SI9400363A - Human macrophage migration inhibitory factor of nonlymphoid origin, expression of mif in e. coli and purification of recombinant protein - Google Patents

Abstract

According to the known cDNA sequence we used the PCR (polymerase chain reaction) technique to isolate a gene encoding human MIF from uterus endometrium The PCR product was cloned in the Escherichia coli plasmid vector pUC 19 and the nucleotide sequence was confirmed. We were able to successfully express human MIF in the bacteria Escherichia coli by use of the pKP 1500 expression plasmid. The recombinant protein accumulated intracellularly in soluble form, comprising more then 30 % of total cell protein. We have designed an original two step procedure where protein purification was accomplished by gel filtration and ion exchange chromatography. The purified recombinant MIF was used to immunise a rabbit and antibodies obtained were used for MIF detection in human tissues by immunohistochemical techniques.

Description

DESCRIPTION OF THE INVENTION

NAME OF THE INVENTION

Human macrophage migration inhibitory factor of non-lymphoid (epithelial) origin, expression of MIF in Escherichia coli and purification of recombinant protein

BACKGROUND OF THE INVENTION

Macrophage migration inhibition factor (MIF) is the first lymphokine detected. It was first shown in 1966 that antigen-stimulated lymphocytes form a substance that inhibits macrophage migration in vitro (Bloom, BR & Bennett, B. (1966). Science 153, 80-82 / David, JR (1966). Nati. Acad. Sci. USA 65, 72-77). This unknown compound has been called the macrophage migration inhibitory factor (MIF). Shortly after, it was discovered that supernatants of stimulated macrophages containing MIF not only prevent the movement of macrophages but also alter their function toward accelerated destruction of microbes and tumor cells (Churchill, WH, Piessens WF, Sulis, C: A., David, JR (1975) J. Immunol 115, 781 / Nathan, CF, Karnovsky, ML, David JR (1971) J. Exp Med 133, 1356 / Nathan, CF, Remold, H.

G., David, J. R. (1973). J. Exp. Med. 137, 275). MIF activity has also been demonstrated in the synovial fluid of patients with rheumatoid polyarthritis (Odink, K., Cerletti, N., Bruggen, J., Clerc, R. G., Tarcsay, L., Zwadlo, G., Gerhards, G., Schlegel, R. . & Sorg, C. (1987). Nature (London) 330, 80-82), in leukocyte culture supernatants during transplant rejection in mice (Al-Askari, S., David, JR, Lawrence,

H. S. & Thomas, L. (1965). Nature (London) 205, 916-917 / Harrington, J. T. (1977). Whole. Immunol. 30, 261-271) and in many chronic inflammatory processes (Burmeister, G., Zwadlo, G., Michels, E., Brocker, E. & Sorg, C. (1984). Lymphokine Res. 3, 236 / Schlegel Gomez , R., Diepgen, TL

, Neumann C., Sorg, C. (1990). Arch. Dermatol. Really. 282, 374378). MIF is thought to be closely linked to the onset of late hypersensitivity and cellular immunity (Bloom, BR & Bennett, B. (1966). Science 153, 80-82 / David, JR (1966). Natl. Acad. Sci. USA 65 , 72-77 / David, JR & David, RA (1972) Prog. Allergy 16, 300-449). In order to demonstrate unambiguously that the above-mentioned altered macrophage functions are induced by MIF and not by any other compound, a strong need for a purified native or (and) recombinant protein has arisen. The low level of MIF activity in native samples makes it difficult to isolate and biochemical characterize it, and so far it has not been able to isolate the native protein in its pure form.

