TH26798U - Fosetyl-aluminum colorimetric test kit. - Google Patents

Claims (3)

OCR 10KL (07/08/2568) 1. A primer set specific to the SNP molecular marker in the xa5 gene at position 437499 on chromosome 5, associated with resistance to rice leaf streak disease, consists of primers with the following base sequences: Forward primer line 1 (BLS_5_437499-FAM-F) with the base sequence: 5' GAGCTCGCCATTCAAGTTCTTGA 3'; Forward primer line 2 (BLS_5_437499-HEX-F) with the base sequence: 5' GAGCTCGCCATTCAAGTTCTTGT 3'; and Reverse primer (BLS_5_437499-R) with the base sequence: 5' GATAGTAATAGGTGGAAGGAGATATGGTA 3'. 2. The selection process for rice resistant to rice streak disease using primers specific to the SNP molecular marker in the xa5 gene at position 437499 on chromosome 5, associated with rice streak disease resistance according to claim 1, involves the following steps: a. Amplification of the DNA extracted from rice samples using primers specific to the marker. SNP molecules labeled with fluorescent markers on forward primers using PCR technique. b. SNP genotyping analysis based on PCR product fluorescence, where the fluorescence of the PCR product specific to forward primer line 1 (BLS_5_437499-FAM-F) indicates the presence of the AG allele, and the fluorescence of the PCR product specific to forward primer line 2 (BLS_5_437499-HEX-F) indicates the presence of the TC allele, found in susceptible varieties. The genotype of the resistant variety is AG/AG, and the genotypes of the susceptible variety are TC/TC and AG/TC. 3. Selection process of rice resistant to photosynthetic leukopenia using a primer set specific to SNP molecular markers associated with photosynthetic leukopenia resistance trait according to claim 2, where selected rice samples are from leaves, seeds, roots, panicles, stems, individually or in combination.