serine acid at the 20th position in the gene 83954 -30- 200401036 (AGC) is replaced by a glycine (GGC) missense variant, which alone causes only a slight abnormality in glucose tolerance, but if the genetic elements of type 2 diabetes are combined, its onset will be earlier and more Aggravated. First, a DNA synthesizer (made by Applied Biosystem) was used to synthesize the IAPP-F-2 primer and the IAPP-R-1 primer for detecting the variation of the amylin gene in the ICAN reaction, each of which has the sequence of the sequence listing The base sequences of Nos. 1 and 2. Then a DNA synthesizer was used to prepare the chimeric oligonucleotides having the base sequences described in Sequence Numbers 3, 11 and 21 of the Sequence Listing, and one person for wild-type detection? Needle 0 ("2), 1 person? 9 probes and 18? 8 probes, to IAPP probes CGG (M2), IAPP 9G probes, and IAPP 8G probes for variant detection of the base sequences described in Sequence Numbers 4, 12, and 22 of the Sequence Listing. Also, IAPP probes for wild-type detection CAG (W2), IAPP 9A probe and IAPP 8A probe are DABCYL (Glen Research) with 6-FAM (manufactured by ABI) as the fluorescent logo on the Y end and 3 'end as the extinction logo. (Made by the company) DNA-RNA-DNA type oligonucleotide probe; on the other hand, IAPP probe CGG (M2), IAPP 9G probe and IAPP 8G probe for variant detection are added at the 5 'end ROX (fluorescently labeled) ROX (manufactured by ABI) and a DNA-RNA-DNA type oligonucleotide probe with DABCYL added as a matting mark at the 3 · end. In addition, fragments each having a base sequence of 600 bp as described in Sequence Numbers 5 and 6 of the Sequence Listing were prepared by a conventional method, and then they were individually selected and segmented into a pGEM-T EASY vector (promega). These plastids were used as the wild type positive control group (sequence number 5) and the variant positive control group (sequence number 6). The positive control group was prepared to have a concentration of 103, 104, 105 83954 31 200401036 per 1 μΐ. Therefore, if the above-mentioned control group 10 μ 使用 is used, it will be 10 04, 105 and 1 6 sets. The reaction conditions of the IC AN method are shown below. That is, add Hypas-KOH hydroxide to a final concentration of 3 2 mM

(pH 7.8) '100 mM acetic acid | formaldehyde, 1% DMSO, 0.01% BSA, 4 mM magnesium acetate, each 500 μM dNTPs mixture, 4U BcaBESTDNA polymerase (manufactured by TAKARA Bio), using International Publication No. 02 / Bca RNaseH 4800U prepared by the method described in Gazette No. 22831, each of 25 pmol IAPP-F-2 and IAPP-R-1 primer pairs, 5 pmol IAPP probe CAG (W2) and 10 pmol IAPP probe CGG (M2) And 10 μΐ of each positive control group as a template nucleic acid, and the final volume was adjusted to 25 μ1 with sterilized water. This reaction solution was set at 55 in advance. (: Smart Cycler (manufactured by TAKARA Bio), and held for 100 minutes. As a result, when a wild-type positive control group was used as a template, in any of 1, 04, 1 05, and 1 06 sets / reactions 'Each of the 6-FAM fluorescent signals from the IAPP probe CAG (W2) was observed to increase. The other hand, the ROX fluorescence signal from the IApp probe CGG (M2) was not seen to increase. When using the variant positive control group, a significant increase in the ROX luminescence signal from the IAPP probe CGG (M2) was observed in any of the systems of 104, 105, and 106 sets / reaction. On the one hand, no increase in the fluorescence signal from the IAPP probe CAG (W2) 26_FAM is generally seen. From the above, it can be confirmed that the method of the present invention includes embedding two types of wild-type and / or modified-type two-end markers. The combination of probes can be used to detect the variation of the starch insoluble gene in real time. 83954 -32- 200401036 (2) Detection in genomic DNA Review in the instant ic AN reaction system using human genomic DNA as a template. Detection method. Except using commercially available human genomic DNA (human genomic DNA; 1 ng '1 ng or 50 ng / reaction) except for the nucleic acid used as a template, the rest were the same as the reaction conditions described in Example 1-(1). The results were the same as those of the positive control group. W2) 6-FAM fluorescence signal increased significantly. On the other hand, no increase in ROX fluorescence signal from the IApp probe CGG (M2) was observed. Moreover, this result is similar to the analysis of human genomic DNA by the usual sequencing method. The results are consistent. Therefore, it is confirmed that the results according to the present invention are the same as the previous method. (3) Review of RNaseH

Review the RNaseH used in the method of the invention. That is, in the reactions described in Example 1- (1) above, a system using Tli RNaseH (prepared by the method described in International Publication No. 02/22831) (00U / 25 μΐ reaction) was used instead of Bca RNaseH. In this example, the iaPP-F-1 primer and the IAPP-R6008 primer having the base sequences described in Sequence Numbers 7 and 8 of the Sequence Listing are used. The reaction temperature was set to 60 ° C. The other conditions are exactly the same as the reaction conditions described in Example 1- (1) above. As a result, when a wild-type positive control group was used as a template nucleic acid, a 6-FAM fluorescence signal from the IAPP probe CAG (W2) was significantly increased in a system of 106 sets / reaction. On the other hand, no increase in the ROX fluorescence signal from the IAPP probe CGG (M2) was seen. Moreover, when a variant positive control group was used, a significant increase in ROX fluorescence signal from the IAPP probe CGG (M2) was observed in a system of 106 sets / response. On the other hand, the IAPP probe was not generally seen CAG (W2) 6-FAM 83954-200401036 f Optical signal increased. That is, in this example, the reaction temperature is 60. . In the unwarranted situation, by using RNaseH to select and cut the target nucleic acid and probe correctly paired or mismatched, or use RNaseH to select and cut the target nucleic acid and probe to form a stable double strand, it will be higher Accuracy detects the intended basis replacement. (4) Review of the specificity of the base number of the rNa part of the chimeric probe is 丨 bases. For the case where the A part of the fungible probe used in this description method consists of a purine base of 1 base Review of SNp detection methods. In this example, a combination of the 5 pm01 IAPP 9A probe and the 5 pm1 IApp 9G probe with