AUSTRALIA PATENTS ACT 1990 REGULATION 3.2 Name of Applcant INSTITUTE FOR RESEARCH IN BIOMEDICINE Actual Inventor/s ANTONIO LANZAVECCHIA and ANNALISA MACAGNO Address for Service: E. F. WELLINGTON & CO, Patent and Trade Mark Attorneys, 312 St, Kilda Road, Melbourne, Southbank, Victoria, 3006. Invention Title: "HUMAN CYTOMEGALO VIRUS NEUTRALIZING ANTIBODIES AND USE THEREOF", The following statement is a full description of this invention including the best method of performing it known to us.
This application is a division' application derived from Australian Patent Application No. 2012203417, which in turn is a 'divisional' application derived from Australian Patent Application No. 2009272284 (PCT/1B2009/006641 WO 2010/007533 ),Claiming priority of US Provisional Application Serial No. 61/081334, the endre text of which are hereby incorporated herein by reference, BACKGROUND Human cytornegalovirus (hCMV) is a widely distributed pathogen that may cause severe pathology in inmnosuppressed aduls and upon infection of the fetus and ha been implicated in chronic diseases such as athertselemsis, hCMV infects multiple cel types including fibroblasts, to endothelial, ephelial and hematopoiedc es [1] In vitro ppagated attenuated siniIs of bCMV, which are being developed as candidate vaccines, have lost the tropism for endothelial cels, while retaining the capacity to infect fibroblast [21, Two viral glycoprtein comrplezes are believed to control the ellular tropism of hGMV. A complex of glycoprotcins such as gMi gL and gO appears to b required for infection of fibrolasta while a complex of gHE gL and proins encoded by the 15 Ut11-UL 12S genes is implicated in infction of endothelial ceha, epithelia cell and dendritic chls 12-8]. Hyperinmune globulin aa already commercializd for the prophylaxis of hCMV disease associated with transplantation and recent evidence indicates that they have therapeutic effect in pregnant women [91. This therapeutic approach is limited by the low amount of ncutaluing 20 antibody that can be transfrred and for this reason the availability of human antibodies (such as human monoclonal antibodies) with high neutralizing capacity would be highly desirable Although sonc antibodies to gH, gB and UL128 and UL130 gene products have dcmonstated in virro neutralizing acdvities 17, 10, 11) and an antibody to gH was evaluated in clinical trials (that were discontinued due to lack of therapeutic effects), the neutalizing potency of the antibodies isolated so 25 far is modest Neutrahsation by these antibodies was observed at antibody concentrations ranging fwa 0.5 to 20 pg/n. Further, the current mthods typically measure the neutralizing potency of anti-hCMV antibodies using fibroblasts as target cells. However, hCMV is also known to cause pathology by infecting other cell types such as endothela, epithelial cels and leukocytes. Known antibodies to UL128 and UL130 show very low potency in neutralizing infection of endothelial cells 30 f71 and there do not appear to be any monoclonal antibodies available that would be capable of neutralizing infection of non-fbroblast target cells with high potency, There is therefc a need for antibodies that neutralize hCMV infection, particularly ICMV infection of non-fibroblast target cells, with high potency, as well as the elucidation of the target(s) to which such antibodies bind, 35 SUMMARY OF INVENTION The invention is based, in part on the discovery of novd antibodies that neutralize hCMV infection with high potency as well as nove epitopes to which the antibodies of the invention bind. Accordingly, in one aspect, the invention comprises an antibody and antigen binding fragments thereof tat have high potency in neutralzding hCMV.
IA
In one embodinent of the invention, the invention comprises a snonoconal anAody, or an antigen binding fragment thereof that binds to an epitope in the hCMV ULl2g protn, wherein the aibody neutralize hCMV infection, In another embodiment of the invention, the invention comprises an antibody, or an antigen binding fragment thereof, that binds to an epitope fioed by 5 the hCMV proteins gH, gL, UL128 and IL 130, the hCMv pmteins UL128, UL]30 and ULJ3 I A, or the hCMV proteins UL130 and UL'31 A, whenein the antmibody neutralizes hCMV infection. In yet another embodiment of the mvention, the intvention comprises an antibody, or an antigen binding fragment thereof, comprising at least one complementarity determining region CCDR') sequence having at least 95% sequence identity to any one of SEQ ID NOs: 18193, 204, 10 205,210, 174-177, 149, 178, 65-70, 8146, 07 02, 129-134, 145-150, 113, 161-164, -6, 17-22,33 38, 49-54, or 114-118, wherein thc antibody neutraizcs hCMV infection. In yet another embodiment of the invention, the invention conprises a heavy chain CDR1 selected from the gup consistng of SEQ i) NO : 88, 174, 65,8, 97, 129, 145, 113, 1, 17,33, and 49; a heavy chain CDR2 selected from the group consisting of SEQ ID NOs: 189, 204, 175, 66 15 82, 98 130, 146, 161, 2, 2, 18, 34, 50, an 1d 1; a a heavy chain CDR3 selected from the group consisting of SEQ ID NOs: 190,205, 210, 176, 67, 83, 99, 131, 147, 162,3, 19,35, 51, and 115, wherein the antibody neutralizes hCMV infection. In yet another embodiment of the invention, the invention comprises an antibody, or an antigen binding fragment thereof, comprising a light chain CDR I selected fmm the goup consisting of SEQ ID NOs, 191, 177,68, 84,100,132,148, 163,4 20 20,36, 52, and 116; a light chain CDR2 sciceted fom the group consisting of SEQ 1D NOs: 192, 149, 69, 85, 101, 33, 5, 21,37, 3, and 117; anda Iight chainCDR3 selected ftom the group consisting of SEQ ID NOs. 193, 1?8,70,86,102,134,150,164.6,22,38,54, and 118, wherein the antibody neutralize hCMV infection. In still another embodiment of the invention, the invention comprises an antibody, or an 25 antigen binding fragment thereof; wherein the antibody comprises a heavy chain viable region comprising the armno acid sequence of SEQ 10 NO: 200 and a light chain variable region comprising the amino acid sequence of SEQ TD NO: 201; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 200 and a light chain variable region comprising the amino acid sequence ofSEQ ID NO: 213; or a heavy chain variable region 30 comp sing the amino acid sequence of SEQ ID NO: 208 and a light chain '.ariable region comprisig the amino acid sequence of SEQ 1) NO: 201; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 208 and a light chain variable region comprising the amino acid sequence of SEQ IL) NO: 213; or a heavy chain variable region comprising the amino acid sequence of SEQ ItD NO: 212 and a light chai vana ble region 35 cotptising the amino acid sequence of SEQ iD NO: 201; or a heavy chain vanable region comprising the amino acid sequence of SEQ ID NO: 212 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 213; or a heavy chain variable region comprising the amino a1cd sequence of SEQ ID NO: 184 and a light chain variable region comprising the amino acid sequence of SEQ It NO: 185; or a heavy chan vanable region 40 comprising the amino acid sequence of SEQ ID NO: 77 and a light chain variable region comprising the amino acid egence of SEQ ID NO: 78 or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 93 and a light chain variable region comprising the amino acid sequence o f SE Q T) NO 94; or a heavy chain variable region comprising the amino acid sequence of SEQ ID) NO: 109 and a light chain variable region comprising the amino acid sequence of SEQ liD NO: 1 10; or a heavy chain variable region comprising the amino acid sequence of SEQ MD NO 141 and a light chain variable region comprising the anino acid sequence of SEQ ID) NO; 142: or a 5 heavy chain variable region comprising the amino acid sequence of SEQ 1) NO: 157 and a light chain variable region comprising the amino acizd sequence of SEQ 1D NO: 13: or a heavy chain variable region comprising the armno acid sequence of SEQ ID NO: 170 and a light chain variable region comprisig the amino acid sequence of0EQ ID NO: 71; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 13 and a Ight chain variable region comprising 10 the amino acid sequence of SEQ ID NO: 14; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 29 and a light chain variable region comprising !hc amino acid sequence of SEQ .D NO: 30; or a heavy chain i ariabe region comprising the amino acid sequence of SEQ ID NO: 45 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 40; or a heavy chain variable region comprising the amino acid sequence of SEQ 11D NO; 61 15 and a light chain variable region comprising the amino acid sequence of SEQ W0 NO: 62; or a heavy chain variable region comprising the amino acid scqucace of SEQ ID NO: 125 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 126, and wherein the antibody neutralize CMV infection. fi a further embodiment ofthe invention, the invenion comprises an antibody, or an antigen 20 binding fragment thereof, that neutralizes infection of endothelial cell-% epiealial cells, retinal cells, myckuid cells, dzndriuic cous isoblasi or roeschymal stronal ells by a clinical isolate of hCM, wherein the convention of tibody required for 909 neutralization of hCMV is 12 pg/mlor k In another embodiment of the invention, the invention comprises an anybody or en antigen bining ftagment thereofthat neutralizes infection ofendothelial ce ls epithelialcll 25 retinal celiaryelcid cellsdedtic cells, fibroblasts, or nsenchymal stomal cells by a clinical isolate of hCMV. wherein the concentratio of antibody required for 90% neutralisation ofhCMV is 10 pg4nl or less and wherein the antibody is not MSL-109 or SF9. In yet another embodiment of the invention the invention comprises an antibody, or an anigen binding Nagment thereof comprising at least one COR sequence having atleast 95% 30 sequence identity to any one of5EQ ID NOs: 216-221 22 23-23 5, 149,236,246-21 27-23 296 301.12, 36321 332,33&34135260,361 or 262-267, wherein the antibody neutralizes hCMV infection. In yet another embodiment of the invention, the invention comprises an anbodyoren andgen blding fragnmen thereof comprising a heavy chain CDRI selected from the group 35 consisting of SEQ I) NOs: 216,232, 246, 27, 296, 3163 ,352, 360 and 262;aeavychain CDR2 selected from the g-oup consisting of SEQ ID NOs: 2 233,247,2799 312 317, 337 and 263;and a heavy chaiCDRselected fomthe group consisting of SEQ D NOs: 218,234, 248280, 298,318, 332, 338 and 24 where the anybody neutralizes hCMV infecto In yet another embodisment of the invention, he invention comprises an antibody, or an 40 antigen binding fragment thereof, comprising a light chain CDRi selected from the group consisting of SEQ TD N~s: 219, 235, 249, 28, 299, 319, 339 and 265: a light chair CDR2 selected from the 3 group consisting of SEQ ID NOs: 220, 149, 250, 282, 300, 320. 340 and 266 and a light chain CDR3 selected from the group consisting of SEQ ID NOs: 221, 236, 251, 283, 301, 324. 341. 361 and 267, wherein the antibody neutralizes htCMV infection. In still another embodiment ofthe invention, the invention comprises an antibody, or ar 5 antigen binding fragment thereof, wherein the antibody comprises a heavy chair variable region comprising the amino acid sequence of SEQ ID NO: 228 and a light chain variable region comprising the amino acid sequence of SEQ ID NO; 229; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 242 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 243; or a heavy chain variable region 10 comprising the anio acid sequence of SEQ ID NO: 258 and a hght chain variable region comprising the amino acid sequence of SEQ ID NO: 259; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO; 290, and a ight chain variable region comprising the amino acid sequence of SEQ ID NO: 291; or a heavy chain viable region comprising the amino acid sequence of SEQ ID NO- 294, and a light chain variable region 5 comprising the amino acid sequence of SEQ ID NO: 291; or a heavy chain variable region comprising rte amino acid sequence of SEQ ID NO: 308, and a light chain variable region coupraising the amino acid sequence of SEQ ID NO, 309; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 314, and a light chain varable region comprising the amino acid sequence of SEQ i) NO: 309; or a heavy chain variable region 20 comprising the amino acid sequence of SEQ LD NO: 328, and a light chain variable region comprising the amino acid sequence of SEQ ID NO. 329; or a heavy chain variable region comprising the amino acid sequence of SEQ I) NO: 334, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 329; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 348 and a hght chain variable region 25 comprising the amino acid sequence of SEQ ID NO: 349; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 357 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 291; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 367 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 368 ora heavy chain variable region 30 comprising the amino acid sequence of SEQ 11) NO: 274 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 275, and wherein the anybody neutralzes hCMV infection The invention further comprises an antibody, or an antigen binding fragment thereoL produced by inmortaised B cel clone 8121, 2C22, 8C15, 4N 10, 11312, ;3( 6 4H9,6B4, 10C6, 35 ortLLidcposited with the Advanced Biotechnology Center (ABC), Earg Rossana Beni 10, 16132 Genoa (Italy ndehe terms of the Budapesa Treaty, on Y9,2008 (under Accesson Numibers PD08005, PD08007, PD08006, PD 08009, PD0080 1 PD 08012 PD 08013,PD08004 PD 08014, and PD 08010 respectively) and by inmonaled Bcell clone 7H3 deposited on July in, 2008 underAccession Number PD 08017. Antibodies and antigen binding fragmentsthereof; with 40 the samc amino acid sequence uN those cxpreosed from the aforementioned deposited immunortalised B cells are also considered to be within the scope of the invemion. .4 In another aspect, the invention complies a nuclici acid molecule comprising a polynucleotide encoding an antibdy or antibody frament of the invention that teutralizes hCMV infection. In yet another aspect, the invention mprise -el expressing an anibody of the invenion. In still another aspect, the invention comprises an isolated or purified immunogenic S polypeptidecomprising an epitopetat binds to an antibody of fhe invention. The invention xbrtkcr comprises a phwnetelcomposition, comprising an antibody of the invention or an antigen binding fragment thereof a ncleic acid molculeof the invention, or an immunogenic polypeptide of the invendonand a pharmacutically acceptable diuent or carrier The invention also comprseapharmaceutical composition comprising a first antibody or an 10 antigen binding fragment thereof and a second antibody, or an antigen binding fragment thereof, wherein the first antibody is an antibody of the invention, and the second antibody is an antibody that neutralizes hCMV infection, Use of an antibody of the invention, or an antigen binding fragment thereof a nucle acid of the invention, an immanogenic polypeptide of the invention, or a phamaceutical composition ofthe 15 invention Iin the manufacture of a medicament for he treatment of hCM infection yin a vaccine, or (iii) in diagnosis of hCM infection is also contemplated to be within the scope of the invention. Further use of an antibody of the invention, or an antigen binding fragment thereof, for monitoring the quality of anti-hCMV vaccines by checking that the antigenof said vaccine contains the specific epitope in the correct conformation is also contemplated to be within the scope of the 20 invention In a further aspect, the invention comprises an epitope wich specifically binds to an antibody of any one of the invention, or an antigen binding fragment thereof, for use (i) in therapy, (i'0 in te onuufactere of a medicament for treaiug hCM infection, (iii as a vaccine, or (iv) in screening for ligands able to nutralise hCMV infection. 25 BRrFF DESCRPTION OF Thm DRAVINUS Figu I shows staining ofHEK293T cells t:ansfected wih hCMV UL12, U1.30, UL131A. gl and gi genes, alone or in d i frent combinations, by representati nmonocona antibodies (15M8, 24.12 and 8121), Figure 2 shows osscompetition experiments in which HEK193T c els traufeeted with 30 hCMV gi (A) or gB (B) gene were fits incubated with an unlabeled compettor antibody followed by staining with a bietmnyla ted anti-gi- or anti-tB antibody. Figure 3 shows staining of HEK293T cells expressing either the wild type VI1814 UL 28 gene or a pan-mutated Ut28 gene by human monoclonal antibody 15D8 and a norcompeting anti UtI 28 mouse monoclonal antibody. The pan-mutated UL128 gene contains substitutions of the 3$ wild type VR 18 14 sequence with known variants described in othe clinical isolates and laboratory strains of hCMV DETMLED DESCRIPTION OF THE INVENTION The invention is base, in part on the discovery of novel antbodies that neutralize 1CMV infection with ilgh potency as wel as novel epitopes to which the anties of theinvention hind 40 Such antibodiesre desirablesonl ow concentrtions are required in order to neutralize a given amount of virus. This faciitates higher levels of protection whilst administering lower amounts of antibody. Accordingly, in one aspect, the invention comprises a neutralizing antibody and antigen binding fragments thereof having high potency in neutralizing hCMV infection. Human monoclond antibodies and the imortalised B cell clones that secrete such antibodies are also included within 5 the scope of the ivention. As used herein, the terms "fragment," "antigen binding fragment" and "antibody fragment" are used interchangeably to refer to any fragment ofan attibody of the invention that retains the antigen-binding activity of the antibodies Exemplary antibody fragments include, but are not limited to, a single chain antibody, Fab, Fab', Flab9), Fy or scfv, 10 As used herein, the term "high potency" is used to refer to an anybody of the invention or an antigen binding fragment thereof that neutralize hCMV infection with an ICw of less than about 2 pg/mi, (i.e, the concentration of antibody required for90% neutraisation of a clinical isolate of hCMV is about 2pg/ml or les forexample L.9, L, 15, L7, 16, 15, 14, 13, 1.25, 1.2, 115, 1, cr 105 pgml or less), In one embodimert the amibody of the preset invention, or antigen binding 15 fragment there, has an lW.V oft !ig/mi or less (ie. 0,95, 0.9, 0,8,A5, 0.8,07%,7, 0,6,0.5,0, 0,3, 0.2, 0.1, 0.05, 0.91 pg/mI or less), lat another emnbodenentt, the antibody of thbe present invention, or antigen binding fragment thereof, has an IG, of 0.16 pg/m or less (i.e, 0.15, 0.125 0.1, 0,.075, 0.05. 