SI23734A - Procedure for extracting DNA of microorganisms from foodstuffs - Google Patents

Abstract

A process is described that allows for the effective extraction of DNA from microorganisms without the need for pre-cultivation of microorganisms on pre-afforestation rich and selective media. It allows the extraction of DNA from samples with a complex matrix present in different types of foods. The process has a high yield, therefore it is also suitable for the extraction of DNA microorganisms from samples with low level of contamination Based on the decomposition of the sample using a combination of detagents of denaturant proteases and axial shaking with balls of diameter less than micrometers whereby secured DNA separates from other components by purification over silicate columns in the presence of a strong denaturant or by hybridization of targeting DNA directly from the degraded sample of functionalized Magnetic particles with immobilized specific probes The procedure is quick and allows the immediate use of extracted DNA in further molecular detection methods such as PCRin Real Time PCR

Description

Process for extracting DNA from microorganisms from food

The object of the invention is a method for isolating the DNA of microorganisms that occur in food and which can cause infections or diseases in humans. The invention encompasses reagent mixtures and a protocol that allows bacterial DNA to be extracted from the required matrices in sufficient quantities for further molecular detection (e.g., by PCR and Real-time PCR), without first enriching the microorganisms and growing on selective media.

Validated methods to verify the presence of pathogenic microorganisms in foods so far include standard microbiological techniques based on the isolation of living microbes from foods in the analysis. Typically, a food sample is homogenized and affixed to a pre-enrichment medium, followed by adherence to enrichment and then selective media, where the growth of the pathogenic microorganism sought by CFU (colony forming units) is checked. These methods are outdated and time-consuming, with a generation time of 24 h to 7 days or more, in slow-growing microorganisms. They are therefore unsuitable for rapid diagnosis, which is essential for the control of the microbiological integrity of foodstuffs, the timely withdrawal of contaminated foodstuffs from sale and the prevention of the spread of contaminated foodstuffs. Moreover, these techniques do not allow the identification of microorganisms that are capable of becoming dormant, metabolically inactive, and therefore cannot be grown. However, under favorable conditions they are able to reactivate and cause infection in humans.

Molecular methods involving DNA extraction from a food sample and detection by PCR or Real-time PCR with initial oligonucleotides that specifically amplify a selected section on the genome of the pathogen sought are rapid diagnostic solutions. The biggest problem with existing molecular methods is the inefficient extraction of DNA from pathogens from foods. Food matrices are often complex and specific to the type of food, which makes it difficult to formulate a universal DNA extraction protocol. In addition, there are components in the matrix that make it impossible to efficiently extract the DNA of pathogenic microorganisms, especially when the level of contamination is low but nonetheless dangerous for humans. The matrix components can additionally inhibit subsequent detection by enzymatic reactions such as PCR and Real-time PCR, resulting in erroneously negative results. In the case of low levels of contamination, the amount of sample taken for analysis is extremely important. For molecular methods, the quantities range from 0.1 g to 5 g, while classical microbiological techniques analyze 25 g of the sample by standard, increasing the possibility of detecting the presence of the pathogen against molecular methods.

The process of the invention greatly enhances the efficiency of extraction of DNA from pathogens from foods compared to existing protocols. The process is short, straightforward, does not involve hazardous chemicals, and provides a basis for the rapid identification of contaminated foods in combination with molecular detection methods such as PCR and Real-time PCR.

Description of the invention

The subject of the invention is a method for the efficient extraction of DNA of microorganisms from food. The process is adapted to extract DNA from complex matrices and allow the continued use of DNA in rapid molecular detection methods such as PCR and Real-time PCR.

The process involves mixtures of reagents and a protocol adapted to extract the minimum amounts of DNA of the microorganisms in the sample. Extraction enables high DNA utilization and is fast and easy to perform.

