SA515360489B1 - Targeting bcl11a distal regulatory elements for fetal hemoglobin reinduction - Google Patents

Abstract

Provided herein are methods and compositions for increasing fetal hemoglobin levels in a cell by disrupting BCL11A expression at the genomic level. Also provided herein are methods and compositions relating to the treatment of hemoglobinopathies by reinduction of fetal hemoglobin levels. Fig. 1

Description

1

SES Distal Regulatory Reinduction of Hemoglobin Induction BCLITA Targeting Elements

Targeting BCL1 1A distal regulatory elements for fetal hemoglobin reinduction Full description Background of the invention In adults, four globin proteins Normal hemoglobin Normal hemoglobin includes beta, including oily alpha (a) proteins, including alpha proteins ol, globin proteins, particularly in mammalian fetal development during mammalian embryonic development. (B) proteins Which includes two human fetal hemoglobin proteins, the fetus produces fetal hemoglobin © 8 - - globin B from two proteins Ya: gamma (y)-globin proteins gamma (la)-globin In the postnatal period, the conversion of globin, referred to as the “transformation of fetal oi globin proteins,” occurs, and at this point, the erythropoietic substances change from predominantly no-globin to predominantly synthesized 8 - globin The evolutionary transition from fetal hemoglobin production begins at about HOA ((X2P2 ((272)l) to adult hemoglobin production or HOF towards dominant or 0 dominant. This produces HDA weeks of gestation and continues for a short period after birth until it becomes YE to YA and an increase of gamma---globin genes shifting primarily from decreased transcription of gamma--globin genes On average, the blood of a normal adult contains beta-globin 98085 transcripts of the remaining 01 bet-globin genes are more variant than HOF although levels of HOF 71 are less than twice that of healthy adults and are genetically controlled. Anemias of genetic origin in which there is decreased production of red blood cells (RBCs) and/or increased damage (hemolysis) of red blood cells. These also include fetal defects that result in the production of abnormal hemoglobin with an impaired ability Some of the disorders listed include a concomitant failure of oxygen to maintain oxygen concentration in adequate amounts, while others involve normal 8. —globin awk 8 production - globin 0 slam 8 failure to produce 8 - globin All natural. These are referred to as protein-related disorders

© Generally by name 8 - Hemoglobinopathy. For example, 8-thalassemia results from a partial defect, or IS, in the expression of the 8-globin gene, which results in a deficiency or absence of HDA. Sickle cell anemia results from a point mutation in the structural 8-globin gene, which results in the production of abnormal sickle ais (HbS) hemoglobin. HBS is susceptible to polymerization, particularly under Jb© deoxygenation conditions. HDS RBCs are more fragile than normal RBCS and undergo pall decay more rapidly, which progressively leads to anemia. chase The search for a treatment aimed at reducing globin chain imbalance in patients with hemoglobinopathy] focuses on pharmacological treatment of hereditary fetal hemoglobin ¢02y2 (persistence fetal HbF). The therapeutic potential of these methods is suggested by observations of type 0 Moderate phenotype for individuals with common genetic traits of heterozygous marine anemia and hereditary persistence of fetal hemoglobin (HPFH) in addition to patients with heterozygous marine anemia who do not produce hemoglobin in adults, but it is noted Low requirement for blood transfusions in the presence of high concentrations of genomic hemoglobin.Furthermore, a certain group of adult Vo patients with B-chain abnormalities have been observed to have normal (Aol) levels of genomic hemoglobin (HF) 16181 has been observed to have a clinical course of milder disease than patients with normal levels of HEF in adults.For example, a group of Saudi patients with Sickle cell anemia and genetically expressing 71-770 of the HOF are only mild clinical manifestations of the disease” et al. (Pembrey). The increased HOF As mentioned above, Sale The conversion from fetal hemoglobin to adult hemoglobin (HDA) continues within six months after birth. However, in the majority of patients with The pre-globin-7 genes are intact and fully functional, so that if these genes are reactivated, functional hemoglobin synthesis can be maintained during puberty, thus

and improve disease severity. inappropriately The in vivo molecular mechanisms underlying globin conversion are poorly understood. Evidence supporting the possibility of (sale) activating gene hemoglobin production comes from experiments showing that peripheral blood; which contains reproductive cells; When given an appropriate combination of growth factors 0, WAL produces erythrocyte-like colonies and flows in semisolid culture. Individual cells in these colonies can accumulate fetal hemoglobin (HDF), adult hemoglobin (HbA), or a combination thereof. in cultures from the blood of adults»; accumulation of nucleated red cells with either (F-A+) HbA only or a combination of HbA; HOF (++]). In a cage fashion the independent colonies contain + cells (Fog which indicates that both types are offspring of the same 0 > circulating stem cells. Thus, during early stages of development in culture, OLE cells are permeated) via mechanisms now known; Whether or not you genetically express HBF. It is clear that the proportion of Ft cells in adults is not preprogrammed in vivo; But it is clearly dependent on culture conditions: (Say) modification of the HBF gene expression pathway and 15/8a; for example (Jill) in vitro by Alle concentrations in serum as a result of the activity of a non-specific compound that can be absorbed on charcoal Overall, the identification of molecules that play a role in transducing gluconeogenesis will be important in developing novel therapeutic strategies that interfere with adult hemoglobin and induce fetal hemoglobin synthesis.These molecules will provide new targets for developing therapeutic interventions for many hemoglobinopathies in which Led reactivates synthesis. GENERAL DESCRIPTION OF THE INVENTION In the present application, methods and compositions of (sa) fetal 8-globin cual levels in a cell are presented by perturbing the expression of 8061118 at the genomic level. Also presented in the present application are methods and formulations related to the treatment of hemoglobinopathy by re-induction of fetal 8-globin levels.

—o—

One of the aspects described in the present application relates to a method for producing a protocell that has reduced expression

For 0088 801118 or protein, the method involves contacting an isolated protocell with a binding agent

The genomic acid “sual DNA of the cell on the chromosome” site

TY AY syphilis (according to UCSC Genome Collection 19 Browser hg)

© human genome), and accordingly reduced mRNA or protein expression of BCL11A

Another aspect described in the present application relates to a method for producing a genetically engineered human cell with modification

At least one gene comprises contact of an isolated cell with an effective amount of a combination comprising at least

Deoxyribo Nucleic acid (DNA) nucleic acid endonuclease targets the endonuclease

Or an expression vector carrying the coding sequence for a DNA-targeting endonuclease, by which 0 DNA-targeting endonuclease cleaves the genomic DNA of the cell at the Y chromosome site

10771/62171574 and causes one genetic modification

least in it.

Also presented in the present application is another isolated genetically engineered human cell with genetic modification

At least one on the chromosome? Website 10077/0117-7507131061894. In one embodiment, at least one genetic modification is a deletion in genomic DNA at the specified location. in one form,

isolated genetically engineered human cell Lil); An engineered human cell

Decreased or lower expression of mRNA or protein than 801118 compared to a non-comparison cell

One genetic modification in the chromosome? SOYTACTI Y= VY TO AR

Another aspect described in the present application relates to the use of an isolated genetically engineered human cell with at least one 0 gene modification in the chromosome? Location 100776517-75697156184 described at

The current application is for the purpose of increasing the levels of fetal hemoglobin 6781a5 in my breasts.

.mammal

Another aspect described in the Mall application concerns the use of an isolated genetically engineered human cell with a modification

At least one gene on a chromosome? The site TH YYACH Y=T0 eV TO AS described in Yo The current order for the treatment of hemoglobinopathy/A051000810A1610009 in breasts.

h —_ _ The aspect of AT described in the present application relates to the use of an isolated genetically engineered human cell with at least one genetic modification in the chromosome? Location 007700117-75071106184 described in the present application for the manufacture of a drug for the treatment of mammary haemoglobinopathy by which fetal hemoglobin levels are increased in breast tissue. © Another aspect described in the application Mall is a composition comprising isolated engineered human cells Us with at least one genetic modification in the chromosome ? Website 10077/117-55067156184. In one embodiment, the composition furthermore includes a pharmaceutically acceptable carrier sabe. Another aspect described in the present application relates to the use of a formulation comprising engineered human WDA Lis isolates having at least one genetic modification in the chromosome ? Website VTA 0778217-56 Yee for the purpose of increasing fetal hemoglobin levels in Tedi. Another aspect described in the present application relates to the use of a formulation comprising engineered human WDA Lis isolates having at least one genetic modification in the chromosome ? Location VTA 0778217-56 The aspect of AT described in the present application relates to the use of a composition comprising isolated Lis 0 engineered human cells having at least one genetic modification in chromosome ? Y = Te VY TOA A drug has been manufactured for the treatment of f hemoglobinopathies in Dede by which IS hemoglobin levels are increased Another aspect described in the present application is a formulation comprising at least a DNA-targeting endonuclease or an expression vector carries the coding sequence for a DNA-targeting endonuclease (0) by which a DNA-targeting endonuclease cleaves the genomic DNA of a human cell in the chromosome? Locus 10077/6117-7507156184 and causing at least one genetic modification at it. In one embodiment, the composition furthermore includes a pharmaceutically acceptable carrier. Another aspect described herein relates to the use of a formulation comprising at least one DNA-targeting endonuclease or an expression vector carrying the coding sequence of a YO-DNA-targeting endonuclease by which a DNA-targeting endonuclease cleaves DNA CAR

to

The genome of a human cell at chromosome 7 at position Y=T0 VV TOA 10077771 and causes modification

At least one gene in it for the purpose of increasing fetal hemoglobin levels in a child.

Another aspect described herein relates to the use of a formulation containing at least an endonuclease

A DNA target or expression vector carrying the coding sequence for an indonuclease targets DNA

© by which an endonuclease DNA cleavage targets the genomic DNA of a human cell in

chromosome? Location 1007776717-76071106184 and causes at least one genetic modification there

For the treatment of hemoglobinopathy in Tedi.

Another aspect described herein relates to the use of a formulation comprising at least an endonuclease

A DNA target or an expression vector carrying the coding sequence for an indonuclease targets DNA Ve, by which an endonuclease targets DNA cleaves the genomic DNA of a human cell in

chromosome? Location 1007776717-76071106184 and causes at least one genetic modification there

To manufacture a drug for the treatment of hemoglobinopathy in gynecomastia by which hemoglobin levels are increased

Embryo in my hand.

In one embodiment, the application (Jal) is presented using an agent that binds the genomic DNA of a cell at the VO chromosome? position 1007780717-75071566184 (according to the UCSC Genome Assembly).

Browser hg 9 human genomic) to increase fetal hemoglobin in breasts or to treat celiac disease.

Mammary hemoglobin or to reduce the expression of mRNA expression or 806111/8, where it decreases

mRNA or protein expression of 86111/8.

In one embodiment, the use of an effective amount of a formulation comprising at least 0 endonuclease targeting DNA or an expression vector carrying the coding sequence for an endonuclease targeting DNA is presented in the present application.

DNA to increase fetal hemoglobin in my breast, or to treat hemoglobinopathies in the breast, or

To reduce the expression of mRNA or 80111/8, an endonuclease that cleaves DNA targets

The cell's genomic DNA is at chromosome ¥ position 100777717-75071501845 and causes modification

At least one gene in it.

CAN

-- In one embodiment, the present application submits the use of an effective amount of a formulation comprising at least a DNA-targeting enzyme or an expression vector carrying the sequence coding for a DNA-targeting enzyme to increase hemoglobin (al) in mammals or to treat hemoglobinopathies In mammals, or to reduce the expression of mRNA or BCL11A, where a DNA-targeting enzyme produces at least one epigenetic modification in the cell's genomic DNA on chromosome 1, and accordingly affects the expression of mRNA or 80178. In one embodiment, at least one epigenetic modification is at position =I AS 7 . In another embodiment, a single epigenetic modification reduces the expression of 0401/8 or the protein BCL1IA. In one embodiment, at least one epigenetic modification affects the cell's genomic DNA on chromosome 1 indirectly or directly at 70071366184- 10727/80219700 for chromosome 7. In one embodiment, the use of any of the cell isolates described in the present application to increase fetal hemoglobin in breasts or to treat hemoglobinopathies in breasts is presented in the present application. In one embodiment, in the present application is presented the use of a formulation comprising engineered human WA Lys isolated to increase fetal hemoglobin in the breast or to treat mammary hemoglobinopathy, where 1 of the cells has at least one genetic modification in the chromosome? Site Y=Te VY TOA lTMT 1 (according to UCSC Genome Assembly 19 Human Genomic Browser hg) performed by lee contacting cells with an effective amount of a formulation comprising at least an endonuclease targeting acid 0118 or an expression vector Carries the coding sequence for a DNA-targeting endonuclease by which a DNA-targeting endonuclease cleaves the cell's genomic DNA in the chromosome *location ToYYACTIY=Te VY TYAY - 0 (according to UCSC Genome Browser hg Collection 19) And it causes at least one genetic modification in it. In one embodiment, the use of a formulation comprising engineered human WA Lys isolated to increase fetal hemoglobin in breasts or to treat mammary haemoglobinopathy, where the cells have at least one epigenetic modification in chromosome 7, is presented in the present application. In the models, one epigenetic modification on at least YO on chromosome 7 is at loci ToeYYACIY=T0 eV TVA (according to the UCSC Genome Browser Assembly hg 9 human genome). In the AT model, only one epigenetic modification is made 1e

at least on chromosome 7 by the process of contacting cells with an active amount of a combination comprising at least one DNA-targeting enzyme or an expression vector carrying the coding sequence for a DNA-targeting enzyme in which a DNA-targeting enzyme produces at least one epigenetic modification In the genomic DNA of a cell at the ¥ chromosome affecting position 00774717-7507156184 (according to © UCSC Genome Browser hg Assembly 19) and occurring there. In one embodiment, the use of any cell isolates described in the present application or any of the combinations described in the present application for the manufacture of a drug to increase fetal hemoglobin in breast dala or for the treatment of hemoglobinopathies in breasts is presented in the present application. Another aspect described herein is a method for increasing fetal hemoglobin levels in a cell, 0 The method includes steps: contacting an isolated cell with an effective amount of a combination comprising at least a DNA-targeting endonuclease or an expression vector carrying the coding sequence for a DNA-targeting endonuclease (Alls DNA by which the endonuclease cleaves DNA targets the genomic DNA of the cell in chromosome 1 site TeeV TAC Y=T0 eV TOA and causes at least one genetic modification in it, by which the expression of fetal hemoglobin increases in Said cell, or its precursor, Vo in relation to the precontact cell The AT side is described in the present application A method for increasing fetal hemoglobin levels in two mammals in need of it The method comprises the steps of contacting an isolated hematopoietic protocell of said mammal with an amount of An active form of a combination comprising at least one DNA-targeting endonuclease or an expression vector carrying the coding sequence for a DNA-targeting endonuclease by which the endonuclease-0 (mes) cleaves the genomic DNA of the cell in the chromosome? TOA 77 and causes At least one genetic modification therein, by which the expression of fetal hemoglobin in said mammal is increased, relative to said precontact expression. Another aspect described in the present submission is a method for increasing fetal hemoglobin levels in two breasts in need of it. The method involves implanting an isolated genetically engineered human cell with at least one YO gene modification in the chromosome? Mammal site ET TAC Y= TeV TO AS.

CAR

I. In one embodiment, this disclosure provides a method for increasing fetal hemoglobin levels in two mammals in need of it, the method includes the steps of providing an isolated pool of hematopoietic progenitor cells or hematopoietic stem cells from the mammal in vivo, and contact A group of hematopoietic progenitor cells or stem cells with an effective amount of composition comprising at least an endonuclease targeting acid 0118 or with which it targets DNA carrying the coding sequence of an endonuclease targeting acid joes vector © 01 Genomics cell on the chromosome? The DNA endonuclease cleaves the DNA site and causes at least one genetic modification therein, by which TYYYA LTS VAS 3 increases expression of fetal mammary hemoglobin, relative to precontact expression. in one embodiment. , This disclosure presents a method to increase the levels of fetal hemoglobin in breasts in need of primary hematopoiesis or stem cells to form WIA, the method includes the steps of isolating a group of 0 blood from the mammal, and touching in vivo a group of primary cells or hematopoietic stem cells, or a DNA expression vector with an effective amount of a combination comprising at least an endonuclease targeting an acid by which an endonuclease targets an acid (Alls DNA carrying the coding sequence of an endonuclease targeting an acid 60, 7176, 1184) The genomic locus 1 of the cell on the DNA chromosome cleaves the DNA and causes at least one genetic modification in it, by which the expression of 10,778,117 NO increases in the fetal mammalian hemoglobin, relative to the expression before contact. In one embodiment, this detection offers a way to increase fetal hemoglobin levels in two breasts in need. E, the method includes steps to provide for the isolation of a group of primary hematopoietic cells or stem cells, 716 680 genomic cells on the chromosome site of hematopoietic DNA from the mammal and delete acid and cause at least one genetic modification in it, by which it increases Expression 117 LYYA 840A-:A,YS of fetal mammary hemoglobin, relative to precontact expression. In one embodiment, this disclosure provides a method for increasing fetal hemoglobin levels in breasts in need of it. The method includes Steps to isolate a group of primary blood-forming cells or stem cells to form the genome of the cells on the chromosome? The site DNA deletes the acid of all blood from the mammal and outside the body and causes at least one genetic modification in it, by which 117 ,7748 ,1:-184 ITT YO increases the expression of fetal hemoglobin in the mammal, relative to the expression before contact.

CAR

-11- In one embodiment, this disclosure presents a method for treating hemoglobinopathy in mammals comprising steps: outside WA hematopoietic stem cells or 105©5: (b) touching WIA (a) providing hematopoietic progenitor cells or in vivo or in vitro with an effective amount of a combination comprising at least an endonuclease that targets DNA or an expression vector carrying the coding sequence of an endonuclease that targets the genomic acid of a cell on the DNA and cleaves the DNA DNA by which it targets an acid endonuclease © and causes at least one genetic modification 778, 117 Tam AL VY chromosome? The site in which fetal hemoglobin expression is increased in the mammal, relative to precontact expression: and (c) given from step (b) in the mammal. In one embodiment, this disclosure provides a method for treating hemoglobinopathies in Mammalian Including steps: From mammals: (b) cells outside the pall contact hematopoietic progenitor cells or Jie-forming stem cells (0) in vivo or in vitro with an effective amount of a formulation comprising at least an endonuclease targeting Which DNA or expression vector carries the coding sequence of an endonuclease that targets the DNA genomic acid of the cell on the DNA and cleaves the DNA by which the endonuclease targets the acid and causes at least one genetic modification Tam 778, 117 AL VY chromosome ?the location by which expression of fetal hemoglobin increases in the mammal, relative to expression before lly in it, VO contact: and (c) giving from step (b) in the mammal. In one embodiment, This disclosure presents a method for the treatment of hemoglobinopathy in mammals comprising the steps of: (b) ex vivo hematopoietic stem SIPSCs or WA (a) provision of hematopoietic precursor cells or

TY Uncle Te AT TT The genome of the cells on the chromosome? patched DNA (a mea deletion causing at least one genetic modification therein, by which expression of fetal hemoglobin 00 in the mammal is increased, relative to precontact expression: and (c) given cells from step (b)) in In one embodiment, this disclosure presents a method for treating hemoglobinopathy in mammals comprising steps: Mammary hematopoietic stem: (b) ex vivo LDA hematopoietic precursor cells or Je (a) TY Uncle Te AT TT The genome of the cells on the chromosome? patchwork DNA (mea deletion) causing at least one genetic modification in it, by which expression of fetal hemoglobin YO is increased in the mammal, relative to precontact expression: and (c) administration from step (b) in the mammal. ,

CAR

_— \ \ _ In an embodiment, this disclosure provides a method for treating hemoglobinopathies in mammals (eg, human) comprising the introduction of a combination described in the present application comprising isolated transgenic cells with at least one genetic modification on the chromosome? site IAT NTT 11" ,74 0 by which expression of fetal hemoglobin is increased in the mammary gland.

human) involving overexpression of fetal hemoglobin in the mammal by the method described in the present application. In one embodiment of this and all other aspects described in the present application, the isolated cell or group of cells is the human cell(s).

0 In one embodiment of this and all other aspects described in the present application, the isolated cell or group of cells is a primary cell(s). In one embodiment of this and all other aspects described in the present application, the human cell is a proto-hematopoietic cell. In one embodiment of this and all other aspects described in the present application, the human cell

VO is an induced pluripotent stem cell. In one embodiment of this and all others described in the present submission, an induced pluripotent stem cell is a hematopoietic progenitor cell. In one embodiment of this and all others described in the present submission, the primary hematopoietic cell is an erythroid ADL cell.

0 In one embodiment of this and all other aspects described in the present application, the original cell is contacted to form blood or is isolated ex vivo, in vitro, or in vivo. In one embodiment of this and all other aspects described in the present application, at least one genetic modification is a deletion.

‎CAR

— \ _ In one embodiment of this and all other aspects described in the present application, the deletion removes the entire interchromosomal region ? LYYA Tam VAS 7/15 Te 117 ,7/15 or removes part of the area resulting in rupture of one or more hypersensitive sites - 1 (DHS)© in another embodiment of this side and all Other aspects described in the present application, the deletion includes one or more of the hypersensitive loci for 1,laa, oot, 0A+,17+ (DHS) DNAse described in the present application in the Examples section. In another embodiment of this and all other aspects described in the present application, the deletion comprises one or more crystal image digitizers of one common oligonucleotide | single nucleotide polymorphism (SNP) | 0 Described in Schedule XY In another embodiment of this aspect and all other aspects described in the present application, the omission includes one or more of the fragments listed in Schedule 7. In another embodiment of this aspect and all other aspects described in the present application, A deletion removes the entire region between chromosome 7 loci LT AG ,715 Te 7748, 117 or part of region 0 resulting in rupture of one or more loci hypersensitive to DNAse 1 (0115). In one embodiment, as used in the present application, the expression “fraction” in the context of a genomic deletion is at least 2/00 of the specified region. In an additional embodiment of any treatment modality, the modality includes chemotherapy ils and/or treatment radiation eles) to remove or reduce progenitor cells or stem cells endogenous to mammary hematopoiesis. In an embodiment of any method, contact cells with at least one genetic modification can HL Lela 335 and stored until the cells are needed for administration into the breast.In an embodiment of any method described, primary cells, hematopoietic stem cells, or cell isolates may be distributed using the IPSCs described in the present application.

_— ¢ \ _ In an embodiment of any method described, primary cells, hematopoietic stem cells, iPSCs, or cell isolates are endogenous to the mammal, which means that the cells are derived from the same mammal. In another embodiment of the method described, primary cells, hematopoietic stem cells, 105605, or isolated cells are non-BE BD to mammalian, which means that the cells are not derived from the same mammal, but from another of the same species. For example, a mammal is a human. In one embodiment of any treatment method, the method also includes selection for a patient in need of increased expression of fetal hemoglobin. In one embodiment of any treatment method, the method also includes selection of two breasts in need of treatment for hemoglobinopathies. 0 In any form of any prescribed treatment method, hemoglobinopathy is 8 - hemoglobinopathy B —hemoglobinopathy . In any form of any prescribed treatment method, the hemoglobinopathy is 8-thalassemia. Figure 1a presents the distribution of the 776+ SNPs previously reported to be associated with erythroid-like traits at 801 X > 5 P with respect to the enhancer, related to exon0016*©, related to intronic 1477 no, and intergenic sequences. The genomic distribution | 0 for these regions is shown. Figure 1b Graph plots the cumulative distance distribution of 163,706 SNPs associated with erythroid-like traits relative to the nearest erythroid-like enhancer. Sequences of over ?kb from 1958 genes annotated by Refseq CAR yoo, no H3K9ac, or H3K27ac, either H3K4mel, presence, DNase hypersensitivity | cohort of 176 randomized 50 l SD + 13/270163. Altered H3K4me3 mean distance (GWAS) has been associated with globular-like traits. Selection (from a database of SNPs of non-random species as well. SNPs for genotyping, or Affy 6.0 from a SNPS array plotted followed by comprehensively parallel sequencing performed with ChIP genotypes Fig. no.? a shows © H3K4me3 (H3K27me3) erythroblasts derived from 0034+ cells with anti-nuclear antibodies isolated from globulins L Poll 5, TALI “GATAL (H3K27ac (H3K4mel) so that the DNase loci | Erythroid, fetal brain, and 8- and 1-lymphocytes subjected to FIDF treatment that associated with fission SNPS were identified by comprehensively parallel sequencing work. Those with the highest SNPs include guarding 8-01 x 0 > © at F sae or FIDF cells associated with a level 0 contiguous spherule-like DHS given. Three GWAS are encoded in F correlation with 05a or cell number 86111/8 TSS and 0+e based on distance in kB from 67+, 0A+b DHS red 8611178 Fig. B. 6010-9008 presents major human erythropoietic substances at shaded. TY of Figure 00+, 0A+, 17+, DHS inserted chromatin. 71 for Lida intron-7, assay.

LCR HS3 and positive comparator loci (0-globin (GAPDH, OCT4) enrichment at negative comparator Vo are shown for comparison. HS=40 and alpha-globin Fig. of primary human erythroblasts using promoter 8011178 as fixative Reaction frequency calibrated according to BCLIIA reaction across locus LCR-HBB displays anonymous healthy donors from whom IV-forming stem cells/progenitor cells were available Figure 0 blood Genotyping was performed at 181427407 to distinguish heterozygous individuals Five donors were identified Hematopoietic stem cells/primary cells were subjected to colony spheroid differentiation

TALL red. Chromatin was isolated from erythroblasts, immunoprecipitated with 687781 or accessed to a thermal sequencing reaction to quantify relative abundance DNA or ChIP DNA subjecting rs 1427407 G lil Yo

CAR

_ a \ _ Figure No. "b presents data from anonymous healthy donors who had stem cells / primary hematopoietic cells available, for which genotyping was performed at, rsT606173 rsl427407 5 57569946 to distinguish individuals heterozygous Lill al-Qazdani rs1427407-rsT606173 So 157569946 three donors were identified. (asl bill) revealed that the ©57569946 allele “was on the same chromosome as the ©G allele 51427407 and the ©157606173 allele in each. Hematopoietic stem/progenitor cells were subjected to erythroid-like differentiation colony Genomic DNA and RNA were isolated, and cDNA was produced by reverse transcription. Displays the mean HDF for haplotypes 151427407-57606173 in the lS statistic selection.

CSSCD 0 Mean HbF Level 74.05 (3.10 50) in YAY individual rsl427407-6-6 7606173y,11018 (4.50 50) in rs1427407-rs7606173 T-G/G-T Yet heterozygous, 711, 71 (4.37 (SD) in 60 individuals 7-6 rsl427407-rsT606173. Symmetric values for © 1 single-student tests. Haplotype frequencies in CSSCD are: TG : TC , deaf GC AA 66 01 Vo fig. a- z showing data from the 1-KB fragment of 8011178 intron-? comprising 01155 +57 +/e 0045 (comprising +0 £- 0Y, 14 kb of TSS transcribed prior to 15068 minimal promoter and sum gene 862 surrounded by 119 insulator elements. Transient Lis-modified mouse embryos were born by nuclear injection at the one-cell stage. Figure 1 showing a mutant embryo Wis transient E12.5 stained with X-gal 0 Fig. b shows WIA suspensions isolated from peripheral blood and fetal liver from fixed Lis 12.5 transgenic embryos. Figure C shows data from bone marrow erythroblasts (CDT71+/Terl 19+) and splenic lymphocytes (19 000+ L8-cells). Lymphocyte 5+CD3L1-lymphocytes) that were isolated and sorted from fixed transgenic transgenics from young adults. Cells were subjected to X-gal staining or CAR dye

l \ — RNA followed by RT-qPCR. Gene expression was assayed according to 5/0011, and shown for 1-lymphocytes, which express neither BCL11A nor 862a1. Figures zo-lo showing mouse erythroleukemia Lally (MEL) cells and B= allergen lymphocytes transfected with two pairs of TALENS each designed to generate 058 on either end at the ortho site 01 kb 801117 enhancer intron-7 erythroid-like from +10.44-55.4 kb. Clones (termed AS50.4-60.4) were isolated using a deletion of the β allele of a 01 kb section. Fig. fo shows 1-0068 ports of Bell la with primer pairs recognizing pre-sequences , stretching, and after ARTS Ve Fig. No. Bear displays an immunoblot of 850.4-60.4 with anti-BCL 11 A. Fig. No. 0c shows globin gene expression in AS50.4-60.4 MEL clones. The oP globulins of adults P2 and mother are shared, while independent primers recognize fetal PHI sy oP globulins. , 15 at 512.5.The embryos were phenotypically smeared by PCR 1862. A fraction of transgenic embryos was shown by X-gal staining of fetal liver aus. One to two kb sequence fragments cloned into a TKS enhancer construct of a minimal .GFP enhancer The enhancer sum constructs were transfected with lentiviral expression vectors into primary human erythropoietic subjects Selection of infected cells with puromycin resistance. s YAS Mean Intensity GFP Fluorescence Intensity Figure A presents Blan data by characterizing mouse chromatin properties of erythrocyte-like cells revealing a similar enhancer signature at the locus ortho-18 at Bell-intron. Mouse smears obtained from a previously published total chromatin characterization of HU-like erythrocytes, with histone modifications and DNase-γ cleavage from GATAL and from TALI 0010-5680.

m \ — dotted rectangle connecting a similar enhancer fingerprint at the ortho locus identifies a 50.4-60.4 m element targeted for a Lat1-mediated deletion. Fig. 19 Jag. Schematic of the 1/81-1-mediated genome engineering strategy used in the present submission. They represent 181,115 sequence-specific nuclease enzymes. Two pairs of TALENS© were genetically engineered to generate double strand breaks, one at 50.4+ Bell la and the other at Set. Progeny with two DSBSs were isolated by NFFEJ calling cross section 01. kilobytes. The clones were examined by PCR with the prefixes '©', '', and the 46-01 internal and extended deletions. Figure 8 shows a Southern blot of genomic DNA digested with 11100111 from clones -50.4m4, which confirmed that these clones had predicted the excision allele and lacked the non-extracting allele. 0 Figure 01 presents Sanger sequencing work of PCR products from clones 50.4–60.4. The sequences “V5 (00,64) To (+10) are shown , 4) left and right to identify TALEN with interfering spacers. Some alleles showed evidence of binding directly at the tip of each digested divergent sequence, while other alleles showed the loss of hundreds of additional nucleotides. Only one allele was isolated for each of clone #1 MEL and proclone #2 P V0 Figure 11 presents genotype data obtained in 1,178 individuals from 055600 for YA as a contrast Within 861118 +17, +8/e or +5 .DHSs the most significant associations are consistent with a higher degree of [0]7a7 level between SNPs (MAF) > 1 (p = (V+) before (rs1427407) or After (rs7606173) conditional analysis of SNP .00551427407 for chromosome ?, buildingl9 Fig. 11a presents genotype data obtained for lee in 1,178 individuals from 05500 for YA Yo as an intravariant. 861118 +17, oA+ or +5 DHSs. Most significant associations are consistent with the highest degree of [0]7 [0] between SNPs (MAF) (p = (V+) > 1) before (rs1427407) or

After (rs7606173) conditional analysis of SNP .00551427407 for chromosome ?, buildingl9 Fig. 11b analyzes linkage of 107 at /806111. Genotype data obtained on 1,178 individuals from 65560 YA displays a variant within 861118 +17, of oA+ +00

.DHSs vo

E1

q —_ \_ The sentinel SNPs are those with the highest association with the HOF level or pre-GWAS iF cell number L(V Y-V) These SNPS are illustrated for BCLIIA intron- ? With the statement 01155 yen +17, + / e 4 +00 . Detailed Description: © The methods and constructs described in the present submission relate, in part, to the discovery of a distal regulatory region prior to the 118a80 gene that could regulate the expression of the 8011178 protein. The 8011178 protein acts as a stage-specific regulator of fetal hemoglobin expression by suppressing La-globin induction. In this way, the methods and structures presented in the present application are novel methods for regulating expression of globin-LA in erythroid-like cells. More specifically, these activities could be combined into methods for treating M-0 hemoglobinopathy by inducing no-globin by inhibiting the BCLIIA gene product. In one embodiment, a method for producing an isolated progenitor cell with low expression of BCL1IIA mRNA or protein, the method involves contacting an isolated primary cell with a DNA-binding agent (the cell's genomic mea on chromosome ?Location IY, 7748 Tem A TT (according to 19 UCSC Genome Browser hg Human Genome Collection), and accordingly reduced expression of BCL1 1A 1 5 or a protein mRNA In one embodiment, in the present application, a method for producing isolated progenitor cell with low expression of mRNA 801118 or protein is presented, the method includes provision of isolated progenitor cell and contact The primary cell isolated with a factor that binds the cell's genomic DNA to the chromosome ?IVT site, as tyy (according to 19 UCSC Genome Browser hg Human Genome Collection), Yo and accordingly reduced the expression of BCL1 1A or mRNA protein In one embodiment, in the present submission a method for producing primary cell isolates with low expression of mRNA 80 is presented. 1118 or protein, the method involves contacting an isolated primary cell with a binding agent to cause an epigenetic modification of the cell's genomic DNA on the chromosome? Accordingly, reduced expression of /80111 or mRNA protein. In one embodiment, the epigenetic modification is in the CAR

11

UCSC (according to 117,778 Tem A IT Te genomic at chromosome? loci DNA human genome asin Genome Browser set hg 19 In one embodiment, a method for producing a progenitor cell is presented in the present application isolates characterized by low expression or protein, the method includes provision of an isolated primary cell and cell contacts of 801118 mRNA from the genomic cell of the cell on chromosome? The isolated primary DNA with an agent that produces an epigenetic modification in the © acid in one embodiment, The modification is .mRNA or BCLIIA protein and accordingly reduced expression of .mRNA

TAY Tem A YT Te cell of chromosome 1 genomics at the epigenetic DNA site in the DNA of a human genome assembly). UCSC Genome Browser hg 19 (according to the disclosure described in the present application, in a preferred embodiment , is not related to the cloning of human beings, operations to modify the genetic identity of the germline of human beings, uses of human embryos 0 for industrial or commercial purposes or operations to modify the genetic identity of animals that are likely to make them suffer without any essential medical benefit to humans or animals , as well as the organisms resulting from such processes. One aspect described in the present application relates to a method for producing an isolated genetically engineered human cell characterized by at least one genetic modification involving cell contact with an effective amount of at least one combination or expression vector It carries the coding sequence of a DNA endonuclease on an endonuclease targeting acid 0

DNA and cleaves DNA, by means of which the endonuclease targets DNA.