0.025, 0.02, 0.0 15, 0,0125,.1, 0.0075, 0.005, 0.004,0,003, 0.002 pg/mI or less), In another embodiment, the antibody can neotralize hCMV infection at n concentration of 0 416 ag/mI or less 20 (i.e. at 0.015, 0.013, 0.01, 0.008, 0,005, 0.003, 0.002,0,001, 0,0005pgm or lass This rneansthat only very low concentrations of antibody are required for 90% neutralisation of a cynical isolate of hCMV in varo compared to the conceration of known antibodies g,, MSL -109, F9 or 3E3, required for neutralisaton of the same litre of hCMVW, Potency can be measured using a standard neuralisation assay as known to one of skill in the art. 2 In one embodiment, the inventin provides an antibody, for example, a monoclonal antibody or a human monoclonal antibody, or an autigen binding fragment thereof, that binds to an epitope in the hCMV U T128 protein and neutralizes hCMV infecdon wit aen IQ of tess than abolu jg/ for example 1.9, 1, 75, 13, 1.6, 15. IA,; 1.3,125, 1.2, 15, 1.1 (,15t 1, 0,95, 0.9, 018; 0 .8, 075, 0.7, 0.6.0. 5, A0.3,02,0.15, 0,125, 01, 0,075, 0.05, 0,025, 0.02, 0.015, 0.0125,.,01, 30 0.0075, 0.005, 0,004 0,003, 0,0020,00L 0,00O5gml or less, In another embodiment, the invention providesan antibody, or an antigen binding fragment thereof, that hindso an epitope formed by the hCMV proteins gH, gL, Ut 128 and UL 130, and ncutralizes hiCMV infection with an iC 90 of less than about 2 pgm, for example 1. .8, 1 7.75, 1 7, 1.6,5, 1., 11.3, 1 5, 1.2, 1.15, I.1, 1.05, 0, 0.9, 0.85, ., 0.5, 0.7, 0,6, 0,5 04, 0.3, 0.2, 35 0.15, 0.12$, 0.1, 0,075, 0.05,. 0.0 0.02,0.015, 0,0125, 0.01,0,0075, 0.005, 0.04 0,003, 0,002 .0 0 1 0.4005pg/inl or less. In another embodimnm, the invention provides ni atibody, or an atigen binding fragment thereof, that bids to an epitope formed by the hCMV proteins ULI 28, UL130, and UL13I A, and neutralizes hCMV infection with an IC$, of les tn about 2 pg/md for example 1.,1.8, 1.75, 17, 40 1.6, 15, 14, 13,1 25, 1.2, 115,11,1.05,1L0.45. 01, 0.85. 0, 0.75, 07 o. 0.5, 0A 0.0.2, 6 015 025,0 075005 0 025,002 0015,0.0125, 0.01 00075,0005, 0004,0.003 0.002 0.001, 0005pg/n or less. In another embodiment, the invention provides an antibody, or an antigen binding fragment thereof, that binds to an epitope formed by the htCMV proteins UL 130 and UL 131 A, and neutralizes 5 hCMV infection with an o(4 of less than about 2 pg/iL, for example 1.9, 1.75, 1.7, I,6, 1.5, 1.4, 1.3 1.25, 12, 1.1$. .1, 1.05, 1,0.95,03,0.85, 08, 0.75, 0.7,06,0.50.,4,03, 0,2,0.15,0.125,0.1, 0.075, 0 OS, 0,025, 0.02 0.015, 0.0125, 0.01, 0.0075, 0.005, 0.004, 0.003, 0,002 0.001, 0.00gg'm'J or less. In yet another embodiment, the invemion provides an antibody, or an antigen binding 10 fragment thereof, thal binds to an epitope in the hCMV giH protein and neutralizes CM infection With an IC% of les than about 2 pg/mI, for example 1.9, 1. 1.75, L7, 16, 1 5, 1.4, 13, L25, 1.2, 1.15,1.1 1,0OS,L0.95, 0.9, 0.25,.,8, 05,0,0,6, 0.,OA4 0.30.2, 0,15,O0125, 0., 0,075,.05, 0,025, 0.02, 0,015, 0.0125, 001, 0.0075,0.005, 0.004, 0,00 0 002 0.001 0.0005pg/ml or lem. In yet another embodiment, the invention provides an antibody, or an antigen binding 15 fragment thereof, that binds to an epitope in the hCMV gB protein and neutralizes hCMV infection with an 1Cs of less than about 2pg/m, for example 19, 1.8, 1.75, 17, 1.6, 5, 1A, 1.3, 1,25, 1.2, 1.15, L, 1.05, 1.0,95, 09, 0.85, 08, 0.75,0 0.6, A .0.4,0.3, 02, 0.15, 0.125 0. 1 0.07, 0.05, 0.025. 0.02, 0,015, 0.0125, 0.01, 0.0075, 0.005, 0004, 0003, 0.002 0,001, 0.0005pg/ml or less. In another embodiment the invention pv ides an antibody, or an antigen binding fragment 20 thereof, that bin to an epitope fomed by the hICMV proteins gM and gN and neutralizes hOMV infection with an 1I4, of less than about 2pg/ml, for example 1L9,1L8, 1.75, L.7.1L6, 1.5,1.A,1.3, 125, 1.2, IS, I L L, 0,95, 09, 0.85,4 035 0., 0,O 0,4,0,3 0,2, 0.15, 0 125, 0.1, 0,075, 05 , 0.02, 0,015, 0.0125,0,01, 0.0075, 0.005, 0.004, 0.003, 0,002 0,001, 0,0005pg/m1 or less, 25 Antbodies or the invention The invention provides antibodies having particularly high potency in neutralizing hCMV As used herein, an "antibody that neutralizes>' is one that prevents, reduces, delays or interferes with the ability of a pathogen, eg., hCMV, to initate and/or pevreuate an infection in a host. The aanbodies of the invention ad antigen-binding fragrments thereof are able to neutralize hCMV 30 infection of several kinds of cells. In one embodiment, an antibody according to the invention neutralizes infection of epithelial Cells, retinal cella, endothelial cells, mNeloid cells and dendritic, cells. The antibodies of the invention may also neutralize hCM V infection of fibroblarts and niesenchynmai shmmal cells, These antibodies can he used as prophy lactic or therapeutic agents upon appropriate formulation, or as a diagnostic tool, as described herei 35 The antibodies of the mention may be monelonal anibodie, human antibldies, or reeonbinamt antibodies. In one emnbothmneni, the antibodies of the invention arc mnonoclonal anbodies eg, human monoclonal antibodies. The invention also provides fragments of the antibodies of the invention, particularly fragmentshat retain the antigen-binding activity of the antibodienmd ntcraize hCMV infection. Although the specification, including the clains, may, in 40 some places, refer explicity to antibody fragments) variant(s) and/or derivative(s) of anibodies, it 7 is understood that the tern "antibody"or antibodyy of the nvention" includes all categories of antibodies, namely, antibody fragment(s), variant(s) and derivative(s) of antibodies. In one embodiment, the antibodies of the invention and antigen binding ftagmnems thereof bind to one or more hCMV proteins. The antibodies of the invention may bind to an epiope formed 5 by a single hCMV protein or by a combination of two or mor CMV proteins. Exemplary hCMV proteins inchide, but are not limited to, products of viml genes ULS (envelope glycoprotein B. "gB"), UL75 (envelope glycoprotein H, "gH"), UI100 (glycoprotein M "gM") UL73 (glycopntein N, gN"), U 15 (glycoprotein L. "gL"), UL1.y4 (glycoprmtein , "gO"), U 28 (glycoprotein ULI28, "ULI 28"h UL.130 (glycoprotein UL130 "UL 130") or UL131A (glycoprotein UL131A, 10 "UL 1 IA"). i one embodiment, the antibodies of the invention bind to an epitope formed by a single hCMV protein. In another embditen, the antibodies bind to an opitope formed by the combination of2, 3, or more hCMV proteins. In an exemplary embodiment, the invention comprises an antibody, or an antibody fragment thereof, that binds to an epitope in the hCMV protein UL 128, or to an epitope formed by the hCMV 15 proteins U1).130 and UL 31A, or to an epitope formed by the hCM V proteins U L 28, U Ll 30 and UL 13 1A, or to an epitope formed by the hCMV proteins girL,gL UL128, and UL130, or to an epitope in the hCMV protein gH. or the hCMV protein gB or to an epitope formed by the hCMV proteins gM and gN, in one embodiment, the invention comprises an antibody, or an antibody fragment thereof 20 that binds to an epitope in U28. In another embodiment, the invention compiles an ttntibody, or an antibody fragment thereof, that bids to an epitope forced by UL I '0 and UL. 31. As used herein, an epitope formed by U 30 and U1.13 A means that the iTore may be formed by both UL 130 and UL a131 A protein or may be formed by one of the two proteins, the presence of the other protein being necessary for antibody binding. In yet another embodiment, the invention comprises 25 an antibody, or an antibody fragment thereof, that binds to an epitope fomted by UL1.28, UL130 and UL131A, As used herein, anepitape formed by UL128,1U130 and UIL131A means that the epitope may be formed by alI three proteins (U 1.12$, UL 130 and UL 1 3 A) or may be fonned by one or more protein(s), the presence of the other protein(s) being necessary for antibody binding. In still another embodiment, the invention comprises an antibody, or an antibody fragment thereof that 30 binds to an epitope formed by gHl, gL. UL1.128, and UL1.130. As used herein, an epitape Cormed by g, gU UL128, and UL 130 means that the epitope may be formed by all tut proteins (gHl, gL UL .28, and .1U 0 VO) or may be formed by one or more of the four protein(s). the presence of the other protein(s) being necessary for antibody binding. In another embodiment, the invemion comprises an antibody, or an antibody fragment thereof, that binds to an epixepe formed by gM and 35 gN. As used herein, an epitome formed by gM and gN mtaans that the epitope may be formed by both gM and gN or may be formed by one of the two proteins, the presence of the other protein being necessary for antibody binding The sequences of the heavy chains and light chains of several exemplary antibodies of the invention, each comprising three CDRs on the heavy chain and three CDRs on the tight chain have 40 been determined. The position of the CDR amino acids are defined according to the IMGT nuInbering system 12, 13, 14] The sequences of the CDRs, heavy chansght chains as well as the
S
eqUnces of the nucleic acd Tolecues encoding the CDRs, heavy chains, light cains are disclosed in the sequence listing. Table I provides the SEQ ID NOs, for the sequences of the six CD1s of the exemplary antibodies of the invention. Tables 2 and 3 provide the SEQ ID NDs for the sequences of the heavy and light chains, respectively, of the excrplary antibodies of the invention, and Table 4 $ provides the SEQ WD NOs for the sequences of the nucleic acid molecules encoding the cDR heavy chains and light chains of the anibodies, Table 1 SEQ ID NOfor Antibody CDRR1, CDRHJ, SEQ 1 NOs. for CDRLI, CDRH13 CDRL2, CDRL3 S1I8 188, 189, 190 191, 19293 15D)8 variant 1 188, 204, 205 191, 192, 193 5D8 variant2 188, 189,210 191, 192 93 4N10 1, 2,3 4, 5. 6 107 17, 18 19 20 21, 22 10P3 33, 34,35 36,37, 38 4122 49, 5051 52, 53, 54 8L 13 113, 114,113 116, 117, 118 2C12 65,66,67 68,69, 70 8C15 81,82,83 84,85,86 916 __ 97, 98, 99 100, 101, 02 7113 129, 130, 131 132, 133, 134 8J!6 145,146,147 148,149, 50 8121 174,1175, 176 | 177, 149. 178 7I13 113, 1 162 163, 14 164 713 316,317,318 319,320,321 7H3 variant l 316, 317, 332 | 319,.320, 321 6B4 336, 337, 338 339, 340, 341 S_ _7 278, 21 1.'279, 280 281,282 283 10C6 32,279 281, 282, 283 4H39 296, 297, 298 1 299, 300, 301 41-19 ariant--- . .................. 4H9 vaxiant 1 296, 312, 298 299, 300 301 lIfM 232, 233, 234 235,149,236 1H11 216, 217, 218 _ _ 219,.223, 221 3016 246,247, 248 249,250,251 2811 360, 279,280 281,282,361 613 26, 263,264 265266, 267 Table 2. Antibody SEQ ID NOs for Heavy Chains 1508 200 l5D8varn 208 SDS) variamt? 212 4N10)___ 13 30F7 29 10P3 45 4122 61 M-L13 1___ 25 ____ 201 77 8C215 93 9 16 ---- - ----------- --- 9 - 713 13 A________I__ 6 157 8121 -84 7113 170 9 7H3 328 73 variant 1 334 6B4 348 5E 1 29W. SFi variantl. 294 10C6 |357 41H9 308 4H9 variant 314 11812 _242 13H-11 ___ 228 3016 238 2B11 367 603 274 Table 3. Antibody SEQ ID NO for Logt Chains 15D8 201 15D8 variant 1 |201 15DS variant 2 4 213 4N10 IA1 10F7 30 10P3 46 4122 62 8L3126 ____ 2C12 78 8Cis5 94 916 110 F7)13 142va_. I8J16 9158 8121!_______ 185 7113 3l 7H3 ________329 3 variant 1 329 6B4 ___349 5F1 291 53 vaIa 1 291 10C6 291 4H79 309 N11 vint 1 309 118312 243 13H 111 229 3(316 259 2811 368 6L3 275 Table 4 Antibody SEQ 1D NO far N3le Acids eacoding D m y Chains Light Chaios and Variants (CDR1 1, CDRH, CORMI, CDRL1, CDRL2, CDRU and varlants, Heavy Chain and variants; and Light Chains and variants) 15.D8 194-199 and 206,207,211; 202 and 20, 14; 203 and 215 4N10 --- ;--5;- 10P3 39-44; 47;48 4122 55-60; 63; 64 81.13 119-I2 1T28 -- --- -- 202 71-76; 79; 80 CI5 87-92; 95; 96 916 l03~i8, 1! 1, 112 71013 135-140; 143; 144 8316 151-156 59; 160 _______ 8121 179-182155,183; 186; 187 713 65,166, i67, 168, 155, 169; 172; 173 713 322-327 and 3 )3; 330 and 3il: 331 6B4- 342-347; 350; 35 SF1 284-289; 292 and 295; 293 1006 353-355, 287, 288, 356; 358; 359 4H9 302-307 and3; 310 and 31; 311 11812 237-240, 155, 241; 244; 245 134I 1 222-227; 230; 231 3016 252-257; 260; 261 2B11 362-3M; 287,365,366; 369; 370 613 |-268-273; 276; 277 In one embodiment, the antibodies or anybody fragments of the invention comprise one or more heavy or light chain CDRs of the exemplary antibodies of the invention, In an exemplary embodimeat 4 thc antibodies or antibody fragments of the invention comprise an amno acid sequence selected from the group consisting of SEQ TD NOs: 188-193, 204-205, 210, 1-6, 17-22, 5 33-3& 49-54, 113-118, 65-70, 816, 97-102, 129-134, 145-150, 174-178, and 161-164. In another anbodimnt, the antibodies of the invention comprise a heavy chain comprising an amino acid sequence of one or more of SEQ ID NOt 188-190, 204, 205, 210, 1-3 17-19, 33-35, 49-51, 113-1 l5.65-67,8t-83, 97-99, 129-131, 145-147, 174-176, 161 or 162. Forexample, the antibodies of the invention comprise a heavy chain comprising SEQ ID NO: 188 for Ci)R-I I, SEQ 10 ID NO. 19 for CDR2, SEQ ID No: 190 for CDRH-13; SEQ ID NO: 188 for CDRHJI, SEQ ID NO; 204 for CDRH2, SEQ ID NO: 205 for CDRH3; SEQ ID NO; 188 for CDRH I, SEQ ID NO: 189 for CDRU, SEQ TD NO: 210 for CDRH3; SEQ ID NO: I for CDRHI, SEQ ID NO: 2 for CDRH2, SEQ ID NO: 3 for CDRIH3; SEQ ID NO; 17 for CDRH 1, SEQ MD NO; 18 for CDRI-12, SEQ ID NO: 19 for CDRIH-3; SEQ ID NO- 33 for CDRH1, SEQ 1D NO: 34 for CDRH2, SEQ ID NO: 35 for 15 CDRH3; SEQ ID NO 49 for CHRHI, SEQ D NO: 50 for CHRH2, SEQ ID NO: 51 for CDRH13: SEQ ID NO: 113 forCDRHL, SEQ ID NO: 114 for CDRI2, SEQ ID NO: 115 for CDRU3; SEQ ID NO: 65 for CDRIH, SEQ ID NO: 66 for CDRPH2, SEQ ID NO: 67 for CDRH13; SEQ ID NO:8 1 for CDR H , SEQ ID NO 82 for CDR{2, SEQ ID NO: 83 for CDRT13; SEQ 1) NO: 97 for CDRIH, SEQ ID NO: 98 for CDRH2, SEQ ID NO: 99 for CDRH3 ; SEQ ID NO. 129 for CDR H 1, SEQ ID 20 NO: 130 for C DRH2, SEQ ID NO: 131 for CDR3; SEQ ID NC): 145 for CR1,41 SEQ ID NO: 146 for CD RW2, S EQ ID NO: 147 for CDRH3; SEQ 1D NO: 174 for CDRH Il SEQ ID NO: 17$ for CDRM42, S EQ 1 NO: 176 for CDRK3; and SEQ i) No:1 13 for CDR 11SQ NO; 16 i for CDR012, SEQ 11) NO: 162 for 1CDR13. in yet another embodiment the antibodies of the invention comprise a light chain comprising 25 an amio acid sequence of one or more of SEQ ID NOs: 191-193, 4-6, 20-22,36-38, 5 , 116 118, 68-70, 84-6, 100-102, 132-134, 148-150, 177. 178, 163, or 164, For example, the antibodies of the invention comprise a light chain comprising SEQ I) NO: 191 for CD)RI. 1, SEQ 1D NO: 192 for CDRL2; SEQ ID NO: 193 fOr CDRL3; SEQ 10 NO: 4 for CDMR L, SEQ ID NO: 5 for CDRL2 I1 and SEQ 1D NO: 6 for CDRL3; SEQ ID NO: 20 for CDR L1, SEQ TD NO: 21 for CDRU2 SEQ WD NO: 22 for CURL3, SEQ ID NO; 36 for CDRIL, SEQ ID NO: 37 for CURL2, SEQ ID NO: 38 for CDRI3; SEQ ID NO: 52 for CDRL1, SEQ lONO: 53 for CDRL2, SEQ ID NO: 54 for CDRL3; SEQ ID NO: 116 for CDRL I, SEQ ID NO: J17 for CDRL2, SEQ ID NO: 118 for CDRL3; SEQ 1D 5 NO; 68 for CDRL 1, SEQ ID NO: 69 for CDRL2, SEQ ID NO: 70 for CDRL3; SEQ 11- NO 84 for CDRL, SEQ ID NO: 85 for URL2, SEQ ID NO: 6for CDRL3; SEQ 11) NO: 100 for CDR I SEQ D NO: 101 foroRLrDRSEQ INOEQ WDNO: 132 for CDRL I, SEQ ID NO: 133 for CDRL2, SEQ ID NO: 134 for CDRL3; SEQ ID NO: 148 for CDR L 1, SEQ ID NO: 149 for CDRL2, SEQ ID NO: 150 for CDRL3; SEQ ID NO: 177 for CDR I , SEQ D NO: 149 for 10 CDRL2, SEQ ID NO: 178 for GURU; SEQ ID NO: 163 fbrCDRLISEQ D NO: 149 forCDRL2 and SEQ I0 NO: 164 for CDRL3. In stl anotherembodimnt the anbodies of the invenion comprise a heavy chain with an amino acid sequence that is at least 70% identical to those of SEQ ID NOs: 200,208, 212, 13, 29, 4S, 61, 125, 77, 93, 109, 141, 157, 184. or 170, and neutralize hCMV infection In one embodiment, 15 the antibody binds to an epitope in the hCMV UL 128 protein and comprises a heavy chain having an amino acid sequence that is at least 70%, at Icast 75%, at least 80%, at least 85%, at least 90%, at lea 95%. at least 98%, or at [es 99% identical to the amino acid sequence of SEQ I) NO: 200, 208 or 212, and neutralizes hCMV infection. 1n one embodiment, an amibody according to the invention comprises a heavy chain having the sequence recited in SEQ ID NO: 200 208 or 21 2, and 20 neutralizes hCMV infection. In another emboditent, the antibody binds to an epitope fonmed by the hCMV proteins ULi 30 and ULI 31A and comprises a heavy chain having an amino acid seguence that is at leat 70%, a least 75%a t least 80%, at least 85%. at least 90% at least 95%, at least 9%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 13, 29, 45, 61 or 125, and neutralizes 25 hCMAV infection. lit one embodincat, an antibody according to the invention comprises a heavy chain having the sequence recited in SEQ ID NO; 13, 29, 45, 61 or 125, and neutralizes hCMV infection, in yet another embodiment the antibody binds to an epitope formed by te hCMV proteins Ut128, UL130 and UtL13 1A and comprises a heavy chain having an amino acid sequence that is at 30 least 70%, at least 7% at least 80% at least 85% at least 90% at least 95% at least 98% or at least 99% identical to the amino acid sequence of SEQ TO NO:77,9 109, 141, 157, or 170, and neutralizes ICMV infectionIn one embodiment. an antibody according to the invention comprises a heavy chain having the sequence recited in SEQ H) NO: 77, 93, 109, 141, 157, or 170, and neutralizes hCMVinfection 35 Ii a further dembodient, the antibody bind's to an epitope formed by the hCMV proteins gO, gL, U 128 and L.10 and comprises a heavy chain having an amino acid sequence that is at least 70% at leas 75%, at least 80%, at least 8%, at least 90%, at least 958%%, is 9 orat least 99% idrnical to the amino acid sequence of SEQ ID NO: 184, and neutrlizes hOlAV infietion In. one emblodimnentan antibody according to the invernion comprises a heavy chain having the 40 sequence recited in SEQ ID NO: 14, and neutradizes 8CMXinfection. 12 In yet another embodimenthe antibodies of the invention comprise a light champ with an amino acid sequence that is at least 70% idential to those of SEQ ID NOs: 201,213, 14, 30, 46, 62, 126 78, 94, 110, 142, 158, 185 or 171, and neutralize hCMV infection In one embodiment, the antibody binds to an epitope in the hICMV U128 protein and 5 comprise a ght chaIn having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 201cr 213, and neutralizes bCMV infection, In one wtboditnt, an antibody according to the invention comprises a light chain having the sequence tecited in SEQ ID NO: 201 or 213, and neutralizes hCMV infection. 