SA93130328B1 - Anti-CD4 recombinant antibodies for human therapy - Google Patents

Anti-CD4 recombinant antibodies for human therapy Download PDF

Info

Publication number
SA93130328B1
SA93130328B1 SA93130328A SA93130328A SA93130328B1 SA 93130328 B1 SA93130328 B1 SA 93130328B1 SA 93130328 A SA93130328 A SA 93130328A SA 93130328 A SA93130328 A SA 93130328A SA 93130328 B1 SA93130328 B1 SA 93130328B1
Authority
SA
Saudi Arabia
Prior art keywords
ser
val
leu
sequence
gly
Prior art date
Application number
SA93130328A
Other languages
Arabic (ar)
Inventor
رولاند ايه. نيومان
نبيل حنا
رونالد دبليو. راب
Original Assignee
ايدك فارماسوتيكالز كوربوريشن
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ايدك فارماسوتيكالز كوربوريشن filed Critical ايدك فارماسوتيكالز كوربوريشن
Priority to SA93130328A priority Critical patent/SA93130328B1/en
Publication of SA93130328B1 publication Critical patent/SA93130328B1/en

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

الملخص: يتعلق الاختراع الراهن بأجسام مضادة خيمرية chimeric antibodies متخصصة بمستضد CD4 البشري، و DNA يحمل شيفرتها، و تراكيب صيدلية تحتوي عليها واستخدامها كعوامل علاجية. وتحتوي الأجسام المضادة الخميرية chimeric antibodies هذه على تتابعات متغيرة مأخوذة من قرد ينتمي للعالم القديم Old World monkey وتتابعات الحقل الثابت البشري، يفضل جاما ١ gamma 1 أو جاما ٤ 4 gamma البشرية أو أشكال مطفرة mutated forms منها. وتمتلك هذه الأجسام المضادة خواص علاجية مرغوبة من ضمنها التولد المضاد المنخفض low antigenicity، و فعالية إفراغ خلايا T المنخفضة (أو المعدومة)، و الألفة affinity الجيدة نحو CD4 البشري والثبات المحسن enhanced stability (عمر النصف في الجسم الحي in vivo half-life).Abstract: The present invention relates to chimeric antibodies specific for the human CD4 antigen, their DNA encoding, and pharmaceutical compositions containing them and their use as therapeutic agents. These chimeric antibodies contain variable Old World monkey and human constant field sequences, preferably human gamma 1 or gamma 4 or mutated forms thereof. These antibodies possess desirable therapeutic properties including low antigenicity, low (or no) T-cell clearance efficacy, good affinity for human CD4 and enhanced stability (in vivo half-life).

Description

: أجسام مضادة مأشوبة ل ‎Anti-CD4‏ مستخدمة للعلاج البشسري الوصف الكامل مجال الاختراع يعتبر هذا الطلب استمراراً جزئياً لطلب براءة الاختراع الأمريكي بالرقم المتسلسل ‎١/4977,777‏ المودع في اء يونيو 998١م‏ (براءة الاختراع الأمريكية رقم 9% ‎(0,Y07,+‏ ‏الذي يعتبر استمراراً جزئياً لطلب براءة الاختراع الأمريكي بالرقم المتسلسل > 7974,07/. المودع في ‎Yo‏ يناير 485١م‏ (براءة الاختراع الأمريكية رقم ‎(0,70A,0V‏ الذي يعتبر استمراراً جزئياً لطلب براءة الاختراع الأمريكي بالرقم المتسلسل ‎١7/11 ,77‏ المودع في ١٠؛‏ يوليو 197 ام (المتنازل عنه)؛ الذي يعتبر استمرارا جزئياً لطلب براءة الاختراع الأمريكي بالرقم المتسلسل 07/887,7481؛ المودع في ‎(YY‏ مارس 497١م‏ (المتنازل عنه) باسم نيومان ومعاونيه ‎(Newman et al,‏ الذي يعتبر ‎Tl aia ١‏ جزئياً لطلب براءة الاختراع الأمريكي بالرقم المتسلسل 097/775,064؛ المودع في ‎Yo‏ يوليو ١99١م‏ (المتنازل عنه)؛ التي أدمجت جميعها؛ بما في ذلك الرسوم؛ في هذا البيان للإحالة إليها كمرجع. ويتعلق هذا الاختراع بأجسام مضادة مأشضوبة ‎recombinant‏ ‏5 متخصصة ب 004 تعتبر مفيدة للعلاج البشري؛ وبطرق لإنتاج هذه الأجسام المضادة. ‎yo‏ خلفية الاختراع إن ‎CD4‏ عبارة عن بروتين سكري ‎glycoprotein‏ سطحي ‎JS lua ie yp 7 aay‏ رئيسي على خلايا السلالة اللمفية ‎T lymphocyte T‏ التي تشمل المقدار الأكبر من الخلايا التبموسية ‎thymocytes‏ ومجموعة فرعية من ‎LOA‏ 7 المحيطية ‎cells‏ 1 ل06016:01. ويعبر كذلك عن مستويات منخفضة من 004 بواسطة بعض الخلايا غير ‎ddl‏ ‎non-fymphoid cells Ye‏ بالرغم من أنه لا يعرف المفهوم الوظيفي لهذا التوزيع الخلوي التباعدي. ويؤدي 004 وظيفة التمييز الإسهامي ‎cco-recognition‏ على خلايا ‎T‏ الناضجة vr ]] ‏من النوع‎ MHC ‏متراكب التوافق النسيجي الرئيسي‎ SL ha ‏بواسطة التفاعل مع‎ ‏وبشكلٍ رئيسيء‎ .200860 presenting cells ‏المعبّّر عنها في الخلايا المائحة للمستضدات‎ 8 ‏تشكل خلايا 1 ذات “004 المجموعة الفرعية المساعدة التي تنظم وظائف خلايا 7 و‎ ‏للعدوات الفيروسية؛ البكتيرية؛ الفطرية والطفيلية.‎ 7 WIA ‏أثناء الاستجابات المعتمدة على‎: Anti-CD4 Recombinant Antibodies Used in Human Therapy Full Description Scope of Invention This application is a partial continuation of US Patent Application Serial No. 4977,777/1 filed on June 1999 (US Patent No. 9%) 0,Y07,+ which is a partial continuation of US Patent Application Serial No. > 7974,07/.Yo Filed January 4851 AD (US Patent No. (0.70A,0V) which is a partial continuation of the patent application U.S. Patent No. 77,11/17 Filed July 10, 197 A.D. (Waived); Which Is Partially a Continuation of U.S. Patent Application Serial No. 07/887,7481; Filed YY March 4971 A.D. ( (assigned) in the name of Newman and his collaborators (Newman et al, whose Tlaia 1 is in part of US Patent Application Serial No. 097/775,064; filed in Yo July 1991 AD (assigned); all of which are incorporated; including that drawings; are herein for reference.The present invention relates to recombinant B004-specific 5 recombinant antibodies that are useful for human therapy, and to methods for producing these antibodies. yo Background of the invention CD4 is a surface glycoprotein JS lua ie yp 7 aay principal on T lymphocyte lineage cells that includes the bulk of thymocytes and a subset of LOA 7 peripheral cells 1 for 06016:01. Low levels of 004 are also expressed by some non-ddl non-phymphoid cells Ye, although the functional concept of this spacing cellular distribution is not known. 004 performs a co-recognition function on mature T cells vr[] of MHC type MHC SL ha by interacting with mainly 200860 presenting cells expressed on the cells. Antigen-presenting 8 '004' 1 cells constitute the helper subset that regulates the functions of 7 f cells for viral infections; bacterial; Innate and Parasitic. 7 WIA during dependent responses

° وأثتاء تود الأمراض ‎pathogenesis‏ ذاتية المناعة ‎autoimmune‏ بالتحديد عندما يختل ‎J" aad‏ المستضدات الذاتية؛ تساهم خلايا 7 ذات “004 في الاستجابات الالتهابية مما يؤدي إلى إتلاف المفاصل والأنسجة. وتسهل هذه العمليات عن طريق تجديد الخلايا الالتهابية ‎inflammatory cells‏ في السلالة المكونة للدم ‎hematopoietic lineage‏ إنتاج الأجسام المضادة؛ السيتوكينات ‎cytokines‏ والوسائط ‎mediators‏ الالتهابية؛ وتنشيط ‎Killer cells tall LAY‏° During autoimmune pathogenesis, precisely when J" aad degrades self-antigens; 004-7 cells contribute to inflammatory responses leading to joint and tissue damage. These processes are facilitated by the regeneration of inflammatory cells. In the hematopoietic lineage production of antibodies; cytokines and inflammatory mediators; and activation of Killer cells tall LAY

‎٠١‏ ويعتبر التهاب المفاصل شبه الروماتزمي ‎«Rheumatoid arthritis (RA)‏ وهو عبارة عن مرض التهابي يصيب الغشاء الزلالي ‎¢synovium‏ أحد مظاهر المناعة الذاتية التي تؤدي إلى ‎«JST‏ تشوه؛ وإتلاف المفاصل. وكما هو شأن أغلب الأمراض ذاتية المناعة؛ لم تحدد ‎Lola‏ ‏أسباب ‎JRA‏ غير أنه؛ من المعروف بأن ‎RA‏ يتميز بمستويات مرتفعة من الخلايا اللمفية 7 ذات “004 المنشطة في المفاصل ‎Abad)‏ ولا يوجد ‎Ula‏ علاج لمرض ‎RA‏ ويصمتم01 Rheumatoid arthritis (RA) which is an inflammatory disease of the synovium ¢synovium is an autoimmune manifestation that leads to “JST deformity; and joint damage. As is the case with most autoimmune diseases; Lola did not specify the reasons for the JRA other than that; RA is known to be characterized by elevated levels of activated 004-7 lymphocytes in the Abad joints. There is no Ula cure for RA and they are

‎ye‏ العلاج الأولي لمرض ‎RA‏ بحيث يخفف من أعراض المرض ويحسن القدرات الوظيفية على المدى القصير. وتعطى علاجات ثانوية وثالثية من الكوابت المناعية ‎immunosuppressors‏ ‏والستيرويدات ‎steroids‏ مثل أزاثيوبرين ‎cazathioprine‏ مثوتريكسات ‎methotrexate‏ ‏وبردنيسولون ‎cprednisolone‏ التي تستهدف المرض الأساسي؛ في الحالات الأكثر خطورة وتكون إما فعّالة بدرجة طفيفة فقط أو تظهر سمية غير مقبولة بالنسبة للعلاج طويلye Initial treatment for RA so that it relieves symptoms of the disease and improves functional abilities in the short term. Secondary and tertiary treatments are given from immunosuppressors and steroids such as azathioprine, methotrexate and cprednisolone, which target the underlying disease; In more severe cases they are either only slightly effective or exhibit unacceptable toxicity for prolonged treatment

‏© الأمد. ولا تقي كذلك من إتلاف المفاصل.© Al-Amd. It also does not protect against joint damage.

‏وإلى جانب ‎(RA‏ تشترك خلايا *004 كذلك في حالات مزمنة أخرى من ضمنها الصدفية ‎¢psoriasis‏ الداء السكري المعتمد على الإنسولين ‎<insulin-dependent diabetes mellitus‏ )453 الاحمرارية الجهازية ‎systemic lupus erythematosus‏ وأمراض الأمعاء الالتهابية ‎inflammatory bowel diseases‏ وعلاوة على ذلك؛ من المحتمل أن يسهم التعبير عن 004 فيIn addition to RA, *004 cells are also involved in other chronic conditions including psoriasis, <insulin-dependent diabetes mellitus, systemic lupus erythematosus, and inflammatory bowel disease. bowel diseases and moreover; Expression of 004 likely contributes to

‎vo‏ حدوث الأمراض ذاتية المناعة الأخرى.vo occurrence of other autoimmune diseases.

¢ وباشتراك خلايا 7 في تكوّن واستمرار الأمراض ذاتية المناعة؛ أصبح كبت المناعة استراتيجية هامة للمعالجة. وقد استخدمت عقاقير كبت المناعة المتوفرة ‎Jue‏ السبورين الحلقي ‎cyclosporin A A‏ بنجاح لمعالجة رفض الأعضاء المزروعة. غير أن التأثيرات الجانبية السامة لها تجعلها غير مقبولة للعلاج طويل الأمد للأمراض ذاتية المناعة.¢ Involvement of 7 cells in the formation and persistence of autoimmune diseases; Immunosuppression has become an important treatment strategy. The available immunosuppressant drug Jue cyclosporin A A has been used successfully to treat rejection of transplanted organs. However, its toxic side effects make it unacceptable for the long-term treatment of autoimmune diseases.

° وقد تحقق إفراغ ‎WIA de gana‏ 7 الكاملة؛ بما في ذلك المجموعة الفرعية *004؛ في المواقع السريرية؛ باستخدام طرق من ضمنها تصريف القناة الصدرية؛ المعالجة الإشعاعية للخلايا اللمفانية (الشبيهة باللمف) الكلية ورحلان الخلايا اللمفية ‎lymphopheresis‏ مما يؤدي إلى تحسن سريري عند بعض المرضى. غير أنه؛ تركزت الاستراتيجيات الحالية على عوامل أكثر انتقائية تمنع الاستجابات المناعية غير المرغوبة بدون أن تؤدي إلى سمية الأعضاء° A full WIA de gana 7 offload has been achieved; including subset *004; in clinical settings; using methods including thoracic duct drainage; Radiation therapy to total lymphocytes and lymphocytes, which leads to clinical improvement in some patients. is that; Current strategies have focused on more selective agents that inhibit unwanted immune responses without leading to organ toxicity

الصلبة أو تأثيرات جانبية خطيرة أخرى. وتتمثل ‎saa]‏ طرق تحقيق ذلك بشكل فعّال فيsolid or other serious side effects. [saa] The ways to do this effectively are

الإزالة أو شل النشاط الانتقائي للخلايا 7 التي تتوسط المرض باستخدام أجسام مضادة وحيدةSelective removal or immobilization of disease-mediated 7 cells using single antibodies

النسيلة ‎.monoclonal antibodies (mAbs)‏ وتمثل ‎mAbs‏ المضادة ل ‎CD4‏ إحدى هذهClonal .monoclonal antibodies (mAbs) Anti-CD4 mAbs are one such

الاستراتيجيات. وفي النماذج الحيوانية للمناعة الذاتية وزرع الأعضاء؛ توقف أى تكبح ‎mAbs‏strategies. and in animal models of autoimmunity and transplantation; Stop any inhibiting mAbs

ل 00-004م تقدم المرض عند إعطائها وقائياً أو علاجياً. وبالإضافة لذلك» قدمت النتائجFor 00-004 AD, the disease progressed when given preventively or curatively. In addition, the results were presented

‎vo‏ الأولية لبعض التجارب السريرية باستخدام ‎mAbs‏ المضادة ل ‎CD4‏ في ‎(RA‏ الصدفيةvo preliminary study of some clinical trials using anti-CD4 mAbs in psoriasis (RA).

‎epsoriasis‏ مرض الأمعاء الالتهابي ‎inflammatory bowel disease‏ والالتهاب الوعاثي الجهازي ‎Ss systemic vasculitis‏ أولياً على الفعالية العلاجية الكامنة.epsoriasis, inflammatory bowel disease, and systemic vascular inflammation (Ss systemic vasculitis) are primarily based on potential therapeutic efficacy.

‏وبشكل أساسي؛ يتمثل الهدف من العلاج باستخدام ‎mAb‏ المضاد ل 004 في وقفAnd basically; The goal of treatment with anti-004 mAb is to stop

‏فعالية الإتلاف الذاتي لخلايا “004 وبصفة خاصة أثناء الأطوار الحادة من الاضطراب ذاتيThe self-destructive efficacy of “004” cells, particularly during acute phases of autoimmune disorder

‎pic) ‏من عدم الاستجابة المناعية‎ Alla ‏المناعة. ويتمثل الهدف العلاجي الأساسي في فرض‎ x.pic) From the lack of immune response Alla immunity. The primary therapeutic goal is to impose x.

‏النشاط ‎(anergy‏ أو التحمل طويل الأمد للمستضدات المسببة للإصابة (أو الأنسجة المعينة)Activity (anergy or long-term tolerance to infection-causing antigens (or specific tissues)

‏المعززة للمرض الأساسي؛ بدون ضعضعة عمليات الدفاع في العائل السليم من قيبلenhancing the underlying disease; Without undermining defense processes in healthy hosts

‏العدوات المؤاتية. وبصرف النظر عن ‎(RA‏ قد تكون كذلك ‎mAbs‏ ل 004 مفيدة لمعالجةfavorable enemies. Apart from RA, mAbs for 004 may also be useful for treatment

‏أمراض ذاتية المناعة أخرى مثل؛ الداء السكري المعتمد على الإنسولين ‎insulin-dependent‏Other autoimmune diseases such as; Insulin-dependent diabetes mellitus

‎mellitus Yo‏ 5ع18661ل» الذئبة الاحمرارية الجهازية ‎(systemic lupus erythomatosis‏ الصدفيةmellitus Yo 5p 18661l Systemic lupus erythomatosis Psoriasis

° 5م مرض الأمعاء الالتهابي ‎inflammatory bowel disease‏ والتصلب المتعدد ‎multiple‏ ‏0105 .5°C Inflammatory bowel disease and multiple sclerosis 0105 .

ونظرآً للأهمية المحتملة ل ‎mAbs‏ المضادة ل 004 بصفتها عوامل ‎Ande‏ مناعية؛ فقد ذكرت شركات ومجموعات بحث عديدة ‎mAbs‏ مضادة ل 0104 بصفتها عوامل علاجية م فعتّالة. فعلى سبيل المثال؛ ذكرت شركة سنتوكور ‎mAb Centocor‏ مضاد ل 004 يشار إليه بسنتارا ‎Centara‏ وهو عبارة عن «اهم« فأري خيمري مضاد ل 004. وكذلك فقد نكرت شركة جونسن أند جونسن/أورثو ‎mAb Johnson & Johnson/Ortho‏ مضاد ل- 004 يتمثل في ‎<OKT-4a‏ وهو عبارة عن ‎mAb‏ فأري محول إلى صورة بشرية. وكذلك ذكرت شركة بروفز ويلكم ‎mAb Burroughs Wellcome‏ مضاد ل ‎CD4‏ وهو عبارة عن ‎mAb‏ فأري محول إلى ‎٠١‏ صورة بشرية مضاد ل 004. ‎dll,‏ طورت كل من شركتي ساندوز ‎Sandoz‏ وميداميوون ‎MedImmune‏ (بالتعاون مع شركة ميرك ‎Aas mAbs (Merck‏ إلى صورة بشرية فأرية مضادة ل ‎CD4‏ متخصصة ب 004. وكذلك طورت كل من الشسركات بكتون ديكنسون ‎<Becton Dickinson‏ إميونوتك ‎Immunetech‏ وبويرنجر مانهيم ‎mAbs Boehringer Mannheim‏Given the potential importance of anti-004 mAbs as Ande immunogenic factors; Anti-0104 mAbs have been reported by several companies and research groups as potent mAbs. for example; mAb Centocor has stated anti-004 referred to as Centara, which is the “most important” chimeric mouse anti-004. Johnson & Johnson/Ortho has also denied that mAb Johnson & Johnson/Ortho is anti-004. In <OKT-4a, a murine mAb converted into a human image. Burroughs Wellcome anti-CD4 mAb, which is a murine mAb converted into 01 human image anti-004. dll, was also mentioned by Profs and Wellcome, developed by Sandoz and MedImmune (MedImmune). mAbs Boehringer Mannheim, in collaboration with Aas mAbs (Merck), developed a mouse anti-CD4 human form of 004. The companies Becton Dickinson, Immunetech, and Boehringer Mannheim also developed mAbs.

مضادة ل ‎.CD4‏ ‎Vo‏ وبصرف النظر عن ‎mAbs‏ المضادة ل 004؛ فقد تم الكشف عن عقاقير ومعدّلات مناعية مختلفة تمتلك قابلية تطبيق فعّالة لمعالجة ‎JRA‏ وتشتمل ‎OVA xa‏ مناعية وعقاقير من هذا القبيل على؛ ‎Sa‏ مواد معيقة للالتصاق الخلوي؛ مواد معيقة لمستقبلة السيتوكين ‎cytokine‏ ذيفانات مناعية ‎immunotoxins‏ ومواد مضادة لمستقبلة ‎WA‏ 7. وتشتمل أمثلة خاصة على انترفيرون ‎gamma interferon Lela‏ مضاد ‎ICAM-1‏ (وهو عبارة عن ‎mAb‏ فأري مضاد ‎»٠‏ ال 054 يعيق مرور الكريات البيضاء بواسطة الالتصاق)؛ ‎Campath-1H‏ (وهو عبارة عن ‎mAD‏ مضاد ل 00»52 ‎Syne‏ إلى صورة بشرية مأخوذ من جرذ؛ مستقبلة ‎cA2 IL-1‏ (وهو عبارة عن ‎mAb‏ خيمري لعامل تصلب الورم ألفا (178-ألفا)؛ 571 ‎CDP‏ (وهو ‎mAb‏ مضاد ل ‎(TNF‏ مضاد ل 11-28 (وهو ‎mAb‏ مضاد ل 0025 فأري محول إلى صورة بشرية)؛ 380 ‎CHH‏ 5902 (وهو عبارة عن ‎mAb‏ مضاد ل 007 بشري فأري)؛ ‎IL-2 Yo‏ 088486 (ذيفان اتدماجي 2-.؛ غير متخصص ‎CD4 WDA,‏ ر 608)؛ ‎¢(IL-1RA) Antril‏anti-CD4 .Vo apart from anti-004 mAbs; Various drugs and immunomodulators have been revealed that have effective applicability for the treatment of JRA. OVA xa immunomodulators and such drugs include; ‎Sa adhesion inhibitors; cytokine receptor blockers immunotoxins and WA 7 receptor antagonists. Specific examples include the gamma interferon Lela antibody ICAM-1 (a murine antibody mAb) 054 obstructs the passage of leukocytes by adhesion); Campath-1H (a mAD anti-00'52 Syne) to human form from rat; cA2 IL-1 receptor (a chimeric mAb for tumor sclerosing factor-alpha (178-alpha) ); 571 CDP (anti-TNF mAb 11-28 (anti-mouse mAb 0025 humanized); 380 CHH 5902 (anti-TNF mAb l 007 mouse human); IL-2 Yo 088486 (combination toxin 2-.; non-specific CD4 WDA, p. 608); ¢ (IL-1RA) Antril

تأTA

+ مضاد ل ‎mAbs) TCP‏ وبروتينات تستهدف المجموعات الفرعية من مستقبلات خلايا ‎oT‏ و ‎XomaZyme—CDS‏ (مادة اقترانية ‎Aula‏ مضادة ل 005 فأرية). وتشتمل كذلك معدّلات مناعية وكوابت مناعية أخرى لها استخدام فال في ‎dallas‏ الأمراض ذاتية المناعة على راباميسين ‎Rapamycin‏ (كابت مناعي فموي)؛ ثيرافكتين ‎¢Therafectin °‏ ليفلوتوميد ‎Leflunomide‏ (عقار أولي كابت للمناعة)؛ تتنيداب ‎Jad) Tenidap‏ سيتوكين/مثبط-60)؛ 101-25 و ‎RS-61443‏ (كابت مناعي فموي). ‎LS‏ أشير؛ ذكرت أجسام مضادة وحيدة النسيلة عديدة ل 604 لها استخدامات علاجية فعّالة. وفي أغلب الأحوال؛ تشتمل هذه الأجسام المضادة على ‎mAbs‏ فأرية؛ ‎mAbs‏ ‏مضادة ل 004 خيمرية أو محوئلة إلى صورة بشرية-فأرية. ‎Ve‏ ويكون للأجسام المضادة وحيدة النسيلة الفأرية استخدام فال في تشخيص الأمراض البشرية بالإضافة إلى استخدامها في التجارب السريرية كعوامل علاجية لمعالجة الأمراض البشرية الحادة والمزمنة؛ ‎Lay‏ في ذلك سرطانات الدم (اللوكيميا ‎«(leukaemias‏ ‏الأورام اللمفية ‎dymphomas‏ الأورام الصلبة ‎solid tumors‏ (على سبيل المثال أورام القولون ‎colon tumors‏ الثدي ‎¢breast tumors‏ الكبد ‎«(hepatic tumors‏ مرض الإيدز (متلازمة نقص ‎Vo‏ المناعة المكتسبة ‎(AIDS‏ والأمراض ذاتية المناعة ‎autoimmune diseases‏ غير أنه؛ تعتبر الأجسام المضادة الفأارية غير مستحسنة لكونها غالبا ما تحدث استجابة مناعية في العائل ضد الأجسام المضادة وحيدة النسيلة الفارية. وذكرت كذلك أجسام مضادة خيمرية فأرية/بشرية. وتشتمل هذه الأجسام المضادة على خواص الارتباط للجسم المضاد الفأري الوالدي ووظائف المستفعلات المقترنة بالمنطقة الثابتة © - البشرية. انظرء على سبيل المثال؛ ما جاء في براءة الاختراع الأمريكية رقم 2,801,557 باسم كابيلي ومعاونيه ‎Cabilly et al.,‏ رقم 5,177,775 باسم شوميكر ومعاوتيه ‎‘Shoemaker et al.,‏ رقم 4 17 باسم بيفرز ومعاونية ‎‘Beavers et al.,‏ ورقم ‎5,816,74١‏ باسم بوس ومعاونيه ‎(Boss et al,‏ التي أدمجت جميعها في هذا البيان للإحالة إليها كمرجع. وعادة ما تشكّل هذه الأجسام المضادة الخيمرية عند تحضير مكتبة مورثات ‎Yo‏ مجينية من الدنا (الحمض النووي الريبوزي منقوص الأكسجين) المستخلص من أورام هجينية+ anti-TCP mAbs and proteins targeting oT cell receptor subsets and XomaZyme—CDS (anti-mouse Aula conjugate 005). Other immunomodulators and immunosuppressants that have a valid use in dallas of autoimmune diseases also include rapamycin (an oral immunosuppressant); ¢Therafectin ° leflunomide (primary immunosuppressive drug); Tenidap (cytokine/inhibitor-60); 101-25 and RS-61443 (oral immunosuppressant). LS is pointing; Several reported monoclonal antibodies to 604 have potent therapeutic uses. And in most cases; These antibodies include mouse mAbs; Chimeric anti-004 mAbs or transformed into human-mouse form. Ve and mouse monoclonal antibodies have Val use in the diagnosis of human diseases in addition to their use in clinical trials as therapeutic agents for the treatment of acute and chronic human diseases; Lay, including blood cancers (leukemias) lymphomas solid tumors (for example colon tumors breast tumors liver hepatic tumors) However, murine antibodies are not recommended because they often induce an immune response in the host against murine monoclonal antibodies. Mouse chimeric antibodies were also mentioned. These antibodies include the binding properties of the parental murine antibody and the functions of effectors associated with the human constant-region © See, for example, US Patent No. 2,801,557 by Cabilly et al., No. 5,177,775 by Shoemaker and his collaborators 'Shoemaker et al., No. 4 17 as Beavers and collaborators 'Beavers et al., and collaborators' 'Beavers et al., and collaborators' No. 5,816,741 as Boss et al., all of which are incorporated into this statement for reference. What these chimeric antibodies form when a library of genomic Yo genes is prepared from DNA (deoxyribonucleic acid) extracted from hybridomas

ل فأرية موجودة مسبقآً (انظر ما جاء عن نيشمان ومعاونية ‎Nishman et al.,‏ في مجلة بعنوان أبحاث السرطان ‎(Cancer research)‏ المجلد 47 ص 499( 9897١م).‏ ومن ثم تغربل المكتبة لتحديد ‎Gl) ge‏ المناطق المتغيرة من السلسلتيّن التقيلة والخفيفة اللتين تظهران نماذج ‎sale)‏ ‏ترتيب أجزاء الأجسام المضادة الصحيحة. ومن ثم تثشربط مورّثات المنطقة المتغيرة المنسلة © في ناقل تعبيري يحتوي على عليبات ‎cassettes‏ منسلة من مورث المنطقة الثابتة البشرية ثقيلة أو خفيفة السلسلة الملائمة. ومن ثم يعبر عن المورثات الخيمرية في نسل خلوي معين؛ ‎Le‏ ‏ما يكون نسل ورم نخاعي فأري. غير أنه؛ بالرغم من استخدام الأجسام المضادة الخيمرية هذه في العلاج البشريء فإنها تكون كذلك معرضة لبعض المشاكل. وبشكل مماتل للأجسام المضادة وحيدة النسيلة الفأرية؛ ‎YL‏ قد ينتج المتلقون البشريون أجساماآً مضادة ضد الجسم المضاد الخيمري. ويعتبر هذا غير مفيد بالنسبة للعلاج المتواصل باستخدام الجسم المضاد الخيمري. وكتحسين على الأجسام المضادة الخيمرية التقليدية؛ كشف بعض الباحثين عن طرق لإنتاج أجسام مضادة وحيدة النسيلة بشرية لا ينبغي أن تتعرض لهذه المشاكل. انظر مثلآ ما جاء عن إرليش ومعاونيه ‎Erlich et al‏ في مجلة الكيمياء السريرية ‎«(Clinical Chemistry)‏ ‎vo‏ المجلد ‎(FE‏ ص ‎AAA OTA‏ ١م؛‏ في مجلة الورم الهجيني ‎(Hybridoma)‏ المجلد ‎١7‏ ص ‎TAA (FAC‏ ١م؛‏ وفي مجلة الورم الهجيني؛ المجلد 7 ص )10 ‎ad AAY‏ وفي مجلة الأورام الهجينية للأجسام المضادة البشسرية ‎(Human Antibody Hybridomas)‏ » المجلد ‎١١‏ ص ‎YY‏ ‎٠‏ م. وتفترض هذه المراجع ‎Lad‏ أنه ينبغي تحمسّل الأجسام المضادة الثديية الرئيسية غير البشرية؛ على سبيل المثال الأجسام المضادة وحيدة النسيلة المأخوذة من الشمبانزي ‎fam‏ ‎x.‏ في البشر ‎Todas‏ لتشابهها بنيوياً مع الأجسام المضادة البشرية. غير أنه؛ يكون لإنتاج الأجسام المضادة في البشر قيود محظورة واضحة. ‎las‏ 1 لأنه تكون الأجسام المضادة البشرية غير استمناعية في قرود الريص ‎Rhesus‏ ‎monkeys‏ (أي؛ لا تحث استجابة جسم مضاد)؛ فقد تنبأ ارليش ومعاونوه كذلك أنه ينبغي أن تكون الأجسام المضادة الثديية الرئيسية غير استمناعية في البشر. ويبين المحرر إرليش ‎Yo‏ ومعاونوه أنه لا يلزم اختبار الأجسام المضادة في البشر إذا اشتمل جسم مضاد ثديي رئيمسيfor pre-existing mice (see what was reported by Nishman et al., in the journal Cancer Research, Vol. 47, p. Both the heavy and light chains that show "sale" forms are the correct antibody moiety order. The genes of the scrambled variable region © are then ligated into an expression vector containing cassettes spilled from the appropriate heavy or light chain human constant region gene. The chimeric genes are then expressed in a specific cell line; Le What is the offspring of a mouse myeloma? is that; Although these chimeric antibodies are used in human therapy, they are also prone to some problems. identically to the mouse monoclonal antibody; YL human recipients may produce antibodies against the chimeric antibody. This is considered unhelpful for continuous chimeric antibody therapy. As an improvement over traditional chimeric antibodies; Some researchers have uncovered ways to produce human monoclonal antibodies that should not have these problems. See, for example, what was reported by Erlich et al. in Clinical Chemistry vo vol. (FE p. AAA OTA 1m; in Hybridoma vol. 17 p. TAA (FAC 1em; in The Journal of Hybriomas; vol. 7 p. 10) ad AAY and in the Journal of Human Antibody Hybridomas » Vol. 11 p. YY 0 M. These Lad references assume that major non-human mammalian antibodies, eg the chimpanzee fam x. The production of antibodies in humans has obvious limitations.las 1 Because human antibodies are non-immunogenic in rhesus monkeys (that is, they do not induce an antibody response), Ehrlich and collaborators also predicted that they should be Principal mammalian antibodies are not immunogenic in humans Ehrlich Yo and collaborators report that antibody testing in humans is not required if a primary mammalian antibody is involved

AA

‏على الأقل. على‎ of ‏بشري‎ immunoglobulin ‏على منطقة ثابتة مماثلة لتلك لجلوبلين مناعي‎ ‏بنية لا تزيد درجة اختلافها عن جلوبلين مناعي بشري عن درجة اختلاف الأجسام المضادة‎ ‏البشرية المختلفة عن بعضها البعض.‎ ‏وكتحسين على الأجسام المضادة الخيمرية المعروفة التي غالباً ما تكون مستضدية في‎ ‏البشرء تصف الطلبات ذات الصلة لبراءات الاختراع الأمريكية بالأرقام المتسلسلة‎ ٠ ‏يتايرء‎ Yo ‏1545م 47,097 8/7 ؛؛ المودع في‎ (pin 7 ‏المودع في‎ 4/47/7777At least. of human immunoglobulin on a constant region similar to that of immunoglobulin of a structure that is no more different from human immunoglobulin than different human antibodies from each other. And as an improvement over the well-known chimeric antibodies that are often Be antigenic in humans Relevant applications for US patents describe serial numbers 0 YT Y Y 1545 CE 47,097 8/7 ;; Filed to (pin 7) Filed on 4/47/7777

YY ‏المودع في‎ cr V/AOTLYAY م١597 ‏يوليو؛‎ ٠١ ‏5م و 7/517,717؛ المودع في‎ ‏يوليو؛ 9951 ١م؛ التي أدمجت جميعها‎ Yo ‏مارسء 947١م و 97/775,054؛ المودع في‎ ‏للإحالة إليها كمرجع؛ صنع الأجسام المضادة وحيدة النسيلة المأخوذة من القرد المنتمي للعالم‎ ‏القديم والأجسام المضادة الخيمرية المشتقة منها والناتجة باستخدام الطرق المأشوبة التي تحتوي‎ - ‏على الحقل المتغير لجسم مضاد مأخوذ من قرد ينتمي للعالم القديم (على سبيل المثال قرد‎ ‏الرباح أو المكاك)؛ المندمجة مع منطقة ثابتة منسلة مأخوذة من إنسان؛ قرد شمبانزي أو قرد‎ ‏آخر أو مناطق هيكلية من قرود أخرى. وتصف هذه الطلبات بشكل خاص صنع هذه الأجسام‎ ‏المضادة وحيدة النسيلة المأخوذة من القرد المنتمي للعالم القديم والأجسام المضادة الخيمرية‎ ‏المشتقة منها التي تعمل ضد المستضدات البشرية؛ بالإضافة إلى استخدام أجسام مضادة‎ ve ‏مأشوبة خيمرية كعوامل علاجية مناعية لمعالجة الأمراض البشرية.‎ ‏سبيل‎ lo) Land) ‏المدهش بأن القرود مختلفة‎ Glassy) ‏وتقوم هذه الطلبات على‎ ‏المثال» قرود الرباح أو المكاك (من ضمنها قرود السينومولجس وقرود الريص))؛ بخلاف‎ ‏قرود الشمبانزي؛ لا تكون فقط مختلفة بدرجة كافية عن البشر بحيث تتيح تود الأجسام‎ ‏المضادة للمستضدات البشرية في هذه القرود حتى بالنسبة للمستضدات البشرية المحفوظة‎ Yo ‏على سبيل المثال؛ 004 و 0054؛ إنما تكون مشابهة بدرجة كافية للبشر حيث تحتوي‎ Laas ‏على أجسام مضادة تكون مشابهة بنيوياً للأجسام المضادة البشرية؛ بحيث لا تحدث استجابة‎ ‏ضد الجسم المضاد في العائل عندما يتم إدخال هذه الأجسام المضادة المأخوذة من القرود؛ أو‎ ‏الأجسام المضادة الخيمرية المأشوبة المشتقة منهاء في إنسان.‎YY FILE CR V/AOTLYAY AD 1597 JULY; 01 5 AD AND 7/517,717; deposited in July; 9951 1 m; all of which were incorporated Yo March 9471 AD and 97/775,054; deposited in for reference; Manufacture of Old World monkey monoclonal antibodies and chimeric antibodies derived therefrom using recombinant methods containing - the mutant field of an Old World monkey antibody (eg baboons or macaques); merged with a fixed area flocculant taken from a human; A chimpanzee, other monkey, or skeletal regions of other monkeys. These requests specifically describe the manufacture of these Old World monkey monoclonal antibodies and chimeric antibodies derived from them that act against human antigens; In addition to the use of chimeric recombinant ve antibodies as immunotherapeutic agents for the treatment of human diseases. (Lo Land) The surprising way that monkeys are different Glassy) These requests are based on, for example, “baboons or macaques (including monkeys cynomolgus and rhesus monkeys); Unlike chimpanzees; Not only are they different enough from humans to allow the antibodies to antigens to be detected in these monkeys even to the conserved human antigens Yo for example; 004 and 0054; Rather, they are similar enough to humans that Laas contain antibodies that are structurally similar to human antibodies; so that no antibody response occurs in the host when these antibodies taken from monkeys are introduced; Or recombinant chimeric antibodies derived from a human terminator

TeTe

وتكشف هذه الطلبات أنه بخلاف بعض الأجسام المضادة السابقة المستخدمة للعلاج البشري؛ بما في ذلك الأجسام المضادة الخيمرية المعروفة؛ لا تعاني هذه الأجسام المضادة الخيمرية من عدة ‎case‏ على سبيل المثال ‎)١‏ الاستمناع وحث الاستجابة ضد الأجسام المضادة ‎(HAA)‏ في البشر عند الاعطاء المتكرر اللازم لمعالجة الحالات المزمنة؛ ‎(YF‏ ‏م عمُْر النصف القصير نسبياً مقارنة مع الأجسام المضادة البشرية؛ و ) نقص وظائف المستفعلات في الخلايا البشرية أو المتممة. وتعتبر ‎A‏ هذه العيوب ميزة خاصة بالنسبة للعلاج البشري. فعلى سبيل المثال» في ‎Ala‏ الأمراض البشرية المزمنة؛ بما في ذلك الأمراض ذاتية المناعة؛ أو أي مرض يستلزم فيه إعطاء جسم مضاد لفترة طويلة؛ يتمثل أحد العوائق الرئيسية للعلاج المتكرر بالأجسام ‎٠‏ المضادة في استجابة العائل للجسم المضاد العلاجي. وغالباً ما تكون استجابات ‎HAA‏ غير ‎ALG‏ للتتبؤ من مريض لآخر. كما أنه ‎We‏ ما توجه هذه الاستجابات» وإن كانت لا تقتصر على ذلك؛ نحو المنطقة الثابتة من جزيء الجسم المضاد؛ وحالما تحدث؛ فإنها غالبا ما تعيق؛ أو تخفض فعالية العلاج باستخدام ذلك الجسم المضادء أو جسم مضاد آخر من نفس النمط الإسوي. وستتغلب الأجسام المضادة الخيمرية المأشوبة الموصوفة في الطلبات المشار إليها ‎١‏ أعلاه على هذه المشكلة وتكفل تولد أجسام مضادة لها التخصصية الملائمة ووظيفة المستفعلة المرغوبة؛ واستخدامها في إنتاج الأجسام المضادة المأشوبة. وعادة ما تشتمل هذه الأجسام المضادة المأشوبة على جزء ملائم من المنطقة المتغيرة لجسم مضاد يحصل عليه من قرد ممنع ويعتبر ذلك ضرورياً لربط المستضد؛ والمنطقة الثابتة لجسم مضاد يحصل عليه من إنسان أو قرد شمبانزي. وبالتالي؛ يكفل هذا المحافظطة على © - التخصصيات والألفات العالية للأجسام المضادة وحيدة النسيلة المأخوذة من ‎ca ill‏ ووظائف المستفعلة المرغوبة عن طريق الانتقاء الملائم للمنطقة الثابتة في الإنسان أو قرد الشمبانزي. وتذكر العديد من هذه الطلبات ذات الصلة بشكل خاص جسماً مضاداً خيمرياً نموذجياً مأخوذاً من قرد/إنسان متخصص ب ‎«CD4‏ يشار إليه ب 089.1؛ يحتوي على الحقل المتغير للسلسلة الثقيلة والخفيفة لجسم مضاد وحيد النسيلة ل 004 ناتج في قرد سينومولجس و على ‎vo‏ المنطقة الثابتة لمنْدا )1( للسلسلة الخفيفة للجلوبلين المناعي البشري والمنطقة الثابتةThese requests reveal that unlike some previous antibodies used for human therapy; including known chimeric antibodies; These chimeric antibodies do not suffer from several cases (eg) 1) immunogenicity and induction of an antibody (HAA) response in humans upon repeated administration required to treat chronic conditions; (YF) relatively short half-life compared to human antibodies; and f) lack of effector functions in human or complement cells. A considers these drawbacks a particular advantage for human therapy. For example, in Ala chronic human diseases; including autoimmune diseases; or any disease in which an antibody is required for a long period of time; A major barrier to repeated antibody-0 therapy is host response to the therapeutic antibody. HAA responses other than ALG are often predictable from patient to patient. We also do not direct these responses,” although it is not limited to that; towards the stationary region of the antibody molecule; And as soon as he spoke; they often hinder; or the efficacy of treatment with that antibody or another antibody of the same isotype is reduced. The recombinant chimeric antibodies described in the submissions 1 above will overcome this problem and ensure the generation of antibodies having the appropriate specificity and desired effector function; and their use in the production of recombinant antibodies. These recombinant antibodies usually include an appropriate portion of the variable region of an antibody obtained from an immunized monkey and that is necessary for antigen binding; and the constant region of an antibody obtained from a human or a chimpanzee. And therefore; This ensures the preservation of the © - specificities and high affinities of the monoclonal antibodies from ca ill and the desired effector functions by appropriate selection of the constant region in human or chimpanzee. Several of these particularly relevant requests mention a typical chimeric monkey/human antibody specific for “CD4” denoted as 089.1; Contains the variable field of the heavy and light chain of a monoclonal antibody to 004 produced in monkey synmolgs and the vo Menda constant region (1) of the human immunoglobulin light chain and the constant region

) جاما ‎١‏ )11( للسلسلة الثقيلة للجلوبلين المناعي البشري. ويمتلك هذا الجسم المضاد بعض فعالية إفراغ خلايا ‎oT‏ إلا أنها كون بدرجة أخفض بالمقارنة مع فعالية الأجسام المضادة وحيدة النسيلة ل 004 السابقة. غير أنه؛ من المرغوب إنتاج أجسام مضادة تمتلك فعالية إفراغ خلايا ‎T‏ منخفضة أو معدومة نظرآً لأنه سيحسن هذا من قدرتها العلاجية بشكل فكال. وتصف كذلك هذه الطلبات أنظمة ناقلة مفضلة لإنتاج أجسام مضادة خيمرية من هذا القبيل» وبشكل خاص 5.2 ‎TCAE‏ و ‎TCAE6‏ تشتمل على ما يلي: ‎)١(‏ أربع عليبات انتساخية ‎Yay)‏ من ثلاث)؛ بترتيب ترادفي: ( أ ) منطقة سلسلة خفيفة ثابتة للجلوبلين المناعي البشري. وفي الناقل 5.2 ‎(TCAE‏ تتمثل هذه المنطقة في منطقة السلسلة الخفيفة الثابتة كابا للجلوبلين المناعي البشضري ‎٠١‏ (الأحماض الأمينية أرقام ‎Gig 7١1-٠١78‏ لترقيم كابات و0م16» النمط الأليلي ‎((Km3‏ وفي الناقل 6 ‎TCAE‏ هي منطقة السلسلة الخفيفة الثابتة للسشمندا للجلوبلين المناعي البشري (الأحماض الأمينية أرقام ‎Gay YY om) cA‏ لترقيم كابات؛ النمط المورثي ‎Oz‏ سالب ‎type Oz minus‏ مددي ‎Meg‏ سالب ‎<Mcg minus‏ النمط الألييي ‎Ke‏ سالب ‎-(Ke minus allotype‏ ‎vo‏ (ب) منطقة سلسلة ثقيلة ثابتة للجلوبلين المناعي البشري؛ وفي كلتا الوحدتين البنائيتين كانت السلسلة الثقيلة للجلوبلين المناعي البشري عبارة عن منطقة ثابتة من نوع ‎١ Ls‏ (الأحماض الأمينية أرقام ‎Gy 77-1١6‏ لترقيم كابات لها النمط ‎LY‏ ‏8ه و 0 (ج) ‎(DHFR‏ يحتوي على منطقة الحاث حقيقي النواة ومنطقة تعدد ‎ALY)‏ ‎polyadenylation Ye‏ الخاصة به. ) د ( ‎(NEO‏ يحتوي كذلك على منطقة الحاث حقيقي النواة ومنطقة تعدد الأدتلة الخاصة به. ‎(Y)‏ عليبتا السلسلة الخفيفة والثقيلة للجلوبلين المناعي البشري اللتان تحتويان على تتابعات إشارة تخليقية لإفراز سلاسل الجلوبلين المناعي.) gamma 1(11) of human immunoglobulin heavy chain. This antibody has some oT cell stimulating activity but it is of a lower degree compared to the previous 004 monoclonal antibody activity. However, it is desirable to produce antibodies with The efficacy of emptying T cells is low or non-existent since this would significantly improve their therapeutic potential.These submissions further describe preferred vector systems for the production of such chimeric antibodies” and in particular 5.2 TCAE and TCAE6 include the following: (1) four reproduction cassettes (Yay) of three); In tandem order: (a) Human immunoglobulin invariant light chain region. In transporter 5.2 (TCAE), this region is represented by the kappa constant light chain region of human immunoglobulin 01 (amino acid numbers Gig 711-0178 for capat numbering and 0m16” allelic pattern ((Km3) and in transporter 6 TCAE it is Scimanda constant light chain region of human immunoglobulin (amino acid numbers Gay YY om) cA karate numbering; genotype Oz negative type Oz minus Meg negative <Mcg minus allele type Ke negative - (Ke minus allotype vo (b) a constant human immunoglobulin heavy chain region; in both residues the human immunoglobulin heavy chain was a type 1 Ls constant region (amino acid numbers Gy 77-116 To number cables of type LY 8e and 0(c) (DHFR contains the eukaryotic inductor region and its polyadenylation Ye region ALY). (d) NEO also contains the real inductive region The nucleus and its pluriandric region (Y) The two human immunoglobulin light and heavy chain boxes that contain synthetic signaling sequences for the secretion of immunoglobulin chains.

١ ‏عليبتا السلسلة الخفيفة والثقيلة للجلوبلين المناعي البشري اللتان تحتويان على رابطات دنا‎ )©( ‏نوعية تسمح بإيلاج منطقتي السلسلة الثقيلة والخفيفة المتغيرة للجلوبلين المناعي اللتين تحافظا‎ ‏على إطار قراءة الترجمة ولا تغيران الأحماض الأمينية التي توجد عادة في سلاسل الجلوبلين‎ . ‏المناعي‎1 The human immunoglobulin light and heavy chain canisters contain specific DNA (©) linkers that allow insertion of the immunoglobin variable heavy and light chain regions that maintain the translation reading frame and do not alter the amino acids normally found in globulin chains. Immune

° غير أنه؛ على الرغم مما ذكر ‎(Ele‏ لا تزال هناك حاجة في التقنية لابتكار أجسام مضادة ‎AD uns‏ متخصصة ب ‎(CDE‏ تمتلك تولد مضاد منخفض في البشر؛ ويمكن استخدامها ‎ladle‏ على سبيل المثال؛ لمعالجة الأمراض ذاتية المناعة مثل التهاب المفاصسل شبه الروماتزمي ‎rheumatoid arthritis‏ وعلى وجه التحديد؛ هناك ‎dala‏ لإنتاج أجسام مضادة ل 004 تظهر خواص ‎Ai Tuas‏ على سبيل ‎(JB‏ عمثر نصف أطول و/أو تفتقر أو° is that; Despite what Ele mentioned, there is still a need in the technology to create AD uns antibodies specific for CDE that have low antigenicity in humans; ladle could be used, for example, to treat autoimmune diseases such as arthritis. rheumatoid arthritis and specifically; there is dala for the production of antibodies to 004 showing the properties of Ai Tuas eg (JB) longer half-life and/or lacking or

‎٠‏ تفتقد إلى فعالية الإفراغ بصفة جوهرية. أهداف الاختراع ولبلوغ هذه الغاية؛ ‎Judy‏ هدف الاختراع الراهن في تزويد أجسام مضادة وحيدة النسيلة وخيمرية جديدة متخصصة ب 004 لها خواص ‎dias‏ على سبيل المثالء عمثر نصف ‎(Jbl‏ استمناع منخفض في البشر و/أو فعالية إفراغ خلايا 7 مخفضة أو ‎١‏ معدومة. وبعبارة أدق؛ يتمثل هدف الاختراع في إنتاج أجسام مضادة خيمرية ل 004 تحتوي على جزء لتمييز المستضدات من جلوبلين مناعي مأخوذ من القرد المنتمي للعالم القديم متخصص ب 004 وتتابعات ‎Jia‏ ثابت مأخوذة من إنسان أو 8 وبشكل ‎gala‏ منطقة سلسلة خفيفة ثابتة بشرية من نوع ‎LS‏ أو 1 0 ‎lt‏ وتتابعات منطقة سلسلة ثقيلة بشرية ثابتة من نوع جاما ‎١‏ أو ‎Lila‏ ؛ بشرية أو من نوع جاما ؛ مطفرة لها وظائف مستفعلة متغيرة © وثبات محسسّن يتفوقان على التمط الإسوي ‎.gamma 4 isotype 4 lela‏ ويتمثل هدف أكثر تحديدا للاختراع الراهن في تزويد أجسام مضادة وحيدة النسيلة وخيمرية جديدة تحتوي على تتابع منطقة السلسلة الثقيلة المتغيرة المضاد ل 004 المأخوذ من القرد النوعي المبين في الشكل ‎١‏ وتتابع منطقة السلسلة الخفيفة المتغيرة المضاد ل ‎CD4‏ ‏المأخوذ من القرد المبين في الشكل ‎oF‏ المندمجين مع تتابعات الحقل الثابت المأخوذة من قرد ‎vo‏ أو ‎(lal‏ يفضل تتابع الحقل الثابت للسلسلة الخفيفة من النوع ‎kappa LS‏ أو لتمندا0 lacks substantial emptying efficacy. The objectives of the invention and to achieve this end; Judy The objective of the present invention is to provide novel specific B004 monoclonal and chimeric antibodies that have dias properties eg low immunogenicity half (Jbl) in humans and/or reduced or no 1-cell secretion activity. In other words, More precisely, the objective of the invention is to produce chimeric antibodies to 004 that contain an antigen-discriminating portion of an immunoglobulin taken from an Old World monkey specialized for 004 and constant Jia sequences taken from a human or 8 in the form of a human constant light chain region (gala) of a species LS or 1 0 lt and constant human heavy chain region sequences of gamma-type 1 or Lila; human or gamma-type; mutagen with variable effector functions© and enhanced stability that outperform the .gamma 4 isotype 4 lela A more specific objective of the present invention is to provide novel monoclonal and chimeric antibodies containing the anti-004 variable heavy chain region sequence from the species monkey shown in Figure 1 and the anti-CD4 variable light chain region sequence from the monkey shown in Fig. oF combined with the constant field sequences from monkey vo or lal preferably the light chain constant field sequence of type kappa LS or tamanda

VYVY

‏البشرية أو سلسلة‎ gamma 4 ¢ ‏أو جاما‎ gamma 1 ١ ‏وتتابع المنطقة الثابتة جاما‎ lambda ‏ثقيلة من نوع جاما ؛ مطفرة لها وظائف مستفعلة متغيرة وثبات محسّن يتفوقان على‎ .gamma 4 isotype اماج ‏النمط الإسوي‎ ‏تكفل التعبير عن هذه‎ DNA ‏للاختراع الراهن في تزويد تتابعات دنا‎ Al ‏ويتمثل هدف‎ ‏الأجسام المضادة الخيمرية ل 004 المحسنة والنواقل والخلايا العائلة التي قد تستخدم للتعبير‎ ٠ ‏عن هذه الأجسام المضادة الخيمرية ل 004. ويفضل أن تشتمل هذه النواقل على النواقل‎ ‏التعبيرية المشار إليها في الطلبات التي أدمجت في هذا البيان للإحالة إليها كمرجع؛ ويفضل أن‎ ‏صيني).‎ AB ‏(مبيض‎ CHO ‏تكون الخلايا العائلة عبارة عن خلايا‎ ‏للاختراع الراهن في تزويد تراكيب صيدلية لاستخدامها في‎ AT ‏هدف‎ AIS ‏ويتمثل‎ ‏معالجة أو الوقاية من الاضطرابات المتعلقة ب 004؛ وبشكل خاص الأمراض ذاتية المناعة؛‎ > 0human or gamma 4¢ chain or gamma 1 1 gamma constant region gamma lambda heavy gamma constant region sequence; Mutagen with variable effector functions and improved stability that are superior to the gamma 4 isotype. Expression of these DNAs of the present invention ensures the supply of Al DNA sequences. may be used to express 0 of these chimeric antibodies to 004. These vectors should preferably include the expression vectors referred to in the applications incorporated herein for reference; Preferably Chinese). Especially autoimmune diseases; >0

CD4 ‏أو وقائياً من الأجسام المضادة الخيمرية ل‎ Ladle ‏تحتوي على مقدار فعّال‎ ‏المحسّنة موضوع الاختراع في توليفة مع حامل مقبول صيدلياً.‎ ‏ويتمثل هدف آخر كذلك للاختراع الراهن في تزويد طرق لمعالجة أو الوقاية من‎ ‏الاضطرابات المتعلقة ب 04©؛ وبشكل خاص الأمراض ذاتية المنتاعة وحالات أخرى حيث‎ ‏أو وقائياً من الأجسام‎ Ladle ‏يكون الكبت المناعي مرغوباً عن طريق إعطاء مقدار فَّال‎ ١ ‏المضادة الخيمرية ل 004 الجديدة موضوع الاختراع في توليفة مع حامل مقبول صيدليا.‎ ‏شرح مختصر للرسوم‎ ‏وتتابع الحمض الأميني للحقل‎ DNA Lal) ‏(تتابعا التمييز أرقام: ١-؟): يبين تتابع‎ ١ ‏الشكل‎ ‎.089.1 ‏المتغير خفيف السلسلة ل‎ ‏وتتابع الحمض الأميني للحقل‎ DNA ‏الشكل ؟ (تتابعا التمييز أرقام: “*-؛): يبين تتابع الدنا‎ x. ‏المتغير ثقيل السلسلة ل 1.وع0.‎ ‏وتتابع الحمض الأميني‎ DNA ‏الشكل ؟ (تتابعا التمييز أرقام: 1-5): يبيّن تتابع الدنا‎ ‏البشريين‎ Ja 0 TV ‏للحقلين المتغير والثابت‎ .059.1 ‏في‎ Cd a gallCD4 or protectively chimeric antibodies to Ladle containing an enhanced effective amount of the subject of the invention in combination with a pharmaceutically acceptable carrier. Another objective of the present invention is to provide methods for the treatment or prevention of disorders related to 04© ; In particular, autoimmune diseases and other cases where, or prophylactic from Ladle antibodies, immunosuppression is desirable by administering the amount of Val 1 anti-chimeric new 004 subject of the invention in combination with a pharmaceutically acceptable carrier. Brief explanation of the drawings The amino acid sequence of the DNA Lal domain (discrimination sequence numbers: 1-?): Sequence 1 of Fig. (Discrimination sequence numbers: “*-;): indicates the x DNA sequence. The heavy-chain variant L1. and P0. and the amino acid sequence DNA form? (Discrimination Sequence Numbers: 1-5): The human DNA sequence shows Ja 0 TV for the variable and constant fields .059.1 in Cd a gall

١ ‏وتتابع الحمض الأميني‎ DNA ‏يبيسّن تتابع الدنا‎ :)8<-١7 ‏الشكل 4 (تتابعا التمييز أرقام:‎ ‏يحملان شيفرة تتابع المنطقة المتغيرة والثابتة‎ (pall 0 ‏وتتابع الحمض الأميني‎ DNA ‏الشكل © (تتابعا التمييز أرقام: ؟-١٠): يبيّن تتابع الدنا‎ ‏اللذين يحملان شيفرة تتابع منطقة السلسلة الثقيلة‎ ° .8 ‏البشرية جاما ؛ التي تحتوي على الطفرة‎ ‏وتتابع الحمض الأميني‎ DNA ‏يبيتن تتابع الدنا‎ (VY) ‏(تتابعا التمييز أرقام:‎ ١ ‏الشكل‎ ‏اللذين يحملان شيفرة تتابع منطقة السلسلة الثقيلة‎ ‏التي تحتوي على الطفرتين‎ 4 Lala ‏البشرية‎ ‎.E ‏و‎ ٠١1 The amino acid sequence DNA specifies the DNA sequence 8<-17: Fig. 4 (two recognition sequence numbers: coding for the variable and constant region sequence pall 0) and the DNA amino acid sequence Fig. © (the recognition sequence Numbers: ?-10): the two DNA sequences that code for the sequence of the human 8° .8 heavy chain region indicate the gamma that contains the mutation and the DNA sequence harboring the (VY) DNA sequence (the two recognition sequences). Fig. 1 Fig. 1 that codes for the sequence of the heavy chain region that contains the human mutations 4 Lala E. and 01.

Ag Y=Y ‏اح‎ Js a ‏(تتابعات التمييز أرقام: 55-17) : تبيتن تتابع الحمض النووي لتتابعات قيادية‎ ‏مختلفة مفيدة في الاختراع.‎ ‏الشكل 1 : يبيتن مخطط التبعثر لارتباط 089.1 بخلايا‎ ‏بشرية جديدة‎ (PMCs) ‏أحادية النتواة من دم محيطي‎ ‏عند الربع الأيمن العلوي؛ خلايا‎ A ‏يبين القطاع‎ CuaAg Y=Y Ah Js a (Discrimination sequences Nos. 55-17): The DNA sequence of different lead sequences useful in the invention is shown. Figure 1: The scatter plot of 089.1 binding to new human cells ( PMCs) mononuclear from peripheral blood in the right upper quadrant; Cells A shows sector Cua

OKT3 ‏لمفية صبغت مرتين باستخدام 089.1 و‎ ‏ويبين القطاع 8 عند الربع الأيمن العلوي» مجموعة‎ ‏صبغت مرتين باستخدام 089.1 و 01214؛ ويبين‎ ‏أ القطاع © عند الربع الأيسر السفلي» عدم وجود‎ (CE9.1 ‏خلايا مصبوغة مرتين باستخدام 008 و‎ ‏ويبين القطاع © الضابط خلايا صبغت باستخدام‎ ‏جلوبلين مناعي جي 180 سوي وبشري.‎ 089.1 — Fe ‏تبيتن خواص الارتباط بمستقبلة‎ : ade ga) ٠١ ‏الأشكال‎ ‏وفقاً للرسم‎ CDA" ‏حيث تبيسّن القياسات تراص‎ Yo 1aOKT3 lymphocytes stained twice with 089.1 and sector 8 is shown in the upper right quadrant. Group stained twice with 089.1 and 01214; Sector A shows © in the lower left quadrant” (CE9.1) the absence of cells stained twice with 008 and sector © shows cells stained with normal and human immunoglobin G180. Binding to the receptor: ade ga) 01 Figures according to the drawing “CDA” where the measurements show the agglutination of Yo 1a

VEVE

‏البياني النسيجي لتعداد الخلايا التدفقي للأرومات‎ ‏خلايا وحيدة النواة‎ (I ‏الرابطة مع‎ fibroblasts ‏الليفية‎ ‎Lala ‏حصل عليها حديثاً مستحثة بواسطة انترفيرون‎ 089.1 ‏(007/)؛ حيث استخدمت أجزاء 1768002 من‎Histogram of the flow cell count of blastocytes mononuclear cells (I) associated with fibroblasts fibroblasts newly obtained by Lala induced by interferon 089.1 (007/); where fragments 1768002 of

Jan ‏وحيدة التواة‎ WA ‏كمادة ضابطة سلبية؛ ب)‎ °Jan monogamy WA as negative control; b) °

GINF ‏عليها حديثاً مستحثة أو غير مستحثة ب‎ ‏أو بعدم وجود الجسم‎ SODA ‏وج) في وجود‎ ‏المضاد.‎ ‎(MLR) ‏يبيتن تثبيط تفاعل خلايا لمفية مخلطة‎ : ١١ ‏الشكل‎ ‏بشرية بواسطة 089.1 حيث أ) استخدمت خلايا‎ = dala ‏بشرية‎ PBLs ‏أحادية النواة من دم محيطي‎ ‏عليها حديثاً كمستجيبات واستخدمت خلايا محفزة‎ ‏معالجة بميتوميسين © مأخوذة من متبرع ليس ذي‎ ‏علاقة لاختبار خواص التثبيط لمدى من تراكيز‎ ‏وقيست نسبة التثبيط بمقدار اندماج الثيميدين‎ 1 ‏المستخدم في إنتاج 17-2 وب) أجري‎ thymidine ‏باستخدام مستجيبات مأخوذة من قرود‎ MLR ‏شمبائنزي ومحفزات مأخوذة من قرود شمبانزي‎ ‏وهو عبارة‎ Leu 38 ‏ليست ذات علاقة؛ حيث استخدم‎ ‏عن مضاد 004 بشري مأخوذ من فأرء كمادة‎ 7 ‏ضابطة.‎ ‏يبيتّن خواص التسمم الخلوي المستحث بالخلايا‎ : VY ‏الشكل‎ ‏المعتمد على الجسم المضاد ل 089.1 حيث حفز‎ ‏انحلال الخلايا المستهدفة 5001-18 بوجود خلايا‎ ‏يمثشل‎ 4D9 ‏وحيث‎ Lala ‏مستفعلة محفزة بانترفيرون‎ Yo ‏تأ‎Figure 11: Inhibition of the reaction of mixed lymphocytes (MLR) in human form 11 by 089.1, where a ) Human PBLs mononuclear = dala cells from fresh peripheral blood were used as responders and stimulated cells treated with mitomycin © from an unrelated donor were used to test the inhibition properties for a range of concentrations and the inhibition rate was measured by the amount of fusion thymidine 1 used to produce 17-2 and b) thymidine was performed using effectors from MLR chimpanzees and stimuli from chimpanzees which Leu 38 is unrelated; Where he used a human antibody 004 taken from a mouse as a control material 7. It demonstrates the properties of cell-induced cytotoxicity: VY The antibody-based form of 089.1 stimulated lysis of target cells 5001-18 in the presence of 5001-18 cells It represents 4D9 and where Lala is an active catalyst with interferon Yo Ta

Veo ‏جسم مضاد وحيد النسيلة مضاد ل 004 فأري وهو‎ (1gG2a) IY ‏عبارة عن جلوبلين مناعي جي‎ ‏نسيجياً لتعداد الخلايا التدفقي‎ ily ‏يبيتّن رسماآ‎ : ١١ ‏الشكل‎ ‏بوجود وعدم‎ Sup-T1-18 ‏بخلايا‎ Cl, ‏يبيتن ارتباط‎Veo monoclonal antibody against 004 mouse (1gG2a) IY is a tissue immunoglobulin G for flow cell count ily shows a diagram: Figure 11 with or without Sup-T1-18 cells Cl, is bound

Gl “hag ‏حالة‎ ٠٠٠٠١ ‏وجود 089.1 حيث سجلت‎ ° ‏لنتائج على شكل رسم بياني نسيجي؛ ويمشل‎ ‏أجسام مضادة متعدد النسيلة مأخوذة من‎ 5Gl “hag case 00001 having 089.1 where ° was recorded for results in the form of a histogram; It includes polyclonal antibodies taken from 5

Ghd ‏قرد بها عيار مصلي مرتفع من مضاد 004؛‎ ‏بالإضافة إلى مضاد‎ Clg ‏المادة الضابطة السلبية في‎ .CE9.1 ‏ل ,01 بوجود‎ ١ ‏يبيتّن معايرة التسمم الخلوي المعتمد على المتممة‎ : Ve ‏الشكل‎ ‏ل 089.1 حيث يتم انحلال الخلايا 5001-18 بوجود‎ 409 ‏والمتممة المأخوذة من الأرنب» حيث‎ 1 ‏مادة ضابطة فأرية مضاد ل 004 من الفئة‎ Jia ‏الفرعية 15028 التي تكون قادرة على تثبيت المتممة؛‎ Vo ‏يمثل مزيجاً من أجسام مضادة‎ PRO 965 ‏وحيث‎ ‏متعددة النسيلة مأخوذة من مصل قرد السينومولجس‎ ‏بها عيار مرتفع من مضاد‎ cynomolgus monkey .CD4 ‏أجريت‎ lle ‏يبيتن دراسة عقاقيرية لجرعات‎ : Yo ‏الشكل‎ vy. ‏على ستة قرود من الشمبانزي؛ حيث عبثشر عن‎ peripheral ‏في الدم المحيطي‎ CD8 «CD4 ‏مستويات‎ ‎٠٠٠١و‎ Vow ‏مدى فترة تراوحت بين‎ Je blood ‏يوم؛ وتبيتن كذلك منحنيات 008-003 التي تشير‎ ‏في 04©؛ القطاع العلوي:‎ Aad) ‏إلى عدد الخلايا‎ YoGhd monkeys with a high sero-titer of anti-004; in addition to anti-Clg the negative control in CE9.1 L. 01, in the presence of 1 assay of complement-dependent cytotoxicity: Ve Figure L 089.1 where cells 5001-18 are lysed in the presence of 409 and the complement taken from the rabbit, where 1 mouse anti-L 004 control of Jia subclass 15028 that is able to stabilize complement; Vo represents a mixture of antibodies Whereas, PRO 965 is a polyclonal extract taken from the serum of cynomolgus monkeys, which has a high titer of anti-cynomolgus monkey CD4. A pharmacological study was conducted for two doses: Yo Fig. vy. on six chimpanzees; Where he tampered with peripheral CD8 CD4 levels in the peripheral blood of 0001 and Vow over a period that ranged between Je blood a day; Curves 003-008 denote in 04©; Upper sector: Aad) to the number of cells Yo

TeTe

يا الفئة-١‏ وتمثل المجموعة التي تلقت محلولا ملحياً. حيث روقبت تعدادات الخلايا وحيث تشير الأسهم إلى جرعات 089.1. القطاع الأوسط: الفئفة-؟ ‎JA‏ قردين من قرود الشمبانزي التي تلقت ‎٠ °‏ مجم/كجم من 089.1. وكرر إعطاء الجرعة عندما عادت ‎dad‏ تعدادات 004 إلى ‎dad‏ تبلغ حوالي ‎0٠‏ من خط الأساس. القطاع السفلي: الففة-؟ وتمثل قردين من قرود الشمبانزي التي تلقّتت ‎٠١‏ ‏مجم/كجم من 089.1. وكرر إعطاء الجرعة ‎Ve‏ عندما عادت قيمة تعدادات 604 إلى قيمة تبلغ حوالي ‎90٠‏ من خط الأساس. الشكل ‎١١‏ (تتابعات التمييز أرقام: 99-057): يبيتن بوادئ تفاعل بوليمراز التسلسلي ‎(PCR)‏ الملائمة للحصول على المنطقة الثابتة البشرية جاما 4 . ‎ye‏ الشكل ‎١7‏ (تتابعا التمييز أرقام: ‎:)١7-١١‏ يبيتن تتابع السلسلة الثقيلة ل ‎.CEPY4PE‏ ‏الشكل ‎YA‏ : يبيتن الرحلان الكهربائي ‎electrophoresis‏ ‏على هلام من متعدد أكريل أميد باستخدام كبريتات دودسيل الصوديوم ‎SDS-polyacrylamide‏ ‎CE9Y4E(G4E) «CE9y4(G4) «CE9.1 — gel‏ و ‎-CE9YPE(G4PE) Y.‏ ويبين جزيء الوحدة النصفية ‎Halfmer‏ عند وزن جزيثئي بلغ ‎Av‏ كيلو دالتون الشكل ‎Ya‏ : يتضمن بيانات تمثل طوري الارتباط والتفكك لمنحنيي تقدم ‎SPR‏Class O-1 represents the group that received the saline solution. where cell counts were monitored and where arrows indicate 089.1 doses. Middle Sector: Class-? JA Two chimpanzees received 0° mg/kg of 089.1. Repeat dose administration when dad counts of 004 returned to dad of about 00 from baseline. Bottom sector: Alfafa-? It represents two chimpanzees that received 10 mg/kg of 089.1. Repeat administration of the Ve dose when the 604 counts returned to a value of about 900 from baseline. Figure 11 (Tagging Sequence Nos: 99-057): Suitable PCR primers for obtaining the human gamma4 constant region. ye Figure 17 (discrimination sequence numbers: 11-17). Sodium SDS-polyacrylamide CE9Y4E(G4E) “CE9y4(G4)” CE9.1 — gel and -CE9YPE(G4PE) Y. The Halfmer half-unit molecule at a molecular weight of Av kDa is shown in Fig. Ya: includes data representing the association and dissociation phases of the two SPR progression curves

لا الشكل ‎٠١‏ : يبيتتن تأشير الوحدات البنائية من جسم مضاد وحيد النسيلة ل 604 في ‎MLR‏ الرئيسي. الشكل ‎7١‏ : يبيتّن التصاق النسل الخلوي 1117-1 وحيد النواة المستحث بفعل 17801 بنواتج العدوى ° التحويلية للأرومات الليفية ل *004. الشكل ‎YY‏ : يبيّتن التصاق يتوسطه ‎JS‏ من 4ص 5 ‎FcR‏ ‏ل 89.1» ‎CE9y4E «CE9y4‏ و ‎.CE9y4yK‏ ‏الشكل ؟؟ : ‎("aw‏ نتائج ‎CDC‏ و0062 عند استخدام ‎«CE9Y4PE‏ 089.1 وجسم مضاد وحيد النسيلة ‎١‏ تثبيتي فأري ل 004 ‎Hu‏ ‏الشكل ‎Ye‏ : يبيتن التراكيز في البلازما بعد إعطاء جرعة بلغت ‎١‏ مجم/كجم من ‎CE9Y4E‏ و 48و08 فلي جرذان من نوع سبراجيو-داولي ‎.Sprague-Dawley‏ ‎١٠‏ الشكل ‎Yo‏ : يبيتن تأثير المعالجة باستخدام أجسام مضادة وحيدة النسيلة على استجابة الأجسام المضادة المتخصصة بألبومين البيضة في فثران ‎HuCD4‏ ‏المعكفلة ‎.transgenic Wl yg‏ الوصف التفصيلي للاختراع ‎Y.‏ يزود الاختراع الراهن أجساماً مضادة خيمرية وحيدة النسيلة جديدة متخصصة ب 4 تشتمل على جزء الارتباط بالمستضد لمنطقة متغيرة من جسم مضاد وحيد النسيلة — ‎CD4‏ مأخوذ من قرد ينتمي للعالم القديم مدمج في تتابعات الحقل الثابت المرغوبة المأخوذة من إنسان أو قرد؛ ويفضل تتابع الحقل الثابت ثقيل ‎ALL‏ البشري ‎Lala‏ ١؛‏ جاما ؛ أو جاما ؛ مطفرة وتتابع الحقل الثابت خفيف السلسلة البشري من نوع كابا أو لتمندا. وتتظهر ‎vo‏ هذه الأجسام المضادة خواصاً محسنة بالنسبة للأجسام المضادة وحيدة النسيلة ل 004 1.1Figure 01: Residue-marking of a monoclonal antibody to 604 resides in the primary MLR. Figure 71: Adhesion of the 17801-induced mononuclear progeny 1117-1 to the transforming products of ° fibroblast infection of *004. Figure YY: JS-mediated adhesion of 4p5 FcR of 89.1 “CE9y4E” CE9y4 and CE9y4yK. Figure ?? : “aw results of CDC and 0062 when using “CE9Y4PE 089.1 and a mouse monoclonal antibody 1 fixative for Hu 004 Figure Ye: concentrations remain in plasma after administration of a dose of 1 mg / kg of CE9Y4E and 08.48 FLE of Sprague-Dawley rats. 10 Figure yo: The effect of monoclonal antibody treatment on the albumin-specific antibody response in HuCD4 thighs is demonstrated. . Desirable constant field sequences from human or ape; preferably human ALL heavy chain constant field sequence Lala 1;gamma; or gamma; mutagen and human light chain constant field sequence of type kappa or lamanda. improved properties relative to the monoclonal antibody to 1.004

اa

التقليدية؛ على سبيل المثال؛ ألفة عالية نحو ‎CD4‏ البشري واستمناع ضئيل أو معدوم في الإنسان. وتظهر الأشكال المعدلة لجاما ؛ وظيفة مستفعلة مخفضة أو معدومة» على سبيل ‎(Jia)‏ فعالية ارتباط بمستقبلة ‎Fo‏ أو تثبيت المتممة؛ وفعالية إفراغ خلايا ‎T‏ ضئيلة أو معدومة. ويمكن إيجاد طرق للحصول على الأجسام المضادة وحيدة النسيلة المأخوذة من القرد ° المنتمي للعالم القديم المتخصصة ب 004 ونسائل تنتج ‎J‏ لأجسام المضادة وحيدة النسسيلة المأخوذة من القرد المنتمي للعالم القديم المتخصصة ب 004 في طلبات براءات الاختراعtraditional; For example; High affinity for human CD4 and little or no immunogenicity in humans. Modified shapes are shown for gamma; reduced or no effector function” eg (Jia) binding activity to the Fo receptor or stabilization of complement; There is little or no effect of emptying T cells. Methods for obtaining Old World monkey antibody 004 and clones producing J for Old World monkey antibody 004 can be found in patent applications

ذات الصلة المشار إليها ‎Gils‏ والتي أدمجت في هذا البيان للإحالة إليها كمرجع. ‎JC‏ عام؛ تشتمل هذه الطرق على تمنيع قرد ينتمي للعالم القديم من مستضد ‎CD4‏ ‏البشري في ظروف بحيث ينتج القرد المنتمي للعالم القديم أجساماً مضادة ل ‎«CD4‏ تخليدrelated referenced to Gils which are incorporated into this release for reference. JC General; These methods include immunizing an Old World monkey with human CD4 antigen in conditions such that the Old World monkey produces “immortalizing” CD4 antibodies.

