SI8110859A8 - Process for producing recombinant dnk molecule, capable of inducting polypeptide expression in an one-cell host - Google Patents

Description

PROCEDURE FOR THE MANUFACTURE OF A HUMAN FIBROPLAY INTERFERON TYPE POLYPEPTIDE

Technical field

The invention is in the field of biotechnological processes for the synthesis of polypeptides. The designation according to the International Patent Classification is C 07 C 103/52; C 12 N 15/00; C 12 P 21/02; C 07 H 21/04; A 61 K 45/02.

Technical problem

The present invention solves a technical problem of a method for producing IFN-beta type polypeptides by their expression in a transformed host, wherein the transformation of the host is effected by previously located and isolated sequences and recombinant DNA molecules encoding for HuIFN-beta expression.

The state of the art

This application uses the interferon nomenclature published in Natur », 284, p. 2421 (10 Joll, 1980). This nomenclature supersedes the one that has been amended on our earlier applications on the basis of which the now-finalized application has priority. P.P., IP is now designated IFN and fibroblaetn and 'interferon is now designated IPR-beta.

It is known to fast two classes of interferons (IFH). Class I interferons are small (glyco) -proteins, and melt-n-acids, which make up the components, repel 'virus infection (λ, Issacs and J. Lindennann, • Interferon I. Interferon *, Away »Royal Soc. Ser. B ., 147, pp. 258-67 (1957) AND WE Stevart, II, "Pha Interferon Svste", Springer-Verli (1979) (hereafter The Interferon Syatea ·)) "Class II IFNs are labile and acidic. Currently, they are poorly characterized !. Although they are specific for de leves (The Interferon Sveten, pp. 135-45), IFNs are not virus specific. Indeed, IFN Stiti shares it against a wide variety of viruses.

Human interferon (HuIFN ·) is classified into three groups, alpha, beta, and gamma. HuIFN-beta or fibroblast interferon is produced after appropriate Induction into diploidnia fibroblast® delian. It is also produced in anomalous amounts, together with the major® amount of HuIFN-alpha, into the lymphoblastoid »delian. IFN-beta made from these parts is extensively cross-linked and characterized (E. Knight, Jr., • Interferon t Purification And Znitial Characterization Pro® Bunan Diploid Whole ··, Contd. Kati. Aoad. Sol. OSA, 73, pp. 52023 (1976).

It is a glycol protein of aolecnl weight of about 20,000 (M. M ^ ranovskaStevart, et al., Contributions of Carbohydrate Moieties To The Physi And Biologioal Properties of Humane Leukocyte, Lys ^ phoblastoid And Fibroblast Interferons, Abet. Ann. Maeting Anar. Soc. Mlcroblol., P. 246 (1978) It is also heterogeneous in size probably because of its carbohydrate species.

The amino acid composition of authentic human fibroblast interl roaa has also been published (E. Knight, Jr., et al., Huaan Fibroblast Interferon: Anino Acid Analysis And Anino-Terainal Anino Acid Seguence, Science, 207, pp. 525-26 (1980)) . X explaining the amino acid sequence of an authentic human fibroblast protein is n progression.

Until now, the amino acid sequence of the NHj teminus has been authenticated to an authentically mature protein with the first 13 amino acid residues: Met-Ser-TyrAan-Leu ~ Leu-Gly-Phe-Leu-Gln-Arg-Ser-Ser ... (E. Knight. Jr., et al., Above).

Two distinct genes, one located on Foodsan 2 and the other on Chronososus 5, have been reported to code for IFH-beta (DL S late and FH Ruddle, Fibroblast Interferon In Man Is Coded Tvo Loci On Separate Chromosones, Celi, 16, pp. 171 -80 (1979)) · Medjutin, other studies indicate that the IPH-beta gene is located on chronosone 9 (A. Medger, et al. Involvenent Of A Gene On Chronosone 9 Zn Hunan Fibroblast Interferon Productioa ”, Mature, 280. pp. 493-95 (1979).

Although an authentic HuIFN-beta glycosyllran, the removal of a carbohydrate species (F. J. Bridgen, et al., Hunan Lynphoblastoid Interferon *,

J. Biol. Chen., 252, pp. 6585-87 (1977)) or the synthesis of IFH-beta in the presence of a Sia inhibitor is intended to induce glycosylation (HE Stevart, II, et al., * 8ffect of Glyoosylatiee Inhibitors On The Prodne ti on And Pruperties of Hean Leukcyte Interferon, Vlrology. 97, pp.

473-76 (1979); J. Fujisava, et al ·, Honglyoosylated Mouse L Whole Interferon Produced By Tunicaarfcin Action, J. Biol. Chezu, 253 pp. 8677-79 (1978); E. A. Havell, et al ·, * Altered Molecular Bpsoies Of Hunan Interferon Produced in the Proslence of Glycosvlation Inhibitors J. Biol. Chem., 252, pp. 4425-27 (1977); The Interferon Systsn, p. 181) gives a sleeker form of IFH-beta, which joffes always keep the most 111 of its 37H activity.

HuIFH-beta, as 1 smog human protein, should also be poly * raorphic. Therefore, the cells of certain individuals may produce IFN-beta species that are within a general IFM-beta class that are physiologically similar but structurally insignificantly different from the prototype class of which sn is a part. Therefore, while the protein structure of IFN-beta is generally well defined, some individually! can produce IFN-beta, which are minor variants of the general type.

IFN-beta is not normally found in normal or healthy cells (The Interferon Svstea, pp. 55-57). instead, the protein is produced as a consequence of exposure to the ITN induceatn cell. IFN induce sn agents are usually viruses but can also be of antiviral character, such as naturally occurring double stranded RNA slats, intracellular microbes, microbial products and various chemical agents, numerous attempts have been made! to exploit these neurus and inducers to make human cells resistant to viral injection (S. Baron and F. Bianzani (eds.), Teras Reports on Blolocrr And Medicine, 35 (Teras Reports), pp. 528-40 (1977)) · These attempts were not very successful; instead, the use of exogenous BuIFN-beta is now preferred.

Therapy for interference against tumor 1 virus or cancer was performed at various dose intervals and with racial routes of administration (The Intor feron System, pp. 305-321). For example, interferon is effectively administered orally, with an inoculum - intravenously, intranusally, intranasally, "intradermally, and subcutaneously - and in the form of drops with (Ao, fat 1 sprays. It is usually given 1 to 3 pats a day for doses of 10 to 10 units. For example, viral infections are usually treated with 1 or 2 doses a day for a few days to two weeks and tnaori 1 cancers are usually treated with one 111 multiple doses a day for several months or years. the particular patient should, of course, be determined by a physician, who will consider such well-known factors as the course of the disease, previous therapy and the patient's response to interferon with the choice of route of administration and dose interval.

As an antiviral agent BalTO is corilden with following respiratory infections (Teras Reports, pp. 486-96) "herpes simplex caratitis (Teras Reports, pp. 497-500" R. Sundnacher, Erogenous Interferon in Eye Diseases, International Vlrolog IV "The Bagae , Abstract nr. W2 / ll, p. 99 (1978)) »Acute Hesnragic Conjunctivitis (Teras Reports, pp. 501-10)» Adenoviral Keratoconjunctivitis (A. Sooano, et al., ISM Meao I-A8131 (October, 1979 )) "Varicella soeter (Teras Reports, pp. 511-15)" elteoegalovirus infections (Teras Reports, pp. 523-27) "and hepatitis B (Teras Reports, pp. 516-23). See also The interferon Holy, pp. 307-19. However, using ITO as an antidote requires more ITO than has been anticipated so far.

ITO Has Other Effects Apart from Its Entivlruded Effect · Be an example, it antagonizes the effect of colony squeezing factors, inhibits the growth of henna fragments forming hemopoietic colonies, and has no unrealistic differentiation of the macrophage granalocyte precursor marrow (TeraB Reports. Op. 343-49). It also inhibits erltroid differentiation of aa by DMSO-treatment with delays. Leukemia Attack (Teras Reports, pp. 420-28) · It is significant that some parts of the echo line of the leg are significantly more sensitive to BalZo-beta neg * to BaZTO-alpha and the sheep gaze (S. Einhom sad H. Strander, Is Interferon Tissa «-8peclfio? - Bffect of Banan Leukocyte And Pibrcblaet Interferon On The Groath of ppaphoblastoid And Oeteoeareon Whole Lines *, J. Cen, Virol., 35, pp. 573-77 (1977)» T · Kosata, et al ·, Coaparlson Of The Suppresslon Of Whole And Virus Groath In Trsna Formed Banana Celish By Leukoepte And Pibrcblaet Interferon, J. Gen. Virol.,

43, pp. 435-39 (1979).

ITO will also play a role in regulation and technological reaction.

Re prieer, depending on the dose of 1 time of yield and the antigen ratio.

ΙΓΝ Knives are both immunopotential and immunosuppressive in vivo and in vitro (Texas Reports, pp. 357-69). Furthermore, it is noted that specifically sensitizing lymphocytes produce ITO after contact with the antibody. Such antigen-inducing antigens therefore serve as a regulator of the immune response, affecting both the circulation of antigen levels and the expression of cellular immunity (Texas Resorts, pp. 370-74). IPN is also known to enhance murine lymphocyte activity by deletion-mediated antibody-dependent cytotoxicity (RR Herberman, et al., Augmentatlon By Human Matural Interferon And Antibody-Dependant CellMediated Cytotoxicity, Mature, 277, op. 221-23 (1979) ; P. Beverly and D. Knight, * Kllling Comes Maturally, Hattre, 278, pp. 119-20 (1979); Texa »Reporta, pp. 375-80; JR Hiddlestone, et al., Inducti And Kinetios Of Matural Killer Celiš and Humana Folloving Interferon Therapy, Nature, 282, pp. 417-19 (1979); S. Einhorn, et al., Interferon And Spontaneous Cytotoxicity In Man II Studies "In Patients Recelving Esogenous Leukocyte Interferon, Acta Med" Soand ., 204, pp. 477-83 (1978). Both can be directly or indirectly contracted in an immune attack against Tumor Cells.

Therefore, in addition to its use as an antiviral agent, HuZPM has a potential application in antithumoma 1 anticancer therapy (The Interferon System, g ». 319-21 1 394-99). IPM is known to influence the growth of many classes of tumors in many Slavic countries (The Interferon System, pp. 292-304). Interferonl, like many other antitumor agents, seems to be most effective when used against small tumors. The antitumoml effects of animal IPM were dose- and baggy but demon- strated in conoentraea below toxic levels. Prana thorne, numerous investigations have been performed 1 clnical tests 1 continue to be performed in the field of antitumor and anticancer properties of HuIFN. These include treating several malignancies such as I oeteoaarcoma, acute myelid leukemia, multiple myeloma 1 Hodikins disease

- 7 Taras Reports, pp. 429-35). Furthermore, HuIPN-beta has recently been shown to induce local tumor regression when truncated and subcutaneous tea fivors in melanoma 1 of the invading ea ifednino breast (T. Nemo to, et al., Human Interferon And Intralesional Therapp Of Melanoma And Breast Carcinoma. American Assoc. Por Cancer Research, Abs 993, p. 246 (1979). Although the results of these clinky tastes were encouraging, antitumor and anticancer prim-beta recipients were severely swollen by the lack of an adequate source of purified ZPH-beta.

Significantly, some parts of the echo lines that resist the antibodies with strong IFN-alpha effects remain sensitive to ljive-beta. This diferential effect suggests that IFN-beta may be used successfully against certain classes of resistant tumor portions that occur under selective pressure in patients treated with high doses of ZPN-alpha (T. Kuva ta, et al, supra; AA Creasv, et al., The Bole of G ^ -Gj Arreet In The Inhibition Of Tumor Whole Grovth By Interferon, Abstracts, Conferenee On Regulator? Punctions Of Interferon. MI Acad. Sci., No. 17 (October 23-26,

1979).

At the biochemical level, IPNs induce the formation of at least 3 proteins, protein kinases (B. Lebleu, et-1., Interferon, Double-Stranded RNA And Protein Phosphorylation, Proceedings of the Mother. Acad. Sd. USA, 73, pp. 3107-11 ( 1976); AG Hovanesslan and I. il Nerr, The (2 * -5 *) Ollgoadenplate (ppp Α2'-5Α2'-5 · Α) Saynthetase And Protein Kinase (s) Prom InterferonTreated Celish, Bur. J. Blochem. , 93, pp. 515-26 (1979)), (2'-5 ') oligo {polpmeraae (AG Hovanesslan, et al., Spnthesla Of Lev-Moleeular Neight Inhibitor Of Protein Spntheels Nlth Bnzyme Prom InterferonTreated Celish, Nature, 268 , pp. 537-39 (1977); AG Hovanesslan and IM serr, Bur. J. Blochem., strict) 1 phosphodiherase (A. Schmidt, et al ·, An Interferon-Induced Phosphodiesterase Degrading (2'-5 ') oligolsoadenvlate And The CCA Term »Of tRNA, Proc.Natl.Acad.Sci.

- 3 OSA, 76, pp. 4788-92 (1979).

I IFN-beta and IFN-alpha seems to sources cited by similar anziiaatske Roads (C. Baglioni / ^Interferon-a Induoed Lnzjmatic Activities And Their .Role And The State Antiviral ⁴ / Cell, 17, pp 255-64 (1979) and both may share a common active inner cleft because they both recognize the distal receptor encoded by krcEiosoir.o? i 21 (M. Viranovzska-Stevart,

The Releases of Human Chromosoiie 21 in Sensitivity to Interferon ”/“ J. Gen. Virol., 37, pp. 629-34 (1977). The appearance of one or more of these enzymes in the tertiary ® aa ΙΓ77 deletions should be facilitated by further characterization of the protein ea by the activator of slienora ea ΙΓΝ.

Dana * ae HuIFN-beta Produces Human Partial Lines Cultured in Tissue Culture · This is a costly low yield procedure. One large producer makes aas »about 40-50 x 10 units S ir of this IFN-beta per year (V.G. Edy, et al., Human Interferons Large Scale Production

In Embrio Fibroblast Culturas, in Juan Interferon (W. R. Stinebring and R. J · Chapple, eds.}, Plenum Publishing Corp., pp. 55-60 (1978)) ·

After purification by adsorption on glass beads of controlled pores, IFH-beta specific activity of <3 about 10 ^€ units / mg in 50% yield from the extracts of the crude parts was isolated (A. Billiau, et al.

Human Fibroblast Interferon For Clinical Trialst Production, Partial

Purufucation And Characterization, Antimlcrobial Aoents And Chemother «py, pp. 49-55 (1979). Further purification to a specific activity of about 10 units / mg was achieved by cyan-chelate affinity chromatography in about 100% yield (A. Billiaa, et al., Production, Purifica * soil And Properties Of Human Fibroblast Interferon, Abstracts, Conference Oa Re <yulatoryFcnctlons of Interferons, NT, Acad. Sci., nr. 2 (October 23-25, 1979)) · Because the specific HuITN-beta activity is so high, the amount of IFN-beta required for cooercial applications is low. For example, 100 g of pure IFH-beta provide between 3 and 30 illion doses.

~ 9 Recent advances in molecular biology have facilitated the introduction of DMA, which codes for specific non-bacterial eukaryotic proteins into bacterial cells. Basically, with DNA different from that made by chemistry synthesis, "the construction of such recombinant DNA molecules involves the steps of producing a single strand (cDNA) DNA copy template production of the purified RNA (fiRNA) template for the desired protein / cDNA conversion to double-stranded DNA / binding the DNA to the corresponding n place where n corresponds to the two cloning carrier so that recombinant DNA molecule 1 is formed then the corresponding host is transformed with that recombinant "DNA molecule". Such transformation may enable the host to produce protein. Several non-bacterial genes and proteins have been obtained in E. poly using recombinant DNA technology. These include, for example, IFN-alpha (S. Naga ta, et al. £ yathesie in E. coli Of A Polypeptide vlth Human Leukoejte Interferon Activity, Dature, 284, pp. 316-20 (1980)) · Further, recombinant DNA technology has been used to produce plasmids that are said to contain a gene sequence encoding IFH-beta (T. Taniguchi, et al., Constructioa And Identification Of A Bacterial Plasmid Containing The Human F ib Slave Last Interferon Gene Seguence, Proc. Japan Acad. Ser. 55, pp. 464-59 (1979).

However, in neither of the preceding rows was the actual sequence of the genes with IEN-beta described, nor was the sequence compared to the initial aninokieelin sequence or to the amino-acid composition of authentic IFN-alpha. Banijl lines were targeted only at IFN-alpha, which is a distinct chemical, biological and immunological IFN-beta class I interferon (cf. above). Recent work is based on hybridazadone data only. These data alone do not make it possible to determine that the 11 selected clone contains a complete or actual gene sequence encoding for ZFNbeta or that the sequenced-g of the cloned gene is capable of expressing iFK-beta in bacteria. Hybridization only proves that

- it into a specific DNA insertion sequence in a conscious honolomegase with 1 co-complement of the ea mRNA component · poly (A) RNA how to induce interferon activity when inserted into oocytes. moreover, the extent of the nac homol is dependent on the selected hybridization axes for the test procedure. Therefore, hybridization of the saao to oRiiA component of poly (A) RNA does not demonstrate that the DNA sequence selected is a sequence encoding a HuIFN-beta or polypeptide that enhances the ilunological or biological activity of BulFN-beta or that such sequence will be useful in the production of such polypeptides a corresponding to doo dooiniaa.

At the Seainar n Zurich on February 25, 1950, Taniguchi stated that a nucleotide sequence was determined to be one of its hybridizable maples. He also stated that the first 13 amino acids from which the sequence encodes were identical to those determined by Knight, et al., Above for authentic HuIFN-beta. Taniguchi did not describe the full nucleotide sequence with its clone, nor did it compare the amino acid composition with the composition of the antentiSaog HuIFH-beta. Taniguiehi has since published a full nucleotide sequence with its hybridizing clone (T. Taniguiehi et al. "Prices" 10 "pp. 11-15 (1950)). The sequence differs by one nucleotide from that described and stored in the British patent application. 8011306, filed April 3, 1980, which is an application on the basis of which the present application is prioritizing, the Audaokiseliase sequence cited by Taniguiehi is identical to the one described and protected in the previous application. Taniguiehi also did not announce expression in the appropriate host of polypeptides that exhibit immune or biophysical activity of HeIFN-beta at the time of unification of British Patent Application 89.18701, filed 6 ion, 1980, on the basis of which this application claims priority. It is this expression of the polypeptides that exhibit the immune or biological activity of UuIFN-beta 1 agents, polypeptides, genes, and their recombinant DHA molecules, that characterize the present invention.

- 11 Ui ee this invention will relate to such as the obvious suggestion of Research Description Ho. 18309, p. 361-62 (1979) to produce pure or substantially Sista mRNA. IFN-alpha before attempting? »To clone the IFN gene iii to produce interferon-like fJLbroblast polypeptides in bacterial hosts.

Finally, he needs to understand that the choice of the ONA sequence or the construction of a DNA molecule that hybridizes to ηΐΐ'Α from a pell? DNA, in black, that ®SNA produces auIPlii activity in the oocytes, sufficiently demonstrating that the DNA sequence of the hybrid insert is recombinant The DMA molecule corresponds to HuIFN. Instead, in the absence of an amino acid sequence that encodes a native DMA sequence 1 amino acid sequence of an authentic protein, only the production of a polypeptide that exhibits HnIFN immune or biological activity can truly demonstrate that the selected DNA sequence or DS construct is a DNA molecule. Significantly, only after such nuIFN activity has it been demonstrated that the DSA sequence, recombinant DNA molecule, or related sequences thereof, can be used useful in the present invention with the selection of other sequences corresponding to HulFM or the production of recombinant DNA molecules capable of expressing products having an immune or biological activity of HuIFN-beta.

It is therefore clear from the foregoing that the problem of HuX? N-beta production by using recombinant DNA technology is much different from any of the methods described above. Here, the specific DNA sequence must be restrained by a structure - encoding for HuIFN-beta expression in the appropriate host - and separated from a very complex mixture of DBA sequences in order to be used to produce HuIFN-beta. Furthermore, this problem of separation site 1 makes it difficult to predict the extremely extreme concentration of the desired DNA sequence in a complex mixture and the lack of effective means for rapid analysis of many DNA sequences of the mixture to select and separate the desired sequence.

Description of solution to a technical problem

The present invention solves the problems of providing, in accordance with the invention, a method for the production of polypeptides that exhibit biological or immunological activity of HuIFN-beta · The method of the present invention is characterized by the fact that a host is grown, which is transformed by DNA sequences or recombinant DNA molecules that conduct the proi: guided polypeptides that exhibit the immunological or biological activity of H ul J-beta, and that the polypeptide is harvested from the cultured culture.

Based on the present invention, it is possible to obtain polypeptides exhibiting immunological or biological activity of HuIFN-beta for use in anti-viral and antitumor or anticancer agents and methods. The present invention makes it possible to produce these polypeptides in amounts and processes that have not been available so far.

As will be apparent from the description that follows, the process of replicating said DNA sequences and recombinant DNA molecules in the talking host enables the production of genes encoding for said polypeptides in large quantities. The molecular structure and properties of polypeptides can be easily determined. Polypeptides and genes are useful, either produced locally, or after appropriate derivatization and modification, in preparations and methods for detecting and improving the performance of these products, and for use in anti-viral, anti-cancer, or anticancer agents and methods.

This method is therefore clearly different from the methods previously mentioned above, in that, as opposed to the methods of the prior art, it involves the production and selection of DNA sequences and recombinant DHA molecules containing the corresponding DNA sequences encoding for ηε at least one polypeptide that exhibits immune or biological activity of HuIFN-beta.

-15 It will be clear from the foregoing that an essential part of the present invention is a method of providing a DNA sequence characterized by encoding for a polypeptide exhibiting immunological or biological activity of HuIFN-beta and selected from the group consisting of G-pHFIF-1 DNA inserts. G-pHFTF-3, G-pHFIF-6 G-pHFEF-7, G-pPla-HEEF-67-12, G-pPla-HFIF-67-12deltal9, GpPla-HiIF-67-8, G-pPla-HFIF -67-12delta279T, G-pPla-HFEF-67-12deita218Ml, G-pPla-HilF-6712deltaMl, G-pPla-HKF-67-12deltal9BX-2, DNA sequences that hydrolyze in any of the preceding DNA inserts, BNA sequences, obtained from any source, including natural, synthetic or semi-synthetic sources, related by mutation, including single or multiple, base substitutions, omissions, insertions and inversions with any of the preceding DNA sequences and inserts, and DNA sequences comprising sequences or codons that, when expressed, encode for a polypeptide exhibiting similar immune or biological activity with p an olpeptide encoded after codon expression by any of the preceding DNA sequences. The sequences obtained according to the method of the present invention are further used for the production of HuIFN-beta and HuIFN-beta-like polypeptides in the hosts.