10 In one embodiment, the amibody binds to an epitope formed by the hCMV proteins Li 30 and U1 131 A and comprises a light chain having arn amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ I) NO: 14, 30, 46, 62 or 126, and neutralize hCMV infection, in one embodiment, an antibody according to the invention comprises a light chain having the 15 sequence recited in SEQ ID NO: 14, 30,46, 62 or 126, and neutralize hCM'V infection. In another embodimentthe antibody binds to an epitope formed by the hCMV proteins UAL128, UL130 and UL13IA and comprises a light chain having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% at least 98%, or at least 99% identical to the amino acid sequecccof SEQ 13D NO: 78, 94, 110, 142, 158, or 171Land 20 neutralizes hCMV infection, Inone etbodiment, an anybody according to the invenion comprises a light chain having the sequence recited in SEQ 1D NO: 78, 94, 110, 142, 158, or 171, and neutralizes hCMV infection, in a further embodimetthe antibody binds to an epitope formed by the hCMV protcins g, gL, UL-11 and U1130 and comprises a light chain having an amino acid sequence that is at least 2S 70%, at least 15%, at east 80%, at least 5% at last 90%, atast95%, at east 98%or latest 99% identical to the amino acid sequence of SEQ ID NO: 185iand neutralizes hCMVinfeton In one embodiment, an antibody according to the invention comprises a light chain having the sequence recited in SEQ ID NO 185, and netraiss hCMV ifection In another embodiment, the antibodies or antibody fragments of the invention comprise one 30 or more heavy or light chain CDRs ofthe exemplary antibodies of the invenion I an exemplary embodiment, the antibodies or antibody fragmrents of the invention comprise an amino acid sequence selected from the group consisting of SEQ 11D Ns: 316-321, 332, 336-341, 278-283, 352. 296-30312,232-236,149,216-221, 246,251, 360, 361 and 262-267, and neutralize hCMV infection, AS In yet another embodiment, the antibodies of the invenion comprise a heavy chain comprising an amino acid sequence of one or more of SEQ ID NO,: 316-318, 332 336338,278 280, 352, 296-298, 312, 232-234, 216-218, 246-248, 360, 361 and 262-264, For example, the anibodies of the invention comprise a heavy chain comprising SEQ ID NO: 316 for CDRHI, SEQ ID NO. 317 for CDRW., SEQ ID NO: 318 forCDkH3; SEQ ID NO: 316 fbr CDRI1, SEQ ID NO: 40 317 for CDR H2, an d SEQ ID NO: 332 for CDRR3; SEQ ID NO 336 for CDRH I, SEQ 1D NO: 337 for C)R2, SEQ ID NO: 338 for CD-1R3: SEQ ID NO: 278 for C 1,1. SEQ ID NO: 279 for 13 CDRH2, SEQ ID NO: 280 for CDI{H3; SEQ 10 NO: 352 for CDRH1I, SEQ I NO: 279 for CDRH-2, SEQ ID NO: 280 for CDRHI3; SEQ ID NO: 29 for CDR HI, SEQ ID NO: 297 for CDR!2, SEQ ID NO: 298 For CDRH3; SEQ ID NO: 296 for CDRH I, SEQ IDNO: 312 for CDRH2, SEQ IDNO: 298 for CDR-3: SEQ ID NO: 232 for CDR H I. SEQ IDNG: 233 for 5 CDRH2, SEQ ID NO: 234 for CDRH3, SEQ 1) NO: 216 for CDRI, SEQ ID NO: 21 for CDRHZ, SEQ ID NO: 218 for CDRH3, SEQ ID NO: 246 forCDRHI. SEQ I) NO 247 for CDRH2, SEQ ID NO: 248 forCDRH3; and SEQ ID NO: 360 forCDRlH, SEQ ID NO: 279 for CDRH2, SEQ ID NO: 280 forCDR H3; and SEQ D NO: 262 for CDRHI , SEQ ID NO: 263 for CDRH2, SEQ ID NO: 264 for CDRH3. 10 In still anobtherebodimentte antibodies of the inVention comprise a ght chain comprising an aMino acid sequence of one or more of SEQ ID NOs: 319-321, 339-341, 281-283. 299-01. 149,235, 236.219-221/249-251265-267. For example, the anibodies of the invention comprise a light chain comprising SEQ D NO 319 for CDRL 1, SEQ ID NO: 320 for CDRL2, SEQ ID NO: 321 for tDRL3; SEQ ID NO: 339 for CURL , SEQ D NOI: 340 for CDRL2, SEQ I D NO: 15 341 for CDRLS; SEQ ID NO: 281 for CDRIA. SEQ ID NO 282 for CDRL2, SEQ ID NO: 283 for CDRL3; SEQ ID NO: 299 or CDR1, SEQ ID NO: 300 for CDRI, SEQ ID NO01 for CDRL3; SEQ ID NO: 23 for CDRL1,SEQ ID NO: 149 for CDRL2, SEQ ID NO: 236 for CDRLS; SEQ ID NO: 219 for CURL , SEQ 1D NO: 220 for CD2, SEQ ID NO: 221 for CDRLS; SEQ D NO: 249 for CDR1, SEQ ID NO: 250 for GUR2, SEQ 1) NO: 251 for CDR L3; and SEQ ID NO: 281 for 20 CR1, SEQ ID NO: 282 for CDRL.2, SEQ I) NO: 361 for CRL and SEQ ID NO: 265 for CDRL1, SEQ ID NO: 266 for CDRL2, SEQ 1D NO: 267 for CDRL3 In a farther embodiment the antibodies of the invention comprise a heavy chain with an amino acid sequence that s at least 70%identcal to those of SEQ ID NO:328 334, 348,290,294, 357 308, 314, 242, 228, 258, 367 or 274, and neutralizes hCV infection 25 1 one embodimentthe antibody baind to an epitope in the hCMV gB proteinand comprises a heavy chain having an amino acid sequence that is at lest 70%ateast5%alet0% at leat 85%, at least 90%. at least 95%, at least 98%; or at least 99% identical to the amino acid sequence of SEQ 1D NO:f328, 334. 348, 290, 294308,357.314 or 367, and neutralizes hCMV infection in one embodiment, an antibody according to the invention comprises a heavy chain having the 30 sequence recited in SEQ I) NO: 328, 331, 348, 290,291, 308 357, 314 or 367 and neutralizes iCMV infection In another embodiment, the antibody binds to an epitope in the hCMV 2H protein and comprises a heavy chaitn having an amino acid sequence that is at least 70%, at least 75%, at least 80%, a: easS5% a east 90%, at least 95%, at least 98%, oral leat 99% identical to the amino 35 acid sequence-of SEQ ID NO: 242., 228, or258, and neutmlizes hCMV infections. In one embodiment, an aibody according to the invention comprises a heavy chain having the sequence recited in SEQ ID NO: 242, 228, or 258, and neutralzes hCMV infection. If another embodimentthe antibody binds to an epitope formed by the hCMV proteins gM and gN and comprises a heavy chain having an amino acid sequence that is at least 70%, at least 40 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the amine acid sequence of SEQ 1) NO: 274, and neutralizes hCMV infection In one embodiment, 14 an antibody according to theiyendoncomprises a heavy chain having thesequence recited in SEQ ID) NO 274, and neutnfizes hCMV infection, In yet another embodi-ment, the antibodies of the invention comprise a light chin with an amino acid sequence that is at leost0% identicatothose of SEQ ID NOs: 329, 349,291, 309 243. 5 229, 259, 368 or 275, and neutralize hCMfV infeion. In one embodiment, the antibody binds to an epitope in the hOMV gBR proca and comprises a light chain having an amino acid sequence that is atlast 70%, a leas 75%, at least 80%, at least 85%, at least 90% at least 95%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO, 329, 349, 291, 09or 36 and neutralies hCM infection In one enfodiment; an it) antibody according to the invention comprises a light chain having the sequence recited in SEQ ID NO: 329, 349, 291, 309 or 36, and neutralizes hCMV infection. In another embodiment, the antibody binds to anepitope in the hCMV gH protein and comprisesalight chain having an amino acid sequence that is least 70% at least 75%. at east 80%, at least 85% at least 90%% t Iat least 8%, or at tastf9% identical to the amino IS acid sequence of SEQ ID NO: 243, 229, or 259 and naturalize hCMV infection, Ia one embodiment, a antibody according to the invention comprises a light chain havIing thesequence recited in SEQ ID NO: 243, 229, or 259, and neutralizes hCMV infection; In another embodiment, the antibody binds to an epitope formed by the bCMV proteins gM and gN and comprises a light chain having an amino aid sequence that is at least 70%, at least 75%, 20 at least 80% at least 35% at least 90% at least 95%, least 98%, or at leait 99% identical to the amino acid sequence of SEQ ID NO: 275, and neutralizes hCMV infection. In one embhodimnent, an antibody according to the invention comprise a tight chain having the sequence recited in SEQ ID NO: 275, and neutralizes hCMV lifoction. in one embodiment, ithe antibody of the invention is not MSLA09 SF9, 3E3 or R551A. In 25 another embodiment, the antibody of the invention i not IF 11, 2F4, 5A2 or 60, disclosed in US, ApplicatinNosi H/ %69,104 and 12J174,568, Exemplary antibodies of the invention include, but arc not limited to,1508, 4N10, lF7, 10P3, 122, 8LI 2012, 8015,916. 7813,.8J16, 8121,71313,,684, SF1,1006, 4H9,2B11. 11812, 1311 1.3G16 and 613. 30 Variants of l 51)8 that neutralize hCMV infection consist of a heavy chain variant having amino acid sequence recit ed in SEQ ID NO: 208 ("1518 variant "), and SEQ l) NO: 212 41 5D8 variant 2"), and a light chain having the amino acid sequence recited in SEQ 11D NO: 213 (150)8 variant 2) The nucleic acid sequences encoding the vaiatn heavy chain variants are recited in SEQ ID NO: 209 (1SDR variant 1l and SEQ 10 NO: 214 (15DR8 variant 2). Thbe nucleic acid encoding the 35 variant light chain is recited in SEQ 1) NO: 215 (1 5S variant 2). Thus, antibodies comprising the 1508 variant heavy chains (SEQ 11) NO; 208, 212) and variant light chain (SEQ ID NO: 213) lust neutralize hCMV infection arc included within the scope of the invention, A used herein, the term 15D8" is used to refer to any and/or all variants of 15DS that neutralize hOMV infection, for example, those with heavy chains coresponding to SEQ 1D NO: 208 40 ad 212 and light chais corresponding to SEQ ID NO; 213. 15 A variant of 773 that neuraizes lhCMV nfection consists of a heavy chain having the amino acid sequence recied in SEQ NO A34 ("713 variant 1" The nuleic acid sequence encoding the atiant heavy chain is recited in SEQ II NO: 35 Thusantbodies compising the 7H3 variant heavy chain (SEQ ID NO 334) that neutralize hCMVinfection are included within the 5 scope of the invention. As used herein, the term "7H3 is used to refer to any and/or alt variants of 7M3 that neutralize hCMV infection, for example, those with heavy chains corresponding to SEQ ID NO:334. A variant of SF that neutralizes hCMV infection consists of a heavy chain having the amino acid sequence recited in SEQ ID NO: 294 ("SF1 variant 1"). The nucleic acid sequence encoding 10 the variant heavy chain is recited in SEQ I D NO: 293 Thus, antibodies comprising the 5F I variant heavy chain (SEQ ID NO: 294) that neutralize hCMIV infection are included within the scope ofthe invention, As used herein, the term "5F I" is used to refer to any and/or all variants of5F I that neuralize h MY infection for example, those with heavy chains corresponding to SEQ ID NO:294. 15 A variant of 4-19 that neutralizes hCMV infection consists of a heavy chain havingthe amino acid sequence recited in SEQ ID NO: 314 I 419 variant I"). The nucle acid sequence encoding the vaiatit heavy chain is recited in SEQ 11) NO: 315. Thus, antibodies comnprisitng the 4H9 variant heavy chain (SEQ 13 NO: 314), that neutralize hCMV infection are included within the scope of the invention. 20 As used herein, the term "419" isused to refer to any and/of all variants of 4H9 that neutralize hCMV infection, for example, those with heavy chains corresponding to SEQID NO:314 In one embodiment, an antibody of the invention, or antigen binding fragment thereof. comprniscs all ofthe CDRs of antibody 15D8 as listed intatle I, aud neutraliZes hCMV infection in a human ho. In anmher embodiment, an antibody of the invention, or antigen biading fragmen 25 thereof, comprises all of the CDRs of antibody 15D variant I as listed in Table 1, and neutalizes hCMV infection in a human host. In another embodiment, an antibody of the invention, or antigen binding fragment thereof comprises all ofithe CDR- of antibody 15D varisa 2 as listed in Table 1, and neutralize hCMV infection in a human host. In yet another embodiment an antibody of the invention, or antigen binding fragment thereof, comprises all of the CDRs of antibody 8121 as listed 30 in Table 1, and neutralizes ?hCMV infection in a human host. In yet another embodiment, an antibody ofthe invendoo or antigen binding fragment thereof comprises all of the CDRs of antibody 4lN10 as listed in Table land neutralizes hCMV infection in a human hoest in another enibodirnent, an antibody ofihe invention, or antigen binding fragment thereof, comprises all of the CDRs of anibady 10p as listed in Table 1, and utraizes 35 hMIV infection in a human host In another embodiment, an antibody of the invention, or antigen binding fragment thereofomrpisc all of the CDRs of antibody IP3 as listed in Table , and neutralizes hCMV infection in a human host. In another embodimentn antibody of the invention orantigen binding fragment themof comprises all of the CDRs of antibody 4122 as lsted in Table 1, and neutraizes hCMVinfection in a human host. hi another embodiment, an antibody of the 16 invention or antigea binding fragment thereof, comprises all of the CDRs of antibody 813 as listed in Table 1, and neutralizes hCMV infection in a human host In yet another embodiment, an antibody of the invention, or antigen binding fragment thereof, comprises alI of the CDRs of antibody C12 asi isted in Table I, and neutralizes hCMV 5 infection in a human host. in another embodiment, an antibody of the invention, or antigen binding fragment thereof comprises allofhe CDRs of antibody 8115 as listed in Table 1, and neutralizes hCMV infection in a human. host. In another anbdienat, an antibody of the invention, or antigen binding fragnen thereof, comprises all of the CDRs of antibody 916 as listed in Table 1, and neutralizes hCMV infection in a human host Innother embodiment an antibody of the invention, 10 or antigen binding fragment thereof comprises all of the CDRs of antibody 71113 as listed in Table I and nontralizesbCMV infeeion in a human host. In another embodiment, an antibody of the invention, or antigen binding figment thereof comprises all of the CDRs of antibody 8316 as listed in Table 1, and neutralizes hCMV ifection in a human host ln another embodiment an antibody of the invention, or antigen binding fragment tereof compares adl of the CDRs of anybody 7113 as 1 listed in Table 1, and neutralizes 5CMV infection in a human host In yet another embodimentan antibody of te invention, or antigen binding fragment thereof, comprises all of the CDRs ofiantibody 71-13 as listed in Table 1 and neutralizes hCMV infection in a human host In another embodiment an antibody ofhe invention, or antigen binding fragment thereof. comprises allof the CDRsof antibody 7H3 variant I as listed in Table ,and 20 neutralizes hC>MVinfection i a human host. In another embodiment, an antibody of the invention or antigen binding Fragment thereofcomprises al of the CDRs of antibody 6B4 as listed in Table 1, and neutralies hCMV infection in a human host In another embodiment antibody of the invention, or antigen binding fragment thereof; comprises all of the CDRs of antibody 5F as listed iTRable 1, and neutaizes hMV infection in a human. host, In another embodiment, an antibody of 25 the invention or antigen binding fragment thereof, mprises all of he CDRsof antibody 10C6 as listed in Table I and neutraizes hCMV infection in a human host. In another embodennt, an antibody of the inetoo ntienbiding fragmentm thereo(f, opie all of the CURs of antibody 4W as listed Table 1I and neutralizes hMV infection in a uan host In another embodiment, an antibody of the invention, or antigen bindig fragment tereof, compr ses a i of the 30 CDRs of anybody 4H19 variant Ias listed in Table 1, and neutralizes iCMV infection in a human host In another embodiment, an antibody of the inventionor antigen binding fragment hereof cormpnses all of the CDRs of antibody 21311 as listed in Table 1, and neunralizeshCMV infection in a human host. In yet another embodiment an antibody of thke imntion, or antigen binding fragment 35 thereof, comprises alf of the CDRsof amibody 11812 as listed in Table 1 and neutralizes hCAV infection in a human host In another emibodiment, an antibody of the invention, or antigen binding firgment thereof comprises al of te C3Rs of antibody l 31-1t as hsted in Table 1, and neutraizes hCMV infection in a human host, In another embodiment an antibody of the invention, or antigen binding fragment thereof, comprises all of the CRs of antibody 3G16 as listed inTable 1, and 40 neutralizes hCMV infection in a human host In yet another embodiment antibody of the invention, or antigen. binding fragment thereof, comprise all of the DRs of antibody 6l gas lited in Tale I and neutralizes hCMV infection I a human ost 11 The invention further compries an antibody, or fragment thereof that binds to an epitope capable of binding to an antibody of the invention, or an antibody that competes wth an antibody of the invention. Antibodies of the invention also include hybrid antibody molecules that comprise one or 5 more CDRs from an antibody of the invention and one or more CDRs from another artibody to the same epitope. In one embodiment, such hybrid antibodies comprise three CDRs from an antibody of the invention and three CDRs from another antibody to the sane epiope. Exemplety hybrid anibodies comprise i) the three light chain CDRs f1om an antibody of the invention and the three heavy chain CDs from another antibody to the same epitope, or ii) the three heavy chain CDRs It from an antibody of the invention and the three light chain CDRs from another antibody to the sane cpitopc. In another aspect, the invention also includes nucleic acid sequeces encoding partor al of the light and heavy chains and CDRs of the antibodies of the present invention In one embodiment. nucleic acid sequences according to the invention include nucile acid sequences having at least 15 70% latest 75%, a east 80%, aleas 85%ateast 90* at les 95%, at least 98%. or at lea 99% identity to the nuleic acid encoding a heavy or light chain of an antibody of the invendona In anther embodiment, a nuceic acid sequence of the invention has the sequence of a nucleic acid encoding a heavy or light cha CDR of a anybody of the invention, For example nucleic acid sequence according to the invention comprises a seencnce that is at least 75% identical to the 20 nuclei acid sequences of'SEQ ID NOs; 7-12,15,16, 23-28, 31, 32, 39-44, 47 48 55-60, 63, 64, 71-76, 79. 80, 87-92, 95 96 -108 1, 112,9 1 124, 127 128, 135-140, 143, 144, 151-156, 1590, 165-69 172,7 17983 186,187, 194 199.202,203206207, 209 21 214,215, 222227230, 23 -2324, 244, 241 52-257, 260,26 268732727 28-289, 292, 293, 29$. 