UCSC (according to Te 7136, 10-184, 10,778 11 The genome of the cell on the chromosome? locus human genome set) and causes at least one genetic modification in it. Genome Browser hg 9 Another aspect presented in The current demand is for a way to increase fetal hemoglobin levels in a cell or protein expression in a cell. In 801118 mRNA isolates, the method involves reduction of Yo or protein by and induced by 801118 mRNA. At least one DNA locus at UCSC Genome Browser hg 19 DNA loci (according to TYY of Atamegala, LY or protein by 801118 human mRNA). On the other hand, the reduction of the expression of the genomic 1 of the cell is achieved on the DNA chromosome and causes at least one genetic modification at the YO yy acid resulting in an epigenetic modification of the genetic function at 10-184, 10-184, 778, 117 VT , 10 site In this aspect, enhancer activity is reduced. 117,774 Tem A YY chromosome? Location by IY LYYA 1-184 VY Te 7 located within the location of this chromosome 861118 or expression of 801118 mRNA reduction in this aspect, the effectiveness of the enhancer in improving less, at least 770 less, 7710 Less, at least 701 Protein in the cell is at least 75 less Less, at least .75 Less, at least 7760 Less, at least 79760 Less, at least Zee Less, at least 790 less, at least 1-fold less, at least 1-fold less, at least 0 some-0001 times less, at least 001 times less, at least 01 less, at least some-0 Less, or more, compared to a comparison cell that was not processed in any way disclosed in the present application. Or protein expression in the cell Protein expression 801118 mRNA mean reduction 0 Less, at least 7780 Less, 7718 Less, at least 701 at least Te is less than, at least .75 less, at least 7760 less, at least 79760 less, at least 7400 less, at least least 790 less, at least 1-fold less, at least 1-fold less, at least 0 some-0001 JY) twice less, at 001 z Less, at least 01 less, at least ano in the current application. lee less, or more compared to a comparison cell not processed in any way disclosed 10 Another aspect introduced in the current application relates to a way to increase Fetal Hemoglobin Levels in an Isolated 8061118 mRNA Cell The method includes provision of a human cell or primary cell isolate and reduction of the protein in the cell. cell, The method includes steps: _Contact an isolated human cell with an effective amount of a formulation comprising Yo or an expression vector carrying the coding sequence of a DNA-less endonuclease on an acid-targeted endonuclease

DNA cleaves DNA by means of which the Ally DNA targets acid endonuclease 0656 (according to 11,778,10-184,VT 60,11 genomes of a cell on chromosome ?location is a human genome set) and causes At least one genetic modification in it, Genome Browser hg 9, by which the expression of fetal hemoglobin in the cell, or its progenitor, is increased relative to the pre-contact YO cell.

Another aspect presented in the present application relates to a method for increasing fetal hemoglobin levels in a cell. The method includes the steps of providing a human cell or progenitor cell isolate, contacting a human cell or progenitor cell isolate with an effective amount of a formulation comprising at least an endonuclease targeting acid 0108 or A vector expressing Jang the coding sequence of a DNA-targeting endonuclease by which the endonuclease © targets DNA and cleave the cell's genomic DNA on the chromosome? Locus 01, LY of the Ampegala receptacle, TYY (according to 19 UCSC Genome Browser hg human genome set) and causes at least one genetic modification therein, by which it increases the expression of fetal hemoglobin in the cell, or its progenitor, relative to the cell before contact. Another aspect described in the present submission relates to a method for increasing fetal hemoglobin levels in mammals 0 in need of it, the method involving reduction of mRNA 8011/8 or protein expression in a mammalian hematopoietic progenitor cell. In one aspect, reduction of expression of mRNA 861118 or protein is achieved by and causes at least one genetic modification at the cell's genomic DNA on the chromosome? Locus 66 VTA, T= AG VAT 117 (according to UCSC Genome Browser hg 9 human genome set). On the other hand, reduction of expression of BCLIIA mRNA 1 or protein is achieved by and causes at least one epigenetic modification at the cell's genomic DNA on chromosome ?. In another aspect, the reduction of expression of mRNA 861118 or protein is achieved by and causes at least one epigenetic modification at the cell's genomic DNA on chromosome > TAS YY TT site XLA 117. Another aspect described in the present application relates to the method To increase levels of fetal hemoglobin in mammals 0 in need of it, the method involves feeding a human cell or a mammalian progenitor cell and reducing mRNA 801118 or protein expression in the cell. In one aspect, the Lad method involves selecting two mammals in need of increased fetal hemoglobin levels. Another aspect described in the present submission relates to a method for increasing fetal hemoglobin levels in two mammals in need of it, the method includes hematopoietic proto-cell contact steps in (til) with an effective amount YO of a formulation comprising at least one DNA-targeting endonuclease Or an expression vector carrying the coding sequence of a DNA-targeting endonuclease with which the endonuclease targets a DNA-targeting CAR

Ad — \ — and cleaves the cell's genomic DNA on the chromosome? locus 0, YA TIAL YT 17 (according to 19 UCSC Genome Browser hg human genome set) and causes at least one genetic modification in it, by which expression of fetal hemoglobin in mammals is increased, relative to precontact expression. © Aspect AT described in the present application relates to a method for increasing fetal hemoglobin levels in mammals in need of it, the method includes the steps of providing an isolated human cell, progenitor cell, or primary LDA isolate group to form a pall of the cell-contact mammals human, progenitor cell or pal-forming progenitor cell with an effective amount of combination comprising at least a DNA-targeting endonuclease or an expression vector carrying the coding sequence of a DNA-targeting endonuclease with which 0 endonuclease targets DNA The genomic DNA of the cell is bisected on the chromosome. Locus 01, LY of the Atambagala sucker, TYY (according to 19 UCSC Genome Browser hg human genome set) and causes at least one genetic modification therein, by which expression of fetal hemoglobin is increased in ail) mentioned , with respect to the expression before contact. Another aspect presented in the present application relates to a method for increasing fetal hemoglobin levels in two breasts of Vo in need of it, the method involving transplantation of a genetically engineered human cell as described in the present application in the submission. In one embodiment of this and all other aspects described in the present application, the method also includes provision of an isolated cell, an isolated progenitor cell, or an isolated group of cells which may be a progenitor cell or a hematopoietic progenitor cell. In one embodiment of this and all other aspects described in the present application, an isolated progenitor cell is an isolated progenitor cell .isolated progenitor cell In an embodiment of this and all other aspects described in the present application, an isolated progenitor cell is an isolated human cell .isolated human cell In one embodiment of this and all others described in the present application, the isolated human YO cell is a progenitor hematopoietic cell.

_ \ ¢ —_ In the AT model of this and all sides (AY) described in the present application, the hematopoietic cell is a cell of the erythroid race. Je primary cell hematopoiesis methods are well known in the art, eg, by flow cytometry purification of CD34+ or 00133+ cells, microbeads conjugated with antibodies against CD34 or CD133, primary cell markers. Composition © blood. Commercial kits are also available, for example, MACS® Technology CD34

STEMCELL™ Technology Human, 21034 Human MultiSort Kit, and MicroBead Kit . 501100009801 Kit Hematopoietic Progenitor Cell EasySep™ Mouse In another embodiment of this and all other aspects described in the present application, the human cell is an induced pluripotent stem cell (IPSC) 0 in another embodiment of This and all other aspects described in the present application, any cell contact described in the present application can be ex vivo, in vitro, or in vivo. Any cell described herein has contact with a factor that binds the cell's genomic DNA on the Y chromosome and an epigenetic modification occurs in the genome of the cell on the Y chromosome, accordingly Vo reduced the expression of 806111 or the mRNA protein. In one embodiment, the epigenetic modification on chromosome 7 locus TYY LVYALT- YA (according to UCSC Genome Browser hg 9 Human Genome Collection). In one embodiment of this and all other aspects described in the present application, at least one epigenetic modification in the genomic DNA of a cell on chromosome 1 indirectly or .1 of chromosome 117,748 STA YT Te Directly Affects Location Ye ,1 0-1894 YT Te According to its use in the current application, 'Indirectly Affects Location'

"DNA of chromosome 7" refers to the effects of long distance on an epigenetic modification of 117,774 TYY DNA of a cell's genomic TYY on the chromosome of this locus during virginal chromatosis in a further embodiment of this aspect and all other aspects described in the application. The current, any Yo cell contact described in the present application includes contact with an agent that binds the cell's genomic DNA CAR

A / _ on the chromosome? Location VAT, 0-184 1, 72748, 117 (according to UCSC Genome Browser hg 9 human genome set), epigenetic modification occurs on chromosome 1, and accordingly in another model of this and all aspects Other than that described in the present application, the contact of any © cell described herein includes contact with an effective amount of a composition comprising at least a DNA-targeting enzyme or a BU expression carrying the coding sequence for an enzyme that targets DNA-All by which the enzyme that targets DNA causing an epigenetic modification on chromosome 1, and accordingly in another embodiment of this and all other aspects described in the present application, contact with any 0 cell described in the present application involves contact with an effective quantity Which combination includes at least one DNA-targeting enzyme or a BU expression carrying the coding sequence for a DNA-targeting enzyme by which the DNA-targeting enzyme occurs epigenetic modification on a chromosome? The Maltalla locus of Impegalla, TYY (according to UCSC Genome Browser hg 19 J human genome set) and accordingly reduced expression of BCLIIA or mRNA protein. In one aspect, VO increases expression of fetal hemoglobin in the mammal, relative to precontact expression. In another embodiment of this aspect and all other aspects described in the present application, the original cell is brought into contact to form blood, the isolated human cell, or a cell isolated ex vivo or in vitro In another embodiment of this aspect and all other aspects described in the present application, the modification is Yo has at least one gene deleted. In another embodiment of this and all other aspects described in the present submission, at least one epigenetic modification is present. In further embodiment of this and all other aspects described in the present application, the deletion includes one or more sites hypersensitive to 1,0A+,17+ (DHS) DNAse ,+00 as described in the present application in the Examples section. In another embodiment of this and all other YO aspects described in the present application, the deletion consists primarily of one or more CAR hyperlocal sites

Cyne as described in the present order in section 17+, 0A+, 0045 (DHS) DNAse 1 sensitivity to

DNAse 1 examples. In another embodiment, the deletion consists of one or more sites hypersensitive to, as described in the present application in the Examples section. The present, hypersensitive sites genetic modification includes or affects one or more © hypersensitive sites as described in the present application in the Examples section. In accordance with 0045 0A+ ,17+ (DHS) DNAse 1 for use in the present application, the phrase 'affects one or more sites hypersensitive to

DNAse 1 means that the normal function of these DNAse 1 hypersensitive sites is reduced eg, access to transcription factors or degradation enzymes, 00+, 0A+, 17+ (DHS) are (DHSs) DNase In general, loci are hypersensitive to .001856 | Ji malala in these .DNase DNases that are sensitive to cleavage by the chromatin enzyme regions of chromatin making DNA specific regions of the genome. chromatin lost its condensed structure, revealing acid

Jie for degradation by enzymes; accessible DNA. These accessible regions of chromatin are functionally associated with transcriptional activity; Given. DNase because this remodeled state is required for the binding of proteins such as transcription factors. As such, the expected epigenetic modification in the current demand entails reduced access to fewer enzymes, 7710 fewer, at least 701 being at least 75% less DNA degradation, at least 7460 less, at least .75 less, at least 7760 less, at least 7700 at least -1 less, at least 1-fold less, at least Za less, at least TA less, At least 70-fold less, 100-fold less, At least 10-fold less, At least 0-fold less, At least Ye At least 1,000-fold less, or more, than an unprocessed comparison cell in Any variant disclosed in the present request. In another embodiment of this aspect and all other aspects described in the present request, the deletion described in Table 7. In another embodiment of this SNP markers includes one or more of Aspect Markers and all other facets described in the present application, the deletion consists primarily of one or Yo of this aspect and all HAT facets described in Table 7. In a sample SNP more than one Markers

CAR yy Described Other SNP Described in the present application, the deletion consists of one or more digits of 7. In the table In another embodiment of this aspect and all other aspects described in the present application, the modification is not Described in the table 7. According to a genetic SNP that includes or affects one or more markers, the phrase 'affects one or more markers' for use in the current application means that the SNP 'affects one or more of the markers'. SNPS transcription factors Reduction of the normal function(s) of these SNPs leads to reduced binding of these SNPs to methylation For example, methylation can induce .mRNA transcription factors, leading to reduced expression of /80111 or a protein in another embodiment of this aspect and all other aspects described in the present application, the deletion in another embodiment of this aspect and all of .17 includes one or more of the fragments listed in Table 0 other aspects described in the application present, the deletion consists essentially of one or more of in another form this aspect and all other aspects described. Model 17. In the present application, the deletion consists of one or more of the fragments listed in Table 01, other than this aspect and all other aspects described in the present application, the deletion is from

YY Te gma, AY except Te VAT VT Te from 778 Te to Ye from 10, 5,777 » to +1 1/14 Te from 11 to Te from YY YA LT to 7 to PM 7132 111.01 Ala, from 0 to AVY except Te from 0, 6 VYY

IVA FHD to Net TY Te oe, AAR TYE Te 1 H to 177 ST “from TVA from SAA LYYY Te to 11 YY), 10 ceo TLV, 10 to 779 VY Te From YY 1,0a ge, Yo VE 0 th to VY 10,ee, EY) VY 0 yala to Th Yo

AYN 1 or from ED1, SAY 0, from Na Tam 8 to VER Te A to EA

LOOT em Te to 4 in another form of this aspect and all other aspects described in the present application, Amendment

7. Epigenetic Lay includes or affects one or more of the fragments listed in Schedule 7 'Used in the present application, the phrase 'affects one or more of the fragments listed in Schedule 5' means that the function(s) is reduced Natural for these fragments, for example, access to

CAR yA transcription factors. For example, methylation of these fragments can reduce binding factors. mRNA or BCL11A protein transcription, leading to reduced expression of In another model of this and all other aspects described in the present submission, the modification is

IIE Te to VAT YT Te from 78, 117 LT Non-genetic from 184,716,360 to

See TYNE Te to 7756 VY Te Rachela, 117 , from 1 of 10, 77L, 347 to AY. 8

Cle, from YAY, 777 160 to 9 VY 4,10 from 84/77 Te y, "ATS to 171, 011, from 1483 TY ET to OFT 177, 01 ae , “YY TYAS to 12 , to 711 VY) 10 from , oT Te to 1, 1/Te from 174 LT, YY 5 to , a to YO VY Te Nimr, Ka 1, 2771, 0 to YA” except 4.01 from 0, 77/77, 90A

AYY Te From 875,10 8 to 7/44 Te .No, From 60 to 2 to Ys

LOOT M Te lam Faddh to JT or from 101 , in another form of this and all other aspects described in the present application, removes the omission or removes part of the area 7748 , 117 LT AG , 715 Te The entire region between chromosome 7 loci

La, (DHS) DNAse 1 resulting in rupture of one or more hypersensitive sites for For use in the present application, the expression 'tearing' indicates a reduction in transcript 861118 similar 05

DNAse - by erythrocytes in a cell that has ruptured one or more hypersensitive sites

Ste at least ve at least ZY at least (eg, at least 70 by at least 1 Za at least ZA at least Tye at least eT at least 0.75 (ie, no detectable erythrocyte-like transcription) 7000 at least 794 or even 700 compared to a cell without such rupture. In one embodiment, the rupture involves the inability of the Yo-modifier position

GATAL to bind to its native transcription factors (eg, DNAse-1 hypersensitive to TALI) in another model of this and all other aspects described in the present submission, epigenetic modification that interferes with formation and/or maintenance On the epigenetic footprint at the Mohsen Ali area

UCSC Genome Browser (According to TYY LVYALT— YA Chromosome 7 Location, Uncle Yo

CAR

hg 9 human genome assembly) and accordingly lead to decreased expression of 80111 or mRNA protein, and increased expression of fetal hemoglobin in mammals. In one embodiment of this and all other aspects described in the present application, an epigenetic modification that interferes with the formation and/or maintenance of an epigenetic imprint at the enhancer region on chromosome 7 fo locus, except for TYY LVYALT- YA (according to UCSC Genome Browser hg 19 human genome assembly) including but not limited to epigenetic modifications that affect the sensitivity of | DNase, epigenetic modifications affecting histone modifications, epigenetic modifications affecting GATAL/TALL binding, and epigenetic modifications affecting long-term enhancer interaction of the BCL11A promoter. For example, epigenetic modification that interferes with formation and/or Or preserving the epigenetic imprint at the enhancer region on the chromosome? The site Tem VA YT Te 774, 117 includes but is not limited to at least one intrachromosomal deletion? Site 60, 715, -184 LTS 1, 117 so that the overall function of this region is affected by which the expression of mRNA or 801118 is reduced or reduced. For example, the deletion is at DNAsel sensitivity regions 0 The yo chromosome Location Tam VAS VY Te 774, 117, for example, +17, L005 0A The deletion can be at +67 or + 88, cod, or a combination thereof. For example, at +17 and at +00 +17 +00 or at all three of +17, OM 5 +00 as another example, an epigenetic modification that interferes with the formation and/or maintenance of an epigenetic imprint at the enhancer region on the chromosome ? The site Tm YA YT Te 7748, 117 includes, but is not limited to, 0 changes in modifications of histones on the chromosome? Which is not at position 01 LYALL TSA 7 117 or changes in modifications of histones on the chromosome? At locus D only, LYALL TAG 117, or each of the histone modifications on the chromosome? Not at site 10, YT 184-:1, 774, 117 and also at site LT SIAL TT Khala 01 so that the overall function of this region is affected by which the expression of mRNA Yo or .BCL1IA CAR

=« So in another model, the epigenetic modification that interferes with the formation and/or maintenance of the epigenetic imprint at the enhancer region on the chromosome? Tem VA YT Te 774, 117 includes, but is not limited to, an insertion of at least one repressor-specific genetically engineered sequence that alters the epigenetic features of non-coding elements at the chromosome? YA LTA TT site © 117 and consequently suppression of target gene expression. The focus of the first is on any specificity on individual enhancers of suppression in a non-genetic manner. In other words; The introduction of genetically engineered repressor-specific sequences into chromosome 7 could result in predictable interference with the modification of the 80111/8 gene. Vo Any methods known in the art can be used to produce the expected epigenetic modification. For example, as described in 2013, Mendenhall E.

M. et al., Nat.

Biotechnol. 06 September and 2013 2013. Maeder ML et al., Nat Biotechnol. 09 October In one embodiment of this and all other aspects described in the present application, insertion of at least one engineered suppressor-defined sequence at any chromosome site? Vo leads to, but is not limited to, DNAsel desensitized regions on the chromosome “for position 01, , C1, 117 YYA, eg, +17, 0A+, +00 increased histone modifications on the chromosome ? For LVYA locus 1, 184 VAT Te 117: And low transcription factors bind to 1 to the enhancer region on the chromosome? The TT locus has suppressed POY LYYA and reduced or impaired interaction between chromosome 7 of the Tam YA YT locus 274, 117 with the BCL11A 00 promoter. In an embodiment of this and all other aspects described in the present submission, the overall effects of insertion of a genetically engineered suppressor-specific sequence at least one on any Y chromosome site would be low or lower expression of mRNA and BCL 1 1A . In some models, according to what is used in the context of mRNA and expression of /80111, the interaction between the YO chromosome? For Site VYA ,1:-144 WT, 117 or Enhanced 8061118 with CAR Booster

1 for enhancer region, expression 'low' or GATAL/TALL, transcription factors that are associated with , 86118 less, at least 770 less, at least 701 indicates at least 75 less mead less, ye less, at least 700 less, at least Tee less, at least Zee less, at least less, at least 7960 less, at least 1-times less, at least 7"-times less, TA is at least two-fold lower, at least 100-fold lower, at least 01-at least 50-fold lower, at least 5-fold lower, or more compared to the comparative situation which would be in the absence of epigenetic modification or Vd-0 861118 | Entering the genetically engineered sequences in the current request. What is meant by a reduction or protein expression in the cell means that protein expression is 75% lower on less mRNA, on Zee less, at least 770 less, at least 7710 less, at least 701 less than at least

Za less, at least TA at least 750 less, at least 700 less, at least 770 less, at least Ys less, at least 1-twice less, at least 1-twice less, at least -- twice less , at least 0-fold less, at least 1,000-fold less, or more compared to a cell 001-fold less, at least 0 in a comparison that does not feature epigenetic modification or insertion of genetically engineered sequences in the present application. Forms from this aspect and all other aspects described in the present application, entry occurs

DNasel suppressor-specific sequence engineered at least one within the susceptibility regions of 1 00+ 5 OA, 17+ eg, 117, VTA Tem VAS VY TT of the chromosome? Location or +58 or +1 YY or at the oot or +oA terminal The entry can be at the #' terminal +67 or +250, or between +00 and +17. OAF Between OAs 7+ or between 00+ in one of the forms from this aspect and all other aspects described in the present application, alter an entry

DNasel quencher-defined sequence treated with leaf geometry and at least one of the regions sensitive to Yo

SY scraped off the cell VT Te of the chromosome > location in one embodiment of this aspect and all other aspects described in the present application, alterations change

SOY suppressed cells YY Te chromosome position 1 DNAsel epigenetic regions of susceptibility to In one embodiment of this and all other aspects described in the present application, alterations alter 117 cells LT AG YT Te epigenetic alterations histones on the chromosome > for the patchwork YO

CAR

_— \ If in one embodiment of this and all other aspects described in the present application, insertion of an engineered suppressor-defined sequence alters at least one modification of histones on the Y chromosome of the LTA VT LT patch during the CY genus in one of the embodiments In this and all other aspects described in the present application, the epigenetic modifications (GATAL/TALL Lis) alter the _enhancer region on the chromosome? For site -184, 7156 Te IY, 1 LTS so that the overall function of this region is affected by which the expression of mRNA or 861118 is reduced or reduced. For example, transcription factors bind to 687781/1/811. In an embodiment of this and all other aspects described in the present submission, insertion of at least one engineered suppressor-defined sequence occurs within GATAL/TALL according to the Yo described in the present submission. The entry can be at the #' terminal or the Y terminal '67/81 or 1/1 . The entry could be between 687/81 TALL; the entry alters the binding of 6/81781/1/811 to the enhancer region on chromosome ¥ to locus 72748, 117 LTA TT so that the overall function of this region is affected by which the expression of mRNA is reduced or decreased or 80611178. For example, transcription factors bind to 7/81/1/11m/6. Vo In one embodiment of this and all other aspects described in the present submission, epigenetic modification alters the interaction between enhancer 861118 and enhancer 801118 . In one embodiment, the interaction is reduced or impaired so that the overall function of this region is affected by which the expression of the BCL11A mRNA is reduced or reduced. In one embodiment of this and all other aspects described in the present submission, epigenetic modifications alter the interaction between the chromosome? For position 60, 715, Tem AG 7748, 117 with reinforcement 861118 . In one embodiment, the interaction is reduced or impaired so that the overall function of this region is affected by which the expression of mRNA or 801118 is reduced. Also, in the present application, an isolated Uy engineered human cell characterized by at least one genetic modification on the chromosome ? Locator Tem) A TT 7748, 117 (according to UCSC Genome Browser hg 19 Yo Human Genome Collection) made by lee cell contact with the amount of CAR

An effective combination of at least one DNA-targeting endonuclease or an expression vector carrying the coding sequence of a DNA-targeting endonuclease by which the DNA-targeting endonuclease cleave the cell's genomic DNA on a chromosome? It has a locus CIAL YT Te 74,117 and causes at least one genetic modification there. In one embodiment of this and all other aspects described in the present application, the human cell

The genetically engineered isolate characterized by at least one epigenetic modification at the genomic DNA of the cell on chromosome 7. In one aspect of this and all other aspects described in the present application, the genetically engineered human cell is isolated characterized by at least one epigenetic modification at the genomic DNA of the cell on chromosome 7. The cell's genomic DNA on the chromosome at the site VY states a plural JUYY

0 In some aspect of any of these isolated genetically engineered human cells characterized by at least one epigenetic modification, the cells are transplanted into my breast for use in increasing fetal mammary hemoglobin. In one embodiment of this and all other aspects described in the present application, a genetically engineered human cell isolate characterized by at least one genetic modification at the cell's genomic DNA on the chromosome of the in situ during virgin abortion TYY is transplanted into a mammal for use

Ve in increasing fetal hemoglobin in the mammal. In one embodiment of this and all other aspects described in the present application, a genetically engineered human cell isolate characterized by at least one genetic modification at the cell's genomic DNA on the chromosome of the defective locus, spliced by TYY, is stored for subsequent use by Cryopreservation.

0 In some aspect of any of these isolated genetically engineered human cells characterized by at least one epigenetic modification, the cells are stored for later use by cryopreservation. In one embodiment of this and all other aspects described in the present application, a genetically engineered human cell isolate that is characterized by at least one genetic modification at the cell's genomic DNA on the chromosome of the in situ within TYY virginity is cryopreserved, And melt it

YO and implanted in my breast for use in increasing fetal hemoglobin in the breast.

OYAY

always

In some aspect of any of these isolated genetically engineered human cells, a single epigenetic modification is noted

At least, it's cryopreserved, thawed, and implanted in my breasts for use in increasing hemoglobin.

embryonic in the mammary.

Another aspect presented in the present application relates to a composition comprising isolated genetically engineered human cells,

© Where cells have at least one genetic modification on the Y chromosome of the CYA TT site

TYY LVYA (according to 19 UCSC Genome Browser hg Human Genome Collection)

The process of contacting cells with an effective amount of a formulation comprising at least an acid-targeting endonuclease

DNA or an expression vector carrying the coding sequence of a DNA-targeting endonuclease by which

The endonuclease targets DNA and cleave the genomic DNA of the cell on the chromosome. Ye for site TYY LVYALT—YA9 VY, (according to 19 UCSC Genome Browser hg)

human genome) and causes at least one genetic modification in it.

Another aspect presented in the present application relates to a composition comprising isolated genetically engineered human cells,

Where cells have at least one non-genetic modification on a chromosome? In one embodiment, it is

Epigenetic modification of at least one chromosome? At site LYALL TA YT Te7l yo (according to 19 UCSC Genome Browser hg Human Genome Collection). In another embodiment, it is modified

At least one gene on the ¥ chromosome is removed by the process of cell contact with an effective amount of combination

Include at least one DNA-targeting enzyme or an expression vector carrying the coding sequence for an enzyme

It targets DNA, by means of which the enzyme that targets DNA makes an epigenetic modification

at least one in the cell's genomic DNA on chromosome 1 affecting locus 0.01 except as TYY imperfections (according to 19 UCSC Genome Browser hg

human) and cause it.

In one embodiment of this and all other aspects described in the present application, the combination takes place

Increased fetal hemoglobin mRNA or protein expression in cell contacts.

oYAY

Whereas in an embodiment of this and all other aspects described in the present application, the cells of any of the combinations described are endogenous, to the mammal that is the recipient of the cells in a transplant procedure, that is, the LS DA is derived from or harvested from the mammal prior to any Described modification. In an embodiment of this and all other aspects described in the present application, the cells of any of the constructs described are not BE Ld to a mammal that is the recipient of the cells in a transplant procedure, that is, the cells of the construct are not derived from or harvested from the mammal prior to any Described modification. In one embodiment of this and all other aspects described in the present application, the cells of any of the combinations described are minimally HLA-type-matched with the mammalian being the recipient of the cells in a transplant procedure. 0 In one embodiment of this and all other aspects described in the present application, the cells of any of the combinations described are primary cells isolated prior to any modification described. In one embodiment of this and all other aspects described in the present application, the cells of any of the combinations described are isolated primary hematopoietic cells prior to any modification described. In one embodiment of this and all other aspects described in the present application, the cells of any 5 ge constructs described are WDA isolated induced pluripotent stem cells prior to any modification described. In another embodiment of this and all other aspects described in the present application, the deletion includes one or more sites hypersensitive to 1, 0A+, 17+ (DHS) DNAse and +D as described in the present application in the Examples section. In further embodiment of this and all other aspects described in the present application, the deletion consists primarily of one or more sites hypersensitive to 1, 0A+, 17+ (DHS) DNAse and +e as described in the present application in Examples section. In another embodiment, the deletion consisted of one or more hypersensitive loci of DNAse 0A+,17+ (DHS) 1 0045 as described in the present application in section AB). In one embodiment, as used in the present application, the expression 'fragment' in the context of a genomic deletion is at least 701 to about l of the specified region. In other embodiments, the deleted fragment is on f of less than YAR, on CAR

Cyr at least Ave at least Ze at least edo at least Ze at least 770, at least from the specified area. 72001 at least 72955, at least 799 or even ea at least TA In another embodiment of this aspect and all other aspects described in the present application, the deletion described in Table 7 is included. In another embodiment of this aspect the SNP includes one or more markers and all other aspects described in the present application, consisting The deletion is essentially from one or more of the ©s described in table ”. In another embodiment of this and all other aspects the SNPs are described in the SNPs described in the present application, the deletion consists of one or more of the SNPs

NX Schedule In another embodiment of this aspect and all other aspects described in the present application, the omission includes one or more of the fragments listed in Table 7. In another embodiment of this aspect and all 0 other aspects described in the present application , the omission consists essentially of one or more of In another embodiment of this aspect and all other aspects described 1. The fragments included in the table In the present application, the omission consists of one or more of the fragments listed in Table 7. In OTHER FORM 01 of this aspect and all other aspects described in the present application, omission from

YY Te from AY!Al Te to YAR VT Te Lalaka to Netbakhala, from Ye

COTLYYY Te eo TLV 0 Aala, 1 to LT Rakhala, 1 to 7 to FATTY LT from YAY VY Te to 0 s YY E Te to 0, “Father, from ,

Cle to 815 IY Te from AAS TYE Te Barkhla, from Na 1 to 177

YY Te to 701 YY 16 from , TTL, Te to 735 to LT from 1,

NOE VE Te decrease to 74 Te Lak from VY Te to VAL YY E Te 0 digits or from 101 SAYY Te to ERA LAY Te Lak from Te A” to YEA LT from LOOT km Te ak stand to TL in another embodiment of this aspect and all other aspects described in the present order, remove the omission 0656 (according to 117,778 Tem A ITT full The interchromosomal region of a human genome assembly) or removes part of the region resulting in a rupture of one or more loci hypersensitive to DNAse 1 Genome Browser hg 19 Yeo (0115)

CAR

_7 For in one embodiment of this and all other aspects described in the present application, the method also includes the selection of two mammals in need of increased fetal hemoglobin. In one embodiment of this and all others described in the present application, the mammary was diagnosed as having hemoglobinopathy. © In one embodiment of this and all other aspects described in the present application, it is the mammalian

who in dala increased fetal hemoglobin has been diagnosed as having hemoglobinopathy. In one embodiment of this and all other aspects described in the present application, hemoglobinopathy 8 —hemoglobinopathy 8 . In one embodiment of this and all other aspects described in the present application, it is morbidity

0 - Hemoglobin sickle cell disease. In one embodiment of this and all other aspects described in the present application, hemoglobinopathy is M8 - thalassemia 8 . In one embodiment of this and all other aspects described in the present application, the contact cell, the human cell, a hematopoietic progenitor cell or its precursor, is given to the mammal.

