SK11052000A3 - Inhibition of dna modulation caused by mutated p53 - Google Patents

Abstract

The invention relates to a method for inhibiting DNA modulation caused by mut p53, comprising the inhibition of mut p53 bonding on the DNA with strand separating potential. The invention also relates to a system for identifying substances suitable for said inhibition.

Description

Technical field

The present invention relates to a method of inhibiting DNA modulation caused by mutated p53. The invention also relates to a system for identifying substances suitable for such inhibition.

BACKGROUND OF THE INVENTION

The protein referred to as p53 is present in the cells. This protein is a tumor suppressor protein that is activated in the event of DNA damage. It then binds to the promoters of the target genes and activates their transcription. As a result, cell growth is arrested with subsequent repair of DNA damage or cell death.

P53 has been shown to be mutated in many tumors. In this form, it usually has no tumor suppressor activity. More often, it is even present in a form which itself has oncogenic properties. Various attempts have been made to inhibit mutated p53 (hereinafter referred to as mut p53) because of its oncogenic effects. However, these attempts did not produce satisfactory results.

SUMMARY OF THE INVENTION

It is therefore an object of the present invention to provide a system by which a mutant p53 can be examined and optionally inhibited, if appropriate because of its oncogenic properties.

This object of the invention is achieved using the system defined in the claims.

It is a further object of the present invention to provide a method for inhibiting DNA modulation caused by a mutant p53 comprising inhibiting the binding of the mutant p53 to

508 / B i

DNA with the potential to separate the strands.

The present invention is based on the discovery that a mutant p53, but not wild-type p53, can cause DNA modulation that has the potential to separate the strands. The inventor has found that such DNA is extensively and often present in MAR DNA. MAR (" matrix binding region ") DNA refers to higher-order chromatin regulatory elements by which chromatin is divided into topologically independent " loops " which allow independent spatial and temporal regulation of gene expression and DNA replication. The inventor has also found that DNA with the potential for chain separation often contains the sequence AATATATTT or variations thereof. In addition to this sequence, this DNA also contains other AT-rich regions. Furthermore, the inventor has found that the modulation of DNA may be of various types, for example that a solid complex may be formed between the mutant p53 and the DNA or that the DNA strands may be separated. It has been found that modulation is often of the type of chain separation, as long as said sequences and optionally adjacent sequences have a significant AT content. Conversely, modulation is often of the type of solid complex formation when these sequences contain a small amount of AT. It has further been found that DNA modulation caused by mut p53 can be inhibited when the binding of mut p53 to DNA with the potential for chain separation is inhibited.

In the present invention, these discoveries are used in a method for inhibiting DNA modulation caused by mut p53. Such a method comprises inhibiting the binding of mut p53 to DNA with the potential for chain separation.

The term "mut p53" includes any p563, or portion thereof, that can bind to DNA with the potential to separate the strands. In particular, p53 may be a protein with a mutated core domain and / or a mutated C-terminus. Examples of such p53 mutants are Pro273 p53 and MethA p53. The p53 mut may also be a protein which together with another protein forms a fusion protein.

The term " DNA with the potential to separate the strands "

DNA that can be modulated by mutant p53. Modulation may be of various types, for example, a solid complex may be formed between mut p53 and DNA with the potential for strand separation, or strands may be separated

508 / B

DNA. Specifically, the DNA with the potential to separate the strands may be DNA that contains one or more copies of the AATATATTT sequence or variations thereof. In addition, the DNA may also contain other AT-rich regions. DNA with the potential for chain separation is often found in MAR DNA.

The term "binding" refers to any method by which a mutant p53 can bind to DNA with the potential for chain separation. In particular, there can be any binding that binds mut p53 directly to DNA. It can be any binding that binds mut p53 indirectly to DNA, i. through factors other than proteins.