302-307 310, 311,3 3, 31, 3322-32 3 331 3333 342-347350 351 35 5638 25 359, 362-364, 365, 3661, 369 and 370. ait one embodiment. the nuccic acid sequence according to the invention comprises a sequence that is at least 80%, at least 85% at least 90%, at least 95% at least 97% at least 98%, or at least 99% identical to the nucleic acid sequences of the above listed SEQ lDNOs. Duc to the redundancy of the genetic code, variants of these sequences will exist that encode 30 the same amio acidsequences These variants are included within the scope of the invention. Variant antibodies that neutrlize hCMV infection are alo included within the scope of the ivenion 'Thus, variants of the sequences recited in the application are also included within the scope of the inYention. Such variants nclde namtura variants generated by somati mutation iat o during the immune response or in zro upon culure of immorlized 1 cel clones Aleratvely, 35 variants may atic due to the degenertcy of the genetic code, at, mentioned above or may be produced due to erTors in traneriptionor translation. Further variants of the antibody saucncS -having improved affnity ando potency may be obtained using methods known in the art and are included within the scope of the inventioa, For example antio acid suasitutions may be used to obtain antibodies with further improved affinity 40 Mtematively, codon optimization of the nucleotide sequence may be used to improve the efficiency of translation in expesion systems for the production of the antibody. Further, polynucleotides 48 conprising a sequence optimized forantibody specificity or neutralizing actiity by he application of a directed evoluion method to any of the nucleacid sequences of the invention are also within the scope of the invention. in one embodiment variant antibody sequences tiat neutralize hCMV infection may share 5 70% or more (L '75%, 80%. 85%, 90%, 95%, 97%, 98%, 99% or more) amino acid sequence identity with the sequences cited M the application, In some embodiments such sequence identity is caculated with regard t to the full length of the reference sequence (i.e the sequence cited in the application). In some further embodimenits, percentage identity, as referred to herein, is as determined using BLAST version 2,13 using the default parameters specified by the NCBI (the 1O National Center for Biotechnology Jnformation) (Blosum 62 math; gap open peiahdty=fl I and gap caension penalty-11, Further included within the scope of the invention are vectors, for example expression vectors, comprising a nucleic acid sequence according to the invention. Cells transformed with such vectors are also milnd.ed within the scope of the invention. Examples ofsueh cells include but are I5 not limited to, ukarytic cells, e~g. yeast cils, animal cells or plant cells, in one embodiment the cells are Inannalian, e.g, human, CHO, HEK293T, PER.C6, NSO, myeloma or hybridona celLs, The invenion also relates to monoclonal antibodies that bind to an epitope capable of binding the antibodies of the invention, including, but not limited to. a monoclonal antibody selected fomm the group consising of 158, 4N 10, 10F7, 10P3, 4122, 8-13, 2C12, 8C5, 916, 7813, 8116, 20 8121. 7113, 783, 684, SFL 10C6, 489, 11B12, 13H11, 3016, 2B11 and 613 Monoclonal and recombinant antibodies are particularly useful in identification and putrification of the individual polypeptides or other antigens against which they are directed. The antibodies of the invention have additional utility in that they may be employed as agents in immounoassays, radioimmunoassays (RJA) or enzyme-linked inmunosorbent assays (ELISA), In 25 these applications, the antibodies can be labelled with an analytically-deteclable reagent such as a radioisotope, a tlucoscent molecule or an enzyme, The antibodies may also be used for the tnolecular identification and eharacterisanon (epitope mapping) of antigens, Antibodies of the invention can be coupled to a drug for delivery to a treatment site or coupled to a detectable label to facilitate imaging of a site comprising cells of interest. such as cells 30 infected with hCMVMethods for coupling antibodies to drugs and detectable labels am well known in the art, as are methods for imaging using detectable labels Labelled antibodies may be employed in a wide variety of asays, emplovariety ide variety of labels, Detection of the formation of an antibody-antigen complex between an antibody u fthe invention and an epitope of interest (an hCMV epitope) can be faciltated by attaching a detectable substance to the antibody. Suitable 35. detection means include the use of labels such as radionuclides, enzymes. coenzytmes, fluotescers, chemniluminescers, chromogens enzyme substraits or co-factors, enzyme inhibitors, prosthetic group complexes, free radicals, particles, dyes, and the like. Examples of suitabic cazytes include horseradish pexidase, alkaline phosphatase, fgaactosidae, or aceylehonesterase, examples of suitable prosthetic group complexes incde streptavidmrbieun and avidinhiotin; examples of 40 suitahle fluorescent materialinclude umbelliferone fluorescen fluorescein isotiocyanate, rhodatmitediciototriazinylamine fluoresmein dansyl chloride or phycoerythrin; an example ofa 19 luninesccnt maeial is lumino!; e ample of bioluminescent nerials include uciferase, luciferin, and aequorin; and examples of suitable radioactive material include m mL "S, or H, Such labeled reagents may be used in a variety of well-known assays, such as radioimmunoassay enzyme immunoassays eg., ELISA, tlorescent immunoassays, and the like, See for example, S references An ant body according to the invention may be conjugated to a therapeude moiety such as a cytotoxin. a therapeutic agent, or a radioactive metal ion or radioisotope. Exampcs of adioisotopes include, but aren't limited to, 1-131, 1-123, 1.125, V-9, R4e-88, Re--186, At-21 1C, U-67, Li-212, Bi-213. Pd-109 Tc-99, LIn I, and the like Such antibody conjugates cian be used for rmodifying a 10 given biological response; the drug noiety is not to be onstrued aslimited to classical chemical therapeutic agents. For caxamplc, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for ample, a toxin such as abrin, ticin A, pseudomonas exotoxin, or diphtheria toxin Techniques for conjugating such therapeutic miety to antibLdies are well known. See, for 15 example, Amon el at (l49) 'Monoclonal Antibodies for lomutorasctng of Drug in Cancer Therapy" in Monocional Amibodies and Camer Thraptp, ed. Reisiied nal (Alan RK Lisl, Inc), pp. 243-256; ed Helstron a al. (1987) "Antibodies for Drug Deivery, in Contraied Drug Delivery ad. Robinso et at (2d ed, Marcel Dekker, Inc pp 23-65a Thorpe (985) "Antibody Careers of Cytotoxic Agents in Cancer Thempy, A Review," in Monocnal Antibodie 'a84z 20 Biological and Clinied Applicakms, ed. Pinchera et a. pp 475-506 (Editrice Kurtis, Milano, Italy, 1985); "Analysis, Results, and Future Prospective of the Thenapeutic Use of Radiolabeled Antibody in Cancer Therapy," in Monolonld AndbodiasJivr Cmcer Deredon. and Therapy, ed, Baldwin er al, (Academic Pres New York, 985) pp, 303-316; and Thnie et! , (l 982) bnamnot Rev 62:119-158, 25 Atmatively, an antibody can be conjugated to a second antibody to form antadibody heteroconjugate as described in reference 19, In addition. linkers may be used between the label and the antibodies of the invention (20]. Antibodies or, antigen-binding, fragments thereof may be directly labelled with radioactive iodine, indium, yttrium, or other radioctive particle known in the art [21). Treatment may consist of a combination of treatment with conjugatid and non-conjugated 30 anihodies administered simkaneously or subsequently (22, 231, Antibodies of die invention may also be attached to asduppo Additionally, antibodies of the invemion, or functional anibody fragments thereof, can be chemically nodificd by covalen conjuganon to a polymer to, for cXanple, increase their circuling half-ife, for example. Examples of polymers, ;nd methods to attach thento peptides, am shown in 35 references 24-27, in some embodiments the polymers may be selected from polyoxyethylated polynis and polyethylene glycol (PEG). PEG is soluble in water at room temperature and has the general formula: R(O-CHs --C 5 .), 0-Rfl where R can be hydrogen., or a protective gmoup such as an alky] or aikanol group, In onc embodiment the protective group may have between I and 8 carbons. In a further embodihme the protective group 1b methy. The symbol n is a positive integer in one 40 embodinetan i between I and 1,000 in another embodiment n is between 2 and 500 Mn one embodiment the PEG has an average molecular weight between 1,000 and 40,00) In a further 20 emiboiment the PEG has a molecular weight between 2,000 and 20,000. I yet a further embodiment the PEG has a molecular weight of'between 3,000 and I 2,000. laone embodiment PEG has at least one hydroxy group, In moher embodiment the PEG has a terminal hydroxy group' h yet another embodiment it is the terminal hydroxy group which. is activated to react with a free 5 amio group on the inhibitor, However, it wil be naierstod that the type and amount of the reactive groups may be varied o achieve a covalently conjugated PEC/antibody of the present invention. Water-soluble polyoxyethylated potyots are also useful in the present inventon They include polyoxyethylated sozbitol, polyoxyethylated glucose, polyoxyethylated glycerol (P0G), and 10 the like. In ane embodiment, POG is use Without being bound by any theory, because the glycerol backbone of polyoxyethylatcd glycenol is the same backbone occurring naturally in, for example. animals and humans in mono-, di-, triglycerides, this branching would not necessarily be seen as a foreign agent in the body, In some embodiments POG has a molecular weighs in the sate range as PEG The sructiture for POG is shown in reference 28. and a discussion of POG/IL-2 15 conjugates is found in reference24 Another drug delivery system that can be used for increasng circulatory halflife isthe liposone Methods of preparing lipoane delivery systems are discused in 3eferencoa 29,30 and 31. Other drug delivery systems are known in the art and are described in, for example, references 32 and 3 3 20 Antibodies of the invention may be provided in puTified form, Typically, the antibody will be present in a compositon that is subsumariallv fre of other polypeptides e.g. where less than 90% (by weight), usually less than 60% and more usually less than 50% of the composition is made up of other polypeptides. Atibodies of she invention may be irmmunogenie in non-human (or heteroiogous) hosts eg 25 in hic In partcularthe antibodies may have an idiotope that is immunogenic in non-human hosts, but not in a human host Antibodies of the invention for human use include those tha cannot be easily isolated frm hosts suet as mice goats abbts rams, non-primate mammals. etc, and cannot generally be obtained by huanisasio or from ;o-nice1 Andbodies of the invention can be of any isotope (e'g IgA. IgG, IgM i.e an a, y or p heavy 30 chain), but will generally bel gG Within the IgG isotype, antibodies ay be IgO 3, IgG2, IgG3 or 1gG4 subclass Antibodies of the invention may have a or a X lght chain, Production of anilbodies Monoclonal antibodies according to the invention can be made by any method known in she art, The general methodlogy for making monocIonal antibodies using hybridoma technology is 35 well known $34.35] Preferably, the alternative EBV immostaisation method described in reference 36 is used. Using the method described in reference 36.13 cell producing the antibody of the invention can be transfiomnd with EV in the presence of a polyclonal 1 cel activator. Tansformation with EBV 1s a standard technique ad can easily be adapted io include polycional B cel actiVtors. 21 Additional stimulants of cellular growth and diflereniation may optionally be added during the transformation step to fluther enhance the efficiency. These stinmlats may be cytokines such as IL-2 and IL-, In one aspect, IL-2 is added during the immonalisation step to fIrther improve the efficiency of immortalisation, but its use is not essential. Theimmoralised B cells produced using these methods can then be cultured using methods known in the art and antibodies isolated therefrom, The antibodies of the invention can also be made by culturing single plasma cell in mieowell culture plates using the method described in UK Patem Application 0X1937t5. Further, from single plasma cell cures, RNA can be extracted and single cell PCR can be performed using 10 methods known in the art, The Vii and V regions of the antibodies can be amplified by RWT-PCR, sequenced and cloned into an expression vector that is then transfected into 1EK293T cells or other host cells, The cloning of nucleic acid in expression vectors, the innrsfrction of'host cells, the culture of the transfected host cels and the isolation of the produced antibody can be done using any methods known to one of skill in the art, 15 Monoclonal antibodies may be further purified, if desired, using filtrationcrifugation and various chromatographic methods such as IPWLC or affinity chromatography. Techniques for purification of monoclonal antibodies including techniques for producing phanaceutica-gade antibodies, are wel known in the art. Fragments of the monoclonal antibodies of the invention can be obtained tomthe 20 monoclonal antibodies by methods that include digestion with enzymesuch as pepsin or papain and/or by cleavage of disuffide bonds by chemical reduction Alternaively fragmentsof the monoclonal antibodies can be obtained by clotting and expression of part of the sequences of the heavy or eight chains. Anybody Tragments may include Fab Fab'F(ab') 2 and Ev fragmcnta The invention also encompasses single-chainFv fragments sc) derived from the heavy and light 25 chains of a monoclonal antibody of the invention egthe invention includes a scfv comparing the CDR from an antibody ofthe invention.Also included are heavy or light cain monomers and dimers as well as single chain aniibodies, egsingle chain Fvs in which the heavy andlight chain variable domains arc joined by a peptidc linker. Standard techniques of molecular biology may be used to prepare DNA sequences coding for 30 the antibodies or fgagments of the antibodies of the present invention. Desired DNA sequences may be synthesised completely or in part using oligonucetide synthesistechniquesSite-directed mutagenesis and polymerase chain reaction (PCK techniqus may be used as appropriate Any suitable host ceU/vector system may be used for expression of the DNA sequences encoding the antibody molecules of the present invention or agents thereof Bacterial, for 35 example Ef cali, and other micmbial systems may be udin par for expession of antibody fagments such as Fab and F(abi fragments.and especially Fragments and single chain antibody fragments, for example. sitgic chain Eva Eukaryotic, ag. mammalian, host cell expression systems may be used for production of larger antibody moleculeincluding compete antibody molecules. Suitable manealian host cells include CHO, HEK293TPER.C6, NSO, myeloma or hybridoma 40 cells. 22' The present invention also provides a process for the production of an antibody molecule according to the present invention comprising culturing a host cell comprising a vector of the presentinvention under conditions suitable for leading expression of protein fo DNA encoding the antibody molecule of the present invention, and isolating the antibody molecule. 5 The antibody molecule may comprise only a heavy or light chain polypeptide, in which case only a. heavy chain or ight chain polypeptide coding sequence needs to be used to transfeet the host cells For production ofproducts comprising both heavy and light chains, the cell line may be transfected with tvo vectors, a first vector encoding a tight chain polypeptide and a second vector encoding a heavy chain polypeptide. Alternatively, a single vector may be used, the vector 10 including sequences encoding light chain and heavy chain polypeptides Alternatively, antibodies according to the invention may be produced by i) expressing a nucleic acid sequence according to the invention in a cell, and ii isolating the expressed antibody product.Additionally, the method may inclAde iii) purifying the antibody. Seening and isoklan f'B celIA 15 Transformed B cell may be screened for those producing antibodies of the desired antigen specificity, and individual B cel clones may then be produced fron the positive cells. The screening step may be carried out by EUSAhy staining of tissues or cells (including transfcctcd cells), a neutralisation assay or one ofta number of othcrmthods known in the att for identifying deired antigen specificitya. te assay may select on the basis of simple antigen 20 recognition, or may select on the additional basi of a desired function tg. to select neutralizing antibodies rather than just antigen binding antibodies, to select antbodies that can change characteristics of targeted cells, such as their signalling cascades, their shape their growth rate, their capability of influencing oher cells, their response to the influence by other cells or by other reagents or by a change in conditions, their diferetiation status ex, 25 The cloning step for separating individual clones from the mixture of positive cels may be carried out using limiting dilation micomtion,tonsingle cell deposition by cell sorting or another method known in the a, The inmortalised B cell clones of the invention can be used in various ways e.g as a source of monoclonal antibodies, as a source of nucleic acid (DNA or mRNA) encoding a monoclonal 30 antibody of interest; for research. er. The invemion Omp in comprising imnortalised B memory cells, whercin the cells produce antibodies with high neutralizing potency specific for hCMV, and wherein the antibodies are pmduced at ?5pg per celI per day, The invention also provides a composition comprising clones of an immortalised B memory cel, wherein the clones produce a mnonoclonal 35 antibody with a high affinty specific for hCMV, and wherein the antibody is produced at $pg per cell per day, Preferably said clones produce a Monoclonal antibody with a high potency in neutralizing IMV infection.