the base sequences described in Sequence Listings 11, 12, 21, and 22, or the $ AppiA 8A probe is used. Combination of needle and 5 pmol IAPP 8G probe. The reaction conditions of the other methods are shown below. That is, add Hyphas-potassium hydroxide buffer ({^ 7.8) to a final concentration of 32 mM, {10011 ^ potassium acetate, 1% 131 ^ 80, 0.01% BSA, 4 mM magnesium acetate, each 5 〇〇μΜ2άNτρδ mixture, 0.04% propylene diamine, 2U BcaBEST DNA polymerase, 100U Tli RNaseH, 50pmol each of IAPP-F-2 and IAPP-R] primer pairs, and each positive control group as a template nucleic acid ( The concentration was 2 x 105 sets / μ1) 5 μ1, and the final volume was adjusted to 25 μΐ with sterilized water. Add 5 μ1 of water instead of template as the negative control group. This reaction solution was placed in a Smart Cycler previously set at 60 t and held for 100 minutes. As a result, in the case of using the wild-type positive control group as a template, a 6-FAM fluorescence signal from the IAPP 9A probe or the IAPP 8 eight probe was significantly increased; in the case of the negative control group, no preparation was observed. & No. 'cross. On the other hand, no significant increase in the ROX fluorescence signal from the IAPP probe or 83954-34- 200401036 IAPP 8G probe was observed. In the case of using the variant positive control group, a significant increase in the ROX fluorescence signal from the IAPP 9G probe or the IAPP 8G probe was observed; in the case of the negative control group, no change in the fluorescence signal was observed. On the other hand, no significant increase in the 6-FAM fluorescence signal from the IAPP 9A probe or the IAPP 8A probe was observed. From the above, it was confirmed that even with an embedded probe in which the RNA portion is composed of 1 purine base, the variation of the amylin gene can be detected immediately. Example 2 Detection of Pancreatic Islet Islet Amyloid Protein Genes by PCR SNPs The review target was the same as in Example 1, and the starch insoluble gene encoding pancreatic Islet Islet starch protein was selected. First, in order to detect the variation of the amylin gene in the PCR reaction system, a DNA synthesizer (manufactured by Applied Biosystem) was used to synthesize the IAPP-F primer and the IAPP-R primer having the base sequences described in sequence numbers 9 and 10. Then, a DNA synthesizer was used to prepare chimeric oligonucleotides having the base sequences described in SEQ ID NOS: 11, 12, 21, and 22; the IAPP 9A FAM probe and the IAPP 8A FAM probe for wild-type detection; and variant detection. Use IAPP 9G ROX probe and IAPP 8G ROX probe. In addition, the IAPP 9A FAM probe IAPP 8 A FAM probe for wild-type detection is a DNA-RNA- with 6-FAM as a fluorescent label at the 5 'end and DABCYL as an extinction label at the 1 end. DNA-type oligonucleotide S-man probe; on the other hand, IAPP 9G ROX probe and IAPP 8G ROX probe for variant detection are ROX added as fluorescent label on the 5 'end and 3' added on the 3 'end. As a matting mark, the DNA-RNA-DNA type coupon of DABCYL is used to remove acid. 83954 -35-200401036 In addition, a fragment having a 600 bp base sequence described in sequence numbers 5 and 6 of the sequence listing, respectively, was modulated by a conventional method, and then it was segmented into pGEM-T EASY vector (promega) ). These plastids were used as a wild type positive control group (sequence number 5) and a variant positive control group (sequence number 6), respectively. The positive control group was prepared to have a concentration of 105 sets per 1 μ1. Therefore, if 1 μ1 of the above-mentioned control group is used, each reaction will be 105 sets. The reaction conditions for PCR are as follows. That is, using TaKaRa ExTaq R-PCR ver. (Manufactured by TAKARA Bio), adding 1 x R-PCR buffer, each 300 μM dNTPs, 3 mM magnesium solution, 1.25U ExTaq R-PCR ver., 100U Tli RNaseH II , Each 10 pmol of IAPP-F primer and IAPP-R primer, 5 pmol of IAPP 9A FAM probe or IAPP 8A FAM probe, 5 pmol of IAPP 9G ROX probe or IAPP 8G ROX probe, and as a template nucleic acid Each positive control group was 1 μΐ (the above concentrations are the final concentrations), and the final volume was adjusted to 25 μΐ with sterilized water. This reaction solution was placed in a Smart Cycler (manufactured by TAKARA Bio), and after being processed at 95 ° C for 10 seconds, it was repeatedly cycled at 95 ° C / 5 seconds, 60 ° C / 15 seconds, and 72 ° C / 15 seconds for 50 seconds. Times. The measurement of the fluorescence intensity was performed in the step of 60 ° C / 15 seconds.

As a result, when a wild-type positive control group was used as a template, a 6-FAM fluorescence signal from the IAPP 9A FAM probe or the IAPP 8A FAM probe was observed to increase significantly. On the other hand, no increase in the ROX fluorescence signal from the IAPP 9G ROX probe or the IAPP 8G ROX probe was generally seen. In the case of using the variant positive control group as a template, a large increase in the ROX fluorescence signal from the IAPP 9G ROX probe or the IAPP 8G ROX probe was observed. On the other hand, no increase in the 6-FAM fluorescence signal from the IAPP 9A FAM probe or IAPP 8A 83954 • 36- 200401036 FAM probe was observed. In addition, in the case of using a wild type positive control group and a variant positive control group as templates to mix the same amount as a heterogeneous model system, it was observed that 6 from the IAPP 9A FAM probe or IAPP 8A FAM probe -FAM luminous signal increased significantly. In addition, a significant increase in the R 0 χ fluorescence signal from the IApp 9G Rox probe or the IApp 8G Rox probe was also seen. From the above, it can be confirmed that the method of the present invention can detect a single base of an amylin gene in a real-time pCR reaction system by combining two types of chimeric probes labeled at both ends, such as wild type and mutant type. variation. Example 3 Review of ICAN SNPs detection of aldehyde dehydrogenase 2 gene (1) Detection in model system The SNPS detection method in the real-time IC AN response system using a chimeric probe in combination was reviewed. For the review, select the gene encoding the aldehyde dehydrogenase 2 enzyme. In exon 12 of this gene, the 487th glutamic acid (GAA) substitution with a base polymorphism of lysine (AAA) exists. So far, there have been reports of differences in personal constitutions related to drinking. Close relationships and related to the risk of cancer. First, in order to detect the mutation of the aldehyde dehydrogenase 2 gene