There are two possible options:

i) Direct DNA extraction ii) Molecular enrichment of targets

i) Direct DNA extraction

1. Weigh a homogenized sample into a 1.5 ml threaded microcentrifuge (hereinafter mc). A decomposition buffer is added to the mc thread (the amount depends on the moisture content of the sample; the drier samples need more buffer) containing 0.01 to 1% Triton Χ-100 detergent, 0.5 M to 6 M guanidinium hydrochloride (Gu-HCI) or guanidinium isothiocyanate (GITC) in the same concentration range, 10 to 500 pg / ml proteinase K enzyme, 5 mM EDTA (ethylenediamine tetraacetic acid), 50 mM Tris (tris (hydroxymethyl) aminomethane), pH 7, 5. Sterile glass beads less than 150 pm in diameter are added to the mc. The detergent protects against excessive cell fragmentation and simultaneously destroys the stability of cell membranes. Triton serves to destabilize bacterial membranes, guanidinium hydrochloride / isothiocyanate denatures proteins and hydrates released DNA. EDTA complexes divalent ions, thereby inhibiting the action of DNases, proteinase K degrades proteins to oligopeptides and amino acids, facilitating DNA purification in later steps. Tris serve as a buffer system, while glass beads serve to break down cell walls and membranes.

2. Mc is inserted into a shaker that allows shaking along the mc axis, with a frequency of 20 to 30 Hz, such as. Smarthelix Full Disruptor (IFB, d.o.o., SLO). Shaking is repeated 3 times in 30 min, with an intermediate incubation of the sample at 50 to 65 ° C, which allows optimal proteinase K. function. The number of shaking steps is adjusted to the resistance of the sample. To break down the challenging patterns, the number of shakes is increased and vice versa.

3. The digested sample is incubated for 5 to 10 min in boiling water to inactivate proteinase K.

4. The digested sample is then centrifuged to separate the digested cells and glass beads from the solution (supernatant) containing the released DNA.

5. The supernatant with the released DNA is transferred to new sterile 1.5 ml mc (thread not required) and added 3 times the volume of 4 to 7 M Gu-HCI or GITC, pH 6.5.

6. Transfer the solution to columns with a silicate membrane, e.g. Epoch Spin Columns (Epoch Biolabs, USA), where DNA in Gu-HCI or GITC solution binds to the silicate membrane. The silicate membranes are washed according to known protocols, e.g. the remaining solutions are first eliminated by centrifugation into the collecting mc. The centrifuged solution is discarded and the membrane is washed 3 times with a rinse solution containing 20 mM NaCl, 2 mM Tris and 80% ethanol. After each rinse, the columns are centrifuged and the collected solution in the collecting mc discarded each time.

7. The bound DNA is then extracted by washing (short centrifugation) with 10 mM Tris buffer, pH 8.5, into new sterile mc.

The extracted DNA process is suitable for use in further processes such as PCR and Real-time PCR.

) Extraction by molecular enrichment of targets

1. Follow the steps from item. 1 to 4 by design i).

2. Transfer the supernatant to the new 1.5 ml mc. Magnetic beads are added to molecularly enrich the target and separate the target DNA from the remaining components in the degradation buffer, which could inhibit further detection by PCR. The magnetic beads must be properly functionalized to be resistant to degradation buffer, while allowing specific microbe-specific probes to be immobilized for the micro-organism. An example is magnetic beads surface-functionalized with streptavidin (e.g. Dynabeads MyOne Streptavidin Cl, Invitrogen, USA) that bind biotin-labeled specific oligonucleotide probes. The probes are from 20 to 50 nucleotides in length and are complementary to a section on the genome specific for the selected microorganism. Multiple probes with specificities for different microorganisms can also be immobilized, allowing simultaneous extraction of DNA from different microorganisms. The probes or probes thus prepared can be used to capture the target DNA of the microorganism in the supernatant with appropriate hybridization conditions according to existing protocols. The collected target DNA magnet beads are collected with an external magnet and the remaining solution is discarded. The magnetic beads are washed according to the manufacturer's instructions and the bound target DNA is released from the magnetic beads with a denaturation at 95 ° C for a few minutes. The beads are collected again with an external magnet, and the remaining target DNA solution is transferred to new sterile mc and can be used in further procedures such as PCR and Real-time PCR.

