SI20877A - Lipopeptides, their preparation and their use for inactivation of gram-negative bacteria, gram-positive bacteria and neutralization of endotoxins - Google Patents

Abstract

The invention refers to new lipopeptide compounds with the formula P-B, where P designates a peptide containing a high proportion (higher than 20%) of basic aminoacids Arg and/or Lys or nonpolar aminoacids Phe, Tyr, Trp, Ile, Leu or Val and where the group B designates a satuared or insaturated aliphatic chain containing 6 to18 carbon atoms. It refers also to the procedure of preparation of these compounds and their use for inactivation of Gram-negative and Gram-positive bacteria and neutralization of endotoxins. The invention is demonstrated by antimicrobial acting against Gram-negative and Gram-positive bacteria and endotoxin-neutralizing acting of compounds on the basis of recombinant cationic antimicrobial peptide LF12 (aminoacid sequence: Phe-Gln-Trp-Gln-Arg-Asn-Ile-Arg-Lys-Val-Arg-hSer), prepared by derivatization of peptide LF12 with unsaturated and saturated alkyl chains of different lengths.

Description

Lipopeptides, their preparation and their use for inactivation of Gram-negative bacteria, Gram-positive bacteria and for neutralization of endotoxins

FIELD OF THE INVENTION

The present invention is within the scope of the pharmaceutical industry and relates to novel antimicrobial and / or endotoxin neutralizing agents, i.e., lipopeptides of the formula PB, wherein P denotes a peptide with a high proportion (> 20%) of the basic amino acids Arg and / or Lys and nonpolar amino acids Phe , Tyr, Trp, lle, or Val, and group B indicates a saturated or unsaturated aliphatic chain containing 6 to 18 carbon atoms.

A technical problem

As the resistance of pathogenic microorganisms to conventional antibiotics increases, there is a growing need for new agents that have a broad spectrum of action against both Gram-positive and Gram-negative bacteria. An additional problem is that we do not know the effective treatment for septic shock that can occur due to infection of the blood by Gram-negative and / or Gram-positive bacteria and other microorganisms. Even in developed countries, a very high percentage of patients with sepsis (20-40%) die. Sepso is triggered by bacterial cell wall components, primarily lipopolysaccharides (LPS), also called endotoxins, which are present in the outer membrane of Gram-negative bacteria. Thus, the search for effective antimicrobial agents also matches the search for active ingredients that would simultaneously neutralize endotoxins and act antimicrobially.

Prior knowledge (state of the art)

LPS-binding agents released from bacterial cell walls into the bloodstream can counteract its toxic action. Vertebrates, invertebrates, plants and fungi have circulatory system proteins and peptides that can bind LPS and serve as the first line of defense against germs (antimicrobial peptides of microbial origin, eg polymyxin B, octapeptin; endogenous peptides or fragments of major proteins, e.g. Defensins, magainin, lactoferricin, peptides from BPI (bacteriacidal permeability increasing protein) ...). {Swanson, P.E., et al. (1980) Biochemistry 19, 33073314}, {Odeli, E.W., Sarra, R., Foxworthy, M., Chapple, D.S. & Evans, R.W. (1996) FEBS Lett. 382, 175-178}, {Marra, M. N., et al. (1990) J. Immunol. 144, 662-666}, {Su, G.L., et al. (1995) Crit.Rev.Immunol. 15, 201-214}, {Tobias, P.S., et al. (1997) J. Biol.Chem. 272, 18682-18685}.

Over the last 50 years, hundreds of peptide antibiotics have been discovered that can be divided into two groups. The first group includes non-ribosomal (gramicidins, polymyxins, bacitracins, glycopeptides, etc.), and the second group includes ribosomal peptide antibiotics. The former are mainly formed in bacteria, while the latter are also formed in eukaryotic organisms as an integral part of the system at the level of resistance of these organisms {Hancock, R.E. & Chapple, D.S. (1999) Antimicrob.Agents Chemother. 43, 1317-1323}.