Exemplary inmoraised B cell clne accord ng to the inventionclude, but are not lined to. lSD8,4N10, lOF 10P3, 4122, 8L213,2 8Clt916, 7IJ31 72i,113,H3 61M, 5F1 i0C26, 4H19. 13H 31 IONI01,213Wand 61-3 Epitapes 5 As mentioned above, thc antibodies of the invention can be used to map the epitopes to which they bind. The nvemors have discovered that the several antibodies neutrali:ing hCMV infection of endothelial cells, epithelial cels, retinal cells and dendritic cells, are directed towards epitopes in the hC MV 1U28 protem, epitopes firmed by the hCMV proteins Ul 30 and UI 131 A, epitopes formed by the hICMV proteins UL 128, ULI 30 and u13.13 IA, epitopes formed by the YhCMV 10 proteins gH, gl., UL128 and UL130, gB, gH, or epitopes formed by the hCMV proteins gM and gN. The epitopes to which the antibodies of the invention bind may be linear (continuous) or conformational (discontinuous) and formed by a single hCMV protein or by the combination of 2, 3 or more hCM'V pirteins. The epitopes recognised by the antibodies of the parent invention may have a number of 15 uses. The epitope and mirmotopes thereof in purified or synthetic form can be used to raise immune responses (i.e. as a vaccine, or for the production of antibodies for other uses) or for screening patient serum for antibodies that iromunoreact with the epitope or mnimotopen thereof In one embodiment such an epirope or mimotope or antigen comprising such an epitope or mimotope may be used as a vaccine for raiig an immue response The antibodies and antibody fragments of the 20 invention can also be used in a method ofmanitoring the quality of vaccines, In particular the antibodies can be used to check that the antigen in a vaccinontains the specific inmunogaec epitope in the correct conformation. The epitope may also be useful in screening for ligasds that bind to said epitope, Such igandi, include but are not limited to antibodies; including those from camels, sharks and other 25 species fragmen of antibodies peptides, phage display technology products aptamners, adnectina or fragments of other viral or cellular proteins, may block the epitope and so prevent infection, Such ligands are encompassed within the scope of the invention RecoinbMunt expresyiol 'The immortalised B memory ells of the ientdon may also be used as a soure of nucleic 30 acid for the cloning of antibody genes for subsequent recombinant expression. Expression from recombinant sources is more common for pharmaccutical purposes than expression from 13 cels or hybridomas e-g, fot reasons fstability; reproducibility, ulture ease, etc. Thus the invention provides a method for preparing a recombinant cell, comprising the steps of&6) obtaining one or more ntcleic acids (e.g heavy and/or ight chain genes) from the cell clone 35 that encodes the antibody of interest; and (ii) inseting the nuctle acid into an expression host in order to permit expression of e antibody ot interest in that host. Simlarly, the invention provides a method for preparing a recombinant cell, comprising the steps of: (i) sequencing nucleic acid(s) from the B cell clone that encodes the antibody of interest; and (ii) using the sequence information from step (i) to ppapre nuceic acids) for insertion into an 241 expression host in order to pemi expression of the antibody of interest in that host. The nucleic acid may, but need not, be manipulated between steps (i) and (ii) to introduce restriction sites, to change codon usage, atd/or to optimisc tramnscriptioT And/or transition regulatory sequences. The invention also provides a method of preparing a recombinant cell, comparing the step of 5 transforming a host cell with one or more nucleic acids that encode a monoclonal antibody of interest, wherein the nucleic acids are nucleie acids that were derived from an immortalised B cell clone of the invention, Thus the procedures for first preparing the nudeic acid(s) and then using it to tmnsbform a host cell can be performed at different times by different people in different places (e.g, in different countries), 10 These recombinant cels of the invention can then be used for expression and culture purposes. They are particularly useful fbr expression of antibodies for large-scale pharmaceutical production. They can also be used as the ative ingredient of a pharmaceuical composition, Any suitable culum techniques can be ued, including but not limited to static culture, roller bottle culture, ascites fluid, hollow-fiber type bioreactor cartridge, modular minifermenter, stirred tank, 15 microcarrier culture, ceramic core perfusion, etc, Methods for obtaining and sequencing immunoglobhn genes from B cells are well known in the art (e.g. see reference 37). The expression host is preferably a eukaryotic cell! including yeast and animal cells particularly mammalian cels ( CHO ' cells, NSO cells, human cels such as P ERC6 [Cruceli; 20 reference 3>] or H KB- I I [Baye; references 39 & 40] ceIs, msyeloma cells (41 & 42), ec.), as well as plant cels, Preferred expression hosts can glycosylate the antibody of the invention, particularly with carbohydrate structures that are not themselves immunogenic in human, In one embodiment the expression host may be able to grow in scrum-froo media, In a further embodiment the expression hos may be able to grow in culure without the presence of aniaterived products. 25 The expression host may be cultured to give a cell line. The invention povides a method for preparing one or more nudeic aci molecules(eg. heavy and hght chain gnes)that encode an antibody of interest comprisingthe steps of: (i) preparing an immortalised B cell clone according to the invention; (i) obtaining front the B ceel clone nuclic acid that encodes the antibody of interest. he touention also provides a method for 30 obtaining a nucleic acid sequence that encodes an antibody of interest comparing the steps of ) preparing an irmortalised B cell clone according to the invention; i'i)sequencing nucleic acid from the B cell clone that encodes the antibody of interest. The invention also provides a method of preparing nucleic acid molecule(s) that encodes an antibody of interest, coiprisng the step of obtaining the ncleic acid from a B cll Clone that was 35 obtained from a transformed B cell of the invention Thus the procedures for first obtaining the B cl clore and then prop tg nuclcic acid( fmm it can be pcrfbrmxed at very differeftimes by different people in different places (eg indifferent counties) The invention provides a method for preparing an antibody (eg. fbr pharmaceutical use), comprising the steps of: () obtaining and/or sequencing one or more nucleic acids (eg heavy Ind 40 light chain genes) from the selected B ell clone expressing die antibody of interest; (ii) inscrtng the nucleic acids) ito or usig the nucie acid(s) to prepare an expression host that can express the antibody of interest; (iii) cultring or sub-ulturing the expression host. under conditions where the antibody of interest is expressed; and, optionally, 6vi puifying the antibody of the mierest The invention also pr ovides a method of preparing an antibody comprising the steps of: 5 culturing or sub-culturing an expression host cell population under conditions where the antibody of interest is expressed and, optionally, purifying the amibody of the mterest, wherein said expression host cell population has been prepared by (i) pro viding nucleic acid(s) encoding a selected B cell the antibody of interest that is produced by a population of B memory lymphocytes prepared as described above, (ii) inserting the nucleic acid(s) into an expression host that can express the 10 antibody of interest, and (Iii) culturing or sub-culturing expression hosts comprising said inserted nucleic acids to produce said expression host eclI population. Thus the procedures for first preparing the recombinant expression host and then culturing it to express antibody can be perfoermd at very different times by different people in different places (eg in different countries). Further, cell lines expressing exemplary antibodies of the invention, 4N10, 2C 12, 8C 15, 15 8121, 6B4: h, 4119, 1 1BI2, 3G16, and 6L3 were deposited with the Advanced Biotechnology Center (ABC), Largo Rossana Benzt 10, 16132 Genoa (Italy), under the terms of the Budapest Treaty, on July 9,2008, (undet Acccsion Numbers PD 08009, PD 08007, PD 08006, PD 08005. P) 08004, PD 08014, PD 08013. PD 08011,PD 08012, and PD 08010, respectively) and an immnottalized B3 celi line expressing 713 was deposited on July 16, 2008 under Accession Number 20 PD 08017- An antibody, or an antigen binding fragmAent thereof, expressed from the above celi lines as well as antibodies, and antigen binding fragments thereof, with the same ano acid sequence as those expressed front the above cell lines are also considered to be within the scope of the invention, These deposits are provided for the convenience of those skiled in the art. and are neither an admission that such deposits are required to pretice the invettion nor that equivalent embodiments 25 are not within the skill of the art in view of the present disclosure The public availability of these deposits is not a grant of a license to make, use or sell the deposited materials under this or any other patents. The nucleic acid sequences of the deposited materials are incorporated in the present disclosure by reference and are controlling if in conflict, with any sequence described hereint Pharmaestfical anmpostns 30 The invention pmvides a pharmaceutical composition continuing the antibodies and/or aTibody fragments of the invenion ani/or nucleic acid encoding such amiboxies and/or imtortalised B cells that express such antibodies and/orte epitopes recognised by the antibodies of the invemion. A pharmaceutical composition may also contain a pharmaceutically acceptable scarier to allow administration. The camera should not itseWt induce the production of antibodies hatirful to 35 the individual receiving the composition and should not be toxic. Suitable carriers may be large, slowly mnetabolised mscromnoleules such as proteins, polypeptides liposomes polysaccharides, polytactic sad, polyglycolic acids, polymic c amino acids, amino acid copolymers anud inactive vims praticles 26 Plunaceutically acceptable salts can be used, for example mineral acid sals, such as bydrochlorides, hydrobromides, phosphates and sulphates, or sals of organic acids, such is acetates, propionatet;, maloates and benzoates. P aCeutically acceptable carriers in therapeutic compositions mayadditionaly contain 3 liquids such as water, saline, glycerol and ethanol, Additionally, auxiliary substance such as wetting or emulsifying agents or pIT buering substances, may be present in such compositions Such carters enable the pharmacctcal compositions to be fbrmulated as tablets, pills, dragces capsules, liquids. gels, syrups, slurries and suspensions for ingestion by the patient. Within the scope of the invention, forrs of administration may includethose tforos suitable 10 for parenerla administration, e.c'. by injection or iniZon, for example by bolus injection or continuous infusion. where the product is for injection or infusion it may take the form ofa suspension. lution or emulsion in an oily or aqueousvehicle and it may contain fonnulatory agents, such as suspending, preservativetabiising and/ordispersing agents. Altemativey, the antibody molecule may be in dry fhrm, for reconstitution before use with an appropriate sterile 13 liquid. Once formulated, the compositions of the invention can be administered directly to the subject. In one embodiment the compositions are adapted for administration to human subjects. The pharmaceutical composition ofthis invention may be administered by any number of routes cludun banot oraldt intravenous intramuscular ntraarterial. inramdlay routes including, bu orsemt d so, Orl nnv.os rtiiclr ftanedullary, 20 intrapcritonaal intrathecal, intraventricular; transdermal transcutancous, topical subeutancos, intranasal, enterAsablingua, intraaginal or ectal rutes. H-lyposprays may also be used to administer the phamacetieal compositions of the invention, Typically. the therapeudc comrposiions may t prepared as injcctableseither as liquid soltons or stspatsios. Solid forms suitable for solution in, or suspension in, liqid vehicles prior to injection may also be prepared. 25 Direct delivery of the compositions will geneAlly be accomplished by injection, subcutaneousy, intraperitoneallyintravenoly or intramuscuarlyor delivered to the interstitial space of a tissue, The composition can also be administered into a lesioa Dosage treatment may be a single dose schedue or a multiple dose schcdtlc. Known antibody-based pbarmaceuticals provide guidance relating to frequency of administration e.g. whether a pharmaceudid should be delivered 30 daily, weekly, monthly, etc, Frequency and dosage may also depend on the seventy of symptoms Compositions of the invention may be prepared in various forms. For example, the compositions may b prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solutions in, or suspension in, liquid vehicles prior to injection can also be prepared (eg a lyophilised compositionlike SynagiM and Heriepsti ibr recotatutiun with sterile water 33 containing a preservatives The composition may be prepared fli topical administration e.g as an ointment cream or powder. The composiion may be prepped for oral administration g as a tablet or capsule, as a spray, or as a syrup (optionaly flavosred To composition may be prepared for pulmnonaly adiitao ~ sa naeusing a ftte" powder' ot a spray. The composition maytli prepared as a suppository or pessary The composition may be prepared for nasal, aual or ocular 40 administration e-g a drops The composition may be inkit ftrm, designed such that a combined composition is reconstituted just prior to administration to a patient For example, a lyophilised antibody can be provided in kit form with sterile water or a sterile bufer, It will be appreciated that the active ingredient in the composition will be an antibody molecule, an, antibody figment or variants and derivatives thereof As such, it will be susceptible to 5 degradation in the gastrointestinal tract. Thus, if the composition is to be administered by a route using the gastrointestinal tract, the composition will need to Contain agents which protect the antibody from degradation but which release the antibody once it has been absorbed from the gastoitestinal tract. A thorough discussion of pharmaceutically acceptable carriers is available in Gennaro (2000) 10 Remington: The Science and Pracfice of Phar7ac. 20th edition, ISBN: 0683306472. Pharmaceutical compositions of the invention generally have a pH between 5,5 and $5, in some embodiments this may be between 6 and 8, and in further embodiments about 7. The pH may be maintained by the use of a buffer, The composition may be sterile and/or pyrogen free. The composition may be isotonic with respect to human li one embodiment pharmaceutical 15 compositions of the invention are supplied in hermeticaly-acaled containers. Pharnaceutical compositions will include an effective amount of one or more antibodies of the invention and/or one or mote inmmortalised B cells of the invention and/or a polypeptide comprising an eptope that binds an antibody of the invention ix. an amount that is sufficient to treat, amehonte, or pMvent a desired disease or condinon, or to exhibit a detectable thempeutic 20 effect, Therapeutic effects also include reduction in physical symptoms. The precise effective amount for any particular subject wil depend upon their size and health, the nature and extent of the condition, and the therapeutics or combination of tempeutics selected for administration. The effective amount for a given situation is determined by routine experimentation and is within the judgment of a cinician, For purposes of the present invention, an effective dose will generally be 25 from about 0,0 1mgitg to about 30mngkg, or about 0.05 mg&g to about 10 mg/kg of the compositions of the present ivention in the individual to which it is administered. Known antibody based pharmaceuticals provide guidance in this respect e.g Herceptin'"' is administered by intravenous infusion of a 21 nmg/m solution, wih an initial loading dosc of 4mg/kg body weight and a weekly maintenance dose of 2mg/kg body weight; RituS is adminirStered weekly at 30 375mgmi etc. In one embodiment compositions can include more than one (g2,4 era) antibody of the invention to provide an additive or synergistic therapeutic effetna aher embodiment the composition may comprise one or more (ex 2, 3,4. 5, em) antibody of the non and one or more (e.g 2, 3, 4, 5, ern) additional amibodies that neutralie hCMV infection. 35 For example, one antibody may bind to an epitope in the tCMV UL!28 poteinen epiope formed by the hCMV proteins UL 130 and U1L131 A, en pope formed by the CMV proteins UL128, U1L130 and ULI3IA, anepitopx: formed by the hCMV proteins gH, gL, ULI12S and UL I30, an epitope in thte hCMV gp in, an epitope in the hCMV gH C protein, o an epope forned by the hCMV proteins gM and gN, while another may bind to a different epitope in the hCMV UL128 40 protein, an cpitope formed by UL 10 and Uij3 IA, an epitope formed by iLt 28, UL 130 and UL 31A, an epitope formed by gi, gLs UL)28 and UL10, dB, gif) gL, gM, gN, gO, or an epitope