Figure 1 is a schematic representation of one embodiment of the method of the present invention for making a mixture of recombinant DNA molecules, some of which are characterized by inserted DNA sequences encoding for polypeptides of this porn.

2 is a schematic illustration of an initial process for testing a clone of the present invention.

3 is a schematic representation of one embodiment of a method for a clone tester using DNA sequences made according to the invention.

Figure 4 shows the complete nucleotide sequence of the strands

--.— .14Lt for encoding a BuZFN-bat DBA. The sequence is indicated by the number from the beginning of the insert as 1 in the untranslated region of the insert. Nucleotides 65-127 predate the signal sequence and nucleotides 128-625 represent mature flbroblast interferon. The amino acid sequences of the slgnal polypeptide are given above their respective nucleotide sequences; slg polypeptide anino acids labeled from -21 to -1 amino acids of the whole interferon numbered from 1 to 166. Review of restriction data 1 fragment analysis of RuIFN-beta DNA present in the culture deposited with UK patent application 80.11306, filed 3 April 1980, showed that two nucleotides were altered in Fig. 4 compared to Fig. 4 of that British application. These changes are in the untranslated sequence that precedes the predetermined signal sequence of the BuIFN-beta ORA. These changes do not affect the BuIFN-beta DNA sequence iii or the amino acid sequence of its translatable product 1, nor do they alter the use of the sequences as hybridization probes with clone testing for BuIFN-beta related DNA inserts.

FIG. 5 shows the orientation and restriction maps of several plaques of the invention.

Figure 6 is a comparison of the amino acid composition of the human fibroblast interferon as determined according to the present invention and the one that is also determined from the automatic fibroblast interferon.

Figure 7 shows the restrackelone mspu of the BumM> eta gene from this sequence and the sequencing strategy used in sequencing pBFZF3, pBFIFi 1 pHTCF7.

Figure 8 is a schematic illustration of the construction of recombinant pPLa-HFIF-67-1 DNA molecule from this invention.

Figure 9 is a schematic illustration of the construction of recombinant DNA molecules pPLa-BFIF-67-12 and pPLa-HFIF-67-12 * 19 from this finding.

* 15

Fig. 10 I sheaatskl view of the coaztrakei of the recesfinaat nm m »lacquer ρΤηΑ-Ώ & ΗΡ- $ 7 ~ 9 from this invention.

Fig. 11 shows an Ohanatal view of the skeleton and a paired roatrifceion map of the pPLa-HFXF- <7-l2 of the present invention.

Figure 12 shows a schematic view of the oriental and pareial matrix · »eioae hood gp £ a * BFX ^ d? ~ 12dl9 lz of the present invention.

Fig. 13 i aheaatic view of erytheae 1 pareial reatrdkelen <

imasemn saChi gmotam ηαα & ΛΒη.

He wants a better description of the process described here for you to give aladadl date opla.

Sofcleotld— "Tangible sailboat nm iii" that stalled by Borfzrao door (pestomo), phosphate and aaot batarooiklidaa base »A base born with Bedama door spray glycosidao« gleak (1 'aglyan pentozo) 1 ta »oahlaamol base a · Sasa step * tarile aoklootld · Satiri BMk base for adaaia (k), gazelle (· β ·), eitosia (* C ·) and those {»·). Satire base n 1, S, C l araeil <· 9 * |.

mm Sekvpaea — A llaosml genus of alochloid compound & ib one with drug foafodiastarakia bound upper 3 * and 5 * sgla zaaodaib pentose «

Kodoo ** nm saquaaaa three aaclaotides (triplet) encoding via with SBlnokiseliaa, translaelzai ztsrtal signal 171 translaeloai temi *** aaeleal zigaal «With priasr« adklootldal triplets TTk, TT6, CK »CK, CTk 1 CTS encode for aaozaekieelina Xzu ^w ), TbS, Tik, and TA 1 to translaeloai the delayed signals and IM i traazlaeizai the starting signal.

«» - «« trM «l« d.} · «& A proper mn from ofiitszanja« Ba priaar, nm zekvanea GCTOOTTeTkke nora «· to heal α three wounds with readings or three phases, whereby evaks give different aninokieelin eq.

GCT GOT TOT AAG — Ala-Glv-Cve-Lva

G ^{CTg gTT GTK} AG — Leu-Val — Val

GC TOG TTG TAA G — Trp-Leu- (STOP)

Polypeptide — The linear order of aninociaellin-coupled peptidines linked to each other by alpha-anino 1 carbekai groups of adjacent amino acids ·

Genonr- All DMAs are shared by viruses. It includes, inter alia, * structural genes encoding aupetance polypeptide, such as 1 with the operator, prenoter 1 binding site of ribeson * 1 interecoome sequences, including such sequences as the Sto au Shine-Delgamo sequences.

Structural gene — a DBA cross-coding sequence A template or a non-indigenous BKA (aBBA) sequence of an aninokiaellar characteristic of a specific polypeptide ·

Transcription — The start of ufiHA production from a structural gene.

TGugaglja — The process of producing polypeptides and nBHA.

Expression — A process that undergoes a structural gene to produce a polypeptide · It is a transcription 1 transcription caffeine ·

Plasnid - Sehraeosenic double-stranded DBA sequences that include intact replicas * so that the plasmid replicates in the distant donor · When the plasmid is placed within a non-partial organ of sleep, the characteristics of that organism are changed or transformed as a result of the DBA plasmid. Ba priner, a plasmid carrying a tetracycline-resistant gene (Tat ¹¹ ), is a transfomile of dahlia previously sensitive to tetracycline in a resistant cell.

The cell of the traasfandsana pleznidon owl is a tranafomant.

Pag 111 Bekterlofeo — A bacterial virus many of which contain DBAs encapsulated in protein anotech or coating (* capsid ^w ).

The cloner is cloned— Plasnid, both phages 111 the second ZIBA sequence

- 17, which can be replicated in the host further and is characterized by a small number of endonuclease recognition sites at which such DNA sequences can be excised in a particular manner without loss of the essential biological function of the DNA, e.g. replicates, the production of a coating or g-binding protein of promoter or binding sites, and comprising a marker suitable for use in the identification of transformed cell salts, e.g., tetracycline resistance or resistance to ampicillin. The cloning carrier is often an owl vector.

Cloning - A process for obtaining popu- alia of organisms or DNA sequences derived from one such organism or sequences asexually "reproducing".

Reconblnnt DNA molecule ill Hybrid DNA— A molecule containing DNA segments from different genomes that have been spliced end-to-end outside living cells 1 have the capacity to infect some host cells 1 can be maintained in them.

Expression Control Sequence— The nucleotide sequence that controls 1 regulates the expression of structural genes when they are operatively linked in those genes. These include the lac system, the major operator and promoter regions of phage lambda, the fd protein control region 1 of the other sequence that is known to co-control the expression of prokaryotic or eukaryotic cell genes and their viruses.

In Figure 1, we have shown a schematic representation of one embodiment of a process for making a mixture of recombinant DNA molecules, some of which include the inserted DNA sequences that characterize the present invention

MAKING POLY (A) RNA CONTAINING FIBROBIA INTERFERON mRNA (IFN-beta BRNA)

The RNA used in the present invention was extracted from human VOS cells, a diploid fibroblast cell line that could propagate in single-layer cultures at 37 ° c. IFN-beta ae products

- 18 these "parts of the poala induction a" poly (I, C) of this oichlohekaiiald.

With typical RNA isolation, each of 20 bottles aa diploid »

The VGS delljaraa α confluenters layer was primed over nodl aa 100 units / nl IFN-beta and culture au induced for 1 hour with 100 ^ ug / l poly (I, C) 1 50 / Ug / al) cyclohecalinide, incubated au aa cyclohekallsidott ( 50 / Ug / »1) points» 4 Sasas, defenses, and scratches in phosphate buffered saline 1 were centrifuged. cells ae raakinu fluid »15» and. at 0 ° C to separate the intact nuclei containing MIA and isolate cytoplasmic RNA auxiliaries in hypotonic buffer (10 »M Tris-HCl (pl 7.4), 10» M NaCl and 1.5 »M MgClj) and add» NP40 to 1 %. They separate the granulation »in the Sorvall SS-34 rotor both» 5 «and 3000 rp». They add ae sodium dodecyl sulfate (SDS) 1 EDTA in the aupernatant to lt, or 10 µM, and aaeSa ae extracted 5 times aa 2 x sapr. 1: 1 redistillated phenol and chloroforB-isoBBalalcohol (25: 1), five cups and aqueous phases separated by RNA separating centrifugation »in a Sorvall SS-34 rotor at 8000 rp» points »10» inut after each extraction. RNA ae attaches from aqueous faae addition »1/10 sapr. 2 M sodium acetate (pH 5.1} 1 2.5 ethanol. Usually 60 to 90 / ug total cytoplasmic RNA per bottle is obtained.

Other cytoplaan extraction methods have also been used. tical RNAs. To the primate, the total raacin fraction was precipitated in 0.2 N Tria-HCl (pH 9.0), 50 "H NaCl, 20" M EDTA and 0.5 "

SDS 1 is extracted ae aa phenol-chlorophore »as above (FH Reynolda et al ·, Interferon Activity Produced By Translation Of Human Interferon Heaaenger EMA In Cell-Free Riboseaal Syate» And And Flax »Ooocytea, Proceed To tl, Acad. Acad , Sci.PSA, 72, pp. 4881-87 (1975)) 111 and the washed portions co-opted n 400 / Ul 0.1

-15M NaCl, 0.01 Μ Trls-BCl (pH 7.5) 1 0.001 Μ EDTA (* ΝΤΕ buffer) and 2.5 ml 4 Μ guanidinium isothiocyanate 1 1 M beta-mercaptoethanol in 20 mM sodium acetate (pH 5.0) are added and then the cells homogenize. The lysate was layered on a 1.3-ml 5.7 M CsCl layer in a Beckman SW-60 Ti nitrocellulose tube, rotated at 39,000 rpn so that the granule was RNA and separated from DNA, protein 1 lipid, and SNA was extracted once with phenol-chloroform ( J. Morser, et al., Charaoterisation Of Interferon Messenger SNA Fram Human Lymphobl * stoid Celish, J. Gen, Vlrol., 44, pp. 231-34 (1979).

Total SNA is tested for the presence of IFN-beta mRNA by injection into the cytoplasm of Eancpas laevis oocytes and determination of the IFN-beta activity that is induced therein (Reynold, supra, above). The assay is performed by dissolving the SNA in water and injecting about 50 µl into each oocyte. The oocytes were incubated overnight at eobic temperature in Barth substrates (J. Gurdon, J. Bmbrvol. Bsper. Morphol., 20, pp. 401-14 (1968)), homogenized in part of the substrate, separated by centrifugation and determined. IFN-beta activity of the supernatant. Detection of IFN-beta activity was by reducing the cltopathic effect (NB Stevart and SE Sulkia, Interferon Production in Hampsters Experimentally Infected Nith Midwife Virus, Away, Soc. Bsp. Biol. Med., 123, pp. 550-53 (1955)) · Carat virus was a vesicular stoaatitis virus (Indian strain) and the cells were human diploid flbroblast cells trlsomna with cartilage 21, thus obtaining higher IFN-beta sensitivity. IFN-beta activity is expressed relative to IFN reference standard 59/19.

Poly (A) IFN-beta aSSA-containing SNA isoylated with cytoplasmic δηβ SNA by adsorption of ollgo (dT) - cellulose (type 7; PL Biochemieals) into 0.4 M NaCl, 19 mM Tris-HCl (pH 7.8), 10 mK EDTa 1 0.2 «8DS for 10 minutes at room temperature. SNA aggregation is minimized

----- 20 by heating the SNA for 2 "and at 70 ° C before adsorption. Cellulose leaching slides for the aforementioned "buffer", the poly (A) RNA fraction was eluted with 10 "M Tris-HCl (pH 7.8), 1" M EDTA and 0.2 "SDS. It usually raises 4-Sr watts of total ΓΝΑ, kne 5tc and more marine crickets at 269 m

Further purification from the enrichment of poly (A) PHA in IFN-beta "SNA is performed using forstaatld-sucrose gradients (T. Pavson, et a. 'The sla' of Rous Sarooma Virus aRNAz Activs Zn Cell-Free Trans lati <Nature, 268 , pp. 416-20 (1977) These gradients give slightly higher decomposition than denaturated sucrose gradients, typically about 80 / ug poly (A) RNA is dissolved in 50% formaide, 100 zM LICI, 5 mM EDTA 0.2% SDS and 10 dH Tris-HCl (pH 7.4), warmed to 37 ° C for 2 minutes so as to prevent aggregation and to be screwed on a 5-20% sucrose gradient in Beckman SW-60 Ti pollalomer tubes. 4.5 hours at 60000 rpm in a Beckman SW-60 Ti rotor with a total »e-labeled eukarlot SNA that serves as a size marker, determining the optical gradient density by gradient 1. All RHA fractions were quenched twice by 0.5 M NaCI and 2.5% ethanol, and tested for mRNA activity as described above. about a 40-fold increase in ZFN-beta mRNA contains poly (A) RNA.

Alternatively, ee ollgo (dT) -sorbated mRNA (60 ^ ug) fractionated by electrophoresis on a 4% pollacryaldal nude in 7 Mcarbamide, 0.1% SD 50 mM Tris-borate (pH 8.3) and 1 sW EDTA, whereby mRNA was dissolved in this buffer and heated for 1 min at 55 ° C before being applied to gal. After electrophoresis iso ze a 2 m wide section of gel 1 RNA was eluted from each homogenized portion of the gel, further cleared by impurity by adsorption on oligo (dT) cellulose 1 tested ae on ZFN-beta mRNA as before.

At this point, it should be understood that even poly (A) EMA prolsvc * 2.1: “obtained both from d-echarous gradient forms and from fractionation on polyacrylamide gel does not contain a very large number of different mRNAs. I sure v with mRNA that is specific with IPN-beta, other mRNAs with undesirable contaminant (Figure 1). Unfortunately, these containeate RNAs behave similarly to HuIFN-beta mRNA in the rest of the cloning process of the present invention. Therefore, their presence in poly (A) RNA will lead to the obligatory generation of a large number of unwanted bacterial maples containing genes that can encode from a polypeptide different from IFN-beta. This contamination poses complex testing problems in isolating deplorable IPN-beta hybrid clones, "secreting IPN-beta, probing probes further introduces the disadvantages" of a solely purified HuIPN-beta mRNA ill ONA sample, or part thereof acting as a probe for identification testing. mourned maples. Therefore, the IFN-beta clone test procedure consumes a lot of time 1 heavy Je. Further, because of the very small percentage of IFN-beta clones that are expected to express IPN-beta themselves in biologically or immunologically active form, isolation of the active clone is a needle in a haystack n test procedure.

Conveniently, we can use recombinant DNA technology to harbor a purified sample of HuIFN-beta mRNA or cDNA or a portion thereof. The purified mRNA or cDRA mRNA can then be used to rapidly test a very large number of bacterial clones, thus significantly increasing the likelihood of an isolated clone expressing IPN-beta in active form.

SYNTHESIS OF DOUBLE TWO-FRAME THREAD CONTAINING IFN-beta pPNA

Poly (A) SNA enriched in IPN-beta mRNA is used as template with complementary DNA (cPSA) production, essentially as described in S. D · vos, et al ·, Canstruotion And Charaetarisation of

-22 λ Plasaid Contalalng A Nearly Full-Siza DNA Copy Of Saoteriophage MS2 KNA * .J. Mol. Biol., 128, pp. 595-619 (1979) s «construction of a plasmid containing the D2? A horse of bacteriophage MS2 WA.

single-strand cDKA is made of poly (A) RNA using DSA-dependent RNA polymerase (25 units) from avian myeloblastosis virus (* AMV) and its reverse transcriptase (gift from Dr. J. Beard, Life Science · , Gulfport, Florida), initiated by aa (dT) _{J0 primer} (6 ^ ug, Mila ·) which was hybridized to the poly (A) tail of SNA, in 50 ^ ul 50 mM Tris-HCl (pH 8.3), 10 oM MgClj. 30 OM Betaarcaptoatanol, 4 aM Ha ^ PjO ?, 2.5 / Ug // Ul inactivated bovine serum albumin, dTTP, dATP, dCTP and dGTP, each at 0.5 MM and alpha ^^ P-dATP (20 / UCi, Amarsham) · After For 30 minutes at 41 [deg.] C., the reaction was quenched by the addition of EDTA to 10 nM, the reaction was extracted with an equal volume of. phenolthlorooformtisoemylalkabolol (25 <24tl) and the aqueous phase was separated on a Sephada :: G50 column and eluted in TE buffer (10 nM Tris-NCl (ph 7.5) 1 raft EDTA). Empty fractions exhibiting radioactivity were precipitated by the addition of 10 µg Tt, transfer of RNA, potassium acetate (pB 5.1) to 0.2 M 1 2.5 closed.

ethanol.

The cDNA population synthesized above actually represents complex cDNAs originating from different mRNAs that were present in different poly (A) mRNAs (Figure 1). Furthermore, due to premature labeling of AMF reverse transcriptlase, many cDNAs are incomplete copies of different mRNAs in poly (A) RNA (not shown in Spill 1).

Before the phyto is said to have a double strand, the cDNA is separated from its aggregate with a co-complementary chess ion «NA by precipitation with ethanol and incubation in TE buffer (10 ad: Tris-HCl (pfi 7.5), 1 mK EDTA) with ribonucleases (10 unit, Sankyo Co ·, Ltd) and pancreatic ribcnuclease A (10 / ng, Sigma) up to 20 ^ ul for 30 minutes at

-2337 ° C (ribonuclease are free of specific endo- and exo-deoxyribonucleases with one). Separation of the template strand by ribonuclase um3to ea by alkali Avoid cDNA mutation by alkali-catalyzed deamination is avoided.

The cDNA strand is prayed to be "sintered to be double stranded by DNA polymerase X (A. Efstratiadis," t al., Enzynatic In Vitro Synthe Of Globin Genes, Celi, 7, pp. 273-86 (1976)). The 10 µl ribonuclease / cDNA mixture from the above was diluted to 20 ml with MgClj up to 10 nM, DTT up to 10 mM, potassium phosphate (pB 6.9) up to 100 nM, dATP, dCTP, dTTp and dSTP each up to 0.3 mM were added , alpha- ³² P-dATP (2- ^ uCi, Amersha ») and DMA polymerase I (49 units, Biolabs). After 6 hours at 15 ° C, 2DTA up to 10 uN 1 SDS was added up to 9.1% and cDKA from two-strand "filament extraction" (phenol-chloroformiizeamyl alcohol), chromatography (Sephadez G50) and precipitation of the blank fractions as above.

To open a single-strand latch on the double-stranded cDNA structure, the stalolen cDNA was dissolved in 109 ^ ul 0.2 M HaCl, 59 sodium acetate (pB 4.5), 19 mM zinc acetate * and 2 ^ ug

DiiA of cow thymus denatured by heating and reacted with Sl nuclease (5 units, Sigma) for 30 minutes at 37 ° C. Addition of EDTA up to 10 µM, ex bands of aa femolthloroform: oxoyl alcohol and precipitation and aqueous phase addition of 10 µg S. coli transfer of SNA as carrier, 0.2 M sodium acetate (pH 5.1) and 2.5 sapr. ethanol so that a cDNA mixture with a double strand and a blank end is obtained. This mixture is heterogeneous both as a consequence of the heterogeneity of the poly (A) SNA used as a template to make it (Figure 1) and due to premature termination; CONA transcripts of Poactiu SiiV reverse transcriptase (not shown in Figure 1) ·

To attenuate the effect of the latter heterogeneity, double-stranded sDNA is sorted by electrophoresis ca 4% polyacrylateLdnoat gel in 50 »M - 24 -

Tris-borate buffer (pH 6.3) and 1 «H FDTA, where 5 * - Paarkiranl restrikeioai fragments (0X174 (? T) -DNA) serve as size junkers. It is selected by DNA bands of appropriate size (eg, class i ». Vna-SSO bp, - 6 * 0-700 bp and 550-650 bp).

As double-stranded single-stranded DNA was electrophoresed, the poly (A) RNA on the polyacrylamide gel exhibits a primal band at about 850 bp, ena that this band represents the full length of the DNA. The bands were eluted with crumbled gel in 0.5 M anonium K-acetate and 0.1%

SDS 1 a »Sleep j one overnight. As the waste is removed by centrifugation, DNA is adsorbed on the hydroxyapatite powder, and is digested on a Sephadez G50 column in 5 µl sodium phosphate (pH 7.5), washed extensively with buffer, eluting with 0.45 K sodium phosphate. (pH 7.5) and the immediate effect of the salt is the effects of seeding the Sephadex G50 matrix.

Fractions containing eluted DNA, such as ³² P-radioactively regirated, were added the addition of 10 [mu] g E. coli transfer BNA, sodium acetate to 0.2 H and 2.5 sapr. ethanol.

The efficacy of the cDNA preparation described above was demonstrated by typical "ekeperitinone" in which about 2 µg of poly (A) RNA yielded about 16 ng of double-stranded cDNA after a foramamide-sucrose gradient, which has an interval of 900 to 900 bp.

Again, it is crazy to realize that a double strand cDNA has produced a large number of cDNAs, of which only a few are ITN-beta cDNAs (Figure 1) with a double strand strand

Can use racial combinations dooin / carrier with cloning in cDNA cloning with double "nor transfer this" invention "

For example, useful cloning carriers may consist of segregated chromosoans, non-chroasoas and syn, and such DNA sequences, such as racially imaged SV40 derivatives and known bacterial plasma di, e.g., K. coli plasaids that include col El. pCRl, «25 pBR322, ρΜΒ3 and their derivatives, plascd.de of various domains, e.g.

RP4, DNA phage, ". Eg., Numerous phage lambda derivatives," "e.g., hl-i 989 1 other DNA phages, e.g., HI 3 χ Fliatoanteoua DNA iage with equations and vectors derived lx combination of pla2. J. DNA phages such as plasmids that have been modified to use DNA phages or other sequences to control expression or plasmid DNA of a yeast such as 2 plasmids or derivatives thereof. Corina hosts may include bacterial hosts such as E. coli HB 101, E. crCl Χ1776,

E. eolj Χ2232, E. coli MSCI and Pseudomonas aoea, 3ect.Ilua subtilis, Bacillus stcarotheraophllga and other bacilli, yeast and other gljlvioe, lvivorous lli or native plants such as * Cells of animals (including human) or other plants in culture iii . Of course, not all home / vefcor combinations are equally effective. Certain choices of the clone / host clone combination may be made by an expert after due consideration of the principles and principles without departing from the scope of this underwriting.