VO In one embodiment, this disclosure provides a method for increasing fetal hemoglobin levels in two mammals in need of it, the method includes the steps of providing an isolated pool of hematopoietic progenitor cells or hematopoietic stem cells from the mammal in ex vivo, and contacting a pool of progenitor cells or stem cells to form a pall with an effective amount of a combination comprising at least a DNA-targeting endonuclease or an expression vector carrying the coding sequence of a DNA-targeting endonuclease with which to target

,,01 the genome of the cell on the chromosome? The DNA endonuclease cleaves DNA site 0 and causes at least one genetic modification therein, by which 117 LYYA LTS YAR 7 increases expression of fetal mammalian hemoglobin, relative to precontact expression. In a further embodiment of this method, the contacted group of primary cells or hematopoietic stem cells introduced into the mammary. sale] that have increased expression of fetal hemoglobin is cryopreserved and stored or

‎CAR

A —_ in another embodiment, a cryopreserved population of primary or hematopoietic stem cells with increased expression of fetal hemoglobin is thawed and then (sale) introduced into the mammal. In a further embodiment of this method, the method includes chemotherapy and/or radiotherapy to remove or reduce mammary hematopoietic progenitor cells or endogenous stem cells. In any of the models© in the manner described, primary cells or hematopoietic stem cells can be distributed using that described in the present application. In one embodiment, this discovery provides a method for increasing fetal hemoglobin levels in two mammals in need of it, the method includes the steps of isolating a group of primary hematopoietic cells or hematopoietic stem cells from the mammal, and contacting in vivo a group of primary cells or stem cells to form blood 0 with an effective amount of a combination comprising at least an endonuclease targeting DNA or an expression vector carrying the coding sequence of an endonuclease targeting DNA (Alls DNA) by which the endonuclease targets DNA and cleave the cell's genomic DNA on the chromosome ?-184,7156 Te 117 YYA 704 site and causes at least one genetic modification therein, by which the expression of fetal hemoglobin in the mammal is increased, relative to precontact expression. Cryopreserved extracorporeal contact ALL of progenitor cells or hematopoietic stem cells that have increased expression of fetal hemoglobin stored or reintroduced into the mammal. hematopoietic stem and which are characterized by increased expression of fetal hemoglobin and subsequently re-introduced into the embryo. In a further embodiment of this method, the method includes chemotherapy and/or radiotherapy to remove 0 or reduce progenitor cells or endogenous stem cells of mammary hematopoiesis. In any of the models in the manner described, progenitor cells or hematopoietic stem cells can be distributed using mammalian-derived iPSCs. In any embodiment of the method, the method also includes selection of mammals in need of increased expression of fetal hemoglobin. In one embodiment, this disclosure provides a method for increasing fetal hemoglobin levels in two breasts that Yo needs, the method involves the steps of providing Jie with a pool of mammary hematopoietic progenitor or hematopoietic stem cells and deleting the cells' genomic DNA at chromosome? For the ITT CAR website

LVYA TYAS 117 and causes at least one genetic modification in it, by which expression of fetal hemoglobin is increased in said mammal, relative to said precontact expression. In a further embodiment of this method, a group of progenitor cells or hematopoietic stem cells with deleted genomic DNA and characterized by increased expression of fetal hemoglobin is cryopreserved and stored or reintroduced into the mammal. In the DAT model a pool of primary WDA or stem cells to form a pall is thawed with deleted genomic DNA and characterized by increased expression of fetal hemoglobin (sale) and then inserted into the mammal. In a further embodiment of this method, the method includes chemotherapy and/or radiotherapy to remove or reduce a primary WIA or an endogenous stem WIA of mammary hematopoiesis. In any embodiment of the method described, primary cells or hematopoietic stem cells 0 can be distributed using the 1050658 described in the present order. In either embodiment of the method described, primary cells, hematopoietic stem cells, or IPSCs are mammalian counterparts, which means that Wall is derived from the same mammal. In another embodiment of the method described, the progenitor cells, hematopoietic stem cells, or IPSCs are not mammalian counterparts, which means that the cells are not derived from the same mammal, but from another mammal of the same species. For example JB the mammal is a human. In any embodiment of the method, the method also includes the selection of mammals in need of increased expression

Fetal hemoglobin. In one embodiment, this discovery provides a method for increasing fetal hemoglobin levels in two mammals in need of it, the method involves the steps of isolating a group of hematopoietic progenitor cells or hematopoietic stem cells from the mammal and outside the body all deletion of the genomic DNA of the cells on the chromosome ? Locus TY has a cleavage cleft, LYYA 117 and causes at least one genetic modification therein, by which titration exceeds fetal hemoglobin in said mammal, relative to said precontact expression. In a further embodiment of this method, a group of hematopoietic progenitor or stem cells with deleted genomic DNA and characterized by increased expression of fetal hemoglobin is cryopreserved and stored or reintroduced into the mammal. In another embodiment, the cryopreserved pool of primary YO cells or stem cells is thawed to form a pall with increased expression of fetal hemoglobin and then (sale) introduced into the mammal. In a further embodiment of this method, the method includes chemotherapy and/or chemotherapy

‎CAR

=” _ AY radiotherapy or reduction of progenitor cells or endogenous stem cells of mammary hematopoiesis. In any of the models in the manner described, progenitor cells or hematopoietic stem cells can be distributed using mammalian-derived iPSCs. In either embodiment of the method, the Lad method involves selection of mammals in need of increased expression of fetal hemoglobin. © In an embodiment of any method described, the method also includes selection of mammals in need of increased expression of fetal hemoglobin. A representative mammal in need of increased expression of fetal hemoglobin would be the one diagnosed as having haemoglobinopathy. In one embodiment, this disclosure provides a method for treating mammalian haemoglobinopathies comprising the steps of: (a) providing hematopoietic progenitor cells or WDA hematopoietic stem cells or 10505: (b) contacting cells ex vivo or in vitro With an effective amount of a combination comprising at least a DNA-targeting endonuclease or an expression vector carrying the coding sequence of a DNA-targeting endonuclease by means of which the endonuclease targets DNA and cleave the cell's genomic DNA on the chromosome "for locus TY , 1,7748:-1484 TT and causes at least one genetic modification therein, by which the expression of fetal hemoglobin is increased in said mammal, relative to the precontact expression of said NO: and (c) administration of step (b) in the mammal In one embodiment of any method, cells after step (b) Leta 333500 may be required for administration into the breast.In an additional embodiment of this method, the method includes chemotherapy and/or AY radiation or reduction of progenitor cells or endogenous stem cells to form pal) in the breast in any of the embodiments by the method described. Pfh, primary cells or 0 -_ hematopoietic stem cells or 10565 are autologous to the mammal, which means that the cells are derived from the same mammal. In another embodiment of the method described, the progenitor cells or stem cells of aall formation or 10565 are non-cetogenic to mammalian, which means that the cells do not derive from the same branch, but from another branch of the same species. For example, a mammal is a human. In one embodiment of any method described, the method also includes selection of breasts in need of treatment for hemoglobinopathies. CAR gy In one embodiment, this disclosure presents a method for treating hemoglobinopathy in mammals comprising the steps of: (a) isolating primary hematopoietic cells or hematopoietic stem cells from the mammal: (b) cell contact ex vivo or in vitro with an effective amount of a combination comprising at least an endonuclease targeting DNA or an expression vector carrying the coding sequence of an endonuclease targeting the cell's genomic acid on DNA and cleaving the DNA with it targeting the endonuclease acid © and causes at least one genetic modification 117 ,778 Tam AL VY chromosome? of the site in it, by which expression of fetal hemoglobin increases in the mammal, relative to said pre-contact expression: and (c) administration from step (b) in the mammal. In models, cells after step (b) can be selected for breast implants in need of Lad breast reduction treatment. In any embodiment of the method, method 0 includes haemoglobinopathies. In one embodiment, this disclosure presents a method for the treatment of mammary haemoglobinopathies comprising the steps of: (b) ex vivo hematopoietic stem SIPSCs or WA (a) providing hematopoietic progenitor cells or 17 genome TYAS WATT status of cells on the chromosome? The locus has a DNA deletion and causes at least one genetic modification therein, by which the expression of fetal hemoglobin VO in said mammal increases, relative to said precontact expression: and (c) administration of cells from step (b )) in the mammal. The bozodella until it is required for administration into Lelia in one embodiment, the cells after step (b) can be the mammalian. In a further embodiment of this method, the method includes chemotherapy and/or radiation therapy to remove or reduce endogenous hematopoietic progenitor cells or stem cells in the breast. at any 0

IPSCs are models of the method described, which are progenitor or hematopoietic stem cells or are mammalian analogues, which means that the cells are derived from the same mammal. In another embodiment of the method described, primary cells or hematopoietic stem cells or 10565 are not mammalian counterparts, which means that the cells are not derived from the same mammal, but from another mammal of the same species. That is, a human. In any model of the method, the method also includes the selection of oi, JB for example YO breasts in need of treatment for hemoglobinopathy.

CAR

_ \ —_

In one embodiment, this disclosure presents a method for treating hemoglobinopathy in breasts that includes steps:

(a) Je hematopoietic progenitor cells or LDA hematopoietic stem cells from mammals: (b) ex vivo

Deletion of the genomic DNA of cells on the chromosome of this locus during TYY

It causes at least one genetic modification in it, by which the expression of fetal hemoglobin is increased

© in the mammalian, with respect to the said pre-contact expression: and (c) given from step (b) in the mammalian.

In one embodiment, cells after step (b) can HL Leki 335 be required for administration in

mammary. In a further embodiment of this method, the method includes chemotherapy and/or therapy

Radiosurgery to remove or reduce progenitor cells (or endogenous Leda cells) of mammary hematopoiesis. in

Any model of the method, the method also includes the selection of breasts in need of treatment for hemoglobin-0 disease.

In one embodiment, this disclosure provides a method for treating hemoglobinopathies in breasts (eg

human) comprising the insertion of the composition described in the present application comprising engineered treated cells

Is it genetically isolated with at least one genetic modification on the chromosome? For site 60, 715, 184-

TY y YYA y Te, by which the expression of fetal hemoglobin in the mammal increases. In an additional 1 embodiment of this method, the method includes chemotherapy and/or radiotherapy for removal or reduction

Primary cells or endogenous stem cells (Land) for hematopoiesis in the mammal. in any form of manner,

The Lad method involves the selection of patients in need of hemoglobinopathy treatment.

In one embodiment, this disclosure provides a method for treating hemoglobinopathies in breasts (eg

human) involving overexpression of fetal hemoglobin in the mammal by the method described in 0 -_ the present application.

In any form of any treatment method described, hemoglobin-8 is impaired - hemoglobinuria.

In any form of any treatment method prescribed, the disorder is hemoglobin 8 - thalassemia.

In any form of any treatment method described, hemoglobinopathy is sickle cell anemia.

‎CAR

_ Ad —_

In one embodiment of any of the methods described, they are progenitor cells or hematopoietic stem cells

or iPSCs are autologous to mammary, which means that the cells are derived from the same mammal. in

Another example of any of the methods described are primary hematopoietic stem cells or hematopoietic stem cells

IPSCs are not LE As to mammalian, which means that the cells are not derived from the same

5 mammals, but another mammal of the same species. For example 0, a mammal is a human.

In an embodiment on any of the methods described, the contact can be any cell described in the application

The current outside the living body, in the laboratory, or in the living organism.

In another embodiment of any method described, the contact of any cell described in the present application includes

Contact with a factor that binds the genomic DNA of the cell on the chromosome? No genetic modification occurs

In one embodiment, is the epigenetic modification on the chromosome? For the site YA LTA YT,

17 (according to UCSC Genome Browser hg 19 Human Genome Collection).

In another embodiment of any method described, the contact of any cell described in the present application includes

Contact with a factor that binds the genomic DNA of the cell on the chromosome? Location CIAL YT Te A WY LYYA (according to 19 UCSC Genome Browser hg human genome set), and modification occurs

No gene on the chromosome?, and therefore reduced expression of /80111 or (4555) mRNA.

In another embodiment of any method described, the contact of any cell described in the present application includes

Contact with an effective amount of a formulation comprising at least a DNA-targeting enzyme or expression vector

carries the coding sequence for a DNA-targeting enzyme with which 1 for an enzyme that targets DNA

,. mRNA is a protein

In another embodiment of any method described, the contact of any cell described in the present application includes

Contact with an effective amount of a formulation comprising at least a DNA-targeting enzyme or expression vector

It carries a wall sequence coding for an enzyme that targets DNA, and through which 1 of an enzyme that targets DNA Yo, an epigenetic modification occurs on the chromosome? For the website VYA Tem AL TT 117 (according to

‎CAR

_ _ UCSC Genome Browser hg 9 human genome assembly) and accordingly reduced the expression of BCL11A or the mRNA protein. In one aspect, expression of fetal hemoglobin increases in mammals, relative to precontact expression. In another embodiment of A method described, the original cell is contacted to form blood, the isolated human cell, or a cell isolated ex vivo or in vitro. In another embodiment of any method described, at least one genetic modification is a deletion. In another embodiment of this and all other aspects described in the present submission, at least one epigenetic modification is present. In one embodiment, in the present application the use of an agent that binds the cell's genomic DNA on the UCSC Genome Browser (according to the TYY LVYALT—YA chromosome 7 locus, Xala Ye human genome set) to increase fetal hemoglobin in breasts or for the treatment of hemoglobinopathy hg 9

BCL11A in mammals or to reduce the expression of 00818 or 56111/8, where the expression is reduced. mRNA or protein In one embodiment, in the present application the use of an effective amount of a combination comprising at least V0 DNA-targeting endonuclease or an expression vector carrying the coding sequence of a DNA-targeting endonuclease to increase fetal hemoglobin In mammals or for the treatment of mammary haemoglobinopathy or to reduce the expression of mRNA or 80111/8, wherein the endonuclease targets DNA and cleaves the genomic NA9 of the cell on the chromosome for position 1 0 77 A 0 1 += 1 AQ 0 7 1 1 0 1 0 1 and cause at least one genetic modification in it. 0 In one embodiment, the present application submits the use of an effective amount of a formulation comprising at least a DNA-targeting enzyme or an expression vector carrying the coding sequence for a DNA-targeting enzyme to increase fetal hemoglobin in breasts or to treat hemoglobinopathies in breasts or to reduce the expression of mRNA or 801118, whereby an enzyme that targets DNA causes at least one epigenetic modification of the cell's genomic DNA on chromosome 1 and accordingly affects the expression of 01 in one of In the models, at least one epigenetic modification is at the site BCLIIA or mRNA Yo CAR gon. Another model, the effect of one epigenetic modification is to reduce the expression of BL 117 LVYA,1:- 144, 7. mRNA for 8061118 or a protein. In one embodiment, the use of any isolated cells described in the present application to increase fetal hemoglobin in a patient or to treat mammary haemoglobinopathy is presented in the present application.

Lys Engineered Human WA In one embodiment, in the present application, the use of a formulation comprising an isolated © is presented to increase fetal hemoglobin in the breast or to treat hemoglobinopathy in the breast, wherein it is characterized by

TAY cells Tem AG YT Te cells with at least one genetic modification on the chromosome of the locus human genome group) done by contact process UCSC Genome Browser hg 19 (according to or vector DNA cells with an effective amount of A combination comprising at least one acid-targeting endonuclease by which DNA targets expression carrying the coding sequence of an endonuclease that targets 0,60 genomic acid of the cell on the chromosome? UCSC Genome Browser hg 19 (according to TYY Atamegala sucker, LY human) and causes at least one genetic modification in it.

Engineered human Lys WA In one embodiment, the use of a formulation comprising an isolate to increase fetal hemoglobin in the breast or to treat mammary haemoglobinopathy, wherein the VO cells have at least one epigenetic modification on the chromosome is presented in the present application. In one embodiment, the epigenetic modification (according to 117 VTA, TA TT at least one on chromosome 7 at locus human genome set).In another embodiment, one UCSC Genome Browser hg 9 epigenetic at least on the ¥ chromosome by the process of cell contact with an active amount of a combination comprising or an expression vector carrying the coding sequence for a DNA-targeting enzyme at least one yo-acid-targeting enzyme a single epigenetic modification to the DNA by which the enzyme that DNA targets the VT 60 genomic acid of the cell on the chromosome?, affecting the lowest DNA location in the DNA of a human genome set (UCSC Genome Browser hg 19 (according to TYY Sakh Agla 4) And it causes.

CAR

h —_ _ In an embodiment, the use of any of the cell isolates described in the present application or any one of the combinations described in the present application for the manufacture of a drug to increase fetal hemoglobin in Teddy or for the treatment of mammary haemoglobinopathy is presented in the present application. In one embodiment of use of the formulation described herein, the formulation induces an increase in fetal hemoglobin mRNA or protein expression in cell contacts. In one example of using the combination described in the present application, the cells of any of the combinations described are autologous (Lael), to the mammal that is the recipient of the cells in a transplant procedure, ie, the cells of the combination are derived from or harvested from the mammal prior to any modification described. In one embodiment of the use of the combination described in the present application, the cells of any of the combination 0 described are non-autologous TE to a mammal that is a recipient of cells in a transplanted shal, i.e., the cells of the combination are not derived from or harvested from the mammal prior to No modification described. In one embodiment of the use of the combination described in the present application, cells of any of the combinations described are minimally HLA-type-matched from the mammalian recipient of the cells in a transplant procedure. In one embodiment of the use of the combination described in the present application, the cells of any of the 1 25 combinations described are primary cells isolated prior to any modification described. In an embodiment using the combination described in the present application, the cells of any of the combinations In an embodiment using the combination described in the present application, the cells of any of the combinations described are isolated induced pluripotent stem cells prior to any modification described. 0 In one embodiment of the use of the composition described in the present application, the cells of any of the compositions described are cryopreserved prior to use. There are known variants associated with HBF in /80111. Six GWAS of the HOF level (or Lay-associated trait with high cell count []) were performed in individuals of the CAR offspring.

PV

European, African and Asian BCL11A (1"-7). Each of them distinguishes a variant associated with the trait in its range.

HOF and consistent with (9,01,20) and 5-thalassemia SCD The same variants are associated with clinical severity of L as a major determinant of these disorders. Variance in 80611178 was estimated to explain -715 of the variance in as the most closely related Four different SNPs (67,07,7) HDF were characterized for the trait at the 5766432 5 (1) 54671393 (A) rsl 18868658 (1( rsl427407), (1) 5766432, with a high trait score © Intron-? BCLITA from each other in kb ¥ the guard inside SNPS congregate :)(1-01)

The sentinel HOF explains the association of SNPs (Figs. A and 11b). It appears that haplotypes including 861118 at the SNPS locus linked fifty SNP haplotypes (11, 47) better than any - 01 x © > P) genome-wide marker HBF within an intron- ?association level of SNPS-twenty-seven Despite large-scale sequencing efforts, image coding has not been described (A 0 (£7) BCL11A variant 50111 at the HOF locus to map association signal with CSSCD previously; the authors used and reported strong association with 14671393 (£7) in that study; 51427407 was entered. The above are 18766432 and two additional SNPs from in a subset of (8, 01, 11, 51). The most highly associated guard SNPs for the trait were (8, 01, 11, 51). The most highly associated sentinel 1 sentinel SNPs were available; no SNPS result was available. whose genotypes were in all VYA individuals (p-significant correlation at 54671393 8766432 or 1886868 for after conditioning on the 51427407 genotypes and vice versa; the correlation remained highly significant for the genotype ¢r81427407 at (Table 4). Accordingly, m rs 18868681 8766432 54671393 when conditioning on the 01155 globule-like range HBF most strongly associated with the SNP level represented the 0 1427407 guard described above. The red SNPs better explain the association of the trait than shown. Conditional analysis Correlations remained significant after adjustment for 181427407 and the correlation was in 157599488 ;(1\=) + x 4,11 = P) DHS +55 most significant residual for 157,606173 in -01 * 3.47 = P ) is only slightly less significant GIS, (£F) previously reported by Led 3, DHS +62 rare variant image within three 01155 DNA signals and did not give sequence analysis 1. (Table 1) 01 YO .)# (Table HBF Additional Independent Linked Signals

CAR eA The authors show that allele-specific transcription factor (TF) binding is related to the expression of /80111. Allele-specific biochemical studies were performed using informative heterozygotes to control for cross-reactivity differences between samples to ensure equal abundance of both alleles; It was demonstrated by equal representation of alleles in paired gDNA (Figs. b (zs) showing asa © 1427407 directly at the center of the binding peak of GATAL and TALI at 62+ DHS (Fig. RY In in vivo ChIP experiments, chromatin was sonogrammed to approximately 5,000 base pairs of fragments.Sanger sequences were made from five primary human samples of erythrocyte-like producers of heterozygotes heterozygotes for 1,427,407 rs used for 6010-0068 at erythroid-like 01155. The other SNP of heterozygote was only in the Ove range 0 5 base pair of 1427407 in any of these samples is 157599488 (4 1 7-base pair 'V' (S1427407) which was heterozygous in only two of the five samples. This SNP did not fall within promoters of Lis 67/1 or TALL. Rather, it seemed unlikely that another SNP Within 62+ DHS could explain the observed allele-specific association of TF.In addition, the inventors discovered that there was an association between BCLIIA expression and HPF level Vo the inventors' studies provide an estimate of the change in expression of 8011178 that could be associated on him CLINICALLY SIGNIFICANT INCREASE IN HDF LEVEL Among a limited group of human lymphoblastoid-like cell lineages, Lad reported an Ale precursor between a high HDF-associated A allele of 54671393 with low expression of . (11). 861118 Extending these trials to a larger group of genotyped strains failed to confirm this observation. and then; The authors show that expression of 801117 of haplotype 0.0 of 1s1427407-rs7606173 associated with HDF in a specific erythrocyte-like context” is likely to be consistent with the results of susceptibility. DNase expression of mRNA /806111 in primary erythrocyte-like producers differed by 01"-fold between rs1427407-1s7606173 HOF6 high and low©-6 haplotypes in HBF (Jal) no. correspondingly; median HBF levels were 796 and 77.1 in homozygotes de G-C 4 T-G remains Yo order (Fig. ZV). Noteworthy; results showing Allele-specific expression of /806111 in human primary spheroid cells

CAR

erythropoiesis in cells heterozygous for the rs1427407-rs7606173 haplotype and thus the modest effects on expression of /80111 reflect combined effects of all functional SNPs within the haplotype range. While the protective legacy of haplotype 8611178 was clinically useful on a group basis (5, 01,90), the mean HBF level in heterozygotes 1–6 remained below that required to prevent death from SCD. However; The sensitivity of the HBF level of BCL1IA expression predicts that disease alleviation could require only a modest additional reduction in the expression of 86111/8. The inventors also studied the developmental regulation of the globin and 86111/5 genes. During human development, globin- was replaced 0 is derived from the yolk sac in the first trimester with globin-a] derived from fetal liver.After birth;Ui erythrocytes exit from the liver into the bone marrow;globin-la 0 is gradually suppressed and globin-la predominates.Single conversion occurs During this transition, which occurs at mid-gestation, primary erythrocytes derived from the circulating yolk sac express globins in the embryonic stage Oy and IHD, while erythrocytes specific to the fetal liver express globins in baloch stage 1la and 02) According to this evolutionary transition, 806111/8 is expressed in the selected progeny but not in the erythroid-like progeny in prophase 1 and is required for the change in expression of the globin gene (OF V1) in progenitors Amount of 52.0-64.4+ transgenic 80111 fixed at 01.5 000, expression observed lacZ was detected only in the fetal hepatocyte and not in the circulating blood within the fetus, placenta or yolk sac (Fig. A). These results, combined with the result of expression of 1802 in 17.5 dpc fetal liver-specific erythroblasts but not in 00 yolk sac-derived primary erythroblasts (Fig. b), indicate that BCLITA enhancer sequences Elicit expression in a developmentally defined pattern consistent with endogenous globin gene transfer. A series of deletion mutants were generated to purify the minimum elements required for enhanced erythrocyte-like activity. Sequences containing the +58 0115 center were sufficient for enhanced erythrocyte-like activity. Those sequences containing only the flanking +67 or oot elements were unable YO to direct expression of an erythroid-like gene (Fig. 1) to test the ability of DHSs to improve gene expression in primary human erythropoietic subjects , we used CAR virus delivery

A lenticular effect of the lida GFP sum system has been described before (39). Similarly, gene expression of +/e DHS enhanced in the reported amount experiment (Fig. 1). The inventors decided to generate cell lines with the deletion of the 18 Bell enhancer to investigate the requirements for the yell enhancer for 806111/8. . Erythrocyte-like penetrating cells with enhanced disruption were generated. Since there were no suitable human erythrocyte-like cell lines available at the Baluch stage, as a proof of principle, the inventors turned to the mouse system. Mouse p30 erythroid leukemia (MEL) cells are based on 801118 globin gene expression of the adulthood phenotype (VE) and the authors identify an erythrocyte ages complex enhancer homologous at the ortho locus at Bell 118. From Ll. for intron-7. Similar to intron-?” enhancer 801118 numbered in a human GWAS, these sequences were characterized by a series of erythrocyte-like 0 cells specific for DHSS. In addition, these sequences were transcribed by H3K27ac3, H3K4mel, and lacked H3K2Tme3. 5 H3K4me3 and were occupied by each of 68181 TALI in mouse erythrocyte-like chromatin (Fig. A). Complex regulatory elements that include a series of adjacent DHSSs have been shown to be important for gene expression at multiple sites, including Among others are the control region of the beta-globin locus; the conservative sequences of multiple 1-alpha-globin species and the IgH regulatory region (00-07) and we observed unique species-specific features of the combined enhancer. For example, the authors identified conservative mouse sequences for each One of 014158 +17, oot 5 oA+ human subjects, found to have DNase 1 hypersensitivity to erythroid cells at +7 5 +00 aay, that conservative oA sequences lacked hypersensitivity to erythrocytes DNase|.0|PCR and Southern staining verified the excision of the 64 KbTe fo section related to intron 98 in Tl. Three unique MEL clones and two unique pro-8 lymphocyte clones (Fig. 01 when the section relating to the intron is omitted; We observed a significant decrease in the /806111 transcript in MEL cell clones by 41-0068 using primer pairs that detect YO connections of the exon “JE” and with an extension or after a deletion (Fig.

-e- for convenience; Specific expressions used in this document are compiled in their entirety (including Specification; (AB) and the accompanying claims). Unless otherwise stated, all technical and scientific expressions used in this document have the same meaning as they are specifically perceived. Generalized by those of ordinary skill in the field to which the invention belongs © As used in the present application, the phrase “a factor that binds the genomic DNA of a cell on the Y chromosome of locus TOY ,7748 TIAL YT Te refers to small molecules; or acids Nuclear; proteins, peptides, or oligonucleotides that can bind to a site within genomic DNA (eg, chromosome ? of locus LYALL TAG TT 117) and suppress expression of 8061118 or protein mRNA in a cell by At least 770 compared to a mRNA of 0 or a protein level of 80611178 in a cell not treated with such an agent.In one embodiment, the agent interferes with “8011178 interacts with 8011178 binding partners,” as that phrase is used in the present application. As used herein indicates The expression 'sin' is lowercase" to a chemical agent including; for example and not exclusive peptides; or peptide analogues; or amino acids; or amino acid analogues; or “Vo polynucleotides” or polynucleotide analogues; or aptamers; or nucleotides” or analogues of nucleotides or organic or inorganic compounds (that is, including heterocyclic organic or organometallic compounds) having a molecular weight less than about 00001 g per mole; organic or inorganic compounds having a molecular weight less than about 5080850 g per mole; organic or inorganic compounds having a molecular weight less than about 10001 g per mole; Organic or inorganic compounds having a molecular weight less than about PRS 0 g per mole and salts, esters and other pharmaceutically acceptable forms of these compounds. The 'gyal acid' as described here can be either RNA or DNA and can be single or double-stranded; eg JB can be selected from a group comprising: a nucleic acid that encodes a protein of interest oligonucleotides; analogues of a nucleic acid; for example, peptide— “PNA (peptide— nucleic acid (PNA) pseudo-complementary (PNA (pc-PNA) Yo) fixed nucleic acid locked nucleic acid (LNA) etc. include amino acid sequences listed, for example but not (oan) an amino acid sequence that encodes CAR

h proteins; For example, which act as cloning qubits; anti-transcriptional molecules; anti-transcriptional molecules and ribosomes 805855005; small nucleic acid sequences antisense inhibitory molecules; For example, but not limited to RNAi siRNA shRNAi (RNAi min) antisense oligonucleotides (MRNAI) antisense oligonucleotides etc. © 'interferes with BCLITA interactions with BCL11A-binding partners' means that the amount of interaction 861117 protein with BCL11A binding partner had at least 75% lower in the 861118 inhibitor-treated groups, and then the control group, and the comparison group, where no 806178 inhibitor was present. Treatment with an IA inhibitor 8611 at least 701 lower, at least 770 lower, at least 770 lower than Ys, at least 746 lower, at least 750 lower, at least 700 lower, at least 1776 lower, at least ZA is less, at least Za is less, at least 1-times less, at least 1-times less, at least 1-times less, at least 10-times less, at least 001-fold less, at least 0-fold less, or more than a control group treated with a control group in which no BCL11A inhibitor was added At two extremes, the interaction of 8011178 can be tested by quantifying the amount of 8611178 Yo bound to the binding partner 801117 using Industry standard techniques, including, but not limited to, mass spectrometry, immunoprecipitation, or gel filtration assays. Alternatively, or in addition, the efficacy of 861118 can be tested by measuring the expression of fetal hemoglobin at an mRNA or protein level after treatment with the candidate 8611178 inhibitor. In one embodiment, the activity of 11/8 801 represents the interaction of 11/8 861 with its binding partners: (GATA-1 0 06-1 components of the RBBP7 complex; MTA2 0210-3 “NURD”). As such, it can be considered Any antibody or fragment thereof, small molecule, chemical agent or compound that can inhibit this reaction Lie of activity 8011178. As used in the present application, the term "engineered cell" refers to a cell that includes at least one genetic modification, According to the use of this expression in the current request. CAR

Imprisoned according to its use in the present application, the term 'genetic modification' refers to disruption at the genomic level that results in a reduction in the expression of 806111/8 or activity in a cell. Representative genetic alterations could include deletions, frameshift mutations, point mutations, exon removal , removal of one or more sites hypersensitive to 1 (DHS) DNAse (eg, LY “), or more © (DHS) regions etc. The expression ‘inhibits expression of BCLIIA’ is meant The amount of expression of 86111/8 is at least 75% lower in a cell or group of cells treated with an endonuclease that targets DNA than in a comparable cell, control cell or group of cells, in which there is no endonuclease that targets DNA 8/No0. The percentage of expression of 8611178 in the treatment group is at least 200 Ye less, at least 7710 less, at least 770 less, at least 7460 less, at least 750 less, at least 7650 less, at least Tye less, at least 780 less, at least 790 less, at least 1-times less, at least 1"-times less, at least 0--times less, at least 01-times less, at least , 100-fold less, at least 1,000-fold less, or more than a comparable control treatment group Led No DNA-targeting endonuclease added. Vo The expression 'inactivates /80111' means that the amount of functional activity of 861117 is at least 2 less in a WIA cell or group treated with the methods described in the present application, than in the comparable cell, comparison cell or group, where there is no Any endonuclease that targets DNA Preferably, the percentage of 801117 activity in the IA 8061-1 co-treated group should be at least 701 lower, at least 7710 lower, at least 7760 lower, at least 740 lower. , at least 756 0 less, at least 760 less, at least 7970 less, at least 780 less, at least 7960 less, at least -1 times less, at least 1-times less, at least-5 At least 100-fold lower, at least 100-fold lower, at least 1000-fold lower, at least 1000-fold lower, or more than a comparable treatment group Led No DNA-targeting endonuclease is added. At a minimum, the activity of 8011178 can be tested by quantifying the expression of 118 BCL at the levels of the Yo protein or mRNA, using standard techniques in the art. Alternatively, or in addition, the activity of 861117 can be determined using a sum structure, Where the sum structure is sensitive to the activity of 861118. CAR

Duh

The Gluin-7 site sequence is recognizable by DNA binding promoter 01061666.

.BCL11A lactic acid-binding motif

In one embodiment, as used in the present application, DNA expression targets an endonuclease

endonuclease refers to an endonuclease enzyme that generates a double-stranded spacer at a desired locus in the genome (eg, chromosome ? of position 60, (VY 1,774, 0-184 NT) without producing

Unwanted double-strand breaks. It could be the target DNA

A naturally occurring endonuclease enzyme (eg, bacterial meganuclease

bacterial meganuclease or can be generated synthetically (eg, megaenzymes

genetically engineered meganuclease nucleases, 18105, or ZFNs, among others).

0 In another embodiment, according to its use in the present application, the expression “DNA targets endonuclease” refers to an endonuclease enzyme that generates a single-stranded spacer or "cleft" or spacer on one of the strands of the acid phosphate sugar base DNA at a desired locus in the genome (for example, chromosome 7 for locus 0) can be used as a TOY homozygotes without producing unwanted off-target DNA strand breaks.