cDNA encoding human MIF was first cloned in 1989. Weisser and colleagues cloned it in COS cells. Functional expression of cDNA cloning from stimulated T cells has thus enabled the identification of a clone with strong macrophage migration inhibitory activity (Weisser, WY, Temple PA, Witek-Giannotti JS, Remold HG, Clark SC & David JR (1989). Sci. USA 86, 75227526). Supernatants have also been shown to stimulate antibody synthesis after centrifugation of the culture of COS cells (containing the recombinant gene encoding human MIF) (Weisser, WY, Pozzi, LM, David JR & Titus RG (1992). Nat. Acad. Sci 89, 8049-8052). Preliminary studies of infections with the intracellular parasite Leischmania donovani (Weisser, Y. W., Pozzi, L. M. & David J. R. (1991). J. Immunol. 147, 2006-2011) as well as the proven ability of MIF-containing supernatants from COS cell cultures to activate macrophages ( with the latter expressing nitric oxide synthetase and forming nitric oxide) convincingly suggest that the newly discovered 14 kDa large protein is likely to play a crucial role in cell-regulated immunity (Cunha FQ, Weisser WY, David JR, Moss DW, Moncada S. & Liew F.Y. (1993) .The Journal of Immunology 150, 1908 -1912 / Liew, F.,., Millot, S., Parkinson, C., Palmer, R. M., Moncada, S. (1990) .J Immunol. 129. 351). Recently, the central role of MIF in endotoxemia and toxic shock has also been reported. In 1993, Wistow and colleagues isolated MIF from eye lenses (Wistow GJ, Shaughnessy, MP, Lee, DC, Hodin, J. & Zelenka, PS (1993). Natl. Acad. Sci. USA 90, 804980529), year preceded by Blocki et al. rat liver protein (Blocki FA, Schlievert PM & Wackett LP (1992). Nature 360, 269-270), which matched the primary structure of human lymphocytic MIF in 25 (out of 26) Nterminal amino acid residues. The putative MIF from rat liver expressed both MIF and glutathione reductase activity and was thought to link the chemical and immune detoxification systems.

Suzuki reported crystallization and preliminary crystallographic studies of MIFs from human lymphocytes in 1994 (Suzuki, M., Murata E. & Tanaka I. (1994). J. Mol. Biol. 235, 1141-1143). From the aforementioned article, it can be seen from the abundance of information that MIFs were expressed in Escherichii coli and purified by affinity chromatography, based on Blocki et al. (Blocki F. A., Schlievert P. M. & Wackett L. P. (1992). Nature 360, 269-270).

Although research on MIF is continuously increasing today, MIFs from natural sources have not been isolated in sufficient quantities to allow at least its biochemical characterization, the amounts of recombinant MIF from tissue cultures are low, but very low in bacteria. In the latter case, no yield data are available, precise isolation procedures are not described, and, as far as we know, recombinant purified

MIF is not yet on the market and some companies have been selling it for some time.

DETAILED DESCRIPTION OF THE INVENTION

Construction of expression vectors

The region of the gene encoding human MIF was isolated by PCR (polymerase Chain reaction). Two-stranded cDNA, which served as a template for PCR amplification, was synthesized using chemicals and according to the instructions of the Amersham factory (cDNA synthesis kit). mRNA for the aforementioned reverse transcriptase cDNA synthesis reaction was isolated from the human uterine endometrium by the guanidinium isothiocyanate method followed by isopycnal centrifugation in a cesium chloride trifluoroacetate gradient and then purified total RNA by dye affinitis by affinity.

Initial oligonucleotides used (primers):

I.: 5 'GGATCCGAATTCATGCCGATGTTCATCGTAAACACCA 3' (oligonucleotide corresponding to the N terminal portion of the MIF; cut site with EcoRI restriction endonuclease is underlined, start / start / codon shown in bold letters)

II. : 5 'GTCGACAAGCTTTTAGGCGAAGGTGGAGTTGTTCCA 3' (oligonucleotide corresponding to C terminal portion of MIF; Hindlll restriction endonuclease cut site underlined, terminal / stop / codon shown in bold letters)

The same initial oligonucleotides in the same reaction not only allowed PCR amplification, but also the creation of appropriate sites on either side of the coding region recognizable for cutting by restriction endonucleases.

The latter allowed targeted insertion (cloning) for MIF coding regions into multiple cloning sites on different Escherichie coli vectors; such as pUcl9 (Messing, J. (1983). Methods and Enzymology, Vol. 101, pp. 20-78 (Wu, R., Grossman, L. & Moldave, K., Ed.). San Diego: Academic Press ), pIN-III-ompA2 (Auerswald, EA, Genenger, G., Mentele, R., Lenzen, S., Assfalg-Machleidt, I., Mitschang, L., Oschkinat, H. & Fritz H. (1991) J. Biochem. 200, 131-158 / Ghrayeb, J., Kimura, H., Takahara, M., Hsiung, H., Masui, Z., Inouye, M. (1984). , 3 (10), 2437-2442), pKpl500 (Miki, T., Yasukochi, T., Nagatani, H., Furuno, M., Orita, T., Yamada, H., Imoto, T., Horiuchi. T. (1987). Protein Engineering 1, 327-332). Oligonucleotides were synthesized on an Applied Biosystem DNA Synthesizer apparatus according to the manufacturer's instructions. With saturated ammonium hydroxide, the synthesis products were extracted from the columns and deprotection of the protecting groups was carried out. The oligonucleotides were then purified by polyacrylamide gel electrophoresis (Sanbrook,

J., Maniatis, T. & Fritsch, E. F. (1989). Molecular Cloning: A laboratory manual; Cold Spring Harbor Laboratory).