Further, within each specific cloning carrier, different sites for double stranded DNA insertion can be selected. These sites are usually constructed with the help of restricdone endonuklease that cuts them.

For example, in p3R322, the Fifth locus is located in the beta-lactamase gene, between nucleotide triplets encoding for aainophyseles 181 and 182 of that protein. This site was used at the beginning of S. Nagata et al., Supra, in the synthesis of polypeptides exhibiting the in vitro or biological activity of IFH-alpha. One of the two spreads of Hladil endonuclease is between the triplets I code for amino acids 101 1 102 and one of several Tag sites is on the triolet that codes for amino acids * ft * <5 beta-lactamase in pMt323. Similarly, the Ecom site and the PvuII site in this plasmid lie outside the coding region, the BooK1 site is located between the gene encoding it for resistance to tetracycline or ampicillin. This site was used by sn T. Taniguichi et al., Supra, υ their ccombinant scheme and scheme. This set of experts have been well received. Of course, it should be appreciated that a cloning carrier useful for a sheep of the invention must have an endonuclease junction site for interfering with the selected SKR fragment. Instead, the carrier can be coupled for fraguene by alternative procedures ·

A vector or cloning carrier and a specific site selected from its junction of the selected DMA fragment to form recombinant DNA molecules are arranged on the axis of various factors, e.g., numbered sites that are adherent to a particular restriction enzyme, by the size of the protein required 8 Proteolytic degradation by host enzyme enzymes, contrains, or extracellular protein expressions that are difficult to separate during purification time, by expression characteristics, such as the location of starting points 1 key codons related to the sequence vector, and other factors understood by those skilled in the art. The choice of vectors and sites of interference for a given gene is determined by the balance of these factors, and not all choices are equally effective with the given case.

Inko has learned several techniques for inserting foreign DNA into a carrier with a cloning or vector to form a recombinant DMA molecule, a preferred method of initial cloning according to the invention is plasmid digestion (determined p88322) with a restriction enzyme that is specific to the site selected with insertion (designated Fifth) and adding dA tails "at 3 'ends" to the terminal transferase. In a similar way, double strand eDMA is elongated by adding dT tails to 3 ′ jeres so as to allow fusion with the tail plasmid · The tail plasmid and cDMA ee then kale

- 2? : to s «insert cDTIA into the proper nose of the nlasnaid and circularise the hybrid R! 'A at 2 on': the anplonsntary character of the tails enriches them in cohesion (Figure 1). Robiveiii recititant DNA molecule now crazy »! uaetnut gene at irabranon P :: tl rontrikcionoit rsesfcu (Figure 1). This procedure of da-dT tail binding for insertion is described in RA Jackson et al., Diooheiaical Methcda Por Inserting Hew Gene ti c Information Into DNA Of Sinian Virus 40: Circular SV40 DNA Molecules Containing Laada Phage Genes And The Galactose Operon Of Hscherichia coli. Before c. TTatl. Acad, Sci. USA, 69, pp. 2904-909 (1972) and R. Devos Qt al., Supra. It results in about 3 times more recombinant h DKA plasiaids than dG-dC tail binding.

Natural, other known methods for inserting DNA sequences into cloning carriers to form recombinant DNA molecules are equally useful in the present invention. These include, for example, dG-dC tail binding, direct ligation, synthetic binders, exonuclease and polyerase repair responses that accompany ligacs, or elongation of DNA strands with DNA polyerase and a corresponding template with one strand after ligation.

It should be understood, of course, that the nucleotide sequences or cDNA fragments inserted on the selected clone carrier iseet may include nucleotides that are not part of the actual structural gene for the desired polypeptide iii, or may include only the fragment or complete structural gene for the desired protein. All that is needed is that no matter which DiiA sequence is involved, the transformed host produces a polypeptide that has the biological or immunological activity of HuIFN-beta or is itself a DNA sequence? Cornell as a hybridization probe for harboring clone cells contains DNA sequences useful in the production of polypeptides having immunological or biological activity of HuIFN-beta.

The cloning carrier iii vector containing the foreign gene used with xa trans is formed by a ckruaein such that s *> σ '? Χ: 5ι that dccaacin expresses polypeptides that exhibit immunologic or kiologic activity of HuIFN-beta from which the hybrid gene encodes. Choosing the right doasadin is also controlled by most of the fact - those in science.

These include, for example, compatibility with the choice vector, toxicity of proteins encoded with the hybrid plasmid, ease of isolation of the desired protein, expression characteristics, biosecurity and cost. the balance of these factors must ee processes with the understanding that these hosts do not have to be equally effective 2a expressing a particular recombinant DNA strand.

In the present synthesis, a fair initial cloning carrier is the bacterial plasmid pBR322 and the preferred initiation of restriction endonuclease is Fifth (Fig. 1}. Plasmid is small (about 2.6 megadaltocay plasmid carrying antibiotic resistance * antibiotic resistance genes). ληρ, and tetraeicline (Tet). The plasmid is fully oecmterloan (F. Bolivar et al ·, Vnutrietien And Characterization ef '7av Cloning Vehicle II · A Multi-Purpose Cloning System, Ghana, pp. <5-113 (1977) / J.G. Sutoliffe, p3R322 Aestriction Map Derived Tron The DNA Segueacet Aoourate SNA Size M & rkers Up To 4361 Nucleotd.de Pairs Long,

Nucleic Acida Assearoh, 5, pp. 2721-28 (19713 / J. G. Sutoliffe, Coraplete Hueleotide Seguence of The Escherichia coli Plaid p3R322,

Col4 Sprlo »iUrbor» raMtln, 41, I, pp. 77-90 (197 «)).

Obstruction of the BKA insert into this site is provided by a large number of bacterial clones, each containing one of the DNA genes or fragments thereof present in the eDNA product made earlier. Again, only a few of these clones contain the gene with IPN-beta or its fragments (Figure 1), and none of them may allow expression of polypeptides that exhibit immunological or biological activity of IPN-beta. Preferred home based on the present invention -

j · E. coli HB 101.

1. Making Pst1-cleaved, dA-elongated pBR322

Plasmid pBR322 was digested co-aptly at 37 ° C with Pati endonucleosors (Nev England Biolabs) in 10 «M Tris-HCl (pH 7.6), 7 nW MgCl ₂ r 7 dK 2-mercaptoethanol. The sraeSa was extracted with 1 vapor of phenol and 10 vapor of ether and settled with 2.5 vapor. of ethanol »0.2 H of a sodium yuan-aoetate solution.

Addition of hcsnopolymeric dA tails (Fig. 1) terminal * »deoxynucleotidyl transferase (TdT) (preSiSden according to L. Chang and F. J.

Bollum, Deoxynucleotlde-Polyxaerizing Eazynes Of Calf Thymus Gland ”,

J. Biol, Chem., 246, pp. 905-16 (1971) contained in a reaction volume of 50 µl containing 0.14 M potassium cacodylate, 30 mM

Tris-HCl (pH 6.8), 1 [mu] M CoSO, 0.2 [mu] g / [mu] l of albumin of oxen sertsaa 32 inactivated by heating, 0.8 sM DTT, 0.2 [mu] M dATP and non-alpha-PdATP. Incubation is at 37 ° C for 5 minutes before EDTA is added to 10 aM and SDS to 0.11 and the bold is extracted with phenol and chromatographed on Spehadez 650 in TE buffer. Blank fractions containing linearized and elongated pBR322 were further purified by adsorption in 10 aM Tris-HCl (pB 7.8), 1 mM EDTA and 0.4 M NaCl on oligo (dT) cellulose. After extensive iaping, the bleached fractions were eluted with 10 aN TTiS-BCl (pH 7.8) and 1 oH EDTA.

2. Making dt-elongated bottom

Double stranded DNA was elongated with dTKP residues in a similar manner to the Bto js described above with dA tail binding pBR322, except that dTTP and neBto ^ Η-dTTP were replaced by dATP and alpha - ^^ P-ATP · Crosslinking nn oligo (dT ) cellulose is of course omitted. Earlier, dT-elongated DNA was bold of different species, only a few of which were related to HuIFN-beta (Figure 1).

- 303. Making Ca-treated g «coli BB101

Ca + ^ - treated E. coli HB101 was made by the procedure provided by E. M. Lederberg and S. M. Cohen, Transformation of Salmonella Tvphinurlum By piasmid Deoxyribonuolalo Aoid *, J. Bacteriol., 119, pp. 1072-4 (1974) inoculated B. coli HB101 (gift from H. Boyer) in 5 sl U3 media (10 parts of bactotryptone, 5 parts of yeast extract and 5 parts of NaCl per liter) and the cultures were grown overnight at 37 ° C. Candle cultures decayed 1/100 in 20 al LB substrates 1 cultured to a density of about 2 x 10® bacteria per inch, cooled rapidly on ice and granulated at 6000 rpm flow »5 ainut in a Sorvall S834 rotor at 4 ° C . the cells, triturated at 0-4 ° C, were washed with 20 ml of 100 nM CaCl2. After 20 minutes on ice, divisible rogra-ulu 1 resuspended in 2 ml 100 aM CaCl? 1 bleed at 0 ° C for 15 aliquots Aliquots (200 / Ul), supplemented with glycerol up to 11 ", and stokify for a few months at -80 ° C, losing activity (DA Morrison, Transformatlon Zn Bscheriohia coli» Cryogenic Preservation Of Cosapetent Celiš, J. Bacteriol. 132, pp. 349-51 (1977)) ·

4. Quenching of the dA-lengthened PBR322 1 dt-lengthened DMA molecule The dA- and dT-tails of the vector and the complementary DMA insert allow for quenching to form a knock-off Bleached hybrid piasmid or a recombinant OMA molecule · S «for this purpose, the vector 1 of the bold sorted dt-tail-bound cDKA was dissolved in TSE buffer (10 mM Trle-HCl (pH 7.6), 1 xS <EDTA,

100 s «MsCl) to 1.5 plasmids and to the molar ratio of plasmids to OMA insert 1.5 to 2.0. After warming to 65 ° C for 10 min ·, the bold lagoon cooled to room temperature for 4 hours.

The product, of course, is the great boldness of racially recombinant DMA molecules and the inanimate nomad sn cloning of anger-inserted ORA sequences. However, each recombinant DMA molecule contains a cDHA segment aa

-31P «tl place. Each such cDNA segment can capture a gene or fragment thereof. Only very few of the cDHA fragments encode with HuIFN-beta or a portion thereof (Figure 1). The vast majority encodes with one of the other proteins or their portions of the Sia and SNA portion of the poly (A) RNA used in the process and of the present invention (Figure 1). It should also be appreciated that none of the clones in the above cluster need to be able to express polypeptides that exhibit immune or biological IFN-beta activity.

5. Tranafekcja K. bare HB101 aa tempered hybrid »plasmid has

P3 safe drives have been used when necessary for the transfekoic procedure and all subsequent stages in which the resulting transformed bacteria are treated. Aliquots (90 [mu] l or less) of the above mixture were cooled to 0 [deg.] C. 1 N CaCl was added? to 0.1 M. Aliquots (100 / ul or less) of this solution were added to 200 µl of Ca ++ - treated E. coli BB101 on ice 1 after standing at 0 ° C for 30 min., the cells were subjected to heat shock for 5 min. minutes at 37 ° C and cooled again to 0 ° c. for 15 minutes. After the addition of 2 ml of LB medium, the cells were incubated at 37 ° C in a shaking "water" bath for 30 to 1 minute. The bacterial suspension was applied to 1.2% agamous fruits containing LB medium supplemented with 10 / ug / ml tetracycline.

Since plasmid pB & 322 includes a tetracycline resistance gene, E. coli hosts that have been transformed from plasmids have this gene intact and will grow in light-weight antibiotic cultures of those bacteria that are not so transformed. Therefore, growth in a tetracycline-containing culture allows the selection of hosts transformed with a recashing DHA molecule or a recycled vector.

After 24 hours at 37 [deg.] C., the colonies were individually collected and suspended in 100 [mu] l LB medium (supplemented as above) in the wells of microtiter plates (Dyaateeh). After incubation at 37 ° C overnight, 11 / Ul dlmethylsulfoxide was mixed in each hole and the plates were sealed with adhesive tape. The plates were stacked at -20 [deg.] C. and a stock of 17,000 individual colonies of transformed S. coli HB101 was made. This stock was also derived from 270 fmol (128 ng) of dT-tail-bound cDBA inserts, which were again synthesized from

4.4 ^ u gradiently cross-linked poly (λ) RNA. About 98% of the clen from this stock were sensitive to carbenicillin (a more stable aatpicillin derivative). Therefore, about 98% of the cattle contained a plasmid having an insert in the Pst1 site of the beta-lactamase gene pBR322, and about 2% contained a re-labeled anger insert vector.

These 17,000 maples contain a variety of recombinant DKA molecules that represent complete or partial copies of smefie mBNA in a poly (A) RKA preparation and from cells producing HuIFN-beta (Figure 2). The major part of these contains only one recombinant DNA molecule.

Only very few of these recombinant DNA molecules will bind with BuZFB-beta. According to Torn, clones must be tested to separate NuZPN-beta-related clones from others.

TESTING HA CHLORINE CONTAINING HuIFK-beta CPHA

There are several approaches to testing bacterial clones containing HuZFN-betaeDHA. These include, for example, RNA selecelone hybridization (Alsrine, at al ·, below), differential hybridization (TP St · John and RV Davis, Isolation of Galactose-Inducible DKA Seguences Prom Saceharcmyees Cerevisiae By Dlferential Plague Filter Hybridization *, Whole, 18 , pp. 443-452 (1979)); hybridization with a synthetic probe (B. Soyes et al., Detection And Partial Seguenee Aaalpsls Of Gastrin mRNA By Osing An Oligodeoxynucleotide Probe, Away, Bati Acad. Sd · PSA, 76, pp. 1770-74 (1979)) columns that produce the desired! protein lmunolophics (L. Villa-Komaroff, et al ·, “A Bacterial Articles Synthetozong ProinsullnT, Proc. on tl, Aoad. Sol, PSA. 75, pp. 3727-31 (1978) ill biological (ACT Chang, et al. , Phenotjpic Erpresslon In E. coli Of A DNA Seguence Coding For Mouse Dihydrofolate Reductase, Nature, 275, pp. 617-24 (1978) We have chosen RNA selection hybridization as the most appropriate and most promising procedure for primary testing.

A. RNA selection assay for hybridization

1 · Opla initial test

In Fig. 2, recombinant DNA molecules were isolated from single cultures of about 46 carbenicillin-sensitive and tetracycline-resistant clone-resistant clones (two mixtures of 2 clones are shown in 81id 2) (Phase A) · Recombinant DNA molecules were digested and hybridize to the total RNA it contains! HuIFN-beta mRNA made as before (Phase B) · All hybrids recombinant DNA molecule-total RNA are separated from non-hybridized total RNA (Phase C). Hybridized total rna is isolated from the hybrid and purified (Phase D) · Regenerated RNA is tested for HuIFN-beta mRNA activity as above (Phase S) · If, only if, a recombinant DMA molecule retains a recombinant DMA molecule having a nucleotide sequence inserted that a »to hybridize to HuIFN-beta uRNA in total RNA, under strict hybridization conditions, then de mRNA released from that hybrid will induce HuIFN-beta cropping into ooeitlma, so Bto mRNA released from any other hybrid is recombinant DNA molecule-total RNA molecule-total RNA related to IFN-beta. If a clone of 46 clones gave a positive reaction, clone z regruplzanl into subgroups - 6 subgroups (4 subgroups of 8 and 7 subgroups) 1 each subgroup was tested as before. This procedure is repeated until one clone is identified that responds to this course

There is no certainty that the recaabinant SNA molecules and bacterial cultures that are trans f orated with them are thus identified.

- 34 e a dr The ap-beta cDNA or lll sequence is encoded that the DNA sequence actually encodes for IFN-beta or ll enable the clone to express polypeptides that exhibit immune or biological activity of IFN-beta. However, reconnaissance DNA molecules will certainly contain extensive nucleotide sequences that are complementary to the IFN-beta encoding sequence for SNA. Therefore, the recombinant DNA molecule should at least be used as a probe source for rapid testing of other recombinant DNA molecules and clones that have been transformed with them to identify further sets of maples that may contain an authentic or caraplet nucleotide sequence for IFN-beta encoding . these clones can then be analyzed for expression of polypeptides that exhibit the biological or immune activity of IFN-beta. And the nucleotide sequence of the inserted DNA fragment of these hybrid plasmids 1 its amino acid translational product can be determined and correlated, if any, with the amino acid "composition and pod sequence" published for the authentic IFN-beta (above).

2. Conducting a business test

Phase A - Making a mixture of recombinant DNA molecules

Replicates of a microtiter fetus containing 96 clones from the top clone stock were performed on LB agar plates, one containing 10 / ug / ml tetracycline and the other supplemented with 100 / Ug / ml carbeniellin. In this way, two sets of about 45-46 carbeaicillin-sensitive tetracycline-1 clones were collected and cooled separately at 37 ° C in 100 ml LB medium containing 10 / µg / ml tetracycline. These cultures were harvested, rotated in a Sorvall OS-3 rotor at 8000 rpm for 10 minutes, washed twice with TBS buffer (50 mM Tris-HCl (pH 8), 5 "M EDTA, 5" M BaCl) and resuspended in 40 ml of TBS per liter of starting culture volume.

*

Challium shakes with lisesirrTritna K-100 (M. Saka, «t al ·, • Plasnid Cleaiag Vehicles Derlved Fran Plasnida Col Sl, T, MK And RK2 'a Betbods Zn Eazvnoloov, 60« Reoonbiaaat OSA (R. ve, ed .) (1988) (a Btaapl). 49 al, TES euepeadovealh dalia compound salt with 29 ni 10 * saherose in 50 zM Trie * SCl (pH 9) and llsosin to 1.3 ng / el and paste salt to stand at room temperature "20 nia. To this suspension was added 1 ni 0.5 M EDTA-HaflB (pB 8), 8 ni 0.2 * Triton *" X * 100, 25 UM KOTA, 50 aM Tris-HCl (pa 8) and dissolved perfluorine at room theaters token 10 nuts. chslijskl otpaei and nejvedi bottom chronozenae DBA are separated by a backama 8V27 rotor «aa S4000 epa token for 45 minutes .The prosaic tedaoot is cooled on ice, fused with 1/3 saprenillas 40 * 6000 s. 2 M vacl and allow ss to stand over nodl aa 0 ° C. The resulting precipitate was shaken off with a Colored SM rotor «at 5000 rg® token for 10 minutes aa 4 ° C 1 dissolved ao in TRS buffer. The solution, with 0.2 sap 19 ng / nl etldljunhramida (Color) 1 Cs Cl up to 1 g / nl, ao oaatrifuged in a Boeknaaa MO Ti-rotor at 48000 rpm until aajaaajo 48 hours, at day j ob had iodine poliomeraa tube sufficient with lysate from 1 * 2 liters of data to fill the culture. DBA foot strips visualize in aperture under OV «illumination · Highest density reed corresponds to X OBA plasmid, drug strip corresponds to ττ χ shape of XXX plasmid & zma 1 of some chronosonic DBA · First strip ao to collect from test tubes, ethidophosphoride is separated by fiest extraction isoaailalkoholcn, 1 aqueous £ azy dissolve with 3 sapr · water-doped with up to 6.2 M astrium acetate (pB 5.1) pr * talofieaja SBA ss

2.5 sapr * ethanol. The SBA was dissolved again, the salt extracted with phenolene 1 was re-settled with eta & olon. The quality of the DBA is recorded by elsktrmforeson aa 1 * agarosaon gel «in 40 ns Tns * BQfic (pB 67 * 8), 20 a« aatr acetate, 2 «K SOTA, sent dog with vrfii bases with otidi jmftirnnl (Ion. If DNA suvlfio ssiogo kentsniairaaa with RNA, then be further distilled as a nontralaon sucrose gradient: 300 ^ ug

- 36 *

DNA about 10 mM Tris-BCl (pa 7.6) and 1 rt EDTA Sarlated aa 36-ml

5-20 "gradient a 19 rt Trts-HCl (pB 7.6), 1" EDTA, 1 N NaCI, centrlfuglra s · in polioloma tube during 16 Sas aa 24060 rpm a Beekman SV rotor at 18 ° C 1 fractions containing DNA ^ °° 260 ^ ^{se eakt} £ ^{> e} * atalase with sodium juaacetate-ethanol.

race B “DNA hybridization with Dkupnam RNA

About 150 vgfo * thus made, fused with the uniquely labeled ²² p- «arketa DNA and 2 ^ ug pSTBV-1 DNA (recombinant plarnid containing a copy of the cSTNA pano vallSlna satellite virus aakrpsa tobacco CSTOT *) - 8NA> jr. Van Emnelo, at al., * Constructlo & And Ckaraotarisatiea Of A Plasnid Containing A Neraly Full-Size DNA Copy Of Satellite Tobacco Neerodls Virus RNA, J. Mol «Biol. * (in the fitaapi) as internal controls, ee snieaaja sonikadjon and USE sonicator 1 is deposited ea natrlaa-acetate-ethanol.

Make Ae Solid Aatrlks Dlasobensylloxylnethyl (DBM) -Cellulose (cf ·, JC Alvine, et al ·, Mothod Por Dotaction Of Spedflc RKAs For Agarose 6els 9γ Transfer TO Diazobeazyl Okynetil Paper And Hybridiaing MA Probes, Proo. Natl Acad. Sd. 74, pp. 5350 · (1977)) washing the process of the book is described by JC Alaine, et al ·, * Deteetlen Of Spedfle RKAs Ir Spedflc Pragnents Of DNA Practionation In (MethodsEnzyaology, MethodsEnzyaology, 68t Reoombinant DNA (k. Va, ed.) (1980) 8a paper trik, Vhatnan 548 paper is submerged submerged, and a solution containing 2 * 3 ng l * (n * nitcobansilokai) natil pyridiaianblorld (HPBC / BDH) 1 0.7 is not rubbed- acetate trihydrate a 28.5 / Ul water on on, incubate at 6 · C to strain and another 10 nin., 1 drop to 130 *

I35 ° C currents 30-40 nin. After rinsing a few pats with water (about 29 nin.), 3 pats with acetone (about 20 nin.) And joking and ethochlor · Paper ao extracted aa 60 ^e C for 36 nin. a 0.4 ni 20 »natlndltlonlt2« β »37 * τ with occasional wrinkling. The paper m is again washed with 4 heels 5a a water, once aa 34 «sirdsta kiaelia for 5 min. 1 4 times aa with water, transfer ao aa 0.3 ml per hen ² ice cold 1.2 M HCl to which 10 mg / ml of fresh lTANO ₂ was added (immediately after use for 30 min at 0 ° C), 1 was washed quickly 2 times with 80% dimethyl sulfoxide (spectrophotometer quality. Measure) -20% 25 nM sodium phosphate (pH 4.0). For powdered matrices, substantially the same procedure is followed by the use of microgranular oelulos powder (Nhatman CC31), at Som with the amount of ssspraa of the corresponding toSiao oelulosic matrix.

and in the beginning we used powdered matrices as long as the weighing capacity was higher, so that relatively smaller sapremins with hybridization, rinsing and elution could be used. Xenia we used paper natri) »with individual clone testing. Used, the paper allows for efficient elution with water.