U,
formed by gM and gN Wihout benig hound to any iheory/ ono annhody may be targeted to the mechanism that mediates infection of fibrobtastwhilethe other antibody may be targeted to the mechanism thatmediates infection of endotheial elds For optiml clinical effect it may well be advantageous to address both mechanisms of hCMV infection and maintenance. 5 in one embodimer the invention provides a pharmaceutical composition comprising two or more antibodies wherein the first anibody is speciic for a first Ul128 epitope, and the second antibody is specific fora second UL 128 epitope, a combination of ULU3 end 1A, a combination of Ul28, 1 )130 and ULiIAa conbimition of g, Ut128 and U.130, gB. gil, gL, gM. gN, gO. or a combination of gM and gN 10 a another embodiment, the invention pnvides a pharmaceutical composition comprising two or mor antibodies, wherein the nrst antibody is specific for a frst epitope on a combination of UL 130 and 131A, and the second antibody is specific for U.128. a second epitope on a combination of UL 130 and 1 I A, a coninatioln of UL I2, UL i)30 and 1 L 131 A. a combination of gH, gL, UL 128 and ULt 130, gB, gHI, gL, gM, gN, gO, or a combination of gM and gN. 1S In yet another =nmbodimecnt, the invention provides a pharmaceutical composition comprising two or more antibodies, wherein the first antibody is specific for a first epitope on a combination of ULM128, UL30 and 131A, and the second antibody is specific for UL12$, a combination of ULl30 and UIJ131 A, a secnd epitope on a combination ofC U 128, Ut 130 and 13 )A, a conibination of gi, gt, UL128 and UL130, gB, gH, gt, gM, gN, gO, or a combination of gM and gN, 20 In still another embodiment, the invention provides a pharaceutical composition comprising two or more antibodies, wherein the first antibody is specific for a first epitope on a combination. ofgH, gL, UL128, Lt130 and UL131A, and the second antibody is specific for U1L-128, a combination of 1)130 and UL) 131 A, a combInation of UL ,28. LJ 30 and 13IA, a second epitope on a combination of gH, gL, Ut 128 and UL130, gB, gH, gL, gM, gN, gO, or a 25 combination of M and gN In a further embodiment, the invention provides a pharmaceutical composition comprising two or more antibodies, wherein the first antibody is specific for a first gB epitope, and the second antibody is specific for UL12$, a combination of UI3 and UL131A, a combination of UL128 UL 130 and ULI lA, a combination of gH, gL, UIJ128 and UL .130, a second gB epitope, gHl, gL, 30 giM, gN, gO, or a combination of gM and gN In another embodent, the invention pmvides a pharmaceutical composition comprising two or more antibodies, wherein the first antibody is specifc for a fira gH epitope, and the second antibody is specific for UL ,28, a combination of UL 130 and UL 131 A, a combination of L128, U1130 and U1131A. a combination of gugU UL128 and UL30, gBasecond gH epitope. gL, 35 gM, gNi, gO, or a combinrtion of gM and gN la yet another embodiment, the invention provides a pharmaceutical composition comprising two or more antibodies, wherein the first antibody is speciIc for a first epitope on a combination of gM and gNl, 'and the second antibody is specific for UL 12$, a combination of ULI 30 and UlL!13A, a combination ofUjLl28, 1L130 and UL113] A, a combination, of gH,. gL, UL1128 and UL1.130, gB, gH, 40 gL, gM, gN, gO, or a second epihope on a combination of gM and gN, 9 Exemplary antibodies of the invention for use in a pharmaceutical composition that bind to an epitope in the hCMv UL I28 protein include, but are not limited to, 15D8. Exemplary anibodies of the invention ihr use in a pharmaceutical composition that bnd an epitope tomned by the hCMV proteins UL130 and UL13 A include, but are not limited to, 4N10, OF7, 10P13, 4122, 81L1.3, IFI1, S 214 and 5A2 (see U3.S. .Apphcatot No. 11/ 969,104, filed January 3, 2008), Exemplary antbodies of the invention for use in a pharmacetical nomposition that bind an epitope formed by the hCMV proteinsUL28, UL 30 and UL 31A include, bt are no- liited o, 2C 2, 7-11, 7113,8Cl5, 8)16, 916, and 604 (see US. Application No, 121174,568, filed July 16, 2008. E xemplary antibodies of the invention for use in a phannaceatical composition that bind an epitope formed by the hCMV 10 proteins gH, gL, UtL 12R and UL 130 include, but are not limited to, 8121. Exempiary antibodies of the invenion for use in a pharmaceatcal composition that bind to an epitope n the hCMV gB protein include, but arc not limited to, 73, 10C6, SF1, 684,41H9 gnd 2M3 1 Exemplaty antibodies of the invention for use in a pharmaceutical composition that bind to an epitope in the hCMV gH protein include, but are not limited to, 111B12, 131 il, and 3G16, Exemplary antibodies of the 15 invention for use in a pharmaceutical composition that bind an epitope formed by the hCMV proteins gM and gN include, but arm not limited to, 6L3. The invention further provides a pharmaceutical composition comprising two or more antibodies, wherein the first antibody is an antibody or antibody fagmnent of the invention and the second antibody is an antibody now known in the art, or later discovered, that nemahses hCMV inf.cton. Examples of such antibodies 20 include, but are not limited to MSL-109, ?F9 or 3133. In onc embodiment, the invction provides a pharmaceutical composition comprising the anybody I5D8 or an antign binig fragment thereof, and a phatmaceutically acceptable canier. In another embodiment, the invention provides a pharmaceutical composition comprising the antibody 15138 variant Ir an anmigen binding fragment thereof, and a pharmaceutically acceptable carrier, In 25 another embodiment, the invention provides a pharmaceutical composition comprising the antibody 15D8 variant 2or an antigen binding fragment thereof, and a pharaceutically acceptable carrier, In another embodimen, the invention provides a pharmaceutical composition comprising the anibody 812! or an antigen binding fragment thereof, and a pharmaceutically acceptable carrier. in yet another embodimet, the invetton provides a pharmaceutical composition comprising 30 the antibody 2C12 or ant igon binding fragmnr=ct therof, and a pharmaceutically acceptable carrier. In another embodiment, the invention provides a phamnacutical compositin comprising the antibody 815 Sor an antigen binding fragment thereof, and a pharmaeutically acceptable carrier, In another embodiment, the invention provides a pharmaceutical composition comprising the antibody 916 or an antigen binding fragrment thereof, and a pharmacericalty acceptable carrier, 35 In anothcrrcmbodimcatd the invention provides a pharmaccurical composition comprising the antibody 713 or tni antigen binding fragment thereof, and a phsrmaeeutically acceptable carrier, In another embodiment, the invention provider a pharmaceutical composition comprising the antibody 8.116 or an antigen binding fragment thereof, and a pharmaceutically acceptable carrier, in another embodiment, the invention provides a pharmaceutical composition comprising the antibody 7113 or 40 n antigen binding fragment thereof, and a pharmaceutically acceptable cattier, In yet another embodiment, the invention pmvides a pharmaceutical composition comprising the antibody 4N 0 or an antigen binding fragment thereof, and a phanraceuticaliy acceptable Carrier, In another emnbodirent the invention prvides a pharnaceutical composition comprising the antibody 10F7 or an antigen binding fragment thereof, and a pharmaceutcaally acceptable carrier, In another embodiment, the invention provides a phanmeurical composition comprising the antibody 10P3 or an antigen binding fragment thereof, and a pharmaceutically acceptable career. In 5 another embodiment, the invention provides a pharmacenca! composition comparing the antibody 4122 or an atngen binding fragment thereof, and a pharmaceutically acceptable carrier, in another embxdiment, the invetion prov ides a pham3cutical composition comprising the antibody 8L 3 or an antigen binding fragment thereof, and a phamaceudealy acae carrier. In yet another embodiment, the invention provides a pharmaceutical cromnpositiom comprising 10 the antibody 71B3 or an antigen binding fragment thereof, and a pharmaceutiafly acceptable carrier. In another embodiment, the invention provides a pharmaceutical composition comprsmg the antibody 7H3 variant 1 or an antigen binding fragment thereof, and a pharmace-uticaly acceptable carrier, ln another embodiment, the invention provides a pharmaceutical composition comprising the antibody 10C6 ora antigen binding fragment therco, and a pharmaceuticay acceptable 15 career, in another embodiment, the invention provides a pharmaceutical composition comprising the antibody 5E! or an antigen binding fragment thereof, and a pharmaceuticryly acceptable carrier in another embodiment, the invention provides a pharmaceutical composition comprising the antibody 6B4 or an anigen binding fragment thereof, and a pharmaceutical acceptable carrier. In another embodiment, the invention provides a pharmaceutical composition comprising the antibody 20 4119 or an antigen bindmg figment thereof. and a pharaeticaliy acceptable carrier, In another embodiment, the invention provides a pharmaceutical composition comprising the antibody 4H9 variant I or an antigen binding fragment thereof, and a phamnaceutically acceptable carrier. In another embodiment, the invention provides a pharmaceutical composition composing the antibody 2B Ii or an antigen binding fragment thereof, and a pharmaceuticlly acceptable carrier. 25 In yet another embodiment, the invention provides a pharmaceutical composition comprising the antibody 13H Il or an antigen binding fragxmt thereof, and a pharmaeeutically acceptable earrier. In another embodiment, the invention provides a pharmaceutical composition comprising the antibody I I 2 oran antigen binding fragment thereof and a pharmeceuticany acceptable carrier. In smother emhodiment, the venion provides a phannaceuncal composition comprising 30 the antibody 301 6 or n antigen binding fragment thereof, and a pharmaccutically acceptable crier, In another embodiment, the Invention provides a pharmaceutical composition comparing the antibody 61^ or an antigen binding fragment thereof, and a pharmaceutically acceptable carrier in one embodiment, the pharmiceutical compositions of the invention may comprise the above antibodies or antigen binding fragments thereof, as the sole active ingredient. In another 35 embodiment, the pharmaceutical composition may compnsc 2 or ree, e.g., 2, 3, 4,5 6, 7, or more of the above antibodies or antigen binding fagment thereof. As discussed herein, the phamaceutical compositions of the invenon may also comprise one or more antibodies, or antigen binding fragment thereof, and a second antibody, or antigen binding fragment thereof, that ncutratises CMV infcnon. 4) Antibodies of the invention may be administered (ether combined or separately) with other 4 herapetics eg with chemotherapeutic compounds, with radiotherapy, e Preferred therapeutic 31 compounds illdude anvti-iral compounds such as gancielovir, toscarnet and cidofovir, Such combination therapy provides an additive or synergisti improvement in therapeutic efficacy relative to the individual therapeutic gents when administered alone. The term "synergy" is used to describe a combined effect of two or more active agents that is greater than the sum of the individual effects 5 of each respective active agen T hs, where the combined effect of two or more agents results in "synergistic inhibition" of an activity or process, it is intended that the inhibition of the activity or process is greater than the sum of th inhibitory effects of each respective active agent, The term "synergistic therapeutic effect" refers to a therapeutic effect observed with a combination of two or more therapies wherein the therapeutic effect (as measured by any of a number of parameters) is 10 greater than the sum of the individual therapeutic effects observed wth the respective individual therapies. Antibodies may be administered to those patients who have previouslyshown no response to treatment for CMV infection, ia. have been shown to be refraetiv to anti-hCMV treatment. Such treatment may include previous treatment with an anti-virai agent This may be due to, for example 15 infection with an anti-viral resistant strain of hCMV. n compositions of the invention that include antibodies of the invention, the aibodies may make up at Ieant $50% by weight (eg 60%7% 5%, 80%,85% 90%, 95% 97% , 98%99% or more) of the total protein in the composition, The anibodies are thar in purified form The invetrion provides a method of preparing a pharmaceutica comprising tsteps of: 20 {i) prpating an antibody of the invention; and (ii) adnixing the purihed antibody with one or more pbarmaceutically-tscceptable carriers, The invention aLso provides a method of prepaig a pharmaceuticad, comprising the step of admiring an andibody with one or more pharmaeeati ciy-acceptable carrier wherein the antibody is a monoclonaatibody that was obtained from a transformed B cell ofthe invention Thus the 25 procedures for first obtaining the monocIonal antibody and then preparigthe pharmaceutical can be performed at vey different tmes by different people in different places (cg in different countries). As an ahernative to deverng antibodies or B cells for therapeutic purposes, it is possible to deliver nucic acid (ypically DNA) tha encodes the monoclonal antibody (or acive fragment thereof) of mterest to a suce susuch that the nuclci acid cn be expressed in the subject in iw to 30 provide a desired the tapeutic effect. Suitable gete therapy and nucleic acid delivery vectors are known in the art Compositions of the invention may be immunogenic eompositionsand in some embodiments may be vaccine compositions comprising an antigen comprising an epitope in the hCMV U1128 protein, formed by the hCMV proteins UL 30 and 13 A., formed by the hCMV 35 proteins UL128 UL130 and U131A, formed by the hCMV proteins gsH, gL, 111128 and UL 130, in the hCMV g8 protein, in the bCMV gH protein, or formed by the hCMV proteins gM and gN. Alterative compositions may comprise (i) an antigen comprising an epitope formed by a combination of hCMV proteins 1UL128, UL 130 and UL 13 1A, and (ii) an antigen comprising at epitope found on gB, gH, gL, gM, gN, g), UL 28, 1UL130 or UL13 1A, or a combination thereof, 40 Vaccines according to the inveTion may either be prophylactic i a to prevent infection) or therapeutic (i'e. to treat infection). 32 Composutons may include an antmicrobial particularly if packaged in a multiple dose format. They may comprise a detergent eg, a Twee polysorbatee), such as Tween 80. D)eergenta are generally present at low level eg <0.03%. Compositions mnay also include sodium salts (e~g sodium chloride ) to give tonicity. A concmtrationof I0+mg/ml NCI is typical ) Compositions may compose a sugar alcohol (e.g. mannitol) or a disaccharide (e.g, scrose or trehialose) eg at aroumd 15-0mg/rml (e g. 25 mg/mIx particularly if they are to be lyophilised or if they include material which has been reconsituted from lyophilised material The pH of a composition for lyophiliation may be adjusted to around 6.1 prior to lyophilisation. The compositions of the invention may also comprise one or more immunoregulatury agents, 10 1In one embodiment, one or more of the immunoregulatory agents includes) an adjuvant, The epitope compositions of the invention may elicit both a cel mediated immune response as wc as a humoral immune response in order to effectively address a hCMV infection. This immune response may induce long lasting (eg neutralizing) antibodies and a cell mediated immunity that can quickly respond upon exposure to hCMV 15 Medical ncatments and umxs' The antbodies, antibody fragments of the invention or derivatives and variants thereof may be used for the treatment of hCMV infection, for the prevention of K.CMV infection or for the diagnose of hCMV infection Methods of diagnosis may include contactig an anybody or an antibody fragment with a 20 sample. Such samples may be tissuesamples taken from, for exampie.salivary gands lung, ie, pancreas, kidney, ear, eye, pacenta, alimentary tracktheart, ovaries, pituitary, areas thyraid, brain or skin, The methods of diagnosis may also include the detection of an antigen/antibody complex. The invention therefore provides (i) an antibody, as antibody fragment, or variants and 25 derivatives thereof according to the invention i) an immortalised B cell clone according to tohe invcntyon, (iii) an epitope capable of binding an antibody of the myvntion or (v) a igand, preferbly an antibody, capable of brndng an epitope that binds an antibody of the invention for use in therapy. Also provided is a nehod of treatag a patient comprising administering 1o that patient (i) an antibody, an antibody fragment, or variants and derivatives thermof according to the invention, or. a 30 ligand, preferably an antibody, capable of binding an epitope that binds an antibody of the invention, The invention also provides the use of (1) an antibody, an antibodyfragment, or vaants and derivatives thereof according to the invention, (it) an immortalised B cel clone according to the invention, (iii) an epitope capable of binding an artibody of the invention, or (iv) a ligand, preferably an antiody, that binds to an epitope capable of finding an antibody of the invention, in 5 the inanufactur of a medicancat for the prevention or treatment of hdMV infecdon The invention provides a composition for use as a mtedicmem for the prevention or treament of an htCMV infection. It also provides the use of an antibody and/or a protein comprising an epitope to which such an antibody mbid in the manufacture of a medicanent for treatment of a patient and/or diagnosis in a patent. It1 aso provides a method for treating a subject in need of -S * treatmer t, comprismg the step of administering a compcaition of the invention to the subject in Some embodiments the subject may be a huan, One way of checking eficacy of therapeutic treatment involves motortring disease symptoms aftr administration of the composition of the invention. Treatment can be a siigle dose schedule or a multiple dose schedule. 