It is an accepted view that the antimicrobial specificity of peptides for different microorganisms stems from differences in peptide interactions with membranes with different lipid composition {Epand, R.M. & Vogel, H.J. (1999) Biochim.Biophys.Acta 1462, 11-28}. By studying the morphology of Gram-negative and Gram-positive bacteria that have been affected by cationic antimicrobial peptides, electron microscopes have determined that cell death is caused by the breakdown of the cytoplasmic membrane {Sitaram, N. & Nagaraj, R. (1999) Biochim. Biophys.Acta 1462, 29-54}, in which anionic lipids are largely present, which is not the case for mammalian membranes. There is very likely no single universal mechanism of antimicrobial action that cationic peptides would have. Obviously, the interaction of peptides with membranes determines the antimicrobial specificity of each peptide.

Most LPS-binding antimicrobial peptides have an amphipathic structure with a high content of hydrophobic and positively charged amino acids. The cationic cyclic peptide antibiotic of microbial origin of polymyxin B is a very effective LPS neutralizing agent that is a negatively charged molecule under physiological conditions but is too toxic to be used as a drug because it causes membrane damage and hemolysis. Knowledge of the interactions between these peptides and proteins with LPS, and in particular the membranes of both bacterial and higher eukaryotic cells, is indispensable for the successful development of novel anti-sepsis agents without toxic side effects. The asymmetric distribution of base and nonpolar groups in polymyxin B is thought to be because it causes amphiphilicity, a necessary condition for the neutralization of LPS molecules {Thomas, C.J., et al. (1999) J. Biol.Chem. 274, 29624-29627}. Similar segregation of the cationic and hydrophobic groups is also found in cationic antimicrobial peptides and some serum proteins that bind to LPS {Frecer, V., et al. (2000) Eur.J.Biochem. 267, 837-852}.

As the frequency of Gram-positive sepsis increases, it is necessary to look for active ingredients that work against both Gram-negative and Gram-positive bacteria. The mortality of patients with Gram-negative sepsis is higher than that of Gram-positive sepsis. However, the importance of cell wall components of Gram-positive bacteria (eg, lipoteichoic acid), which also trigger an immune response that can lead to sepsis, should not be overlooked. Some synthetic cationic peptides that bind to LPS and act antimicrobially against Gramnegative bacteria have also been shown to interact with lipoteichoic acid, a major component of Gram-positive bacteria that triggers cell activation {Scott, MG, et al. (1999) Infect.lmmun. 67, 6445-6453}. Smaller synthetic molecules that neutralize LPS and are not toxic to human cells could be useful as potential drugs to prevent and stop septic shock. It should be noted that antimicrobial activity and binding to LPS, which is present only in Gram-negative bacteria, are two separate phenomena, which often overlap, and that binding of LPS molecules does not necessarily mean neutralization of LPS.

An effective anti-sepsis therapeutic agent, however, is desirable to neutralize the released LPS molecules, not cause side effects in the patient, and act simultaneously as an antimicrobial agent.

Different lipopeptides of microbial origin are effective antibiotics {Vater, J. (1986) Progr.Colloid and Polymer Sci. 72, 12-18}. It has recently been shown that some lipopoliamines effectively neutralize LPS and have no adverse side effects on mammalian cells {David, S.A., et al. (1999) Antimicrob.Agents Chemother. 43, 912-919 and US 5,998,482}. In the case of polymyxin B, removal of the lipid chain has been shown to result in a decrease in antimicrobial activity and a poorer anti-endotoxic effect of the antibiotic thus altered. Chemical modification of lipopeptides of microbial origin from Actinoplanes has been used to prepare active ingredients with improved pharmacological properties - i.e. decreased hemolytic activity (US 6,194,383) and good antimicrobial activity against Gram-positive bacteria.

Human protein fragments such as BPI, bactenecin and lactoferrin have already been used as endotoxin neutralizing agents (US 6,153,730;

EP 1 074 561 A2; US 6,172,185; US 5,856,438; WO 0049040).