Each PCR amplification cycle was performed in successive stages: denaturation (1 minute at 94 ° C) followed by annealing (1 minute at 55 ° C) followed by extension (2 minutes at 72 ° C). 100 μΐ of the reaction mixture contained: lOraM Tris (pH 8.4), 50 mM KC1, 100 ng cDNA (pre-incubated in boiling water bath for 10 minutes), lgm oligonucleotide I, Ipm oligonucleotide II, deoxynucleotide triphosphate (dATP, dCTP , dGTP and dTTP; each individual nucleotide in 200 μΜ concentration), 1 mM MgCl2, with 2.5 units of Taq polymerase (Perkin Elmer). To prevent evaporation, a layer (100 μΐ) of mineral oil was pipetted onto the top of the reaction mixture. PCR amplification was performed on a Perkin Elmer thermo cycler apparatus. Terminal extension (synthesis of missing base pairs) after 30 cycles of aiding was enabled by heating the PCR product at 72 ° C for 10 minutes. Subsequently, the mineral oil was carefully removed and after phenolization and

Sal, G.; Manfioletti G. Acid. Really. 16, 9878) ethanol precipitation (Sanbrook, J., Maniatis, T. & Fritsch, EF (1989). Molecular Cloning: A laboratory manual; Cold Spring Harbor Laboratory) About 400 base pairs large PCR product was cut with EcoRI and Hindlll restriction endonucleases at least 5 hours under standard conditions (Sanbrook, J., Maniatis, T. & Fritsch, EF (1989). Molecular Cloning: A laboratory manual; Cold Spring Harbor Laboratory). After cutting with both of these restriction enzymes, the reaction mixture was again phenolized and the DNA precipitated with ethanol. Subsequently, the nucleic acid was dried in a speed-vac concentrator, resuspended in 50 μΐ TE buffer and purified by gel chromatography on lml spin columns filled with Sephacryl S-300. Escherichia coli plasmid vectors were cut and purified in the same manner; except that at the gel filtration step, Sephacryl S-400 was used. The inserts and vectors were glued in a molar ratio of 3: 1 in favor of the inserts, and the ligation was performed for 15 hours at 15 ° C under otherwise standard conditions (Sanbrook, J., Maniatis, T. & Fritsch, EF (1989). A laboratory manual; Cold Spring Harbor Laboratory). Fluorescence methods were used to determine the concentrations of vectors and inserts (Sanbrook, J., Maniatis, T. & Fritsch, E. F. (1989). Molecular Cloning: A laboratory manual; Cold Spring Harbor Laboratory).

Competent cells of Escherichie coli, strain DH5a (Hannahan, D. (1983). J. Mol. Biol. 160, 557-580 / Hannahan, D.

(1985). DNA cloning: a practical approach, Vol.l, pp! 09-135 (Glover, D. M. Ed.). Oxford: IRL Press), transformed with 1 μΐ ligation mixture. After isolation of plasmid DNA (Del & Schneider C. (1988) Nucleic was identified on MIF positive clones by restriction analysis. Nucleotide sequences at three positive clones from three independent PCR reactions were confirmed by dideoxysequencing (Sanger, F., Nicklen, S & Coulson (1977) Away from Acad. Sci. USA. 74, 5463. With the exception of a single different nucleotide, whose diversity resulted in information for a different amino acid, the nucleotide sequence was consistent with that published (Weisser, WY. Temple PA, Witek-Giannotti JS, Remold HG, Clark SC & David JR (1989), Natl Acad. Sci USA 86, 7522-7526) The substitution was the same as described by Wistow (Wistow GJ, Shaughnessy , MP, Lee, DC, Hodin, J. & Zelenka, PS (1993), Acad. Sci. USA 90, 8049-80529) The nucleotide sequence and the corresponding amino acid sequence are shown below:

ATG Met CCG ATG TTC ATC GTA AAC ACC AAC GTG CCC Pro CGC GCC TCC GTG Val 15 45 Pro Met Phe Ile 5 Val As n Thr As n Val 10 Arg Ala Sir CCG GAC GGG TTC CTC TCC GAG CTC ACC CAG CAG CTG GCG CAG GCC 90 Pro Asp Gly Phe Leu Sir Glu Leu Thr Gin Gin Leu Ala Gin Ala 20 25 30 ACC GGC AAG CCC CCC CAG TAC ATC GCG GTG CAC GTG GTC CCG GAC 135 Thr Gly Lys Pro Pro Gin Tyr Ile Ala Val His Val Val Pro Asp 35 40 45 CAG CTC ATG GCC TTC GGC GGC TCC AGC GAG CCG TGC GCG CTC TGC 180 Gin Leu Met Ala Phe Gly Gly Sir Sir Glu Pro Cys Ala Leu Cys 50 55 60 AGC CTG CAC AGC ATC GGC AAG ATC GGC GGC GCG CAG AAC CGC TCC 225 Sir Leu His Sir Ile Gly Lys Ile Gly Gly Ala Gin As n Arg Sir 65 70 75 TAC AGC AAG CTG CTG TGC GGC CTG CTG GCC GAG CGC CTG CGC ATC 270 Tyr Sir Lys Leu Leu Cys Gly Leu Leu Ala Glu Arg Leu Arg Ile 80 85 90 AGC CCG GAC AGG GTC TAC ATC AAC TAT TAC GAC ATG AAC GCG GCC 315 Sir Pro Asp Arg Val Tyr Ile As n Tyr Tyr Asp Met As n Ala Ala 95 100 105

AAT GTG GGC TGG AAC AAC TCC ACC TTC GCC TAA

360

Asn Val Gly Trp Asn Asn Ser Thr Phe Ala * 110 115 One of the recombinant plasmid pUC19, with cloned for MIF the coding region, we cut with restriction skim

endonucleases EcoRI and HindIII, and the individual fragments were fractionated after cutting by agarose gel electrophoresis. The fox, which, according to the corresponding DNA size markers, contained approximately 400 base pairs a large fragment was cut from the gel, and then DNA was isolated by the glass particle adhesion method (Vogelstein, B. & Gillespie, D. (1979). Natl. Acad. Sciu. USA 76, 615-619). The human MIF coding region was then subcloned into the expression vectors pIN-III-ompA2 and pKP1500 following the same procedure as described above.

Expression and purification of recombinant protein

Level I: Multiplication of bacterial cultures

1 bioreactor (Chemap LF 7/14/20) filled with 10 l of sterile LB soup (10 g of tryptone, 5 g of yeast extract and 10 g of NaCl per 1 medium) was inoculated with 200 ml of saturated Escherichia coli preculture. The preculture was prepared by 200 ml of sterile minimal M9 medium (with 100 mg ampicillin / 1 medium) (Sanbrook, J., Maniatis, T. & Fritsch, EF (1989). Molecular Cloning: A laboratory manual; Cold Spring Harbor Laboratory) in 500 ml Erlenmeyer flask was inoculated with 10 μΐ in glycerol of frozen stock culture of E. coli cells, strain JM 109 (Miller, H. (1987). Methods in Enzymology 152, 145-170) transformed with pMEX expression plasmid (pKP1500 with cloned for MIF coding region) and bacteria were amplified for 36 hours at 21 ° C on a rotary shaker incubator (140 rpm). Ampicillin (100 mg / 1 culture) was aseptically added to the fermentor sterile medium immediately prior to preculture, and 15 ml of Silicone 1510 (as an antifoaming agent) was added aseptically before sterilization by autoclaving. After inoculation, bacterial culture in the fermenter was amplified at 37 ° C with controlled stirring (600 rpm) and aeration (301 / min) for 2.5 to 3 hours (until the culture reached absorbance at 6oo nm between o, 5 and 1). At that time, the culture was induced with IPTG (0.5g / 101 culture) and multiplied for 4 hours under the same conditions as before induction.