5 In one embodiment, an antibody of the invention, an antigen-inding fragment thereof, an epitope or a composition of the invention is administered to a subject in need of such prophylactic or therapeutic treatment, Such a subject includes, but is not limited to, one who is particularly at risk of, or susceptible to, hCMV infection, Exemplary subjects include, but are not limited to, immunocompromised subjects or hCMV-seronegative or hC.MV recently infected pregnant women. i) Exemplary immunocompmmised subjects include, but are not limited to, those affected with HIV or those undergoing immunosuppcssive therapy. Antibodies of the invention and anigen -biding fragments thereof can also be used in passive immuaisation. Further a described in the present invention, they may also be ure4 in a kit for the diagnosis of NIMV infection. 15 Epitopes capable of binding an antibody of the invention, eg, te monoilonal antibodies 15D, 4N10, 107, 10P3, 4122, 8L13, 212, 8C15, 916, 7813,816, 812 1, 711 , 7H3, 6B4, 5-1, 10C6, 4119, 2131, 11B12, 131-111,3G16, and 6L3, may be used. in a kit for monitoring the efficacy of vaccination procedures by detecting the presence of protective anti-hCMV antibodies. Antibodies, antibody fragment, or variants and derivatives thereof, as described in the 20 present invention may also be used in a kit for monitoring vaccine manufacture with the desired immunogenicity The invention also provides a method of preparing a pharmaceutical, composing the step of adinixig a monoclonal antibody with one or more pharmnaeuucally-acccptablc criers, wherein the monoclonal antibody is a monoclonal antibody that was obtained from an expression host of the 25 invention Thus the procedues for fust obtaining the monoclonal antibody (eg expressing it and/or putifying i) and then admixing it with the pharmaceutical carriers) can be performed at very different times different people in different places (eg in different countries). Starting with a transformed B ell of the invention, various steps of culuring, sub-culturing, cloning, sub-cloning, sequencing, nucleic acid preparation ec. can be performed in order to 30 perpetuate the antibody expressed by the transformed 1 cell, with optional optimization at each step. In a prefercd embodiment, the above methods further comprise techniques of optimisation (exg. afinity maturation or opimisaion) applied to the nucleic acids encoding the antibody. The invention encompasses all cells, nucleic acids, vectors, sequences, anibodies rc. used and prepared dwing such tepa 35 In al these methods, the nucleic acid used in the expression hoast may be nipulated to insert, deletc or amend certain nucleic acid sequences Changes from such manipulation include, but are not limited to, changes to introduce Mrtricton sites, to amend codon usage, to add or optimise transcription and/or translation regulatory sequences c, It is also possible to change the nucleic acid to alter the encoded amino acids. For example, it any be useful to introduce one or more (eg 40 1,2, 3, 4, 5, 6, 7 8, 9, 10, etc) ammo acid substitutions, deletions and/or insertions into the 54 antibody's amino acid sequence. Such point mutations can modify etTector functions, anigen binding affinity, post-translational modifications, innunogenicy, etc,. can introduce amino acids for the attachment of covalent gmups (e.g. labels) orcat introduce tags (e.g. for purificatiott purposes) Mutations can be introduced in specific sites or can be introduced at random followed by 5 selection (e.g. molecular evolution). For instance, one or more nucleic acids encoding any of the CDR ogions, heavy chain variable regions or light chain variable regions of antibodies of the invention can be randomly or directionally mutated to introduce different properties in the encoded amino acids, Such changes can be the result of an iterative process wherein initial changes are retained and new changes at other nucleoride positions are introduced, Moreover, changes achieved 10 in independent steps may be combined. Different properties inroduced into the encoded amino acids may include, but are not limited to, enhanced affinity. General The term"comprising encompasses "including" as; well as consting" eg, a composition "comprising" X may consist exclusively of X or may include something additional eg. X - Y, 15 The word "substantially" does not exclude completely"g a composition which is '%ubstantially free" from Y may be completely free frm Y, Where necessary, the word "substantially" may be omitted frm the definition of the invention The ftrm "about"in relation to a numerical value x means, for example xt0% The term "disease" as used herein is intended to be generally synonymous and is used 20 interchangeably with, the tem "disorder"and "condition" asi medial condition), in that all reflect an abnormal condition of the human or animal ody or of one of its parrs that impairs normal fInctioning, is typically manifested by distinguishing signs and symptoms and causes the human or animal to have a reduced duration or guadiy of life As used herein, reference to "treatment' of a patient is intended to include preventionand 25 prophylaxis The term "patient" means all mammals including humans. Example; of patients include hmans cows, dog, cats, horses, goat&, sheep, pigs, and rabbits, Generally, the patient is a human. EXAMPLES Exemplary ermbodiments of the present invention are provided in the following examples 30 The following examples arc presented only by way of illustration and to assist one of ordinary skill in using the inventor The examples arc not inanded in any way to otherwise limit the scope of the invention. ramp/el: (Ining nf B cells and .srnening p.r ACMV neutrraijng aen'vft Donors with high hCMV neutralizing antibody tites in the serum were identified, Memory 35 B cells were isosated and itmnortalised using EBV and CpC as desctibed in reference 36. Briefly, memory B cells were isolated by egatve selection using CD22 beads, followed by removal of JgM. IgD t IgA' B cells using specific antibodies and cell sorting. The sorted cells (gG') were immortahwd with EBV in the presence of CpG 2006 and irradiated aliogenic mononucicar coils. Replicae cultures each conteining 50 memory B cels werese up in twenty 9 wcl Ubotto plans. After two weeks the culture supematants were coveted and tested fr their capacity to neutralize hCMV infection of eberbrasts or epi delis in separate assay. cell clones wer isolated ftrom positive polyclona cultures as described in reference 36IgC concetrans in thesupernatant of selected ones were determined using an IgO-specific ELSA 5 For the viral neutralization assaya tired amount of a cjrical hCMV isoate was mixed with an equal volume of culture supematant or with d lutions of humam Sera containing neutralizing antibodies, After I hour incubation at room temperature the mixture was added to confluent ronolayers of either endotbelia cells (e.g. IUVEC cels or HMEC-1 cells), epithelial cell (e.g. ARPE retinal cells), fibroblasts (eg. MRC-9 orinesenchymal stromal cells) or myeloid celLs (e.g. Mt monocyte-derived dendritic cells) 6 well fiat-bottom plates and incubated at 37C for two days. The supernatant was discarded, the cells were fxed with cold methanol and stained wa a mixture of mouse monoclonal antibodies to hCMV early antigens followed by a fluoresecin-labeled goat anti mouse 1g. The plaes were analyzed using a fuorescence microscope, In the absence of neutralizing antibodies the infected cells were 100- 1,000/field, while in the presence of saturating 15 concentrations of neutralizing antibodies the infection was completely inhibited. The neutralizing tier is indicated as the concentration of anybody (pg/ml) that gives a 50% or 90% reduction of hCM infection Table SA show the neutralizion of a CMV clinical isolate (VR1814) on both a fibroblastic cell ine (MRC,-9) and a human retinal epithelial cell line (ARPE). Some antibodies 20 neutralized hCMV infection of cpithclal cell (ARPE) but they did not neutral infeinon of fibmblasts (MRC-9), This agrees with previous data that dierent proteins are responsible for tropism towards a particular cell type [7j. Most of these antibodies, which are :>pecific fur one or more proteins of the gH/gLAUt2/UU 30/Ut 13 A protein complex. neutralized hCMV infection of epithelial cels at very low concentrations (50% reduction of hC MV infection at concentraions 25 ranging from 0.01 'sg/mil and 0.001 pg/nl. Other antibodies, which arc specific for the hCMV protein gB, gH or a combination of gM and gN, neutraied hCMV infection of fibroblasts and epihelial cells with ornparable potency. These results show that some of the hCMW neutralizing antibodies are equally potent on both fiboblasts and epithelial cel, while others show differential activity on the two cel types. 30 Based on the analysis shown in Table 5A, antodies were g3uped into Group I (neutralizing hCMlV infetnon of both fibrobbsis and epithelial cells) and Group 2 (neutralizing hCMV infection of epiChelial els) Table 5B shows an independent experiment performed uswg purified antibodies. The results show that Group 2 antibodies neutralized infection of epithelial cells with K90 values (tAc. the concenration of antibody required to give 90% reduction of viral 35 infection) ranging rm 0.007l pg/mni to 0.003 pg/rai while Group i antibodies neutralzed infection of both fibroblasts and epithelial cells with 1(90 vahies ranging from 0, gg/ml to 30 pgniml Group 2 antibodies aso neurized infection of endothelial tells (HUVEC) and myeloid cells (monocyte derived dendritic cel) (data not shown). Group I antibodies also neutralized infection of endotholial "eIs o(I-uV ECi, mycloid cells (mronocyte-derived dendritic cils) and bone manow 40 mesenchymal stronal cell as shown for some representative atibodies in Table 5. Antibodies of the invention also neutralized infecnon of endothe Ial cel (HUVEC) by different hC MV clinical isolates. VR6952 (from urine), VR3480 BI (fiom biood, ganciclovir-resistant) and V R 4760 (tri blood, ganciclovir and foscamne resistant) (data not shawa). It is anticipated that antibodies that neutralize infection of different cell types may be combined to bring about an additive or synergistic neutalization effect when the different cell types 5 are present during infection. As one example, a neutrahzing antibody, such as I 508 which ir, potent in neutralizing infection of epithelal cells but does not nemtralize infection of fibmblasts might be combined with 3G16 which doies have virus neUtralizmg activity on fibrAbiasts. As another example. a neutralizing antibody, such as 916 which is potent itn neutralizing infection of epithelial cells but does not neutralize infection of fibrmbiasts, might be combined with 614 which does have virs 10 neutralizing activity on fibtoblasts. Table SA 50% 50% Nautraiiatiot 5 Neutralization9 mAb Donor Specifcityt MRC-9 ARPE MROS 6RA UL12l 4N10 GI0 UL302UL13A + 4 10F7 PAP ULO10/UL13A ++ 10P3 PEL UL30/UL3IA 0 U A 4122 PE, UL30/UL131A $13 PEL UL130/UJ31A 44 2C12 PAP ULI28/ULI3O/ULI3IA + -++ 7TB13 PA? ULI28/ULI30/ULI3IA -e 7113 PAP ULL28/UL1307UL13iA i A 8C15 PA? ULL28/UL130/UL13 A ++++ SJ16 PA? UL28UL2S 30I/ULI3A -+A 1916 PEL U5fJ28/U30AULI31A e 812 PEL gR/gL/UL 128/UtLI30 -, 11112 PAY gH 1311U GIRA gH ++r 3G16 PEL gA --- 3 PE L gB 10C26 PEL gBt 5 SF3 PEL g13 6-4 PEL g - B- 4119 PEEL gBl 613 PEEL gMigN Not done 1) Values indicating the concentration of antibody required to give a 59% reduction of hCMV infection of Eibrobbasts ie.g MvRC-9) or epithehial cedh (.g A RPE retinal edh). Conceration as follow +C+ <0.00 pgtnil; ++2<0.0 gimhl; +t C 9.J gg/mi: -s 2 phg/mi; 15 - Not neutraling at dhe highest concentration tumid(2 plg?mt ,~ 2) Specificity a denined in T able 0i
-------------
Table 5B s-.' 9#'% 90% * ~Neturalizaton~ Nautnzatnt> p Ab Donor Spet9cM S MRC. ARPE 2 1518 RA UL128 nn, 2 4N10 (310 U'L130/UL13}A mn 002 2 1OF7 PP U /U .I n c 02 122 a 0,0025 2 12 PL UL.130UL1331 n 0.025 2 813 PE L3/L3Ann 0.001 2 2C12 PAP U 2nn I 2 7813 PAP MU.L28UL 30/ULI31A an i003 2 7113 PAP UL18UI03U113iA nn 0.0 2 8C15 PAP UL128/ULI30/UL13IA nn (0025 2 8J16 PAP UL128/Li30JUL3iA n 00008 2 916 PEti 128/ULi30;Uii3iA nn 0,007 2 8121 PEL gH/gL/UL12RLI3 nn 033 - 1112 PAP ga 15 1.2 1 1311.1 ORA giL 12 04 1 3G16 PEL gH 1.0 U-3 1 H713 PEL g)) 3 0.6 I 10C6 PEL gB 0.75 02 I SF1 EEL 4B5 0. L I £1B4 1 PML 1Bi0 0.15 4H1 PEL gO 10 0,4 1 2B11 EL gB 0.5 02 S 613 PEL gMigN 30 10 )t Valhes indicating the concentrasoui of antibody in pg/m$ quired to give a 90% reduction a'fhCMV (VR1814)infectesn of fibrests (eg MRC-9) or epitelial cells ARg. AR PE retnal cels) 2) Speeciwb as defined in Tabled. 33) nn, not neut-raliAng at the highetconcentration tested (10 pg/ml). Table 5C 50% Neutrasaation' 3 Group mAb Specificity MUV'C Mn-DC RM-MSC 1 7_ 3 gH 0d .06 2 10C6 &&I 019 02 03 1__ 5F! gHl 0l1 0.05 0.3 1 684 t gH nd 031 2 J) Values indicatig oncentria antibody to 5 reduction CMV (VRI 114 infectio of primary els U , mn umbilial vein n clls monocywte derived dendtihie cells. BM-MSC. mesenchymal bonje-raanuw stiomna! cells 10 Eample 2: ldenhifcation oftke taget anigens recognizly r e manoclonal antibodies To map thespecficity of the hCMV neutrahliIng antibodies, HEK?2g3T cls wem transfecIdt wih one or more vectors encoding M ength ICMV proteinUL12SULi130, ULl31LA gil, gL, gBl gM, and gN. Aflet 3dh celsw fiicdpemcabilized andtained th the human mmoonal antibodies followed by goat antihuman igOFgure lshowsthe binding of representative antibodies to H EK293T cels exposing one or more hCMV prtins. Table 6 shows the staining patern of all the different antibodies to hCMV gene-annsfcred H8K2931T cells. With the exception of antiody 15D8, that stained UL 128-transiected cells, all the other Group 2 antibodies did not stain single gene transfectams, suggesting that they may recognize epitopes that 5 reqmnre co-expression of rnore than one gene product. Indeed, five antibodies (4N 10 ) 1 , 10P3, 4122 and 8 13) stained cells co-expressing UL130 and UL 13 IA, six antibodies (2 12, 7B3, 7113, 8C715,18J i and 916) stained cells cooexpresing UL128, UL .130 and Ut 133 A, and one anbody (8121) stained cel tmansfected with 1)328 anti Ul 30 as well as with gH and gL. All these antibodies also stained HEK293T cells transfected with all genes foming the gH/gJUTL 128-130 complex. Among the Group I antibodies, tree ( B12, 13H 1 and 30 16) stained cells exprssing the hCMV protein gH, six (73, 10C6, 5F1, 684, 4119 and 28I 1) stained celIs expressing the hCM V potei g8 and one (6(3) stained cells coexprcsing the haCMV proteis gM and giN, Table & MonedelO ntIbody Group 2 Group 1 1EK293T cells transfoeted 15D8 4N10 2712 8121 11812 713 | 603 with. 1 7B13 131111 10C6 IoP3 7113 3G16 ri I 41-2! 8(15 684, 81u3 8316 419 A1 2811 UL.128 a d") UL__30_nd UL28+-UL 3 + - ad UL128+ULI3-A - - -- nd UL30+UL13lA nd ULI28tULI30+ULt131A + + gH+gL+ gi+ULl28+UL130+UL131A + + + t id nd gt.+UtL28+4t130+ULs3A + + + - - ndl nd gttgL+UL128 +- + ad ad gH+gL+ULl3O nd ad gHlsgL+UL131A - - - - nil nd gBt-gL+UL328+UL130) + - - + nil nd gaL ULI2SEULl30UL 3lA + + + + + gB - -. -- n-d - M nd ad ad ad n gnd - - ad nd ad' gM~N d d +i 1) - ad ndon . .... -......... 