TH18512Y - Primer kit and method for the detection of Scale Drop Disease Virus (SDV) in sea bass. - Google Patents

Abstract

------01/05/2020------(OCR) Page 1 of 1 Summary of Invention This invention develops a simple and rapid LAMP (Lamp Applications) method for detecting Scale Drop Disease Virus (SDDV) in sea bass. The reaction process is straightforward, utilizing a set of six primers specific to eight base sequences on the adenosine triphosphatate (ATPase) gene of the Scale Drop Disease Virus. The LAMP reaction is performed at an optimal temperature of 65°C for 60 minutes. This results in a specific, rapid, and uncomplicated diagnostic method for Scale Drop Disease Virus in economically important aquatic animals, eliminating the need for expensive equipment. ------------ Page 1 of 1 Summary of Invention This invention develops a simple and rapid LAMP (Lamp Applications) method for detecting SDDV in sea bass. The reaction process is straightforward, utilizing a set of six primers specific to eight base sequences on the adenosine triphosphatate (ATPase) gene of the Scale Drop Disease Virus. Six primers specific to eight base sequences on the adenosine triphosphatate (ATPase) gene of the SDDV virus were used. The LAMP reaction was performed under optimal conditions of 65°C for 60 minutes. This method provides a specific, rapid, and uncomplicated diagnostic technique for SDDV in economically important aquatic animals, eliminating the need for expensive equipment.

Claims (8)