II. stage: Preparation of bacterial cell lysate hours after induction with IPTG, the bioreactor was cooled to 12 ° C and the culture of the bacteria was poured into ice-filled bottles. The bacterial cells were separated from the culture medium by 20 minutes centrifugation in a Sorval centrifuge at 4 ° C and 8000xg. All 50g after centrifugation of the obtained bacterial biomass were resuspended in 200 ml of sterilized deionized water, the suspension was frozen three times in succession and thawed again and sonicated in an ultrasonic bath (70 W) for 1.5 minutes. Cell debris after membrane breakage by a combination of freezing and thawing and ultrasound was removed by centrifugation. After centrifugation at 4 ° C and 8000xg for 20 minutes, the supernatant was transferred to a 350 ml ultrafiltration cell (Amicon) equipped with a magnetic stirrer and a ΥΜ2 filter (with a pore size allowing only membrane less than 2 kDa to pass through the membrane) and concentrated four times. at 4 ° C.

III. degree: Gel filtration

The glass column (50 mm in diameter) was filled with Sephadex G50 up to 1500 mm in height and equilibrated with buffer A (0.1 M

Tris pH 7.4; 0.3 M NaCl;

of the concentrated supernatant was applied to the gel surface at a flow rate of 42ml / hour. Fractions,

lmM EDTA). The pattern (200 ml from rates 11) we are carefully Mrs eluted with buffer A at size 14 we are ml collected

automatic (with fractional manifold). Separation of the sample on a Sephadeks G-50 column took approximately 32 hours at 4 ° C. The amount of protein in the individual fractions was monitored by measuring the absorbance at 280 nm. According to the curve that showed the relationship between the sequence number of each fraction and the protein content therein, certain fractions were selected and analyzed by SDS polyacrylamide electrophoresis and by IEF. Aliquots of the fractions taken for analysis were previously dialyzed by the microdialysis method (Andrej Francky, personal communication). Protein extracts of E. coli JM109 cells containing the pKPISOO expression plasmid without insert were used as controls. Fractions in which IEF or SDS polyacrylamide electrophoresis showed a sufficiently high content of recombinant protein were combined and concentrated to a total volume of 150 ml on the aforementioned ultrafilter.

IV. degree: Ion exchange chromatography

The glass column was filled with 250 ml of CM cellulose, which was previously regenerated according to the manufacturer's instructions and suspended in buffer B (10 mM phosphate buffer pH 6.4). The column was then equilibrated with the same buffer for 24 hours at a flow rate of 19 ml / hour. 75 ml of the concentrated sample (from stage III) were dialyzed against buffer B before application to the column B. To remove unbound proteins, the column was washed with buffer B after application of the sample until the absorbance at 280 nm decreased again to values below 0.05 then the bound proteins were eluted with a linear NaCl gradient (500 ml of buffer B and 500 ml of buffer B with 0.3 M NaCl were mixed in a separate gradient vessel). Separation was carried out at 4 ° C. Fractions (approximately 6.3 ml) were collected automatically. Protein elution was monitored in the same manner as that described for gel filtration. All fractions from the second peak of the elution diagram contained a highly purified recombinant MIF. After combination, they were dialyzed at 4 ° C against deionized water, concentrated by ultrafiltration to a concentration of 5mg / ml and stored at 70 ° C. Several samples were lyophilized previously.

Electrophoresis

The purity of the protein was checked and the molecular weight was determined by SDS polyacrylamide electrophoresis on a Pharmacia Phast system apparatus, using factory-prepared 8-25% polyacrylamide gels and a mixture of Sigma SDS 7 standards for molecular weight determination (seven proteins ranging in size from 14400 to 94000 Yes) . Electrophoresis and protein staining with Comassie brilliant blue G-250 were performed according to the instructions of the manufacturer of the apparatus.

In the analysis of proteins from total cell lysates, cell culture was centrifuged, the sediment was resuspended in deionized water, mixed with equal volume of 2 times concentrated SDS electrophoresis buffer (Sanbrook, J., Maniatis, T. & Fritsch, EF (1989). Molecular Cloning : A laboratory manual; Cold Spring Harbor Laboratory) and the mixture heated for 10 minutes in a boiling water bath. The cells were then sonicated for 1 minute in an ultrasonic bath (70W) and centrifuged for 10 minutes in an Eppendorf hemofuge at 14000 rpm. The supernatants after centrifugation, diluted with concentrated SDS electrophoresis buffer 1 times as appropriate, represented the samples for application to polyacrylamide gels.