A technical problem

The most important object of the invention was to provide novel agents that would act antimicrobially against Gram-negative and Gram-positive organisms while neutralizing endotoxin and thus being useful for the treatment of infections and septic shock.

It is also an object of the invention to provide novel pharmaceutical compositions useful for the treatment of infections and septic shock.

Detailed description of the invention with embodiments

The first object of our invention is novel lipopeptides based on human peptide fragments.

Another object of the invention is the preparation of the above novel lipopeptides.

A third object of the invention is the use of said novel lipopeptides for the preparation of pharmaceutical agents against Gram-positive bacteria, Gram-negative bacteria and for neutralizing endotoxin.

According to the present invention, novel lipopeptides have been prepared based on peptide fragments of human proteins containing a high proportion of basic and hydrophobic amino acids.

The novel compounds of the present invention are presented in the form of the general formula PB (1), wherein P denotes a peptide with a sequence similar to a human protein fragment containing a high proportion (> 20%) of the basic amino acids Arg and / or Lys and the hydrophobic amino acids Phe, Tyr , Trp, Ile or Val and wherein group B denotes a saturated or unsaturated aliphatic chain containing from 6 to 18 carbon atoms.

Specific examples include, as part of the above formula P, peptides based on a sequence of human lactoferrin with the following sequence:

Phe-Gln-Trp-Gln-Arg-Asn-lle-Arg-Lys-Val-Arg-hSer, where hSer stands for homoserin, while examples of group B in general formula (1) include:

C6, C8, C12, C14, C16, C18: 1 (cis) aliphatic chains linked by an amide bond with homoserine.

These compounds were, according to the present invention, obtained from recombinant fusion protein between ketosteroid isomerase, selected peptide and hexahistidine supplementation with methionine amino acid residue present only in all three parts {Kuliopulos, A. & Walsh, C.T. (1994) J.Am.Chem.Soc. 4599-4607}.

Cleavage of said fusion protein with CNBr releases a peptide that contains a homoserine lactone group at the Cterminal portion and is then isolated and derivatized with alkylamines. The lipopeptide compounds of the present invention can also be obtained by chemical synthesis.

The compounds of the invention have increased antimicrobial activity against both Gram-positive and Gram-negative bacteria and improved lipopolysaccharide neutralization.

We have shown that the LF12 peptide with an aliphatic chain of 6, 8, 12, 14, 16 and 18 carbon atoms acts antimicrobially against Gram-negative and Gram-positive bacteria, and that prolongation of the LF12 peptide with differently long lipid chains enhances the antimicrobial activity of the peptide. Thus, we observed the greatest improvement in the lipopeptide LF12-C12, which had antimicrobial activity against E. coli DC2 at 50 times lower concentration, against S. aureus at 80 times lower concentration, and against S. epidermidis at 400 times lower concentration than the starting peptide LF12.

For lipopeptides with even longer lipid chains (LF12-C14, LF12-C16, LF12C18), a decrease in the effectiveness of antimicrobial activity was observed compared to the lipopeptide LF12-C12. The LAL assay measured that the lipopeptide LF12-C12 caused a 50% inhibition of the LAL reaction at 12 times lower concentration than that of the LF12 peptide itself. The efficient neutralization of LPS with the LF12-C12 lipopeptide confirms our assumption at the beginning of the work that by increasing the lipophilicity of the recombinant cationic peptide LF12, we will improve the neutralization of LPS molecules. Our results are consistent with the LPS neutralization data of a synthetic peptide from 33 human lactofericin amino acids, containing the part on which our recombinant peptide LF12 is based {Zhang, G.H., et al. (1999) Infect. Immun. 67, 1353-1358}.

Said antimicrobial activity of the compounds of the present invention can be used for the prophylaxis or treatment of infections and septic shock in mammals, including humans.

The compounds may be incorporated into pharmaceutical preparations for use either parenterally or intravenously using a variety of pharmaceutical carriers and additives. The compounds of the present invention can be used in various biopharmaceutical preparations such as tablets, pills, powders, aerosols, aqueous solutions or suspensions, injectable and infusion solutions; alone or in combination with other antimicrobial agents, including for in vitro neutralization of endotoxin.