The OSA-made mount was dissolved with 25 nM aster of phosphate (pB 4.0), aerated with 1 minute, very cool with 1 added with 4 sapr.

DMSO. They were purchased from a matrix (50 mg, powder) or a paper disk (10 nm pebble) was usually bubbled over the weekend at 4 ° C with continuous stirring. The volume of DMA is maintained to be severe enough to allow close contact with the matrix, thereby enhancing DHA buying from the matrix. After coupling, siporo arrays 4 times aa with water and 4 times with 0 · 4 ll VaOB at 37 ° C for 10 minutes each time again 4 times with water at ambient temperature 1 finally twice with buffer with hybridized (501 focmsnid ( dojonisova, Baker), an plperesin-N, W * -bile (2-ethaneulic acid) (pB 4 «4) (” FXP88 * Sigma), 1 μM KOTA, 0.5 * KaCl and 0.1% 808) at 4 ° C. Kfikasnestl dripwood have ^^ P-radioactivity.

^ ug «drops BKA, made towards earlier, 1 50 sg BTBV-SKA

- dissolve it in 259 y «l (59 ^ ul for paper Matrices (chlbrizadon buffer and add oa DKa k« floated matrix. The matrices are heated aa 70 ° C for 2m. and kept at 37 * C overnight with mild mixing ».

Phase C - Separation of hybridized total RNA-DNA from non-hybridized total RNA

Powders of aatrix powder centrifugation, aerial hybridized RNAs, and separated 1 aatride were washed 7 times with a total of 2 »1 501 fomaaids, mM PZPSS (pH 6.4), 1 mM EDTA, 0.3 M NaCl and 0.11 SDS, at Sen with lower aadrii of these The leachate filtrate destablicates non-specific RHA-DNA-bound yen. Each Rinse is given to resuspending the matrix into the buffer. ”· With penalty, first rinse with RKA (• Fraction 1) leases, and 1 rinses 2-4 (• Fraction 2 * and Rinses 5-7 (• Fraction 2 ·) are collected. · In hybridizations on a paper matrix, a "lacy process is used, which is" the purchasing volume is limited to 1 ml.

Pasa P * Purification of Ribrldizevone «Purchase RNA

The hydrated total RNA-DNA eluted from the ss powder matrix with 3 elution from land 900 ^ ol 991 formamide, 0.21 SDS at 70 ° C. for 2 min. and cooled very well on ice. ”The vicious process of hybridization and elution with formsmidem were essential as described in A. G. Smith (private communication). Hybridized "RNA-DUA heap eluted with a paper matrix salt, first by rinsing with 100 [mu] l of ice cold water, 1 by two elution with water (total 300 yal) at 80 [deg.] C. for 2 ml. the rinses are collected (“Fraction 4).

To one half of each of the 4 fractions, add tRNA liver fat or rtbous RIA (Fraction ΙΑ, 2A, Sa and 4a) and to the other half 0 ^ «$ eukarlot poly (A) RNA or rbbosemic RNA (Fractions IB, 2B, SB , 4B). Purification Droplets added 0.5 N saci 1 2.5 sapr. ethanol to remove formamide 1 tubes of other impurities.

- 39 Phase E - Determination of IFN-beta mRNA activity

The fractions ΙΑ, 2A, 3A and 4A were translated into 25 µl of nuclease-treated rabbit reticulocyte lysate (made according to the procedure of R. B. Pelham and

R. J. Jackson, An Efficient mRNA-Dependent Translation Syster For Reticulocyte

Lysates, E ur. J. Bjochem., 7, pp. 247-56 (1976)) by the procedure they gave

B. LeBleu, et al., Translation Of Mouse Interferon rnftMA In Xenopus Laevis

Oocytes And In Rabbit Reticulocyte Lystes, Biochem. Biopfays. Really. Commun.,

82, p. 665-673 (1978) except the addition of 250 mM spermidine-HCl, 1 mM fructose35

1,6-diphosphate in the presence of raM S-methionine (0.5 mCi / ml, Amersham). After incubation, 25 [mu] l of reticulocyte lysate from the above was combined with 1 [mu] l of 10% deoxybolate-10% Triton Χ100 and 2 [mu] l of antiserum-PBS (1: 9) and heated at 37 [deg.] C. for 1 h. Add 20 yal Staphylococcus aureus Cevran I (freshly washed, SW Kesslerz, et al., Rapid Isolation Of Antigen From Celish With A Staphylococcal Protein A-Antibody Adsorbent: Parameters Of The Interactlon Of Antlbody-Antigen Complexes Wlth Protein A, J. Immunology 115, pp. 1617-1624 (1975)) in 10% 100 mM NaCl, mM Tris-HCl (pH 7.4), 1 mM EDTA, 0.05% NP40 and the mixture was maintained at 20 ° C for 30 minutes and centrifuged fippendorf 5412 centrifuges for 2 minutes.

The granule was washed and centrifuged twice with PBS and the final granule was dissolved in buffer sample and electrophoresed in a 13% polyacryloid gel keo as described in U.K. Laemmli, et al., Cleavage Of Structural Protein During The Assemhly Of The Head Of Bacteriophage T4, Nature, 227, pp. 680-85 (1970), and then submitted to the author's CV. Comparison of STNV-RNA translated products in Fractions IA and 4A provides an indication of the efficiency of hybridization and RNA degradation in the process.

The fractions IB, 2B, 3B and 4B were dissolved in 2 ^ yl of water and tested in oocytes for IFN-beta mRNA content as described above.

3. Later test - hybridization on nitrocellulose plates

Some late J tests of single clones were performed on nitrocellulose plates (M. Cochet, et al., Cloning Of An Almost Full-Lengt Chicken Conalbumin DoubleStraaded cDNA ”, Nucleic Acids Research, 6, pp. 2435-2452 (1979). The DNA was dissolved in 2M NaCl and 0.2 M NaOH, warmed to 100 C for 1 minute, cooled strongly, and applied as a stain to Millerpore filters that were deoderate-free (pore size 0.45 μm; 7 mm diameter). The filters were baked for 2 hours at 80 ° C, washed in 0.3 M

- 40 NaCl, 2 mM EDTA, 0.1% SDS, 10 mM Tris-HCl (pH 7.5) and dried at room temperature. RNA was hybridized for 3 hours at 47 ° C in 30% formamide, 0.5 NaCl, 0.4% SDS, mM EDTA, 50 mM PIPES (pH 7.5). Stop the hybridization by dilution with 10 ml of 0.1 M NaCl and filter the filters several times in 15 ml of 0.3 M NaCl, 0.1% SDS, mM EDTA, 10 mM Tris-HCl (pH 7) by shaking at 45 ° C and several times in the same solution. without SDS at 4 ° C. Elution of the hybridized RNA-DNA was performed in 30 ^ ul O mM potassium um-chloride at 100 C for 1 minute.

4. Results of the RNA Selection Hybridization Test

16 groups of about 46 clones (Groups A-P) were tested. In six groups, Fraction IB contained only IFN-beta mRNA activity, in eight groups no IFN-beta mRNA was detected and in two groups (Groups C and O) IFN-beta mRNA was observed in Fraction 4B.

Group C and O tests are given in the following format: logarithm of IFN-beta units (calibrated against reference standard 69/19), detected by Fraction IB (non-hybridized) and in Fraction 4B (hybridized) test. The detection limit of Ula is 0.1

The group Fraction IB Fraction 4B C 1.0 0 0.5 0.5 0 0.2 0 0 0

0.2 0.5

Group O was subdivided into 6 subgroups (Subgroups O 'to O; four of eight clones 1 o and two of seven clones each) and hybridized and tested as before, except that 400 ml of culture per clone was used. The subgroups gave the following results, presented in the same format as above. Hybridization was performed with the exception of DBM-cellulose powder except

unless otherwise noted. Subgroup Fraction IB Fraction 4B θ. 0 1.2 1 0 1.5 0 0.5 0 0.5 0.2 0.5 0 a 1.2 O ₂ 0.7 0 ° 3 0.7 0 0.5 0 ° 4 0 0

Procedure on DBM Cellulose Paper.

Subgroup ° 5 ° 6

--4-1 Fraction IB

0.5

Fraction 4B

The subgroup was subdivided into its individual clones (designated clones θΐ / j - θι / g) * hybridized and tested as above, except that 700 ml of culture per clone was used. Hybridization was again performed on DBM-cellulose powder unless otherwise indicated.

Clone

Fraction IB

1/1

1 / i

1/3

1/4

1/5

1/6

1/7

1/8

Fractions I 4B

0.2 o 0.7 0 0.7 θΚκ 1.0 0 1.2 0 0.2 0 „Bb 0.7 0 1.2 0 1.0 0.2 1.2 ! .0 {?) 1.2 o 1.2 0 1.2 0 B 1.0 0 1.2 0 0.7 0 0.7 <OCH2 * 1.0 '0 0.7 0 1.0 <0.2 * £ B » 0.5 0 0.5 0 _B 1.2 0 <0.2 0.9 0 1.7 * mr ¢ 0.2 1.2 CT 0 0.7 0 - 1.0

* Process on DBM Cellulose Paper in.

Nitrocellulose plates.

Therefore, clone O. contains a recombinant DNA molecule capable of hybridizing 1/8 to lift IPN-beta mRNA from total IFN-beta mRNA-containing RNA.

- 42 Non-specific RNA-DNA binding is very improbable because of the comparisons

F ^r of the reaction 1A and 4Λ reveals that suštinski middle nespecifičnog of binding STNV DNA In these same experiments. BC, such as recorded by translocation in the reticulo- 35 citric rabbit lysate in the presence of S-methionine, after gel electrophoresis, as described by aore. Clone O, marked £. coli HBl0l (G-pBR322 (Pst) / HFIFl 1/8 ......

{G-HBlOl-pHFIF1), its recombinant DNA molecule G-pBR222 (Pst) HFIF1 (pHFIF1), and its hybrid insert pHFIF1 fragment. This nomenclature shows that the clone and recombinant DNA molecule originate in Gent (G) and comprises a plasmid pBR322 containing, at the Pst1 site of HuIFN-beta cDNA (HFIF), whose designated molecule was first located ('* 1 ^M ).

IDENTIFICATION OF CLONES CONTAINING RECOMBINANT DNA MOLECULES

HYBRIDIZED FOR pHFIFl pHFIFl, isolated above, is used to test stock clones, made previously, for bacterial clones containing recombinant DNA molecules having related DNA insert e, by colony hybridization (M. Grunstein and D.S.

Hogness, ”A Method For The Iaolatton Of Cloned DNA's That Contain A Specific Gene, Cont. Natl. Acad. Sci. USA, 72, pp. 3961-3965 (1975). This procedure enables the rapid identification of related clones by hybridization of a radioactive probe made from pHFIF1 for DNA terminated bacterial colonies fixed in nitrocellulose filters

The stock of clones stacked on microtiter plates, as described above, is replicated on similarly sized nitrocellulose plates (pore diameter 0.45 Schleicher and Schuel iii M illipore) previously boiled to remove detergent and placed on LB agar plates. containing tetracycline (10 µg / ml). Bacterial colonies were cultured overnight at 37 C. Bacteria were dissolved and fixed on nitrocellulose plates by sequential washing in 0.5 M NaOH (twice for 7 min.), 1 M Tris-HCl (pH 7.5) (7 min ·), 0.5 M Tris-HCl (pH 7.5) and 1.5 M NaCl (7 min.), 2 x SSC (0.15 M NaCl, 0.015 M sodium citrate (pH 7.2) (7 min.)). After washing thoroughly with ethanol and air drying, the plates were baked at 80 ° C for 2 hours in vacuo and stocked at room temperature.

The hinf 1 restriction fragment specific for the pHFIF1 fragment (infra) serves as a colony hybridization probe, as described below. This fragment (about 170 base pairs) was purified by electrophoresis by cutting the Hinf digester product pHFIF1 in a 6% polyacrylsmid gel. After staining of DNA bands with ethidium bromide, specifi - 43 -:;

The fragment is eluted, re-subjected to electrophoresis, and labeled with a ³² P translation aid ”(PWJ Rigby et al., Labeling Deoxyribonucleic Actd for High Specific Activity In Vitro By Nick Translation With DNA Polymerase 1”, J. Mol.

Biol. , 113, pp. 237-251 (1977)) by incubation in 50 1 50 mM Tris-HCl (pH 7.4), mM MgCl _o , 20 mM beta-mercaptoethanol, containing 2.5 µd and dCTP, dTTP and dGTP at 400 µM, 100 pmol alpha- ATP (Amersham, 2000 Ci / mmol) l 2.5 units of DNApolymerase I (Boehringer) at 14 ° C for 45 minutes. Unreacted deoxynucleoside triphosphates were separated by gel filtration via Sephadex G-50 in Tg buffer. Highly 32p-labeled DNA is positioned ea 0.1 close. Of 2 M sodium acetate (pH 5.1) and 2.5 mL. o ethanol at-20 C.

Hybridization of the upper DNA probe Impregnated on the filter is essentially as described in D. Hanaban and M. Meselson (private communication): The filters made above are preincubated for 2 hours at 68 ° C in 0.1% Ficoll, 0.1% polyvinylpyrrolldone. 0.1% bovine serum albumin. 0.15 M NaCl 0.03 M Tris-HCl (pH 8), 1 mM EDTA and washed with 0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin, 0.75 M NaCl, 0.15 M Tris-HCl (pH 8), 5 mM EDTA and 0.5% SDS. Hybridization was performed overnight at 68 ° C in a solution identical to the rinse solution using a P-labeled probe that was denatured at 100 ° C for 5 minutes before use. Hybridized Fasts were washed twice with 0.3 M NaCl, 0.06 M Tris-HCl (pH 8), 2 mM EDTA for 2 hours at 58 ° C before air-drying and autoradiography ·

About 1350 clones are tested, all of which come from the 800-900 DNA class. Thirteen colonies, including pHFIF1, gave a positive result. Zwic clones are labeled G-HBlOl-pFIF1 up to 13 and their recombinant DNA molecules pHFIFl up to 13. One of the clones. pHFIF2, was hybridized to poly (A) mRNA containing IFN-beta mRNA and tested using DSM-cellulose paper (above). Because the total 1FN- & NA activity was detected in the hybridized fraction and the non-hybridized RNA did not contain any detectable activity, it is clear that the clones identified by colloia hybridization on part of the pHFIF1 fragment also hybridize to IFN-beta mRNA.

Of course, it is clear that this method for testing a clone using HuIFNbeta DNA insert of pHFIF1 or another DNA clone insert identified using DNA insert pHFIF1, as described above, can be equally well used on other clones containing DNA sequences originating from recombinant DNA technology ,

- 44 from the synthesis, from convenient sources or combinations thereof or from clones containing DNA sequences related to a mockup of the above DNA sequences based on mutation, including simple or multiple arms, base substitutions, insertions, inversions or omissions. Therefore, such DNA sequences and their identification also fall within the scope of this invention. It is also clear that DNA sequences that have not been tested using the above DNA sequences, but nevertheless due to the arrangement of their nucleotides, encode for the poly peptides for which they encode the 1 upper DNA sequences also fall within the scope of this invention.

CHARACTERIZATION OF IFN-beta RELATED RECOMBINANT Plasmids

Thirteen maples (pHFIF1-13) that were detected by colony-deficient hybrids are further characterized. A physical map of the inserted clones was constructed and the orientation of the inserts in the various clones was determined.

F and wire maps of plasmids were constructed by digestion with various restriction enzymes (Nev England Biolabs) in 10 mM Tris-HCl (pH 7.6), 7 mM MgCl, and 7 mM beta-mercaptoethanol at 37 C by well known methods. Digeration products were electrophoresed in 2.2% agarose or on 6% polyacrylamide gels in 40 mM Tris-HOAc (pH 7.8), 20 mM EDTA. It was analyzed after visualization by staining with ethidium bromide and compared with the detailed physical map of pBR322 (JG Sutcliffe, above). Restriction maps of various plasmids based on these digestion schemes are co-structured. These are purified by sequencing DNA inserts in various plasmids, essentially following the procedure provided by AM Maxam and W. Gilbert, ^H A Nev Method for DNA Sequencing, Proc. Natl. Acad. Sci. USA, 74, pp. 560-564 (1977).

Plasmid DNA from various pHFIF-13 according to the present invention is harvested by the method provided by Kahn et al., (Gore), which was previously used to isolate DNA from a clone test set. Isolated Form I DNA is purified by neutral centrifugation on a sucrose gradient as before and confined to a variety of restriction enzymes, essentially as recommended by the manufacturer (Nev England Biolabs).

Limited DNA was dephosphorylated for 30 min. at 65 ° C in the presence of a bacterial alkaline phosphatase unit and 0.1% SDS. After two extractions with phenol 32 and ethanol precipitation, the DNA was 5′-terminally labeled with gamma-β-ATP (ca. 3000 Cl / romol) and with polynucleotide kinase (D-L Biochemicals, Inc.) ·

For sequencing, the tagged fragments are handled n * two ways. Some

- 45 are purified on a polyacrylamide gel before being broken down with another restriction enzyme. Others are currently being treated with another restriction enzyme. In both cases, the desired fragments are separated on a poacrylamide gel in Tris-borate-EDTA buffer. Figure 7 shows various restriction fragments (mark the circles in a marker and sterile direction the wound segments) and also show the strategy »! sequencing using pHFIF1, pHFIFS, pHFIF6 and pHFIF7.

The fragments are degraded in accordance with the procedure given by A. M. Maxam and W. Gilbert (above). The products were fractionated on polyacrylic amide m gels of various concentrations and lengths in 50 mM Tris-borate, 1 mM EDTA (pH 8.3) at 900 V to 2000 V.

Each strand of the cDNA insert is sequenced by both strands and each restriction site that has served as a labeled terminus is sequenced using a fragment enclosing it. The complex nucleotide sequence thus obtained for a strand encoding for IFN-beta DNA iii gene and its corresponding amino acid sequence is described in FIG. 4. Because none of the plasmids pHFIF1-13 contained the complete gene for H ul PN-beta, FIG. 4 was generated from a combination of data from at least two such plasmids. In this respect, Si. 5 shows the ratio of inserts pHFIF1, pKFIF3, pKFIF6 and pHFIF7, with solid arrows showing the orientation of the various parts of the insert.

In FIG. 4, the heteropolymer portion of the insert is aligned at one end by a T-rich segment as well as coil A (which probably reflects the polyA terminus of the mRNA). For reference, the insert is numbered from the first nucleotide of the complex insert to the nucleotide, which is abundant in the untranslated insert section. The ATG inducing triplet in position 65-67 and the TGA termination triplet in position 636-628 define a reading frame that is continuous with meaningless codons. Other translatable sequences, e.g., in various Reading Tales aligned with ATG or GTG, and the termination signal is too short to encode for the IFN-betn size expected polypeptide. Therefore, the region between nucleotides 65 and 625 most likely includes the nucleotide sequence of a complex DNA sequence encoding for IFN-beta according to the present invention.

This sequence does not exclude the possibility that no modifications to the gene, such as mutations, including simple and multiple, replacement of the piston, omission, insertion, or inversion, have already occurred, or that these may be used later to modify its properties or the properties of the polypeptide it translates. Nor does it exclude polymorphisms that may occur in physiologically similar but structurally slightly different

- 46 -genomic n iii smoke polypeptides than stom is the case with those listed on

Fig. 4 (above, p. 3). For example, another clone identified by the present invention has a T instead of a nucleotide 90 nucleotide sequence encoding for IFN-beta.

This change in the third nucleotide of the codon does not alter the amino acid encoding it. The amino acid sequence encoded by the DNA sequence of FIG. 4 is identical to the amino acid sequence published by faniguichi et al., Above.

It is reported that cloned cHNA \ 7 poly A KNA by conventional methods (A. Gfstratiadis et al., Supra) may lack 5'-terminal nucleotides and may even contain artificial sequences (it. I . Richard "et al.," Molecular Cloning And Seguence Analfsis Of Adult Chicken 3eta-Globin c'3NA, Nucletc Acids Research,

7, pp. 1139-40 (1979). 7 Moreover, it is uncertain whether ATG located nn nucleotides 65-67 is in fact the first ATG of the authentic IFN-beta sequence. However, from the top of the following description, it is understood that ATG not nucleotides 65-67 is the first ATG of authentic IFN-beta raRNA.

By framing a polypeptide encoded by this insertion region with the cd 13 amino acid sequence of the amino acid of an authentic 1 µl fibril intracheron — the NetSorTvrJ.crT.euT ^ uCT.ypheI-enGlnArgSerSer - that was identified by Knight et al. The selected reading frame is correct and encodes the F5-127 nucleotides by the horn for the signal peptide preceding the nucleotide sequence encoding the mature polypeptide.

Furthermore, in eukaryotic and mRPA, the first AVG triplet from the 5 'terminus is usually the initiation site for protein synthesis (M. Kozak, Hov Do Eukarvotic Sibosomes Select Tritiation Heg.tons In Pssnengar RNA? ”, Celi, 13, pp. 1109-23 (1978). Here's the coder. and which ^ lexnon fragment corresponding to the first amino acid f ib slave of the lass 5. n ter fe j she 22 codons from the first ATG. This again suggests that the DNA sequence encoding the fibroblast interferon may be preceded by a sequence that mediates the signal polypeptide of 21 amino acids. The putative signal sequence contains a series of hydrophobic amino acids «Such accumulation of hydrophobic residues is naturally a characteristic of signal sequences (c.f. B. B. Davis and P. C. Tai, The Mechanian Of Protein Secretion

4? Aeross Membranes », Nature, 2S3, pp. 433-38 (1980).

«Uk.lootid sequence which is in any case corresponds to srclor *. ' HuIFR-beta comprises 435 nucleotides; ar-irckiseliua. Yes, yes. neiaa karooKsiterminal prcracL ·, ίχΊάιύώ-) Icofina interferonac pciipeptide is 20065. The saetav base sequence coding is 15% OC. The use of the corona nav.tar r.ckvance zn interferon coding is in! »Vs Lijivob <stacking ca they * ?, which is attached ?;« t askNA mammal in general (R. Graothau at al., Coding Catalog Vsage And The Genome Evpothesie _f Nuclaic Acid »Research, 8, pp. 49-62 (1980)). Maca's deviations can be attributed to the small number involved.