‎٠‏ خلايا القرد التي تكون مسؤولة عن إنتاج الأجسام المضادة ل 004؛ على سبيل ‎«Jal‏ عن طريق اندماج الأورام الهجينية؛ التحويل الفيروسي بواسطة الفيروس المأخوذ من قرد الرباح هربس بابيو ‎«Herpes papio‏ تتسيل خلايا ‎B‏ المفردة (المسمى أيضاً "التخليد العابر') ‘ وإنتاج مكتبة من الجلوبلينات المناعية المأشوبة. وفي تجسيدات مفضلة؛ تشتمل هذه الطريقة على اختيار خلية ‎B‏ مأخوذة من القرد سواء من كرية بيضاء لدم محيطي؛ الطحال؛ نخاع العظم أو0 monkey cells that are responsible for producing antibodies to 004; Jal by fusion of hybridomas; Viral transformation by virus from the monkey baboons 'Herpes papio' cyclizes single B cells (also termed 'transient immortalization') and produces a library of recombinant immunoglobulins. In preferred embodiments, this method includes B cell selection taken from the monkey either from peripheral blood leukocyte; spleen; bone marrow or

‎vo‏ العقدة اللمفية؛ اختيار لب ينتج الجسم المضاد الملائم؛ استخلاص ‎GB) ga‏ الجلوبلين المناعي التى تحمل شيفرة ذلك الجسم المضاد من النسل الخلوي الذي تم تخليده؛ والتعبير عن المورثات في نسل خلوي منتج ‎gl)‏ نسل خلوي يتيح إنتاج الجسم المضاد بدرجة كافية للاستفادة منه في العلاج البشري). وكما هو موضح في الطلبات المشار إليها أعلاه؛ تشتمل القرود الأوروبية على قرود الرباح والمكاك (التي من ضمنها قرد الريص وقرد السينومولجس).vo lymph node; selection of a core that yields the appropriate antibody; extraction of the (GB) ga immunoglobulins encoding that antibody from the immortalized cell line; and the expression of the genes in a progenitor cell line (gl) (a cell line that enables production of the antibody sufficiently to be useful in human therapy). and as described in the requests referred to above; European monkeys include baboons and macaques (including rhesus monkeys and cynomolgus monkeys).

‎LS 7‏ نوقش أعلاه؛ تشتمل الأجسام المضادة الخيمرية موضوع الدراسة في التجسيدات المفضلة على تتابعات السلسلة الخفيفة المتغيرة والثقيلة المتغيرة المأخوذة من القرد المنتمي للعالم القديم والمضادة ل 004 المبينة في الشكلين ‎١‏ و*؛ المدمجة في تتابعات الحقل الثابت البشري. وتوصف طرق مناسبة للحصول على تتابعات الحقل المتغير للسلسلة الخفيفة والثقيلة النوعية هذه بالتفصيل في طلبات براءة الاختراع الأمريكية بالرقم المتسلسل ‎٠8/597167‏LS 7 discussed above; The chimeric antibodies studied in the preferred embodiments include the variable light chain and variable heavy chain sequences from Old World monkey anti-004 shown in Figures 1 and *; Embedded in human static field relays. Appropriate methods for obtaining the variable field sequences of these specific light and heavy chains are described in detail in US Patent Applications Serial No. 08/597167

‎«lu Yo ‏المودع في‎ cv ‏رم‎ VY, «VY ‏وبالرقم المتسلسل‎ a) 4. + ‏يونيو‎ VY ‏المودع فى‎ Yo“lu Yo deposited in cv rum VY,” VY with the serial number a) 4. + June VY deposited in Yo

‎1.11.1

٠ ‏التي أدمجبت‎ VAY ‏يوليوء‎ ٠١ ‏5م وبالرقم المتسلسل 7/917,797١؛؛ المودع في‎ ‏جميعها في هذا البيان بكافة محتوياتها للإحالة إليها كمرجع. وتكشف هذه الطلبات كذلك عن‎ ‏تتابع الحمض الأميني والحمض النووي الكامل لهذه التتابعات.‎ ‏وقد تدمج تتابعات الحقل المتغير للسلسلتيئن الخفيفة والثقيلة هذه مع أي تتابع من‎ ‏م تتابعات الحقل الثابت البشري المرغوبة. وسيؤثر الاختيار المحدد على وظيفة المستفعلة للجسم‎ ‏المضاد الخيمري ل 004 الناتج. ويفضل أن يشتمل الحقل الثابت ثقيل السلسلة البشري على‎ ‏ثابت جاما ؛ مطفر يشار إليه في هذا البيان بالرمز‎ Jia ‏جاما 4 أو‎ ؛١‎ Lala ‏الحقل الثابت‎ ‏؛‎ lala ‏ويعتبر اختيار‎ APE ‏جاما 48 أو جاما ؛ مطفّر يشار إليه في هذا البيان بالرمز جاما‎ ‏أو تفتقر بصفة‎ Lalo ‏نظراً لأنه كما تبيّن يؤدي إلى إنتاج أجسام مضادة خيمرية تفتقر‎ Tada ‏ويعتقد بأن هذا‎ .)١ ‏جوهرية إلى فعالية إفراغ خلايا 7 (تتراوح من 96100-860 مقارنة بجاما‎ ‏صحيح نظراً لأنه يكون الحقل الثابت جاما ؛ غير قادر على ربط المتممة. وقد تود طفرة‎ ‏في الحقل الثابت كذلك لتحسين خواص الجسم المضاد الخيمري الناتج» على سبيل المثال‎0 which merged VAY July 01 5 AD with serial number 7/917,7971 ;; All of the deposited in this statement with all its contents for reference. These requests also disclose the complete amino acid and DNA sequences for these sequences. These light and heavy chain variable field sequences may be combined with any of the desired human constant field sequences. The specific selection will affect the effector function of the resulting chimeric anti-004 antibody. It is preferable that the human heavy-chain constant field include a gamma constant; mutagen referred to in this statement by the symbol Jia gamma 4 or 1 Lala constant field lala and the choice of APE is considered to be gamma 48 or gamma 1; A mutagen referred to in this statement as gamma or lacking as Lalo because it has been shown to produce chimeric antibodies lacking Tada and this is believed to be intrinsic to cell-clearing activity7 (range 860-96100)1. Comparing to gamma is correct since the constant field is gamma; it is unable to bind the complement. A mutation in the constant field may also be desired to improve the properties of the resulting chimeric antibody, for example.

E ‏الخصوص» يعتبر التحويران 7 و‎ day Jey ‏الثبات و/أو للتخلص من فعالية الإفراغ.‎E specials » Modifications 7 and day Jey are considered to stabilize and/or to eliminate emptying efficacy.

Lol ‏؛ في منطقة الرزّة يمنحان‎ Lela ‏4؛ اللذان سيوصفان أدناه؛ تحويرين للحقل‎ Lala ‏للحقل‎ ‏محسٌّن الفعالية ويتخلصان من فعالية الإفراغ. وعلاوة على ذلك؛ يتوقع أن تزوٌ تحويرات‎ vo ‏أخرى أيضاً أجساماً مضادة خيمرية لها خواص محتّنة.‎ ‏ويفضل أن يتمثل الحقل الثابت البشري خفيف السلسلة الموجود في الأجسام المضادة‎ ‏البشرية من نوع‎ AL LL ‏موضوع الدراسة في المنطقة الثابتة خفيفة‎ CDA ‏الخيمرية ل‎ ‏نمدا أو كاباء والأفضل أن تتمثل في المنطقة الثابتة خفيفة السلسلة البشرية من نوع‎ ‏وتعرف تتابعات الحمض النووي وتتابعات الدنا التي تحمل شيفرة الحقول الثابتة‎ data TY »٠ ‏تتابعات الحمض‎ AK ‏التقنية. وتزود‎ (Bata TT ‏4؛ كابا‎ Lela) ‏البشرية من نوع جاما‎ ‏وتتابعات الحقل الثابت من‎ PE ‏الأميني والحمض النووي للحقل البشري جاما ؛ والطوافر 5 و‎ ‏على التوالي.‎ oF ‏الأشكال ؛-١ والشكل‎ Slat a Te i ‏وتشتمل التجسيدات النموذجية للاختراع على جسم مضاد وحيد النسيلة خيمري ل‎ ‏يشتمل على حقول ربط المستضد التي يحصل عليها من‎ CEL ‏يشار إليه بالرمز‎ oe siCD4 vo 1.7lol; In the Al-Razza region, they give Lela 4; which will be described below; Two field modifications, Lala, of the Potency Enhancer field, and eliminate the voiding activity. Furthermore; Other vo mutations are also expected to supply chimeric antibodies with immunomodulatory properties. The human light chain constant field present in the studied human AL LL antibody is preferably represented by the chimeric CDA light constant region of Nimda or Kabaa, and it is better to be represented in the constant region of the human light chain of the type, and it defines the DNA sequences and the DNA sequences that carry the code for the fixed fields “data TY” 0 DNA sequences AK technical. Human gamma-type (Bata TT 4; kappa Lela) constant field sequences from PE and human gamma field DNA are provided; and variants 5 and oF, respectively. Figures-1 and Figure Slat a Te i; and exemplary embodiments of the invention include a chimeric monoclonal antibody to comprising antigen-binding domains obtained from CEL denoted by the symbol oe siCD4 vo 1.7

Y.Y.

قرود المكاك السينومولجسية التي منّعت ب 004 بشري (مبينة في الشكلين ‎Ys)‏ ‏توليفة مع الحقول الثابتة ل 1501 البشري؛ والأجسام المضادة الخيمرية وحيدة النسيلة المشتقة منهاء على سبيل المثال» ‎«CE9y4‏ 0894716 و ‎«CE9y4E‏ 0897408 التي تمتلك نفس حقول ربط المستضد ل 089.1 إلا أنها تمت هندستها وراثياآً بالمنطقة الهيكلية للارتباط ب ‎Fe‏ ل م 1204 البشري. ويحتوي الجسم المضاد وحيد النسيلة 089:41 على طفرة ‎(L236E)‏ حيث استعيض عن اللوسين ‎leucine‏ بحمض الجلوتاميك ‎glutamic acid‏ بجانب منطقة الرزة للجسم المضاد (تحوير من نوع ‎(BE‏ ويحتوي الجسم المضاد وحيد النتسيلة 0897428 على نفس الطفرة التي استعيض بها عن اللوسين بحمض الجلوتاميك بالإضافة إلى طفرة ‎(S229P)‏ حيث استعيض عن السيرين ‎serine‏ بالبرولين ‎proline‏ (تحوير من نوع "2" و "7). ويختلف الجسم ‎Ve‏ المضاد .8974157 عن 089/4 بالاستعاضة عن منطقته الثابتة خفيفة السلسلة من 1 بشريSinomological macaques immunized with human 1501 (shown in Figures Ys) in combination with constant fields of human 1501; Chimeric monoclonal antibodies derived from eg CE9y4 0894716 and CE9y4E 0897408 possess the same antigen-binding domains of 089.1 except that they have been genetically engineered with the structural region to bind to human FeLM1204. The monoclonal antibody 089:41 contains a mutation (L236E) where leucine was replaced by glutamic acid next to the anchor region of the antibody (a modification of the type (BE) and the monoclonal antibody 0897428 contains the same mutation In which leucine was replaced by glutamic acid, in addition to the (S229P) mutation, where serine was replaced by proline (a “2” and “7” type modification). The Ve antibody .8974157 differs from 089/4 by replacing its fixed light-chain region of 1 human

بالنمط الفرعي 7 البشري. ولقد أجريت هذه التحولات والطفرات للحقل الثابت ‎Tks‏ لأنه من المعروف أن الاستجابات الحيوية للأجسام المضادة ‎IgG‏ تعتمد على تركيب حقولها عند النهايات الكربوكسيلية؛ أي؛ نمطها الإسوي. وبالتالي؛ عن طريق تغيير النمط الإسوي للجسم المضاد - بواسطة هندسة البروتينات؛ يكون من الممكن تعديل الاستجابة الحيوية لجسم مضاد ‎IgG‏ ‏بشكل ‎(Jd‏ وعلى وجه التحديد الأجسام المضادة وحيدة النسيلة الخيمرية ل ‎CD4‏subtype 7 human. These mutations were made of the Tks constant field because it is known that the biological responses to IgG antibodies depend on the structure of their fields at the carboxylic terminus; any; its isotype. And therefore; by altering the isotype of the antibody - by engineering the proteins; It is possible to modulate the biological response to an IgG antibody in the form of Jd, specifically chimeric monoclonal antibodies to CD4.

موضوع الدراسة. وتتمثل النتيجة المرغوبة لاستراتيجية الهندسة هذه في أنه لن يقلل تغيير الأنماط الإسوية للجزء ‎Fe‏ في الجسم المضاد من ألفة الربط لمناطق ‎Fab‏ التي تربط المستضد 004. ‎٠‏ غير أنه؛ لم يكن هذا معروفآً في البداية. وكان من المحتمل أنه قد يؤثر تغيير المنطقة الثابتة أو تحويرها بشكل عكسي على ربط 004. ولذلك؛ اختبرت الأجسام المضادة الناتجة لتحديد تأثيرات التحوير على خواص الجسم ‎clad‏ وبالأخص على ربط المستضد 004. ولقياس التأثيرات الممكنة الناتجة عن تغيير الحقل الثابت على ربط المستضد؛ فإنه يمكن استخدام طرق معايرة معروفة. وعلى وجه الخصوص؛ أجريت دراسة على التفاعل بين 004 و ‎«CE9y4AK «CE9y4 «CE9.1 Yo‏ 8942 و ‎CE9y4Pe‏ باستخدام تحليل سكاتشرد ‎Scatchard‏ ورنينThe subject of the study. The desired outcome of this engineering strategy is that altering the isotypes of the Fe part of the antibody will not reduce the binding affinity of the Fab regions that bind antigen 004. 0 However; This was not known at first. It was possible that changing or morphing the fixed region could adversely affect the binding of 004. Therefore; The resulting antibodies were tested to determine the effects of the modulation on the properties of the clad antibody and in particular on 004 antigen binding. To measure the possible effects of altering the static field on antigen binding; It can use known calibration methods. In particular; A study was conducted on the interaction between 004 and “CE9y4AK” CE9y4 “CE9.1 Yo 8942 and CE9y4Pe using Scatchard analysis and resonance

صs

‎Osa All‏ السطحي ‎surface plasmon resonance (SPR)‏ و أظهرت نتائج هذه المعايرات أنهOsa All surface plasmon resonance (SPR), and the results of these calibrations showed that

‏كان ارتباط 004 بكل من الأجسام المضادة التي تم اختبارها متكافثاً. ولقد وجد أن جميع قيم004 was bound to each of the antibodies tested. I have found that all values

‏ثوابت التفكك عند الاتزان عند درجة حرارة بلغت © 7م (درجة مئوية) بالنسبة لارتباط ‎CD4‏Dissociation constants at equilibrium at a temperature of © 7 °C (°C) for CD4 binding

‏بالأجسام المضادة عند قياسها بواسطة ‎SPR‏ بلغت ‎٠.١‏ نانومولار تقريباً. وأظهرت القياساتThe antibody yield when measured by SPR was approximately 0.1 nanomolar. Measurements are shown

‏0 كذلك أنه:0 also:

‎)١(‏ يحدث ارتباط 004 بالأجسام المضادة بواسطة نموذج ربط متماثل ومستقل عند(1) Binding of 004 to antibodies occurs by a homologous and independent binding motif at

‎{Ora ga‏ و{Ora ga and

‎(Y)‏ تكون خواص الربط الوظيفية لحقول ربط المستضد مستقلة عن التحويرات البنيوية التي(Y) The functional binding properties of antigen-binding domains are independent of the structural modifications they make

‏تجرى للجزء ‎Fe‏ في الجسم المضاد ‎Lay‏ في ذلك الأنماط الإسوية جاما ٠؛ ‎Lola‏ ؛ أو جاما ؛ ‎٠‏ - المطفر. وبناءً عليه؛ يثبت الاختراع الراهن أنه قد يكون تغيير الأنماط الإسوية بين 1501 وThe Fe part of the Lay antibody is bound to include gamma-0 isotypes; Lola; or gamma; 0 - Mutagen. Accordingly; The present invention establishes that alteration of isotypes between 1501 and

‏4 استراتيجية مفيدة لهندسة الأجسام المضادة بدون فق د ألفة ربط المستضد وعلى وجه4 A useful strategy for engineering antibodies without loss of antigen-binding affinity

‎.CD4 ‏ربط الأجسام المضادة ب‎ capa).CD4 binding of antibodies to capa)

‎ اماجب‎ ١ ‏سيوصف أدناه» وجد كذلك أنه عند الاستعاضة عن الحقل الثابت جاما‎ LS1 will be described below.” It was also found that when replacing the static field with gamma LS

‏55 خفض الارتباط بالمستقبلة ‎(Fe‏ تثبيت المتممة وفعالية إفراغ خلايا ‎T‏ بصفة جوهرية وكذلك ‎٠‏ أدت التحويرات من 8 و ‎P‏ على الترتيب إلى إلغاء ربط مستقبلة ‎Fe‏ وفعالية إفراغ خلايا 755 Decreased binding to the Fe receptor (Fe) Complement stabilization and significantly reduced emptying activity of T cells, as well as 0 Modifications of 8 and P, respectively, resulted in debinding of the Fe receptor and efficient emptying of 7 cells

‏بشكل إضافي وزودت ‎Gta BLE‏ للأجسام المضادة. وبناءً عليه؛ فإنه من المعقول افتراضAdditionally, Gta BLE was supplemented with antibodies. Accordingly; It is reasonable to assume

‏أنه يمكن اختيار الأجسام المضادة الخيمرية الأخرى الناتجة ‎GE‏ للاختراع ‎al)‏ متتIt is possible to choose other resulting chimeric antibodies (GE) of the invention (al) died

‏هندستها بحيث تحتوي على الحقل الثابت البشري ‎Lala‏ ؛ أو أشكاله المطفرة)؛ بحيث تمتلكengineered to contain the human constant field Lala ; or its mutagenic forms); so that owns

‏وظيفة مستفعلة ‎Fo‏ متغيرة؛ تفتقر بصفة جوهرية أو تفتقر تمامآ إلى فعالية إفراغ خلايا 7؛ ‎vo‏ و/أو تظهر ‎laa BLE‏ وتعرف طرق معايرة فعالية إفراغ ‎oT WA‏ وظيفة مستفعلات ‎Fo‏passive function Fo variable; substantially or completely lacking effective 7-cell vacuolization; vo and/or laa show BLE and methods for calibrating the efficacy of emptying oT WA define the function of the Fo reactants

‏وثبات الأجسام المضادة في التقنية.And the stability of antibodies in the technique.

‎Slug‏ عليه؛ يزود الاختراع الراهن ‎Labial‏ مضادة مأشوبة نوعية تمثل أجساماً مضادةslug on it; The present invention provides a specific recombinant antibody representing antibodies

‏وحيدة النسيلة خيمرية مأخوذة من ثديي رئيسي/إنسان توجه نحو المستضد 004 البشريA chimeric monoclonal from a primate mammal/human directed towards human antigen 004.

‏وتظهر خواصاً محسنة؛ على سبيل ‎(JE‏ فعالية إفراغ ‎WA‏ 7 منخفضة وثبات أكبر. ‎play‏ ‎vo‏ على هذه ‎(pal pall‏ يكون لهذه الأجسام المضادة المأشوبة فائدة خاصة كمعدلات مناعيةIt shows improved properties; For example (JE) lower WA 7 emptying potency and greater stability. play vo on these (pal pall) These recombinant antibodies have particular utility as immunomodulators

‏اa

YYYY

‏التهاب المفاصسل شبه‎ Je ‏وتعتبر مفيدة بصفة خاصة لمعالجة الأمراض ذاتية المناعة‎ ‏بالإضافة إلى أعراض غير‎ (SLE) ‏الروماتزمي؛ الصدفية؛ الذئبة الإحمرارية الجهازية‎ ‏رد فعل العائل للطعم)‎ (a ye) ‏مرض الطعم مقابل المعيل‎ Jie ‏الأعراض ذاتية المناعية‎ ‏(فيروس نقص المناعة‎ HIV ‏رفض الأعضاء المزروعة؛ الربو والإصابة ب‎ (GVHD) ‏م البشرية). كما أنه تستخدم الأجسام المضادة موضوع الدراسة كعوامل مساعدة في العلاج‎ ‏وعلى وجه الخصوص؛ قد تعطى الأجسام المضادة موضوع الدراسة قبل؛‎ OE) pall ‏المتعلق‎ ‏أثناء وبعد إعطاء ناقل (يحتوي على دنا علاجي) لمنع أو خفض الاستجابة الخلطية للعافل‎ .004 ‏تجاه الناقل المذكور. وتعتبر هذه الأمراض أمثلة لحالات مرتبطة ب‎ ‏وصف بتفصيل أكبر في الأمثلة؛ يتم توليد الجسم المضاد المأشوب 089.1 عن‎ WS ‏المتغيرة لربط المستضد المأخوذة من قرد مكاك سينومولجسي في‎ Fy sis ‏طريق تطعيم‎ ٠ ‏مناطق ثابتة بشرية؛ على سبيل المثال؛ حقول ثابتة 1801. وعلى وجه التحديد؛ يشتمل الجسم‎ ‏والحقل البشري لََمْدا. ويشتمل كل من‎ ١ ‏المضاد 0189.1 على الحقل البشري جاما‎ (die ‏على الحقل الثابت جاما ؛ أو شكل مطفر‎ CE9Y4PE ‏و‎ CE9y4E «CE9y4AK «CE9y4 ‏كابا. ولا يمكن تمييز تتابعات الجسم المضاد المأشوب الناتج‎ Slat 0 TT ‏والمنطقة الثابتة‎ ‏عن تتابعات الجلوبلين المناعي البشري. ونتيجة لذلك؛ ينبغي أن تظهر هذه الأجسام المضادة؛‎ ve ‏بالإضافة إلى الأجسام المضادة ل 004 الأخرى الناتجة باستخدام طرق مشابهة؛ عند إعطائها‎ ‏بالمقارنة مع أجسام مضادة‎ Unf ‏في أجسام البشر استمناعا مخفضاً أو معدوماً وتصفية مصلية‎ .004 ‏خيمرية فأرية-بشرية أو وحيدة النسيلة فأرية مشابهة موجهة نحو‎ ‏في 004 البشري؛ وليس المأخوذ من قرد‎ ١ ‏ويرتبط الجسم المضاد 059.1 بالحقل‎ ‏على الخلايا‎ Tg sil) ‏من‎ MHC ‏وهو يمثل منطقة تشترك في التفاعل مع جزيئات‎ Sa Y. ‏المائحة للمستضد. وقد أظهرت المعايرات أيضاً أنه تمتلك الأجسام المضادة النموذجية الأخرى‎ .089.1 ‏نفس خواص ربط المستضد ل‎ ‏ولقد لوحظت فعالية معدّلة للمناعة شديدة باستخدام الجسم المضاد 089.1 في أنبوب‎ reduced ‏على هذه الخواص» أي؛ الاستمناع المخفض‎ Sli ‏الاختبار وفي الجسم الحي.‎ ‏التصفية المصلية الأبطأ والتعديل المناعي الفعَّال؛ مقارنة مع الأجسام‎ «immunogenicity Yo yy المضادة وحيدة النسيلة ل 004 البشري المعروفة الأخرى المأخوذة من الفئران أو القوارض؛ ينبغي أن يكون هذا الجسم المضاد بالإضافة إلى الأجسام المضادة الأخرى المذكورة في هذا البيان مناسبا بصفة خاصة للعلاج طويل الأمد للأمراض حيث يعتبر الكبت المناعي مرغوباء على سبيل المثال؛ الاضطرابات ذاتية المناعة والأمراض الالتهابية المزمنة مثل التهاب ‎٠‏ المفاصل شبه الروماتزمي ‎Rheumatoid arthritis RA‏ غير أنه؛ كما هو متوقع ينبغي أن تكون هذه الأجسام المضادة مفيدة لمعالجة العديد من الحالات المرضية الأخرى ‎Lay‏ في ذلك على سبيل المثال؛ التهاب الدرقية لهاشيموتى ‎thyroiditis‏ 191000 الأوديما المخاطية الأولية ‎pant) primary myxoedema‏ الدرقي/مرض جريفز ‎cthyrotoxicosis/Graves disease‏ فقر الدم الخبيث ‎¢pernicious anaemia‏ التهاب المعدة الضموري ذاتي المناعة ‎autoimmune atrophic‏ ‎gastritis ١‏ التهاب القلب ذاتي ‎cautoimmune carditis de Lidl‏ مرض أديسون ‎«Addison's disease‏ انقطاع الحيض المبكر ‎cpremature menopause‏ الداء السكري من النوع ]1 ‎type I-diabetes‏ ‎mellitus‏ متلازمة جودباستور ‎«Good pastures syndrome‏ الوهن العضلي الوخيم ‎myasthemia‏ ‎«gravis‏ التصلب المتعدد ‎sclerosis‏ 6م101 العقم عند الذكور ‎infertility‏ عاد» الفقاع الدارج ‎cpemphigus vulgaris‏ المرض الفقعاني ‎2a! pemphigoid‏ الودي ‎«sympathetic ophthalmia‏ ‎Vo‏ التهاب العنبة العدسي ‎cphacogenic uveitis‏ فقر الدم الانحلالي ذاتي المناعة ‎autoimmune‏ ‎chaemolytic anaemia‏ فرفرية ذاتية بقلة الصفيحات الدموية ‎idiopathic thrombocytopenic‏ ‎purpura‏ قلة ‎LAN‏ البيضاء الذاتي ‎cidiopathic leucopenia‏ التشمع الصفراوي الأولي ‎primary‏ ‎cirrhosis‏ صونااطء التهاب الكبد المزمن الال ‎active chronic hepatitis‏ (الذي يخلو من المستضد البروتيني السطحي لفيروس التهاب الكبد ‎(B‏ ؛ التشمع مجهول ‎cryptogenic dial‏ ‎cirrhosis‏ متلازمة مرض الأمعاء الالتهابي ‎cinflammatory bowel disease syndrome‏ متلازمة شوجرين ‎Sjogren's syndrome‏ الصدفية ‎psoriasis‏ التهاب المفاصسل شبه الروماتزمي ‎arthritis‏ ل الالتهاب الجلدي العضلي ‎<dermato myositis‏ تصلب الجلد ‎«scleroderma‏ ‎Uae‏ الأنسجة الضامة المختلطة ‎tissue connective disease‏ 160 الذئبة الاحمرارية القرصانية ‎discoid lupus erythematosus‏ التهاب الأوعية الجهازي ‎systemic vasculitis‏ والذثبة systemic lupus erythematosus (SLE) ‏الاحمرارية الجهازية‎ YoJe-like arthritis and considered particularly useful for treating autoimmune diseases as well as symptoms other than rheumatic (SLE); psoriasis; Systemic Lupus Erythematosus Host Reaction to Graft (a ye) Graft vs. Provider Disease Jie Autoimmune Symptoms (HIV Rejection of Transplants; Asthma and Human GVHD) . It also uses the antibodies under study as auxiliary agents in treatment, and in particular; The study antibody may be administered before the corresponding OE) pall during and after the administration of a vector (containing therapeutic DNA) to prevent or reduce the humoral response of the carrier .004 to the said vector. These diseases are examples of related conditions described in greater detail in the examples; Recombinant antibody 089.1 is generated for antigen-binding variant WS taken from a synomulsic macaque in Fy sis by grafting 0 human constant regions; For example; static fields 1801. Specifically; The body and the human field include a lambda. The 1 antibody 0189.1 includes the human field gamma (die on the constant field gamma; or a mutant form CE9Y4PE and CE9y4E “CE9y4AK” CE9y4 kappa. The resulting recombinant antibody sequences cannot be distinguished Slat 0 TT and the constant region of the human immunoglobulin sequences. As a result, these antibodies should show ve, as well as other anti-004 antibodies generated using similar methods, when administered in comparison with Unf antibodies in human bodies. reduced or no serofiltration of .004 mouse-human chimeric or similar mouse monoclonal directed at human V004; not from monkey 1 antibody 059.1 binds to the field on cells (Tg sil) of the MHC It represents a region involved in interaction with antigen-giving SaY molecules. The titrations also showed that other typical antibodies .089.1 have the same antigen-binding properties, and severe immunomodulatory activity was observed using the 089.1 antibody in a reduced tube on these properties. Reduced immunogenicity Sli test and in vivo. Slower sera clearance and efficient immune modulation; comparison with other known human “immunogenicity Yo yy” monoclonal antibody to 004 from mice or rodents; This antibody, together with the other antibodies mentioned in this statement, should be particularly suitable for the long-term treatment of diseases where immunosuppression is desirable eg; Autoimmune disorders and chronic inflammatory diseases such as rheumatoid arthritis 0 However; As expected, these antibodies should be useful for treating many other conditions. Lay including, for example; Hashimott's thyroiditis 191000 primary myxoedema (pant) primary myxoedema thyroid/Graves' disease cthyrotoxicosis/Graves disease ¢pernicious anemia autoimmune atrophic gastritis 1 autoimmune carditis cautoimmune carditis de Lidl Addison's disease cpremature menopause type I-diabetes mellitus Good pastures syndrome myasthenia gravis “gravis multiple sclerosis sclerosis 6M101 male infertility is back” pemphigus vulgaris cpemphigus vulgaris pemphigoid disease 2a! sympathetic pemphigoid sympathetic ophthalmia Vo cphacogenic uveitis autoimmune hemolytic anemia autoimmune chaemolytic anaemia autoimmune thrombocytopenic purpura autoimmune leukopenia cidiopathic LAN leucopenia primary biliary cirrhosis sonata active chronic hepatitis (devoid of hepatitis B surface protein antigen; unknown cirrhosis cryptogenic dial cirrhosis inflammatory bowel disease syndrome) cinflammatory bowel disease syndrome Sjogren's syndrome Psoriasis psoriasis arthritis subrheumatoid arthritis Dermatomyositis Scleroderma Uae Mixed connective tissue tissue connective disease Lupus 160 Pirate discoid lupus erythematosus systemic vasculitis systemic lupus erythematosus (SLE) systemic erythema Yo

T+T+

‎LS‏ نوقش أعلاه؛ يعتبر التهاب المفاصل شبه الروماتزمي ‎(RA)‏ مرضاً التهابياً يصيب الغشاء الزلالي ويمثل مظهرآ من مظاهر المناعة الذاتية التي تؤدي إلى تآكل؛ تشويه؛ وإتلاف المفاصل. وكما هو منطبق على أغلب الأمراض ذاتية المناعة؛ لم تحدد ‎Gala‏ أسباب ‎RA‏ إنما يتميز بوجود مستويات مرتفعة من الخلايا اللمفية 7 ل “004 المنشطة في المفاصل م المصابة. ‎(Ulla‏ لا يوجد علاج لمرض ‎RA‏ ويصمم العلاج المستخدم لمعالجة هذا المسرض الموهن فقط لتخفيف الأعراض وتحسين القدرات الوظيفية على المدى القصير. وعلاوة على ذلك؛ لا تعطى علاجات ثانوية وثالثية من الستيرويدات والكوابت المناعية مثل أزاثيوبرين؛ مثوتريكسات وبردنيسولون التي تستهدف المرض الأساسي إلا في الحالات الأكثر خطورة وعادة ما تكون فعالة بدرجة طفيفة أو تظهر سمية غير مقبولة عندما تستخدم في العلاج طويل > الأمد. وبشكل مغاير؛ يتوقع أن يكون الجسم المضاد موضوع الدراسة مناسبآً طوال فترة الإعطاء طويلة الأمد والمستمرة مع إدراك حقيقة أنه يظهر استمناعاً ‎(Laide‏ عمثر نصف أطول وفعالية تعديل مناعي فخّالة بالمقارنة مع الأجسام المضادة وحيدة النسيلة لل 604LS discussed above; Rheumatoid arthritis (RA) is an inflammatory disease of the synovium that is an autoimmune, erosive manifestation; distortion; and joint damage. As is true of most autoimmune diseases; Gala did not specify the causes of RA but it is characterized by the presence of elevated levels of activated 7L'004 lymphocytes in the affected AD joints. (Ulla) There is no cure for RA and the treatment used to treat this debilitating pathogen is designed only to relieve symptoms and improve functional abilities in the short term. Furthermore, secondary and tertiary therapies of steroids and immunosuppressants such as azathioprine, methotrexate and prednisolone that target the underlying disease are not given. except in the most severe cases and are usually only slightly effective or exhibit unacceptable toxicity when used in long-term therapy. Longer half-life and superior immunomodulatory efficacy compared to the monoclonal antibody to 604.

‏البشري المعروفة الأخرى التي ‎Jean ty‏ عليها من الفئران أو القوارض. وبشكل جوهري؛ من المحتمل أن تتوسط الأجسام المضادة وحيدة النسيلة المأشوبة ل ‎CDA vo‏ النموذجية المذكورة في هذا الطلب أو الأجسام المضادة الأخرى الناتجة ‎Gy‏ للاختراع الراهن وكما ذكر في الطلب المشار إليه أعلاه (المدمج للإحالة إليه كمرجع) الفعالية العلاجية عن طريق وقف أو تعديل فعالية الإتلاف لخلايا “004 وخصوصاً أثتاء الأطوار الحادة للاضطرابات ذاتية المناعة مثل التهاب المفاصل شبه الروماتزمي. وبذلك» يؤدي إعطاء الأجسام المضادة ‎Gy‏ للاختراع إلى حدوث ‎Alla‏ من عدم الاستجابة المناعية (عدم النشاط) أو ‎٠‏ التحمل طويل الأمد للمستضدات المحدثة للإصابة (أو الأنسجة المعينة) التي تثشبقي على المرض الأساسي بدون ضعضعة عمليات الدفاع في العائل السليم من قببل العدوات المواتية. وبصرف النظر عن ‎(RA‏ ينبغي أن تكون الأجسام المضادة وحيدة النسيلة ل ‎CD4‏ ‏مفيدة في معالجة الأمراض المحددة أعلاه وتزود استخداماً خاصاً لمعالجة الداء السكري المعتمد على الإنسولين؛ الذئبة الاحمرارية الجهازية؛ التشمع؛ مرض الأمعاء الالتهابي؛ ‎yo‏ التصلب المتعدد؛ بالإضافة إلى أمراض ذاتية المناعة أخرى. وقد تكون كذلك مفيدة في معالجةOther known human infections that Jean ty encountered were rats or rodents. In essence; Recombinant monoclonal antibodies to the model CDA vo mentioned herein or other resulting Gy antibodies of the present invention and as mentioned in the above application (incorporated for reference) may mediate therapeutic efficacy by stopping or modifying efficacy. Destruction of “004” cells, especially during acute phases of autoimmune disorders such as rheumatoid arthritis. Thus, administration of the Gy antibody of the invention results in an Alla of immune non-response (inactivity) or 0 long-term tolerance to infection-inducing antigens (or specific tissues) that cleaves to the underlying disease without impairing the defense processes of the healthy host. by favorable enemies. Apart from RA, monoclonal antibodies to CD4 should be useful in treating the diseases identified above and provide particular use for the treatment of insulin-dependent diabetes mellitus; systemic lupus erythematosus; cirrhosis; inflammatory bowel disease; yo multiple sclerosis. In addition to other autoimmune diseases, it may also be useful in treating

‎TeTe

YoYo

الأمراض غير ذاتية المناعة مثل اللوكيمياء الورم اللمفي؛ مرض الطعم-مقابل-المعيل (مرض رد فعل العائل للطعم)؛ رفض الأعضاء المزروعة؛ الربو والإصابة ب ‎HIV‏non-autoimmune diseases such as lymphoma leukemia; graft-versus-breadwinner disease (disease of the host's reaction to graft); rejection of transplanted organs; Asthma and HIV infection

وينبغي أن تتوسط الأجسام المضادة وحيدة النسيلة المأشوبة ل 004 الناتجة وفقآ للاختراع الراهن التأثير العلاجي المرغوب في الجسم الحي بواسطة آلية واحدة أو أكثر منRecombinant monoclonal antibodies to 004 obtained according to the present invention should mediate the desired therapeutic effect in vivo by one or more mechanisms.

‎٠‏ الآليات التالية:The following mechanisms:

‎¢Y ‏من الصنف‎ MHC ‏إعاقة تفاعل 004 مع جزيئات‎ (i) ‏إحداث تعديل على 004 من سطح الخلية؛‎ (ii) ‏التسبب في عدم النشاط و/أو موت الخلايا المبرمج؛‎ (iii) ‏إفراغ خلايا 04©؛ أو (») حث تحمل المستضدات الذاتية.‎ (iv)¢Y class MHC blocking the interaction of 004 with molecules (i) inducing modification of 004 from the cell surface; (ii) causing inactivity and/or apoptosis; (iii) emptying cells 04©; or (“) induce tolerance to self-antigens.” (iv)

‎sae) ‏وبالرغم من أنه يؤدي الإفراغ العابر لخلايا “004 إلى كبت المناعة وربما إلى‎ ١ ‏جهاز مناعي مفرط النشاط بطريقة ما إلى وضعه الطبيعي؛ فإنه ليس بالضرورة أن تعتمد‎ ‏الآلية الأساسية التي تظهر بواسطتها الأجسام المضادة ل 004 تأثيرها في الجسم الحي على‎ ‏وبدلاً من ذلك؛ يعتقد أن ارتباط الأجسام المضادة بجزيء 004 يمنع تنشيط‎ .7 LDA ‏إفراغ‎ ‏مما يؤدي إلى عدم نشاط أو‎ T ‏المساعدة بواسطة المستضدات المرتبطة بمستقبلة خلايا‎ T ‏خلايا‎sae) and although transient discharge of “004 cells leads to immunosuppression and may 1 somehow return an overactive immune system to normal; The primary mechanism by which anti-004 antibodies exert their effect in vivo is not necessarily dependent on It is believed that binding of antibodies to molecule 004 prevents activation of 7. LDA secretion leading to inactivation or inactivation of T helper by T cell receptor-binding antigens.

‎J" aad Vo‏ خلايا ‎T‏ الخاص بالمستضدات. فعلى سبيل المثال؛ يظهر الجسم المضاد ‎CE9.1‏ الذي يشتمل على الحقل البشري جاما ‎١‏ فعالية كبت مناعي جوهرية. غير أنه؛ يفرغ ‎LDA‏ 004 بشكل جزئي فقط في قرود الشمبانزي. وعلاوة على ذلك؛ تشير نتائج التجارب التي أجريت في البشر أنه يؤدي هذا الجسم المضاد إلى إفراغ خلايا أقل جوهرياً بالمقارنة مع الأجسام المضادة وحيدة النسيلة الأخرى التي تستخدم حالياً في التجارب السريرية.J" aad Vo antigen-specific T cells. For example, the human antibody CE9.1 containing the human gamma 1 field shows intrinsic immunosuppressive activity. However, it only partially secretes LDA 004. Furthermore, results from human trials indicate that this antibody induces significantly fewer cell lysates compared to other monoclonal antibodies currently used in clinical trials.

‎Y.‏ كما أنهء في النماذج التجريبية في الجسم الحيء تم حث التحمل الخاص بالطعم المباين بواسطة أجسام مضادة ل 004 لاإفراغية تشعطى عند التطعيم. ولا تستلزم المحافظة على حالة التحمل جسماً مضاداً ل 4( إفراغياً إنما يبدوء من منطقة ثانية؛ أنها تعتمد على الوجود الدائم للمستضد. واعتماداً على هذه النتائج؛ كما هو متوقع ينبغي أن تكون الأجسام المضادة المأشوبة موضوع الدراسة أو الأجسام المضادة ل 004 المأشوبة الأخرى الناتجة وفقاًY. also terminated in in vivo experimental models. Tolerance to the contrast graft was induced by non-secretory anti-004 antibodies given upon vaccination. Maintaining a tolerance state does not require an antibody to 4) secretion but rather starts from a second region; it depends on the permanent presence of the antigen. Based on these results, as expected, the recombinant antibodies under study or other recombinant antibodies to 004 should be produced according to

‎Yo‏ للاختراع مناسبة لمعالجة الأمراض ذاتية المناعة. وتعيق برامج المعالجة القصيرة باستخدامYo of the invention is suitable for the treatment of autoimmune diseases. Short processing programs are hampered by using

A! ‏أجسام مضادة ل 004 استجابات خلايا 7 المساعدة ضد المستضدات الذاتية مما يؤدي إلى‎ ‏تحسينات سريرية طويلة الأمد في عدم وجود الكبت المناعي الشامل.‎ ‏يمكن‎ dy yma ‏وبناءً على المعلومات الموجودة في الطلب الراهن؛ وباستخدام طرق‎ ‏لشخص متمرس في التقنية أن يتحقق بسهولة من نظام مأمون الاستخدام» محتمل وفقال‎ ‏م من الأجسام المضادة المأشوبة ل 004 النموذجية التي كشف عنها في هذا البيان بالإضافة‎ ‏إلى الأجسام المضادة الأخرى الناتجة بشكل جوهري وفقآ للاختراع.‎ ‏خيمرياً وحيدة النسيلة ل 604 مأخوذاً من قرد‎ Tobias Lassa 029.1 ‏وكما أشير؛ يعتبر‎ ‏والذي‎ (CHO) ‏مبيض القداد الصيني‎ WIA ‏مكاك-إنسان يمثل جزيء 1601 الذي يعبر عنه في‎ .7097-4١ ‏يظهر تماثلاً مع مناطق هيكلية للجلوبلين المناعي البشري بنسبة تتراوح من‎ ‏ولذلك؛ ينبغي أن يظهر هذا الجزيء استجابة مناعية مخفضة أو حتى معدومة في الإنسان‎ ٠ ‏وينبغي أن يظهر عمّر نصف مصلي أطول مقارنة مع الأجسام المضادة الخيمرية الفأرية-‎ ‏البشرية أو وحيدة النسيلة الفأرية. كما أنه يظهر الجسم المضاد تفاعلية متبادلة محدودة مع‎ ‏الأنسجة البشرية. فعلى سبيل المثال؛ لم يشاهد أي دليل على ارتباط هذا الجسم المضاد مع‎ ‏الأنسجة غير اللمفانية عند إجراء الاختبار. وكما هو متوقع؛ يرتبط الجسم المضاد ببعض‎ ‏وليس بجميع الخلايا اللمفانية المأخوذ من الدم المحيطي والأعضاء الأخرى. وقد وجد كذلك‎ ١ ‏أنه يتفاعل هذا الجسم المضاد مع خلايا 7 ل *004 المأخوذة من قرد الشمبانزي إلا أنه لا‎ ‏المأخوذة من قرد الريصء السينومولجس أو قرود المكاك ذات‎ cD ‏يتفاعل مع خلايا 7 ل‎ ‏الذيل الخنزيري؛ قرود الرباح؛ الجرذان؛ الفئران؛ أو الأرانب. ولذلك؛ اعتماداً على هذه‎ ‏تشتمل قرود الشمبائنزي على أنواع مناسبة لتعزيز التأثيرات العقاقيرية في الجسم‎ Ade Lal ‏أي؛ قدرته على أن يعمل ككابت مناعي فغّال.‎ alia) ‏لهذا الجسم‎ Wy. ‏ويظهر الجسم المضاد 089.1 فعالية إفراغ خلايا 7 قابلة للانعكاس في قرود‎ ‏الشمبانزي. كما أنه من المحتمل تحسينه بحيث يتفوق على الأجسام المضادة وحيدة النسيلة‎ ‏ضد 04> الفأرية والفأرية/الخيمرية الحالية نتيجة لعمْر النصف الطويل المتوقع له في‎ ‏أمصال البشر وتأثيراته المناعية المعاكسة المحتملة المنخفضة. ويتوقع كذلك؛ بتحديد وجود‎ ‏تابعات الحقل الثابت البشري؛ أنه سيحافظ الجسم المضاد موضوع الدراسة عند إعطائه للبشر‎ veA! Antibodies to 004 helper-7 cell responses against self-antigens leading to long-term clinical improvements in the absence of systemic immunosuppression. Using methods, a person skilled in the technique can easily ascertain a potentially safe-to-use system of typical 004-recombinant antibodies disclosed herein as well as other antibodies produced substantially according to the invention. Monoclonal L 604 from monkey Tobias Lassa 029.1 As indicated; The Chinese hamster ovary (CHO) WIA is considered a macaque-human representing the 1601 molecule which is expressed at .7097-41 and shows homology to human immunoglobulin structural regions ranging from therefore; This molecule should elicit a reduced or even no immune response in human 0 and should exhibit a longer serum half-life compared to mouse-human or mouse monoclonal chimeric antibodies. It also shows limited antibody cross-reactivity with human tissues. for example; No evidence of this antibody binding to non-lymphoid tissues was seen when the test was performed. As expected; The antibody binds to some, but not all, lymphocytes from peripheral blood and other organs. It was also found 1 that this antibody interacts with 7L*004 cells from chimpanzees, but it does not interact with 7L*004 cells from cynomolgus monkeys or macaques with cD; baboons; rats; mice; or rabbits. Therefore; Depending on these, chimpanzees include species suitable for enhancing pharmacological effects in the body, Ade Lal, ie; Its ability to act as an effective immunosuppressant (alia) for this body Wy. The antibody 089.1 shows reversible 7-cell secretion activity in chimpanzees. It is also potentially improved to outperform existing murine and murine/chimeric >04 monoclonal antibodies due to its long expected half-life in human sera and its low potential adverse immunogenic effects. further expected; by specifying the existence of human constant field functions; It will preserve the antibody under study when administered to humans

ب على وظائف المستفعلة الطبيعية للأجسام المضادة البشرية. وفي الواقع؛ تم تقييم وظائف المستفعلة للجسم المضاد 059.1 بالإضافة إلى الأجسام المضادة الأخرى المشار إليها في معايرات مختلفة عديدة. ووجد أن الجسم المضاد 089.1 ينُظهر فعالية تثبيط في ‎Jeli‏ ‏الخلايا اللمفية المخلطة ‎(MLR)‏ ويظهر ‎Loma Wala)‏ مع ‎(Clg‏ إلا أنه لا يظهر تسمم خلوي م مستحث بالمتممة. كما وجد أنه يظهر تسمم خلوي مستحث بالخلايا معتمد على الجسم المضاد ‎(ADCC)‏ وارتباطا مع 208. كما أنه تم تقييم الجسم المضاد 089.1 في الجسم ‎al‏ لقرود الشمبانزي حيث وجد أن إعطاءه يؤدي إلى حدوث إفراغ جزئي لخلايا 004؛ وتعديل لمستقبلة ‎.CD4‏b On the natural effector functions of human antibodies. Indeed; The effector functions of the 059.1 antibody as well as the other indicated antibodies were evaluated in several different titrations. The antibody 089.1 was found to show inhibition activity in Jeli mixed lymphocytes (MLR) and Loma Wala with (Clg) but it did not show complement-induced cytotoxicity. Antibody dependent (ADCC) and binds to 208. Antibody 089.1 has also been evaluated in the al body of chimpanzees where it was found to induce partial emptying of 004 cells; modulation of the .CD4 receptor.

ولقد أعطي الجسم المضاد 089.1 لقرود الشمبانزي بمقادير متنوعة من الجرعات. ‎٠‏ وبعبارة أدق» درست تأثيرات جرعات بمقادير تبلغ ‎en)‏ ل قو ‎٠١‏ ‏مليجرام/كيلوجرام عند شمبانزي أعطي الجرعة على فترات تراوحت من ‎١4 DY‏ يوماً. ولم يلاحظ أي دليل سريري على السمية. وتسببت جرعات بمقدار ‎١‏ مليجرام لكل كيلوجرام أو أكبر في تقليل ‎DA‏ “004 الدائرة في الدم بنسبة 9640-86 بعد ‎YE‏ ساعة من إعطاء الجرعة. ولم يلاحظ انخفاض كبير في خلايا “004 بعد 7 أيام من إعطاء جرعة بلغ مقدارها ‎١‏ مليجرام/كيلوجرام. وبعد إعطاء جرعة مقدارها © مليجرام/كيلوجرام؛ استعيد تعداد خلايا *004 الدائرة في ‎all‏ إلى قيمة بلغت 9640 تقريباً من قيمة خط الأساس بعد ‎١‏ أيام وإلى ‎٠‏ تقريباً من قيمة خط الأساس بعد ‎Vt‏ يوماً. وبعد جرعة بلغ مقدارها ‎٠١‏ ‏مليجرام/كيلوجرام؛ لم يستعاد تعداد خلايا *004 الدائرة في الدم بعد ‎١7‏ أيام من المعالجة إلا أنه استعيد إلى ‎dad‏ بلغت ‎964٠0‏ فقط من قيمة خط الأساس بعد ‎Las £Y‏ من إعطاء الجرعة. ‎als‏The antibody 089.1 was given to chimpanzees in various doses. To be more precise, the effects of doses of amounts of (en) to Gu 01 mg/kg were studied in chimpanzees given the dose at intervals of 14 DY days. No clinical evidence of toxicity was observed. Doses of 1 mg/kg or greater reduced circulating DA “004 in blood by 9640-86 YE hours after dose administration. No significant decrease in 004 cells was observed 7 days after a dose of 1 mg/kg. After a dose of © mg/kg has been given; The *004 cell population of the circuit in all was restored to a value of ~9640 from the baseline value after 1 days and to ~0 from the baseline value after Vt days. and after a dose of 10 mg/kg; The circulating *004 cell count in the blood did not recover after 17 days of treatment but did recover to a dad of only 96,400 from baseline value after Las £Y after dose administration. als

‎ys‏ يلاحظ حدوث أية تغييرات في وسائط مرضيات سريرية أخرى. ولقد اختبر الجسم المضاد 089.1 كذلك في البشر. فعلى سبيل ‎(JA‏ قيمت فعالية الجسم المضاد 089.1 أيضاً في تجارب من الطور الأول يعطى خلالها مرضى مصابون بالتهاب المفاصل شبه الروماتزمي جرعات منفردة بمقادير متزايدة. وكانت هذه النتائج مبشرة ‎faa‏ وبعبارة دقيقة؛ أظهر حوالي نصف المرضى الذين تم إعطاؤهم الجرعات تحسناً بنسبة »9600 على الأقل في علامات المفاصل الحساسة للألم لديهم» مع تحقيق جانبية للحدثys No changes in other pathologic parameters are noted. The antibody 089.1 has also been tested in humans. For example, the effectiveness of JA 089.1 was also evaluated in phase I trials in which patients with rheumatoid arthritis were given single doses in increasing doses. These results were promising faa, to be exact; about half of the patients who were given the doses showed an improvement of » at least 9600 in their pain-sensitive joint markers » with a collateral investigation of the event

YAYa

‏المعاكس معتدلة بدرجة كبيرة. وعلاوة على ذلك؛ كما نتوقش أعلاه؛ مع أنه تم الافتراض أولاً‎ ‏أن 089.1 سوف يكون إفراغيا؛ إلا أنه في الحقيقة لم يظهر هذا الجسم المضاد إلا إفراغاً‎ ‏عند الإعطاء المنفرد. ويمكن أن تكون المميزات اللاإفراغية الجزئية لهذا الجسم‎ Tle ‏جزئياً‎ ‎7 ‏المضاد مفيدة لأنه ورد في عدد من الدراسات التي أجريت على الحيوانات أن إفراغ خلايا‎ ‏ل 0047 كما يظهر لا يعتبر ضرورياً لفعالية الأجسام المضادة وحيدة النسيلة ل 04ه.‎ © ‏في مقالة بعنوان "لا يعتمد حث التحمل‎ Carteron et al. ‏عن كارتيرون ومعاونيه‎ ela ‏(انظر ما‎ ‏في المجلة‎ C03 14“ WA ‏المناعي أثناء إعطاء الجسم المضاد وحيد النسيلة ل 14 13 على‎ 215-717 ‏ص‎ ٠46 ‏المجلد‎ (Underlying Journal of Immunology) ‏الأساسية تعلم المناعة‎ ‏في مقالة بعنوان "الأجسام المضادة‎ Carteron et al, ‏عن كارتيرون ومعاونيه‎ ela ‏ما‎ ta) AAA ‏تعمل‎ CD4 ‏وحيدة النسيلة من 76072 ضد 004 والأجسام المضادة وحيدة النسيلة السليمة ضد‎ ‏وخلايا © في كليتي‎ 817 IT ‏على تثبيط تراكم خلايا 7 ل *004؛ خلايا 7 ل *008 وخلايا‎ ‏المناعة السريري وعلم المناعة‎ ple ‏معرضين للإصابة بالذئبة"؛ في مجلة‎ NZB/NZW (J 87-777 ‏مجلد 1:07 ص‎ (Clinical Immunology Immunopathology) ‏المرضية السريري‎ ‏م). وعليه؛ يمكن أن يعمل هذا الجسم المضاد كمادة مضادة مستقبلة تقليدية عن طريق:‎ 6 ‎(i 20‏ إعاقة تفاعل 004 مع مستقبلته المعاكسة 1 ‎$MHC‏ أو ‎(ii‏ التسبب في تعديل 004 من سطح الخلية. وفي هذه الظروف؛ سوف توهن أو تعوّق استجابات خلايا 7 ل “004 التي تتطلب مشاركة مستقبلة ‎.CD4‏ وتعتبر حقيقة أن الجسم المضاد المعني 0729.1 يظهر كما يبدو فعالية إفراغ قليلة في البشر ‎Bade‏ لأنها يمكن أن تحسن ‎AS‏ يمكن أن تجنب الحاجة لمراقبة متكررة لتعداد ‎WIA‏ “004؛ ويمكن أن تحسن الفعالية كذلك. ‎Y.‏ ولقد صمم الجسم المضاد 89.1© من أجل تقليل أعداد خلايا 004 في الجسم الحي بواسطة آليات الارتباط بالمتممة وبمستقبلة ‎Fe‏ وبينت دراسات أجريت على قرود الشمبانزي أن 089.1 يسبب إفراغاً ‎Ga‏ لخلايا 004؛ وبينت النتائج الأولية أن الإفراغ الخلوي في البشر قد خفض بشكل كبير مقارنة مع الأجسام المضادة وحيدة النسيلة ‎(mAbs)‏ ل 004 المعروفة الأخرى. غير أنه؛ من المرغوب أيضاً إنتاج أجسام مضادة لا تتميز بالفعالية الإفراغية. ‎Yo‏ وينبغي تحسين الفائدة من ‎mAbs‏ "اللاإفراغية" ل 004 للأسباب التالية:The opposite is very moderate. Furthermore; As we discuss above; Although it was first assumed that 089.1 would be empty; However, in fact, this antibody showed only emptying upon single administration. The partial non-secreting properties of this Tle partially antibody 7 antibody may be useful because in a number of animal studies it has been shown that the secretion of L0047 cells is not necessary for the activity of the L0047 monoclonal antibody. © In the article “Induction of tolerance is not dependent on Carteron et al. ela (see what is in the journal C03 14” WA), immunoglobulins during administration of a monoclonal antibody to 14 13 at 215-717 p. 046 (Underlying Journal of Immunology) Basic Learning Immunology in the article “Antibodies” Carteron et al, on Carteron et al, on Carteron et al., ela (ta) AAA CD4-acting monoclonal from 76072 against 004 and healthy monoclonal antibodies against © and 817 cells in my kidneys IT 817 inhibited the accumulation of 7L*004 cells; 7L*008 cells and clinical immunology and ple cells are at risk for lupus"; in NZB/NZW Journal (J 87-777 vol 1:07 p.m. Clinical Immunology Immunopathology m) Therefore, this antibody can act as a conventional receptor antibody by: 6 (i 20 blocking the interaction of 004 with its opposite receptor $1 MHC or ii) causing modification of 004 from the cell surface. It will attenuate or inhibit 7-cell responses to “004” that require CD4 receptor engagement. The fact that the respective antibody 0729.1 appears to show little clearance activity in humans is Bade because it can improve AS could obviate the need for frequent monitoring. The antibody 89.1© was designed to reduce the numbers of 004 cells in vivo by binding mechanisms to the complement and to the Fe receptor. Studies in chimpanzees showed that 089.1 causes excretion. Ga to 004 cells, and preliminary results showed that cellular secretion in humans was significantly reduced compared with other known Ga 004 monoclonal antibodies (mAbs) to 004. However, it is also desirable to produce antibodies that do not have secretion activity. Yo The benefit of “non-excretory” mAbs should be improved for 004 for the following reasons:

Yq ¢CD4 ‏ل‎ mAbs ‏من أجل تحفيز فعالية‎ CD4 ‏لا يتطلب إفراغ خلايا‎ (i ‏سلامتها؛‎ CDA WIA ‏ينبغي أن يعزز عدم حدوث إفراغ‎ (i ‏في مرحلة مبكرة من تقدم المرض؛‎ mAbs ‏تتيح السلامة المميزة استخدام‎ (ii ‏ينبغي أن يحسن عدم حدوث إفراغ لخلايا 004 الفعالية؛ و‎ (iv ‏سيجنب أو يقلل عدم حدوث إفراغ لخلايا 004 الحاجة لمراقبة تعداد خلايا 004 بشكل‎ )» 0 ‏متكررء؛ وبالتالي زيادة ملاعمة وتكاليف المعالجة الكلية.‎ ‏وتؤيد ما تم التوصل إليه في هذا الصدد حقيقة أنه قد تبين» في عدد من النماذج‎ ‏الحيوانية؛ أنه لا يتطلب حدوث إفراغ للخلايا 7 ل *004 من أجل تحفيز فعالية الأجسام‎ ‏لا إفراغي ل 004 مثل عمل مادة‎ mAb ‏وعليه؛ سيعمل‎ .CD4 ‏المضادة وحيدة النسيلة ل‎ ‏مضادة مستقبلة تقليدية الذي يشمل:‎ ٠ (MHC ‏إعاقة التفاعل بين 004 ومستقبلته المعاكسة‎ (i ‏إحداث تعديل على 004 من سطح الخلية؛ أو‎ (i ‏التسبب في عدم نشاط و/أو موت خلايا 7 المبرمج.‎ (i .004 ‏وبذلك؛ تغير أو تعاق استجابات خلايا 7 ل *004 التي تتطلب مشاركة مستقبلة‎ ‏وبوجه عام؛ يظهر أن استجابات خلايا 7 التي تستحث من قبل مستضدات قوية أو‎ Vo ‏لا تعتمد على وظائف تميم مستقبلة 004 وبالتالي لن تعاق بواسطة الأجسام‎ Ale ‏ذات ألفة‎Yq¢CD4 for mAbs in order to stimulate CD4 efficacy does not require emptying cells (i) their viability; CDA WIA should promote non-clearing (i) early in disease progression; mAbs allow Distinctive safety The use of (ii) no 004 cell enucleation should improve efficacy; and (iv) no 004 cell enucleation would avoid or reduce the need to frequently monitor 004 cell counts; thus increasing the suitability and overall treatment costs. What has been reached in this regard is supported by the fact that it has been shown, in a number of animal models, that it does not require the occurrence of emptying of 7L *004 cells in order to stimulate the activity of the non-secreting L004 antibodies, such as the action of the mAb. Accordingly, CD4 will act as a monoclonal antibody to a conventional receptor antagonist which includes: i) blocking the interaction between MHC 004 and its opposite receptor i) causing modification of 004 on the cell surface; or i) causing inactivation activity and/or programmed 7 cell death. (i.004) Thereby altering or inhibiting the responses of 7 cells to *004 that require co-receptor participation. In general, it appears that 7 cell responses that are induced by strong antigens or Vo It is not dependent on co-receptor 004 functions and therefore will not be inhibited by affinity Ale objects

T ‏المضادة وحيدة النسيلة ل 004 بفعالية. وعلى النقيض من ذلك» تتطلب استجابات الخلية‎ ‏لمستضدات ضعيفة (مثل مستضدات ذاتية) وظيفة تميم مستقبلة 004 ولذلك تشبط بواسطة‎ ‏الجسم المضاد وحيد النسيلة ل 004. وعادة؛ تزال خلايا 7 المتفاعلة ذاتياً بشدة (خلايا 7 التي‎ ‏ذات الألفة العالية نحو المستضدات الذاتية) في الغدة‎ (TCRs) 7 ‏تحتوي على مستقبلات خلايا‎ © ‏في السطح الخارجي.‎ Tad ‏ولذلك لا تظهر‎ clonal deletion ‏التيموسية عن طريق "حذف نسيلي‎ ‏التي تستحث الاستجابة ذاتية المناعة تكون عبارة عن خلايا‎ 7 WA ‏وبخلاف ذلك. يعتقد أن‎ ‏بشكل ضعيف تخلصت من الآليات الطبيعية للتحمل المحيطي. وتعتمد خلايا من‎ Tal ‏متفاعلة‎ ‏هذا القبيل على مشاركة تميمات المستقبلات؛ مثل 004؛ من أجل التوليد الكامل للاستجابة.‎ ‏ولذلك؛ ستحرم إعاقة تميمات المستقبلات خلايا 7 هذه من وظائف التأشير المشترك الحاسم‎ vo ‏يأ‎T 004 monoclonal antibody with efficacy. In contrast, cell responses to weak antigens (such as self-antigens) require coenzyme 004 function and are therefore inhibited by the monoclonal antibody to 004. Normally; The highly self-reactive 7 cells (7 cells with high affinity for self-antigens) in the gland (TCRs) 7 still contain TAD cell receptors on the outer surface. Therefore, clonal deletion of the thymus does not appear. By way of 'clonal deletion' that induces an autoimmune response are WA 7 cells otherwise. It is believed that they have only weakly eliminated the normal mechanisms of peripheral tolerance. Such interacting Tal cells depend on the participation of coreceptor coenzymes. Therefore, blocking receptor coenzymes will deprive these 7 cells of their critical co-signaling functions vo ya

التي ينتج عنها التنشيط الجزئي أو عدم النشاط. وأيضاًء؛ كما ذكر أعلاه؛ من المرغوب بشكل إضافي إنتاج أجسام مضادة خيمرية متخصصة ب 004 لها ثبات أكبر ( لها عمر نصسفthat result in partial activation or inactivity. Also; As mentioned above; It is additionally desirable to produce chimeric antibodies specific for 004 with greater stability and half-life

أطول في الجسم الحي). ومن أجل تحقيق هذه الغاية؛ تم تخليق أجسام مضادة خيمرية ‎de gia‏ تحتوي على م الحقل الثابت البشري جاما 4. واختير هذا الحقل ‎AY‏ كما يبدو لا يرتبط بالمتممة البشرية أو مستقبلات 2©:1. ولذلك؛ افترض أن الأجسام المضادة الخيمرية التي تحتوي على هذا الحقل الثابت تفتقر أو تفتقر بصفة جوهرية إلى فعالية إفراغ خلايا 7. كما تم تحضير أجسام مضادة خيمرية عديدة تحتوي على أشكال محورة معروفة للحقل ‎cul A‏ جاما 4؛. وبصفة خاصة؛ يحتوي العديد منها على الشكل المحور "7 الذي وصف من قبل دونكان ومعاونيه ‎٠‏ لد اك «هعءص0 في مجلة الطبيعة ‎(Nature)‏ المجلد 777 ص 854-0707 ‎ca) AAA‏ من قبل وينتر ومعاونيه ‎Winter et al,‏ في نشرة براءة الاختراع الدولية رقم ‎AAA AAS YAR‏ لي ‎Cua‏ كشف عن هذا الشكل المحور من أجل تقليل الارتباط بالمتممة ومستقبلات ‎FOyl‏ ‏ويتضمن هذا التحوير الاستعاضة عن اللوسين بحمض الجلوتاميك عند الموقع 7776 ‎Lig)‏ ‏لترقيم كابات ‎(YEA‏ لإزالة أي ارتباط متبق بمستقبلة ‎Fe‏ وكذلك» تحتوي أجسام مضادة ‎١‏ خيمرية عديدة على الشكل المحور "7 الذي كشف عنه فيما جاء عن أنجال ومعاونيه ‎cAngal et al‏ في مجلة ‎alo‏ المناعة الجزيئثية ‎¢(Molecular Immunology)‏ المجلد ١؛‏ ص ‎٠١8-٠١‏ 1997م. ويعزز هذا التحوير الذي يتضمن الاستعاضة عن حمض ‎ial‏ ‏سيرين في الموقع 774 ‎Gg)‏ لترقيم كابات ‎(YE)‏ بحمض أميني برولين؛ الثبات (عمر النصف المصلي) عن طريق تثبيت روابط ثنائي الكبريتيد ‎disulfide bonds‏ بين السلاسل الثقيلة ولقد ‎ve‏ ورد أنه يعزز التوزيع النسيجي المحسن بالنسبة لجلوبلين مناعي خيمري 64 (1804) يفتقرlonger in vivo). In order to achieve this end; Chimeric antibodies de gia containing the human constant field gamma4 were synthesized. This AY field was chosen as it appears not to bind to human complement or 2©:1 receptors. Therefore; It has been assumed that chimeric antibodies containing this constant field lack or are substantially lacking efficacy for 7 cell clearance. Several chimeric antibodies containing known modified forms of the cul A gamma4; field have also been prepared. In particular; Many of them contain the axis form "7" described by Duncan et al. in Nature vol 777 p. 854-0707 ca) AAA by Winter et al. In the International Patent Publication No. AAA AAS YAR Lee Cua disclosed this modified form in order to reduce binding to complement and FOyl receptors. YEA to remove any residual binding to the Fe receptor and many “chimeric 1-antibodies contain the axis isoform 7” which was revealed by cAngal et al. in the journal Molecular Immunology ¢. ) vol. 1; Stability (serum half-life) by stabilizing disulfide bonds between heavy chains and it has been reported to promote improved tissue distribution for chimeric immunoglobulin 64 (1804) lacking

لمثل هذا التحوير. وبعبارة أدق؛ كان الأساس المنطقي لإنتاج 08974 هو إبطال تثبيت المتممة وتقليل فعاليات الارتباط بمستقبلة ‎Fe‏ ويختلف هذا الجسم المضاد عن الجسم المضاد ‎CE9.1‏ من حيث أنه يحتوي على الحقل الثابت البشري جاما ؛ (وليس جاما ‎.)١‏ ومع ذلك؛ مع أنه كان هذا ‎vo‏ الجسم المضاد مرغوباً لم يكن الناتج ذا طبيعة نمطية أو يمكن التنبؤ بها. وبالفعل» وجد فيfor such a modification. More precisely; The rationale for producing 08974 was to inhibit complement binding and reduce binding activities to the Fe receptor. This antibody differs from CE9.1 in that it contains the human constant field gamma; (not Gamma.) 1 However; Although this VO antibody was desirable, the result was not of a typical or predictable nature. Indeed, it was found in

الاختراع الراهن أن الأجسام المضادة الخيمرية التي تحتوي على الشكل غير المحور جاما 4 ترتبط بمستقبلة ‎Fe‏ بنفس الكيفية التي يرتبط بها الجسم المضاد جاما ¥ وعلى النقيض من ‎cell‏ كان الأساس المنطقي لتحضير الجسم المضاد 08974116 هو تعزيز إنتاجية الوحدة البنائية ‎Lila‏ ؛. ويختلف هذا الجسم المضاد عن الجسم المضاد 089.1 من حيث أنه يحتوي على م السلسلة الخفيفة البشرية كابا ‎Tata = pul‏ (2). وتبين من تقييم الجسم المضاد 089:4 في أنبوب الاختبار بواسطة معايرة ارتباط بمستقبلة ‎Fo‏ تقيس ارتباط الجسم المضاد بخلايا وحيدة النواة أو أنسال خلوية وحيد النواة منبهة؛ أن الجسم المضاد ‎CE9y4‏ لا يزال ممتلكاً فعالية ارتباط كبيرة بمستقبلة ‎Fe‏ وبالإضافة إلى ذلك؛ في نظام المعايرة هذاء لم يكن ارتباط الجسم المضاد 689:4 مميزآ عن ارتباط الجسم المضاد 0289.1 (الذي يحتوي على الحقل جاما ‎.)١‏ ‎٠‏ وعليه؛ كان الأساس المنطقي لصنع الجسم المضاد 0895 هو إبطال أي ارتباط متبق بمستقبلة ‎Fe‏ بشكل كامل يفوق ما تحققه الأجسام المضادة الخيمرية التي تحتوي على الحقل غير المحور ‎Lila‏ ؛. ويحتوي الجسم المضاد 8912© على الحقل الثابت ‎lala‏ ؛ المحور عند أحد المواقع (الشكل المحور 2). ‎(daly‏ كان الأساس المنطقي لصنع الجسم المضاد 0897408 هو تعزيز الثبات بشكل يفوق الثبات الذي تحققه الأجسام المضادة الخيمرية التي تحتوي على الحقل غير ‎١‏ المحور جاما ؛ أو طفرة عند أحد المواقع (الشكل المحور ‎Cua (BE‏ يحتوي الجسم المضاد هذاThe present invention demonstrates that chimeric antibodies containing the non-gamma-4 form bind to the Fe receptor in the same way as the γ-γ antibody. In contrast to cell, the rationale for preparing antibody 08974116 was to enhance Lila residue yield; . This antibody differs from antibody 089.1 in that it contains the human m light chain kappa Tata = pul (2). Evaluation of the 4:089 antibody in test tube by a Fo-receptor binding assay that measures antibody binding to stimulating mononuclear cells or progenitors of mononuclear cells; that the CE9y4 antibody still had high binding activity to the Fe receptor and in addition; In this titration system the binding of antibody 689:4 was indistinguishable from that of antibody 0289.1 (which has the gamma field .1 0 ). The rationale for making antibody 0895 was to more completely abolish any remaining binding to the Fe receptor than chimeric antibodies containing the non-modified field Lila; The antibody 8912© contains the constant field lala ; Pivot at a location (Fig. Pivot 2). (daly) The rationale for making antibody 0897408 was to enhance stability beyond that achieved by chimeric antibodies containing the non-gamma-axial 1 field; or a site mutation (Cua (BE) axial form) This antibody has

على الحقل الثابت ‎Lala‏ ؛ المحور عند موقعين (الشكلان المحوران م و ‎(E‏ ‎LS‏ نوقش؛ اختير الحقل الثابت البشري ‎Lala‏ ؛ بصفته النمط الإسوي لإبطال وظائف المستفعلات؛ أي؛ تفاعليتها مع مستقبلات ‎Foy‏ البشرية أو ‎«Clg‏ وعدم حدوث إفراغ لخلايا ‎CDA”‏ في الجسم الحي. ولقد اختيرت هذه المرشحات الأربع من الأجسام المضادة وحيدةon the constant field Lala; The axon at two sites (Fig. M and E axes (LS) was discussed; the human constant field Lala was selected as the isotype for deactivation of effectors, i.e., its reactivity to the human Foy or Clg receptors and no vacuolization. CDA” in vivo These four candidates were selected from single antibodies

(CHO) ‏النسيلة وعبر عنها في خلايا مبيض القداد الصيني‎ ٠ ‏واختير اثنان من الأجسام المضادة وحيدة النسيلة المرشحة هذه لإجراء دراسة أكثر‎ ‏وكما لوحظ؛ يحتوي كل من الجسمين‎ .CE9Y4PE ‏و‎ CE9Y4E ‏شمولية؛ أي؛ الجسم المضاد‎ ‏المضادين هذين على استبدال لحمض جلوتاميك في منطقة 0112 لإزالة الارتباط المتبقي‎ ‏المقترن بالمنطقة الثابتة في الحقل جاما ؛. وبالإضافة إلى ذلك؛ يحتوي الجسم‎ Fe ‏بمستقبلة‎(CHO) clone and expressed in hamster chin 0 cells. Two of these candidate monoclonal antibodies were selected for further study and as noted; CE9Y4PE and CE9Y4PE .both bodies contain inclusive; any; These two antibodies substituted a glutamic acid in the 0112 region to remove the remaining binding associated with the constant region in the gamma field ;. In addition; The body contains a Fe receptor

YYYY

‏على استبدال لحمض أميني برولين في منطقة الرزة؛ يقصد منه تعزيز ثبات‎ CE9Y4PE ‏المضاد‎ ‎disulfide bond interaction ‏التأثير المتبادل بين السلسلة الثقيلة ورابطة ثنائي الكبريتيد‎ ‏ولقد وجد أن الأجسام المضادة هذه لا يمكن تمييزها من حيث ألفتها نحو 004؛ وزنها‎ ‏عدم‎ (MLR) ‏الجزيئي؛ ثباتها بعد تعرضها لمسخ حراري؛ كبت تفاعل خلايا لمفية مخلطة‎ ‏(التسمم الخلوي المستحث‎ ADCC ‏وافتقار إلى الفعالية عند حدوث‎ Fo ‏م حدوث ارتباط بمستقبلة‎ ‏(التسمم الخلوي المستحث بالمتممة). وعليه؛‎ CDC ‏بالخلايا المعتمد على الجسم المضاد) و‎ mAb ‏يظهر كلا من هذين الجسمين المضادين معايير التفاعلات في أنبوب الاختبار بالنسبة ل‎ ‏والمتممة.‎ Fe ‏الألفة نحو 04© بدون وظائف المستفعلة في التفاعل مع مستقبلة‎ le ‏ويراد من‎ .CE9Y4PE ‏مقارنة بين خصائص الجسم المضاد 089.1 و‎ ١ ‏ويبين الجدول‎ ‏أن يشير إلى الأجسام المضادة الخيمرية التي ترتبط‎ Fe ‏المصطلح ارتباط مخفض بمستقبلة‎ ٠ yl ‏بدرجة أقل من ارتباط الأجسام المضادة الخيمرية التي تحتوي على الحقل‎ Fo ‏بمستقبلة‎ ‎JE ‏ويفضل أن تقلل بنسبة تتراوح من 96760 إلى 96860 على الأقل مقارنة معها والأفضل أن‎ ‏أن يتم إبطال الارتباط كلياً.‎ Sais ‏بنسبة تتراوح من 9680 إلى 96850 على الأقل والأكثر‎ ‏غير أنه؛ كما تبين من النتائج المتعلقة باستخدام الجسم المضاد الخيمري جاما ؛ غير المحور‎ ‏الم يكن الناتج المرغوب ذا طبيعة يمكن التنبؤ بها.‎ ١on a substitution for the amino acid proline in the nizza region; It is intended to enhance the stability of the anti-CE9Y4PE disulfide bond interaction. These antibodies were found to be indistinguishable in terms of their affinity towards 004; non-molecular weighing (MLR); its stability after being subjected to thermal deformation; Suppression of reaction of scrambled lymphocytes (ADCC induced cytotoxicity) and lack of efficacy when receptor binding occurs (complement-induced cytotoxicity). Hence; antibody-dependent CDC) and mAb Both of these antibodies exhibit standard test-tube reactions for Fe and the complement. The table shows that chimeric antibodies that bind the term Fe reduced binding to the 0 yl receptor less than chimeric antibodies containing the Fo field bind to the JE receptor and preferably reduce by 96760 to 96860 at least compared to it, and it is better that the link be completely nullified. As shown by the results with the use of the gamma chimeric antibody; Change the pivot if the desired output is not of a predictable nature

YYYY

١ ‏الجدول‎ ‏ا88‎ CROMPE ‏و‎ 689.1 sd ‏عقارنةبين وظائف المستفطة الجسم‎ 0 0>1 Table A88 CROMPE and 689.1 sd Comparison between vasodilating functions of the body 0 0>

CE9Y4PE ‏الفعالية الجسم المضاد الجسم المضاد‎ ‏في أنبوب الاختبار‎ ‏تعم نعم‎ MLR ‏ضعيف لا‎ Clq ‏الارتباط ب‎ ‏لا لا‎ CDC ‏نعم لا‎ ADCC ‏نعم لا‎ FcR ‏الارتباط ب‎ ‏في الجسم الحي (شمبانزي)‎ ‏لا‎ So CD4 Wa ‏إفراغ‎ ‏نعم نعم‎ CD4 ‏تعديل مستقبلة‎ (Wy dae 110004“ ‏تحتوي على‎ oJ yi) all ‏في الجسم‎ ‏جزئي لا‎ CD4 ‏إفراغ خلايا‎ ‏نعم نعم‎ CD4 ‏تعديل مستقبلة‎ ‏التسمم الخلوي المستحث بالخلايا المعتمد على الجسم المضاد‎ =ADCC ‏التسمم الخلوي المستحث بالمتممة‎ CDCCE9Y4PE Antibody Activity Antibody in test tube Yes No MLR Weak No Clq Binding to No No CDC Yes No ADCC Yes No FcR Binding to in vivo (Chimpanzee) No So CD4 Wa emptying Yes Yes CD4 receptor modulation (Wy dae 110004” contain oJ yi) all in the body Partial No CD4 emptying from cells Yes Yes CD4 receptor modulation Antibody-dependent cell-induced cytotoxicity =ADCC Complement-induced cytotoxicity CDC

Fc ‏مستقبلة‎ FcR ‏تفاعل الخلايا اللمفية المخلطة‎ MLR ° ‏وعليه؛ تثبت هذه النتائج أنه يمكن إنتاج الأجسام المضادة الخيمرية وفقآ للاختراع التي‎Fc receptor FcR mixed lymphocyte interaction MLR° and therefore; These results prove that chimeric antibodies can be produced according to the invention

Jia ‏البشري؛ حيث تفتقر لوظائف مستفعلة محددة عن طريق اختيار تتابعات‎ CDA ‏ترتبط ب‎ ‏ثابت نوعية.‎ ‏وباستخدام الأجسام المضادة الخيمرية النموذجية ل 004 أو أجسام مضادة خيمرية‎ ‏للاختراع بصفتها كوابت مناعية أو معدّلات 004 من أجل معالجة‎ Ga ‏أخرى يتم إنتاجها‎ ٠ ‏حأ“‎human jia; where they lack specific effector functions by selection of CDA sequences bound to a specificity constant. By using typical chimeric antibodies to 004 or chimeric antibodies of the invention as immunosuppressants or modifiers 004 for another Ga treatment they are produced 0 h

اضطرابات ذاتية المناعة؛ بما في ذلك؛ على سبيل المثال التهاب المفاصل شبه الروماتزمي؛ حيث يمكن إعطاء أجسام مضادة كهذه بمفردها أو في توليفة مع مركبات أخرى ملائمة لمعالجة الحالة المرضية الخاصة. فعلى سبيل ‎(Jal‏ يمكن إعطاء الجسم المضاد المعني في توليفة مع بروتينات أخرى؛ على سبيل المثال بروتينات مستقبلة الأجسام المضادة وحيدة م النسيلة القابلة للذوبان ل ‎(Wi-TNF‏ الأجسام المضادة وحيدة النسيلة لمستقبلة 11-2 الأجسام المضادة وحيدة النسيلة والبروتينات الاندماجية للمستقبلة التي تقاوم التفاعل بين ‎CD40‏ و ‎gp39‏ ‏والجلوبين المناعي 011.84 في الأجسام المضادة وحيدة النسيلة الذي يقاوم التفاعل بين 87 و ‎Lad 5 .CD28‏ في حالة معالجة التهاب المفاصل شبه الروماتزمي؛ يمكن إعطاء الجسم المضاد المعني في توليفة مع علاجات أخرى؛ على سبيل المثال؛ راباميسين؛ ليفلونوميد؛ ‎ye‏ تتيداب» ‎RS-61443‏ (ميكوفينولات موفيتيل ‎Surenyl Jab) gn ¢ (Mycophenolate Mofetil‏ (هيالورونات الصوديوم ‎(Sodium Hyaluronate‏ » اللقاح المضاد للببتيد ‎((VB17) TCP‏ أنيرفا ‎X‏ ‎Anvera X‏ (اللقاح المضاد ل ‎(MHC‏ ومواد ماصة مناعية لبروتين ‎A‏ خارج الجسم أو توليفات منها. وبشكل إضافي؛ يمكن إعطاء الجسم المضاد المعني في توليفة مع أجسام مضادة أخرى يتم إنتاجها ‎Gy‏ للاختراع أو تعرف في التقنية تكون متخصصة ب 004 البشري. ويمكن أن ‎١‏ يؤدي ذلك إلى حدوث تأثيرات مؤازرة؛ على سبيل المثال؛ إذا ارتبطت الأجسام المضادة هذه بمحددات مستضدية مختلفة لبروتين خلايا ‎.CD4‏ ‏وتذكر الأمثلة التالية لوصف الاختراع بشكل إضافي. المثال ‎١‏ ‏التنسيل والتعبير عن جسم مضاد خيمري من قرد أو إنسان له تخصصية ب ‎CD4‏ ‏7 يمثل ما يلي مثالا ‎fanaa‏ للطرق والأجسام المضادة ‎Gay‏ لهذا الاختراع. توليد أنسال مخلدة للخلية 8 مأخوذة من قرد تم تمنيع قرد سينومولجس بالغ (من مركز الرمال البيضاء في مدينة نيومكسيكو للرئيسيات) عن طريق إعطائه حقنة في العضل؛ عند مواقع متعددة؛ باستخدام خلايا 604 قابلة للذوبان ‎(SCD4)‏ بمقدار يتراوح من ‎300-١٠١‏ ميكروجرام أو أغشية خلوية ‎”٠١#١(‏ خلية) ‎eve‏ النسل الخلوي ل 004 الموجب وهو 71م50 باستخدام مادة مساعدة قياسية. وأعيد التمنيعautoimmune disorders; including; For example, sub-rheumatoid arthritis; Such antibodies can be given alone or in combination with other compounds appropriate to treat the particular disease condition. For example Jal the antibody in question can be administered in combination with other proteins, eg soluble monoclonal antibody receptor proteins for Wi-TNF monoclonal antibodies to the receptor 2-11 monoclonal antibodies and fusion proteins of the receptor that counteracts the interaction between CD40 and gp39 and IgM 011.84 in the monoclonal antibody counteracting the interaction between Lad 87 and Lad 5 CD28. In the case of treatment of rheumatoid arthritis, the antibody in question can be given in combination with therapies Others, eg; TCP Anvera X Anvera X (anti-MHC vaccine) and ex vivo protein A immunosorbents or combinations thereof. Additionally, the respective antibody may be administered in combination with other Gy-produced antibodies The invention or know-how in technology is specific to human 004. 1 This can lead to synergistic effects; For example; If these antibodies bind to different antigenic determinants of CD4 cell protein .and mention the following examples to further describe the invention. Example 1 Cloning and expression of a chimeric antibody from a monkey or a human specific for CD47 The following is a fanaa example of the methods and Gay antibodies of this invention. Generation of immortalized 8-celled progeny from monkeys An adult Sinomolgus monkey (from the White Sands New Mexico Primate Center) was immunized by intramuscular injection; at multiple sites; Using soluble 604 cells (SCD4) 300-101 µg or cell membranes “01#1 (cell) eve Cell progeny of 004 positive 71M50 using standard adjuvant. and re-immunized

YoYo

كل أسبوعين إلى ثلاثة أسابيع بما مجموعه ‎T‏ مرات. وحقن القرد بجرعة معززة يبلغ مقدارها ‎٠‏ ميكروجرام من ‎SCD4‏ في المنطقة الإربية في أحد الفخذين وبعد أسبوع واحد أزيلت العقدة اللمفية المصرفة من نفس الفخذ جراحياً. وأزيلت الخلايا اللمفية من العقدة اللمفية عن طريق تشريح النسيج وشطفه باستخدام وسط ‎DMEM‏ (وسط ايجل المعدل لدلبيكو) معقم. وتم م تمرير معلق الخلايا خلال شاش من النايلون وجمع عن طريق الفرز بالطرد المركزي بمعدلEvery two to three weeks a total of T times. The monkey was injected with a booster dose of 0 μg of SCD4 into the groin of one thigh and one week later the lymph node draining from the same thigh was surgically removed. Lymphocytes were removed from the lymph node by dissecting the tissue and rinsing it with sterile DMEM (Delbecco's modified Eagle's medium). The cell suspension was passed through nylon gauze and collected by centrifugation

يساوي ‎٠٠٠١‏ مضروباً في تسارع الجاذبية لمدة ‎٠١‏ دقائق. وعلق حوالي ‎"٠١*7١‏ خلية لمفية في محلول منظم يتكون من تريس-كلوريد الأمونيوم ‎Tris-ammonium chloride‏ (بتركيز ‎١١‏ ملي مولار ودرجة حموضة تبلغ ‎alan (ve‏ حرارة بلغت ‎A FY‏ لمدة © دقائق لتحليل الكريات الدموية الحمراء. وجمعت الخلايا اللمفية عن طريق الفرز بالطرد المركزي وعلقت مرة أخرى في إستر المثيل للحمض الأميني .آ-لوسين ‎(LME)‏ وحضنت عند 77م لمدة £0 دقيقة. ورشحت الخلايا المعالجة ب ‎LME‏ خلال منخل من النايلون وفرزت بالطرد المركزي. وأضيف ‎١‏ مل من مصل بطن الساق ‎«all‏ علقت الخلايا وغسلت مرتين في وسط ‎RPMI‏ خالٍ من المصل. وتم عد الخلايا وخلطها في أنبوب نابذ مفرد مخروطي الشكل بحجم ‎9٠‏ مل مع عدد ‎Blas‏ من خلايا ورم نضخاعي مخلطة ‎Vo‏ 616855 غسلت ‎Gaus‏ مرتين في وسط ‎JA‏ من المصل. وعلقت الخلايا بلطف في ‎١‏ مل من ‎PEG‏ (جليكول متعدد الإثيلين ‎(polyethylene glycol‏ بنسبة ‎٠‏ 960 الذي أضيف ببطء مع تقليب معتدل خلال فترة بلغت دقيقة. ثم أعيد تعليق الخلايا مرة أخرى بإضافة ‎Yo‏ مل من الوسط الخالي من المصل خلال فترة بلغت © دقائق؛ مع الخلط المعتدل لتخفيف ‎PEG‏ وبعد الغسل مرتين باستخدام الوسط الخالي من المصل أعيد تعليق الخلايا عند تركيز بلغ ‎oxo 7‏ )7 )+ مل في وسط ‎(RPMI‏ يحتوي على مصل بطن ساق جنيني بنسبة 97670 وجنتاميسين (متراكب مضاد حيوي أمينو جليكوسيد) ووضعت في صفائح زراعة نسيجية دقيقة تحتوي على 96 ‎Ge‏ بتركيز بلغ ‎١1‏ مل لكل عين. وأضيف حجم مساو من وسط ‎HAT‏ (وسط زراعة نسيجية يحتوي على هيبوزنثين؛ أمينوبترين وثيميدين) ‎(de ١٠(‏ إلى كلIt is equal to 0001 multiplied by the gravitational acceleration for 10 minutes. About 71*01 lymphocytes were suspended in a buffer solution consisting of Tris-ammonium chloride (at a concentration of 11 mM and a pH of Alan (ve) at a temperature of A FY for minutes for analysis). Erythrocytes Lymphocytes were collected by centrifugation and resuspended in A-leucine methyl ester (LME) and incubated at 77 °C for £0 min LME-treated cells were filtered through a nylon sieve and sorted by centrifugation All cells were suspended and washed twice in serum-free RPMI medium. Cells were counted and mixed in a single conical centrifuge tube of size 90 ml with a number of Blas cells. Myeloma scrambled Vo 616855 Gaus was washed twice in JA medium from the serum.The cells were gently suspended in 1 mL of PEG (polyethylene glycol 960 0%) which was added slowly with Moderately agitated over a period of 1 min.Then the cells were resuspended again by adding Yo ml of serum-free medium over a period of ∼ minutes, with moderate mixing of the PEG dilution and after washing twice with the serum-free medium, the cells were resuspended at a concentration of oxo 7 (7 (7) + ml) in medium (RPMI) containing serum of fetal leg stomach serum at a percentage of 97670 and gentamicin (an aminoglycoside antibiotic complex) and placed in micro-tissue culture plates containing 96 Ge at a concentration of 11 ml each. eye. An equal volume of HAT (tissue culture medium containing hypozenthine; aminopterin and thymidine) (de 10) was added to each

عين وتركت الهجائن لتنمو لمدة ‎١7-١‏ يومآً قبل الغربلة والمسح.The hybrids were sampled and left to grow for 1-17 days before sifting and wiping.

غربلة ومسح الهجائن الخلوية المندمجة من أجل إنتاج مضاد ال ‎CD4‏ ‎Cy al‏ معايرة تحديد تخصصية مضاد ال 004 كما يلي: طليت صسفائح ‎ELISA‏ ‏(معايرة مناعية إشرابية مرتبطة بالأنزيمات) ب 004 مأشوب عند تركيز بلغ ‎٠٠١‏ نانوجرام لكل عين وسدت باستخدام زلال المصل البقري بتركيز 961 في ‎PBS‏ (محلول منظم هه بالفوسفات) . وأخذت عينات بحجم مقداره ‎5٠‏ ميكرولتر من السائل الطافي للورم الهجيني من كل عين وتركت للحضن باستخدام الصفائح المطلية ب 004 لمدة ‎٠١‏ دقيقة. وكشسف عن الارتباط عن طريق الحضن مع مضاد الجلوبلين المناعي في الإنسان والجلوبلين المناعي في القرد الموسوم بالمادة المشعة نظير ‎Baal‏ المأخوذ من الماعز لمدة ‎٠١‏ دقيقة. وبعد الغسيل ؛ مرات باستخدام ‎ele‏ مقطرء تم عد الخلايا في العيون باستخدام عداد جاما. وأعيد معايرة ‎٠‏ العيون الإيجابية مرتين أما خلايا الورم الهجيني المأخوذة من تلك العيون فقد نسلت تنسيلا ‎Ge‏ ثلاث مرات؛ ‎Vf‏ عند تركيز بلغ © خلايا لكل عين ثم مرتين عند تركيز بلغ خلية واحدة لكل عين. وعند هذه المرحلة؛ غربلت مضادات 004 الموجبة من ‎Cua‏ القدرة على الارتباط ب 004 على سطح الخلية. وتمت هذه الغربلة والمسح عن طريق تثبيط ارتباط مضاد ‎CD4‏ وحيد النسيلة الفأري؛ الذي يسمى ‎(IF‏ بالنسل الخلوي ل 004 الموجب وهو ‎٠‏ | 50011. وباختصارء تم هذا التثبيط عن طريق حضن مقادير مختلفة من مضاد 004 المأخوذ من القرد و ‎٠١‏ ميكروجرام من 183 الموسوم ‎Ty‏ بشكل مشترك مع ‎“Vo XY‏ خلية ‎SupT1‏ ‏لكل عين في صفيحة تحتوي على 5 عيثآً. وبعد الحضانة لمدة ساعة واحدة عند درجة حرارة الغرفة (من حوالي ‎٠١‏ إلى 75م) أزيلت الخلايا بواسطة الخواء فوق مرشحات مصنوعة من ألياف زجاجية. وبعد الغسل الشامل باستخدام ‎PBS‏ تم عد الخلايا في المرشحات ‎plainly.‏ عداد جاما لتحديد تثبيط ارتباط 183 بخلايا ‎supT1‏ من قبل السوائل الطافية من الورم الهجيني المأخوذ من القرد. ولقد تم انتقاء نسيلة مرشحة أنتجت ‎Tolima Lowa‏ أظهر تثبيطاً شديداً ضد 113. وعين النمط الإسوي للنسيلة باستخدام مواد مفاعلة بشرية للتنميط الإسوي ووجد أنها عبارة عن جلوبلين مناعي ‎(1g62) G2‏ يمتلك سلسلة خفيفة من نوع ل ‎ala‏ وتم زراعة التنسل ‎vo‏ الخلوي هذا لغرض إكثاره لتنسيل ‎Gl) ge‏ الجلوبلين المناعي الخاصة به.Screening and wiping of fusion cell hybrids for the production of anti-CD4 Cy al. Calibration to determine the specificity of anti-004 as follows: ELISA plates (enzyme-linked immunosorbent assay) were coated with recombinant 004 at a concentration of 001 ng each. Eyes were blocked using bovine serum albumin at a concentration of 961 in PBS (phosphate buffer). Samples of 50 µl of hybridoma supernatants were taken from each eye and incubated on B004-coated plates for 10 minutes. And detection of binding by incubation with anti-immunoglobulin in humans and immunoglobulin in monkeys labeled with the radioactive isotope Baal taken from goats for 10 minutes. and after washing; Times using distilled ele the cells in the eyes were counted using a gamma counter. The 0 positive eyes were recalibrated twice, and the hybridoma cells taken from those eyes cleared a Ge cysteine three times; Vf at a concentration of ¼ cells per eye, then twice at a concentration of 1 cell per eye. And at this point; Cua positive anti-004 screened out the ability to bind to 004 on the cell surface. This screening was accomplished by inhibiting the binding of a mouse monoclonal anti-CD4; which is called IF by the 004-positive cell lineage of 0 | 50011. Briefly, this inhibition was achieved by incubating different amounts of anti-004 from the monkey and 01 μg of Ty-tagged 183 co-localized with “Vo”. XY SupT1 cell per eye in a plate containing 5 moths.After incubation for 1 hour at room temperature (from about 10 to 75°C) the cells were removed by vacuum over glass-fibre filters.After thorough washing with PBS cells were counted in the filters plainly. A gamma counter was used to determine the inhibition of binding of 183 to supT1 cells by the supernatants of the monkey hybridoma. A candidate clone produced Tolima Lowa was selected that showed strong inhibition against 113. The pattern was determined. The isoform of the clone using human reagents for isotype profiling was found to be an immunoglobulin (1g62) G2 that possesses an L-la light chain.

vv ‏مخلدة لقرد‎ B ‏وخفيفة متغيرة مأخوذة من خلايا‎ ALE ‏تنسيل مورثات منطقة سلسلة‎ ‏المخلدة‎ B ‏من خلايا‎ "٠١7١ ‏(الحمض النووي الريبوزي) الكلي من‎ RNA ‏عزل الرنا‎ guanidinium isothiocyanate ‏المأخوذة من قرد باستخدام طريقة أيزو ثيوسيانات الجو انيدينيوم‎ ‏مكمل وحيد الجديلة باستخدام بادئ‎ DNA ‏من مقدار الرنا الكلي لصنع دنا‎ ٠١/١ ‏ولقد استخدم‎ ‏ولقد استخدام‎ Reverse transcriptase ‏وترانزسكربتاز عكسي‎ oligo-dT ‏قليل النوويدات‎ primer | ‏م‎ ‎(PCR) ‏من مقدار دنا المكمل وحيد الجديلة لإجراء تفاعلات البوليمراز المتسلسلة‎ ٠١١ ‏الستة بادثئاً من ستة بوادئ قليلة النوويدات متخصصة بالعائلة‎ PCR ‏وتضمنت كل من تفاعلات‎ ‏مع قليل نوويدات ذي منطقة ثابتة لأحد‎ Sal 1 ‏عند النهاية ©" تحتوي على الموقع المحدد‎ Vy ‏ويبين كل منهما في‎ «Nhe 1 ‏عند النهاية " يحتوي على موقع‎ (IgG) G ‏الجلوبلينات المناعية‎ ‏يستخدم فيها بادئآً من خمسة بوادئ‎ PCR ‏وبشكل ممائل؛ أجريت خمسة تفاعلات‎ .١1-١7 ‏الشكل‎ > ‏وبادئ‎ Bgl IT ‏لّمْدا قليلة النوويدات للتتابع القيادي عند النهاية ©' تحتوي على موقع‎ ‏وكانت ظروف‎ Avr TT ‏منطقة ثابتة عند النهاية ” يحتوي على موقع‎ dla a ‏ثلاث مرات. ومررت‎ PCR ‏التفاعل كما هو موصوف أعلاه. وأجري كل تفاعل‎ ‏المنتجات لكل من تفاعلات تضخيم السلسلة الشقيلة والخفيفة على مواد‎ ‏هلامية من الأجاروز بتركيز 901,7. ونتج عن بادئ يحتوي على السلسلة‎ ٠ )٠١“ ‏(تتابع التميبيز رقم:‎ VH4 ‏الثقيلة‎ ‏والبادئ لتمندا (تتابع التمسييز‎ (5-ACTAAGTCGACATGAAACACCTGTGGTTCTT 3( ‏نطاقات‎ (5-ATCACAGATCTCTCACCATGACCTGCTCCCCTCTCCTCC 3( (Y1 ‏رقسم:‎ ‏شديدة بواسطة الرحلان الكهربائي على هلام الأجاروز. واستخدمت منتجات هذه التفاعلات‎ ‏للتنسيل في الناقل 6 70/81؛ الذي يحتوي على الجلوبلين المناعي البشري 61 (801]) وتتابعات‎ - ٠ ‏المنطقة الثابتة مدا البشرية.‎ ‏بشكل متعاقب.‎ TCAE 6 ‏المنطقتين المتغيرتين في الناقل التعبيري؛‎ GB) ga ‏وتم تنسيل‎vv immortalized monkey B and light variant taken from ALE cells Cloning of immortalized B chain region genes from total RNA 0171 cells of RNA isolate guanidinium isothiocyanate from monkey By using the method of atmosphere anidinium isothiocyanate, a single-stranded complement using a DNA primer from the total amount of RNA to make 1/10 DNA. Reverse transcriptase and oligo-dT oligonucleotide primer were used. m (PCR) of the amount of complementary single-stranded DNA to perform the six 011-polymerase chain reactions starting from six oligonucleotide primers specific to the PCR family and included each of the reactions with an oligonucleotide with a constant region of one of Sal 1 at The “©” end contains the specific site “Vy” and shows each of them in “Nhe 1” at the end “contains the (IgG) G site of immunoglobulins in which it is used as one of five PCR primers and italics; five reactions were carried out .11-17 Fig. > Initiator Bgl IT lemma oligonucleotide of the lead sequence at the end ©' contains a site and Avr TT conditions were a constant region at the end “contains dla a site three times. The PCR reaction was passed as described above. Each reaction of the products for both the amplification and light chain reactions was carried out on agarose gels at a concentration of 901.7. It resulted in a primer containing series 0 (01) (discrimination sequence No.: VH4 Heavy) and the starter for Tamanda (discrimination sequence (5-ACTAAGTCGACATGAAACACCTGTGGTTCTT) 3 domains (5-ATCACAGATCTCTCACCATGACCTGCTCCCCTCTCCTCC 3) (Y1 section: virulent by electrophoresis on an agarose gel.The products of these reactions were used for cloning into vector 6 70/81; which contains human immunoglobulin 61 (801]) and human constant region-0 sequences. TCAE 6 The two variable regions in the expression vector; GB) ga were cleaved

Sal 1 ‏باستخدام الأنزيمين المحددين‎ TCAE 6 ‏ذو السلسلة الثقيلة والناقل‎ PCR ‏أولاً؛ هضم منتج‎ «phenol/chloroform ‏واستخلصت المنتجات باستخدام مزيج من فينول/كلوروفورم‎ Nhe 1 ‏و‎ ‎— ‏واستمرت عملية ربط منتج‎ SEPHADEX 6-25 ‏ومررت خلال عمود تدويري من نوع‎ YoSal 1 with the two specific enzymes TCAE 6 heavy chain and vector PCR first; The “phenol/chloroform” product was digested and the products were extracted using a mixture of phenol/chloroform Nhe 1 and — the binding process of the SEPHADEX 6-25 product was continued and passed through a Yo spin column

YAYa

‏وتم ربط‎ Ta ‏عند 4٠م في وجود ليجاز (أنزيم ربط) دنا‎ Jill ‏بالناقل المقطوع طوال‎ 08 ‏ميكرولتر بنسبة مولية للوليجة/الناق ل‎ ٠١ ‏نانوجرام تقريباً من الدنا الكلي في حجم بلغ‎ ‏ولقد استخدمت المادة المرتبطة لتحويل الخلايا المؤهلة من السلالة البكتيرية‎ .1:٠١ ‏بلغت‎ ‏ووضعت الخلايا المحولة على شكل طلية على‎ (Stratagen ‏من شركة (ستراتاجين‎ XL-1 Blue ‏ميكروجرام/مل من الأمبيسيلين 80010111:0. وجمعت‎ 5٠ ‏صفائح الأجار 18 التي تحتوي على‎ ‏مستعمرات البكتيريا المقاومة للأمبيسيلين وزرعت في صورة مزارع صغرية بحجم © مل.‎Ta was linked at 40 μm in the presence of Jill DNA ligase (enzyme binding) to the cut vector along 08 μl with a molar ratio of the ligand/transfer of approximately 10 nanograms of total DNA in a volume of The qualified cells of the bacterial strain were 1:01. Transformed cells were plated on Stratagen XL-1 Blue µg/mL of ampicillin 80010111:0. 50 agar plates were collected. 18 colonies of ampicillin-resistant bacteria were grown in microcultures of © ml.

Sa ‏من كل مزرعة من هذه المزارع بطريقة‎ plasmid DNA ‏واستخلص دنا بلازميدي‎ ‏ومررت المنتجبات على‎ Nhe T ‏القلوي القياسي؛ وقطع باستخدام الأنزيمين المحددين 5811 و‎ ‏هلام الأجاروز بتركيز 961,7. واستخدمت بلازميدات ذات وليجات من 4560 زوج قاعديآ‎ ‏تقريبآً بصفتها مراصيف من أجل التنسيل اللاحق لمناطق السلسلة الخفيفة المتغيرة. وتم قطع‎ ٠ ‏للسلسلة الخفيفة وأيضاً البلازميد الذي يحتوي على الوليجة ذات السلسلة‎ POR ‏منتجات تفاعل‎ ‏وغربلت المزارع الصغرية‎ laa ‏وربطت‎ Ave 1] ‏و‎ Bgl 1] ‏الثقيلة باستخدام الأنزيمين المحددين‎ ‏وأحرزت نواتج الهضم التي أنتجبت‎ Ave 17 Bgl I ‏البلازميدية عن طريق القطع باستخدام‎ ‏قاعدياً تقريباً علامة موجبة. وزرعت البلازميدات التي تحتوي‎ lag) 490-4650 ‏وليجة من‎ ‏بكميات كبيرة من أجل تعيين تتابع الدنا.‎ Bgl IVAVe TL ‏و‎ Sal Nhe 1 ‏على كل من الوليجتين‎ vo وحصل على ناقلي التعبير عن الجسم المضاد الخيمري الترادفيين وهما 52 ‎TCAE‏ ‎TCAE 6‏ من الناقل ‎Cua «CLDN‏ يعتبر هو مشتقة للناقل ‎b‏ 8101110 (انظر مجلة العلم ‎(Science)‏ المجلد ‎(YOY‏ ص 7/7ا-4/اء )39 ‎(a)‏ ويعتبر 5 817110 بدوره مشتقة للتاقل التعبيري ‎TND‏ (انظر ما جاء في مجلة الدنا ‎(DNA)‏ المجلد ف ص ١متحلتت‏ 4 ام). 7 ويختلف ‎b‏ 81037110 عن الناقل ‎TND‏ من النواحي التالية. وضع العليبة الانتساخية لريدكتاز ثاني هيدروفولات ‎(DHFR)‏ (الحاث؛ الدنا المكمل؛ ومنطقة تعدد الأدتلة ‎(polyadenylation‏ بين عليبة منشط البلازمينوجين ‎plasminogen‏ النسيجي (عليبة التعبير ‎(t-PA‏ ‏وعليبة الأنزيم الناقل لمجموعة الفوسفات من النيوميسين ‎(NEO)‏ بحيث تكون جميع العليبات الثلاث مرتبة ترادفياً وفي نفس الاتجاه الانتساخي. وبالإضافة إلى ذلك؛ استعيض عن حاث ‎Yo‏ مورث ال ‎DHFR‏ الناقل ‎CLDN‏ بالحاث الرئيسي للجلوبين بيتا المأخوذ من الفأر (انظرSa from each of these cultures by plasmid DNA method, plasmid DNA was extracted, and the products were passed on the standard alkaline Nhe T; Cuts using the two specific enzymes 5811 and agarose gel with a concentration of 961.7. Plasmids with ligands of approximately 4560 base pairs were used as dockers for the subsequent cloning of the variable light chain regions. 0 was cut for the light chain, as well as the plasmid containing the insertion with the POR chain, reaction products, and the laa microcultures were sifted, and the heavy Ave 1 and Bgl 1 were linked using the two specific enzymes, and the digestion products that were obtained were obtained. I generated the Ave 17 Bgl I plasmid by cutting with a nearly basophilic positive marker. Plasmids containing lag) 490-4650 ligands were cultured in bulk for DNA sequencing. Bgl IVAVe TL and SalNhe 1 were cultured on each of the vo ligands and obtained two tandem chimeric antibody expression vectors, namely 52 TCAE TCAE 6 from the vector Cua “CLDN is considered to be a derivative of the vector b 8101110 (see Science vol YOY p. 7/7a-4/a)39 (a) 5 817110 is in turn a derivative of TND expression (see DNA Journal vol.p.1 pg 4m). 7 b 81037110 differs from the TND transporter in the following respects. Transcription of dihydrofolate reductase (DHFR) (inductor; complementary DNA; polyadenylation region) between the tissue plasminogen activator (tPA) expression packet and the neomycin phosphate group transfer enzyme (NEO) packet ) such that all three cans are arranged in tandem and in the same transcriptional direction.In addition, the Yo inductor of the DHFR gene transporter CLDN was replaced by the master inducer of mouse beta globin (see

Ya «Fa lad) «(Molecular Cell Biology) ‏ما جاء في مجلة علم أحياء الخلايا الجزيئية‎ ‏برابط متعدد. ويمكن‎ t-PA ‏المكمل ل‎ Gall ‏واستعيض عن‎ (aYAAY 1754-١7 456 ‏ص‎ ‎(NEO «DHFR ‏فصل جميع العليبات الانتساخية الثلاث لحقيقيات النواة (وهي عليبات التعبير»‎ ‏عن طريق الهضم باستخدام النوكلياز الداخلي‎ (PUCY ‏البلازميدي البكتيري (المشتقة‎ Lal ‏عن‎ ‎Notl ‏المحدّد‎ ° (LTR) ‏لأنه استعيض عن التكررات الانتهائية الطويلة‎ RLDN10b ‏عن‎ CLDN ‏ويختلف‎ ‏لرواس في مقدمة الرابط المتعدد بمعزز حاث المورث المبكر الفوري للفهيروس المضخم‎Ya «Fa lad) «(Molecular Cell Biology) What came in the Journal of Molecular Cell Biology, with a multiple link. t-PA complementary to Gall and replaced by aYAAY 1754-17 456 p. Bacterial plasmid PUCY (the Lal derivative of the Notl specific ° (LTR) because the RLDN10b long-terminal repeats were replaced by CLDN and the Roses at the front of the multiple linker differ from the immediate early gene promoter of the amplified virus ,

A(2Y AAO OY) ‏ص‎ cf) ‏المجلد‎ (Cell) ‏للخلايا البشري (انظر ما جاء في مجلة الخلية‎ ‏من حيث:‎ CLDN ‏عن‎ TCAE 6 ‏و‎ TCAE 5.2 ‏ويختلف الناقلان التعبيريان‎ ‏من ثلاث)؛ بترتيب ترادفي:‎ Ya) ‏انتساخية‎ Slade ‏أنهما يحتويان على أربع‎ )١( ٠ ‏أ ) منطقة سلسلة خفيفة ثابتة للجلوبلين المناعي البشري حصل عليها عن طريق تضخيم‎ ( ‏تتمثل هذه‎ (TCAE 5.2 ‏الدنا المكمل بواسطة تفاعل بوليمراز المتسلسل. وفي الناقل‎ ‏للجلوبلين المناعي البشري (الأحماض‎ LIS ‏المنطقة في منطقة السلسلة الخفيفة الثابتة‎ ‏وفي الناقل‎ o(Km3 ‏لترقيم كابات؛ النمط الأليلي‎ Gig 7١4-٠١8 ‏الأمينية أرقام‎ ‏هي منطقة السلسلة الخفيفة الثابتة مدا للجلوبلين المناعي البشري‎ TCAE 6 Vo (lls 02 ‏لترقيم كابات؛ النمط المورثي‎ Gay 719-٠١78 ‏(الأحماض الأمينية أرقام‎ ‏سالب).‎ Ke ‏سالب؛ النمط الأليلي‎ Meg ‏(ب) منطقة سلسلة ثقيلة ثابتة للجلوبلين المناعي البشري؛ وفي كلتا الوحدتين البنائيتين‎ ‏كانت السلسلة الثقيلة للجلوبلين المناعي البشري عبارة عن منطقة ثابتة من نوع‎ ‏لترقيم كابات لها النمط الأليلي‎ Gay EVASIVE ‏(الأحماض الأمينية أرقام‎ ١ ‏جاما‎ Y. ‏حيث حصل عليها عن طريق تضخيم الدنا المكمل بواسطة تفاعل‎ ((Gmiz ‏و‎ Gmla ‏بوليمراز المتسلسل.‎ ‏الخاصة به.‎ Alia) ‏يحتوي على منطقة الحاث حقيقي النواة ومنطقة تعدد‎ DHFR ‏(ج)‎ ‏الخامسة‎ Alay) ‏يحتوي كذلك على منطقة الحاث حقيقي النواة ومنطقة تعدد‎ NEO ) ‏د‎ ( ‏به.‎ Yo ‏أ‎A(2Y AAO OY) p. cf) Cell volume of human cells (see what was stated in Cell Journal in terms of: CLDN for TCAE 6 and TCAE 5.2 and the two expressive vectors are different of three); In tandem order: Ya) Slade transcriptomes that they contain four (1) (0a) constant light chain region of human immunoglobulin obtained by amplifying (this is represented by TCAE 5.2 complementary DNA by polymerase reaction In the transporter of human immunoglobulin (LIS) the region in the constant light chain region and in the transporter o (Km3) for caprate numbering; allelic pattern Gig 714-018 Amino numbers are the constant light chain region of Human immunoglobulin TCAE 6 Vo (lls 02 for Kabat number; genotype Gay 719-0178 (amino acid numbers negative). Ke negative; Meg allelic type (b) IgM constant heavy chain region In both residues, the human immunoglobulin heavy chain was a constant region of the type of caps numbering type Gay EVASIVE (amino acid numbers 1 gamma Y). Where he obtained it by amplifying the DNA Complement by reaction (Gmiz and Gmla polymerase chain. Alia) contains the eukaryotic inductor region and the DHFR polyubiquitous region (c) V. Alia) also contains the inductor region Eukaryotic and NEO multiplicity zone (d) by. Yo prof

0 ‎(Y)‏ عليبتا السلسلة الخفيفة والتقيلة للجلوبلين المناعي البشري اللتان تحتويان على تتابعات إشارة تخليقية لإفراز سلاسل الجلوبلين المناعي.0 (Y) The two human immunoglobulin light-chain and heavy-chain canisters that contain synthetic signal sequences for the secretion of immunoglobin chains.

‎Gade (V7)‏ السلسلة الخفيفة والثقيلة للجلوبلين المناعي البشري اللتان تحتويان على رابطات دنا نوعية تسمح بإيلاج منطقتي السلسلة الثقيلة والخفيفة المتغيرة للجلوبلين المناعي اللتين ° تحافظان على إطار قراءة الترجمة ولا تغيران الأحماض الأمينية التي توجد عادة في سلاسل الجلوبلين المناعي. ويؤدي إدخال التغيرات الموصوفة؛ إلى تشكيل الناقلين ‎TCAE 2‏ و 6 ‎.TCAE‏ ويؤدي تنسيل مورثات منطقة السلسلة الخفيفة والثقيلة المتغيرة للجلوبلين المناعي؛ من النسل الخلوي للورم الهجيني المخلط المضاد ل ‎CD4‏ وهو ‎(E9.1‏ ‏في الناقل ‎TCAE6‏ إلى الحصول على الوحدة البنائية التي قد أودعت في ‎Ac gana) ATCC‏ ‎Ve‏ المزارع النمطية الأمريكية). ونسلت الوحدة البنائية؛ التي قد أودعت؛ والتي تحمل شيفرة الجسم المضاد 689.1 الذي يحتوي على منطقة السلسلة الثقيلة المتغيرة للجلوبلين المناعي المأخوذ من قرد السينومولجس ومنطقة السلسلة الخفيفة المتغيرة للجلوبلين المناعي المأخوذ من قرد ‎OI (und ga ginal‏ تبين تتابعاتهما في الشكل ‎١‏ والشكل 7 على الترتيب؛ من النسل الخلوي للورم الهجيني المضاد ل 004 وهو 89.1. ومتطقة السلسلة ‎Vo‏ الثقيلة الثابتة هي من أصل بشري من النمط الإسوي جاما ‎١‏ والنمط الأليلي ‎Gmla‏ و 2. كما أن منطقة السلسلة الخفيفة الثابتة ‎lal aT‏ هي من أصل بشري؛ لها النمط المورثي 02 ‎meg «ills‏ سالب والنمط الأليلي ‎Ke‏ سالب. وتنسل مورثات الجلوبلين المناعي في الناقل التعبيري 6 ‎TCAE‏ المأخوذ من الثدييات؛ الموصسوف في الطلبات المذكورة سابقاً المدمجة للإحالة إليها كمرجع؛ والتي عند إخضاعها لعملية تشكيل المسام ‎Y.‏ بالكهرباء في النسل الخلوي الثديي ‎CHO‏ تنتج جسماً مضاداً خيمرياً مضادً ل ‎CD4‏ من قرد/إنسان. ولقد استخدمت الوحدة البنائية للدنا الموصوفة في هذا البيان» لتحويل السلالة البكتيرية ‎Blue‏ 21-1 والتي تم انتقاؤها في المضاد الحيوي الأمبيسيلين وأودعت فيGade (V7) human immunoglobulin light and heavy chains that contain specific DNA linkers that allow insertion of the immunoglobulin variable heavy and light chain regions ° that maintain the translation reading frame and do not alter the amino acids normally found in immunoglobulin chains. performs the introduction of the changes described; leads to the formation of TCAE transporters 2 and TCAE 6. It leads to cloning of the immunoglobulin variable light and heavy chain region genes; From the cell lineage of the anti-CD4 mixed hybridoma (E9.1 in the vector TCAE6 to obtain the residue that was deposited in Ac gana (ATCC Ve) American Typology Cultures). the structural unit was born; that have been deposited; which is encoded for antibody 689.1 containing the immunoglobulin heavy chain variable region from monkey synmolgs and the variable light chain region for immunoglobulin from monkey OI (und ga ginal) Their sequences are shown in Figure 1 and Figure 7 respectively; from the cell lineage The anti-004 hybridoma is 89.1.The persistent Vo heavy chain region is of human origin with gamma isotype 1 and alleles Gmla and 2.The lal aT light chain constant region is of human origin; Genotype 02 meg “ills negative and allele Ke negative. The immunoglobulin genes are translocated into the expression vector 6 TCAE from mammals described in the previously mentioned submissions merged for reference, which when subjected to Y. The electrolyte of mammalian cell lineage CHO produced a chimeric anti-CD4 antibody from monkey/human.The DNA residue described in this statement was used to transform the bacterial strain Blue 21-1 which was selected in the antibiotic ampicillin and deposited in

‏صورة معلق خلوي بكتيري في وسط ‎LB‏ معقم يحتوي على الجليسرول بنسبة 9619.Photograph of a bacterial cell suspension in sterile LB medium containing glycerol pH 9619.

تعيين تتابع دنا حضر الدنا البلازميدي من مزارع بحجم ‎٠٠١‏ مل. ونقي بشكل إضافي عن طريق الترسيب ‎aaa)‏ واحد) باستخدام مزيج من كلوريد الصوديوم بتركيز 0,¥ مولار وجليكول متعدد الإثيلين بنسبة 9678 )1 أحجام) على الثلج لمدة ‎V0‏ دقيقة. وبعد الفرز بالطرد المركزي 0 بتسارع يفوق تسارع الجاذبية ب ‎٠٠٠٠١‏ مرة لمدة ‎AaB ٠١‏ غسلت الكرية باستخدام الإيثانول بنسبة ‎oY‏ وفرزت بالطرد المركزي مرة أخرى وجففت في ‎hina‏ من نوع ‎Speedivac‏ (من شركة سافانت أ710ة5). وأعيد تعليق كرية الدنا في ماء منزوع الأيونات عند تركيز يتراوح من ‎790-٠١٠١‏ ميكروجرام/مل. وأجري تعيين التتابعات بواسطة © ميكروجرام من دنا ثنائي الجديلة باستخدام تقنية سانجر. ولقد استخدم بوادئ تعيين تتابع > ممائثلة للتتابعات ضمن الناقل التعبيري في اتجاه وبعكس اتجاه تعبير المورث (الاتجاه المجاري والمعاكس) لوليجتي السلسلة الخفيفة أو السلسلة الثقيلة. وتم تعيين تتابع الوليجتين في الاتجاهين: من النهاية ‎ro‏ إلى ” ومن النهاية ؟” إلى ©". وتم تعيين تتابع نسيلتين للسلسلة الخفيفة لمضاد ‎CD4‏ ونسيلتين للسلسلة الثقيلة لمضاد ‎CD4‏ ولدت كل منهما من تفاعلات ‎PCR‏ ‏منفصلة على التوازي من أجل تحديد إذا ما أدخلت أية تغيرات في النوويد أثناء تفاعل ال ‎PCR Ve‏ ولقد وجد أن كل من نسيلتي السلسلة الثقيلة ونسيلتي السلسلة الخفيفة تكون متطابقة على امتداد طولها الكلي؛ مما يثبت أنه لم تدخل أية أخطاء أثناء عملية التضخيم. ويبين تتابع السلسلتين الثقيلة والخفيفة لمضاد 004 في الشكلين ‎١‏ و 7. التعبير عن مضاد 604 الخيمري من قرد/إنسان لا يكون الناقلان التعبيريان 5.2 ‎TCAE‏ و 6 ‎TCAE‏ قابلين للاستخدام للتعبير المتكامل ‎٠‏ - الثابت في النسلين الخلويين ‎Sp2/0‏ و ‎CHO‏ فحسب؛ إنما يكون بإمكانهما أيضاً التعبير؛ لأنهما يحتويان على الأصل 5740 (الفيروس القردي 0٠4؛)؛‏ بشكل عابر في النسل الخلوي ‎COS‏ ‏(خلايا فيروسية معيبة). وتم التعبير عن خلايا ‎COS‏ كما يلي: زرعت خلايا ‎COS‏ قبل يوم واحد من العدوى التحويلية بحيث تكون في اليوم التالي مندمجة بنسبة ‎70-5٠‏ بالوزن. وأزيل وسط الزراعة وغسلت الخلايا مرتين باستخدام المحلول المنظم للعدوى التحويلية ‎vo‏ (©7-محلول ‎NaCl‏ بتركيز ‎٠58‏ ملي مولار؛ تريس بتركيز ‎YO‏ ملي مولار؛ محلول ‎KCl‏DNA sequencing prepared from 100 ml cultures. Further purify by precipitation (1 aaa) using a mixture of 0.¥ M NaCl and 9678 polyethylene glycol (1 vol) on ice for V0 min. After centrifugation 0 at 0001 times greater than gravity for 01 AaB, the pellet was washed with oY ethanol, centrifuged again, and dried in a Speedivac hina (Savant A710A5). The DNA globule was resuspended in deionized water at a concentration of 790-0101 μg/mL. Sequence mapping was performed by µg of dsDNA using the Sanger technique. He used primers to set sequences similar to the sequences within the expressive vector in the direction and opposite direction of gene expression (downstream and opposite direction) for the two ligands of the light chain or the heavy chain. The sequence of the two inserts is set in both directions: from the end ro to “and from the end?” Two anti-CD4 light chain clones and two anti-CD4 heavy chain clones generated from separate parallel PCR reactions were sequenced to determine if any nucleotide changes were introduced during the Ve-PCR reaction. It was found that both the clones of the heavy chain and the two clones of the light chain are identical along their total length, which proves that no errors were introduced during the amplification process.The sequence of the heavy and light chains of anti-004 is shown in Figures 1 and 7. Expression of chimeric anti-604 from Monkey/Human Expressive vectors 5.2 TCAE and 6 TCAE are not only usable for the integrated 0-constant expression in the cell lineages Sp2/0 and CHO, but are also capable of expressing because they contain the parent 5740 (simianvirus 004;); transiently transiently transfected in COS cell progeny (defective viral cells).COS cells were expressed as follows: COS cells were cultured one day prior to transforming infection so that the next day they were integrated at a ratio of 50-70 by weight.The culture medium was removed and the cells were washed twice with the transforming infection buffer (©7-NaCl) at 058 mM; Tris at YO mM concentration; KCl solution

1l

بتركيز © ملي مولارء ‎NayHPO,‏ بتركيز ‎١8‏ ملي مولار؛ ‎MgCl‏ بتركيز ‎١‏ ملي مولارء ‎CaCl‏ بتركيز ‎١‏ ملي مولار). ومزج ‎Yo‏ ميكروجرام من بلازميد 6 ‎TCAE‏ المنقى بكلوريد السيزيوم الذي يحتوي على سلسلتي الجلوبلين المناعي الخيمري التقيلة والخفيفة لمضاد ‎CD4‏ ‏من قرد/إنسان مع “ مل من دكستران ‎DEAE‏ لكل طبق (بتركيز ‎١‏ مجم/مل في ‎(TB‏ وترك ‎٠‏ الدنا ليحضن مع الخلايا لمدة ساعة واحدة عند ‎TY‏ م. وأزيل محلول الدنا واستعيض عنه ب ‎V‏ مل من الجليسرول بتركيز 90780 لمدة تراوحت من *,7,5-1؟ ‎Cua (A383‏ غسلت بعد هذه المدة الخلايا مرتين باستخدام ‎TB‏ وحضنت الخلايا في © مل من وسط جديد يحتوي على كلوروكين بتركيز ‎٠٠١‏ ميكرومولار لمدة ‎0-F‏ ساعات عند 77 م؛ وغسلت بعد هذه المدة مرتين باستخدام الوسط وحضنت باستخدام ‎DMEM‏ (وسط إيجل المعدل لدلبيكو) عادي لمدة 7" ساعة. وأجري معايرة للسائل الطافي (بحجم ‎٠٠١‏ ميكرولتر) من خلايا 005 ذات العدوى التحويلية باستخدام محاليل مخففة متنوعة من أجل تحديد وجود الجسم المضاد بواسطة التقنية التي أساسها ‎ELISA‏ واستخدم مضاد 1 ‎lato‏ البشري المأخوذ من الماعز لطلي صفائح معايرة تحتوي على 46 ‎Lue‏ ومضاد الجلوبلين المناعي 6 (80]) البشري المأخوذ من الماعز الموسوم بالبيروكسيداز بصفته الجسم المضاد المستخدم للكشف؛ في ظروف ‎ELISA‏ ‎١‏ قياسية. ووجد أن خلايا ‎COS‏ تنتج ما بين ‎٠١‏ و 50 نانوجرام/مل من الجسم المضاد الخيمري من قرد/إنسان. وركزت أحجام أكبر بمقدار ‎٠١‏ أضعاف من السائل الطافي واستخدمت في معايرة إشعاعية مناعية بالارتباط المباشر ‎(RIA)‏ بخلايا ‎SupT1‏ ل 004 الموجب. واستخدم الجسم المضاد الوالدي الكامل المأخوذ من القرد وجلوبلين مناعي بشري عديم الصسلة به كضابط إيجابي وسلبي على الترتيب. كما استخدم مضاد ال 004 المأخوذ من القرد ومضاد ‎CD4 Wy.‏ الخيمري من القرد/الإنسان لتثبيط ارتباط الجسم المضاد ل 604 عالي الألفة المأخوذ من الفأر ‎(1F3)‏ ودلت هذه النتائج على أن الجسم المضاد المأشوب المأخوذ من القرد/الإنسان (مجموعة المزارع النمطية الأمريكية ‎(ATCC)‏ رقم 1907( لا يرتبط بخلايا ال 004 الموجب فحسب بل يكون قادرآ على تثبيط ارتباط 173 بخلايا ال 004 الموجبat a concentration of © mM NayHPO, at a concentration of 18 mM; MgCl at a concentration of 1 mM (CaCl at a concentration of 1 mM). Yo mixed µg of 6-TCAE plasmid purified with cesium chloride containing the chimeric immunoglobulin heavy and light chains of anti-CD4 from monkey/human with “ml of dextran DEAE per plate (at a concentration of 1 mg/ml In (TB) and 0 left the DNA to incubate with the cells for one hour at TY M. The DNA solution was removed and replaced with V ml of glycerol at a concentration of 90780 for a period ranging from *,7.5-1? Cua ( A383 cells were washed twice with TB and incubated in ¾ ml of fresh medium containing chloroquine at a concentration of 100 µm for 0-F hours at 77 °C; after this period, they were washed twice with medium and incubated with DMEM (Delbecco's modified Eagle's medium) normal for 7" h. The supernatant (volume 100 μl) of transformatively infected 005 cells was titrated using various dilutions for antibody presence determination by ELISA-based technique and anti-1 was used. human goat lato for plating titrant plates containing Lue 46 and peroxidase-tagged human goat immunoglobulin 6 (80]) as the detection antibody; under standard ELISA 1 conditions. It was found that COS cells produced between 10 and 50 ng/mL of chimeric antibody from monkey/human. 10-fold larger volumes of the supernatant were concentrated and used in a direct binding radioimmunoassay (RIA) of positive SupT1L004 cells. The parental whole monkey antibody and unrelated human immunoglobulin were used as positive and negative controls, respectively. The monkey/human chimeric CD4 Wy. antibody was also used to inhibit the binding of the highly affinity mouse antibody 604 (1F3). These results indicated that the recombinant antibody taken from the monkey/human (group (ATCC No. 1907) not only binds to 004-positive cells but is also able to inhibit binding of 173 to 004-positive cells.