in an ICAN reaction system, a DNA synthesizer (manufactured by Applied Biosystem) was used to synthesize ICAN-ALDH2- having the base sequences described in sequence numbers 13 and 14 of the sequence listing, respectively. F chimeric primers and ICAN-ALDH2-R chimeric primers. Then, a chimera having a base sequence described in SEQ ID NOs: 15 and 16 of the Sequence Listing was synthesized, and an ALDH2 wG probe for wild-type detection and an ALDH2 mA probe for variant detection were synthesized. The ALDH2 wG probe for 'wild-type detection' is the DNA-RNA of the Eclipse with the Rox label as the fluorescent label on the 5 'end and the photon label on the 3' end with the optical label 83954 -37- 200401036 -DNA-type fenamic acid probe; on the other hand, the "ALDH2mA probe for variant detection" is an Eclipse with an extinction label at the 5 end and an additional 12 bases with 13 bases. DNA-RNA-DNA type oligonucleotide probe for light-labeled FAM. Further, each fragment having a base sequence of 2 15 bp described in SEQ ID NOs: 17 and 18 of the Sequence Listing was prepared by a conventional method, and then the fragments were individually selected and cloned into pGEM EASY vectors (promega). These plastids were used as a wild-type positive control group (sequence number 17) and a variant-type positive control group (sequence number 18). The positive control group was prepared to have a concentration of 2 × 104 sets per 1 ... Therefore, if 5 μ1 of the above-mentioned control group is used on the right, each reaction will become 105 sets. The reaction conditions of the ICAN method are as follows. That is, Hyphas-potassium hydroxide buffer (pH 7.8) at a final concentration of 32, 100 mM potassium acetate, and 5 mM gadolinium acetate 1 were added. / 〇dimethyl sulfene, 0.004 〇 /. Propylenediamine, 0.1 μ betaine, 0.11% bovine serum albumin ’each 60 〇 | ^ € 1] ^? 3,411 to 36 ug 8 d of DNA polymerase 'iOOU Tli RNaseHII, each 50pm 0kICAN_ALDH2-F chimeric primer and ICAN-ALDH2-R chimeric primer pair, 5 pmol ALDH2 wG probe, 7.5 pmol of ALDH2 mA, and 5 μ 卜 of each positive control group as template nucleic acid, and the final volume was adjusted to 25 μΐ with sterilized water. This reaction solution was placed in a Smart Cycler (manufactured by Takara Bio), and was treated at 70 ° C for 5 minutes, and then at 58 ° C. (: Hold for 25 minutes, and then hold at 5 (rc for 20 minutes. The measurement of the fluorescence intensity is maintained at 58 and 5 hours, and each of them is measured for 1 minute. Results) When using a wild-type positive control group as a template It can be observed that the ROX fluorescence signal from the ALDH2 wG probe has increased significantly. Another 83954 200401036-* ~ Diqu 1 Heart Bean Watch Festival has increased the 6-FAM fluorescence production number from the ALDH2 mA probe. Also, + ° In the case of using the variant positive control group as a template, it can be observed that the FAM fluorescence signal of Cheng's and ALDH2 mA probes has greatly increased. The other-Fang'ertian 'is generally not observed. To rci 3 from the ROX fluorescence signal from the ALDH2 wG probe. In addition, the wild-type positive control group and the variant-positive control group were used as templates to use a mixture of heterogeneous model systems, Brother Qing observed a significant increase in the ROX fluorescence signal from the ALDH2 wG probe, and also observed a significant increase in the 6-FAM fluorescence signal from the ALDH2 mA probe. From the above, it can be confirmed that the method of the present invention responds in real time to the ICAN response. In the system, the wild type and mutant The chimeric probes labeled at both ends can be combined to identify the single-base polymorphism of the aldehyde dehydrogenase 2 gene. (2) Detection in genomic DNA Review the immediate ican response in the case of using human genomic DNA as a template SNPs detection method in the system. As a template nucleic acid, the QIAamp DNA Mini Kit (QIAGEN) was used to modulate oral mucosal cells and blood samples provided after entering the treatment stage. In addition to using genomic DNA (5 Q ng / reaction) Other than ') were performed under the same conditions as the reaction conditions described in Example 3- (1).' Also use the primer pairs of the ALDH2-F primers and the ALDH2-R primers shown in SEQ ID NOS: 19 and 20 'below The pcR was performed under the conditions described above. The amplified product obtained by the household was refined with Microcon-30 (Milipore & Division), digested with Eco57I, and subjected to 3% NuSieve 3: 1 agarose gel electrophoresis, and also typed by RFLP. 83954 -39- 200401036 PCR was performed using TaKaRa ExTaq (manufactured by TAKARA Bio). That is, 1 x ExTaq buffer, 200 μM dNTPs each, 1.25 U ExTaq, 10 pmol of ALDH2-F primer and ALDH2-R primer were added. Yes and do 5 μΐ of human genomic DNA was prepared as a template nucleic acid (the above concentrations are the final concentrations), and the final volume was adjusted to 50 μ 用 with sterilized water. This reaction solution was placed in Smart Cycler SP (manufactured by TAKARA Bio) at 94. (: After processing for 30 seconds, repeat the cycle of 94 ° C / 30 seconds, 55 ° C / 30 seconds and 72 ° C / 30 seconds 30 times. Ugly (: 0571 is identification (: Ding 0 8880) Although the restriction enzyme can cut off the amplification product from the wild type of aldehyde dehydrogenase 2, it does not cut off the amplification product from the mutant type. As a result, in RFLP using Eco 571, it was observed that the amplification product was cut off. The second fragment produced, that is, in a genomic DNA specimen considered to be a wild-type homozygote, a significant increase in the ROX glory signal from the ALDH2 wG probe was observed. On the other hand, the ALDH2 mA probe was not generally observed Increase of 6-FAM fluorescence signal in needle. In RFLP using Eco 571, three fragments of the amplified product were cut off and those not cut off, that is, in the genomic DNA examination of the heterozygous junction In the body, a significant increase in the ROX fluorescence signal from the ALDH2 wG probe was observed. Also, a significant increase in the 6-FAM fluorescence signal from the ALDH2 mA probe was also observed. In the RFLP using Eco 5 71, an increase was observed A fragment of the product that has not been cut, that is, a heterotypic junction that is considered to be a variant A significant increase in 6-FAM fluorescence signal from the ALDH2 mA probe was observed in the genomic DNA specimen of the subject. On