Fig. The structure of the polypeptide is attached to many aa. 4a., A complex fragment, unevenly, "unaffected by the modifications to the interacting polypeptides caused by it, enters in vivo, e.g., glycosyls". For this reason, the juora needs to understand that the amino acid sequence imaged in Figure 4 must be identical to HuIFK-beta produced in vivo.

the sequencing of the first 13 amino acids of an authentic fibroblast interferon (Knight et al., above) and a sequence derived from the cosplay complex gene ss FIG. 4 shows no differences. Amino acid composition · cc ?. • -d.jcvJ, d.ir ^ nto zn autsntlcn? f.ibroblastic irtrrfcron ε of one serum, and derived from the sequence of complex ^ genes from this prou- alae on the other hand, also show essential similarities. FIG. 6 shows a comparison of these compositions.

pd rtVr-Hh ir turbid mr ·: 1. * b _O jt rta initially made pr «ata certify pr on with fibrobiast interferon, lack-i nc snchli como li-hnu · ϋ« 'Λ sequence they auiiita otoshedje choris probe for testing a collection of DNA sequences native to UuIF *? - beta.

Further, the combination of inert portions of these recombinant .rclecle DNAs yields a complete sequence that encodes for IFN-beta, as deextracted below, within the skill of the art. For example,

-48 -iraajujj? N ref er '

*. · -? 3 c easy to see that ae Petl-Pgll xrag .:

EcoKI-rstl fragrtftnt pLEIFS; .will merge sr. The stT-EccI ~ fragment of pEFlk'7 or the Bglll-Pstl fragment of pHFIFS can be fused to the P3tI-3glII fragment of clone 7 so that the com ^ lskcra proverb with the HuIFN-beta encoding is used. Connect these framenets τ · -o * a before performing the job of inserting a single frcr-mt into the desired plasmid.

RULESF7.7 l'L7.7.1.IS; K FOR IIuIFN-bcta 7-A GVRZiu

2A37.ŽB bOFPLKkSSU DNA SFKVFITO ' ^X THOSE CODES' FSFP.7

IJK OF POLYPEPTIDES EMITTED BY ACTS

ΆΊ03Ί unlFil-hefa

BaJ.tarinfag lambda contains two strong promoters a, P _f * T ' _K , M i is an activity controlled by the repressor protein, a product of the phage cl gene.

In the presence of the renpressor, transcription from these promoters is further suppressed. Repressor assembly is affected by strong transcription: with and P _R (for luoncgraphy, see ". Ssybalski and%. Gzvbr.K: · /" 7 7> .prehensive Molscuiar Map Of bacfcar iophage laisda. Gen o - 3, 217-37 . · (I07>)>.

Constr. No derivatives of soil-ida pbk322 nullicopy (F. Bolivar et al. Tonstraction Ard Characterization Of New Clonina Vohicles.

II. A Multiple Cloning Syetem, Gene, 2, 95-113 (1977) so I incorporate the P _T promoter. These plasmids were disclosed to St. in Patent Application Patent 30.28983, filed September 8, ILO, and incorporated herein by reference.

A · gteruktnra p? .Azmida that nn7r7? ? prcKotor plasasld y? La2311

The plaza. i.C pILa231i (shown in Fig. 8) contains three Haell fragments. The larger fraguenfc, about 191C base pairs, contains P ^ O. reginr i .: bacteriophage ianbda 1 rogicn Let-lactarnase gene from pPP322 (H, Gutcllffe, Complete Nucleotide Seguonce of The Fscherichia coli riacnic 'pBP.322, Cold Spring Harbor Svctt-ogium, 49, 77-90, (1979)). Near this fragment I Saell fragment with? 379 porous base derived from p lies that Col E ^.

«'

The origin of replication is obscured by the coupling between the two fragments (A. Oka et al., Nucleotlda Seguemce of Sna 11 ColZ ^ Derivatives Ves. Structure of the Reglossic Por Autonomons Repi cation And Coli c in Essential Por Ismunity ' _and Mol. Gen. Genet ., 172, 131-159 (1979). The third Haell fragment, a duphine of about 1600 base pairs, encodes for resistance to stone cin. This fragment was originally derived from plasmid pCR ^ (C. Covey et al., A Method Por. The Deteotion Of Resection Sites Zn 2fcacterial Plasmid DKA, Mol. Gen. Genet. 145, 155-158 (1978)). Dirty transcription from the P _L promoter is chalked in the same way as the beta-lactamase gene. Plasmid pPLa2311 confers resistance to 109 ^ oc'ul carbenivillin and 50 / ug / ml kanamycin.

O-pPDaS plasmid

Plasmid C3-pPLa8 (shown in Fig. 9) was derived from the pPIo2311 converts Pati site in the beta-lacquamosis gene to the BamHI site. This was achieved by treatment with the 8j nuc le nitrogen of Patl-open pPLa23Il after blind ligand end for the BamHI binding fragment (obtained from Colla boratlve Research Inc., Valtham, Mass.) And re-eclculation of the molecules after BamHI cleavage. Planil pPLa8 does not specify carbenicillin resistance but 1 further gives resistance to kaaamlcla.

Plasmid G-pPIic24

The plasmid tt-pPDc24 (shown aa 81. 10) contains the beta-lactamase gene and the origin of replication ii pB & 322. The 290-bass Haell-BcoRI fragment contains the region and bacteriophage of the lambda. The transcription directorate «from the P ^ promoter is the prose ·· EooRI attestation. The 431-pair BooRI-Baam fragment encodes the ribozyme binding site and the first 98 aacid acid residues of the bacteriophage HS2 replicase gene, derived from plasmid pM82-7 (R. Devos et al., Construotion And Characterization Of A Plasmid Coataining A Me_aly Full-size DMA Copy Of Baotsriophage MS2 «HA ', ^J · #ol« Mol »/ lS, 595-619 (1979). MS2 protein translation

- 57 replica fragments * «go collinear m transcription® from the promoter.

^B 'Care? _L ? Rax.t (? R-ku aktlvnogul z & vjano of temperature

Transcription from a promoter present on plasmids pPLa2311, pPLa8, and pPLc24 · - is repre- sented by the maintenance of plasmids n E. coli strain synthesizing rapressor protein. Due to the antoregulaclonal mode of synthesis (H. Pt.aahne et al., Autoregnlation And Function Of A Repreaeor

In Bacteriophage lambda *, Solano »194, 156 * 161 (1976), a ceded copy of the lysogenic chroiaozoic strain can completely repress the P_ promoter present on the multicopy of the plasmid.

The strains used in the present invention were eu E. coli K 12 ^ 31 (KI 2 M72 lac ^ AtrpBAŽ Sm ^R (\ cI857 ^ 717 ^ 53 HI bio); C. Bernard et al., Construction of Plaamid Cloning Vehicle That Promote Gene Expreealon Millet The Bacteriophage lambda P ^ Promctar, Gene7 5, 59-76 (1979) ^{1 E} - ggU MS219 (K12 K72 lac ^ trp ^ Sn * (> 01857 AHI bio252) and H. Greer. The kil Gene Of Bacteriophage lamda. Virologp, 66, 589-604 (1975)) · Both strains produce defective, incomplete lambda profag carrying a cl gene mutant. The gene mutant encodes for a temperature-sensitive repreor, so that it allows tracecryption from the P ^ promoter by shifting the temperature - at 28 ° C repreaor still active and repreacts the transcription of aa P _L promoter, but at 42 ° C the repreor is inactivated and transcription from the Pj promoter j- the goal of the learned.

A El isolation from the prophage separates part of the oro gene and all other genes further away from ero (H. Roads laz zi et al. Isolation and Characterization of Deletlone Zn Bacteriophage lambda Residing Aa Prcphage I E. coli K12, Mol. Gen. Cepet, 117 , 211-218 (1972). Isolation of ero genes is appropriate because it is known that the accumulation of ero proteins repre- sents trascriptomy from the P ^ promoter (A. Johnson et al., Hlechanlam Of Aetion Of The Pro Bacteriophage Lambda Protein.

Mother »Acad. Sel, O.S.A., 75, 1783-1787 (197?)). Strain IJ5219 further contains a bio252 isoform that separates all genes to the left of the cIU, including kil.

After induction temperature, strain H5219 expresses the functional product of HHgen. The K12deltaHX strain, on the other hand, has two auber mutations in K phito ga Sini functionally l £ -nsgatlvnim. The gene product is known to act as an anti-terainer in the lactic bacteriophage (J. W. Roberts, Transcription Tenaination And Late Control In Pbage Lambda,

Away. Natl, Acad .. Sci, US, A ,, 72, 3300 * 3304 (1975). Antl-tarmiaa The desired effect is also inflamed with tenainatorakia sequences that are not naturally present on the phage of the DHA lambda (e.g., natural stop at the end of the trp operon), provided that the RNA transcript begins at the P _L proeitor. Further, the effects of polarity, introduced by the presence of «noasens codons in the P ^ transcript, were oscillated by the action of the N-gsna protein (with monograph see N. Franklin and C. Tanofsky, The N Protein Of Lambda * Evidence bsarlng On Transcription Tenaination, Polarity And The Alteration Of SiJSSll Peljmerase * and the Poivmergae RNA (Cold Sprlng Harbor Laboratory, 1975) pp. Ί93-70β).

Therefore, since the aforementioned plasmids are in the thermo-inducible bacterial oj, the base permits experimental inclusion or exclusion of P ^ promoter activity. And the choice of K12deltaHI or M5219 allows transcription that vrfil lli will be absent or in the presence of the product, the jg gene. The latter may be suitable as the phyto described above, in cases where the DNA reglonl to be transcribed are those that contain transcription sequences similar to tenainers or retard sequences for RNA polymers.

C. Construction of Clones having a DNA Sequence Coding for HuIFN-Beta Considered in a Plasmid Containing a Pre-Eter

In the following description, isolation of plasmid Kft, zestrlkdona DNA analysis of 1 ligaei DSA firagmmata screamed eu as phyto is described above with

Ε & ίΑ with double thread. The transformation step was also as described above except that when with El2deltaFT iii M521® bark strains and as a host, the Heat Juice was carried out at 34 ° C flow *. For 5 minutes, transforads were incubated at 28 ° C.

1- Construction of G-PPLa- ^ I? -67-3 Plasmid

The reason for this henna was her observation that the combination of the corresponding restriction fragments from the ti-pBR322 (Pst) / HFIP-6 and G-pBR322 (Pst) / HPIP-7 clans allowed the reconstruction of a complete, continuous IPlf-beta coding sequence. The flow of the derived fragments through several contraction phases is shown schematically aa. 8. Plazaid G-pBR322 (Pst, / HPIP-6 cleaves with EcoRI 1 Pstl 1 bound to plasmid G-pSK322 (Pst) / HFIP-7 which was broken with Pstl and Pvul. After league * the mixture is digested. with EcoRI and Haell. / - The high molar abundance of this mixture was then coupled to the plasmid G-pPLa2311, which was dlger's and ^H fteXI and EcoRI. Transformantl in the CGOOr ^ aJflambda strain was obtained (which was used because of its relatively high transformation ability and that is why it contains the wild-type cl gene) is a lesson in resistant to kanaaicin. Of the 15 transformants tested. two lost their resistance to xaamtmta carbenicillin. Restriction analysis of DNA isolates not from plasmids of these transforants revealed that one had the G-pLa-HFIF-67-1 structure described in FIG. 8. This plazaid contained j unique EcoRI site and unique Pati aaeto. Caabnovated EcoRI-Pstl digestion produced two fragments - one of which co-mapped with the fragment obtained after EgoR1-Pstl cleavage <S-pBR322 (Pst) / HPIP-6. RglU digestion ruptured a small fragment of about 650 base pairs. The size of the last fragment is consistent with the expected size after fusion of the adjacent Bglll-Pstl fragment of G-pBR322 (Pzt) / HPIP-6 clone for further! Patl-BglI portion of G-pBR322 (Pzt) / HPIP-7. HlncIIdigestiia shed three fragments such as sec- 53 on the basis of the presence of BincII ms * ta in the P ^ reglon, the amino-torxinano portion of the beta-lacquered tan gene and ae trans lated the 5 * end of the EuIFN-beta DNA sequence. This placard is designated G-pPL & -KFIF__S7-l.

Based on the previously sponsored characterization of the analgesic reetriction enzyme, plasmid G-pPLa-flFIF-67-1 should contain the HuIFN-beta coding sequence. The desired transcription direction of the chalk is collinear to that of the P ^ promoter «.. Between the P ^ and HuIFN-beta sequences of the coding gene, the plasmid still contains the poly (A) tail and the inverted 3 * end of the fragment as in 3-pBF322 (Pst). / HFIF-C.

2. G-pPLa-ETIF-67-12 plaaaald construction

The next phase in the structures was focused on the separation of the G-pPLa-HFIF-67-1 poly (A.T) tail and part of the inverted 3 'end fragment (see S of Figure 9). G-pPLa — HFIF-67-1 DNA was digested with Bglll and Bpall. Since the HuIFN-beta coding sequence does not contain the Hpall site, this treatment results in a Bgill fragment containing the forehead IFN-beta coding sequence and inactivates the remainder of the vector. The resulting Bglll fragment was fused to plasmid C-pPLa8 which was digested with & BamEI. The Bglll and BamHI enzymes form identical locked ends so that the Bglll ends can bind to the open BamHI site and circumferentially. Such a site is no longer a substrate for Bglll III BJEI but s® clears the enzyme Sau3Al (Mbol) (see Pirrotta, '' Two Restroctic Endonucleaceb From Escllius globigii, Huoleic Aclds ges.> 3, 1747-1760 ( 1976). The washings of the Brnec ligation are reshaped with BamHI so that those G-pTLaS molecules that are simply recirculated are co-eluted. The trans foman ti in C600r ^^ (lambda) is again debuted with the choice of kanaaicin resistance.

Transformates were titrated by determining the size of unbroken DBA on an agarose gel, as described above with the characterization of IFU-bsta-released rexuabiaanthine plasaids. clones that were slightly removed from the Q-pPEa8 parent with «further subjected! reatrikeionoj - 54 -;

analysis were aa FatI 111 BineII. The fruit »is jsfa ^ Vlr ^ which has quenched one FatI maato 1 three famines disappeared. One frater t of this clone I ccmlgrated aa Cool the fragment of lz pFLaS which is derived 1? P. to bera-lactamazaeg regi on. Dear little clone fragment nero about 400 base pairs - consistently aa by inserting the Bglll fragment n G-pPLaO in the oriatational sense relative to the prosaotor. This nlazmld is designated G-pPLa-HFIF — 67—12. The phases that au roots in the construction of this piasmid are shown schematically in Fig, 9. A more detailed map of the evec plasmid is shown in 81. 11. The size of the plasmid (about 4400 base pairs) is estimated at the size of its constituent fragments, which are again estimated z »a basis of relative mobile? * l after electrophoresis on ag & roznlm gels.

E. coli K12deltaHI 1 Χ5219 is then transformed with the caracteciaani * plasmid G-pPLa-HFIF-57 ~ l2.

Inspection of a particular nucleotide sequence around Bglll / panfil junction in G-pPLa-HFIF-67-12 revealed an interesting feature. The polypeptide iniated to AOG sequences for the coding of the beta-lacer * of that plaanild terminates on a double-stranded amber codon located within the 5 'end of the (untranslated) BoIFft-beta coding sequence. These termini are located 23 nucleotides before the initiation of the AOG HuIFM-beta algal peptide, i.e. »

-. _1-in Merger

ISTŠ | BamHI / Bglll

CCcicGG.AOC.UUC.AGn.UOC.GGA.GGC.AAC.CnU.nCG.AAG.CCO

Pro-JAr g-I le-Phe-Ser-? He-Gly-G ly-Aan-Le u-Ser-Lys-Pr oUUG-CUC. UGG. CAC. AAC. AGG. UAG. THE HAG GCGACACOGCOGGOGOUGOCAAC

Leu-Leu-Trp-His-Asn-Arg am am

AOG- (HuXFN-beta peptide coding signal sequence) -AOG- (mature HuIFR-beta coding sequence)

The figure in the enclosure refers to the number of amino acid residue υ beta-lactate · the fatty protein pBR322 (j, Sutellgfe, above). Mark (♦) indicate that the CCU codon present in this position at pBR322 has been changed to CCC due to the conversion of the Pati site in pPLa23ll to the BaajKI site in pPLaS (see above) ·

Therefore, this construction opens the possibility to reinitiate the ADG HuIFN-betA signal peptide and therefore the possible expression of IPN-beta fused to its signal peptide but not fused to a portion of the betalak tarnate. Such internal reinitiation after premature tertiization has been observed in the repressor gene of the E. coli lactose operon (T. Platt et t * Trans la ti opal Restarts: AUG Rainitiation Of A lac Rpreesor Fragment *, Proc. Bati * Aoad, Soj, U.3. A., 69, 897-901 (1972). This construction enabled the secretion of mature IFN-beta by correct bacterial recognition of the HuIFN-beta signal sequence ·

3. Construction of plasmid G-pPLa-HFIF-67-12daltal9

From the known pBR322 sequence and HuIFN-beta coding sequence, it can be concluded that the assembly of the G-pPLa-HFIF-67-12 straight HincII fragment (from within beta-lactamases to 3 nucleotides in front of the initiating ABG HuIFN-bot signal peptide) to the fcontinual frame from the assay starting with ASG beta-lactamases and perfecting after the HuIPN-beta encoding sequence. It is contemplated that this coding will encode for a polypeptide containing 82 amino acid residues from the beta-lsctamase coding sequence, one amino acid encoded at the fused HincII site, a HuIFB-beta signal peptide, and mature

HuIFN-beta, i.e.:

—7

GOt.MC.AUG-inuTFF-Beta oinnnl peptide fcocran r.rkvercoro) -ΑΠΟValkAan-Met ”(coding sequence for mature HuSV-beta)

The figure in the enclosure refers not to the amino acid residue in the beta-lactamase protein pBR322 (J. Suteliffe, above). Therefore, this construct can be facilitated by the expression of a co-fused polypeptide that * 36 contains a portion of beta-lactasease fused * via * 'a core src acid for a HuIFN-beta signal peptide that is a sw cond * nzo «z? ^. for mature EuIFH-bet Such a fused protein can be secreted i3 cells.

G-pPLa-HPIF-67-12 is partially digested in HincII * Zocle ligation at a DNA concentration of about 0.01 w? A ae ruskine with Korll, an isot ah isomer Pvul that produces 3 * »commodities and a jndn krnjovc (R. Waiig et al., Blochi ». Blophvs. Aota, in B tang) 1 again undergoes ligation at low DNA concentration. The parent's c-p? La-5FIF- $ 7-12 contains two Korll methates, one ento inactivating the kanamycin gene and another located in the HiacII fragment that should be omitted from the p las :, id. The purpose of the Korll-digestion-religion phase is not to break the parent DNA molecules with the HincII enzyme. Such molecules have two Korll sites and, under the conditions used *% lgg & c, two fragments will eventually reunite. The trans- fonants are digested into ceOOr ". ^ * (. Laabda), with selections for kanamycin, 1 are seeded with a reatrionation assay" for the presence of One Purity. Further clone analysis was performed using HincII digestion. The week clone is missing from the smallest HincII fragment, but is otherwise identical to G-pPLa-SFTF-67-12 and labeled Q-pPLa-HFir-07-12deltal9. The phase stages used in the construction of this plasmid are schematically different. 9. The map map of this plasmid is shown aa fig. 12. The size of the plasmid (about 4059 base pairs) is estimated to be the magnitude of the size of its short-fragment fragments, which again percolate through their relativity to the electrophoresis on the atjaro.inoin gel. coli X12deltaHI 1 115219 is then transforaiSu with the characteristic plasmid &lt; RTI ID = 0.0 &gt; and &lt; / RTI &gt; G-pPLa-HFIF-67-lldcltal9.

4. Construction of G-pPLc-HFIF-67-8 Pelazoids

Plazraid O-pFLc24 provides another opportunity to capture HuIFN-beta sequences at such an anchin that they can potentially »narrow nintctlzevntl another condensed! poiipeptide. Insertion of the BglTI fragment From r! -PPT.a-decidedTr-57—1

- s? at C-p-7.c24 leads to a ccntlnual ra »» a o * Ifavan encoding for, 93 aziinoquiaolin outlets and a * \ S2 replica gene «« (V.

Fiers et al. Complct® iTuolootiAe Se ^ uenc «Cf Pacteric ^ hage MS2 SMAt Priciary And 5econdary Structurc Of The Hcplicasc Gene, Mature, 260, 500-507 (1976)), whereby 27 aninocleelins encoded by sequences leach Bglll sites and initiate ACGN signaling HuG sequences -beta, after the HuIFN-beta signal? peptide and areotype of HuIFN-beta, i.e. ·:

IS ~

UGG GAU.t ^ CD.CAC.DDU.CGG.AGC.CAA.CCU.UVC.GAA.GCC.DUC.CCU

Trp · Asp-Leu-Gln-Fhe-Arg-Arg-Gln-Pro-Phe-Glu-Ala-Phe-AlaCOG .GCA.CAA.CAG. GCJA.GDA.GGC.GAC. ACO .GVO .CGD .GOD .GOC .AAC.

beu-Ala-GlB-Gln-Val-Val-Gly-Asp-Thr-Val-Arg-val-Val-AsnAOG- (Sequence with HuIFP-beta signaling peptide encoding) -AUG- (SequenceMet with Encoding of Happy HuZFN- beta}

The figure in parentheses refers to the number of non-acidic axes thereof in the protein of the wS2 replicase gene (H. Devoe et al., Above »W. Flere et al., Above).

Therefore, this construct mc5e expresses a fused polypeptide containing a portion of the MS2 replica, fused over 27 aninokieelles with a HuIFN-beta signal peptide that is fused to mature HuIFN-beta.

C-pPLa-Hrir-57-l tigers ac EgiII and execute no league «! I ea -uaskiiiutorc pPT.c2 <MOT. The ligadon mnails are reinocciated by SamHT so fine they cliain the parental pFIe24 x) olecules and are transforced into the C6CCr ^ r ^ (larhda) selccier to the carbonityallin resistance. Transfoils are analyzed by the HfncTI assay. Ir known positions of reetriction nests do not pPLc? '* Nolo s »to predict that it thinner 5al« _ IFK-beta fragment ?, in snilsln erythntation in relation to P ^ should produce extra ΠίησΤί fragnvtnt of about * 5n pairs of bass. The reprepositive clone exhibiting this configuration is designated pPTx: -HFIF-67-8. The phases used in the construction of this plasmid are deflected in .58 ·?

schematically in FIG. 1 «. A more detailed epi of this plasmid shown in FIG. 13. Valichiaa laziida (about 3650 pairs * of ours) is a cheah srt of the magnitude of coastituent fragments, which are the abbot of the studied nioliovoar «relative to the la apoil of _A ; o ^ la eiaztroioraz on agarose gel.

