TH19731C3 - DNA probes and primers specific to genes involved in immune and stress responses in white shrimp and their expression level measurement process. - Google Patents

Abstract

Summary of the invention which appears on the advert page ReadFile:------06/11/2020------(OCR)This invention involves a DNA probe and a group-specific primer. The genes involved in the immune and stress responses of white shrimp have been developed and optimized with high specificity and precision on the target genes and can be applied for the measurement of levels. The simultaneous expression of several genes with this artificial beadarray technique enables the expression of both individual and more than two genes to be measured simultaneously per sample to be tested. By using less time resulting in lower cost compared to standard method, real-time polymerase chain reaction method sees the probe and primer as fabricated. This has the potential to be developed into a series of probes and primers for measuring the expression levels of genes involved in the immune system and stress response of white shrimp, which can be applied to beada techniques. The real-time ray and polymerase chain reaction methods depend on the objectives of each task, which can be beneficial. especially for aquaculture industry, animal feed and aquaculture etc.--------------Page 1 of 1 Page Summary of invention This invention deals with DNA probes and plants. The gene-specific mers involved in the immune and stress response of white shrimp have been developed and optimized with high specificity and precision to the target genes and can be taken. Applied for simultaneous measurement of the expression of several genes using bead array techniques, this fabrication enables the measurement of both individual and more than two gene expression levels simultaneously. This results in a lower cost compared to the standard real-time polymerase chain reaction method. The invention primer has the potential to be developed into a series of probes and primers for measuring the expression levels of genes involved in the immune system and stress response of white shrimp. It can be applied to bead-array techniques and real-time polymerase chain reaction methods. It depends on the objectives of each work, which will be of great benefit to the aquaculture, feed and breeding industries, etc.

Claims (7)

Claims (all) which will not appear on the classifieds page:------06/11/2020------(OCR) 1.DNA probe kits specific to the genes associated with The immune system and stress response of white shrimp consisted of at least one selectable probe DNA from A. The first DNA probe specific to the alf1 gene had the nucleotide sequence GGAGTTCATGGGTcACAGCTGCAGGTACAGTCAGCGGGCCCTCCTTCTATAB DNA probe. The second, pen3a gene-specific, has a nucleotide sequence, TCCTTCGCCCTGGTCTGCCAAGGCCAAGTGTACAAGGGCGGTTACACGCG. The third proPO gene-specific DNA has a nucleotide sequence, CCTGCACAACATAGGCCACGACATCCTGGCCTTCTCGCCACGATCCTGACA, with the fourth gene specific to the pen3a gene. lec has a nucleotide sequence GCGAGAAGGGCCAGGCACAGTGCCACCCAACGGAGACGATCAGTGCATAe. The fifth DNA probe specific to lyz gene has a nucleotide sequence ATAAACCGCCAACAGAAACCGCCAGCACGGACTACGGCATCTTCCAGATcAAf. The sixth nucleotide DNA sequence is specific to the lyz gene. The otide is TCCATGAAGACCTACGTCAAGTGGGGAGACGCTAAGTTTTGGGAAAAGCT. The seventh DNA probe specific to the imd gene has the nucleotide sequence ACGAGATGATGAGTCGCTGGCATGACAGGGA. The hsp70 gene-specific DNA probe has the nucleotide sequence CGCTGCGCGCGCTGCCTGTGAGCGTGCGAAGCGTACCCTGTCTTCCTCGACG The hsp90 gene-specific DNA probe contains the nucleotide sequence ACGAGGAGCGCGCTGAACAAGGACGAGGCC. The tenth nucleotide specific to the EF1a gene has the nucleotide sequence AGCAAGGGAAGCTGCTGACTTCACCGCCCAGGTGATCGTCCCTCAACCACC. 