the other hand, no increase in ROX fluorescence signal 83954 -40-200401036 from the ALDH2 wG probe was observed. From the above, it can be confirmed that the results of the method of the present invention are consistent with the results of the previous RFLP method. Example 4 Review of PCR SNPs detection of aldehyde dehydrogenase 2 gene (1) Review of the detection in the model system and use of the chimerism of the present invention The real-time PCR reaction of the probe is a method for detecting SNPs. The target of the review was to select the same gene encoding the aldehyde dehydrogenase 2 enzyme as in Example 3. First, in order to perform the mutation of the aldehyde dehydrogenase 2 gene in the PCR reaction system For detection, a DNA synthesizer (manufactured by Applied Biosystem) was used to synthesize ALDH2-F primers and ALDH2-R primers having the base sequences described in sequence numbers 19 and 20 of the sequence listing, respectively, and then synthesize sequence numbers 15 and 1 of the sequence listing. The chimeric oligonucleotide of the base sequence described in 6, the ALDH2 wG probe for wild-type detection and the ALDH2 mA probe for variant detection. The ALDH2 wG probe for wild-type detection is at the 5 'end. Add the ROX logo as the fluorescent label and the DNA_RNA-DNA type nucleotrophic acid probe as the extinction label on the 3 'end. On the other hand, the ALDH2 mA probe for variant detection, A DNA-RNA-DNA type nucleoside g-man probe for attaching EcHpse as an extinction marker on the y-terminus and FAM as a fluorescent marker between 12 and 13 bases. Further, the fragments having the base sequence of 215 in the sequence numbers 17 and 18 in the sequence listing were respectively prepared by a conventional method, and then the fragments were individually selected and cloned into a P-GEM EASY vector (produced by Promega). These plastids were used as the wild type positive control group (sequence number 17) and the variant positive control group (sequence number 83954 -41 · 200401036 number 18). The positive control group was prepared to have a concentration of 2 x 104 sets per 1 μm. Therefore, if 5 μΐ of the above control group is used, each reaction will be 105 sets. The reaction of PCR is as follows, that is, using TaKaRa ExTaq R-PCR ver. (Manufactured by TAKARA Bio), adding 1 x r_pcr buffer, each 300 μM dNTPs, 5 mM magnesium solution, 1.25U ExTaq R-PCR ver., 100U Tli RNase Η II, 10 pmol of ALDH2-F primer and ALDH2-R primer pair, 5 pmol of ALDH2 wG probe, 20 pmol of ALDH2 mA probe, and 5 μ1 of each positive control group as template nucleic acid And adjust the final volume to 25 μΐ with sterilized water. This reaction solution was placed in a smart cycler (manufactured by TAKARA B10), and after being processed at 95 ° C for 10 seconds, it was repeatedly performed at 9 5 ° C / 5 seconds, 5 3 C / 1 5 seconds, and 72 C / 1 45 cycles in 5 seconds. The measurement of the fluorescence intensity was performed in the step of 5 3 ° C / 15 seconds. As a result, in the case where a wild-type positive control group was used as a template, a significant increase in the ROX fluorescence signal from the ALDH2 wG probe was observed. On the other hand, generally no increase in the? -FAM fluorescence signal from the ALDH2 mA probe was observed. In the case of using the variant positive control group as a template, a 6_FAM fluorescence signal from the ALDH2 mA probe was significantly increased. On the other hand, no significant increase in the Rox glory signal from the ALDH2 wG probe was observed. Furthermore, the same amount of mixture of the wild-type positive control group and the variant-positive control group was used as a template. The ROX fluorescence of the wG probe increased significantly. In addition, a 6-FAM fluorescence signal from a mA pin was significantly increased. From the above, it can be confirmed that the method is too old for tomorrow ’s evening, in a real-time PCR reaction system, 'by inserting wild-type and / or variable-type 箄 — 寺 — chimeric probes labeled at both ends- 42-200401036 Combined to identify single base polymorphisms of the aldehyde dehydrogenase 2 gene. (2) Detection in genomic DNA Review the SNPs detection method in the immediate pcR reaction system using human genomic DNA as a template. As a template nucleic acid, Aamp dna mini kit (QIAGEN) was used to prepare oral mucosal cells and blood samples provided after entering the treatment stage. Except that genomic DNA (50 ng / reaction) was used, it was performed under the same conditions as the reaction conditions described in Example 4- (1). In addition, the amplified product obtained by pairing the primers of the ALDH2-F primer and the ALDH2-R primer with Microcon-30 (Milipore) was purified at the same time, digested with Eco 571, and subjected to 3% NuSieve 3: 1 agarose gel electrophoresis. It is also determined by RFLP. Eco 571 is a restriction enzyme that recognizes CTGAAG. Although it can cut off the amplification products from the wild-type dehydrogenase 2 wild type, it will not cut off the amplification products from the mutant type. As a result, in the RFLP using Eco 571, two fragments resulting from the amplification product being cut off were observed, that is, in a genomic DNA specimen that was considered to be a wild-type homozygote, and an ALDH2 wG probe was observed. Rox fluorescence signal increased significantly. On the other hand, no increase in 6-FA M fluorescence 4s 5 tigers from the ALDH2 mA probe was generally observed. In use. In the RFLP of 571, three fragments of the amplified product and the non-cleaved product were observed, that is, ROX fluorescence from the ALDH2 wG probe was observed in the genomic DNA specimen considered to be a heterozygote. The signal increased significantly. In addition, a significant increase in 6-FAM fluorescence signal from the ALDH2 mA probe was also observed. In the RFLP using Eco 571, a fragment of the amplified product was not cut, that is, in the genomic DNA specimen of the heterozygote that is considered to be a variant, 83954 -43-200401036 was observed from the ALDH2 mA probe. The 6-FAM fluorescence signal of the needle increased significantly. On the other hand, 'the increase in ROX fluorescence signal from the ALDH2 wG probe was not generally observed. From the above, it can be confirmed that the results of the method of the present invention are consistent with the results of the previous RFLp method. Industrial Applicability The method for detecting a base substitution of the present invention is useful for detecting a base substitution