B. coli »12deltakl and R3i.U transicriiisaae are with characterized plasmidcm G-pBLc-rr? Ir-f 7- ⁿ .

5. Construction of the g-pPla-BF1F-67-I2delta279T Platinum

Plamaid pKT279 (gift from K. Tahtadijej pKT279 is a derivative of pBS322 that has a distinct part of the gene for beta-lactamase I and aaa Poti site constructed on the amino acid 4 of botanical lactanase) is digested with Pstl 1 3 'terminal acyanic extestion and fused to 1 fragment «Beautiful« Jerajev tre ti ran jon ea%. coliUKA poliaerazoet I (Klenovfrags «snt) in the absence of decxinucleotide phosphate. The linearized Pati and PiiA fragment with 3 * blind "ends" "pKl'279 are then digested with ScoRI so that the prot ringing fragment encodes, among other things, the oeta-lactai-aase signal sequence for the first 4 amino acid mature proteins.

This NA fragment is then used to replace. KpaI-P.coRI fragment j ^ La-BFIF-67-12deltal9 (Inflammatory site is due to the above-described omission of ls G-pPLa-HFIF-67-12) by ligation of Hoal-EcOR1 restricted pPla-HFIP-67-l2daltal9 with that fragment © »In the presence of the T4 PHA league ·

Broken jen * sequence at Pati (alepl-end evi) -Ppal fusion jei (sequence for encoding beta-lactamase eignal peptide) -CAC.CGC «AAC · Mis-Arg-Asn—

AUU- (HuIF ^ -bet coding sequence); -AUGMet (mature MuIFU-bet * coding sequence)

Therefore, the construction results in an IFH-beta which is preceded by two signal sequences in tandem - a bacterial signal sequence (beta-lactamase) and an IFN-beta signal sequence - coupled to several

- 59 amino acids. For this reason, this conjecture r »5e give repression '. ·', Mature log HuIFF-beta kouden rovar og for rtra sigrolnn popt * da 115. if the tandea combination is a bacterial signal eqvonco .1 Γα? ^- ^ - '«ota signal sequence understood by bacteria and correctly rash * ·», the construction of the knife "express it mature"? HuIPP-hat and its excretion from the cell ·

8. the bare F15219 is trans formed.?* with pPI. »- nFIF-67-12 <. 'Elt <i27ST.

C. T-Plate Toner G- ^ PLa-KriF-67-12delta218Kl

B. Construction of plasmid G-pPLa- ^t TTTr ^> -57-l2dQlta21S:; 'l

Plasmid pKT218 (a gift from K. Trlnadgoj pK7215 is a derivative of pB5322 that has part of the beta-lactamase gene and its signal sequence is omitted and the patient site conjugated to the amino acid 4 beta-lactamase signal sequences) is digested with SeoRi 1 AluT a fragment encoding an oatalog glass for the initial portion of the betaignactamase eignal peptide. This fragment undergoes ligaeia in the presence of 74 DNA ligase ea fragments »made from pPLa-apzp-67-13deltal9 by Aid digestion in the presence of actinoaaicJLna D (0.05 rally) (up to the eignal peptide) .t performs ae. Restriction with Kcek.I .

The resulting plasmid, depleted by pPLa-riFTF-C7-12delt.3 ?.lfiitl, contained the initial portion of the gene encoding the beta-lactamase signal peptide, the dec gene encoding the RuTTH-beta signal peptide, and upregulating the mature HuZFk-beta . The predicted sequences of the plasmid regrowth drevzrajder are:

caaI and WwL * · VWv «kV ii. (sequences for encoding mature nuIFS-beta)

SlarAle-Lee-Sez — MefcThe figure in the enclosure refers ae n3 the number of axiucltisali. '<: Y residual in the beta-lact signal peptide.' 'For the sake of this, this construction' axis oaugulate the expression of the mature Sul ^ -beta b.oalonsoviog for the part bacterial signal sequence and part of its co-signaling sequence. Again, if the bacterial host recognizes and correctly disrupts the tandai signal response, it will express the mature HuTRT-fceta and this · piazr.-id and excrete

- 60 and more "g" coliM52I9 ee is transformed with pPLa-aFIF-67-12delta21gMl.

7. Construction of plasmids G-pPXjt-Hgiy-67-12deitaMl

Plasmid pPLa-HFIF-67-12delt * l> is linearized as before aa Alul in the presence of actinamycin D (0.05 mM) such that aa generates a cross-section at the Alul site in the BuIPIHbeta signal peptide · After digesting with Bpal.

DHA ae recirculates in the presence of the T4 PSA ligase. The resulting plasmid, a potent pPLa-HFIF- € 7-12 deltaMl, lasso is only a small fraction of the IFK-beta signal sequence preceded by a DMA sequencer encoding mature IFN-beta.

Fredvldejeaa jet coupling sequence

GOU CUC.OTU.CCA.USA Val · leu-Phe-Pro-STOP

ΓαΠΟ- (sequence with the encoding of the lucky HuIFN-beUaJl

The vertically encircled figure refers to the amino acid residue of the beta-lactamase. The horizontally fenced episodes refer to a sequence in the second frame of the eye. Therefore, translation of the sequence encoding the beta-lactamase and the preoetal portion of the sequence encoding the IFK-beta signal peptide is captured on the UGA-codon. However, bar code (A06) aa encountered IFK-beta is present in the same bridge, although in the frame growth aa ofiitaoaaje, therefore it may perform a reinitiation of tracakia at that point so that the product! met BuZFH-beta.

8. coli M5219 was transformed with aa pPLe-aFIF-67-12deltaMl. t. Plasmid construction of 3-rf? Im-BFiy-57-12deital9 ΒΧ-2

Plasmid pFLa-8PZF- <7-12deltal9 oe linearizes oa Bpal and treats ae ammgracoucle BAL 31 to remove vapors! bass sequentially ea the end of a linearized DMA fragment (B. Grap et al ·, “Brtraeellular

Mueleaoeo Of Paeudomoaaa Bal 31 I. Cbaraeterisatiom of Single BtrandSpeelfie Deoajribendenualease ·, Buoleic Acida Boo., 2, pp. 1459-92 (1975)) · By varying the time a and the conditions of aa exonuclease treatment, will a series of fragments that have racial nucleotide numbers and signal-coding sequences be construed? of the BuZFK-beta peptide, if iaa, that precedes the ADG start codon of mature HulTB-beta. These fragments can then be used to construct ribosomal binding sites at racial distances from the atartic codon and to obtain a selective secondary structure near that codon to enhance expression of the mature? HuIFSF-beta.

The exonuclease and B-treated fragments are attached at the "beautiful ends" with * - "ooll DSR polymaras I (Klenov fragment) in the presence of dATP and dGTP by filling in the macojl 5 'puncturing ends !. Subsequently, the Khol binding element, which has the 5'-CCTCGAGG-3 * (Collaberative Research) efficiency, is fused at the blind ends of the SRR fragments. These fragments are then efcfciabafa elongated with a Rcoai double-strand® bonding element having 5 * -CCGM «TCea-3 'sequences (Kollaborative Research).

After digesting with RopRI, fragments having sticky * RcoRI ends are redcrularized with B »coli DNA lgazcm. The use of these ligases by the T4 DBA ligase site, avoids the reeucularisation of the fragile ends with blind ends ·

Zsabere ee one plasmid and is designated pPLa-HPIP-67-12deltal9 BK-2. thorn KboZ site of about 25 base pairs in front of WHO starting? codons of the happy BuZPB-beta. Ihol anto isa iso BooRI site generated by EcoRI ligament binding? element of the Bpal fragment for the BooRI site of the liquid 'P ^ preator in pPLa-BFXF- <7-12daltal9 · Therefore, the sequence encoded by beta-lactamase is omitted. Furthermore, because it is a separate read portion of the BuZFB-beta signal sequence, only the happy BuZPB-beta expression is expressed.

B. complex of K12deltaHX is transafter mixed with pPLa-HFIP-67-12deltal9

ΒΧ-2.

- 6? iiodpvahjk χ Ki ^ T ^ iutfijA Huzrp-beta haphatomco basmioisa A- Making bacterial ex bands ta

1. Inductioal procedure

An aliquot from stock cultures (crushed at -80 ° C in 501 glycerin501 LB media), including stock cultures of strains K12deltaHX and M5219 transformed with plasmids containing ZTR-beta fragments described above, were inoculated into fresh LB medium with stained antibiotic 1 cultured until dried at 28 ° C. Two batches of 500 ml LB anti-rabies antibiotics inoculated ea ea per 1 ml of dried delia 1 by culturing with anal agitation aa 28 ° C de guatine dahlia 2 with 10® ml.

One batch will be transferred to 42 ° C and continue flashing. Bended from the used plasaid, the culture is harvested with racial burdens after moving to 42 ° C. The control culture remaining at 28 ° C was harvested in the same bag as the culture at 42 ° C. the longia were collected by uantrifugation in OSA rotor I (Sorvall) aa 800 rppm for 10 minutes · The oranals aa washed with 20 al 50 mM Tria HCI (pH 7.4), 30 aMEHaCl and regranulated with an 8S34 rotor (Sorvall) for 10 minutes aa 10,000 rpm. · Grenella aa rapidly saars in bold dry lad-methanol and stokes at -80 ° C. When complaining about osmotic Juice on the defended dahlias, the slithering facet aa deliver.

Corifidaaa and in two raslifiit procedures with rakacid and bacterial extraction.

2. Extra-clonal procedures of Dalia aa were resuspended in a phial sapremin of 4 ml of the buffer described above and added aa by lysosome (Sigma) to 1 mg / ml. The incubation was 30 min at 0 ° C. Suspension aa undergoes two self-priming cycles by sequential defending in an ethanol-CO 2 (-80 ° O amoeba) and in a water bath at 37 ° C. 8-100 fractions were made by ultracentrifugation of the raked bacteria (4 forces) in Beckman 8W60 Tirotor for 1 hour aa 60,000 rp »& * ° ^c · pony« which is still used by the supernatant.

Termination B

Raakidaaje B is as described above (raakidaaje λ) except that the solution is 50 aM Tris-HCl (pH 8.0) -30 aU NaCl is seeded with 50 »H HEPES (Signa) - NaOH (pH 7.0), 30» H NaCl , 3 »K beta-nercaptoethanol 1 3% serum of newborn calf (Gibco).

Osaotic Juice

Immediately after sowing and rinsing, some granules are resuspended in 20% sucrose, 100 eM EDTA, 100 nM Trie HCl (pH 7.4) at an axial density of dahlia 1 and 10 ^l0 / l. Suspension of the ee is kept on ice for 10 minutes and then centrifuged for 10 minutes not 10,000 rp »in the Sorvall SS34 rotor · The sucrose solution is carefully filtered off from the test tube 1 pellet is resuspended in J volume (further density is 1 x 10 ¹⁰ /» l). The resuspended divisions remained on ice 10 "in. and then they were again centrifuged at 10,000 rp toke 10 aiauts in an 8834 rotor (Sorvall). Supeant ee depunl aa 3% aeru »a calf fetus, 50 uH

HEPES buffers (pH 7), 30 M NaCl, and 3 bM beta * nercaptoethanol. The supervillain ee owls aupernatant after Osnotski Sok. Stokes ee aa e ^e C.

3. T »l <> tw» and «« »» 0.11

al (NH *) ₂ 00 | of the solution, added to room temperature, added to 0.5 1 1 of control solution or S-100 extract, this eaeBa kept on ice for 30 in minutes, and then the precipitate was granulated in the Bppendorf centrifuge until 10 ata were not present at room temperature. The granule will be redissolved in PBS (eluent phosphate buffer solution) ·

b. j »lnt.rf.roM

l. Direct antivirus test

HuIFN-beta ee tested for »icrotitarakia plltloaaa (Sterilin pono technique inhibition of CFE (oltopetal effect) on human» fibroblaatiaa

- ¢ 4 - which, in the triangles with chromosome of the 21st dahlias, pellaged one day pn the cretaceous, incubated aa with a? Ry dilution (log ^ o * β · 5) of sample 1 for 24 hours and infection with aa vesicular stomatitis virus (Indiana • oj) so that the stock contains 10 ^ dilutions with 10 ** $ units / ml forming my C-929 plates. GHt is white Sl 24 hours of work V8V is infected and the interferon endpoint is defined as a sample dilution causing a 509 decrease in viral? CPS. The 3oi tasters included the HuIFN-beta internal standard, which was calibrated in addition to the NIH human fibroblast reference GO23-902-527.

trlzoan cell line with chromosome 21 (hence why owls? 2p Biopsies · skin paeianth aa Dcvn syndrome was performed. Yen charlottype 1 was found to be prolific with all chromosomes except chromosome 21 (trisomnron). starvation de ee can «compare with the sensitivid of a cell line trisomous for chromoa 21 as described in Clerog et al., Nea-antlvlral Aetlvitle« Of Interferon Cre Controlled By Chromoaoma 21, Nature, 256, pp. 132-134 ( 1975) 1 FD Cleroq et al ·, Chromnoeme 21 Does Not Cede For An Interferon Receptor ·,

Nature, 264, 249-252 (1976).

In other tastes, the erosion of the lineage Β _χ 8Μ (A. Billiau et al., * Humen Fibroblast Interferon For Clinioal TrialsT Froduetion, Partial Purufueation And Characterization, Anti-mlcrobial Agent And Chemctheranv. 16, 49-55 (1979)). This funnel line is dlploid fibroblastic and dysomic with chromosome 21 a. It is derived from a 2-month-old human fetus. In addition to the strong line, EjSM is less sensitive to HuIFN-beta by a factor of 10.

2. Test 2> 5-synthetase

Another step in detecting interferon presence is using a 2.5-A slntetascm assay. Interferon has been shown to induce this

- 65 ensim, which translates ATP into trimers (and to a lesser extent dimers, tetramers, and mmltlmers) 2,5-A (A. Kimshi et al ·, The Kinetics Of The Zaduetiem Of Three Translation-Enzyraee Regulators By Interferon, Away, Natl « Agad. Sel. US, A, 76, 3208-3212 (1979).

25 µm confluent balloons containing E ^ SM cell cultures (A. Billiau et al., Above) were treated for 20 h with 1 * 6 dilution of bacterial extracts or control interfaroaam in MBM-10% serum of the theist fetus. The ss cultures were separated with trlpsla (0.25%), EDTA (0.17%) and abundant ss ipsper with 140 mM KaCl in 35 mM Tris buffer (pH 7.5). All subsequent operations return to 4®C. Cells were homogenized in 1.5-2.0 for 20 mM BBPBS buffer (pB 7.4) containing 10 sM ECI, 1.5 mM nagmisacetate 1 0.5 oM dithiothreitol Ipufer from dissolution Z *) n Douneed glass homogenizer. The Bosmgenate was centrifuged for 20 min. at 10,000 z g 1 supernatant (S10) ee stacks in liquid nitrogen when not used immediately.

S

The 96-well confluent microtiter plates (10 dalia in 0.2 acre per 0.28 cm ruplee) were treated with interference or bacterial extracts as above. After a 20-hour treatment, the wells were collected on ice, washed three times with 140 mM When in 35 mM Trla buffer (pfi 7.5) · The cultures were then raked by adding 5 / Ul solution containing 0.5% Nonidet P40 and 1 in each well. mM phenylethanesulfonylflaorld (PMSP) in dissolution buffer z. After vigorous shaking for 20 minutes on ice, the 11 cells were collected and centrifuged for 20 minutes at 10,000 z g as above.

3.5 / Ul lysate made as a phyto I indicated above (cleavage A 111 cleavage B) was incubated for 2 h at 31 ° C in 6 / Ul iacubaolone amoeptie containing 108 mM potassium aoetate, 25 mM magnesium meetata, mM HPBSE / KOT (pfi 7.4), 5 mM ATP, 4 nM fructose 1,6-bls-foafate, zM dithiothreitol 1 20 / ug / nl poly (I) .poly (C) 1 2 / «Ci lyophilized

- 66 (al £ a-32j>) - ATP (400 Cl / znol, from Radiochasiical Cenre, Aaorshaa, O.K.). After stopping the reaction by heating the flow »3 min. at 95 C 1 clarification for 2 ml at 9,000 xg, usorcl was treated with 150 0 / ml alkaline phosphostase from calf intestine (Boehrlnger, Mannheim, no. no. 405412) for 1 hour at 37 ° C., again clarified 1 as stain (1 / Ul per sample) on thin-film plates under polyethyleneamine-cellulose (Polygram, cel 300 PEI 20 x 20 cm from Macherey-Hagel Co., Duren Senany). The plates were washed in vacuo before chromatography in 1 M sulfuric acid for 2-3 hours. After drying, they undergo autoradiography for 1-24 hours.

C. Detection of Huir »-beta activity in bacterial extracts

1. Control experiments

The main problems are encountered in performing the tests described above.

Both are important for interpreting the test data. Bacterial extracts (including control extracts) produced by termination by the methods described above appear to include a non-interference factor that exhibits antiviral activity in the assay. It is clear whether the factor is an antiviral agent, or that the factor 11 is an antiviral agent, e.g., interferon, under test conditions. The presence of the factor was detected again in 8100 extracts. The activity of the factor was six times higher in the control * extraction of K12deltaHZ or M5219 bacteria, where the activity of the factor was a lifetime of about 0.7 log ^ / ml. For some reason, the antiviral activity of the factor was diminished and sometimes Sak was eliminated completely by precipitation with (KH ^) ^ 80 ^ under conditions that also deposited interferon in control experiments.

Because of the antiviral activity that can be attributed to the contaminating factor, it is difficult to draw conclusions about the presence of minor Collins interferons in bacterial * extracts. However, it was possible to distinguish between the antiviral activity of factor C 67 and the activity of authentic interferon using diploid fibroblast EjSM. These dream cells are more sensitive to HuIPN-beta than conventional chrysozoid trizoan cells. 21. But the cells are much more sensitive to the factor, such as interferon. For example, using pMS2-7 (R. Devos st al., Construction And Charaeterlzation Of A Plasrnid Contaiaing A Neraly Full-Slze DNA Copy Of Bacteriophage MS2 RNA *, J. Mol, Biol.

128. 595-619 (1979) n B. coli RB191 (H. Bo / er and D. Rouland-Dussoir,

A Complemaatatlon Anal / sis Of DNA Restriction And Modification In Escherichia ooll J. mol. Biol .. 41, 459-471 (1969) iii KUdeltaHlO "pPLa2311 as control licks, data demonstrate" this relative effect as shown in the Bledeco J table, at Seeds is antiviral activity "arena as logunit / ml.

BB101-pMS2-7 (Breaking A) 0.7 HB101 — pM82-7 (Breaks B »but of beta-marcaptoethanol bass and calf ssrama base) <9.2 1.2 HB101 — pMS2—7 (Breaks B) not perfect 9.7 BB101-PMS2-7 (Breaking B) 9.2 1.9 HBl01-pMB2-7 (Breaking B) 9.7 2.6 K12deltaHI-G-pPLa2311 (Breaking B) 0.2 4.9 K12daltaHI-G-pPLa2311 (42 ° Cj Osmotic shock) 9.5 > 1.7

Furthermore, the presence of authentic Huim-hat ss is reflected by the different ratio of values to tEjSM and high value to Tj, compared to that which causes the presence of factors. This is shown in the following j

Tablicii

^T 21 B | SM the supernatant of the job Dial-O-pPIa2Jll (42 ° C) 9.5 2.5 of osmotic shock K12 * BX-O-pPLa2311 (42 ° C) 1.5 2.5 4 Bnm-beta (Authentic) breakup B pos- HB101-pMS2-7 9.2 2.5 ls (NHp2 ^SO 4 bal- HB101 — pM3-2—7 + HuIFNbeta (authentic) 2.7 2.5 Senja (added before breaking up)

Because of tofu, the comparison of T ₂₁ »BjSM 1 activity of absolute activity on T cells facilitates the use of antiviral tastes.

'O. ¢ 8 opis described above, with non-invasive detection of HuIFN-beta in Baltery extract. Furthermore, it should be emphasized that for extracts of cultures B, the naked (or KlldeltaHI 111 M5219) transformed with some of the plasmids of the present invention are, e.g., G-pPLa-UPIF-67-12, G-pPLa-HFlP-67 -12deltal9, G-pPLc-HFIF-67-8, G-pPLa-HPIP-67-12delta279T, G-pPLa-HFIF-67-12delta2l8MI, G-pPLa-HFIF-67-I2deltaMI or G-pPLa-HFIP-6 ? -12deltal9 ΒΧ-2, such interference with the help of an unknown factor n antivirus father-in-law was less severe. In these tastes, ηβ-highly concentrated extracts (for example, 150-ml cell cultures at 6 × 10 ⁸ cells / ml are cleaved and extracted into 4 al) will erode low or hedetecting levels of antiviral activity that can be attributed to unknown factor. toru.

It has also been shown that the presence of this unknown factor begs to be detected in the 2,5-A siatatase activity assay. Here, however, the factor can be completely eliminated by precipitation with (NH3 ^ SO *. Therefore, the actual presence of HuIFN-beta in the bacterial extract, clearly ratified by the presence of the contaminating factor yesterday, can also be detected unequivocally in this assay.

However, S. coli HB101 / G-pBR322 (Pst) / HFIF-6 extracts, which have a non-intricate collineam coding sequence (lacking the last few base pairs) that is so incapable of expressing a mature polypeptide, yielded a repeat positive 2. 5-A slntetase activity, but at least so far, not antiviral activity. This demonstrates that the 2,5-A test should not be considered as the only criterion for the presence of interferon completely made by bacteria. This also demonstrates that interferons of a less complete nature may also have useful activity.