بنفس تراكيز الجسم المضاد الكامل المأخوذ من القرد أو 173 نفسه تقريباً.Approximately the same concentrations of the whole antibody taken from the monkey or 173 itself.

الل المثّال ‎Y‏L is represented by Y

يتعلق هذا المثال بالتمييز الوظيفي في أنبوب الاختبار للجسم المضاد 089.1؛ ‎Lay‏ في ذلك تأثيراته على تكاثر ‎Wa‏ 7 وإنتاج 11-2 في تفاعل ‎MLR‏ خواص ارتباطه بمستقبلة ‎Fo‏ ‏والمتممة؛ وقدرته على إحداث استجابة ‎ADCC‏ و ‎.CDC‏ وبالإضافة إلى ذلك؛ تم تحليل ‎oo‏ التأثيرات في الجسم الحي على توسط مستقبلة 004 والمجموعات الفرعية اللمفانية في الدم المحيطي. وتم تحليل ما يلي. واستخدمت المواد والطرق التالية في هذا المثال. [انظر ما جاء عن أندرسون ومعاونيه ‎cAnderson et al‏ في مقالة بعنوان 'تمييز ‎mAb‏ محول إلى ‎Andis ya‏ رئيسية (عن طريق دمج مناطق ‎V‏ من أجسام مضادة متولدة في قرود المكاك بحقول ثابتة بشرية) ل 004 البشري في أنبوب الاختبار وفي الجسم الحي: اه« يسبب تعديل ‎ALE awe‏This example pertains to functional discrimination in the test tube of antibody 089.1; Lay, including its effects on Wa 7 proliferation and 11-2 production in the MLR interaction, its binding properties to the Fo receptor and its complement; its ability to trigger an ADCC and .CDC response and in addition; The in vivo effects on receptor-mediated 004 and peripheral blood lymphoid subsets were analyzed. The following was analyzed. The following materials and methods were used in this example. [See cAnderson et al. in the article 'Discrimination of an mAb converted into an Andis ya major (by incorporating V regions of antibodies generated in macaques with human constant fields) of human 004 in Test tube and in vivo: uh" causes modification of ALE awe

‎٠‏ 004 وليس إفراغ خلايا ‎IT‏ 604 في قرود الشمبانزي"].0 004 and not emptying of IT 604 cells in chimpanzees”].

‏المواد والطصرق التركيب الجزيئي والتعبير عن مضاد ال 004 المسمى بريماتايزد ‎Ads) (PRIMATIZED)‏ تجارية) ضخمت ‎Gl) ga‏ الجلوبلين المناعي للمنطقة المتغيرة عن طريق ‎PCR‏ ونسلت من ورم ‎Ne‏ هجيني مخلط حصل عليه من قرد 2750 ب 5004؛ كما وصف ‎lle‏ [ فيما جاء عن آر. إيه. نيومان ومعاونيه ‎(Newman, RA. et al‏ في مقالة بعنوان "تحويل أجسام مضادة مأشضوبة إلى أجسام مضادة ثديية رئيسية للعلاج المناعي لمرض بشري: جسم مضاد خيمري من مكتاك (قرد آسيوي)/إنسان ل ‎CDA‏ بشري"؛ في مجلة التقنية الحيوية ‎(Biotechnology)‏ المجلد + ‎¢V‏ ‏ص ‎(V E00‏ 1997م]. وتم إيلاج ‎CB) ge‏ منطقتي السلسلة الثقيلة والخفيفة المتغيرة في ناقل ‎٠‏ - تعبيري عليبي؛ وهو 6 ‎(TCAE‏ بطريقة ترادفية وعبر عنها بصفتها جلوبلين مناعي 61 (1801) من نوع لتتمندا ‎(IgGIA)‏ بعد التدامج الشابت في ‎hi] DHFR-CHO Wha‏ ما ‎sla‏ ‏عن نيومان في المرجع المذكور ‎[la‏ وسمحت ثلاث دورات من التضخيم بمقادير متزايدة من المثوتريكسات بإنتاج أنسال خلوية عبرت عن مستويات من الجسم المضاد تزيد عن ‎Vo‏ ميكروجرام/ملي لتر خلال ‎A‏ أيام. وتم توليد نسل خلوي إنتاجي زرع في مزرعة »| تحتوي على ‎WIA‏ معلقة ‎plugs‏ تدريجياً قبل التلقيح بمفاعل ليفي مجوف [انظر ما جاء عن 1.1MATERIALS AND METHODS Molecular structure and expression of the anti-004 labeled Ads (PRIMATIZED) amplified (Gl) ga immunoglobulin of the variable region by means of PCR and extracted from a mixture Ne hybridoma obtained from monkey 2750 B 5004; As described by lle [as reported by R. any. Newman, RA. et al. (Newman, RA. et al.) in the article “Transformation of recombinant antibodies into key mammalian antibodies for immunotherapy of human disease: a muktaca/human chimeric antibody to human CDA”; in Technology. Biotechnology vol + ¢V p. (V E00 1997AD).The heavy and light chain variable regions (CB)ge were inserted into the 0-canal expressive vector 6 (TCAE) in a manner Tandem and expressed as immunoglobulin 61 (1801) of the type of Tatamanda (IgGIA) after fusions young in hi] DHFR-CHO Wha Ma sla on Newman in the mentioned reference [la] and allowed three cycles of amplification in amounts Increasing numbers of methotrexate produced cell progeny that expressed antibody levels greater than Vo μg/mL within A days. hollow fibrous [see above 1.1

$e ‏في مقالة بعنوان "إنتاج أجسام مضادة وحيدة النسيلة فأرية على‎ Evans et al ‏إيفانز ومعاونيه‎ «(BioTechniques) ‏نطاق واسع باستخدام مفاعلات حيوية ليفية مجوفة"؛ مجلة التقنيات الحيوية‎ .]م١‎ AAA ‏ص 57لا‎ cA ‏المجلد 6؛ العدد‎ ‏بتمرير السائل الطافي للمزرعة من‎ «CE9.1 (mAb) ‏ونقي الجسم المضاد وحيد النسيلة‎ ‏مل؛ من شركة‎ ٠١ aan) (Prosep A) ‏م المفاعل خلال عمود من نوع بروسيب إيه‎ ‏حيث عودل مسبقاً باستخدام محلول ملحي منظم‎ o(Bioprocessing Inc.) ‏بيوبروسيسينج إنك.‎ ‏إلى‎ PBS ‏مل/دقيقة. وغسل العمود باستخدام‎ 1 YO Janay 7,7 ‏بالفوسفات تبلغ درجة حموضته‎ ‏الجسم المضاد المرتبط باستخدام خمسة أحجام من‎ Spay ‏أن تم تثبيت قيمة لخط الأساس‎ ‏مولار/الجليسين بتركيز‎ ١.7 ‏العمود من محلول منظم من مزيج من حمض الأسيتيك بتركيز‎ ‏وبلغت نسبة الاستعادة حوالي 9704960. وعدلت درجة‎ .4,٠ ‏مولار بلغت درجة حموضته‎ ١ ٠١ ‏حموضة ناتج التصويل إلى قيمة بلغت ,8 ومرر خلال عمود من نوع كيو-سيفاروز‎ ‏غسل باستخدام‎ Cua ‏وارتبط 089.1 بالعمود‎ (Pharmacia ‏(من شركة فارماسيا‎ (Q-Sepharose) ‏ميجا مولارء؛ بدرجة حموضة بلغت 8,9. وصول الجسم‎ YO ‏مزيج من تريس-1101 بتركيز‎ ‏بدرجة حموضة بلغت‎ OY se ‏ملي‎ ٠٠ ‏المضاد باستخدام مزيج من تريس-1101 بتركيز‎$e in the article “Large-Scale Production of Mouse Monoclonal Antibodies by Evans et al Evans et al. (BioTechniques) Using Hollow Fiber Bioreactors”; Journal of Biotechnology.] P1 AAA p 57 no cA vol 6; Number by passing culture supernatants of “CE9.1 (mAb) and purified monoclonal antibody ml; From (Bioprocessing Inc.) o (Bioprocessing Inc.) buffered saline (Bioprocessing Inc.) to PBS ml/min. Column washing with 1 YO Janay 7.7 phosphate pH bound antibody using five volumes of Spay was fixed to a baseline 1.7 mM/Glycine concentration of the column from a buffer solution of a mixture of acetic acid with a concentration of about 9,704,960. The recovery rate was about 9,704,960. The degree of 0.4 Molar, with a pH of 1 01, was adjusted to a value of 8, and passed through a Q-Sepharose column, washed with Cua 089.1 was attached to the column (Pharmacia (Q-Sepharose) in megamolars, with a pH of 8.9. The arrival of the body YO mixture of Tris-1101 at a concentration of pH of 0.0 mM se. 00 antibody using a mixture of Tris-1101 at a concentration

Sad ‏ملي مولار وركز عن طريق الترشيح‎ ٠٠١ ‏يحتوي على محلول 11:01 بتركيز‎ 6,8 vo ‏(باستخدام جهاز من نوع ملي بور بليكون) باستخدام محلول ملحي إسوي التوتر قابل للحقن‎ ‏من‎ NDP ‏وأخيرآً؛ رشح 689.1 خلال مرشح من نوع‎ (USP) ‏لدستور الأدوية الأمريكي‎ Ga (Pall Filtration ‏لبول‎ Wg ‏ميكرومتر (الترشيح‎ ٠١.60 4 ‏النايلون.. يبلغ حجم عيونه‎Sad was concentrated by filtration 001 mM containing an 11:01 solution with a concentration of 6.8 vo (using a Millipur Plycon device) using an isotonic saline injectable solution of NDP and finally; Filtration 689.1 Through Type (USP) USP Ga (Pall Filtration) For Urine Wg Micrometer (Filtration) 01.60 4 0 Nylon.. Eye Size

CD4" ‏ل‎ supT-18 ‏بخلية‎ CE9.1 ‏تخصصية الارتباط: ارتباط‎ 176 ‏سدت صفائح ذات مقياس ميكرولتري لها قواعد على شكل حرف 1 وتحتوي على‎ 1 ‏يحتوي‎ PBS ‏لمدة ساعة واحدة على الثلج باستخدام‎ Wass (Corning ‏(من شركة كورنينج‎ Lue .760,1 ‏على زلال المصل البقري بتركيز 960.7 ومحلول أزيد الصوديوم بتركيز‎ ‏)؛ التي غسلت مسبقاً باستخدام المحلول المنظم‎ "٠١7١ ‏(عددها‎ SupT-18 ‏خلايا‎ Ci was ٠, ‏دقيقة على الثلج باستخدام تراكيز متفاوقة من 689.1 (تتدرج من‎ Fo ‏نفسه؛ لمدة‎ ‏دقيقة على‎ Ve ‏ميكروجم/مل). وغسلت الخلايا مرتين وحضنت لمدة‎ ٠١ ‏بيكوجم/مل إلى‎ voCD4" of supT-18 to CE9.1 cell Binding specification: binding to 176 μl platelets with 1-bases containing 1 blocked PBS for 1 hour on ice with Wass Corning (Corning Lue .760,1) on bovine serum albumin 960.7 and sodium azide solution, pre-washed with buffer “0171” (number of SupT-18 cells Ci was 0 , min on ice using varying concentrations of 689.1 (gradient from Fo the same; for 1 min on Ve µg/mL). Cells were washed twice and incubated for 10 pg/mL to VO.

TaTa

$0$0

التلج باستخدام طبقة ثانية من جسم مضاد )5 ‎5a‏ مضاد الجلوبلين المناعي الفأري المأخوذ من الماعز الموسوم ب ‎FITC‏ (أيزو ثيوسيانات الفلوريسين)). وغسلت الخلايا مرتين؛ وعلقت مرة ثانية في محلول منظم للتثبيت (يتكون من فورمالدهيد بتركيز 967 في ‎(PBS‏ وحللت باستخدامImmobilization with a second layer of FITC (fluorescein isothiocyanate)-tagged goat anti-mouse immunoglobulin 5a (5a) antibody. cells were washed twice; They were suspended again in a buffer solution (consisting of formaldehyde at a concentration of 967 in PBS) and analyzed using

عداد خلايا تدفقي من نوع فاكسكان ‎FACScan‏ (من شركة بيكتون ديكينسون). ‎oo‏ تخصصية الارتباط: التحليل عن طريق التدفق لارتباط 089.1 بالكريات البيضاء في الدمFACScan (Becton Dickinson) flow cell counter. oo Binding specificity: flow analysis of 089.1 binding to blood leukocytes

المحيطي البشري عزلت خلايا أحادية النواة من الدم المحيطي البشري باستخدام تقنية الفرز بالطرد المركزي فيكول/هايباك ‎(Ficoll/Hypaque)‏ القياسية [انظر ما جاء عن إيه. بويوم ‎Boyum, A‏ في مقالة بعنوان "عزل الكريات البيضاء؛ الخلايا المحببة والخلايا اللمفية من الدم؛ في مجلة ‎٠١‏ المستضدات النسيجية ‎(Tissue Antigens)‏ » المجلد 4؛ ص 775 9974١م) ‎٠‏ وأزيلت الطبقة البينية التي تحتوي على خلايا الدم المحيطي أحادية النواة ‎((PMNC)‏ غسلت باستخدام المحلول الملحي الموازن لهانك ‎(HBSS)‏ وعدت. وحضنت ‎'٠١*#©#‏ خلية باستخدام ‎٠١‏ ميكرولتر من 1 (بتركيز ‎Yo‏ ميكروجرام/ملي لتر)؛ لمدة ‎Te‏ دقيقة عند ‎af‏ ومن ثم غسلت الخلايا باستخدام ‎HBSS‏ وحضنت باستخدام مضاد الجلوبلين المناعي جي-أيزو ثيوسيانات الفلوريسين ‎(IGG-FITC) | ٠‏ البشري المأخوذ من الماعز (من شركة فيشر سينتيفيك ‎(Fisher Scientific‏ وبعد الحضانة على الثلج لمدة ‎Yo‏ دقيقة إضافية؛ حللت الخلايا بواسطة جهاز فاكسكان ‎FACScan‏ ‏من شركة بيكتون ديكينسون باستخدام وسائل ضبط أوتوماتية للتعادل ومعايرة مسبقة باستخدام كريات من نوع كاليبريت ‎Calibrite‏ وميزت مجموعات ‎LIA‏ لمفية قابلة للحياة بواسطة تبعثر ضوئي أمامي مقابل زاوية قائمة وعزلت مجموعة الخلايا اللمفية بأكملها عن طريق صرف ‎٠‏ جميع الحوادث الأخرى. ولم تعكس قياسات التفلور ‎fluorescent‏ المتتالية إلا الأحداث الخلوية اللمفية المنطلقة. وشملت الأجسام المضادة وحيدة النسيلة ‎mAbs‏ المستخدمة من أجل تحديد عدد الخلايا الملونة بملونين وفي الدراسات المتعاقبة على دم الشمبانزي؛. مضاد 003 البشضري (©10-4-17؛ من شركة بيكتون ديكينسون)؛ مضاد ال ‎CDS‏ البشري المقترن بالفلوريسين ‎{leu-2a-FITC) fluoresceein‏ من شركة بيكتون ديكينسون)؛ مضاد ال ‎CDS‏ البشري المققرن ‎ve‏ بفيكوإريثرين ‎tleu-2a-PE) phycoerythrin‏ من شركة بيكتون ديكينسون)؛ مضاد ال ‎CD20‏ ‎Ta‏Human peripheral mononuclear cells were isolated from human peripheral blood using the standard Ficoll/Hypaque centrifugation technique [see above. Boyum, A. in an article titled “Isolation of leukocytes; granulocytes and lymphocytes from blood; in the journal 01 Tissue Antigens » Volume 4; p. 775 99741AD) 0 and the interlayer containing Peripheral blood mononuclear cells (PMNC) were washed with Hank's Balanced Saline (HBSS) and counted. '01*#©# cells were incubated with 01 μl of 1 (μg/mL Yo). L), for Te min at af, then the cells were washed with HBSS and incubated with human anti-immunoglobulin G-isofluorescein isothiocyanate (IGG-FITC)|0 from goat (Fisher Scientific) Fisher Scientific, and after incubating on ice for an additional 1 min, cells were analyzed with a Becton Dickinson FACScan using automatic equalizers and pre-calibrated using calibrite beads, and viable LIA lymphocyte populations were distinguished. By frontal photoscattering against a right angle the entire lymphocyte population was isolated by dismissing all other incidents 0. Consecutive fluorescence measurements reflected only the released lymphocyte events. The monoclonal antibody mAbs used for the determination of the number of bistained cells and in successive studies of chimpanzee blood included; Human Anti-003 (©10-4-17; Becton Dickinson Company); human fluorescein-conjugated anti-CDS {leu-2a-FITC) fluoresceein from Becton Dickinson Corporation); human anti-CDS conjugated to phycoerythrin (tleu-2a-PE) from Becton Dickinson Company); Anti-CD20 Ta

البشري المقترن بفيكوإريثرين ‎tleu-16-PE)‏ من شركة بيكتون ديكينسون)؛ مضاد الجزء 2 للجلوبلين المتاعي © ‎(IgG)‏ البشري المأخوذ من الماعز المقترن بالفلوريسين ‎Oa)‏ ‏شركة كابيل ‎¢(Cappel‏ ومضاد ال 004 الفأري المقترن بالفيكوإريثرين (01074؛ من شركة أورثو فارماسوتيكالز ‎(Ortho Pharmaceuticals‏ ‎٠‏ التفاعلية المتبادلة في النسيج البشري قيم الجسم المضاد 029.1 من ‎Cua‏ التفاعلية المتبادلة على الأنسجة البشرية السليمة. واختبر 059.1 المضاف إليه بيوتين على مقاطع مجمدة تم قطعها في حجيرة تحتوي على مشراح لقطع الأنسجة المجمدة من ‎VY‏ نسيجاً مختلفا باستخدام تقنية البيروكسيداز المناعي ‎immunoperoxidase‏ بمتراكب أفيدين-بيوتين ‎avidin-biotin‏ [انظر ما ‎ela‏ عن إم. ويلكيك ‎٠‏ > ومعاونيه ‎«Wilchek, 14. © al,‏ في مقالة بعنوان "متراكب الأفيدين-البيوتين ‎avidin-biotin‏ في تطبيقات التحليل الحيوي”؛ مجلة الكيمياء الحيوية التحليلية ‎(analytical Biochemistry)‏ المجلد ‎١‏ العدد ‎OY‏ 987١م)‏ . واستخدمت خلايا 50071 ‎(CD47)‏ بصفتها الضابط الإيجابي وخلايا ‎(cp4) 8‏ بصفتها النسل الخلوي الضابط السلبي ‎٠‏ بينما استخدم جسم مضاد خيمري من قرد/إنسان مضاف إليه بيوتين (جلوبلين مناعي 61 ‎ane ((1gG1)‏ الصلة بصسفته الضابط ‎١‏ السلبي من الجسم المضاد. وبالنسبة لغالبية الأنسجة؛ تم اختبار ثلاث عينات منفصلة وقدرت التفاعلية مع 0189.1 بواسطة مقياس من صفر إلى ‎TY‏ وقدرت؛ في بعض الأنسجة؛ بنيات مختلفة ضمن النسيج بشكل منفصل. فعلى سبيل المثال؛ في ‎SH‏ قدرت التفاعلية للخلايا الكبدية؛ القنوات المرارية وخلايا كبفر بشكل مستقل. © 9 تخصصية الأنواع تم غربلة ومسح الدم المحيطي المأخوذ من عدة رئيسيات وغير رئيسيات مخبرية شائعة باستخدام 089.1 لتمييز التفاعلية المتبادلة المحتملة لخلايا 7 ل 004 الموجب. حيث شملت المجموعة قرود الشمبانزي؛ قرود الرّباح؛ قرود الريص؛ قرود السينومولجس وقرود المكاك ذات الذيل الخنزيري؛ جرذان؛ فثران؛ أرانب وكلاب. وعزلت خلايا الدم من ‎5-١‏ مل ‎ge Yo‏ الدم الكامل بالفرز بالطرد المركزي (بمعدل ‎٠‏ دورة في الدقيقة لمدة © دقائق) عندhuman phycoerythrin conjugated tleu-16-PE (Becton Dickinson Company); Human goat anti-immunoglobulin © (IgG) part 2 conjugated with fluorescein Oa (Cappel) and mouse anti-Phycoerythrin-conjugated 004 (01074; Ortho Pharmaceuticals 0 Cross-reactivity in human tissue Cua antibody 029.1 measured cross-reactivity on healthy human tissues.1 059.1 with biotin was tested on frozen sections cut in a microtome chamber containing VY frozen tissue sections of a different tissue using the immunoperoxidase technique with the avidin-biotin complex [see ela on M. Wilchek 0 > and collaborators » Wilchek, 14. © al, in the article “The avidin-biotin complex in applications Bioanalysis” Journal of Analytical Biochemistry Volume 1 No. OY 9871.50071 cells (CD47) were used as the positive control and 8 (cp4) cells as the negative control cell progeny 0 while a biotin-supplemented monkey/human chimeric antibody (immunoglobulin 61 ane ((1gG1) bind to its negative control 1 form of the antibody was used. For most tissues; Three separate samples were tested and the reactivity with 0189.1 by scale from zero to TY was estimated; in some tissues; Different structures within the tissue separately. for example; In SH the reactivity of hepatocytes was estimated; bile ducts and CPFR cells independently. © 9 Species specificity Peripheral blood from several common primates and non-primates was screened and screened using 089.1 to characterize potential cross-reactivity of 004-positive 7L cells. Where the group included chimpanzees; baboons; rhesus monkeys; cynomolgus monkeys and pig-tailed macaques; rats; pharynx Rabbits and dogs. Blood cells were isolated from 1–5 mL ge Yo whole blood by centrifugation (at 0 rpm for ½ minutes) at

Ly ‏وأعيدت العملية مرة أخرى وأعيد‎ PBS ‏؛ م وغسلت بإعادة تعليقها في أحجام متساوية من‎ ‏ميكرولتر من المطلق‎ 7٠0 ‏تعليق الخلايا في أحجام متساوية من مصل بقري جنيني. ووضع‎ ‏ميكرولتر من‎ Yo ‏ملي لتر مع‎ ١5 ‏الخلوي من كل نوع في أنبوب نابذ مخروطي الشكل سعته‎ ‏مجم/ملي لتر). ومزج الجسم المضاد والخلاياء وضعت على الثلج لمدة‎ YO ‏(بتركيز‎ 1 ‏ميكرولتقر من‎ Yo ‏ومن ثم أضيف‎ (HBSS ‏دقيقة ومن ثم غسلت بشكل شامل باستخدام‎ ٠ °Ly and the process was repeated again and PBS; M and washed by resuspending in equal volumes of absolute 700 μL of cell suspension in equal volumes of fetal bovine serum. A microliter of Yo (ml) with 15 cytokine of each type was placed in a conical centrifuge tube with a capacity of 1 mg/ml). The antibody was mixed and the cells were placed on ice for YO (at a concentration of 1 µL of Yo), then HBSS min was added and then washed thoroughly with 0 °C.

مضاد الجلوبلين المناعي ‎FITC a‏ البشري المأخوذ من الماعز (من شركة فيشر سينتيفيك) ومزجت العينات. وبعد الحضانة على الثلج لمدة ‎Ve‏ دقيقة إضافية؛ أزيلت العينات من الثلج وأضيف ‎٠١‏ مل من محلول الانحلال المنظم (بيكربونات البوتاسيوم ‎potassium bicarbonate‏ بتركيز ‎١01‏ مولارء بدرجة حموضة بلغت ‎VE‏ يحتوي على كلوريد الأمونيوم ‎ammonium‏Human goat anti-immunoglobulin FITC a (from Fisher Scientific) and samples were mixed. and after incubation on ice for an additional 1 min; The samples were removed from ice and 01 ml of buffer solution (potassium bicarbonate) was added at a concentration of 101 M with a pH of VE containing ammonium chloride.

‎١,17 3S Suchloride ٠‏ مولار وإثيلين ثاني أمين رابع أسيتيك ‎(EDTA)‏ الصوديوم بتركيز ‎١‏ مولار)؛ دفّئ ‎Gas‏ إلى ‎PY‏ م. وحضنت العينات عند درجة حرارة الغرفة لمدة ‎٠‏ دقيقة وتلا ذلك الفرز بالطرد المركزي بمعدل ‎١5060‏ دورة في الدقيقة لمدة 0 دقائق. وغسلت كريات خلوية موسومة مرتين إضافيتين في ‎HBSS‏ (بدرجة حموضة بلغت 7,4) يحتوي على زلال المصل البقري بتركيز 961 وأزيد الصوديوم بتركيز 960.06. وتم تثبيت1,17 3S Suchloride 0 M and Ethylene Disodium Tetraacetic Acid (EDTA) 1 M); Warm Gas to PY m. Samples were incubated at room temperature for 0 minutes, followed by centrifugation at 15060 rpm for 0 minutes. Labeled cell pellets were washed two more times in HBSS (pH 7.4) containing bovine serum albumin at a concentration of 961 and sodium azide at a concentration of 960.06. And it was installed

‎he‏ الخلايا الموسومة عن طريق إعادة تعليقها في محلول منظم للتثبيت (كلوريد الصوديوم بتركيز 8 مولار يحتوي على فورمالدهيد بنسبة 961.0؛ رشح خلال مرشح يبلغ حجم عيونه ‎٠,77‏ ‏ميكرومتر). وحللت العينات بواسطة جهاز فاكسكان من شركة بيكتون ديكينسون كما وصسف أعلاه. المعايرات الوظيفية في أنبوب الاختبار: تفاعل خلايا لمفية مخلطة وحيد وثلاثي الاتجاهhe tagged cells by resuspending in fixation buffer (8M NaCl containing 961.0 formaldehyde; filtered through a filter with 0.77 µm eyes). Samples were analyzed using a Becton Dickinson faxcan as described above. Functional titrations in test tube: a one- and three-way mixed lymphocyte reaction

‎Ye‏ زرعت خلايا 7 (بواقع ‎TY OLY‏ خلية) مأخوذة من إنسان أو شمبانزي مع أو بدون 1 في عيون دقيقة مسطحة القاعدة لمدة ‎V‏ أيام مع خلايا ‎PBM‏ معالجة بميتوميسين ‎C‏ ‏(بواقع ‎(DY 0X0‏ حصل عليها من متبرع ليس ذو علاقة من أصل بشري أو شمبانزي؛ على الترتيب. أضيف ثيميدين تريتيومي بتركيز بلغ ‎١‏ ميكروكوري/عين إلى المزرعة أثناء تخر ‎YA‏ ساعة من الزراعة. وفرزت صفائح عيارية دقيقة بالطرد المركزي؛ وغسلت الكرياتYe 7 cells (ty OLY cell) from human or chimpanzee with or without 1 were cultured in flat-bottomed micro-eyes for V days with PBM cells treated with mitomycin C (DY 0X0). Obtained from an unrelated donor of human or chimpanzee origin, respectively. Tritomic thymidine at a concentration of 1 microcurie/eye was added to the culture during the last YA hour of cultivation. Microtiter plates were centrifuged; the pellets were washed

م الخلوية باستخدام ‎HBSS‏ ومن ثم عدّت في عداد الومضان بالسائل. وتم معايرة كل عينة ثلاث مرات. وأجريت تفاعلات خلايا لمفية مخلطة بشرية باستخدام ثلاثة متبرعين منفصلين ليسوا ذوي علاقة بصفتهم مخاليط محفزة ومستجيبة. ولقد اختير هذا البروتوكول من أجل تعظيم © فرص تحقيق استجابة جيدة في عينات عشوائية غير مميزة ‎HLA‏ (مستضد الكرية البيضاء البشرية) من دم الطبقة الرقيقة من الكريات البيضاء التي تغطي الخلايا المتراصة في الدم. وفي هذا البروتوكول؛ لم يعالج دم أي متبرع بالميتوميسين © أو بالأشعة. معايرة التصاق ‎THP-1 WA‏ لقياس قعالية ارتباط 09.1 بمستقبلة ‎Fe‏ ‏تعتمد هذه المعايرة على تجسير نسلين خلويين؛ أحدهما يعبر عن 004 والآخر يعبر ‎٠‏ عن مستقبلات ‎(Fo‏ بواسطة الجسم المضاد ل 004. وكان شريك التعبير عن 004 المستخدم عبارة عن النسل الخلوي سريع الالتصاق للأرومة الليفية الفأري ‎DAP‏ الذي أعطي العدوى ‎Gli gas‏ مع 004 البشري ‎.(DAP/CD4)‏ وكانت الخلايا الحاملة لمستقبلة ‎Fo‏ عبارة عن 1110-1. ووضعت خلايا ‎DAP/CDA‏ في صفائح مسطحة القاعدة تحتوي على 976 ‎Lae‏ (بحجم ‎٠٠١‏ ‏ميكرولتر/عين؛ بتركيز 700089 خلية/عين) وتركت لتلتصق طوال الليل. وأعيد تعليق خلايا ‎Vo‏ 2100-1 في 00 ملي لتر من وسط ‎RPMI‏ (بواقع ‎TY eX)‏ خلية/ملي لتر) واستحثت لمدة ‎YE‏ ‏ساعة عند 77م بإضافة 00 وحدة/ملي لتر من ‎YEN‏ (إنترفيرون جاما). وحملت خلايا 1110-1 المستحثة ب ‎yIFN‏ بإستر أسيتو مثوكسي كالسين ‎(CAM)‏ من شركة موليكيولار بروبس ‎Molecular Probes‏ كما يلي: غسلت الخلايا باستخدام محلول منظم للتحميل ‎PBS)‏ لدلبيكو مع الكالسيوم والمغنيسيوم وزلال المصل البقري بتركيز 0/1 96) وأعيد © - تليقها عند تركيز ‎TY exe‏ خلية/ملي لتر في ‎٠١‏ ملي لتر من نفس المحلول المنظم. وخفقف ‎CAM‏ (بتركيز ‎١‏ مجم/ملي لتر في ‎DMSO‏ (كبريتوكسيد ثاني المثيل)) (بنسبة 50:1) باستخدام المحلول المنظم للتحميل وأضيف إلى معلقات خلايا 1110-1 بنسبة ‎1:١‏ حجم/حجم. وبعد الحضانة لمدة ‎٠١0‏ دقيقة عند درجة حرارة الغرفة؛ أضيف ‎Yo‏ ملي لتر من محلول منظم للتحميل جديد إلى كل ؛ ملي لتر من مزيج الخلايا/34م0 وحضنت لمدة 50 دقيقة إضافية عند ‎Yo‏ درجة حرارة الغرفة. ومن ثم غسلت الخلايا مرتين باستخدام المحلول المنظم للتحميل وعلقتCellularity was measured using HBSS and then counted in a liquid scintigraphy counter. Each sample was calibrated three times. Human mixed lymphocyte reactions were performed using three separate, unrelated donors as stimulus-responder mixtures. This protocol was chosen in order to maximize the chances of achieving a good response in random, uncharacterized HLA (human leukocyte antigen) samples of blood from the thin layer of leukocyte covering the agglutinin cells. In this protocol; No donor's blood was treated with mitomycin© or radiographs. THP-1 WA adhesion assay to measure the binding potency of 09.1 to the Fe receptor This assay is based on bridging two cellular lineages; One expresses 004 and the other expresses 0 receptors (Fo) by antibody to 004. The expression partner of 004 used was the fast-adhesive cell lineage of murine fibroblast DAP that had been given Gli gas infection with human 004. Fo-carrying cells were 1110-1 (DAP/CD4). Vo 2100-1 cells were resuspended in 00 mL of RPMI medium (by TY eX cells/ml) and induced for 1 h at 77 °C with the addition of 00 units /mL of YEN (interferon gamma). yIFN-transduced 1110-1 cells were loaded with acetomethoxycalcin ester (CAM) from Molecular Probes as follows: the cells were washed with Delbecco's loading buffer (PBS) supplemented with calcium, magnesium, and bovine serum albumin at a concentration of 0/0. 1 96) was re-conformed when TY exe was concentrated at 1 cell/mL in 10 mL of the same buffer. CAM (at a concentration of 1 mg/mL in DMSO (dimethyl sulfoxide)) (50:1 ratio) was diluted with loading buffer and added to 1110-1 cell suspensions in a 1:1 volume/volume ratio. and after incubation for 100 minutes at room temperature; yo ml of fresh loading buffer solution was added to each ; mL of cell/34 M 0 mixture and incubated for an additional 50 min at room temperature. Then the cells were washed twice with loading buffer and suspended

مرة أخرى عند تركيز بلغ ‎Yo XA‏ خلية/ملي لتر. وأضيفت محاليل مخففة متسلسلة من 089.1 في ‎PBS‏ (بدون الكالسيوم؛ المغنيسيوم أو ‎(BSA‏ إلى عيون تحتوي على خلايا ‎DAP‏ ل ‎CD4"‏ ‏وحضتت لمدة © دقائق عند درجة حرارة الغرفة. ومن ثم أضيف ‎٠٠‏ ميكرولتر من معلق خلايا ‎THP-1‏ محمول ب ‎CAM‏ وحضنت الصفائح عند درجة حرارة الغرفة لمدة ساعة في ‎٠‏ الظلام. كما تم معايرة العيون الضابطة التي لا تحتوي على خلايا ‎DAP‏ وبعد فترة الحضانة غسلت العيون ثلاث مرات باستخدام ‎(PBS‏ وبعد الغسيل النهائي» أضيف ‎٠٠١‏ ميكرولتر من إلى كل عين؛ تلاه إضافة ‎٠١‏ ميكرولتر من تريتون إكس-١٠٠‏ بتركيز ‎.967١‏ وبعد وضع الصفائح على هزاز ‎١5-٠١ sad‏ ثانية؛ قرأت قياسات الصفائح في جهاز مسح فلوري ‎Fluoroscan‏ (من شركة إم تي إكس لاب سيستمز إنك. ‎(MTX Lab systems Inc.‏ ‎٠‏ > معايرة الارتباط بخلية أحادية النواة منشطة لقياس فعالية ارتباط 0789.1 بمستقبلة ‎Fe‏ ‏أجريت معايرة مستقبلة ‎Fo‏ كما هو موصوف ‎Lad‏ يتعلق بخلايا ‎THP-1‏ أعلاه باستثناء الاختلافات التالية: حضرت خلايا أحادية النواة من دم محيطي جديد لإنسان عن طريق الفصل التدريجي القياسي لفيكول/هايباك ‎Ficoll/Hypaque‏ وبيركول ‎Percoll‏ ونبهت خلايا وحيدة النواة باستخدام ‎IFN‏ كما وصف أعلاه؛ ولكن لمدة £4 ساعة. وطُليت الصفائح باستخدام خلايا ‎ve‏ أحادية النواة منبهة لمدة 74 ساعة؛ كما أنه في هذه المعايرة؛ حمل النسل الخلوي ‎SupT-18‏ ‏ل *004 باستخدام ‎«CAM‏ الموصوف أعلاه. ومن ثم أضيفت خلايا ‎SupT-18‏ إلى الصصفائح المطلية بالخلايا أحادية النواة المنبهة كما وصف أعلاه. ويتمثل الفرق الرئيمسي في هذه المعايرة في أن النسل الخلوي ل *004 حمل باستخدام ‎CAM‏ وأضيف إلى الخلية الحاملة لمستقبلة ‎Fo‏ على الصفيحة. ولقد عكس الترتيب في المعايرة أعلاه التي تستخدم خلايا 1110-1. © > الارتباط بالأرومات الليفية الفأرية المدخل إليها العدوى تحويلياً ب ‎FoyRIT‏ ‏حصل على نسل خلوي لأرومة ليفية فأرية ‎¢(CDW32-L)‏ تم تخميجه تحويلياً باستخدام ‎FCRH‏ البشري؛ من مجموعة المزارع النمطية الأمريكية ‎AATCC‏ وحدد الارتباط المباشر ل 1 عن طريق حضن الجسم المضاد في وجود وغياب 004.. وتم الكشخف عن ارتباط 1 عن طريق الحضانة مع الأجسام المضادة للجلوبلين المناعي البشرية المأخوذة من ‎Yo‏ الماعز المقترنة ببيروكسيداز فجل الخيل (من شركة ساوثيرن بيوتيك ‎٠ (Southern Biotech‏ وثم ‎Te‏Again at a concentration of Yo XA in cells/mL. Serial dilutions of 089.1 in PBS (without calcium; magnesium or BSA) were added to eyes containing CD4 DAP cells and incubated for ¾ minutes at room temperature. Then 00 µL was added. of a suspension of THP-1 cells loaded with CAM and the plates were incubated at room temperature for 1 hour in 0 darkness.The control eyes that did not contain DAP cells were also calibrated and after the incubation period the eyes were washed three times with ( PBS and after the final wash” 100 μL of PBS was added to each eye, followed by the addition of 01 μL of Triton X-100 with a concentration of .9671 and after placing the plates on a rocker for 01-15 seconds, the measurements of the plates were read in Fluoroscan (MTX Lab systems Inc. 0) Activated mononuclear cell binding calibration To measure the binding efficiency of 0789.1 to the Fe receptor Fo receptor titration was performed as Lad related to THP-1 cells are described above except for the following differences: mononuclear cells were prepared from fresh human peripheral blood by standard stepwise separation of Ficoll/Hypaque and Percoll and mononuclear cells were stimulated with IFN As described above; But for £4 an hour. Plates were plated with excitable ve mononuclear cells for 74 hours; It is also in this calibration; Induce the cell lineage SupT-18 for *004 using the “CAM” described above. SupT-18 cells were then added to plates coated with stimulated mononuclear cells as described above. The main difference in this assay is that the cell progeny of *004 were carried with CAM and added to the cell carrying the Fo receptor on the plate. The order has been reversed in the above calibration using 1110-1 cells. © > Binding to Transformationally Infected Mouse Fibroblasts with FoyRIT Obtained a murine fibroblast cell line ¢ (CDW32-L) transfected with human FCRH; From the AATCC collection of American culture cultures, direct binding of 1 was determined by incubating the antibody in the presence and absence of 004.. Binding of 1 was detected by incubation with human Yo-goat immunoglobulin antibody conjugated to horseradish peroxidase (from Southern Biotech and then Te

توليد أجزاء ‎Fab‏ ل 089.1 عن طريق الهضم الأنزيمي واستخدمت كضوابط سلبية. وطرحت قيم الامتصاصية التي حصل عليها من 0189.1 (ومن أجزاء ‎(Fab‏ التي حضنت مسبقاً مع الخلايا في وجود 004: من قيم الامتصاصية التي حصل عليها من الأجسام المضادة في ‎sCD4. le‏ © معايرة ‎ADCC‏ (انحلال ‎(SupT-1 WDA‏ جمعت عينات دم بشري جديدة معالجة بالهيبارين وعزلت خلايا ‎PMN‏ بإجراءات فرز بالطرد المركزي قياسية بواسطة جهاز من نوع فيكول/هايباك. وحللت خلايا الدم الحمراء الموجودة في الطبقة الرقيقة من الكريات البيضاء باستخدام محلول منظم من كلوريد الأمونيوم وغسلت ‎DAN‏ مرتين في محلول ملحي موازن لهانك. ونبهت الخلايا اللمفية في الدم ‎٠‏ المحيطي ‎(PBLs)‏ باستخدام ‎٠١‏ وحدات من 1-2 لكل ملي لتر من 8714/مصل البقر الجنيني ‎(FCS)‏ بتركيز ‎96٠0‏ لمدة ؛7 ساعة عند ‎ca TY‏ ,0© بتركيز %0. وبعد ‎YE‏ ساعة؛ أعيد تعليق ‎PBLs‏ في مزيج من وسط ‎FCS/RPMI‏ بتركيز 965. ووسمت خلايا 980011-18 (عددها ‎0X)‏ )1( بحضنها مع نظير الكروم )© ‎(Cr)‏ ‏بفعالية إشعاعية بلغت ‎٠٠١‏ ميكروكوري لمدة ساعة واحدة عند 7م ‎CO,‏ بتركيز 965. ‎١‏ | وغسلت الخلايا مرتين باستخدام مزيج من ‎FCS/RPMI‏ بتركيز %0 وأضيف ‎fy ex)‏ خلية إلى كل عين. وخففت ثلاث كميات من الجسم المضاد 089.1 بشكل متسلسل بنسبة ١:؟‏ باستخدام مزيج من ‎FCS/RPMI‏ بتركيز 965 وأضيفت عينات ثلاث مرات إلى العيون التي تحتوي على 500771-18 لمدة ‎Yo‏ دقيقة عند ‎CO; ca TY‏ بتركيز 965. واستخدم ‎٠٠١‏ ‏ميكرولتر من تريتون إكس-١٠٠‏ بتركيز ‎96١‏ و ‎٠٠١‏ ميكرولتر من أوساط كضوابط إطلاق © | أقصى وذاتي؛ على الترتيب. وأضيفت ‎PBLs‏ المنبهة ب 11-2 (بواقع ‎"٠١8‏ خلية) إلى العيون. وفرزت الصفائح بالطرد المركزي لمدة ‎FLAY‏ بمعدل 900 دورة في الدقيقة وحضنت لمدة ‎VT‏ ساعة عند 7م ‎CO;‏ بتركيز 968. وجمع السائل الطافي من كل عين وقرأ مقدار الإشعاعية في ‎dae‏ جاما. وأجريت المعايرة ثلاث مرات. وحددت النسبة المثوية لانحلال الخلايا باستخدام الصيغة التالية: ‎Yo‏ ‏1.1 oyGenerate Fab fragments for 089.1 by enzymatic digestion and were used as negative controls. The absorbance values obtained from 0189.1 (and from Fab fractions pre-incubated with cells in the presence of 004) were subtracted from the absorbance values obtained from the sCD4 antibody.le© ADCC assay (SupT-decay) 1 WDA Fresh heparin-treated human blood samples were collected PMN cells were isolated by standard centrifugation procedures with a Vicoll/HIPAC machine Red blood cells in the leukocyte sublayer were analyzed with ammonium chloride buffer and DAN was washed twice 0 peripheral blood lymphocytes (PBLs) were stimulated with 01 units of 1-2 per mL of 8714/FCS 9600 for 7; 1 hour at 0% ca TY 0. After YE 1 hour, PBLs were resuspended in FCS/RPMI 965 medium. 980011-18 cells were labeled (number 0X) (1). Incubated with chromium isotope © (Cr) with a radioactivity of 001 microcurie for one hour at 7 °C CO, at a concentration of 965. 1 | The cells were washed twice using a mixture of FCS/RPMI at a concentration of 0% and added fy ex) cells into each eye. Three amounts of antibody 089.1 were serially diluted at a 1:1 ratio using a mixture of FCS/RPMI at a concentration of 965 and samples were added three times to eyes containing 500771-18 for yo. min at CO; ca TY at a concentration of 965. 100 μl of Triton X-100 at a concentration of 961 and 100 μl of media from © | extreme and subjective; Respectively. B-11-stimulated PBLs (by 2-11 cells) were added to the eyes. The plates were centrifuged for FLAY at 900 rpm and incubated for 1 h at 7 °C CO; 968 pH. The liquid was collected. The supernatant from each eye was read and the amount of radioactivity was read in gamma dae.Titration was carried out three times.The percentage of cell lysis was determined using the following formula: Yo 1.1 oy

Vox ‏النسبة المئوية للانحلال- (تعداد العينة-الإطلاق الذاتي)‎ ‏(الإطلاق الأقصى-الإطلاق الذاتي)‎Vox Percent Dissolution - (Sample Count - Self Release) (Maximum Release - Self Release)

Clq ‏معايرة الارتباط ب‎ ‏في معلق‎ SupT1-18 ‏باستخدام النسل الخلوي ل 004 الموجب‎ Clq ‏أجريت معايرة‎ 004 ‏خلية/ملي لتر. وأضيف الجسم المضاد 059.1 والجسم المضاد ل‎ MY ox ‏يبلغ تركيزه‎ ‏ميكرولتر) بتراكيز متكافئفة‎ 5٠ ‏الضابط المنقى بالاستشراب الألفي المأخوذ من القرد (بمقدار‎ ‏خلية مستهدفة ل 004 الموجب. وحضن‎ "٠١*77 ‏ميكروجرام/ملي لتر إلى‎ ٠١ ‏بلغ مقدارها‎ 0 ‏معلق الخلايا والأجسام المضادة لمدة ساعة واحدة على الثلج ومن ثم غسلت مرتين باستخدام‎ ٠١ ‏البشري (بتركيز‎ Clq ‏ميكرولتر من‎ ٠٠ ‏وأضيف‎ PBS ‏بتركيز 961 في‎ BSA ‏ميكروجم/ملي لتر) إلى كل أنبوب وحضن لمدة ساعة واحدة على الثلج. وغسل كل أنبوب‎ ‏مرتين؛ ومن ثم حضن (لمدة ساعة واحدة؛ على الثلج؛ في الظلام) مع محلول مخفف بنسبة‎ ‏ميكرولتر). ومرة‎ 5٠ ‏البشري المأخوذ من الأرنب (بمقدار‎ Clg ‏لمضاد‎ FITC ‏من‎ 19:١ ٠ ‏و‎ 961١ ‏بتركيز‎ formaldehyde ‏أخرى غسلت الخلايا مرتين وثبتت في مزيج من فورمالدهيد‎ ‏من شركة بيكتون‎ FACScan ‏وحللت الخلايا بواسطة تعداد خلايا تدفقي من نوع‎ .5 ‏من أجل جمع البيانات‎ (Consort 30) 7٠ ‏ديكينسون باستخدام مجموعة برامج كونسورت‎ ‏وتحليلها.‎ ‏معايرة التسمم الخلوي المستحث بالمتممة‎ > ‏خلية) عن طريق حضنها مع © بفعالية‎ VX) ‏(بواقع‎ SupTI-18 ‏وسمت خلايا‎ ‏بنسبة 965. وغسلت‎ 00, a TY ‏ميكروكوري لمدة ساعة عند‎ ٠٠١ ‏إشعاعية بلغ مقدارها‎ ‏خلية إلى كل‎ BY ex) ‏بنسبة 965 وأضيفت‎ FCS ‏و‎ RPMI ‏الخلايا مرتين باستخدام مزيج من‎Clq binding assay in SupT1-18 suspension using the cell line of 004 positive Clq 004 cells/mL titration was performed. Antibody 059.1 and antibody to MYox were added (concentration of 004 μl) at stoichiometric concentrations of 50 control purified by millipede chromatography taken from monkeys (at an amount of 004 target cell positive). Incubated with 77*01 μg/ml To 0 10 the cells and antibodies were resuspended for 1 hour on ice and then washed twice with human 01 (Clq concentration of 00) and PBS at 961 μg/mL BSA was added. L) to each tube and incubated for 1 hour on ice Each tube was washed twice and then incubated (for 1 hour on ice in the dark) with a 50 μl diluted human rabbit solution once. (with an amount of Cg of anti-FITC of 19:1 0 and 9611 with another concentration of formaldehyde), the cells were washed twice, fixed in a mixture of formaldehyde from Becton company FACScan, and the cells were analyzed by flow cytometry type 5. For data collection and analysis (Consort 30) 70 Dickinson using the Consort software suite. Titration of complement-induced cytotoxicity (> cell) by incubating it with (Actively VX) (by SupTI- 18 cells were labeled with a ratio of 965. A 00, a TY microcurie was washed for one hour at 001 irradiance (cells per BY ex) with a ratio of 965 and FCS and RPMI were added to the cells twice using a mixture Who

Yi) ‏عين. وخففت محاليل الجسم المضاد 089.1 والأجسام المضادة الضابطة ل 004 بنسبة‎ ‏بنسبة 968 وأضيفت عينات بمقدار‎ FCS ‏و‎ RPMI ‏بشكل متسلسل باستخدام مزيج من‎ - ٠ ‏ميكرولتر‎ ٠٠١ ‏ميكرولتر ثلاث مرات إلى العيون التي تحتوي على 50071-18. وأضيف‎ ٠ ‏ميكرولتر من الأوساط إلى العيون لقياس‎ ٠٠١ ‏من تريتون إكس-١٠٠ بتركيز 961 أو‎ (a 77 ‏على الترتيب. وبعد 90 دقيقة من الحضانة عند‎ dor ‏الإطلاق الأقصى والذاتي ل‎ oyYi) an eye. Antibody solutions of 089.1 and control antibodies to 004 were diluted 968% and samples of FCS and RPMI were added serially using a mixture of 0-001 μl three times to eyes containing 50071-18. 0 µL of media was added to the eyes to measure 001 of Triton X-100 at a concentration of 961 or 77 a, respectively. After 90 minutes of incubation at the maximum and endogenous release of oy

‎CO,‏ بتركيز ‎Yo‏ أضيف محلول مخفف بنسبة )01 من المتممة المأخوذة من الأرنتب (منCO, with a concentration of Yo, was added to a solution diluted by (01) of the complement taken from the rabbit (from

‏شركة كابيل) إلى العيون. وحضنت الصفائح لمدة 90 دقيقة أخرى عند ‎ea PV‏ ,00 بتركيزKabel) to Laayoune. The plates were incubated for another 90 minutes at 0.00 ea PV concentration

‏1706 ومن ثم فرزت بالطرد المركزي لمدة 7 دقائق بمعدل ‎90٠0‏ دورة في الدقيقة. وجمع1706 and then centrifuged for 7 minutes at 9000 rpm. and collect

‏السائل الطافي من كل عين وقرأ مقدار الإشعاعية بواسطة ‎dae‏ جاما. وأجريت المعايرة ثلاثThe liquid floats from each eye and the amount of radioactivity was read by dae gamma. Three calibrations were performed

‎Spee‏ وحددت النسبة المثوية لانحلال الخلايا باستخدام الصيغة التالية: النسبة المثوية للانحلال- (تعداد العينة-الإطلاق الذاتي) (الإطلاق الأقصى-الإطلاق الذاتي) دراسات الجسم ‎all‏ على قرود ‎Gadd‏ ‏قسمت ستة من قرود الشمبانزي إلى ثلاث فئات تتكون كل فئة من حيوانين: الففة 1Spee and the lethality ratio for cell lysis was determined using the following formula: Permissive ratio of lysis- (sample count-self-release) (maximal release-self-release) All-body studies on Gadd monkeys Six chimpanzees were divided into three groups consisting of Each category of two animals: Alfafa 1

‏(الفئة الضابطة بالمحلول الملحي)؛ الفئة ]1 (تتلقى ‎٠٠١‏ مجم/كجم من الجسم المضاد ‎(CE9.1‏ ‎٠‏ والفئة ‎IT‏ (تتلقى ‎٠٠١‏ مجم/كجم من الجسم المضاد 029.1). حيث أعيد معالجة حيوانات الفئة(Saline control group); Class 1] (receiving 100 mg/kg of antibody CE9.1 0) and Class IT (receiving 001 mg/kg of antibody 029.1).

‏]1 باستخدام ‎٠١‏ مجم/كجم من 089.1 بعد ‎Yo‏ يومآء؛ شريطة أن تكون تعدادات خلايا 7 ل[1 using 01 mg/kg of 089.1 after Yo days; Provided that the cell counts are 7 l

‏“04 قد عادت إلى 9670 من قيمة خط الأساس. وأعيد معالجة حيوانات الفئة 11 باستخدام“04 has returned to 9670 from the baseline value. Class 11 animals were re-treated with

‎٠‏ مجم/كجم بعد ‎lag 7٠‏ شريطة أن تكون تعدادات خلايا 7 ل 0047 قد عادت إلى0 mg/kg after lag 70 provided that 7 of 0047 cell counts have returned to

‏07 من قيمة خط الأساس. وإذا لم تحقق هذه القيم بحلول اليوم ‎Fe‏ تغربل الحيوانات لتحديد قيم خلايا 1 ل “03©؛ “004 و ‎CDS”‏ على فترات ‎Cal‏ شهرية حتى تحقق قيم خلايا07 from the baseline value. If these values are not achieved by day Fe, the animals are sifted to determine the values of 1 cells for “03©; “004 and CDS” at monthly cal intervals until cell values are achieved

‎CDA” AT‏ القيمة المستهدفة المعنية لتلك الفئة. وفي هذا الوقت؛ سوف تتلقى الحيوانات مرةCDA” AT is the respective target value for that class. And at this time; You will receive the animals once

‏أخرى جرعة مقدارها ‎٠٠.١‏ مجم/كجم من الجسم المضاد 089.1 في الوريد؛ بحيث لا يتجاوزother dose of 100.1 mg/kg antibody 1.089 intravenously; so that it does not exceed

‏عدد الجرعات ثلاثة كحد أقصى.The maximum number of doses is three.

‏وتم تحديد قيم خط الأساس للتعداد الكلي لخلايا الدم البيضاء؛ قيم ‎LDA)‏ اللمفيةBaseline values for the total white blood cell count were determined; Lymphatic (LDA) values

‎٠‏ والخلايا المحببة والمجموعات الجزئية للخلايا اللمفية ل *003؛ “004 و *008 قبل ‎١‏ أيام من0, granulocytes and lymphocyte subsets for *003; “004 and *008 1 day before

‏إعطاء الجرعة؛ في اليوم صفر مباشرة قبل إعطاء الجرعات ومرة ثانية بعد ‎YE‏ ساعة و ‎VE‏give the dose; On day 0 immediately before dose administration and again 1 hour after YE and VE

‎Log‏ من إعطاء الجرعة. وأخضعت قرود الشمبانزي لثلاث دورات من المعالجة بإعطائهاLog of dose administration. Chimpanzees were given three cycles of treatment

‏جرعات بلغ مقدارها ‎٠١‏ مجم/كجم في هذه الدراسة.Doses of 01 mg/kg in this study.

oyoy

النتائج تخصصية ارتباط الجسم المضاد وحيد النسيلة ‎CE9.1‏The results are specific for CE9.1 monoclonal antibody binding

أظهرت قياسات الألفة بواسطة ‎Lah SPR‏ يتعلق بارتباط 089.1 ب ‎CD4‏ القابل للذوبان قيمة ل ‎Kd‏ بلغ مقدارها ‎٠١‏ نانو مولار (انظر ما جاء عن بريجهام-بيرك ومعاونيهAffinity measurements with a Lah SPR of 089.1 binding to soluble CD4 showed a Kd value of 10 nM (see Brigham-Burke et al.

‎Brigham-Burke et al °‏ في نشرة بي أي إيه سيمبوسيوم الأمريكية الشمالية ‎North American‏Brigham-Burke et al ° in the newsletter of the BIA North American Symposium North American

‎<BlAsymposium‏ 190١م‏ (تحت الطبع)). ولم يلاحظ أي ارتباط بالأنسال الخلوية — 4ه وأثبتت دراسات التثبيط أنه يمكن إبطال الارتباط بخلايا “004 بشكل كامل بواسطة ‎CD‏ القابل للذوبان بكيفية منضبطة.<BlAsymposium 1901 AD (in press)). No binding to cell lineages was observed — 4e and inhibition studies demonstrated that binding to “004 cells” could be completely inhibited by soluble CD in a controlled manner.

‏ومن أجل تحديد تخصصية تفاعلية 089.1؛ حدد الارتباط بخلايا ‎PBM‏ بشرية معزولةIn order to define an interactive specialization 089.1; Select binding to isolated human PBM cells

‎٠‏ حديثا بتحليل تعداد خلايا تدفقي ثنائي اللون. ويبين الشكل 4 أنه قد ارتبط حوالي ‎Vx‏ من خلايا “003 ب 089.1. وضمن المجموعة الجزئية ذات الأصل اللمفاني؛ أظهرت جميع الخلايا التي ارتبطت ب ‎OKT4‏ كذلك تفاعلية إيجابية بالنسبة للارتباط ب ‎¢CE9.1‏ بينما أظهرت كل خلايا “008 تفاعلية سلبية. كما أظهرت كل خلايا 003 تفاعلية مع 089.1؛ بالرغم من أنه لم تحدد بعد طبيعة هذه التفاعلية بوضوح.0 was recently analyzed by two-color flow cell counts. Figure 4 shows that about Vx of '003' cells were associated with 089.1. Within the subgroup of lymphoid origin; All cells that bound to OKT4 also showed a positive reactivity for binding to ¢CE9.1 while all of the '008 cells showed a negative reactivity. All 003 cells showed reactivity with 089.1; Although the nature of this interaction has not yet been clearly defined.

‎\o‏ وأجري تحليل كيمياء الأنسجة المناعي لتحديد التفاعلية النسيجية ل 089.1؛ بما في ذلك ‎Tapes YY‏ بشريا ‎Las‏ مختلفا من أصل لمفاني أو أصل غير لمفاني. ‎Jays‏ النسيج اللمفاني الأعضاء الرئيسية؛ الدماغ؛ القلب؛ الجلد العضلي الهيكلي؛ الكبد؛ الكلية؛ الأنسجة الغدية والتناسلية. ولم يظهر مثل هذا التحليل حدوث أية تفاعلية متبادلة مع أي نسيج غير تلك الأنسجة التي من أصل لمفاني ‎Lay‏ في ذلك العقد اللمفية؛ الطحال؛ اللوزة والدم المحيطمي\o Immunohistochemical histochemistry analysis was performed to determine histo-reactivity for 089.1; Including Tapes YY human Las different of lymphatic or non-lymphatic ancestry. Jays lymphoid tissue major organs; the brain; the heart; musculoskeletal skin; liver; the college; Glandular and reproductive tissues. Such analysis did not show any cross-reactivity with any tissue other than those of Lymphoid origin in those lymph nodes; spleen; Amygdala and peripheral blood

‎cull) x.‏ غير مبينة). كما لوحظ الاصطباغ؛ المقتصر على التجمعات اللمفانية في المعي الغليظ؛ الرئة؛ المريء والجلد. تثبيط ‎MLR‏ البشري بواسطة ‎CE9.1‏cull) x. not shown). pigmentation is also observed; restricted to the lymphoid communities of the large intestine; lung; esophagus and skin. Inhibition of human MLR by CE9.1

‏قيم تأثير 089.1 على استجابات خلايا 7 بواسطة ‎MLR‏ بشريء يتمثل في إنتاج 1-2 أو استجاباته التكاثرية. ويعيق 089.1 كلا من التكاثر وإنتاج ‎IL-2‏ عند تركيز مثبط ‎(IC)‏ في ‎Te‏ ot ‏تانوجرام/مل‎ 7١ ‏نانوجرام/مل؛ مع تثبيط بحوالي 96860 عند 16 تبلغ‎ "0-٠١ ‏المدى من‎ .)٠١ ‏(الشكل‎ ‎Fe ‏بمستقبلة‎ CE9.1 ‏فعالية ارتباط‎Evaluate the effect of 089.1 on MLR-mediated 7 cell responses to human 1-2 production or its proliferative responses. 089.1 inhibits both proliferation and production of IL-2 at an inhibitory concentration (IC) in Te ot 71 ng/mL; With an inhibition of about 96,860 at 16 "0-01 range (Fig. 01). CE9.1 receptor binding efficiency.

CE9.1 ‏لتحديد تفاعلية‎ Fo ‏ومستقبلة‎ CD4 ‏طورت معايرات التصاق بين الخلايا أساسها‎ ‏على الخلايا وحيدة النواة. وفي أحد أشكال المعايرة؛ عزلت الخلايا وحيدة‎ Fo ‏مع مستقبلات‎ © ‏جديدة عن طريق الفرز بالطرد المركزي التدرجي لبيركول؛ زرعت‎ PBM ‏النواة عن خلايا‎ ‏ساعة. وبعد هذه المدة؛ أضيفت خلايا‎ $A ‏في صفائح بمقياس ميكرولتري نبهت ب 1777 لمدة‎ ‏ل *004 المحمولة بالصبغة إلى الخلايا وحيدة النواة سريعة الالتصاق المنشطة في‎ 1 ‏وجود أو غياب 059.1. وفي شكل ثان لمعايرة الالتصاق هذه؛ نبه النسل الخلوي وحيد النواة‎ ‏المنشطة‎ THP-1 ‏وبعد 4" ساعة؛ حملت خلايا‎ IFN ‏غير الملتصق؛ 1117-1 باستخدام‎ ١ ‏باستخدام صبغة واسمة وأضيفت في وجود أو غياب 089.1؛ إلى نواتج العدوى التحويلية‎ ‏ساعة) داخل الصفائح ذات‎ YE ‏(قبل‎ ase ‏سريعة الالتصاق؛ التي طليت‎ CDA” ‏للأرومة الليفية‎ ‏ب‎ mAb ‏المقياس الميكرولتري. وفي كلتا الحالتين؛ يعتمد الالتصاق بين الخلايا على ارتباط‎ ‏على الخلية الأخرى.‎ Fo ‏الخلايا وبمستقبلات‎ saa) ‏على‎ CD4 ‏و ١٠جء على أساس الخلايا وحيدة‎ ب٠١‎ ٠١ ‏وتظهر البيانات الممثلة في الأشكال‎ Vo ‏يتوسط الالتصاق‎ CE9.1 ‏وخلايا 500113 بل *004 أن‎ AIFN ‏النواة الجديدة المنشطة ب‎ ‏نانوجرام/مل. وأعيق‎ ٠١ ‏الخلوي بكيفية معتمدة على الجرعة؛ بقيمة تقريبية ل و80 تبلغ‎ ‏ولم يكن‎ F(ab"); ‏وهي‎ CE9.1 ‏بواسطة 004؛ ولا يمكن أن يستحث بجزء من‎ Lala ‏الالتصاق‎ ‏بإمكان الخلايا وحيدة النواة المنشطة ب 007 أن ترتبط ب 089.1 (انظر الشكل ١٠ب). وتم‎ ‏الحصول كذلك على بيانات مماثلة باستخدام المعايرة التي أساسها معايرة الأرومة الليفية ل‎ ye ‏و “004 (البيانات غير مبينة). كما لوحظ الارتباط المباشر ل 089.1 بنسل الأرومة‎ THP-1 ‏الليفية الفاري المصاب بالعدوى التحويلية بواسطة مستقبلات 20,817 البشري (البيانات غير‎ ‏مبينة).‎CE9.1 To determine the interaction of Fo and the CD4 receptor intercellular adhesion assays based on mononuclear cells were developed. In one form of calibration; Fo receptor monocytes with fresh © receptors were isolated by Percol's gradient centrifugation; PBM cultured nuclei on clock cells. And after this period; $A cells in microliter plates stimulated with 1777 l for *004 dye-borne were added to activated fast-adhesive mononuclear cells in 1 in the presence or absence of 059.1. In a second form of this adhesion calibration; Monocyte progenitors stimulated activated THP-1 and after 4' h cells carried non-adherent IFN-1117-1 using a marker dye and were added in the presence or absence of 089.1 h to the transforming infection products. ) within plates with YE (pre-adhesive ase; CDA” of fibroblasts were coated with microliter-scale mAb. In both cases, adhesion between cells depends on binding on the other cell. Fo cells and saa receptors) on CD4 and 10G on a B01 01 monocyte basis and the data represented in the figures show Vo adhesion mediated by CE9.1 and 500113 Bl*004 cells mediated neonuclear AIFN activated B ng/mL .01 cytokinesis was inhibited in a dose-dependent manner, with an approximate value of 80 and F(ab"); which is CE9.1 by 004; A portion of Lala cannot induce adhesion. Mononuclear cells activated by 007 can bind to 089.1 (see Figure 10b). Similar data were also obtained using the ye fibroblast assay and “004” titration (data not shown). Direct binding of 089.1 to the transforming-infected mouse THP-1 fibroblast progeny via human 20,817 receptors was also observed (data not shown).