The term "inhibition" refers to any method by which the binding of mut p53 to DNA with the potential for chain separation can be inhibited. The method of inhibition depends on whether the binding of the mut p53 to DNA is direct or indirect. In the case of indirect binding, i. By binding through factors other than proteins, inhibition can be accomplished using substances that inhibit said other factors. It is also possible to use substances that inhibit the mut p53. In the case of direct binding of mut p53 to DNA, it is preferred to use substances that inhibit the mut p53. Such substances may, for example, inhibit the mutated p53 core domain and / or the mutated C-terminus of p53. Examples of such substances are PAb 240 and PAb 421.

The present invention also provides a system suitable for identifying substances that inhibit DNA modulation caused by mut p53. Such a system comprises mut p53 and DNA with chain-separating potential, as well as optional substances whose inhibitory effect on binding of mut p53 to DNA with chain-separating potential is tested. The definitions above apply to individual components of the system. It will be appreciated that modulation and inhibition of DNA can be determined by conventional methods. For example, DNA strand separation and complex formation, respectively, and their inhibition can be determined by the EMSA (Electrophoretic Mobility Shift Assay) assay. In this assay, it is necessary to incubate mut p53 with labeled double-stranded DNA, which has the potential for strand separation and electrophoretic separation of the mixture so that single stranded formation is visible.

508 / B

DNA and their complexes and inhibition of these events.

Using the present invention, it is possible to inhibit DNA modulation caused by mut p53. Such modulation may be the formation of a solid complex between the mut p53 and DNA with the potential for strand separation or DNA strand separation. DNA modulation is of great importance in many cellular processes. For example, DNA strand separation is an essential step in gene expression and DNA replication. The DNA strand separation is effectively controlled. This control is canceled by mut p53. This allows cell degeneration, such as tumor formation.

Using the present invention, it is possible to treat diseases in which mut p53 causes DNA modulation. Such diseases are mainly tumor diseases. Furthermore, the present invention allows the identification of substances suitable for inhibiting DNA modulation caused by mut p53, particularly in the case of tumors. Such substances are also an object of the present invention.

Swap the figures in the drawings

Fig. 1 shows the DNA strand separation caused by mut p53 in the case of MARI DNA.

Fig. 2 shows DNA strand separation caused by mut p53 in the case of MARU DNA.

Fig. 3 shows complex formation caused by mut p53 for MAR5 DNA.

Fig. 4 shows complex formation caused by mut p53 for MAR7 and MAR8 DNA.

Fig. 5 shows inhibition of DNA strand separation caused by mut p53 for MAR1 DNA.

The invention will now be explained in the following example.

508 / B

DETAILED DESCRIPTION OF THE INVENTION

Example 1

DNA modulation caused by mutant p53 and its inhibition

DNA modulation takes place by separating the DNA strands and forming complexes, respectively.

a) Induction of DNA strand separation and complex formation, respectively, by mut p53

Two MAR regions in the form of oligonucleotides were obtained from the 997 bp XbaI IgE MAR fragment found in the heavy chain immunoglobulin gene transcription enhancer region. These regions were MARI, i. The 3'-contiguous transcription enhancer region and MARIA, i. 5'-contiguous transcription enhancer region. The oligonucleotides had the following sequences:

MARI IgH enhancer

5'3 '- Neighboring region

AGTGTCTTTAATTTCTAATATATTTAGAAAACTGC

MARIE IgH enhancer

5'3 '- Neighboring region TTTTAACAATAATAAATTAAGTTTAAAATATTTGCG

MAR1 contains the above AATATAATTT sequence. MARIA contains a variation of this sequence in which the overall AT character of the sequence is not disrupted.

Further, oligonucleotides were obtained which contain MARI variations that reduce the overall AT character of the sequence. These oligonucleotides have the following sequences:

MAR6: ACTATGCTT

MAR7: GCTCTCTTT

508 / B

Further, oligonucleotides were obtained which contain the MAR1 sequences together with adjacent "GC edges". The overall AT character was reduced by "GC margins".