Vo and according to its use in the present application, the term 'expression vector' refers to a nucleic acid molecule capable of transporting a HAT nucleic acid to which it binds. One type of vector is a Fuad, which indicates a circular double-stranded DNA loop to which additional DNA segments can be attached. Another type of vector is a viral vector; where additional DNA segments in the viral genome can be attached. Certain vectors are able to spontaneously replicate in the host cell into which the led is introduced (eg

00 Bacterial vectors that have a bacterial reproductive origin, and mammalian vectors for particles attached to chromosomes). Other vectors (non-sosome-associated mammalian vectors) are incorporated into the host cell's gene pool upon introduction into the host cell; Thus, it is replicated with a group of genetic factors of the family cell. Furthermore, specific vectors are able to effectively direct the expression of genes to which they bind. These vectors are referenced throughout this document

YO is referred to as 'recombinant gene expression haulers'; or simply expression vectors. In terms of cole expression vectors, they are useful in recombinant DNA technologies

OYAY

The gene is in the form of plasmids. In the current specification; The expressions 'plasmid' and 'vector' are used interchangeably where the plasmid is frequently used from the vector. However, the invention includes other forms of genetic expression vectors; such as viral vectors J) replication-defective retroviruses, lentiviruses ¢, adenoviruses and adeno-associated viruses .); that perform equivalent functions. Within the gene expression vector’, “effectively associated” means that the nucleotide sequence 8008 of interest binds to upregulated sequences in such a way as to allow genetic expression of the nucleotide sequence (for example, in a laboratory transcription/translation system or in a target cell at Introducing the vector into the target cell. Said regulatory sequences are described” eg in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Many of the 1 host cell types and those that are directly genotyped express a nucleotide sequence only in specific host cells (eg Tissue-specific regulatory sequences 115506). DNA by a vector containing a regulatory sequence to directly synthesize the DNA-targeting endonuclease enzyme at specific time intervals; or over a specified period of time. Those skilled in the art know that design of an expression vector can depend on these 0 | factors as a choice of target cells; the level of gene expression required; and the like. As used in the present application, the term 'cleavage' generally refers to the generation of a double-stranded spacer in the ye DNA genome at a desired locus. As used in the present application, the term “effective amount of a combination comprising at least a DNA-targeting endonuclease” refers to an amount of a DNA-targeting endonuclease producing sufficient Yo endonuclease activity to generate a double-stranded spacer at the desired genomic location. In one embodiment, an effective amount of endonuclease was generated that targets a double-stranded DNA breaker at the desired genomic location in

At least 770 cells in a group in contact with a combination (eg, at least JX at least Tee at least Tee at least Te at least 770, at least TA at least ,0 At least 790 at least 799, or even 7001 for cells in the group containing genetic modification produced by an endonuclease formulation targeting DNA (© depending on its use in the present application). The expression 'increased levels of fetal hemoglobin' in a cell indicates that Fetal hemoglobin was at least 75% higher in groups treated with an agent that cleaves BCLIIA mRNA or protein expression (eg, endonuclease targeting DNA) by binding to genomic DNA at chromosome 1 at position 60, SYA LVN LVYA 117, than in the ALE group for comparison, comparison, where there is no factor. It is preferable to have 0 percent of fetal hemoglobin expression in a group treated with such an agent that binds genomic DNA at the chromosome? LT VAS YT LT 7748, at least 117 120 up, at least 7710 up, at least 770 up, at least 7460 up, at least Tow Higher, at least 72700 higher, at least 770 higher, at least 7860 higher, at least 1790 higher, at least 1-times higher, at least 1-times higher, at least cameo higher, on No Least 100-fold higher, at least 100-fold higher, at least -0001-fold higher, or more than the group treated with a comparator of comparable LB size and culture conditions. The term 'comparator treatment group' is used in the present application to describe a group of cells treated with matched media, viral induction, amino acid sequences, temperature; cell crosslinking ratio; beaker volume » pH; etc; With the exception that a factor that binds genomic DNA is added at chromosome 0? for TAG VT Te 774, 117. In an embodiment, any method known in the art can be used to measure an increase in the expression of fetal hemoglobin, eg; Western Blot analysis of fetal y —globin protein and quantification of mRNA for fetal 7 globin protein. The term “isolated cell” as used in the present application refers to a cell that has been removed YO from an organism in which it originally resides, or is a descendant of such cell Jie. Optionally the cell has been been cultured in the laboratory, for example, in the presence of the other Wal. Optionally enter the cell CAR

7e later in a second organism or reintroduced into the organism from which the cell was isolated (or from which the cell is a descendant). The expression 'isolated group' in relation to an isolated group of WA as used in the present application denotes a group of cells removed and separated from a mixed or heterogeneous© group of cells. In some embodiments, the isolated population is a much more pure group of cells than the heterogeneous group from which the cells were isolated or enriched. In some embodiments, an isolated population is an isolated population of human hematopoietic progenitor cells, eg, a significantly pure population of pallor-forming human primary LDA compared to a heterogeneous population of cells that includes human hematopoietic and hematopoietic progenitor cells from which Vy human hematopoietic progenitor cells were derived. The expression 'extremely pure,' with respect to a given group of cells, denotes a group of WAN of at least about Ve, preferably at least about ZA, more preferably at least about Jae, and preferably at least about 795 pure , with respect to cells that make up the total cell population. That is, the expressions 'extremely pure' or 'essentially pious,' in relation to a group of primary cells 1 _of hematopoiesis, refer to a group of cells containing less than about TY and preferably less than about 715, 711 78, 71, and preferably less than about 75, BVA SIVA S/S 21, or less than 0.71 and from cells that are not primary hematopoietic cells according to for what is defined by the expressions in the current request. According to its use in the present application, the expression pe includes the reduction or mitigation of at least one Yo of an adverse effect or symptom of a condition, disease or disorder. For example, the expression Tallady Ee refers to administration to a subject of an effective amount of a formulation, eg, an effective amount of a formulation comprising a group of hematopoietic progenitor cells such that the subject has a reduction in at least one symptom of the disease or an improvement in Disease, for example, is a desired instrumental or clinical outcome. For the purposes of this disclosure, desired clinical or beneficial outcomes include, but are not limited to, alleviation of one or more symptoms, reduction of the extent of disease, stabilization of disease (eg, no worsening of the condition), delay or slow disease progression, amelioration or Alleviation of disease, remission (whether partial or complete), CAN

-meh- whether detectable or non-detectable. In some embodiments, treatment may indicate a prolongation of survival compared to the expected survival without treatment. Thus, those skilled in the art realize that treatment may improve the condition of the disease, but it may not be a complete cure for the disease. In some cases, treatment may include prevention. However, in alternative embodiments, treatment does not include prevention. © The term “pharmaceutically acceptable” is used in the present application to refer to those compounds, substances, compositions, and/or dosage forms which are, within the scope of good medical judgment, suitable for use in contact with human tissues and organisms without excessive toxicity; irritant; an allergic response; or other problem or complication commensurate with a reasonable benefit/risk ratio. La, for use in the present application, the term 'pharmaceutically acceptable'; LF for physiological endurance” and the various grammatical forms ending in “combinations” and carriers; Diluents and Jeli are used interchangeably and show that the substances can be administered to a mammal without producing physiological effects such as nausea, dizziness, gastric upset, etc. A pharmaceutically acceptable carrier will not cause Enhancing the elevation of the immune response to an agent with which it is mixed with it, except when needed The preparation of a pharmaceutical formulation containing dissolved or dispersed Vo active ingredients known in the art and not requiring strict restriction of the formulation The pharmaceutical formulation includes the compound of the invention in combination With one or more pharmaceutically acceptable ingredients The carrier may be a solid; semisolid or liquid diluent; cream or capsule Typically; such compositions are prepared as ALE for injection (Le) as solutions liquid or suspensions; However, solid forms of solutions or suspensions in liquid may also be prepared prior to use. Yo may also be in the form of an emulsion or in an oily formulation. The active ingredient may be mixed with pharmaceutically acceptable excipients compatible with the active ingredient in amounts suitable for use in the therapeutic methods described herein. Jian Appropriate excipients; For example; In the water; or saline solution; or dextrose; glycerol, ethanol, or the like, and combinations thereof. in addition to; If necessary; The formulation may include minor amounts of YO adjuvants such as wetting or emulsifying agents, pH buffering agents, etc. Ally can enhance the potency of the active ingredient. CAR

-4H8-

The therapeutic composition of the present invention may include pharmaceutically acceptable salts of the ingredients herein. Pharmaceutically acceptable salts include acid addition salts (formed by free amino groups of a polypeptide) formed by inorganic acids; for example, hydrochloric© and phosphoric Phosphoric acids The mentioned organic acids are included in acetic acid, tartaric acid, mandelic acid, etc. Salts formed using free carboxyl groups can also be derived from inorganic bases, such as hydroxides hydroxides of sodium, potassium, ammonium, calcium, or ferric; the mentioned organic bases are isopropylamine and trimethylamine. ¢ and ?-ethylamino jelly ethylamino ethanol ;histidine ¢ , procaine and the like Physiologically acceptable carriers are known in the art. Representative ALLY carriers are sterile aqueous solutions which do not does not contain substances in addition to the active ingredients and water; or contain a buffer solution Jie sodium phosphate at a physiological pH ded; or Vo Physiological Saline or Jie (Lads) phosphate-buffered saline additionally; aqueous carriers may or may include more than one buffer salt; as well as salts such as sodium and potassium chlorides sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. mentioned in glycerin” or vegetable oils, Jie cottonseed oil, water and oil emulsions. The amount of active agent used in the invention that will be effective in treating a specific disorder or Ala will depend on the nature of the disorder or condition; it can be determined by techniques

standard clinical. According to its use in the present application, 'prevent' or 'to prevent,' when used in reference to a disease, or a disorder or symptoms thereof, indicates a reduction in the likelihood that an individual will develop a disease or disorder, for example, hemoglobinopathy. The likelihood of developing a disease or disorder is reduced, eg qa an individual has one or more risk factors for a disease or disorder that either fails Lovie, JE That disease or disorder later or with less severity, in terms of Jie The composition of the disorder or the composition of the statistic, in relation to a group with the same risk factors and not receiving treatment as described in the present application.Failure to reduce the development of symptoms of a disease, or the development of symptoms is considered reduced at least on a clinically acceptable scale for that disease or disorder) 701 (eg, by © or delayed (eg, by days, weeks, months, or years) effective prevention. With endonuclease targeting acid Lod the phrase 'increased levels of fetal hemoglobin in a cell' indicates that fetal hemoglobin in a cell or group of cells is n at least 75 higher in the acid-treated cell or group of cells than in a comparable group, comparatively, in which no DNA enzyme targets acid endonuclease 0 preferably expressing fetal hemoglobin in a cell. DNA endonuclease targets acid above, at least 771 up, at least 701 up, DNA endonuclease targets acid dallas low 730 up, at least 7460 up, at least 756 up, at least 71650 up, At least

JN higher, at least 780 higher, at least 7960 higher, at least 1-x higher, at least 0 001 times higher, at least 01 higher, at least Geese 7-x higher, at least | 5-fold higher, at least 1000-fold higher, or more than a comparable comparator-treatment group. amine, temp; ratio

BCL1IA cytokine tangle; beaker volume » pH; etc; With the exception of the addition of a single "mammal" or group of "mammals"; And it includes “AS mammals” that the GIS means by the term 0, for example, but not limited to; humans; primates such as monkeys; monkeys, kittens, lions and tigers; the Jie family and chimpanzees; the canine family such as dogs and wolves; Cats Horses such as the horse; Donkeys and zebras; Animals that eat such as cows; Pigs and sheep; Fossils such as gazelles and giraffes; Rodents such as mice; Rats, hamsters and guinea pigs; and Bears.In some favored embodiments, the mammal is the human beings

CAR

in one of the models; It was diagnosed that the human being suffers from hemoglobinopathy. In colin's model, according to another, hemoglobinopathy is a hemoglobinopathy]. in one of my favorite forms; Hemoglobinopathy is sickle cell disease. As used here 'sickle-hemoglobin disease' can be sickle cell anemia; sickle cell hemoglobin disease and sickle cell thalassemia (HDS B+)©; sickle cell beta plus disease (155©) ©

preferred PB; The hemoglobinopathies are AT thalassemia beta zero (105/]0). In a form as used in the present application, the term "hemoglobin impairment" refers to any abnormality of the structure or function of any individual's hemoglobin; It includes defects in the initial structure; or secondary; triple deletions or substitution mutations in the Jie and quadruple regions of hemoglobin caused by any mutation; or mutations or deletions in the promoters or enhancers of such genes that encode the I globin gene

Lad results in less hemoglobin being produced compared to a normal or standard condition. The term includes any decrease in the amount or activity of hemoglobin, whether normal or abnormal; What happens is similar. Los 107005 disease; or chemotherapy; Jie and toxins by external agents As used herein to refer to an amount of Clad cell composition In one embodiment, the term refers to "an amount that is safe and effective for treating; treat or improve symptoms of hemoglobinopathy; slow progression of disease or inhibit presentation of hemoglobinopathy; slow or inhibit the onset of symptoms of hemoglobinopathy clad; secondary to hemoglobinopathy or inhibit development of secondary symptom of hemoglobinopathy. The effective amount for treating hemoglobinopathy depends on the type of hemoglobinopathy to be treated, the severity of the symptoms, the mode of administration, etc. Therefore, the cad is not the age of the subject, the general condition, candle, and the subject who is given 0 necessarily to determine an exact 'effective amount'. however; for any particular case; An appropriate 'effective quantity' may be determined by one of ordinary skill in the art using routine experiments only. As used in the present application the term 'comprising' or 'comprising' is used with reference to a composition, method, and a corresponding component thereof, which are essential to the invention, and are still open to the inclusion of unspecified elements; Essential or not. YO

CAR

h \ —_ _ as used in the present application The term 'Gall' refers primarily to those elements which are required for a specific embodiment. The term allows for additional elements that do not materially affect the essential, innovative or functional feature of that embodiment of the invention. The term denotes "which consists of" to combinations, methods, and corresponding components thereof as described in the present Application 0, which excludes any element not cited in the form description. As used in this specification and the accompanying claims; the indefinite and definite articles include reference to the plural unless The contrary is clearly indicated in the context. Thus, for example, references to 'methods' include one or more 'methods' and/or steps of the kind mentioned herein and/or which would become apparent to those skilled in the art upon perusal of Disclosure etc. It is understood that the foregoing detailed description and following examples are for illustrative purposes only and are not restrictive to the scope of the invention Numerous variations and modifications may be made to the disclosed embodiments which are evident to those skilled in the art; without departing from the scope of the present invention .Furthermore; is included n all patents; patent applications; releases clearly identified herein by reference to description and disclosure purposes; For example; The methodologies described in the cited publications 10 can be used in conjunction with the present invention. These prospectuses are provided only for disclosure prior to the filing date of the current application. Nothing in this sense shall be construed as a provision that the inventor shall have the right to register with a date prior to the said disclosure under the previous invention or for any other reason. All statements as to the date or presentation of the contents of such documents are based on the information available to the applicants and do not constitute any acceptance of a correction of the dates or contents of those documents. Yoo hemoglobinopathy Fetal hemoglobin (HF) is a tetramer fy of adult globin© polypeptides and two globin polypeptides 8. globin-7-like. During pregnancy, globin genes are generated98065 globin 7 duplex dominant genes transcribed from the globin B locus after birth; The y globin is gradually replaced by YO by globin | to adults,” a process referred to as “embryonic conversion” (7). The molecular mechanisms by which CAR is involved have remained

The basis for this conversion is highly ill-defined and subject to extensive research. Developmental conversion from dominant fetal hemoglobin production or HDF (0272) to adult hemoglobin production or HDA (0202) begins at about 78 to TE weeks of pregnancy and continues for a short time after birth at which point the Led HDA becomes dominant. This conversion mainly results from decreased transcription of the gamma globin 0 genes and increased transcription of the beta globin genes. in the middle; Normal adult blood contains only about 77 HOF” although levels of the HBF residue are more than 100-fold different in healthy adults (Semin.

Hematol. 38(4):367-73 (2001) “Atweh” ) These disorders also include genetic defects that result in the production of abnormal hemoglobin with an associated impaired ability to maintain oxygen concentration. Some of these disorders include failure to produce normal globin in sufficient amounts; Others involve failure to produce completely normal globin. Disorders associated with the B-globin protein are generally referred to as hemoglobinopathies. For example JB produces marine anemia | From a partial or total defect in the genetic expression of the globin 1 gene “ff” resulting in a deficient or non-existent HDA. Sickle cell anemia results from a single nucleotide mutation in the structural globin [3] gene; resulting in the production of abnormal sickle cell hemoglobin (HBS) HBS RBCs are more fragile than normal RBCs and undergo hemolysis easily; Which ultimately leads to anemia (Semin.

Hematol. 38(4):367-73 (2001) Atweh) Furthermore, “the presence of the BCLITA gene variant and HBSIL-MYB variants improve clinical risk in beta marine anemia. This variant was found to be associated with HOF levels. Here it is shown that there is a difference ratio of ∼ for a less severe beta thalassemia profile with a high HEF variant (in press “Blood 2009” Galanello 5. et al.) The research focuses The therapeutic potential of these approaches is suggested by observations of the mild phenotype of individuals with common genetic traits of anemia. Marine blood B homogenate and genetic sustainability of hereditary hemoglobin CAR

— a — persistent fetal hemoglobin (HPFH) plus patients with homozygous pall3 marine anemia who do not produce hemoglobin in adults; However, a low requirement for blood transfusions is observed in the presence of high concentrations of genetic hemoglobin. Furthermore it; A certain group of adult patients with M series abnormalities has been observed to have levels above normal 5 of the gene hemoglobin H bF ( » and have been observed to have a clinical course of disease more Vise! than patients with normal levels of HPF in adults.For example, JED, a group of Saudi patients with sickle cell anemia and genetically expressing 71-770 HBF have only mild clinical manifestations of Br disease. et al. (Pembrey) Haematol 40: 415-429 (1978) L. It is now accepted that hemoglobin 0 disorders such as sickle cell anemia and marine anemia are ameliorated by increased L-107 production. Reviewed in Jane and Cunningham Br. J. Haematol. 102: 415-422 (1998)) (N. Engl. J. Med. 328: 129-131 (1993) Bunn. Although the molecular mechanisms that control developmental transfer in vivo are genetic expression The globin 7 gene to M is currently known; there is accumulating evidence that external factors can influence the genotyped expression of the globin 7 gene. HBF activation (sale) detected to have activity -0 that was first shown using Algal) by HEF processing is an initiating synthesis of

Proc Natl Acad Sci No 5 A. (DeSimone) Azacitidine in Experimental Animals (1982) 79(14):4428-31). Subsequently, studies confirming the ability of © -azacytidine | 0 on an increase in HDF in patients with anemia (Bad) and sickle cell disease et Ley, 307: 1469-1475 (1982) «N. Engl. J. Medicine cet al. (Ley) (Blood 62: 370-380 (1983)” al. Additional experiments show that monkeys treated with cytotoxic doses of arabinocytosine (Ch) responded to significant elevations in retinal cells, Science. 224(4649):617-9 Papayannopoulou et al.) F Yo (1984)); Treatment with hydroxyurealy sy induced globin 7 in monkeys or monkeys et al. al.) p. (1984) 310(14):869-73 Engl J Med. l1).

—vo- The ability of group II compounds to induce HBF (Lisi sale) activity was validated with 05 86 short chain fatty acids. Initial observation in fetal cord blood progenitor cells led to the discovery that y-aminobutyric acid can act as an inducer of fetal hemoglobin Biochem (Perrine et al.) yell. (Biophys Res Commun. 148(2):694-700 (1987) © Subsequent studies show that butyrate stimulates globin production in adult monkeys Blood. 000518010018165 et al.) ¢Dec (1988) 72(6): 1961-7) and also induce globin 7 in progenitor erythrocyte-like cells in adult animals or patients with sickle cell blood. (Perrine et al.) (1989) 74(1):454-9). Short-chain fatty acid derivatives, Jie phenyl (Br J Haematol. 83(3):555-61 (1994) Dover et al.) butyrate 1/816a5ala080m 0 1: Blood. 186(8):3227-35 “Liakopoulou et al.) valproic acid and valproic acid in vivo. Given the large number of isotopes or derivatives of HBF acids that induce the short-chain fatty acids (1995) of this family, there are a number of potential compounds of this family that are more effective than butyrate50173816. It was considered that phenyl acids acetic

Blood Cells Mall Dis. 101461500 et al.) phenylalkyl and phenylalkyl phenylacetic Yo potential HBF Subsequent studies; They are Ui-modifiers which were discovered ¢(22(2):150-8. (1996) The use of butyrate or Jal remains as they belong to this family of compounds. However, at its time it is in poverty Sickle cell or marine anemia is under trial and cannot be recommended for sual therapy outside of clinical trials. The range of these compounds is Jie©-azacytidine, hydroxyurealys, recombinant human erythrocyte recombination, and butyric acid analogues; In addition to combinations thereof. After these studies; Hydroxyurea has been used to induce HDF in humans and the latter became the first and only Yo-ho drug approved by the (FDA) Food and Drug Administration for the treatment of hemoglobinopathies. With cell variability in defects indicates that there is something wrong with the long-term use of these agents or treatments;

-?-

Including unwanted side effects and change in patient responses. For example (JO) Although hydroxyurea induces HBF production and has been shown to reduce sickle cell crisis in the blood clinically; it is possibly limited by myelotoxicity and the risk of carcinogenesis. Potential long-term carcinogenesis may also exist. In azacitidine-based therapies 0 Erythrocyte component-based therapies have not been shown to be stable in a range of patient populations Short half-lives of butyric acid in the body all showed a potential drawback in the suitability of these compounds for use in interventions Furthermore, very high doses of butyric acid are required to induce genetic expression of the oy globin gene, which requires catheterization for sustained diffusion of the compound. Moreover, high doses of 0-butyric acid can be associated with neurotoxicity. More than one Blood 81 member was damaged: «et al.

Blau (1993) 529-537. Although even a slight increase in HBF levels is beneficial in sickle cell disease; Marine pal anemia requires a much higher augmentation which cannot be reliably or safely achieved by any of the agents currently in use (Seminars 0 Olivier)

(Hematology 33: 24-42 (1996) 0.) Identification of natural regulators of HPF induction and production may provide a means to elicit therapeutic interactions lam on the multiple defects of the compounds described above. Genome-wide association insights into the genetic basis of multiple complex diseases and their implications (McCarthy et al.) Manolio et. al.

J Clin Invest 118356 (2008) Nat Rev Genet 9 1590 xe. (2008) that, in the majority of cases, the link between genetic association and pathophysiology has not been detected. Nathan and 0505 hematology of (Nathan et. al.) (XI 0. «1864] xiv) pp. 2 v. “infancy and childhood ed. 6th 2003)). Extensive YO studies of two genomes identified three major loci comprising a set of five single nucleotide polymorphisms (SNPs) of about

0 of the assorted images at the 167 levels. Proc Natl Acad Sci U 5 “Lettre et al.) Menzel ¢1620 (2008) “Proc Natl Acad Sci U 5 A 105 Uda et al. “A (2008) Nat Genet 39 cet al. (2007) 1197 Furthermore, many of these metamorphoses appear to predict clinical severity of sickle cell disease (Proc Natl Acad Sci” Lettre et al.) A (2008) © 5 no) and at least one of these SNPs could influence clinical outcome in marine anemia (Proc Natl Acad Sci U 5 A 105 Uda et al.) (2008) 1620 . The SNPs with the greatest effect are placed; Which explains more than 7,010 variant motifs in the HOF in the second intron of the gene on chromosome ¢F 80111/8. Where the role of 80111/8 has been verified; C2H2 zinc finger transcription factor in lymphocyte development Nat Immunol 4 Liu et al. Mol Cancer 5 Liu et al. Its role in red blood cell production or regulation of the globin gene has not been determined. At the beginning of the era of DNA resulting from genetic recombination; Studies of the structure of the globin gene provided a strong molecular basis for examining the conversion of embryonic globin. Much effort has been focused on identifying elements at the cis locus of the B gluten locus that are necessary for the proper regulation of genes in the BJ-like globin group 1. These studies rely on in-natural mutations and deletions that surprisingly affect HOF levels. in adults” that were attached by generating a transgenic ly mutant that comprises part of the pool Nathan and Oski's hematology “Nathan et. al.) (Xli p. 1864 xiv) pp. 2v. «of infancy and childhood ed. 6th 2003) and G. “Exp Hematol 33” Stamatoyannopoulos (2005) 259 Although the exact cis0 elements required for globin conversion remain undefined; findings in transgenic mice indicate that the globin 7 genes They are spontaneously dormant in the adult stage, a finding that is very consistent with the absence of embryonic-stage-specific activators or the presence of a stage-specific repressor gene.The results for gene association provide candidate genes to examine for their involvement in the control of oy globin genes such as 80111/8. Blood Yo In one embodiment, the original cell is contacted to form blood ex vivo or in vitro. In a specific embodiment, the cell that is contacted is a cell of an erythrocyte lineage

M+- -the erythroid lineage In one embodiment, the cell composition includes cells that have low expression of BCL1IA. Elevation of all types of WA blood Ly including myeloid cells (monocytes; macrophages; neutrophils; WIA “basophils”). eosinophils ¢ red blood cells erythrocytes; megakaryocytes / platelets ¢ dendritic cells and lymphoid cell lineages (NK BT WDA) lineages The term “cell of an erythrocyte-like progeny” refers to a cell in contact with a cell that undergoes erythropoiesis and which after final differentiation forms a erythrocyte or a red blood cell (RBC) ax .80 those cells into one of three cell lineage; erythrocyte-like cells; lymphocytes and myeloid cells; Law From the original blood cells to the bone marrow. Once exposed to specific growth factors and other components of the hematopoietic microenvironment, progenitor cells can mature to form a pall through a combination of differentiation intermediate 0 cell types and intermediate compounds of the erythrocyte lineage P4805. Hence; The term cellular ADL includes erythrocyte-like cells » as used herein on hematopoietic progenitor cells », rubriblasts » prorubricytes » and erythroblasts ; Metarubricytes, reticulocytes, and erythrocytes. 0 In some embodiment, the hematopoietic progenitor cell includes at least one of the hematopoietic progenitor cell surface marker profiles: +Thyl/CD90, +CD34, +00059, +/ -/ 003810 , and C-kit/CDI +17. Preferably, the progenitor cells of hematopoiesis contain many of these markers. In some embodiments, hematopoietic progenitor cells of the erythroid lineage include a characterization of the erythroid lineage cell surface index: 1071© and 19 160.

ve

Stem cells are; Like the original cells to form hematopoietic blood Progenitor cells ¢ are able to multiply and lead to an increase in the original cells that have the ability to

The generation of a large number of mother cells, which in turn leads to an increase in differentiated or differentiated daughter cells. maybe

Induce the same daughter cells to reproduce lly the offspring of which Lad after differentiates into one or more cell types

© mature cell; Law Lad One or more cells are retained with the possibility of maternal development. Thus, the term "stem cell" refers to a cell that has the ability or potential, under specified conditions, to

differentiation into a more specialized phenotype or dia that sequesters the ability” under specific conditions; on

Reproduction without differentiation to a large extent. In one embodiment, the term progenitor or stem cell refers to a mother cell

In general, which specializes the descendant (offspring) of Baha Sale in different directions; by «pal on

Vs for example by fully acquiring individual traits; Which leads to an advanced multiplicity of embryonic cells and tissues. Cell differentiation is a complex process that typically occurs through many cell divisions. A differentiated cell can be derived from a pluripotent cell which is derived from a pluripotent cell, and so on. While each of the aforementioned multipotent cells can be considered as a

stem cells The extent to which each cell type leads to an increase in differentiated cells can vary.

0 Some differentiated cells also have the ability to multiply cells that have a greater potential for development. This ability can be natural or Lia can be naturally regenerated when treated by various factors. in many biological situations; Stem cells are also 'pluripotent' because they can produce more offspring

of a distinct cell type but not considered required for "stem". Self-renewal is another traditional part of the definition of a stem cell; it is considered essential as used in this document. Theoretically, it could happen.

0 . Self-renewal by either of two primary mechanisms. Bla' stem cells can divide with one daughter cell retaining the stem state and the other genetically expressing some other specific characteristic function and phenotype. alternatively Some stem cells in a group can divide identically into

two stem cells Thus preserving some WAN stem cells in the JSS while other cells in the cluster only increase the differentiated offspring. In general, the original DAL is

YO is a cellular phenotype that is more primitive (ie, it is an older step along an evolutionary or progressive pathway than a fully differentiated cell). dale The original cells have a high or very high reproductive potential. can go up

‎CAR

1 “= progenitor cells into multiple distinct differentiated cell types or into a single differentiated cell type; Based on the developmental pathway and the environment in which cells develop and differentiate. in the context of cell genesis; The adjective 'differentiated' or 'lal' is a relative term. A 'differentiated cell' is a cell that has advanced further in development than the cell with which it is compared. Thus, stem cells can differentiate into progenitor cells with restricted cellular smoothness Jia) progenitor opal-forming cells which in turn can differentiate into other types of progenitor cells further down the pathway (eg erythrocyte-producing substance Arig ¢ (s) that dale stage of a differentiated cell; such as corpuscle erythrocytes, which play an ase role in a particular type of tissue and may or may not retain the ability to proliferate iPS cells 0 In some embodiments, the engineered human cells Las described in the present submission are derived from stem cells Isolated pluripotency.The advantage of using 105605 is that the cells can be derived from the same subject as the progenitor cells are given.That is, a somatic cell can be obtained from a subject, reprogrammed into an iPS cell, and then sold ) differentiated into a hematopoietic progenitor cell that will be given to subject (eg, autologous 1 cells). Because oF progenitor cells are primarily derived from an autologous source, the risk of graft rejection or allergic responses is reduced compared to using cells from another subject or group of subjects. In some embodiments, hematopoietic progenitor cells are derived from non-autologous sources. In addition, the use of iPSCs eliminates the need for cells obtained from an embryonic source. Thus, in one embodiment, the stem cells used in the methods disclosed are not embryonic stem cells. Although differentiation is generally not reversible under physiological contexts, several methods have recently been developed to recreate Programming of somatic cells into induced pluripotent stem cells. Representative methods are known to those skilled in the art and are briefly described in the present application below. As used in the present application, the term 'reprogramming' refers to a Jad process or reflects the state of Yo in a differentiated Jo cell (eg, a somatic cell). In another way, CAR reprogramming refers to yy Programming to the process of directing cell differentiation backwards into one or more undifferentiated progenitor cells. It should be noted that placing too many progenitor cells in homeostasis may result in some loss of fully differentiated traits. Therefore, it simply does not make the cells stable mentioned contained in the term cells e.g., undifferentiated cells (Ho) differentiated from these cells are undifferentiated cells or pluripotent cells. The transition of a differentiated cell to pluripotent potential requires a further reprogramming The stimulus that leads to a partial loss of differentiation in the homeostasis. Reprogrammed cells also have the characteristics of the ability to pass extensively without loss of growth potential, relative to the primary cell parents, which generally have the capacity for a limited number of divisions only in culture on an installation or peripheral before reprogramming z Lia reprogrammed either differentiated sale] The cell to be studied may be 0 models, reprogramming involves an entire inversion of a differentiated cell state (eg, a somatic cell) into a pluripotent state or a multiactivity state. In some embodiments, reprogramming involves complete or partial reversal of the differentiation state of a differentiated cell (eg, a somatic cell) into an undifferentiated cell (eg an embryonic-like cell). , embryonic cell sale) the expression of specific genes by cells, the expression of which furthermore contributes to VO programming. In specific models described herein, reprogramming of a differentiated cell (eg somatic) causes The differentiated cell assumes an undifferentiated state (for example, an Ada cell, a reprogrammed JA, or a stem cell (sale) is undifferentiated). The resulting cells are referred to as “mutated cells” (iPS) or induced pluripotentiation (IPSCs) cells. Reprogramming may involve switching, for example, inverting, at least some of the Yo ais, (methylation) phenotypes (eg, methylation of nucleic acid to modify nucleic acid) Epigenetic changes, genomic printing, etc., that occur during cellular chromatin differentiation. Reprogramming is distinct from the simplistic preservation of the existing undifferentiated state of the cell. Truly pluripotent or maintaining less than the existing differentiated state of a cell that is already a cell Reprogramming is also distinct from pall Multiactivity (eg, a yo-forming stem cell) Promote self-renewal or proliferation of cells that Be truly all-in-one or multi-functional, on the

CAR

7For although the compositions and methods described in the present application may also be used for the said purpose, in some embodiments. The particular method or method used to generate pluripotent stem cells from somatic cells ([led] broadly referred to as 're-(aad') is not critical to the claimed patent. Hence, any method that reprograms the somatic cell into the species The pluripotent analogues are suitable for use in the methods described in the present submission Reprogramming approaches to generate pluripotent cells using specific combinations of iPS cell transcription factors Yamanaka and Takahashi converted somatic cells in the period into cell-like cells ES with potential for expanded development by direct conversion 0 to (Takahashi and Yamanaka, 2006) c-Myc, KIf4, Sox2, Oct4 5 cells resemble ES because they restore the pluripotency-associated 5 MUC transcriptional circuitry. In addition, the 10505 fulfills all standard experiments for pluripotency: namely, in vitro differentiation into cell types of three germ layers, teratoma formation, contribution to chimeras, germline transfer, (Maherali and Hochedli). Nger, 2008) germline transmission diss; Vo tetraploid (Woltjen et al., 2009). The following studies indicated that human iPS cells can be obtained using similar transduction methods Lowry et al., 2008; Park et al., 2008; Takahashi et al. ., 2007; Yu et al., (Jules, 2007b) transcription (0CT4, SOX2 trio, and NANOG), identified as the core group of transcription factors governing pluripotency (2008) (Jaenisch and Young, 2008). Producing iPS cells daly Yo Delivering amino acid sequences that encode genes associated with a stem cell in an adult, the somatic cell, historically using viral expression vectors iPS cells can be generated or derived from terminally differentiated somatic cells, as well as from adult stem, or somatic stem cells.In other words, a non-pluripotent progenitor cell can be made pluripotent or multifunctional by reprogramming.In the cases mentioned, it may not be necessary to include as many reprogramming factors as are required to reprogram a differentiated cell