that occurs naturally or is artificially introduced. According to the present invention, it is possible to detect the presence or absence of base substitution on a target nucleic acid simply, reproducibly, and with high sensitivity. Also, the present invention can be used to detect and identify base substitutions (such as SNPs) generated on genomic DNA of organisms such as polymorphisms and mutations, and can also be used in humans to search for disease genes, analyze drug sensitivity, and analyze genomic drugs. R & D and genomic medicine. Sequence Overview Sequence 5 Tiger 1 · Chimeric nucleotide primer IApp_F_2 for amplifying DNA of a part of human amylin gene. " Nucleotides 17 to 19 are ribose Nucleic acid-other nucleotides are deoxyribose riboic acid ,. SEQ ID NO: 2: Chimeric oligonucleotide primer [app-R-i] used to amplify the DNA of a part of the human amylin gene. "Nucleic acid 18 to 20 are ribonucleosides-other nucleotides are deoxyribonucleic acid,". Sequence editing 3 · Chimeric nucleus for detecting fragments of human wild-type starch insoluble gene Acid probe CAG (W2)., Ribonucleotide 8 to 1Q are ribonucleoborate_other nucleotides are deoxyribonucleic acid ". Sequence editing 4. For the detection of the human variant amylin gene 83954 -44- 200401036 pieces = chimeric oligonucleotide probe CGG (M2) U acid 8 to M are ribonucleotide-other nucleotides Is a deoxyribonucleotide. SEQ ID NO: 5: The eight sequence of the wild-type dianfen insoluble gene from humans. Knife sequence number 6: The eight sequence of the mutated temple-insoluble gene from humans. Knife sequence number 7 : Used to amplify one of the human starch insoluble genes, Zou Bazhi's leg & oligom primer IAPP_F]. "Core ⑴ to 叩: Glycosyl--other riboic acid is deoxyribonucleic acid ". SEQ ID NO: 8 & co-recruitment nucleus of DNA which is part of the amplified human insoluble gene: y: acid primer IApp_R6_. "Nucleic acid ^ ^ to μ are ribonucleic acid-other nucleotides are deoxyribonucleotides". SEQ ID NO: 9: PCR primer IAPP-F for amplifying DNA of a part of human amylin gene . SEQ ID NO: 10 · PCR primer IAPP-R for amplifying DNA of a part of human amylin gene. SEQ ID NO: 11: Probe IPAA9AFAM for detecting DNA fragment of human wild-type amylin gene. &Quot; Nuclear Nucleotide 9 is ribonucleic acid. Other ribonucleic acid is deoxyribonucleic acid: y: acid ". Sequence number 12: Probe IPAA9GFAM, a probe for detecting the DNA fragment of the human variant amylin gene. " Nucleic acid 9 is ribonucleic acid-other ribonucleic acid is deoxyribonucleic acid ". SEQ ID NO: 13: Chimeric oligonucleotide primer for amplifying DNA of a part of human aldehyde dehydrogenase 2 gene iCAN_ALDH2_F. Nucleic acid μ to add 83954 -45- 200401036 is ribonucleic acid _ other nucleotides are deoxyribonucleic acid ". Sequence, blunt 1 4. Chimeric nucleosome primer Ican aldh2_r used to amplify DNA of a part of human aldehyde dehydrogenase 2 gene. "Nucleic acid and even tritium are ribonucleic acid. Other ribonucleic acid is deoxyribonucleic acid. The sequence, 'Bin No. 1 5' is used to detect the a fragment of human wild-type aldehyde dehydrogenase 2 gene. Probe ALDH2 wG. Mu is ribonucleic acid. Other nucleotides are deoxyribonucleic acid ". Sequence number 16: for detecting human half δ_w

钿 j Human 颉 mutant aldehyde dehydrogenase 2 gene DNA slice and probe ALDH2 mA. &quot; Nuclear: y: acid 9 垃 ラ 她 &gt;#, 〇 甘 鲛 9 is a ribonucleotide _ other nucleotides are deoxyribose, ribonucleotide. SEQ ID NO: 17-Partial sequence of the wild MHase 2 gene from human. SEQ ID No. 18: Partial sequence of a human-derived variant acid dehydrogenase 2 gene. SEQ ID No. 19: PCR primer ALDH2F used to amplify DNA of a part of the human dehydrogenase 2 gene. SEQ ID NO: 20: PCR primer AlDH2R used for tjjs Α coffee, — used for ttian human cheekaldehyde dehydrogenase 2-based DNA. # 刀 之 SEQ ID NO: 21: Probe IAPP 8A MM for detecting human wild cyst fragments. "The other riboflavin of the ribonin gene is deoxyriboflavin." It is ribonucleotide. SEQ ID NO: 22: Probe IAPP 8G Rox used to detect human variant lake DNA fragments. „Nuclear» ‘lysin + other nucleotides of the gene are deoxyribonucleotides”. '' ', &Lt; Tang Nucleotide-Its 83954 -46-200401036 Sequence Listing &lt; 110 &gt; TAKARA BIO INC. &Lt; 120> Detection method of nucleotide substitution &lt; 130 &gt; &lt; 140 &gt; 092104652 &lt; 141 &gt; 2002-03-05 &lt; 150 &gt; JP 2002-62543 &lt; 151〉 2002-03-07 &lt; 160 &gt; 22 &lt; 170 &gt; Patentln Ver. 2. 1 &lt; 210 &gt; 1 &lt; 211〉 19 &lt; 212> DNA <213 &gt; Artificial Sequence &lt; 220 &gt; &223; Description of the combined DNA / RNA molecule: nucleotides 17 to 19 are ribonucleotides-other nucleotides are deoxyribonucleotides . &lt; 220〉 &lt; 223> Explanation of artificial sequence: Chimeric nucleotide primer IAPP-F-2 83954 &lt; 220> &lt; 220> 2⑽401036 &lt; for amplifying DNA of a part of human amylin gene 223> Explanation of the combined DNA / RNA molecule: nucleotides 17 to 19 are ribonucleotides-other nucleotides are deoxyribonucleotides. &lt; 400 &gt; 1 acactgccac atgtgcaac &lt; 210 &gt; 2 &lt; 211〉 20 &lt; 212 &gt; DNA &lt; 213> Artificial sequence &lt; 220 &gt; &lt; 223> Description of the combined DNA / RNA molecule: Nucleic acid 18 to 20 is a ribonucleotide-other nucleotides are deoxyribonucleotides "&lt; 220〉 &lt; 223〉 Description of artificial sequence: chimeric nucleus for DNA amplification of part of human amylin gene Acid primer IAPP-R-1 &lt; 400〉 2 cttgccatat gtattggauc 83954 200401036 &lt; 210 &gt; 3 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213〉 artificial sequence &lt; 220〉 &lt; 223〉 combined DNA / RNA Molecular description: Nucleotides 8 to 10 are ribonucleotides-other riboacids are deoxyribonucleotides. &lt; 220 &gt; &lt; 223 &gt; Description of the artificial sequence: a chimeric oligonucleotide probe CAG (W2) for detecting a DNA fragment of a human wild-type amylin gene. &lt; 400> 3 ttcattccag caaca &lt; 210 &gt; 4 &lt; 211 &gt; 15 &lt; 212 &gt; DNA &lt; 213> Artificial sequence &lt; 220> &lt; 223> Description of the combined DNA / RNA molecule: Nucleic acid 8 to 10 is a ribonucleotide-the other nucleotides are deoxyribonucleotides. 83954 &lt; 220 &gt; 200401036 &lt; 223 &gt; Description of the artificial sequence: a chimeric oligonucleotide probe CGG (M2) for detecting a DNA fragment of a human variant amylin gene. &lt; 400〉 4 ttcattccgg caaca 15

&lt; 210 &gt; 5 &lt; 211 &gt; 600 &lt; 212 &gt; DNA &lt; 213> artificial sequence &lt; 220 &gt; &lt; 223 &gt; Description of artificial sequence: A partial sequence of a part of a wild type amylin gene from human.