00 التسمم الخلوي المستحث بالخلايا المعتمد على الجسم المضاد ‎(ADCC)‏ ‏تبين أن خلايا 50011 الموسومة إشعاعياً؛ المستخدمة كخلايا مستهدفة في معايرة ‎ADCC‏ تنحل بشكل نوعي من قبل خلايا مستفعلة في وجود ‎(CES.‏ وتم بلوغ القيمة القصوى للتسمم الخلوي عند تركيز بلغ تقريباً 7 ميكروجرام/ملي لتر وبنسبة مئوية للاتحلال النوعي م الكلي بلغت حوالي ‎Yor‏ (الشكل ‎(VY‏ . وكضابط إيجابي؛ تم استخدام مضاد ال 004 الفاري للنمط الإسوي الجلوبلين المناعي ‎(1gG2a) G2a‏ (409). وكان سلوك الجسم المضاد هذا ‎Silas‏ ‏إلى حد بعيد لسلوك 089.1 بحيث أعطى نفس المستوى من الانحلال الخلوي الكلي. وعليه؛ كان 089.1 فعالا ‎Tas‏ في الارتباط بمستقبلات ‎Fo‏ على ‎WIA‏ مستفعلة وتوسط قتل الأنسال الخلوية المستهدفة ل *04. ‎٠‏ ا تثثبيت المتممة بواسطة ‎CE9.1‏ ‏تم قياس ارتباط 4 عن طريق تعداد الخلايا التدفقي؛ كما هو موصوف أعلاه (في بند المواد والطرق). وكما هو مبين في الشكل ‎OF‏ وعلى الرغم من حقيقة أن 089.1 يحتوي على منطقة سلسلة ثقيلة ثابتة بشرية من النمط الفرعي جاما ‎١‏ لم يظهر 089.1 إلا أدنى حد من الارتباط ب ‎Clq‏ (انظر الشكل ‎(VF‏ وكانت الأجسام المضادة المصلية ل 004 المأخوذة ‎ee‏ القرد المنقاة بالاستشراب ‎AY‏ فعالة في حث الارتباط ب ‎«Clq‏ مما يوحي بأن الافتقار إلى الارتباط ب ‎Clq‏ بواسطة 089.1 هو خاصية نوعية للجسم المضاد هذا. وينعكس الافتقار إلى الارتباط ب ‎Clq‏ بواسطة 1 في عدم القدرة على تثبيت المتممة (انظر الشكل ‎(VE‏ ‏وتنتج كل من الأجسام المضادة ل 004 المنقاة ‎Gil‏ المأخوذة من مصل القرد والجلوبلين المناعي 628 ‎(1gG2a)‏ وحيد النسيلة ‎ll‏ نسبة مئوية كبيرة للانحلال خلال مدى التركيز ‎٠‏ نفسه. التفاعليات المتبادلة لأنواع ‎CE9.1‏ ض أظهر تحليل تعداد الخلايا التدفقي للخلايا اللمفية من أنواع مختلفة أنه لم يرتبط ب 1 بقوة إلا خلايا قرود الشمبانزي والخلايا البشرية. وكان قرد الرباح من الأنواع الأخرى الوحيدة التي أظهرت تفاعلية ضعيفة مع 089.1 (أقل من الخلايا البشرية ب ‎٠١‏ أضعاف). ‎Yo‏ وتفاعلت الخلايا اللمفية المأخوذة من البشر والشمبانزي ‎Tam‏ على حد سواء مع ‎mAb‏ (انظطر00 Antibody-dependent cell-induced cytotoxicity (ADCC) Radioactively tagged 50011 cells; The cells used as target cells in the titration of ADCC were specifically degraded by effector cells in the presence of CES. The maximum value of cytotoxicity was reached at a concentration of approximately 7 µg/mL and with a percentage of total specific decay of about Yor (Fig. (VY). As a positive control, murine anti-004 of the immunoglobulin (1gG2a) G2a isotype (409) was used. This antibody behaved so closely to Silas 089.1 that it gave the same level of total cytolysis. Therefore, 089.1 was effective Tas in binding to Fo receptors on WIA-activators and mediating killing of target cell lineages of *04.0 Complement inhibition by CE9.1 Binding of 4 was measured by cell count. Despite the fact that 089.1 contained a human constant heavy chain region of subtype gamma 1, 089.1 showed only minimal binding to Clq (see Figure VF) and 004 serum antibodies to 004 from monkey ee chromatography-purified AY were effective in inducing binding to Clq suggesting that the lack of binding to Clq by 089.1 is a specific characteristic. this antibody. The lack of binding to Clq by 1 is reflected in the inability to bind complement (see Figure VE). It produces both Gil-004-purified antibody from monkey serum and IgM-628 (1gG2a) monoclonal antibody. ll A large percentage of dissolution over the same concentration range 0 Cross-reactivity of CE9.1 species Z Analysis of flow-through cell counts of lymphocytes from different types showed that only chimpanzee and human cells bound 1 strongly. The only other species showed weak reactivity with 089.1 (01-fold lower than human cells).Yo Lymphocytes from both human and chimpanzee Tam reacted equally to the mAb (see

الجدول ‎(TV‏ وعكس هذا في تثبيط مماثل لتكاثر خلايا 7 وإنتاج 1-2 في تفاعل الخلايا اللمفية المخلط في الشمبائنزي بواسطة الجسم المضاد 089.1 (البيانات غير مبينة). الجدول ؟ الأنسواع التفاعلية البشر +++ الشمبانزي +++ الرباح + الريص - السينومولجس - المكاك خنزيري الذيل ~ الكلب _ الأرنب . الجرذ - ‎Ja‏ - دراسة في الجسم الحي على “ قرود شمبانزي ° بناءً على الافتقار إلى إفراغ ‎WA‏ 004 في دراسة باستخدام مقادير متزايدة من الجرعات في قرد شمبانزي مفردء أعطيت جرعة بلغت ‎٠١‏ مجم/كجم إلى ؛ قرود شمبانزي (بالإضافة إلى حيوانين في فئة ضابطة تلقيا محلولاً ملحيا). وكما وصف في المواد والطرق؛ تم إعطاء جرعة بلغت ‎٠١‏ مجم/كجم لكل حيوان من فئتي الجرعة في اليوم صفر من الدراسة. ويلخص الشكل ‎١١‏ التأثيرات على تعدادات ‎CDSs CDA WA‏ في هذه الحيوانات. ‎٠‏ ويمكن ملاحظة أنه كان ثمة انخفاض في عدد الخلايا التي تعبر عن مستقبلة 004 بعد إعطاء الجسم المضاد مباشرة. ولم يلاحظ الانخفاض في تعدادات خلايا 004 إلا بعد إعطاء كل جرعة من الجسم المضاد مباشرة. ‎aly‏ يلاحظ أي تغير ‎Flee‏ في تعدادات خلايا 004 في الفئة الضابطة التي تلقت المحلول الملحي. وبقيت تعدادات خلايا 008 غير متأثرة طيلة فترة المعالجة بالرغم من ملاحظة قابلية تغير بشكل يومي (انظر الشكل ‎(Vo‏ القطاع ‎ul)‏ دوائر ov ‏مفتوحة) . وبفحص مجموعة “0037-008؛ لوحظت انخفاضات ملموسة بدرجة أقل في أعداد‎ ‏خلايا 004. وتوحي البيانات بظهور مجموعات خلايا 7 ل -008 0037 التي يمكن أن تكون‎ ‏قد ظهرت نتيجة تعديل مستضد 004. وتكون الآلية الدقيقة للتعديل غير واضحة في هذه‎ ‏المرحلة؛ إلا أنها قد تشمل حصر جزيئات 004 داخلياً أو عزلها نتيجة للارتباط المتقاطع‎ ‏المعبر عنها على خلايا أخرى لمفانية أو وحيدة النواة. وتظهر مقارنة‎ Fo ‏م بواسطة مستقبلات‎ ‏بالرغم من أن التأثير‎ CDA" ‏أنه يمكن حدوث بعض الإفراغ لخلايا‎ Vo ‏أعداد الخلايا في الشكل‎ ‏وفي معظم الحالات يبدو أن تأثير التعديل يستمر لفترة‎ .CD4 ‏الرئيسي ناتج عن تعديل مستقبلة‎ ‏أيام بعد إعطاء الجسم المضاد مباشرة؛ حيث بعد هذه المدة يعود‎ ٠١-١7 ‏تتراوح من حوالي‎ ‏مستوى التعبير عن 004 إلى قيمة تقل عن مستويات خط الأساس بقليل.‎ ‏إلى النقطة الزمنية عند خط الأساس‎ Gls ‏الكلية منخفضة‎ 004 LDA ‏وتبقى تعدادات‎ Ve ‏ولكن بعد توقف المعالجة؛ تعود إلى المدى العادي. وتم متابعة‎ 9680-٠١ ‏بنسبة تتراوح من‎Table (TV) This was reversed in a similar inhibition of 7-cell proliferation and 1-2 production in mixed lymphocyte reactivity in chimpanzees by antibody 089.1 (data not shown). Sinomologs - Hog-tailed Macaque ~ Dog_Rabbit.Rat - Ja - In vivo study in “chimpanzees” ° based on lack of voiding WA 004 in a study using increasing amounts of doses in a single chimpanzee given a dose of 10 mg/kg to chimpanzees (in addition to two control animals who received saline solution). 11 Effects on the numbers of CDSs CDA WA in these animals.0 It can be seen that there was a decrease in the number of cells expressing the 004 receptor immediately after administration of the antibody.The decrease in the number of 004 cells was not observed until after each dose of The direct antibody aly no Flee change was observed in the 004 cell counts in the control group that received saline. The 008 cell counts remained unaffected throughout the treatment period although a daily fluctuation was observed (see Fig. (Vo sector ul) open ov circles). By examining the group “0037-008; Less appreciable decreases were observed in the numbers of 004 cells. The data suggest the emergence of 0037-008-7 cell populations that could have emerged as a result of the 004 antigen modification. The exact mechanism of the modification is not clear at this stage; However, they may include internalization or isolation of 004 molecules as a result of cross-linking expressed on other lymphoid or mononuclear cells. A comparison of Fo by CDA receptors shows that some emptying of Vo cells can occur in the number of cells in the figure, and in most cases the effect of the modulation seems to last for the period of the main CD4. Receptor days immediately after antibody administration, after which time it returns 01-17 ranging from about expression level of 004 to a value just below baseline levels to the time point at baseline Total Gls 004 LDA is low and Ve counts remain but after treatment is stopped they return to the normal range.9680-01 has been followed up by

Caley (Faia) ‏يوم‎ Veo ‏أو‎ )١ ‏و‎ ١ ‏(الفئتان‎ Log Yoo ‏قرود الشمبانزي لفترة بلغت‎ ‏من المعالجة‎ lags Av ‏تعدادات خلايا 004 لحيوانات الفئة 7 إلى المستويات الطبيعية بعد‎ ‏تقريباً من قيمة‎ 967٠0 ‏لحيوانات الفئة الثالثة إلى‎ 004 LA ‏النهائية في حين عادت تعدادات‎ ‏خط الأساس خلال نفس الإطار الزمني.‎ ve ‏المثال ؟‎ ‏يصف هذا المثال التركيب المورثي للناقل التعبيري للدنا المستخدم في خلايا ثديية‎ ‏مضاداً خميرياً ل 004 مأخوذ من إنسان/قرد مكاك‎ Lawn ‏لإنتاج 089425 الذي يعتبر‎ .8 ‏الذي يتضمن الشكلين المتغيرين © و‎ v4 ‏يحتوي على النمط الإسوي البشري‎ ‏تركيب الناقل التعبيري للدنا‎ ve ‏من النسل الخلوي‎ PCR ‏عزل مورث السلسلة الثقيلة جاما ؛ البشرية بواسطة‎ ‏عند النهاية‎ IDEC ‏باستخدام البادئ‎ (UCLA ‏,(حصل عيه من إس. موريسون»‎ 4 ‏اللذين يحتويان على‎ (V1 ‏رقم 74؛ والبادئ 1080 عند النهاية 7 رقم 67؛ (انظر الشكل‎ ٠ ‏على الترتيب. وتم تعيين تتابع الجزء المنسل الكامل لمورث‎ BamH 1 ‏و‎ Nhe 1 ‏الموقعين‎ ‏جاء عن كابات‎ Lad ‏السلسلة الثقيلة جاما ؛ البشرية ووجد أنه مطابق لذلك الموصوف‎ vo oA 31-7747 ‏الطبعة الخامسة رقم‎ (NIH) ‏(نشرة المعاهد الوطنية للقلب‎ Kabat et al, ‏ومعاونيه‎ ‏وتم تتسيل‎ .)١7 ‏(انظر الشكل‎ (0 49Y) ‏دائرة الخدمات الصحية والإنسائية الأمريكية‎ ‏ونقلت مورّثات الجلوبلين المناعي ذات‎ Anex2 ‏في الناقل التعبيري‎ Nhe UBamH 1 ‏الجزء‎ ‏السلسلة الخفيفة والثقيلة الكلية من هذا البلازميد إلى بلازميد تعبيري آخر على الجزء المحددة‎ ‏في‎ (G4, L, Oz) CD4 ‏وسمي هذا البلازميد مضاد‎ Sac ‏.من الموقع 3811 إلى‎ ٠ .NEOSPLA3F ‏لتغيير الحمض الأميني رقم 749 ورقم‎ PCR ‏واستخدمت عملية توليد الطفر بواسطة‎ ‏باستخدام البادئ شركة لاند 08212 عند النهاية‎ PCR ‏في المنطقة الثابتة جاما ؛. وأجري‎ YY ‏يحتويان على الموقعين المحددين‎ TAA ‏عند النهاية 7 رقم‎ DEC ‏وبادئ‎ (Midlond) © ‏وتم تتسيل الجزء في بلازميد مضاد‎ (VT ‏على الترتيب (انظر الشكل‎ BspH ‏و1‎ Nhe I 0-0٠Caley (Faia) day Veo or 1) and 1 (Log Yoo categories) chimpanzees for a period of treatment Av lags Av 004 cell counts of category 7 animals returned to normal levels after approx. A value of 96,700 for class III animals reached the final 004 LA while baseline counts returned within the same time frame. ve Example? 004 derived from human/Lawn's macaque to produce 089425 which is 8. which includes the two variants © and v4 contains the human isotype Expressive vector DNA ve construct from cell lineage PCR isolate the sequence gene human gamma heavy gamma by IDEC using the prefix UCLA (obtained from S. Morrison) 4 containing V1 no. 74; and prefix 1080 at the 7 end no. 67; (see Fig. 0, respectively. The full spline sequence of the BamH 1 and Nhe 1 genes signed by human Lad heavy chain gamma caps was determined and found to be identical to that described vo oA 31-7747 ed. Fifth NIH (National Heart Institutes Bulletin Kabat et al, et al., et al., and Tessel). 17 (See Figure 0 49Y). Anex2 in the Nhe UBamH expressive vector 1 part the total light and heavy chain from this plasmid to another expressive plasmid on the part specified in (G4, L, Oz) CD4 and this plasmid was named anti-Sac from the site 3811 to 0.NEOSPLA3F to change amino acid number 749 and PCR number and mutagenesis was used by using the initiator Land Corporation 08212 at the end PCR in the gamma constant region;. A YY was carried out containing the two sites specified TAA at the end of the DEC number 7 and an initiator (Midlond)©, and the fragment was cascaded into an antibody (VT) plasmid, respectively (see Figure BspH and 1NheI 0-00

CD4 ‏في عملية ربط ثلاثية الأجزاء وسمي بلازميد التتابع مضاد‎ CD4(G4L,02)CD4 in a three-part ligation and the sequence plasmid was labeled anti-CD4(G4L,02)

NEOSPLA3F ‏في‎ (G4 (PE), ‏مآ‎ 02( + ‏المثال‎ ‎(CHO) ‏التعبير في خلايا مبيض القداد الصيني‎ ‏تدامج البلازميد وانتقاء نسائل لإنتاج أجسام مضادة‎ eo ‏في‎ Urlaub et al ‏(انظر ما جاء عن إرلوب ومعاونيه‎ (DG44) CHO ‏زرعت خلايا‎ 6 ‏مجلد‎ ¢(Som. Cell Mol. Genet.) ‏الوراثيات الجزيئية للخلايا الجسدية‎ Alaa ‏تحتوي على 00 ميكرومولار من‎ CHOS-SFM I ‏ص 011-000 1985م) في أوساط‎ ‏أوساط‎ ((GIBCOBRL) ‏إل‎ J ‏ميكرومولار من الثيميدين (شركة جيبكو/بي‎ A ‏الهيبوزنثين و‎NEOSPLA3F in (G4 (PE), MA 02) + example (CHO) expression in Chinese hamster ovary cells incorporation plasmid and selection of clones to produce eo antibodies in Urlaub et al (see What was reported by Erlopp and his collaborators (DG44) CHO cells 6 vols ¢ (Som. Cell Mol. Genet.) Molecular Genetics of Somatic Cells Alaa were cultured containing 00 micromolar of CHOS-SFM I p011- 1985 000) in media (GIBCOBRL) L J micromolar of thymidine (GIBCO/B A hypozenthine and

HT ‏و‎ CHO ‏وتسمى هذه الأوساط أوساط‎ (CHO -- ٠ ‏وأجريت خمس عمليات لتشكيل المسام بالكهرباء باستخدام عدد من الخلايا بلغ‎ ‏ميكروجم من دنا البلازميد إمضاد 004 ((408 لتمنداء -02) في‎ © Wax ‏؛‎ ‏(من شركة بي تي‎ BTX 600 ‏باستخدام جهاز تشكيل المسام بالكهرباء من نوع‎ [NEOSPLA3F ‏مل. وقبل عملية تشكيل المسام‎ ١,4 ‏أكس؛ ساندييجو؛ كاليفورنيا) في مراكن جاهزة سعتها‎ ‏الذي يفصل المورثات المعبر عنها في الخلايا‎ Pac 1 ‏بالكهرباء تم حصر البلازميد بواسطة‎ voHT and CHO and these media are called (CHO-0) media. Five electroporation processes were performed using a number of cells amounting to micrograms of plasmid DNA antibody 004 ((408 to Munda-02) in © Wax; (from BT Inc. BTX 600 using an electropore-forming device [NEOSPLA3F ml. and prior to the 1.4x pore-forming process; San Diego, CA) in a pre-capacity container that separates the genes expressed in Pac1 cells electroporated the blocking plasmid with vo

TeTe

‎Ap‏ عن جزء البلازميد المستخدم لزراعة البلازميد في البكتيريا. وتضمنت ظروف عملية تشكيل المسام بالكهرباء ‎Taga‏ كهربائياً بلغ ‎77١0‏ فولت؛ شحنة كهربائية بلغت £0 ميكروفاراداي؛ ومقاومة بلغت ‎١١‏ أوم. وأجريت كل عمليات تشكيل المسام بالكهرباء عن طريق طلي الخلايا في طبق مفرد به ‎AT‏ عيناً (حوالي 4006859 خلية/عين). وغذيت م الأطباق بأوساط ‎HT + CHO‏ يحتوي على 6418 (جينيتيسين» جييكو)؛ بتركيز بلغ ميكروجم/مل للمركب الفعال؛ بعد يومين من عملية تشكيل المسام بالكهرباء؛ وبعد ذلك أضيف حسب الحاجة حتى ظهور المستعمرات. وتمت معايرة السائل الطافي من المستعمرات المندمجة لفحص وجود جلوبلين مناعي خيمري بواسطة ‎ELISA‏ متخصصة بالجسم المضاد البشري. وظهرت ‎YA‏ مستعمرة مقاومة ل 6418 على © صفائح (من أصسل 80؛ عينا). ‎٠‏ واندمجت المستعمرة المقاومة ل 6418 التي تعبر عن معظم الجسم المضادء النسيلة 501 بعد ‎"٠‏ يومآً من عملية تشكيل المسام بالكهرباء. وأظهر تحليل نقل وطبع سذرن أن النسيلة 501 عبارة عن مادة مندمجة بنسخة واحدة ‎lL)‏ غير مبينة). وفي مزرعة عمرها ؛ أيام زرعت بمعدل ‎"٠١‏ خلية/مل في وعاء تدويري سعته ‎١5‏ مل؛ تضاعفت هذه النسيلة كل ‎YA‏Ap for the plasmid fragment used to grow the plasmid in bacteria. The conditions for the electropore formation process included Taga, an electrical current of 7710 volts; an electric charge of £0 microfarads; And a resistance of 11 ohms. All pore electroporation procedures were performed by electroplating cells in a single dish with AT eye (~4006859 cells/eye). m dishes were fed with HT + CHO medium containing 6418 (Geneticin »Geiko); at a concentration of µg/mL of the active compound; 2 days after the electroporation process; Then add as needed until colonies appear. The supernatants from the merged colonies were assayed for the presence of chimeric immunoglobulins by an ELISA specific for human antibody. YA colonies resistant to 6418 were shown on © plates (out of 80; samples). 0 The colony resistant to 6418 expressing most of the antibody clone 501 fused 0 days after the electroporation process. Southern transfer and print analysis showed that clone 501 was a monoclonal 501 lL fusion (not shown). In a days old farm, it was grown at a rate of 10 cells/ml in a rotating container with a capacity of 15 ml. This clone multiplied every YA

‏ساعة؛ وبلغ معدل إنتاج الأجسام المضادة ‎١,5‏ بيكوجرام/خلية/يوم )19+ مجم/لتر).hour The antibody production rate was 1.5 pg/cell/day (19+ mg/l).

‎Vo‏ التضخيم تم تكبير خلايا النسيلة 501 وطليت بتراكيز مختلفة تراوحت من ‎NV‏ خلية/|إصفيحة إلى ‎oxy‏ )© خلية/,صفيحة في أطباق بها 97 ‎Lae‏ تحتوي على أوساط ‎CHO‏ + مثوتريكسات تركيزه © نانومولار (شركة إم تي إكس؛ سيجما () أميثوبتيرين). وبعد ‎lags ٠١‏ أصبحت النسيلة 501-589 مندمجة على ‎BA‏ عددها ‎"٠١7‏ خلية/صفيحة (على 4؛ ‎lie‏ من ‎Jal‏ ‎Le 9+ 0‏ في هذه الصفيحة). وتم تكبير هذه النسيلة. وفي مزرعة عمرها ؛ أيام زرعت بمقدار ‎BE‏ خلية/مل في ‎(T150‏ تضاعفت هذه النسيلة كل 70,5 ساعة؛ وكان لها معدل إنتاج أجسام مضادة بلغ ‎١5,7‏ بيكوجرام/خلية/يوم ‎VA)‏ مجم/لتر). وتم تكبير النسيلة 501-589 وطليت بتراكيز مختلفة تراوحت من ‎٠٠١‏ خلية/صفيحة إلى ‎xt‏ )© خلية/صفيحة في أطباق بها ‎le 7‏ تحتوي على أوساط ‎CHO‏ + مثوتريكسات تركيزه 00 نانومولار. وبعد 76 يوماً ‎vo‏ أصبحت النسيلة 501-289-5001 مندمجة بنسبة حوالي 9630 على خلايا عددها ‎٠١‏ ‎Ta‏Vo amplification 501 clone cells were amplified and plated with different concentrations ranging from NV cell/|lamella to oxy (© cell/,lamella) in 97 Lae plates containing CHO media + nanomolar methotrexate ( MTX Corporation; Sigma () methopterene). After lags 01, clone 501-589 became fused to BA of “017 cells/plate (on 4; lie of Jal Le 9 + 0 in this plate). This clone was enlarged. In a days old culture grown at BE cells/ml in (T150), this clone doubled every 70.5 hours; it had an antibody production rate of 15.7 pg/cell/day (VA) mg/ The clone 501-589 was enlarged and plated with different concentrations ranging from 100 cells/platelet to xt (© cell/plate) in plates containing le 7 containing CHO media + methotrexate at a concentration of 00 nM. vo days clone 501-289-5001 became fused by about 9630 on 01 Ta cells

ب خلية/صفيحة (نمت الخلايا على ‎lie ٠٠‏ من أصل 7 ‎Lue‏ في هذه الصفائح). وهكذا تم تكبير هذه النسيلة. بنوك خلوية لإمدادات الطور ‎I‏ لمختزن البذور الأصلي ‎(PSS)‏ ل »29:4 جمد ‎9٠0‏ نانومولار من ‎MTX PSS‏ للنسيلة 501-589-5001. وزرعت الخلايا في ‎٠‏ وعاء تدويري سعته 500 مل يحتوي على وسط ‎CHO‏ بالإضافة إلى ‎5٠0‏ نانومولار من ‎MTX‏ وعند زمن التجميد؛ بلغت كثافة المزرعة ‎MY ox),‏ خلية/مل وبلغت قابليتها للحياة 7 أما مدة التضاعف فقد بلغت 79,7 ساعة. وحدد إنتاج الأجسام المضادة بواسطة ‎ELISA‏ ‏شطيرية (معايرة الطبقة بين الطبقتين) بحيث بلغ ‎YY La‏ بيكوجرام/خلية/يوم. وفصلت الخلايا من الوسط بالطرد المركزي ووضعت في قوارير بكثافة بلغت ‎"٠٠١77,‏ خلية/مل في ‎Jaa ١‏ بقري جنيني من شركة جيه ‎J‏ إتش بيوسينسز ‎JRH Biosciences‏ بنسبة 9/695 ‎DMSO‏ من شركة سيجما بنسبة 965 ومن هذا المزيج الرئيسي المألوف؛ جمد ‎١‏ مل من وسط التجميد الذي يحتوي على الخلايا في قوارير. وجمدت القوارير عند ‎Vom‏ م ووضعت في اليوم التالي في خزان نتروجين سائل. وتركت قارورة تحتوي على ‎MTX PSS‏ بتركيز بلغ ‎٠٠‏ نانومولار لإذابة الثلج وبذرت ‎Vo‏ الخلايا في وعاء تدويري سعته ‎٠٠١‏ مل يحتوي على وسط ‎CHO‏ مع ‎5٠‏ نانومولار من ‎(MTX‏ وبعد © أيام؛ جزّئ الوعاء التدويري هذا إلى وعاءين تدويريين سعة كل منهما ه١١١‏ مل عند كثافة بلغت ‎"٠١77‏ خلية/مل؛ بحيث احتوى أحد الوعاءين التدويريين على وسط ‎CHO‏ مع ‎٠٠‏ نانومولار من ‎MTX‏ واحتوى الوعاء التدويري الآخر على وسط ‎CHO‏ فقط. وبعد ¥ أيام؛ جمد ‎١5‏ مل من الخلايا والوسط الذي حصل عليه من الوعاء التدويري © الذي تضمن وسط ‎CHO‏ فقط وأرسلت لإجراء اختبار الميكوبلازما باتباع طريقة النقاط المأخوذة بعين الاعتبار لشركة تكتاجين ‎Tektagen‏ واستمرت دورات الإنتاج في وجود وبعدم وجوده لمدى ‎A‏ أسابيع. وأظهرت النتائج من تكتاجين أن مضاد ‎y4(PE)) CD4‏ للمنداء ‎(0Z-‏ في 1086050137 في 110©؛ والنسيلة ‎5C1-5B9-20C1‏ لمختزن البذور الأصلي يخلوان من الميكوبلازما. وتم نقل ‎٠١‏ قوارير تحتوي على ‎PSS‏ 104 بتركيز ‎5١ Yo‏ نانومولار لتخزينها في نتروجين سائل. 1.7B cell/plate (cells were grown on lie 00 out of 7 Lue in these plates). Thus, this clone was enlarged. Primary seed store (PSS) supply cell banks for “29:4.” Freeze 900 nm of MTX PSS of clone 501-589-5001. Cells were cultured in 0 500 mL rotating beaker containing CHO medium plus 500 nM of MTX and at freezing time; The density of the culture was (MY ox) (cells/ml), the viability was 7, and the doubling time was 79.7 hours. Antibody production was determined by sandwich ELISA (layer-between-layer titration) to be YY La pg/cell/day. Cells were separated from the medium by centrifugation and placed in flasks at a density of 0,177 cells/mL in Jaa 1 fetal bovine from JRH Biosciences at a ratio of 695/9 to DMSO from Sigma at a ratio of 965. From this familiar master mix 1 mL of the freezing medium containing the cells was frozen in vials The flasks were frozen at Vom C and placed the next day in a liquid nitrogen tank Vials containing MTX PSS at a concentration of 0 nanomolar thawed and Vo cells were seeded in a 100 mL circulating vessel containing CHO medium with 50 nM of MTX and after © days; compartmentalize this circulating vessel into two circulating vessels of 111 mL each at density of ‒0,177 cells/mL such that one of the two circulating vessels contained CHO medium with 00 nM of MTX and the other cyclic vessel contained only CHO medium. After ¥ days, freeze 15 mL of Cells and medium obtained from the circulating vessel © which contained CHO medium only and were sent for mycoplasma testing by following the point-wise method of Tektagen company. The production cycles continued in the presence and absence of A for weeks. The results from Tectagen showed that the y4(PE)) CD4 antiserum (0Z-V1086050137 in 110©; clone 5C1-5B9-20C1 from the original seed stock was free of mycoplasma. 01 vials containing 1.7 PSS 104 at 51 yo nanomolar concentration for storage in liquid nitrogen.

> بنك الخلايا الرئيسي ‎(MCB)‏ ‏تركت قارورتان تحتويان على ‎MTX PSS‏ بتركيز ‎5٠‏ ملي مولار ‎i Lill‏ ‎5C1-5B9-50C1‏ لإذابة الثلج وبذرت الخلايا في دورق تدويري سعته ‎٠٠١‏ مل يحتوي على وسط ‎«CHO‏ مع ‎٠٠‏ نانومولار من ‎MTX‏ وامتدت الزراعة لمدة ستة أيام ‎Jai)‏ دوارق ‎٠‏ تويرية أكبر بشكل متزايد حتى حصل على حجم بلغ ‎٠058١‏ مل؛ مع كثافة بلغت ‎"١١9,5‏ ‏وقابلية للحياة بلغت 706948. وفصلت الخلايا من الوسط بالطرد المركزي وعلقت مرة أخرى عند كثافة بلغت ‎TY XY,‏ خلية/مل في مصل بقري جنيني من شركة جيه آر إتش بيوسينسز بنسبة 96956 ‎DMSO‏ من شركة سيجما بنسبة 965 هايبريماكس. وأخذت عينات بلغت ‎٠١‏ ‏مل من المعلق الخلوي من وسط التجميد ووضع كل منها في ‎Av‏ عبوة صغيرة مصممة ‎٠‏ > بصفتها البنك الخلوي الرئيسي 4-8<-6422850. وجمدت القوارير عند -. لام وبعد ‎YE‏ ساعة؛ ‎Jas‏ بنك الخلايا لتخزينه في نتروجين سائل. المثال ه ثبات ‎mAbs‏ ل ‎CD4‏ ‏تمت مراقبة الثبات الفيزيائي والكيميائي لمحاليل ‎CE9Y4PE‏ و 089:42 على مدى ¥ ‎١‏ أشهر عند مو 6 م؛ وباستخدام الضوء المنتشر بواسطة الرحلان الكهربائي على هلام متعدد أكريل أميد باستخدام كبريتات دوديسيل الصوديوم ‎(SDS-PAGE)‏ (مختزل وغير مختزل)؛ التركيز البؤري متساوي الجهد الكهربائي ‎(IEF)‏ الاستشراب السائل عالي الأداء ‎(HPLC)‏ معكوس الطور؛ الاستشراب بالاستبعاد الحجمي (©58)؛ ‎ads ELISAs‏ اختبار ابتدائي أجري بواسطة ‎RP-HPLC‏ و ‎SDS-PAGE‏ غير المختزل أن 08942 يتكون من نوعين ‎Te‏ رئيسيين هما بالتحديد؛ الجزيء الكامل غير المختزل وجزيء مقترن بشكل غير إسهامي ينقسم عند إخضاعه لظروف التحليل؛ إلى وحدتين متماثلتين يطلق عليهما وحدات نصفية. ومما يثير الانتباه أنه لم تلاحظ اختلافات كبيرة في جانبيات التحليل الحيوي لنوعي ‎mAbs‏ بواسطة 580؛ ‎«IEF‏ 505-0868 (مختزل) 5 ‎.ELISA‏ وتقل مقادير "الوحدة النصفية :021606" في 089:45 عن 7601 كما حدد بواسطة ‎RP-HPLC‏ أو ‎SDS-PAGE‏ (غير المختزل). ويبين الشكل ‎VA‏ ‎vo‏ تحليلاً بواسطة ‎SDS-PAGE‏ (غير مختزل) لمونمر و"وحدة نصفية" في محاليل 89478 و> Master Cell Bank (MCB) Two vials containing MTX PSS at 50 mM i Lill 5C1-5B9-50C1 were left to thaw and cells were seeded in a 100 mL rotating flask containing medium “CHO with 00 nanomolar of MTX and cultivation extended for six days (Jai) in increasingly larger 0-tower flasks until a volume of 0.581 mL was obtained; with a density of 119.5” and a viability of 706948. Cells were separated from the medium by centrifugation and resuspended at a density of TY XY, cells/mL in JRH Biosciences Fetal Bovine Serum in DMSO 96956. From Sigma by Hypermax 965. Samples of 10 ml of cell suspension were taken from the freezing medium and each placed in a small vial Av > designed as the main cell bank 4-8<-6422850. Vials were frozen at - L. After YE 1 hour Jas cell bank was stored in liquid nitrogen Example E Stability of CD4 mAbs The physical and chemical stability of solutions of CE9Y4PE and 089:42 were monitored over a period of ¥ 1 month at Mo 6 m; Diffuse Light by Electrophoresis on Polyacrylamide Gel with Sodium Dodecyl Sulfate (SDS-PAGE) (Reducing and Unreducing) Isoelectric Focusing (IEF) High Performance Liquid Chromatography (HPLC) Phase inverse; volume exclusion chromatography (©58); ads ELISAs Preliminary testing by RP-HPLC and non-reducing SDS-PAGE that 08942 consists of two main Te species namely; the non-reducing whole molecule and the non-reducing Te molecule non-covalently coupled that splits when subjected to analysis conditions; into two identical units called half units. Interestingly, no significant differences were observed in the bioanalytical profiles of the two mAbs by 580; “IEF 505-0868 (reduced) 5 ELISA and half-unit amounts: 021606 at 089:45 are less than 7601 as determined by RP-HPLC or SDS-PAGE (non-reduced). Figure VA vo shows an analysis by SDS-PAGE (non-reducing) of a monomer and a “semi-unit” in solutions of 89478 and

78. وبقى مقدار "الوحدة النتصفية" في 089745 ثابتا بالنسبة للاختبار الابتدائي خلال ثلاثة أشهر عند أي من ظروف الاختبار. وبقي محتوى "الوحدة النصفية” في 0189:4312 أقل من 7 عند الظروف المستخدمة في كافة أوقات الاختبار. ولم تلاحظ اختلافات كبيرة في الثبات بين 8947© 5 ‎CEOY4PE‏ .عند © م و١‏ ؛أم). وكان محلول 059:42 المخزن تحت الضوء المنتشر أقل ‎TLD‏ بدرجة طفيفة بالمقارنة مع 0297471. وتوحي البيانات أن "الوحدة النصفية" في 089748 ليس له تأثير ملحوظ على الثبات ‎Ja)‏ للجزيء الكلي. ولم تلاحظ اختلافات78. The amount of "elimination unit" in 089745 remained constant for the initial test over three months under any of the test conditions. The “half unit” content of 0189:4312 remained less than 7 at the conditions used at all times of the test. No significant differences in stability were observed between 8947© 5 CEOY4PE at ©m and 1um. The stored 059:42 solution was Under diffused light the TLD is slightly lower compared to 0297471. The data suggest that the 'half-unit' in 089748 has no appreciable effect on the stability (Ja) of the overall molecule. No differences were observed

كبيرة في الثبات الفيزيائي لمحاليل ‎CE9y4PE‏ و ‎.CE9y4E‏Great in physical stability of CE9y4PE and CE9y4E solutions

الألفة والكيمياء الرياضية ل ‎mAbs‏ ل 004 بواسطة رنين البلازمون السطحيAffinity and mathematical chemistry of L004 mAbs by surface plasmon resonance

يمكن تحديد الكيمياء الرياضية لارتباط 004 القابل للذوبان مع ‎mAbs‏ الثابتة بواسطة ‎ve‏ تجارب ‎bli)‏ إشباعي على ‎BlAcore‏ (من شركة فارماسيا ‎(Pharmacia‏ وتم تحليل البيانات المتعلقة بطوري الارتباط والتفكك لتقدم ‎SPR‏ (انظر الشكل ‎(V4‏ مباشسرة باستخدام الشكل المتكامل لمعادلات معدل السرعة كما وصف ‎Lad‏ جاء عن أوشانسي ومعاوتيه ‎«O’Shannessey et al,‏ في مجلة الكيمياء الحيوية التحليلية؛ مجلد ‎YY‏ ص ‎CETA=ETY‏ ‏7ام. ويقدم ملخص لبيانات الارتباط؛ ‎Tima‏ عنها بعدد مولات 004/مول من ههه في ‎ve‏ الجدول ‎WY‏ وما يمكن ملاحظته من هذه البيانات أنه في كل الحالات؛ تكون الكيمياء الرياضية للارتباط أكبر من 12),0 وبمعرفة أن ‎BlAcore‏ عبارة عن نظام تفاعل في الطور الصلب وأن بروتوكول التثبيت بروتوكولا ‎(Lil ple‏ توحي هذه النتائج بأن موقعي ارتباط المستضد لكل ‎mAb‏ يكونان مخصصين. وبالتالي؛ كانت الكيمياء الرياضية لارتباط 004 هي نفسها لكل ‎mAbs‏ وقريبة من القيمة التظرية التي تبلغ ‎LY,‏ وعلاوة على ذلك؛ أظهرت قياسات الألفة ألفةThe mathematical chemistry of the binding of soluble 004 to fixed mAbs was determined by bli saturation experiments on BlAcore (Pharmacia) and data on the binding and dissociation phases of the SPR progression were analyzed (see Fig. (V4) directly using the integral form of the rate-of-velocity equations as described by Lad. Reported by O'Shannessey et al, in the Journal of Analytical Biochemistry; vol. YY p. CETA=ETY 7m. A summary of the data is provided. Correlation; Tima about it with the number of moles 004/mol of HA in ve table WY and what can be seen from this data is that in all cases; the mathematical chemistry of the correlation is greater than 12),0 and knowing that BlAcore is a system Solid-phase reaction and fixation protocol (Lil ple) These results suggest that the two antigen-binding sites for each mAb are specific. Thus, the mathematical chemistry of binding to 004 was the same for all mAbs and close to an isotopic value of LY, Furthermore; affinity measurements showed affinity

‎٠‏ > متطابقة لجميع متراكبات ‎mAb‏ وتبلغ تقريباً ‎١‏ نانومولار.0 > identical for all mAb complexes and is approximately 1 nanomolar.

“> الجدول ‎٠7‏ ‏الكيمياء الرياضية والألفة للارتباط المقاسين بواسطة رنين البلازمون السطحي الجسم المضاد الكيمياء الرياضية ‎Gy‏ الألفة ‎BlAcore‏ (نانومولار عند 0 ‎(oY‏ ‎CE9.1‏ 5[ 44,- 164 ْ 1 ,6 4و9و0 ا 7 ج094 7 خا 01941 1,4 المثال ‎“١‏ ‏التقييم الحيوي في أنبوب الاختبار ل ‎CE9Y4PE‏ ‏الملخص ‏0 تمت مقارنة 089.1؛ ‎«CE94PE‏ ومشتقات جاما ؛ الأخرى من حيث الفعالية التي تستحثها منطقة ‎(MLR) Fab‏ وحقل ‎Fo‏ (الارتباط بمستقبلة ‎(CDC ¢ADCC Fe‏ ولم ‎«a tas‏ الفعالية التي تعتمد على ‎(MLR) Fab‏ بين ‎mAbs‏ ولكن اختلفت من حيث خواصها للارتباط بمستقبلة ‎Fo‏ وأظهرت مشتقة جاما ؛ غير المحورة بشكل مثير للدهشة ارتباطاً قويآ بمستقبلات ‎(Fe‏ ولكن الطفرة 18 في 08742 و ‎CE9Y4PE‏ ألغت هذا الارتباط بالإضافة إلى فعالية ‎.ADCC 0٠‏ تأثير ‎mAbs‏ على استجابات الخلايا اللمفية المخلطة ‎(MLR)‏ ‏أجريت معايرة لاستجابة الخلايا اللمفية ‎(MLR) dda taal‏ ثلاثية الاتجاه لتحديد تأثير الوحدات البنائية ل ‎mAb‏ على تكاثر خلايا ‎T‏ مستحثة بمستضد مغاير وإنتاج ‎EL-2‏ ‏وتعتمد ‎MLRs‏ على وجود خلايا 7 ل 0047 ؛ ويعتمد مقدار كبير من الاستجابة على مشاركة ‎Vo‏ مستقبلة 4 خلال تفاعلها مع جزيئات النوع 1 ل ‎MAC‏ على ‎WA‏ تمنح المستضد. وتمثل استجابة ال ‎MLR‏ العلاقة المتبادلة في أنبوب الاختبار لأوجه رفض المواد المزروعة فيMathematical Chemistry and Correlation Affinity Measured by Antibody Surface Plasmon Resonance Mathematical Chemistry Gy Affinity BlaAcore (nanmolar at 0 (oY CE9.1 5[ 44,- 164 1 ,6 4,9,0a 7c094 7 kha 01941 1,4 EXAMPLE “1 In-Tube BioEvaluation of CE9Y4PE Abstract 0 089.1 CE94PE and other gamma derivatives were compared in terms of activity induced by the MLR region ) Fab and the Fo field (binding to the (CDC ¢ADCC Fe) receptor. The (MLR) Fab-dependent activity was not “a tas” among mAbs, but differed in terms of its binding properties to the Fo receptor and showed a gamma derivative Surprisingly, unmodified binds strongly to the (Fe) receptor, but mutation 18 in 08742 and CE9Y4PE abrogates this binding in addition to the effectiveness of ADCC 00. Effect of mAbs on mixed lymphocyte responses (MLR) titrations were performed for a three-way dda taal lymphocyte response (MLR) to determine the effect of mAb residues on heterologous antigen-induced T cell proliferation and EL-2 production and MLRs depend on the presence of 7L0047 cells; a large amount depends of the response on the participation of the Vo receptor 4 through its interaction with MAC type 1 molecules on WA to confer antigen. The MLR response represents the test-tube correlation to rejections of cultured material

> الجسم الحي. واستنادا إلى العوامل العقاقيرية الأخرى؛ تثبط م1078 كذلك بواسطة كوابت مناعية مثل سبورين حلقي ‎A‏ ‏وكانت جميع الوحدات البنائية ل طه متكافئة من حيث قدرتها على تثبيط ‎(MLR‏ ‏حيث حددت في صورة استجابة تكاثر الخلايا 7 وإنتاج 1-2 (انظر الشكل ‎Yo‏ والجدول 4). وبالتالي؛ لم يؤثر تطعيم الحقول 37 ل 1 على بنيات 14 البشرية؛ والشكلين البديلين ‎SP"‏ ‏8 في منطقة الرزة ‎hinge‏ وحقول 2 على قدرة ‎mAbs‏ في تثبيط استجابات خلايا 7 التي تعتمد على 004 في أنبوب الاختبار. الجدول ؛ تأثير ‎mAbs‏ على 14018 الخلاصة الجسم المضاد التكاثر إنتاج ‎IL-2‏ ‎(IC50) ( 1C50)‏ ‎٠١ CE9.1‏ نانوجم/مل © نانوجم/مل ‎٠١ 084‏ نانوجم/مل © نانوجم/مل ‎٠ CE9y4E‏ نانوجم/مل ‎٠‏ نانوجم/مل “تدوع ‎7١‏ نانوجم/مل ‎٠‏ نانوجم/مل ‎٠ CE9Y4PE‏ نانوجم/مل غير محدد الاستنتاج ‎lal ١‏ كل الأجسام المضادة وحيدة النسيلة ‎mAbs‏ في قدرتها على تثبيط ‎MLR‏ ‏خواص الارتباط بمستقبلة ‎Fc‏ ل ‎mAbs‏ ‏التثبت من معايرة تحديد الارتباط بمستقبلة ‎Fe‏ ‏شكل 089401 بحيث يتفادى فعاليات الارتباط ب ‎FoR‏ ولقياس هذه ‎Aled‏ طورت معايرة تعتمد على ارتباط الخلايا المستحث ب 208 و 004 من خلال التجسير عبر ‎mAbs‏ ‏10 وتقيس هذه المعايرة وظائف ارتباط ‎mAbs‏ بكل من 004 و 788 في نفس الوقت؛ في صورة ا> vivo. and based on other pharmacological agents; M1078 is also inhibited by immunosuppressants such as cyclosporin A. All Taha residues were equivalent in their ability to inhibit MLR as they were identified as cell proliferation response 7 and production of 1-2 (see Figure Yo and Table 4). Thus, inoculation of fields 37 of 1 on human 14 constructs; and the two variants SP"8 in the hinge region and fields of 2 did not affect the ability of mAbs to inhibit 004-dependent 7 cell responses in the test tube. Table Effect of mAbs on 14018 Abstract Antibody Reproduction IL-2 Production (IC50) ( 1C50) 01 CE9.1 ng/mL © 01 084 ng/mL © ng/mL CE9y4E 0 ng/mL 0 ng/mL “Fluidity 71 ng/mL 0 ng/mL CE9Y4PE 0 ng/mL Unspecified Conclusion lal 1 All monoclonal antibodies mAbs in Its ability to inhibit MLR Fc receptor binding properties of mAbs Validation of a calibration to determine binding to the Fe receptor Figure 089401 so that it avoids binding activities with FoR To measure these Aled developed a calibrator based on induced cell binding b 208 and 004 by bridging via 10 mAbs This titration measures the binding functions of mAbs with both 004 and 788 simultaneously; in the image of a

ب علاقة متبادلة في أنبوب الاختبار لإفراغ خلايا 004 المستحث ب 708 وه في الجسم الحي. ويشير الشكل ‎7١‏ إلى أن 089.1 يسهل التصاق الخلايا وحيدة النواة التي تعبر عن ‎FeR‏ (خلايا 1117-1 المستحثة ب ‎(IFNy‏ مع الأرومات الليفية *004 (النسل الخلوي للأرومة م الليفية المعديّة تحويليا بواسطة 004) في معايرة التصاق. ويعتمد الارتباط على حقول ‎Fe‏ ‏للجسم المضاد وحيد النسيلة ل 089.1؛ ‎La‏ أن ‎F(ab)2‏ المبتور لم يتمكن من تسهيل الارتباط. ويتطلب الارتباط أيضاً وجود موقع تمييز المستضد ل 089.1 لأن إشغاله ب ‎sCD4‏ يثبط الارتباط الخلوي. تحديد فعاليات ‎mAbs‏ للارتباط بمستقبلة ‎Fe‏ ‎Ve‏ تم تقييم الأجسام المضادة وحيدة ‎ali wll‏ التالية؛ 089.1 ‎«(IgG4) CE9y4 «(1gG1)‏ 894 (الهجين ‎AK‏ ل ‎<IgG4) CE9y4AE «(IgG4‏ الطافرة ‎(IgG4) CE9APE (E‏ الطافرة ‎(PE‏ لتحديد قدرتها على الارتباط؛ء في نفس الوقت؛ مع 004 على سطح الخلية 5 ‎FoR‏ ‎LS‏ كان مرجوآء كان ل 089.1 فعالية ارتباط جيدة في هذه المعايرة. وبشكل مثير للدهشة؛ احتفظت الوحدات البنائية ل 1804؛ ‎CE974AK 5 CE9y4‏ بألفة كافية للارتباط ب ‎FcR‏ ‎No‏ بحيث تعذر تمييزها عن 089.1 في هذه المعايرة. وفقدت الفعالية في هذه المعايرة فقط عندما أدخل الشكل البديل "8" كما هو في 089:42 و 0859405 (انظر الشكل ‎(YY‏ ‏خواص ©0894 للارتباط ب و61 في أنبوب الاختبار يمتلك نظام المتممة؛ من بين مكوناته الوظيفية المختلفة؛ القدرة على التفاعل مع أنواع معينة من الأجسام المضادة بكيفية تؤدي إلى انحلال الخلايا وإتلافها. وعادة ما تمتلك الأجسام © - المضادة 1801 البشرية القدرة على الارتباط ب ‎Clg‏ وإفراغ الخلايا المستهدفة التي تحمل المستضدات السطحية التي تتخصص بها هذه الأجسام المضادة. وتظهر أنماط إسوية بشرية أخرى مثل 1504 قدرة منخفضة على الارتباط ب ‎Clq‏ وبالتالي تكون غير قادرة على إفراغ الخلايا المستهدفة. ويمكن أن تحقق هندسة 089408 في الوحدة البنائية ‎(Gla of Lala‏ هدف ‎ada‏ تثبيت المتممة والسماح للجسم المضاد بالارتباط مع الخلايا المستهدفة ‎CD4‏ مما يلغي ‎vo‏ التأثيرات الجانبية الإتلافية المحتملة. ‎Te‏b In test tube correlation of 004-cell vacuolization induced by AH-708 in vivo. Figure 71 indicates that 089.1 facilitates adhesion of FeR-expressing monocytes (IFNy-induced 1117-1 cells) with fibroblasts *004 (the cell progeny of M. fibroblasts transduced by 004) in an adhesion assay. Binding is dependent on the Fe fields of the monoclonal antibody to 089.1;La that the truncated F(ab)2 was unable to facilitate binding.Binding also requires the presence of the antigen-binding site of 089.1 because its occupancy by sCD4 inhibits binding. Determination of activity of mAbs for binding to the FeVe receptor The following ali wll monoclonal antibodies were evaluated; “(IgG4) mutant CE9APE (E) mutant (PE) to determine its ability to bind; at the same time; with 004 on the cell surface 5 FoR LS was hopeful. 089.1 had good binding activity in these Astonishingly, residues of 1804;CE974AK 5 CE9y4 retained enough affinity to bind to FcR No to be indistinguishable from 089.1 in this titration. Potency was lost in this titration only when the variant '8' was inserted as It is at 089:42 and 0859405 (see Fig. YY) properties of ©0894 to bind to B and 61 in the test tube possesses the complement system; Among its various functional components; The ability to interact with certain types of antibodies in a way that leads to cell lysis and damage. Human 1801©-antibodies usually have the ability to bind to Clg and secrete target cells bearing the surface antigens for which these antibodies are specific. Other human isotypes such as 1504 show a reduced ability to bind to Clq and are therefore unable to empty target cells. The geometry of 089408 in the Gla of Lala residue can achieve the goal of ada stabilizing the complement and allowing the antibody to bind to CD4 target cells, thus eliminating potential destructive side effects. Te

وأجريت مقارنة بين خواص 059405 5 ‎CE9.1‏ في استفعال ‎CDC‏ باستخدام الطريقة التقليدية لانحلال خلايا ‎Sup TI‏ ل “004 الموسومة بالكروم المستحث بالمتممة في وجود متممة مأخوذة من أرنب. وفي هذه الدراسات؛ استخدم اه« فأري لتثبيت المتممة موجه نحو 1:04 وهو ‎(1gG22)4D9‏ بصفته ضابط إيجابي. وكان كل من ‎CE9.1‏ و ‎CE9y4PE‏ غير 0 فعالين في تثبيت المتممة المأخوذة الأرتب (الشكل ‎(YY‏ ولقد لوحظ سابقاً أن ‎CE9.1‏ يرتبط مع ‎Clq‏ بشكل ضعيف وبالتالي يكون غير قادر على تثبيت المتممة البشرية. وتظهر هذه النتتائج أن كلا الوحدتين البنائيتين غير قادرزتين على حث الانحلال الخلوي من خلال آليات استفعال المتممة. خواص 0129:4717 في استفعال ‎ADCC‏ في أنبوب الاختبار ‎Ve‏ يمكن أن تستحث ‎LOA‏ لها قدرة على تسميم الخلايا يمكنها الارتباط مع ‎mAbs‏ عن طريق ‎FoR‏ التسمم الخلوي المستحث بالخلايا المعتمد على الجسم المضاد ‎(ADCC)‏ الموجه نحو الخلايا المستهدفة المغلفة بالجسم المضاد ‎٠‏ ويتم تمييز الخلايا المساعدة ‎T‏ البشرية التي تعبر عن جزيء 004 بواسطة الجسم المضاد أحادي النسيلة 089.1 الذي يحفز الهجوم الحال للخلايا لخلايا قاتلة تحمل ‎FoR‏ الكريات المحببة و/أو البلاعم. وكان الهدف من هندسة ‎١‏ - 089408 هو إلغاء قدرة ‎mAb‏ على الارتباط مع ‎FoRs‏ مما يلغي قدرة الخلايا الإضافية على أن تستحث إفراغ الخلايا المستهدفة 004؛ في حين لا تزال تسمح ل ‎mAb‏ في أن يبقى ‎BS‏ ‏للمناعة. ‏وأجريت مقارنة بين خواص ‎CE9Y4PE‏ و 089.1 على استفعال ‎ADCC‏ باستخدام الطريقة التقليدية لانحلال خلايا 11 ‎Sup‏ ل *004 الموسومة بالكروم المستحث بالخلايا. وتم ‎ye‏ اختيار الجسم المضاد وحيد النسيلة الفأاري ل ‎CD4‏ هو 409 ‎(K <IgG2a)‏ بصفته ضابط إيجابي. وكانت الخلايا المستفعلة عبارة عن كريات بيضاء من دم محيطي بشري حصل عليها من الطبقة الرقيقة من الكريات البيضاء التي تغطي الخلايا الحمراء المتراصة في الدم. ويبين الشكل ‎١١‏ قدرة حث ‎JS‏ من ‎mAbs 4D9‏ و 089.1 لانحلال معين لخلايا *004. وفي ظروف مماثلة؛ كان ل 089478 تأثير ضئيل ‎Jaa‏ ny ‏وتظهر هذه النتائج أن 089:42 لا يمكنه أن يستحث انحلال الخلايا من خلال آليات‎ ‏أو المتممة.‎ FcR ‏الارتباط ب‎ ١ ‏المثال‎ ‎CE9Y4PE ‏تحليل الحركيات الدوائية النسبية ل 09:42 و‎ ‏تم فحص الحركيات الدوائية النسبية لجسمين مضادين وحيدي النسيلة قياديين هما‎ ° ‏و 0859408 في ذكور جرذان من نوع سبراجيو-داولي. وأعطي 05948 و‎ 8 ‏مجم/كجم (أربعة حيوانات‎ ١ ‏في صورة جرعة على شكل جرعة في الوريد بلغت‎ 08 ‏و‎ CEOY4E ‏لكل فئة)؛ وأخذت عينات دم لمدة ؛ أسابيع بعد إعطاء الجرعة. وحددت تراكيز‎ ‏شطيرية لتحديد مضاد 186 بشري و004: أعدت ليس‎ ELISA ‏في البلازما باستخدام‎ 18The properties of 059405 5 CE9.1 in CDC reactivity were compared using the conventional method of complement-induced lysis of chromium-tagged SupTI L'004 cells in the presence of complement from rabbit. And in these studies; Use a rat's complement fixation directed at 1:04 (1gG22)4D9 as a positive control. Both CE9.1 and CE9y4PE were not 0 effective in stabilizing the coenzyme taken (Fig. These results show that both residues are unable to induce cytolysis through complement mechanisms.The properties of 0129:4717 in the activation of ADCC in vitro Ve can induce LOA It has cytotoxic ability It can bind with ‎ mAbs via FoR antibody-dependent induced cell cytotoxicity (ADCC) directed at antibody-coated target cells 0 and human T helper cells expressing the 004 molecule are marked by the monoclonal antibody 089.1 which Cytolytic attack of FoR-bearing killer cells stimulates granulocytes and/or macrophages.The aim of engineering 1 - 089408 was to abolish the mAb's ability to bind to FoRs thereby eliminating the ability of additional cells to induce exocytosis of target 004 cells. Comparison of the properties of CE9Y4PE and 089.1 on activating ADCC using the conventional method of chromium-tagged Sup11*004 induced cell lysis . A murine monoclonal antibody to CD4 ye 409 (K < IgG2a) was selected as a positive control. The effector cells were leukocytes from human peripheral blood obtained from the thin layer of leukocytes covering the red agglutinin cells in the blood. Figure 11 shows the ability of JS from mAbs 4D9 and 089.1 to induce specific lysis of *004 cells. in similar circumstances; 089478 had little effect Jaa ny These results show that 089:42 cannot induce cell lysis through mechanisms or complement. FcR binding to 1 Example CE9Y4PE Relative pharmacokinetic analysis of 09 :42f The relative pharmacokinetics of two leading monoclonal antibodies, ° and 0859408, were examined in male Spragio-Dawley rats. 05948 and 8 mg/kg (four animals 1 were given an intravenous dose of 08 and CEOY4E for each group); And blood samples were taken for a period of time; weeks after the dose is given. And sandwich concentrations were determined to determine the human antibody 186 and 004: ELISA prepared in plasma using 18

CD4 ‏الإثبات وجود 1.0 البشري الدائر في الدم فقط بل كذلك لإثبات قدرته على الارتباط ب‎ ٠ ‏القابل للذوبان البشري المأشوب.‎ ‏مجم/كجم؛‎ ١ ‏على شكل جرعة في الوريد بمقدار بلغ‎ CDA ‏ل‎ mAb ‏وبعد إعطاء‎ ‏انخفضت تراكيز 089:42 في البلازما بكيفية ثلاثية الطور؛ وانخفضت تراكيز 089478 في‎ ‏عدد‎ AS ‏البلازما بكيفية ثنائية الطور (انظر الشكل ؛ 7). ولأغراض المقارنة؛ وبسبب عدم‎ ‏لوصف الطور النهائي ل ج0894 بشكل ملائم؛ تم تحليل جميع جانبيات التركيز‎ Cl ‏تقاط‎ voTo prove not only the presence of human CD4 1.0 circulating in the blood, but also to demonstrate its ability to bind to recombinant human soluble 0.0 mg/kg;1 in an intravenous dose of CDA for mAb and after administration The concentrations of 42:089 in the plasma decreased in a three-phase fashion; The concentrations of 089478 in plasma AS decreased in a biphasic manner (see Figure 7). For comparison purposes; Because the final phase of C0894 has not been adequately described; All aspects of the Cl concentration captured by VO were analyzed

GLAS ‏تغير ضئيلة بين‎ ALE ‏البلدزمي-الزمن باستخدام نموذج ثنائي الطور. ولوحظت‎ ‏الاختبار. وبلغ عمر النصف للطور الثانوي السائد ,© حوالي ؛ أيام ل 089:48؛ و أيام ل‎ ‏من‎ confi A ‏و9697؛ على‎ YTV ‏وكان مسؤولاً عن تحقيق نسبة مئوية بلغت‎ «CE9Y4PE ‏المساحة الكلية تحت منحنى التركيز البلازمي-الزمن. وكانت التصفية البلازمية الظاهرية ل‎ ‏منخفضة (4, مل/ساعة/كجم)؛ وكانت مساوية تقريبآً لنصف التصفية المتحققة‎ 918 7 ‏مل/ساعة/كجم). وهكذاء كانت خصائص الحركيات الدوائية للطافرة‎ V, +) 08942 ‏بواسطة‎ ‏أخرى محولة إلى صورة بشرية في‎ 11 mAbs ‏مشابهة ل‎ «CE9Y4PE 74 mAb ‏ل‎ PE ‏جرذان.‎ ‎aly Lad ‏وأوحى عمر النصف الطويل لدوران 089482 السليم وظيفياً في دم الجرذ‎ ‏فترة زمنية ممتدة عند إعطائه إلى الإنسان.‎ (sda ‏على‎ Yad 0894715 ‏.من المحتمل أن يكون‎ YoGLAS insignificant change between plasma-time ALE using a biphasic model. The test was observed. The half-life of the dominant secondary phase, ©, was about; days for 89:48; and days for from confi A and 9697; on YTV and was responsible for achieving a percentage of “CE9Y4PE total area under the plasma concentration-time curve.” The apparent plasma clearance of L was low (0.4 ml/h/kg); It was almost equal to half of the achieved clearance (7 918 ml/h/kg). Thus, the pharmacokinetic characteristics of mutant (V, +) 08942 by another humanized mutant in 11 mAbs were similar to that of CE9Y4PE 74 mAb in PE rats. 089482 Functionally intact in rat blood for an extended period of time when administered to humans. (sda on Yad 0894715. Possibly Yo

TATA

‏أقل من تلك‎ PE ‏وأكدت هذه النتائج أن التصفية البلازمية ل 089:48 ذي الطافرة‎ ‏للطافرة 0897 في الجرذ بمقدار الضعفين وعمر النصف له أطول.‎ o ‏الجدول‎ ‏بعد إعطاء‎ CE9Y4PE ‏وسائط الحركيات الدوائية (المتوسط +الانحراف المعياري) ل 012597415 و‎ ‏مجم/كجم إلى جرذان من نوع سبراجيو-داولي‎ ٠١ ‏جرعة في الوريد بلغت‎Less than that of PE and these results confirmed that the plasma clearance of mutant 089:48 of mutant 0897 in the rat was twice as high and its half-life was longer. o Table after administration of CE9Y4PE pharmacokinetic media (mean + deviation standard) for 012597415 and mg/kg to spragio-dawley rats. 10 intravenous doses were

Vss % AUC, T,” ‏با‎ MRT 0 ‏بستكم‎ CL —ImAb ‏(مل/ساعة/كجم) . (ميكروجم#ساعة/مل) _--. (ساعة) (ساعة) (ساعة) (مل/كجم)‎ CD4 ٠+4 ١٠+ / ‏ره لخر الإلاخجطعفرة‎ ١+4 ١١٠ 177+ 4 06974 ‏اما‎ ٠١+07 7. ‏لطر متعم‎ ١مل‎ 5 ١٠١ ‏أ لالم‎ Ye, YY 0974 14 ‏بصلطااء. 8 اعرف 4 7774 دعص‎ CE9Y4PE ‏المساحة الكلية تحت منحنى التركيز البلازمي‎ =AUC ‏اختصارات وسائط الحركيات الدوائية: ,آ0©«التصفية الكلية من البلازما؛‎ ‏متوسط زمن المكوث؛ باح عمر النصف الظاهري في الطصور الابتدائي؛ با عمر النصفي‎ =MRT ‏مقاجل الزمن؛‎ ‏النسبة المئوية للمساحة تحت منحنى التركيز البلازمي مقابل الزمن خلال الطور‎ =%AUC, ‏الظاهري في الطور الثانوي؛‎ ‏الثانوي؛‎ ‏حجم التوزيع عند الحالة المستقرة.‎ =Vss ‏وبناء على هذه النتائج؛ ينبغي أن يكون 089,48 ملائماً للاستخدام العلاجي؛ مثلاء‎ ‏عن طريق إعطائه في الوريد. كذلك قد تكون طرق أخرى للإعطاء ملائمة.‎ ٠Vss % AUC, T,” MRT 0 bascum CL —ImAb (ml/h/kg). (µg#hr/mL) _--. (hour) (hour) (hour) (ml/kg) CD4 0+4 10+ / rh for the last ejaculation 1+4 110 177+ 4 06974 for 01+07 7. Opaque 1ml 5 101 A Lam Ye, YY 0974 14 in Salad. 8 Know 4 7774 CE9Y4PE Total Area Under the Plasma Concentration Curve = AUC Pharmacokinetic Media Abbreviations: A0©, “Total Clearance from Plasma; Mean Residence Time; apparent half-life in the primary stage; B = MRT half-life vs. time; percentage of area under the plasma concentration curve versus time during phase = %AUC, apparent in secondary phase; secondary; volume of distribution at steady state. = Vss Based on these results; 089.48 should be suitable for therapeutic use; For example, by giving it intravenously. Other methods of administration may also be appropriate.‎ 0

A ‏المثال‎ ‏وراثياً‎ Alona 11:04 ‏على فئران‎ ad) ‏دراسات عقاقيرية في الجسم‎ ‏وصف فئران 110004 معثّة وراثياً‎ ‏المقدمة‎ ‏من الصعب تقييم‎ CE9Y4PE 5 0891 ‏تجعل درجة التخصصية العالية للأنواع من قبل‎ Yo ‏الفعالية في الجسم الحي. وقد أمكن مراقبة الاستجابة العقاقيرية ل 089.1 بسهولة في قرد‎ ‏الشمبانزي؛ من خلال إفراغ خلايا *004 المعتمد على الجرعة. قد دفعنا الغياب المتوقع لهذه‎A Example Genetically Alona 11:04 on mice ad) Pharmacological studies in vivo Description of 110004 genetically modified mice Introduction It is difficult to evaluate CE9Y4PE 5 0891 The high degree of specialization of the species before Yo Effectiveness in vivo. The pharmacological response to 1.089 was easily monitored in chimpanzees; Through dose-dependent emptying of *004 cells. We have paid the expected absence of this

TetTet

الفعالية في 689/471 لاستخدام وسائل أخرى لتقييم الفعالية. وبصفة خاصة؛ تجبرى دراسة الفعالية في الفثران ‎Aaa‏ وراثياً 12:004. وتوصف الدراسات في هذا النظام أدناه. خصائص التعديل الوراثي ل *11:004 في ‎A 2d) HUCD4 J) J‏ وراثياً المطورة في جامعة كاليفورنيا في سان فرانسيسكو ° (انظر ما ‎ela‏ عن كيلين ومعاونيه ‎«Killeen et al,‏ في مجلة المنظمة الأوروبية لعلم الأحياء الجزيئية ‎(EMBO)‏ مجلد ‎(VY‏ ص 1907-1647 ‎¢(a) 44Y‏ تم تعطيل مورث ‎MuCD4‏ ‏داخلي المنشأ بواسطة تأشيب ‎Silas‏ وأدخل مورث معدل مصغر من 004 البشري خاضع لتتظيم حاث 200004. وفي هذه الفئران؛ التي أصبحت ‎Linge‏ بحيث تحوي تماثلا زيجوتيآء استعيض عن ‎MuCD4‏ ب 11:004. ويستعيد 11:004 ‎OY)‏ الانتقاء الإيجابي والسلبي في الغدة ‎٠‏ التموسية؛ مما يؤدي إلى إنتاج خلايا 7 ل *004 أو 0087 محيطية موجبة مفردة؛ بمستويات يمكن تقديرها بالمقارنة مع تلك الموجودة في الفئران السليمة. وعلاوة على ذلك؛ بالمقارنة مع ‎MCD;‏ الأصلي المبطل؛ء تظهر خلايا 7 ل ‎HuCD4‏ الناضجة خصائص ممائلة لنظائرهما المقابلة في الفئران السليمة: ‎)١(‏ في الجسم الحي؛ تستعاد مستويات 186 في المصسل إلى المستويات الطبيعية 5 )1( تظهر هذه الحيوانات الاستجابات المناسبة التي تعتمد على ‎MHC‏ ‎ve‏ كما أظهرها ‎ANMR‏ أنبوب الاختبار. وكانت خلفية مورثات هذه الفثران معقدة إلى حد ما بسبب الحاجة إلى استخدام سلالات مختلفة من خلايا جذعية جنينية ‎of iy‏ وفي التجارب التي تجرى على الفأر الأصلي المبطل والمعدٌل وراثياً. ونسلت الفئران الأصلية المبطلة/المعدلة وراثياً ‎Gay‏ إلى زيجوتية متماثلة في الموضع ‎(MHC‏ وكانت ‎of Jil)‏ المستخدمة حالياً عند ‎SB‏ عبارة عن نمط فرداني ‎vy.‏ 1-29 وأظهرت النتائج أنه حصل على استجابة جيدة لمستضد غريب. هو ألبومين ‎Aad‏ ‏في فثران ‎HUCD4‏ هذه؛ وأظهرت الدراسات الابتدائية فعالية في الجسم الحي ل 089:4<8. تقييم ابتدائي ل 0089:4718 في فئران ‎asad) HuCD4‏ وراثياً تم استلام ‎HUCD4 1,0 ١١‏ معدلا وراثياً (“112)؛ واستخدموا لمقارنة ‎CE9Y4PE‏ مع ‎TF3 Yo‏ (مضاد 004 بشري فأري) و61.5. وأعطيت ‎of ill‏ جرعة عند اليوم ‎Y= Yo‏ واليومEffectiveness in 689/471 to use other means of efficacy assessment. In particular; An efficacy study in Aaa genotyped hepatitis A 12:004. Studies in this system are described below. Genetically modifying properties of *11:004 in J (HUCD4 J) (2d) genetically modified UCSF° (see ela on Killeen et al., in the Journal of the European Organization for Molecular Biology). (EMBO) vol. (VY p. 1907-1647 ¢(a) 44Y) the endogenous MuCD4 gene was inactivated by Silas recombination and a modified human mini-004 gene downregulated induction 200004 was inserted. replace MuCD4 with 11:004 ; which become Linge homozygous; replace MuCD4 with 11:004. 11:004 (OY) restores positive and negative selection in the parathymic gland 0, resulting in production of 7L*004 or 0087 peripheral cells Furthermore, compared to the original MCD-nulled MCD4-7 cells, mature HuCD4-7 cells show similar characteristics to their corresponding counterparts in healthy mice: (1) in In vivo serum 186 levels are restored to normal levels 5 (1) These animals show appropriate MHC-dependent responses ve as demonstrated by test tube ANMR. Different strains of embryonic stem cells of iy and in experiments conducted on the original invalidated and genetically modified mouse. The original knockout/transgenic Gay mice were offspring homozygous for the locus (MHC) and the currently used Jil of Jil at SB was a haplotype vy.1-29 and the results showed that it had a good antigen response strange. It's two Aad albums in these HUCD4 layers; Trial studies showed in vivo efficacy for 089:4<8. A preliminary evaluation of 4718:0089 in transgenic HuCD4 asad mice received 11 transgenic HUCD4 1.0 (112); They used to compare CE9Y4PE with TF3 Yo (human-mouse anti-004) and 61.5. I gave of ill a dose at day Y = Yo and day

صفر بلغت ‎١‏ مجم من الجسم المضاد داخل الصفاق ومنعت باستخدام ‎OVA‏ لمدة ¥ ساعات بعد إعطاء الجرعة الأخيرة. وذبحت الفئران بعد أسبوعين وتم تقييم المصل والخلايا من ناحية الفعالية الوظيفية. وتبين استجابة الجسم المضاد المتخصص ب ‎OVA‏ في الشكل ‎Yo‏ وكما كان ‎Lad sie‏ لم يكن ل ده الموجه نحو 604 الفأري (1.5 ‎(GK‏ تأثير على الاستجابة ‎٠‏ الخلطية؛ في حين أن كل من الجسمين المضادين وحيدي النسيلة الموجهين نحو 11:04 منعا هذه الاستجابة. كان 089401 الأكثر إثارة بالنسبة للجسمين المضادين وحيدي النسيلة الآخرين. ْZero amounted to 1 mg of intraperitoneal antibody and inhibited with OVA for ¥ hours after the last dose was given. Mice were slaughtered after two weeks, and the serum and cells were evaluated in terms of functional activity. The response of the OVA-specific antibody is shown in Figure Yo and as was Lad sie. This antibody directed at mouse 604 (1,5 (GK) had no effect on the humoral response; whereas both antibodies were monomeric). The two clones directed at 11:04 prevented this response.089401 was the most excitable of the two other monoclonal antibodies.