An implementation example

i) Direct extraction of DNA from different foods

From the food samples previously confirmed for the presence of C. jejuni and S. aureus by classical microbiological techniques according to ISO standards, we compared the molecular and classical microbiological detection of both pathogens. The extraction process of the invention was compared with two competing processes: the QIAamp DNA Stool Mini Kit (Qiagen, USA) and the DNA IQ Casevork Sample Kit for Maxwell 16 (Promega, USA).

1. Weigh, within 1,5 ml of mc threaded thread, 0,5 g of each sample (poultrymeat, delicatessen foods, milk, seafood products). 400 μΙ degradation buffer (0.1% Triton Χ-100, 1.5 M Gu-HCI, 200 pg / ml Proteinase K, 10 mM EDTA, 50 mM Tris, pH 7.5) was added 375 mg glass beads, <106 pm in diameter ( Sigma-Aldrich, USA) vortexed briefly.

2. Mc was shaken in a Smarthelix shaker Full disruptor at 26 Hz, 2 min. Samples in mc were then incubated for 15 min at 56 ° C and then shaken again for 2 min. We then repeated the incubation for 15 min at 56'C and finally shook again for 2 min.

3. The samples were then placed in boiling water for 10 min.

4. Samples were centrifuged for 5 min at 10,000 times gravity acceleration (g).

5. The supernatant was transferred to a new 1.5 ml mc and a volume of 5.5 M Gu-HCl, pH 6.5 was added 3 times. The solution was briefly vortexed.

6. The solution was transferred to silica membrane columns (Epoch Biolabs, USA), and this was inserted into a collecting mc (Epoch Biolabs, USA) and incubated for 1 min at room temperature (ST).

7. The columns were centrifuged for 1 min at 16000 g and the filtrate was discarded.

8. 700 pl of the rinse solution were added and centrifuged again for 1 min at 16000 g and the filtrate was discarded. Wash was repeated with 500 µl of rinse solution and centrifuged for 5 min at 16,000 x g and the filtrate discarded. The columns were dried by centrifugation for 1 min at 16000 times g.

9. 100 µl of 10 mM Tris buffer, pH 8.5 was added to the columns and incubated for 10 min. The columns were transferred to fresh sterile mc and centrifuged for 1 min at 16,000 g.

10. We performed Real-time PCR (7500 Real-time PCR System, ABI, USA) with initial oligonucleotides CJ_hipO_F 5 'AATGCACAAATTTGCCTTATAAAAGC and CJ_hipO_R 5.' - * · ·· .......

TNCCATTAAAATTCTGACTTGCTAAATA for detection of C. jejuni and femA-SAF 5 'TGCCTTTACAGATAGCATGCCA and femA-SAR 5' AGTAAGTAAGCAAGCTGCAATGACC for S. aureus. 20 μΙ of the mixture contained a 1-fold concentration of Power Sybrgreen PCR Master Mix (ABI, USA), 300 nM pathogen-specific starting oligonucleotides, and 1 μΙ of DNA extracted according to the invented process. The genomic DNA of each pathogen was used as the standard. Samples were duplicated for three different dilutions of extracted DNA. Multiplication was performed according to the factory settings of the apparatus, the attachment and multiplication temperature was 60 ° C, the number of cycles was 50. We also performed an analysis of dissociation curves to check the specificity of multiplication.

Figure 1. shows the efficiency of DNA extraction from pure cultures of Escherichie sp. and Salmonelle sp. by the process of the invention. X denotes the process according to the invention, using 0.1% in XI in the decomposition mixture and 0.5% Triton Χ-100 in X5. For comparison, extraction was performed with the Smarthelix Complex Samples DNA Extraction Kit (IFB, d.o.o.) based on highly efficient phenol-chloroform extraction.