&Lt; 400 &gt; 5 aatctcagcc atctaggtgt ttgcaaacca aaacactgag ttacttatgt gaaaattgtt 60 tctttggttt tcatcaatac aagatatttg atgtcacatg gctggatcca gctaaaattc 120 taaggctcta acttttcaca tttgttccat gttaccagtc atcaggtgga aaagcggaaa 180 tgcaacactg ccacatgtgc aacgcagcgc ctggcaaatt ttttagttca ttccagcaac 240 aactttggtg ccattctctc atctaccaac gtgggatcca atacatatgg caagaggaat 300 gcagtagagg ttttaaagag agagccactg aattacttgc ccctttagag gacaatgtaa 360 ctctatagtt attgttttat gttctagtga tttcctgtat aatttaacag tgcccttttc 420 atctccagtg tgaatatatg gtctgtgtgt ctgatgtttg ttgctaggac atataccttc 480 tcaaaagatt gttttatatg tagtactaac taaggtccca taataaaaag atagtatctt 540 ttaaaatgaa atgtttttgc tatagatttg tattttaaaa cataagaacg tcattttggg 600 83954 -4- 200401036 &lt; 210 &gt; 6 &lt; 211> 600 &lt; 212 &gt; DNA &lt; 213> artificial Sequence &lt; 220 &gt;

&lt; 223> Explanation of artificial sequence: a partial sequence of a variant amyloidin gene from human. &Lt; 400> 6 aatctcagcc atctaggtgt ttgcaaacca aaacactgag ttacttatgt gaaaattgtt 60 tctttggttt tcatcaatac aagatatttg atgtcacatg gctggatcca gctaaaattc 120 taaggctcta acttttcaca tttgttccat gttaccagtc atcaggtgga aaagcggaaa 180 tgcaacactg ccacatgtgc aacgcagcgc ctggcaaatt ttttagttca ttccggcaac 240 aactttggtg ccattctctc atctaccaac gtgggatcca atacatatgg caagaggaat 300

gcagtagagg ttttaaagag agagccactg aattacttgc ccctttagag gacaatgtaa 360 ctctatagtt attgttttat gttctagtga tttcctgtat aatttaacag tgcccttttc 420 atctccagtg tgaatatatg gtctgtgtgt ctgatgtttg ttgctaggac atataccttc 480 tcaaaagatt gttttatatg tagtactaac taaggtccca taataaaaag atagtatctt 540 ttaaaatgaa atgtttttgc tatagatttg tattttaaaa cataagaacg tcattttggg 600 &lt; 210 &gt; 7 &lt; 211 &gt; 17 &lt; 212> DNA &lt; 213〉 Artificial sequence 83954 &lt; 220〉 &lt; 220〉 200401036 &lt; 223〉 Explanation of the combined DNA / RNA molecule: nucleotides 15 to 17 are ribonucleotides-other nucleotides are deoxyribonucleotides For acid. &lt; 220 &gt; &lt; 223> Explanation of artificial sequence: Chimeric oligonucleotide primer IAPP-F-1 for amplifying DNA of a part of human amylin gene. &lt; 400> 7 tgcaacgcag cgccugg &lt; 210 &gt; 8 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213> Artificial sequence &lt; 220> &lt; 223> Description of the combined DNA / RNA molecule: nuclear: y: acid 18 to 20 are ribonucleotides-other nucleotides are deoxyribonucleotides. &lt; 220> &lt; 223> Description of artificial sequence: Chimeric oligonucleotide primer IAPP-R6008 for amplifying DNA of a part of human amylin gene. 83954 200401036 &lt; 400 8 cccacgttgg tagatgagag &lt; 210 &gt; 9 &lt; 2U &gt; 20 &lt; 212 &gt; DNA &lt; 213〉 artificial sequence &lt; 220〉 &lt; 223〉 description of artificial sequence: used to amplify human amylin A part of the DNA primer IAPP-F. &lt; 400〉 9 tcacatttgt tccatgttac &lt; 210 &gt; 10 &lt; 211〉 22 &lt; 212〉 DNA &lt; 213〉 artificial sequence &lt; 220 &gt; &lt; 223> Description of artificial sequence: used to amplify the human starch insoluble gene Part of DNA PCR primer IAPP-R. 83954 200401036 &lt; 400 &gt; 10 caataactat agagttacat tg 22 &lt; 210 &gt; 11 &lt; 211〉 15 &lt; 212 &gt; DNA &lt; 213〉 Artificial sequence &lt; 220 &gt; &lt; 223〉 Explanation of the combined DNA / RNA molecule: nuclear Nucleotide 9 is a ribonucleotide-other nucleotides are deoxyribonucleotide. &lt; 220 &gt; &lt; 223 &gt; Explanation of artificial sequence: Probe IPAA 9A FAM for detecting DNA fragments of human wild-type starch insoluble gene. &lt; 400 &gt; 11 ttcattccag caaca 15 &lt; 210 &gt; 12 &lt; 211 &gt; 15 &lt; 212> DNA <213 &gt; Artificial sequence 83954 &lt; 220 &gt; 200401036 &lt; 223> Description of the combined DNA / RNA molecule: Nucleotide 9 is ribonucleic acid-other nucleotides are deoxyribonucleic acid. &lt; 220 &gt; &lt; 223> Explanation of artificial sequence: Probe IPAA 9G FAM for detecting a DNA fragment of a human variant amylin gene.