واستجابت كل فئات الفثران ل ‎ConA‏ و15؛ غير أنه؛ كان هناك بعض الاختلاف في الاستجابة لألبومين البيضة وفي ‎MLR‏ وقد يكون هذا نتيجة لحقيقة أن هذه الدفعة منAll phthran classes responded to ConA, 15; is that; There was some difference in response to albumin and in MLR and this may be due to the fact that this batch of

‎ys‏ الحيوانات تضمنت ‎JS‏ من الفئران الذكرية والأنثوية وكانت بأعمار مختلفة. وتمت معالجة ‎MuCD4-/- J J‏ (مبطلة ‎(CD4‏ و+/+ 11:004 (فئران ‎Ane‏ وراثيا) باستخدام 089.1؛ ‎CE9Y4PE‏ أو محلول ملحي. وأجريت الدراسة على مدى فترة بلغت ‎YA‏ ‎Lay‏ حيث أخذت العينات في الأيام ١ء‏ 9 لاء ‎YAS VE‏ واستخدم تحليل تعداد الخلايا التدفقي باستخدام ثلاثة ألوان لخلايا الطحال من هذه الفئران ‎ail‏ مصير خلايا 7ل ‎CD4"‏ و0087. ‎١‏ ولفحص مستويات ‎FT WA‏ استخدمت الأجسام المضادة التالية: ‎(OKT4-FITC «CD3-PE‏ ‎.CDS-TC‏ ولتتبع مصير الخلايا 7 و 5 في هذه الفثران استخدمت الأجسام المضادة التالية: ‎«CD2-FITC «CD3-PE‏ ©0045-1. ولتتبع مصير الخلايا المطلية ب 089.1 أو 48و08ys The animals included JS male and female mice and they were of different ages. MuCD4-/- J (inactivated CD4 and +/+ 11:004 (Ane transgenic mice) were treated with 089.1; CE9Y4PE or saline. The study was conducted over a period of 1 ya Where samples were taken on days 1-9 for YAS VE and flow cell count analysis was used using three colors of spleen cells from these mice ail 7 for CD4" and 0087 cells. The following antibodies: OKT4-FITC “CD3-PE” CDS-TC. To track the fate of cells 7 and 5 in these batches, the following antibodies were used: “CD2-FITC” CD3-PE ©0045-1. To track the fate of Cells coated with 089.1 or 48, 08

‏استخدمت المجموعة التالية من ‎.CD3-TC «Leu3a-FITC «OKT4-PE mAb‏ وأظهرت البيانات أنه في كل الفئران ‎Lal yy Ah wall‏ المعالجة ب 089.1 5 ‎CE9Y4PE‏ ‎((HUCD4 +/+( -‏ طليت كل خلايا “004 بجسم مضاد في اليوم الأول. واستمر الطلاء لبضعة أيام ولم يعد من الممكن الكشف عنه بحلول اليوم ‎YA‏ وانخفض العدد الكلي لخلايا *004 المعالجة في الفثران المعالجة ب 089.1 بشكل ملحوظ؛ حتى في اليوم ‎Jeg YA‏ النقيض من ذلك؛ لم تظهر الفئران المعالجة ب 089475 أي انخفاضات في عدد خلايا *004 الكلي. وأظهر كلا الجسمين المضادين ‎SU‏ على تعديل مستقبلة ‎(CDA‏ وبالرغم من وجود زيادة ‎Yo‏ متداولة في النسبة المثوية لعدد خلايا “608 في الفئران المعالجة ب 089.1؛ لم يوجد دليلThe following set of CD3-TC “Leu3a-FITC” OKT4-PE mAb was used and the data showed that in all Lal yy Ah wall mice treated with 089.1 5 CE9Y4PE ((HUCD4 +/+) - plated All “004” cells were treated with an antibody on day 1. Plating continued for a few days and was no longer detectable by YA day and the total number of treated *004 cells in the 089.1-treated rats decreased significantly; even on the contrast Jeg YA day Mice treated with 089475 showed no decreases in the total number of *004 cells. Both SU antibodies showed CDA receptor modulation although there was a circulating Yo increase in the homologous percentage of the number of '608' cells in mice treated with 089.1. There is no evidence

‎TeTe

الا ٍ على أن هذه الأعداد المطلقة قد تأثرت بشكل ملحوظ بالمعالجة. وكانت أعداد الخلايا ‎CDs"‏ ‏غير متأثرة أيضاً في الفثران المعالجة ب ‎(CE9Y4PE‏ وفي جميع التجارب؛ عند استخدام أي من الجسمين المضادين» بقي عدد الخلايا 3 ‎JG‏ ‏دراسات في الجسم ‎Al‏ على قرود الشمبانتزي ° فحص ‎١‏ قرود شمبانزي لتحديد إفراغ خلايا 7 ل ‎CD‏ و/أو تعديل مستقبلة ‎CD4‏ من سطح الخلية بعد تسريب جرعات متزايدة من الجسم المضاد ‎«CEWPE‏ وصل مقدارها إلى حد ‎٠‏ مجم/كجم. وأخذت عينات من الدم المحيطي لقرود الشمبانزي قبل ثلاثة أسابيع وقبل أسبوعين من بدء الدراسة لتثبيت مستويات خط الأساس لخلايا 7 ل *004. وبالإضافة إلى خلايا *004؛ تم كذلك قياس مستويات خلايا “003 و0087 بواسطة تعداد الخلايا التدفقي. ‎٠‏ واستخدم الجسم المضاد وحيد النسيلة 01674؛ الذي يرتبط مع جزء مختلف من الجزيء 004 ولا يتنافس على الارتباط مع 089:40 بصفته ضابط وبطرح تعدادات خلايا ‎CDE"‏ من تعدادات خلايا *003 الكلية أمكن حساب قيمة نظرية لعدد خلايا 7 ل *004. وبمقارنة هذه القيمة مع أعداد خلايا *004 المقاسة باستخدام 01074؛ ‎(Sal‏ تمييز تعديل مستقبلة ‎CD4‏ عن إفراغ خلايا *004. ‎Vo‏ وعند بدء الدراسة؛ تلقى كل قرد شمبانزي جرعة من محلول ملحي تم تسريبه في الوريد. وأخذت عينات الدم مباشرة بعد التسريب ‎YT da‏ أيام و4١ ‎leg‏ وتم تريب ‎٠,٠06‏ ‏مجم/كجم من 089488 إلى كل قرد شمبانزي وأخذت عينات الدم بعد “ أيام ‎VE‏ يوماً. وتمت مراقبة أعداد خلايا “004 فإذا كانت ضمن المدى ‎(salad)‏ أعطي مستوى الجرعة التالي من ‎.CE9Y4PE‏ وفي كل الحالات؛ تلقى كل قرد شمبانزي الجرعات التالية ‎Gay‏ للبروتوكول ‎vo‏ التالي: محلول ملحي؛ 0,06 مجم/كجم من ‎(CE9YAPE‏ 1,0 مجم/كجم من ‎(CCE9Y4PE‏ محلول ‎V0 ¢ als‏ مجم/كجم من ‎.CE9Y4PE‏ ‏ولم تُلحظ تأثيرات على مستويات 004 بعد عمليات تسريب المحلول الملحي أو 18 عند تركيز بلغ 8606 مجم/كجم. وعند تركيز بلغ 1,0 مجم/كجم؛ لوحظت طلية من خلايا ‎CDA”‏ وشوهد تعديل جزئي وعابر لمستقبلات 004 من سطح الخلية؛ بالرغم من عدم ‎vo‏ حدوث إفراغ لخلايا “004. وعند تركيز بلغ ‎V0‏ مجم/مل من ‎(CEIYPE‏ لم يلاحظ حدوثHowever, these absolute numbers were significantly affected by the treatment. The numbers of CDs cells were also unaffected in the rats treated with (CE9Y4PE) and in all experiments; when using either of the two antibodies, the number of cells remained 3 JG. Studies in the Al body on chimpanzees ° Examination 1 chimpanzees to determine the secretion of CD7 cells and/or modification of the CD4 receptor from the cell surface after infusion of increasing doses of CEWPE antibody up to 0 mg/kg. Peripheral blood samples were taken chimpanzees three weeks before and two weeks before the start of the study to stabilize baseline levels of 7L*004 cells.In addition to *004 cells, levels of 003 and 0087 cells were also measured by flow cell count.0 and the monoclonal antibody 01674 was used. It binds to a different part of molecule 004 and does not compete for binding with 089:40 as a control. Subtracting the "CDE" cell counts from the total *003 cell counts, a theoretical value of 7 cells was calculated for *004. By comparing this value with the measured *004 cell counts Using 01074(Sal) to distinguish CD4 receptor modulation from secretion of *004.Vo cells. At the start of the study, each chimpanzee received a dose of saline as an intravenous infusion. Blood samples were taken immediately after infusion YT da 41 days and 0.006 mg/kg of 089488 were infused into each chimpanzee and blood samples were taken after VE days. The numbers of “004” cells were monitored and if they were within the (salad) range, the next dose level of CE9Y4PE was given. In all cases; Each chimpanzee received the following doses Gay for the following vo protocol: saline; 0.06 mg/kg of CE9YAPE 1.0 mg/kg of CCE9Y4PE V0 ¢ als solution mg/kg of CE9Y4PE. No effects were seen on 004 levels after saline infusions or 18 At a concentration of 8606 mg/kg.At a concentration of 1.0 mg/kg, an coating of “CDA” cells was observed and partial and transient modulation of 004 receptors from the cell surface was seen, although no vo exocytosis occurred from “004” cells. V0 mg/mL of CEIYPE was not observed

إفراغ لخلايا “004 في أي من الحيوانات؛ بالرغم من مشاهدة تعديل ملحوظ في جميع الحيوانات. وكان تأثير التعديل عابرآً واستعيد إلى خط الأساس في فترة تراوحت من 4١-1؟‏ يومآً. ولم تشاهد تأثيرات معاكسة في أي حيوان. وأمكن الكشف عن 089:48 على سطح الخلية بعد يومين على الأكثر من إعطاء الجرعة وفي المصل.excretion of “004” cells in any of the animals; Although a noticeable modification was seen in all animals. The effect of the modification was transient and was restored to baseline in a period ranging from 1-41 days. No adverse effects were seen in any animal. It was possible to detect 089:48 on the cell surface after two days at most of dose administration and in the serum.

0 ولقد تم تصميم 089408 ليكون عبارة عن جسم مضاد لاإفراغي ولم يلاحظ حدوث أي إفراغ في أي حيوان؛ حتى عند الجرعة العالية نسبياً البالغة 10 مجم/كجم. وكان 8 ثابتاً في أمصال قرود الشمبانزي وبقي في الدورة الدموية لمدة وصلت إلى ‎Lag 7١‏ الاستخدام ‎Ve‏ يمكن تنقية الأجسام المضادة الناتجة بالكيفية الموصوفة أعلاه؛ أو بواسطة تقنيات0 089408 was designed to be a non-excretion antibody and no excretion was observed in any animal; Even at the relatively high dose of 10 mg/kg. 8 was stable in chimpanzee sera and remained in the circulation for up to Lag 71 Usage Ve The resulting antibodies can be purified in the manner described above; or by technology

‏مماثلة؛ باستخدام توليفة من تقنية الاستشراب الألفي والاستشراب بالاستبعاد الحجمي لتمييزهاsimilar Using a combination of millennial chromatography and volume exclusion chromatography to distinguish them

‏في المعايرات الحيوية الوظيفية. وتشمل هذه المعايرات تحديد التخصصية وألفة الارتباطin functional bioassays. These calibrations include determining specificity and correlation affinity

‏بالإضافة إلى وظيفة المستفعلة المقترنة بالنمط الإسوي المعبر عنه؛ ‎ADCC Sia‏ ؛ أو تثبيتIn addition to the effector function associated with the expressed isotype; ADCC Sia; or install

‏المتممة. وقد تستخدم أجسام مضادة من هذا القبيل في صورة عوامل علاجية فعالة أو غيرThe complement. Such antibodies may be used as active or passive therapeutic agents

‎١‏ فعالة تجاه عدد من الأمراض البشرية التي تشمل التعبير عن 004 وخلايا ‎Lay oT‏ في ذلك1 is effective against a number of human diseases involving the expression of 004 and Lay oT cells in that

‏الورم اللمفي ذلك الذي يتميز بتحويل الخلايا اللمفية 5 فيه؛ أمراض معدية تتضمن الإيدزlymphoma that is characterized by transformed lymphocytes 5 in it; Infectious diseases, including AIDS

‏(متلازمة فقد المناعة المكتسبة)؛ أمراض ذاتية المناعة وأمراض التهابية؛ وزراعة الأعضاء.(acquired immunodeficiency syndrome); autoimmune and inflammatory diseases; and transplantation.

‏ويمكن استخدام الأجسام المضادة إما في صورتها الأصلية؛ أو كجزء من متراكب جسمAntibodies can be used either in their original form; or as part of an overlay body

‏مضاد/خلابة؛ جسم مضاد/عقار أو جسم مضاد/ذيفان. وبالإضافة إلى ذلك يمكن استخدامantagonistic Antibody/drug or antibody/toxin. In addition can be used

‎٠‏ > أجسام مضادة كاملة أو أجزاء من أجسام مضادة ‎(FabyFabFv)‏ في صورة مواد مفاعلة0 > Whole antibodies or antibody parts (FabyFabFv) as reactants

‏للتصوير أو في صورة لقاحات أو مستمنعات ممكنة في المعالجة بالتمتيع الفعال لتوليد استجابات مضادة للأنماط الذاتية.For imaging or as possible vaccines or immunogens in active immunotherapy to generate anti-autotype responses.

‏ويمكن تحديد مقدار الجسم المضاد المفيد في إحداث تأثير علاجي بواسطة تقنياتThe amount of antibody useful in producing a therapeutic effect can be determined by techniques

‏قياسية معروفة ‎fun‏ لأولئك الملمين في التقنية. وتزود الأجسام المضادة ‎sale‏ بواسطة طرقA well-known record of fun for those tech-savvy. Sale antibodies are provided by means of

‎Yo‏ قياسية ضمن محلول منظم لدرجة الحموضة مقبول صيدلياً؛ وقد تعطى بواسطة أي طريقةYo is standardized in a pharmaceutically acceptable pH buffer solution; It may be given by any method

‎1.7 vy ‏مرغوبة. وبسبب فعالية الأجسام المضادة المطالب بحمايتها حالياً والقدرة على تحملها من قبل‎ ‏البشرء يكون من الممكن إعطاء هذه الأجسام المضادة بشكل متكرر لمقاومة أمراض مختلفة أو‎ ‏حالات مرضية مختلفة في إنسان.‎ ‏وتكون الأجسام المضادة المأشوبة ل 004 (أو أجزاء منها) وفقآً لهذا الاختراع مفيدة‎ ‏حث كبت الجهاز المناعي في الإنسان أو الحيوان. ولذلك‎ Ole ‏كذلك لحث التعديل المناعي؛‎ ٠ ‏أو علاجياً في إنسان أو حيوان آخر‎ Wildy ‏يتعلق هذا الاختراع بطريقة لحث التعديل المناعي‎ ‏بحاجة له بإعطاء مقدار فعال غير سام من جسم مضاد من هذا القبيل وفقآ لهذا الاختراع إلى‎ ‏هذا الإنسان أو الحيوان الآخر.‎ ‏ويمكن إظهار قدرة مركبات هذا الاختراع على حث التعديل المناعي بواسطة‎ ‏لمفية مخلطة‎ WIA ‏اختبارات قياسية مستخدمة لهذا الغرض؛ على سبيل المثال؛ اختبار تفاعل‎ > ٠ ‏أو اختبار لقياس تثبيط تكاثر خلايا 7 الذي يحدد بواسطة امتصاص الثيميدين.‎ ‏لهذا الاختراع لها فائدة في حث التعديل‎ Gy ‏وتعني حقيقة أن الأجسام المضادة‎ ‏المناعي أنها مفيدة في معالجة أو الوقاية من مقاومة أو رفض الأعضاء أو الأنسجة المزروعة‎ ‏(مثلاً الكلية؛ القلب؛ الرثة؛ نخاع العظم؛ الجلد؛ القرنية؛ ..إلخ)؛ معالجة أو الوقاية من‎ ‏الأمراض ذاتية المناعة؛ الالتهابية؛ التكاثرية وفرط التكاثرية؛ والمظاهر الجلدية لأمراض‎ ve ‏التهاب المفاصل شبه الروماتزميء الذثبة الاحمرارية؛ الذئبة‎ Sie) ‏تتوسطها المناعة‎ ‏الاحمرارية الجهازية؛ التهاب الدرقية لهاشيموتو؛ التصلب المتعدد؛ الوهن العضلي الوخيم؛‎ cnephrotic syndrome ‏الداء السكري من النوع ١ء التهاب عنبة العين؛ متلازمة أمراض الكلى‎ contact ‏التهاب الجلد بالملامسة‎ catopical dermatitis ‏الصدفية؛ الالتهاب الجلدي التحساسي‎ ‏الالتهاب الجلدي الدهني‎ sal eczematous dermatitides ‏عناتنمسعل؛ والتهابات جلدية أكزيمية‎ ٠ ‏الفقاع الفقاعي‎ cpemplugus ‏الفقاعي‎ cLichen planus ‏الجزاز المتبسط‎ cseborrheic dermatitis ‏الأوديما‎ curticaria ‏الشرى‎ <epidermolysis bullosa ‏انحلال البشرة الفقاعي‎ cbullous pemphicjus ‏كثرة الحمضيات‎ erythema ‏الحمامي‎ cvasculitides ‏الالتهاب الوعائي‎ cangioedemas ‏الوعائية‎ ‏إلخ)؛ معالجة مرض انسداد‎ ..calopecia areata ‏الحاصة البقعية‎ (cutaneous eosinophilias ‏الجلدية‎ ‏الالتهابات والتحساسات‎ creversible obstructive airways disease ‏المسالك الهوائية الساد العكوس‎ Yo1.7 vy is desirable. Because of the effectiveness of the antibodies currently claimed and their ability to be tolerated by humans, it is possible to administer these antibodies repeatedly to combat different diseases or different disease conditions in a human being. Recombinant antibodies to 004 (or parts thereof) are according to This invention is useful for inducing suppression of the immune system in humans or animals. Therefore Ole further to induce immune modulation;0 or therapeutically in a human or other animal Wildy This invention relates to a method of inducing immune modulation in need of administering a non-toxic effective amount of such antibody according to this invention to This human or other animal. The ability of the compounds of this invention to induce immune modulation can be demonstrated by mixed lymphocytes (WIA) standard tests used for this purpose; For example; A reaction test > 0 or an assay to measure the inhibition of 7-cell proliferation determined by thymidine uptake. The present invention has utility in inducing Gy modification. The fact that immunogenic antibodies mean that they are useful in the treatment or prevention of organ resistance or rejection or transplanted tissues (for example, the kidney, the heart, the heirs, the bone marrow, the skin, the cornea, etc.); treat or prevent autoimmune diseases; inflammatory; reproductive and hyperproliferative; and the cutaneous manifestations of diseases such as rheumatoid arthritis, erythema erythema; lupus Sie) immune-mediated systemic erythema; Hashimoto's thyroiditis; Multiple Sclerosis; myasthenia gravis; cnephrotic syndrome; type 1 diabetes mellitus; uveitis; contact nephrotic syndrome; catopical dermatitis; psoriasis; allergic dermatitis seborrheic dermatitis sal eczematous dermatitides and eczematous dermatitis 0 Pemphigus bullous cpemplugus bullous cLichen planus simplified necrosis cseborrheic dermatitis edema curticaria urticaria epidermolysis bullosa cbullous pemphicjus eosinophilia erythema erythema cvasculitides vasculitis vascular cangioedemas etc.); Treatment of obstructive disease calopecia areata cutaneous eosinophilias cutaneous infections and allergies creversible obstructive airways disease airways reversible cataract Yo

TTTT

ViVi

المعوية ‎intestinal inflammations and allergies‏ (مثلاء اعتلال الجوف ‎«coeliac disease‏ التهاب الشرج 005 الالتهاب المعدي المعوي الناتج عن كثرة الحمضيات ‎eosinophilia‏ ‎«gastroenteritis‏ الشرى الاصطباغي 0286070519 مرض كرون ‎crohn's disease‏ والتهاب القولون التقرحي ‎ulcerative colitis‏ والأمراض التحساسية المتعلقة بالأغنية ‎food-related‏ ‎allergies | ٠‏ (مثل الشقيقة ‎cmigraine‏ التهاب الأنف ‎rhinitis‏ والأكزيما ‎(eczema‏ وكذلك» يكون للأجسام المضادة موضوع الاختراع فائدة ممكنة في معالجة حالات غير الحالات ذاتية المتاعة ‎Cua‏ يكون التعديل المناعي ‎De (bse jo‏ مرض الطعم مقابل المعيل (رد ‎Jad‏ العائل للطعم ‎«((GvHD)‏ رفض المواد المزروعة ‎transplant rejection‏ الربو ‎casthma‏ الإصابة ب ‎HIV‏intestinal inflammations and allergies (eg coeliac disease 005 gastroenteritis eosinophilia pigmentary urticaria 0286070519 crohn's disease and ulcerative colitis and diseases Allergies related to food-related allergies | 0 (such as migraine, cmigraine, rhinitis, rhinitis, and eczema) as well as “the antibodies subject of the invention have a possible benefit in treating conditions other than autoimmune cases [Cua]. The modification is Immunotherapy De (bse jo) Graft versus breadwinner disease Jad host response to the graft (GvHD) Transplant rejection Asthma casthma HIV infection

اللوكيمياء الورم اللمفي ‎clymphoma‏ من بين أمراض أخرى.lymphoma, among other diseases.

‎٠١‏ ويكون متمرس في التقنية قادر بواسطة إجراء تجارب روتينية؛ على تحديد المقدار الفعال غير السام من الجسم المضاد لغرض حث الكبت المناعي. غير أنه؛ وبوجه عام؛ تكون الجرعة الفعالة في المدى من حوالي 0.06 إلى ‎٠٠١‏ مليجرام لكل كيلوجرام من وزن الجسم لكل يوم.01 and shall be skilled in the technique capable by performing routine experiments; Determination of an effective, non-toxic amount of antibody for the purpose of inducing immunosuppression. is that; and in general; The effective dose is in the range of about 0.06 to 100 milligrams per kilogram of body weight per day.

‏وينبغي أن تكون الأجسام المضادة (أو أجزاؤها) ‎Gy‏ لهذا الاختراع مفيدة أيضاً فيThe Gy antibodies (or parts thereof) of this invention should also be useful in

‏0 معالجة الأورام في حيوان ثديي. وبعبارة أدق؛ ينبغي أن تكون هذه الأجسام المضادة مفيدة في تقليل حجم الورم؛ تثبيط نمو الورم و/أو إطالة زمن البقاء للحيوانات التي تحمل الورم. وهكذاء يتعلق هذا الاختراع ‎Lad‏ بطريقة لمعالجة الأورام عند إنسان أو حيوان آخر بإعطاء هذا الإنسان أو الحيوان مقداراً فعالاً غير سام من جسم مضاد. وسيكون متمرس في التقنية قادرآء بواسطة إجراء تجارب روتينية؛ على تحديد المقدار الفعال غير السام من الجسم المضاد0 Treatment of tumors in a mammal. More precisely; These antibodies should be helpful in reducing the size of the tumor. Inhibiting tumor growth and/or prolonging the survival time of tumor-bearing animals. Thus this invention Lad relates to a method for treating tumors in a human or other animal by administering to that human or animal an effective non-toxic amount of an antibody. A person skilled in the technique will be able by performing routine experiments; to determine the effective non-toxic amount of antibody

‏© ا لغرض معالجة الأورام المكونة للسرطان. غير أنه؛ بوجه عام؛ يتوقع أن يكون مقدار الجرعة الفعالة في المدى من حوالي 05 إلى ‎٠٠١‏ مليجرام لكل كيلوجرام من وزن الجسم لكل يوم.© A for the purpose of treating cancer-forming tumors. is that; generally; The effective dose is expected to be in the range of about 50 to 100 milligrams per kilogram of body weight per day.

‏ويمكن إعطاء الأجسام المضادة ‎Gay‏ للاختراع إلى إنسان أو حيوان آخر ‎Gy‏ لطرق المعالجة المذكورة ‎a‏ بمقدار كاف لإحداث تأثير من هذا القبيل بدرجة علاجية أو وقائية. ويمكن إعطاء أجسام مضادة من هذا ‎Gag Jal)‏ للاختراع إلى إنسان أو حيوان آخر من هذاThe Gay antibodies of the invention may be administered to a human or other animal Gy of the aforementioned treatment methods a in an amount sufficient to produce such an effect of a therapeutic or prophylactic degree. Antibodies from this (Gag Jal) of the invention may be administered to a human or other animal from this

‎ve‏ القبيل في شكل جرعة تقليدي محضّر بمزج الجسم المضاد وفقآ للاختراع مع مادة حاملةve in a conventional dosage form prepared by mixing the antibody according to the invention with a carrier

‎TeTe

Yo ‏لتقنيات معروفة. وسيدرك من قبل متمرس في التقنية أن‎ Gy ‏أو مخففة مقبولة صيدلياً تقليدية‎ ‏شكل وصفات المادة الحاملة أو المخففة المقبولة صيدلياً يحدد بواسطة مقدار المقوم الفعال‎ ‏المراد مزجه؛ طرق الإعطاء ومتغيرات أخرى معروفة جيداً.‎ ‏للاختراع عن طريق الفم؛‎ Gy ‏وقد تكون طريقة إعطاء الجسم المضاد (أو جزئه)‎ ‏م بطريقة غير معوية؛ بالاستتشاق أو موضعياً. ويشمل المصطلح إعطاء بطريقة غير معوية كما‎ ‏عن‎ cad ‏استخدام في هذا البيان الإعطاء في الوريد؛ في العضل؛ تحت الجلد؛ عن طريق‎ ‏طريق المهبل أو داخل الصفاق. ويفضل بوجه عام أشكال الإعطاء تحت الجلد وفي العضل‎ ‏من أشكال الإعطاء غير المعوي.‎ ‏وتكون أنظمة الجرعات اليومية التي تعطى عن طريق الفم أو بطريقة غير معوية التي‎ ‏تستخدم مركبات وفقآ للاختراع لحث الكبت المناعي وقائياً أو علاجياً؛ أو لمعالجة الأورام‎ - ‏المكونة للسرطان عادة في المدى من حوالي 06 إلى ١٠٠؛ ولكن يفضل في المدى من‎ ‏مليجرام لكل كيلوجرام من وزن الجسم لكل يوم.‎ ٠١ ‏إلى‎ ١,5 ‏حوالي‎ ‏عن طريق الاستتنشاق. ويقصد‎ Lad ‏للاختراع‎ Gy ‏وقد يعطى الجسم المضاد‎ ‏بالمصطلح عن طريق "الاستتشاق" الإعطاء بالاستنشاق عن طريق الفم وداخل الأنف. ويمكن‎ ‏مثل تركيبة من حلالة هوائية أو جهاز‎ cal ‏تحضير أشكال جرعات مناسبة لإعطاء من هذا‎ ١ ‏المفضل لمركب وفقآً‎ de jal) ‏استنشاق معاير الجرعة؛ بواسطة تقنيات تقليدية. ويكون مقدار‎ ‏مليجرام.‎ ٠٠١ ‏إلى‎ ٠١ ‏للاختراع يراد استخدامه عادة في المدى من حوالي‎ ‏للاختراع موضعياً. ويقصد بالمصطلح إعطاء‎ Gy ‏إعطاء الجسم المضاد‎ (Say ‏كما‎ ‏للاختراع (أو‎ Gy ‏موضعي إعطاء غير جهازي ويشمل وضع مركب يحتوي على جسم مضاد‎ ‏جزء منه) على سطح بشرة الجلد؛ على التجويف الخدي وإدخال الجسم المضاد هذا في الأذنء‎ YL ‏العين والأنف قطرة قطرة؛ بحيث لا يدخل بشكل ملحوظ إلى تيار الدم. ويقصد بالإعطاء‎ ‏الصفاق وفي العضل. وسيختلف مقدار‎ Jada ‏الجهازي إعطاء عن طريق الفم؛ في الوريد؛‎ ‏على الجسم المضاد المختارء‎ Bl ‏الجسم المضاد المطلوب للتأثير العلاجي أو الوقائي؛ طبعاً؛‎ ‏والحيوان الذي يخضع للمعالجة؛ ويخضع في النهاية لاجتهاد‎ dalled) ‏طبيعة وحدة الحالة‎Yo for well-known technologies. A person skilled in the technique will understand that Gy or a conventional Pharmaceutical Acceptable Diluent The form and recipes of the Pharmaceutical Acceptable Diluent or Carrier are determined by the amount of active ingredient to be mixed; Routes of administration and other variants are well known. For the invention is oral; by inhalation or topically. The term non-enteric administration as used in this statement includes intravenous administration; intramuscularly Under the skin; Via vaginal or intraperitoneal. Subcutaneous and intramuscular forms of administration are generally preferred over non-enteric forms of administration. Oral or non-enteral daily dosing regimens using compounds according to the invention to induce prophylactic or therapeutic immunosuppression; or to treat tumors - usually carcinogenic in the range from about 06 to 100; But preferably in the range of 1.01 milligrams per kilogram of body weight per day to approximately 1.5 by inhalation. Lad of the invention means Gy and the antibody by the term “inhalation” may be given by oral and intranasal inhalation. It is possible, as a formulation of an aerosol or cal device, to prepare suitable dosage forms for administration of this (1) preferred compound according to de jal) inhalation dose titration; by conventional techniques. The amount of .001 to 10 milligrams of the invention is usually intended to be used in the range of about .001 of the invention topically. The term Gy administration means antibody administration (Say as of the invention) (or non-systemic topical Gy administration involving application of a complex containing an antibody part thereof) to the epidermal surface of the skin; to the buccal cavity and introduction of this antibody In the ear YL eye and nose drop by drop so that it does not significantly enter the bloodstream administration is intended peritoneal and intramuscular The amount of systemic Jada given by mouth, intravenously, will vary on the selected antibody Bl The antibody required for a therapeutic or preventive effect; of course; and the animal that is subject to the treatment; and ultimately subject to diligence dalled) the nature and severity of the case

الطبيب المعالج. ويكون مقدار الجرعة الموضعية المناسبة من جسم مضاد ‎(Gy‏ للاختراع ‎sale‏ ‏في المدى من حوالي ‎١‏ إلى حوالي ‎٠٠١‏ مليجرام لكل كيلوجرام من وزن الجسم يومياً. التركيبات ْ في حين يمكن إعطاء جسم مضاد أو جزء مته في صورة مفردة؛ فإنه يفضل أن يوجد في صورة تركيبة صيدلية. ويمكن أن يشكل المقوم ‎(Jail‏ للإعطاء الموضعي؛ نسبة تتراوح من 960.001 إلى ‎96٠١‏ وزن/وزن؛ مثلاآًء من 961 إلى 967 من وزن التركيبة؛ بالرغم أنه يمكن أن يشكل نسبة مقدارها ‎96٠١‏ وزن/وزن ولكن يفضل أن لا تزيد النسبة عن %0 وزن/وزن والأفضل أن تتراوح من 96001 إلى 961 وزن/وزن من التركيبة. وتشتمل التركيبات الموضعية ‎Gy‏ للاختراع الراهن على مقوم فعال مع مادة حاملة ‎٠‏ مقبولة واحدة أو أكثر له وبشكل اختاري أي مقوم (مقومات) علاجي آخر. وينبغي أن تكون المادة الحاملة (المواد الحاملة) ‎"A pie’‏ من ناحية التلاؤم مع المقومات الأخرى للتركيبة ولا تضر بمستخدم التركيبة. وتشمل التركيبات الملائمة للإعطاء الموضعي مستحضرات سائلة أو شبه سائلة ملائمة للنفاذ عبر الجلد إلى الموقع المطلوب علاجه؛ مثل المروخات؛ الغسولات؛ الكريمات؛ ‎ve‏ المراهم؛ أو المعاجين وقطرات ملائمة للإعطاء في العين؛ الأذن والأنف. ويمكن أن تشتمل القطرات وفقآ للاختراع الراهن على محاليل أو معلقات مائية أو زيتية معقمة ويمكن تحضيرها بإذابة المقوم الفعال في محلول مائي ملائم من عامل قاتل للجراثيم و/أو قاتل للفطريات و/أو أي ‎sala‏ حافظة أخرى ملائمة؛ ويفضل أن ‎Jan‏ على عامل ذي فعالية سطحية. ويمكن تنقية المحلول الناتج ‎La‏ بعد بالترشيح؛ نقله إلى وعاء ملائم ‎٠‏ > يحكم سده فيما بعد ويعقم بالتحمية في ‎alia‏ موصد أو بالمحافظة عليه عند درجة حرارة تتراوح من ‎٠٠١-٠٠‏ م لمدة نصف ساعة. وبشكل بديل؛ يمكن تنقية المحلول بالترشيح ونقله إلى الوعاء بواسطة تقنية معقمة. وتكمن أمثلة العوامل القاتلة للجراثيم والفطريات الملائمة ض لإضافتها إلى القطرات في نترات ‎nitrate‏ أو أسيتات ‎acetate‏ فتيل الزثبق ‎phenylmercuric‏ ‏بنسبة 960,007 كلوريد البنزالكونيوم ‎benzalkonium chloride‏ بنسبة 960,01 وأسيتات كلور vy ‏بنسبة )+ ,+ %. وتشمل مذيبات ملائمة لتحضير محلول زيتي‎ chlorhexidine acetate ‏هكسيدين‎ ‎.propylene glycol ‏كحول مخفف وجليكول بروبيلين‎ (glycerol ‏جليسرول‎ ‏للاختراع الراهن تلك الغسولات الملائمة لوضعها على الجلد أو‎ Gy ‏وتشمل الغسولات‎ ‏العين. ويمكن أن يشتمل غسول للعين على محلول مائي معقم يحتوي بشكل اختياري على‎ ‏م عامل قاتل للجراثيم ويمكن تحضيره بواسطة طرق مشابهة لتلك المستخدمة لتحضير القطرات.‎ ‏لتعجيل‎ Sale ‏ويمكن أن تشمل الغسولات أو المروخات التي يتم وضعها على الجلد أيضاً‎ ‏الجليسرول أو زيت‎ Jie ‏و/أو مرطب‎ cacetone ‏كحول أو أسيتون‎ Fhe ‏التجفيف ولتبريد الجلد؛‎ ‏مثل زيت الخروع أو زيت الفول السوداني.‎ ‏وتكون الكريمات؛ المراهم أو المعاجين وفقآً للاختراع الراهن عبارة عن تركيبات شبه‎ ‏صلبة للمقوم الفعال معدة للاستخدام الخارجي. ويمكن تحضيرها بخلط المقوم الفعال في‎ ٠ ‏صورة مجزأة بشكل دقيق أو في صورة مسحوق؛ بمفرده أو في محلول أو معلق في مائع‎ ‏مائي أو غير مائي؛ باستخدام وسائل ملائمة؛ بأساس شحمي أو غير شحمي. ويمكن أن يشتمل‎ ‏صلب؛ لين أو سائل؛ جليسرول؛ شمع‎ paraffin ‏الأساس على هيدروكربونات مثل بارافين‎ ‏العسل؛ صابون فلزي؛ لثأ؛ زيت من مصدر طبيعي مثل زيت اللوزء الذرة؛ الفول السوداني؛‎ ‏حمض الستياريك أو‎ Jia ‏الخروع أو الزيتون؛ دهن الصوف أو مشتقاته؛ أو حمض دهني‎ ae ‏الأولييك مع كحول مثل جليكول البروبيلين أو جليكولات متعددة الاثيلين. ويمكن أن تتضمن‎ ‏التركيبة أي عامل ذي فعالية سطحية ملائم مثل عامل ذي فعالية سطحية أنيوني» كاتيوني أو‎ ‏غير أيوني مثل إسترات السوربيتان أو مشتقاتها من متعدد أكسي إثيلين. ويمكن أن تشستمل‎ ‏التركيبة أيضاً على عوامل تعليق مثل الصمغ الطبيعي؛ المشتقات السليلوزية أو مواد غير‎ ‏عضوية مثل مركبات سليكا سليكونية ومقومات أخرى مثل اللانولين.‎ © ‏وفترة التباعد المتلى بين‎ Ball ‏وسيدرك من قبل متمرس في التقنية أن الكمية‎ ‏الجرعات المفردة لجسم مضاد أو جزء منه وفقآ للاختراع ستحدد بواسطة طبيعة وحدة الحالة‎ ‏المعالجة؛ شكل؛ طريقة وموقع الإعطاء؛ والحيوان المحدد المعالج؛ وأنه يمكن تحديد القيم‎ ‏من قبل متمرس في التقنية أنه يمكن التحقق‎ Lad ‏المثلى هذه بواسطة تقنيات تقليدية. وسيدرك‎ ‏أي عدد‎ (Ama ‏الجرعات المعطاة لمريض في فترة‎ de seas) ‏.-_من الفترة العلاجية المثلى‎ Yo ‏أ‎Physician. The appropriate topical dose of antibody (Gy of the invention sale) is in the range from about 1 to about 100 milligrams per kilogram of body weight per day. Jail for topical administration; a ratio ranging from 960.001 to 9601 w/w; e.g. from 961 to 967 of the weight of the formulation; although it can form a ratio of 9601 w/w but preferably not more than 0% w/w and preferably from 96001 to 961 w/w of the formulation.Gy topical formulations of the present invention comprise an active rectifier with one acceptable 0 carrier One or more of them and optionally any other therapeutic ingredient(s). The carrier(s) shall be 'A pie' in terms of compatibility with other ingredients of the formulation and shall not harm the user of the formulation. Formulations suitable for topical administration include liquid or semi-liquid formulations suitable for penetration through the skin to the site to be treated, as lotions; lotions; creams; ve ointments; or pastes and drops suitable for administration into the eye; ear and nose. The drops according to the present invention may comprise sterile aqueous or oily solutions or suspensions and may be prepared by dissolving the active ingredient in an appropriate aqueous solution of a bactericidal and/or fungicidal agent and/or any other suitable preservative sala; Jan is preferred over a surface-active agent. The resulting solution, La, can be further purified by filtration; Transfer it to a suitable container 0 > Close it later and sterilize it by heating it in a sealed alia or by maintaining it at a temperature ranging from 00-001 C for half an hour. alternatively; The solution can be filtered and transferred to the vessel by aseptic technique. Examples of suitable bactericidal and fungi-killing agents to be added to the drops are nitrate or phenylmercuric acetate with a percentage of 960.007, benzalkonium chloride with a percentage of 960.01 and vy chloride acetate with a percentage of (+, +%). Suitable solvents for the preparation of an oily solution include chlorhexidine acetate, propylene glycol, dilute alcohol, propylene glycerol, and glycerol of the present invention. The eye contains a sterile aqueous solution that optionally contains a bactericidal agent and can be prepared by methods similar to those used to prepare eye drops. To speed up the sale, lotions or lotions that are applied to the skin may also include glycerol or Jie oil. and/or emollient cacetone alcohol or acetone Fhe drying and for cooling the skin; such as castor oil or peanut oil. Creams; ointments or pastes according to the present invention are semi-solid compositions of the active ingredient intended for use It can be prepared by mixing the active ingredient in finely divided form or in powder form, alone, in solution or suspension in an aqueous or non-aqueous fluid, using appropriate means, with a fatty or non-greasy basis. It may include solid; soft or liquid; glycerol; paraffin wax based on hydrocarbons such as honey paraffin; metallic soap; latex oil from a natural source such as almond corn oil; Peanuts; Stearic Acid or Jia; Castor or Olive; wool grease or its derivatives; or an oleic ae fatty acid with an alcohol such as propylene glycol or polyethylene glycols. The composition may include any suitable surfactant such as anionic or non-ionic surfactant such as sorbitan esters or their polyoxyethylene derivatives. The formulation may also include suspending agents such as natural gums; cellulosic derivatives or inorganic substances such as silica compounds and other constituents such as lanolin. © and the interval between the Ball and a person skilled in the art will realize that the quantity of single doses of an antibody or part thereof according to the invention will be determined by the nature of a unit case, treatment; appearance; method and site of administration; the specific animal being treated; And that these optimal Lad values can be determined by an expert in the technique. These optimal Lads can be verified by conventional techniques. And he will realize what number (Ama doses given to a patient in the de seas period) -_ from the optimal therapeutic period Yo A

VAVA

‏جرعات جسم مضاد أو جزء منه وفقآً للاختراع معطاة يومياً خلال عدد محدد من الأيام» من‎ ‏قبل أولئك المتمرسين في التقنية باستخدام اختبارات تقليدية لتحديد الفترة العلاجية.‎ ‏وبدون شرح أي تفاصيل إضافية؛ يعتقد بأن المتمرس في التقنية يمكنه؛ باستخدام‎ ‏الوصف السابق؛ الاستفادة من الاختراع الراهن على أكمل وجه. ولذلك يفسر ما يلي على أنه‎ ‏عبارة عن أمثلة توضيحية فحسب وليست مقيدة لنطاق الاختراع الراهن بأي طريقة.‎ ٠ ‏تركيب كبسولة‎ ‏يحضر تركيب صيدلي وفقآ لهذا الاختراع في صورة كبسولة بملء كبسولة جيلاتينية‎ ‏للاختراع؛‎ Gly ‏مجم من جسم مضاد أو جزء منه‎ 5٠ ‏صلبة من قطعتين قياسية تحتوي على‎ ‏مجم من‎ Ag ‏مجم من الطلق‎ YY Lactose ‏مجم من اللاكتوز‎ ٠٠١ ‏في صورة مسحوق؛‎Antibody doses or part thereof according to the invention given daily over a specified number of days” by those skilled in the technique using conventional tests to determine the therapeutic period. Without explaining any further details; He believes that a skilled in technology can; using the previous description; Make full use of the current invention. The following is therefore interpreted as illustrative examples only and is not limiting to the scope of the present invention in any way. Antidote or part thereof 50 standard two-piece solids containing mg of Ag talc YY lactose mg of lactose 001 mg in powder form;

Magnesium stearate ‏ستيارات المغتيسيوم‎ ye ‏تركيب غير معوي قابل للحقن‎ ‏لهذا الاختراع في صورة ملائمة للإعطاء بالحقن بتقليب‎ Gig ‏يحضر تركيب صيدلي‎ 961١ ‏للاختراع بنسبة 961,5 بالوزن في جليكول اثيلين تركيزه‎ iby ‏جسم مضاد أو جزء منه‎ ‏بالحجم وماء. ويعقم المحلول بالترشيح.‎ ‏تركيب مرهم‎ vo ‏وفقآً للاختراع.‎ dia ‏جم من جسم مضاد أو جزء‎ ١ ‏جم‎ ٠٠١٠١ ‏بارافين لين أبيض اللون حتى يصل الوزن الكلي إلى‎ ‏للاختراع في حجم قليل من السواغ لإنتاج منتج‎ Gy ‏يشتت الجسم المضاد أو جزؤه‎ ‏متجانس؛ سلس. ثم تملا الأنابيب المعدنية القابلة للطي بالمادة المشتتة.‎ ‏تركيب كريم موضعي‎ > ٠ ‏جم من جسم مضاد أو جزء منه وفقآ للاختراع.‎ ١ -(Polawax GP 200( ٠٠١ ‏جم من بولاواكس جي بيه‎ ٠ .Lanolin Anhydrous ‏جم من لانولين لامائي‎ ‏جم من شمع عسل أبيض اللون.‎ 5 -Methyl hydroxybenzoate ‏جم من هيدروكسي بنزوات المثيل‎ ١ Yo va ‏جم.‎ ٠٠٠١ ‏ماء مقطر حتى يصل الوزن الكلي إلى‎ ‏م . ويضاف محلول من‎ ٠ ‏يسخن البولاواكس؛ شمع العسل واللانولين معاً عند‎ ‏هيدروكسي بنزوات المثيل ويتم الحصول على مزيج متجانس باستخدام تقليب بسرعة عالية.‎ ‏للاختراع‎ Gig ‏م. ثم يضاف الجسم المضاد أو جزؤه‎ ٠ ‏ثم تترك درجة الحرارة لتهبط إلى‎ ed CE a pd CS Oy JulS JS citys ‏تركيب غسول موضعي‎ ‏جم من جسم مضاد أو جزء منه وفقآً للاختراع.‎ V0 ‏جم من متعدد سوربات‎ ١,١ Sorbitan 110001656 ‏جم من أحادي لورات السوربيتان‎ 1 .Polysorbate 0 Y. ‏جم من الجليسرين.‎ ٠,٠ cCetostearyl Alcohol ‏جم من كحول سيتوستياريل‎ ١,١ 1. -Methyl Hydroxy benzoate ‏جم من هيدروكسي بنزوات المثيل‎ 7 ‏مل.‎ ٠٠١ ‏لدستور الأدوية البريطاني حتى يصل الحجم الكلي إلى‎ GE ‏ماء منقى‎ 2 V 0 ‏مل من الماء عند‎ Vo ‏يذاب هيدروكسي بنزوات المثيل والجليسرين في‎ ‏عند‎ laa ‏وكحول سيتوستياريل‎ ٠١ ‏ويصهر كل من أحادي لورات السوربيتان؛ متعدد سوربات‎ ‏#لام ويضافوا إلى المحلول المائي. ويجانس المستحلب الناتج؛ يترك ليبرد مع التقليب‎ ve ‏المتواصل ويضاف الجسم المضاد أو جزؤه وفقاً للاختراع في صورة معلق في الماء المتبقي.‎ ‏ويقلب المعلق بأكمله حتى يصبح متجانساً.‎ ‏تركيب قطرة للعين‎ ‏جم من جسم مضاد أو جزء منه وفقاً للاختراع.‎ 8 -Methyl Hydroxybenzoate ‏جم من هيدروكسي بنزوات المثيل‎ 601 Y. -Propyl Hydroxybenzoate ‏جم من هيدروكسي بنزوات البروبيل‎ 0,0 8 ‏مل.‎ ٠٠٠١ ‏ماء منقى وفقا لدستور الأدوية البريطاني حتى يصل الحجم الكلي إلى‎ ‏مل من ماء منقى عند 5 لام‎ Ve ‏والبروبيل في‎ dia ‏يذاب مركبا هيدروكسي بنزوات‎ ‏ويترك المحلول الناتج ليبرد. ثم يضاف الجسم المضاد أو جزؤه وفقآً للاختراع؛ ويتم تعقيم‎Magnesium stearate ye Non-enteric injectable composition of this invention in a form suitable for parenteral administration by stirring Gig Prepare pharmaceutical composition 9611 of the invention 961.5 by weight in ethylene glycol of concentration ib antibody or part thereof size and water. The solution is sterilized by filtration. Composition of ointment vo according to the invention. dia g of antibody or fraction 1 g of 00101 white soft paraffin until the total weight of the invention in a small volume of excipients to produce a product Gy dispersing antibody or its fraction homodimer; seamless. Then the collapsible metal tubes are filled with the dispersion. Topical cream formulation > 0 g of an antibody or part thereof according to the invention. of anhydrous lanolin g of white beeswax 5 -Methyl hydroxybenzoate g of methyl hydroxybenzoate 1 Yo va gm of 0001 distilled water until the total weight is 0 m and a solution of 0 is added Polawax, beeswax and lanolin are heated together at methyl hydroxybenzoate and a homogeneous mixture is obtained using high-speed stirring. of the invention Gig M. Then the antibody or its fraction 0 is added and the temperature is allowed to fall to ed CE a pd CS Oy JulS JS citys Topical lotion composition g of antibody or part thereof according to the invention. V0 g of polysorbate 1,1 Sorbitan 110001656 g of sorbitan monolaurate 1 g Polysorbate 0 Y. g of Glycerin. 0.0 cCetostearyl Alcohol 1.1 g of Cetostearyl Alcohol 1. -Methyl Hydroxy benzoate 7 ml. of Methyl Hydroxybenzoate 7 ml. British Pharmacopoeia 001 for total volume to GE Water Purified 2 V 0 ml of water at Vo Dissolve methyl hydroxybenzoate and glycerin in at laa and cetostearyl alcohol 01 and melt each of sorbitan monolaurate; Polysorbate #L and added to the aqueous solution. and homogenizes the resulting emulsion; Leave to cool with continuous stirring and add the antibody or part of it according to the invention in the form of a suspension in the remaining water. The entire suspension is stirred until it becomes homogeneous. Formulation of eye drops 8 gm of antibody or part thereof according to the invention. -Methyl Hydroxybenzoate g 601 Y. -Propyl Hydroxybenzoate g Propyl Hydroxybenzoate 0.0 8 ml. 0001 Purified water according to the British Pharmacopoeia until the total volume is ml of purified water At 5 L, Ve and propyl in dia, two hydroxybenzoate compounds are dissolved and the resulting solution is left to cool. then the antibody or its fraction according to the invention is added; And it is sterilized

. ف المحلول بالترشيح من خلال مرشح غشائي حجم عيونه ‎flag Sue ١077‏ ¢ ويجمع بشكل معقم في أوعية معقمة ملائمة. تركيب للإعطاء بالاستنشاق بالنسبة لوعاء يحتوي على حلالة هوائية تتراوح سعته من ‎١59‏ إلى ‎٠١‏ مل: يخلط م ‎٠١‏ مجم من جسم مضاد أو جزء منه وفقآً للاختراع مع عامل تزليق بنسبة تتراوح من ‎٠,7‏ ‏إلى 960,5؛ مثل متعدد سوربات ‎AO‏ أو حمض أولييك؛ ويشتت خليط من هذا القبيل في مادة داسرة ‎Sie epropellant‏ الفريون «85608؛ يفضل في توليفة من ‎SLY)‏ كلورو رابع فلوروإيثان ‎(1,2-dichlorotetrafluoroethane‏ وثاني فلو روكلوروميثان ‎difluorochloromethane‏ ‏ويوضع في وعاء حلالة هوائية مناسب معد للإعطاء بالاستتشاق عن طريق الم أو داخل ‎٠‏ - الأنف. وبالنسبة للتركيب المعد للإعطاء بالاستنتشاق لوعاء حلالة هوائية تتراوح سعته من ‎V0‏ ‏إلى ‎٠١‏ مل يذاب ‎٠١‏ مجم من جسم مضاد أو جزء ‎Gy die‏ للاختراع في مقدار يتراوح من 7 إلى ‎A‏ مل من الايثانول ‎cethanol‏ يضاف عامل تزليق بنسبة تتراوح من ‎١.١‏ إلى 960,7؛ مثل متعدد سوربات 45 أو حمض أولييك؛ ويشتت خليط من هذا ‎Jill‏ في مادة داسرة؛ مثل الفريون؛ يفضل في توليفة من (٠١7-ثاني‏ كلورو رابع فلوروإيثان ‎(1,2-dichlorotetrafluoroethane yo‏ وثاني فلورو كلوروميثان ‎«difluorochloromethane‏ ويوضع في وعاء ‎ADs‏ هوائية معد للإعطاء بالاستتشاق عن طريق الفم أو داخل الأنف. وتكون الأجسام المضادة والتراكيب الصيدلية ‎Gy‏ للاختراع مفيدة بصفة خاصسة للإعطاء غير المعوي؛ أي تحت الجلد؛ في العضل أو في الوريد. وتشمل التراكيب المعدة للإعطاء غير المعوي عادة محلولاً لجسم مضاد أو جزء منه وفقآ للاختراع أو خليط منهما ‎Y.‏ مذابين في مادة حاملة مقبولة؛ يفضل مادة حاملة مائية. ويمكن استخدام تشكيلة من المواد الحاملة المائية؛ على سبيل المثال؛ ماء؛ ماء منظم درجة الحموضة؛ محلول ملحي بنسبة 54 جليسين بنسبة ‎«Yo, FY‏ وما أشبه. وتكون هذه المحاليل معقمة وتخلو عادة من مواد جسيمية. ويمكن أن تعقسّم هذه المحاليل بواسطة تقنيات تعقيم تقليدية معروفة ‎Tam‏ ويمكن أن تحتوي التراكيب على مواد مساعدة مقبولة صيدلياً حسب الحاجة للاقتراب من الظطروف ‎vo‏ الفسيولوجية مثل عوامل ضبط وتنظيم درجة الحموضة...إلخ. ويمكن أن يختلف تركيز الجسم. The solution was filtered through a membrane filter with eyes size of flag Sue 1077 ¢ and collected aseptically in suitable sterile containers. Composition for inhalation administration for an aerosol container with a capacity of 159 to 100 ml: 10 mg of an antibody or a portion thereof according to the invention is mixed with a lubricating agent in the ratio of 0.7 to 960, 5; such as AO polysorbate or oleic acid; Such a mixture is dispersed in a propellant Sie epropellant Freon «85608; Preferably in a mixture of (SLY) chlorotetrafluoroethane (1,2-dichlorotetrafluoroethane) and difluorochloromethane and placed in a suitable aerosol container prepared for inhalation or intranasal administration. By inhalation into an aerosol container with a capacity of V0 to 10 ml, 01 mg of an antibody or the Gy die fraction of the invention is dissolved in an amount ranging from 7 to A ml of ethanol, a lubricating agent of ranging from 1.1 to 960.7; such as polysorbate 45 or oleic acid; and a mixture of this Jill is dispersed in a propellant; such as Freon; preferably in a combination of (017-dichlorotetrafluoroethane (1,000) 2-dichlorotetrafluoroethane yo and difluorochloromethane “difluorochloromethane” and placed in an aerobic container ADs prepared for oral or intranasal inhalation. Intramuscular or intravenous Compositions intended for non-intestinal administration usually include a solution of an antibody or part thereof according to the invention, or a mixture thereof, Y. dissolved in an acceptable carrier; An aqueous carrier is preferred. A variety of aqueous carriers may be used; For example; water; pH regulated water; Saline solution of glycine 54 by ratio “Yo, FY” and the like. These solutions are sterile and usually free of particulate matter. These solutions can be diluted by known conventional sterilization techniques (Tam) and the formulations may contain pharmaceutically acceptable adjuvants as needed to approach vo physiological conditions such as pH adjusting agents, etc. And the concentration of the body can vary

اث المضاد أو جزء منه ‎Gi‏ للاختراع في تركيبة صيدلية من هذا القبيل بشكل واسع؛ أي» من أقل من حوالي 960,5 عادة ما لا يقل عن حوالي 961 إلى ‎١١‏ أو 9670 بالوزن على ‎SS‏ ‏ويختار بصفة أساسية بناءً على أحجام الموائع؛ قيم اللزوجة.؛..إلخ؛ وفقآً للطريقة المحددة للإعطاء المختارة.The antidote or part thereof (Gi) of the invention in such a pharmaceutical composition is widely used; i.e. from less than about 960.5 usually not less than about 961 to 11 or 9670 wt. on SS and chosen primarily on the basis of fluid volumes; viscosity values.;..etc; According to the specific method of administration chosen.

° وهكذاء يمكن تحضير التركيب الصيدلي ‎Gy‏ للاختراع لحقنه في العضل بحيث يحتوي على ‎١‏ مل من ماء منظم درجة الحموضة معقم؛ و50 مجم من جسم مضاد أو جزء منه وفقآً للاختراع. وبشكل ‎(Say (Pilea‏ تحضير تركيب صيدلي ‎Gy‏ للاختراع للتسريب في الوريد بحيث يحتوي على ‎YO‏ مل من محلول رينجر معقم؛ و١٠5١‏ مجم من جسم مضاد أو جزء منه ‎li‏ للاختراع. وتعرف طرق حالية لتحضير تراكيب قابلة للإعطاء بطريقة غير معوية° Thus, the pharmaceutical composition [Gy] of the invention may be prepared for intramuscular injection containing 1 ml of sterile pH-regulated water; and 50 mg of an antibody or part thereof according to the invention. In the form of (Say (Pilea) preparation of a pharmaceutical composition Gy of the invention for intravenous infusion containing YO ml of sterile Ringer's solution and 1051 mg of an antibody or part thereof of the invention. Existing methods are known for the preparation of administerable compositions in a non-intestinal manner

جيدآ أو تكون واضحة لأولئك المتمرسين في ‎All‏ وتوصف بتفصيل أكبرء على سبيل ‎(JU‏ انظر ما جاء في كتاب بعنوان العلوم الصيدلية لريمنجتون؛ الطبعة 9٠؛‏ من شركة ماك ببلشنج كومباني؛ مدينة إيستون؛ ولاية بنسلفانياء حيث أدمج في هذا البيان للإحالة إليه كمرجع. ويمكن تجفيد الأجسام المضادة (أو أجزائها) وفقآً للاختراع للتخزين ويعاد تكوينها في مادة حاملة ملائمة قبل الاستخدام. ولقد تبين أن هذه التقنية فعالة مع جلوبلينات مناعية تقليدية(JU) See Remington Pharmaceutical Sciences, 90th ed., of The Mac Publishing Company, Easton City, Pennsylvania, where I am incorporated into this statement for reference. The antibodies (or their fractions) according to the invention may be lyophilized for storage and reconstituted in an appropriate carrier prior to use.This technique has been shown to be effective with conventional immunoglobulins

‎١‏ ويمكن استخدام تقنيات إعادة التكوين والتجفيد المعروفة في التقنية. وبالاعتماد على النتيجة المطلوبة؛ يمكن إعطاء التركيب الصيدلي ‎Lady‏ للاختراع للاستخدامات العلاجية و/أو الوقائية. وفي مجال الاستخدام العلاجي؛ تعطى التراكيب إلى مريض يعاني ‎Tila‏ من مرض؛ بمقدار كاف لمعالجة المرض ومضاعفاته أو على الأقل ‎lida aay TS‏ وفي مجال الاستخدامات الوقائية؛ تعطى التراكيب التي تحتوي على1 Reconfiguration and lyophilization techniques known in the technique can be used. Depending on the required result; The pharmaceutical composition 'Lady' of the invention may be administered for therapeutic and/or prophylactic uses. And in the field of therapeutic use; The compositions are given to a patient suffering from Tila's disease; in an amount sufficient to treat the disease and its complications, or at least lida aay TS, and in the field of preventive uses; Compositions containing

‎٠‏ - الأجسام المضادة أو خليط منها ‎Gi‏ للاختراع الراهن إلى مريض لا يعاني مسبقاً من حالة مرضية لتعزيز مقاومة المريض.0 - Antibodies or mixtures thereof, Gi of the present invention, to a patient without a pre-existing disease condition to enhance the patient's resistance.

‏ويمكن إجراء عمليات الإعطاء المفرد أو المتعدد للتراكيب الصيدلية بحيسث تختار مستويات الجرعات وشكلها مستويات من قبل الطبيب المعالج. وعلى أي ‎eda‏ ينبغي أن يزود التركيب الصيدلي وفقاً للاختراع كمية من الأجسام المضادة ‎Anaad‏ (أو أجزاء منها) ‎Lady‏ ‎vo‏ للاختراع كافية لمعالجة المريض بشكل فعال.It is possible to perform single or multiple administration operations for pharmaceutical compositions, where the dosage levels and form levels are chosen by the attending physician. On any eda the pharmaceutical composition according to the invention should provide an amount of Anaad antibodies (or parts thereof) Lady vo of the invention sufficient to effectively treat the patient.