39 To further explore the identity of the antigen sites 1o which the ancbodies bind, csot competition experiments were performed, Here, HEK2Z93T cells were trAvsfected with vectors encoding fIdI length htCMV proteins gHl, gL, ULU28, ULI 30 and ULA1 A The cells were then incubated with a 20-fold excess of a competitor ICMV ieutralizitng antibody before addition of a 5 biotitylated antibody, This procedure was repeated several limes with diflfrent competitor antibodies and bioinylated antibodies. la these experims four antibodies described in Patent Application No. I 1/9,104 ( i IF) 1, 2F4 and SA2) and PThent Application No. 1274,568 (664) were included, The data is shown in Table 7A, B Table 7.A IIhibition of binding (%) Competitor Specficlty, 158- 4N10- tF?- 4122- 1Ff?- 2F4- 5A2 ( biodia biotit biotin blutin biotin blotbi bioti excess) 15D8 tUL128 ion 0 0 0 0 0 4N0 UL130/UL.131A 0 1100 10 0 0 0 100 1JF7 UL 0/1 UL131A 0 0 100 100 100 100 0 1OP3 UL 130/U L I31A 0 od, nd 0 0 0 Nd 4122 U IJ30UL I3A 0 101 100 100 100 0 SL13 t UL130ATV I3A u;d a id IN n~d _100 Nd d IFI1 UL13 0,1U L 3 A 0 0 1 H 100 Too 100w 0 2F4 ULWl/UL131A ad 0 100 100 100 100 0 SA2 U 3i0U tLI3IA ad I00 0 0 0 5&0 100 2C2 U128/UL13u0/UL1A 1 0 0 0 0 0 0 0 7g13 UL128tUL130UL.131A nd Jd d Id nd nd ad 7113 L128L130/UL131A ad ad ad d 0 ad ad 8C15 21 l UL30/UL131A ad ld ad 0 ad ad ad 8416 U12LUJL1303UL,131A nd ad ad 0 010 ad 916 128IUL 30/ULI3IA nd ad Nd 0 0 0 nd G4 ULLt,12UL13UL131A 0 0 0 0 0 0 0 812 H'L/ULI28/ULS30 0 9 ad 0 0 0 95 10 U) Speciticity as defined is Table 6. 2) Conmpeution below 100% mray be due to paral overlap of epitopes or to steri hindrance or to lower affinity. Table 7D. Inhibition of binding (%1) ltetn4 el& 2C>T 8C1- 816 91- 6C4- 8121 (20foid bh at ain blobirne biorla biotin biatin lexess) ____________I 5D8 UL 8S ad ad ad 0 0 JOF7 ULBO ULI2 A 0 a d ad 4M U f30ULI 1A 0 ld 0 ad d 0 L J01 , tI31A ad ad ad nad ad ad 40 2F4 UL130,ULj3A 0 ad ad 0 0 0 SA2 ULI30/UL131A 0 ad ad 0 0 92 202 UL128ULI30/UL131A 100 100 100 100 100 0 7813 UT 28/ULI30/UL131A 100 100 100 100 100 0 7113 Ut-- 283/UL131A 0 0 0 0 0 0 05 ULI28/UL13WUL131A 1N too 100 10 100 0 8J16 ULI28Ui30fUU3IA 01 1A 100 7 100 0 916 U1321U30/UL3A 100 100 100 100 100 0 6G4 UIU 2/T iS3o0U 3A [100 100 100 100 100 0 8121 eggUUl28/ULl30 0 ad ad nd 0 100 3016 gR 0 ad Ad nd 0 0 1)Specincty as denied is Table 6 2)Compethia bclow 100% amy be due to prial ovetna ofqeitupa or to site hindniac or to lower affnity. Based on th data in Table 7A, Bat least seven distinct antigenic sites can be distinguished on 5 the hCMV complex formed by gH, gL, Ug 128 and UL30 (Table 8). Site is present in U128 and is defined by antibody 15D8. Sites 2 to 4 are forme by the combinaton of UL130 and UL13A and are defined by the antibodies 10F7 4122,813,1 IFI and 2F4 (site 2), by 4N10 and 5A2 (site 3) and by 10P3 (sie 4)espectively.Sits 5 and 6 afr Jned by the combination ofULi28 UL0 and UL 131A and ase defined by antibodies 2C12, 7B13,8015, 86, 916 and 6G4 (site5) and by 7113 if) (ste 6), respectivelyinaly, site 7 is for ed by the combination of gH gLU128 and UL" 30 ad is defined by the antibody -121. Antibodies defining site 7 ad site 3 partially competed with ch other, suggesting that thee sites may be close in the structure of she g1-I/gULI28 131A complex. It is anticipated that neutralizing antibodies targeted to different eptopes on the same target cabe used innbinaion to achieve robust neutralimdonof virus infection as exemplified by 15 10F and4N10 or by 8116 and 7113. Moreover, it is anticipated that neutralizing anibodies targeted to different target molecules or combinatins of target molecules may be used together to achieve robust virus neutralizaion. As onceamplc Tablc 8 suggests tnat) 15D and I OF7, 15D8. and 2C12,or 8316 and 8121 could be combined to bring about additie or synergenic KCMV neutralization effects 20 Table 8. Target antigen Antigenic site AntIbodies denning the antigenk site UL128 15D8 UIO /uIUA 2 31AF7,4122, iSltS F 1,2F4 UL130/UL131A 4N10, 5A2 ULi3O/ULI3IA 4lOP3 'UL128/ULI3/UL131 A S 202, 7B13,8C15,8J6, 916,6G4 gH/g~~~~ L/L2/L3 121i In a manner simiIar to what described in Tabic 7. REK293T cells were transfected with a vector encoding full length gito examine the crossompetiion binding of the anti-ef antibodies As can be seen in Figure 2A and Table 9, at least two ditThrent binding ses were identified in the CMV gH protein. The antibody l deflnes one sie and the antibodies lB and 13F11 define S a Necond site. Finaly HEK293T ces were transfeeted with a vector encoding fI length gil t examine the cross-competition binding of the anti-gg antibodies; As can be seen in Figure 2 ad Table 10, at least three diTerent antigenic sites were identfied in the hCMV gB protein The antibody 6134 define one site, 7113 defines a second ie and the set of0C6, SF1, 4119 and 2B311 define a third site. Antibody 6114 (recognizing gB site 1) reacted by EUSA with the gB 69-76 10 peptide (Ost of 01044gn it is anticipated that antibodies that target different sites even on the same target molecule can be used in combination to achieve mbust virus neutna lition. it is anticipated ihat antibodies that target difftt sites even atu thie same target moleuale can be used in combination to achieve robust virus neutralization. Table 9. Inhibition of blading (%) of 20-fold excess bicdi bioda Motin 3G316 gRl 100 0 0 hIBI2 gH ) 100 100 2 21141 gH 0 gm0 100 2 i$ 1} As defned in Tab Ic A Table 10 * itibitin o binding (%) of Competitor p71 6 F1- 4- 4119- 2Bh1- Antigenk ie In 9B 20-fold x Sin biotin botin obin biotin biotin 6B4 qB 0 0 0 100 0 0 P to ( 2 7113 gB100 0lt) 0 0 02 10C6 gB 0 100 10 0 too 10 3 WI gB 0 100 104 0 o 100 3 419 g 0 100 100 0 10 100 3 2.811 gB 0 100 10 0 1*0 1 0 1) As defined in Tabk 6, 2) Compeition belew 10K% may be due to partial ovrhp c fepitopes, to steric hindrance or to lower affinity. To summize. 15DS binds to an epiope in L 126 that is distinct from the epitope recognized 20 by 2C12, 7 ,1113 604 (all specific for a combination of U 128, UL130 and UL 31A) and from the epitope recognized by 8121 (specific for a combination of gi g UL28 and Ut 10) In addition binding of 15SD to its epitope is not inhibited by4N, 0F7, 10P3 and I FlI (all specific for a combination of UL 130 aind UL1!31IA), 4N10 binds to an epitope which requires expression of UL130 and UL S A and that is the 25 same or largely ovrapping to the epitopes recognized by 5A2 speciee for a combination ofUL 30 and, ULT3 A) and 812! (specific for a combination of gH, gil, U 128 and UL 0) but dismnct f&om the 42 epoopes recognized by 107F 4122112F4 (alspecifi for a combbnaIon ofUL1 and Il 131 A) 2C12 and 64 (both specific for a combination of J28 ULA 30 and UL 13 A) n addition biding of 4N10 to its epitope is not inhibited by 15DMSpecific for Ul ' 28). 1iY? bind& to an epirope which requims exprewiotn of UL.130 andTUL13IA that is the sane or 5 largely overlapping to the epitope(s) recognized by 4122813, i I nd 2F4 bt distinct from epitope(s) recognized by 4N10 and 5A2 (both specific for a combination of U1130 and UL13IA) as well as distinct ftom epitoes recognized by 2C12 and 60-4 (both specific for a combination of U ,28. UU130 and U131A). In addition binding of lOF7 to its epitope is not inhibited by I 5DA (specific for UL128) or by 13H1 specific for gH). 10 4122 bmnds to an epitope wInch reg ores expression of UL 130 and ULX3IA and that is the same or partiafly overlapping to epitope~s) recogmaze d b y 2F4, i 151 and lOP7 but distinct fromnepitope(s) recognized by 4N 10, 1 0P3 and 5A2 (all specific for a combination of UiLl30 and UL.U31A as wel a distinct fmom the epitopes recognied by 2C1, 8C15, 8316, 916G04 (all specific fora combination of UL.128, Ul 130 and L 1 I Al and $121 specificc for acombination of gH, gL, U128 and UL130. In 15 addition binding of4122 to its cpiopc is not inhibited by (ho antibodies 1508 (specific for UL 128) or by 13H11 (specific for gH). 2I2 binds to an epitope which requires expression ofbCMV UL128,UL130 and U13IA gene prodots and thats the same or laZely ovrlappingto epepe(s)recognized by 7B133, i1 &316,916 and 604 but distinct from the epitope recognized by 7113 (all specific for a combination of 20 ULL.28;UL130 and U1131A) and disinct fom epitope(s rognized by 15D8 (speci fornu28). 4N, 10.F7 1013 4[22, 813 IN 1,2F4, SA2 (al specific for a combination oftUL130 and UI31A) and 8121 (specific fora combination of g1, gL, UL 128d UL130). Ir addition binding of 2012 to its epitope is nor inhibited by 3G16 specificc for gH) 015 binds to an epitope which requirexpression ofVhCMV ULI28. UL:0 and UL IA 25 gene products and that is the same or largelyoverlapping to epiope(s) recognized by 2012, 7B31 8316,916 and 604 but distinct from the epitope recognized by7113 (al specific for a combination of Ul12%U130 and UlF3IA)M 8JI6 binds to an Cpitope which requires exprsion of hCMV 1.128, U130 and UL131A gene products and that is the same or largely overlapping to epitope(s) recognized by 202,7B133, 30 8C15;916 and 6G4, but distinct from the epitope recognized by 7113 (all specific for a combination of UL1128; L.130 and U113 IA) and from the epitope recognized by 4122 (specific for combination of UL.130 and 113 IA) 916 bmds to an epitope which re exprion ofhCMV UT 12 U .51130 and UL 131 A gene products and that is the same or largely overlapping to epitope(s) recognized by 2C12, 78 13, 8C15, 35 R316 at 6G4 bit distinct from the epiope recognized by 7113 (all specific for a combination ot U1L128, UL 30 and UL 13 IA) and from the epitope(s) recognized by 2F4 and SA (speelfic for a combination of U 30 and 113IA). 8121 binds to n epitope which qluiresexpression of hCMV gOgid L128 and 1LD0 gene products and that may be parially overlapping to epitope(s) recognized by 4N 10 and 5A2 (both 40 specific for a combination of UL 130 and UL1 IA) but distinct from epitopes recognized by 1508 43t (specific UL128) lOP, 10P3, 4122, IF1 2F4 (all specific for a combination of UU30 end UU31 AX 2012,7.813, 7113, C1, 86 916 and 604 (all specific for a combination of UL128, LL130 and UL131) n addition binding of 8121 toits epitope isnot inhibited by 3G16 (specific fbr gH 3G16 binds to a n epitope in gHl that is di"tinCt from the epiop.s reconized by 1111B 4and 5 131-11 1 (both specific for gl), 11812 binds to an cpitop int gH that is sam or largely overlapping to the epilope recognized by 13H I 1 and distinct from theepiopes recognized by3G16 (both specific for gi). 131l binds to an epitope in gff that is the same or largely overlappingto the epitope recognized by 1RB12 and distinct frm the epitopes recognizd by 3Q16 (bothpecific for gRl 10 6B4 recogaizes am epitope in g at is distinct from hc epilope recognized by 733H419 SF1, 10C6andZ28l (allspecific for gB) 7M3 binds to an epitope in gB that is distinct from the epitope(s) recognized by 684 7143, 419, 5F1, 100C6 and 2B11 (all specifle fi or gB 1006 binds to an epitope ing& that is the same orpartiaylv overlapping to the epitope(s) 15 recognized by 5F 414H9 and 21311. but distinct from the epitope(s) recognized by 73 and 6B4 (all specific for g$). SF1 binds to an epitope in gl that is the samne or largely overlapping to the epitope(s) recognized by 1006 4H9 and 2B11 ut distinct from fe epitepe(s) recognized by 684 and 7H3 (al specific for g1) 20 419 binds to an epitope in g hat is he same or largely overlapping to the epitope(s) recognized by 5F. 10C6 and 2811, Nt ditint heam the epitope(s) recognized by 6%-4 and 7113 (all specific for gl), 2811 bind; t an epitope in gBa that is the same or largely overlapping to the epitope(s) reaognizehy 5F1, 06 and 41-19 but ditinct fmm the epitope(s) recognized by 6R4 and 7H3 (all 25 specific for gH) Erampk 3: Breadth of neutralizng activity of antibody 5IDS UL 128 is the most conserved gene of the UL 132-128 locus However, sequences derived from several clinEal isctlates revealed te istence of 10 variant wish one or moreamions when conipardto te VRI 14 sequence We thcrvforc investigated whether the binding of the UL"128 30 specific antibody 15D0 would be affected by any of these mutations. To this aim, punished anio acid sequences of variants ofULI28 fom clinical isolates (VR4603-M. VR4836-M, VR500-K VR4254-M, VR4969-M, VR43 13- M. VR4116-M, VR3235-T> VRS055T, VR4 168-A, VR 1814 PCR) and laboratory gtmins (Towne, TB140/F, AD 169, Merlin and Toledo) were aligned. and a gene was synthesized encoding a prteit tha includes all amino acid subsitutions described as welas an 35 additional muatiot that we found to be generated atvery high frequency in vitro Upon PCR amplification (F33V The nucleotide sequence of the synthetic gene was: atgaaeageaagacetgacegccgaegacetsgtgotatggacaageggtgegggtagc~ganigatgtgeg aatlcatncgtcaaccaccegcoggaacgetgtstgaattcaeaatgtgcaatctgltcaccgtcogegctgcggitteggeggegaagtt getacagtcoegagaasacggergagatnegagggategteaenaecatgaccalstacaegccaggiteesacaaacgacga 44 gctgeaactacaatecgtatactgaagegacggggaatacgetgggcaaaggagcgaaagggagtacctgctgggegocgct ggcagegttcccitcgatggacaacctggatacgcaaaaacccggattcggggcggaJcagtactggagagcgttaagaalacc aucggetggatgtggeegegetaaatgggetatutgetgcagtag. HEK293T cells were transfcted with the original UL 128 from VRI814 or with the pan 5 mutated gene and stained with serial dilutious of I SD8 antibody. As shown in Figure 3, the original and the pamutated UL 128 protein were recognized by 1508 with comparable efficiency (saturamed staining at 0.2 gg/ml). These findings indicate that 15DM recognize a highly conserved epitope in the UL128 encoded protein. All patents and publications referred to herein ar expressly incorporated by reference in their 10 enti It should be noted that there are alternative ways of implementing the present invention and that various modifications can be mado without departing from tho scope and spiri of the invention Accordingly the present embodiments are to be considered as illustrative and not restricteive and the nvention is not to be limied to the details given herein4, butmay be modified within the sCope and $ equivalents of The appended claims. 45 REFERENCES (the contents of which are hereby incorporatld by reference) [1] Placher et a (1996) Aet iras Res 46:195-261 [23 Gern a!. (2002) J A-ed Piro! 66:335339, [3 Adler, B., L Scrivano, Z. Ruzics, Rupp, C. Singer, and U. Kusainuw4i. 2006. Role ofhinan cytomegaiuvims UL13 IA in cL type-specific virus entry and rlase..I Gn Vm> 872451-2460 [43 Gers, U, E. Pe Uivalle, D. Lillkri, L Lo, C. Frlaa, G Hahn, F. Baldanti. and Mi Revello. 2005, Dendritic-cell infection by human cylomegalovinus is restricted to strans canying funtiumi UL131-128 geucs and m dniate:> effcient viral antigen presentation toCDli Tcr11.J~ en Krod86:275-284. [5) Habt (., M,., Reveil, M.i Patron, E, Perisale, G Ca6Ompaini, A. Sarasini. M,- Wger, A. Gallin, 0, Milanesi, U. Koszinowsi, F. Baldant, and (. Gema. 2004, Human cytomegalovimts UUI 31-428 genes are indispensable for virus growth in endothclial cells and virus transfer to leuk"cytes. J Pro 78:10023-10033. (6] atinae, , M M Seci. U Fimsi M, leradi, 0. Milanesi, and A. Gallina 2005. Human cytomegalovins tL 30 protein promotes endothelird cell infection through a producer ccnl modification of the virion. J ro! 79:8361-8373. [7] Wang, iD, and T, Shenk, 2005. Human cytomegalovrs vinon protein complex reqmed for epithehal and endothdeial cell tropism. Poe Nat! Aca S&i US A !02:18l5318138. [R) Wan, D, ad T. Shenk. 2005. Human cytomegalovirus UL L13 open reading frame i required for epitheial cell troops, J Viro! 79:10330-1033& [9] Nigro er at 2005aFsiYC imnization during pregnancy for congenital cytomeg aovirus infection, N EngJ Med 353:13$0- 362, [10] Biomueki e al. 2004, A phase 1l, doubte-masked, randomized, placebocontrolled evaluation of a human monoclonal anti-Cytmegalovims amibody (MSL -109) in combination with standard therapy versus standard therapy alone in the thertaren of AIDS pacets with Cy1uegaluvirs runitis. .tfwra! Rex 64:103-111. :1,, McLean t a. 200I Recogniion of human cytomegalovirs by human prtary immuncglobulins identifies an innate foundlaton te an adaptive imnmunc response, j/ /mmt, 1 74:4768 -4177. [12] Lefran c et ,2003. 1MGT unique numbering fur inmmunoglbulin and IT cel- receptor variable domains and ig super family V-like domains. Dlea Camp Irmus!. 27):577. 1133 Lefrae al. 1997, Unique database nmbering system for imm nogeneuic analysis. fmmuno/gV Today. l8-509, [14 Le (1999) The hnmunnolgi, 7132-136. [15S US 3.766162 [16 US 279133 [13US 3,87837 [13) US 4,333 402 [193 US 4,676,980 (203 US94A83175 (21) US 5,595,721 [22] W000/5 2031 {231 WO00i52473 (24) US 4,766,106 [25N US 4,179,337 [261 US -1,495.28$ [27] US 4,609,546 [28) Knnuf c i t(98i B io. Cht em63:15064-15070 [293 Camion at (1982) Uacer Resarch 42:4734 (30) Cafiso (1981) lriohen iopkt Aca649:129 (31) Soka (1980) Ann. fRy iophyz Eng.9:4167 [321 Pornansky eta!. 1980) Drug Dotlsry Syswens (RU .luanu. ed, Oxford, N.Y. pp. 253-315 (333 Puznansky (1984)}Pharm Rev: 36 277 [343 Kohlc, .ad Milstein, C,. 1975, Namre 256:495-497. 45 [33) Ko .,ar t al, 1983.g [361 WQ2090~/6677 [37c (hapk 4 osiernmnnov (thediti 2000; ASIN C71@ 5 [t) Jioe ed anta hag 2003,19!): 163S 391] Co el af Q'otecAnnaoga 20023720 411 UsS ,07415 [42] US 6,300404