Isoelectric Focusing A mm thick polyacrylamide isoelectric focusing gel (5% T and 5% C, 10% glycerol, 0.45% ammonium persulfate and 6.66% Pharmalyt ampholin / pH 3-10 /) was pre-focused at a constant electrical power of 25W ( with a voltage limit of 300 V) at 7 ° C. After application of the samples (each sample was applied in a volume of 20 to 50 μΐ) and standards (using Pharmacia's mixture of standards with isoelectric points in the range of 3.5 to 9.3), the isoelectric focusing was carried out at a constant power of 25 W (with voltage limit 1500V) approximately 2 hours.

After the IEF was completed, the proteins were fixed by soaking the gel for 15 minutes in 20% TCA, then stained for 5 minutes in a dye solution (0.2% Coomasie blue G-250 dye, 45% methanol and 10% acetic acid) and then stained in the same solution of acetic acid and methanol; in this case, no dye added.

As an alternative, we sometimes chose the IEF on the Pharmacia Phast System apparatus, using pre-prepared gels in the pH range of 3 to 9, and focusing as instructed by the manufacturer of the apparatus.

Determination of the N-terminal amino acid sequence

The amino-terminal sequence of the recombinant protein was determined by Edman method on an automatic pulsed liquid-phase protein analyzer (applied Biosystem, Foster City, CA / model 477A) with an on-line amino acid analyzer (PTH, model 120A). The sequencing was performed in regular (regular) cyclical programs, with chemicals and according to the manufacturer's instructions.

Biological test for macrophage migration inhibition activity

The biological activity of recombinant human MIF was determined on budding peritoneal macrophages as indicator cells and according to the method described by Harrington et al. (Harrington JT, JR. & Stastny P. (1973) J. Immunol. 110 (3). 752-759).

The% inhibition of migration was calculated as follows:

% inhibition = 100 - (average migration of test samples / average migration of controls) X 100

By this definition, any inhibition in excess of 20% is considered significant.

amplification electrophoresis.

Polymerase chain reaction (PCR) amplification on a cDNA array served to isolate the MIF coding regions and at the same time construct suitable restriction sites on both sides of the gene that made it easy to insert into multiple cloning sites at two different Escherichia coli expression vectors. Products

DNA was analyzed by agarose gel First plasmid vector, pKP1500 was used to express recombinant protein in the cytoplasm of E. coli cells. The second, pIN-III-ompA2, carried a signal sequence to transport the recombinant protein into the periplasmic space of the bacterium. In the cloning process, the procedures described in the Detailed Description of the Invention section were closely followed. The cloning efficiency for the MIF coding regions was very high in both cloning into the pUC19 general purpose vector, into the p-ALTER mutation vector, and to both of these expression vectors. Recombinant clones could be identified by restriction analysis of plasmid DNA of only a small number of colonies, as 70 to 90% of all clones analyzed were MIF positive.

The expression efficiency of human recombinant MIF depending on the different vectors and E. coli strains used was determined by protein analysis of total cell lysates and cell extracts, respectively. Cell lysates were prepared as described previously with SDS polyacrylamide electrophoresis. The preparation of the cell extracts was performed in an analogous manner to that of the second stage of the protocol for the expression and purification of the recombinant protein, only in substantially smaller amounts. Samples were analyzed for both SDS polyacrylamide electrophoresis and IEF together with known molecular weight standards or markers of known isoelectric points and together with controls. As a control, total lysate was used in SDS polyacrylamide electrophoresis, and coarse E. coli JM109 cell extract with an expression vector without insert was used in IEF. In cell cultures containing pIN III-ompA2 cloned into the MIF coding sequence of bases by protein analysis of cell lysates or extracts, no recombinant protein could be detected. In contrast, when analyzing bacterial cell cultures containing the recombinant pMEX plasmid (pKP1500 vector with the cloned MIF coding gene), a new strong protein spot appeared compared to the control. The latter traveled at SDS polyacrylamide electrophoresis at a rate which, according to the relevant standards, corresponded to the expected one (travel speed of approximately 12.5 kDa of large protein). Using IEF, we determined the isoelectric point 7.0 using control and appropriate standards for human recombinant MIF.