The invention is explained, but by no means limited to the present embodiments. Wherever in the Examples cited there are no references to the sources of reagents used, these are reagents of the quality required for work in molecular biology and biochemistry.

EXAMPLE 1

Preparation of the recombinant peptide LF12

Incorporation of the peptide coding sequence into the pET31b (+) expression vector (Novagen, Madison, Wl, USA) provides a recognition site for the A / ivNI restriction enzyme (New England Biolabs, Beverly, MA, USA), which results in the formation of complementary three-nucleotide ends (AGT) coding for methionine at either end of a recognition site composed of three nucleotides.

The ketosteriod isomerase (KSI) is modified so that it does not contain methionine residues. Thus, the only sites in the fusion protein cleaved by CNBr are at the boundary between the KSI and the peptide and the peptide and hexahistidine tail. Such a construct also allows the classification of several related sequences for a peptide separated by nucleotides for methionine {Kuliopulos, A. & Walsh, C.T. (1994) J.Am.Chem.Soc. 4599-4607}. The entire coding sequence for the LF12 peptide was contained in two phosphorylated starting oligonucleotides (The Great American Gene Company, Ramona, CA, USA), which were subcloned into the pET31b (+) expression vector.

Initial oligonucleotides for the recombinant peptide LF12, i.e. LF12-5 '(5'P-TTTCAGTGGCAACG CAACATTCGTAAAGTGCGCATG-3' (in phosphorylated form at 5'end)) and LF12-3 '(5'P-GCG CACTTTA CGAATGTGTGTGTGTGTGTGTGTGTG in phosphorylated form at 5'end)), denatured for 10 min at 95 ° C, glued in ligation buffer and ligated into pET31b (+) expression vector with T4 DNA ligase (New England Biolabs) overnight at 16 ° C.

After transformation into E. coli DH5a, colonies with recombinant expression vector were determined by chain polymerization reaction using the initial KSI oligonucleotides (GGCAAGGTGGTGAGCATC) and T7term (TGCTAGTTATTGCTCAGC) (The Great American Gene Company, Ramona, CA, USA). The recombinant peptide LF12 was obtained in E. coli BL21 (DE3) pLysS in the form of inclusion bodies of the KSILF12-His ₆ fusion protein. An appropriate amount of injection (1/100 to 1/20 of the final volume) was prepared in the LBA medium and incubated overnight at 37 ° C and 200 rpm. The bacterial culture was diluted the next day with an amount of LBA medium that was 0.1θοο between 0.15 and 0.2, and incubated in Erlenmeyer bottles at 37 ° C with shaking 220 rpm. When the absorbance value at 600 nm of the fermentation mixture increased to 0.8, 0.4 mM IPTG (isopropyl-1 thio-pD-thiogalactoside) was added. The fermentation was continued for the next 2 hours, after which the fermentation mixture was centrifuged for 10 minutes at 4 ° C and 8000 rpm. After centrifugation, the supernatant was decanted and the pellet resuspended in lysis buffer (0.1% deoxycholate, 50 mM phenylmethylsulfonylfluoride, 1 mM ethylenediaminetetraacetic acid (EDTA), 10 mM Tris / HCl pH 8.0). The suspension was poured into a beaker and incubated on ice. The release of cellular material was achieved by breaking down bacterial cell walls by ultrasound (razb400 cell breaker, Tekmar). The probe was immersed in a beaker containing the sample we had on ice for all time and sonicated for 3 minutes (pulse 1 second, pause 2 seconds) until the viscosity of the solution dropped. The suspension was centrifuged for 10 minutes at 4 ° C and 12,000 rpm. The pellet containing the inclusion body protein was then washed twice with lysis buffer, twice with 2 M urea (urea) in 10 mM Tris / HCl pH 8.0 and once with 10 mM Tris / HCI pH 8.0, to centrifuge each suspension for 10 minutes at 4 ° C and 12,000 rpm and discard the supernatant. The cleaned inclusion bodies were stored in the freezer at -20 ° C. Fusion protein production was 400 mg / l in LBA medium corresponding to 40 mg of LF12 peptide per 1 L of LB medium (casein hydrolyzate, 10 g / L, yeast extract, 5 g / L, NaCI, 10 g / L, pH set to 7.0 with NaOH). The indicated fusion protein yield is considered to be shaken culture in Erlenmeyer bottles. The KSI-LF12-His6 fusion protein was also obtained by growing in a fermentor with LBA medium (LB medium with ampicillin up to 100 pg / l). In this case, the protein production was up to 1 g / L of culture medium. The inclusion bodies of the fusion protein were dissolved in 6 M GuHCI (guanidinium hydrochloride), 20 mM Tris pH 8.0. After centrifugation for 15 minutes at 12,000 rpm and room temperature, the supernatant was loaded onto a Ni ²⁺ -NTA column (Ouiagen), pre-saturated with 1 M NiS0 ₄ and equilibrated with buffer containing 5 mM imidazole, 0.5 M NaCl, 6 M GuHCI and 20 mM Tris / HCI pH 8.0. After application of the sample, the column was washed twice with 4 ml each of rinse solutions I (5 mM imidazole, 0.5 M NaCI, 6 M GuHCI, 20 mM Tris / HCl pH 8.0) and II (16 mM imidazole, 0.5 M NaCI, 6 M GuHCI, 20 mM Tris / HCI pH 8.0), or until the absorbance value at 280 nm was below 0.01. The fusion protein was eluted with an elution solution (300 mM imidazole, 0.5 M NaCl, 6 M GuHCI, 20 mM Tris / HCl pH 8.0). The eluted fractions were pooled and dialyzed overnight against deionized water with 1 mM EDTA pH 8.0 in a dialysis bag impermeable to molecules larger than 10 kDa.