Oligonucleotides were synthesized, at the end they were labeled with ³² Pa and heat treated so that they were finally obtained in double-stranded form. These oligonucleotides were incubated with wild-type p53 and mut p53, for example, MethA p53 and Pro273 p53, respectively, and analyzed by the EMSA assay. The following steps were taken in this procedure:

Mixtures containing natural p53, MethA p53 and Pro273 p53, respectively, were pre-incubated with 2 µg Poly d1: dC (non-specific competitor) in 10 mM HEPES, pH 7.8; 50 mM KCl, 1 mM EDTA, 5 mM MgCl 2, 10% glycerin; for 20 minutes.

After pre-incubation, labeled oligonucleotides were added and the mixtures were incubated at ambient temperature for 30 minutes. Then the mixtures were electrophoresed on a 4% native polyacrylamide gel for 3 hours and the gel was dried and subjected to autoradiography (Figs. 1-4).

It has been found that mut p53, for example MetA p53 and Pro273 p53, respectively, can cause DNA modulation, for example, strand separation and complex formation, respectively, for DNA with the potential for strand separation.

b) Inhibition of DNA strand separation due to mut p53

The steps described under (a) were performed except that mixtures of MethA p53 also contained PAb 421 and PAb 240 antibodies, respectively. Oligonucleotides containing MAR1 DNA were used (Figure 5).

It has been shown that using substances that inhibit mut binding of p53 to DNA with a potential for chain separation, such as PAb 421 and PAb 240, respectively, mutation of DNA strands induced by mut p53 can be inhibited.

Claims (23)

PATENT CLAIMS What is claimed is: 1. A method for inhibiting DNA modulation caused by mut p53, comprising inhibiting the binding of mut p53 to DNA with the potential for chain separation. Method according to claim 1, characterized in that the modulation is the formation of a solid complex between the mut p53 and DNA with the potential for chain separation. The method of claim 1, wherein the modulation is I separation of DNA strands with the potential for strand separation. The method of any one of claims 1 to 3, wherein the mutant p53 comprises a mutated core domain. The method of any one of claims 1 to 3, wherein the mutant p53 comprises a mutated C-terminus. Method according to any one of claims 1 to 5, characterized in that the DNA with the potential to separate the strands comprises the sequence AATATATTT or a variation thereof. The method of claim 6, wherein the variation comprises the sequence AAAATATTT. The method according to any one of claims 1 to 7, characterized in that the DNA with the potential for chain separation is present in the MAR DNA. The method of any one of claims 1 to 4 and 6 to 8, wherein the inhibition is performed using a substance that inhibits the mutated p53 core domain. 31,508 / B The method of claim 9, wherein the substance is PAb 240. A method according to any one of claims 1 to 3 and 5 to 8, characterized in that the inhibition is carried out using a substance that inhibits the mutated end of p53. The method of claim 11, wherein the substance is PAb 421. The method of any one of claims 1 to 8, wherein the inhibition is performed using substances that inhibit the mutated core domain and the mutated C-terminus of p53. The method of claim 13, wherein the substances are PAb 240 and PAb 421. The method of any one of claims 1 to 14, wherein the DNA modulation caused by the mutant p53 is inhibited in the treatment of diseases. 16. The method of claim 15, wherein the disease is a cancer. * 17. A system for identifying substances suitable for inhibiting DNA modulation caused by a mutant p53, characterized in that it comprises a mutant p53 and DNA with the potential for chain separation. 18. The system of claim 17, further comprising a substance whose inhibitory effect on the binding of mut p53 to DNA with the potential for chain separation is tested. 31,508 / B The system of claims 17 or 18, wherein the mutant p53 comprises a mutated core domain. The system of claims 17 or 18, wherein the mutant p53 comprises a mutated C-terminus. System according to any one of claims 17 to 20, characterized in that the DNA with the potential for chain separation is present in the MAR DNA. System according to any one of claims 17 to 21, characterized in that the DNA with the potential for chain separation comprises the sequence AATATATTT or a variation thereof. 23. The system of claim 22, wherein the variation comprises the sequence AAAATATTT.