TH26206U - Primer kits for the detection of Listeria monocytogenes using the LAMP and LAMP-LFD techniques. - Google Patents

Abstract

OCR 10KL (07/11/2024) Primer kit for the detection of Listeria monocytogenes using the LAMP and LAMP-LFD techniques. The primer kit for the detection of Listeria monocytogenes using the LAMP and LAMP-LFD techniques consists of primers and probes, where the primers... Use the following base sequences: Primer Name (primers) Base Sequence (5'-3') Length (bp) Lis_4-F3 (Lis_4-F3) TTITCGCAGGTTCGGTTA 18 Lis_4-B3 (Lis_4-B3) GAAACGACTACTTCTTTTGCT 21 Lis_4-FIP (Lis_4-FIP) TAAGAAACTTTCGCCCATTGGTAC-CATTTGGTTGCTAAACTACGC 45 Lis_4-BIP (Lis_4-BIP) CACTACTCGTTCCGCTTGGT-AGAAAACCAGGTATAAGGGT 21 DIG-Lis_4-FIP (DIG-Lis_4-FIP) DIG-TAAGAAACTTTCGCCCATTGGTAC-CATTTGGTTGCTAAACTACGC 45 Biotin-Lis_4-Probe The Biotin-Lis_4-probe (Biotin-GCAATTATCGGTGGCATGCT 20) was developed using optimal reaction concentrations and conditions. Listeria monocytogenes was pre-enriched at 37°C for 12 hours, and DNA was extracted via boiling and centrifugation. The optimal reaction temperature was 60°C for 60 minutes. 8 µL of the LAMP product was added to 100 µL of room temperature essence buffer solution, mixed thoroughly, and the LFD plate was immersed in the mixture. After approximately 5 minutes, the results were read.

Claims (3)

OCR 10KL (07/11/2567) 1. Primer kit for Listeria detection. Listeria monocytogenes was detected using the LAMP and LAMP-LFD techniques, employing primers and probes. The primers used had the following base sequences: Primer Name, Base Sequence (5'-3'), Length (bp): Lis_4-F3, TTTTCGCAGGTTCGGTTA, 18; Lis_4-B3, GAAACGACTACTTCTTTTGCT, 21; Lis_4-FIP, TAAGAAACTTTCGCCCATTGGTAC-CATTTGTTGCTAAACTACGC, 45; Lis_4-BIP, CACTACTCGTTCCGCTTGT-AGAAAACCAGGTATAAGGGT, 21; Dick-Lis_4-FIP. (DIG-Lis_4-FIP) DIG-TAAGAAACTTTCGCCCATTGGTAC-CATTTGGTTGCTAAACTACGC 45 Biotin-Lis_4-probe (Biotin-Lis_4-probe) Biotin-GCAATTATCGGTGGCATGCT 20 2. A set of primers for the detection of Listeria monocytogenes using the LAMP and LAMP-LFD techniques under Patent 1, where the probe used has the following base sequence: Biotin (Biotin-GCAATTATCGGTGGCATGCT). 3. Primer kit for Listeria detection. Listeria monocytogenes (Listeria monocytogenes) using the LAMP and LAMP-LFD techniques according to patent 1 or 2, with the following reaction concentrations and optimal reaction conditions: The reaction consists of 0.4 µmolar each of DIG-labeled Lis-4-BIP primers, 0.8 µmolar each of Lis-4-F3, Lis-4-B3, and biotin-labeled probe, 1.4 millimolar of dNTPs, 4 millimolar of magnesium sulfate (MgSO4), and the enzyme BST DNA polymerase. (Bst DNA polymerase) 8 units, supplied buffer (Tris hydrochloride) (Tris-HCl) 20 millimolar, (ammonium sulfate) ((NH4)2SO4) 10 millimolar, (potassium chloride) (KCl) 10 millimolar, (magnesium sulfate) MgSO4 2 millimolar, (Triton X)-100 0.1 percent, pH 8.8) 1x concentration, Betaine 0.8 molar, Listeria DNA sample. Listeria monocytogenes, pre-enriched in tryptic soy broth (TSB) at 37°C for 12 hours, was used to extract DNA via boiling and centrifugation. 2 µL of DNase- and RNase-free distilled water was added to adjust the total volume to 25 µL. The optimal temperature was determined by performing the reaction at 60°C for 60 minutes. 8 µL of the LAMP product was added to a tube containing 100 µL of assay buffer at room temperature, mixed thoroughly, and an LFD plate was immersed in the mixture for 5 minutes. The results were then read.