AYAY

‏لهذا الاختراع‎ Gy ‏الإشارة إلى أنه يمكن استخدام الأجسام المضادة‎ Lad ‏وينبغي‎ ‏لتصميم وتخليق المركبات الببتيدية أو غير الببتيدية (المحاكيات) التي يمكن أن تكون مفيدة في‎ slang ‏العلاج نفسه بصفتها الجسم المضاد. انظر مثلاً ما جاء عن ساراجوفي‎ 2149) (YAo-VAY ‏في مجلة العلم 6 مجلد "د ص‎ «Saragovi et al 0 ولقد أودعت السلالة ‎¢XL1 Blue‏ مضاد ‎CD-4‏ في ‎TCAE6‏ التي تعبر عن 089.1 بواسطة مجموعة المزارع النمطية الأمريكية ‎ATCC‏ وعينت بالرقم 14076. وأجري هذا الإيداع في 4 يونيوء 197 ١م.‏ ويعترف مقدمو الطلب والمتنازل لهم عن هذا الطلب بمسئوليتهم تجاه استبدال هذه المزارع إذا ماتت قبل انقضاء المدة المحددة للبراءة الصادرة على هذه الوثيقة؛ بعد © سنوات .من آخر طلب للمزرعة؛ أو ‎١‏ سنة؛ أيما كانت ‎(Joh)‏ ومسئوليتهم تجاه إعلام المودع لديه عن إصدار هذه ‎Bel ll‏ حيث في ذلك الوقت ستصبح المادة المودعة متوفرة للعامة بشكل بات. وحتى ذلك الوقت ستوفر المادة المودعة لمفوض البراءات تحت شروط دستور اللوائح الفدرالية؛ الفصل ‎(TY‏ الجزء ١-؛١‏ والدستور الأمريكي؛ الفصل ‎Fo‏ الجزء ‎AVY‏Hereby Gy indicates that Lad antibodies can and should be used for the design and synthesis of peptide or non-peptide compounds (mimetics) that could be useful in slang the same therapy as the antibody. See, for example, what was reported on Saragovi (2149) (YAo-VAY) in the Journal of Science 6 vol. By American Typical Farm Group ATCC Designated No. 14076. This filing was made on June 4, 1971. The applicants and assigns of this application acknowledge their liability to replace these farms if they die before the expiry of the term of the patent issued herein; after © years .of the farm's last order; or 1 year; whichever (Joh) and their responsibility to notify the Depositary of the issuance of this Bel ll at which time the Deposit Material will become strictly publicly available. Until such time the Depositary Material will be made available to the Commissioner Patents under the terms of the Constitution of Federal Regulations, Chapter TY Part 1-1 and the US Constitution, Chapter Fo Part AVY

AYAY

‏قائمة بيان التتابعات‎ ‏بيانات عامة:‎ )١( 59 ‏عدد التتابعات:‎ (iii) :١ ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) : ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ 47١ ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: القرد‎ ‏الموقع في المجين:‎ (viii) 0189.1 ‏سلسلة خفيفة متغير من‎ Jin ‏(أ) كروموسوم/قطعة:‎ ‏السمات:‎ (ix)Sequence List General data: (1) 59 Number of sequences: (iii) 1: Data specific to the discrimination sequence number: (Y): Characteristics of the sequence: (i) 471 base pair (a) Length: (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear Molecule type: DNA (genomic) (i) Original source: (vi) (a) Organism: monkey Genome position: (viii) 0189.1 light chain variant of Jin (a) chromosome/segment: Trait: (ix)

CDS ‏(أ) الاسم/المفتاح: سي دي إس‎ 40047١ ‏(ب) الموقع:‎ ‏السمات:‎ (ix) ‏(ا) الاسم/المفتاح: ببتيد-ناضج‎ 6٠٠047٠0 ‏(ب) الموقع:‎CDS (a) name/key: CDS 400471 (b) locus: traits: (ix) (a) name/key: peptide-mature 60004700 (b) locus:

عم ‎(xi)‏ وصف التتابع: تتابع تمييز رقم ‎:١‏ ‎TGG TTC TIC CTC CIC 026 GIG GCA GCC CCC AGA 438‏ وى ‎GAC ATG AAA CAC‏ ‎Met Lys His Leu Trp Phe Phe Leu Lau Leu Val Ala Ala Pro Arg‏ 10- 15- 19- 96 ناك ‎CCA GGA‏ عو ‎GTC TIC TCC CAG GIG CAG 6 CAG GAG GCG‏ يح ‎Trp Val Leu Ser Gln Val Gln Leu Gln Glu Ala Gly Pro Gly Leu Val‏ 5 1 ‎AAG CCT TCG GAG ACC CTG TCC CTC ACC TGC AGT GIC TCT GGT GGC TCC 144‏ ‎Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser‏ 20 15 ‎TTC TGG ATC CGC CAG TCC CCA GGG AAG 192‏ 0و ‎ATC AGC GGT GAC TAT TAT‏ ‎Ile Ser Gly Asp Tyr Tyr Trp Phe Trp lle Arg Gln Ser Pro Gly Lys‏ 40 . 35 30 ‎AGT GGT GGG GGC ACC AAT 240‏ ع ‎GGA CTG GAG TGG ATC GGC TAC ATC TAT‏ ‎Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn‏ 60 55 50 45 ‎TAC AAT CCC TCC CTC AAC AAT CGA GTC TCC AIT TCA ATA GAC ACG TCC 288‏ ‎Tyr Asn Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser‏ 75 70 65 ‎ANG AAC CTC TTC TCC CTG AAA CTG AGG TCT GIG ACC GCC GCG GAC ACG 336‏ ‎Lys Asn Leu Phe Ser Leu Lys Leu Arq Ser Val Thr Ala Ala Asp Thr‏ ‎as 90‏ 80 ‎AAA TAT CTT CAC TGG TTA ise‏ د ‎GCC CTC TAT TAC TGT GCG AGT AAT ATA‏ ‎Ala Val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Leu His Trp Leu‏ 105 100 95 ‎CAG GGA GTC CIG GIC ACC GIC TCC 420‏ عو مود ‎TTA TAC‏ ‎Leu Tyr Trp Gly Gln Gly Val Leu Vel Thr Val Ser‏ 120 115 110 1.1Am(xi) Relay Description: Relay Discrimination No.: 1 TGG TTC TIC CTC CIC 026 GIG GCA GCC CCC AGA 438 Wii GAC ATG AAA CAC Met Lys His Leu Trp Phe Phe Leu Lau Leu Val Ala Ala Pro Arg 10- 15- 19- 96 NA CCA GGA O GTC TIC TCC CAG GIG CAG 6 CAG GAG GCG Trp Val Leu Ser Gln Val Gln Leu Gln Glu Ala Gly Pro Gly Leu Val 5 1 AAG CCT TCG GAG ACC CTG TCC CTC ACC TGC AGT GIC TCT GGT GGC TCC 144 Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser 20 15 TTC TGG ATC CGC CAG TCC CCA GGG AAG 192 0 and ATC AGC GGT GAC TAT TAT Ile Ser Gly Asp Tyr Tyr Trp Phe Trp lle Arg Gln Ser Pro Gly Lys 40 . 35 30 AGT GGT GGG GGC ACC AAT 240 p GGA CTG GAG TGG ATC GGC TAC ATC TAT Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn 60 55 50 45 TAC AAT CCC TCC CTC AAC AAT CGA GTC TCC AIT TCA ATA GAC ACG TCC 288 Tyr Asn Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser 75 70 65 ANG AAC CTC TTC TCC CTG AAA CTG AGG TCT GIG ACC GCC GCG GAC ACG 336 Lys Asn Leu Phe Ser Leu Lys Leu Arq Ser Val Thr Ala Ala Asp Thr as 90 80 AAA TAT CTT CAC TGG TTA ise D GCC CTC TAT TAC TGT GCG AGT AAT ATA Ala Val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Leu His Trp Leu 105 100 95 CAG GGA GTC CIG GIC ACC GIC TCC 420 Aw Mod TTA TAC Leu Tyr Trp Gly Gln Gly Val Leu Vel Thr Val Ser 120 115 110 1.1

AoAo

A ‏بيانات خاصة بتتابع التمييز رقم‎ ( Y ) ‏مميزات التتابع:‎ (i) ‏حمض أميني‎ ١4 ‏(أ) الطول:‎ ‏حمض أميني‎ tg gill ‏(ب)‎ ‏(ج) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: بروتين‎ (ii) :7 ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)A Data for recognition sequence number (Y) Characteristics of the sequence: (i) 14 amino acid (a) Length: tg gill amino acid (b) (c) Format: linear Molecule Type: Protein (ii) :7 Sequence Description: Recognition Sequence No.: (xi)

Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ale Als Pro Arg Trp -19 =15 -10 -5Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ale Als Pro Arg Trp -19 =15 -10 -5

Val Leu Ser Gls Val Gln Leu Gla Glu Ala Gly Pro Gly Leu Val Lys 1 5 10Val Leu Ser Gls Val Gln Leu Gla Glu Ala Gly Pro Gly Leu Val Lys 1 5 10

Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser IlePro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser Ile

Ser Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys GlySer Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys Gly

Leu Glu Trp Ile Gly Tyr lle Tyr Gly Ser Gly Gly Gly Thr Asn Tyr 60Leu Glu Trp Ile Gly Tyr lle Tyr Gly Ser Gly Gly Gly Thr Asn Tyr 60

Asn Pro Ser Leu Asn Asa Arg Val Ser Ile Sar Ile Asp Thr Ser Lys 6S 70 75Asn Pro Ser Leu Asn Asa Arg Val Ser Ile Sar Ile Asp Thr Ser Lys 6S 70 75

Asn Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala 890 83 90Asn Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala 890 83 90

Val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys TyT Leu His Trp Leu Len 95 100 105Val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys TyT Leu His Trp Leu Len 95 100 105

Tyr Trp Gly Gln Gly Val Leu Val Thr Val Ser 110 115 120 : ‏أ ( بياتات خاصة بتتابع التمييز رقم‎ ) ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ YAY ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ i)Tyr Trp Gly Gln Gly Val Leu Val Thr Val Ser 110 115 120 : A (Data for Discrimination Sequence No.) Sequence Characteristics: (i) YAY Base Pair (a) Length: (b) Type : nucleic acid (c) How to splice: single-stranded (d) Format: linear Molecule type: DNA (genomic) i)

تم ‎(vi)‏ المصدر ‎ad!‏ : (أ) الكائن الحي: القرد ‎(vidi)‏ الموقع في المجين: 0( كروموسوم/قطعة : ‎Jaa‏ سلسلة ثقيلة متغير من 191 ‎(ix)‏ السمات: (أ) الاسم/المفتاح: سي دي إس ‎CDS‏ ‏(ب) الموقع: اال +$ ‎(ix)‏ السمات: )'( الاسم/المفتاح: ببتيد-ناضج (ب) الموقع: ‎TY PAY‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: 7: ‎CTG CIC CIC GGC CIC CTT GCT CAC TIT ACA 48‏ و2 ‎ACC ATG GCC TGG GCT‏ ‎Met Ala Trp Ala Leu Leu Leu Leu Gly Leu Leu Ala Kis Phe Thr‏ 5- 10« 15« 19- ‎AGT CAG CCT CGC TCA GTG TCC GIG 96‏ ا ‎GAC TCT GCG GCC TCC TAT GAG‏ ‎Asp Ser Ala Ala Ser Tyr Glu Leu Ser Gla Pro Arg Ser Val Ser Val‏ 5 1 ‎TCC CCA GGA CAG ACG GCC GGG TIC ACC TCT GGG GGA GAC AAC GIT GGA 144‏ ‎Ser Pro Gly Gln Thr Als Gly Phe Thr Cys Gly Gly Asp Asn Val Gly‏ 20 15 ‎AGG AAA AGT GTA CAG 6 TAC CAG CAG AAG CCA CCG CAG GCC CCT G76 192‏ ‎Arg Lys Ser Val Gln Trp Tyr Glan Gln Lys Pro Pro Gln Ala Pro Val‏ 35 30 ‎CCC TCA GGG ATC CCT GCG CGA 240‏ كو ‎CTG GTC ATC TAT GCT GAC AGC GAA‏ ‎Leu Val Ile Tyr Ala Asp Ser Glu Arg Fro Ser Gly Ile Pro Ala Arg‏ ‎Ss 60‏ 50 45 ‎TTC TCT GGC TCC AAC TCA GCG AAC ACC GCC ACC CTG ACC ATC AGC GGG 288‏ ‎Phe Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr lle Ser Gly‏ ‎Te‏(vi) Source ad!: (a) Organism: monkey (vidi) Location in genome: 0 (chromosome/segment: Jaa heavy chain variant of 191 (ix) Traits: ( a) name/key: CDS (b) locus: A + $ (ix) traits: (‘) name/key: peptide-mature (b) locus: TY PAY (xi ) Relay Description: Relay Marking No.: 7: CTG CIC CIC GGC CIC CTT GCT CAC TIT ACA 48 and 2 ACC ATG GCC TGG GCT Met Ala Trp Ala Leu Leu Leu Leu Gly Leu Leu Ala Kis Phe Thr 5 - 10« 15« 19- AGT CAG CCT CGC TCA GTG TCC GIG 96 A GAC TCT GCG GCC TCC TAT GAG Asp Ser Ala Ala Ser Tyr Glu Leu Ser Gla Pro Arg Ser Val Ser Val 5 1 TCC CCA GGA CAG ACG GCC GGG TIC ACC TCT GGG GGA GAC AAC GIT GGA 144 Ser Pro Gly Gln Thr Als Gly Phe Thr Cys Gly Gly Asp Asn Val Gly 20 15 AGG AAA AGT GTA CAG 6 TAC CAG CAG AAG CCA CCG CAG GCC CCT G76 192 Arg Lys Ser Val Gln Trp Tyr Glan Gln Lys Pro Pro Gln Ala Pro Val 35 30 CCC TCA GGG ATC CCT GCG CGA 240 KU CTG GTC ATC TAT GCT GAC AGC GAA Leu Val Ile Tyr Ala Asp Ser Glu Arg Fro Ser Gly Ile Pro Ala Arg Ss 60 50 45 TTC TCT GGC TCC AAC TCA GCG AAC ACC GCC ACC CTG ACC ATC AGC GGG 288 Phe Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr lle Ser Gly Te

AYAY

65 70 7565 70 75

GTC GAG GCC GGG GAT GAG GCT GAC TAT TAC IGT CAG GTG TGG GAC AGT 336 val Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Glu Val Trp Asp Ser 80 85 90GTC GAG GCC GGG GAT GAG GCT GAC TAT TAC IGT CAG GTG TGG GAC AGT 336 val Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Glu Val Trp Asp Ser 80 85 90

ACT GCT GAT CAT TGG GTC TTC GGC GGA GGG ACC 06 CTG ACC ‏ع‎ CTA 384ACT GCT GAT CAT TGG GTC TTC GGC GGA GGG ACC 06 CTG ACC P CTA 384

Thr Ala Asp His Trp Val Phe Gly Gly Gly Thr Arg Leu Thr Val Leu 9S 100 185Thr Ala Asp His Trp Val Phe Gly Gly Gly Thr Arg Leu Thr Val Leu 9S 100 185

GGT 38?GGT38?

Gly $6 ‏رقم‎ ai] i ‏أ ( بيانات خاصة بتتابع‎ ) ‏مميزات التتابع:‎ 0 ‏حمض أميني‎ ١ YA: J shall (') ‏(ب) التوع: حمض أميتي‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: بروتين‎ (id) : 4 ‏التتابع: تتابع تمييز رقم:‎ “ag (xi)Gly $6 No. ai] i A (sequence data) Characteristics of the sequence: 0 amino acid 1 YA: J shall (') (b) Speciation: amino acid (d) morphology: Linear Molecule Type: Protein (id) : 4 Sequence: Recognition Sequence No.: “ag (xi)

Met Ala Trp Ala Leu Leu Leu Leu Gly Leu Leu Ala His Phe Thr Asp «19 -5 -0 «5Met Ala Trp Ala Leu Leu Leu Leu Gly Leu Leu Ala His Phe Thr Asp «19 -5 -0 «5

Ser Ala Ala Ser Tyr Glu Leu Ser Gln Pro Arg Ssr Val Ser Val Ser 1 5 10Ser Ala Ala Ser Tyr Glu Leu Ser Gln Pro Arg Ssr Val Ser Val Ser 1 5 10

Pro Gly Gln Thr Ala Gly Phe Thr Cys Gly Gly Asp Asn Val Gly ArgPro Gly Gln Thr Ala Gly Phe Thr Cys Gly Gly Asp Asn Val Gly Arg

Lys Ser Val Gln Trp 7 Gln Gln Lys Pro Pro Gla Ala Pro Val LeuLys Ser Val Gln Trp 7 Gln Gln Lys Pro Pro Gla Ala Pro Val Leu

Jo 35 40 45 val Ile Tyr Ala Asp Ser Glu Arg Pro Ser Gly Ile Pro Ala Arg Phe 60Jo 35 40 45 val Ile Tyr Ala Asp Ser Glu Arg Pro Ser Gly Ile Pro Ala Arg Phe 60

Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Val 65 70 75Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Val 65 70 75

Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Ser Thr 80 8s 90Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Ser Thr 80 8s 90

Ala Asp His Trp 1 Phe Gly Gly Gly Thr Arg Leu Thr Val Leu Gly 95 100 105 1.1Ala Asp His Trp 1 Phe Gly Gly Gly Thr Arg Leu Thr Val Leu Gly 95 100 105 1.1

AAAA

‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ 70١7 ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏المصدر الأصلي:‎ (vi) (Homo Sapiens) ‏(أ) الكائن الحي: الإنسان‎ ‏الموقع في المجين:‎ (vii) 089.1 ‏متغير وثابت من نوع لتتمندا في‎ Jin ‏(أ) كروموسوم/قطعة:‎ ‏السمات:‎ (ix)Data for the discrimination sequence No. (7) Characteristics of the sequence: (i) Base pair 7017 (a) Length: (b) Type: nucleic acid (c) How to splice: Single-stranded D ) 089.1 variable and constant of the type of Litamanda in Jin (a) chromosome/segment: Traits: (ix)

CDS ‏(أ) الاسم/المفتاح: سي دي إس‎ ٠٠١١٠١١ ‏(ب) الموقع:‎ ‏السمات:‎ (ix) ‏الاسم/المفتاح: ببتيد-ناضج‎ )( ٠٠١7٠١7 ‏(ب) الموقع:‎ 10 ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)CDS (a) name/key: CDS 0011011 (b) locus: traits: (ix) name/key: peptide-mature) ( 0017017 (b) locus: 10 description Relay: Relay Recognition No.: (xi)

ATG GCC TGG GCT CIG CTG CTC CIC GGC CTC CIT GCT CAC TIT ACA GAC 48ATG GCC TGG GCT CIG CTG CTC CIC GGC CTC CIT GCT CAC TIT ACA GAC 48

Net Ala Trp Ala Leu Leu Leu Leu Gly Leu Leu Ala His Phe Thr AspNet Ala Trp Ala Leu Leu Leu Leu Gly Leu Leu Ala His Phe Thr Asp

TaTa

حم 10 5 1 ‎TCT GCS GCC TCC TAT GAG TTG AGT CAG CCT CGC TCA 16 TCC GTG TCC 96‏ ‎Ser Ala Ala Ser Tyr Glu Leu Ser Gln Pro Arg Ser Val Ser Val Ser‏ 25 20 ‎CCA GGA CAG ACG GCC GGG TTC ACC TGT GGG GGA GAC AAC GTT GGA AGG 144‏ ‎Pro Gly Gla Thr Ala Gly Phe Thr Cys Gly Gly Asp Asn Val Gly Arg‏ ‎as 40 45‏ ‎AAA AGT GTA CAG TGG TAC CAG CAG AAG CCA CCG CAG GCC CCT 636 CI6 192‏ ‎Lys Ser Val Gla Trp Tyr Gln Gln Lys Pro Pro Gln Ala Pro Val Leu‏ 60 55 50 ‎GTC ATC TAT GCT GAC AGC GAA CGG CCC TCA GGG ATC CCT GCG CGA TIC 240‏ ‎Val Ile Tyr Ala Asp Ser Glu Arg Pro Ser Gly Ile Pro Ala Arg Phe‏ 80 75 70 65 ‎TCT GGC TCC AAC TCA GGG AAC ACC GCC ACC CTG ACC ATC AGC GGG GTC 288‏ ‎Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Val‏ 95 90 85 ‎GCC GGG GAT GAG GCT GAC TAT TAC TGT CAG GIG TCG GAC AGT ACT 336‏ عن ‎Glu Ala Gly Asp Glu Ala Asp Tyz Tyr Cys Gla Val Trp Asp Ser Thr‏ 1160 105 100 ‎GCT GAT CAT TGG CTC TIC GGC GGA GGG ACC CG CIG ACC GTC CTA GGT 384‏ ‎Ala Asp His Trp Val Phe Gly Gly Gly Thr Arg Leu Thr Val Leu Gly‏ 125 : 120 115 ‎GTC ACT CTG TTC CCG CCC TCC TCT GAG 432‏ قف ‎CAG CCC AAG GCT GCC CCC‏ ‎Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Sar Glu‏ 240 138 130 ‎GAG CTT CAA GCC AMC AAG GCC ACA CTG GTG TGT CTC ATA AGT GAC TTC 480‏ ‎Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu lle Ser Asp Phe‏ 160 155 150 145 ‎TAC CCG GGA GCC GTG ACA GTG GCC TGS AAG GCA GAT AGC AGC CCC GTC 528‏ ‎Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val‏ 178 170 165 ‎AAG GCG GGA GTG GAG ACC ACC ACA CCC TCC AAA CAA AGC AAC AAC AAG 576‏ ‎Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Glan Ser Asn Asn Lys‏ 190 185 180 ‎TAC GCG GCC AGC AGC TAC CTG AGC CTG ACG CCT GAG CAG TGG AAG TCC 624‏ ‎Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Tzp Lys Ser‏ 205 200 15 ‎CAC ACA AGC TAC AGC TGC CAG GTC ACG CAT GAA GGG AGC ACC GTG GAG 672‏ ‎His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu‏ 220 21% 210 ‎AAG ACA GTG GCC CCT ACA GAA TGT TCA TGA 702‏ ‎Lys Thr Val Ala Pro Thr Glu Cys Ser °*‏ 230 225 ‎Te‏ q.Ham 10 5 1 TCC TAT GAG TTG AGT CAG CCT CGC TCA 16 TCC GTG TCC 96 Ser Ala Ala Ser Tyr Glu Leu Ser Gln Pro Arg Ser Val Ser Val Ser 25 20 CCA GGA CAG ACG GCC GGG TTC ACC TGT GGG GGA GAC AAC GTT GGA AGG 144 Pro Gly Gla Thr Ala Gly Phe Thr Cys Gly Gly Asp Asn Val Gly Arg as 40 45 AAA AGT GTA CAG TGG TAC CAG CAG AAG CCA CCG CAG GCC CCT 636 CI6 192 Lys Ser Val Gla Trp Tyr Gln Gln Lys Pro Pro Gln Ala Pro Val Leu 60 55 50 GTC ATC TAT GCT GAC AGC GAA CGG CCC TCA GGG ATC CCT GCG CGA TIC 240 Val Ile Tyr Ala Asp Ser Glu Arg Pro Ser Gly Ile Pro Ala Arg Phe 80 75 70 65 TCT GGC TCC AAC TCA GGG AAC ACC GCC ACC CTG ACC ATC AGC GGG GTC 288 Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Val 95 90 85 GCC GGG GAT GAG GCT GAC TAT TAC TGT CAG GIG TCG GAC AGT ACT 336 About Glu Ala Gly Asp Glu Ala Asp Tyz Tyr Cys Gla Val Trp Asp Ser Thr 1160 105 100 GCT GAT CAT TGG CTC TIC GGC GGA GGG ACC CG CIG ACC GTC CTA GGT 384 Ala Asp His Trp Val Phe Gly Gly Gly Thr Arg Leu Thr Val Leu Gly 125 : 120 115 GTC ACT CTG TTC CCG CCC TCC TCT GAG 432 Stop CAG CCC AAG GCT GCC CCC Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Sar Glu 240 138 130 GAG CTT CAA GCC AMC AAG GCC ACA CTG GTG TGT CTC ATA AGT GAC TTC 480 Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu lle Ser Asp Phe 160 155 150 145 ‎TAC CCG GGA GCC GTG ACA GTG GCC TGS AAG GCA GAT AGC AGC CCC GTC 528 Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val 178 170 165 AAG GCG GGA GTG GAG ACC ACC ACA CCC TCC AAA CAA AGC AAC AAC AAG 576 Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Glan Ser Asn Asn Lys 190 185 180 TAC GCG GCC AGC AGC TAC CTG AGC CTG ACG CCT GAG CAG TGG AAG TCC 624 Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Tzp Lys Ser 205 200 15 CAC ACA AGC TAC AGC TGC CAG GTC ACG CAT GAA GGG AGC ACC GTG GAG 672 His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu 220 21% 210 AAG ACA GTG GCC CCT ACA GAA TGT TCA TGA 702 Lys Thr Val Ala Pro Thr Glu Cys Ser °* 230 225 Te q.

HI ‏بيانات خاصة بتتابع التمييز رقم‎ (Y ) ‏مميزات التتابع:‎ 0 sad ‏(أ) الطول: 777 حمض‎ ‏(ب) النوع: حمض أميني‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: بروتين‎ (ii)HI Data for Discrimination Sequence Number (Y) Characteristics of the sequence: 0 sad (a) Length: 777 acids (b) Type: amino acid (d) Format: linear Molecule type: protein (ii)

Ha ‏رقم‎ iad ‏وصف التتابع: تتابع‎ (xi)Ha iad number Relay description: Relay (xi)

Met Ala Trp Ala Leu Leu Leu Leu Gly Leu Leu Ala His Phe Thr Asp 1 5 10 13Met Ala Trp Ala Leu Leu Leu Leu Gly Leu Leu Ala His Phe Thr Asp 1 5 10 13

Ser Ala Ala Ser Tyr Glu Leu Ser Gln Pro Arg Ser Val Ser Val SerSer Ala Ala Ser Tyr Glu Leu Ser Gln Pro Arg Ser Val Ser Val Ser

Pro Gly Gln Thr Ala Gly Phe Thr Cys Gly Gly Asp Asn Val Gly Arg am An aRPro Gly Gln Thr Ala Gly Phe Thr Cys Gly Gly Asp Asn Val Gly Arg am An aR

Lys Ser Val Gln Trp Tyr Gln Gln Lys Pro Pro Gln Ala Pro Val Leu 60Lys Ser Val Gln Trp Tyr Gln Gln Lys Pro Pro Gln Ala Pro Val Leu 60

Val Ile Tyr Ala Asp Ser Glu Arg Pro Ser Gly Ile Pro Ala Arg Fhe 65 70 75 80Val Ile Tyr Ala Asp Ser Glu Arg Pro Ser Gly Ile Pro Ala Arg Fhe 65 70 75 80

Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly val 85 90 95Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly val 85 90 95

Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Ser Thr 100 103 110Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Ser Thr 100 103 110

Als Asp His Trp Val Phe Gly Gly Gly Thr Arg Leu Thr Val Leu Gly 115 129 125Als Asp His Trp Val Phe Gly Gly Gly Thr Arg Leu Thr Val Leu Gly 115 129 125

Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu 130 135 140Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu 130 135 140

Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Fhe 145 150 - 155 160 © . Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val 165 170 175Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Fhe 145 150 - 155 160 © . Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val 165 170 175

Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys 180 185 190Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys 180 185 190

Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser 19% 200 205Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser 19% 200 205

His Arg Ser Tyr Ser Cys Gln val Thr His Glu Gly Ser Thr Val Glu 210 215 220His Arg Ser Tyr Ser Cys Gln val Thr His Glu Gly Ser Thr Val Glu 210 215 220

Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 a :7 ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ ٠404 ‏(أ) الطول:‎ ‏حمض نووي‎ ig sill ‏(ب)‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (ii) ‏الموقع في المجين:‎ (viii) ‏؛‎ Lala ‏متغيرة وثابتة من نوع‎ ALD ‏(أ) كروموسوم/قطعة: منطقة سلسلة‎ ‏السمات:‎ (ix)Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 a : 7 Recognition Sequence Data: (Y) Sequence Characteristics: (i) Base Pair 0404 (a) Length: nucleic acid ig sill (b) (c) how to splice: single-stranded (d) morphology: linear type of molecule: DNA (genomic) (ii) location in the genome: (viii); Lala Variable and fixed type ALD (a) chromosome/segment: trait chain region: (ix)

CDS ‏الاسم/المفتاح: سي دي إس‎ (0 ٠٠١٠04 ‏(ب) الموقع:‎ ‏السمات:‎ (ix) ‏(أ) الاسم/المفتاح: ببتيد-ناضج‎ ٠٠١٠464 ‏(ب) الموقع:‎ ‏وصف التتابع: تتابع تمييز رقم: ل:‎ (xi)CDS Name/key: CDS (0 001004) (b) Locator: Traits: (ix) (a) Name/key: 0010464-mature-peptide (b) Locator: Sequence description : Relay Recognition No.: for: (xi)

ATC AAA CAC CTG TCG TTC TTC CIC CTC ‏وك‎ GTG GCA GCC CCC AGA TG6 48ATC AAA CAC CTG TCG TTC TTC CIC CTC WAC GTG GCA GCC CCC AGA TG6 48

Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15

GTC TTG TCC CAG GIG CAG CTG CAG GAG TCG GGC CCA GGA ‏و2‎ 262 AAG 96 val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val LysGTC TTG TCC CAG GIG CAG CTG CAG GAG TCG GGC CCA GGA 2 262 AAG 96 val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys

CCT TCC GAG ACC CTG TCC CTC ACC TGC AGT GTC TCT GGT GGC TCC ATC 144CCT TCC GAG ACC CTG TCC CTC ACC TGC AGT GTC TCT GGT GGC TCC ATC 144

Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser Ile as 40 45Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser Ile as 40 45

AGC GGT GAC TAT TAT TGG TTC TGG ATC CGC CAG TCC CCA GGG ARG GGA 192AGC GGT GAC TAT TAT TGG TTC TGG ATC CGC CAG TCC CCA GGG ARG GGA 192

Ser Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys Gly 60Ser Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys Gly 60

CTG GAG TGG ATC GGC TAC ATC TAT GGC AGT GGT GGG GGC ACC AAT TAC 240CTG GAG TGG ATC GGC TAC ATC TAT GGC AGT GGT GGG GGC ACC AAT TAC 240

Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn TyrLeu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn Tyr

TeTe

بل 80 75 70 65 ‎AAT CCC TCC CTC AAC AAT CGA GTC TCC ATT ICA ATA GAC ACG TCC ANG 28s‏ ‎Asn Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys‏ 95 90 85 ‎ACC GCC GCG GAC ACG GCC 3136‏ وو ‎AC CIC ITC TCC CTC AAA CTG AGG ICT‏ ‎Asa Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Als Ala Asp Thr Ala‏ 110 105 100 ‎GTC TAT TAC TGT GCG AGT AAT ATA TTG AAA TA? CTT CAC TGC TIA TTA 184‏ ‎Val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Les His Trp Leu Leu‏ 125 120 115 ‎GTC TCC TCA GCT AGC ACC AAG 432‏ وعد ‎GGC CAG GGA GTC CIG‏ مد ‎TAC‏ ‎Tyr Trp Gly Gla Gly Val Leu Val Thr Val Sex Ser Ala Ser Thr Lys‏ 140 135 130 ‎GCG CCC TGC TCC AGS AGC ACC TCC GAG 430‏ مد ‎GGC CCA TCC GTC TIC CCC‏ ‎Gly Pro Sar Val Phe Pro Leu Ala Pro.Cys Ser Arg Ser Thr Ser Glu‏ " 160 135 150 143 ‎AGC ACA GCC GCE €2G GGC TGC CTS GTC AAG GAC TAC TIC CCC GAA CCG 328‏ ‎Ser Thr Ala Ale Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro‏ 175 170 165 ‎GTG TCG TGG AAC TCA GGC GCC 6 ACC AGC GGC GTG CAC ACC 576‏ وعد ‎GTC‏ ‎Val Tor Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr‏ 190 185 180 ‎TAC TCC CTC AGC AGC 6 624‏ عد ‎TTC CCG GCT GTC CTA CAG TCC TCA GGA‏ ‎Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val‏ 205 200 193 ‎ACG AAG ACC TAC ACC TGC AMC 672‏ عد ‎GTG ACC CTG CCC TCC AGC AGC TTG‏ ‎Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn‏ 220 215 210 ‎GTA GAT CAC ARG CCC AGC AAC ACC MAG GTG GAC AAG AGA GTT GAG TCC 720‏ ‎Val Asp Eis Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser‏ 240 235 230 225 ‎AMA TAT GGT CCC CCA TGC GCA TCA TGC CCA GCA CCT GAG TIC CTG GGG 768‏ ‎Lys Tyr Gly Pro Pro Cys Pre Ser Cys Pro Ala Pro Glu Phe Leu Gly‏ 255 250 245 ‎TTC CCC CCA AAA CCC AAG GAC ACT CIC ATG 816‏ وده ‎GGA CCA TCA GIC TIC‏ ‎Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met‏ 270 265 260 ‎ATC TCC CGG ACC CCT GAG GTC ACG TGC GTG 016 GIG GAC GTG MGC CAG 864‏ ‎Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln‏ 28% 290 273 ‎GAA GAC CCC GAG GTC CAG TIC AAC 7GG TAC 016 GAT GGC GTG GAG GIG 912‏ ‎Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val‏ 300 295 290 ‎CAT AAT GCC AAG ACA MAG CCG CGG GAG GAG CAG TTC AAC AGC ACG TAC 960‏ ‎His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr‏ ‎30s 310 315 . 320‏ ‎CGT GTG GTC AGC GTC CTC ALC GTC CTG CAC CAG GAC TGG CTG AAC GGC 1008‏ ‎Arg Val val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly‏ 335 330 325 ‎AAG GAG TAC AAG TGC AAG GTC TCC AAC AAR GGC CTC CCG TCC TCC ATC 1056‏ ‎Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile‏ 350 145 340 ‎GAG AAA ACC ATC TCC AAA GCC AMA GGG CAG CCC CGA GAG CCA CAG GTG 1104‏ ‎Glu Lys Thr Ile Ser Lys Ala Lys Gly Gla Pro Arg Glu Pro Gln val‏ 365 380 355 ‎TAC ACC CTG CCC CCA TCC CAG GAG GAG ATG ACC AAG AAC CAG GTC AGC 1152‏ ‎Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser‏ 380 175 3170 ‎ACC TGC CTG GTC AAA CGC TTC TAC CCC AGC GAC ATC GCC 016 GAG 1200‏ وى ‎Tel‏BEL 80 75 70 65 AAT CCC TCC CTC AAC AAT CGA GTC TCC ATT ICA ATA GAC ACG TCC ANG 28s Asn Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 95 90 85 ACC GCC GCG GAC ACG GCC 3136 Wu AC CIC ITC TCC CTC AAA CTG AGG ICT Asa Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Als Ala Asp Thr Ala 110 105 100 GTC TAT TAC TGT GCG AGT AAT ATA TTG AAA TA? CTT CAC TGC TIA TTA 184 Val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Les His Trp Leu Leu 125 120 115 GTC TCC TCA GCT AGC ACC AAG 432 Promise GGC CAG GGA GTC CIG D TAC Tyr Trp Gly Gla Gly Val Leu Val Thr Val Sex Ser Ala Ser Thr Lys 140 135 130 GCG CCC TGC TCC AGS AGC ACC TCC GAG 430 D GGC CCA TCC GTC TIC CCC Gly Pro Sar Val Phe Pro Leu Ala Pro.Cys Ser Arg Ser Thr Ser Glu " 160 135 150 143 AGC ACA GCC GCE €2G GGC TGC CTS GTC AAG GAC TAC TIC CCC GAA CCG 328 Ser Thr Ala Ale Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro 175 170 165 GTG TCG TGG AAC TCA GGC GCC 6 ACC AGC GGC GTG CAC ACC 576 Promise GTC Val Tor Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr 190 185 180 TAC TCC CTC AGC AGC 6 624 count TTC CCG GCT GTC CTA CAG TCC TCA GGA Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val 205 200 193 ACG AAG ACC TAC ACC TGC AMC 672 Count GTG ACC CTG CCC TCC AGC AGC TTG Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn 220 215 210 GTA GAT CAC ARG CCC AGC AAC ACC MAG GTG GAC AAG AGA AGA GTT GAG TCC 720 Val Asp Eis Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser 240 235 230 225 AMA TAT GGT CCC CCA TGC GCA TCA TGC CCA GCA CCT GAG TIC CTG GGG 768 Lys Tyr Gly Pro Pro Cys Pre Ser Cys Pro Ala Pro Glu Phe Leu Gly 255 250 245 TTC CCC CCA AAA CCC AAG GAC ACT CIC ATG 816 GGA CCA TCA GIC TIC Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 270 265 260 ATC TCC CGG ACC CCT GAG GTC ACG TGC GTG 016 GIG GAC GTG MGC CAG 864 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln 28% 290 273 GAA GAC CCC GAG GTC CAG TIC AAC 7GG TAC 016 GAT GGC GTG GAG GIG 912 Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 300 295 290 CAT AAT GCC AAG ACA MAG CCG CGG GAG GAG CAG TTC AAC AGC ACG TAC 960 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr 30s 310 315 . 320 CGT GTG GTC AGC GTC CTC ALC GTC CTG CAC CAG GAC TGG CTG AAC GGC 1008 Arg Val val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 335 330 325 AAG GAG TAC AAG TGC AAG GTC TCC AAC AAR GGC CTC CCG TCC TCC ATC 1056 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile 350 145 340 GAG AAA ACC ATC TCC AAA GCC AMA GGG CAG CCC CGA GAG CCA CAG GTG 1104 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gla Pro Arg Glu Pro Gln val 365 380 355 TAC ACC CTG CCC CCA TCC CAG GAG GAG ATG ACC AAG AAC CAG GTC AGC 1152 Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser 380 175 3170 ACC TGC CTG GTC AAA CGC TTC TAC CCC AGC GAC ATC GCC 016 GAG 1200 Wii Tel

Leu Thr Cys Lau Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 385 390 395 400Leu Thr Cys Lau Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 385 390 395 400

GG GAG AGC AAT GGG CAG CCG GAG AAC AAC TAC ANG ACC ACG CCT CCC 1248GG GAG AGC AAT GGG CAG CCG GAG AAC AAC TAC ANG ACC ACG CCT CCC 1248

Trp Glu Ser Asn Gly Gla Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 405 410 415Trp Glu Ser Asn Gly Gla Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 405 410 415

GTG CTG GAC TCC GAC GGC TCC TTC TIC CIC TAC AGC AGG CTA ACC GIG 126GTG CTG GAC TCC GAC GGC TCC TTC TIC CIC TAC AGC AGG CTA ACC GIG 126

Val Leu Asp Ser Asp Gly Ser The Phe Leu Tyr Ser Arg Leu Thr Val 420 423 430Val Leu Asp Ser Asp Gly Ser The Phe Leu Tyr Ser Arg Leu Thr Val 420 423 430

GAC AAG AGC AGG TGG CAG GAG GGG AAT GTC TIC TCA TGC TCC GIG ATG 1344GAC AAG AGC AGG TGG CAG GAG GGG AAT GTC TIC TCA TGC TCC GIG ATG 1344

Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met 435 449 445Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met 435 449 445

CAT GAG GCT CIG CAC AAC CAC TAC ACA CAG AAG AGC CTC TCC CTG TCT 1382CAT GAG GCT CIG CAC AAC CAC TAC ACA CAG AAG AGC CTC TCC CTG TCT 1382

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 455 460His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 455 460

CTG GGT AAA TGA - 1404CTG GGT AAA TGA - 1404

Leu Gly Lys * 463Leu Gly Lys * 463

PA ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ 0) ‏الطول: ١731؛ حمض أميني‎ (0 ‏أميني‎ aad ‏(ب) النوع:‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: بروتين‎ (ii)PA Data for Discrimination Sequence No: (Y) Sequence Characteristics: 0) Length: 1731; Amino Acid (0 amino aad (b) Type: (d) Formwork: Linear Molecule Type: Protein (ii)

A ‏وصف التتابع: تتابع تمييز رقم:‎ (xi) ‏تمأ‎A Description of the sequence: Recognition sequence number: (xi) complete

Met Lys Ris Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 ‏د‎ 10 15 val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val LysMet Lys Ris Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 d 10 15 val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys

Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser IlePro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser Ile

Ser Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys Gly 60Ser Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys Gly 60

Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asa Tyr 65 70 : 15 80Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asa Tyr 65 70 : 15 80

Asn Pro Sar Leu Asn Asn Arg val Ser Ile Ser Ile Asp Thr Ser Lys 85 90 95Asn Pro Sar Leu Asn Asn Arg val Ser Ile Ser Ile Asp Thr Ser Lys 85 90 95

Asn Leu Phe Ser Leu Lys Leu Arg Ser val Thr Ala Als Asp Thr Ala 100 105 1190Asn Leu Phe Ser Leu Lys Leu Arg Ser val Thr Ala Als Asp Thr Ala 100 105 1190

Val Tyr Tyr Cys Ala Ser Asn Ile Lau Lys Tyr Leu His Trp Leu Lau 118 120 125Val Tyr Tyr Cys Ala Ser Asn Ile Lau Lys Tyr Leu His Trp Leu Lau 118 120 125

Tyr Trp Gly Gla Gly Val Leu Val Thr Val Ser Ser Ala Ser Thr Lys 130 138 140Tyr Trp Gly Gla Gly Val Leu Val Thr Val Ser Ser Ala Ser Thr Lys 130 138 140

Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu 145 150 155 160Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu 145 150 155 160

Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro 165 170 175Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro 165 170 175

Val Thr Val Ser Tzp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr 180 185 190Val Thr Val Ser Tzp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr 180 185 190

Fhe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val 195 : 200 205Fhe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val 195 : 200 205

Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn 210 225 220Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn 210 225 220

Val Asp His Lys Pro Ser Asa Thr Lys Val Asp Lys Arg Val Glu Ser 225 230 235 240Val Asp His Lys Pro Ser Asa Thr Lys Val Asp Lys Arg Val Glu Ser 225 230 235 240

Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Lsu Gly 245 250 258Lys Tyr Gly Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Lsu Gly 245 250 258

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 260 265 270Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 260 265 270

Ils Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln 275 280 285Ils Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln 275 280 285

Glu Asp Pro Glu Val Gln Phe Aan Trp Tyr Val Asp Gly Val Glu Val 250 293 300Glu Asp Pro Glu Val Gln Phe Aan Trp Tyr Val Asp Gly Val Glu Val 250 293 300

His Ash Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr TyrHis Ash Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr

Jos 310 315 320Jos 310 315 320

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 325 330 335Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 325 330 335

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile 340 345 350Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile 340 345 350

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 355 360 365Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 355 360 365

Tyr Thr Leu Pro Pro Sec Gln Glu Glu Met Thr Lys Asn Gln Val Ser 370 37s 330Tyr Thr Leu Pro Pro Sec Gln Glu Glu Met Thr Lys Asn Gln Val Ser 370 37s 330

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 385 390 395 400Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 385 390 395 400

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 405 410 418 val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val 420 425 430Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 405 410 418 val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val 420 425 430

Asp Lys Ser Arg Trp Gla Glu Gly Asn Val Phe Ser Cys Ser Val Met 435 449 445Asp Lys Ser Arg Trp Gla Glu Gly Asn Val Phe Ser Cys Ser Val Met 435 449 445

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 485 460His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 485 460

Leu Gly Lys 465 :4 ‏بيانات خاصة بتتابع التمييز رقم؛‎ (¥ ) ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ ١5 ‏الطول:‎ (0 ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏ا‎Leu Gly Lys 465 : 4 Data for recognition sequence number; (¥) Characteristics of the sequence: (i) Base pair 15 Length: (0) (b) Type: nucleic acid (c) How Controversy: single strand a

‏الهيئة الشكلية: خحطي‎ (3) ‏نوع الجزيء: دنا (مجيني)‎ (i) : ‏المصدر الأصلي‎ (vi) ‏(أ) الكائن الحي: الإتسان‎ ‏في المجين:‎ ad gall (viii) [5 ‏من نوع جاما ؛ تحتوي على الطفرة‎ ALS ‏كروموسوم/قطعة: سلسلة‎ (1) ‏السمات:‎ (ix)Format: linear (3) Molecule type: DNA (genomic) (i): original source (vi) (a) Organism: homolog in the genome: ad gall (viii) [5 gamma type; Containing mutation ALS chromosome/segment: chain (1) trait: (ix)

CDS ‏الاسم/المفتاح: سي دي إس‎ (0 ٠١١46 ‏(ب) الموقع:‎ ‏السمات:‎ (ix) ‏(أ) الاسم/المفتاح: ببتيد--تاضج‎ ٠١١١4 ‏(ب) الموقع:‎ 4: ‏وصف التتابع: تتابع تمييز رقم‎ (xi)CDS Name/key: CDS (0 01146 (b) Position: Traits: (ix) (a) Name/key: Peptide-- maturation 01114 (b) Position: 4: Relay description: (xi) number recognition relay

ATG AAA CAC CTG TGG TTC TTC CTC CIC CIG GIG GCA GCC CCC AGA TGG 48ATG AAA CAC CTG TGG TTC TTC CTC CIC CIG GIG GCA GCC CCC AGA TGG 48

Met Lys His Leu Trp Phe Phe Lsu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15Met Lys His Leu Trp Phe Phe Lsu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15

GTC TTC TCC CAG GIG CAG CTC CAG GAG ‏وى‎ GGC CCA GGA CTC 26 AAG 96 avGTC TTC TCC CAG GIG CAG CTC CAG GAG Wii GGC CCA GGA CTC 26 AAG 96 av

Val Leu Ser Gln Val Gla Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 23 30Val Leu Ser Gln Val Gla Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 23 30

CCT TCG GAG ACC ‏وك‎ TCC CTC ACC TGC AGT GIC TCT GGT GGC TCC ATC 144CCT TCG GAG ACC TCC CTC ACC TGC AGT GIC TCT GGT GGC TCC ATC 144

Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser lle 35 40 45Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser lle 35 40 45

AGC GGT GAC TAT TAT TGG TIC ‏فو‎ ATC CGC CAG TCC CCA GGG MAG GGA 192AGC GGT GAC TAT TAT TGG TIC Fu ATC CGC CAG TCC CCA GGG MAG GGA 192

Ser Gly Asp Tyr Tyr Trp Phe rp Ile Arg Gln Ser Pro Gly Lys Gly 60Ser Gly Asp Tyr Tyr Trp Phe rp Ile Arg Gln Ser Pro Gly Lys Gly 60

CTG GAG TGG ATC GGC TAC ATC TAT GGC AGT GGT GGG GGC ACC AAT TAC 240CTG GAG TGG ATC GGC TAC ATC TAT GGC AGT GGT GGG GGC ACC AAT TAC 240

Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asa Tyr (1 70 75 80Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asa Tyr (1 70 75 80

ART CCC TCC CIC AAC AAT CGA GTC TCC ATT TCA ATA GAC ACG TCC ANG 288ART CCC TCC CIC AAC AAT CGA GTC TCC ATT TCA ATA GAC ACG TCC ANG 288

Asa Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 85 30 95Asa Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 85 30 95

AAC CTC TTC TCC CTC AAA ‏وى‎ AGG TCT GTC ACC GCC GCG GAC ACG GCC 336AAC CTC TTC TCC CTC AAA Wii AGG TCT GTC ACC GCC GCG GAC ACG GCC 336

Asn Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Als Asp Thr Ala 100 108 110Asn Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Als Asp Thr Ala 100 108 110

GTC TAT TAC TGT GCG AGT AAT ATA TTG AAA TAT CTT CAC TGG TTA TIA ki 23 val Tyr Tyr Cys Ala Ser Asn Ile Lsu Lys Tyr Leu His Trp Leu Leu 115 120 125GTC TAT TAC TGT GCG AGT AAT ATA TTG AAA TAT CTT CAC TGG TTA TIA ki 23 val Tyr Tyr Cys Ala Ser Asn Ile Lsu Lys Tyr Leu His Trp Leu Leu 115 120 125

TAC TGC GGC CAG GGA GTC CG 026 ACC GTC TCC TCA GCT AGC ACC ANG 432TAC TGC GGC CAG GGA GTC CG 026 ACC GTC TCC TCA GCT AGC ACC ANG 432

Tyr Trp Gly Gla Gly Val Leu Val Thr Val Ser Ser Ala Ser Thr Lys 130 135 : 140Tyr Trp Gly Gla Gly Val Leu Val Thr Val Ser Ser Ala Ser Thr Lys 130 135 : 140

GCG CCA TCC GTC TIC CCC CTG GCG CCC TGC TCC AGG AGC ACC TCC GAG 430GCG CCA TCC GTC TIC CCC CTG GCG CCC TGC TCC AGG AGC ACC TCC GAG 430

Gly Pro Ser Val Phe Pro Leu Als Pro Cys Ser Arg Ser Thr Sex Glu 145 150 155 180Gly Pro Ser Val Phe Pro Leu Als Pro Cys Ser Arg Ser Thr Sex Glu 145 150 155 180

AGC ACA GCC GCC CTG GGC TGC CTG GTC AAG GAC TAC TTC CCC GAA cca 523AGC ACA GCC GCC CTG GGC TGC CTG GTC AAG GAC TAC TTC CCC GAA cca 523

Ser Thr Ala Ala Leu Gly Cys Lau Val Lys Asp Tyr Phe Pro Glu Pro 165 170 175 ‏وى‎ ACC GTG TCG TGG AAC TCA ‏عو‎ GCC CTU ACC AGC GGC GTG CAC ACC 576Ser Thr Ala Ala Leu Gly Cys Lau Val Lys Asp Tyr Phe Pro Glu Pro 165 170 175 Wee ACC GTG TCG TGG AAC TCA Aw GCC CTU ACC AGC GGC GTG CAC ACC 576

Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val Bis Thr 180 183 190Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val Bis Thr 180 183 190

TIC CCG GCT GTC CTA CAG TCC TCA GGA CTC TAC TCC CIC AGC AGC GTC 624TIC CCG GCT GTC CTA CAG TCC TCA GGA CTC TAC TCC CIC AGC AGC GTC 624

Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser val 195 200 205Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser val 195 200 205

GTC ACC GTG CCC TCC AGC AGC TTG GGC ACG AAG ACC TAC ACC TGC ANC 672 val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asa 210 215 220GTC ACC GTG CCC TCC AGC AGC TTG GGC ACG AAG ACC TAC ACC TGC ANC 672 val Thr Val Pro Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asa 210 215 220

GTA GAT CAC AAG CCC AGC AAC ACC AAG GTG GAC AAG AGA GTT GAG TCC 720GTA GAT CAC AAG CCC AGC AAC ACC AAG GTG GAC AAG AGA GTT GAG TCC 720

Val Asp Nis Lys Pro Ser Asn Thr Lys Val Asp Lys Arg val Glu Ser 225 230 238 240Val Asp Nis Lys Pro Ser Asn Thr Lys Val Asp Lys Arg val Glu Ser 225 230 238 240

AAA TAT GGT CCC CCA TGC CCA TCA TGC CCA GCA CCT GAG TIC GAG GGG 768AAA TAT GGT CCC CCA TGC CCA TCA TGC CCA GCA CCT GAG TIC GAG GGG 768

Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Glu Gly 243 250 255Lys Tyr Gly Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Glu Gly 243 250 255

GGA CCA TCA GTC TIC CIG TTC CCC CCA MA CCC AMG GAC ACT CTC ATG 816GGA CCA TCA GTC TIC CIG TTC CCC CCA MA CCC AMG GAC ACT CTC ATG 816

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 260 265 270Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 260 265 270

ATC TCC ‏مع‎ ACC CCT GAG GTC ACG TGC GTG GIG 016 GAC GTG AGC CAG 864ATC TCC WITH ACC CCT GAG GTC ACG TGC GTG GIG 016 GAC GTG AGC CAG 864

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln 275 280 285Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln 275 280 285

GAA eae CCC GAS CTC CAG TTC AAC 06 TAC CTC GAT ‏عم‎ GIG GAG GTG 912GAA eae CCC GAS CTC CAG TTC AAC 06 TAC CTC GAT Uncle GIG GAG GTG 912

Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 290 29% 300Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 290 29% 300

CAT AAT GCC AAG ACA ARG CCG CGG GAG GAG CAG TTC AAC AGC ACG TAC 960CAT AAT GCC AAG ACA ARG CCG CGG GAG GAG CAG TTC AAC AGC ACG TAC 960

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr 308 310 315 320His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr 308 310 315 320

CGT GIG GTC AGC GTC CIC ACC GTC CIG CAC CAG GAC TGG CTIG AAC GGC 1008CGT GIG GTC AGC GTC CIC ACC GTC CIG CAC CAG GAC TGG CTIG AAC GGC 1008

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 125 336 3135Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 125 336 3135

م ‎AAG GAG TAC AAG TGC AAG GTC TCC AAC AMA GGC CTC CCG TCC TCC ATC 1056‏ ‎Lys Glu Tyr Lye Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile‏ 350 3145 340 ‎GAG AAA ACC ATC TCC AAA GCC MRA GGG CAG CCC CGA GAG CCA CAG 86 1104‏ ‎Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gla Vel‏ 36 350 355 ‎TAC ACC CTG CCC CCA TCC CAG GAG GAG ATG ACC AAG AMC ‘ CAG CTC MC 1152‏ ‎Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser‏ 1380 375 3720 ‎GTC AAA GGC TTC TAC CCC AGC GAC ATC GCC 26 GAG 1200‏ ون ‎CTG ACC TGC‏ ‎Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ils Ala Val Glu‏ 400 195 390 : 385 ‎TCG GAG AGC AAT GGG CAG CCG.M AAG GAG TAC AAG TGC AAG GTC TCC AAC AMA GGC CTC CCG TCC TCC ATC 1056 Lys Glu Tyr Lye Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile 350 3145 340 GAG AAA ACC ATC TCC AAA GCC MRA GGG CAG CCC CGA GAG CCA CAG 86 1104 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gla Vel 36 350 355 TAC ACC CTG CCC CCA TCC CAG GAG GAG ATG ACC AAG AMC 'CAG CTC MC 1152 Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser 1380 375 3720 GTC AAA GGC TTC TAC CCC AGC GAC ATC GCC 26 GAG 1200 N CTG ACC TGC Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ils Ala Val Glu 400 195 390 : 385 TCG GAG AGC AAT GGG CAG CCG.

GAG AAC AAC TAC AAG ACC AMG CCT CCC 1248‏ ‎Trp Glu Ser Asa Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro‏ ‎40S 410 413‏ ‎GTC CTG GAC TCC GAC GGC TCC TIC TIC CTC TAC AGC AGG CTA ACC GIG + 1296‏ ‎Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val‏ 430 423 420 ‎CAC AAG AGC AGG TGG CAG GAG GGG AAT GTC TIC TCA TGC TCC GIG AIG 1344‏ ‎Trp Gla Glu Gly Asn Val Phe Ser Cys Ser Val Net‏ وعد ‎Asp Lys Ser‏ 445 440 435 ‎CAT GAG OCT CTG CAC AAC CAC TAC ACA CAG AAG ACC CIC TCC CT6¢ TCT 1392‏ ‎Ser Leu Ser‏ يفط ‎His Glu Ala Leu Eis Asn His Tyr Thr Glo Lys Ser‏ 460 433 450 ‎CTG GGT AAA TGA 1404‏ ‎Leu Gly Lys *‏ 465 ‎(Y)‏ بيانات خاصة بتتابع التمييز رقم: ‎:٠١‏ ‏0 مميزات التتابع : (ب) النوع: حمض أميني (د) الهيئة الشكلية: خطي (نن) نوع الجزيء: بروتين أGAG AAC AAC TAC AAG ACC AMG CCT CCC 1248 Trp Glu Ser Asa Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 40S 410 413 GTC CTG GAC TCC GAC GGC TCC TIC TIC CTC TAC AGC AGG CTA ACC GIG + 1296 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val 430 423 420 CAC AAG AGC AGG TGG CAG GAG GGG AAT GTC TIC TCA TGC TCC GIG AIG 1344 Trp Gla Glu Gly Asn Val Phe Ser Cys Ser Val Net Promise Asp Lys Ser 445 440 435 CAT GAG OCT CTG CAC AAC CAC TAC ACA CAG AAG ACC CIC TCC CT6¢ TCT 1392 Ser Leu Ser Wet His Glu Ala Leu Eis Asn His Tyr Thr Glo Lys Ser 460 433 450 CTG GGT AAA TGA 1404 Leu Gly Lys * 465 (Y) Discrimination Sequence Data No.: 01 0 Sequence Characteristics: (b) Type: Acid Amino (d) Formal form: linear (Nn) Molecule type: protein a

:٠١ ‏وصف التتابع: تتابع تمييز رقم:‎ (xi):01 Sequence Description: Sequence Recognition No.: (xi)

Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15

Val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val LysVal Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys

Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser Ile 3s 40 45Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser Ile 3s 40 45

Ser Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys Gly . 30 55 60Ser Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys Gly. 30 55 60

Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn Tyr 63 10 75 80Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn Tyr 63 10 75 80

Asn Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 85 90 95 -Asn Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 85 90 95 -

Asn Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala 100 105 110 val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Leu Kis Trp Leu Leu 1135 120 125Asn Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala 100 105 110 val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Leu Kis Trp Leu Leu 1135 120 125

Tyr Trp Gly Gln Gly Val Leu Val Thr Val Ser Ser Ala Ser Thr Lys 130 138 140Tyr Trp Gly Gln Gly Val Leu Val Thr Val Ser Ser Ala Ser Thr Lys 130 138 140

Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu 145 150 155 160Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu 145 150 155 160

Ser Thr Ala Ala Leu Gly Cys Lau Val Lys Asp Tyr Phe Pro Glu Pro ‏يي‎Ser Thr Ala Ala Leu Gly Cys Lau Val Lys Asp Tyr Phe Pro Glu Pro Yi

Yoo 165 170 175Yoo165 170 175

Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr 180 185 190Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr 180 185 190

Fhe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val 195 200 208 val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn 210 213 220Fhe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val 195 200 208 val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn 210 213 220

Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser 225 230 238 240Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser 225 230 238 240

Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Glu Gly 245 230 255Lys Tyr Gly Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Glu Gly 245 230 255

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 260 265 220Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 260 265 220

Ile Ser Arg Thr Pro Glu val Thr Cys Val Val Val Asp Val Ser Gln 273 280 285Ile Ser Arg Thr Pro Glu val Thr Cys Val Val Val Asp Val Ser Gln 273 280 285

Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 250 295 300Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 250 295 300

His Asp Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr 305 310 315 320His Asp Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr 305 310 315 320

Arg Val Val Ser val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 32% 330 335Arg Val Val Ser val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 32% 330 335

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile 340 345 350Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile 340 345 350

Glu Lys Thr Ile Ser Lys Als Lys Gly Gln Pro Arg Glu Pro Gln Val 355 360 365Glu Lys Thr Ile Ser Lys Als Lys Gly Gln Pro Arg Glu Pro Gln Val 355 360 365

Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser 370 37% 380Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser 370 37% 380

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 385 390 393 400Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 385 390 393 400

Trp Glu Ser Ash Gly Glan Pro Glu Asn Asa 7 Lys Thr Thr Pro Pro 403 410 415Trp Glu Ser Ash Gly Glan Pro Glu Asn Asa 7 Lys Thr Thr Pro Pro 403 410 415

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val 420 25 430Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val 420 25 430

Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Mest 435 440 448Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Mest 435 440 448

His Glu Ala Leu His Asa Eis Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 455 460His Glu Ala Leu His Asa Eis Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 455 460

Leu Gly Lys 463 : :١١ ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏تأ“‎Leu Gly Lys 463 : : 11 Data for the Discrimination Sequence No.: (Y) TA’

٠١١ ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ ٠4٠04 ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏الهيئة الشكلية: خطي‎ )( ‏نوع الجزيء: دنا (مجيني)‎ i) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: الإنسان‎ ‏الموقع في المجين:‎ (viii)011 Characteristics of the sequence: (i) base pair 04004 (a) length: (b) type: nucleic acid (c) how to splice: single-stranded morphology: linear (type) Molecule: DNA (genome) i) Original source: (vi) (a) Organism: human Location in the genome: (viii)

E ‏(أ) كروموسوم/قطعة: سلسلة ثقيلة من نوع جاما ؛ تحتوي على الطفرة 8 و‎ ‏السمة:‎ (xi)E (a) chromosome/segment: gamma heavy chain; Have mutation 8 and trait: (xi)

CDS ‏(أ) الاسم/المفتاح: سي دي إس‎ ٠٠١٠٠4 ‏(ب) الموقع:‎ ‏السمة:‎ (ix) ‏الاسم/المفتاح: ببتيد ناضج‎ )( ٠٠١٠٠64 ‏(ب) الموقع:‎ :١١:مقر ‏وصف التتابع: تتابع تمييز‎ (xi) ‏يأ‎CDS (a) Name/Key: CDS 001004 (b) Location: Trait: (ix) Name/Key: Mature Peptide )( 0010064 (b) Location: :11:HQ Description of the relay: Discrimination relay (xi) ya

YoYo

ATC AAA CAC CTG ‏قود‎ TIC TIC CTC CIC CIG GIG GCA GCC CCC AGA 8 48ATC AAA CAC CTG Fuel TIC TIC CTC CIC CIG GIG GCA GCC CCC AGA 8 48

Met Lys His Leu Trp Phe Fhe Leu Leu Leu Val Ala Ale Pro Arg Trp 1 5 10 15Met Lys His Leu Trp Phe Fhe Leu Leu Leu Val Ala Ale Pro Arg Trp 1 5 10 15

GIC TTG TCC CAG GTG CAG CTG CAG GAG TCG GGC CCA GGA ‏وى‎ GIG AAG 96 val Leu Ser Gln Val Glan Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30GIC TTG TCC CAG GTG CAG CTG CAG GAG TCG GGC CCA GGA Wei GIG AAG 96 val Leu Ser Gln Val Glan Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30

CCT TCC GAG ACC ‏وده‎ TCC CTC ACC TGC AGT GTC TCT GGT GGC TCC AIC 144CCT TCC GAG ACC This is TCC CTC ACC TGC AGT GTC TCT GGT GGC TCC AIC 144

Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser Ile as 40 43Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser Ile as 40 43

ACC GGT GAC TAT TAT TGG TTC TGG ATC CGC CAG TCC CCA GGG MAG GGA © 2ACC GGT GAC TAT TAT TGG TTC TGG ATC CGC CAG TCC CCA GGG MAG GGA © 2

Ser Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys Gly 50 55 60Ser Gly Asp Tyr Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys Gly 50 55 60

CTG GAG TGG ATC GGC TAC ATC TAT GGC AGT GGT GGG GGC ACC AAT TAC 240CTG GAG TGG ATC GGC TAC ATC TAT GGC AGT GGT GGG GGC ACC AAT TAC 240

Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn Tyr 65 79 75 80Leu Glu Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn Tyr 65 79 75 80

AAT CCC TCC CTC AAC AAT CGA GTC ICC ATT TCA ATA GAC ACG ICC ANG 288AAT CCC TCC CTC AAC AAT CGA GTC ICC ATT TCA ATA GAC ACG ICC ANG 288

Asn Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 8s 90 95Asn Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 8s 90 95

AAC ‏عن‎ TTC TCC 29 MMA 26 AGG TCT GTG ACC GCC GCG GAC ACG GCC 336AAC for TTC TCC 29 MMA 26 AGG TCT GTG ACC GCC GCG GAC ACG GCC 336

Asn Leu Fhe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala 100 108 110Asn Leu Fhe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala 100 108 110

GTC TAT TAC TGT GCG AGT AAT AIA TTG AAR TAT CIT CAC TGG TTA TTA 384 val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Leu His Trp Leu Leu 115 120 125GTC TAT TAC TGT GCG AGT AAT AIA TTG AAR TAT CIT CAC TGG TTA TTA 384 val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Leu His Trp Leu Leu 115 120 125

TAC ‏مد‎ GGC CAG GGA GTC CTG GTC ACC GTC TCC TCA GCT AGC ACC ANG 432TAC D GGC CAG GGA GTC CTG GTC ACC GTC TCC TCA GCT AGC ACC ANG 432

Tyr Trp Gly Gln Gly Val Leu Val Thr Val Ser Ser Ala Ser Thr Lys 130 135 ١ 140Tyr Trp Gly Gln Gly Val Leu Val Thr Val Ser Ser Ala Ser Thr Lys 130 135 1 140

GGG CCA TCC GTC TIC CCC ‏وه‎ GCG CCC TGC TCC AGG AGC ACC TCC GAG 480GGG CCA TCC GTC TIC CCC AH GCG CCC TGC TCC AGG AGC ACC TCC GAG 480

Gly Pro Sex Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Sar Glu 145 150 155 160Gly Pro Sex Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Sar Glu 145 150 155 160

AGC ACA GCC GCC CTG CGC TGC CTG GTC AAG GAC TAC TTC CCC GAA cca 528AGC ACA GCC GCC CTG CGC TGC CTG GTC AAG GAC TAC TTC CCC GAA cca 528

Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro : 165 170 175Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro : 165 170 175

GTG ACG GTC 7CG IGG AAC TCA GGC GCC CTG ACC AGC GGC GTG CAC ACC 576GTG ACG GTC 7CG IGG AAC TCA GGC GCC CTG ACC AGC GGC GTG CAC ACC 576

Val Thr Val Ser Trp Asa Ser Gly Ala Leu Thr Ser Gly Val His Thr 180 185 190Val Thr Val Ser Trp Asa Ser Gly Ala Leu Thr Ser Gly Val His Thr 180 185 190

PIC CCG GCT ‏دده‎ CTA CAG TCC TCA GGA CTC TAC TCC CTC AGC AGC GTG 624PIC CCG GCT DDEDH CTA CAG TCC TCA GGA CTC TAC TCC CTC AGC AGC GTG 624

Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val 200 205Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val 200 205

GTG ACC GTG CCC TCC AGC AGC TTG GGC ACG AAG ACC TAC ACC TGC AAC 672 val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Aan 210 215 2260GTG ACC GTG CCC TCC AGC AGC TTG GGC ACG AAG ACC TAC ACC TGC AAC 672 val Thr Val Pro Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Aan 210 215 2260

GTA GAT CAC MAG CCC AGC AAC ACC AAG GTG GAC AAG AGA GTT GAG TCC C720GTA GAT CAC MAG CCC AGC AAC ACC AAG GTG GAC AAG AGA GTT GAG TCC C720

Val Asp Hil Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser 225 230 233 240Val Asp Hil Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser 225 230 233 240

AA TAT GGT CCC CCA TGC CCA CCA TGC CCA GCA CCT GAG TIC GAG GGG 768AA TAT GGT CCC CCA TGC CCA CCA TGC CCA GCA CCT GAG TIC GAG GGG 768

Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Glu Gly 245 230 255Lys Tyr Gly Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Glu Gly 245 230 255

GGA CCA TCA GTC TIC CTG TTC CCC CCA AAA CCC AAS GAC ACT CIC ATG 816GGA CCA TCA GTC TIC CTG TTC CCC CCA AAA CCC AAS GAC ACT CIC ATG 816

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 260 263 270Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 260 263 270

ATC TCC ‏معن‎ ACC CCT GAG GTC ACG TGC GIG GIG GIG GAC GTG AGC CAG B64ATC TCC Maan ACC CCT GAG GTC ACG TGC GIG GIG GIG GAC GTG AGC CAG B64

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln 275 280 285Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln 275 280 285

TeTe

٠0

GAA GAC CCC GAG GTC CAG TIC AAC TGG TAC GIG GAT GGC GTG GAG GIG 912GAA GAC CCC GAG GTC CAG TIC AAC TGG TAC GIG GAT GGC GTG GAG GIG 912

Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 290 295 300 ١Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 290 295 300 1

CAT AAT GCC AAG ACA AAG CCG CGG GAG GAG CAG TTC AAC AGC ACG TAC 360CAT AAT GCC AAG ACA AAG CCG CGG GAG GAG CAG TTC AAC AGC ACG TAC 360