2,5-A synthase activity is »assisted by incorporation into 2,5-A trlaor as indicated by autoradiography · Results (reshaped 3 times (shown in the following table, zooming in)

-'SS32 positive values reflect the increased incorporation of p.

a / pHFIP-6 7 +++ J extract after (NH.), 30. deposition of 7 ++ extract b / pMS2-7 7 + * + »to extract b / pJSS2-7> +++» after (NHJ, So. precipitation of 7 ++ plus HuIPN-beta

Another important problem in these assays is the low regeneration of HuHV-beta secreted by human fibroblasts at time 1 after racial exparininal phases. · Sequence j The regeneration of leukoel interfero and fibroblae interferon added to 8-100 extracts demonstrates that HttZPV-feeta is only excl. efficacy versus HuIPH-alpha which Isola has 100% value (antiviral values are given as log _ie units / ml »measured on cells · *) ·

XFW-h. smashed. «8-100-extract HB101-pMS2-7 (break A) 2.5 IFH-alpha decomposed. in B-BBM plus 39 calf serums 2.7

IFB-k in S-I00-extract HB101-pHB-2-7 (crack A) 0.7 ITB-C * dec. in E-MKM plus 3 * calf serum 1 · 7

Other experiments in which ZTO-beta was added to a deli strong granule prior to dissolution and extraction (Sec and calf serum were added up to 3 "as a stabilizer) showed that only 10-30" IFB-beta was isolated.

log _X 0 unit / ml

HB101 — pHS2—7 (B rupture but no beta-mercapteethanol or calf serum)

ΙΓΗ-beta

BSPES ^T 2l 2 _χ 6Μ pH 8 0.7 (10 «) 1.7 pB 7 1.0 (20 «) 1.7 pH 6 0.7 (10 «) 1.7 $ R 6 1.7 (50 «) 1.5

(no bacteria)

Further experiments were performed to evaluate the stability and regeneration of ZFB-beta activity. Deposition with pra ^) ₂ BD ^, as described above, or in the presence or absence of bacterial extract, caused the titre of the antiviral test to decrease:

log | Q unique / ml

Deposition aa o · «'' · ⁰ « pre after ZTO-beta 1.0 0.5 IFN-beta 2.7 2.5 HB101 — pMS2—7 + OTI-beta (breakup B) 1.5 1.2

Kl2aelt <tHl - «- pPLa2311 (2 | ° C) + IFH Bot (Breaking B) 1.7 1.5

K12deltaBX— <3 — pL & 2311 (28 ° C) ♦ IFN-beta (Breaking B) 2.2 3.0

IFN-beta dialysis (via aodl n «4 ° C vs. PBS) or the presence of lli in the absence of bacterial extracts also usually led to reduced isolation of IFN-beta activity» log ^ g unit / ml.

Dialysis pre after IFN-beta in PBS 1.0 0.5 IFN-beta in PBS 2.7 2.5 K12deltaHI-G-pPLa8 (28C) 4 IFN-beta (cleft B) 1.2 <0.2 « 4 IFN-beta (breakup B) 3.0 1.7 • 4 ZFB-beta (breakup B, 2.S 1.0 «I 4 IFN-beta (broken) 1.5 0.5

Foito is Type I IFN-beta interferon and its activity should be stable in acid. The sheep were tested by IFN-beta azoric acid in the presence or absence of bacterial oats (extracts), over 5 sM glyclae-BCl (pB 2.2) at 4 ° C. This treatment resulted in the formation of a precipitate, which was granulated in a Bppendorf centrifuge at 12,000 χ g for 2 minutes. The supernatant was then tested for antiviral activity. Although there was some antiviral activity left behind by this treatment, there was a costly loss in the coll-lnl of isolated interferon.

logjQ units / ml

Daljaliza

HB101-pM82-7 (Breaking A) 4 IFN-beta X12doltaHI-G-pPTa2311 (28 ° C) Osmotic Juice 4 ♦ IFN-beta

M52l9-G-pFLaS (42®C) (cleavage B, 4 IBT-beta M5219 «Oppba8 (28 ° C) (cleavage H) 4 IFN-beta

The mismanagement of HuIFN-beta activity is impaired

pre after 0.7 0.5 1.2 1.2 1.2 0.7 3.0 2.8 with these racial treats «

In comparison with the control experiments described above, they must be interpreted with caution. NOT antlvirus titers do not indicate that laterferon is degraded. The fine ground may be due to the non-adhesive gluing of HuIFN-beta from "folded for djalltu 111 for bacterial extract components, e.g." to the membrane component. For example, it has been well proven that IFN-beta is a hydrophobic protein (its hydrophobicity is also devon triaaa by its amino acid sequence ") when it is non-peggly glued to its walls" to 111 111 surface.

Further, bacterial IFN-beta, without glycosylation, may be Oak 1 hydro * fobnijl. Therefore, the sake of eating the glycosylated IFN-beta derived from human dales does not necessarily have to be effervescent to IFN-beta of bacterial origin.

2. Penonstriction of IFN-beta activity

a. Natjvlrusaa activity

Bacterial pdnttt extracts B, salts M5219 lil NUdsltaHI, which contains planiles © -pPIe-NFIF-57-12, a-pPLa-Hrn ^ C7-12deltal9, G-pFLo-BFIF-G7-8, G-pPLa-HFIF-67 -12delta279T, G-pLa-HFIF-57-12delta218ΗΣ, Ople * BFIF * d7 * 12deltaMZ HiG-pPLa-HFIF-47-12d «ltal9 ΒΧ-2 were analyzed for IFN-beta antiviresae activity. Fostupol with indzolcol 1 making 8-100 extracts of 1 sepenate after osmotic BoC were seitinally described herein. ISO No Bacterial Culture (3-5 x 10® Delia / ml) Carried out by experiment. Nvi MoloBkl titers be given e log ^ jediaios / ml.

G-pPLa-HFIF-67-12 was co-transfused with R. poly 113219 transfusion and N. ooli NUdeltaBl and 8 * 100 extracts were made by digestion B. All samples were crushed with (184) 3804 before anti-viral activity testing.

* 21

X12deltaBZ - «- pLa * aFXF * € 7 * 12 (2I ° C) • (42% 90 min.) Μ $ 219 * € * ρΡ £ η · ΒΝΣΝ * (7 * 12 (20¾) •« Λ, 90 Bin. ) <0.2 0.2 / 0 .3 <0.2

0.7 / 0.7 <x. · (1.0 / <1.0 <1.0 <1.0 / <1.2

The Brega digit e of the table above is a titer determined by retesting the same esos »Noatrol experiment e» which I authenticate

- 72 <·

IFN-beta added n 8. ooH HB101-pK82-7 before termination The naanaSi * cell is an IFN-beta of 30t in the assay. Therefore, it is clear that after induction, IFN-beta detects antiviral activity and bacterial 11 tu. These three, given below for detection on E ^ SM cells, clearly indicate that IFN-beta activity is not due to contaminating bacterial activity. Such contaminating bacterial activity would give a value of at least 2.0 aa BjSM, which would correspond to the values of 0.5 l or 0.7 at TJ j (see control experiment above).

Plasmid G-pP £ a «HFZF-č7-12dex» 19 was kerilized to transform B, coli ttSSli a d-extracts with cleavage made B. All sampled atalolen ea ea as described above, and tested eo aa antiviral activity «Again is clear about the presence of HuIFN-beta anti-viral activity and the ex-band team. The value between cities indicates the aivo of detection, due to the certain toxicity of specific samples for human cells and tissue culture.

1) M5219 — β-ρΡΙΛ — NFIF-67—12deltal9 (29 ° C) ii) M $ 219-O> ^ L »-BrXP- <7-12deltal9 (42 ° C,» 0 min.final cell density «3 x 10 ⁸ / ml) aa T «j at B ^ SM

i) <9.3 2.2 (<2.0) ii) 2.2 (<0.5) 2.2 (<2.0)

A control experiment, to which nutrient TFP-betn was added to HB101pKB2-7 before cell dissection showed 30% regeneration. Here, high values in TJ _X Cells 1 ratio of activity at ^T 21 over that at B | SK try to significantly contaminate the learning bacterial activity (as stated above) at temperature-indicated intervals ·

The plasmid d-pPic-eFIF- <7-8 was digested with the transformation of B.jopII MS219 and the d-ldd extracts aa made by breaking B *

- 73 All samples will be cared for Saal e * aBonium-aulphate and tested for anti-viral activity.

i) Μ52Ι9-β-ρΡ1ο-3Ζ1Γ- «7-8 (26 ° C)

11} * (42 ° C, 180 min., Final particle density * 6 x 10 * jtol) at T, d

n) <0.5

2.2 («5.5) on Ε _χ 5! 1

2.2 (¢ 2.0)

2.2 (<2.0)

The values of α brackets increase the level of detection due to the tokaichata. A control experiment to which * authentic IFR-beta was added not ΒΒ1Θ1pKB-2-7 before discontinuation of dahlia exhibited 308 regeneration * Again, it is clear that the bacterial extract exhibited HuIF! M> eta antiviral activity.

JS second * to the experiment the supervisor of these parts after Osnotski Beck was tested for ΧΓΗ-beta anti viral activity

1) control: K521> -G-pPIa-HFIF- «7« 12daltal> (28 ° C) ii) M5219-G-pPbe-BFZr <-67-0 (28 ° C) lil) (42 ° C, 180 nin, density of dahli «€ x 10 ⁹ Ab1).

The toasts were screamed at "n dalyas, both before and after deposition of ea sulfate". The values in the frame are the level of detection.

jaauSfiisSsala <0.2 <0.2

0.7 (<0.2}

i) <0.2 11) <0 * 2 iii) l.S (<0 * 2)

OH-beta isolation was if 108 in control * ekeperis »atiiaa · Control lyses did not repress detectable activity aa E ^ SM. the values obtained by m superuatantis * after eaeotec arc indicate that teuperatar lndukovuni l6219 ~ Q-pPbe-BRP - <? - 8 extract has anti * virus «activity which is not present in the nonadherence of the specimens. Vsonfe (iii) after thaelei aa aeceijm-zulfatoe, which iaa tl tar 0.7 loffjg units on el », was dialysed to pH 2.2, as described above.

- 74: 1 did not overdue the essential smearing of activity. This stability in acid is determined by type I personal interferons, e.g., UW-beta ·

G - <? Pra-gny-47-12delta27 »T

Plazmld 9-pKm- "MV-" 7-12delta279T koriMen for transforming g eolia M5219 1 S-100 extracts are rendered with breaking off B. Uzoro with "st & leženi with enoai .mu.m-sulf atom pre testing pomodu CPS T ₂₁ dahlias. Delia extracts induced at 42 ° C showed an anti viral titer of 1.5-1.7 hunting _1Q a / ml extract.

G-ppjz ^ xy-47-Hdeimim

Plazmld G-pPLe- «FIF-67-12delta21? MI koriSden j · for transformations g. coli '£ 5219 and 3-100 extracts were made using B. B. The samples were sfcaloženl zn osonljuarsalfatea before testing with CFB »at _n dalia. Aa 42 ° C induced deli extracts showed an antiviral titre of 1.5 lO9j £ «/ ml extract *

G-pPI ^ t-gFIF — 07-12deltaMI

Plasmld G - ^ 'La-HFTF-47-12deltaMX was used to traeferermel E. eoli K5219 and 8-100 extracts were dissolved B «The ozone was rinsed with amoaljun-eulfatcet before testing the CPS vessels on parts of the wells 2 ° C showed an antiviral titer of 2.0 109) 4 units / ml extract.

. * W

Plasmld G-pPLa-3FIF-07-12doltal9 ΒΧ-2 koriftden is for transferring «g« ooll S12delta8Z 1 8-100 extracts aa made by breaking up B. Samples held in place oa amoalma-euifate before the test of possession of aa and FS-4 Delia extracts induced aa <0 ° C showed au antivirusai titer of 1.7-2.0 lev _lc u / ml extract.

The further dean of mufttiam bacterial expression of ΧΡβ-beta is given by the * * perimentlma oa noutraliaaoia of antibodies. The anti-interfering anti-serum was aa coma «imnaisirmaim ma 10 ⁷ units autentl & aog UE- 75 beta (human hearing» fibr at its own forehead), and was primed to »

• v * Λ control by glass beads ea porasm (λ. Billiau et el., Above). As the bacterial tracts were titrated up to anti-viral activity, the diluted antiserum was added to our samples, brown &lt; RTI ID = 0.0 &gt; e &lt; / RTI &gt; incubated at 37 [deg.] C., applied to human diploid T _2i fibroblasts and screened anti-viral activity as described previously «The degree of neutralization using IFN-beta antisera varies from ++ ♦ (complete neutralization to - (no neutrality)) · The values between the constructs are approximately approximated by the lower antiserum with 50i neutralization.

1) M5219-G-pPLc-MT-C7-8 (42 ° C, 180 min; koji gives 2.2 log _LFL antiviral jodinice / al sa T ₂₁ CELIJA)

2) K52l9-Gp? La (42 ° C, 180 min) to which IFli-beta (and from human fibroblasts) is added before dissolution (which gives 1.7 µg anti-udder units on Τ ₂ χ cells) · Antisera dilution (1) (3)

10 '+

+ (10

4.5)

Similar results from au aa extracts are M5219-pFIm-eFXF- <7-X2delt 19 (42 ° C) · Differences in neutralization titer but bacterial? HV-beta is this? millet sex and authentic ZFtf-beta may be due to the difference in antigunesta lli in the speelfift XFM activity of these bacterial proteins relative to the authentic ZFN-beta, which is due to a lack of glycosylation in bacterial pcoteim.

= · 3 <a »bm» Pst «aIg» -b8t »« BtlvltB »» «ktlvno.U.

(1) Thermal te.MjM. is irn-tat * la · «aMapMfc Χ, Β-alfa« «slo« MskliUJe »oaoblm.-F 's« its antivirus activity regenerated after breaking it in boiling It 8DS, lt beta-tterkaptoetaaolu , SM Carbamide (Stevart, <WE ΣΤ et al. _T Distinct Noleoular Spsdes Of Kuzma laterferem, Kegti ** nts For Stabiliratlon When Feaotivation Of Human Lencooyte And Fibroblast Interferon, J. Gen, VIrol., 26, 327-331 (1975) , although 1009 regeneration was not ethically obtained. For this test, bacterial further 150 ml of culture were resuspended in buffer aa cleavage B and an equal volume of 29 SDS, 29 beta-mercaptoethanol and 10 H carbamide were added, bold ca 2 min and fractions were made. S-100.

i) control: K5219-G-pPLa-HFIF-57-12deltal9 (28 ° C) ii) 3 log control. _n HuIFN-beta unit shattered. in S rupture buffer iii) K5215-OpPLc-aFIF-67 * 8 (42 ^V C, 180 min daly density "

S Z 10 * / ml).

The teats were returned to the T ^ -dcli of the goat. The ze-adarca value indicates the detection site, zfcof of internal toxicity.

Before cooking After cooking

i) <1.5 <1.5 ii) 2.2 (<1.5) 2.0 (<0.5) iii) 3.0 (<2.0) 2.2 (<1.5)

The control experiment showed a regression of about 105 IFS-beta activity. · No detectable value of n Z ^ SM in parallel lysatin controls. These data indicate that although only about 109 IFN-beta regemeriaane was added to the coatrol experiment, this IFH-beta antiviral activity was present in the extract from the temperature K5219-G-pP2> o-HFIF-67 * 8 check even after this ofitrog treatment. In fact, a fairy antiviral activity was found after this treatment in comparison with the set procedure by breaking the B, * this augments the possible bonding of XF »* beta to give strong components» in the last «procedure.

<2) m> »»

HuIFN-beta antiviral activity is also being sought for dialysis. Sz example, the pools versus PBS for 16 h at neutral pB and at 4 ° c antiviral activity (log ^ u / ml) of bacterial extracts were delineated, albeit with reduced titremc.

i) Il5213-prtc-HFXF-67-3 (42 * 0 ii) KS 219-pILa-nPIF-67-12delte19 <42 * 0 iii) IFN-beta in M3219-f £ La-8 «2 * 0

Before «UlaUze After.« GJallse

i) 2.3 2.3 1) 3 2.3 i) 1.5 1.3 U) 2.3 1.3 U) 2.3 2 li) 2.3 1

The observed decrease in the activity after dialysis may be due to the non-specific adhesion of the ITN-beta ee membrane and they were eaten, etc.

(3) Telecommunication ee (NB *) 3804

The anti-viral activity (log _1Q «/!) Of bacterial extracts has, from this finding, begun to melt with 674 saturated" ammonium "sulfate (2 const (NHpjSO * solution up to 1 const. Extract), which is the concentration for dew After 30 min on ice, the granules were eentrifuged at 12,000 xg for 10 min and redissolved in BBS for testing. "

i) ii) iii) KS219 ~ pPLc-HFTP-67-8 X5219-p? La-HFIF-67-l2deltal9 IFM-bcta a MS219 — pPLa — 6 (42 * C) (42 * 0 (42 * C) before deposition after the balo i) 2 2 i) 2 2.3 li) 2 2 iii) 1.3 1.3 lil) 1.5 1.3

<"> A" P "?

The antiviral activity (log ₁₀ µg / ml) of bacterial extracts from this finding was also stable to acid. The extracts were 111 times for 15 hrs against 50 ml of glycine-NCl (pB 2.2), after which the slurry was returned to MHS for 3 h and was subsequently sacrificed with BCl and then neutralized with VaOR. After separation of the precipitate, a test was performed:

i) M5219-pPTx = -HFIF-67-8 ii) M5219-pPlA-HFIT-57-12filt 12 iii) IFN-beta in M52i9-p? la-S (42 ° C) (42 * 0 (42 ° C) poale -Ussllae before acid i) 2 1.3 i) 0.7 0.7 ii) 2 1 iii) 3 2

d. 2,5-A Slntetase activity

The supernatant after osmotic Juice M52l9-G-pPLc-HFIF-67-8 (described above) was tested for aa prlsostvb 2,5-A synthetase as described above, and for a noncritical plaque, except for Sto ei &lt; / RTI &gt; Obtained with «the following results a

1) M5219-G-pPLo-HFIF-67-8 (28 ° C) (see above) ii) M5219-G-pPLc-KFII'-67-8 (42 ° C) (see above)

Values reflecting the activity of 2,5-A synthetase exhibit ³² Pr-dioctivity incorporated into the 2,5-k triac form

1) untreated cells

2) bacterial extract (s): 1/6 dilution

3) bacterial extract (11) x 1/6 dilution

4) bacterial extract (1) t IFK-beta to 1 * 5 log ₁₀ units / ml

5) see 3 but incubated with ant1-IFN-beta antiserunone

6) see 4 but incubated «a aa ti-IFN-be ta-an tiaezuao®

7) control IFH-beta 0.5 log ^ units / ml

8) control IFN-beta leg ^ units / nl

9) control IFK-beta

1.5 1 «9 | £ Unit / nl

10) Control IFH-beta log ^ unit / ml

(confused countdown) (after rejection of endogenous base) 3342 cpm 0 βρΛ 1972 -4370 6960 363 8 7037 3693 3950 608 2960 -382 4463 1120 7680 4338 13615 10273 25040 21G98

! * 79..Experts tested activity 2 _r 5-K sla these theses deaastriate that οηρ · »» natant after osmetic Aok temperature-induced M5219-O-pPLe * HPIP-67-8j which has antiviral activity (see above) also induces activity 2,5-A synthetase while uninfected bacterial iso j to ae Sini · This is parallel to the corneas of anti-viral activity testing.

The degree of stimulation of 2,5-A synthetase is equal to the activity of IF8 * b «t <added to the control lysate (compare examples (3) and (4)) · Using the wrong concentration of the class from samples (7) to (10) shows that I take note of the distractions, please overestimate the activity of 1 ° 9jq

1.7 units / el n of both samples (3) and (4), which is compatible with the values of n directly to the “anti-viral” test, i.e., 1.5 log-- units for both samples. This series of eccentric names also indicates that the induction of 2,5-K synthetases is required to neutralize ea anti-IFR-beta antioera »non, as in the case of the antiviral test.

e. AatlTtr-J »» »ahttvnoafr j» fau.i »^ ll-jnfcin H, nt1ww

BkatcakU (1) and (11) <ηϊ31 »-0-ρΡΐΛ-Ηηρ-« Τ-β, f »'! "" Tested aa antiviral "activity on various cell lines of all of Mayan or rodent origin. They did not show any such foreign interference with the active activity on these cells, and neither the IFM-beta antenna touch was made with human dalium. There was also no activity on the lung cell line that was sensitive to human leukoeitic interferon. these results provide further evidence that the ira-beta produced by the bacterial strain attaches substantially identical features to the human fibroblast cells exfoliated TFS-beta.

£. Feel the sensitivity to proteases

The susceptibility of ISTT-beta from the bacterial hosts of the invention was tested by treating "diluted bacterial ecotracks with judo" amounts of trypsin axis for 1 hour at 37 * c. The so-called viral active IFN-beta abolishes tryps and oo *. at sllCnlm concentrations with those which the acutea activates anteatically «IFB-beLa affe« «and iaactive control»!

llsat.

X5219-pPLe- & Xr »€ 7-12cheitor9 MS 2 lO-pPLe-gFIt-67-3 UV-beta« MS21> -pPLa-t M52l> -pPL®-ira-67 «MS210-pFI» (42 * C) (1000 tt / bl) <42 * C) '(42 * 0 (42 * C> C 30 tt / al) (42 * 0 endpoint JteML—

0.03

0.03

0.03

0.03

0.03

3. tUUilkaol laaktivaegirM ^ eta leak it out and have the bacterial Cells m «t to it« begin unobtrusive theatry «of the actives * prolsvoch. Xbeg of this "IVP-beta activity which is Chstskt's augmented" bacterial "extracts" * "as described above, was believed to be a more efficient processing of the expectant cacheus protein (e.g.," HalFM-beta coacasease "with beta-lactaaase, K32 lli bekterleke eigaelae sekvenee) sparkling bacterium or furnace non-testable a active prolsvok.

M is Isvesao cha 11 is an asset of pro-leakage, and such is the "extraction" of the BaZnHbeta rally (met HalO-beta is the aeravae pro-lever of S-pPXa-HFIP- <712 celtaMl 1 G-pPLa-fiFZP «<< 7-12celtal8 ΒΧ-2). mcjoti »« frakeloaaela bacterial extracts slsktrefereso »aa pollakrtlaalčaea« ala pocha aalovlaa чеastarlsaaja has discovered the planting of the activum prolsvo.

> rvi's eye just shed his hair lengthened his eyelids 15000-10000 chaltoae and aogao to see the happy "Baznhfeeta · Bra" l sash, who is a hair bigger aolekelak "teilaa," his father to be keodusaele and shed ill aakoapletao to let out a short hair aaShe will be a pcooavoc who is a metaphor and met a snHbeta begin «sleviaa use of a bower posaatlk finder« onofaclce a canine jiv which protein proves «if ib laa« a pere met «EFM-beta« It manifests the activity of BaZnhfeet.

Improvement · of yield of 1 activity of polypeptide that enhances «activity

BCWt «te« t <> lt nw »tmtal m» «wwiWMl« ti ........... ..,. /

The gray product of the j protein is comaaded aa three main factors of the number of k-pop of its genes within the deli, the efflux on which the gm spear is transcribed 1 the efflux with which the ene is translated.