Sala

peripherally. Additionally, reprogramming can be induced by the introduction of non-viral reprogramming factors, for example, by the introduction of the proteins themselves, or by the introduction of nucleic acids encoding the reprogramming factors, or by the introduction of messenger RNAs which, once genetically translated, produce sale factors Reprogramming (see, for example, Warren et al., Cell Stem Cell, 2010 Nov © o(5;7(5):618-30) Reprogramming can be accomplished by introducing combinations of nucleic acids They encode stem cell related genes including, for example, Jia 00-4 (also known as Oct=3/4, Sox 15, Sox3, Sox2, Sox3, Sox2, Pouf51, and Sox18). , , KIfl 12 no 4, LIN28, LIN28, 161, Rem2, n-Myc, Myc-) , c-Myc, NR5A2 5 (in one embodiment, sale) includes programming using the methods and constructs described in the present order plus In addition, one or more 001-3/4, a member of the SOX family, a member of the KIf family, and a member of the Myc family of the somatic cell were introduced into the somatic cell.In one embodiment, the methods and constructs described in The current order furthermore contains one or more entries from each of the 4 c-MYC, Nanog, Sox2 ,0ct and 14 are not reprogrammable. As noted above, the specific method used for reprogramming is not necessarily critical to the methods and combinations described in the present application. However, where it is desired to use das1 cells differentiated from cells that have been reprogrammed to, for example, treat humans, in an embodiment the reprogramming of das is not done by the genome-altering method. Thus, in the said models, reprogramming is achieved,

For example, without the use of an expression vector plasmid or viral plasmid vectors the reprogramming efficiency (ie, the number of reprogrammed cells) derived from a group of initiating cells can be improved by adding several small molecules as shown by Shi, Y. , et al Cell-Stem Cell 2:525-528, Huangfu, D., et al (2008) Nature 0 (2008) Biotechnology 26(7): 195-7191, and Marson, A., et al. (2008) Cell-Stem Cell 3:132-5.Therefore, an agent or combination of factors that improve the efficiency or rate of iPSC production can be used to produce patient or disease-specific IPSCs.Some examples of non-exclusive agents include that improve the efficiency of [sale] Programming on Wit soluble, bit-formatted medium BIX-01294 (G9a Wnt Yo) histone methyltransferase 1805781856 No 00810 (histone 1 (MEK) bound) methyltransferase inhibitors DNA methyltransferase, repressors

Histone deacetylase (HDAC) valproic acid —'s , valproic acid azacytidine , dexamethasone , superyl anylide 50061080118 , hydroxamic acid (/1a/5), vitamin C, and Tri Costatin 110051817 (TSA), among others. © Other, non-exclusive examples of reprogramming enhancing agents include: Suberoylanilide Hydroxamic Acid 610 Ae (SAHA) eg, 3, vorinostat (and other hydroxamic acids), Depudecin, BML- 210 (eg, Depudecin), HC Toxin, Nullscript (4-(1,3-Dioxo-IH,3H—(-) J a4, (benzo[de]isoquinolin-2-yl)-N -hydroxybutanamide | Sodium 207 , Trichostatin A (TSA) 10000518110, Compound M Apcidin , APHA Sodium Butyrate Sodium Vo 817/1816 , Bivaloyloxymethyl butyrate (Pivanex, AN-9) pivaloyloxymethyl butyrate Trapoxin 8 , 001800700610 , Depsipeptide (also known as FR901228 or FK228), benzamides (eg, 1-994 (He) eg, L1-Acetyldynaline NVP- LAQ-824, MGC DO0103 (MS-27-275 (N-acetyl dinaline) CBHA (10-carboxycinnaminic acid) hydroxamic acid—A , Tubacin , JNJ16241199 (bishydroxamic acid VY.17 1, proxamide) proxamide, oxamflatin, 3-C1-UCHA, oxamflatin (eg, -3)-6, CHAP31, (chlorophenylureido)caproic hydroxamic 0 and 50, CHAP. Other reprogramming enhancing agents include, for example, Predominant negatives from HDACS (eg, catalytically inactive images), siRNA anticoagulants for HDACs, and © antibodies that bind specifically to 5/10. Said inhibitors are available, for example, from BIOMOL International, Fukasawa, Merck Biosciences, Novartis, Gloucester oY AY

17

Pharmaceuticals, Aton Pharma, Titan Pharmaceuticals, Schering AG, Sigma Aldrich 4 , Pharmion, MethylGene To confirm the induction of pluripotent stem cells for use in the methods described herein, isolated clones can be tested for expression of a stem cell marker. This expression in a cell derived from is known as an induced pluripotent stem cell. Stem cell markers DAY somatic cell © Ecatl, ZL, Nanog, CD9, SSEA4, SSEA3 can be selected from the non-exclusive set including in one of 0 Natl 5 Utfl , Rex| In Slc2a3, Zpf296, Daxl, Cripto, Fgf4, 5013, Eras, Esgl models, a cell that expresses 0014 or 8009 is identified by the name all-in. Methods for detecting expression of said markers may include, for example, or Westen flow analyses such as Westen blot, encoded polypeptides: sic presence of polypeptides 0 detection of protein markers Lad only, but RT-PCR the cells. In some embodiments, detection is not included via 068-81, while (did) intercellular markers can be quickly identified as cell surface markers, for example, by immunocytochemistry. Confirmation of the pluripotent stem cell characteristics of the isolated cells by assays assessing the ability of 1 Kg to differentiate into cells of each of the three germ layers. As an example, 5 teratogenesis in the hairless protuberances can be used to assess the pluripotency of isolated clones Cells are introduced into hairless mice and histopathologic analysis and/or immunohistochemistry is performed on the tumor arising from the cells Tumor growth includes cells from all three germ layers, for example, and furthermore indicates Somatic cells, as the term is used in the present application, mean any cells that make up the body of an organism — mammalian body ill, with the exception of germline cells. cell in a body, etc The cells from which they are formed (gametophytes, sperm apart from eggs, sperm, and undifferentiated stem cells) form the differentiated somatic cell. For example (gametocytes Yo

SRV

Metal, internal organs, skin, bones, blood, and connective tissue, all made of somatic cells. differentiated somatic cells Additional somatic cell types for use with the structures and methods described in the present application include muscle cell (primary fibroblast) myocyte (for example, a muscle cell (lo) © and pancreatic islet cell hepatocyte hepatic cell “mammary cell ius cell” s neural cell) in some embodiments, the somatic cell is a progenitor cell or is 4 pancreatic islet cell A precursor of a primary or secondary cell lineage. In some embodiments, the somatic cell is obtained from a sample; blood sample due human hair follicle, for example, hair follicle “(adipose biopsy or skin biopsy le) biopsy ~~ 0 and is Hence the cell (oral swab sample) and a swab sample (eg, human somatic oral swab sample). Some non-exhaustive examples of somatically differentiated cells include, but are not limited to, adipose; neuronal; endothelial nerve; epithelial Adal cell; immune cells; skeletal muscle; skeletal muscle; cardiac; Yo circulating blood; blood cells; lung; lung; WA «splenic spleen hepatic liver cells renal bone marrow cells kidney cells gastrointestinal tract LDA cells in some embodiments the somatic cell may be the pancreatic cell and bone marrow cells of the pancreas , brain, isolated from any bodily tissue including, but not limited to, the brain, the muscle, the fat, the intestine, the stomach, the alimentary canal, the stomach , liver yo endocrine ; systemic endocrine spleen ¢ skin; The skin, the uterus, the uterus, the muscle, etc. In addition, the somatic cell may be of any skeletal species, with bone and bone 7 apes; pigs; horses; The sheep or the cell JEN yall includes non-exhaustive examples of human cells. In some embodiments, the somatic cell is the human somatic cell. When using reprogrammed cells used to generate primary hematopoietic cells for use in the therapeutic YO treatment of disease, it is desirable, but not necessary, to use somatic cells isolated from

—yy— The patient being treated. For example, somatic cells involved in diseases, somatic cells involved in the curative treatment of diseases and the like can be used. In some embodiments, reprogramming can be performed from a heterogeneous population comprising recombinant cells [Sale] method of selecting reprogrammed cells and somatic cells derived or regenerated by any known means. For example, the LDA could be reprogrammed using a drug resistance gene or similar, such as a selectable marker gene to isolate © using the selectable marker as an indicator. Program it as disclosed in the present application for any sale) somatic cells that have alkaline phosphatase can express a number of pluripotent cell markers, including: alkaline phosphatase 0-stage specific embryonic antigen JABCG2 (AP) ;Tra—2-49 /6E ;TRA-1-81 ;1.-TRA-1 ;SSEA-4 ;SSEA-3 ;(SSEA-1) 0 smooth 2-smooth muscle actin tubulin 0)-m-tubulin ;E— cadherin , Eras/ECATS ,Cripto, (Fof4) ¢ fibroblast growth factor (a-SMA) muscle actin transferase Letesa-11:210296( 77 206 finger protein ; Dax (ECATI) ES 1) cell-associated transcriptase j(Natl) 10- acetyltransferase ECAT10, M: M: 4; ECATT: Mn: 6; ECAT3; ESG1/DPPAS/ECAT2 0 Non-fetal cell transcription factor differentiated (A17 no): All4: 1017; ECAT15-2; ECAT15-1 including 141: silent chromosome telomera genes se 53m: 53011: Rex telomerase containing F-box; TRIM28; Dnmt3b; Dnmt3a; silent X chromosome genes; TDGF1; Esrb; c-Myc; KIf4; Sox2; Oct3/4; Nanog/ECAT4; (FbxI5) 11) pluripotency protein associated with ?CYP25A1;GDF3;FoxD3;Zfp42;GABRB3 0 000 8:) of cell 11 (18th) lymphoma cleavage point lymphoma (DPPA2) Other general markers of pluripotency potential, etc. Other markers may include : 0004 also mentioned WAY. Bmil 5 ,p—catenin ;Grb2 ;Stat3 ;Sox|5 ;Dnmt3L can be characterized by the down-regulation of markers characteristic of the somatic cell from which the iPS cell is derived

Jee is versatile YO

DNAS mes genomic modification and indonuclease targets

VA

As used in the present application, the term "genomic modification" refers to a reverse genetics method that uses synthetically engineered nucleases to cut and form specific double-strand breaks at the desired site(s) in the genome, which are then repaired by cellular processes homologous recombination (FR) seal), non-homologous Jie and homology directed repair (104) 2 in a double-stranded separation, whereas DNA Directly NHEJ ends join the missing .end—joining (NFfEJ) at the point of separation. DNA Generate a soley sequence Homologous sequence as template HDR Uses Genomic modification cannot be performed using conventional restriction endonucleases because most restriction enzymes are not known As its target and the probability is very high that the DNA combination is found on a few base pairs in a base pair that has been identified in many locations throughout the genome resulting in many Vo segments (ie, not limited to the desired location To overcome this challenge, the composition of the double breakaways Due to the site-specific strand, many distinct classes of bioengineered and bioengineered nucleases have been discovered to date. First, Zinc finger nucleases (ZFNs) These are meganucleases, zinc finger nucleases, effector nucleases and effector nucleases. , 0859/0415. (TALENSs) transcription-activator yo are commonly grouped into four groups: the group of meganucleases. GIY-YIG group, LAGLIDADG groups with structural elements, affect catalytic activity and cognitive continuum. For example, it is characterized by having either one or two copies of the LAGLIDADG element Members of the collection

Chevalier et al. (2001), Nucleic Acids Res. 29 (18): conserved (see LAGLIDADG 0 with one copy of the LAGLIDADG element form). Meganuclease 3757-4 was found as homodimers, while members of with two copies of the LAGLIDADG element were found as Monomers. Similarly, members of the 617-716 group have LAGLIDADG residues in length and comprise four or five 001-71 which range from GIY-YIG Van Roey units of conserved sequence elements with four invariant residues. , two of which are required for activity (see YO characterizing meganucleases.)©] al. (2002), Nature Structure. Biol. 9: 806-811 oY AY

14 histidines contain highly conserved histidine sequences His—Cys box meganucleases over a region of several hundred amino acid residues (see CYStEINeS and cysteine in the case of Chevalier et al. (2001), Nucleic Acids Res. 29(18): 3757-4 Members are defined by elements containing two histidine pairs NHN Chevalier et al. (2001) group (see asparagine © The four groups of meganucleases (Nucleic Acids Res. 29(18): 3757-3774) are largely independent of each other in terms of conservative structural properties and, thus, catalytic activity gall and DNA activity. Sequence specificity is recognized. Meganucleases are commonly found in microbial species and have the unique property which makes them therefore highly specific (bp VE<) of having extremely long 0 grasping sequences naturally cut at the desired location.This can be exploited to make specific double-stranded dissociations Location in genomic modification So skilled in the field can use this MN It occurs naturally, however the number of naturally occurring meganucleases mentioned is limited. To overcome this challenge, high-throughput mutagenesis and screening methods were used to generate variants of meganucleases that recognize unique sequences. For example, several meganucleases combine to form hybrid 0 enzymes that recognize a new sequence. Alternatively, the RAAs can be swapped

A for a meganuclease to design a sequence-specific meganuclease (see, for example, US Patent No.

Certo, meganucleases can be engineered using the methods described in, for example, (ATY 071:707,777 4 A US Patent Nos. MT et al. Nature Method (2012) 9:073-975

VEY OA Cr ITY KD A IY AYIA NYE JA GYAY NYA LA GATY Zulf JAY whose contents are listed for reference in , 24,117 A TAZH 18 R8 »: or VEY A Ye the current order in its entirety. Alternatively, meganucleases with specific cutting properties can be obtained

Precision Biosciences' Directed Site Using Commercially Available Technologies For compliance, Neoclease Editor™ Gemnomeic Editing technology is bound to DNA from an unspecified cutting enzyme TALENS 5 2215 endonuclease restriction technology utilizes YO zinc fingerselsyll fingers Jie A specific peptide that recognizes DNA peptides by sequence

“Aa. transcription activator-like effectors (TALEs) and transcription activator-like effectors (TALEs) and its cleavage site are separated Typically, the endonuclease that is the recognition site is selected from each other, its cleavage part is separated, and then linked to a peptide that recognizes the sequence. Therefore, we get an endononuclease with very high specificity for the desired sequence. A representative restriction enzyme additionally with the advantage of needing a dimer to have Fokl with the said properties is 0,4. © has nuclease activity, which means significantly increased privacy with each nuclease partner identifying a genetic sequence that can only perform a unique Fokl function. To enhance this effect, DNA nucleases have been engineered and have increased catalytic activity. A nuclease that performs the homodimer function avoids the possibility of unwanted homodimer activity and thus increases the specificity of double-stranded separation. 0 has similar properties, but the difference is TALENS and ZFNs, although Nuclease parts for each of the ZFNs on zinc fingers depend on DNA lies in the Lys recognition peptide between these engineered nucleases as DNA in 18155. Both domains of a peptide that recognizes TALENSs are characterized; Cys2-His2

Cys2-His2 is found naturally in combinations in its proteins. Zinc fingers occur in various combinations in Lede typically in repeats that are spaced 3 50 ft apart, and 1 stall is found in a variety of nucleic acid-interacting proteins such as transcription factors. Repeats, on the other hand, with a one-to-one recognition ratio between amino acid and TALES pairs in repeat patterns, TALES 5 nucleotides are identified. Due to the occurrence of both zinc fingers, various combinations can be experimented with to create a wide range of sequence specificities. Methods for manufacturing site-specific zinc finger endonucleases include, for example, a modular assembly (where 0 low lial OPEN zinc fingers bind to a triplet sequence connected in a row to cover the desired sequence), stringency of peptide domains against triple nucleotides followed by highly stringent selections of peptide combinations against the final target in bacterial systems), and single-bacterial hybrid screening of zinc finger populations, for use with the methods and formulations described in the application (ZFNs, among others). The current Sangamo Biosciences™ (Richmond, CA) can be obtained commercially. For example, Yo

CAN

For genome editing with the Cas9/CRISPR methods it is expected in the present submission to use the system and constructs described in the present submission. Systems of repeats that aggregate regularly and are spaced between are useful in modifying (Cas ddaiyal-CRISPR)/CRISPR) short palindromic repeats.

Jinek, M. et al. Science (eg, hil) (2012) 337 (6096): 816-821. Alternatively, genome editing can be done by genetically engineering a genome based on a virus that serves as a platform. Genomic modification around adenoviral vectors (FAAV) of DNA recombinant product used that help insert, delete or replace AAV expressing acid sequences into the genomes of living mammalian cells. Single-stranded Sense or Sense, We, single-stranded deoxyribonucleic acid (ssDNA) 0 Single-stranded DNA of about 4.7 kb long. sole) have high conversion rates and have the unique property of double-stranded induction in the genome. Those who are skilled in the field can homogeneous DNA in the absence of separations

Lindl to target the genomic location and make each of the autologous TAAV gene alterations design an expression vector with a feature targeting the FAAV deletion allele. The total and/or absolute genomic modification of Jie, dda in Vo is a single TAA and does not result in any off-target genomic alterations. Genome editing technology

Cambridge, ) Horizon™ rAAV Genes IS™ system Commercially available, e.g., UK Pharmaceutical acceptable carriers Methods for administering human hematopoietic progenitor cells to a subject as described in this Order 0 include the use of therapeutic combinations Include hematopoietic progenitor cells Therapeutic formulations contain a physiologically tolerable carrier in addition to the cell composition and optionally at least one additional bioactive agent as described in the present order, dissolved or dispersed therein as an active ingredient.In a preferred embodiment, The therapeutic composition is not highly immunogenic when administered to a breast or human patient for therapeutic purposes, unless indicated. Yo

CAR

-7m- Generally, the blood-forming progenitor cells described in the present application are administered as a suspension with a pharmaceutically acceptable carrier. Those skilled in the art will understand that a pharmaceutically acceptable carrier to be used in a cell preparation will not include buffer solutions, compounds, cryopreserving agents, preservatives, or other agents in amounts that materially interfere with the viability of cells to be delivered to the subject. © A cell-based formulation may include, for example, osmotic buffer solutions that allow maintenance of cell membrane integrity and, optionally, nutrients to maintain cell viability or enhance taste upon administration. Said formulas and suspensions shall be known to those skilled in the art and/or may be adapted for use with original hematopoietic cells as described in the present order using routine experiments. Vs A cell formulation may also be emulsified or presented as a lipid formulation, provided that the emulsification procedure does not adversely affect cell viability. Cells and any other active ingredient may be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient and in quantities suitable for use in the therapeutic methods described in the present application. Additional agents included in a cell formulation as described herein may include pharmaceutically acceptable VO salts from constituents therein. Pharmaceutically acceptable salts include acid addition salts (formed using free amino groups of polypeptide 0017060106 ) formed using inorganic acids such as, for example (mea, JU hydrochloric or phosphoric or Those organic acids such as acetic acid, tartaric, mandelic, Yo, etc. The salts formed with free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, potassium; ammonium, ammonium, calcium, or iron hydroxides, ferric hydroxides, and these organic bases such as isopropylamine, siva amine, trimethylamine. ethylamino ethanol « histidine , YO , procaine , etc. Physiologically tolerable carriers are well known in the art. Typical liquid carriers are sterile aqueous solutions that do not contain substances in addition to the OY AY components ‏

or containing a buffer such as sodium phosphate at physiological pH values, physiological saline, or both, as phosphate buffered saline 00016. Still additionally, the aqueous carriers may include more than one brine buffer, as well as salts such as sodium, potassium chlorides, dextrose, polyethylene glycol, and other solutes. Liquid formulations may also contain liquid phases in addition to and with the exception of water. Examples of the additional liquid phases mentioned are glycerin, vegetable oils, jie, cottonseed oil, and water-containing emulsifiers. The amount of active compound used in cell formulations as described in the present order that is effective in treating a specific disorder or condition will depend on the nature of the disorder or condition, and may be determined by standard clinical techniques. Administration and efficacy According to their use in the present application, the terms “give,” “introduce” and “inculcate” are used interchangeably in the context of placing cells, eg JE) hematopoietic progenitor cells, as described in the present application in Submitted, by method or A pathway that results in at least Sia positioning of cells presented at the desired location 1, such as a locus of injury or repair, so as to produce the desired effects. Cells may be administered for example as hematopoietic progenitor cells, or progenitor cells differentiated from them by any suitable pathway resulting in delivery to the desired site in a subject where at least a portion of the implanted cells or components of the cells remain alive. The duration of cell viability after administration to a subject can be as short as a few hours, eg, twenty-four hours; A few (ald) or lasting for several years, ie, a long-lasting 0 graft. For example, in some embodiments of aspects described in the present application, an effective amount of hematopoietic progenitor cells is administered via the systemic route of administration, such as in the membrane Peritoneal or intravenous When presented prophylactically, hematopoietic progenitor cells described in the present application may be administered to a subject prior to any presentation of usta salopathy (eg, prior to switching from 7-fetal globin to a CAR

CAE

Mostly 8-globin. As such, prophylactic administration of a hematopoietic progenitor cell kit prevents hemoglobinopathies, as disclosed in the present order. When administered therapeutically, provide hematopoietic progenitor cells at (or after) onset of symptom or indication of impairment Hemoglobin, for example, at the onset of sickle cell disease. In some embodiments of the aspects described in the present application, the original cell population is given to form the blood according to the methods described in the present application and includes allogeneic hematopoietic progenitor cells obtained from one or more donors. As used in the present application, “allogeneic” refers to a hematopoietic progenitor cell or biological samples comprising hematopoietic progenitor cells obtained from one or more different donors of the same species, where the genes in one or more do not match from the positions. For example, a hematopoietic progenitor cell line may be given to a subject and be derived 0 from umbilical cord blood obtained from one or more unrelated subject donors, or from one or more non-identical brothers and sisters. In some embodiments, synergistic hematopoietic progenitor cell populations can be used, such as those obtained from genetically identical animals, or from identical twins. In other embodiments of this aspect, the progenitor cells of hematopoiesis are cells obtained or isolated from a subject and given an autologous pall: that is, the progenitor cells to be Vo to the same subject, that is, the donor and the recipient are similar., , For use in the various aspects described in the present order, an effective quantity of hematopoietic progenitor cells Hematopoietic precursor cells, 011 x 5 hematopoietic progenitor cells, at least 011 on Jas hematopoietic primary cells, At least 0 x 01 hematopoietic precursor cells, at least at least 017 Veo hematopoietic precursor cells, at least Veg xo hematopoietic precursor cells, at least 014 014 hematopoietic precursor cells

Adsl 015 x Hematopoietic Precursor Cells, at least ? Yeo x Y Hematopoietic Precursor, at least xo 015 Hematopoietic Precursor Cells, at least 015 x Hematopoietic Precursor Cells, on Hematopoietic precursor cells, Yeo xv Hematopoietic precursor cells, at least 015 xT Blood, at least Hematopoietic precursor cells, on Yeo x 9 Hematopoietic precursor cells, at least Yeo x A at least hematopoietic progenitor cells, at least 016 * Y hematopoietic precursor cells, at least xy 1011 at least Ye x 5 hematopoietic progenitor cells, at least x 016 hematopoietic precursor cells blood, at least; 7 01 ? CAR

—Ao—

Vel x 7 hematopoietic progenitor cells, at least 016 xT hematopoietic precursor cells, at least 0 cells Tx 9 hematopoietic progenitor cells, at least 011 x A hematopoietic progenitor cells, at least primary hematopoiesis, or its complications. The progenitor hematopoietic cells may be derived from one or more donors, or may be obtained from an autologous source. In some embodiments of the aspects described in the present application, the original cells are expanded to form blood in a homeostasis prior to administration to a 5-needed subject. In one embodiment, the term 'effective amount' as used in the present application denotes an amount A group of human primary hematopoietic cells or their precursor cells required to eliminate at least one or more of the symptoms of hemoglobinopathies, and related to a sufficient amount of a combination to provide the desired effect, therapeutically effective. Treating a subject with impaired hemoglobinuria. The term 0 is sufficient pall on it denotes an amount of hematopoietic progenitor cells or a formulation comprising SL hematopoietic progenitor cells to enhance a specified effect when administered to a typical subject, such as one with or at risk of hemoglobinopathies. The term effective quantity as used in the present application also includes a quantity sufficient to prevent or delay the progression of the disease symptom, alter the course of the disease symptom (including, but not limited to, slowing the progression of the disease symptom), or reverse the disease symptom. It should be recognized that in any given case, the correct Ve may be determined by one of ordinary skill in the art using routine experiments. Amount “dled” as used herein The term “give” refers to the setting of a hematopoietic stem cell composition according to Described in the present application in a subject by a method or course that entails locating a composition, at least, in the desired location. The cell composition can be administered by any suitable route Lipa the cell An effective treatment in the subject, that is, an administration that results in delivery to the site required in the subject aie Yo produce cells to Ex) where at least part of the composition has been delivered, i.e. at least the desired site for a period of time. Modes of administration include injection; infusion; instillation; Intramuscular or intravenous “injection” includes, but is not limited to, intravenous ¢ intraventricular Jala ¢ intrathecal Jala ¢ intra-arterial intra-arterial » ; via intracardiac Heart Jala « intraorbital ; J peritoneum ¢ intradermal dermis

At ¢ intraarticular joint Jala ¢ subcuticular under the epidermis ¢ subcutaneous under the skin intraspinal medulla Jala subarachnoid; subcapsular intrasternal cut and infusion Jala and injection ¢ intracerebro spinal cerebral-spinal Jada » For cell delivery, administration by injection or infusion is generally joint. Forms, cells as described in the present order are given systemically. The phrases “give a peripheral administration” “and it is given peripherally” according to its use in the request “les systemic,” “the current administration is given to give a group of primary blood-forming cells indirectly at the target site,” in a tissue, or an organ, so that it enters, instead, into the circulatory system of the subject and, consequently, is subject to metabolism and other processes. However, treatment is considered to be “effective treatment,” according to the use of the term in the present application, if any or all indications or symptoms, for example, fetal 0-globin levels, change in a beneficial way, and symptoms or disease markers improve clinically acceptable or attenuated following inhibitor therapy.Efficacy may also be measured 701 eg, by at least Lie YO by the individual's failure to exacerbate as assessed by hospitalization or need for medical interventions (eg For example, halting or at least slowing down the progression of the disease.) Methods for measuring these indicators are known to those skilled in the field The and/or described in the current application. Treatment includes any treatment of disease in an individual or animal (some non-exhaustive examples include human, mammal) and includes alleviation of (Y) inhibition of disease, eg stopping or slowing the progression of sepsis: or (1) on: Yo disease, for example, resulting in regression of symptoms: and (7) to prevent or reduce the possibility of development of infection or sepsis. A treatment of the present invention improves one or more of the symptoms: Symptoms associated with a beta-globin disorder by an increase in the amount of fetal hemoglobin in the individual. Typically, the symptoms of anemia and hypoxia of the JU are associated with hemoglobinopathies, including for example tissue YO; organ dysfunction and regression values. Abnormal hematoma; abnormal erythrocytes

— A 7 —

active » abnormal reticulocyte (erythrocyte) count; Abnormal iron load

iron load » and the presence of sideroblasts 9; and enlarged spleen

@impaired; Weak peripheral blood flow, hepatomegaly, and hepatomegaly «splenomegaly».

increased and increased hemolysis « dyspnea ; and shortness of breath peripheral blood flow

hemolysis©; jaundice; Pain crises related to anemia 306016

acute chest syndrome 80016; and splenic detention

hand-foot; hand and foot stroke; Stroke, priapism and priapism « sequestration

.angina pectoris and the pain 7 represents the angina pectoris syndrome

In one embodiment, the progenitor hematopoietic cell is contacted ex vivo or in vitro with a Vy-DNA targeting endonuclease, and the cell or its progenitor is administered to a mammal (eg, human).

In an additional embodiment, the original hematopoietic cell is a cell of the erythroid progeny. In one of the models, it is

Administration of a formulation comprising a hematopoietic progenitor cell previously contacted with an acid-targeting endonuclease

DNA and a pharmaceutically acceptable carrier.

In an embodiment, any method known in the art can be used to measure the increase in Vo expression of fetal hemoglobin, eg, Westen blot analysis for fetal hemoglobin

And quantification of TMRNA no-fetal globin.

In one embodiment, the original cell contacts to form a pall with an endonuclease that targets the DNA in

laboratory, or ex vivo. In one embodiment, the cell is of human origin (eg,

autologous or heterogeneous cell). In one embodiment, the combination causes an increase in the expression of 0 fetal hemoglobin.

The present invention may be defined in any of the following alphabetically numbered paragraphs:

[1] Method for Producing a Progenitor Cell Involving Low Expression of .118 801 MRNA or Protein,

The method involves contacting an isolated primary cell with an agent that binds the cell's genomic DNA at

UCSC Genome (according to assembly 117,778 Tom A WITT chromosome 7 locus)

_A A —_

Browser hg 19 human genome), and accordingly reduced mRNA or protein expression of 11 BCL

A

[B] A method for producing an isolated genetically engineered human cell that includes at least one genetic modification that includes

on contact of an isolated cell with an effective amount of a formulation comprising at least a DNA-targeting endonuclease© or an expression vector carrying the coding sequence of a DNA-targeting endonuclease that

Through it, the endonuclease targets DNA and cleave the genomic DNA of the cell on the chromosome.

Locus 60, Tem AS YT 748l7, 117 and causing at least one genetic modification there.

[C] The method according to para or [b], where an isolated protocell or an isolated cell is a protocell of formation

blood.

0 [d] the method according to [c], wherein the primary cell of the formation of the pal is a cell of the erythroid race. [a] The method according to [a] or [b], wherein an isolated progenitor cell or an isolated cell is an iPS cell.

[F] The method according to paragraph [C], where the original cell is touched to form blood outside the living organism or in the laboratory.

Ve ([g] method according to GY paras [a]-[f]), where at least one genetic modification is a deletion.

[h] The method according to [g], where the deletion eliminates the entire interchromosomal region? site 60, 7, 0-184 1, 774, 117 or gets rid of part of the region resulting in interruption of one or more sites hypersensitive to 1 (DHS) DNAse.

[i] An isolated genetically engineered human cell that has at least one genetic modification in a chromosome?

0 Location YA Tem A TT 117 pursuant to [b]-[h]. [j] turkeys containing genetically engineered human WA isolated from [i].

[k] A method for increasing fetal hemoglobin levels in a cell, the method includes steps: contact of an isolated cell with an effective amount of a formulation comprising at least a DNA-targeting endonuclease or a CAR transporter

A q —_ _ an expression carrying the coding sequence for a DNA-targeting indonuclease by which the endonuclease targets DNA and cleave the cell's genomic DNA on the chromosome? locus Cie LYYA LTS YAR 7 117 and causes at least one genetic modification therein, by which expression of fetal hemoglobin is increased in said cell, or its progenitor, relative to said cell before said contact. [L] The method according to paragraph [C], wherein the isolated cell is a primary hematopoietic cell. [M] The method according to [C] or [L], wherein the original hematopoietic cell is a cell of the erythroid lineage. That] the method according to paragraph [C], where the isolated cell is an induced pluripotent stem cell. [Q] The method according to paragraph [l] or [a] where the original cell is touched to form blood outside the living body or Yo in the laboratory. [p] The method according to any paragraphs [k]-[o], where at least one genetic modification is a deletion. [P] The method according to paragraph [p], where the deletion gets rid of the entire region between the chromosomes? Site 01 , 7 , 0-144 1, 774, 117 or strips off part of the region resulting in interruption of one or more sites hypersensitive to 1 (DHS) DNAse VO [R]. fetal hemoglobin in a mammal in need of it, the method comprises the steps of contacting an isolated hematopoietic progenitor cell in said mammal with an effective amount of a formulation comprising at least a DNA-targeting endonuclease or an expression vector carrying the coding sequence of a lly-DNA-targeting endonuclease By which endonuclease targets DNA and cleaves the genomic DNA of the cell on the chromosome? Locus 10, WT LYYA cough 17 0 and causes at least one genetic modification therein, by which expression of fetal hemoglobin is increased in said mammal, relative to precontact expression. The invention is further illustrated by the following examples which should not be taken as limiting. The contents of all references cited throughout this application, as well as the figures and table in the present application are included for reference. CAR

q “= — METAL The inventors have discovered and described regulatory elements of the 80111 gene that are critical for its expression in the erythroid cell line. Common genetic variants within these sequences are associated with fetal hemoglobin level and severity of the beta-globin disorder. These sequences include distal regulatory elements with enhanced chromatin imprinting; It contains accessible chromatin; active histone marks; and occupancy by erythrocyte transcription factors. These elements interact with the 80611178 promoter and enhance gene expression in erythrocytes but not other BCL11A-expressing strains such as lymphocytes8. These regulatory elements can be targeted for the purposes of ladle BCLITA layin and re-induction of fetal hemoglobin. This can be done by mechanisms that are not limited to 0 genomic modification.” splicing of nucleic acids or proteins” and epigenetic modification. Advantages of this method include: blocking a physiological regulator of fetal hemoglobin level, which leads to increased production of gamma-globin and decreased production of beta-gluin; minimal effect on total glucose output or on red blood cell production or function; Limiting the effect on cells outside the erythrocyte lineage and thus reducing potential toxicity. MATERIALS AND METHODS Cell cultures 6034+ human cells were obtained from the peripheral blood liquified from healthy donors from the Centers of Excellence in Molecular Hematology at Yale University, New Haven, Fred Hutchinson Cancer Research Center, Seattle, Connecticut. Subject the cells to ex vivo maturation of erythrocytes using the Washington 0 two-phase serum-free liquid cultures protocol as described above (79). obtained

Peripheral blood mononuclear cells (PBMCs) were cultured on peripheral blood mononuclear cells from healthy donors from Children's Hospital 805100. Differentiation of erythrocytes from PBMCs was performed as described previously (40). WIA erythroleukemia of Yo mouse erythroleukemia (MEL) and 7957 T cells were cultured as previously described (V9).