The isolated fusion protein KSI-LF12-His ₆ was dissolved in 70% TFA (trifluoroacetic acid) (Sigma) or in 80% formic acid (Fluka) to a final protein concentration of 10 mg / ml and transferred to a 100 ml glass flask. In digestion, solid CNBr (Aldrich) was added to the solution in 100-fold molar excess over all methionine in the fusion protein. The contents of the flask were then purged with nitrogen for 1 minute, then the flask was sealed, wrapped in aluminum foil and incubated for 24 hours or more at room temperature. The reaction products were dried to dryness on a rotavapor (rotary evaporator) at 30 ° C and washed three times with twice deionized water.

-1010

The suspension of the products in twice-deionized nitrogen-purged water was stirred overnight at 50 rpm and protected from light at room temperature. The next day, the suspension was centrifuged for 15 minutes at 12,000 rpm and room temperature. The supernatant containing the cleaved peptide was concentrated in a vacuum centrifuge. The insoluble pellet contained the hydrophobic carrier protein KSI.

The separated peptide in the supernatant was separated from the admixture of other peptides (mainly peptide containing terminal hexahistidine tail) by RPHPLC (reverse phase high resolution liquid chromatography) (Knauer, VWM) using a LiChrospher 100 RP-18 column. Eluting with a gradient of ΟΙ 00% buffer B (80% acetonitrile, 0.1% TFA in twice deionized water) for 20 minutes at a flow rate of 0.5 ml / min, the cleaved peptide was eluted at 60% buffer B and eluted at 100% buffer B untreated fusion protein KSI-LF12His6 The final yield of the isolated peptide LF12 was 6 mg per 1 L of LB medium. The efficacy of CNBr cleavage and the purity of the isolated peptide LF12 was verified by SDS polyacrylamide electrophoresis on a 12% polyacrylamide gel (Protean II, Bio Rad).