------01/05/2563------(OCR) Page 1 of 2 pages. Claim 1. The primer kit for detecting Scale Drop Disease Virus (SDR) in sea bass consists of: a. Outer primer SDDV-ATPS-forward outer primer (SDDV-ATPase-F3) with base sequence 5’-AATGACCGAAATACGACCG-3’; b. Outer primer SDDV-ATPS-backward outer primer (SDDV-ATPase-B3) with base sequence 5’-CTAGTTGTCGTTTCTTGACTCT-3’; c. Inner primer SDDV-ATPS-forward inner primer (SDDV-ATPase-FIP) with base sequence 5’-TTTTCCACGGCCCGGTTTTTTT ACGACGATGAAATCGGAG-3’; d. Inner primer SDDV-ATPS-backward inner primer (SDDV-ATPase-BIP) with... The base sequence is 5’- CCGCAGCGGTTGTCATTTCTTTTG TAACATTCTGGAACTAACCCA-3’. The loop primer SDDV-ATPase-Loop Forward (SDDV-ATPase-LF) with the base sequence 5’- GCCCAAAACAACCAATTTCATC -3’ and the loop primer SDDV-ATPase-Loop Backward (SDDV-ATPase-LB) with the base sequence 5’- TGGTTCAGAAGAAGCCAATCA -3’ are used. 2. The method for detecting Scale Drop Disease Virus (SDDV) in sea bass using the primers under Patent 1 consists of: a. Performing a LAMP reaction by mixing the DNA extracted from the biological sample to be tested for Scale Drop Disease Virus with a LAMP solution containing a set of primers. According to claim 1, the buffer solution, magnesium sulfate solution, betaine, deoxynucleotide, and BST DNA polymerase are used as LAMP products, and b. Analysis for Scale Drop Disease Virus from LAMP products. 3. Method for detecting Scale Drop Disease Virus causing scale defoliation in sea bass according to claim 2, where the buffer solution consists of tris hydrochloride, ammonium sulfate, potassium chloride, magnesium sulfate, octylphenoxypolyethoxyethanol. 4. Method for detecting Scale Drop Disease Virus causing scale defoliation in sea bass. According to claim 2, the concentrations of the lamp solutions are as follows (page 2 of 2): a. Outer primer SDDV-ATPS-forward outer primer 0.2 µmolar; b. Outer primer SDDV-ATPS-backward outer primer 0.2 µmolar; c. Inner primer SDDV-ATPS-forward inner primer 2.0 µmolar; d. Inner primer SDDV-ATPS-backward inner primer 2.0 µmolar; e. Loop primer SDDV-ATPS-loop forward 2.0 µmolar; f. Loop primer SDDV-ATPS-loop backward 2.0 µmolar; g. Buffer solution at concentration 1x pH 8.8 containing 20 millimolar Tris hydrochloride (Tris-HCl). Ammonium sulfate (NH4)2SO4 10 millimolar, potassium chloride (KCl) 10 millimolar, magnesium sulfate (MgSO4) 2 millimolar, polyethoxyethanol 0.1 percent, magnesium sulfate solution 6.0 millimolar, betaine 0.8 molar, deoxynucleotide (dNTP) 1.6 millimolar, BST DNA polymerase 8 units, and sterile distilled water to adjust the total volume to 25 microliters. 5. Method for detecting Scale Drop Disease Virus (SDV) in sea bass according to any one of claims 2-4, where the LAMP solution is supplemented with 20 microliters of mineral oil to prevent evaporation during the reaction. 6. Method for detecting Scale Drop Disease Virus causing scale defoliation in sea bass, according to claim 2, where the LAMP reaction is performed at 65°C for 60 minutes. 7. Method for detecting Scale Drop Disease Virus causing scale defoliation in sea bass, according to claim 2, where biological samples can be selected from muscle tissue, spleen, liver, and kidney. 8. Method for detecting Scale Drop Disease Virus causing scale defoliation in sea bass, according to claim 2, where the analysis for Scale Drop Disease Virus is performed using gel electrophoresis technique. ------------ Page 1 of 2 pages. Claims 1. The primer kit for detecting SDDV virus consists of: a. SDDV-ATPS-Forward Outer Primer (SDDV-ATPase-F3) with the base sequence 5'-AATGACCGAAATACGACCG-3' b. SDDV-ATPS-Backward Outer Primer (SDDV-ATPase-B3) with the base sequence 5'-CTAGTTGTCGTTTCTTGACTCT-3' c. SDDV-ATPS-Forward Inner Primer (SDDV-ATPase-FIP) with the base sequence 5'-TTTTCCACGGCCCGGTTTTTTT ACGACGATGAAATCGGAG-3' d. SDDV-ATPS-Backward Inner Primer (SDDV-ATPase-BIP) with the base sequence 5'- CCGCAGCGGTTGTCATTTCTTTTG TAACATTCTGGAACTAACCCA-3’ J. SDDV-ATPase-Loop Forward loop primer (SDDV-ATPase-LF) with base sequence 5’- GCCCAAAACAACCAATTTCATC -3’ and F. SDDV-ATPase-Loop Backward loop primer (SDDV-ATPase-LB) with base sequence 5’- TGGTTCAGAAGAAGCCAATCA -3’ 2. The method for detecting SDDV virus using primers according to Patent 1 consists of: a. The LAMP reaction, where DNA extracted from the biological sample to be tested for SDDV is mixed with a LAMP solution containing the primers according to Patent 1, a buffer solution, magnesium sulfate solution, betaine, deoxynucleotide, and BST DNA polymerase to obtain the LAMP product; and b. Analysis for SDDV virus detection from the LAMP product. 3. Method for detecting SDDV virus according to claim 2, where the buffer solution consists of tris hydrochloride, ammonium sulfate, potassium chloride, magnesium sulfate, octylphenoxypolyethoxyethanol. 4. Methods for detecting the SDDV virus. According to claim 2, the concentrations of the lamp solutions are as follows: a. Outer primer SDDV-ATPS-forward outer primer 0.2 µmolar; b. Outer primer SDDV-ATPS-backward outer primer 0.2 µmolar; c. Inner primer SDDV-ATPS-forward inner primer 2.0 µmolar; page 2 of 2; d. Inner primer SDDV-ATPS-backward inner primer 2.0 µmolar; e. Loop primer SDDV-ATPS-loop forward 2.0 µmolar; f. Loop primer SDDV-ATPS-loop backward 2.0 µmolar; g. Buffer solution at concentration 1x pH 8.8 containing 20 millimolar tris hydrochloride (Tris-HCl). Ammonium sulfate (NH4)2SO4 10 millimolar, potassium chloride (KCl) 10 millimolar, magnesium sulfate (MgSO4) 2 millimolar, polyethoxyethanol 0.1 percent. Magnesium sulfate solution 6.0 millimolar. Betaine 0.8 molar. Deoxynucleotide (dNTP) 1.6 millimolar. BST DNA polymerase 8 units. Sterile distilled water to adjust the total volume to 25 microliters. 5. Which of the following methods for detecting SDDV virus, as per claim 2-4, includes a LAMP solution supplemented with 20 µL of mineral oil to prevent evaporation during the reaction? 6. Method for detecting SDDV virus according to claim 2, where the LAMP reaction is performed at 65 degrees Celsius for 60 minutes. 7. Method for detecting SDDV virus under claim 2, where biological samples can be selected from muscle, spleen, liver, and kidney tissues. 8. Method for detecting SDDV virus according to claim 2, where SDV analysis is performed by gel electrophoresis technique.