According to the results of the protein assays, Escherichie coli JM109 cells transformed with the pMEX plasmid were selected for further work (for the production on a large scale and purification of the recombinant protein). In order to minimize the possibility of proteolytic degradation of the recombinant protein, all isolation and purification steps were performed at 4 ° C. Gel filtration was chosen as the first stage of purification of recombinant human MIF in order to get rid of very large molecules (nucleic acids such as chromosomal or plasmid DNA and high molecular weight proteins, including any polymers resulting from improper folding of the recombinant protein). in a heterologous bacterial system) and very small (such as various bacterial toxins, pyrogens, metabolites). The purification path was followed by determination of the amount of proteins in individual fractions (via absorbance measurements at 280 nm) and analysis of proteins in individual fractions with IEF, resp. by SDS polyacrylamide electrophoresis, where protein spots appeared at the expected sites in the presence of recombinant protein (according to control and known relevant standards). Fractions that were judged to contain enough recombinant protein after protein analysis were pooled, concentrated and further purified by ion exchange chromatography on CM cellulose. At this point, we have previously tested the performance of different buffers at different pHs. Most suitable was 10 mM phosphate buffer pH 6.4. There is also a logical explanation for this, since the isoelectric point of human recombinant MIF is about 7.0 and most bacterial proteins are acidic (with isoelectric points lower than 6.3). In order to bind recombinant MIF to CM cellulose at this pH, the pH of the buffer must be carefully calibrated, or, if there are problems with binding to the carrier, the pH of the buffer should be lowered by 0.1 to 0.2 units. The elution diagram of separation using conventional ion-exchange chromatography on CM cellulose using 10 mM phosphate buffer pH 6.4 shows only two peaks. The former is unbound impurities (without recombinant protein), and in the second peak, only strongly purified recombinant human MIF is eluted.

After two purification steps, 10 l of bacterial culture (or about 50 g of wet weight of bacterial cells) were isolated from a highly purified recombinant protein. Its purity was assessed by the presence of a single intense spot on the gels after SDS polyacrylamide electrophoresis and IEF and by the presence of one peak on the elution diagram after separation on an HPLC apparatus. Protein identity was confirmed by determining the first 25 N-terminal amino acids and matching them with the predicted amino acid sequence. Macrophage migration inhibition tests on peritoneal bud macrophages as indicator cells have shown that the protein is biologically active.

CONCLUSION

Using human expression vector pKP1500 (with tac promoter and temperature-sensitive replication start site), we successfully expressed human MIF in Escherichia coli. The recombinant protein accumulated intracellularly in soluble form and represented roughly over 30% of all cellular proteins. We developed the original two-step gel filtration protocol for the first and ion exchange chromatography at the second purification step, which made it possible to obtain very pure protein with minimal losses, which was confirmed by SDS polyacrylamide electrophoresis analysis, isoelectric focusing of the protein and separation by HPLC apparatus. . Protein identity was demonstrated by determination of the N-terminal amino acid sequence and its activity by a macrophage migration inhibition assay. We isolated 1 gram of highly purified and biologically active recombinant human macrophage migration inhibitory factor from 10 1 bacterial cultures (50 grams wet weight of bacterial cells). We believe that by optimizing the process, the final yields could be even higher.

Claims (6)