Comparison of detection of C. jejuni and S. aureus in different foods with standard microbiological methods and molecular methods is shown in Table 1. X method - DNA extraction process according to the invention, Qiagen method - ClIAamp DNA stool mini kit (Qiagen, USA), Maxwell method - DNA IQ Casevork Sample Kit for Maxwell 16 (Promega, USA). Molecular detection was performed with a 7500 Real-time PCR system (ABI, USA). The '+' indicates the samples where the presence and the absence of the micro-organism in the sample were detected. SV - raw sample, BG - enrichment medium.

Standard Methods (IVZ) Molecular Methods (IFB)

Biopax Oiagen Maxwell method method method method label. Presence Quantification according to Table 1.

of the sample parameter Type of sample [+/-] standard SV BV st BG st BG 94 Campylobacter spp. poultrymeat - not found in 25g + - - - - - 95 Campylobacter spp. poultrymeat - not found in 25g + + - - - + 96 Campylobacter spp. poultrymeat - not found in 25g + - - - + - 97 Campylobacter spp. poultrymeat - not found in 25g + - - - - - 98 Campylobacter spp. poultrymeat - not found in 25g + - - - - - 99 S. aureus delicacy food + 1,0x10E3 in 1g + + + - + + 100 S. aureus delicacy food - <1,0x10E2 in 1g + - - - - - 101 S. aureus delicacy food - <1,0x10E2 in 1g - - + - - - 102 S. aureus milk - raw cocktail of brookers - <1,0x10E2 in 1g + - - - + - 103 S. aureus crab + 1,6x10E3 in 1g + + + + - -

Table 2 shows a comparison of the extraction efficiency of C. jejuni and S. aureus DNA from different foods by the method of the invention (X), the QIAamp DNA stool mini kit method (O; Qiagen, USA), and the DNA IQ Casevork Sample Kit for Maxwell 16 method (M; Promega, USA). C, values representing no. of a cycle in which the PCR concentration of the amplified DNA reached a plateau. The value is inversely proportional to the concentration of DNA in the extract.

Table 2.

C _t values for different methods The pattern X Q M 92 21.15 27.96 23,12 93 19.07 27.39 23,12 99 33.91 42.77 38.23

Claims (1)

<4, Process for the extraction of nucleic acids of micro-organisms directly from homogenized food samples, without cultivation on pre-enrichment, enrichment and selective media, characterized in that i) a mixture of reagents containing Triton Χ-100 in concentrations of 0.01 to 1%, guanidinium hydrochloride or guanidinium isothiocyanate in concentrations of 0.5 to 6 M, proteinase K in concentrations of 10 is used to extract the DNA from the sample up to 500 pg / ml, EDTA at a concentration of 5 mM, Tris at a concentration of 50 mM, the final pH of the solution thus prepared being 7.5; the reagent mixture is added to the sample and shaken 3 times or more. if necessary according to the complexity of the sample, with beads <150 pm in diameter, along the axis of the microcentrifuge, in a shaker with a frequency of 20 to 30 Hz, with an intermediate alternate incubation of the mixture of the sample and the reagents at a temperature of 50 to 65 ° C for a total of 30 min, after the end of shaking is incubated for 5 to 10 min in boiling water, after which the decomposed material and beads are separated by centrifugation from the remaining solution containing the released DNA; ii) 3 times the volume of guanidinium hydrochloride or guanidinium isothiocyanate in concentrations of 4 to 7 M, pH 6.5, is added to the centrifuged mixture of reagents and the sample of claim i, and the DNA solution thus prepared is purified by silicate membrane columns according to known protocols, membrane elution was performed with a 10 mM Tris solution, pH 8.5; iii) the method of claim i is used to extract DNA from the sample, followed by the capture of the DNA of the target micro-organism or of several different micro-organisms directly from the released DNA solution, using micro-organisms specific oligonucleotide probes and functionalized magnetic particles according to known protocols.