&lt; 400〉 12 ttcattccgg caaca 15 &lt; 210〉 13 &lt; 211〉 20 &lt; 212 &gt; DNA &lt; 213> artificial sequence

<220> &lt; 223> Explanation of the combined DNA / RNA molecule: nucleotides 18 to 20 are ribonucleotides-other nucleotides are deoxyribonucleotides. &lt; 220 &gt; &lt; 223 &gt; Explanation of artificial sequence: Chimeric oligonucleotide primer ICAN-ALDH2-F for amplifying DNA of a part of human aldehyde dehydrogenase 2 gene. 83954 200401036 <400 >> 13 agttgggcga gtacgggcug &lt; 210 &gt; 14 &lt; 211> 20 &lt; 212 &gt; DNA &lt; 213> Artificial sequence &lt; 220 &gt; <223 &gt; Description of the combined DNA / RNA molecule: nucleotides 18 to 20 is a ribonucleotide-the other nucleotides are deoxyribonucleotides. &lt; 220 &gt; &lt; 223 &gt; Description of artificial sequence: Chimeric oligonucleotide primer ICAN-ALDH2-R for amplifying DNA of a part of human aldehyde dehydrogenase 2 gene. &lt; 400 &gt; 14 cagaccctca agccccaaca &lt; 210〉 15 &lt; 211 &gt; 14 &lt; 212 &gt; DNA &lt; 213> Artificial sequence 83954 -10- &lt; 220> 200401036 &lt; 223> Explanation of the combined DNA / rna molecule · -Ribonucleotide η is ribonucleotide-other ribo acids are deoxyribonucleotides: y: acid. &lt; 220〉 &lt; 223〉 Explanation of artificial sequence · • Probe ALDH2 wG for detecting DNA fragment of human wild-type dehydrogenase 2 gene 〇 &400; 15 ggcatacact gaag 14 &lt; 210〉 16 &lt; 211 &gt; 17 &lt; 212 &gt; DNA &lt; 213〉 artificial sequence &lt; 220〉 &lt; 223 &gt; 郷, sugar core avoidance surface &lt; 220 &gt; &lt; 223〉 artificial sequence description: used to detect human variant aldehyde Probe ALDH2 mA for the DNA fragment of the catalase 2 gene. 83954 -11 · 17200401036 &lt; 400> 16 catacactaa agtgaaa &lt; 210) 17 <211> 215 &lt; 212 &gt; DNA &lt; 213> artificial sequence &lt; 220> description of aldehyde dehydrogenase 2 gene &lt; 223> artificial sequence : from the human wild-type of a portion of the sequence &lt; 400> 17 cagggtcaac tgctatgatg tgtttggagc cc.agtcaccc tttggtggct acaagatgtc 60 ggggagtggc cgggagttgg gcgagtacgg gctgcaggca tacactgaag tgaaaactgt 120 gagtgtggga cctgctgggg gctcagggcc tgttggggct tgagggtctg ctggtggctc 180 ggagcctgct gggggattgg ggtctgttgg gggct 215 &lt; 210 &gt; 18 &lt; 211 &gt; 215 &lt; 212 &gt; DNA <213 &gt; artificial sequence &lt; 220> &lt; 223> Description of artificial sequence: a partial sequence of a mutant aldehyde dehydrogenase 2 gene derived from humans 83954 -12- 200401036 &lt; 400 &gt; 18 cagggtcaac tgctatgatg tgtttggggc ccagtcaccc. tttggtggct acaagatgtc 60 ggggagtggc cgggagttgg gcgagtacgg gctgcaggca & tacactaaag tgaaaactgt 120 gagtgtggga cctggg; ggggctggggctctggggctctggggctctggggctctgggg 212 &gt; DNA &lt; 213 &gt; Artificial Sequence &lt; 220 &gt; &lt; 223 &gt; Explanation of Artificial Sequence: PCR primer ALDH2F used to amplify the DNA of a part of the human aldehyde dehydrogenase 2 gene. &lt; 400〉 19 cagggtcaac tgctatgatg t 21 &lt; 210〉 20 &lt; 211〉 21 &lt; 212〉 DNA &lt; 213 &gt; artificial sequence 83954 '13- &lt; 220 &gt; 200401036 &lt; 223> Explanation of artificial sequence: A PCR primer ALDH2R that amplifies a portion of the human aldehyde dehydrogenase 2 gene. &lt; 400 &gt; 20 agcccccaac agaccccaat c &lt; 210 &gt; 21 &lt; 211 &gt; 14 &lt; 212〉 DNA &lt; 213〉 Artificial sequence &lt; 220〉 &lt; 223> Description of combined DNA / RNA molecule: Nucleotide 8 Ribonucleotides-Other nucleotides are deoxyribonucleotides. &lt; 220 &gt; &lt; 223 &gt; Description of artificial sequence: Probe IAPP 8A for detecting a DNA fragment of a human wild-type amylin gene. &lt; 400 &gt; 21 tcattccagc aaca &lt; 210 &gt; 22 83954 -14- 200401036 &lt; 211 &gt; 14 &lt; 212 &gt; DNA &lt; 213〉 Artificial sequence &lt; 220〉 &lt; 223〉 Description of the combined DNA / RNA molecule: Nucleotide 8 is a ribonucleotide-the other nucleotides are deoxyribonucleotides. <220> &lt; 223> Explanation of artificial sequence: Probe IAPP 8G for detecting a DNA fragment of a human variant amylin gene. &lt; 400〉 22 tcattccggc aaca 83954 -15-

Claims (1)

200401036 Scope of patent application: 1. A composition for detecting whether there is a base substitution in a specific base on a target nucleic acid, which comprises: (a) primers that can increase the area of the target nucleic acid containing a specific base ° Mysterious primers contain at least a member selected from deoxyribonucleic acid and riboic acid analogs and ribonucleotides, and the ribonucleotides are arranged at the 3 ′ end of the primer or at least 2 on the end side Kinds of oligonucleotide primers; (b) Probes that can hybridize to private nucleic acids containing the aforementioned specific bases and can be cleaved by nucleases or not depending on the type of the known bases; (Ii) a hydrazone polymerase having a strand displacement activity; and (d) a nuclease. 2. A composition for detecting whether there is a base substitution in a specific base on a target nucleus μ + Μ &amp; nucleus, comprising: (a) the target nucleic acid can be &amp; y containing a specific base The introduction of regional growth is related. At least two oligonucleotide primers containing at least two members selected from the group consisting of deoxyribonucleic acid and ribonucleotide analogs; (b) can hybridize with the target nucleic acid, including four specific bases, and the region containing the above specific base 'And probes that can be cleaved or not cleaved by nucleases depending on the types of specific bases mentioned above, and will not be cleaved by DNA * 入 略 七 c 口 ## 51 y 3, exonuclease activity cleaved probes (C) DNA polymerase, and (d) Nuclease. 3. If the compound of the 9th member of the scope of the patent application, the DNA polymerase 83954 is a DNA polymerase with strand replacement activity. 4. The composition of members 1 and 2 of the scope of application for a patent, wherein the probe is a probe containing riboribamic acid, and the ribozyme is a ribonuclease. 