PATENT APPLICATIONS 1. Initial oligonucleotide with nucleotide sequence I.: 5 'GGATCCGAATTCATGCCGATGTTCATCGTAAACACCA 3' in II. : 5 'GTCGACAAGCTTTTAGGCGAAGGTGGAGTTGTTCCA 3', characterized in that they allow amplification of the nucleotide sequence encoding MIF by polymerase chain reaction and subsequent cloning of the PCR product into different vectors. 2. An expression vector construct for the expression of recombinant MIF in Escherichia coli, called pMEX, characterized in that it contains the nucleotide sequence encoding human MIF shown below AT G Met CCG ATG TTC ATC GTA AAC ACC AAC GTG CCC CGC GCC Ala TCC Sir GTG Val 15 Pro Met Phe lle Val 5 As n Thr As n Val 10 Pro Arg CCG GAC GGG TTC CTC TCC GAG CTC ACC CAG CAG CTG GCG CAG GCC Pro Asp Gly Phe Leu Sir Glu Leu Thr Gin Gin Leu Ala Gin Ala 20 25 30 ACC GGC AAG CCC CCC CAG TAC ATC GCG GTG CAC GTG GTC CCG GAC Thr Gly Lys Pro Pro Gin Tyr lle Al a Val His Val Val Pro Asp 35 40 45 CAG CTC ATG GCC TTC GGC GGC TCC AGC GAG CCG TGC GCG CTC TGC Gin Leu Met Al a Phe Gly Gly Sir Sir Glu Pro Cys Ala Leu Cys 50 55 60 AGC CTG CAC AGC ATC GGC AAG ATC GGC GGC GCG CAG AAC CGC TCC Sir Leu His Sir lle Gly Lys lle Gly Gly Ala Gin As n Arg Sir 65 70 75 TAC AGC AAG CTG CTG TGC GGC CTG CTG GCC GAG CGC CTG CGC ATC 270 Tyr Sir Lys Leu Leu Cys Gly Leu Leu Ala Glu Arg Leu Arg Ile 80 85 90 AGC CCG GAC AGG GTC TAC ATC AAC TAT TAC GAC ATG AAC GCG GCC 315 Sir Pro As p Arg Val Tyr Ile Asn Tyr Tyr Asp Met Asn Ala Ala 95 100 105 AAT GTG GGC TGG AAC AAC TCC ACC TTC GCC TAA 360 As n Val Gly Trp Asn Asn Ser Thr Phe Ala 110 115 the other nucleotide sequences encoding sequences amino acids no different from those shown in more than twenty amino acids inserted into the plasmid vector pKP1500 as shown in Figure 1. 3. A method of culturing recombinant bacterial cells, characterized by such a combination of an expression vector, a host strain and multiplication conditions, to enable recombinant MIF to be obtained in a soluble form in the heterologous E. coli system. 4. A method of isolating and purifying a recombinant MIF, characterized in that it involves a combination of a. ) MIF extractions from bacterial cells by freezing and thawing bacterial cells b. ) a two-step purification protocol for recombinant protein, including gel filtration and ion exchange chromatography c. ) and the method for tracking and quantifying recombinant MIFa during purification on the basis of isoelectric focusing and / or SDS polyacrylamide electrophoresis analyzes. 5. Nucleotide sequence ATG CCG ATG TTC ATC GTA AAC ACC AAC GTG CCC CGC GCC TCC GTG 45 CCG GAC GGG TTC CTC TCC GAG CTC ACC CAG CAG CTG GCG CAG GCC 90 ACC GGC AAG CCC CCC CAG TAC ATC GCG GTG CAC GTG GTC CCG GAC 135 CAG CTC ATG GCC TTC GGC GGC TCC AGC GAG CCG TGC GCG CTC TGC 180 AGC CTG CAC AGC ATC GGC AAG ATC GGC GGC GCG CAG AAC CGC TCC 225 TAC AGC AAG CTG CTG TGC GGC CTG CTG GCC GAG CGC CTG CGC ATC 270 AGC CCG GAC AGG GTC TAC ATC AAC TAT TAC GAC ATG AAC GCG GCC 315 AAT GTG GGC TGG AAC AAC TCC ACC TTC GCC TAA 360 characterized in that it encodes for human MIF in epithelial cells of different tissues, such as in the epithelial cells of the human uterine endometrium. 6. Recombinant MIF with amino acid sequence Met Pro Met Phe Ile Val Asn Thr Asn Val Pro Arg Ala Ser Val 5 10 15 Pro Asp Gly Phe Leu Ser Glu Leu Thr Gin Gin Leu Ala Gin Ala 20 25 30 Thr Gly Lys Pro Pro Gin Tyr Ile Ala Val His Val Val Pro Asp 35 40 45 Gin Leu Met Ala Phe 50 Gly Gly Ser Ser Glu Pro Cys Ala Leu Cys 55 60 Sir Leu His Ser Ile Gly Lys Ile Gly Gly Ala Gin Asn Arg Ser 65 70 75 Tyr Sir Lys Leu Leu Cys Gly Leu Leu Ala Glu Arg Leu Arg Ile 80 85 90 Sir Pro Asp Arg Val Tyr Ile Asn Tyr Tyr Asp Met Asn Ala Ala 95 100 105 Asn Val Gly Trp Asn Asn Ser Thr Phe Ala * ¹ 110 115 or other sequences amino acids that from the displayed differ by more than twenty amino acids, characterized in that it is obtained from E. coli by the method of claims 3 and 4 or in any similar manner, and its use for the preparation of pharmaceutical preparations, diagnostic reagents as well as its use for any other purpose , which are outside the scope of non-applied scientific research.