EXAMPLE 2

Preparation of semi-synthetic lipopeptides based on peptide LF12

The recombinant peptide LF12 after cleavage with CNBr contains a reactive homoserine lactone group at the C-terminal portion that can be used to bind to the primary or secondary amino group of another molecule. The purified peptide LF12 (170-260 nmol) was first dried to dryness in a vacuum centrifuge, then completely lactonized with 20 μ 20 70% TFA and then dried to dryness. The dried pellet was dissolved in 50 μΙ anhydrous DMF (Ν, Ν-dimethylformamide) (Fluka), which was added with a Hamilton needle to seal the gases, and then 8 μΙ Et ₃ N. was added, then the selected aliphatic amine was added to 100 multiple molar excess and incubated overnight at 45 ° C.

-1111

For derivatization of the recombinant peptide LF12, aliphatic amines with different long saturated and unsaturated chains were used (Table 1).

Table 1. Semi-synthetic lipopeptides based on the LF12 peptide prepared.

LF12 lipopeptide Functional group added LF12-Ethylenediamine -NH- (CH ₂ ) ₂ -NH ₂ LF12-spermidine -NH- (CH ₂ ) 3-NH- (CH ₂ ) 4-NH ₂ LF12-C6 -NH-CH ₃ (CH ₂ ) ₅ LF12-C8 -NH-CH ₃ (CH ₂ ) ₇ LF12-C12 -NH-CH ^ CH ^ n LF12-C14 -NH-CH ₃ (CH ₂ ) and ₃ LF12-C16 -NH-CH ₃ (CH ₂ ) ₁₅ LF12-C18 -NH-CH ₃ (CH ₂ ) ₈ = (CH ₂ ) ₉

After completion of the reaction, the same volume of chloroform and deionized water was added to the reaction mixture in DMF and the sample tube was shaken vigorously for 5 minutes. After centrifugation for 5 minutes at 10,000 rpm and room temperature, the upper (aqueous) phase was transferred to a clean tube and the extraction was repeated twice by adding the same volume of twice deionized water twice as initially. The content of lipopeptide in the aqueous phase after extraction was verified by measuring the absorbance at 280 nm.

The aqueous phase lipopeptides were isolated by RP-HPLC column as previously the peptide itself (linear gradient of 30-70% buffer B in 20 minutes and 70-100% buffer B in 10 minutes at a flow rate of 0.5 ml / min). Lipopeptides eluted at a higher proportion of buffer B than the basic peptide (Table 2).

-1212

Table 2. Elution of LF12 peptide and semi-synthetic lipopeptides by RP-HPLC.

Peptide Elution at% buffer B # LF12 45 ( ¹⁵ N) LF12 45 LF12-Ethylenediamine 45 LF12-spermidine 46 LF12-C6 52 LF12-C8 54 LF12-C12 58 LF12-C14 72 LF12-C16 76 LF12-C18 80

# With a linear gradient of 30-70% buffer B in 20 minutes and 70-100% buffer B in 10 minutes at a flow rate of 0.5 ml / min.

Isolated LF12 and prepared lipopetides were analyzed with a FAB mass spectrometer (Table 3).

Table 3. Comparison of theoretical and experimental molecular masses

of the peptides we prepared. Peptide Theoretical molecular mass (Yes) Experimental molecular weight (Yes) LF12 1613,8 1613,6 ( ¹⁵ N) LF12 1639,8 1640,2 LF12-Ethylenediamine 1673,9 1674,3 LF12-spermidine 1759,0 1759,3 LF12-C6 1714,9 1715,0 LF12-C8 1743,2 1743,2 LF12-C12 1798,7 1798,7 LF12-C14 1827,2 1828,1 LF12-C16 1854,3 1854,3 LF12-C18 1881,3 1881,6

-1313

EXAMPLE 3

Neutralization of LPS in vitro with LF12 peptide and semi-synthetic lipopeptides based on LF12 peptide

The ability of the prepared peptides to neutralize the action of LPS in vitro was tested by the enzyme test of the amoebocyte lysate of Limulus polyphemus (LAL test). LPS in animals triggers a proteolytic cascade leading to hemolymph gelling. With the addition of a chromogenic substrate, which is degraded by activated proteases from the hemolymph lysate, color development can be monitored in the test.