(derivative v-Abl) 8-cell precancerous rat lymphocytes stably transformed with “penicillin-streptomycin plus 707 penicillin-streptomycin RPMI as indicated (£) were cultured in sodium perioate 71 Non-Essential Amino Acids; 721 HEPES 77 (FCS 5 μM) 8-mercaptoethanol 0011, 9A01800176NEM 01800176N1 » pyruvate mercaptoethanol.

DNase 1 and ChIP sensitivity (39). Chromatin immunoprecipitation and massively parallel sequencing were performed as indicated.

H3K4me3 «(£¢4 - «Vv Millipore) 13/270083 : The following antibodies were used «Abcam] 132786 (ab8895 Abcam) H3K4mel (vie - .¢ Millipore) «(sc-899 (Santa Cruz «Polll) Polymerase 11 RNA polymerase ((ab4729|0) was determined by ChIP-gPCR and analyzed as described previously (47). ). For DNase | ACH cleavage of inserted chromatin 7 1 with CHIP Determination of relative enrichment by comparison of amplification of material and GATAL Using loci previously recorded as occupied and unoccupied by (79) 11% as positive comparators and negative, respectively, 0 (3C) Chromosome Jalil as previously described (¥9) except as described below. Nuclei from primary human erythrocyte-linked 3C formaldehyde test were digested. Quantitative real-time PCR before crosslinking and reverse crosslinking.Hind was performed using a fragment containing 0.17. (Bio-Rad) iQ SYBR Green Supermix using 0 relates to the amplification efficiency of different primers; Lad on booster 801117 as installation area. To correct: Comparative template preparation by digestion and ligation of an equivalent molar mixture of two of the 501118 synthetic chromosomes comprising one bacterial artificial chromosomes (BACs) locus (CTD-) - human globin J and one (RP11-139C22) 5 RP11-606L8 (complete human RP11-606L8) 11- The interaction between the fragments was at 1151/1152 and 1153 from a position comparison area (3055511 © qv).

LCR as a comparison sample. Reaction frequency was expressed as magnification relative to human globin reaction (LCR).

Known BAC" approximated to comparison template position /806111 of the afferent layout 861118 The three of an intron? For DHSS all coordinates (among hg19) the labels were selected - Te for him (AK) for (AT) Te KH YY of type +17 (No: AT ©

YY (AE VY Te — AY YY EL :chr2) 5e + (ve RARE AR (CEU) marker identified from the Thousand Genomes Project database using Northern European reference sets 055110135 additional substitution in YA (Table 51). Find (ASW) and African-American (YRI) Nigeria from DNA at DHS for three Sanger spacers. The inventors identified the sequences with L(Y) chemistry (NTSM table CSSCD from a group (SCD) and 1? from patients with sickle cell disease OY Yo, respectively. From HBF determination effort, low (<77) of ZA with high levels (greater than Seven new variant sequences were identified (Table 7).Because most of the markers are clustered at 676 small genomic intervals, it was not possible to design tests to determine the genotypes of some of them.Among the DHSS genotype determination tests were performed Non-repetitive identified in three Jay markers in 1,717 participants from 655©60; comprising a cohort of 5060 African-Americans 46 5 were identified to have known HOF and DNA levels (71). Available/1a0 genomic individuals and alternate sequences were excluded. 569080007 IPLEX Marker genotypes using the genotyping success <90 7 platform. The total concordance ratio of Jaze DNA in the two tabulated (YA = n ¢QC) SNPs showing the quality of passage is .7000. From copies Triple A and 11B below 00155 Three. It is considered a large part 11 and "and this is illustrated schematically in my figure * Yo Genotypes are rarely defined in the reference groups and then they are unexciting SNPs from SNPS 178 individuals and 17 from QC remained after" (18-0) CSSCD is surprisingly monomorphic in

AEF 04) as previously described HPF polymorphisms for analysis. Levels greater than (1) were modeled using the >510(?;) through the MAF (linkage procedure and conditioning analyzes for monosubstituted variants of ST MAF) linear regression under an addition-characteristic genetic model. Analyzes of popular alternatives revealed Yo

X = 1.79 P ( HbF has the strongest binding level with DHS +62 for 51427407 in (7)

CAR

Or 0-0 form 11 a and b). The initialization analyzes showed that after initialization on 251427407 and 57606173 no other SNPs were significant (Fig. ?b). Modifying the principal components (PCs) on an Aco in individuals with genome-wide genotyping data to compensate for admixture and other fusion conditions produced similar results. © For rare, low-frequency substitutions (MAF < 0 7) the authors performed cluster-based analyzes using each of the three 62+ (DHSS 58+ and 55+) as a unit test. For these analyses, we used the (45) Sequences Nuclear Ligation Test program (SKAT-0) with the default variables The inventors chose a cut-off value of 0 7 for the MAF in order to maximize statistical power given our limited sample size; however, note that markers with a MAF between 71 and 75 were also analyzed in the 0 substitution analyses. This overlap in the alternatives is justified using adjustment analyzes with common alternatives associated separately with HBF levels. 151427407 and 57606173; results no longer significant laa to suggest poor LD between rare/low-frequency and common 5005 variants (© table) The inventors found no evidence that the rare, low-frequency sequence substitutions in 01155 BCL11A affect V0 HBF levels in subjects with SCD despite resequencing by Sanger of this 01155 in AA Subjects with a severe HOF phenotype (haplotype frequency ratios of 51427407-57606173) in CSSCD are: 1-6 4.5 1-717 .777,1 6-6 147,2 6-06 6 Mean HOF level of 74.8 (.0050) in 711 individuals of 6-6 r81427407-rs7606173 filler (5050) in Yo£0 offending suffixes of rS1427407-rs7606173 T-G/G-T and 1211.7 (7750) in 60 individuals 1-6 rS1427407-rs7606173 (Fig. 7c). for comparisons of HOF levels between genotypes; © values were determined by one-tailed Student t-tests. determining the molecular haplotype of two heterozygous SNPS on the same chromosome; There are two possible instars: Blab-H-Yo (form 1) and 5/8-8-M (T-form (Y) for SNPs in the 11-kb fragment of the IY CAR intron

18 e80 of + oY, - 144 kb; The phase was determined by cloning the PCR products and determining the determine phase 57569946. To determine the phase of the two alleles (SNP co-distribution of dav incorporating PCR kilobase on the chromosome?)” Vo (a) separated by 7 was performed. Fusion of two emulsion PCR regions as described above (74; 75) with a slight modification. Brings “two senses” from separate parts of the same chromosome together into a single product. By heating the reaction in the emulsion © with aqueous micro-droplets surrounded by oil; Superiority amplification products are derived from a monomeric molecule It was heterozygous for 57569946 and aed from the following known esa lIDNA individuals (at final concentrations shown): 7

KOD, no 14); Buffer (Novagen, 71086) KOD Hot Start polymerase 8NO0 for MgSO4 (1X) Ve. (15,_mM - A oY (M) dNTPs each); SFr prefixes) 187569946-R each); i&M prefixes Y) rS1427407-R 457569946-F molar); $Y) rs7569946-R-reveomp-rS1427407-F molar); internal bridging indentation (nm). The aqueous reaction |8a 100 was added dropwise with stirring to the Yeo-gDNA phase of oil (e8a 200) to form an emulsion. Two parts 0 & 1 125 of the emulsion were amplified under the following conditions: Vo sec; Ve 125 sec; Te 10 sec; Ye 2 min; £0 cycle of 15 degrees 40 VO nested in 25 L PCR Hexane fusion extracted with hexane PCR 2 minutes. The solution product ¢(0.5 U) KOD Hot Start was subjected to DNA Polymerase A as follows: polymerase enzyme (mM each); dNTPs (mM, Y) +; (Ak, 5). 109504 (©17); KOD from alii (Logie nanomolar per Yoo) 1S1427407-nested-R ; rs7569946-nested-F prefix sec;01 turn of 90° YO nl ); 40° 2 min; VO) Fusion of PCR extract, product, 0 interfering product by ash electrophoresis, 0° min. Ve seconds; Fe degrees Ve seconds” 01 degrees 0 _Creates a mono-band of the expected size. The agarose in agarosa gel©9 electrophoresis es!

Life Technologies, Zero Blunt PCR Cloning Cloning the purified product with a fusion amplification kit resulted in the identification of Sanger clones; Sequencing was determined by the L method (K2700-20; ©, 8-8). The probability of each phase was calculated based on Assuming a-bA-B distribution: possible sequences YO polynomial (Table 1).The probability ratio of the two designs was calculated as a measure of the statistical significance of the model.

C q _ haplotype with data match 1 (compared to model.?). A ratio approaching infinity suggests Model 1a, a ratio of 1 suggests equilibrium, and a ratio close to zero suggests Model 7. Thermal sequence determination Healthy 0034+ cell donors were screened for five donors heterozygous for ©51427407. These 0034+ cells are for ex vivo differentiation of erythrocytes by BEY. Chromatin was isolated and ChIP was performed with GATAL and 1811 antibodies. JA chromatin compared to sales 67/1 or precipitated TALL was subjected to thermal sequencing in order to determine the allelic balance of 14,277,407 rS .then healthy CD34+ donors were screened for identification of three heterozygous for haplotype 0 /1-6-© 57606173--51427407. These 0034+ cells were subjected to ex vivo erythroid differentiation. (CDNA) Zaidi DNA glad) and Hala 0 were done. To determine the thermal sequences in order to determine the allelic balance of 157569946, the PCR conditions were as follows: 2X 111015181180 master mixture (Qiagen) 47 10:012waa (concentration Final “mM” template DNA (ans 1-0,1) and biotin-specific forward and reverse primers = Yeo SNP (nM each). The conditions for the PCR cycles were as follows: 15 40 /941 10 min; fo cycle of m 0 sec; 0 m 0 sec; “lam 0 sec; a VY ° min. One prefix processed from each pair of biotin (biotinylated) and the strand of the PCR product containing the biotin-treated primer was attached to streptavidin beads and combined with a specific sequence-specific primer. The prepared single-stranded DNA was sequenced and its genotype was analyzed using (Qiagen Pyrosequencing) PSQ96 HS System as per manufacturer's instructions 0. Transgenic mice The reported fortified formulation pWHERE-Dest was obtained from Dr. William Pu. modified from (Invitrogen, pwhere)pWHERE as previously described (£7 (where it contains Turkish on a rat 1119 substitution flanking lacZ Jus 6086-1468 derived minimally from 15068 lower YO augmented using the Gateway destination bar at premolar MCS. Enhanced fragments of IDNA OY AY have been enlarged

— a q — mouse; It was recombined into the pDONR221 vector (Invitrogen, 12536-017) with BP clonase (Invitrogen, 11789020) and recombined into the PWHERE-Dest vector with LR clonase (11791020). Plasmids were digested (Invitrogen, .25 using Pacl to remove the main chain of the vector. Reported lacZ fragments were purified by intra-gel electrophoresis and then concentrated (Promega, A7280) Wizard DNA Clean-Up System. Transgenic mice were generated Transgenic prokaryotic injections into fertilized 1/8 oocytes Approximately 01 ng/μL of DNA solution was used for a series of injections Aly 60-1 were used as recipients for the injected embryos Embryos aged 0.14 were extruded 16.05 days since the date of injection from surrogate mothers with complete and histological X-gal staining as described previously (17). (Vector Laboratories, H-3403) Nuclear Fast Red. Appendices were used for PCR genotype determination. Animal procedures have been approved by Children's Hospital Instititution. al Animal Care and Use Committee Human Erythropoietic Substance Enhancement Test Genomic DNA fragments containing putative enhancers were cloned into pLVX-Puro J# (Clontech, 632164) 0 down TK 332s and the amGFP gene As indicated (79). 97 T cells were infected with FuGene6 (Promega, E2691) reacting agent according to the manufacturer's protocol. Media were changed after 4 7 h with SFEM medium supplemented with penicillin-streptomycin 77 and after 1 h; The supernatant was collected and filtered. Erythrocyte cultures derived from +6034 cells were induced using slow titration on both days of expansion; E 0 By cyclic infection as indicated in (FA)Glad) Cells were resuspended in erythrocyte differentiation media YE 1 h after the second infection. Selection started with PUrOMYCIN 1 μg/mL after 8; hour of infection. Transduced cells after five ald in differentiation media were analyzed by flow cytometry for the mean fluorescence intensity of GFP oY AY flow cytometry.

_qy_ 7-AAD, BD Pharmingen, ) aminoactinomycin Na-1 Live cells were opened by exclusion Bone marrow suspensions (for erythroblasts) and spleen (for lymphocytes) were isolated from young (5 ..) adults. after hypotensive lysis of mature red blood cells; Uy mice transgenic (BD, 550992) biotin-CD71 were sorted based on staining using (7-AAD-) live cells.

CD19-APC (BD, 553673) Ter-119-PE (BD, 554067) APC © streptavidin and CD19+ “CD71+Ter119+” sorted CD3-PE (BD, 100308) or (BD, 550992). )

RNA +003 from the groups used for cytokinesis and isolation

TALEN induced chromosomal deletion to cause cleavage (TALENS) Transcriptase activator-like effector nuclease enzymes engineered the intron? of mouse 801118 at positions 64 00 kb (termed locus 5) and 0: on the following sequences TALENS (position 37 (for 155. sacl recognizes 0.4+kk right); 5 °) CCATGCCTTTCCCCCCCT (E66 AH 5011/0866 left 61 left). Done 3: (CTGACTAATTGATCAT left) 3°)GAGTTAAAATCAGAAATCT 8! Done to identify 6. Done RVD using Golden (£4) Gate 181115 synthesis by cloning the enzyme domain (Invitrogen, V790-20)pcDNA3.1 synthesized in DNA cloning of Vo-binding domains; 8152 domain at the no end and 63+ domain at the end © previously shown Fokl nuclease 0.5 89 0012*670 four with TALEN 89 2.5 each of plasmids (£9) preceding 8 were delivered by electrophoresis according to WDA protocol or MEL Voix to ? (Lonza)

EA by flow cytometry after GFP positive cells were sorted (10028, VCA-1005). Cells were cultured by limiting dilution in dishes of 96 samples to isolate individual clones. Yo for 9011/8 to detect amplification of a short product from a previous locus PCR showed the clones examined by at position 5 and a subsequent locus at position 3 Delete the interpolated sector. Monoclonal clones were subjected to obtain bi-allelic deleted clones. The deleted allele was TALEN to a second round of deletion by the action of the deleted fragment. The ual report on the identification of clones that have a bi-allelic deletion by detecting its absence

DNA digestion 235. Southem allele. The deletion was verified by spotting approximately one 00 deletion repeats in the Yo before the gDNA locus of the Ss 561-50 probe jl and hybridizing with the ¢Bmtl genome using

CAR

Cap

5°) to a 3.76 kbp fragment of the untreated allele and an AQ fragment of the −50.4 kbp allele

4 deleted.

1-005 and immunoblotting

RNA (ie) with RNeasy columns (Qiagen, 74106) was reverse transcribed using the iQ SYBR Green kit using qPCR (Bio-Rad, 170-8890) cDNA for iScript synthesis ©

(Bio-Rad, 170-8890) Supermix and immunoblotting as indicated by L(Y) for genes

Mouse Cluster 11-globin A shared primer pair recognizes adult 1” globins of both types VY

and 11, while independent primers recognize 11” globins of the two types 13H 5 ey antibodies were used

Santa Cruz, ) GAPDH (Abcam, ab19487) 58011178: antibody following immunostaining (0-25778-50).

results

Genome-wide association studies (GWAS) confirmed associated variant genetic variants

by attributes; Which is often located in the regulatory DNA. I have undergone the theory that variance

Regulatory could explain the heritability to a large extent for a sparse empirical evaluation. Here the authors show that Ls Vo, a common gene in BCLITA, is associated with fetal hemoglobin level (HPF) showing sequences that are not

A cryptogram decorated with a 335m chromatin imprint of erythrocytes. Reveals the refractory layout in regulatory DNA

A hypothesized co-mutant variant associated with decreased transcription factor binding; diminished expression

About 80111/8,; The high HBF surrounding sequences in the body of the jas all are evolutionary and specific

Strain-determinant stage. by genetic engineering of the genome; It turns out that this enhancer is required for the expression of BCLITA 0 erythroblasts, but has no benefit outside the erythroid lineage. These results show how

GWAS can highlight functional alterations that have a modest effect in the underlying causal elements of expression

proper genetic. ‎Jay Enhanced 801118 Teacher by Ladle as GWAS favored in Disorders

| -Globin.

asl was | 0/8516 has been tremendously successful in identifying thousands of common Yo single-nucleotide polymorphisms (SNPs) associated with human traits and diseases. However, progress has been made

‎CAR

Linking genetics to a causal biological process is often difficult. Challenges include the large number of identical substitutions that can be associated with individual traits (due to Baad linkage balance (LD) the modest effect of many variant associations with the trait; and the location of many associated substitutions in the non-coding genome. Recent studies of chromatin mapping have highlighted Genome-wide richness of GWAS substitutions in regulatory DNA ile © suggesting that many causal substitutions can affect gene regulation However, experiments showed only a few examples confirming the importance of substitutions or causal elements. The GWAS for the HOF level is particularly striking. Genetic variance at only three loci (5 BCL11A (HBS1L-MYB) (HBB) accounts for 50 7 of the heritable variance in HDF). The same variants are also associated with clinical severity in Sickle cell disease with major [0]-globinopathies and thalassemia 8; perhaps unsurprisingly because Jane HBF is central to these disorders.Work from the lab of the inventor and others has confirmed that 801118 is a direct regulator of HbF levels. 8011178 is a suppressing agent Genetic transcription resides in the multiprotein complexes that operate the cluster Gusta c Yeni. Whereas a synthetic /80111 deficiency leads to embryonic death and impaired lymphocyte development; The erythrocyte-specific deficit in /80111 offsets developmental repression of fetal globin 0 genes and is sufficient to treat the haematological and pathological features of sickle cell disease in mouse models. Therefore, 801116 has emerged as a new therapeutic target in [-]-globin disorders. Understanding the implications of the 801118 vulnerability is essential. Human coding variants of 8011178 have not been described despite extensive re-sequencing efforts. The variants of 801118 associated with HDF levels lie in the non-coding regions of 806111/8. To further understand how common genetic variation affects 86111/8; 0 (HBF level and severity of [|-globin disorder]; the role of HEF-associated substitutions was tested in detail. Trait-associated substitutions near ely fre erythrocytes Several GWAS studies have been performed in addition to flair planning To continue on the characteristics of erythrocytes (La) including phenotypes such as the number and size of erythrocytes; Hemoglobin concentration” and level ((HDF to identify SNPs associated with 1776 traits of interest including the genome P) less than -58 Yo 8). SNPs are enriched in enhancers and coding regions compared to random SNPs (Fig. 1). The majority of SNPs also reside elsewhere in the genome. General chromatin features of CAR eam cells that produce primary human erythrocytes are described; This led to the identification of a wide range of enhancers

DNase Distant Erythrocytes Recognized by Characteristic Histone Modifications and Hypersensitivity to Non-SNPs Erythrocytes with Enhancers Compared to GWAS SNPS Strong Colony Formation Associated with Erythrocyte Traits was observed. or associated with erythrocyte traits in the form of randomly altered SNPS. 71.5 of the direct SNPs fell into the erythrocyte enhancers; with an enrichment of lanza VY, compared to randomly shifted reinforcers (P)J of 4-01*1 compared to 71.4 SNPS unrelated to erythroid traits; which Jia had a 1.4-fold enrichment (P = 0.017 017) and many of the SNPs were found to be in close affinity to the erythrocyte enhancer (Fig. 1b). The mean distance to the erythrocyte enhancer was There are 47.1 7786 erythroid-associated traits” compared to the SNPs of (kb) 1.6 00 unassociated erythrocyte trait-specific SNPs and 87.4 kb, respectively. These results show that a large part of the common variants associated with erythrocyte traits lie in or near erythrocyte enhancers, and are consistent with the theory that causal variants often influence gene-dependent regulation. Context. Vo sign 610/85 HBF on Laas Erythrocyte Enhancer Six GWAS were performed at the HOF level (or FADIA number of highly compatible traits); including groups of European ancestry “African” and Asian Each identified variants associated with the trait in 8061-118 Variation in 8011178 is assessed to explain -715 of the trait variance Four different SNPs were identified as being associated with the highest degree of AD character machine (51427407; 0 so-called 'sentinel' SNPs cluster ¢rs766432 5 54671393 511886868 0a. The Y haplotypes appear to be 1 k base from each other in the ¥ intron of 8061118 (a haplotype). The binding of fifty SNPs compared to any sentinel HBF better explains the binding of SNPs comprising

HOF within an intron? With a level of 50005 SNPS at position 801118 and twenty-seven (AY Xo from JETP) of significance encompassing at least the whole genome YO the distribution of HPF-associated SNPs in 8011178 was compared with the sensitivity to | DNase is an indicator of the state of chromatin that suggests regulatory capacity. in human erythrocyte-producing cells; CAR observed

“yer is adjacent to and overlapping with oF-linked substituents in the DNase intron | Three Peaks of Hypersensitivity to 62+ (DHSs) DNase | which are termed loci of hypersensitivity to AY (HOF fig. b). Brain and lymphocytes are shown. BCL1IA 12155 and 55+ based on a kbase distance of 58+ do not express oT/80111; cells le lymphocytes, two tissues expressing levels of 8 ligands (BCL11A in situ DNase | significantly) showed unique patterns of susceptibility to 8011180-associated traits (Fig. ?a). SNPs overlapping with DNase 1 sensitivity to chromatin imprinting around the /80111 site was further analyzed by chromatin immunoprecipitation of hemocyte ChIP-seq with massively parallel sequence identification (0510-560). in primary human erythroid SNPS report histone modifications with an enhancer imprint overlaid with the les H3K27ac and H3KAmel tags in intron ?of 80111/8; including the presence of Vo 6787781a). 1 63 and 627003/13 (Fig. 6010-9068) Experiments showed three distinct peaks of TY binding of this enhancer region (Fig. TALL).

DHS in intron ¥ of 861118 where each falls into erythrocyte TALL 1 (Fig. You regulate its expression. Interactions between Enhancer 8011178 and fragments were evaluated via, including sequences, before; beyond and within genes. The largest enhanced interaction was observed at the BCL1IA locus associated with traits (Fig. ¥c). SNPs intron region ? Containing 0115 erythrocytes, these results show that these sequences have regulatory potential. Regulatory substitutions 0 causal associated with the trait can act by modifying cis 5005 elements of Borrower 01155 in the critical regulatory SNPs. Therefore, large-scale genotyping was performed in the Collaborative DNA Study of 1767 samples of 1767 and 55+ in 58+62 LDU erythrocytes from a cohort of African Americans with squamous cell disease (CSSCD). have sickle cell disease 17 genomic HOF variants have been identified and their sickle cell DNA levels are known Available Yo

CAR yay ¢ YRICCEU The three of the 005110 DHSS reference groups found in the DNA sequences of the CSSCD individual from Sanger's AA at the Thousand Genomes Project; And by specifying the sequences using the ASW method

VA was a marker in genotype test design and YT was a failure (HBF severely phenotyped for multiple SNPS individuals, 17 of VIVA and 7). after quality control; Remaining 1 monomorphic (larger tabular minor allele frequency (MAF) (forms for association test. Common Substitution Analysis revealed © *” = 1,13) HOF had the strongest association with DHS level +62 reports that 51427407 is in (71 of .1) table 0-0; in position HDF of the Recombinant Signal Layout with CSSCD previously; The inventors used in the study” was an estimated 51,427,407. ersd671393 80118 also reported the strongest association with prior studies 3 rS11886868 5 5766432 Additional SNPs were identified from 0 in the FDA (or sentinel HDF number) that correlate most highly with a level. SNPs as two of their four sentinel SNPs subset of individuals (AA 778) genotypes at each linkage of significance at dam were known; when initialized on genotypes at 51427407 the association was not still high significantly “Sally; or 1511886868; crs766432” rsd671393 for 51427407 when initialized to 54671393 5766432 or 511886868 (Table 9). So Vo in 0115 erythrocytes is interpreted as the most closely related HBF SNP, so 157142740 represents The other sentinel SNPs shown above were the best associated with traits compared to within 01155 of the three HBFs found. Other associations were found at the level of “rs1427407 when configured to. The most significant remaining association was 176061733 in 1.” that were not completely lost (coA+ DHS reported table was 57599486 in 01-01 x 0,3) =P) 58+ 0015 | 0 in this conditional analysis. After initializing all (1-01 XV, YY) = P) beforehand, statistical significance was only slightly lower (setting 1). Individual available pattern data Principal components (PCs) with extensive genomes for them to account for combination drug and other combined substances triggering rs1427407-rs7606173 (data shown). The monotype of ol) yielded similar results to YO

HBF is defined as that strongly associated with a level of 1-6

CAR

Q1 Rare variants with low frequency (MAF > 75) were also analyzed for association with HbFs using each of the three 00155 +217 (OA+ and +00) as test groups. Two of the groups were found to be statistically significant.” ie DHS +67 and 0115 +55, but after initialization (rs7606173 5 rs1427407) the results were no longer statistically significant, indicating weak LD among the rare/low frequency 5 shared SNPs (Table 4).Therefore, there is no evidence of rare, low-frequency sequential heterozygotes within 01155/80111 sisi at the level of HbFs in patients sans50, despite Sanger rearrangement of a single AA number of CSSCD 51427407 SNPs fall within peak linkage 67/81 and 1811 as defined by -0510 0 580 0010-0065 (Figs. A nucleotide of a sequence element strongly resembling a 5-50"/6/81/8 aay half-complex regulatory sequence [CTG(N9)GATA]. This regulatory sequence was shown to be highly rich in complexes 687781 and 1811 in LDA erythrocytes by erythrocyte LDA experiments. ChlP-seq eye selected Primary erythrocytes from an individual heterozygous for the Gl major allele 5 T-allele secondary at 151,427,407 were exposed to ChIP followed by V0 sequencing as per synthesis. The inventors specified an equal balance of allele compounds in the inserted DNA. However, a more frequent association with allele=G compared with 1-allele of yy equals 40:75 was observed in both GATAL J and 1811 immunoprecipitated chromatin samples (Fig. (Iv) reported reported that the HOF-associated allele-A, elevated l54671393/ was associated with the expression of 8061118 in human lymphoblastoid cell lineages.The inventors (sale) could not produce a statistically significant association between the 861118 genotype and the level of expression that analyzes of a larger group of lymphoblastoid cell lineages (data not shown).It was speculated that the 1s1427407-rs7606173 monotype associated with elevated HOF affects the expression of 8611178 in an erythroid context.The common synonym of the 57569946 SNP falls within exon—4 l/80111 and can act as a marker for allele expression.Three primary samples of human Yo erythrocytes were determined to be double heterozygous for monotype rs1427407-rsT606173 and 157569946.The samples were subjected to conversion to monotype Molecular by incorporation into emulsion PCR CAR yee master for 157569946 in allele-G explained p The process of converting to mono mode was that for each sample it was subscripted. HBF-associated HBF/51427407-+57606173 G-C metaphase with genomic monotype was evaluated by synthetic-sequencing 187569946 to determine the balance of CDNA 3 genomic DNA; A DNA imbalance was observed in the allele while the 6 compounds were counterbalanced by the low HOF, which favors increased expression of the cDNA-bound 8166-6 Statistical significance in ©

HOF 51427407b associated T-allele These results indicate that the elevated oF (Fig. r$7569946.) that disrupts half of the 5-50 regulatory sequence*/6/8778 is associated with reduced binding and reduced expression. baseline TALL; GATALL 457 1s1427407- 8061118 in erythropoietic subjects reported in 60 homozygous individuals with HBF monosomy 71" in 74.0" compared to #211 The high was 87,606,173 1-6 0 (1-1 X Y,0 = P) and the low was HBF 1s1427407-rs7606173 1-6 with a normal SNP level (Fig. *c). in general; The following evidence indicates that 151427407 has the highest association with the phenotype of any known variant”; Considers associations that: HOF affect the regulatory sequence required for Blu association (the sentinel described SNPS observed with and is related to association with 681/1 and 1811 as well as with the expression of “TALL; GATAL 10” though In addition, the heterochromia at this locus is in control of the common monotypes.861118.86111/8.linked to the least perturbation only in the expression of the enhancer's effectiveness for the expression of erythroid-like cells. SNPs to understand the context within which Kelo TE £207, 4) plays a function harboring cis-regulatory elements. The inventors cloned -"1-k-base 0" and evaluated the enhancer potential in DHSS containing three erythrocytes (TSS base) from a transgenic transmitter test. In this test putative enhancer sequences are placed before a secondary promoter Linked to isolating sequences Constructs were introduced into mouse zygotes with (18CZ) and transmitter gene (HSP6S) Expression of transmitter gene monitored throughout development Endogenous mouse 8011/8 showed excess expression over the course of organ formation central nervous system with much lower expression observed in the fetal liver.

CAR

P-1 is highly restricted to the fetal liver; the specific site of erythropoiesis; with less expression observed in the central nervous system (Fig. ;a). The distinguishing feature of globin genes is their complementary organization. during human development; Gusta beta derived from the yolk sac is suspensed in the first trimester by Lala globin y —globin derived from the liver © embryonic liver A1618. near the birth date; Gayot gamma is closed and beta globin becomes activated. There is a single loss of transgene expression during mouse development. during this shift; which occurs in the middle of pregnancy; Circulating yolk sac-derived primitive erythrocytes express embryonic-stage globulins #* and Lan BEE. Fetal liver-specific erythroblasts express adult-stage globins BL and 82. In line with this growing shift; 0 8611180 is expressed in the definite-stage, not prokaryotic, erythroid lineage. Strains with stable genetic transformation were derived from 861 118 14.4-207.0+ transmissible mice. In these mice, when LDA circulated, erythrocytes did not stain with X-gal, while liver erythroblasts stained strongly positively (Fig.;b). At (E10.5 uel) lacZ was observed only in the beginning of the fetal liver and not in the fetal circulation; placenta; or the yolk sac (Figure 1a). These Vo results indicate that the regulatory sequences 8061118 intron-? numbered B85//A6 is sufficient to determine the appropriate complementary expression of the gene. Jala hematopoietic compartment, expression of 11/8 BCL is found in erythropoietic substances and lymphocytes-8. Erythropoietic substances and lymphocytes-8 were isolated from transgenic young adult animals and the expression of the 1862 gene was measured. 8011178 endogenous (0-lef Cae) o,f levels were expressed in splenic B-lymphocytes compared to bone marrow erythropoietic subjects. However, expression of 1802 was restricted to the erythropoietic material (aly) observed in T-8 lymphocytes (Figure;c). These results indicate identification by erythrocyte-like cells of these regulatory sequences. A series of deletion mutants were generated to phosphorylate the minimum elements required for enhanced erythrocyte-like activity. Sequences containing the +58 DHS center were sufficient for enhanced erythrocyte-like activity. Those sequences containing only the surrounding +67 or oot elements were not CAR capable

Nate directed the expression of an erythrocyte-like gene (Fig. 7b). This 01155 has been tested for its ability to improve gene expression in key human erythropoietic subjects. Use as described previously. TK with minimal GFP enhancer The Inventors Lentivirus delivery to a reported system but not +00 or +67 is able to similarly enhance expression of oA+ DHSs, only (VY Genetic profile in the reported amount experiment (Fig. © Enhancer Requirements for Expression of Erythroid Cells 861118 The inventors then chose to specify the requirements for these regulatory sequences for appropriate expression of the previously published total chromatin properties of the Bell la globin genes An in situ examination of erythrocyte-like cells revealed that this region of the ?intron has an enhancer imprint similar to that of LAL.