His Asn Ala Lys Thr Lys Pro ‏وعم‎ Glu Glu Gln Phe Asn Ser Thr Tyr 305 310 315 320His Asn Ala Lys Thr Lys Pro Uncle Glu Glu Gln Phe Asn Ser Thr Tyr 305 310 315 320

CGT GTG GTC AGC GTC CTC ACC GTC ‏عن‎ CAC CAG GAC TGC CTG AAC 0 1008CGT GTG GTC AGC GTC CTC ACC GTC FOR CAC CAG GAC TGC CTG AAC 0 1008

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 325 330 335Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 325 330 335

AAG GAG TAC AAG TGC AAG GTC TCC AAC AAA GGC CIC CCG TCC TCC ATC 1056AAG GAG TAC AAG TGC AAG GTC TCC AAC AAA GGC CIC CCG TCC TCC ATC 1056

Lys Glu Tyr Lye Cys Lys Val Ser Asn Lys Gly Leu Pro Sar Ser lle 340 343 350Lys Glu Tyr Lye Cys Lys Val Ser Asn Lys Gly Leu Pro Sar Ser lle 340 343 350

GAG AAA ACC ATC TCC AAA GCC AMA GGG CAG eee CGA GAG CCA CAG GTG 1104GAG AAA ACC ATC TCC AAA GCC AMA GGG CAG eee CGA GAG CCA CAG GTG 1104

Glu Lys Thr Ile Ser Lys Ale Lys Gly Gln Pro Arg Glu Pro Gln Val 355 360 - 365 5Glu Lys Thr Ile Ser Lys Ale Lys Gly Gln Pro Arg Glu Pro Gln Val 355 360 - 365 5

TAC ACC ‏وى‎ CCC CCA TCC CAG GAG GAG ATG ACC AAG AAC CAG GTC AGC 1152TAC ACC Wii CCC CCA TCC CAG GAG GAG ATG ACC AAG AAC CAG GTC AGC 1152

Tyr Thr Leu Pro Pro ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser 370 375 380Tyr Thr Leu Pro Pro ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser 370 375 380

CTG ACC TGC ‏وده‎ GTC ARMA GGC TTC TAC CCC AGC GAC ATC GCC GTC GAG 1200CTG ACC TGC This is GTC ARMA GGC TTC TAC CCC AGC GAC ATC GCC GTC GAG 1200

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lle Ala Val Glu ss 390 335 400 a6 GAG AGC AAT GGG CAG CCG GAS AAC ARC TAC AAG ACC ACG OCT CCC 1248Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lle Ala Val Glu ss 390 335 400 a6 GAG AGC AAT GGG CAG CCG GAS AAC ARC TAC AAG ACC ACG OCT CCC 1248

Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro ¢05 410 45Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro ¢05 410 45

GTG CIG GAC TCC GAC GGC TCC TTC TIC CTC TAC AGC AGG CTA ACC GTO 1296GTG CIG GAC TCC GAC GGC TCC TTC TIC CTC TAC AGC AGG CTA ACC GTO 1296

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val 420 425 430Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val 420 425 430

GAC MG AGC AGG TGG CAG GAG GGG AAT GIC TIC TCA TGC TCC JTG 3 1344GAC MG AGC AGG TGG CAG GAG GGG AAT GIC TIC TCA TGC TCC JTG 3 1344

Asp Lys Ser Arg Trp Gla Glu Gly Asn Val Phe Ser Cys Ser Val Net 435 440 445Asp Lys Ser Arg Trp Gla Glu Gly Asn Val Phe Ser Cys Ser Val Net 435 440 445

CAT GAG GCT CTG CAC AAC CAC TAC ACA CAG AMG AGC CTC TCC C6 TCT 1392CAT GAG GCT CTG CAC AAC CAC TAC ACA CAG AMG AGC CTC TCC C6 TCT 1392

Mis Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 455 460Mis Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 455 460

CTG GGT AMA TGA 1404CTG GGT AMA TGA 1404

Leu Gly Lys * 465Leu Glu Lys * 465

AY: ‏خاصة بتتابع التمييز رقم‎ ally ( ١ ) ‏مميزرات التتابع:‎ 0 ‏حمض أميني‎ £1Y ‏(أ) الطول:‎ ‏(ب) النوع: حمض أميني‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: بروتين‎ (ii)AY: specific for recognition sequence number ally ( 1 ) Sequence modulators: 0 amino acid £1Y (a) length: (b) type: amino acid (d) morphology: linear Molecule Type: Protein (ii)

AY: ‏وصف التتابع : تتابع تمييز رقم‎ (xi)AY: Sequence Description: Number Recognition Sequence (xi)

TeTe

٠0

Met Lys Kis Leu Trp Phe Phe Leu Leu Leu Val Als Ala Pro Arg Trp 1 5 10 15Met Lys Kis Leu Trp Phe Phe Leu Leu Leu Val Als Ala Pro Arg Trp 1 5 10 15

Vol Leu S¢r Gln val Gln Leu Gla Glu Ser Gly Pro Gly Leu Val Lys 20 25 30Vol Leu S¢r Gln val Gln Leu Gla Glu Ser Gly Pro Gly Leu Val Lys 20 25 30

Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Sar Ile 15 40 45Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Sar Ile 15 40 45

Ser Gly Asp Tyr Tyr Trp Phe Trp lle Arg Gln Ser Pro Gly Lys 7 $0 55 60Ser Gly Asp Tyr Tyr Trp Phe Trp lle Arg Gln Ser Pro Gly Lys 7 $0 55 60

Leu Glu Trp Ils Gly Tyr lle Tyr Gly Ser Gly Gly Gly Thr Asn Tyr 70 75 "0Leu Glu Trp Ils Gly Tyr lle Tyr Gly Ser Gly Gly Gly Thr Asn Tyr 70 75"0

Asn Pro Ser Leu Asa Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 8s 90 93 : Asn Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala 100 10% 110 val Tyr Tyr Cys Ala Ser Asa Ile Leu Lys Tyr Leu His ‏وج‎ Leu Leu 113 129 ’ 125Asn Pro Ser Leu Asa Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 8s 90 93 : Asn Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala 100 10% 110 val Tyr Tyr Cys Ala Ser Asa Ile Leu Lys Tyr Leu His and Leu Leu 113 129 ' 125

Tyr Trp Gly Gla Gly Val Leu Val Thr Val Ser Sec Ala Ser Thr Lys 130 135 140Tyr Trp Gly Gla Gly Val Leu Val Thr Val Ser Sec Ala Ser Thr Lys 130 135 140

Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu 145 150 155 160Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu 145 150 155 160

Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro 165 170 175Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro 165 170 175

Val Thr Val Ser Trp Asn Ser Gly Als Leu Thr Ser Gly Val Hie Thr 180 185 190Val Thr Val Ser Trp Asn Ser Gly Als Leu Thr Ser Gly Val Hie Thr 180 185 190

Phe Pro Ala Val Leu Gla Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val 193 200 © 205 . val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asa 210 215 220Phe Pro Ala Val Leu Gla Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val 193 200 © 205 . val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asa 210 215 220

Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser 225 230 235 240Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser 225 230 235 240

Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Glu Gly 245 250 255Lys Tyr Gly Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Glu Gly 245 250 255

Gly Pro Ser Vel Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Net 260 263 270Gly Pro Ser Vel Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Net 260 263 270

Ile Ser Arg Thr Pro Glu Vel Thr Cys Val Val Val Asp Val Ser Gln 27% 280 28sIle Ser Arg Thr Pro Glu Vel Thr Cys Val Val Val Asp Val Ser Gln 27% 280 28s

Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 290 295 J00Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 290 295 J00

His Asn Als Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr 305 310 313 320 . Arg Val Val Ser val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly 2s 330 JasHis Asn Als Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr 305 310 313 320 . Arg Val Val Ser val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly 2s 330 Jas

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro ker Ser Ile 340 348 350Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ker Ser Ile 340 348 350

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val ss ase 68Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val ss ase 68

Tye Thr Leu Fro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser 370 175 380Tye Thr Leu Fro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser 370 175 380

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 1135 190 398 400Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 1135 190 398 400

Trp Glu Ser Asa Gly Glan Pro Glu Asn Asa Tyr Lys Thr Thx Pro Pro 408 410 413Trp Glu Ser Asa Gly Glan Pro Glu Asn Asa Tyr Lys Thr Thx Pro Pro 408 410 413

Val Leu Asp Ser Asp Gly Ger Phe Phe Lau Tyr Ser Arg Leu The Val 420 425 430Val Leu Asp Ser Asp Gly Ger Phe Phe Lau Tyr Ser Arg Leu The Val 420 425 430

Asp Lys Ser Arg Tzp Gla Glu Gly Asn Val Phe Ser Cys Ser Val Met 435 440 445Asp Lys Ser Arg Tzp Gla Glu Gly Asn Val Phe Ser Cys Ser Val Met 435 440 445

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser ‏دما‎ Ser Leu Ser 450 455 460His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Dama Ser Leu Ser 450 455 460

Leu Gly Lys 465 ‏أ“‎Leu Gly Lys 465 A

0 (7) بيانات خاصة بتتابع التمييز رقم: ‎VY‏ ‎(i)‏ مميزات التتابع: (أ) الطول: 77 زوج قاعدي (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎i)‏ نوع الجزيء: دنا (مجيني) ض ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي: (أ) الكائن الحي: إنسان أو قرد ‎(viii)‏ الموقع في المجين: (أ) كروموسوم/قطعة: تتابع قيادي من نوع ‎VHI‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم:١١:‏ ‎ACTAAGTCGA CATGGACTGG ACCTGG 26‏ (7) بيانات خاصة بتتابع التمييز رقم: ‎PVE‏ ‎(i)‏ مميزات التتابع: () الطول: ‎7١‏ زوج قاعدي (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ض ‎i)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي: (أ) الكائن الحي: إنسان أو قرد ‎Te‏0 (7) Data for recognition sequence number: VY (i) Characteristics of the sequence: (a) Length: 77 bp (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: Linear i) Type of Molecule: DNA (Genomic) Z (iv) Antisense: None (vi) Original Source: (a) Organism: Human or Monkey (viii) Location in the Genome: ( a) Chromosome/segment: VHI leadership sequence (xi) Sequence description: Recognition sequence No. 11: ACTAAGTCGA CATGGACTGG ACCTGG 26 (7) Data for Recognition Sequence No.: PVE (i) Characteristics of the sequence: (a) Length: 71 base pairs (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear i) Molecule type: DNA (genomic) (iv ) Counter trend: None (vi) Original source: (a) Organism: human or monkey Te

Ve ‏الموقع في المجين:‎ (viii) 17112 ‏(أ) كروموسوم/قطعة: تتابع قيادي من نوع‎ :١6:مقر ‏وصف التتابع: تتابع تمييز‎ (xi)Ve position in the genome: (viii) 17112 (a) chromosome/segment: leadership sequence type: 16: locus Description of the sequence: recognition sequence (xi)

ACTAAGTCGA CATGGACATA CTTTGTTCCA 31 $0 ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏(أ) الطول: 79 زوج قاعدي‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (ii) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii)ACTAAGTCGA CATGGACATA CTTTGTTCCA 31 $0 Recognition sequence data: (7) Characteristics of the sequence: (i) (a) Length: 79 base pairs (b) Type: nucleic acid (c) How to splice: single-stranded (d) morphology: linear, type of molecule: DNA (genomic) (ii) antisense: none (iv) original source: (vi) (a) organism: human Or ape at the position in the genome: (viii)

VH3 ‏(أ) كروموسوم/قطعة: تتابع قيادي من نوع‎ 018) ‏وصف التتابع: تتابع تمييز‎ (xi)VH3 (a) chromosome/segment: leading sequence type 018) Sequence description: recognition sequence (xi)

ACTAAGTCGA CATGGAGTTT GGGCTGAGC 29 a ‏بيانات خاصة بتتابع التمييز‎ (Y) ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ ١ ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏كيفية الجدل: وحيد الجديلة‎ (a)ACTAAGTCGA CATGGAGTTT GGGCTGAGC 29 a Recognition sequence data (Y) Characteristics of the sequence: (i) 1 base pair (a) Length: (b) Type: nucleic acid How to splice: Single-stranded (a)

٠١ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (ii) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii)01 (d) Format: Linear Type of Molecule: DNA (genomic) (ii) Antisense: None (iv) Original Source: (vi) (a) Organism: Human or Monkey Location in the genome: (viii)

VH4 ‏كروموسوم/قطعة: تتابع قيادي من نوع‎ ()VH4 chromosome/segment: lead sequence ()

DYNA) ‏وصف التتابع: تتابع تمييز‎ (xi)DYNA) relay description: Discrimination relay (xi)

ACTAAGTCGA CATGAAACAC CTGTGGTTCT T 31ACTAAGTCGA CATGAAACAC CTGTGGTTCT T 31

VY ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ 7١ ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii)VY Data for Discrimination Sequence Number: (Y) Sequence Characteristics: (i) Base Pair 71 (a) Length: (b) Type: nucleic acid (c) How to splice: Single-stranded (d) Format: linear Molecule type: DNA (genomic) (i) Antisense: none (iv) Original source: (vi) (a) Organism: human or monkey Location in the genome: (viii)

VHS ‏(أ) كروموسوم/قطعة: تتابع قيادي من نوع‎ :١١7:مقر ‏وصف التتابع: تتابع تمييز‎ (xi)VHS (a) chromosome/segment: leadership sequence type :117:locus description of the sequence: recognition sequence (xi)

ACTAAGTCGA CATGGGGTCA ACCGCCATCCT 31 1aACTAAGTCGA CATGGGGTCA ACCGCCATCCT 31 1a

ض ‎٠‏ ‎(Y)‏ بيانات خاصة بتتابع التمييز رقم: ‎VA‏ ‎(i)‏ مميزات التتابع: (أ) الطول: ‎7١‏ زوج قاعدي (ب) التوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ض ‎i)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي: (أ) الكائن الحي: إنسان أو قرد ‎(vidi)‏ الموقع في المجين: (أ) كروموسوم/قطعة: تتابع قيادي من نوع ‎VHS‏ ‎(xi)‏ وصف التتابع: تتابع تمييز ‎DAE‏ ‎ACTAAGTCGA CATGTCTGTC TCCTTCCTCA T 31‏ ‎(Y)‏ بيانات خاصة بتتابع التمييز ‎9a‏ ‎(i)‏ مميزات التتابع: (أ) الطول: ‎7٠١‏ زوج قاعدي (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎(if)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي: (أ) الكائن الحي: إنسان أو قردz 0 (Y) Data for discrimination sequence number: VA (i) Characteristics of the sequence: (a) Length: 71 base pairs (b) Speciation: nucleic acid (c) Mode of splicing: single strand (d) Format: linear z i) Molecule type: DNA (genomic) (iv) Antisense: none (vi) Original source: (a) Organism: human or ape (vidi ) Location in the genome: (a) Chromosome/segment: VHS-type leadership sequence (xi) Sequence description: Discrimination sequence DAE ACTAAGTCGA CATGTCTGTC TCCTTCCTCA T 31 (Y) Discrimination sequence data 9a (i) Characteristics of the sequence: (a) Length: 701 base pairs (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear (if) Type of molecule: DNA (Genomic) (iv) Antisense: None (vi) Original Source: (a) Organism: Human or Monkey

Ved ‏الموقع في المجين:‎ (vidi) : 14101 ‏يحتوي على الموقع‎ VHI ‏(أ) كروموسوم/قطعة: تتابع قيادي من نوع‎ :١19:مقر ‏وصف التتابع: تتابع تمييز‎ (xi)Ved locus in the genome: (vidi) : 14101 containing the locus VHI (a) chromosome/segment: leadership sequence type: 119: locus Sequence description: recognition sequence (xi)

GGCAGCAGCY ACGCGTGCCC ACTCCGAGGT 30 :٠١ ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ Te ‏الطول:‎ (i) ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏الهيئة الشكلية: خطي‎ (9 ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (vii)GGCAGCAGCY AGCGTGCCC ACTCCGAGGT 30 : 01 Data for the recognition sequence number: (Y) Characteristics of the sequence: (i) Base pair Te Length: (i) (b) Type: nucleic acid (c) How to argue: single-strand Format: linear (9) Molecule type: DNA (genomic) (i) antisense: none (iv) original source: (vi) (a) organism Position in the genome: human or ape: (vii)

Miu ‏يحتوي على الموقع‎ VH2 ‏(أ) كروموسوم/قطعة: تتابع قيادي من نوع‎ :7٠:مقر ‏وصف التتابع: تتابع تمييز‎ (xi)Miu containing locus VH2 (a) chromosome/segment: leading sequence type :70:locus Description of the sequence: recognition sequence (xi)

GACCGTCCCG ACGCGTGTYT TGTCCCAGGT 30GACCGTCCCG ACGGTGTYT TGTCCCAGGT 30

YY ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ YY ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎YY Data for recognition sequence number: (Y) Sequence characteristics: (i) YY base pair (a) Length: (b) Type: nucleic acid (c) How to splice: Single-stranded (D) Formal form: linear

YY. ‏نوع الجزيء: دنا (مجيني)‎ (ii) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii) 14181 ‏(أ) كروموسوم/قطعة: تتابع قيادي من نوع 7113 يحتوي على الموقع‎YY. Type of molecule: DNA (genomic) (ii) Antisense: none (iv) Original source: (vi) (a) Organism: human or ape Position in the genome: (viii) 14181(a) chromosome/segment: lead sequence type 7113 containing locus

PY a) ‏وصف التتابع: تتابع تمييز‎ (xi)PY a) Description of the sequence: Discrimination sequence (xi)

GCTATTTTCA CGCGTGCCA GTGTGAG 27GCTATTTTCA CGCGTGCCA GTGTGAG 27

YY ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ YY ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏الكائن الحي: إنسان أو قرد‎ () ‏الموقع في المجين:‎ (vidi) 14101 ‏يحتوي على الموقع‎ VHA ‏كروموسوم/قطعة: تتابع قيادي من نوع‎ (1) ‏وصف التتابع: تتابع تمييز رقم:77:‎ (xi)YY Discrimination sequence data: (7) Sequence characteristics: (i) YY base pair (a) Length: (b) Type: nucleic acid (c) How to splice: Single-stranded (d) Format: linear Molecule type: DNA (genomic) (i) Antisense: none (iv) Original source: (vi) Organism: human or monkey () Locus in the genome: (vidi) 14101 containing locus VHA chromosome/segment: leading sequence type (1) Sequence description: recognition sequence No.: 77: (xi)

GCGGCTCCCA 6061610201 GTCCCAG 27GCGGTCCCCA6061610201GTCCCAG27

YY ‏بيانات خاصة بتتابع التمييز رقم:‎ )7(YY Data for Discrimination Sequence No.: (7)

أ ‎(i)‏ مميزات التتابع: (أ) الطول: ‎Ye‏ زوج قاعدي (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎(ii)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد " ‎(vi)‏ المصدر الأصلي: (أ) الكائن الحي: إنسان أو قرد ‎(vi)‏ الموقع في المجين: (أ) كروموسوم/قطعة: تتابع قيادي من نوع ‎VHS‏ يحتوي على الموقع ‎Mul‏ ‎(xi)‏ وصف التتابع: تتابع تمييز ‎YY iad)‏ ‎GGCTGTTCTC ACGCGTGTCT GTGCCGAGGT 30‏ ‎(Y)‏ بيانات خاصة بتتابع التمييز رقم: 4 7: ‎(i)‏ مميزات التتابع: (أ) الطول: ‎YY‏ زوج قاعدي (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة ْ (د) الهيئة الشكلية: ‎sha‏ ‎i)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي: (أ) الكائن الحي: إنسان أو قرد ‎(viii)‏ الموقع في المجين:A (i) Characteristics of the sequence: (a) Length: Ye, base pair (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear (ii) Type of molecule: DNA (Genee) (iv) Antiverse: None (vi) Original source: (a) Organism: human or ape (vi) Location in the genome: (a) Chromosome/segment: Leading sequence from VHS type contains position Mul (xi) Sequence description: Recognition sequence YY iad) GGCTGTTCTC AGCGTGTCT GTGCCGAGGT 30 (Y) Recognition sequence data: 4 7: (i) Sequence characteristics: (a) Length: YY base pair (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: sha i) Molecule type: DNA (genomic) (iv) Opposite direction: none (vi) original source: (a) organism: human or ape (viii) location in the genome:

YAYYAY

XhoI ‏يحتوي على الموقع‎ VH13a,5 ‏(أ) كروموسوم/قطعة: بادئ سلسلة من نوع‎ :7 ‏وصف التتابع: تتابع تمييز رقم:4‎ (xi)XhoI containing locus VH13a,5(a) chromosome/segment: Initiator type:7 Sequence description: Sequence recognition number: 4 (xi)

CAGGTGCAGC TGCTCGAGTC TGG 23 (YO ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ YY ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ )( ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii)CAGGTGCAGC TGCTCGAGTC TGG 23 (YO) Recognition Sequence Data: (7) Characteristics of the sequence: (i) YY base pair (a) Length: (b) Type: nucleic acid (c) How to argue: single-stranded (d) morphology: linear type of molecule: DNA (genomic) )( antisense: none (iv) original source: (vi) (a) organism Position in the genome: human or ape: (viii)

Xho 1 ‏(أ) كروموسوم/قطعة: بادئ سلسلة من نوع 7112 يحتوي على الموقع‎ ‏تمييز رقم:©7:‎ al ‏وصف التتابع:‎ (xi)Xho 1 (a) chromosome/segment: 7112-type sequence initiator containing loci Marking No.:©7: al Sequence description: (xi)

CAGGTCAACT TACTCGAGTC TGG 23 :776 ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏زوج قاعدي‎ YY ‏الطول:‎ () ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏ا‎CAGGTCAACT TACTCGAGTC TGG 23 : 776 Data for recognition sequence number: (Y) Characteristics of the sequence: (i) YY base pair Length: ( ) (b) Type: nucleic acid (c) How Stranding: single-braided (d) Formal form: linear a

١٠١101

‎(i)‏ نوع الجزيء: دنا (مجيني) ض ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي:(i) Type of Molecule: DNA (genomic) Z (iv) Antisense: None (vi) Original Source:

‏(أ) الكائن الحي: إنسان أو قرد ‎(viii)‏ الموقع في المجين:(a) Organism: human or ape (viii) Location in the genome:

‏(أ) كروموسوم/قطعة: بادئ سلسلة من نوع ‎VH3b‏ يحتوي على الموقع 70:01 ‎(xi)‏ وصف التتابع: تتابع تمييز رقم:7؟:(a) Chromosome/segment: VH3b chain initiator containing position 70:01 (xi) Sequence description: Recognition sequence No.:7?:

‎GAGGTGCAGC 1001006010 TGG 23‏ (7) بيانات خاصة بتتابع التمييز رقم: ‎PY‏GAGGTGCAGC 1001006010 TGG 23 (7) Data for Discrimination Sequence No.: PY

‎(i)‏ مميزات التتابع:(i) Features of the relay:

‏(أ) الطول: 77 زوجا قاعدياً(a) Length: 77 base pairs

‏(ب) ‎ig ill‏ حمض نووي(b) ig ill nucleic acid

‏(ج) كيفية الجدل: وحيد الجديلة(c) How to argue: single strand

‏(د) الهيئة الشكلية: خطي ‎(i)‏ نوع الجزيء: دنا (مجيني) (»:) الاتجاه المضاد: لا يوجد ‎(viii)‏ الموقع في المجين:D

‏(أ) كروموسوم/قطعة: بادئ سلسلة من نوع ‎VHA‏ يحتوي على الموقع ‎Xhol‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم : ‎YY‏ ‎CAGGTGCAGC TGCTCGAGTC GGG 23‏ (7) بيانات خاصة بتتابع التمييز رقم: ‎YA‏ ‎(i)‏ مميزات التتابع: : (أ) الطول: ‎YY‏ زوجاً قاعدياً (ب) النوع: حمض نووي ‎Td‏(a) Chromosome/segment: VHA-type chain initiator containing Xhol site (xi) Sequence description: Recognition sequence number: YY CAGGTGCAGC TGCTCGAGTC GGG 23 (7) Data for recognition sequence number : YA (i) Characteristics of the sequence: (a) Length: YY base pair (b) Type: Td nucleic acid

اa

(ج) كيفية الجدل: وحيد الجديلة(c) How to braid: single-braid

(د) الهيئة الشكلية: خطي ‎ii)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي:(d) Format: linear ii) Molecule type: DNA (genomic) (iv) Antisense: None (vi) Original source:

(أ) الكائن الحي: إنسان أو قرد ‎(viii)‏ الموقع في المجين:(a) Organism: human or ape (viii) Location in the genome:

(أ) كروموسوم/قطعة: بادئ سلسلة من نوع 7116 يحتوي على الموقع ‎Xhol‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: 78: ‎CAGGTACAGC TGCTCGAGTC AGG 23‏ ‎(Y)‏ بيانات خاصة بتتابع التمييز رقم: 174:(a) Chromosome/segment: 7116 sequence initiator containing position Xhol (xi) Sequence description: Recognition sequence number: 78: CAGGTACAGC TGCTCGAGTC AGG 23 (Y) Recognition sequence data: 174 :

‎(i)‏ مميزات التتابع:(i) Features of the relay:

‏(أ) الطول: 77 زوجاً قاعدياً(a) Length: 77 base pairs

‏(ب) النوع: حمض نووي(b) Type: nucleic acid

‏(ج) كيفية الجدل: وحيد الجديلة(c) How to argue: single strand

‏(د) الهيئة الشكلية: خطي ‎(ii)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: يوجد ‎(vi)‏ المصدر الأصلي:D

‏(أ) الكائن الحي: إنسان أو قرد ‎(viii)‏ الموقع في المجين:(a) Organism: human or ape (viii) Location in the genome:

‏(أ) كروموسوم/قطعة: بادئ الجلوبلين المناعي 61-4 يحتوي على الموقع ‎Nhel‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: 79: ‎GGCGGATGCG CTAGCTGAGG 165 26‏ (7) بيانات خاصة بتتابع التمييز ‎etal)‏ ‎1a‏(a) Chromosome/segment: IgM primer 61-4 containing Nhel site (xi) Sequence description: Recognition sequence no: 79: GGCGGATGCG CTAGCTGAGG 165 26 (7) data for the recognizing sequence etal) 1a

Yo ‏مميزات التتابع:‎ (i) ‏زوجاً قاعدياً‎ YA ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii)Characteristics of the sequence: (i) YA base pair (a) Length: (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear Molecule type: DNA (genomic) (i) Antisense: none (iv) Original source: (vi) (a) Organism: human or ape Position in the genome: (viii)

Bgl Il ‏يحتوي على الموقع‎ LS ‏(أ) صبغة/قطعة: بادئ سلسلة خفيفة من نوع‎Bgl Il contains site LS (a) pigment/piece: light chain starter type

Ye ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)Ye Relay Description: Relay Recognition No.: (xi)

ATCACAGATC TCTCACCATG GTGTIGCAGA CCCAGGTC 38ATCACAGATC TCTCACCATG GTGTIGCAGA CCCAGGTC 38

YY ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏زوج قاعديآً‎ TY ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ ):»( ‏الموقع في المجين:‎ (viii)YY Data for the discrimination sequence number: (7) Characteristics of the sequence: (i) base pair TY (a) length: (b) type: nucleic acid (c) mode of splicing: single-stranded (D) Morphology: Linear Molecule Type: DNA (genomic) (i) Antisense: None: “(Location in the genome: (viii)

Bgl II ‏يحتوي على الموقع‎ LIS ‏كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع‎ (1)Bgl II loci containing LIS chromosome/segment: light chain initiator type (1)

FY ‏وصف التتابع: تتابع تميبز رقم:‎ (xi)FY Relay Description: Tempez Relay No.: (xi)

ATCACAGATC TCTCACCATG GRGWCCCCWG CKCAGCT 37ATCACAGATC TCTCACCATG GRGWCCCCWG CKCAGCT 37

TaTa

١١11

PY ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏زوجاً قاعدياً‎ 4١ ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ i) ‏الاتجاه المضاد: لا يوجد‎ ):»( ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii)PY Discrimination sequence data: (7) Characteristics of the sequence: (i) 41 base pairs (a) Length: (b) Type: nucleic acid (c) How to splice: Single-stranded (d) Format: linear Molecule type: DNA (genomic) i) Anti-reflection: none: “(Original source: (vi) (a) Organism: human or monkey Location in the genome: (viii)

Bgl Il ‏يحتوي على الموقع‎ LS ‏(أ) كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع‎ :77 ‏وصف التتابع: تتابع تميبز رقم:‎ (xi)Bgl Il containing locus LS (a) chromosome/segment: light chain initiator type: 77 Sequence description: Tempes sequence No.: (xi)

ATCACAGATC TCTCACCATG GACATGAGGG TCCCCGCTCA G 41ATCACAGATC TCTCACCATG GACATGAGGG TCCCCGCTCA G 41

PY ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏قاعدياً‎ lag) 4١ ‏(أ) الطول:‎ ‏حمض نووي‎ ig sill ‏(ب)‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (ii) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii)PY Discrimination sequence data: (7) Characteristics of the sequence: (i) base (lag) 41 (a) length: nucleic acid ig sill (b) (c) how to splice : single-stranded (d) morphology: linear Molecule type: DNA (genomic) (ii) antisense: none (iv) original source: (vi) (a) organism: Human or ape position in the genome: (viii)

TaTa

لا )1( كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع ‎LS‏ يحتوي على الموقع ‎Bgl IT‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: ‎YY‏ ‎ATCACAGATC TCTCACCATG GACACVAGGG CCCCCACTCA G 41‏ ‎(Y)‏ بيانات خاصة بتتابع التمييز ‎VE)‏ ‎(i)‏ مميزات التتابع: (أ) الطول: 79 زوجاً قاعدياً (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎i)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي: (أ) الكائن الحي: إنسان أو قرد ‎(viii)‏ الموقع في المجين: (أ) كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع لّمندا يحتوي على الموقع ‎Bgl II‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: ‎WE‏ ‎ATCACAGATC TCTCACCATG 6001600010 1001060100 39‏ ‎(Y)‏ بيانات خاصة بتتابع التمييز رقم: ‎YO‏ ‎(i)‏ مميزات التتابع: )1( الطول: ‎Ya‏ زوجاً قاعديآً (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎(i)‏ نوع الجزيء: دنا (مجيني) ‎Te‏No (1) Chromosome/segment: LS light chain initiator containing loci Bgl IT (xi) Sequence description: Recognition sequence number: YY ATCACAGATC TCTCACCATG GACACVAGGG CCCCCACTCA G 41 (Y) Data for the VE discrimination sequence (i) Characteristics of the sequence: (a) Length: 79 base pairs (b) Type: nucleic acid (c) How to splice: single-stranded (d) Morphology: linear i) Type of Molecule: DNA (Genomic) (iv) Antisense: None (vi) Original Source: (a) Organism: Human or Monkey (viii) Location in the Genome: (a) Chromosome/Segment : Lamenda light chain starter with position Bgl II (xi) Sequence description: Recognition sequence number: WE ATCACAGATC TCTCACCATG 6001600010 1001060100 39 (Y) Data for recognition sequence number: YO (i) Characteristics of the sequence: (1) Length: Ya, base pair (b) Type: nucleic acid (c) How to splice: single-stranded (d) Morphology: linear (i) Type of molecule: DNA ( Majini) Te

علا ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي: (أ) الكائن الحي: إنسان أو قرد ‎(viii)‏ الموقع في المجين: (أ) كروموسوم/قطعة: بادئ سلسلة خفيفة ‎lata Tle ge‏ يحتوي على الموقع ‎Bgl II‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: 10 ‎ATCACAGATC TCTCACCATG 60010060010 CACTACTTC 39‏ ‎(Y)‏ بيانات خاصة بتتابع التمييز رقم: ‎PY‏ ‎(i)‏ مميزات التتابع: (أ) الطول: 74 زوجاً قاعدياً (ب) ‎ig ill‏ حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎(i)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vi)‏ المصدر الأصلي: )( الكائن الحي: إنسان أو قرد ‎(viii)‏ الموقع في المجين: (أ) كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع لتملنْدا يحتوي على الموقع ‎Bgl II‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: ‎YT‏ ‎ATCACAGATC TCTCACCATG 001601000 )10100100 39‏ (7) بيانات خاصة بتتابع التمييز رقم: ‎FV‏ ‎(i)‏ مميزات التتابع: ‎Ta‏Ola (iv) antisense: none (vi) original source: (a) organism: human or ape (viii) location in the genome: (a) chromosome/segment: light chain initiator lata Tle ge contains location Bgl II (xi) Sequence description: Recognition sequence number: 10 ATCACAGATC TCTCACCATG 60010060010 CACTACTTC 39 (Y) Data for recognition sequence number: PY (i) Relay features : (a) length: 74 base pairs (b) ig ill nucleic acid (c) how to splice: single-stranded (d) morphology: linear (i) type of molecule: DNA (genomic) (iv) Antisense: none (vi) original source: () organism: human or ape (viii) locus in the genome: (a) chromosome/segment: Lamlanda light chain initiator containing site Bgl II (xi) Description of the sequence: Recognition Sequence No.: YT ATCACAGATC TCTCACCATG 001601000 (10100100 39) (7) Data for Recognition Sequence No.: FV (i) Sequence Characteristics: Ta

١٠ ‏(أ) الطول: 79 زوجآً قاعدياً‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (vidi) ‏(أ) كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع لََمنْدا يحتوي على الموقع‎10 (a) length: 79 base pairs (b) type: nucleic acid (c) mode of splicing: single-stranded (d) morphology: linear Molecule type: DNA (genomic) (i) ) Antisense: none (iv) Original source: (vi) (a) organism: human or ape Position in genome: (vidi) (a) chromosome/segment: light chain initiator Lamanda type contains the location

Bgl IIBgl II

PV ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)PV Relay Description: Relay Recognition No.: (xi)

ATCACAGATC TCTCACCATG 6020100010 10101110 39ATCACAGATC TCTCACCATG 6020100010 10101110 39

TPA ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏زوجا قاعديا‎ YA ‏الطول:‎ () ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii)TPA Data for the discrimination sequence number: (7) Characteristics of the sequence: (i) YA base pair, length: ( ) (b) type: nucleic acid (c) how to splice: single-stranded (d) Format: linear Molecule type: DNA (genomic) (i) Antisense: none (iv) Original source: (vi) (a) Organism: human or monkey Location in the genome: (viii)

TaTa

VY. ‏كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع لََّمنْدا يحتوي على الموقع‎ (1)VY. Chromosome/segment: Lamenda light chain initiator containing locus (1)

Bgl 1 :78 ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)Bgl 1 :78 Description of the sequence: Recognition sequence number: (xi)

ATCACAGATC TCTCACCATG ACTTGGACCC CACTCCTC 38ATCACAGATC TCTCACCATG ACTTGGACCC CACTCCTC 38

YA ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i)YA Data for the discrimination sequence No.: (7) Characteristics of the sequence: (i)

Lacs ‏(أ) الطول: 776 زوجآ‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (vidi)Lacs (a) Length: 776 pairs (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear Molecule type: DNA (genomic) (i) Opposite direction: there is (iv) the original source: (vi) (a) the organism: a human or an ape the position in the genome: (vidi)

Kpnl ‏يحتوي على الموقع‎ LS ‏(أ) كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع‎Kpnl loci containing LS (a) chromosome/segment: light chain initiator type

BsiW1 ‏والموقع‎ ‎TA ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)BsiW1, position TA, relay description: relay recognition number: (xi)

CCGTTTGATT TCCAGCTTGG TACCTCCACC GAACGT 36 the ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏زوجاً قاعدياً‎ 7٠0 ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎CCGTTTTGATT TCCAGCTTGG TACCTCCACC GAACGT 36 the Data for the recognition sequence number: (Y) Characteristics of the sequence: (i) 700 base pairs (a) Length: (b) Type: nucleic acid (c) How to dial: single-stranded (d) Formal form: linear

١١١ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: يوجد‎ ):»( ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii)111 Molecule type: DNA (genomic) (i) Antisense: there is:”(Original source: (vi) (a) Organism: human or ape Location in the genome: (viii )

Kpnl ‏كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع كابا يحتوي على الموقع‎ ()Kpnl chromosome/segment: kappa light chain initiator containing locus ( )

BsiW1 ‏والموقع‎ ‎: 460 ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)BsiW1 Location: 460 Relay Description: Relay Recognition No.: (xi)

TGCAGCATCC 014006111042 TTTCCAGCTT 30 14) ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i)TGCAGCATCC 014006111042 TTTCCAGCTT 30 14) Data for Discrimination Sequence No. (Y) Sequence Characteristics: (i)

Gaels ‏زوجاً‎ 7٠0 ‏الطول:‎ )( ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (ii) ‏الاتجاه المضاد: يوجد‎ (iv) ‏المصدر الأصلي:‎ (vi) ‏(أ) الكائن الحي: إنسان أو قرد‎ ‏الموقع في المجين:‎ (viii) ‏(أ) كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع مدا يحتوي على الموقع‎Gaels 700 pairs Length: )( (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear Molecule type: DNA (genomic) (ii ) Antisense: exists (iv) original source: (vi) (a) organism: human or ape Location in the genome: (viii) (a) chromosome/segment: light chain initiator of The field type contains the location

Kpnl ‏والموقع‎ 1 : 4١ ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)Kpnl Location 1 : 41 Sequence Description: Relay Recognition No.: (xi)

ACCTAGGACG GTAAGCTTGG TACCTCCGCC 30 :47 ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y)ACCTAGGACG GTAAGCTTGG TACCTCCGCC 47 : 30 Data for Discrimination Sequence No.: (Y)

TaTa

‎(i)‏ مميزات التتابع:(i) Features of the relay:

‏(أ) الطول: 776 زوجاً قاعدياً(a) Length: 776 base pairs

‏(ب) النوع: حمض نووي(b) Type: nucleic acid

‏(ج) كيفية الجدل: وحيد الجديلة(c) How to argue: single strand

‏(د) الهيئة الشكلية: خطي ‎i)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: يوجد ‎(vi)‏ المصدر الأصلي:D

‏(أ) الكائن الحي: إنسان أو قرد ‎(vidi)‏ الموقع في المجين:(a) Organism: human or monkey (vidi) Location in the genome:

‏(أ) كروموسوم/قطعة: بادئ سلسلة خفيفة من نوع لَّمندا يحتوي على الموقع ‎Kpn 1‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: 47 : ‎ACCTAGGACG GTCASSTTGG TACCTCCGCC GAACAC 36‏ ‎(Y)‏ بيانات خاصة بتتابع التمييز رقم: ‎HEY‏(a) Chromosome/segment: Lamenda light chain initiator containing locus Kpn 1 (xi) Sequence description: Sequence recognition number: 47 : ACTAGGACG GTCASSTTGG TACCTCCGCC GAACAC 36 (Y) Sequence-specific data Distinguish No.: HEY

‎(i)‏ مميزات التتابع:(i) Features of the relay:

‏(أ) الطول: ‎lag YY‏ قاعدياً(a) Length: lag YY basally

‏(ب) النوع: حمض نووي(b) Type: nucleic acid

‏(ج) كيفية الجدل: وحيد الجديلة(c) How to argue: single strand

‏(د) الهيئة الشكلية: خطي ‎(i)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: يوجد ‎(vi)‏ المصدر الأصلي:D

‏(أ) الكائن الحي: إنسان أو قرد ‎(viii)‏ الموقع في المجين:(a) Organism: human or ape (viii) Location in the genome:

١ ‏يحتوي على الموقع‎ lat a Tle ge ‏(أ) كروموسوم/قطعة: بادئ سلسلة خفيفة‎ 11 contains locus lat a Tle ge (a) chromosome/segment: light chain initiator 1

FEY ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)FEY Relay Description: Relay Recognition No.: (xi)

CTTGGGCTGA CCTAGGACGG TCAGCCG 27 :44 ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‎(i)‏ مميزات التتابع: ‏(أ) الطول: ‎VY‏ زوجاً قاعدياً ‏(ب) النوع: حمض نووي ‏(ج) كيفية الجدل: وحيد الجديلة ‏(د) الهيئة الشكلية: خطي ‎(i)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(viii)‏ الموقع في المجين: ‏(أ) كروموسوم/قطعة: منطقة سلسلة ثقيلة متغيرة من نوع 177111 ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: 4 4 : ‎CCATGGACTG GACCTGG 17‏ (7) بيانات خاصة بتتابع التمييز رقم: 160 ‎(i)‏ مميزات التتابع: ‏)1( الطول: ‎Ye‏ زوجاً قاعدياً ‏(ب) النوع: حمض نووي ‏(ج) كيفية الجدل: وحيد الجديلة ‏(د) الهيئة الشكلية: خطي () نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: لا يوجد ‎(vii)‏ الموقع في المجين:CTTGGGCTGA CCTAGGACGG TCAGCCG 27 : 44 Data for Recognition Sequence No.: (Y) (i) Characteristics of the sequence: (a) Length: VY base pair (b) Type: nucleic acid (c) How to splice : single-stranded (d) morphology: linear (i) type of molecule: DNA (genomic) (iv) antisense: none (viii) location in the genome: (a) chromosome/segment: 177111 Type 177111 Variable Heavy Chain Area (xi) Sequence Description: Recognition Sequence No.: 4 4 : CCATGGACTG GACCTGG 17 (7) Data for Recognition Sequence No.: 160 (i) Sequence Features: (1) Length (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear () Molecule type: DNA (genomic) (iv) Antisense: no (vii) Location in the genome:

٠١01

VH2 ‏(أ) كروموسوم/قطعة: منطقة سلسلة ثقيلة متغيرة من نوع‎ : 40 ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)VH2 (a) chromosome/segment: variable heavy chain region type: 40 Sequence description: Recognition sequence number: (xi)

ATGGACATAC TTTGTTCCAC 20 :47 ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏قاعدياً‎ lay) Ye ‏(أ) الطول:‎ATGGACATAC TTTGTTCCAC 47 : 20 Discrimination Sequence Data: (Y) Sequence Characteristics: (i) Basic lay) Ye (a) Length:

Gash ‏(ب) النوع: حمض‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏الموقع في المجين:‎ (viii)Gash (b) Type: Acid (c) How to splice: Single-stranded (d) Format: Linear Molecule Type: DNA (genomic) (i) Antisense: None (iv) Location in the genome: (viii)

VH3 ‏(أ) كروموسوم/قطعة: منطقة سلسلة ثقيلة متغيرة من نوع‎ : 47 ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)VH3 (a) chromosome/segment: variable heavy chain region type: 47 Sequence description: Recognition sequence number: (xi)

CCATGGAGTT 160010 20CCATGGAGTT 160010 20

TEV ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏قاعدياً‎ lag) ٠١ ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏الموقع في المجين:‎ (viii)TEV Discrimination Sequence Data No.: (7) Sequence Characteristics: (i) Basic (lag) 01 (a) Length: (b) Type: nucleic acid (c) How to splice: Single (d) Strand morphology: linear Type of molecule: DNA (genomic) (i) Antisense: none (iv) Location in the genome: (viii)

VHA ‏(أ) كروموسوم/قطعة: منطقة سلسلة ثقيلة متغيرة من نوع‎VHA (a) chromosome/segment: variant heavy chain region

١١٠ : 67 ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)110 : 67 Sequence description: Sequence recognition number: (xi)

ATGAAACACC ‏ل‎ 20ATGAAACACC for 20

HEA ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏زوجآً قاعدياً‎ ٠١ ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏(نن) نوع الجزيء: دنا (مجيني)‎ ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏الموقع في المجين:‎ (viii)HEA Data for the Discrimination Sequence No.: (7) Characteristics of the sequence: (i) 01 base pair (a) Length: (b) Type: nucleic acid (c) How to splice: Single-stranded (d) Format: linear (nn) Molecule type: DNA (genomic) Antisense: none (iv) Location in the genome: (viii)

VHS ‏كروموسوم/قطعة: منطقة سلسلة ثقيلة متغيرة من نوع‎ 0VHS chromosome/segment: variable heavy chain region type 0

EA: ‏التتابع: تتابع تمييز رقم‎ ag (xi)EA: Sequence: ag (xi) number recognition sequence

ATGGGGTCAA CCGCCATCCT 20 149 ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏زوجا قاعديا‎ 7٠ ‏الطول:‎ )( ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خحطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: لا يوجد‎ (iv) ‏الموقع في المجين:‎ (vidi)ATGGGGTCAA CCGCCATCCT 20 149 Recognition Sequence Data: (Y) Sequence Characteristics: (i) Base Pair: 70 Length: )( (b) Type: nucleic acid (c) How to splice: Single-stranded (d) Morphology: linear Molecule type: DNA (genomic) (i) Antisense: none (iv) Position in the genome: (vidi)

VH6 ‏متغيرة من نوع‎ ald ‏كروموسوم/قطعة : منطقة سلسلة‎ 0 :4 7: ‏وصف التتابع: تتابع تمييز رقم‎ (xi)VH6 variant ald chromosome/segment : chain region 0 :4 7 : sequence description: recognition sequence number (xi)

‎ATGTCTGTCT CCTTCCTCAT 20‏ (7) بيانات خاصة بتتابع التمييز رقم: 100 ‎(i)‏ مميزات التتابع: (أ) الطول: ‎٠١‏ زوجاً قاعدياً (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎(ii)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: يوجد ‎(viii)‏ الموقع في المجين: (أ) كروموسوم/قطعة: منطقة سلسلة ‎ALD‏ ثابتة للجلوبلين المناعي ‎(1M) of‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: ‎HE‏ ‎TGCACT 16‏ 110660006064 (7) بيانات خاصة بتتابع التمييز رقم: )10 ‎(i)‏ مميزات التتابع: )1( الطول: ‎tag 3 ١١7‏ قاعدياً (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎(i)‏ نوع الجزيء: دنا (مجيني) ‎(iv)‏ الاتجاه المضاد: يوجد ‎ad gall (viii)‏ في المجين: (أ) كروموسوم/قطعة: منطقة سلسلة ثقيلة ثابتة للجلوبلين المناعي 61-4 ‎(1gG1-4)‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم :)0 ‎GATGGGCCCT TGGTGGA 17‏ ‎A‏AGTCTGTCT CCTTCCTCAT 20 (7) Data for Recognition Sequence No.: 100 (i) Characteristics of the sequence: (a) Length: 01 base pairs (b) Type: nucleic acid (c) How to splice: single-stranded (d) ) Morphology: linear (ii) Type of molecule: DNA (genomic) (iv) Antisense orientation: present (viii) Location in the genome: (a) Chromosome/segment: IgM constant ALD chain region (1M) of (xi) Sequence Description: Recognition Sequence No.: HE TGCACT 16 110660006064 (7) Data for Recognition Sequence No.: (10) (i) Sequence Features: (1) Length: tag 3 117 base (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear (i) Molecule type: DNA (genomic) (iv) Antisense: there is ad gall (viii) in the genome: (a) chromosome/segment: IgM 61-4 constant heavy chain region (1gG1-4) (xi) Sequence description: recognition sequence number 0: GATGGGCCCT TGGTGGA 17 A

١١7 :27 ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏زوجاً قاعدياً‎ 7١ ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الموقع في المجين:‎ (viii)27: 117 Data for the discrimination sequence number: (7) Characteristics of the sequence: (i) base pair 71 (a) length: (b) type: nucleic acid (c) how to argue: single-stranded (d) morphology: linear type of molecule: DNA (genomic) (i) location in the genome: (viii)

LIS ‏(أ) كروموسوم/قطعة: منطقة سلسلة خفيفة متغيرة من نوع‎ ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)LIS (a) chromosome/segment: variable light chain region type Sequence description: recognition sequence number: (xi)

GATGACCCAG TCTCCAKCCT C 21GATGACCCAG TCTCCAKCCT C 21

OF ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i) ‏زوجا قاعدياً‎ YY ‏الطول:‎ (i) ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الموقع في المجين:‎ (vidi) ‏كروموسوم/قطعة: منطقة سلسلة خفيفة متغيرة من نوع لمندا‎ (1)OF Data for the discrimination sequence number: (7) Characteristics of the sequence: (i) base pair YY Length: (i) (b) Type: nucleic acid (c) How to splice: single-stranded (d) Morphology: linear Molecule type: DNA (genomic) (i) Location in the genome: (vidi) Chromosome/segment: variable light chain region of type Lumenda (1)

POF ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)POF Relay Description: Relay Recognition No.: (xi)

CTCAYTYRCT GCMCAGGGTC C 21 108 ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏قاعدياً‎ ay) V4 ‏(أ) الطول:‎CTCAYTYRCT GCMCAGGGTC C 21 108 Recognition sequence specific data: (Y) Sequence characteristics: (i) Basic ay) V4 (a) Length:

TeTe

VYAVya

‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (ii) ‏الاتجاه المضاد: يوجد‎ (iv) ‏الموقع في المجين:‎ (viii) ‏(أ) كروموسوم/قطعة: منطقة سلسلة خفيفة ثابتة من نوع كابا‎ 108; ‏وصف التتابع: تتابع تمييز رقم‎ (xi)(b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear Molecule type: DNA (genomic) (ii) Antisense: there is (iv) Location in the genome: (viii) (a) chromosome/segment: kappa 108 constant light chain region; Relay description: (xi) number recognition relay

AAGACAGATG GTGCAGCCA 19 100 ‏بيانات خاصة بتتابع التمييز رقم:‎ )7( ‏مميزات التتابع:‎ (i)AAGACAGATG GTGCAGCCA 19 100 Data for the discrimination sequence number: (7) Characteristics of the sequence: (i)

Laelia) Ye ‏(أ) الطول:‎ ‏(ب) التوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خحطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (i) ‏الاتجاه المضاد: يوجد‎ (iv) ‏الموقع في المجين:‎ (viii) ‏كروموسوم/قطعة : منطقة سلسلة خفيفة ثابتة من نوع لللمددا‎ 0 100 ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)Laelia) Ye (a) Length: (b) Speciation: nucleic acid (c) How to splice: single-stranded (d) Format: linear Molecule type: DNA (genomic) (i) Antisense: (iv) Location in the genome: (viii) Chromosome/segment: Lamdda 0 100 constant light chain region Description of the sequence: Recognition sequence number: (xi)

GGAACAGAGT ‏6ه‎ 20 107 ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏التتابع:‎ Ql rae (i) ‏زوجاً قاعدياً‎ 7١ ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎GGAACAGAGT 6H 20 107 Data for recognition sequence number: (Y) Sequence: Ql rae (i) base pair 71 (a) Length: (b) Type: nucleic acid

TeTe

(ج) كيفية الجدل: وخيد الجديلة (د) الهيئة الشكلية: خطي ‎(ii)‏ نوع الجزيء: دنا (مجيني) ‎(vii)‏ الموقع في المجين: )1( كروموسوم/قطعة: بادئ ‎PCR‏ لمنطقة ثابتة بشرية من نوع جاما ؛ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: ‎POT‏ ض ‎GGGGGGATCC TCATTTACCC AGAGACAGGG 30‏ (7) بيانات خاصة بتتابع التمييز رقم: ‎OV‏ ‎(i)‏ مميزات التتابع: (أ) الطول: ‎7١‏ زوجاً قاعدياً (ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎(ii)‏ نوع الجزيء: دنا (مجيني) ‎(viii)‏ الموقع في المجين: (أ) كروموسوم/قطعة: بادئ ‎PCR‏ لمنطقة ثابتة بشرية من نوع جاما ‏ ‎(xi)‏ وصف التتابع: تتابع تمييز رقم: ‎:0١‏ ‎GGGGGCTAGC ACCAAGGGCC CATCCGTCIT C 31‏ (7) بيانات خاصة بتتابع التمييز رقم: ‎HOA‏ ‏)1( مميزات التتابع: ))( الطول: 976 زوجاً ‎Lael‏ ‏(ب) النوع: حمض نووي (ج) كيفية الجدل: وحيد الجديلة (د) الهيئة الشكلية: خطي ‎ii)‏ نوع الجزيء: دنا (مجيني)(c) How to splice: strand strand (d) Morphology: linear (ii) Molecule type: DNA (genomic) (vii) Location in the genome: (i) Chromosome/segment: human constant region PCR primer gamma type; (xi) Description of the sequence: Recognition sequence number: POT Z GGGGGGATCC TCATTTACCC AGAGACAGGG 30 (7) Data for recognition sequence number: OV (i) Sequence characteristics: (a) Length : 71 base pairs (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear (ii) Molecule type: DNA (genomic) (viii) Location in the genome: ( a) Chromosome/segment: Human gamma constant region PCR primer (xi) Sequence description: Recognition sequence no: :01 GGGGGCTAGC ACCAAGGGCC CATCCGTCIT C 31 (7) Data for recognizing sequence no: HOA (1) Characteristics of the sequence: )( Length: 976 pairs Lael (b) Type: nucleic acid (c) How to splice: single-stranded (d) Format: linear ii) Molecule type: DNA Favorite

VY. ‏الموقع في المجين:‎ (viii) اماج ‏لمنطقة بشرية من نوع‎ PCR ‏(أ) كروموسوم/قطعة: تطفير‎VY. Location in the genome: (viii) Imaging of a human PCR region (a) Chromosome/segment: Mutagenesis

POA ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)POA Relay Description: Relay Recognition No.: (xi)

CCGGGAGATC ATGAGAGTGT 0011060111 TGGGGGGAACCCGGGAGATC ATGAGAGTGT 0011060111 TGGGGGGAAC

AGGAAGACTG ATGGTCCCCC 60AGGAAGACTG ATGGTCCCCC 60

CTCGAACTCA GGTGCTGGGC ATGGTGGGCA TGGGGG 96 109 ‏بيانات خاصة بتتابع التمييز رقم:‎ (Y) ‏مميزات التتابع:‎ (i) ‏زوجآً قاعدياً‎ YV ‏(أ) الطول:‎ ‏(ب) النوع: حمض نووي‎ ‏(ج) كيفية الجدل: وحيد الجديلة‎ ‏(د) الهيئة الشكلية: خطي‎ ‏نوع الجزيء: دنا (مجيني)‎ (ii) ‏الموقع في المجين:‎ (viii) ‏منطقة بشرية من نوع جاما ؛‎ PCR ‏(أ) كروموسوم/قطعة: تطفير‎ 108 ‏وصف التتابع: تتابع تمييز رقم:‎ (xi)CTCGAACTCA GGTGCTGGGC ATGGTGGGCA TGGGGG 96 109 Data for recognition sequence number: (Y) Characteristics of the sequence: (i) YV base pair (a) Length: (b) Type: nucleic acid (c) How to divide: single-stranded (d) morphology: linear Type of molecule: DNA (genomic) (ii) location in the genome: (viii) human gamma-type region; PCR (a) chromosome /Piece: Tafseer 108 Relay Description: Relay Recognition No.: (xi)

TCCTCAGCTA GCACCAAGGG GCCATCC 27 1aTCCTCAGCTA GCACCAAGGGCCATCC 27 1a

Claims (1)

YY ‏عناصر الحماية‎ ‏البشري يشتمل على تتابع‎ CD4 ‏متخصص ب‎ chimeric antibody ‏جسم مضاد خيمري‎ -١ ١ ‏منطقة السلسلة الخفيفة المتغيرة المذكورة في تتابعات التمييز رقم 0 وتتابع السلسلة‎ Y 0553 gamma 4 ‏المختار من الفثة التي تتكون من تتابع السلسلة الثقيلة جاما-ء‎ ALE 1 ‏المذكور في تتابع‎ gamma 4 ‏في تتابع التمييز رقم ا تتابع السلسلة الثقيلة جاما-؛‎ ¢ ‏المذكور في تتابع التميييسز‎ gamma 4 ‏التمييز رقم 3 وتتابع السلسلة الثقيلة جاما-؛‎ ° . ١ ١ ‏رقم‎ 3 ‏حيث‎ ١ ‏ل 200-004 وفقاً لعنصر الحماية‎ chimeric antibody ‏الجسم المضاد الخيمري‎ -" ١ ‏الموجودة فيه التتابع المذكور في تتابع‎ gamma 4 ‏تمتلك السلسلة الثقيلة جاما ؛‎ Y .١١ ‏رقم‎ ad 7 ‏حيث‎ ٠ ‏لعنصر الحماية‎ (6 9 Anti-CD4 ‏ل‎ chimeric antibody ‏الجسم المضاد الخيمري‎ -7 ١ .4 ‏تمتلك السلسلة الثقيلة جاما 4 التتابع المذكور في تتابع التمييز رقم‎ 7 ‏ل 200-004 وفقآ لعنصر الحماية )¢ حيث‎ chimeric antibody ‏؟- الجسم المضاد الخيمري‎ ١ . ‏تمتلك السلسلة الثقيلة جاما التتابع المذكور في تتابع التمييز رقم‎ Y ‏عند شخص تشتمل‎ rheumatoid arthritis ‏طريقة لمعالجة التهاب المفاصل شبه الروماتزمي‎ —0 ١ ‏وفقاً لعنصر الحماية‎ Anti- 004 ‏ل‎ chimeric antibody ‏على إعطاء جسم مضاد خيمري‎ Y .immuno suppression ‏بمقدار فال لإحداث كبت مناعي‎ ١ ¥ ‏عند شخص تشتمل‎ rheumatoid arthritis ‏طريقة لمعالجة التهاب المفاصل شبه الروماتزمي‎ -> ١ ‏وفقاً لعتصر‎ Anti- 004 ‏ل‎ chimeric ‏على إعطاء جسم مضاد خيمري تزةصطتئمة‎ YHuman YY protectors include the CD4 sequence specific for the chimeric antibody chimeric antibody 1-1 the variable light chain region mentioned in recognition sequence number 0 and the chain sequence Y 0553 gamma 4 selected from the phthl of which it consists From the gamma-heavy chain sequence ALE 1 mentioned in the gamma sequence 4 in the discrimination sequence No. A the gamma-heavy chain sequence ; ¢ mentioned in the gamma 4 discrimination sequence 3 and the gamma-heavy chain sequence; °. 1 1 number 3 where 1 is for 200-004 according to the protective element chimeric antibody "1" in which the aforementioned sequence is located in the gamma sequence 4 possesses the gamma heavy chain; Y.11 ad number 7 where 0 is for claimant (6 9 Anti-CD4 for chimeric antibody chimeric antibody 7-1 4). The gamma-4 heavy chain possesses the sequence mentioned in discrimination sequence #7 of 200 -004 according to the defending element (¢ where chimeric antibody ?- chimeric antibody 1). The gamma heavy chain possesses the sequence mentioned in the Y discrimination sequence in a person involving rheumatoid arthritis Method for treating rheumatoid arthritis —0 1 According to the protection element Anti- 004 for chimeric antibody on administration of a chimeric antibody Y . immune suppression of value to induce immunosuppression 1 ¥ in a person rheumatoid arthritis method includes treatment of sub-rheumatoid arthritis - > 1 According to the era of chimeric Anti- 004 on administering a chimeric antibody, Tzestamma Y و الحماية ١؛‏ بمقدار فال لإحداث كبت مناعي ‎.immuno suppression‏ ‎١‏ 7- طريقة لمعالجة التهاب المفاصل شبه الروماتزمي ‎rheumatoid arthritis‏ عند شخص تشتمل ‎Y‏ على إعطاء جسم مضاد خيمري ‎chimeric antibody‏ ل ‎Anti- CD4‏ وفقاً لعنصر الحماية و ¥ بمقدار فغَال لإحداث كبت مناعي ‎-immuno suppression‏ ‎—A ١ :‏ طريقة لمعالجة التهاب المفاصل شبه الروماتزمي ‎rheumatoid arthritis‏ عند شخص تشتملand protection 1; by Val to cause immunosuppression. According to the protective element and ¥ in an effective amount to induce immunosuppression —A 1: A method for treating rheumatoid arthritis in a person that includes ‎Y‏ على إعطاء جسم مضاد خيمري ‎chimeric antibody‏ ل ‎Anti- CD4‏ 885( لعنصر الحماية و ‎of‏ بمقدار فال لإحداث ‎CuS‏ مناعي ‎-immuno suppression‏Y on the administration of a chimeric antibody for Anti- CD4 885 (for the protective factor and value of Val for cuS immuno suppression) ‎١‏ 4- طريقة لمعالجة التهاب المفاصل الصدفي ‎psoriatic arthritis‏ عند شخص تشتمل على ‎Y‏ إعطاء ‎JLT ad lata‏ من جسم مضاد خيمري ‎chimeric antibody‏ ل 004 ‎Anti-‏ وفقاً 7 لعنصر الحماية ١؛‏ لإحداث كبت متاعي ‎-immuno suppression‏14- A method for the treatment of psoriatic arthritis in a person involving Y administration of JLT ad lata of a chimeric antibody to Anti-004 according to 7 Claim 1; to induce suppression Immuno suppression ‎-٠ ١‏ طريقة لمعالجة التهاب المفاصل الصدفي عند شخص 35 ‎Jai‏ على إعطاء مقدار ‎Y‏ فغّال من جسم مضاد خيمري ‎Anti- 004 — chimeric antibody‏ وفقاً لعتصر ‎v‏ الحماية ؟؛ لإحداث كبت مناعي ‎-immuno suppression‏-0 1 method for treating psoriatic arthritis in a person of 35 Jai to give an effective Y amount of a chimeric antibody Anti- 004 — chimeric antibody according to the age of protection v?; To cause immunosuppression ‎-١١ ٠‏ طريقة ‎dalled‏ التهاب المفاصل الصدفي ‎die‏ شخص تشتمل على إعطاء مقدار ‎Jad Y‏ من جسم مضاد خيمري ‎Anti- 004 — chimeric antibody‏ وفقاً لعتصر و الحماية ؛ لإحداث كبت مناعي ‎-immuno suppression‏-11 0 method of dalled psoriatic arthritis die person includes administration of Jad Y amount of Anti- 004 — chimeric antibody according to age and protection; To cause immunosuppression ‎—VY ١‏ طريقة ‎dalled‏ التهاب المفاصل الصدفي عند شخص تشتمل على إعطاء مقدار ‎Y‏ فعّال من جسم مضاد خيمري ‎Anti- 004 — chimeric antibody‏ وفقاً لعنصر 1 الحماية 4؛ لإحداث ‎CLS‏ مناعي ‎-immuno suppression‏—VY 1 method for dalled psoriatic arthritis in a subject includes administration of an active Y dose of Anti- 004 — chimeric antibody according to Clause 1 of protection 4; To induce CLS immune suppression ‏تمأpurr ‎aS iY \‏ صيدلي يشتمل على جسم مضاد خيمري ‎Anti- 004 — chimeric antibody‏ وفقآ ‎Y‏ لعنصر الحماية )¢ ومادة حاملة مقبولة ‎Wana‏ . ‎١‏ 4- تركيب صيدلي يشتمل على جسم مضاد خيمري ‎chimeric antibody‏ ل ‎Anti- CD4‏ وفقاً ‎Y‏ لعنصر الحماية ‎oY‏ ومادة حاملة مقبولة صيدلياً . ‎-١ ١‏ تركيب صيدلي يشتمل على جسم مضاد خيمري ‎chimeric antibody‏ ل 004 ‎y Anti-‏ 8( 7 لعنصر الحماية ‎oY‏ ومادة حاملة مقبولة صيدلياً . ‎-١“ ١‏ تركيب صيدلي يشتمل على جسم مضاد خيمري ‎chimeric antibody‏ ل 004 ‎Anti-‏ وفقاً ‎Y‏ لعنصر الحماية ؛؛ ومادة حاملة مقبولة صيدلياً. ‎Te‏aS iY \ Pharmaceutical comprising Anti- 004 — chimeric antibody according to Y of protection element (¢) and an acceptable carrier Wana. 1 4- A pharmaceutical composition that includes a chimeric antibody to Anti-CD4 according to the Y protection element oY and a pharmaceutically acceptable carrier. 1-1 Pharmaceutical composition comprising a chimeric antibody to 004 y Anti-7 (8) of the oY protectant and a pharmaceutically acceptable carrier. 1-1 Pharmaceutical composition comprising a chimeric antibody chimeric antibody to 004 Anti-according to the Y of claim ; and a pharmaceutically acceptable carrier.
SA93130328A 1993-01-10 1993-01-10 Anti-CD4 recombinant antibodies for human therapy SA93130328B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
SA93130328A SA93130328B1 (en) 1993-01-10 1993-01-10 Anti-CD4 recombinant antibodies for human therapy

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
SA93130328A SA93130328B1 (en) 1993-01-10 1993-01-10 Anti-CD4 recombinant antibodies for human therapy

Publications (1)

Publication Number Publication Date
SA93130328B1 true SA93130328B1 (en) 2006-03-08

Family

ID=58232782

Family Applications (1)

Application Number Title Priority Date Filing Date
SA93130328A SA93130328B1 (en) 1993-01-10 1993-01-10 Anti-CD4 recombinant antibodies for human therapy

Country Status (1)

Country Link
SA (1) SA93130328B1 (en)

Similar Documents

Publication Publication Date Title
AU717674B2 (en) Recombinant anti-CD4 antibodies for human therapy
EP0973550B1 (en) Antagonistic anti-avb3 integrin antibodies
JPH09512705A (en) Antibodies to E-selectin
EA021644B1 (en) Human monoclonal antibody against cd20 and use thereof
PL170321B1 (en) Method of producing molecules bonding antigen cd25
BG62656B1 (en) Recombinant antibodies for human medicine
CA2597717A1 (en) Antibodies against cxcr4 and methods of use thereof
CZ140195A3 (en) Humanized antibodies reacting with l-selectin
JP7048567B2 (en) Bispecific antigen binding polypeptide
CA2034574A1 (en) Recombinant human anti-cd18 antibodies
CA2070182C (en) Chimeric immunoglobulin for cd4 receptors
SA93130328B1 (en) Anti-CD4 recombinant antibodies for human therapy
US7037496B2 (en) Chimeric immunoglobulin for CD4 receptors
EP1249456A1 (en) Novel peptide and screening method by using the same
AU2013202393B2 (en) Human cytomegalovirus nuetralizing antibodies and use thereof
TIMoTHY et al. Receptor Function'