We used a chromogenic LAL test from Cape Cod Associates, USA. The test was performed in pyrogen-free glass tubes or sterile microtiter plates for cell culture cultivation (Costar). 50 µl of solution with constant concentration of LPS (3.2 EU / ml) and individual peptides of different concentrations in pyrogen-free water (LAL water) were loaded into the pockets. Another 50 µl of Pyrochrome reagent containing the chromogenic substrate and amoebocyte extract was added and incubated for 22 minutes at 37 ° C. The reaction was stopped by the addition of stop reagent (50% acetic acid) so that the final acetic acid concentration was 10%.

The absorbance at 405 nm was measured with a spectrophotometer. The results were compared with the action of the antibiotic polymyxin B, which effectively neutralizes the LPS, and with the positive control, where we incubated the LPS alone without the presence of peptides, and the negative control (LAL water).

With the LAL assay, we have shown that both the LF12 peptide and its derivatives inhibit the activation of LPS-triggered factor LAG reagent. All peptides were found to inhibit the LAL response to LPS in a concentration-dependent manner (Table 4).

-1414

Table 4. 50% inhibition (IC50) of LAL reaction in the presence of peptides.

Peptide IC ₅₀ (μΜ) * ± error * LF12 29,98 2.47 LF12-C6 11,22 2.24 LF12-C8 8.84 3,32 LF12-C12 2.43 1.62 LF12-C14 19,72 1.00 LF12-C16 12.09 1.41 polymyxin B 1,40 0.56

* Calculation (IC50 ± error) with sigmoid fit.

EXAMPLE 4

Determination of antimicrobial activity of LF12 peptide and semi-synthetic lipopeptides based on LF12 peptide

The bacterial strains listed in Table 5 were used for the experiment.

Table 5. Bacterial strains used to determine the antimicrobial activity of the LF12 peptide and semi-synthetic lipopeptides based on the LF12 peptide.

• Gram-negative bacterial strains: Escherichia coli DC2 CGSC 7139 (E. coli Genetic Stock Center, Yale University, USA) Escherichia coli UB1004 CGSC 7138 (E. coli Genetic Stock Center, Yale University, USA) Escherichia coli Collection of Cultures in Chemical BL21 (DE3) pLysS Institute, Ljubljana, Slovenia • Gram-positive bacterial strain: Staphylococcus aureus ATCC 25923 (American Type Culture Collection, Manassas, United States) Staphylococcus epidermidis ATCC 12228 (American Type Culture Collection, Manassas, United States)

-1515

A mixture of 1.8 ml of LB top agarose, autoclaved and cooled to 50 ° C, and 0.2 ml of overnight bacterial cell culture in LB medium were prepared and poured onto a plate of LB medium, pre-heated to 37 ° C. C. In half an hour the field of bacteria on the plate solidified. 10 μΙ of peptides in the concentration range of 10 ′ ⁷ to IO ′ ² M were applied to the prepared bacterial array plates and incubated for 3 hours at 37 ° C. Antibacterial activity was determined if a clear, cell-free zone formed around the peptide application site. The antimicrobial activity of all the ingredients used to prepare the semi-synthetic lipopeptides was further checked.

We have shown that the LF12 peptide, extended by an aliphatic chain of 6, 8, 12, 14, 16 and 18 carbon atoms, has antimicrobial activity against Gram-negative and Gram-positive bacteria, and that this prolongation of the LF12 peptide enhances the antimicrobial activity of the peptide against E bacteria coli DC2, S. aureus and S. epidermidis (Table 6).

Table 6. Antimicrobial activity of peptides against Gram-negative bacterium E. coli DC2 and Gram-positive bacteria S. aureus and S. epidermidis.