H3K27me3 and H3K4me3 and no H3K2Tac; H3KAMel at the ortho position with a 0 (Fig. 8). In addition to the above, TALL-like globules have been observed; 67/81 and occupied by at these sequences. At each of the DNase 1 erythroid-specified cells with hypersensitivity to note evidence of conservation of cai, 00+ 5 DHSS +62, +58 human erythrocyte-like evolutionary sequences, particularly within +17 5 +00 To determine the requirement for these co-regulatory sequences at the ortho locus for 86111/8 expression, a erythroid leukemia cell line of Vo dependent on expression of . mouse erythroleukemia cell line (MEL) mouse globin pattern of appropriate gene expression in adulthood. It can be induced by enzymes 8601118

TALENS are sequence-specific nucleases that produce small chromosomal deletions. Homologous at 10-kb 801118 was genetically engineered to insert double-stranded spacers to enclose sequences at the locus ortho intron-? The imprint of enhancer chromatin bears erythrocyte-like cells. 0 three unique clones that underwent bi-allelic excision were examined. Jie and NHEJ clones for repair mediated by resection of an intron-related section within the clone Southem and blot PCR verification by Sanger-mediated fission characteristic (Fig. 3) were separating points with the sequence According to NHEJ 01 (Fig. NHEJ repair of intron-related TALEN | 10-45 binary Gada with MEL” expression of .8611178 was analyzed in allele 5 cells. A dramatic reduction was observed. Expresses 8011178 to -77 levels of the value

CAR

-1 l

primary (Fig. #a). Similar reductions have been observed with indentation pairs that reveal exon splices before, with, or after a deletion. By Western staining, expression of 8011178 was not detectable in clones with 05-01 abolished enhancer (Fig. sy .PHI, © In the absence of the “©-01” enhancer of 50111/8 protein, expression of adult globin genes was reduced by -09-7-fold, while fetal globin genes were significantly reduced. Increase of the fetal sy ratio to 1/2 of the adult by mean Canam VRE in three clones lacking

Enhancer-like cells at the ortho-situ BCLIIA erythrocyte-like (Fig. #0c). To determine whether the + sequences; 0,60.45 Kb pertaining to the intron is required entirely for the expression of 0 8611180 , its loss was assessed in a context other than erythrocyte-like cells. The same strategy was used to introduce two pairs of TALENS to obtain clones with an NHEJ-mediated deletion of AS50.4-60.4 in the lymphocyte-8 progenitor cell lineage. Two unique clones -850.4/60.4 were isolated and verified by PCR, staining with blot 5001078177, and Sanger sequencing (Figs. 9 and 10). In contrast to erythrocyte-like LOA, expression of LOA was retained. 1 861118 in clones of pro-8 cells deactivated enhancer A50.4-60.4KD at both RNA and protein levels (Figures A and D). These results indicate that the erythrocyte-like enhancer sequences of the cell-like at the erythrocyte-like ortho locus are not required for transcriptional integration from the 801118 locus, but

They are only necessary for the expression of an erythroid-like cell gene. An enhancer chromatin imprint is found at an intron-? For 80111/8, it directly covers SNPs associated with 0 | 405. The region harbors several biochemical features of the enhancer including occupancy by histones that characterize H3K27ac H3KAmMel in the absence of 1314407163 lo (H3K2Tme3), binding of erythroid-like GATAL TFs, and loci hypersensitive to 011856-1 specific to cell-like cells. with erythropoiesis and long-term enhancer interaction by J. In addition to the above, the inventors were able to map this locus, using 01155 as a guide, to identify SNP rs Yo 1424707 as having the highest association with the trait; fully yielding association for the trait with SNPS The above-described and highly associated guard In addition to the above, it was found in the present application that 1427407 rs CAR yA and 1811 in GATAL progenitors with GATA transcription factors inactivate the half-5-square/stimulus However, even after adaptation to 51427407, association remains with other erythroid SNPs in contiguous 01155 points to a haplotype effect. Haplotypes characterized in contiguous elements show that each modified regulatory function cooperates to give SNP with a combination of genotypes the overall phenotype of expression of 86111/8. using heterozygous donors; An effect of ©.86111/8 and high TF expression were shown to be associated with both modest HBF-associated haplotype These studies help evaluate the change in expression of /80111 that is required to result in a similarly differential increase in Expression of pm uss in patients with HDF disorders is clinically significant in level

HbF and 6-6 57606173 T-G illal-HbF rsl427407- among haplotypes (BCL11A) and 6©-6 were 711.7 and 74.1 T-G heterozygotes of 7.1-fold low HBF and level 0. Reverse results for 500. Of the >770 HBF levels (2 V5 oF) were predicted to prevent this. HBF fold sae target likely approximates reduction in expression of 8011178 from this study identifies Regulatory variation at 801117 that affects the enhancer of globulin cells associated with a coded trait and has a relatively small effect size. As a result of erythrocyte SNPS. Many of these are of slight clinical significance. This study demonstrates that SNPs for these traits are Sometimes a small effect size generated by a non-coding individual is considered to be a variant that does not preclude a large effect size.

SNPs of the implicit regulatory element. For example; Despite the relatively weak effect of functional on the expression of the 8011178 target of the underlying gene; The causal regulators are essential for the expression of the 801117 genes and globin in erythropoiesis-producing substances in the baloch stage. The same regulatory element is indispensable for the expression of 8011178 in non-erythroid Yo strains. The goal of studying protective alleles is to understand the molecular mechanisms underlying the effort to replicate this biological effect in susceptible individuals. And therefore; Many of the polymorphic forms associated with the trait remain in important, context-specific regulatory elements whose function may lie in further elucidating the underlying biology of the trait beyond simply identifying an upregulated gene. For example, while loss of 801117 poor conversion of hemoglobin Yo results in poor angiogenesis, lymphangiogenesis, and fetal lethality. Finally, he can distinguish

CAR

_ \ 0 q —_ A better understanding of causative regulatory elements and associated regulatory networks are implicit features of novel therapeutic targets. The erythroid-like enhancer of 801118 itself could constitute a favored target for therapeutic genome editing in that ablation could suppress the expression of 8611178 in outcome cell progenitors, while the expression of 801118 in erythroid-like HDF was maintained with reduced Strains other than erythroid cells. © References 1. A. Fugger, 6. McVean, J.I. Bell, N. Engl. J.Med. 367, 2370-2371 (2012). 2. J. Emst et al., Nature. 473, 43-49 (2011). 3. D. 5. Paul et al., PLoS Genet. 7, el002139 (2011). Yo 4. M.T. Maurano et al., Science. 337, 1190-1195 (2012). 5. P. van der Harst et al., Nature. 492, 369-375 (2012). 6. ENCODE Project Consortium et al., Nature. 489, 57-74 (2012). 7. S. Menzel et al., Nat. Genet. 39, 1197-1199 (2007). 8. M. Uda et al., Proc. Natl. Acad. Sci. L 5. A. 105, 1620-1625 (2008). 09. 6. Lettre et al., Proc. Natl. Acad. Sci. U. 5. A. 105, 11869-11874 (2008). 10. M. Nuinoon et al., Hum. Genet. 127, 303-314 (2010). 11. N. Solovieffetal., Blood. 115, 1815-1822 (2010). 12. ©. Bhatnagar et al., J. Hum. Genet. 56, 316-323 (2011). 0 13. V. G. Sankaran et al., Science. 322, 1839-1842 (2008).

OY AY

Ny 14. J. Xu et al., Genes Dev. 24, 783-798 (2010). 15. J. Xu et al., Proc. Natl. Acad. Sci. U.S.A. 110, 6518-6523 (2013). 16. V. 6. Sankaran et al., Nature. 460, 1093-1097 (2009). 17. J. Xu et al., Science. 334, 993-996 (2011). 18. F. Esteghamat et al., Blood. 121, 2553-2562 (2013). © 19. ©. Liu et al., Nat. Immunol. 4, 525-532 (2003). 20. Y.Yu et al., J. Exp. Med. 209, 2467-2483 (2012). 21. M. D. Farber, M. Koshy, T. R. Kinney, J. Chronic Dis. 38, 495-505 (1985). 22. E. Soler et al., Genes Dev. 24, 277-289 (2010). 023. M. T. Kassouf et al., Genome Res. 20, 1064-1083 (2010). 24. D.J. Tumer, M.E. Hurles, Nat. Protoc. 4, 1771-1783 (2009). 25. J. Tyson, J. A. Armour, BMC Genomics. 13, 693-2164-13-693 (2012). 26. M. Leid et al., Gene Expr. Patterns. 4, 733-739 (2004). yo 27. M.S. Kowalczyk et al., Mol. Cell. 45, 447-458 (2012). 28. H. J. Lee, E. Kim, J. 5. Kim, Genome Res. 20, 81-89 (2010). 29. D.E. Bauer, S.C. Kamran, S.H. Orkin, Blood. 120, 2945-2953 (2012). 30. A. John et al., Development. 139, 1831-1841 (2012). 0

SY AY

-111- 31. R.0. Patwardhan et al., Nat. Biotechnol. 30, 265-270 (2012). 32. A. Melnikov et al., Nat. Biotechnol. 30, 271-277 (2012). 33. K. A. Frazer, S. S. Murray, N. J. Schork, E. J. Topol, Nat. Rev. Genet. 10, 241-251 (2009). 34. A.N. Koehler, Curr. Open. Chem. Biol. 14, 331-340 (2010). 2 35. F. 0. Umov, E. J. Rebar, M. C. Holmes, H. 5. Zhang, P. D. Gregory,

Nat. Rev. Genet. 11, 636-646 (2010). 36. J.K. Joung, J.D. Sander, Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013). 37. J. van der Oost, Science. 339, 768-770 (2013). 38. Thanks to A. Woo, A. Cantor, M. Kowalczyk, S. Bums, J. Wright, J. Ye

Snow, J. Trowbridge and members of the Orkin laboratory, particularly C. Peng, P. Das, G. Guo, M.

E. Baena, for Kerenyi,

W.Pu the SF. Alt provided the pre-B cell line, A. He discussions. C. Guo pWHERE lacZ reporter Yo 1. Kutyavin sM. Nguyen technical assistance, D. Bates sconstruct, C. Currie expertise with sequence analysis, R. 39. J. Xu et al., Dev. Cell. 23, 796-811 (2012). 40. E. van den Akker, T. J. Satchwell, S. Pellegrin, G. Daniels, A. M. Toye, Yo

Haematologica. 95, 1594-1598 (2010). 04 AY

-11- 41. A. Bredemeyer et al., Nature. 442, 466-470 (2006). 42. R.E. Thurman et al., Nature. 489, 75-82 (2012). 43. G. Galameau et al., Nat. Genet. 42, 1049-1051 (2010). 44. 5. Purcell et al., Am. J. Hum. Genet. 81, 559-575 (2007). 45. M.©. Wu et al., Am. J. Hum. Genet. 89, 82-93 (2011). 0 46. A. He, S. W. Kong, Q. Ma, W. T. Pu, Proc. Natl. Acad. Sci. U.S.A. 108, 5632-5637 (2011). 47. M. A. McDevitt, Y. Fujiwara, R. A. Shivdasani, S. H. Orkin, Proc. Natl.

Acad. Sci. U. 5. A. 94, 7976-7981 (1997). 48. T. Cermak et al., Nucleic Acids Res. 39, e82 (2011). 0 49. J. C. Miller et al., Nat. Biotechnol. 29, 143-148 (2011). 50. R. Galanello et al., Blood. 114, 3935-3937 (2009). 51. H.T. Bae et al., Blood. 120, 1961-1962 (2012). 52. K. E. McGrath et al., Blood. 117, 4600-4608 (2011). 53. 0. Noordermeer, W. de Laat, IUBMB Life. 60, 824-833 (2008). 0 54. D. R. Higgs, D. Vemimmen, B. Wood, Adv. Genet. 61, 143-173 (2008). 55. E. Pinaud et al., Adv. Immunol. 110, 27-70 (2011). for

11 - and 148 /// rs rs conditional on I don't sleep on Ola / your uncle. Hala

DH

MAF numbered 5 rs YY vag +, 00A oA ve dy A oo the 1 +

A AT 3 oY Ty Y¢ oy oive Ty rs 0 257 10 a a lal or a a a + 7 2549 7 vv eh Ao Yo 1 rs +, Yo) vA ve Ye SYA XY, v4 +, 71 fields 1m +

A vy £) YA -10 V¢ 1 Vakha 1 rs

XY, Y¥ | ott videa| + .rah Ye 1 VY Ty

OY AN

-1?- rs

Yot lam +4) vou 7) vodag + 7 ada-0 YY 1 Ly A AA TY rs +, 140 oY A) 1 Ly A TY 0 71317 +

Y £) aA A 5-0 yy Ad 4 TY rs +, TAA oY Xo, 1¢ +34 XY, Yo +, YA YY 174 7 yy 1-0 Yo YAY Y ve to | OAT rs 0 a 0 da +, Yo 0 vY + ¥1 oo 107941 1 dla to A q¢ 24 +d | Lak Naz rs +, 40. Bm Ye EE «Yo oo 10 on 1 aA A yy ve AR 3 +deh | 7 e rs

Xq,11 A XY, AT 1 A Yi.) Mowa'ah 771 (0 a) YA YY | oo+

OY AY

-1/Ag or +50 of oA+,17+ SNPsmBCLIIA DHSs common (7) < MAF) association analysis, MAF .DNase | DHS hypersensitivity locus available for analysis. CSSCD individual out of 117 secondary allele frequency. O+DHS oA+ 7+ 8601118 DHSs Jala SNPs: ¥ Table 0 allele

DH

MAF prime allele 5 genotype H monomorphic | + 5 m C| 7/7844 " crystal | 7 1qdgctm 0" + a ’ yes T C TeViVood | 1 n wy YYYovosy + 9 m defective experiment design C TeVIVIEY | 1 wy YEAYYY YY Monomorphic | + 5 6 Al Kala Kafafadh | 1 crystal | 7 YAYYYYYo monomorphic 1 * 5

Ty T Cl w.vivvia| 1 Crystalline VAAY F + rs 0, A " , B softer 6 Al Halakafahh | 1 $0 YE90AYY

OV AY

-111-

Ye + Yes T G Te YYA LY Y 1 13 » A 7 TY + rs ? For my case, I did 3 experiments with defective design 0721772 + rs Experience 3 T Al TovyAvY | Y b His experiment design is flawed

YAVYA) OA monomorphic 1 i. A G| The Y of the crystal is EYAOY + rs 11 1 3 A G| amav ¥ nl jo '0 YAY) Lov) + rs aa 3 T C| ay ¥ f= ay £9 p + rs re ; T C| deaf | ¥ nl jo 7 cough + Y rs edit 2 T C T+ YYAcoo His experiment design is flawed + 0-4 9. + Y rs

Aaya 2 6 A T«YYAOT14 The design of his experiment is flawed + 11111110

SV AY

-11- for | Monomorphic M 6 014

SRR ay Juri 0/77 + rs b defective experiment design 1 C lead (r / no) 0/6 + rs d for roofs a 6 m + defective experiment design 11178 + rs for fatal cutting 6 MB Defective experiment design 0171100 + rs B Defective experiment design 1 C Te VYAVAY 164 + rs Al Aga 6 MB Defective experiment design 11171458 L | Monomorphic B C Al TYYAAWY F Al-Baluri + rs Alg Ama 6 M B defective experiment design 111779361 + rs WY M M 6 B defective experiment design MSI A

-11- + rs m b defective experiment design T+ VYAAYT

YATAYY

0 + Y rs ; 71 G| Mta AA fy m7 4 "0 re defective experiment design C T Te YYYOAY oA monomorphic money 1 7 l 9 0 C G EDAH QVD crystalline f YAoYo Nov + Y rs meh softer C 71 75

Yo TYY AYA + Y rs yes oA A G because I vt Wag + Y rs defective genotype oA C T aa 17 + rs d softer C 71 777

A 7 monomorphic 1 7 Y rs oA T| Al-Baluri 6477841 e] | | © ' } 1

OV AY

-11- + v re Defective experiment design oA A G emfffh 176 xy + v re ; G| Al 777761

YY they are a 7 l | Monomorphic to Al 6 ps 4 m crystalline + v re m 0 yes 6 77721 "" 1819771 l | Monomorphic L QL evry 78 m crystalline L | Monomorphic toc-crystalline 1175601

A 1 0 rd Yes 0 +71 7 vy 58 7 LAS monomorphic | TF for 0 71 6m (crystalline ipm), '+ v re softer | G A 77447 ¢ 16m7 rad

-1 \ "= + ¥ I's defective experiment design oo G T Ask Fah

YAAEY Tey + ¥ I's defective experiment design oo G A 1646 117/784 monomorphic 1 7 l 9 oo C G crystalline LY 1174 + I's defective experiment design co C T IXRAL-ERAY 25944691 + I's a defective experiment design oo G M May for Kane class + I's a defective experiment design oo A G has returned

YAAYo VO + ¥ I's Defective Experimental Design oo A C rah Afad Ama 84 Monomorphic 1 7 L 9 oo A C Crystalline 17 Monomorphic 1 7 Y rs oo G C Rest in peace, the captivity of the crystal YS

CAR

-1?1- + Y re 1 Yes oo C G TaYYo M vo YI Y + Y re Defective experiment design oo T C 0104 0 l | Monomorphic os Tl G| 0 4 crystalline 15118751 monomorphic | TF of os C 7 .vvevyy crystalline 1174831 + Y re defective genotype oo A G 14 18119971 0001 or ADSNP Ly or +00 located in oA+ 17+ 801118 DHSS within aii SNPS

Lis patterned SNPS and // A85. CEU YRI genomic data for reference populations identified genomic coordinates 9 or .CSSCD within MAF [Sanger sequence registration shal Table 17 Additional digits found by Allemel Ret | Alimel CH

MAF genotype | DHS 'Atanoi | POS| R 0 0 * ee * 0 a" 0 7 1 ma Y 5 m + 17 yes T

AS 1 ed oN AY

—\YY-

Af S$ R Failed Test Design A

Af S$

T+V¥YYY 0

Cont m +56 softer G . VY) oA

Yi Scale 7 55 Stand Cea Yes T c D VY) oA

Ao « Libra 7 55 design stop for " T 0 7 failed test A \

Af S$ 7671" Co 55+ T G VY) oA 0 1

S$ F Ce Soft 00% A 0 : 7 7 1

Maximum Banger to re-do an HOF sequence with counterpart type CSSCD by one of AA [

AR

1 73-Ath 01155 inside .BCL11A Specific novelty numbers listed. SNPs phenotyped MAF, Lud were identified within the registered CSSCD. The hgl9 genomic coordinates are in Table 4. Conditional analyzes of four sentinel SNPs rs rs rs rs Ae LAVIYAY[ YYAATATA 71177 107/1 M| Mar

AF | ker rs 0 0 um 2 Y, YA 0 ,. Father 0 ty Y¢ VEY “> a -1 “> a -1 41 -1 >” -1 Ye 1 1 1 Ya a 0] 6 1 1 rs ty ty Y, EA *, *, f and 0, -1 ov Yv 71 7 34 m -1 a] ory ve| af of gray 1 AH NA | Hala rs no 0 0 h 0 0 ,. Yo ATA .25 A -1 M YY \Y +, YA 11 9511 AR a Af TA Ah . Y Al 3 3

-4?1- rs 0 -| ev] | + | fv 0 0, -1 ov Yv 73 5 1 for ba o—\. 1 NA NA 1 +o Y¢ 1 3 7 Conditional analyzes of four common Sentinel SNPs previously associated with HPF levels (44: 17170 37 210)). The genotype of all four in YYA was determined from 05500 individuals. © for 18766432 could not be calculated when conditional on 184671393 (and vice versa) because these two digits are strongly correlated (2 - AEA - 2 .) 0.157 between 151427407 and 15766432: Ved - 12 , + between © 51427407 5 1886868 a5: AS - 12 , + between 51427407 and 54671393: 2 - between +,YoA - 2 ;rsl 1886868 5 rs766432 between 1886868 |5 5 © Jsaall.rsd671393 Variable image analysis rare and low frequency rs le ays conditional rs le rsYEYVeayY YEYYEWY 17 SY AY solution

C \ \ — Variable image analysis results in rare and low frequency (MAF > 75). Group-based analysis was performed using the SKAT-O algorithm using 0,17+ DHSs 0A, +00 singles as three different groups. The bottom row "All" displays test results when three regions are folded together. Table 1: PCR sequence for individual emulsion incorporation PCR analysis Single type 157569946-51427407 for emulsion incorporation. Heterozygoted for 187569946 and 51427407, generating a fusion amplicon comprising both a3. The SNPs cloned the fusion amplicon, and Sanger sequencing of the individual questions was performed. A number of clones are listed for each genotype. The odds ratio for G-G/A-T compared to the 6-1/8-6 phase was calculated. Table 7: Coordinates of the Distance from BCL11A TSS (kb) 9019, 2 transmitter experiments

The length (bp) is the end of a sender | Name Beginning End 11 ARERR 16064 Ta dYYACHY 1 Bassat - 0 7 q 1¢,¢| LacZ

YTAD 1 16064 01 YYYAY 1 BSAT 2 -7 0 a 1¢,¢ 210 SAFRAN 57241 Te VYACTH 0 4 - 6

Y Y oY,1 Stand for me Yale Tvvay ITA ARTA BR YTA ARTA) 67+ 1 1

Yee OY oYovo SAIYY Outside in Kakla IMPa

A 1 10 5751 77 TeeVYTYA[ TeeYY ad 5354 7 A 100 1 A1TAGT | Teethers 1016+ 1 v Y 1 GFP 0m Yoo 64 10174 TaeAV EAA] 01km 1051+ 3 7 a 1 1 011m 11 01 gat 1 Haf Akt YoY+ 1 A 7 2 Stand for me Tvvay ITA ARTA BR YTA ARTA) 67+1 1

—\YV-

Yer ovivoe 545471 TecYYYd0

A Y

Yea) 17 oo(AoY TeeVYTtV TeYY EVA 5354 1 0 014 74 0mm and no or 3 2 61 +

Yer categories of units of any 771 rad q Y 7 + akhn k 0 ls “net to |= - a 1 mi mtq 1 A 1- yay - - 1 to 1 dm 1 d to 5,577 | 57 1 35 oy-— The putative reinforcer replicated in the reinforcer vector experiments. Chromosome coordinates? Was coordinates .80111/8 TSS as well as with reference to hgl9 included in the oligonucleotide sequences Table A Name Sequence Experiment 1 We are public AAAGAGCTGTCCGAAGTCCA 0082118-53 - + 1 General Nahf GGGCACTTCCTAGTCCCTCT 0082118-35 -4 1 General Tahnaf 04 TTTGAGCAGGAGGGAATTTG mBcllla—dell-F © 1 WAM 04 General Tahnaf 61661 0001616611 mBcellla—-dell-R

AR

—\YA-

TALENGWPCR GCAAGGCAGGTACCAAACAT mBcllla-del2-F

TALENGWPCR TAGAGATCCAGGCCCCTTT mBcllla—-del2-R

TALENGWPCR AGCAAGGAAAGGTGAAGCAG mBcll1a-3'-F

TALENGWPCR CCCAATGTCTTCCGAACTGT mBcllla-3'-R

TALENGWPCR AGGCTGGTCTTGGGATTTTT mBcllla- © upstreamTALEN-F

TALENGAWPCR GCCTTTAACAAGGGTGTCCA mBcllla- downstreamTALEN-R CATAGACCTGGGTCCTGGAA mBcl11a-5'probe-F '0 smear probe Western 0 TTGCAGAGTGACTCCTGTGG mBcl11a-5'probe-R '0 smear probe Western lacZ Ju ye CCAGCCATACCCAAAACAAA hBCL11A-52.0-F lacZ Ju ye cloning CTTTCCCTCTTGCCACTCAG hBCL11A-64.4-R lacZ Ju ye cloning GGCAGAGAAGGCACAGTGA hBCL11A-56.8-F 10 lacZ Ju ye cloning GGCTGTCCTGGCATGTAAGR-5 GGCATGTAAGTFP-A hBCL161. Transmitter cloning 202 AACAGACCCATGTGCTAGGC hBCL11A-63.4-F GFP Ju je /02 cloning TGTGTGGACTGCCTTTTCTG hBCL11A-61.6-R lacZ Ju je cloning GGGAAAAGGGAGAGGAAAAA hBCL11A-58.6-F lacZ h ye ye-ATB1GCCAGAA5GAA-ATB1GCAACA5. 0 oYAY

-1?4- lacZ Jui ye clone GGACTCAGTGGCCTCTTTTG hBCL11A-55.7-F lacZ Ju ye clone GAAGATAATGGCAGCCCAGA hBCL11A-54.4-R

GFP Jue clone TGTGTGGCCAACCTGTAAAA hBCL11A-164.2-F

GFPJuy Clone CTCGCTCTGTTTCCCAGTTC hBCL11A-162.6-R

GFPJuje clone CTCTCCGACGACCTCTTTTG hBCL11A-157.1-F e GFP Ju #Lil GTAGGGAAGGGGCTACTTGG hBCL11A-155.6-R

GFP Transmitter Assay AGAGCCAAACTCCGTCTCAA hBCL11A-154.1-F

GFP Ju clone AAATACCACAGCCCAACAGC hBCL11A-152.5-R 61 clone transponder GAACAGAGACCACTACTGGCAAT hBCL11A-59.4-F

GFP Jue Clone 66666/86666111 68116 0680111-57. 4-7 0 Transcription of a Transponder©61 CTTCCACTGGATGGCACTTT hBCL11A-55.9-F

GFP Jue lus) ACTTCAGCCTCCAGCACTGT hBCL11A-54.2-R

GFP Jue clone CCTCCCAGCAATGTAGGTGT hBCL11A-41.6-F

GFP Jue Translator TGGTGTGGTCCACTGTGACT hBCL11A-40.5-R ©] Translator Translator GCAAGCTTAGCCCCTTCTTT hBCL11A-32.6-F 10

GFP transcription of the TGAGGCAGAGTCAGATGTGG hBCL11A-31.6-R transmitter

GFP Jui clone CCCCGCTCAGAGTAAGTGAG hBCL11A-n45.8-F

GFP Ju clone GGAAACTGCCTATCCCATGA hBCL11A-n47.0-R

GFP Jue clone CAACACCCCGATTTCAGACT hBCL11A-n51.0-F

OVA

YDA GAATGGTCCCGATCTCTTGA hBCL11A-n52.9-R Transponder Cloning [© RT-gPCR (Gapdh) TGGTGAAGGTCGGTGTGAAC mGapdh-RT-F RT-gPCR CCATGTAGTTGAGGTCAATGAAGG mGapdh-RT-R (Gapdh) e RT- gPCR AACCCCAGCACTTAAGCAAA mBcl11a-RT-ele2-F (Bcllla exon-1/2)

RT-gPCR ACAGGTGAGAAGGTCGTGGT mBcl11a-RT-ele2-R (Bcllla exon-1/2)

RT-gPCR GCCCCAAACAGGAACACATA mBcll11a-RT-e2e3-F (Bcl 11a exon-2/3) Yo

RT-gPCR GGGGCATATTCTGCACTCAT mBcl11a-RT-e2e3-R (Bcllla exon-2/3)

RT-gPCR ATGCGAGCTGTGCAACTATG mBcll11a-RT-ed4e4-F (Bcl 11a exon-4/4, xLisoform)

RT-gPCR GTAAACGTCCTTCCCACCACCT mBcll11a-RT-e4e4-R 100 (Bcl 11a exon-4/4, xLisoform)

RT-gPCR CAGCTCAAAAGAGGGCAGAC mBcll11a-RT-e4e5-F (Bcl 11a exon-4/5, Lisoform)

RT-gPCR GAGCTTCCATCCGAAAACTG mBcll11a-RT-e4e5-R Y. (Bcl 11a exon-4/5, Lisoform)

RT-gPCR (eY)TGGCCTGTGGAGTAAGGTCAA mHbby-RT-F 04 AY

—Vry-

RT-qPCR (eY)GAAGCAAGAGGACAAGTTCCCA mHbby-RT-R

RT-qPCR (bH1) TGGACAACCTCAAGGAGACC mHbb-bh1-RT-F

RT-qPCR(bH1)ACCTCTGGGGTGAATTCCTT mHbb-bh1-RT-R

RT-qPCR (b1/b2) TTTAACGATGGCCTGAATCACTT mHbb-b1-RT-F

RT-qPCR(b1/b2) CAGCACAATCACGATCATATTGC mHbb-b1-RT-R©

RT-gqPCR (lacZ) GCCAACATTGAGACACATGG lacZ-RT-F

RT-gPCR(lacZ)TGTCTCTCTGCACCATCCTG lacZ-RT-R

PCR genotyping (lacZ) TTCAATGCTGTCAGGTGCTC lacZ-F

PCR genotyping (lacZ) GCCATGTGTCTCAATGTTGG lacZ-R haplotype fusion 04+ GTCTGCCCTCTTTTGAGCTG rs7569946-F 0 haplotyping ball PCR GACTCCAGACAATCGCCTTT rs7569946-R haplotyping , , AAAGGCGATTGTCTGGAGTCAACCTT rs7569946-R-haplotyping all.