2. The gene-specific primer kits involved in the immune system and stress response of white shrimp consisted of at least one selectable primer set from a specific first primer set. The alf1 gene consists of the front primer AGGACCTCATCCCTTCGCTAGT the rear primer GGACACCACATCCTGCCATTGAb. The per3a gene-specific second primer consists of the front primer CGTGGTCTGCCTGGTCTTCTT rear primer CAAAGGTCTCACGAAGGGTGGTc. The proPO gene-specific third primer consists of ACAGCGGTcAACTTCCCTTAC front primer, GCCCATTTTCCTCCTTGTGAGA front primer, CGCTGATGGCTCGGATGAGA front primer. lyz gene-specific fifth primer set consisting of front primer GGAGTTCGAGTCGTCCTTCTCAACA rear primer GTTAGTCGCTTCCGCACCAGTAf. toll gene-specific sixth primer set consists of front primer. CGAGAGCGAGTTGGACGAGAAG back primer CCTGTGGGTGTGGCATGATGTAb. The seventh primer series imd gene-specific consists of front primer GGTAGCTGGAACATGATAG rear primer cACGTTG. ATAAGCCTTcACCTTA hsp70 gene-specific eighth primer set consisting of a front primer GAAGGACCCAAGTGAGAACAA a back primer GGGTGATGGAGGTGTGTAGAAATC.hsp90 gene-specific primer set consists of a front primer AAAGAAGACCGTGAAGGAGAAG. CTGTGGAACTCGCCGTACTC rear primer and EF1a gene-specific tenth primer series consist of front primer CGTGCCTTCCGACTCGAAGAA rear primer TGGCAATCAAGCACAGGTGAGTAG. 3. The process of measuring the expression level of target genes related to immune system and stress response in white shrimp using the Claim 1 DNA probe set or the Claim 2 primer, where The process consists of a. Immobilization of target gene-specific DNA probes to gene-specific beads in the immune system and the white shrimp stress response to obtain beads that are immobilized to the required DNA probes. b. Complementary DNA synthesis from RNA extracted from biological samples of white shrimp, then DNA amplification and target DNA labeling with biotin by biotin. PCR or polymerase chain reaction with the use of target gene-specific primer combinations to obtain biotin-labeled PCR products and signal assays. The expression of target genes by bead-array technique by using beads immobilized with DNA probe according to A. and PC-Area products with biotin labeling according to Article B were used to hybridize. Ridization then eliminated the PCR product that does not bind to the DNA probe and added streptavidin-ar-phycorythin to bind to biotin. attached to the target gene 4. The process of measuring the expression level of immune-related target genes and stress response of white shrimp according to claim 3, where the immune target gene and stress response of white shrimp were selective. at least one from the alfl gene, pen3a gene, proPO gene, iec gene, lyz gene, toll gene, imd gene, hsp70 gene, hsp90 gene, and EF1a gene. 5.Procedure for measuring the expression level of target genes related to immune system and stress response of white shrimp according to claim 3, where the beads contain polystyrene and fluorescent. 6. The process of measuring the expression level of target genes involved in the immune and stress response of white shrimp according to claim 3 in which the PCR constituents or polymerase chain reactions are composed. a. final concentration of buffer solution is IX b. final concentration of nucleotides (dNTPs) is 150-200 micromolar magnesium chloride (MgCl2), final concentration is 2-2.5mmola. The final concentration of primer forward was 50-100 nm. Primer reversed the final concentration was 50-100 nm. Tac DNA Polymerase Enzyme. The final concentration was 1.25 m dimethyst sulfoxide units (DMSO), the final concentration was 2-5% by volume H, 1-2 micrograms of DNA sample with distilled water. 7. The process of measuring the expression level of target genes involved in the immune and stress response of white shrimp according to claim 3, where the optimal conditions for the polymerase chain reaction to increase The DNA count and biotin labeling of the target DNA were 194°C, 3min 2nd stage (25 cycles)94°C, 30s 54-56°C, 30s 72°C, 1 min. At 372 degrees Celsius, 5 minutes--------------Page 1 of the number 4 claims page 1. The gene-specific DNA probe kits involved in the immune system and stress response of white shrimp consisted of at least one selectable probe DNA strand from a first DNA probe specific to the alpha1 gene sequence. The nucleotide is GGAGTTCATGGGTCACAGCTGCAGGTACAGTCAGCGGGCCCTCCTTCTATAb. The second DNA probe specific to the pen3a gene has the nucleotide sequence TCCTTCGCCCTGGTCTGCCAAGGCCAAGTGTACAAGGGCGGTTACACGCGC. The third DNA probe nucleotide specific to the proPO gene is sequenced. is CCTGCACAACATAGGCCACGACATCCTGGCCTTCTCGACGATCCTGACAd. The fourth gene-specific DNA probe lec has the nucleotide sequence GCGAGAGAAGGGCCAGGCACAGTGCCACGCAACGGACGATCAGTGCATAe. The fifth gene-specific DNA probe has the nucleotide sequence is GCGAGAGAAGGGCCAGGCACAGTGCCACGCAACGGACGATCAGTGCATA. The sixth gene-specific toll has a nucleotide sequence, TCCATGAAGACCTACGTCAAGTGGGGAGACGCTAAGTTTTGGGAAAAGCT. The seventh gene-specific DNA probe has an imd nucleotide sequence, ACGAGATGATGAGTCGCTGGCATGACAGGGAGGCTGAGGACGCGACCGTG. The hsp70 gene has a nucleotide sequence. ACGCCTGCGGTACTGCCTGTGAGCGTGCGAAGCGTACCCTGTCTTCCTCGAC The ninth DNA probe specific to the hsp90 gene has the nucleotide sequence ACGAGGAGCGCTGAACAAGAAGAGCCCCTGGACGCGCAACCCCCCGACGACCACCGACTGTCAGTCAGTCAGTCAGCCTGAGCCTGAGCCtigen. 