5 · —A kind of base substitution test and method, which is a method for detecting whether there is a test group replacement in a specific test group on a target nucleic acid, which is characterized by comprising cultivating a composition containing the following components: # Only double-check whether the probes in the composition are cut off, (a) the target nucleic acid; (b) at least one type of phytosynthesis —… I nucleotide primer, which is above the target nucleic acid = specific test 3, the test sequence of the terminal side is substantially complementary, and has at least a member selected from deoxyribonucleotides and nucleotide analogs and ribonucleotides, and the ribonucleotide system Placed on the 3, end or y-terminus side of the primer; (C) can hybridize to the target nucleic acid region containing the specific base mentioned above, and the type of the base can be cleaved or not cleaved by a nuclease Probes; (d) DNA polymerases with strand displacement activity; and (e) nucleases. A method for detecting base replacement is a method for detecting whether there is a base replacement for a specific base on a target nucleic acid, which is characterized by including cultivating a composition containing a lower knife, and then detecting whether the probe in the composition is cut off. Steps: (a) the target nucleic acid; (b) at least one oligonucleotide primer, which is substantially complementary to the base sequence of the target nucleic acid 3, too @,? And contains at least a member selected from the group consisting of deoxyribonucleic acid and nuclear acid; the type of the test base may be hybridized with the region of the nucleic acid containing the specific base described above; Probes that are cleaved or not cleaved by nucleases and that do not cleave DNA polymerase 3, exonuclease activity; (d) DNA polymerase; and (e) nuclease. For example, the detection method according to item 8 of the patent scope, wherein the DNA polymerase is a DNA polymerase having strand replacement activity. 8. The detection method according to item 5 or 6 of the patent application scope, wherein the composition contains two kinds of primers. 9 'The detection method according to claim 5 or 6, wherein the probe is a ribonucleotide-containing probe, and the nuclease is a ribonuclease. 10. The detection method of claim 5 or 6, wherein the composition is incubated under isothermal conditions. 11. A hybrid nucleic acid primer comprising a base sequence of SEQ ID NO: 1, 2, 7, 8, 13, or 14 of the sequence listing. 12 · — Oligonucleotides: y: acid primers having a base sequence of sequence number 9, 10, 19, or 20 of the sequence listing. 1 3. A chimeric oligonucleotide primer ' having a base sequence of sequence number 3, 4, 11, 12, 15, 16, 21, or 22 of the sequence listing. 1 4. A composition for detecting whether there is a base substitution in a specific base on a target nucleic acid, comprising: 83954 200401036 (species of cleavage nucleotide primers, and the specific / base of the target nucleic acid 1 2 The test sequence at the terminal end is substantially complementary and contains at least a member selected from the group consisting of denucleotide and nucleoside ^ 1 and nucleotide analogs, and ribonucleoside, and the ribonucleoside® The line is arranged at the 3 'end or the 3' end side of the primer; and the package 15. () Under the condition of selective fermentation, it is possible to select whether to hybridize the probe to the target nucleic acid region containing the above specific base. This kind of test base is set up. $ 丨 person, a, i ^., Other methods' It is a method for detecting whether there is a base substitution in a specific test base on the target nucleic acid,., 1 is a method, which is characterized by including cultivation and containing the following Composition of ingredients, i.e., Bt #, and then step of measuring whether the probe in the composition is cut off: (a) the target nucleic acid;, b), to 1 chimeric oligonucleotide Primers, which are substantially complementary to the target nucleic acid = 4 inches, 3 bases, and the base sequence on the end side, At least 16.83954 1 has a member selected from the group consisting of deoxyribonucleotides and nucleotide analogs, and 2 ribonucleosides, and the ribonucleotide is disposed on the 3 or terminal side; 3 scoops :) Under specific temperature conditions, you can choose whether to hybridize the probe to the above-mentioned specific base region on the target nucleic acid; (d) DNA polymerase, and (e) nuclease. A kit for detecting whether there is a base substitution in a specific base on a target nucleic acid, including: U) At least one chimeric oligonucleotide primer, which is above the target nucleic acid 200401036 = special, base The 3 ′ terminal side test sequence is substantially complementary and contains at least a member selected from the group consisting of deoxyribonucleic acid and ribonucleic acid analogs, and ribonucleic acid, B # &gt; k At the 3, end, or 3 end side of the primer; and ⑻ can hybridize to the target nucleic acid region containing the above-mentioned specific test substrate 'see above for the types of test substrates that can be cleaved by nucleases or not . 7. A set of test sample substitutions in a specific test sample of the target nucleic acid ±, comprising: (a) at least one oligonucleotide primer, which is 3 'to the specific test sample of the target nucleic acid The test sequence on the side is substantially complementary; and (b) it can hybridize to the region of the target nucleic acid that contains the above-mentioned specific base: the type of the test substrate can be cleaved by the nuclease or not, and Probe that will be cleaved by 53 DNA polymerase, exonuclease activity. 18. A set of bismuth-tested nucleic acids that determine whether there are base substitutions for specific bases, comprising: (a) at least one chimeric oligonucleotide primer that is related to the specific base of the target nucleic acid 3, the base sequence on the terminal side is substantially complementary, and contains at least a member selected from deoxyribonucleotides and nucleotide analogs and ribonucleotides', and the ribonucleotide is arranged in the The 3, end, or 31 end of the primer; and (b) a probe that can choose whether to hybridize to a region containing the above-mentioned specific base on the target nucleic acid under specific temperature conditions. 83954 200401036 H-specific characteristics of the target nucleic acid Is there a test group replacement set in the line base, which includes: (a) at least one oligonucleotide primer that interferes with the target nucleic acid j, the 3 'end of the base Sequence 4 is substantially complementary and contains at least a member selected from the group consisting of deoxyribonucleic acid and riboic acid, and (b) whether or not the target nucleic acid can be selected under certain temperature conditions. Probe for region hybridization of the above specific test substrate. 83954 200401 036. Designated representative map: (1) The designated representative map in this case is: (). (2) The representative symbols of the representative map are briefly explained: 捌 If there is a chemical formula in this case, please disclose the one that can best show the characteristics of the invention. Chemical formula: 83954