PCR CTTAGCACCCACAAAC rs1427407-F haplotype “PCR CATGTTACTGCAACTTGCTTTTT rs1427407-R 10 haplotype bail) “AGATCCCTCCGTCCAGCTC rs7569946-nested-F haplotype merge z=sTGAAAGTTCAAGTAGATATCAGAAGG haplotype PCR 001427407 -nested-R

AGCAAACCACACAGACTGAAGA 3C-hBCL11A-150.6-F oY AY

-1»7-

CCAGAGCCATTTACGTCACA 3C-hBCL11A-140.9-F 3C CAGAAGGGAATAAGGTACTCTGGA 3C-hBCL11A-114.1-F 30 GTTTGGGCCTCAAGGTCTTT 3C-hBCL11A-111.5-F 30 GAGGTTGGGAGTAAGCATTCTG 3C-hBCL11A-109.1-F 3C ACGCATCAGAATGCCCATAG 3C-hBCL11A-100.7-F ه٠‎ 3C TTTTGAAAGAAAACGCTGACA 3C- hBCL11A-92.3-F 30 TTCCAGCTGGTTAAATTTAGGG 3C-hBCL11A-80.2-F 3CAGAAGGGGCCAGAAGAACAG 3C-hBCL11A-T717.2-F 30 CCTTCTTTTTICTTTCTTGGTTGC 3C-hBCL11A-72.5-F 3C CCCTGCGTGCCATTAAAATA 3C-hBCL11A-66.8-F ٠ 3C AAAGGCCTTGGGAAGAAAGA 3C-hBCL11A-61.2 -F 3C GCAAGTCAGTTGGGAACACA 3C-hBCL11A-59.1-F 3C GGACTCAGTGGCCTCTTTTG 3C-hBCL11A-57.1-F 3C CTGTCTCTGTCTCCCCCAAG 3C-hBCL11A-52.2-F 3CCCAATGCTCCTGTAACAAAGG 3C-hBCL11A-47-F ١ 3CAATGCAGTAGGCAAAGAAGCA 3C-hBCL11A-43.5-F 3C GAAATTTGGAAGGCCACAGA 3C- hBCL11A-38.6-F 30 GCTTGCAACAATTAAAAGATGG 3C-hBCL11A-29.3-F 3C GGTGACAAGGGAGAACCACT 3C-hBCL11A-27.1-F

OVA

-1?-

TGATTTCCTTGCAGCCTTTT 3C-hBCL11A-20.9-F 3C CACACCCACAGCAACAAATG 3C-hBCL11A-8.6-F 3C TGCAGAGATCCCCCAAAGTA 3C-hBCL11Apromoter-R 3C CTCAGGGAGCAAGGGAAATA 3C-hBCL11A-n8.3-F 3C CCCTCCCAACAGGGATTTAT 3C-hBCL11A-n12.6-F ‏ه‎ ‎ 3C CAAAATTGAACACCTATGGTCTGA 3C-hBCL11A-n19.5-F 3C AGGAAGACTTTGGCCTCCAT 3C-hBCL11A-n29.8-F 3C-hBCL11A-n34.6-F TTCCAAACAATTATACACCAACAAA 3C 3C TTTCATGGGGAATAGCCAAC 3C-hBCL11A-n54-F 3C CCCTACTTGTTATTTGCTTCTGC 3C-hBCL11A-n78. 2-F 0 30 3C-hBCL11A-n104.4-F AGCTGAAGTTTCAGGGACCA 3C CCACACCTGCCTTCCTTAGA 3C-LCR-HS1-F 3C TGCATATGATGGGGTAGCAG 3C-LCR-HS3-F

ChlIP-gPCR ChIP-hBCL11A-68.7-F AAGAGAAGGGGGAATTTGGA

ChIP-gPCR ChIP-hBCL11A-68.7-R TGGTGATAAGGGCAGGAAAC01

ChlIP-gPCR ChIP-hBCL11A-65.5-F AGGAAGCTGCAGAAAGGTGA

ChlIP-gPCR ChIP-hBCL11A-65.5-R TGCTTCCCCAGGTTTAGATG

ChlP-gPCR ChIP-hBCL11A-64.7-F CCACTGCTACCCAAAACGAT

ChlIP-gPCR ChIP-hBCL11A-64.7-R CAAGAGCGAAACTCCACCTC H1

-1»6- 010-004 ChIP-hBCL11A-63.9-F ACTGTGTCCAAGTGACCAG

ChIP-gPCR ChIP-hBCL11A-63.9-R CAGCTTCCTTCAGGTGCTTC

ChIP-gPCR CATGTGCCTTTGTCTTCTG ChIP-hBCL11A-63.1-F

ChlIP-gPCR ChIP-hBCL11A-63.1-R TGTGGAGCTCTGGAATGATG

ChIP-gPCR ChIP-hBCL11A-63.0-F ©GAGCTCCACAATCCAACTCC

ChlIP-gPCR ChIP-hBCL11A-63.0-R CCAGGAAGGAAATGAGAACG

ChlP-gPCR ChIP-hBCL11A-62.5-F ACCACAAACATTTCCCTTCT

ChlIP-gPCR ChIP-hBCL11A-62.5-R TTTGCTCTTCTCCAGGGTGT

ChlIP-gPCR ChIP-hBCL11A-62.4-F TTTAAACAGCCACCCCACAC

ChlIP-gPCR ChIP-hBCL11A-62.4-R ACCACGTAGTTGGGCTTCAC00

ChIP-gPCR ChIP-hBCL11A-62.2-F TTTCAACCATGGTCATCTGC

ChlIP-gPCR ChIP-hBCL11A-62.2-R CCCCTGGCATCAAAATGAG

ChlP-gPCR ChIP-hBCL11A-61.8-F GAACCTGGGAGGCAGAAGAT

ChlP-gPCR ChIP-hBCL11A-61.8-R TTTTTGGTGAGACGGAGATTT

ChlIP-gPCR ChIP-hBCL11A-61.7-F CCGGGCAACAAGAGTAAATC 1

ChlIP-gPCR ChIP-hBCL11A-61.7-R ATGCTAGGGTGTTTTGACG

ChlIP-gPCR ChIP-hBCL11A-61.5-F CTCCGTGTTGAGAGCCAAGT

ChlIP-gPCR ChIP-hBCL11A-61.5-R TGTGTGGACTGCCTTTTCTG

ChIP-gPCR ChIP-hBCL11A-61.3-F CAGAAAAGGCAGTCCACACA

OVA

—\yo-

ChIP-gPCR ChIP-hBCL11A-61.3-R CCTCTCCAGATTCCCTCTCA

ChIP-gPCR ChIP-hBCL11A-61.0-F AGCGAGACCCTGTCTCAAAA

ChIP-gPCR ChIP-hBCL11A-61.0-R TCCAGCAGGCTTCAAAAAGT

ChlIP-gPCR ChIP-hBCL11A-60.8-F GGTGGATAACCCCATCTCAG

ChIP-gPCR ChIP-hBCL11A-60.8-R GGAAATGAGAATGCCCTITG ©

ChlIP-gPCR ChIP-hBCL11A-60.5-F CAGTCTAGAAAAGCCCCCTCA

ChlP-gPCR ChIP-hBCL11A-60.5-R GTGGGGGTTCAGTGGTTAGA

ChIP-gPCR ChIP-hBCL11A-60.3-F TCCATGGTGTGGAGTGTGTT

ChlP-gPCR ChIP-hBCL11A-60.3-R ACCCCATGGCAACCAATAG

ChIP-gPCR ChIP-hBCL11A-60.0-F CCATTCCCTGGAGAGTTCAA 0

ChIP-gPCR ChIP-hBCL11A-60.0-R GGGGTCTCTTCCCATCATTT

ChlP-gPCR ChIP-hBCL11A-59.9-F ATGGGAAGAGACCCCAAAAC

ChIP-gPCR ChIP-hBCL11A-59.9-R GGACTCCGAACACCACACTT

ChlP-gPCR ChIP-hBCL11A-59.5-F GGGATCAGAGGTGAACAGGA

ChlIP-gPCR ChIP-hBCL11A-59.5-R TTTAATCAGCTTCCGCCACT 00

ChIP-gPCR ChIP-hBCL11A-59.0-F TGGGGAGAGAAGAGTGGAAA

ChIP-gPCR ChIP-hBCL11A-59.0-R TTGCCAATTGGAGATTAGGG

ChlIP-gPCR ChIP-hBCL11A-58.7-F TGCTCCGAGCTTGTGAACTA

ChlP-gPCR ChIP-hBCL11A-58.7-R GGGAAAGGGCCTGATAACTT

OVA

-? 1-

ChIP-gPCR ChIP-hBCL11A-58.3-F GAGAGTGCAGACAGGGGAAG

ChIP-gPCR ChIP-hBCL11A-58.3-R CCTCTTTCGGAAGGCTCTCT

ChlIP-gPCR ChIP-hBCL11A-58.0-F TGGACTTTGCACTGGAATCA

ChlIP-gPCR ChIP-hBCL11A-58.0-R GATGGCTGAAAAGCGATACA

ChIP-gPCR ChIP-hBCL11A-57.3-F GGGGAGATGATTGAAAGCAA e ChIP-gPCR ChIP-hBCL11A-57.3-R AGAACTTTCCCGGTTCTGGT

ChIP-gPCR ChIP-hBCL11A-57.0-F GCCTTGGACACACAGCAAAA

ChlIP-gPCR ChIP-hBCL11A-57.0-R TCAAATCCTTGCCTTGAACC

ChIP-gPCR ChIP-hBCL11A-56.6-F CCTCAAAATCTCCCTCACTGG

ChlIP-gPCR ChIP-hBCL11A-56.6-R GGGAAATGGGTCCTGCTTTA 0

ChIP-gPCR ChIP-hBCL11A-56.3-F AGGGAGTACACCGCAGACAC

ChlIP-gPCR ChIP-hBCL11A-56.3-R AAGGAAGGCTGCAAGGAAAT

ChIP-gPCR ChIP-hBCL11A-55.9-F GACTTAAACTGCCGCTCCTG

ChlIP-gPCR ChIP-hBCL11A-55.9-R TGACTGGTAAGAGCCGATTG

ChIP-gPCR ChIP-hBCL11A-55.3-F GCTGGGGTGAGTCAAAAGTC 10

ChlIP-gPCR ChIP-hBCL11A-55.3-R GGTCACCTTAAGGAGCCACA

ChlIP-gPCR ChIP-hBCL11A-54.8-F GCACCTGCATTTGTTTTTCA

ChlIP-gPCR ChIP-hBCL11A-54.8-R GGGTCAGATCACCTCCTGCTC

ChIP-gPCR ChIP-hBCL11A-54.4-F AGGCATCCAAAGGGAAGAAT H1

1 No. 010-004 ChIP-hBCL11A-54.4-R GAAGATAATGGCAGCCCAGA

ChIP-gPCR ChIP-hBCL11A-54.0-F TGGGAAAGGTTGCACATTCT

ChIP-gPCR ChIP-hBCL11A-54.0-R GGGCCTCAGGCTCTTTATCT

ChlIP-gPCR ChIP-hBCL11A-53.4-F CCACTGCCAGGCTGTTTTACT

ChIP-gPCR ChIP-hBCL11A-53.4-R GACCGAAAGGAGGAGAGGAG ©

ChlIP-gPCR ChIP-hBCL11A-53.1-F CAGTTCCCCCATTATGCACT

ChlIP-gPCR ChIP-hBCL11A-53.1-R CCCTCTCTGAAGGCACATC

ChlIP-gPCR ChIP-hBCL11A-52.7-F TTCAAGCCTTGGTGGATAGG

ChlP-gPCR ChIP-hBCL11A-52.7-R GCCAGGAAAATTGGTGGTAGA

ChlIP-gPCR ChIP-hBCL11A-52.3-F TGCCCACATGAGACATCTTT 0

ChlIP-gPCR ChIP-hBCL11A-52.3-R AAATTGGCTGCCATTGAATC

ChlIP-gPCR ChIP-hBCL11A-51.3-F CCACCAGAAGTCCTGGAAAA

ChlP-gPCR ChIP-hBCL11A-51.3-R TTGGAGGGACCTGATCTCTG

ChlIP-gPCR ChIP-hBCL11A-50.2-F CCAAGATGGAGAAGCCACAT

ChlIP-gPCR ChIP-hBCL11A-50.2-R TCTGTCTTGGGTCTCCTGGT 0

ChlP-gPCR ChIP-hBCL11A-49.8-F GAGAAGCCCTCAGCAAACAC

ChlIP-gPCR ChIP-hBCL11A-49.8-R GGTTGCATCTTGGCTCCTAA

ChlP-gPCR ChIP-hBCL11A-49.5-F GAAATGCAGGAAAGGAACGA

ChlIP-gPCR ChIP-hBCL11A-49.5-R TCTAGCAGATGGGGTTTTGG

OVA

—\YA-

ChIP-gPCRAGTCTGGGCAACAAAGTGAGA ChIP-hOct4-prom-F

ChIP-qPCR AGAAACTGAGGAGAAGGATG ChIP-hOct4-prom-R

ChIP-gPCRATAGACCATGAGTAGAGGGCAGAC ChIP-hHS3-F

ChIP-gPCR TGATCCTGAAAACATAGGAGTCAA ChIP-hHS3-R

ChIP-gPCR CAGATAACTGGGCCAACCAT ChIP-hHS-40-F e ChIP-gPCR ATTCACCCCTTTCCCTTGTC ChIP-hHS-40-R

ChIP-gPCR CGTAGCTCAGGCCTCAAGAC ChIP-hGAPDH-F

ChIP- CGAACAGGAGGAGCAGAGAG ChIP-hGAPDH-R qPCR aad) oligonucleotide used in experiments 0

OY AY

Claims (1)

-184- BCLIIA protective elements include low expression of a progenitor cell A method for producing a progenitor cell 1. An isolated progenitor or protein, the method involves contacting an isolated progenitor cell mRNA of the cell on the genomic chromosome DNA with cell UCSC acid-binding factor (according to assembly TYY LVYYA presumably, VY Te locus 1 chromosome reduced ly (human genome) Genome Browser hg 19 © BCL11A or trans protein mRNA expression isolated genetic engineered human cell Method for producing at least one LY genetically modified human cell isolated with effective amount of combination comprising at least 15018180 cells An isolated cell contacts Vo or an expression vector carrying the coding sequence of a DNA endonuclease targeting the DNA endonuclease by which the DNA endonuclease targets the cell on the genomic DNA and cleaves the DNA DNA endonuclease causes the modification of 1 , 7748 , 117 14 VAT Te? For less in it. 3, where the primary cell of hematopoiesis is a cell of the erythroid LEY strain. erythroid lineage isolated progenitor Or ?, where the isolated primary cell 1 method according to the protection element Lo is induced pluripotency. Stem cell is a stem cell isolated cell or cell oY AY -.? 1- 7. The method according to Claim 7, where the original cell is touched to form blood outside the living body or in the laboratory. Ly method according to claim 1 or 7, wherein the genetic modification oo is at least one deletion. LA method according to Claim 7, where the deletion eliminates the entire region between the chromosome? The VY site 14-:1, 74l7, 117 eliminates sda from the region resulting in interruption of one or more sites hypersensitive to DNAse 1 (DHS ye). 4. genetically engineered human cell Lil), isolated, isolated, containing at least one genetic modification on chromosome 1, site D, only in accordance with cell 17 obtained by alg method according to the elements Protection 8-7. Vo Aug) containing genetically engineered human cells isolated under claim 4. 1. A method for increasing fetal hemoglobin levels in a cell. The method includes steps: Contacting an isolated cell with an effective amount of a formulation comprising at least 0 DNA-targeting endonuclease or vector An expression that carries the coding sequence of a DNA-targeting endonuclease by which an endonuclease targets DNA and cleaves the cell's genomic DNA on the chromosome? site 14,7748,1,117 VAT Te and causes at least one genetic modification therein, by which expression of Yo increases embryonic hemoglobin in said cell, or its progenitor, relative to said cell before contact mentioned. oYAY -1?- VY method according to claim 11, where the isolated cell 15018180 is a progenitor cell for blood formation. NY method according to claim VY where the progenitor cell of the hematopoietic © is a cell of the erythroid lineage ai). 4. The method according to Claim 11, where the isolated cell is an induced pluripotent stem cell. No 0 The method according to the protection element VY, where the original cell (progenitor cell) is contacted to form blood outside the living body or in the laboratory. . The method according to any of Claims 11-15, where at least one genetic modification is an omission. Vo where the deletion gets rid of the entire region between chromosome 11, the method according to the protective element YY locus 10, 15 no, 1-144 74 no, 117 or from part of the region which the Y chromosome DNAse 1 (DHS) produces. It interrupts one or more sites hypersensitive to NA Yo A composition comprising a genetically modified human progenitor cell used to manufacture a drug to increase fetal hemoglobin levels in a breast in need of it, where genetic modification of a human progenitor cell involves contact steps an isolated progenitor cell of said hematopoietic progenitor cell with an amount Aled of a combination comprising at least an endonuclease targeting a nucleic acid (DNA) or an expression vector carrying the coding sequence a Deoxyribo Nucleic acid targeting Nucleic acid endonuclease. From the endonuclease Yo Deoxyribo is a nucleic acid endonuclease by which the endonuclease (DNA) targets oY AY Nucleic acid (DNA) Deoxyribo Nucleic acid (DNA) cleaves the cell's genomic genome on the chromosome? patch 01 except Cem A 778, 117 and causes at least one genetic modification in it, by which the expression of fetal hemoglobin in said cell, or its progenitor, is increased relative to said cell before contact mentioned. 4 . Genetic engineered human cell Lil), isolated pursuant to claim 9 or formulation pursuant to claim 01 used in the manufacture of a drug to increase fetal hemoglobin levels in mammals in need of it. oYAY 1 A Fail TSE yah + aj 1: Shahah bel kiryat al-jafraa Agia 5 Hi er 2 A Edn, ORR Na 0 fe 1B ANNE RY A and Umm Hala BRR a # Qanab l ah 2 mg RZ 3 i NRE 5 WH MHMH MHMH RES, RNR 1 : taal TLE “remote stomach and SSN BA A L A DIRT. SS Toa Tae I ER A A A Wg] BE ol A A A A A A A A I ; RE a OS CE Da ad Alok 86 A L A A L A L A L: Oh wv Hay Rto Ben Dawaa “« 8 CEES esate RSE IR RR A Rio between Genes: D dab SR Ay sR M RE TR SRY Ww in brother » ky a. SRR SER vd RSA SRN RR Sanna NRE oy 3 i i, a RRR a aR SRE HEH NE Ny ar Ss K SERA ER Qoq Ladj Ago A 1 l ya l lat a 5 = fet] 3 RRC An or DIRE eels HR OT RS i NEE Khum aa 58 ARO NW Ah L A A eh eS A RR # ® FUTR The 1. Neh SO - Net A By the hand of genes, oh purely: 7 . A 0 0 at kha wa ala Fu 2 1 Sk ; OY AY vod. oreo AAS : Ca : Ta 8 ro BARAT : Py & ps For a record other than 8 a wie al & RR PARE virtual: fe "3 m and 5 i Pe ; & ey > Re 1 hi Cai 7,7 8 d اْ &# Me A 1 & wept & A, l l hay ny hi} ' 1 & K salut l > A 8 & es 1 l a 5 8 8 oF ao 0 & & 2 | & 4 A r te F & a m : mt i & Fi SR 1 Ca > SRC i oF &F d : a & oF re > & ase oF # Sa oF a y a a a a FB a a “which the a a a a: ral 5 i.” A Sa a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a Ea Yan Wawa 8 A TE 0 Ey FES Distance to Tt 3 ny Tt Fig AR _ \ ¢ c form ?) 11 wn rn nm hn sn cnn rn = XE ot bn ono sm on i em drs Sn qa tark yl oa NE Eh ا ا ا ِ َ َ َ َ ْ َ َ ْ َ َ َ ْ َ َ ْ َ َ َ َ َ َ َ َ َ َ َ َ where one Bam Abdellat Adak JR I don’t have enough money, I don’t know how to do it, I don’t want to buy it, I don’t know how to buy it, I don’t know how to buy it, I don’t know how to buy it, I don’t know how to buy it, I don’t know how to buy it, I don’t know what it is, I don’t want it, I don’t know what it is Haab Asan Ak Amat 75 Hello, come back, look out for it. oo ne sana & pI NN 8 ld sas fn ahs JO RRC 8 § Fa JETER 8 [REDEEMER SNE SS | I. H3Kdmes i OU HiKdmel © TRE } Poo 1 i £0 § oa this d 1 1 sins J TPR CIEE C1 INR CR PPR FTG | TR § er 1 ET m 8 8 88 : H3K2Tas 154 ) 8 pots AS ST NITY TT wo v1: WF pot Ul Cy. $a Frm aii, RTE EE WR 8 JURE HE RN ST CRO cata Ml i} & Free SRG: + J SET: SOS TC UR: NU: | J Tay 7 § : ba 8 a ee ee i | CCI DUS SPRUUT SRE SEN ein: maida Rann or, Lode. Amada: an or WE ara Ta naam [RE] 1 5- did Gad DNase | SOP SSR Roa T- Hafula for lymphatic drainage 0 A solution that does not have a sense of uncle md rn perhaps eam mm bmn me ae bmn me ae eat jed ae en Leah Baqif edn Ala Mn Jah Deme Ba Eder Liam A Aye I know the facts. Yalma ae I stand ae Deme comes to a file of ml cman Van HbF has not been shown by du SNPs. 3 ] !+ + !113 : {1 FREI £515 I SN; 1 i 8 : : £1 i FE WA bes ° i : wy HEA 4 0 a 1 ; IE SA 04 1 8 0 2 e ‎; . SHE NE and yo a. : k IE od FE b H 2 a TE I ed i ; Ng IEEE SE No! ; ; lua 0 0 inm 0 0 i ; A { | bo Hand sleep 3 EOE 3 3 eH l i 1 i 0 0 1 1 m a 1 i! i Sp SESE ho - NN - by sf 3 ; 0 1 8 i 1 i : i HIRE, 3 3 + C 0 Broad 0 Noun : I A : 2 B Pr rm : hy : { Pod TE 4 4 * L LA LA SS SS 0 0 Ser Dama Yer play tes Be + Bam germ tens + 0 Pho bg Distance from : ES I 3 ~ : f. i FO I 80018 TSS (hd) 3 HE 1 01 ; 0 10 A A : ou BNPs [ LG m l 1 ! |] 0 a * six BAAAA & TAPAS LT 3 relly GAPDH 0074 HS3 540 va A 0 a et a San BELTIA 785 (kb) from Bll and TA EAS FS 143T407 SRE TABR CAACASTRCOCTISTOATATORA Hr - 2 - ا re FY HEF DARCATTICLCTTOTGATUL 4: 5 HAR Ri 0 8th grade: LA AER. Masha ll Asl Muqqi lah except i . bil Ga TR 2, LL S = Fog £5 00H yd 7 bs = i # Bg A LF ad : NE bt i 0 as Th TT 3 i 3 i Mada when he died what aa 1 where A Amit Input GATAY Tala Chip iy chkz (57560048 and ER bang & 0% at or & T 1 BOLTIA haha pa aE An , f i Bam Ed Maha 3 03 3 . 33 ou) for 0 ly td 1 ws 1 Raq J 0 Te 1 [is 1 TE this win Bw 3 + ma 0 ie 3 FEE cc ss ss ss to CONA refrigerators form ab 0 Ea dbc a a l l l a a l l i 1 va 3 f } 8 3 : NN Aj i NY) = i NY iw 1 NU a Nie Rok ¢ wg VAN 1 AN a 0 i ke NN NE SS Ee 7508173--427407 aa form A SAY -\Vev- or LL E125 FB A a a a a a a a a a a a a a a a a a aaa L.S. A S 4 Lh Coal AA i "for you" end tar a : EES. Sk Sa A A A EE RE 0 a SU eae aan NN ad A A « A a a ah EN Nd Rala > L yo H N AT A ON 7 3 EE a oR LE ¥ A L A L CA A A A A A L i Te ee a a a a a a a a aa E12 5FL I NaN N 3 ا ا 3# i Eo NER DE ae . 1 Pe . oe % on 8 4 *# BN = NTN SR ARE TR NE i. Ta Ne “ LL Lo Ng Be Loo him + CORON = 0%, = SRY LL AN gy BE b = eA and hat SY 3 1 0 fT Lo NE « 1 a La NN for Cap 5 » - HER 8 NORE la a a 5 ap we? Pea 5 a Si EE 0" NN ae the bE ta NNN Shas = WERE Sea g a Re } NN San ¥ NN Hi i 3 Nee valuta Ne aw QR es NR Nhe RR ae NN Jay NN. LE" } The SOR rani Ph RON RIS The CO71+Ter110+ CD19+ La 8 8 8 Ek ~ ES i ~ ARE : except SORE amoy a 8 a i) BL i 8 8 0 a hp Co 2 a | > od £ oF SY i i @ * zi form OY AY -1?0 m for ten! i a a 1 0 e 08 MEL and sleep IE ; 8 Exan-di (KL Qat Raq & RK rat Adan 0 i NES 4504-4 0 : 8 ENON IL Tahi db Dt HA LE 14 Ld i. YD 4 1 3 3 1 3 CAR RE WN | > B” 1 Na 8 NY NN 1 a 0 4 a 4 3 0 = PNY NAY NY ~ f = {8 Ry NN 4 aN , 2 N a 2 = HE 3 oy 5 3 AN 3 Ah NR 6 L A ee & + TN 2 DH) SN fs al va as a a L A ov) Ne APS A {4 _s NK NY aN BLEHA ENN Fa i: XR PERERA BRA 8 AMA Cs \ NY Ne 0 A mR 1 L 0 8 Sa & pre ERR I ES B Bla 1 AT Msata NY © L Ee L 1 7 N - 2 ) 1 L AA A ow Mesim #1 #2 GAPDH. Sasa 1 Mmmmmmmmmmmmmmmmmmmmmm MEL Pro-B 08 1 Fro-B A similar shape, a certain shape, Ba B Yrouk Mi | 8 N 4 8” 0 : SR + 8 1 4 0 L EX W WHEE ER 4 NN YE 5 BD 8 3 Na 1 AL JA'A 3 NY a DY 8 #Lazzah 0 “8&8 2 Cae 0 A BE ": Na ZAR AN # Soil NON © d 0 BB nN Nl Br 8 8 8 pe ANN NO NN Se 0 SIRNAS TEE OE CLE © d : 0 1 Iw IE 3 BY 83 ss l ib ieee eee nach 4-504 Has MEL rd EN form DJ CAN -16- EN IR TR RE SS ALA ALA RENE A NAN aN EE SE Sa 0 an i gla CL as RR L A SV NE Loa a oN Cl . A oo LL ak LE Le 3 0 L A A A A A A A A A SR A A A A A A A A A A 1 A L A L 0 a Le So NN a RE C0 0 a ci 5 os N OA AAR ES Nea SE INE No Bc a ET NN 18 a a b very a a a a oN LF Shi 4 EEE SE NIN NN RE aN A SR SS Na NR REN BIN Ne Ea ON NaN 1 1 1 1 { 1 poe 155 OUI up LEERY I seas W Taya Lahss NG NN Affirm NEN 8 NE Ne Ra 5 8 RE iN . Aala A Lala Aa Lae SB a No ae ea RT Rv Laa TNE a Lah Yo Dar an 234 ata 0 aa a a a a l a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a aa a a a a a a a a a a aa a a a ea .: Ae and Josh it ON LA LA ALAT LA AEE Y MSO SS ER 8 L NR L . A L A A RR RN Te NORE des NE TL SRG Ee 5 # ONAN ay A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A 0 A AAD SAY INN 5 Ri a) oN Na NG RUNS aA a BR aa L ANY ON AEN NE A L RR A A L A A AD Na Tl Ca aa a? aa Na aa deed Na 1 REA aa aa a2 3 rea I TR [RRP TRUE TRNE 4 SN REA a a X Na a 2 RA a 0 STIR ey RG vis WN J. : TE YN aaa Ra wr SON eae [AN ER re Ed Lose JN) Boo bo hoo SON Ra 9 Ca 3 AN that Va 3 a. TENE MINN AME OD haar Ah al Baa LONE TaN NET Sa N aay oa Na Sun NG La we CAR -1 2m pn RLF wk £2 6 1 0" l 0 bal a 1 a 0 - + 0 1 lm 0 8 Ya a Ho ved i Ih 0 \ A 0 ps : \ Ss aR | ok N 8 \ 5# aw 1 11!!!HOE NO THIS §& 8 D 1 § 8 BEER BE \ 0 0 A * 5. RE: iE. 7 a en ES I. Nee tooth 8 Nashi + M + Tr + Xr M ' PRE ES 1 ow bong we lengthen the satin BOLTIATSS B La oo 8 V shape SAY — \ o \ — BE i EE EE a 20111 er So. ve L§ SREP Amat Yanah Ra Ya Yakar A L D CA 1 1 Refseq =n Tra HE EL [fe] . 1 1 23 1 i fa 1 i i 8 Patla al-lamsssssst A A Tahta TAR AIA AR FARA AANA i.e. © 1 Tah 41 0 Sal : ' — wal ss drag Cr a . Ah, what is wrong with Asah Sir SRY TT LA SI TN ST PRE SEN [25-0] wl Log! H3KZF ac 8 N 0 a Ng a aldo RG Ng 3 OR 0 strani EN IR SRA a Sos 0 a. TU SH SEPP A NC A A L A L ey 1-1 58 TAL] A R A R Ah i A te Sn AT i rai 6 . Sant] < Seufingd phase | 1 1 Fill in the screen NS Pree [NS Pree]! 1 a DNase! WA 1 FI = FR WANAN STOWEE 1 for SETI SAAT SARA. nes B logo Lay DNasel red id 0 1 for nes esas sa PINOT JOY. = name ss ss ss mt mmh ss ss DNassl vo A: wt to nt Role. INURL GEL In : 70 !Lea 0 8 ERIE +32 PhasiCons' § 1 Halk Pal SL ET LHR 1 8 1 Nb 01 PhasiCons { EY 0 A 0 B 2 fad AS si BEE EE LE Beek JUIN SRN A 4 M 5 0 . TBE (kh) A A A L [Laqaa Lha 1 13 - A N A A : ' 1 , 1 i 1 os f <8 be H may 33 f ion beige gree t——— b > aA AMA RATA ATE: the name of the s ne. Co NR Re 0 b ada brain . Salus te NE Rn atad NN SO a te ala aaa TCV TNE. TU Dada A 3 1 ¥ HAK2 ac sss Need Sw : Soni Anf Tal EE A EE ne SNR Mah Mesms Tey 1 Irs 8 #81 & 8 ¥ Raj 0 4 0 Um . 8 0" 9 0 ahm" su. DNased t for = tam las mahs visas vin son of tag nA FA ES ARS the nS makhla tj Si wean Esa mujh 0 .jed a I Lymphocyte DNase! : X&. EN ARAN ANRY AREAS TSA I A ea vee : 3 T DNase red 0 0 aa BE JAL MALMA D A AAAI TAGS NBAAFAAIENY TEN ARRAN SARA BE LEADING nehtma = oa] i Bo 3 6 Ny F 5 PE 1 to cst PhastCons § © § 8 1 : : $a 3 : 0 b IE 1 $3} = 3} 3 CEL SI EET i HNL LUE 8 IEEE: JAN I type TES (kb) oud Suid hand A file CAN port AEA 3717 B A MEL and Sweden eH SS SS AASN REQ4-H04 Tamper ,. 1 ah d m lat & s wa aa lam nej shak te 1 b fotalen oh oh 1 1 1 1 neg: Woo #i! A Jce Eas | JN B "Waam" M 01 5 {kid Hak CE EA SE Te O Pes JALEN ee: ar Cady Rqa Nedt about the lag AS 4 4 M 8 FERC RN RE PRE SE Lg eT 204-004 A ila Fan Be 504804 AD me, A as ae a CEs: Wala A L Y Net Siar = i as Sh Ey an de 8 Lian Ll a fede LIL aE a Cit “as or Sa a dawy to 3 1 strip Re as SET a 5 a d 3 2 empty Ren hee iq 1 a b b shape with dimple” 15 ands IT we 103 0 Eckert al-Baki fi "m ofl! 1 Tala Iman 4g i Amniho! H { 1 i 1 1 l N : 1 4,0 | ! I SRT! } EI {i rr { PRE vod Ne ! A! yd Walaj 5 1 85 in Lama 1 ! 4! A WN E NX NN B “8 CNN 7 2 No NNER 8 sks a. oN oN NLL I EE 0 RA NEN BONY 3 Ey Nola 8 3 2 Br i 1 Nl ar 8 a Ns B’ 0 i 7 Na 2A i EN 1 0 ENN NA J EEE I NA NA NA 0 ; 0" D RX EE ; Ou 8 NaN ENE i wf ON an 8 a p AN SR a NN Fr] NE 8 5 8 A 88 AN 8 NANG 8 L A 8 No a a Ba NO No NR pia : Noa 7 A A A HEN EN NE No A DN 3 Na l 8 A 7 I: 2 Ed uE a a BE = Ld ERE oO HE ANN Ba 5 wR NUN NE A 1 3 NRE SAN Se 8 pd 9 Ha ANA Na Co aN a 1 L L 2 aN LHe] pi re 8 ANA Na 8 8 Sn NY M : Na NB a LL oe NN =n BE ENS NA NA He IN ON i NaN 0 Ea 5 8 RE A EX NNN Wa NN 8 aN AA Ey SS BB BEBE BE = NL EB 2 EE s i ANNA AN A SN OER HE AANA Wi fe oN 2 a NR a a VN 2 DLA a ON 0 iI 321 EE EE = BE a + NRE DB A NN - L BE with 5 on BERS nS NRE Bc, NESE AN en NR fe ad NF "kd ha kd nd" a a nud ee last 01 aa used © format? Hasika : ’ Ee i for me 8 Bid Coordinator? £50 4-804 ne A ABT A604 NEL Fea-8 ! + zh is form of OY AY o — \ _ LEFT TALE 7 RIGHT TALEN TLE TALLEY RIGHT THEN GASGGIGARGGTCAACTAAL 5 CRANANTC TORT TIARA ATSRTC RAT TRET CAG 0 L op BRAT 308 RL CTY ANRGCARRRAITRACT RIT IACELA TRA 1 1 L aaa.... ‎MEL” #1a#17061 ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا ا َ ا And it's MEL gf, | ! #28 YOU MEL mm am mt mem pre mre 1010577 AVGATIRATIRGICRS | 1 for Six Basics AA AA 1000107 Gas 1114 B #8 H MEL Si | | : IL LA 1 SAY A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A E A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A 1030 GETTARCLAERLLAG ITTY #1b 0 | hua meh Pod Zarfa al-Nafaa al-Lalalia Pomomor Lajal Bessssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss FTOACTGOTTACASETTATE ’ Pro-B so 8 ) | a 1 a ATGATCEATIRATORG. o ¢ —_ \ _ ATO Moi Fa Ham Lum Ah Dj Uncle Awa Aa A Bha A Mali Jam A Bala Din Taht Bin Lat Aa Aa Baha Aa Aa for the birth Hey I'm still giving birth sey presse a l og i lahi + {Xie FRR EN drm ind ERS ETRE lm7 is ro N i : vi oma [ENB 0 5 1 184 hiqi 3 ha ae WP a la la fad 2 < 08 - = yam ft fy rahd 18 Tes BRE oF Eg BAF i 1 08 and b ha a. b a la ty 0 5 yria ‎ER FELT AETANY Tra YA ALY I Ea CATE ‎gi TE gr o EE i Cig Co vay AY‎ ‎LICE FE Sn ed Pa YY octet a EYAL Fe Rs WE opr an [| (71 fed : Canon 8 Shana 1 1 N “N-” CAN — 00 \ _ LD Wag Jm Warwi Mujen B Ry Wal Liam Bert Yeh YY, Sy TEA NYL TVA Msqo 1 1 bo 1 1 1 1 0 I did not have a test IFA PF TITRE F Al Adi L D L D L D M L B 8 8 118 RA A L D RS CI Pent I aed and Amat Halal Fonseca # ASS Cae ad BHP HIE SB 1 HHI ee Gs 1 SE iE HE WHT SHE Fig. 11 August 2018 by CAR The validity period of this patent is twenty years from the date of filing the application, provided that the annual financial fee is paid for the patent and that it is not invalid or forfeited for violating any of the provisions of the patent system, layout designs of integrated circuits, plant varieties, and industrial designs, or its executive regulations issued by King Abdulaziz City for Science and Technology; Saudi Patent Office P.O. Box TAT Riyadh 57??11 ¢ Kingdom of Saudi Arabia Email: Patents @kacst.edu.sa