2. The gene-specific primer kits involved in the immune system and stress response of white shrimp consisted of at least one selectable primer set from a specific first primer set. The alf1 gene consists of an AGGACCTCATCCCTTCGCTAGT front primer of 4 GGACACCACATCCTGCCATTGA front primers. The pen3a gene-specific second primer set consists of a front primer CGTGGTCTGCCTGGTTCTTCTT side primer. After CAAAGGTCTCACGAAGGGTGGTc. The proPO gene-specific third primer set consists of the front primer ACAGCGTCAACTTCCCTTAC, the back primer GCCCATTTTCCTCCTTGTGTGA. The lec gene-specific fourth primer set consists of the front primer. CGCTGATGGCTCGGATGAGA back primer AGGCTGAGTTCGGTGTGGCAATAGe lyz gene-specific fifth primer consists of front primer GGAGTTCGAGTCGTCCTTCAACA back primer GTAGTCGCTTCCGCACCAGTAf. Consists of front primer CGAGAGCGAGTTGGACGAGAAG rear primer CCTGTGGGTGTGGCATGATGTAch. The seventh primer set imd gene-specific consists of front primer GGTAGCTTGGAGAACATGATAG primer. The hsp70 gene-specific primer set consists of the front primer GAAGGACCCAAGTGAGAACAA, the rear primer GGGTGATGGAGGTGTGTAGAAATC, the hsp70 gene-specific primer set, contains the hsp90 gene-specific primer. Front primer AAAGAAGACCGTGAAGGAGAAG, rear primer, CTTGTAGAACTCGCCGTACTC, and EF1a gene-specific tenth primer series consist of front primer CGTGCCTTCCGACTCGAAGAA rear primer, TGGCAATCAAGCACAGGTGTGAGTAG, page 3 of four pages. 3. The process of measuring the expression level of target genes involved in the immune system and stress response of white shrimp using a DNA probe and primer combination according to claim 1 or 2, where the process consists of A. The immobilization of the target gene-specific DNA probes to the gene-specific beads in the immune and stress responses of white shrimp to obtain the gene-specific immobilized beads to the gene-specific DNA probes. Type b. Synthesis of complementary DNA from RNA extracted from biological samples of white shrimp, then DNA amplification and labeling of the target DNA with biotin by PCR or Polymerase chain reaction using target gene-specific primer combinations to obtain biotin-labeled PCR products and c. target gene expression signal assays. By bead-array technique, hybridization of beads that are fixed with DNA probes according to A. and PCR products with biotin-labeled substances according to clause B. are used for hybridization. The PCR product that does not bind to the DNA probe was then removed and added streptavidin-ar-phycorythine to bind to the attached biotin. target 4. The process of measuring the expression level of immune-related target genes and stress response of white shrimp according to claim 3, where the target genes in the immune system and stress response of white shrimp were selective. Atf1 gene, per3a gene, proPO gene, lec gene, lyz gene, toll gene, imd gene, hsp70 gene, hsp90 gene and EF1a gene. 5.Procedures for measuring the expression level of target genes related to immune system and stress response of white shrimp according to claim 3, where the beads consisted of polystyrene and fluorescent. 6. The process of measuring the expression level of target genes involved in the immune and stress response of white shrimp according to claim 3 in which the PCR constituents or polymerase chain reactions are composed. a. final concentration of buffer solution is 1X b. final concentration of nucleotides (dNTPs) is 150-200 micromolar magnesium chloride (MgCl2), final concentration is 2-2.5mmola. The final concentration of primer forward was 50-100 nm, the final concentration of primer reversed was 50-100 nm. The final concentration of DNA polymerase was 1.25 h dimethyst sulfoxide units (DMSO), the final concentration was 2-5% by volume, the DNA sample was 1-2 mcg water. refined 7. The process of measuring the expression level of target genes involved in the immune and stress response of white shrimp according to claim 3, where the optimal conditions for the polymerase chain reaction to increase The DNA count and biotin labeling of the target DNA were 194°C, 3 min 2nd stage (25 cycles) 94°C, 30 sec 54-56°C, 30 sec 72°C. ,1 minute step 372 degrees Celsius,5 minutes