The efficiency of transcription 1 translation (which is expressed by Sine expression) is again dependent on the nucleotide sequences that are normally positioned by an annealed Salt coding sequence. These nucleotide sequences or expression control sequences define, inter alia, the site aa to which the SBk polyasrase interacts such that lalelra transcription (premotor sequence) 1 aa kaye binds rlbosoml and interacts with mksk (transcription product) so that it laller.

e functionals such sequences for the expression control of uniform efficacy. Thus, caries are that the only specific sequences are encoded. The tempered protein ed by their adjacent nucleotide seconds and is often condensed from other known sequences, control of expression is more often than not perfected by the villi of depression.

The plaza is also known to tailor a droplet or bacteriophage derivative for the purpose of breeding copies of genes within the gene, thereby further enhancing the yield of the Celiac protein.

You may use several expression control sequences as described above. These include operator, prumctcr, sn sequencing tic * * 1 lntnrakelaee sequences (including sequences such as Ste eu thine-Balgarae sequences) of E. coli lactose eperon (lac system), corresponding sequences of epthetase trlptophan eintetase (trpocode), major eperetoxet eperonet (trp system), ragione fega lamda as we describe worse 1 β ^ Τ _χ ) t control region Pilerantous DU phage ca iodacn threads «lli dear eekveaoe that coatEoUSa expression of prokaryotic genes or eukaryotic cells 1 of their viruses. Because of that

- 82 ** for pefceljIt is the production of a particular Hepptld "appropriate" host "mole - make a pan that encodes that polypeptide as real Is and to separate the recombinant DMA molecule for its first * bit sequence and to control the expression of IH under the control of one or the villa burner" aekvenei from controls «expression. Such procedures are «recorded in science.

Other steps to improve translation efficiency include targeting chemically IH enzyme-made oligonucleotides in front of an iniolating codome. This procedure is intended to obtain the optimal lightning bolts, primary and secondary, msaindSer ISA. More speculatively, some are also constructed so that the AOG code appears easily (eg, masked by secondary structures) IH aa the tip of their IH about precious single-strand tails. Also deer position 1 sequence of the earlier 8biao * * Balpas power segment aa similar way to optiais. otherwise the general structures of «loom) ansladfiar BMA j« bio documents «» (D. Zenreataat sad 9 Ptmrs • chooondazp Struoturm Of sBSA And Effieieao? Of Translatlen Inltiation ·, Eighth, 9, 1 * 12 (1980).

Further increase in the yield of bleached bleach products than the increase in brena pmn that can be used in CsHJl. This power is achieved by throwing Huipp-beta foam (with IH bass transcription and translaeia controls) into the plasmid Even with most copies of IH into the plasmid with a temperature coatroliaanin copy number (i.e., a plasmid that mutates to oo the copy number of plasmids increase in the job of changing the temperature, B «Oblin ot al«, Flasmlds Kitk Teaperature-depnmdu »t Cepy Steber Por Ampilfleat-en Qt domsd gamse And Tbeir Subjects ·,

6, 91-106 (1979)) · Alternatively, the increase is done with no fists *

M example, «by throwing rsfcomblnaBtaih OSA a small mlm hemsnru **» »*» in the manner described earlier in the bafsriefage of laafed, the most prolet js dlperovanjsm olamoite with restzikaioiLim that aa dsbiva a linear molecule which with the abbot of oil aa carrier with cloning. pr · * the type I described a lE Murray at al ·, lafedald Pbagaa That Blnpllfp The Baaovaz? of For Vitro Reoonblaaats *, Mol · Caa, Canet. ISO, 53-61 (1977) and ».S. Marray at al · , Meleeular Clealng Of DNAο DNA Quenches Osne From Basterlepbage T4 ·, J · Hol.Blol «, 132, 493-505 (1979) so aa recombinant OSA molecule incubates with OSA ligase. provided by Host E, aali »

Particularly "suitable carriers from the cloning of the lanbda contain" temperature oetljlva parent in the repre- sented gene oZ and impressive mothers in this, though this one is untouched by breaking the calf of the host, says gaa B, who is the chief of the psychedelic capsid virus system, lisogoae calvate the caltivift aa relatively low temperature (eg, 28-32¾) and then heat it and lift the apparatus (n «px 48-45 ° C) so that the leakage of the stretch occurs. FrodaSea growth and a high temperature make the high alvoys flush with proteins, which are contained within the calf, since this joft is not a slight sweep of the Ghanaian spillovers, and the poftto iasert gene is not encapsulated and remains trapped by further traaskripe. then breaking up the calf then frees Salt production and brings high. Bolto dream and this report also used me lanbda raprasar system with expression control, mofts be nsepbadaa and ss contralifte cutting of the prophagus, so 1 brea copy of gams help bstorainmssMkog komtrolnogo ragieaa, n.pr ·, derived from the lambdaidnag of 21.

You should clearly and with the polypeptide moieties ignite the ZFB-bat activity (made according to the present invention) to make a form of a condensing protein (n «pr · epeed with a procarlot M-tarschannel segment intends to leach out) or a form of a prointerteraa (e.g. ..

departed from the interferon signal sequence which oa aoooo handled the sentinel) 1X1 as the happy Interferon (the latter being eaten as a mature fibroblast interferon lays aa non-null, aadoclonal that a «uses with nlnlolrul translation). The yield of these various forms of the mole polypeptide with improved mako yam from the combinations of methods discussed in detail. Various codonl with lato or all codons are also used which are used in self-contained DNA sequences. These substituted codonl can be encoded with a gene identical to those encoded by the substituted codoalma but result in a polypeptide yield. Alternatively «a shaman of one 111 combination of codons leading to a shaman of amlnoklsellne ill to a HulTR-betaase-like polypeptide of duieg 111 stealing nlsa mol · promsnltl its properties in a useful way (e.g., increase in stability, cause solubility, increase 2 activity, increase in activity, increase 5-A Sweet Activity 111 Increases Interval Speelfienostl for Fallen}

Finally, the activity of the polypeptides of the tekerablantine DNA molecule produced by the present invention is supposed to be enhanced by fragmented, nodifiable 111 SNA sequences of the polypeptides of the present invention, in well-known ways, departing from the scope of the invention "

The solecd of the hybrid phage Derived from the fragments of human ae DMA that had yet been generated parojalnlm breaks "with fireflies and Alul" 1 fused with gcoRIvetlvne elements and for the Lambda Charoa arms was made by R. M. Lava ot al .. Celi, 15, pp. 1157-74 (1975). This gene bank was tested using the * ln situ * procedure (W «D. Butu and RW Beda, gcienoe, 196, pp. 189-82 (1977); T. Mulati * et al ·, Celi, 15, pp. <17701 (1978)); kerlld as probes ^^ P-marfcated ZTN-beta eDBA «pole ~ 85 iseSsgg of tao-BgHI restriction la pHPIP-21. · added maple fega pecltlvan to hybridiselB oo tselae 1« 000,908 ploSlea by repeated purification of plate at (al. Maniet , fara) · This tile is labeled laabda £ H4A-gH2TP-l. The beetriccic aaallaa of this plot devolved I «on aadrla about 16.3 Xb human DHA.

BooBI digestion laAdaCl4A-g8FIF ** l ge & erised, in addition to two Cbaren <A phage arms, axis »inserta fragments - 4.6, 3.5, 2.4, 1.9, 1.3, 1.2, 0,1 l 0.6 Kb per dat tal · Jobs Southern bletting. aamo 1.9 Kb fragment was hybridized to TwBglIX fragment pBFIP-21.

The 1.9 Xb fragment is still directly promoted to the BCOWI site of pBR322 (a pBH322 derivative that also carries a chloramfeaicol resistance that adheres to one BcoRI site). After Ligella 0.6 ^ ug BooM-digested lambdaCB4A-gHFIP-l DHA at 100 ng pHK32 $ 1 tmaeformnelje n B, healed BB101, and several clones were selected. Sano those clones containing a 1.9 Kb fragment hlbrldlz a ZPHHbotn oDHA eendu. This clone is still strong p (32S) ~ gHFXPM.

Determination of the reetricdone fragment of ISbeds with pBPIP-21 and p (325) -gHFZF-4 demonstrated that the interfering sequences of a clone were burdened, and that the information contained in the DBA of that clone was identical with that of pBPXF ~ 21.

Identification 1 Isolation of the hrcoosomao CHA encoding with BuIFH-beta enables the transpositor of the respective hosts with the tone of DHA and the expression of HuIFB-beta and with it. Such expression is still honorable because there are racial signals that feed the practices of the DHA sequences to be present and to the clans. These signals will be accessible to activate the princess fairies after expressing and reborn moids by postexpressing a polypeptide that encodes it by regis- ting from the DHA chromosome encoding.

• Plasaid pHVZP-21 is further tested poetically by me from this compilation.Tasl-BglZI fragment of this plassdd contains almost tfcupent Botram * tooling FtagtaS and «SP» rogien encodings with nt nat * 8 €

Microorganisms and rekeabiaamtnl DMA molecules w ^ rwl by a process described here still represent the cultures "that were disseminated in the Deutsche Saamlung ven Microorganism Collection in Gatingen, Western Germany, April 2, 1980, and identified with HHF-A de C"

At Σ, COll »101 (G-pBR322 {Five) / HITP3)

At E, coli »181 (O-pBR322 (Five) / HnF6)

C «°° ^{U 33101} (β-pB A322 (> S t) / HFIT7)

These cultures were given accession numbers BSM 1791-1793. They are also illustrations of cultures that are depopulated by the Deutsche culture wheel

1988, 1 identified as HFIF-D that β

Dt * «ββ **« 5219 (<hpPAa * aPXP- <7 * 12)

B »B» OOli Xl2deltaSX (8 «φΚ4ΗΤΣΜ7-12)

Tt S & JSM ¹¹⁵²¹⁹ <G ^ ¹ * -fflW- «7- ¹ 2deltal9)

C. B, OOll Χ5219 (ΟρΡΙο-ΗΚΡ-67-8)

This au culture received accession numbers DSN 1851-1854 · X culture that was deposited in America T ^ pe Culture Collection, Bokville, Merllead February 28, 1981, identified as chaot

B> B, 0011X5219 <pK * -HriF- € 7-12delfcaXI)

x. g> ooli »181 (p <325) -bayiF-4)

This trunk culture is accession numbers ATCC 3/824 1 3/825.

When the number of embodiments and inventions disclosed herein is taken into account, the small basic structure will further erode the strands of the invention so as to provide other embodiments using the methods and preparations of the invention. For that matter, it will be clear that the scope of the present invention is defined by the attached requirements and aa spoelflSalm raulizaui pits which I will give here by way of example.

Claims (15)

PATENT REQUIREMENTS 1. A method for producing a recombinant DNA molecule capable of inducing in a single-cell host the expression of a polypeptide exhibiting the immunological or biological effect of human β-interferon, characterized in that a DNA sequence selected from the DNA insert G-pPLa-HFIF-67 is introduced into the cloning carrier -12 [HincII-Sau3AIj, G-pPLa-HFIF-67-12A19 [HincII-Sau3AIj and G-pPLc-HFIF-67-8 [HincII-Sau3AIj, carried in microorganisms having access numbers DSM 1851 to DSM 1854, from DNA sequences that hybridize to any of said DNA inserts and DNA sequences that have degenerated as a result of a genetic code but encode for a polypeptide with the same amino acid sequence as said DNA inserts and sequences; wherein the DNA sequence in said recombinant DNA molecule is operatively linked to the expression control sequence. The method of claim 1, characterized in that the DNA sequence that hybridizes with said DNA inserts is a DNA insert of G-pPLa-HFIF67-12ΔΜ1 [BamHI-Sau3AIj, carried in a microorganism with ATCC accession number 31824. The method of claim 1, characterized in that the DNA sequence that hybridizes to said DNA inserts is a DNA insert of p [325l-gHFIF-4 [EcoRl carried in a microorganism with ATCC accession number 31825. A method according to any one of claims 1 to 3, characterized in that the DNA sequence is selected from the sequences of the formulas: atgaccaacaagtgtctcctccaaattgctctcctgttgtgcttctccactacag CTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCA GTGTGAGAAGČTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGCAC AGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAGG AGGAOGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAG ACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTGGCT AATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAAAACTGGAGA AAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAAAAGATATTA tgggaggattctgcattacctgaaggccaaggagtacagtcactgtgcctggacc ATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGACTTACAGGTT ACCTCЧGAAAC - Request / 2 i ATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAG caattttcagtgtcagaagctcctgtggcaattgaatgggaggcttgaatactgc ctcaagcacaggatgaactttgacatccctgaggagattaagcagctgcagcagt tccagaaggaggacgccgcattgaccatctatgagatgctccagaacatctttgc tattttcagacaagattcatctagcactggctggaatgagactattgttgagaac ctcctggctaatgtctatcatcagataaaccatctgaagacagtcctggaagaaa aactggagaaagaagatttcaccaggggaaaactcatgagcagtctgcacctgaa aagatattatgggaggattctgcattacctgaaggccaaggagtacagtcactgt gcctggaccatagtcagagtggaaatcctaaggaacttttacttcattaacagac ttacaggttacctccgaaac. 5. The method of any one of claims 1 to 4, characterized by tiae, which is said expression control sequence selected from lac system, system 8-lac, the trp system, the major operator and promoter region of phage λ, the control region of the fd envelope protein and other sequences that control the expression of genes of prokaryotic and eukaryotic cells and their viruses, wherein the expression control sequence is introduced into a cloning carrier to controlled and regulated expression of the DNA sequence. 6. The method of claim 5, wherein the recombinant chiral DNA molecule produced is G-pPLa-HFIF-67-12, G-pPLa-HFIF-67-12A19 and G-pPLaHFIF-67-8, wherein recombinant DNA molecules carried in microorganisms with accession numbers DSM 1851 to DSM 1854. The method of claim 5, wherein the recombinant DNA molecule produced is G-pPLa-HFIF-67-12AMl, carried in a microorganism with ATCC accession number 31824. A method for transforming a single-celled host by introducing into it a recombinant DNA molecule produced by the method of any one of claims 1 to 7. A method for producing a polypeptide that exhibits the immunological or biological action of human β-interferon, characterized in that it is grown by a transformed host produced by the method of claim 8. - REQUIREMENTS / 3 10. The method of claim 9, wherein the transformed host is selected from E. coli HB101 or E. coli Κ12ΔΗΙ (G-pPLa-HFIF-67-12) [DSM 1851, DSM 1852], E. coli M5219 (G -pPLa-HFIF-67-1219) [DSM 1853] and E. coli M5219 (G-pPLa-HFIF-67-8) [DSM 1854]. 11. The method of claim 9, wherein the transformed host is E. coli M5219 (G-pPLa-HFIF-67-12AMl) [ATCC 31824]. A method according to any one of claims 9 to 11, wherein the polypeptide is selected from the polypeptide of the formula: Met-Thr-Aen-LyB-Cys-Leu-Leu-Gln-Ile-Ala-LeU'Iieu-LeuCys-Phe-Ser-Thr-Thr-Ala-Leu-Ser-Met-Ser-Tyr-Asn-LeuLeu- Gly-Phe-Leu-Gln-Arg-Ser-ser-ABn'-Phe “Gln” Cya-GlnLys-Leu-Leu-Trp-Gln-Leu-Asn-Gly-Arg-Leu-GlU Tyr-CysLeu-Lye '-Aep-Arg-Met-Asn-Phe-Asp-lle-Pro-GlU' Glu-IleLys-Gln-teu * -Gln-Gln-Phe-Gln-Lys-Glu-Asp-Ala ~ Ala-LeuThr-Ile -Tyr "Glu-Mat-Leu-Gln-ABn-Ile-Phe-Ala-Ile-PheArg-Gln-Asp-Ser-Ser-Ser-Thr-Gly" Trp-Asn-Glu-Thr-Ile ~ Val-Glu-Aen-Leu-Leu-Ala-Asn-Val-I ^ r-His-Gln-Ile-AsnHis-Leu-Lys-Thr-Val-LeU “Glu-Glu-Lys-Leu-Glu-Lys- GlU " Asp-Phe-Thr-Arg-Gly-Lys-Leu-Met-Ser-Ser-Leu-His-Leu ~ Lys-Arg-Tyr-Tyr-Gly-Arg-ile-Leu-His-Tyr-Leu-Ly9-AlaLys-Glu-Tyr-Ser-His-Cys * -Ala Trp-Thr-Ile-Val-Arg-ValGlu -Ile-Leu-Arg-Asn-Phe-Tyr-Phe * -Ile-Asn-Arg-LeU “ThrGly-Tyr-Leu-Arg-Asn and Met-Ser-Tyr-Aan * -Leu-Leu-GlyPhe-Leu -Gln-Arg “Ser-Ser-Asn-Phe-Gln-Cys-Gln-Lys-LeuLeu-Trp-Gln-Leu-Asn-Gly-Arg-Leu ~ Glu-Tyr-Cys-lieu-LysAsp-Arg-Met -Asn “Phe ~ AsO-lle-Pro-Gli: -Glu-Ils-Lys-GlnLeU“ Gln-Gln-Phe-Gln * -Lys-Glu-Asp-Ala-Ala-Leu-Tnr-IleTyr-Glu-Met -Leu-Gln-Asn-Ile-Phe-Ala-Ile-Phe-Arg-GlnAsp-Ser-Ser-Ser-Thr-Gly-Trp-Asn-Glu-Thr-Ile-Val-GluAsn-Leu-Lleu-Ala -Asn-Val-Tyr "His-Gln-Ile-Aen-His-LeuLys-Thr-Vhl'-Leu-Glu-Glu-LyS" Leu-Glu-Lys-Glu-Asp-PheThr-Arg-GXy-Lys- Leu-Met-Ser-Ser-Leu-His-Leu-Lye-ArgTyr-Tyr-Gly-Arg-Ile-Leu-His-Tyr-Leu-Lys-'Ala Lys-GluTyr-Ser-His-Cys-Ala -Trp-Thr-Ile-Val-Arg-Val-Glu-IleLeu-Arg-Aen-: Phe-Tyr-Phe-lle-Asn-Arg-Leu-'Thr “Gly-TyrLeu-Arg-Aen. - REQUIREMENTS / 4 13. A process for producing a polypeptide that exhibits the immunological or biological action of human β-interferon, characterized in that it is grown by a single-cell host transformed with a DNA sequence selected from the sequences of the formulas: ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTACAG CTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCA gtgtcagaagctcctgtggcaattgaatgggaggcttgaatactgcctcaagcac AGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAGG AGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAG ACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTGGCT aatgtctatcatcagataaaccatctgaagacagtcctggaagaaaaactggaga AAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAAAAGATATTA TGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGTGCCTGGACC ATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGACTTACAGGTT ACCTCCGAAAC and ATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAG CAATTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGC CTCAAGCACAGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGT TCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGC TATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAAC CTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAA AACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAA aagatattatgggaggattctgcattacctgaaggcoaaggagtacagtcactgt gcctggaccatagtcagagtggaaatcctaac-gaacttttacttcattaacagac ttacaggttacctccgaaac, in what is a DNA sequence operably linked to sekvencu for kontrolu expression in navedenom jednočelijskom local man. 14. The method of claim 13, wherein said polypeptide exhibiting the immune or biological action of human β-interferon is selected from the polypeptide of the formula: Mat-Thr-Asn-Lye'Cys-Leu-Leu-Gln-Ile-Ala * -Leii-Leu-LeuCys-Phe-Ser-Thr-Thr-Ala-Leu-Ser-Met-Ser-Tyr-Asn-LeuLeu -Glv-CPhe-Leu-Gln-Arg-Ser-Ser-Asn-Phe-Gln-Cva-GlnLys-Leu "keu-Trp-Gln-LeU" Asn-Gl.y-Arg-Leu "Glu-Tyr" CysLeu -Lys-Asp-Arg * -Met-Asn-Phe-Asp-Ile-Pro-Glu-Glu-IleLyB-Gln-Leu-Gln-Gln-Phe-Gln-Lys-Glu-Aap-Ala'-Ala-Leu 'Thr-Ile-! Tyr-Glu-Met-Leu-Gln-Asn-Ile-Phe-Ala-lle-Phe-REQUIREMENTS / 5 Arg-Gln-Asp-Ser-Ser-Ser-Thr-Gly-Trp-Asn Glu-Thr-IleVal-Glu-Asn-Leu-Leu-Ala-Asn-Val-l ^ r-Hia-Gln-lle-AsnHis-Leu-t / ye-Thr-Val-Leu-Glu-GlU “Lys -Leu-Glu-Lys “GluAsp-Phe-Thr-Arg ~ Gly-Lys-Leu-Met-Ser-Ser-Leu-His-LeuLys-Arg-Tyr-Tyr-Gly-Arg-Ile-Leu-His-Tyr -L & u-Lys-AlaLy6-Glu-Tyr-Ser-His-Cys-Ala-Trp-Thr-Ile-Val-Arcj-Val “Glu-Ile-Leu-Arg-Asn-Phe-Tyr-Phe-'Ile- Asn-Arg-Leu-ThrGly-Tyr-teu-Arg-Asn and Met-Ser-Tyr-Asn-Leu-Leu-GlyPhe-Leu-Gln-Arg-Ser-Ser-Asn ~ Phe-Gln-Cys-Gln- Lys-LeuLeu-Trp-Gln-Leu “Asn-Gly-Arg-Leu-Glu-Tyr-Cys-Leu-LyeAsp-Arg-Met-Asn-Phe-Asp-Ile-Pro-Glu-Glu-Ile-Lys- GlnLeu-Gln-Gln-Phe-Gln-Lys-Glu-Asp-Ala-Ala -Leu - Thr-IleTyr-Glu-Met-Leu-Gln "Asn" Xle-Phe-Ala-Ile-Phe-Arg-GlhAsp-Ser-Ser-Ser-Thr-Gly-Trp-Asn-Glu-Thr- Ile-Val "GluAsn-Leu-Iieu ~ Ala-Asn-Val-Tyr-His-Gln" lle-Asn "His-LeuLys-Thr" Val-Leu-Glu-Glu-Lys-Leu-Glu-Lye-Glu- Asp-Phe Thr-Arg-Gly-Lys-Leu-Met-Ser-Ser-Leu-His-Leu-Lye-ArgTyr-Tyr-Gly-Arg-Ile-LeU His-Tyr-Leu-Lys-Ala-Lys-GluTyr- Ser-His-Cys-Ala-Trp-Thr-Ile-Val-Arg "Val-Glu-IleLeu-Arg-A'sn-Phe-Tyr" Phe-Ile-Aen-Arg-LeU "Thr-Gly-TyrLeu- Arg-Asn. A process for the manufacture of a human virus preparation preparation iii for the treatment of human cancer or tumor III, or for immunomodulation, designated thiae, which is used as the sole IFN-β by a polypeptide produced by the method of any one of claims 9 to 14.