Peptide E. coli DC2 (M) # S. aureus (M) # S. epidermidis (M) # LF12 1,0 * 10 ' ³ 7.5 * 10 ' ⁴ 3,8 * 10 ' ⁴ LF12-C6 5.0 * 10 ' ⁴ 3,8 * 10 ' ⁴ LF12-C8 1.0 * 10 ' ⁴ 5.0 * 10 ' ⁵ LF12-C12 2.0 * 10 ⁵ 9.5 * 10 ' ⁶ 9.5 * 10 ' ⁷ LF12-G14 1.0 * 10 ' ⁴ 5.0 * 10 ' ⁵ LF12-C16 5.0 * 10 ' ⁴ 2.5 * 10 ⁵ LF12-C18 5.0 * 10 ' ⁴ 5.0 * 10 ' ⁵ LF12- 7.7 * 10 ' ⁵ spermidine polymyxin B 2.0 * 10 ' ⁶ 2.0 * 10 ' ⁴ 5.0 * 10 ' ⁵

# Concentrations of peptides formed on a LB culture plate with the indicated bacteria clear cell free zone.

-1616

The semi-synthetic lipopeptides of the invention have antimicrobial activity against Gram-negative and Gram-positive bacteria at concentrations 10- to 100-fold lower than that of the parent peptide, and neutralize the activity of LPS molecules at several-fold lower concentrations than the parent peptide. The novel compounds of the present invention allow the destruction of Gram-negative and Gram-positive bacteria and neutralize endotoxin, and are therefore useful for the prevention of infections, the treatment of sepsis and other similar diseases.

Due to the similarity of the peptide to the human sequence, the likelihood of an immune response to peptides in the human body is reduced. This is also very advantageous in the light of the search for new types of antimicrobial agents due to the increasing resistance of bacteria to conventional antibiotics. /

Claims (14)

PATENT APPLICATIONS Compounds of formula PB, wherein P denotes a peptide moiety having a high content (> 20%) of the basic amino acids Arg and / or Lys and the hydrophobic amino acids Phe, Tyr, Trp, Ile or Val, and group B denotes a saturated or unsaturated aliphatic chain, containing from 6 to 18 carbon atoms. Compounds according to claim 1, characterized in that the peptide moiety P is similar to the amino acid sequence of a fragment of a human protein or peptide. Compounds according to claim 1, characterized in that the amino acid sequence of the peptide moiety is P: Phe-Gln-Trp-Gln-Arg-Asn-lle-Arg-Lys-Val-Arg-hSer. 4. A compound of the formula: Phe-Gln-Trp-Gln-Arg-Asn-lle-Arg-Lys-Val-Arg-hSer. 5. A compound of the formula: Phe-Gln-Trp-Gln-Arg-Asn-lle-Arg-Lys-Val-Arg-hSer-hexylamide. 6. A compound of the formula: Phe-Gln-Trp-Gln-Arg-Asn-lle-Arg-Lys-Val-Arg-hSer-octylamide. 7. A compound of the formula: Phe-Gln-Trp-Gln-Arg-Asn-lle-Arg-Lys-Val-Arg-hSer-dodecylamide. 8. A compound of the formula: Phe-GIn-T rp-Gln-Arg-Asn-lle-Arg-Lys-Val-Arg-hSer-oleylamide. 9. A compound of the formula: Phe-Gln-Trp-Gln-Arg-Asn-lle-Arg-Lys-Val-Arg-hSer-tetradecylamide. -1818 10. A compound of the formula: Phe-Gln-Trp-Gln-Arg-Asn-lle-Arg-Lys-Val-Arg-hSer-hexadecylamide. 11. A compound of the formula: Phe-Gln-Trp-Gln-Arg-Asn-11-Arg-Lys-Val-Arg-hSer-2-amino-ethyleneamide. A process for the preparation of compounds according to claim 1, characterized in that the peptide moiety is obtained in microorganisms. Use of the compounds of claim 1 for the preparation of pharmaceutical agents for inactivating Gram-negative bacteria, Gram-positive bacteria and for neutralizing endotoxin. The use of the compounds of claim 1 for the preparation of antimicrobial agents against Gram-positive bacteria Staphyloccocus aureus and / or Staphyloccocus epidermidis.